Sample records for regulatory dna elements

  1. Computational identification of transcriptional regulatory elements in DNA sequence

    PubMed Central

    GuhaThakurta, Debraj


    Identification and annotation of all the functional elements in the genome, including genes and the regulatory sequences, is a fundamental challenge in genomics and computational biology. Since regulatory elements are frequently short and variable, their identification and discovery using computational algorithms is difficult. However, significant advances have been made in the computational methods for modeling and detection of DNA regulatory elements. The availability of complete genome sequence from multiple organisms, as well as mRNA profiling and high-throughput experimental methods for mapping protein-binding sites in DNA, have contributed to the development of methods that utilize these auxiliary data to inform the detection of transcriptional regulatory elements. Progress is also being made in the identification of cis-regulatory modules and higher order structures of the regulatory sequences, which is essential to the understanding of transcription regulation in the metazoan genomes. This article reviews the computational approaches for modeling and identification of genomic regulatory elements, with an emphasis on the recent developments, and current challenges. PMID:16855295

  2. Multigenome DNA sequence conservation identifies Hox cis-regulatory elements

    PubMed Central

    Kuntz, Steven G.; Schwarz, Erich M.; DeModena, John A.; De Buysscher, Tristan; Trout, Diane; Shizuya, Hiroaki; Sternberg, Paul W.; Wold, Barbara J.


    To learn how well ungapped sequence comparisons of multiple species can predict cis-regulatory elements in Caenorhabditis elegans, we made such predictions across the large, complex ceh-13/lin-39 locus and tested them transgenically. We also examined how prediction quality varied with different genomes and parameters in our comparisons. Specifically, we sequenced ∼0.5% of the C. brenneri and C. sp. 3 PS1010 genomes, and compared five Caenorhabditis genomes (C. elegans, C. briggsae, C. brenneri, C. remanei, and C. sp. 3 PS1010) to find regulatory elements in 22.8 kb of noncoding sequence from the ceh-13/lin-39 Hox subcluster. We developed the MUSSA program to find ungapped DNA sequences with N-way transitive conservation, applied it to the ceh-13/lin-39 locus, and transgenically assayed 21 regions with both high and low degrees of conservation. This identified 10 functional regulatory elements whose activities matched known ceh-13/lin-39 expression, with 100% specificity and a 77% recovery rate. One element was so well conserved that a similar mouse Hox cluster sequence recapitulated the native nematode expression pattern when tested in worms. Our findings suggest that ungapped sequence comparisons can predict regulatory elements genome-wide. PMID:18981268

  3. Using FAIRE (Formaldehyde-Assisted Isolation of Regulatory Elements) to isolate active regulatory DNA

    PubMed Central

    Simon, Jeremy M.; Giresi, Paul G.; Davis, Ian J.; Lieb, Jason D.


    Eviction or destabilization of nucleosomes from chromatin is a hallmark of functional regulatory elements of the eukaryotic genome. Historically identified by nuclease hypersensitivity, these regulatory elements are typically bound by transcription factors or other regulatory proteins. FAIRE (Formaldehyde-Assisted Isolation of Regulatory Elements) is an alternative approach to identify these genomic regions and has proven successful in a multitude of eukaryotic cell and tissue types. Cells or dissociated tissues are crosslinked briefly with formaldehyde, lysed, and sonicated. Sheared chromatin is subjected to phenol-chloroform extraction and the isolated DNA, typically encompassing 1–3% of the human genome, is purified. We provide guidelines for quantitative analysis by PCR, microarrays, or next-generation sequencing. Regulatory elements enriched by FAIRE display high concordance with those identified by nuclease hypersensitivity or ChIP, and the entire procedure can be completed in three days. FAIRE exhibits low technical variability, which allows its use in large-scale studies of chromatin from normal or diseased tissues. PMID:22262007

  4. Replication protein A binds to regulatory elements in yeast DNA repair and DNA metabolism genes.

    PubMed Central

    Singh, K K; Samson, L


    Saccharomyces cerevisiae responds to DNA damage by arresting cell cycle progression (thereby preventing the replication and segregation of damaged chromosomes) and by inducing the expression of numerous genes, some of which are involved in DNA repair, DNA replication, and DNA metabolism. Induction of the S. cerevisiae 3-methyladenine DNA glycosylase repair gene (MAG) by DNA-damaging agents requires one upstream activating sequence (UAS) and two upstream repressing sequences (URS1 and URS2) in the MAG promoter. Sequences similar to the MAG URS elements are present in at least 11 other S. cerevisiae DNA repair and metabolism genes. Replication protein A (Rpa) is known as a single-stranded-DNA-binding protein that is involved in the initiation and elongation steps of DNA replication, nucleotide excision repair, and homologous recombination. We now show that the MAG URS1 and URS2 elements form similar double-stranded, sequence-specific, DNA-protein complexes and that both complexes contain Rpa. Moreover, Rpa appears to bind the MAG URS1-like elements found upstream of 11 other DNA repair and DNA metabolism genes. These results lead us to hypothesize that Rpa may be involved in the regulation of a number of DNA repair and DNA metabolism genes. Images Fig. 1 Fig. 2 Fig. 3 Fig. 4 PMID:7761422

  5. Effect of Regulatory Element DNA Methylation on Tissue-Type Plasminogen Activator Gene Expression

    PubMed Central

    Rivier-Cordey, Anne-Sophie; Caetano, Carlos; Fish, Richard J.; Kruithof, Egbert K. O.


    Expression of the tissue-type plasminogen activator gene (t-PA; gene name PLAT) is regulated, in part, by epigenetic mechanisms. We investigated the relationship between PLAT methylation and PLAT expression in five primary human cell types and six transformed cell lines. CpG methylation was analyzed in the proximal PLAT gene promoter and near the multihormone responsive enhancer (MHRE) -7.3 kilobase pairs upstream of the PLAT transcriptional start site (TSS, -7.3 kb). In Bowes melanoma cells, the PLAT promoter and the MHRE were fully unmethylated and t-PA secretion was extremely high. In other cell types the region from -647 to -366 was fully methylated, whereas an unmethylated stretch of DNA from -121 to +94 was required but not sufficient for detectable t-PA mRNA and t-PA secretion. DNA methylation near the MHRE was not correlated with t-PA secretion. Specific methylation of the PLAT promoter region -151 to +151, inserted into a firefly luciferase reporter gene, abolished reporter gene activity. The region -121 to + 94 contains two well-described regulatory elements, a PMA-responsive element (CRE) near -106 and a GC-rich region containing an Sp1 binding site near +59. Methylation of double-stranded DNA oligonucleotides containing the CRE or the GC-rich region had little or no effect on transcription factor binding. Methylated CpGs may attract co-repressor complexes that contain histone deacetylases (HDAC). However, reporter gene activity of methylated plasmids was not restored by the HDAC inhibitor trichostatin. In conclusion, efficient PLAT gene expression requires a short stretch of unmethylated CpG sites in the proximal promoter. PMID:27973546

  6. Functional footprinting of regulatory DNA

    PubMed Central

    Vierstra, Jeff; Reik, Andreas; Chang, Kai-Hsin; Stehling-Sun, Sandra; Zhou, Yuan-Yue; Hinkley, Sarah J.; Paschon, David E.; Zhang, L.; Psatha, Nikoletta; Bendana, Yuri R.; O'Neill, Colleen M.; Song, Alex H.; Mich, Andrea; Liu, Pei-Qi; Lee, Gary; Bauer, Daniel E.; Holmes, Michael C.; Orkin, Stuart H.; Papayannopoulou, Thalia; Stamatoyannopoulos, George; Rebar, Edward J.; Gregory, Philip D.; Urnov, Fyodor D.; Stamatoyannopoulos, John A.


    Regulatory regions harbor multiple transcription factor recognition sites; however, the contribution of individual sites to regulatory function remains challenging to define. We describe a facile approach that exploits the error-prone nature of genome editing-induced double-strand break repair to map functional elements within regulatory DNA at nucleotide resolution. We demonstrate the approach on a human erythroid enhancer, revealing single TF recognition sites that gate the majority of downstream regulatory function. PMID:26322838

  7. BOX DNA: a novel regulatory element related to embryonal carcinoma cell differentiation.

    PubMed Central

    Kihara-Negishi, F; Tsujita, R; Negishi, Y; Ariga, H


    BOX DNA was previously isolated from the DNA sequence inserted in the enhancer B domain of mutant polyomavirus (fPyF9) DNA. We also reported that BOX DNA functioned negatively on DNA replication and transcription of another polyomavirus mutant (PyhrN2) in F9-28 cells, a subclone of mouse F9 embryonal carcinoma (EC) cells expressing the polyomavirus large T antigen. In this study, we demonstrate that BOX DNA enhances transcription from the thymidine kinase (TK) promoter in various EC cells. One or three copies of BOX DNA, linked to the bacterial chloramphenicol acetyltransferase gene under the control of the herpes simplex virus TK promoter, activated promoter activity in F9, P19, and ECA2 cells. Band shift assays using BOX DNA as a probe revealed that specific binding proteins were present in all EC cells examined; the patterns of BOX DNA-protein complexes were the same among them. A mutation introduced within BOX DNA abolished enhancer activity as well as the formation of specific DNA-protein complexes. In non-EC cells, including L and BALB/3T3 cells, the enhancer activity of BOX DNA on the TK promoter was not observed, although binding proteins specific to the sequence exist. In band shift assays, the patterns of the DNA-protein complexes of either L or BALB/3T3 cells were different from those of EC cells. Furthermore, the enhancer activity of BOX DNA decreased upon differentiation induction in all EC cells examined, of different origins and distinct differentiation ability. In parallel with the loss of enhancer activity, the binding proteins specific for BOX DNA decreased in these cells. Moreover, we cloned a genomic DNA of F9, termed BOXF1, containing BOX DNA sequence approximately 400 bp upstream from the RNA start site of the gene. BOXF1, containing a TATA-like motif and the binding elements for Sp1 and Oct in addition to BOX DNA, possessed promoter activity deduced by a BOXF1-chloramphenicol acetyltransferase construct. Deletion analyses of the construct

  8. The mouse albumin enhancer contains a negative regulatory element that interacts with a novel DNA-binding protein.

    PubMed Central

    Herbst, R S; Boczko, E M; Darnell, J E; Babiss, L E


    The far-upstream mouse albumin enhancer (-10.5 to -8.43 kilobases) has both positive and negative regulatory domains which contribute to the rate and tissue specificity of albumin gene transcription. (R. S. Herbst, N. Friedman, J. E. Darnell, Jr., and L. E. Babiss, Proc. Natl. Acad. Sci. USA 86:1553-1557). In this work, the negative regulatory region has been functionally localized to sequences -8.7 to -8.43 kilobases upstream of the albumin gene cap site. In the absence of the albumin-modulating region (in which there are binding sites for the transcription factor C/EBP), the negative region can suppress a neighboring positive-acting element, thereby interfering with albumin enhancer function. The negative region is also capable of negating the positive action of the heterologous transthyretin enhancer in an orientation-independent fashion. Within this negative-acting region we can detect two DNA-binding sites, both of which are recognized by a protein present in all cell types tested. This DNA-binding activity is not competed for by any of a series of known DNA-binding sites, and hence this new protein is a candidate for a role in suppressing the albumin gene in nonhepatic cells. Images PMID:2370857

  9. cis-acting DNA regulatory elements, including the retinoic acid response element, are required for tissue specific laminin B1 promoter/lacZ expression in transgenic mice.


    Sharif, K A; Li, C; Gudas, L J


    The LAMB1 gene encodes the laminin beta1 subunit of laminin, an extracellular matrix protein. Using several transgenic mouse lines containing various lengths of the LAMB1 promoter driving lacZ reporter gene expression, regions of LAMB1 promoter that contain cis-acting DNA regulatory element(s) have been identified. The 3.9LAMB1betagal transgene is expressed in various tissues during development. LAMB1 transgene expression is observed in a selective set of nephrons of the neonatal and adult kidneys. The cis-acting DNA regulatory elements responsible for LAMB1 transgene expression in ovaries and in juvenile kidneys are present between -'1.4 and -0.7 kb relative to the transcription start site, while those of adult kidneys are located between -2.5 and -1.4 kb. The LAMB1 transgene is also expressed in the epididymis of 1 week old transgenic mice. Mutation of the retinoic acid response element (RARE) in the context of the 3.9LAMB1betagal transgene results in loss of LAMB1 transgene expression in all tissues. Thus, sequences between -2.5 and -0.7 kb plus the RARE are required for appropriate expression of the LAMB1 transgene in mice.

  10. A novel regulatory element (E77) isolated from CHO‐K1 genomic DNA enhances stable gene expression in Chinese hamster ovary cells

    PubMed Central

    Kang, Shin‐Young; Kim, Yeon‐Gu; Kang, Seunghee; Lee, Hong Weon


    Abstract Vectors flanked by regulatory DNA elements have been used to generate stable cell lines with high productivity and transgene stability; however, regulatory elements in Chinese hamster ovary (CHO) cells, which are the most widely used mammalian cells in biopharmaceutical production, are still poorly understood. We isolated a novel gene regulatory element from CHO‐K1 cells, designated E77, which was found to enhance the stable expression of a transgene. A genomic library was constructed by combining CHO‐K1 genomic DNA fragments with a CMV promoter‐driven GFP expression vector, and the E77 element was isolated by screening. The incorporation of the E77 regulatory element resulted in the generation of an increased number of clones with high expression, thereby enhancing the expression level of the transgene in the stable transfectant cell pool. Interestingly, the E77 element was found to consist of two distinct fragments derived from different locations in the CHO genome shotgun sequence. High and stable transgene expression was obtained in transfected CHO cells by combining these fragments. Additionally, the function of E77 was found to be dependent on its site of insertion and specific orientation in the vector construct. Our findings demonstrate that stable gene expression mediated by the CMV promoter in CHO cells may be improved by the isolated novel gene regulatory element E77 identified in the present study. PMID:26762773

  11. A novel regulatory element (E77) isolated from CHO-K1 genomic DNA enhances stable gene expression in Chinese hamster ovary cells.


    Kang, Shin-Young; Kim, Yeon-Gu; Kang, Seunghee; Lee, Hong Weon; Lee, Eun Gyo


    Vectors flanked by regulatory DNA elements have been used to generate stable cell lines with high productivity and transgene stability; however, regulatory elements in Chinese hamster ovary (CHO) cells, which are the most widely used mammalian cells in biopharmaceutical production, are still poorly understood. We isolated a novel gene regulatory element from CHO-K1 cells, designated E77, which was found to enhance the stable expression of a transgene. A genomic library was constructed by combining CHO-K1 genomic DNA fragments with a CMV promoter-driven GFP expression vector, and the E77 element was isolated by screening. The incorporation of the E77 regulatory element resulted in the generation of an increased number of clones with high expression, thereby enhancing the expression level of the transgene in the stable transfectant cell pool. Interestingly, the E77 element was found to consist of two distinct fragments derived from different locations in the CHO genome shotgun sequence. High and stable transgene expression was obtained in transfected CHO cells by combining these fragments. Additionally, the function of E77 was found to be dependent on its site of insertion and specific orientation in the vector construct. Our findings demonstrate that stable gene expression mediated by the CMV promoter in CHO cells may be improved by the isolated novel gene regulatory element E77 identified in the present study.

  12. Hormone stimulation of androgen receptor mediates dynamic changes in DNA methylation patterns at regulatory elements

    PubMed Central

    Dhiman, Vineet K.; Attwood, Kristopher; Campbell, Moray J.; Smiraglia, Dominic J.


    DNA methylation is an epigenetic modification that contributes to stable gene silencing by interfering with the ability of transcriptional regulators to bind to DNA. Recent findings have revealed that hormone stimulation of certain nuclear receptors induces rapid, dynamic changes in DNA methylation patterns alongside transcriptional responses at a subset of target loci, over time. However, the ability of androgen receptor (AR) to dynamically regulate gene transcription is relatively under-studied and its role in the regulation of DNA methylation patterns remains to be elucidated. Here we demonstrate in normal prostate cells that hormone stimulated AR activity results in dynamic changes in the transcription rate and DNA methylation patterns at the AR target genes, TIPARP and SGK1. Time-resolved chromatin immunoprecipitation experiments on the SGK1 locus reveals dynamic recruitment of AR and RNA Polymerase II, as well as the recruitment of proteins involved in the DNA demethylation process, TET1 and TDG. Furthermore, the presence of DNA methylation at dynamic regions inhibits protein binding and transcriptional activity of SGK1. These findings establish AR activity as a contributing factor to the dynamic regulation of DNA methylation patterns at target genes in prostate biology and infer further complexity involved in nuclear receptor mediation of transcriptional regulation. PMID:26646795

  13. Positive and negative regulatory elements in the dnaA-dnaN-recF operon of Escherichia coli.


    Pérez-Roger, I; García-Sogo, M; Navarro-Aviñó, J P; López-Acedo, C; Macián, F; Armengod, M E


    The recF gene of E coli lies within a cluster of genes which play essential roles in DNA replication; the gene order is dnaA dnaN recF gyrB. Each of these genes has its own promoters which, with the exception of dnaA promoters, reside entirely within the translated region of the respective preceding gene. In this report, we analyze the effect of the dnaA and dnaN promoters on recF expression by translational fusions between recF and the lacZ reporter gene. Our results indicate that recF is a distal gene of the dnaA operon, and support the previous proposal that dnaN and recF constitute a transcriptional unit under control of the dnaN promoters. They also suggest that dnaA, dnaN and recF are predominantly expressed from the same mRNA although transcriptional and/or post-transcriptional mechanisms should be specifically involved in lowering expression of the recF gene. Recently, we have localized 3 tandem transcription termination sites in the second half of the dnaN gene, downstream from the recF promoters. Neither of them shows the typical features of simple terminators and apparently they do not work in a minimal system of in vitro transcription. In this report, we present evidence that only one of them is dependent on the Rho protein. Although the operon structure allows coordinate expression of dnaA, dnaN and recF, the presence of internal promoters (the dnaN and recF promoters), which appear to be inducible by DNA damage, and intracistronic terminators, whose activity is inversely proportional to the efficiency of translation, permits expression of individual genes to be independently regulated in response to altered growth conditions.

  14. The Hinge Region as a Key Regulatory Element of Androgen Receptor Dimerization, DNA Binding, and Transactivation

    DTIC Science & Technology


    led to a structure depicted in figure 1A. Two zinc coordinating modules that constitute the receptors DNA-binding domain, are involved in the...expression plasmid (reviewed in Claessens et al. 2001). This led first to the description of the PB-ARE-2 (Claessens et al. 1996), later of scARE and...constructs for specific mutants: has been done and is ongoing. This has led to most of the observations reported in section II of this report. iii.c

  15. The TTSMI database: a catalog of triplex target DNA sites associated with genes and regulatory elements in the human genome.


    Jenjaroenpun, Piroon; Chew, Chee Siang; Yong, Tai Pang; Choowongkomon, Kiattawee; Thammasorn, Wimada; Kuznetsov, Vladimir A


    A triplex target DNA site (TTS), a stretch of DNA that is composed of polypurines, is able to form a triple-helix (triplex) structure with triplex-forming oligonucleotides (TFOs) and is able to influence the site-specific modulation of gene expression and/or the modification of genomic DNA. The co-localization of a genomic TTS with gene regulatory signals and functional genome structures suggests that TFOs could potentially be exploited in antigene strategies for the therapy of cancers and other genetic diseases. Here, we present the TTS Mapping and Integration (TTSMI; database, which provides a catalog of unique TTS locations in the human genome and tools for analyzing the co-localization of TTSs with genomic regulatory sequences and signals that were identified using next-generation sequencing techniques and/or predicted by computational models. TTSMI was designed as a user-friendly tool that facilitates (i) fast searching/filtering of TTSs using several search terms and criteria associated with sequence stability and specificity, (ii) interactive filtering of TTSs that co-localize with gene regulatory signals and non-B DNA structures, (iii) exploration of dynamic combinations of the biological signals of specific TTSs and (iv) visualization of a TTS simultaneously with diverse annotation tracks via the UCSC genome browser.

  16. FAIRE (Formaldehyde-Assisted Isolation of Regulatory Elements) isolates active regulatory elements from human chromatin

    PubMed Central

    Giresi, Paul G.; Kim, Jonghwan; McDaniell, Ryan M.; Iyer, Vishwanath R.; Lieb, Jason D.


    DNA segments that actively regulate transcription in vivo are typically characterized by eviction of nucleosomes from chromatin and are experimentally identified by their hypersensitivity to nucleases. Here we demonstrate a simple procedure for the isolation of nucleosome-depleted DNA from human chromatin, termed FAIRE (Formaldehyde-Assisted Isolation of Regulatory Elements). To perform FAIRE, chromatin is crosslinked with formaldehyde in vivo, sheared by sonication, and phenol-chloroform extracted. The DNA recovered in the aqueous phase is fluorescently labeled and hybridized to a DNA microarray. FAIRE performed in human cells strongly enriches DNA coincident with the location of DNaseI hypersensitive sites, transcriptional start sites, and active promoters. Evidence for cell-type–specific patterns of FAIRE enrichment is also presented. FAIRE has utility as a positive selection for genomic regions associated with regulatory activity, including regions traditionally detected by nuclease hypersensitivity assays. PMID:17179217

  17. Structural polymorphism within a regulatory element of the human KRAS promoter: formation of G4-DNA recognized by nuclear proteins

    PubMed Central

    Cogoi, Susanna; Paramasivam, Manikandan; Spolaore, Barbara; Xodo, Luigi E.


    The human KRAS proto-oncogene contains a critical nuclease hypersensitive element (NHE) upstream of the major transcription initiation site. In this article, we demonstrate by primer-extension experiments, PAGE, chemical footprinting, CD, UV and FRET experiments that the G-rich strand of NHE (32R) folds into intra-molecular G-quadruplex structures. Fluorescence data show that 32R in 100 mM KCl melts with a biphasic profile, showing the formation of two distinct G-quadruplexes with Tm of ∼55°C (Q1) and ∼72°C (Q2). DMS-footprinting and CD suggest that Q1 can be a parallel and Q2 a mixed parallel/antiparallel G-quadruplex. When dsNHE (32R hybridized to its complementary) is incubated with a nuclear extract from Panc-1 cells, three DNA–protein complexes are observed by EMSA. The complex of slower mobility is competed by quadruplex 32R, but not by mutant oligonucleotides, which cannot form a quadruplex structure. Using paramagnetic beads coupled with 32R, we pulled down from the Panc-1 extract proteins with affinity for quadruplex 32R. One of these is the heterogeneous nuclear ribonucleoprotein A1, which was previously reported to unfold quadruplex DNA. Our study suggests a role of quadruplex DNA in KRAS transcription and provides the basis for the rationale design of molecular strategies to inhibit the expression of KRAS. PMID:18490377

  18. Isolation of active regulatory elements from eukaryotic chromatin using FAIRE (Formaldehyde Assisted Isolation of Regulatory Elements)

    PubMed Central

    Giresi, Paul G.; Lieb, Jason D.


    The binding of sequence-specific regulatory factors and the recruitment of chromatin remodeling activities cause nucleosomes to be evicted from chromatin in eukaryotic cells. Traditionally, these active sites have been identified experimentally through their sensitivity to nucleases. Here we describe the details of a simple procedure for the genome-wide isolation of nucleosome-depleted DNA from human chromatin, termed FAIRE (Formaldehyde Assisted Isolation of Regulatory Elements). We also provide protocols for different methods of detecting FAIRE-enriched DNA, including use of PCR, DNA microarrays, and next-generation sequencing. FAIRE works on all eukaryotic chromatin tested to date. To perform FAIRE, chromatin is crosslinked with formaldehyde, sheared by sonication, and phenol-chloroform extracted. Most genomic DNA is crosslinked to nucleosomes and is sequestered to the interphase, whereas DNA recovered in the aqueous phase corresponds to nucleosome-depleted regions of the genome. The isolated regions are largely coincident with the location of DNaseI hypersensitive sites, transcriptional start sites, enhancers, insulators, and active promoters. Given its speed and simplicity, FAIRE has utility in establishing chromatin profiles of diverse cell types in health and disease, isolating DNA regulatory elements en masse for further characterization, and as a screening assay for the effects of small molecules on chromatin organization. PMID:19303047

  19. Global Analysis of DNA Methylation Variation in Adipose Tissue from Twins Reveals Links to Disease-Associated Variants in Distal Regulatory Elements

    PubMed Central

    Grundberg, Elin; Meduri, Eshwar; Sandling, Johanna K.; Hedman, Åsa K.; Keildson, Sarah; Buil, Alfonso; Busche, Stephan; Yuan, Wei; Nisbet, James; Sekowska, Magdalena; Wilk, Alicja; Barrett, Amy; Small, Kerrin S.; Ge, Bing; Caron, Maxime; Shin, So-Youn; Ahmadi, Kourosh R.; Ainali, Chrysanthi; Barrett, Amy; Bataille, Veronique; Bell, Jordana T.; Buil, Alfonso; Deloukas, Panos; Dermitzakis, Emmanouil T.; Dimas, Antigone S.; Durbin, Richard; Glass, Daniel; Grundberg, Elin; Hassanali, Neelam; Hedman, Åsa K.; Ingle, Catherine; Knowles, David; Krestyaninova, Maria; Lindgren, Cecilia M.; Lowe, Christopher E.; McCarthy, Mark I.; Meduri, Eshwar; di Meglio, Paola; Min, Josine L.; Montgomery, Stephen B.; Nestle, Frank O.; Nica, Alexandra C.; Nisbet, James; O’Rahilly, Stephen; Parts, Leopold; Potter, Simon; Sandling, Johanna; Sekowska, Magdalena; Shin, So-Youn; Small, Kerrin S.; Soranzo, Nicole; Spector, Tim D.; Surdulescu, Gabriela; Travers, Mary E.; Tsaprouni, Loukia; Tsoka, Sophia; Wilk, Alicja; Yang, Tsun-Po; Zondervan, Krina T.; Lathrop, Mark; Dermitzakis, Emmanouil T.; McCarthy, Mark I.; Spector, Timothy D.; Bell, Jordana T.; Deloukas, Panos


    Epigenetic modifications such as DNA methylation play a key role in gene regulation and disease susceptibility. However, little is known about the genome-wide frequency, localization, and function of methylation variation and how it is regulated by genetic and environmental factors. We utilized the Multiple Tissue Human Expression Resource (MuTHER) and generated Illumina 450K adipose methylome data from 648 twins. We found that individual CpGs had low variance and that variability was suppressed in promoters. We noted that DNA methylation variation was highly heritable (h2median = 0.34) and that shared environmental effects correlated with metabolic phenotype-associated CpGs. Analysis of methylation quantitative-trait loci (metQTL) revealed that 28% of CpGs were associated with nearby SNPs, and when overlapping them with adipose expression quantitative-trait loci (eQTL) from the same individuals, we found that 6% of the loci played a role in regulating both gene expression and DNA methylation. These associations were bidirectional, but there were pronounced negative associations for promoter CpGs. Integration of metQTL with adipose reference epigenomes and disease associations revealed significant enrichment of metQTL overlapping metabolic-trait or disease loci in enhancers (the strongest effects were for high-density lipoprotein cholesterol and body mass index [BMI]). We followed up with the BMI SNP rs713586, a cg01884057 metQTL that overlaps an enhancer upstream of ADCY3, and used bisulphite sequencing to refine this region. Our results showed widespread population invariability yet sequence dependence on adipose DNA methylation but that incorporating maps of regulatory elements aid in linking CpG variation to gene regulation and disease risk in a tissue-dependent manner. PMID:24183450

  20. Regulatory parameters of DNA replication.


    Zannis-Hadjopoulos, M; Price, G B


    One of the fundamental characteristics that help define life is the ability to propagate. At the basest level in the act of propagation is replication of the genetic information as the databank and architectural plans for each particular life form. Thus propagation of life requires the replication of the genome--for the purposes of our review, eukaryotic DNA replication. In this critical review, we have chosen to present the issues and supporting experimental evidence in question-and-answer format. Over the past 3 to 4 years, the research domain of eukaryotic DNA replication has developed a new dynamism. This new force in discovery of the fundamental elements and mechanisms for DNA replication in higher eukaryotes has been propelled by accepted methodologies for mapping (identification) of origins of DNA replication, applicable to mammalian DNA replication, and by the discovery of the origin recognition complex (ORC) in yeast, which has served as a model in the search for the mammalian equivalent.

  1. CpG site DNA methylation patterns reveal a novel regulatory element in the mouse prion protein gene

    PubMed Central

    DALAI, Wuyun; MATSUO, Eiko; TAKEYAMA, Natsumi; KAWANO, Junichi; SAEKI, Keiichi


    The cellular isoform of the prion protein (PrPC) plays critical roles in the development of prion disorders. Although PrP mRNA is ubiquitously present in a tissue-specific manner, the DNA methylation of PrP gene (Prnp) is still unknown. In this study, we demonstrated that the CpG island (CGI, positioned at −218 to +152 bp from the transcriptional start site) including the Prnp core promoter region was completely unmethylated in all tested tissues. On the other hand, CpG methylation in the CGI shore region (positioned at −599 to −238 bp) occurred in various tissue- and site-specific proportions. Interestingly, the correlation analysis between CpG methylation status and PrP mRNA levels showed that one CpG site methylation at −576 was negatively correlated with the PrP mRNA level (Pearson’s r = −0.374, P=0.035). Taken together, our results suggest that Prnp is a typical housekeeping gene and various methylation frequencies of the CGI shore region are likely to affect Prnp expression in a tissue-specific manner. PMID:27666463

  2. Evolutionary conservation of regulatory elements in vertebrate Hox gene clusters.


    Santini, Simona; Boore, Jeffrey L; Meyer, Axel


    Comparisons of DNA sequences among evolutionarily distantly related genomes permit identification of conserved functional regions in noncoding DNA. Hox genes are highly conserved in vertebrates, occur in clusters, and are uninterrupted by other genes. We aligned (PipMaker) the nucleotide sequences of the HoxA clusters of tilapia, pufferfish, striped bass, zebrafish, horn shark, human, and mouse, which are separated by approximately 500 million years of evolution. In support of our approach, several identified putative regulatory elements known to regulate the expression of Hox genes were recovered. The majority of the newly identified putative regulatory elements contain short fragments that are almost completely conserved and are identical to known binding sites for regulatory proteins (Transfac database). The regulatory intergenic regions located between the genes that are expressed most anteriorly in the embryo are longer and apparently more evolutionarily conserved than those at the other end of Hox clusters. Different presumed regulatory sequences are retained in either the Aalpha or Abeta duplicated Hox clusters in the fish lineages. This suggests that the conserved elements are involved in different gene regulatory networks and supports the duplication-deletion-complementation model of functional divergence of duplicated genes.

  3. Evolutionary conservation of regulatory elements in vertebrate HOX gene clusters

    SciTech Connect

    Santini, Simona; Boore, Jeffrey L.; Meyer, Axel


    Due to their high degree of conservation, comparisons of DNA sequences among evolutionarily distantly-related genomes permit to identify functional regions in noncoding DNA. Hox genes are optimal candidate sequences for comparative genome analyses, because they are extremely conserved in vertebrates and occur in clusters. We aligned (Pipmaker) the nucleotide sequences of HoxA clusters of tilapia, pufferfish, striped bass, zebrafish, horn shark, human and mouse (over 500 million years of evolutionary distance). We identified several highly conserved intergenic sequences, likely to be important in gene regulation. Only a few of these putative regulatory elements have been previously described as being involved in the regulation of Hox genes, while several others are new elements that might have regulatory functions. The majority of these newly identified putative regulatory elements contain short fragments that are almost completely conserved and are identical to known binding sites for regulatory proteins (Transfac). The conserved intergenic regions located between the most rostrally expressed genes in the developing embryo are longer and better retained through evolution. We document that presumed regulatory sequences are retained differentially in either A or A clusters resulting from a genome duplication in the fish lineage. This observation supports both the hypothesis that the conserved elements are involved in gene regulation and the Duplication-Deletion-Complementation model.

  4. Characterization of various promoter regions of the human DNA helicase-encoding genes and identification of duplicated ets (GGAA) motifs as an essential transcription regulatory element.


    Uchiumi, Fumiaki; Watanabe, Takeshi; Tanuma, Sei-ichi


    DNA helicases are important in the regulation of DNA transaction and thereby various cellular functions. In this study, we developed a cost-effective multiple DNA transfection assay with DEAE-dextran reagent and analyzed the promoter activities of the human DNA helicases. The 5'-flanking regions of the human DNA helicase-encoding genes were isolated and subcloned into luciferase (Luc) expression plasmids. They were coated onto 96-well plate and used for co-transfection with a renilla-Luc expression vector into various cells, and dual-Luc assays were performed. The profiles of promoter activities were dependent on cell lines used. Among these human DNA helicase genes, XPB, RecQL5, and RTEL promoters were activated during TPA-induced HL-60 cell differentiation. Interestingly, duplicated ets (GGAA) elements are commonly located around the transcription start sites of these genes. The duplicated GGAA motifs are also found in the promoters of DNA replication/repair synthesis factor genes including PARG, ATR, TERC, and Rb1. Mutation analyses suggested that the duplicated GGAA-motifs are necessary for the basal promoter activity in various cells and some of them positively respond to TPA in HL-60 cells. TPA-induced response of 44-bp in the RTEL promoter was attenuated by co-transfection of the PU.1 expression vector. These findings suggest that the duplicated ets motifs regulate DNA-repair associated gene expressions during macrophage-like differentiation of HL-60 cells.

  5. An internal regulatory element controls troponin I gene expression

    SciTech Connect

    Yutzey, K.E.; Kline, R.L.; Konieczmy, S.F. . Dept. of Biological Sciences)


    During skeletal myogenesis, approximately 20 contractile proteins and related gene products temporally accumulate as the cells fuse to form multinucleated muscle fibers. In most instances, the contractile protein genes are regulated transcriptionally, which suggests that a common molecular mechanism may coordinate the expression of this diverse and evolutionarily unrelated gene set. Recent studies have examined the muscle-specific cis-acting elements associated with numerous contractile protein genes. All of the identified regulatory elements are positioned in the 5'-flanking regions, usually within 1,500 base pairs of the transcription start site. Surprisingly, a DNA consensus sequence that is common to each contractile protein gene has not been identified. In contrast to the results of these earlier studies, the authors have found that the 5'-flanking region of the quail troponin I (TnI) gene is not sufficient to permit the normal myofiber transcriptional activation of the gene. Instead, the TnI gene utilizes a unique internal regulatory element that is responsible for the correct myofiber-specific expression pattern associated with the TnI gene. This is the first example in which a contractile protein gene has been shown to rely primarily on an internal regulatory element to elicit transcriptional activation during myogenesis. The diversity of regulatory elements associated with the contractile protein genes suggests that the temporal expression of the genes may involve individual cis-trans regulatory components specific for each gene.

  6. Transcriptional Regulatory Elements in Fungal Secondary Metabolism

    PubMed Central

    Yin, Wenbing; Keller, Nancy P.


    Filamentous fungi produce a variety of secondary metabolites of diverse beneficial and detrimental activities to humankind. The genes encoding the enzymatic machinery required to make these metabolites are typically clustered in fungal genomes. There is considerable evidence that secondary metabolite gene regulation is, in part, by transcriptional control through hierarchical levels of transcriptional regulatory elements involved in secondary metabolite cluster regulation. Identification of secondary metabolism regulatory elements could potentially provide a means of increasing production of beneficial metabolites, decreasing production of detrimental metabolites, aid in the identification of ‘silent’ natural products and also contribute to a broader understanding of molecular mechanisms by which secondary metabolites are produced. This review summarizes regulation of secondary metabolism associated on transcriptional regulatory elements from a broad view as well as tremendous advances in discovery of cryptic or novel secondary metabolites by genomic mining in the basis of this knowledge. PMID:21717315

  7. Negative transcriptional regulatory element that functions in embryonal carcinoma cells.

    PubMed Central

    Ariizumi, K; Takahashi, H; Nakamura, M; Ariga, H


    We have cloned the polyomavirus mutant fPyF9, which persists in an episomal state in F9 embryonal carcinoma cells (K. Ariizumi and H. Ariga, Mol. Cell. Biol. 6:3920-3927, 1986). fPyF9 carries three copies of exogenous sequences, the prototype of which is a 21-base-pair repeat (box DNA), in the region of the enhancer B domain of wild-type polyomavirus DNA. The consensus sequence, GCATTCCATTGTT, is 13 base pairs long. The box DNA inserted into fPyF9 appeared to come from a cellular sequence and was present in many kinds of DNAs, including F9 chromosomal DNA. The biological function of box DNA was analyzed by chloramphenicol acetyltransferase expression assays, using chimeric plasmids containing box DNA conjugated with simian virus 40 promoter elements. The results showed that box DNA repressed the activities both of the simian virus 40 promoter and enhancer only in transfected undifferentiated F9 cells and not in differentiated LTK- cells. Box DNA functioned independently of orientation and position with respect to the promoter in an enhancerlike manner, although the effect of box DNA was opposite that of the enhancer. The XhoI linker insertion into the consensus sequences of box DNA abolished the repression activity, and the protein(s) recognizing the consensus sequences was identified only in F9 cells, not in L cells. These analyses suggest that box DNA may be a negative regulatory element that functions in undifferentiated cells. Images PMID:2550812

  8. Latent Regulatory Potential of Human-Specific Repetitive Elements

    PubMed Central

    Ward, Michelle C.; Wilson, Michael D.; Barbosa-Morais, Nuno L.; Schmidt, Dominic; Stark, Rory; Pan, Qun; Schwalie, Petra C.; Menon, Suraj; Lukk, Margus; Watt, Stephen; Thybert, David; Kutter, Claudia; Kirschner, Kristina; Flicek, Paul; Blencowe, Benjamin J.; Odom, Duncan T.


    Summary At least half of the human genome is derived from repetitive elements, which are often lineage specific and silenced by a variety of genetic and epigenetic mechanisms. Using a transchromosomic mouse strain that transmits an almost complete single copy of human chromosome 21 via the female germline, we show that a heterologous regulatory environment can transcriptionally activate transposon-derived human regulatory regions. In the mouse nucleus, hundreds of locations on human chromosome 21 newly associate with activating histone modifications in both somatic and germline tissues, and influence the gene expression of nearby transcripts. These regions are enriched with primate and human lineage-specific transposable elements, and their activation corresponds to changes in DNA methylation at CpG dinucleotides. This study reveals the latent regulatory potential of the repetitive human genome and illustrates the species specificity of mechanisms that control it. PMID:23246434

  9. The maize regulatory gene B-Peru contains a DNA rearrangement that specifies tissue-specific expression through both positive and negative promoter elements.

    PubMed Central

    Selinger, D A; Lisch, D; Chandler, V L


    The B-Peru allele of the maize b regulatory gene is unusual relative to most b alleles in that it is expressed in the aleurone layer of the seed. It is also expressed in a subset of plant vegetative tissues. Transgenic maize plants containing the B-Peru gene with the first 710 bases of upstream sequence conferred the same levels of aleurone expression as nontransgenic B-Peru plants, but no pigment was made in vegetative tissues. Transient transformation assays in aleurone tissue localized the aleurone-specific promoter to the first 176 bases of the B-Peru upstream region and identified two critically important regions within this fragment. Mutation of either region alone reduced expression greater than fivefold. Surprisingly, the double mutation actually increased expression to twice the native promoter level. Our results suggest that these two critical sequences, which lie close together in the promoter, may form a negative regulatory element. Several lines of evidence suggest that the B-Peru promoter arose through the translocation of an existing aleurone-specific promoter to the b locus. Immediately upstream of the aleurone-specific promoter elements and in the opposite orientation to the b coding sequence is a pseudogene sequence with strong similarity to a known class of proteins. Our findings that novel aleurone-specific promoter sequences of the B-Peru transcription factor are found adjacent to part of another gene in a small insertion are quite unexpected and have interesting evolutionary implications. PMID:9611220

  10. Modular arrangement of regulatory RNA elements

    PubMed Central

    Roßmanith, Johanna; Narberhaus, Franz


    ABSTRACT Due to their simple architecture and control mechanism, regulatory RNA modules are attractive building blocks in synthetic biology. This is especially true for riboswitches, which are natural ligand-binding regulators of gene expression. The discovery of various tandem riboswitches inspired the design of combined RNA modules with activities not yet found in nature. Riboswitches were placed in tandem or in combination with a ribozyme or temperature-responsive RNA thermometer resulting in new functionalities. Here, we compare natural examples of tandem riboswitches with recently designed artificial RNA regulators suggesting substantial modularity of regulatory RNA elements. Challenges associated with modular RNA design are discussed. PMID:28010165

  11. Modular arrangement of regulatory RNA elements.


    Roßmanith, Johanna; Narberhaus, Franz


    Due to their simple architecture and control mechanism, regulatory RNA modules are attractive building blocks in synthetic biology. This is especially true for riboswitches, which are natural ligand-binding regulators of gene expression. The discovery of various tandem riboswitches inspired the design of combined RNA modules with activities not yet found in nature. Riboswitches were placed in tandem or in combination with a ribozyme or temperature-responsive RNA thermometer resulting in new functionalities. Here, we compare natural examples of tandem riboswitches with recently designed artificial RNA regulators suggesting substantial modularity of regulatory RNA elements. Challenges associated with modular RNA design are discussed.

  12. A mammary cell-specific enhancer in mouse mammary tumor virus DNA is composed of multiple regulatory elements including binding sites for CTF/NFI and a novel transcription factor, mammary cell-activating factor.

    PubMed Central

    Mink, S; Härtig, E; Jennewein, P; Doppler, W; Cato, A C


    Mouse mammary tumor virus (MMTV) is a milk-transmitted retrovirus involved in the neoplastic transformation of mouse mammary gland cells. The expression of this virus is regulated by mammary cell type-specific factors, steroid hormones, and polypeptide growth factors. Sequences for mammary cell-specific expression are located in an enhancer element in the extreme 5' end of the long terminal repeat region of this virus. This enhancer, when cloned in front of the herpes simplex thymidine kinase promoter, endows the promoter with mammary cell-specific response. Using functional and DNA-protein-binding studies with constructs mutated in the MMTV long terminal repeat enhancer, we have identified two main regulatory elements necessary for the mammary cell-specific response. These elements consist of binding sites for a transcription factor in the family of CTF/NFI proteins and the transcription factor mammary cell-activating factor (MAF) that recognizes the sequence G Pu Pu G C/G A A G G/T. Combinations of CTF/NFI- and MAF-binding sites or multiple copies of either one of these binding sites but not solitary binding sites mediate mammary cell-specific expression. The functional activities of these two regulatory elements are enhanced by another factor that binds to the core sequence ACAAAG. Interdigitated binding sites for CTF/NFI, MAF, and/or the ACAAAG factor are also found in the 5' upstream regions of genes encoding whey milk proteins from different species. These findings suggest that mammary cell-specific regulation is achieved by a concerted action of factors binding to multiple regulatory sites. Images PMID:1328867

  13. DNA Vaccines: Regulatory Considerations and Safety Aspects.


    Myhr, Anne Ingeborg


    DNA vaccines have great potential as preventive or therapeutic vaccines against viral, bacterial, or parasitic diseases as well as cancer, and may also be used as gene therapy products. Although many human and veterinary DNA vaccines have been investigated in laboratory trials, only four of these have been approved for commercial use. In this paper an overview of the regulatory requirements for the development of DNA vaccines is given. The regulatory process in EU and USA is described. A discussion concerning the relevance of national regulations on gene technology is included. In addition the main safety concerns associated with DNA vaccines, relating to unwanted side effects in the vaccinated mammal or fish, are presented. Finally, the need for greater openness regarding the assessment information is discussed.

  14. Identifying Synonymous Regulatory Elements in Vertebrate Genomes

    SciTech Connect

    Ovcharenko, I; Nobrega, M A


    Synonymous gene regulation, defined as driving shared temporal and/or spatial expression of groups of genes, is likely predicated on genomic elements that contain similar modules of certain transcription factor binding sites (TFBS). We have developed a method to scan vertebrate genomes for evolutionary conserved modules of TFBS in a predefined configuration, and created a tool, named SynoR that identify synonymous regulatory elements (SREs) in vertebrate genomes. SynoR performs de novo identification of SREs utilizing known patterns of TFBS in active regulatory elements (REs) as seeds for genome scans. Layers of multiple-species conservation allow the use of differential phylogenetic sequence conservation filters in the search of SREs and the results are displayed as to provide an extensive annotation of genes containing detected REs. Gene Ontology categories are utilized to further functionally classify the identified genes, and integrated GNF Expression Atlas 2 data allow the cataloging of tissue-specificities of the predicted SREs. We illustrate how this new tool can be used to establish a linkage between human diseases and noncoding genomic content. SynoR is publicly available at

  15. Dynamic SPR monitoring of yeast nuclear protein binding to a cis-regulatory element

    SciTech Connect

    Mao, Grace; Brody, James P.


    Gene expression is controlled by protein complexes binding to short specific sequences of DNA, called cis-regulatory elements. Expression of most eukaryotic genes is controlled by dozens of these elements. Comprehensive identification and monitoring of these elements is a major goal of genomics. In pursuit of this goal, we are developing a surface plasmon resonance (SPR) based assay to identify and monitor cis-regulatory elements. To test whether we could reliably monitor protein binding to a regulatory element, we immobilized a 16 bp region of Saccharomyces cerevisiae chromosome 5 onto a gold surface. This 16 bp region of DNA is known to bind several proteins and thought to control expression of the gene RNR1, which varies through the cell cycle. We synchronized yeast cell cultures, and then sampled these cultures at a regular interval. These samples were processed to purify nuclear lysate, which was then exposed to the sensor. We found that nuclear protein binds this particular element of DNA at a significantly higher rate (as compared to unsynchronized cells) during G1 phase. Other time points show levels of DNA-nuclear protein binding similar to the unsynchronized control. We also measured the apparent association complex of the binding to be 0.014 s{sup -1}. We conclude that (1) SPR-based assays can monitor DNA-nuclear protein binding and that (2) for this particular cis-regulatory element, maximum DNA-nuclear protein binding occurs during G1 phase.

  16. Information capacity of genetic regulatory elements

    NASA Astrophysics Data System (ADS)

    Tkačik, Gašper; Callan, Curtis G., Jr.; Bialek, William


    Changes in a cell’s external or internal conditions are usually reflected in the concentrations of the relevant transcription factors. These proteins in turn modulate the expression levels of the genes under their control and sometimes need to perform nontrivial computations that integrate several inputs and affect multiple genes. At the same time, the activities of the regulated genes would fluctuate even if the inputs were held fixed, as a consequence of the intrinsic noise in the system, and such noise must fundamentally limit the reliability of any genetic computation. Here we use information theory to formalize the notion of information transmission in simple genetic regulatory elements in the presence of physically realistic noise sources. The dependence of this “channel capacity” on noise parameters, cooperativity and cost of making signaling molecules is explored systematically. We find that, in the range of parameters probed by recent in vivo measurements, capacities higher than one bit should be achievable. It is of course generally accepted that gene regulatory elements must, in order to function properly, have a capacity of at least one bit. The central point of our analysis is the demonstration that simple physical models of noisy gene transcription, with realistic parameters, can indeed achieve this capacity: it was not self-evident that this should be so. We also demonstrate that capacities significantly greater than one bit are possible, so that transcriptional regulation need not be limited to simple “on-off” components. The question whether real systems actually exploit this richer possibility is beyond the scope of this investigation.

  17. Efficiently finding regulatory elements using correlation with gene expression.


    Bannai, Hideo; Inenaga, Shunsuke; Shinohara, Ayumi; Takeda, Masayuki; Miyano, Satoru


    We present an efficient algorithm for detecting putative regulatory elements in the upstream DNA sequences of genes, using gene expression information obtained from microarray experiments. Based on a generalized suffix tree, our algorithm looks for motif patterns whose appearance in the upstream region is most correlated with the expression levels of the genes. We are able to find the optimal pattern, in time linear in the total length of the upstream sequences. We implement and apply our algorithm to publicly available microarray gene expression data, and show that our method is able to discover biologically significant motifs, including various motifs which have been reported previously using the same data set. We further discuss applications for which the efficiency of the method is essential, as well as possible extensions to our algorithm.

  18. Discovery of regulatory elements is improved by a discriminatory approach.


    Valen, Eivind; Sandelin, Albin; Winther, Ole; Krogh, Anders


    A major goal in post-genome biology is the complete mapping of the gene regulatory networks for every organism. Identification of regulatory elements is a prerequisite for realizing this ambitious goal. A common problem is finding regulatory patterns in promoters of a group of co-expressed genes, but contemporary methods are challenged by the size and diversity of regulatory regions in higher metazoans. Two key issues are the small amount of information contained in a pattern compared to the large promoter regions and the repetitive characteristics of genomic DNA, which both lead to "pattern drowning". We present a new computational method for identifying transcription factor binding sites in promoters using a discriminatory approach with a large negative set encompassing a significant sample of the promoters from the relevant genome. The sequences are described by a probabilistic model and the most discriminatory motifs are identified by maximizing the probability of the sets given the motif model and prior probabilities of motif occurrences in both sets. Due to the large number of promoters in the negative set, an enhanced suffix array is used to improve speed and performance. Using our method, we demonstrate higher accuracy than the best of contemporary methods, high robustness when extending the length of the input sequences and a strong correlation between our objective function and the correct solution. Using a large background set of real promoters instead of a simplified model leads to higher discriminatory power and markedly reduces the need for repeat masking; a common pre-processing step for other pattern finders.

  19. A DNA element in the slo gene modulates ethanol tolerance.


    Krishnan, Harish R; Li, Xiaolei; Ghezzi, Alfredo; Atkinson, Nigel S


    In Drosophila, the slo gene encodes BK-type Ca(2+)-activated K(+) channels and is involved in producing rapid functional tolerance to sedation with ethanol. Drosophila are ideal for the study of functional ethanol tolerance because the adult does not acquire metabolic ethanol tolerance (Scholz, Ramond, Singh, & Heberlein, 2000). It has been shown that mutations in slo block the capacity to acquire tolerance, that sedation with ethanol vapor induces slo gene expression in the nervous system, and that transgenic induction of slo can phenocopy tolerance (Cowmeadow, Krishnan, & Atkinson, 2005; Cowmeadow et al., 2006). Here we use ethanol-induced histone acetylation to map a DNA regulatory element in the slo transcriptional control region and functionally test the element for a role in producing ethanol tolerance. Histone acetylation is commonly associated with activating transcription factors. We used the chromatin immunoprecipitation assay to map histone acetylation changes following ethanol sedation to identify an ethanol-responsive DNA element. Ethanol sedation induced an increase in histone acetylation over a 60 n DNA element called 6b, which is situated between the two ethanol-responsive neural promoters of the slo gene. Removal of the 6b element from the endogenous slo gene affected the production of functional ethanol tolerance as assayed in an ethanol-vapor recovery from sedation assay. Removal of element 6b extended the period of functional ethanol tolerance from ∼10 days to more than 21 days after a single ethanol-vapor sedation. This study demonstrates that mapping the position of ethanol-induced histone acetylation is an effective way to identify DNA regulatory elements that help to mediate the response of a gene to ethanol. Using this approach, we identified a DNA element, which is conserved among Drosophila species, and which is important for producing a behaviorally relevant ethanol response.

  20. Annotation of cis-regulatory elements by identification, subclassification, and functional assessment of multispecies conserved sequences

    PubMed Central

    Hughes, Jim R.; Cheng, Jan-Fang; Ventress, Nicki; Prabhakar, Shyam; Clark, Kevin; Anguita, Eduardo; De Gobbi, Marco; de Jong, Pieter; Rubin, Eddy; Higgs, Douglas R.


    An important step toward improving the annotation of the human genome is to identify cis-acting regulatory elements from primary DNA sequence. One approach is to compare sequences from multiple, divergent species. This approach distinguishes multispecies conserved sequences (MCS) in noncoding regions from more rapidly evolving neutral DNA. Here, we have analyzed a region of ≈238kb containing the human α globin cluster that was sequenced and/or annotated across the syntenic region in 22 species spanning 500 million years of evolution. Using a variety of bioinformatic approaches and correlating the results with many aspects of chromosome structure and function in this region, we were able to identify and evaluate the importance of 24 individual MCSs. This approach sensitively and accurately identified previously characterized regulatory elements but also discovered unidentified promoters, exons, splicing, and transcriptional regulatory elements. Together, these studies demonstrate an integrated approach by which to identify, subclassify, and predict the potential importance of MCSs. PMID:15998734

  1. Isolation of a non-genomic origin fluoroquinolone responsive regulatory element using a combinatorial bioengineering approach.


    Srivastava, Santosh Kumar; Iyer, V Rajesh; Ghosh, Tamoghna; Lambadi, Paramesh Ramulu; Pathania, Ranjana; Navani, Naveen Kumar


    Advances in chemical biology have led to selection of synthetic functional nucleic acids for in vivo applications. Discovery of synthetic nucleic acid regulatory elements has been a long-standing goal of chemical biologists. Availability of vast genome level genetic resources has motivated efforts for discovery and understanding of inducible synthetic genetic regulatory elements. Such elements can lead to custom-design of switches and sensors, oscillators, digital logic evaluators and cell-cell communicators. Here, we describe a simple, robust and universally applicable module for discovery of inducible gene regulatory elements. The distinguishing feature is the use of a toxic peptide as a reporter to suppress the background of unwanted bacterial recombinants. Using this strategy, we show that it is possible to isolate genetic elements of non-genomic origin which specifically get activated in the presence of DNA gyrase A inhibitors belonging to fluoroquinolone (FQ) group of chemicals. Further, using a system level genetic resource, we prove that the genetic regulation is exerted through histone-like nucleoid structuring (H-NS) repressor protein. Till date, there are no reports of in vivo selection of non-genomic origin inducible regulatory promoter like elements. Our strategy opens an uncharted route to discover inducible synthetic regulatory elements from biologically-inspired nucleic acid sequences.

  2. EMERGE: a flexible modelling framework to predict genomic regulatory elements from genomic signatures

    PubMed Central

    van Duijvenboden, Karel; de Boer, Bouke A.; Capon, Nicolas; Ruijter, Jan M.; Christoffels, Vincent M.


    Regulatory DNA elements, short genomic segments that regulate gene expression, have been implicated in developmental disorders and human disease. Despite this clinical urgency, only a small fraction of the regulatory DNA repertoire has been confirmed through reporter gene assays. The overall success rate of functional validation of candidate regulatory elements is low. Moreover, the number and diversity of datasets from which putative regulatory elements can be identified is large and rapidly increasing. We generated a flexible and user-friendly tool to integrate the information from different types of genomic datasets, e.g. ATAC-seq, ChIP-seq, conservation, aiming to increase the ease and success rate of functional prediction. To this end, we developed the EMERGE program that merges all datasets that the user considers informative and uses a logistic regression framework, based on validated functional elements, to set optimal weights to these datasets. ROC curve analysis shows that a combination of datasets leads to improved prediction of tissue-specific enhancers in human, mouse and Drosophila genomes. Functional assays based on this prediction can be expected to have substantially higher success rates. The resulting integrated signal for prediction of functional elements can be plotted in a build-in genome browser or exported for further analysis. PMID:26531828

  3. Distant cis Regulatory Elements in Human Skeletal Muscle Differentiation

    PubMed Central

    McCord, Rachel Patton; Zhou, Vicky W.; Yuh, Tiffany; Bulyk, Martha L.


    Identifying gene regulatory elements and their target genes in human cells remains a significant challenge. Despite increasing evidence of physical interactions between distant regulatory elements and gene promoters in mammalian cells, many studies consider only promoter-proximal regulatory regions. We identify putative cis-regulatory modules (CRMs) in human skeletal muscle differentiation by combining myogenic TF binding data before and after differentiation with histone modification data in myoblasts. CRMs that are distant (>20 kb) from muscle gene promoters are common and are more likely than proximal promoter regions to show differentiation-specific changes in myogenic TF binding. We find that two of these distant CRMs, known to activate transcription in differentiating myoblasts, interact physically with gene promoters (PDLIM3 and ACTA1) during differentiation. Our results highlight the importance of considering distal CRMs in investigations of mammalian gene regulation and support the hypothesis that distant CRM-promoter looping contacts are a general mechanism of gene regulation. PMID:21907276

  4. The identification of cis-regulatory elements: A review from a machine learning perspective.


    Li, Yifeng; Chen, Chih-Yu; Kaye, Alice M; Wasserman, Wyeth W


    The majority of the human genome consists of non-coding regions that have been called junk DNA. However, recent studies have unveiled that these regions contain cis-regulatory elements, such as promoters, enhancers, silencers, insulators, etc. These regulatory elements can play crucial roles in controlling gene expressions in specific cell types, conditions, and developmental stages. Disruption to these regions could contribute to phenotype changes. Precisely identifying regulatory elements is key to deciphering the mechanisms underlying transcriptional regulation. Cis-regulatory events are complex processes that involve chromatin accessibility, transcription factor binding, DNA methylation, histone modifications, and the interactions between them. The development of next-generation sequencing techniques has allowed us to capture these genomic features in depth. Applied analysis of genome sequences for clinical genetics has increased the urgency for detecting these regions. However, the complexity of cis-regulatory events and the deluge of sequencing data require accurate and efficient computational approaches, in particular, machine learning techniques. In this review, we describe machine learning approaches for predicting transcription factor binding sites, enhancers, and promoters, primarily driven by next-generation sequencing data. Data sources are provided in order to facilitate testing of novel methods. The purpose of this review is to attract computational experts and data scientists to advance this field.

  5. A user's guide to the encyclopedia of DNA elements (ENCODE).



    The mission of the Encyclopedia of DNA Elements (ENCODE) Project is to enable the scientific and medical communities to interpret the human genome sequence and apply it to understand human biology and improve health. The ENCODE Consortium is integrating multiple technologies and approaches in a collective effort to discover and define the functional elements encoded in the human genome, including genes, transcripts, and transcriptional regulatory regions, together with their attendant chromatin states and DNA methylation patterns. In the process, standards to ensure high-quality data have been implemented, and novel algorithms have been developed to facilitate analysis. Data and derived results are made available through a freely accessible database. Here we provide an overview of the project and the resources it is generating and illustrate the application of ENCODE data to interpret the human genome.

  6. A User's Guide to the Encyclopedia of DNA Elements (ENCODE)

    PubMed Central


    The mission of the Encyclopedia of DNA Elements (ENCODE) Project is to enable the scientific and medical communities to interpret the human genome sequence and apply it to understand human biology and improve health. The ENCODE Consortium is integrating multiple technologies and approaches in a collective effort to discover and define the functional elements encoded in the human genome, including genes, transcripts, and transcriptional regulatory regions, together with their attendant chromatin states and DNA methylation patterns. In the process, standards to ensure high-quality data have been implemented, and novel algorithms have been developed to facilitate analysis. Data and derived results are made available through a freely accessible database. Here we provide an overview of the project and the resources it is generating and illustrate the application of ENCODE data to interpret the human genome. PMID:21526222

  7. Two regulatory RNA elements affect TisB-dependent depolarization and persister formation.


    Berghoff, Bork A; Hoekzema, Mirthe; Aulbach, Lena; Wagner, E Gerhart H


    Bacterial survival strategies involve phenotypic diversity which is generated by regulatory factors and noisy expression of effector proteins. The question of how bacteria exploit regulatory RNAs to make decisions between phenotypes is central to a general understanding of these universal regulators. We investigated the TisB/IstR-1 toxin-antitoxin system of Escherichia coli to appreciate the role of the RNA antitoxin IstR-1 in TisB-dependent depolarization of the inner membrane and persister formation. Persisters are phenotypic variants that have become transiently drug-tolerant by arresting growth. The RNA antitoxin IstR-1 sets a threshold for TisB-dependent depolarization under DNA-damaging conditions, resulting in two sub-populations: polarized and depolarized cells. Furthermore, our data indicate that an inhibitory 5' UTR structure in the tisB mRNA serves as a regulatory RNA element that delays TisB translation to avoid inappropriate depolarization when DNA damage is low. Investigation of the persister sub-population further revealed that both regulatory RNA elements affect persister levels as well as persistence time. This work provides an intriguing example of how bacteria exploit regulatory RNAs to control phenotypic heterogeneity.

  8. The ENCODE (ENCyclopedia Of DNA Elements) Project.



    The ENCyclopedia Of DNA Elements (ENCODE) Project aims to identify all functional elements in the human genome sequence. The pilot phase of the Project is focused on a specified 30 megabases (approximately 1%) of the human genome sequence and is organized as an international consortium of computational and laboratory-based scientists working to develop and apply high-throughput approaches for detecting all sequence elements that confer biological function. The results of this pilot phase will guide future efforts to analyze the entire human genome.

  9. Close Sequence Comparisons are Sufficient to Identify Humancis-Regulatory Elements

    SciTech Connect

    Prabhakar, Shyam; Poulin, Francis; Shoukry, Malak; Afzal, Veena; Rubin, Edward M.; Couronne, Olivier; Pennacchio, Len A.


    Cross-species DNA sequence comparison is the primary method used to identify functional noncoding elements in human and other large genomes. However, little is known about the relative merits of evolutionarily close and distant sequence comparisons, due to the lack of a universal metric for sequence conservation, and also the paucity of empirically defined benchmark sets of cis-regulatory elements. To address this problem, we developed a general-purpose algorithm (Gumby) that detects slowly-evolving regions in primate, mammalian and more distant comparisons without requiring adjustment of parameters, and ranks conserved elements by P-value using Karlin-Altschul statistics. We benchmarked Gumby predictions against previously identified cis-regulatory elements at diverse genomic loci, and also tested numerous extremely conserved human-rodent sequences for transcriptional enhancer activity using reporter-gene assays in transgenic mice. Human regulatory elements were identified with acceptable sensitivity and specificity by comparison with 1-5 other eutherian mammals or 6 other simian primates. More distant comparisons (marsupial, avian, amphibian and fish) failed to identify many of the empirically defined functional noncoding elements. We derived an intuitive relationship between ancient and recent noncoding sequence conservation from whole genome comparative analysis, which explains some of these findings. Lastly, we determined that, in addition to strength of conservation, genomic location and/or density of surrounding conserved elements must also be considered in selecting candidate enhancers for testing at embryonic time points.

  10. An Integrated Encyclopedia of DNA Elements in the Human Genome

    PubMed Central


    Summary The human genome encodes the blueprint of life, but the function of the vast majority of its nearly three billion bases is unknown. The Encyclopedia of DNA Elements (ENCODE) project has systematically mapped regions of transcription, transcription factor association, chromatin structure, and histone modification. These data enabled us to assign biochemical functions for 80% of the genome, in particular outside of the well-studied protein-coding regions. Many discovered candidate regulatory elements are physically associated with one another and with expressed genes, providing new insights into the mechanisms of gene regulation. The newly identified elements also show a statistical correspondence to sequence variants linked to human disease, and can thereby guide interpretation of this variation. Overall the project provides new insights into the organization and regulation of our genes and genome, and an expansive resource of functional annotations for biomedical research. PMID:22955616

  11. An integrated encyclopedia of DNA elements in the human genome.



    The human genome encodes the blueprint of life, but the function of the vast majority of its nearly three billion bases is unknown. The Encyclopedia of DNA Elements (ENCODE) project has systematically mapped regions of transcription, transcription factor association, chromatin structure and histone modification. These data enabled us to assign biochemical functions for 80% of the genome, in particular outside of the well-studied protein-coding regions. Many discovered candidate regulatory elements are physically associated with one another and with expressed genes, providing new insights into the mechanisms of gene regulation. The newly identified elements also show a statistical correspondence to sequence variants linked to human disease, and can thereby guide interpretation of this variation. Overall, the project provides new insights into the organization and regulation of our genes and genome, and is an expansive resource of functional annotations for biomedical research.

  12. Identification of germline transcriptional regulatory elements in Aedes aegypti

    NASA Astrophysics Data System (ADS)

    Akbari, Omar S.; Papathanos, Philippos A.; Sandler, Jeremy E.; Kennedy, Katie; Hay, Bruce A.


    The mosquito Aedes aegypti is the principal vector for the yellow fever and dengue viruses, and is also responsible for recent outbreaks of the alphavirus chikungunya. Vector control strategies utilizing engineered gene drive systems are being developed as a means of replacing wild, pathogen transmitting mosquitoes with individuals refractory to disease transmission, or bringing about population suppression. Several of these systems, including Medea, UDMEL, and site-specific nucleases, which can be used to drive genes into populations or bring about population suppression, utilize transcriptional regulatory elements that drive germline-specific expression. Here we report the identification of multiple regulatory elements able to drive gene expression specifically in the female germline, or in the male and female germline, in the mosquito Aedes aegypti. These elements can also be used as tools with which to probe the roles of specific genes in germline function and in the early embryo, through overexpression or RNA interference.

  13. A saturation screen for cis-acting regulatory DNA in the Hox genes of Ciona intestinalis

    SciTech Connect

    Keys, David N.; Lee, Byung-in; Di Gregorio, Anna; Harafuji, Naoe; Detter, Chris; Wang, Mei; Kahsai, Orsalem; Ahn, Sylvia; Arellano, Andre; Zhang, Quin; Trong, Stephan; Doyle, Sharon A.; Satoh, Noriyuki; Satou, Yutaka; Saiga, Hidetoshi; Christian, Allen; Rokhsar, Dan; Hawkins, Trevor L.; Levine, Mike; Richardson, Paul


    A screen for the systematic identification of cis-regulatory elements within large (>100 kb) genomic domains containing Hox genes was performed by using the basal chordate Ciona intestinalis. Randomly generated DNA fragments from bacterial artificial chromosomes containing two clusters of Hox genes were inserted into a vector upstream of a minimal promoter and lacZ reporter gene. A total of 222 resultant fusion genes were separately electroporated into fertilized eggs, and their regulatory activities were monitored in larvae. In sum, 21 separable cis-regulatory elements were found. These include eight Hox linked domains that drive expression in nested anterior-posterior domains of ectodermally derived tissues. In addition to vertebrate-like CNS regulation, the discovery of cis-regulatory domains that drive epidermal transcription suggests that C. intestinalis has arthropod-like Hox patterning in the epidermis.

  14. Identification of functional elements and regulatory circuits by Drosophila modENCODE.


    Roy, Sushmita; Ernst, Jason; Kharchenko, Peter V; Kheradpour, Pouya; Negre, Nicolas; Eaton, Matthew L; Landolin, Jane M; Bristow, Christopher A; Ma, Lijia; Lin, Michael F; Washietl, Stefan; Arshinoff, Bradley I; Ay, Ferhat; Meyer, Patrick E; Robine, Nicolas; Washington, Nicole L; Di Stefano, Luisa; Berezikov, Eugene; Brown, Christopher D; Candeias, Rogerio; Carlson, Joseph W; Carr, Adrian; Jungreis, Irwin; Marbach, Daniel; Sealfon, Rachel; Tolstorukov, Michael Y; Will, Sebastian; Alekseyenko, Artyom A; Artieri, Carlo; Booth, Benjamin W; Brooks, Angela N; Dai, Qi; Davis, Carrie A; Duff, Michael O; Feng, Xin; Gorchakov, Andrey A; Gu, Tingting; Henikoff, Jorja G; Kapranov, Philipp; Li, Renhua; MacAlpine, Heather K; Malone, John; Minoda, Aki; Nordman, Jared; Okamura, Katsutomo; Perry, Marc; Powell, Sara K; Riddle, Nicole C; Sakai, Akiko; Samsonova, Anastasia; Sandler, Jeremy E; Schwartz, Yuri B; Sher, Noa; Spokony, Rebecca; Sturgill, David; van Baren, Marijke; Wan, Kenneth H; Yang, Li; Yu, Charles; Feingold, Elise; Good, Peter; Guyer, Mark; Lowdon, Rebecca; Ahmad, Kami; Andrews, Justen; Berger, Bonnie; Brenner, Steven E; Brent, Michael R; Cherbas, Lucy; Elgin, Sarah C R; Gingeras, Thomas R; Grossman, Robert; Hoskins, Roger A; Kaufman, Thomas C; Kent, William; Kuroda, Mitzi I; Orr-Weaver, Terry; Perrimon, Norbert; Pirrotta, Vincenzo; Posakony, James W; Ren, Bing; Russell, Steven; Cherbas, Peter; Graveley, Brenton R; Lewis, Suzanna; Micklem, Gos; Oliver, Brian; Park, Peter J; Celniker, Susan E; Henikoff, Steven; Karpen, Gary H; Lai, Eric C; MacAlpine, David M; Stein, Lincoln D; White, Kevin P; Kellis, Manolis


    To gain insight into how genomic information is translated into cellular and developmental programs, the Drosophila model organism Encyclopedia of DNA Elements (modENCODE) project is comprehensively mapping transcripts, histone modifications, chromosomal proteins, transcription factors, replication proteins and intermediates, and nucleosome properties across a developmental time course and in multiple cell lines. We have generated more than 700 data sets and discovered protein-coding, noncoding, RNA regulatory, replication, and chromatin elements, more than tripling the annotated portion of the Drosophila genome. Correlated activity patterns of these elements reveal a functional regulatory network, which predicts putative new functions for genes, reveals stage- and tissue-specific regulators, and enables gene-expression prediction. Our results provide a foundation for directed experimental and computational studies in Drosophila and related species and also a model for systematic data integration toward comprehensive genomic and functional annotation.

  15. Comprehensive identification and analysis of human accelerated regulatory DNA

    PubMed Central

    Gittelman, Rachel M.; Hun, Enna; Ay, Ferhat; Madeoy, Jennifer; Pennacchio, Len; Noble, William S.; Hawkins, R. David; Akey, Joshua M.


    It has long been hypothesized that changes in gene regulation have played an important role in human evolution, but regulatory DNA has been much more difficult to study compared with protein-coding regions. Recent large-scale studies have created genome-scale catalogs of DNase I hypersensitive sites (DHSs), which demark potentially functional regulatory DNA. To better define regulatory DNA that has been subject to human-specific adaptive evolution, we performed comprehensive evolutionary and population genetics analyses on over 18 million DHSs discovered in 130 cell types. We identified 524 DHSs that are conserved in nonhuman primates but accelerated in the human lineage (haDHS), and estimate that 70% of substitutions in haDHSs are attributable to positive selection. Through extensive computational and experimental analyses, we demonstrate that haDHSs are often active in brain or neuronal cell types; play an important role in regulating the expression of developmentally important genes, including many transcription factors such as SOX6, POU3F2, and HOX genes; and identify striking examples of adaptive regulatory evolution that may have contributed to human-specific phenotypes. More generally, our results reveal new insights into conserved and adaptive regulatory DNA in humans and refine the set of genomic substrates that distinguish humans from their closest living primate relatives. PMID:26104583

  16. Identifying splicing regulatory elements with de Bruijn graphs.


    Badr, Eman; Heath, Lenwood S


    Splicing regulatory elements (SREs) are short, degenerate sequences on pre-mRNA molecules that enhance or inhibit the splicing process via the binding of splicing factors, proteins that regulate the functioning of the spliceosome. Existing methods for identifying SREs in a genome are either experimental or computational. Here, we propose a formalism based on de Bruijn graphs that combines genomic structure, word count enrichment analysis, and experimental evidence to identify SREs found in exons. In our approach, SREs are not restricted to a fixed length (i.e., k-mers, for a fixed k). As a result, we identify 2001 putative exonic enhancers and 3080 putative exonic silencers for human genes, with lengths varying from 6 to 15 nucleotides. Many of the predicted SREs overlap with experimentally verified binding sites. Our model provides a novel method to predict variable length putative regulatory elements computationally for further experimental investigation.

  17. Transposable Elements: No More 'Junk DNA'.


    Kim, Yun-Ji; Lee, Jungnam; Han, Kyudong


    Since the advent of whole-genome sequencing, transposable elements (TEs), just thought to be 'junk' DNA, have been noticed because of their numerous copies in various eukaryotic genomes. Many studies about TEs have been conducted to discover their functions in their host genomes. Based on the results of those studies, it has been generally accepted that they have a function to cause genomic and genetic variations. However, their infinite functions are not fully elucidated. Through various mechanisms, including de novo TE insertions, TE insertion-mediated deletions, and recombination events, they manipulate their host genomes. In this review, we focus on Alu, L1, human endogenous retrovirus, and short interspersed element/variable number of tandem repeats/Alu (SVA) elements and discuss how they have affected primate genomes, especially the human and chimpanzee genomes, since their divergence.

  18. Combinatorial Gene Regulatory Functions Underlie Ultraconserved Elements in Drosophila.


    Warnefors, Maria; Hartmann, Britta; Thomsen, Stefan; Alonso, Claudio R


    Ultraconserved elements (UCEs) are discrete genomic elements conserved across large evolutionary distances. Although UCEs have been linked to multiple facets of mammalian gene regulation their extreme evolutionary conservation remains largely unexplained. Here, we apply a computational approach to investigate this question in Drosophila, exploring the molecular functions of more than 1,500 UCEs shared across the genomes of 12 Drosophila species. Our data indicate that Drosophila UCEs are hubs for gene regulatory functions and suggest that UCE sequence invariance originates from their combinatorial roles in gene control. We also note that the gene regulatory roles of intronic and intergenic UCEs (iUCEs) are distinct from those found in exonic UCEs (eUCEs). In iUCEs, transcription factor (TF) and epigenetic factor binding data strongly support iUCE roles in transcriptional and epigenetic regulation. In contrast, analyses of eUCEs indicate that they are two orders of magnitude more likely than the expected to simultaneously include protein-coding sequence, TF-binding sites, splice sites, and RNA editing sites but have reduced roles in transcriptional or epigenetic regulation. Furthermore, we use a Drosophila cell culture system and transgenic Drosophila embryos to validate the notion of UCE combinatorial regulatory roles using an eUCE within the Hox gene Ultrabithorax and show that its protein-coding region also contains alternative splicing regulatory information. Taken together our experiments indicate that UCEs emerge as a result of combinatorial gene regulatory roles and highlight common features in mammalian and insect UCEs implying that similar processes might underlie ultraconservation in diverse animal taxa.

  19. Combinatorial Gene Regulatory Functions Underlie Ultraconserved Elements in Drosophila

    PubMed Central

    Warnefors, Maria; Hartmann, Britta; Thomsen, Stefan; Alonso, Claudio R.


    Ultraconserved elements (UCEs) are discrete genomic elements conserved across large evolutionary distances. Although UCEs have been linked to multiple facets of mammalian gene regulation their extreme evolutionary conservation remains largely unexplained. Here, we apply a computational approach to investigate this question in Drosophila, exploring the molecular functions of more than 1,500 UCEs shared across the genomes of 12 Drosophila species. Our data indicate that Drosophila UCEs are hubs for gene regulatory functions and suggest that UCE sequence invariance originates from their combinatorial roles in gene control. We also note that the gene regulatory roles of intronic and intergenic UCEs (iUCEs) are distinct from those found in exonic UCEs (eUCEs). In iUCEs, transcription factor (TF) and epigenetic factor binding data strongly support iUCE roles in transcriptional and epigenetic regulation. In contrast, analyses of eUCEs indicate that they are two orders of magnitude more likely than the expected to simultaneously include protein-coding sequence, TF-binding sites, splice sites, and RNA editing sites but have reduced roles in transcriptional or epigenetic regulation. Furthermore, we use a Drosophila cell culture system and transgenic Drosophila embryos to validate the notion of UCE combinatorial regulatory roles using an eUCE within the Hox gene Ultrabithorax and show that its protein-coding region also contains alternative splicing regulatory information. Taken together our experiments indicate that UCEs emerge as a result of combinatorial gene regulatory roles and highlight common features in mammalian and insect UCEs implying that similar processes might underlie ultraconservation in diverse animal taxa. PMID:27247329

  20. An information transmission model for transcription factor binding at regulatory DNA sites

    PubMed Central


    Background Computational identification of transcription factor binding sites (TFBSs) is a rapid, cost-efficient way to locate unknown regulatory elements. With increased potential for high-throughput genome sequencing, the availability of accurate computational methods for TFBS prediction has never been as important as it currently is. To date, identifying TFBSs with high sensitivity and specificity is still an open challenge, necessitating the development of novel models for predicting transcription factor-binding regulatory DNA elements. Results Based on the information theory, we propose a model for transcription factor binding of regulatory DNA sites. Our model incorporates position interdependencies in effective ways. The model computes the information transferred (TI) between the transcription factor and the TFBS during the binding process and uses TI as the criterion to determine whether the sequence motif is a possible TFBS. Based on this model, we developed a computational method to identify TFBSs. By theoretically proving and testing our model using both real and artificial data, we found that our model provides highly accurate predictive results. Conclusions In this study, we present a novel model for transcription factor binding regulatory DNA sites. The model can provide an increased ability to detect TFBSs. PMID:22672438

  1. Functional implications of local DNA structures in regulatory motifs.


    Xiang, Qian


    The three-dimensional structure of DNA has been proposed to be a major determinant for functional transcription factors (TFs) and DNA interaction. Here, we use hydroxyl radical cleavage pattern as a measure of local DNA structure. We compared the conservation between DNA sequence and structure in terms of information content and attempted to assess the functional implications of DNA structures in regulatory motifs. We used statistical methods to evaluate the structural divergence of substituting a single position within a binding site and applied them to a collection of putative regulatory motifs. The following are our major observations: (i) we observed more information in structural alignment than in the corresponding sequence alignment for most of the transcriptional factors; (ii) for each TF, majority of positions have more information in the structural alignment as compared to the sequence alignment; (iii) we further defined a DNA structural divergence score (SD score) for each wild-type and mutant pair that is distinguished by single-base mutation. The SD score for benign mutations is significantly lower than that of switch mutations. This indicates structural conservation is also important for TFBS to be functional and DNA structures will provide previously unappreciated information for TF to realize the binding specificity.

  2. Cis-regulatory RNA elements that regulate specialized ribosome activity

    PubMed Central

    Xue, Shifeng; Barna, Maria


    Recent evidence has shown that the ribosome itself can play a highly regulatory role in the specialized translation of specific subpools of mRNAs, in particular at the level of ribosomal proteins (RP). However, the mechanism(s) by which this selection takes place has remained poorly understood. In our recent study, we discovered a combination of unique RNA elements in the 5′UTRs of mRNAs that allows for such control by the ribosome. These mRNAs contain a Translation Inhibitory Element (TIE) that inhibits general cap-dependent translation, and an Internal Ribosome Entry Site (IRES) that relies on a specific RP for activation. The unique combination of an inhibitor of general translation and an activator of specialized translation is key to ribosome-mediated control of gene expression. Here we discuss how these RNA regulatory elements provide a new level of control to protein expression and their implications for gene expression, organismal development and evolution. PMID:26327194

  3. DNA supercoiling: A regulatory signal for the λ repressor

    PubMed Central

    Ding, Yue; Manzo, Carlo; Fulcrand, Geraldine; Leng, Fenfei; Dunlap, David; Finzi, Laura


    Topoisomerases, polymerases, and the chirality introduced by the binding of histones or nucleoid-associated proteins affect DNA supercoiling in vivo. However, supercoiling is not just a by-product of DNA metabolism. Supercoiling is an indicator of cell health, it modifies the accessibility of chromatin, and coordinates the transcription of genes. This suggests that regulatory, protein-mediated loops in DNA may sense supercoiling of the genome in which they are embedded. The λ repressor (CI) maintains the quiescent (lysogenic) transcriptome of bacteriophage λ in infected Escherichia coli. CI-mediated looping prevents overexpression of the repressor protein to preserve sensitivity to conditions that trigger virulence (lysis). Experiments were performed to assess how well the CI-mediated DNA loop traps superhelicity and determine whether supercoiling enhances CI-mediated DNA looping. CI oligomers partitioned plasmids into topological domains and prevented the passage of supercoiling between them. Furthermore, in single DNA molecules stretched and twisted with magnetic tweezers, levels of superhelical density confined in CI-mediated DNA loops ranged from −15% or +11%. Finally, in DNA under tensions that may occur in vivo, supercoiling lowered the free energy of loop formation and was essential for DNA looping. Supercoiling-enhanced looping can influence the maintenance of lysogeny in the λ repressor system; it can encode sensitivity to the energy level of the cell and creates independent topological domains of distinct superhelical density. PMID:25319264

  4. Analysis of long-range interactions in primary human cells identifies cooperative CFTR regulatory elements

    PubMed Central

    Moisan, Stéphanie; Berlivet, Soizik; Ka, Chandran; Gac, Gérald Le; Dostie, Josée; Férec, Claude


    A mechanism by which control DNA elements regulate transcription over large linear genomic distances is by achieving close physical proximity with genes, and looping of the intervening chromatin paths. Alterations of such regulatory ‘chromatin looping’ systems are likely to play a critical role in human genetic disease at large. Here, we studied the spatial organization of a ≈790 kb locus encompassing the cystic fibrosis transmembrane conductance regulator (CFTR) gene. Dysregulation of CFTR is responsible for cystic fibrosis, which is the most common lethal genetic disorder in Caucasian populations. CFTR is a relatively large gene of 189 kb with a rather complex tissue-specific and temporal expression profile. We used chromatin conformation at the CFTR locus to identify new DNA sequences that regulate its transcription. By comparing 5C chromatin interaction maps of the CFTR locus in expressing and non-expressing human primary cells, we identified several new contact points between the CFTR promoter and its surroundings, in addition to regions featuring previously described regulatory elements. We demonstrate that two of these novel interacting regions cooperatively increase CFTR expression, and suggest that the new enhancer elements located on either side of the gene are brought together through chromatin looping via CTCF. PMID:26615198

  5. Analysis of long-range interactions in primary human cells identifies cooperative CFTR regulatory elements.


    Moisan, Stéphanie; Berlivet, Soizik; Ka, Chandran; Le Gac, Gérald; Dostie, Josée; Férec, Claude


    A mechanism by which control DNA elements regulate transcription over large linear genomic distances is by achieving close physical proximity with genes, and looping of the intervening chromatin paths. Alterations of such regulatory 'chromatin looping' systems are likely to play a critical role in human genetic disease at large. Here, we studied the spatial organization of a ≈790 kb locus encompassing the cystic fibrosis transmembrane conductance regulator (CFTR) gene. Dysregulation of CFTR is responsible for cystic fibrosis, which is the most common lethal genetic disorder in Caucasian populations. CFTR is a relatively large gene of 189 kb with a rather complex tissue-specific and temporal expression profile. We used chromatin conformation at the CFTR locus to identify new DNA sequences that regulate its transcription. By comparing 5C chromatin interaction maps of the CFTR locus in expressing and non-expressing human primary cells, we identified several new contact points between the CFTR promoter and its surroundings, in addition to regions featuring previously described regulatory elements. We demonstrate that two of these novel interacting regions cooperatively increase CFTR expression, and suggest that the new enhancer elements located on either side of the gene are brought together through chromatin looping via CTCF.

  6. Epistatic Interactions in the Arabinose Cis-Regulatory Element.


    Lagator, Mato; Igler, Claudia; Moreno, Anaísa B; Guet, Călin C; Bollback, Jonathan P


    Changes in gene expression are an important mode of evolution; however, the proximate mechanism of these changes is poorly understood. In particular, little is known about the effects of mutations within cis binding sites for transcription factors, or the nature of epistatic interactions between these mutations. Here, we tested the effects of single and double mutants in two cis binding sites involved in the transcriptional regulation of the Escherichia coli araBAD operon, a component of arabinose metabolism, using a synthetic system. This system decouples transcriptional control from any posttranslational effects on fitness, allowing a precise estimate of the effect of single and double mutations, and hence epistasis, on gene expression. We found that epistatic interactions between mutations in the araBAD cis-regulatory element are common, and that the predominant form of epistasis is negative. The magnitude of the interactions depended on whether the mutations are located in the same or in different operator sites. Importantly, these epistatic interactions were dependent on the presence of arabinose, a native inducer of the araBAD operon in vivo, with some interactions changing in sign (e.g., from negative to positive) in its presence. This study thus reveals that mutations in even relatively simple cis-regulatory elements interact in complex ways such that selection on the level of gene expression in one environment might perturb regulation in the other environment in an unpredictable and uncorrelated manner.

  7. Identification of active transcriptional regulatory elements with GRO-seq

    PubMed Central

    Danko, Charles G.; Hyland, Stephanie L.; Core, Leighton J.; Martins, Andre L.; Waters, Colin T; Lee, Hyung Won; Cheung, Vivian G.; Kraus, W. Lee; Lis, John T.; Siepel, Adam


    Transcriptional regulatory elements (TREs), including enhancers and promoters, determine the transcription levels of associated genes. We have recently shown that global run-on and sequencing (GRO-seq) with enrichment for 5'-capped RNAs reveals active TREs with high accuracy. Here, we demonstrate that active TREs can be identified by applying sensitive machine-learning methods to standard GRO-seq data. This approach allows TREs to be assayed together with gene expression levels and other transcriptional features in a single experiment. Our prediction method, called discriminative Regulatory Element detection from GRO-seq (dREG), summarizes GRO-seq read counts at multiple scales and uses support vector regression to identify active TREs. The predicted TREs are more strongly enriched for several marks of transcriptional activation, including eQTL, GWAS-associated SNPs, H3K27ac, and transcription factor binding than those identified by alternative functional assays. Using dREG, we survey TREs in eight human cell types and provide new insights into global patterns of TRE function. PMID:25799441

  8. Structural property of regulatory elements in human promoters

    NASA Astrophysics Data System (ADS)

    Cao, Xiao-Qin; Zeng, Jia; Yan, Hong


    The capacity of transcription factors to activate gene expression is encoded in the promoter sequences, which are composed of short regulatory motifs that function as transcription factor binding sites (TFBSs) for specific proteins. To the best of our knowledge, the structural property of TFBSs that controls transcription is still poorly understood. Rigidity is one of the important structural properties of DNA, and plays an important role in guiding DNA-binding proteins to the target sites efficiently. After analyzing the rigidity of 2897 TFBSs in 1871 human promoters, we show that TFBSs are generally more flexible than other genomic regions such as exons, introns, 3' untranslated regions, and TFBS-poor promoter regions. Furthermore, we find that the density of TFBSs is consistent with the average rigidity profile of human promoters upstream of the transcription start site, which implies that TFBSs directly influence the promoter structure. We also examine the local rigid regions probably caused by specific TFBSs such as the DNA sequence TATA(A/T)A(A/T) box, which may inhibit nucleosomes and thereby facilitate the access of transcription factors bound nearby. Our results suggest that the structural property of TFBSs accounts for the promoter structure as well as promoter activity.

  9. Cell-type-specific enrichment of risk-associated regulatory elements at ovarian cancer susceptibility loci

    PubMed Central

    Coetzee, Simon G.; Shen, Howard C.; Hazelett, Dennis J.; Lawrenson, Kate; Kuchenbaecker, Karoline; Tyrer, Jonathan; Rhie, Suhn K.; Levanon, Keren; Karst, Alison; Drapkin, Ronny; Ramus, Susan J.; Couch, Fergus J.; Offit, Kenneth; Chenevix-Trench, Georgia; Monteiro, Alvaro N.A.; Antoniou, Antonis; Freedman, Matthew; Coetzee, Gerhard A.; Pharoah, Paul D.P.; Noushmehr, Houtan; Gayther, Simon A.


    Understanding the regulatory landscape of the human genome is a central question in complex trait genetics. Most single-nucleotide polymorphisms (SNPs) associated with cancer risk lie in non-protein-coding regions, implicating regulatory DNA elements as functional targets of susceptibility variants. Here, we describe genome-wide annotation of regions of open chromatin and histone modification in fallopian tube and ovarian surface epithelial cells (FTSECs, OSECs), the debated cellular origins of high-grade serous ovarian cancers (HGSOCs) and in endometriosis epithelial cells (EECs), the likely precursor of clear cell ovarian carcinomas (CCOCs). The regulatory architecture of these cell types was compared with normal human mammary epithelial cells and LNCaP prostate cancer cells. We observed similar positional patterns of global enhancer signatures across the three different ovarian cancer precursor cell types, and evidence of tissue-specific regulatory signatures compared to non-gynecological cell types. We found significant enrichment for risk-associated SNPs intersecting regulatory biofeatures at 17 known HGSOC susceptibility loci in FTSECs (P = 3.8 × 10−30), OSECs (P = 2.4 × 10−23) and HMECs (P = 6.7 × 10−15) but not for EECs (P = 0.45) or LNCaP cells (P = 0.88). Hierarchical clustering of risk SNPs conditioned on the six different cell types indicates FTSECs and OSECs are highly related (96% of samples using multi-scale bootstrapping) suggesting both cell types may be precursors of HGSOC. These data represent the first description of regulatory catalogues of normal precursor cells for different ovarian cancer subtypes, and provide unique insights into the tissue specific regulatory variation with respect to the likely functional targets of germline genetic susceptibility variants for ovarian cancer. PMID:25804953

  10. A cis-regulatory module activating transcription in the suspensor contains five cis-regulatory elements.


    Henry, Kelli F; Kawashima, Tomokazu; Goldberg, Robert B


    Little is known about the molecular mechanisms by which the embryo proper and suspensor of plant embryos activate specific gene sets shortly after fertilization. We analyzed the upstream region of the Scarlet Runner Bean (Phaseolus coccineus) G564 gene in order to understand how genes are activated specifically in the suspensor during early embryo development. Previously, we showed that a 54-bp fragment of the G564 upstream region is sufficient for suspensor transcription and contains at least three required cis-regulatory sequences, including the 10-bp motif (5'-GAAAAGCGAA-3'), the 10 bp-like motif (5'-GAAAAACGAA-3'), and Region 2 motif (partial sequence 5'-TTGGT-3'). Here, we use site-directed mutagenesis experiments in transgenic tobacco globular-stage embryos to identify two additional cis-regulatory elements within the 54-bp cis-regulatory module that are required for G564 suspensor transcription: the Fifth motif (5'-GAGTTA-3') and a third 10-bp-related sequence (5'-GAAAACCACA-3'). Further deletion of the 54-bp fragment revealed that a 47-bp fragment containing the five motifs (the 10-bp, 10-bp-like, 10-bp-related, Region 2 and Fifth motifs) is sufficient for suspensor transcription, and represents a cis-regulatory module. A consensus sequence for each type of motif was determined by comparing motif sequences shown to activate suspensor transcription. Phylogenetic analyses suggest that the regulation of G564 is evolutionarily conserved. A homologous cis-regulatory module was found upstream of the G564 ortholog in the Common Bean (Phaseolus vulgaris), indicating that the regulation of G564 is evolutionarily conserved in closely related bean species.

  11. Identification of a Soybean Protein That Interacts with GAGA Element Dinucleotide Repeat DNA1

    PubMed Central

    Sangwan, Indu; O'Brian, Mark R.


    Dinucleotide repeat DNA with the pattern (GA)n/(TC)n, so-called GAGA elements, control gene expression in animals, and are recognized by a specific regulatory protein. Here, a yeast one-hybrid screen was used to isolate soybean (Glycine max) cDNA encoding a GAGA-binding protein (GBP) that binds to (GA)n/(CT)n DNA. Soybean GBP was dissimilar from the GAGA factor of Drosophila melanogaster. Recombinant GBP protein did not bind to dinucleotide repeat sequences other than (GA)n/(CT)n. GBP bound to the promoter of the heme and chlorophyll synthesis gene Gsa1, which contains a GAGA element. Removal of that GAGA element abrogated binding of GBP to the promoter. Furthermore, insertion of the GAGA element to a nonspecific DNA conferred GBP-binding activity on that DNA. Thus, the GAGA element of the Gsa1 promoter is both necessary and sufficient for GBP binding. Gbp mRNA was expressed in leaves and was induced in symbiotic root nodules elicited by the bacterium Bradyrhizobium japonicum. In addition, Gbp transcripts were much higher in leaves of dark-treated etiolated plantlets than in those exposed to light for 24 h. Homologs of GBP were found in other dicots and in the monocot rice (Oryza sativa), as well. We suggest that interaction between GAGA elements and GBP-like proteins is a regulatory feature in plants. PMID:12177492

  12. Deciphering RNA Regulatory Elements Involved in the Developmental and Environmental Gene Regulation of Trypanosoma brucei.


    Gazestani, Vahid H; Salavati, Reza


    Trypanosoma brucei is a vector-borne parasite with intricate life cycle that can cause serious diseases in humans and animals. This pathogen relies on fine regulation of gene expression to respond and adapt to variable environments, with implications in transmission and infectivity. However, the involved regulatory elements and their mechanisms of actions are largely unknown. Here, benefiting from a new graph-based approach for finding functional regulatory elements in RNA (GRAFFER), we have predicted 88 new RNA regulatory elements that are potentially involved in the gene regulatory network of T. brucei. We show that many of these newly predicted elements are responsive to both transcriptomic and proteomic changes during the life cycle of the parasite. Moreover, we found that 11 of predicted elements strikingly resemble previously identified regulatory elements for the parasite. Additionally, comparison with previously predicted motifs on T. brucei suggested the superior performance of our approach based on the current limited knowledge of regulatory elements in T. brucei.

  13. Sterol Regulatory Element Binding Protein Is a Principal Regulator of Anaerobic Gene Expression in Fission Yeast†

    PubMed Central

    Todd, Bridget L.; Stewart, Emerson V.; Burg, John S.; Hughes, Adam L.; Espenshade, Peter J.


    Fission yeast sterol regulatory element binding protein (SREBP), called Sre1p, functions in an oxygen-sensing pathway to allow adaptation to fluctuating oxygen concentrations. The Sre1p-Scp1p complex responds to oxygen-dependent sterol synthesis as an indirect measure of oxygen availability. To examine the role of Sre1p in anaerobic gene expression in Schizosaccharomyces pombe, we performed transcriptional profiling experiments after a shift to anaerobic conditions for 1.5 h. Of the 4,940 genes analyzed, expression levels of 521 (10.5%) and 686 (13.9%) genes were significantly increased and decreased, respectively, under anaerobic conditions. Sre1p controlled 68% of genes induced ≥2-fold. Oxygen-requiring biosynthetic pathways for ergosterol, heme, sphingolipid, and ubiquinone were primary targets of Sre1p. Induction of glycolytic genes and repression of mitochondrial oxidative phosphorylation genes largely did not require Sre1p. Using chromatin immunoprecipitation, we demonstrated that Sre1p acts directly at target gene promoters and stimulates its own transcription under anaerobic conditions. sre1+ promoter analysis identified two DNA elements that are both necessary and sufficient for oxygen-dependent, Sre1p-dependent transcription. Interestingly, these elements are homologous to sterol regulatory elements bound by mammalian SREBP, highlighting the evolutionary conservation between Sre1p and SREBP. We conclude that Sre1p is a principal activator of anaerobic gene expression, upregulating genes required for nonrespiratory oxygen consumption. PMID:16537923

  14. Regulatory elements of the Staphylococcus aureus protein A (Spa) promoter.


    Gao, Jinxin; Stewart, George C


    Staphylococcal protein A (Spa) is an important virulence factor of Staphylococcus aureus. Transcription of the spa determinant occurs during the exponential growth phase and is repressed when the cells enter the postexponential growth phase. Regulation of spa expression has been found to be complicated, with regulation involving multiple factors, including Agr, SarA, SarS, SarT, Rot, and MgrA. Our understanding of how these factors work on the spa promoter to regulate spa expression is incomplete. To identify regulatory sites within the spa promoter, analysis of deletion derivatives of the promoter in host strains deficient in one or more of the regulatory factors was undertaken, and several critical features of spa regulation were revealed. The transcriptional start sites of spa were determined by primer extension. The spa promoter sequences were subcloned in front of a promoterless chloramphenicol acetyltransferase reporter gene. Various lengths of spa truncations with the same 3' end were constructed, and the resultant plasmids were transduced into strains with different regulatory genetic backgrounds. Our results identified upstream promoter sequences necessary for Agr system regulation of spa expression. The cis elements for SarS activity, an activator of spa expression, and for SarA activity, a repressor of spa expression, were identified. The well-characterized SarA consensus sequence on the spa promoter was found to be insufficient for SarA repression of the spa promoter. Full repression required the presence of a second consensus site adjacent to the SarS binding site. Sequences directly upstream of the core promoter sequence were found to stimulate transcription.

  15. Idefix insulator activity can be modulated by nearby regulatory elements.


    Brasset, E; Bantignies, F; Court, F; Cheresiz, S; Conte, C; Vaury, C


    Insulators play important roles in controlling gene activity and maintaining regulatory independence between neighbouring genes. In this article, we show that the enhancer-blocking activity of the insulator present within the LTR retrotransposon Idefix can be abolished if two copies of the region containing the insulator--specifically, the long terminal repeat (LTR)--are fused to the retrotransposon's 5' untranslated region (5' UTR). The presence of this combination of two [LTR-5' UTR] modules is a prerequisite for the loss of enhancer-blocking activity. We further show that the 5' UTR causes flanking genomic sequences to be displaced to the nuclear periphery, which is not observed when two insulators are present by themselves. This study thus provides a functional link between insulators and independent genomic modules, which may cooperate to allow the specific regulation of defined genomic loci via nuclear repositioning. It further illustrates the complexity of genomic regulation within a chromatic environment with multiple functional elements.

  16. BLSSpeller: exhaustive comparative discovery of conserved cis-regulatory elements

    PubMed Central

    De Witte, Dieter; Van de Velde, Jan; Decap, Dries; Van Bel, Michiel; Audenaert, Pieter; Demeester, Piet; Dhoedt, Bart; Vandepoele, Klaas; Fostier, Jan


    Motivation: The accurate discovery and annotation of regulatory elements remains a challenging problem. The growing number of sequenced genomes creates new opportunities for comparative approaches to motif discovery. Putative binding sites are then considered to be functional if they are conserved in orthologous promoter sequences of multiple related species. Existing methods for comparative motif discovery usually rely on pregenerated multiple sequence alignments, which are difficult to obtain for more diverged species such as plants. As a consequence, misaligned regulatory elements often remain undetected. Results: We present a novel algorithm that supports both alignment-free and alignment-based motif discovery in the promoter sequences of related species. Putative motifs are exhaustively enumerated as words over the IUPAC alphabet and screened for conservation using the branch length score. Additionally, a confidence score is established in a genome-wide fashion. In order to take advantage of a cloud computing infrastructure, the MapReduce programming model is adopted. The method is applied to four monocotyledon plant species and it is shown that high-scoring motifs are significantly enriched for open chromatin regions in Oryza sativa and for transcription factor binding sites inferred through protein-binding microarrays in O.sativa and Zea mays. Furthermore, the method is shown to recover experimentally profiled ga2ox1-like KN1 binding sites in Z.mays. Availability and implementation: BLSSpeller was written in Java. Source code and manual are available at Contact: or Supplementary information: Supplementary data are available at Bioinformatics online. PMID:26254488

  17. Role of non-coding RNA transcription around gene regulatory elements in transcription factor recruitment

    PubMed Central

    Ohta, Kunihiro


    ABSTRACT Eukaryotic cells produce a variety of non-coding RNAs (ncRNAs), many of which have been shown to play pivotal roles in biological processes such as differentiation, maintenance of pluripotency of stem cells, and cellular response to various stresses. Genome-wide analyses have revealed that many ncRNAs are transcribed around regulatory DNA elements located proximal or distal to gene promoters, but their biological functions are largely unknown. Recently, it has been demonstrated in yeast and mouse that ncRNA transcription around gene promoters and enhancers facilitates DNA binding of transcription factors to their target sites. These results suggest universal roles of promoter/enhancer-associated ncRNAs in the recruitment of transcription factors to their binding sites. PMID:27763805

  18. Identification of positive and negative transcriptional regulatory elements of the rabbit angiotensin-converting enzyme gene.

    PubMed Central

    Goraya, T Y; Kessler, S P; Kumar, R S; Douglas, J; Sen, G C


    The two tissue-specific mRNAs encoding the isozymes of rabbit angiotensin-converting enzyme (ACE) are generated from the same gene by alternative choice of two transcription initiation sites 5.7 kb apart. In the current study, we have characterized the regulatory sites controlling the transcription of the larger pulmonary isozyme mRNA. For this purpose, reporter genes driven by varying lengths of upstream region of the ACE gene were transfected into ACE-producing cells. Our results demonstrated that the transcription of this gene is primarily driven by positive elements within the first 274 bp DNA upstream of the transcription initiation site. The reporter gene driven by this region was expressed in two ACE-producing cells but not in two ACE-non-producing cells thereby establishing its tissue specificity. Our experiments also revealed the existence of a strong negative element located between -692 and -610 positions. This element suppressed the expression of the reporter gene in a dose-dependent and position and orientation-independent fashion thus suggesting that it is a true silencer element. It could also repress the expression of a reporter gene driven by the heterologous strong promoter of the beta-actin gene. The repressing effects of the negative element could be partially overcome by cotransfecting the isolated negative element along with the reporter gene containing the negative element. This result was possibly due to the functional removal of a limiting trans-acting factor which binds to this element. Electrophoretic mobility shift assays revealed that the negative element can form several complexes with proteins present in the nuclear extract of an ACE-producing cell line. At least part of the negative element is strongly conserved in the upstream regions of the human and mouse ACE genes. Images PMID:8165133

  19. Dissection of a Ciona regulatory element reveals complexity of cross-species enhancer activity

    PubMed Central

    Chen, Wei-Chung; Pauls, Stefan; Bacha, Jamil; Elgar, Greg; Loose, Matthew; Shimeld, Sebastian M.


    Vertebrate genomes share numerous conserved non-coding elements, many of which function as enhancer elements and are hypothesised to be under evolutionary constraint due to a need to be bound by combinations of sequence-specific transcription factors. In contrast, few such conserved elements can be detected between vertebrates and their closest invertebrate relatives. Despite this lack of sequence identity, cross-species transgenesis has identified some cases where non-coding DNA from invertebrates drives reporter gene expression in transgenic vertebrates in patterns reminiscent of the expression of vertebrate orthologues. Such instances are presumed to reflect the presence of conserved suites of binding sites in the regulatory regions of invertebrate and vertebrate orthologues, such that both regulatory elements can correctly interpret the trans-activating environment. Shuffling of binding sites has been suggested to lie behind loss of sequence conservation; however this has not been experimentally tested. Here we examine the underlying basis of enhancer activity for the Ciona intestinalis βγ-crystallin gene, which drives expression in the lens of transgenic vertebrates despite the Ciona lineage predating the evolution of the lens. We construct an interactive gene regulatory network (GRN) for vertebrate lens development, allowing network interactions to be robustly catalogued and conserved network components and features to be identified. We show that a small number of binding motifs are necessary for Ciona βγ-crystallin expression, and narrow down the likely factors that bind to these motifs. Several of these overlap with the conserved core of the vertebrate lens GRN, implicating these sites in cross species function. However when we test these motifs in a transgenic vertebrate they prove to be dispensable for reporter expression in the lens. These results show that current models depicting cross species enhancer function as dependent on conserved binding

  20. Integrating motif, DNA accessibility and gene expression data to build regulatory maps in an organism

    PubMed Central

    Blatti, Charles; Kazemian, Majid; Wolfe, Scot; Brodsky, Michael; Sinha, Saurabh


    Characterization of cell type specific regulatory networks and elements is a major challenge in genomics, and emerging strategies frequently employ high-throughput genome-wide assays of transcription factor (TF) to DNA binding, histone modifications or chromatin state. However, these experiments remain too difficult/expensive for many laboratories to apply comprehensively to their system of interest. Here, we explore the potential of elucidating regulatory systems in varied cell types using computational techniques that rely on only data of gene expression, low-resolution chromatin accessibility, and TF–DNA binding specificities (‘motifs’). We show that static computational motif scans overlaid with chromatin accessibility data reasonably approximate experimentally measured TF–DNA binding. We demonstrate that predicted binding profiles and expression patterns of hundreds of TFs are sufficient to identify major regulators of ∼200 spatiotemporal expression domains in the Drosophila embryo. We are then able to learn reliable statistical models of enhancer activity for over 70 expression domains and apply those models to annotate domain specific enhancers genome-wide. Throughout this work, we apply our motif and accessibility based approach to comprehensively characterize the regulatory network of fruitfly embryonic development and show that the accuracy of our computational method compares favorably to approaches that rely on data from many experimental assays. PMID:25791631

  1. Identification of the functional elements in the promoter region of human DNA topoisomerase IIIbeta gene.


    Cho, Young Hoon; Park, Jee Young; Han, Sang Youp; Chung, In Kwon


    In this study, we have isolated and characterized the promoter region of the human DNA topoisomerase IIIbeta (hTOP3beta) gene. The 5' RACE assay showed a short exon 1 encoding only the 35-bp untranslated region and suggested the presence of multiple transcription initiation sites. The hTOP3beta gene promoter lacks a canonical TATA box or initiation element and is moderately high in GC content. Transient expression of a luciferase reporter gene under the control of serially deleted 5'-flanking sequence identified an activator element between -141 and -119 upstream of the transcription initiation site and a second regulatory element between -91 and -71. On the basis of scanning mutations of triple nucleotides, we demonstrated that a 5'GGAACC3' element between -117 and -112 plays a critical role in the up-regulation of the basal transcription activity. Changing the 5'GGAACC3' sequence leads to markedly reduced promoter activity. Gel mobility shift assays revealed that the 5'GGAACC3' element is required for DNA binding by the transcription factor complex. These observations lead to the conclusion that the positive regulatory region including the 5'GGAACC3' core element is essential for efficient expression of the hTOP3beta gene as well as for the binding of as yet unidentified regulatory factor(s).

  2. A General Approach for Identifying Distant Regulatory Elements Applied to the Gdf6 Gene

    PubMed Central

    Mortlock, Douglas P.; Guenther, Catherine; Kingsley, David M.


    Regulatory sequences in higher genomes can map large distances from gene coding regions, and cannot yet be identified by simple inspection of primary DNA sequence information. Here we describe an efficient method of surveying large genomic regions for gene regulatory information, and subdividing complex sets of distant regulatory elements into smaller intervals for detailed study. The mouse Gdf6 gene is expressed in a number of distinct embryonic locations that are involved in the patterning of skeletal and soft tissues. To identify sequences responsible for Gdf6 regulation, we first isolated a series of overlapping bacterial artificial chromosomes (BACs) that extend varying distances upstream and downstream of the gene. A LacZ reporter cassette was integrated into the Gdf6 transcription unit of each BAC using homologous recombination in bacteria. Each modified BAC was injected into fertilized mouse eggs, and founder transgenic embryos were analyzed for LacZ expression mid-gestation. The overlapping segments defined by the BAC clones revealed five separate regulatory regions that drive LacZ expression in 11 distinct anatomical locations. To further localize sequences that control expression in developing skeletal joints, we created a series of BAC constructs with precise deletions across a putative joint-control region. This approach further narrowed the critical control region to an area containing several stretches of sequence that are highly conserved between mice and humans. A distant 2.9-kilobase fragment containing the highly conserved regions is able to direct very specific expression of a minimal promoter/LacZ reporter in proximal limb joints. These results demonstrate that even distant, complex regulatory sequences can be identified using a combination of BAC scanning, BAC deletion, and comparative sequencing approaches. PMID:12915490

  3. Widespread contribution of transposable elements to the innovation of gene regulatory networks

    PubMed Central

    Sundaram, Vasavi; Cheng, Yong; Ma, Zhihai; Li, Daofeng; Xing, Xiaoyun; Edge, Peter


    Transposable elements (TEs) have been shown to contain functional binding sites for certain transcription factors (TFs). However, the extent to which TEs contribute to the evolution of TF binding sites is not well known. We comprehensively mapped binding sites for 26 pairs of orthologous TFs in two pairs of human and mouse cell lines (representing two cell lineages), along with epigenomic profiles, including DNA methylation and six histone modifications. Overall, we found that 20% of binding sites were embedded within TEs. This number varied across different TFs, ranging from 2% to 40%. We further identified 710 TF–TE relationships in which genomic copies of a TE subfamily contributed a significant number of binding peaks for a TF, and we found that LTR elements dominated these relationships in human. Importantly, TE-derived binding peaks were strongly associated with open and active chromatin signatures, including reduced DNA methylation and increased enhancer-associated histone marks. On average, 66% of TE-derived binding events were cell type-specific with a cell type-specific epigenetic landscape. Most of the binding sites contributed by TEs were species-specific, but we also identified binding sites conserved between human and mouse, the functional relevance of which was supported by a signature of purifying selection on DNA sequences of these TEs. Interestingly, several TFs had significantly expanded binding site landscapes only in one species, which were linked to species-specific gene functions, suggesting that TEs are an important driving force for regulatory innovation. Taken together, our data suggest that TEs have significantly and continuously shaped gene regulatory networks during mammalian evolution. PMID:25319995

  4. Covariation among glucocorticoid regulatory elements varies seasonally in house sparrows.


    Liebl, Andrea L; Shimizu, Toru; Martin, Lynn B


    Glucocorticoids (GCs) help individuals cope with changes throughout life; one such change is the seasonal transition through life-history stages. Previous research shows that many animals exhibit seasonal variation in baseline GCs and GC responses to stressors, but the effects of season on other aspects of GC regulation have been less studied. Moreover, whether elements of GC regulation covary within individuals and whether covariation changes seasonally has been not been investigated. Evolutionarily, strong linkages among GC regulatory elements is predicted to enhance system efficiency and regulation, however may reduce the plasticity necessary to ensure appropriate responses under varying conditions. Here, we measured corticosterone (CORT), the major avian GC, at baseline, after exposure to a restraint stressor, and in response to dexamethasone (to assess negative feedback capacity) in wild house sparrows (Passer domesticus) during the breeding and molting seasons. We also measured hippocampal mRNA expression of the two receptors primarily responsible for CORT regulation: the mineralocorticoid and glucocorticoid receptors (MR and GR, respectively). Consistent with previous studies, restraint-induced CORT was lower during molt than breeding, but negative-feedback was not influenced by season. Receptor gene expression was affected by season, however, as during breeding, the ratio of MR to GR expression was significantly lower than during molt. Furthermore, MR expression was negatively correlated with CORT released in response to a stressor, but only during molt. We found that individuals that most strongly up-regulated CORT in response to restraint were also most effective at reducing CORT via negative feedback; although these relationships were independent of season, they were stronger during molt.

  5. Transcriptional regulatory elements in the noncoding region of human papillomavirus type 6

    SciTech Connect

    Wu, Tzyy-Choou.


    The structure and function of the transcriptional regulatory region of human papillomavirus type 6 (HPV-6) has been investigated. To investigate tissue specific gene expression, a sensitive method to detect and localize HPV-6 viral DNA, mRNA and protein in plastic-embedded tissue sections of genital and respiratory tract papillomata by using in situ hybridization and immunoperoxidase assays has been developed. This method, using ultrathin sections and strand-specific {sup 3}H labeled riboprobes, offers the advantages of superior morphological preservation and detection of viral genomes at low copy number with good resolution, and the modified immunocytochemistry provides better sensitivity. The results suggest that genital tract epithelium is more permissive for HPV-6 replication than respiratory tract epithelium. To study the tissue tropism of HPV-6 at the level of regulation of viral gene expression, the polymerase chain reaction was used to isolate the noncoding region (NCR) of HPV-6 in independent isolates. Nucleotide sequence analysis of molecularly cloned DNA identified base substitutions, deletions/insertions and tandem duplications. Transcriptional regulatory elements in the NCR were assayed in recombinant plasmids containing the bacterial gene for chloramphenicol acetyl transferase.

  6. Regulatory Elements in Vectors for Efficient Generation of Cell Lines Producing Target Proteins

    PubMed Central

    Maksimenko, O.; Gasanov, N. B.; Georgiev, P.


    To date, there has been an increasing number of drugs produced in mammalian cell cultures. In order to enhance the expression level and stability of target recombinant proteins in cell cultures, various regulatory elements with poorly studied mechanisms of action are used. In this review, we summarize and discuss the potential mechanisms of action of such regulatory elements. PMID:26483956

  7. Extensive Evolutionary Changes in Regulatory Element Activity during Human Origins Are Associated with Altered Gene Expression and Positive Selection

    PubMed Central

    Fedrigo, Olivier; Babbitt, Courtney C.; Wortham, Matthew; Tewari, Alok K.; London, Darin; Song, Lingyun; Lee, Bum-Kyu; Iyer, Vishwanath R.; Parker, Stephen C. J.; Margulies, Elliott H.; Wray, Gregory A.; Furey, Terrence S.; Crawford, Gregory E.


    Understanding the molecular basis for phenotypic differences between humans and other primates remains an outstanding challenge. Mutations in non-coding regulatory DNA that alter gene expression have been hypothesized as a key driver of these phenotypic differences. This has been supported by differential gene expression analyses in general, but not by the identification of specific regulatory elements responsible for changes in transcription and phenotype. To identify the genetic source of regulatory differences, we mapped DNaseI hypersensitive (DHS) sites, which mark all types of active gene regulatory elements, genome-wide in the same cell type isolated from human, chimpanzee, and macaque. Most DHS sites were conserved among all three species, as expected based on their central role in regulating transcription. However, we found evidence that several hundred DHS sites were gained or lost on the lineages leading to modern human and chimpanzee. Species-specific DHS site gains are enriched near differentially expressed genes, are positively correlated with increased transcription, show evidence of branch-specific positive selection, and overlap with active chromatin marks. Species-specific sequence differences in transcription factor motifs found within these DHS sites are linked with species-specific changes in chromatin accessibility. Together, these indicate that the regulatory elements identified here are genetic contributors to transcriptional and phenotypic differences among primate species. PMID:22761590

  8. Transcription factor MITF and remodeller BRG1 define chromatin organisation at regulatory elements in melanoma cells.


    Laurette, Patrick; Strub, Thomas; Koludrovic, Dana; Keime, Céline; Le Gras, Stéphanie; Seberg, Hannah; Van Otterloo, Eric; Imrichova, Hana; Siddaway, Robert; Aerts, Stein; Cornell, Robert A; Mengus, Gabrielle; Davidson, Irwin


    Microphthalmia-associated transcription factor (MITF) is the master regulator of the melanocyte lineage. To understand how MITF regulates transcription, we used tandem affinity purification and mass spectrometry to define a comprehensive MITF interactome identifying novel cofactors involved in transcription, DNA replication and repair, and chromatin organisation. We show that MITF interacts with a PBAF chromatin remodelling complex comprising BRG1 and CHD7. BRG1 is essential for melanoma cell proliferation in vitro and for normal melanocyte development in vivo. MITF and SOX10 actively recruit BRG1 to a set of MITF-associated regulatory elements (MAREs) at active enhancers. Combinations of MITF, SOX10, TFAP2A, and YY1 bind between two BRG1-occupied nucleosomes thus defining both a signature of transcription factors essential for the melanocyte lineage and a specific chromatin organisation of the regulatory elements they occupy. BRG1 also regulates the dynamics of MITF genomic occupancy. MITF-BRG1 interplay thus plays an essential role in transcription regulation in melanoma.

  9. Potential use of DNA barcodes in regulatory science: applications of the Regulatory Fish Encyclopedia.


    Yancy, Haile F; Zemlak, Tyler S; Mason, Jacquline A; Washington, Jewell D; Tenge, Bradley J; Nguyen, Ngoc-Lan T; Barnett, James D; Savary, Warren E; Hill, Walter E; Moore, Michelle M; Fry, Frederick S; Randolph, Spring C; Rogers, Patricia L; Hebert, Paul D N


    The use of a DNA-based identification system (DNA barcoding) founded on the mitochondrial gene cytochrome c oxidase subunit I (COI) was investigated for updating the U.S. Food and Drug Administration Regulatory Fish Encyclopedia (RFE; The RFE is a compilation of data used to identify fish species. It was compiled to help regulators identify species substitution that could result in potential adverse health consequences or could be a source of economic fraud. For each of many aquatic species commonly sold in the United States, the RFE includes high-resolution photographs of whole fish and their marketed product forms and species-specific biochemical patterns for authenticated fish species. These patterns currently include data from isoelectric focusing studies. In this article, we describe the generation of DNA barcodes for 172 individual authenticated fish representing 72 species from 27 families contained in the RFE. These barcode sequences can be used as an additional identification resource. In a blind study, 60 unknown fish muscle samples were barcoded, and the results were compared with the RFE barcode reference library. All 60 samples were correctly identified to species based on the barcoding data. Our study indicates that DNA barcoding can be a powerful tool for species identification and has broad potential applications.

  10. Satellite DNA-Like Elements Associated With Genes Within Euchromatin of the Beetle Tribolium castaneum

    PubMed Central

    Brajković, Josip; Feliciello, Isidoro; Bruvo-Mađarić, Branka; Ugarković, Đurđica


    In the red flour beetle Tribolium castaneum the major TCAST satellite DNA accounts for 35% of the genome and encompasses the pericentromeric regions of all chromosomes. Because of the presence of transcriptional regulatory elements and transcriptional activity in these sequences, TCAST satellite DNAs also have been proposed to be modulators of gene expression within euchromatin. Here, we analyze the distribution of TCAST homologous repeats in T. castaneum euchromatin and study their association with genes as well as their potential gene regulatory role. We identified 68 arrays composed of TCAST-like elements distributed on all chromosomes. Based on sequence characteristics the arrays were composed of two types of TCAST-like elements. The first type consists of TCAST satellite-like elements in the form of partial monomers or tandemly arranged monomers, up to tetramers, whereas the second type consists of TCAST-like elements embedded with a complex unit that resembles a DNA transposon. TCAST-like elements were also found in the 5′ untranslated region (UTR) of the CR1-3_TCa retrotransposon, and therefore retrotransposition may have contributed to their dispersion throughout the genome. No significant difference in the homogenization of dispersed TCAST-like elements was found either at the level of local arrays or chromosomes nor among different chromosomes. Of 68 TCAST-like elements, 29 were located within introns, with the remaining elements flanked by genes within a 262 to 404,270 nt range. TCAST-like elements are statistically overrepresented near genes with immunoglobulin-like domains attesting to their nonrandom distribution and a possible gene regulatory role. PMID:22908042

  11. Prediction of cis-regulatory elements for drug-activated transcription factors in the regulation of drug-metabolising enzymes and drug transporters.


    Podvinec, Michael; Meyer, Urs A


    The expression of drug-metabolising enzymes is affected by many endogenous and exogenous factors, including sex, age, diet and exposure to xenobiotics and drugs. To understand fully how the organism metabolises a drug, these alterations in gene expression must be taken into account. The central process, the definition of likely regulatory elements in the genes coding for enzymes and transporters involved in drug disposition, can be vastly accelerated using existing and emerging bioinformatics methods to unravel the regulatory networks causing drug-mediated induction of genes. Here, various approaches to predict transcription factor interactions with regulatory DNA elements are reviewed.

  12. Human polyomavirus JCV late leader peptide region contains important regulatory elements

    SciTech Connect

    Akan, Ilhan; Sariyer, Ilker Kudret; Biffi, Renato; Palermo, Victoria; Woolridge, Stefanie; White, Martyn K.; Amini, Shohreh |; Khalili, Kamel; Safak, Mahmut . E-mail:


    Transcription is a complex process that relies on the cooperative interaction between sequence-specific factors and the basal transcription machinery. The strength of a promoter depends on upstream or downstream cis-acting DNA elements, which bind transcription factors. In this study, we investigated whether DNA elements located downstream of the JCV late promoter, encompassing the late leader peptide region, which encodes agnoprotein, play regulatory roles in the JCV lytic cycle. For this purpose, the entire coding region of the leader peptide was deleted and the functional consequences of this deletion were analyzed. We found that viral gene expression and replication were drastically reduced. Gene expression also decreased from a leader peptide point mutant but to a lesser extent. This suggested that the leader peptide region of JCV might contain critical cis-acting DNA elements to which transcription factors bind and regulate viral gene expression and replication. We analyzed the entire coding region of the late leader peptide by a footprinting assay and identified three major regions (region I, II and III) that were protected by nuclear proteins. Further investigation of the first two protected regions by band shift assays revealed a new band that appeared in new infection cycles, suggesting that viral infection induces new factors that interact with the late leader peptide region of JCV. Analysis of the effect of the leader peptide region on the promoter activity of JCV by transfection assays demonstrated that this region has a positive and negative effect on the large T antigen (LT-Ag)-mediated activation of the viral early and late promoters, respectively. Furthermore, a partial deletion analysis of the leader peptide region encompassing the protected regions I and II demonstrated a significant down-regulation of viral gene expression and replication. More importantly, these results were similar to that obtained from a complete deletion of the late leader

  13. Cistrome and Epicistrome Features Shape the Regulatory DNA Landscape.


    O'Malley, Ronan C; Huang, Shao-Shan Carol; Song, Liang; Lewsey, Mathew G; Bartlett, Anna; Nery, Joseph R; Galli, Mary; Gallavotti, Andrea; Ecker, Joseph R


    The cistrome is the complete set of transcription factor (TF) binding sites (cis-elements) in an organism, while an epicistrome incorporates tissue-specific DNA chemical modifications and TF-specific chemical sensitivities into these binding profiles. Robust methods to construct comprehensive cistrome and epicistrome maps are critical for elucidating complex transcriptional networks that underlie growth, behavior, and disease. Here, we describe DNA affinity purification sequencing (DAP-seq), a high-throughput TF binding site discovery method that interrogates genomic DNA with in-vitro-expressed TFs. Using DAP-seq, we defined the Arabidopsis cistrome by resolving motifs and peaks for 529 TFs. Because genomic DNA used in DAP-seq retains 5-methylcytosines, we determined that >75% (248/327) of Arabidopsis TFs surveyed were methylation sensitive, a property that strongly impacts the epicistrome landscape. DAP-seq datasets also yielded insight into the biology and binding site architecture of numerous TFs, demonstrating the value of DAP-seq for cost-effective cistromic and epicistromic annotation in any organism.

  14. An encyclopedia of mouse DNA elements (Mouse ENCODE).


    Stamatoyannopoulos, John A; Snyder, Michael; Hardison, Ross; Ren, Bing; Gingeras, Thomas; Gilbert, David M; Groudine, Mark; Bender, Michael; Kaul, Rajinder; Canfield, Theresa; Giste, Erica; Johnson, Audra; Zhang, Mia; Balasundaram, Gayathri; Byron, Rachel; Roach, Vaughan; Sabo, Peter J; Sandstrom, Richard; Stehling, A Sandra; Thurman, Robert E; Weissman, Sherman M; Cayting, Philip; Hariharan, Manoj; Lian, Jin; Cheng, Yong; Landt, Stephen G; Ma, Zhihai; Wold, Barbara J; Dekker, Job; Crawford, Gregory E; Keller, Cheryl A; Wu, Weisheng; Morrissey, Christopher; Kumar, Swathi A; Mishra, Tejaswini; Jain, Deepti; Byrska-Bishop, Marta; Blankenberg, Daniel; Lajoie, Bryan R; Jain, Gaurav; Sanyal, Amartya; Chen, Kaun-Bei; Denas, Olgert; Taylor, James; Blobel, Gerd A; Weiss, Mitchell J; Pimkin, Max; Deng, Wulan; Marinov, Georgi K; Williams, Brian A; Fisher-Aylor, Katherine I; Desalvo, Gilberto; Kiralusha, Anthony; Trout, Diane; Amrhein, Henry; Mortazavi, Ali; Edsall, Lee; McCleary, David; Kuan, Samantha; Shen, Yin; Yue, Feng; Ye, Zhen; Davis, Carrie A; Zaleski, Chris; Jha, Sonali; Xue, Chenghai; Dobin, Alex; Lin, Wei; Fastuca, Meagan; Wang, Huaien; Guigo, Roderic; Djebali, Sarah; Lagarde, Julien; Ryba, Tyrone; Sasaki, Takayo; Malladi, Venkat S; Cline, Melissa S; Kirkup, Vanessa M; Learned, Katrina; Rosenbloom, Kate R; Kent, W James; Feingold, Elise A; Good, Peter J; Pazin, Michael; Lowdon, Rebecca F; Adams, Leslie B


    To complement the human Encyclopedia of DNA Elements (ENCODE) project and to enable a broad range of mouse genomics efforts, the Mouse ENCODE Consortium is applying the same experimental pipelines developed for human ENCODE to annotate the mouse genome.

  15. Exaptation of Transposable Elements into Novel Cis-Regulatory Elements: Is the Evidence Always Strong?

    PubMed Central

    de Souza, Flávio S.J.; Franchini, Lucía F.; Rubinstein, Marcelo


    Transposable elements (TEs) are mobile genetic sequences that can jump around the genome from one location to another, behaving as genomic parasites. TEs have been particularly effective in colonizing mammalian genomes, and such heavy TE load is expected to have conditioned genome evolution. Indeed, studies conducted both at the gene and genome levels have uncovered TE insertions that seem to have been co-opted—or exapted—by providing transcription factor binding sites (TFBSs) that serve as promoters and enhancers, leading to the hypothesis that TE exaptation is a major factor in the evolution of gene regulation. Here, we critically review the evidence for exaptation of TE-derived sequences as TFBSs, promoters, enhancers, and silencers/insulators both at the gene and genome levels. We classify the functional impact attributed to TE insertions into four categories of increasing complexity and argue that so far very few studies have conclusively demonstrated exaptation of TEs as transcriptional regulatory regions. We also contend that many genome-wide studies dealing with TE exaptation in recent lineages of mammals are still inconclusive and that the hypothesis of rapid transcriptional regulatory rewiring mediated by TE mobilization must be taken with caution. Finally, we suggest experimental approaches that may help attributing higher-order functions to candidate exapted TEs. PMID:23486611

  16. A steganalysis-based approach to comprehensive identification and characterization of functional regulatory elements

    PubMed Central

    Wang, Guandong; Zhang, Weixiong


    The comprehensive identification of cis-regulatory elements on a genome scale is a challenging problem. We develop a novel, steganalysis-based approach for genome-wide motif finding, called WordSpy, by viewing regulatory regions as a stegoscript with cis-elements embedded in 'background' sequences. We apply WordSpy to the promoters of cell-cycle-related genes of Saccharomyces cerevisiae and Arabidopsis thaliana, identifying all known cell-cycle motifs with high ranking. WordSpy can discover a complete set of cis-elements and facilitate the systematic study of regulatory networks. PMID:16787547

  17. BLG-e1 - a novel regulatory element in the distal region of the beta-lactoglobulin gene promoter.


    Reichenstein, Moshe; German, Tania; Barash, Itamar


    beta-Lactoglobulin (BLG) is a major ruminant milk protein. A regulatory element, termed BLG-e1, was defined in the distal region of the ovine BLG gene promoter. This 299-bp element lacks the established cis-regulatory sequences that affect milk-protein gene expression. Nevertheless, it alters the binding of downstream BLG sequences to histone H4 and the sensitivity of the histone-DNA complexes to trichostatin A treatment. In mammary cells cultured under favorable lactogenic conditions, BLG-e1 acts as a potent, position-independent silencer of BLG/luciferase expression, and similarly affects the promoter activity of the mouse whey acidic protein gene. Intragenic sequences upstream of BLG exon 2 reverse the silencing effect of BLG-e1 in vitro and in transgenic mice.

  18. Profiling DNA Methylation and Hydroxymethylation at Retrotransposable Elements.


    de la Rica, Lorenzo; Stanley, Jatinder S; Branco, Miguel R


    DNA methylation is a key epigenetic modification controlling the transcriptional activity of mammalian retrotransposable elements. Its oxidation to DNA hydroxymethylation has been linked to DNA demethylation and reactivation of retrotransposons. Here we describe in detail protocols for three methods to measure DNA methylation and hydroxymethylation at specific genomic targets: glucMS-qPCR, and two sequencing approaches (pyrosequencing and high-throughput sequencing) for analyzing bisulfite- and oxidative bisulfite-modified DNA. All three techniques provide absolute measurements of methylation and hydroxymethylation levels at single-base resolution. Differences between the methods are discussed, mainly with respect to throughput and target coverage. These constitute the core techniques that are used in our laboratory for accurately surveying the epigenetics of retrotransposable elements.

  19. SeqGL Identifies Context-Dependent Binding Signals in Genome-Wide Regulatory Element Maps.


    Setty, Manu; Leslie, Christina S


    Genome-wide maps of transcription factor (TF) occupancy and regions of open chromatin implicitly contain DNA sequence signals for multiple factors. We present SeqGL, a novel de novo motif discovery algorithm to identify multiple TF sequence signals from ChIP-, DNase-, and ATAC-seq profiles. SeqGL trains a discriminative model using a k-mer feature representation together with group lasso regularization to extract a collection of sequence signals that distinguish peak sequences from flanking regions. Benchmarked on over 100 ChIP-seq experiments, SeqGL outperformed traditional motif discovery tools in discriminative accuracy. Furthermore, SeqGL can be naturally used with multitask learning to identify genomic and cell-type context determinants of TF binding. SeqGL successfully scales to the large multiplicity of sequence signals in DNase- or ATAC-seq maps. In particular, SeqGL was able to identify a number of ChIP-seq validated sequence signals that were not found by traditional motif discovery algorithms. Thus compared to widely used motif discovery algorithms, SeqGL demonstrates both greater discriminative accuracy and higher sensitivity for detecting the DNA sequence signals underlying regulatory element maps. SeqGL is available at

  20. Identification of functional elements and regulatory circuits by Drosophila modENCODE

    SciTech Connect

    Roy, Sushmita; Ernst, Jason; Kharchenko, Peter V.; Kheradpour, Pouya; Negre, Nicolas; Eaton, Matthew L.; Landolin, Jane M.; Bristow, Christopher A.; Ma, Lijia; Lin, Michael F.; Washietl, Stefan; Arshinoff, Bradley I.; Ay, Ferhat; Meyer, Patrick E.; Robine, Nicolas; Washington, Nicole L.; Stefano, Luisa Di; Berezikov, Eugene; Brown, Christopher D.; Candeias, Rogerio; Carlson, Joseph W.; Carr, Adrian; Jungreis, Irwin; Marbach, Daniel; Sealfon, Rachel; Tolstorukov, Michael Y.; Will, Sebastian; Alekseyenko, Artyom A.; Artieri, Carlo; Booth, Benjamin W.; Brooks, Angela N.; Dai, Qi; Davis, Carrie A.; Duff, Michael O.; Feng, Xin; Gorchakov, Andrey A.; Gu, Tingting; Henikoff, Jorja G.; Kapranov, Philipp; Li, Renhua; MacAlpine, Heather K.; Malone, John; Minoda, Aki; Nordman, Jared; Okamura, Katsutomo; Perry, Marc; Powell, Sara K.; Riddle, Nicole C.; Sakai, Akiko; Samsonova, Anastasia; Sandler, Jeremy E.; Schwartz, Yuri B.; Sher, Noa; Spokony, Rebecca; Sturgill, David; van Baren, Marijke; Wan, Kenneth H.; Yang, Li; Yu, Charles; Feingold, Elise; Good, Peter; Guyer, Mark; Lowdon, Rebecca; Ahmad, Kami; Andrews, Justen; Berger, Bonnie; Brenner, Steven E.; Brent, Michael R.; Cherbas, Lucy; Elgin, Sarah C. R.; Gingeras, Thomas R.; Grossman, Robert; Hoskins, Roger A.; Kaufman, Thomas C.; Kent, William; Kuroda, Mitzi I.; Orr-Weaver, Terry; Perrimon, Norbert; Pirrotta, Vincenzo; Posakony, James W.; Ren, Bing; Russell, Steven; Cherbas, Peter; Graveley, Brenton R.; Lewis, Suzanna; Micklem, Gos; Oliver, Brian; Park, Peter J.; Celniker, Susan E.; Henikoff, Steven; Karpen, Gary H.; Lai, Eric C.; MacAlpine, David M.; Stein, Lincoln D.; White, Kevin P.; Kellis, Manolis


    To gain insight into how genomic information is translated into cellular and developmental programs, the Drosophila model organism Encyclopedia of DNA Elements (modENCODE) project is comprehensively mapping transcripts, histone modifications, chromosomal proteins, transcription factors, replication proteins and intermediates, and nucleosome properties across a developmental time course and in multiple cell lines. We have generated more than 700 data sets and discovered protein-coding, noncoding, RNA regulatory, replication, and chromatin elements, more than tripling the annotated portion of the Drosophila genome. Correlated activity patterns of these elements reveal a functional regulatory network, which predicts putative new functions for genes, reveals stage- and tissue-specific regulators, and enables gene-expression prediction. Our results provide a foundation for directed experimental and computational studies in Drosophila and related species and also a model for systematic data integration toward comprehensive genomic and functional annotation. Several years after the complete genetic sequencing of many species, it is still unclear how to translate genomic information into a functional map of cellular and developmental programs. The Encyclopedia of DNA Elements (ENCODE) (1) and model organism ENCODE (modENCODE) (2) projects use diverse genomic assays to comprehensively annotate the Homo sapiens (human), Drosophila melanogaster (fruit fly), and Caenorhabditis elegans (worm) genomes, through systematic generation and computational integration of functional genomic data sets. Previous genomic studies in flies have made seminal contributions to our understanding of basic biological mechanisms and genome functions, facilitated by genetic, experimental, computational, and manual annotation of the euchromatic and heterochromatic genome (3), small genome size, short life cycle, and a deep knowledge of development, gene function, and chromosome biology. The functions

  1. Clinical characteristics and prognosis of acute myeloid leukemia associated with DNA-methylation regulatory gene mutations

    PubMed Central

    Ryotokuji, Takeshi; Yamaguchi, Hiroki; Ueki, Toshimitsu; Usuki, Kensuke; Kurosawa, Saiko; Kobayashi, Yutaka; Kawata, Eri; Tajika, Kenji; Gomi, Seiji; Kanda, Junya; Kobayashi, Anna; Omori, Ikuko; Marumo, Atsushi; Fujiwara, Yusuke; Yui, Shunsuke; Terada, Kazuki; Fukunaga, Keiko; Hirakawa, Tsuneaki; Arai, Kunihito; Kitano, Tomoaki; Kosaka, Fumiko; Tamai, Hayato; Nakayama, Kazutaka; Wakita, Satoshi; Fukuda, Takahiro; Inokuchi, Koiti


    In recent years, it has been reported that the frequency of DNA-methylation regulatory gene mutations – mutations of the genes that regulate gene expression through DNA methylation – is high in acute myeloid leukemia. The objective of the present study was to elucidate the clinical characteristics and prognosis of acute myeloid leukemia with associated DNA-methylation regulatory gene mutation. We studied 308 patients with acute myeloid leukemia. DNA-methylation regulatory gene mutations were observed in 135 of the 308 cases (43.8%). Acute myeloid leukemia associated with a DNA-methylation regulatory gene mutation was more frequent in older patients (P<0.0001) and in patients with intermediate cytogenetic risk (P<0.0001) accompanied by a high white blood cell count (P=0.0032). DNA-methylation regulatory gene mutation was an unfavorable prognostic factor for overall survival in the whole cohort (P=0.0018), in patients aged ≤70 years, in patients with intermediate cytogenetic risk, and in FLT3-ITD-negative patients (P=0.0409). Among the patients with DNA-methylation regulatory gene mutations, 26.7% were found to have two or more such mutations and prognosis worsened with increasing number of mutations. In multivariate analysis DNA-methylation regulatory gene mutation was an independent unfavorable prognostic factor for overall survival (P=0.0424). However, patients with a DNA-methylation regulatory gene mutation who underwent allogeneic stem cell transplantation in first remission had a significantly better prognosis than those who did not undergo such transplantation (P=0.0254). Our study establishes that DNA-methylation regulatory gene mutation is an important unfavorable prognostic factor in acute myeloid leukemia. PMID:27247325

  2. FARE-CAFE: a database of functional and regulatory elements of cancer-associated fusion events.


    Korla, Praveen Kumar; Cheng, Jack; Huang, Chien-Hung; Tsai, Jeffrey J P; Liu, Yu-Hsuan; Kurubanjerdjit, Nilubon; Hsieh, Wen-Tsong; Chen, Huey-Yi; Ng, Ka-Lok


    Chromosomal translocation (CT) is of enormous clinical interest because this disorder is associated with various major solid tumors and leukemia. A tumor-specific fusion gene event may occur when a translocation joins two separate genes. Currently, various CT databases provide information about fusion genes and their genomic elements. However, no database of the roles of fusion genes, in terms of essential functional and regulatory elements in oncogenesis, is available. FARE-CAFE is a unique combination of CTs, fusion proteins, protein domains, domain-domain interactions, protein-protein interactions, transcription factors and microRNAs, with subsequent experimental information, which cannot be found in any other CT database. Genomic DNA information including, for example, manually collected exact locations of the first and second break points, sequences and karyotypes of fusion genes are included. FARE-CAFE will substantially facilitate the cancer biologist's mission of elucidating the pathogenesis of various types of cancer. This database will ultimately help to develop 'novel' therapeutic approaches. Database URL:

  3. A brief review on the Human Encyclopedia of DNA Elements (ENCODE) project.


    Qu, Hongzhu; Fang, Xiangdong


    The ENCyclopedia Of DNA Elements (ENCODE) project is an international research consortium that aims to identify all functional elements in the human genome sequence. The second phase of the project comprised 1640 datasets from 147 different cell types, yielding a set of 30 publications across several journals. These data revealed that 80.4% of the human genome displays some functionality in at least one cell type. Many of these regulatory elements are physically associated with one another and further form a network or three-dimensional conformation to affect gene expression. These elements are also related to sequence variants associated with diseases or traits. All these findings provide us new insights into the organization and regulation of genes and genome, and serve as an expansive resource for understanding human health and disease.

  4. Screening in silico predicted remotely acting NF1 gene regulatory elements for mutations in patients with neurofibromatosis type 1.


    Hamby, Stephen E; Reviriego, Pablo; Cooper, David N; Upadhyaya, Meena; Chuzhanova, Nadia


    Neurofibromatosis type 1 (NF1), a neuroectodermal disorder, is caused by germline mutations in the NF1 gene. NF1 affects approximately 1/3,000 individuals worldwide, with about 50% of cases representing de novo mutations. Although the NF1 gene was identified in 1990, the underlying gene mutations still remain undetected in a small but obdurate minority of NF1 patients. We postulated that in these patients, hitherto undetected pathogenic mutations might occur in regulatory elements far upstream of the NF1 gene. In an attempt to identify such remotely acting regulatory elements, we reasoned that some of them might reside within DNA sequences that (1) have the potential to interact at distance with the NF1 gene and (2) lie within a histone H3K27ac-enriched region, a characteristic of active enhancers. Combining Hi-C data, obtained by means of the chromosome conformation capture technique, with data on the location and level of histone H3K27ac enrichment upstream of the NF1 gene, we predicted in silico the presence of two remotely acting regulatory regions, located, respectively, approximately 600 kb and approximately 42 kb upstream of the NF1 gene. These regions were then sequenced in 47 NF1 patients in whom no mutations had been found in either the NF1 or SPRED1 gene regions. Five patients were found to harbour DNA sequence variants in the distal H3K27ac-enriched region. Although these variants are of uncertain pathological significance and still remain to be functionally characterized, this approach promises to be of general utility for the detection of mutations underlying other inherited disorders that may be caused by mutations in remotely acting regulatory elements.

  5. MicroRNAs as regulatory elements in psoriasis

    PubMed Central

    Liu, Yuan


    Abstract Psoriasis is a chronic, autoimmune, and complex genetic disorder that affects 23% of the European population. The symptoms of Psoriatic skin are inflammation, raised and scaly lesions. microRNA, which is short, nonprotein-coding, regulatory RNAs, plays critical roles in psoriasis. microRNA participates in nearly all biological processes, such as cell differentiation, development and metabolism. Recent researches reveal that multitudinous novel microRNAs have been identified in skin. Some of these substantial novel microRNAs play as a class of posttranscriptional gene regulator in skin disease, such as psoriasis. In order to insight into microRNAs biological functions and verify microRNAs biomarker, we review diverse references about characterization, profiling and subtype of microRNAs. Here we will share our opinions about how and which microRNAs are as regulatory in psoriasis.

  6. Non-DNA-binding cofactors enhance DNA-binding specificity of a transcriptional regulatory complex

    PubMed Central

    Siggers, Trevor; Duyzend, Michael H; Reddy, Jessica; Khan, Sidra; Bulyk, Martha L


    Recruitment of cofactors to specific DNA sites is integral for specificity in gene regulation. As a model system, we examined how targeting and transcriptional control of the sulfur metabolism genes in Saccharomyces cerevisiae is governed by recruitment of the transcriptional co-activator Met4. We developed genome-scale approaches to measure transcription factor (TF) DNA-binding affinities and cofactor recruitment to >1300 genomic binding site sequences. We report that genes responding to the TF Cbf1 and cofactor Met28 contain a novel ‘recruitment motif' (RYAAT), adjacent to Cbf1 binding sites, which enhances the binding of a Met4–Met28–Cbf1 regulatory complex, and that abrogation of this motif significantly reduces gene induction under low-sulfur conditions. Furthermore, we show that correct recognition of this composite motif requires both non-DNA-binding cofactors Met4 and Met28. Finally, we demonstrate that the presence of an RYAAT motif next to a Cbf1 site, rather than Cbf1 binding affinity, specifies Cbf1-dependent sulfur metabolism genes. Our results highlight the need to examine TF/cofactor complexes, as novel specificity can result from cofactors that lack intrinsic DNA-binding specificity. PMID:22146299

  7. Conservation of position and sequence of a novel, widely expressed gene containing the major human {alpha}-globin regulatory element

    SciTech Connect

    Vyas, P.; Vickers, M.A.; Picketts, D.J.; Higgs, D.R.


    We have determined the cDNA and genomic structure of a gene (-14 gene) that lies adjacent to the human {alpha}-globin cluster. Although it is expressed in a wide range of cell lines and tissues, a previously described erythroid-specific regulatory element that controls expression of the {alpha}-globin genes lies within intron 5 of this gene. Analysis of the -14 gene promoter shows that it is GC rich and associated with a constitutively expressed DNase 1 hypersensitive site; unlike the {alpha}-globin promoter, it does not contain a TATA or CCAAT box. These and other differences in promoter structure may explain why the erythroid regulatory element interacts specifically with the {alpha}-globin promoters and not the -14 gene promoter, which lies between the {alpha} promoters and their regulatory element. Interspecies comparisons demonstrate that the sequence and location of the -14 gene adjacent to the a cluster have been maintained since the bird/mammal divergence, 270 million years ago. 38 refs., 6 figs.

  8. Cross-Regulation between Transposable Elements and Host DNA Replication

    PubMed Central

    Zaratiegui, Mikel


    Transposable elements subvert host cellular functions to ensure their survival. Their interaction with the host DNA replication machinery indicates that selective pressures lead them to develop ancestral and convergent evolutionary adaptations aimed at conserved features of this fundamental process. These interactions can shape the co-evolution of the transposons and their hosts. PMID:28335567

  9. Identification of polycomb and trithorax group responsive elements in the regulatory region of the Drosophila homeotic gene Sex combs reduced

    SciTech Connect

    Gindhart, J.G. Jr.; Kaufman, T.C.


    The Drosophilia homeotic gene Sex combs reduced (Scr) is necessary for the establishment and maintenance of the morphological identity of the labial and prothoracic segments. In the early embryo, its expression pattern is established through the activity of several gap and segmentation gene products, as well as other transcription factors. Once established, the Polycomb group (Pc-G) and trithorax group (trx-G) gene products maintain the spatial pattern of Scr expression for the remainder of development. We report the identification of DNA fragments in the Scr regulatory region that may be important for its regulation by Polycomb and trithorax group gene products. When DNA fragments containing these regulatory sequences are subcloned into P-element vectors containing a white minigene, transformants containing these constructs exhibit mosaic patterns of pigmentation in the adult eye, indicating that white minigene expression is repressed in a clonally heritable manner. The size of pigmented and nonpigmented clones in the adult eye suggests that the event determining whether a cell in the eye anlagen will express white occurs at least as early as the first larval instar. The amount of white minigene repression is reduced in some Polycomb group mutants, whereas repression is enhanced in flies mutant for a subset of trithorax group loci. The repressor activity of one fragment, normally located in Scr Intron 2, is increased when it is able to homologously pair, a property consistent with genetic data suggesting that Scr exhibits transvection. Another Scr regulatory fragment, normally located 40 kb upstream of the Scr promoter, silences ectopic expression of an Scr-lacZ fusion gene in the embryo and does so in a Polycomb-dependent manner. We propose that the regulatory sequences located within these DNA fragments may normally mediate the regulation of Scr by proteins encoded by members of Polycomb and trithorax group loci. 98 refs., 6 figs., 4 tabs.

  10. The contribution of transposable elements to the evolution of regulatory networks

    PubMed Central

    Feschotte, Cédric


    Preface The control and coordination of eukaryotic gene expression rely on transcriptional and post-transcriptional regulatory networks. Although progress has been made in mapping the components and deciphering the function of these networks, the mechanisms by which such intricate circuits originate and evolve remain poorly understood. Here I revisit and expand earlier models proposing that genomic repeats, and in particular transposable elements, have been a rich source of material for the assembly and tinkering of eukaryotic gene regulatory systems. PMID:18368054

  11. Improved regulatory element prediction based on tissue-specific local epigenomic signatures

    PubMed Central

    He, Yupeng; Gorkin, David U.; Dickel, Diane E.; Nery, Joseph R.; Castanon, Rosa G.; Lee, Ah Young; Shen, Yin; Visel, Axel; Pennacchio, Len A.; Ren, Bing; Ecker, Joseph R.


    Accurate enhancer identification is critical for understanding the spatiotemporal transcriptional regulation during development as well as the functional impact of disease-related noncoding genetic variants. Computational methods have been developed to predict the genomic locations of active enhancers based on histone modifications, but the accuracy and resolution of these methods remain limited. Here, we present an algorithm, regulatory element prediction based on tissue-specific local epigenetic marks (REPTILE), which integrates histone modification and whole-genome cytosine DNA methylation profiles to identify the precise location of enhancers. We tested the ability of REPTILE to identify enhancers previously validated in reporter assays. Compared with existing methods, REPTILE shows consistently superior performance across diverse cell and tissue types, and the enhancer locations are significantly more refined. We show that, by incorporating base-resolution methylation data, REPTILE greatly improves upon current methods for annotation of enhancers across a variety of cell and tissue types. REPTILE is available at PMID:28193886

  12. The pluripotent regulatory circuitry connecting promoters to their long-range interacting elements

    PubMed Central

    Schoenfelder, Stefan; Furlan-Magaril, Mayra; Mifsud, Borbala; Tavares-Cadete, Filipe; Sugar, Robert; Javierre, Biola-Maria; Nagano, Takashi; Katsman, Yulia; Sakthidevi, Moorthy; Wingett, Steven W.; Dimitrova, Emilia; Dimond, Andrew; Edelman, Lucas B.; Elderkin, Sarah; Tabbada, Kristina; Darbo, Elodie; Andrews, Simon; Herman, Bram; Higgs, Andy; LeProust, Emily; Osborne, Cameron S.; Mitchell, Jennifer A.


    The mammalian genome harbors up to one million regulatory elements often located at great distances from their target genes. Long-range elements control genes through physical contact with promoters and can be recognized by the presence of specific histone modifications and transcription factor binding. Linking regulatory elements to specific promoters genome-wide is currently impeded by the limited resolution of high-throughput chromatin interaction assays. Here we apply a sequence capture approach to enrich Hi-C libraries for >22,000 annotated mouse promoters to identify statistically significant, long-range interactions at restriction fragment resolution, assigning long-range interacting elements to their target genes genome-wide in embryonic stem cells and fetal liver cells. The distal sites contacting active genes are enriched in active histone modifications and transcription factor occupancy, whereas inactive genes contact distal sites with repressive histone marks, demonstrating the regulatory potential of the distal elements identified. Furthermore, we find that coregulated genes cluster nonrandomly in spatial interaction networks correlated with their biological function and expression level. Interestingly, we find the strongest gene clustering in ES cells between transcription factor genes that control key developmental processes in embryogenesis. The results provide the first genome-wide catalog linking gene promoters to their long-range interacting elements and highlight the complex spatial regulatory circuitry controlling mammalian gene expression. PMID:25752748

  13. Epigenetic modifications as regulatory elements of autophagy in cancer.


    Sui, Xinbing; Zhu, Jing; Zhou, Jichun; Wang, Xian; Li, Da; Han, Weidong; Fang, Yong; Pan, Hongming


    Epigenetic modifications have been considered as hallmarks of cancer and play an important role in tumor initiation and development. Epigenetic mechanisms, including DNA methylation, histone modifications, and microRNAs, may regulate cell cycle and apoptosis, as well as macroautophagy (hereafter referred to as autophagy). Autophagy, as a crucial cellular homeostatic mechanism, performs a dual role, having pro-survival or pro-death properties. A variety of signaling pathways including epigenetic control have been implicated in the upregulation or downregulation of autophagy. However, the role of epigenetic regulation in autophagy is still less well acknowledged. Recent studies have linked epigenetic control to the autophagic process. Some epigenetic modifiers are also involved in the regulation of autophagy and potentiate the efficacy of traditional therapeutics. Thus, understanding the novel functions of epigenetic control in autophagy may allow us to develop potential therapeutic approaches for cancer treatment.

  14. Statistically significant strings are related to regulatory elements in the promoter regions of Saccharomyces cerevisiae

    NASA Astrophysics Data System (ADS)

    Hu, Rui; Wang, Bin


    Finding out statistically significant words in DNA and protein sequences forms the basis for many genetic studies. By applying the maximal entropy principle, we give one systematic way to study the nonrandom occurrence of words in DNA or protein sequences. Through comparison with experimental results, it was shown that patterns of regulatory binding sites in Saccharomyces cerevisiae ( yeast) genomes tend to occur significantly in the promoter regions. We studied two correlated gene families of yeast. The method successfully extracts the binding sites verified by experiments in each family. Many putative regulatory sites in the upstream regions are proposed. The study also suggested that some regulatory sites are active in both directions, while others show directional preference.

  15. Alu elements and DNA double-strand break repair.


    White, Travis B; Morales, Maria E; Deininger, Prescott L


    Alu elements represent one of the most common sources of homology and homeology in the human genome. Homeologous recombination between Alu elements represents a major form of genetic instability leading to deletions and duplications. Although these types of events have been studied extensively through genomic sequencing to assess the impact of Alu elements on disease mutations and genome evolution, the overall abundance of Alu elements in the genome often makes it difficult to assess the relevance of the Alu elements to specific recombination events. We recently reported a powerful new reporter gene system that allows the assessment of various cis and trans factors on the contribution of Alu elements to various forms of genetic instability. This allowed a quantitative measurement of the influence of mismatches on Alu elements and instability. It also confirmed that homeologous Alu elements are able to stimulate non-homologous end joining events in their vicinity. This appears to be dependent on portions of the mismatch repair pathway. We are now in a position to begin to unravel the complex influences of Alu density, mismatch and location with alterations of DNA repair processes in various tissues and tumors.

  16. A DNA Element Regulates Drug Tolerance and Withdrawal in Drosophila

    PubMed Central

    Li, Xiaolei; Ghezzi, Alfredo; Pohl, Jascha B.; Bohm, Arun Y.; Atkinson, Nigel S.


    Drug tolerance and withdrawal are insidious responses to drugs of abuse; the first increases drug consumption while the second punishes abstention. Drosophila generate functional tolerance to benzyl alcohol sedation by increasing neural expression of the slo BK-type Ca2+ activated K+ channel gene. After drug clearance this change produces a withdrawal phenotype—increased seizure susceptibility. The drug-induced histone modification profile identified the 6b element (60 nt) as a drug responsive element. Genomic deletion of 6b produces the allele, sloΔ6b, that reacts more strongly to the drug with increased induction, a massive increase in the duration of tolerance, and an increase in the withdrawal phenotype yet does not alter other slo-dependent behaviors. The 6b element is a homeostatic regulator of BK channel gene expression and is the first cis-acting DNA element shown to specifically affect the duration of a drug action. PMID:24086565

  17. Mutations in the hormone regulatory element of mouse mammary tumor virus differentially affect the response to progestins, androgens, and glucocorticoids.

    PubMed Central

    Gowland, P L; Buetti, E


    Transcription of the mouse mammary tumor virus DNA is known to be induced by several steroid hormones. Using chimeric MMTV plasmids containing mutations within the hormone regulatory element, we have previously studied the regions required for the glucocorticoid response in mouse fibroblasts. Here we report the characterization of elements essential for the stimulation by progestins and androgens as compared with glucocorticoids. The same set of mutant plasmids was transfected into the human mammary tumor cell line T47D, and the specific transcripts were analyzed by an S1 nuclease protection assay. Androgen-mediated stimulation, although weak, showed an extended sensitivity to mutations, with a slight preference for the proximal region. The results with progestin suggest that sequences within all the described sites protected by the receptor in vitro are required and that the promoter-proximal region (-128 to -78 from the RNA start site) is more important than the distal one (-190 to -160). Moreover, a binding site for nuclear factor I was not required for the progestin response, whereas it was required for glucocorticoids. Thus, the various steroid receptors play a role in the differential regulation of mouse mammary tumor virus transcription by recognizing distinct sequence differences in the hormone regulatory element and interacting with different factors bound to the promoter. Images PMID:2550809

  18. DBTGR: a database of tunicate promoters and their regulatory elements.


    Sierro, Nicolas; Kusakabe, Takehiro; Park, Keun-Joon; Yamashita, Riu; Kinoshita, Kengo; Nakai, Kenta


    The high similarity of tunicates and vertebrates during their development coupled with the transparency of tunicate larvae, their well-studied cell lineages and the availability of simple and efficient transgenesis methods makes of this subphylum an ideal system for the investigation of vertebrate physiological and developmental processes. Recently, the sequencing of two different Ciona genomes has lead to the identification of numerous genes. In order to better understand the regulation of these genes, a database was created containing information on regulation of tunicate genes collected from literature. It includes for instance information regarding the minimal promoter length, the transcription factors involved and their binding sites, as well as the localization of the gene expression. Additionally, binding sites for characterized transcription factors were predicted based on published in vitro recognition sites. Comparison of the promoters of homologous genes in different species is also provided to allow identification of conserved cis elements. At the time of writing, information about 184 promoters, containing 73 identified binding sites and >2000 newly predicted binding sites is available. This database is accessible at

  19. Transposable Elements: From DNA Parasites to Architects of Metazoan Evolution

    PubMed Central

    Piskurek, Oliver; Jackson, Daniel J.


    One of the most unexpected insights that followed from the completion of the human genome a decade ago was that more than half of our DNA is derived from transposable elements (TEs). Due to advances in high throughput sequencing technologies it is now clear that TEs comprise the largest molecular class within most metazoan genomes. TEs, once categorised as "junk DNA", are now known to influence genomic structure and function by increasing the coding and non-coding genetic repertoire of the host. In this way TEs are key elements that stimulate the evolution of metazoan genomes. This review highlights several lines of TE research including the horizontal transfer of TEs through host-parasite interactions, the vertical maintenance of TEs over long periods of evolutionary time, and the direct role that TEs have played in generating morphological novelty. PMID:24704977

  20. Transposable elements: from DNA parasites to architects of metazoan evolution.


    Piskurek, Oliver; Jackson, Daniel J


    One of the most unexpected insights that followed from the completion of the human genome a decade ago was that more than half of our DNA is derived from transposable elements (TEs). Due to advances in high throughput sequencing technologies it is now clear that TEs comprise the largest molecular class within most metazoan genomes. TEs, once categorised as "junk DNA", are now known to influence genomic structure and function by increasing the coding and non-coding genetic repertoire of the host. In this way TEs are key elements that stimulate the evolution of metazoan genomes. This review highlights several lines of TE research including the horizontal transfer of TEs through host-parasite interactions, the vertical maintenance of TEs over long periods of evolutionary time, and the direct role that TEs have played in generating morphological novelty.

  1. Multiple regulatory systems coordinate DNA replication with cell growth in Bacillus subtilis.


    Murray, Heath; Koh, Alan


    In many bacteria the rate of DNA replication is linked with cellular physiology to ensure that genome duplication is coordinated with growth. Nutrient-mediated growth rate control of DNA replication initiation has been appreciated for decades, however the mechanism(s) that connects these cell cycle activities has eluded understanding. In order to help address this fundamental question we have investigated regulation of DNA replication in the model organism Bacillus subtilis. Contrary to the prevailing view we find that changes in DnaA protein level are not sufficient to account for nutrient-mediated growth rate control of DNA replication initiation, although this regulation does require both DnaA and the endogenous replication origin. We go on to report connections between DNA replication and several essential cellular activities required for rapid bacterial growth, including respiration, central carbon metabolism, fatty acid synthesis, phospholipid synthesis, and protein synthesis. Unexpectedly, the results indicate that multiple regulatory systems are involved in coordinating DNA replication with cell physiology, with some of the regulatory systems targeting oriC while others act in a oriC-independent manner. We propose that distinct regulatory systems are utilized to control DNA replication in response to diverse physiological and chemical changes.

  2. Characterization of "cis"-regulatory elements ("c"RE) associated with mammary gland function

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The Bos taurus genome assembly has propelled dairy science into a new era; still, most of the information encoded in the genome has not yet been decoded. The human Encyclopedia of DNA Elements (ENCODE) project has spearheaded the identification and annotation of functional genomic elements in the hu...

  3. Mobile DNA Elements: The Seeds of Organic Complexity on Earth.


    Habibi, Laleh; Pedram, Mehrdad; AmirPhirozy, Akbar; Bonyadi, Khadijeh


    Mobile DNA or transposable elements (TEs) are genomic sequences capable of moving themselves independently into different parts of the genome. Viral invasion of eukaryotic genomes is assumed to be the main source of TEs. Selfish transposition of these elements could be a serious threat to the host cell, as they can insert themselves into the middle of coding genes and/or induce genomic instability. In response, through millions of years of evolution, cells have come up with various mechanisms such as genomic imprinting, DNA methylation, heterochromatin formation, and RNA interference to deactivate them. Interestingly, these processes have also greatly contributed to important cellular functions involved in cell differentiation, development, and differential gene expression. Propagation of TE copies during the course of evolution have resulted in increasing the genome size and providing proper space and flexibility in shaping the genome by creating new genes and establishing essential cellular structures such as heterochromatin, centromere, and telomeres. Yet, these elements are mostly labeled for playing a role in pathogenesis of human diseases. Here, we attempt to introduce TEs as factors necessary for making us human rather than just selfish sequences or obligatory guests invading our DNA.

  4. Recurrent modification of a conserved cis-regulatory element underlies fruit fly pigmentation diversity.


    Rogers, William A; Salomone, Joseph R; Tacy, David J; Camino, Eric M; Davis, Kristen A; Rebeiz, Mark; Williams, Thomas M


    The development of morphological traits occurs through the collective action of networks of genes connected at the level of gene expression. As any node in a network may be a target of evolutionary change, the recurrent targeting of the same node would indicate that the path of evolution is biased for the relevant trait and network. Although examples of parallel evolution have implicated recurrent modification of the same gene and cis-regulatory element (CRE), little is known about the mutational and molecular paths of parallel CRE evolution. In Drosophila melanogaster fruit flies, the Bric-à-brac (Bab) transcription factors control the development of a suite of sexually dimorphic traits on the posterior abdomen. Female-specific Bab expression is regulated by the dimorphic element, a CRE that possesses direct inputs from body plan (ABD-B) and sex-determination (DSX) transcription factors. Here, we find that the recurrent evolutionary modification of this CRE underlies both intraspecific and interspecific variation in female pigmentation in the melanogaster species group. By reconstructing the sequence and regulatory activity of the ancestral Drosophila melanogaster dimorphic element, we demonstrate that a handful of mutations were sufficient to create independent CRE alleles with differing activities. Moreover, intraspecific and interspecific dimorphic element evolution proceeded with little to no alterations to the known body plan and sex-determination regulatory linkages. Collectively, our findings represent an example where the paths of evolution appear biased to a specific CRE, and drastic changes in function were accompanied by deep conservation of key regulatory linkages.

  5. Functional and Regulatory Biomolecular Networks Organized by DNA Nanostructures

    NASA Astrophysics Data System (ADS)

    Liu, Minghui

    DNA has recently emerged as an extremely promising material to organize molecules on nanoscale. The reliability of base recognition, self-assembling behavior, and attractive structural properties of DNA are of unparalleled value in systems of this size. DNA scaffolds have already been used to organize a variety of molecules including nanoparticles and proteins. New protein-DNA bio-conjugation chemistries make it possible to precisely position proteins and other biomolecules on underlying DNA scaffolds, generating multi-biomolecule pathways with the ability to modulate intermolecular interactions and the local environment. This dissertation focuses on studying the application of using DNA nanostructure to direct the self-assembly of other biomolecular networks to translate biochemical pathways to non-cellular environments. Presented here are a series of studies toward this application. First, a novel strategy utilized DNA origami as a scaffold to arrange spherical virus capsids into one-dimensional arrays with precise nanoscale positioning. This hierarchical self-assembly allows us to position the virus particles with unprecedented control and allows the future construction of integrated multi-component systems from biological scaffolds using the power of rationally engineered DNA nanostructures. Next, discrete glucose oxidase (GOx)/ horseradish peroxidase (HRP) enzyme pairs were organized on DNA origami tiles with controlled interenzyme spacing and position. This study revealed two different distance-dependent kinetic processes associated with the assembled enzyme pairs. Finally, a tweezer-like DNA nanodevice was designed and constructed to actuate the activity of an enzyme/cofactor pair. Using this approach, several cycles of externally controlled enzyme inhibition and activation were successfully demonstrated. This principle of responsive enzyme nanodevices may be used to regulate other types of enzymes and to introduce feedback or feed-forward control loops.

  6. Multiple positive and negative 5' regulatory elements control the cell-type-specific expression of the embryonic skeletal myosin heavy-chain gene.

    PubMed Central

    Bouvagnet, P F; Strehler, E E; White, G E; Strehler-Page, M A; Nadal-Ginard, B; Mahdavi, V


    To identify the DNA sequences that regulate the expression of the sarcomeric myosin heavy-chain (MHC) genes in muscle cells, a series of deletion constructs of the rat embryonic MHC gene was assayed for transient expression after introduction into myogenic and nonmyogenic cells. The sequences in 1.4 kilobases of 5'-flanking DNA were found to be sufficient to direct expression of the MHC gene constructs in a tissue-specific manner (i.e., in differentiated muscle cells but not in undifferentiated muscle and nonmuscle cells). Three main distinct regulatory domains have been identified: (i) the upstream sequences from positions -1413 to -174, which determine the level of expression of the MHC gene and are constituted of three positive regulatory elements and two negative ones; (ii) a muscle-specific regulatory element from positions -173 to -142, which restricts the expression of the MHC gene to muscle cells; and (iii) the promoter region, downstream from position -102, which directs transcription initiation. Introduction of the simian virus 40 enhancer into constructs where subportions of or all of the upstream sequences are deleted (up to position -173) strongly increases the level of expression of such truncated constructs but without changing their muscle specificity. These upstream sequences, which can be substituted for by the simian virus 40 enhancer, function in an orientation-, position-, and promoter-dependent fashion. The muscle-specific element is also promoter specific but does not support efficient expression of the MHC gene. The MHC promoter in itself is not muscle specific. These results underline the importance of the concerted action of multiple regulatory elements that are likely to represent targets for DNA-binding-regulatory proteins. Images PMID:2830491

  7. Transposable DNA elements and life history traits: II. Transposition of P DNA elements in somatic cells reduces fitness, mating activity, and locomotion of Drosophila melanogaster.


    Woodruff, R C; Thompson, J N; Barker, J S; Huai, H


    Some transposable DNA elements in higher organisms are active in somatic cells, as well as in germinal cells. What effect does the movement of DNA elements in somatic cells have on life history traits? It has previously been reported that somatically active P and mariner elements in Drosophila induce genetic damage and significantly reduce lifespan. In this study, we report that the movement of P elements in somatic cells also significantly reduces fitness, mating activity, and locomotion of Drosophila melanogaster. If other elements cause similar changes in life history traits, it is doubtful if transposable DNA elements remain active for long in somatic cells in natural populations.

  8. Identification of the DNA damage-responsive element of RNR2 and evidence that four distinct cellular factors bind it.

    PubMed Central

    Elledge, S J; Davis, R W


    The RNR2 gene encodes the small subunit of ribonucleotide reductase, the enzyme that catalyzes the first step in the pathway for the production of the deoxyribonucleotides needed for DNA synthesis. Transcription of this gene is induced approximately 20-fold in response to environmental stimuli that damage DNA or block DNA replication. Deletion and subcloning analysis identified two, and possibly three, upstream activating sequences (UAS) and one repressing (URS) element in the RNR2 regulatory region. A 42-base-pair (bp) fragment from this region was found to be necessary for proper regulation of RNR2 and to be capable of conferring DNA damage inducibility upon a heterologous promoter. This fragment contained both positively and negatively acting sequences. Four DNA-binding factors interacted with the RNR2 regulatory region. One factor was identified as the GRF1 protein, the product of the RAP1 gene. GRF1 bound to the UAS2 element of RNR2, which was found to be directly adjacent to the 42-bp fragment. UAS2 activity was repressed by the 42-bp fragment. Three other factors bound to the 42-bp fragment; one of these factors, RRF3, had a second binding site in the RNR2 promoter. These factors are likely to mediate the response of RNR2 to DNA damage. Images PMID:2685561

  9. Variant-aware saturating mutagenesis using multiple Cas9 nucleases identifies regulatory elements at trait-associated loci.


    Canver, Matthew C; Lessard, Samuel; Pinello, Luca; Wu, Yuxuan; Ilboudo, Yann; Stern, Emily N; Needleman, Austen J; Galactéros, Frédéric; Brugnara, Carlo; Kutlar, Abdullah; McKenzie, Colin; Reid, Marvin; Chen, Diane D; Das, Partha Pratim; A Cole, Mitchel; Zeng, Jing; Kurita, Ryo; Nakamura, Yukio; Yuan, Guo-Cheng; Lettre, Guillaume; Bauer, Daniel E; Orkin, Stuart H


    Cas9-mediated, high-throughput, saturating in situ mutagenesis permits fine-mapping of function across genomic segments. Disease- and trait-associated variants identified in genome-wide association studies largely cluster at regulatory loci. Here we demonstrate the use of multiple designer nucleases and variant-aware library design to interrogate trait-associated regulatory DNA at high resolution. We developed a computational tool for the creation of saturating-mutagenesis libraries with single or multiple nucleases with incorporation of variants. We applied this methodology to the HBS1L-MYB intergenic region, which is associated with red-blood-cell traits, including fetal hemoglobin levels. This approach identified putative regulatory elements that control MYB expression. Analysis of genomic copy number highlighted potential false-positive regions, thus emphasizing the importance of off-target analysis in the design of saturating-mutagenesis experiments. Together, these data establish a widely applicable high-throughput and high-resolution methodology to identify minimal functional sequences within large disease- and trait-associated regions.

  10. Kinetics of transcription initiation directed by multiple cis-regulatory elements on the glnAp2 promoter

    PubMed Central

    Wang, Yaolai; Liu, Feng; Wang, Wei


    Transcription initiation is orchestrated by dynamic molecular interactions, with kinetic steps difficult to detect. Utilizing a hybrid method, we aim to unravel essential kinetic steps of transcriptional regulation on the glnAp2 promoter, whose regulatory region includes two enhancers (sites I and II) and three low-affinity sequences (sites III-V), to which the transcriptional activator NtrC binds. By structure reconstruction, we analyze all possible organization architectures of the transcription apparatus (TA). The main regulatory mode involves two NtrC hexamers: one at enhancer II transiently associates with site V such that the other at enhancer I can rapidly approach and catalyze the σ54-RNA polymerase holoenzyme. We build a kinetic model characterizing essential steps of the TA operation; with the known kinetics of the holoenzyme interacting with DNA, this model enables the kinetics beyond technical detection to be determined by fitting the input-output function of the wild-type promoter. The model further quantitatively reproduces transcriptional activities of various mutated promoters. These results reveal different roles played by two enhancers and interpret why the low-affinity elements conditionally enhance or repress transcription. This work presents an integrated dynamic picture of regulated transcription initiation and suggests an evolutionarily conserved characteristic guaranteeing reliable transcriptional response to regulatory signals. PMID:27899598

  11. Regulation of photoreceptor gene transcription via a highly conserved transcriptional regulatory element by vsx gene products

    PubMed Central

    Pan, Yi; Comiskey, Daniel F.; Kelly, Lisa E.; Chandler, Dawn S.


    Purpose The photoreceptor conserved element-1 (PCE-1) sequence is found in the transcriptional regulatory regions of many genes expressed in photoreceptors. The retinal homeobox (Rx or Rax) gene product functions by binding to PCE-1 sites. However, other transcriptional regulators have also been reported to bind to PCE-1. One of these, vsx2, is expressed in retinal progenitor and bipolar cells. The purpose of this study is to identify Xenopus laevis vsx gene products and characterize vsx gene product expression and function with respect to the PCE-1 site. Methods X. laevis vsx gene products were amplified with PCR. Expression patterns were determined with in situ hybridization using whole or sectioned X. laevis embryos and digoxigenin- or fluorescein-labeled antisense riboprobes. DNA binding characteristics of the vsx gene products were analyzed with electrophoretic mobility shift assays (EMSAs) using in vitro translated proteins and radiolabeled oligonucleotide probes. Gene transactivation assays were performed using luciferase-based reporters and in vitro transcribed effector gene products, injected into X. laevis embryos. Results We identified one vsx1 and two vsx2 gene products. The two vsx2 gene products are generated by alternate mRNA splicing. We verified that these gene products are expressed in the developing retina and that expression resolves into distinct cell types in the mature retina. Finally, we found that vsx gene products can bind the PCE-1 site in vitro and that the two vsx2 isoforms have different gene transactivation activities. Conclusions vsx gene products are expressed in the developing and mature neural retina. vsx gene products can bind the PCE-1 site in vitro and influence the expression of a rhodopsin promoter-luciferase reporter gene. The two isoforms of vsx have different gene transactivation activities in this reporter gene system. PMID:28003732

  12. Cruciform-extruding regulatory element controls cell-specific activity of the tyrosine hydroxylase gene promoter.

    PubMed Central

    Kim, E L; Peng, H; Esparza, F M; Maltchenko, S Z; Stachowiak, M K


    Tyrosine hydroxylase (TH) is expressed specifically in catecholaminergic cells. We have identified a novel regulatory sequence in the upstream region of the bovine TH gene promoter formed by a dyad symmetry element (DSE1;-352/-307 bp). DSE1 supports TH promoter activity in TH-expressing bovine adrenal medulla chromaffin (BAMC) cells and inhibits promoter activity in non-expressing TE671 cells. DNase I footprinting of relaxed TH promoter DNA showed weak binding of nuclear BAMC cell proteins to a short sequence in the right DSE1 arm. In BAMC cells, deletion of the right arm markedly reduced the expression of luciferase from the TH promoter. However, deletion of the left DSE1 arm or its reversed orientation (RevL) also inactivated the TH promoter. In supercoiled TH promoter, DSE1 assumes a cruciform-like conformation i.e., it binds cruciform-specific 2D3 antibody, and S1 nuclease-cleavage and OsO4-modification assays have identified an imperfect cruciform extruded by the DSE1. DNase I footprinting of supercoiled plasmid showed that cruciformed DSE1 is targeted by nuclear proteins more efficiently than the linear duplex isomer and that the protected site encompasses the left arm and center of DSE1. Our results suggest that the disruption of intrastrand base-pairing preventing cruciform formation and protein binding to DSE1 is responsible for its inactivation in DSE1 mutants. DSE1 cruciform may act as a target site for activator (BAMC cells) and repressor (TE671) proteins. Its extrusion emerges as a novel mechanism that controls cell-specific promoter activity. PMID:9512554

  13. Regulatory elements of the floral homeotic gene AGAMOUS identified by phylogenetic footprinting and shadowing.

    SciTech Connect

    Hong, R. L., Hamaguchi, L., Busch, M. A., and Weigel, D.


    OAK-B135 In Arabidopsis thaliana, cis-regulatory sequences of the floral homeotic gene AGAMOUS (AG) are located in the second intron. This 3 kb intron contains binding sites for two direct activators of AG, LEAFY (LFY) and WUSCHEL (WUS), along with other putative regulatory elements. We have used phylogenetic footprinting and the related technique of phylogenetic shadowing to identify putative cis-regulatory elements in this intron. Among 29 Brassicaceae, several other motifs, but not the LFY and WUS binding sites previously identified, are largely invariant. Using reporter gene analyses, we tested six of these motifs and found that they are all functionally important for activity of AG regulatory sequences in A. thaliana. Although there is little obvious sequence similarity outside the Brassicaceae, the intron from cucumber AG has at least partial activity in A. thaliana. Our studies underscore the value of the comparative approach as a tool that complements gene-by-gene promoter dissection, but also highlight that sequence-based studies alone are insufficient for a complete identification of cis-regulatory sites.

  14. LDRD Report FY 03: Structure and Function of Regulatory DNA: A Next Major Challenge in Genomics

    SciTech Connect

    Stubbs, L


    leverage their long-standing investment and expertise in mapping, sequencing, and genetics of human chromosome 19 (ch19). The starting point of this effort was the LLNL and Joint Genome Institute (JGI) genomics teams' success in sequencing mouse DNA related to ch19. This effort was the first comparative sequencing project to be conducted on such a large scale; a manuscript describing this work was published in Science shortly after this LDRD began (Dehal et al., Science 293: 104-111, 2001). Like protein-coding genes themselves, DNA elements that control gene expression are protected from structural change over evolutionary time, since their function is dependent on sequence integrity. By contrast, DNA that serves no function (''junk DNA'') can accumulate mutations that change sequence content without biological consequence. As a result, the ''junk DNA'' of human and mouse are not at all alike in sequence; however, genes and regulatory elements (REs) of human, mouse, and other animals--as far removed from human and fish and birds--are very similar in sequence and structure.

  15. Defining functional DNA elements in the human genome.


    Kellis, Manolis; Wold, Barbara; Snyder, Michael P; Bernstein, Bradley E; Kundaje, Anshul; Marinov, Georgi K; Ward, Lucas D; Birney, Ewan; Crawford, Gregory E; Dekker, Job; Dunham, Ian; Elnitski, Laura L; Farnham, Peggy J; Feingold, Elise A; Gerstein, Mark; Giddings, Morgan C; Gilbert, David M; Gingeras, Thomas R; Green, Eric D; Guigo, Roderic; Hubbard, Tim; Kent, Jim; Lieb, Jason D; Myers, Richard M; Pazin, Michael J; Ren, Bing; Stamatoyannopoulos, John A; Weng, Zhiping; White, Kevin P; Hardison, Ross C


    With the completion of the human genome sequence, attention turned to identifying and annotating its functional DNA elements. As a complement to genetic and comparative genomics approaches, the Encyclopedia of DNA Elements Project was launched to contribute maps of RNA transcripts, transcriptional regulator binding sites, and chromatin states in many cell types. The resulting genome-wide data reveal sites of biochemical activity with high positional resolution and cell type specificity that facilitate studies of gene regulation and interpretation of noncoding variants associated with human disease. However, the biochemically active regions cover a much larger fraction of the genome than do evolutionarily conserved regions, raising the question of whether nonconserved but biochemically active regions are truly functional. Here, we review the strengths and limitations of biochemical, evolutionary, and genetic approaches for defining functional DNA segments, potential sources for the observed differences in estimated genomic coverage, and the biological implications of these discrepancies. We also analyze the relationship between signal intensity, genomic coverage, and evolutionary conservation. Our results reinforce the principle that each approach provides complementary information and that we need to use combinations of all three to elucidate genome function in human biology and disease.

  16. Defining functional DNA elements in the human genome

    PubMed Central

    Kellis, Manolis; Wold, Barbara; Snyder, Michael P.; Bernstein, Bradley E.; Kundaje, Anshul; Marinov, Georgi K.; Ward, Lucas D.; Birney, Ewan; Crawford, Gregory E.; Dekker, Job; Dunham, Ian; Elnitski, Laura L.; Farnham, Peggy J.; Feingold, Elise A.; Gerstein, Mark; Giddings, Morgan C.; Gilbert, David M.; Gingeras, Thomas R.; Green, Eric D.; Guigo, Roderic; Hubbard, Tim; Kent, Jim; Lieb, Jason D.; Myers, Richard M.; Pazin, Michael J.; Ren, Bing; Stamatoyannopoulos, John A.; Weng, Zhiping; White, Kevin P.; Hardison, Ross C.


    With the completion of the human genome sequence, attention turned to identifying and annotating its functional DNA elements. As a complement to genetic and comparative genomics approaches, the Encyclopedia of DNA Elements Project was launched to contribute maps of RNA transcripts, transcriptional regulator binding sites, and chromatin states in many cell types. The resulting genome-wide data reveal sites of biochemical activity with high positional resolution and cell type specificity that facilitate studies of gene regulation and interpretation of noncoding variants associated with human disease. However, the biochemically active regions cover a much larger fraction of the genome than do evolutionarily conserved regions, raising the question of whether nonconserved but biochemically active regions are truly functional. Here, we review the strengths and limitations of biochemical, evolutionary, and genetic approaches for defining functional DNA segments, potential sources for the observed differences in estimated genomic coverage, and the biological implications of these discrepancies. We also analyze the relationship between signal intensity, genomic coverage, and evolutionary conservation. Our results reinforce the principle that each approach provides complementary information and that we need to use combinations of all three to elucidate genome function in human biology and disease. PMID:24753594

  17. Association between hypermethylation of DNA repetitive elements in white blood cell DNA and pancreatic cancer.


    Neale, Rachel E; Clark, Paul J; Fawcett, Jonathan; Fritschi, Lin; Nagler, Belinda N; Risch, Harvey A; Walters, Rhiannon J; Crawford, William J; Webb, Penelope M; Whiteman, David C; Buchanan, Daniel D


    Pancreatic cancer is a leading cause of cancer-related deaths worldwide. Methylation of DNA may influence risk or be a marker of early disease. The aim of this study was to measure the association between methylation of three DNA repetitive elements in white blood cell (WBC) DNA and pancreatic cancer. DNA from WBCs of pancreatic cancer cases (n=559) and healthy unrelated controls (n=603) were tested for methylation of the LINE-1, Alu and Sat2 DNA repetitive elements using MethyLight quantitative PCR assays. Odds ratios (ORs) and 95% confidence intervals (95%CI) between both continuous measures of percent of methylated sample compared to a reference (PMR) or quintiles of PMR and pancreatic cancer, adjusted for age, sex, smoking, BMI, alcohol and higher education, were estimated. The PMR for each of the three markers was higher in cases than in controls, although only LINE-1 was significantly associated with pancreatic cancer (OR per log unit=1.37, 95%CI=1.16-1.63). The marker methylation score for all three markers combined was significantly associated with pancreatic cancer (p-trend=0.0006). There were no associations between measures of PMR and either presence of metastases, or timing of blood collection in relation to diagnosis, surgery, chemotherapy or death (all p>0.1). We observed an association between methylation of LINE-1 in WBC DNA and risk of pancreatic cancer. Further studies are needed to confirm this association.

  18. Computational identification of new structured cis-regulatory elements in the 3'-untranslated region of human protein coding genes.


    Chen, Xiaowei Sylvia; Brown, Chris M


    Messenger ribonucleic acids (RNAs) contain a large number of cis-regulatory RNA elements that function in many types of post-transcriptional regulation. These cis-regulatory elements are often characterized by conserved structures and/or sequences. Although some classes are well known, given the wide range of RNA-interacting proteins in eukaryotes, it is likely that many new classes of cis-regulatory elements are yet to be discovered. An approach to this is to use computational methods that have the advantage of analysing genomic data, particularly comparative data on a large scale. In this study, a set of structural discovery algorithms was applied followed by support vector machine (SVM) classification. We trained a new classification model (CisRNA-SVM) on a set of known structured cis-regulatory elements from 3'-untranslated regions (UTRs) and successfully distinguished these and groups of cis-regulatory elements not been strained on from control genomic and shuffled sequences. The new method outperformed previous methods in classification of cis-regulatory RNA elements. This model was then used to predict new elements from cross-species conserved regions of human 3'-UTRs. Clustering of these elements identified new classes of potential cis-regulatory elements. The model, training and testing sets and novel human predictions are available at:

  19. A positive regulatory element is involved in the induction of the beta-galactosidase gene from Kluyveromyces lactis.

    PubMed Central

    Das, S; Breunig, K D; Hollenberg, C P


    The regulation of the LAC4 gene encoding beta-galactosidase in the yeast Kluyveromyces lactis has been studied. The expression of cloned LAC4 gene present on autonomously replicating plasmids was normally regulated by lactose or galactose as inducers. The LAC4 transcription initiation sites were mapped on two plasmids, PTY75-LAC4 and pKL2. The sites were found to be dependent on the level of gene expression and on the plasmid used. Under induced conditions, the normal cluster of initiation sites was used on both plasmids, whereas under non-induced conditions LAC4 on pKL2 showed additional sites. Deletion mapping of the 5' regulatory region of the LAC4 gene revealed a DNA element required for induction, presumably for the binding of a positive regulator. Images Fig. 2. Fig. 3. Fig. 6. PMID:3924596

  20. Microsatellite Tandem Repeats Are Abundant in Human Promoters and Are Associated with Regulatory Elements

    PubMed Central

    Sawaya, Sterling; Bagshaw, Andrew; Buschiazzo, Emmanuel; Kumar, Pankaj; Chowdhury, Shantanu; Black, Michael A.; Gemmell, Neil


    Tandem repeats are genomic elements that are prone to changes in repeat number and are thus often polymorphic. These sequences are found at a high density at the start of human genes, in the gene’s promoter. Increasing empirical evidence suggests that length variation in these tandem repeats can affect gene regulation. One class of tandem repeats, known as microsatellites, rapidly alter in repeat number. Some of the genetic variation induced by microsatellites is known to result in phenotypic variation. Recently, our group developed a novel method for measuring the evolutionary conservation of microsatellites, and with it we discovered that human microsatellites near transcription start sites are often highly conserved. In this study, we examined the properties of microsatellites found in promoters. We found a high density of microsatellites at the start of genes. We showed that microsatellites are statistically associated with promoters using a wavelet analysis, which allowed us to test for associations on multiple scales and to control for other promoter related elements. Because promoter microsatellites tend to be G/C rich, we hypothesized that G/C rich regulatory elements may drive the association between microsatellites and promoters. Our results indicate that CpG islands, G-quadruplexes (G4) and untranslated regulatory regions have highly significant associations with microsatellites, but controlling for these elements in the analysis does not remove the association between microsatellites and promoters. Due to their intrinsic lability and their overlap with predicted functional elements, these results suggest that many promoter microsatellites have the potential to affect human phenotypes by generating mutations in regulatory elements, which may ultimately result in disease. We discuss the potential functions of human promoter microsatellites in this context. PMID:23405090

  1. Fast and systematic genome-wide discovery of conserved regulatory elements using a non-alignment based approach

    PubMed Central

    Elemento, Olivier; Tavazoie, Saeed


    We describe a powerful new approach for discovering globally conserved regulatory elements between two genomes. The method is fast, simple and comprehensive, without requiring alignments. Its application to pairs of yeasts, worms, flies and mammals yields a large number of known and novel putative regulatory elements. Many of these are validated by independent biological observations, have spatial and/or orientation biases, are co-conserved with other elements and show surprising conservation across large phylogenetic distances. PMID:15693947

  2. DEPPDB - DNA electrostatic potential properties database. Electrostatic properties of genome DNA elements.


    Osypov, Alexander A; Krutinin, Gleb G; Krutinina, Eugenia A; Kamzolova, Svetlana G


    Electrostatic properties of genome DNA are important to its interactions with different proteins, in particular, related to transcription. DEPPDB - DNA Electrostatic Potential (and other Physical) Properties Database - provides information on the electrostatic and other physical properties of genome DNA combined with its sequence and annotation of biological and structural properties of genomes and their elements. Genomes are organized on taxonomical basis, supporting comparative and evolutionary studies. Currently, DEPPDB contains all completely sequenced bacterial, viral, mitochondrial, and plastids genomes according to the NCBI RefSeq, and some model eukaryotic genomes. Data for promoters, regulation sites, binding proteins, etc., are incorporated from established DBs and literature. The database is complemented by analytical tools. User sequences calculations are available. Case studies discovered electrostatics complementing DNA bending in E.coli plasmid BNT2 promoter functioning, possibly affecting host-environment metabolic switch. Transcription factors binding sites gravitate to high potential regions, confirming the electrostatics universal importance in protein-DNA interactions beyond the classical promoter-RNA polymerase recognition and regulation. Other genome elements, such as terminators, also show electrostatic peculiarities. Most intriguing are gene starts, exhibiting taxonomic correlations. The necessity of the genome electrostatic properties studies is discussed.

  3. Recurrent Modification of a Conserved Cis-Regulatory Element Underlies Fruit Fly Pigmentation Diversity

    PubMed Central

    Rogers, William A.; Salomone, Joseph R.; Tacy, David J.; Camino, Eric M.; Davis, Kristen A.; Rebeiz, Mark; Williams, Thomas M.


    The development of morphological traits occurs through the collective action of networks of genes connected at the level of gene expression. As any node in a network may be a target of evolutionary change, the recurrent targeting of the same node would indicate that the path of evolution is biased for the relevant trait and network. Although examples of parallel evolution have implicated recurrent modification of the same gene and cis-regulatory element (CRE), little is known about the mutational and molecular paths of parallel CRE evolution. In Drosophila melanogaster fruit flies, the Bric-à-brac (Bab) transcription factors control the development of a suite of sexually dimorphic traits on the posterior abdomen. Female-specific Bab expression is regulated by the dimorphic element, a CRE that possesses direct inputs from body plan (ABD-B) and sex-determination (DSX) transcription factors. Here, we find that the recurrent evolutionary modification of this CRE underlies both intraspecific and interspecific variation in female pigmentation in the melanogaster species group. By reconstructing the sequence and regulatory activity of the ancestral Drosophila melanogaster dimorphic element, we demonstrate that a handful of mutations were sufficient to create independent CRE alleles with differing activities. Moreover, intraspecific and interspecific dimorphic element evolution proceeded with little to no alterations to the known body plan and sex-determination regulatory linkages. Collectively, our findings represent an example where the paths of evolution appear biased to a specific CRE, and drastic changes in function were accompanied by deep conservation of key regulatory linkages. PMID:24009528

  4. Downstream Regulatory Element Antagonist Modulator (DREAM), a target for anti-thrombotic agents.


    Cho, Jaehyung


    Circulating platelets participate in the process of numerous diseases including thrombosis, inflammation, and cancer. Thus, it is of great importance to understand the underlying mechanisms mediating platelet activation under disease conditions. Emerging evidence indicates that despite the lack of a nucleus, platelets possess molecules that are involved in gene transcription in nucleated cells. This review will summarize downstream regulatory element antagonist modulator (DREAM), a transcriptional repressor, and highlight recent findings suggesting its novel non-transcriptional role in hemostasis and thrombosis.

  5. Chromatin landscape dictates HSF binding to target DNA elements.


    Guertin, Michael J; Lis, John T


    Sequence-specific transcription factors (TFs) are critical for specifying patterns and levels of gene expression, but target DNA elements are not sufficient to specify TF binding in vivo. In eukaryotes, the binding of a TF is in competition with a constellation of other proteins, including histones, which package DNA into nucleosomes. We used the ChIP-seq assay to examine the genome-wide distribution of Drosophila Heat Shock Factor (HSF), a TF whose binding activity is mediated by heat shock-induced trimerization. HSF binds to 464 sites after heat shock, the vast majority of which contain HSF Sequence-binding Elements (HSEs). HSF-bound sequence motifs represent only a small fraction of the total HSEs present in the genome. ModENCODE ChIP-chip datasets, generated during non-heat shock conditions, were used to show that inducibly bound HSE motifs are associated with histone acetylation, H3K4 trimethylation, RNA Polymerase II, and coactivators, compared to HSE motifs that remain HSF-free. Furthermore, directly changing the chromatin landscape, from an inactive to an active state, permits inducible HSF binding. There is a strong correlation of bound HSEs to active chromatin marks present prior to induced HSF binding, indicating that an HSE's residence in "active" chromatin is a primary determinant of whether HSF can bind following heat shock.

  6. Role of Conserved Non-Coding Regulatory Elements in LMW Glutenin Gene Expression

    PubMed Central

    Juhász, Angéla; Makai, Szabolcs; Sebestyén, Endre; Tamás, László; Balázs, Ervin


    Transcriptional regulation of LMW glutenin genes were investigated in-silico, using publicly available gene sequences and expression data. Genes were grouped into different LMW glutenin types and their promoter profiles were determined using cis-acting regulatory elements databases and published results. The various cis-acting elements belong to some conserved non-coding regulatory regions (CREs) and might act in two different ways. There are elements, such as GCN4 motifs found in the long endosperm box that could serve as key factors in tissue-specific expression. Some other elements, such as the AACA/TA motifs or the individual prolamin box variants, might modulate the level of expression. Based on the promoter sequences and expression characteristic LMW glutenin genes might be transcribed following two different mechanisms. Most of the s- and i-type genes show a continuously increasing expression pattern. The m-type genes, however, demonstrate normal distribution in their expression profiles. Differences observed in their expression could be related to the differences found in their promoter sequences. Polymorphisms in the number and combination of cis-acting elements in their promoter regions can be of crucial importance in the diverse levels of production of single LMW glutenin gene types. PMID:22242127

  7. Detection and characterization of regulatory elements using probabilistic conditional random field and hidden Markov models.


    Wang, Hongyan; Zhou, Xiaobo


    By altering the electrostatic charge of histones or providing binding sites to protein recognition molecules, Chromatin marks have been proposed to regulate gene expression, a property that has motivated researchers to link these marks to cis-regulatory elements. With the help of next generation sequencing technologies, we can now correlate one specific chromatin mark with regulatory elements (e.g. enhancers or promoters) and also build tools, such as hidden Markov models, to gain insight into mark combinations. However, hidden Markov models have limitation for their character of generative models and assume that a current observation depends only on a current hidden state in the chain. Here, we employed two graphical probabilistic models, namely the linear conditional random field model and multivariate hidden Markov model, to mark gene regions with different states based on recurrent and spatially coherent character of these eight marks. Both models revealed chromatin states that may correspond to enhancers and promoters, transcribed regions, transcriptional elongation, and low-signal regions. We also found that the linear conditional random field model was more effective than the hidden Markov model in recognizing regulatory elements, such as promoter-, enhancer-, and transcriptional elongation-associated regions, which gives us a better choice.

  8. CpG methylation at GATA elements in the regulatory region of CCR3 positively correlates with CCR3 transcription.


    Uhm, Tae Gi; Lee, Seol Kyung; Kim, Byung Soo; Kang, Jin Hyun; Park, Choon Sik; Rhim, Tai Youn; Chang, Hun Soo; Kim, Do Jin; Chung, Il Yup


    DNA methylation may regulate gene expression by restricting the access of transcription factors. We have previously demonstrated that GATA-1 regulates the transcription of the CCR3 gene by dynamically interacting with both positively and negatively acting GATA elements of high affinity binding in the proximal promoter region including exon 1. Exon 1 has three CpG sites, two of which are positioned at the negatively acting GATA elements. We hypothesized that the methylation of these two CpGs sites might preclude GATA-1 binding to the negatively acting GATA elements and, as a result, increase the availability of GATA-1 to the positively acting GATA element, thereby contributing to an increase in GATA-1-mediated transcription of the gene. To this end, we determined the methylation of the three CpG sites by bisulfate pyrosequencing in peripheral blood eosinophils, cord blood (CB)-derived eosinophils, PBMCs, and cell lines that vary in CCR3 mRNA expression. Our results demonstrated that methylation of CpG sites at the negatively acting GATA elements severely reduced GATA-1 binding and augmented transcription activity in vitro. In agreement, methylation of these CpG sites positively correlated with CCR3 mRNA expression in the primary cells and cell lines examined. Interestingly, methylation patterns of these three CpG sites in CB-derived eosinophils mostly resembled those in peripheral blood eosinophils. These results suggest that methylation of CpG sites at the GATA elements in the regulatory regions fine-tunes CCR3 transcription.

  9. Sites of Predicted Stress-Induced DNA Duplex Destabilization Occur Preferentially at Regulatory Loci

    NASA Astrophysics Data System (ADS)

    Benham, Craig J.


    This paper describes a computational method to predict the sites on a DNA molecule where imposed superhelical stresses destabilize the duplex. Several DNA sequences are analyzed in this way, including the pBR322 and ColE1 plasmids, bacteriophage f1, and the polyoma and bovine papilloma virus genomes. Superhelical destabilization in these molecules is predicted to occur at small numbers of discrete sites, most of which are within regulatory regions. The most destabilized sites include the terminator and promoter regions of specific plasmid operons, the LexA binding sites of genes under SOS control, the intergenic control region of bacteriophage f1, and the polyadenylylation sites in eukaryotic viruses. These results demonstrate the existence of close correspondences between sites of predicted superhelical duplex destabilization and specific types of regulatory regions. The use of these correspondences to supplement string-matching techniques in the search for regulatory loci is discussed.

  10. Systematic localization of common disease-associated variation in regulatory DNA.


    Maurano, Matthew T; Humbert, Richard; Rynes, Eric; Thurman, Robert E; Haugen, Eric; Wang, Hao; Reynolds, Alex P; Sandstrom, Richard; Qu, Hongzhu; Brody, Jennifer; Shafer, Anthony; Neri, Fidencio; Lee, Kristen; Kutyavin, Tanya; Stehling-Sun, Sandra; Johnson, Audra K; Canfield, Theresa K; Giste, Erika; Diegel, Morgan; Bates, Daniel; Hansen, R Scott; Neph, Shane; Sabo, Peter J; Heimfeld, Shelly; Raubitschek, Antony; Ziegler, Steven; Cotsapas, Chris; Sotoodehnia, Nona; Glass, Ian; Sunyaev, Shamil R; Kaul, Rajinder; Stamatoyannopoulos, John A


    Genome-wide association studies have identified many noncoding variants associated with common diseases and traits. We show that these variants are concentrated in regulatory DNA marked by deoxyribonuclease I (DNase I) hypersensitive sites (DHSs). Eighty-eight percent of such DHSs are active during fetal development and are enriched in variants associated with gestational exposure-related phenotypes. We identified distant gene targets for hundreds of variant-containing DHSs that may explain phenotype associations. Disease-associated variants systematically perturb transcription factor recognition sequences, frequently alter allelic chromatin states, and form regulatory networks. We also demonstrated tissue-selective enrichment of more weakly disease-associated variants within DHSs and the de novo identification of pathogenic cell types for Crohn's disease, multiple sclerosis, and an electrocardiogram trait, without prior knowledge of physiological mechanisms. Our results suggest pervasive involvement of regulatory DNA variation in common human disease and provide pathogenic insights into diverse disorders.

  11. DNA methylation in repetitive elements and Alzheimer disease.


    Bollati, V; Galimberti, D; Pergoli, L; Dalla Valle, E; Barretta, F; Cortini, F; Scarpini, E; Bertazzi, P A; Baccarelli, A


    Epigenetics is believed to play a role in Alzheimer's disease (AD). DNA methylation, the most investigated epigenetic hallmark, is a reversible mechanism that modifies genome function and chromosomal stability through the addition of methyl groups to cytosine located in CpG dinucleotides to form 5 methylcytosine (5mC). Methylation status of repetitive elements (i.e. Alu, LINE-1 and SAT-α) is a major contributor of global DNA methylation patterns and has been investigated in relation to a variety of human diseases. However, the role of methylation of repetitive elements in blood of AD patients has never been investigated so far. In the present study, a quantitative bisulfite-PCR pyrosequencing method was used to evaluate methylation of Alu, LINE-1 and SAT-α sequences in 43 AD patients and 38 healthy donors. In multivariate analysis adjusting for age and gender, LINE-1 was increased in AD patients compared with healthy volunteers (ADs: 83.6%5mC, volunteers: 83.1%5mC, p-value: 0.05). The group with best performances in mini mental state examination (MMSE) showed higher levels of LINE-1 methylation compared to the group with worst performances (MMSE>22: 83.9%5mC; MMSE≤22: 83.2%5mC; p=0.05). Our data suggest that LINE-1 methylation may lead to a better understanding of AD pathogenesis and course, and may contribute to identify novel markers useful to assess risk stratification. Further prospective investigations are warranted to evaluate the dynamics of DNA methylation from early-stage AD to advanced phases of the disease.

  12. Multiple cis-regulatory elements are involved in the complex regulation of the sieve element-specific MtSEO-F1 promoter from Medicago truncatula.


    Bucsenez, M; Rüping, B; Behrens, S; Twyman, R M; Noll, G A; Prüfer, D


    The sieve element occlusion (SEO) gene family includes several members that are expressed specifically in immature sieve elements (SEs) in the developing phloem of dicotyledonous plants. To determine how this restricted expression profile is achieved, we analysed the SE-specific Medicago truncatula SEO-F1 promoter (PMtSEO-F1) by constructing deletion, substitution and hybrid constructs and testing them in transgenic tobacco plants using green fluorescent protein as a reporter. This revealed four promoter regions, each containing cis-regulatory elements that activate transcription in SEs. One of these segments also contained sufficient information to suppress PMtSEO-F1 transcription in the phloem companion cells (CCs). Subsequent in silico analysis revealed several candidate cis-regulatory elements that PMtSEO-F1 shares with other SEO promoters. These putative sieve element boxes (PSE boxes) are promising candidates for cis-regulatory elements controlling the SE-specific expression of PMtSEO-F1.

  13. Genome-wide identification of regulatory elements and reconstruction of gene regulatory networks of the green alga Chlamydomonas reinhardtii under carbon deprivation.


    Winck, Flavia Vischi; Vischi Winck, Flavia; Arvidsson, Samuel; Riaño-Pachón, Diego Mauricio; Hempel, Sabrina; Koseska, Aneta; Nikoloski, Zoran; Urbina Gomez, David Alejandro; Rupprecht, Jens; Mueller-Roeber, Bernd


    The unicellular green alga Chlamydomonas reinhardtii is a long-established model organism for studies on photosynthesis and carbon metabolism-related physiology. Under conditions of air-level carbon dioxide concentration [CO2], a carbon concentrating mechanism (CCM) is induced to facilitate cellular carbon uptake. CCM increases the availability of carbon dioxide at the site of cellular carbon fixation. To improve our understanding of the transcriptional control of the CCM, we employed FAIRE-seq (formaldehyde-assisted Isolation of Regulatory Elements, followed by deep sequencing) to determine nucleosome-depleted chromatin regions of algal cells subjected to carbon deprivation. Our FAIRE data recapitulated the positions of known regulatory elements in the promoter of the periplasmic carbonic anhydrase (Cah1) gene, which is upregulated during CCM induction, and revealed new candidate regulatory elements at a genome-wide scale. In addition, time series expression patterns of 130 transcription factor (TF) and transcription regulator (TR) genes were obtained for cells cultured under photoautotrophic condition and subjected to a shift from high to low [CO2]. Groups of co-expressed genes were identified and a putative directed gene-regulatory network underlying the CCM was reconstructed from the gene expression data using the recently developed IOTA (inner composition alignment) method. Among the candidate regulatory genes, two members of the MYB-related TF family, Lcr1 (Low-CO 2 response regulator 1) and Lcr2 (Low-CO2 response regulator 2), may play an important role in down-regulating the expression of a particular set of TF and TR genes in response to low [CO2]. The results obtained provide new insights into the transcriptional control of the CCM and revealed more than 60 new candidate regulatory genes. Deep sequencing of nucleosome-depleted genomic regions indicated the presence of new, previously unknown regulatory elements in the C. reinhardtii genome. Our work can

  14. Cis-regulatory elements are harbored in Intron5 of the RUNX1 gene

    PubMed Central


    Background Human RUNX1 gene is one of the most frequent target for chromosomal translocations associated with acute myeloid leukemia (AML) and acute lymphoid leukemia (ALL). The highest prevalence in AML is noted with (8; 21) translocation; which represents 12 to 15% of all AML cases. Interestingly, all the breakpoints mapped to date in t(8;21) are clustered in intron 5 of the RUNX1 gene and intron 1 of the ETO gene. No homologous sequences have been found at the recombination regions; but DNase I hypersensitive sites (DHS) have been mapped to the areas of the genes involved in t(8;21). Presence of DHS sites is commonly associated with regulatory elements such as promoters, enhancers and silencers, among others. Results In this study we used a combination of comparative genomics, cloning and transfection assays to evaluate potential regulatory elements located in intron 5 of the RUNX1 gene. Our genomic analysis identified nine conserved non-coding sequences that are evolutionarily conserved among rat, mouse and human. We cloned two of these regions in pGL-3 Promoter plasmid in order to analyze their transcriptional regulatory activity. Our results demonstrate that the identified regions can indeed regulate transcription of a reporter gene in a distance and position independent manner; moreover, their transcriptional effect is cell type specific. Conclusions We have identified nine conserved non coding sequence that are harbored in intron 5 of the RUNX1 gene. We have also demonstrated that two of these regions can regulate transcriptional activity in vitro. Taken together our results suggest that intron 5 of the RUNX1 gene contains multiple potential cis-regulatory elements. PMID:24655352

  15. A novel positive regulatory element for exfoliative toxin A gene expression in Staphylococcus aureus.


    Sakurai, Susumu; Suzuki, Hitoshi; Hata, Toshiaki; Yoshizawa, Yukio; Nakayama, Ritsuko; Machida, Katsuhiko; Masuda, Shogo; Tsukiyama, Takashi


    A 1.4 kb positive regulatory element (ETA(exp)) that controls staphylococcal exfoliative toxin A (sETA) transcription was cloned from Staphylococcus aureus. ETA(exp) is located upstream of the cloned 5.8 kb eta gene (etaJ1) obtained from the chomosomal DNA of S. aureus ZM, the standard ETA-producing strain. The cETA prepared from an Escherichia coli transformant into which the recombinant plasmid petaJ1 (5.8 kb eta/pUC9) had been introduced was expressed at high levels in the culture supernatant and the ammonium-sulfate-precipitated culture supernatant fraction as shown by immunoblotting and the single radial immunodiffusion test. However, cETA produced by the recombinant plasmid petaJ3 containing the 1.7 kb eta sequence (etaJ3) with a 1.45 kb ETA(exp)-deficient eta fragment (1.7 kb eta/pUC9) obtained from the 5.8 kb eta sequence by subcloning was not detected in either the culture supernatant or the ammonium-sulfate-precipitated culture supernatant fraction (167-fold concentrate of the culture supernatant) by immunoblotting or the single radial immunodiffusion test. A large amount of cETA was produced by the 1.7 kb eta sequence when it was linked to ETA(exp) amplified by PCR (1.7 kb eta-ETA(exp)/pUC9), regardless of the orientation of ETA(exp) insertion. Northern blot hybridization showed lower levels of the transcripts of the 1.7 kb eta sequence than of the 5.8 kb eta sequence. The rsETA prepared from an S. aureus transformant into which the recombinant plasmid 3.4 kb eta-ETA(exp)/pYT3 (pYT3-etaJ6) had been introduced was expressed at high levels in the culture supernatant fraction as shown by the latex agglutination test. However, the agglutination titre in the culture supernatant fraction of rsETA produced by the recombinant plasmid (1.7 kb eta/pYT3) containing the 1.7 kb eta sequence carrying the 1.4 kb ETA(exp)-deficient eta fragment (pYT3-etaJ3) was 2500-4000 times lower than that of pYT3-etaJ6.

  16. MicroRNA and Transcription Factor Gene Regulatory Network Analysis Reveals Key Regulatory Elements Associated with Prostate Cancer Progression

    PubMed Central

    Sadeghi, Mehdi; Ranjbar, Bijan; Ganjalikhany, Mohamad Reza; M. Khan, Faiz; Schmitz, Ulf; Wolkenhauer, Olaf; Gupta, Shailendra K.


    Technological and methodological advances in multi-omics data generation and integration approaches help elucidate genetic features of complex biological traits and diseases such as prostate cancer. Due to its heterogeneity, the identification of key functional components involved in the regulation and progression of prostate cancer is a methodological challenge. In this study, we identified key regulatory interactions responsible for primary to metastasis transitions in prostate cancer using network inference approaches by integrating patient derived transcriptomic and miRomics data into gene/miRNA/transcription factor regulatory networks. One such network was derived for each of the clinical states of prostate cancer based on differentially expressed and significantly correlated gene, miRNA and TF pairs from the patient data. We identified key elements of each network using a network analysis approach and validated our results using patient survival analysis. We observed that HOXD10, BCL2 and PGR are the most important factors affected in primary prostate samples, whereas, in the metastatic state, STAT3, JUN and JUNB are playing a central role. Benefiting integrative networks our analysis suggests that some of these molecules were targeted by several overexpressed miRNAs which may have a major effect on the dysregulation of these molecules. For example, in the metastatic tumors five miRNAs (miR-671-5p, miR-665, miR-663, miR-512-3p and miR-371-5p) are mainly responsible for the dysregulation of STAT3 and hence can provide an opportunity for early detection of metastasis and development of alternative therapeutic approaches. Our findings deliver new details on key functional components in prostate cancer progression and provide opportunities for the development of alternative therapeutic approaches. PMID:28005952

  17. Sterol Regulatory Element Binding Protein (Srb1) Is Required for Hypoxic Adaptation and Virulence in the Dimorphic Fungus Histoplasma capsulatum

    PubMed Central

    DuBois, Juwen C.; Smulian, A. George


    The Histoplasma capsulatum sterol regulatory element binding protein (SREBP), Srb1 is a member of the basic helix-loop-helix (bHLH), leucine zipper DNA binding protein family of transcription factors that possess a unique tyrosine (Y) residue instead of an arginine (R) residue in the bHLH region. We have determined that Srb1 message levels increase in a time dependent manner during growth under oxygen deprivation (hypoxia). To further understand the role of Srb1 during infection and hypoxia, we silenced the gene encoding Srb1 using RNA interference (RNAi); characterized the resulting phenotype, determined its response to hypoxia, and its ability to cause disease within an infected host. Silencing of Srb1 resulted in a strain of H. capsulatum that is incapable of surviving in vitro hypoxia. We found that without complete Srb1 expression, H. capsulatum is killed by murine macrophages and avirulent in mice given a lethal dose of yeasts. Additionally, silencing Srb1 inhibited the hypoxic upregulation of other known H. capsulatum hypoxia-responsive genes (HRG), and genes that encode ergosterol biosynthetic enzymes. Consistent with these regulatory functions, Srb1 silenced H. capsulatum cells were hypersensitive to the antifungal azole drug itraconazole. These data support the theory that the H. capsulatum SREBP is critical for hypoxic adaptation and is required for H. capsulatum virulence. PMID:27711233

  18. Negative regulatory elements upstream of a novel exon of the neuronal nicotinic acetylcholine receptor alpha 2 subunit gene.

    PubMed Central

    Bessis, A; Savatier, N; Devillers-Thiéry, A; Bejanin, S; Changeux, J P


    The expression of the nicotinic acetylcholine receptor alpha 2 subunit gene is highly restricted to the Spiriform lateralis nucleus of the Chick diencephalon. As a first step toward understanding the molecular mechanism underlying this regulation, we have investigated the structural and regulatory properties of the 5' sequence of this gene. A strategy based on the ligation of an oligonucleotide to the first strand of the cDNA (SLIC) followed by PCR amplification was used. A new exon was found approximately 3kb upstream from the first coding exon, and multiple transcription start sites of the gene were mapped. Analysis of the flanking region shows many consensus sequences for the binding of nuclear proteins, suggesting that the 1 kb flanking region contains at least a portion of the promoter of the gene. We have analysed the negative regulatory elements present within this region and found that a silencer region located between nucleotide -144 and +76 is active in fibroblasts as well as in neurons. This silencer is composed of six tandem repeat Oct-like motifs (CCCCATGCAAT), but does not bind any member of the Oct family. Moreover these motifs were found to act as a silencer only when they were tandemly repeated. When two, four or five motifs were deleted, the silencer activity of the motifs unexpectedly became an enhancer activity in all cells we have tested. Images PMID:8502560

  19. [Regulatory elements in the skin epithelium of Saccoglossus mereschkowskii (Enteropneusta, Hemichordata): electron microscopic and immunocytochemical study].


    Stoliarova, M V; Val'kovich, E I


    The aim of this investigation was to demonstrate the regulatory elements in the skin epithelium of Enteropneusta which are supposed to be related to the chordate ancestors. Using electron microscopy, it was found that in the skin epithelium of a representative of enteropneusts Saccoglossus mereschkowskii, the basal parts of some epitheliocytes took part in formation of a nerve layer. These cells were considered as receptor ciliated cells. The granular epithelial cells were shown to release secretion according to both exocrine and endocrine mechanism; these cells were characterized as endocrine-like regulatory cells. Fine granular cells possibly represent special receptor-endocrine-like cell type. The immunocytochemical detection of FMRFamid neuropeptide localization in histological sections confirmed the electron microscopic data on the presence of receptor and endocrine-like cells in the epithelium. It is suggested that the skin epithelium of Enteropneusta contains a peculiar neuro-endocrine regulatory system that is represented by receptor cells, receptor-endocrine-like cells of an open type and nerve elements of the nerve layer.

  20. Mobile DNA elements in T4 and related phages

    PubMed Central


    Mobile genetic elements are common inhabitants of virtually every genome where they can exert profound influences on genome structure and function in addition to promoting their own spread within and between genomes. Phage T4 and related phage have long served as a model system for understanding the molecular mechanisms by which a certain class of mobile DNA, homing endonucleases, promote their spread. Homing endonucleases are site-specific DNA endonucleases that initiate mobility by introducing double-strand breaks at defined positions in genomes lacking the endonuclease gene, stimulating repair and recombination pathways that mobilize the endonuclease coding region. In phage T4, homing endonucleases were first discovered as encoded within the self-splicing td, nrdB and nrdD introns of T4. Genomic data has revealed that homing endonucleases are extremely widespread in T-even-like phage, as evidenced by the astounding fact that ~11% of the T4 genome encodes homing endonuclease genes, with most of them located outside of self-splicing introns. Detailed studies of the mobile td intron and its encoded endonuclease, I-TevI, have laid the foundation for genetic, biochemical and structural aspects that regulate the mobility process, and more recently have provided insights into regulation of homing endonuclease function. Here, we summarize the current state of knowledge regarding T4-encoded homing endonucleases, with particular emphasis on the td/I-TevI model system. We also discuss recent progress in the biology of free-standing endonucleases, and present areas of future research for this fascinating class of mobile genetic elements. PMID:21029434

  1. The 3' untranslated region of human Cyclin-Dependent Kinase 5 Regulatory subunit 1 contains regulatory elements affecting transcript stability

    PubMed Central

    Moncini, Silvia; Bevilacqua, Annamaria; Venturin, Marco; Fallini, Claudia; Ratti, Antonia; Nicolin, Angelo; Riva, Paola


    Background CDK5R1 plays a central role in neuronal migration and differentiation during central nervous system development. CDK5R1 has been implicated in neurodegenerative disorders and proposed as a candidate gene for mental retardation. The remarkable size of CDK5R1 3'-untranslated region (3'-UTR) suggests a role in post-transcriptional regulation of CDK5R1 expression. Results The bioinformatic study shows a high conservation degree in mammals and predicts several AU-Rich Elements (AREs). The insertion of CDK5R1 3'-UTR into luciferase 3'-UTR causes a decreased luciferase activity in four transfected cell lines. We identified 3'-UTR subregions which tend to reduce the reporter gene expression, sometimes in a cell line-dependent manner. In most cases the quantitative analysis of luciferase mRNA suggests that CDK5R1 3'-UTR affects mRNA stability. A region, leading to a very strong mRNA destabilization, showed a significantly low half-life, indicating an accelerated mRNA degradation. The 3' end of the transcript, containing a class I ARE, specifically displays a stabilizing effect in neuroblastoma cell lines. We also observed the interaction of the stabilizing neuronal RNA-binding proteins ELAV with the CDK5R1 transcript in SH-SY5Y cells and identified three 3'-UTR sub-regions showing affinity for ELAV proteins. Conclusion Our findings evince the presence of both destabilizing and stabilizing regulatory elements in CDK5R1 3'-UTR and support the hypothesis that CDK5R1 gene expression is post-transcriptionally controlled in neurons by ELAV-mediated mechanisms. This is the first evidence of the involvement of 3'-UTR in the modulation of CDK5R1 expression. The fine tuning of CDK5R1 expression by 3'-UTR may have a role in central nervous system development and functioning, with potential implications in neurodegenerative and cognitive disorders. PMID:18053171

  2. The structure of the human peripherin gene (PRPH) and identification of potential regulatory elements

    SciTech Connect

    Foley, J.; Ley, C.A.; Parysek, L.M.


    The authors determined the complete nucleotide sequence of the coding region of the human peripherin gene (PRPH), as well as 742 bp 5{prime} to the cap site and 584 bp 3{prime} to the stop codon, and compared its structure and sequence to the rat and mouse genes. The overall structure of 9 exons separated by 8 introns is conserved among these three mammalian species. The nucleotide sequences of the human peripherin gene exons were 90% identical to the rat gene sequences, and the predicted human peripherin protein differed from rat peripherin at only 18 of 475 amino acid residues. Comparison of the 5{prime} flanking regions of the human peripherin gene and rodent genes revealed extensive areas of high homology. Additional conserved segments were found in introns 1 and 2. Within the 5{prime} region, potential regulatory sequences, including a nerve growth factor negative regulatory element, a Hox protein binding site, and a heat shock element, were identified in all peripherin genes. The positional conservation of each element suggests that they may be important in the tissue-specific, developmental-specific, and injury-specific expression of the peripherin gene. 24 refs., 2 figs., 1 tab.

  3. Distal cis-regulatory elements are required for tissue-specific expression of enamelin (Enam)

    PubMed Central

    Hu, Yuanyuan; Papagerakis, Petros; Ye, Ling; Feng, Jerry Q.; Simmer, James P.; Hu, Jan C-C.


    Enamel formation is orchestrated by the sequential expression of genes encoding enamel matrix proteins; however, the mechanisms sustaining the spatio–temporal order of gene transcription during amelogenesis are poorly understood. The aim of this study was to characterize the cis-regulatory sequences necessary for normal expression of enamelin (Enam). Several enamelin transcription regulatory regions, showing high sequence homology among species, were identified. DNA constructs containing 5.2 or 3.9 kb regions upstream of the enamelin translation initiation site were linked to a LacZ reporter and used to generate transgenic mice. Only the 5.2-Enam–LacZ construct was sufficient to recapitulate the endogenous pattern of enamelin tooth-specific expression. The 3.9-Enam–LacZ transgenic lines showed no expression in dental cells, but ectopic β-galactosidase activity was detected in osteoblasts. Potential transcription factor-binding sites were identified that may be important in controlling enamelin basal promoter activity and in conferring enamelin tissue-specific expression. Our study provides new insights into regulatory mechanisms governing enamelin expression. PMID:18353004

  4. In situ detection of a heat-shock regulatory element binding protein using a soluble synthetic enhancer sequence.

    PubMed Central

    Harel-Bellan, A; Brini, A T; Ferris, D K; Robin, P; Farrar, W L


    In various studies, enhancer binding proteins have been successfully absorbed out by competing sequences inserted into plasmids, resulting in the inhibition of the plasmid expression. Theoretically, such a result could be achieved using synthetic enhancer sequences not inserted into plasmids. In this study, a double stranded DNA sequence corresponding to the human heat shock regulatory element was chemically synthesized. By in vitro retardation assays, the synthetic sequence was shown to bind specifically a protein in extracts from the human T cell line Jurkat. When the synthetic enhancer was electroporated into Jurkat cells, not only the enhancer was shown to remain undegraded into the cells for up to 2 days, but also it was shown to bind intracellularly a protein. The binding was specific and was modulated upon heat shock. Furthermore, the binding protein was shown to be of the expected molecular weight by UV crosslinking. However, when the synthetic enhancer element was co-electroporated with an HSP 70-CAT reporter construct, the expression of the reporter plasmid was consistently enhanced in the presence of the exogenous synthetic enhancer. Images PMID:2740211

  5. Mobile DNA elements in the generation of diversity and complexity in the brain.


    Erwin, Jennifer A; Marchetto, Maria C; Gage, Fred H


    Mobile elements are DNA sequences that can change their position (retrotranspose) within the genome. Although its biological function is largely unappreciated, DNA derived from mobile elements comprises nearly half of the human genome. It has long been thought that neuronal genomes are invariable; however, recent studies have demonstrated that mobile elements actively retrotranspose during neurogenesis, thereby creating genomic diversity between neurons. In addition, mounting data demonstrate that mobile elements are misregulated in certain neurological disorders, including Rett syndrome and schizophrenia.

  6. Mobile DNA elements in the generation of diversity and complexity in the brain

    PubMed Central

    Erwin, Jennifer A.; Marchetto, Maria C.; Gage, Fred H.


    Mobile elements are DNA sequences that can change their position (retrotranspose) within the genome. Although its biological function is largely unappreciated, DNA derived from mobile elements comprises nearly half of the human genome. It has long been thought that neuronal genomes are invariable; however, recent studies have demonstrated that mobile elements actively retrotranspose during neurogenesis, thereby creating genomic diversity between neurons. In addition, mounting data demonstrate that mobile elements are misregulated in certain neurological disorders, including Rett syndrome and schizophrenia. PMID:25005482

  7. Who owns Australia's water--elements of an effective regulatory model.


    McKay, J


    This paper identifies and describes a number of global trends in regulatory theory and legal scholarship. It points out the huge level of complexity demanded by globalisation and the unfortunate complication of this is that there is legal indeterminacy. The legal indeterminacy springs from the desire to amend and alter existing models. That has been the thrust of the Council of Australian Governments changes to adapt and add huge amounts of complexity to a flawed system. This paper argues that an effective water regulatory model requires a fundamental re-examination of the concept of water ownership and a capturing by the State of the right to allocate rainfall. This foundation is effective and the way forward to deal with the key issues in this transition phase. The second key element to an effective regulatory model is the concept of performance-based assessment. This requires information and schemes to be set up to work out ways to monitor and evaluate the performance of the utility on selected criteria. For Australia at present there is a dire lack of agreed criteria on these key issues and these have the potential to pull apart the whole process. The key issues are indigenous rights, governance issues, public participation, alteration of pre-existing rights and incorporation of environmental requirements.

  8. DNA preservation in skeletal elements from the World Trade Center disaster: recommendations for mass fatality management.


    Mundorff, Amy Z; Bartelink, Eric J; Mar-Cash, Elaine


    The World Trade Center (WTC) victim identification effort highlights taphonomic influences on the degradation of DNA from victims of mass fatality incidents. This study uses a subset of the WTC-Human Remains Database to evaluate differential preservation of DNA by skeletal element. Recovery location, sex, and victim type (civilian, firefighter, or plane passenger) do not appear to influence DNA preservation. Results indicate that more intact elements, as well as elements encased in soft tissue, produced slightly higher identification rates than more fragmented remains. DNA identification rates by element type conform to previous findings, with higher rates generally found in denser, weight-bearing bones. However, smaller bones including patellae, metatarsals, and foot phalanges yielded rates comparable to both femora and tibiae. These elements can be easily sampled with a disposable scalpel, and thus reduce potential DNA contamination. These findings have implications for DNA sampling guidelines in future mass fatality incidents.

  9. A Structural Basis for the Regulatory Inactivation of DnaA

    PubMed Central

    Xu, Qingping; McMullan, Daniel; Abdubek, Polat; Astakhova, Tamara; Carlton, Dennis; Chen, Connie; Chiu, Hsiu-Ju; Clayton, Thomas; Das, Debanu; Deller, Marc C.; Duan, Lian; Elsliger, Marc-Andre; Feuerhelm, Julie; Hale, Joanna; Han, Gye Won; Jaroszewski, Lukasz; Jin, Kevin K.; Johnson, Hope A.; Klock, Heath E.; Knuth, Mark W.; Kozbial, Piotr; Krishna, S. Sri; Kumar, Abhinav; Marciano, David; Miller, Mitchell D.; Morse, Andrew T.; Nigoghossian, Edward; Nopakun, Amanda; Okach, Linda; Oommachen, Silvya; Paulsen, Jessica; Puckett, Christina; Reyes, Ron; Rife, Christopher L.; Sefcovic, Natasha; Trame, Christine; van den Bedem, Henry; Weekes, Dana; Hodgson, Keith O.; Wooley, John; Deacon, Ashley M.; Godzik, Adam; Lesley, Scott A.; Wilson, Ian A.


    Summary Regulatory inactivation of DnaA is dependent on Hda, a protein homologous to the AAA+ ATPase region of the replication initiator DnaA. When bound to the sliding clamp loaded onto duplex DNA, Hda can stimulate the transformation of active DnaA-ATP into inactive DnaA-ADP. The crystal structure of Hda from Shewanella amazonensis SB2B at 1.75 Å resolution reveals that Hda resembles typical AAA+ ATPases. The arrangement of the two subdomains in Hda (residues 1-174, 175-241) differs dramatically from that of DnaA. A CDP molecule anchors the Hda domains in a conformation which promotes dimer formation. The Hda dimer adopts a novel oligomeric assembly for AAA+ proteins in which the arginine finger, crucial for ATP hydrolysis, is fully exposed and available to hydrolyze DnaA-ATP through a typical AAA+ type mechanism. The sliding clamp binding motifs at the N-terminus of each Hda monomer are partially buried and combine to form an antiparallel β-sheet at the dimer interface. The inaccessibility of the clamp binding motifs in the CDP bound structure of Hda suggests that conformational changes are required for Hda to form a functional complex with the clamp. Thus, the CDP-bound Hda dimer likely represents an inactive form of Hda. PMID:19000695

  10. Variation in sequence and organization of splicing regulatory elements in vertebrate genes

    PubMed Central

    Yeo, Gene; Hoon, Shawn; Venkatesh, Byrappa; Burge, Christopher B.


    Although core mechanisms and machinery of premRNA splicing are conserved from yeast to human, the details of intron recognition often differ, even between closely related organisms. For example, genes from the pufferfish Fugu rubripes generally contain one or more introns that are not properly spliced in mouse cells. Exploiting available genome sequence data, a battery of sequence analysis techniques was used to reach several conclusions about the organization and evolution of splicing regulatory elements in vertebrate genes. The classical splice site and putative branch site signals are completely conserved across the vertebrates studied (human, mouse, pufferfish, and zebrafish), and exonic splicing enhancers also appear broadly conserved in vertebrates. However, another class of splicing regulatory elements, the intronic splicing enhancers, appears to differ substantially between mammals and fish, with G triples (GGG) very abundant in mammalian introns but comparatively rare in fish. Conversely, short repeats of AC and GT are predicted to function as intronic splicing enhancers in fish but are not enriched in mammalian introns. Consistent with this pattern, exonic splicing enhancer-binding SR proteins are highly conserved across all vertebrates, whereas heterogeneous nuclear ribonucleoproteins, which bind many intronic sequences, vary in domain structure and even presence/absence between mammals and fish. Exploiting differences in intronic sequence composition, a statistical model was developed to predict the splicing phenotype of Fugu introns in mammalian systems and was used to engineer the spliceability of a Fugu intron in human cells by insertion of specific sequences, thereby rescuing splicing in human cells. PMID:15505203

  11. Structure of Proximal and Distant Regulatory Elements in the Human Genome

    NASA Astrophysics Data System (ADS)

    Ovcharenko, Ivan

    Clustering of multiple transcription factor binding sites (TFBSs) for the same transcription factor (TF) is a common feature of cis-regulatory modules in invertebrate animals, but the occurrence of such homotypic clusters of TFBSs (HCTs) in the human genome has remained largely unknown. To explore whether HCTs are also common in human and other vertebrates, we used known binding motifs for vertebrate TFs and a hidden Markov model-based approach to detect HCTs in the human, mouse, chicken, and fugu genomes, and examined their association with cis-regulatory modules. We found that evolutionarily conserved HCTs occupy nearly 2% of the human genome, with experimental evidence for individual TFs supporting their binding to predicted HCTs. More than half of promoters of human genes contain HCTs, with a distribution around the transcription start site in agreement with the experimental data from the ENCODE project. In addition, almost half of 487 experimentally validated developmental enhancers contain them as well - a number more than 25-fold larger than expected by chance. We also found evidence of negative selection acting on TFBSs within HCTs, as the conservation of TFBSs is stronger than the conservation of sequences separating them. The important role of HCTs as components of developmental enhancers is additionally supported by a strong correlation between HCTs and the binding of the enhancer-associated co-activator protein p300. Experimental validation of HCT-containing elements in both zebrafish and mouse suggest that HCTs could be used to predict both the presence of enhancers and their tissue specificity, and are thus a feature that can be effectively used in deciphering the gene regulatory code. In conclusion, our results indicate that HCTs are a pervasive feature of human cis-regulatory modules and suggest that they play an important role in gene regulation in the human and other vertebrate genomes.

  12. Deciphering Cis-Regulatory Element Mediated Combinatorial Regulation in Rice under Blast Infected Condition

    PubMed Central

    Deb, Arindam; Kundu, Sudip


    Combinations of cis-regulatory elements (CREs) present at the promoters facilitate the binding of several transcription factors (TFs), thereby altering the consequent gene expressions. Due to the eminent complexity of the regulatory mechanism, the combinatorics of CRE-mediated transcriptional regulation has been elusive. In this work, we have developed a new methodology that quantifies the co-occurrence tendencies of CREs present in a set of promoter sequences; these co-occurrence scores are filtered in three consecutive steps to test their statistical significance; and the significantly co-occurring CRE pairs are presented as networks. These networks of co-occurring CREs are further transformed to derive higher order of regulatory combinatorics. We have further applied this methodology on the differentially up-regulated gene-sets of rice tissues under fungal (Magnaporthe) infected conditions to demonstrate how it helps to understand the CRE-mediated combinatorial gene regulation. Our analysis includes a wide spectrum of biologically important results. The CRE pairs having a strong tendency to co-occur often exhibit very similar joint distribution patterns at the promoters of rice. We couple the network approach with experimental results of plant gene regulation and defense mechanisms and find evidences of auto and cross regulation among TF families, cross-talk among multiple hormone signaling pathways, similarities and dissimilarities in regulatory combinatorics between different tissues, etc. Our analyses have pointed a highly distributed nature of the combinatorial gene regulation facilitating an efficient alteration in response to fungal attack. All together, our proposed methodology could be an important approach in understanding the combinatorial gene regulation. It can be further applied to unravel the tissue and/or condition specific combinatorial gene regulation in other eukaryotic systems with the availability of annotated genomic sequences and suitable

  13. Positive and negative regulatory elements mediating transcription from the Drosophila melanogaster actin 5C distal promoter.

    PubMed Central

    Chung, Y T; Keller, E B


    The major cytoskeletal actin gene of Drosophila melanogaster, the actin 5C gene, has two promoters, the distal one of which controls synthesis of actin in a tissue- and developmental stage-specific manner. This very strong promoter has widely been used for expression of heterologous genes in cultured cells. To locate functional regulatory elements in this distal promoter, mutants of the promoter were fused to the bacterial chloramphenicol acetyltransferase gene and assayed for transient expression activity in cultured Drosophila embryonic Schneider line 2 cells. The results showed that the upstream end of the promoter extends to 522 bp from the transcription start site. In addition, there are two remote activating regions about 2 kb upstream. Between -522 and -379 are two regions that exert a strong negative effect. Downstream from these negative regions are at least six positive regions and a TATA element. The strongest positive determinant of the promoter was identified at -320 as AAAATGTG by footprinting and by a replacement experiment. When the relevant region was replaced by a synthetic sequence containing this element in a random context, the transient expression activity was restored. The sequence TGTATG located at -355 was also identified as a positive element by a similar replacement approach. Apparently the very high activity of this promoter is the result of the combined activities of multiple factors. Images PMID:2123290

  14. Mapping of Variable DNA Methylation Across Multiple Cell Types Defines a Dynamic Regulatory Landscape of the Human Genome

    PubMed Central

    Gu, Junchen; Stevens, Michael; Xing, Xiaoyun; Li, Daofeng; Zhang, Bo; Payton, Jacqueline E.; Oltz, Eugene M.; Jarvis, James N.; Jiang, Kaiyu; Cicero, Theodore; Costello, Joseph F.; Wang, Ting


    DNA methylation is an important epigenetic modification involved in many biological processes and diseases. Many studies have mapped DNA methylation changes associated with embryogenesis, cell differentiation, and cancer at a genome-wide scale. Our understanding of genome-wide DNA methylation changes in a developmental or disease-related context has been steadily growing. However, the investigation of which CpGs are variably methylated in different normal cell or tissue types is still limited. Here, we present an in-depth analysis of 54 single-CpG-resolution DNA methylomes of normal human cell types by integrating high-throughput sequencing-based methylation data. We found that the ratio of methylated to unmethylated CpGs is relatively constant regardless of cell type. However, which CpGs made up the unmethylated complement was cell-type specific. We categorized the 26,000,000 human autosomal CpGs based on their methylation levels across multiple cell types to identify variably methylated CpGs and found that 22.6% exhibited variable DNA methylation. These variably methylated CpGs formed 660,000 variably methylated regions (VMRs), encompassing 11% of the genome. By integrating a multitude of genomic data, we found that VMRs enrich for histone modifications indicative of enhancers, suggesting their role as regulatory elements marking cell type specificity. VMRs enriched for transcription factor binding sites in a tissue-dependent manner. Importantly, they enriched for GWAS variants, suggesting that VMRs could potentially be implicated in disease and complex traits. Taken together, our results highlight the link between CpG methylation variation, genetic variation, and disease risk for many human cell types. PMID:26888867

  15. Structural characterization and regulatory element analysis of the heart isoform of cytochrome c oxidase VIa

    NASA Technical Reports Server (NTRS)

    Wan, B.; Moreadith, R. W.; Blomqvist, C. G. (Principal Investigator)


    In order to investigate the mechanism(s) governing the striated muscle-specific expression of cytochrome c oxidase VIaH we have characterized the murine gene and analyzed its transcriptional regulatory elements in skeletal myogenic cell lines. The gene is single copy, spans 689 base pairs (bp), and is comprised of three exons. The 5'-ends of transcripts from the gene are heterogeneous, but the most abundant transcript includes a 5'-untranslated region of 30 nucleotides. When fused to the luciferase reporter gene, the 3.5-kilobase 5'-flanking region of the gene directed the expression of the heterologous protein selectively in differentiated Sol8 cells and transgenic mice, recapitulating the pattern of expression of the endogenous gene. Deletion analysis identified a 300-bp fragment sufficient to direct the myotube-specific expression of luciferase in Sol8 cells. The region lacks an apparent TATA element, and sequence motifs predicted to bind NRF-1, NRF-2, ox-box, or PPAR factors known to regulate other nuclear genes encoding mitochondrial proteins are not evident. Mutational analysis, however, identified two cis-elements necessary for the high level expression of the reporter protein: a MEF2 consensus element at -90 to -81 bp and an E-box element at -147 to -142 bp. Additional E-box motifs at closely located positions were mutated without loss of transcriptional activity. The dependence of transcriptional activation of cytochrome c oxidase VIaH on cis-elements similar to those found in contractile protein genes suggests that the striated muscle-specific expression is coregulated by mechanisms that control the lineage-specific expression of several contractile and cytosolic proteins.

  16. Movable Genetic Elements: Detection of Changes in Maize DNA at the Shrunken Locus Due to the Intervention of Ds Elements

    DOE R&D Accomplishments Database

    Burr, B.; Burr, F.A.


    This report describes our initial attempts at the molecular characterization of a maize controlling element. We have prepared a cDNA probe and used it to detect changes at a locus where Ds elements are found. Evidence of their presence are indicated by changes in the restriction patterns, but there is as yet no information on the physical nature of the controlling elements nor on the kinds of rearrangements they cause.

  17. Movable genetic elements: detection of changes in maize DNA at the Shrunken locus due to the intervention of Ds elements

    SciTech Connect

    Burr, B.; Burr, F.A.


    This report describes our initial attempts at the molecular characterization of a maize controlling element. We have prepared a cDNA probe and used it to detect changes at a locus where Ds elements are found. Evidence of their presence are indicated by changes in the restriction patterns, but there is as yet no information on the physical nature of the controlling elements nor on the kinds of rearrangements they cause.

  18. Specific interactions between DNA and regulatory protein controlled by ligand-binding: Ab initio molecular simulation

    NASA Astrophysics Data System (ADS)

    Matsushita, Y.; Murakawa, T.; Shimamura, K.; Oishi, M.; Ohyama, T.; Kurita, N.


    The catabolite activator protein (CAP) is one of the regulatory proteins controlling the transcription mechanism of gene. Biochemical experiments elucidated that the complex of CAP with cyclic AMP (cAMP) is indispensable for controlling the mechanism, while previous molecular simulations for the monomer of CAP+cAMP complex revealed the specific interactions between CAP and cAMP. However, the effect of cAMP-binding to CAP on the specific interactions between CAP and DNA is not elucidated at atomic and electronic levels. We here considered the ternary complex of CAP, cAMP and DNA in solvating water molecules and investigated the specific interactions between them at atomic and electronic levels using ab initio molecular simulations based on classical molecular dynamics and ab initio fragment molecular orbital methods. The results highlight the important amino acid residues of CAP for the interactions between CAP and cAMP and between CAP and DNA.

  19. Specific interactions between DNA and regulatory protein controlled by ligand-binding: Ab initio molecular simulation

    SciTech Connect

    Matsushita, Y. Murakawa, T. Shimamura, K. Oishi, M. Ohyama, T. Kurita, N.


    The catabolite activator protein (CAP) is one of the regulatory proteins controlling the transcription mechanism of gene. Biochemical experiments elucidated that the complex of CAP with cyclic AMP (cAMP) is indispensable for controlling the mechanism, while previous molecular simulations for the monomer of CAP+cAMP complex revealed the specific interactions between CAP and cAMP. However, the effect of cAMP-binding to CAP on the specific interactions between CAP and DNA is not elucidated at atomic and electronic levels. We here considered the ternary complex of CAP, cAMP and DNA in solvating water molecules and investigated the specific interactions between them at atomic and electronic levels using ab initio molecular simulations based on classical molecular dynamics and ab initio fragment molecular orbital methods. The results highlight the important amino acid residues of CAP for the interactions between CAP and cAMP and between CAP and DNA.

  20. Identification of two regulatory elements controlling Fucosyltransferase 7 transcription in murine CD4+ T cells.


    Pink, Matthias; Ratsch, Boris A; Mardahl, Maibritt; Schröter, Micha F; Engelbert, Dirk; Triebus, Julia; Hamann, Alf; Syrbe, Uta


    Fucosyltransferase VII encoded by the gene Fut7 is essential in CD4(+) T cells for the generation of E- and P-selectin ligands (E- and P-lig) which facilitate recruitment of lymphocytes into inflamed tissues and into the skin. This study aimed to identify regulatory elements controlling the inducible Fut7 expression in CD4(+) T cells that occurs upon activation and differentiation of naive T cells into effector cells. Comparative analysis of the histone modification pattern in non-hematopoetic cells and CD4(+) T cell subsets revealed a differential histone modification pattern within the Fut7 locus including a conserved non-coding sequence (CNS) identified by cross-species conservation comparison suggesting that regulatory elements are confined to this region. Cloning of the CNS located about 500 bp upstream of the Fut7 locus, into a luciferase reporter vector elicited reporter activity after transfection of the αβ-WT T cell line, but not after transfection of primary murine CD4(+) Th1 cells. As quantification of different Fut7 transcripts revealed a predominance of transcripts lacking the first exons in primary Th1 cells we searched for an alternative promoter. Cloning of an intragenic region spanning a 1kb region upstream of exon 4 into an enhancer-containing vector indeed elicited promoter activity. Interestingly, also the CNS enhanced activity of this intragenic minimal promoter in reporter assays in primary Th1 cells suggesting that both elements interact in primary CD4(+) T cells to induce Fut7 transcription.

  1. Genome-Wide Identification of Regulatory Elements and Reconstruction of Gene Regulatory Networks of the Green Alga Chlamydomonas reinhardtii under Carbon Deprivation

    PubMed Central

    Vischi Winck, Flavia; Arvidsson, Samuel; Riaño-Pachón, Diego Mauricio; Hempel, Sabrina; Koseska, Aneta; Nikoloski, Zoran; Urbina Gomez, David Alejandro; Rupprecht, Jens; Mueller-Roeber, Bernd


    The unicellular green alga Chlamydomonas reinhardtii is a long-established model organism for studies on photosynthesis and carbon metabolism-related physiology. Under conditions of air-level carbon dioxide concentration [CO2], a carbon concentrating mechanism (CCM) is induced to facilitate cellular carbon uptake. CCM increases the availability of carbon dioxide at the site of cellular carbon fixation. To improve our understanding of the transcriptional control of the CCM, we employed FAIRE-seq (formaldehyde-assisted Isolation of Regulatory Elements, followed by deep sequencing) to determine nucleosome-depleted chromatin regions of algal cells subjected to carbon deprivation. Our FAIRE data recapitulated the positions of known regulatory elements in the promoter of the periplasmic carbonic anhydrase (Cah1) gene, which is upregulated during CCM induction, and revealed new candidate regulatory elements at a genome-wide scale. In addition, time series expression patterns of 130 transcription factor (TF) and transcription regulator (TR) genes were obtained for cells cultured under photoautotrophic condition and subjected to a shift from high to low [CO2]. Groups of co-expressed genes were identified and a putative directed gene-regulatory network underlying the CCM was reconstructed from the gene expression data using the recently developed IOTA (inner composition alignment) method. Among the candidate regulatory genes, two members of the MYB-related TF family, Lcr1 (Low-CO2 response regulator 1) and Lcr2 (Low-CO2 response regulator 2), may play an important role in down-regulating the expression of a particular set of TF and TR genes in response to low [CO2]. The results obtained provide new insights into the transcriptional control of the CCM and revealed more than 60 new candidate regulatory genes. Deep sequencing of nucleosome-depleted genomic regions indicated the presence of new, previously unknown regulatory elements in the C. reinhardtii genome. Our work can

  2. Small RNAs, DNA methylation and transposable elements in wheat

    PubMed Central


    Background More than 80% of the wheat genome is composed of transposable elements (TEs). Since active TEs can move to different locations and potentially impose a significant mutational load, their expression is suppressed in the genome via small non-coding RNAs (sRNAs). sRNAs guide silencing of TEs at the transcriptional (mainly 24-nt sRNAs) and post-transcriptional (mainly 21-nt sRNAs) levels. In this study, we report the distribution of these two types of sRNAs among the different classes of wheat TEs, the regions targeted within the TEs, and their impact on the methylation patterns of the targeted regions. Results We constructed an sRNA library from hexaploid wheat and developed a database that included our library and three other publicly available sRNA libraries from wheat. For five completely-sequenced wheat BAC contigs, most perfectly matching sRNAs represented TE sequences, suggesting that a large fraction of the wheat sRNAs originated from TEs. An analysis of all wheat TEs present in the Triticeae Repeat Sequence database showed that sRNA abundance was correlated with the estimated number of TEs within each class. Most of the sRNAs perfectly matching miniature inverted repeat transposable elements (MITEs) belonged to the 21-nt class and were mainly targeted to the terminal inverted repeats (TIRs). In contrast, most of the sRNAs matching class I and class II TEs belonged to the 24-nt class and were mainly targeted to the long terminal repeats (LTRs) in the class I TEs and to the terminal repeats in CACTA transposons. An analysis of the mutation frequency in potentially methylated sites revealed a three-fold increase in TE mutation frequency relative to intron and untranslated genic regions. This increase is consistent with wheat TEs being preferentially methylated, likely by sRNA targeting. Conclusions Our study examines the wheat epigenome in relation to known TEs. sRNA-directed transcriptional and post-transcriptional silencing plays important roles in

  3. A conserved RNA structural element within the hepatitis B virus post-transcriptional regulatory element enhance nuclear export of intronless transcripts and repress the splicing mechanism.


    Visootsat, Akasit; Payungporn, Sunchai; T-Thienprasert, Nattanan P


    Hepatitis B virus (HBV) infection is a primary cause of hepatocellular carcinoma and liver cirrhosis worldwide. To develop novel antiviral drugs, a better understanding of HBV gene expression regulation is vital. One important aspect is to understand how HBV hijacks the cellular machinery to export unspliced RNA from the nucleus. The HBV post-transcriptional regulatory element (HBV PRE) has been proposed to be the HBV RNA nuclear export element. However, the function remains controversial, and the core element is unclear. This study, therefore, aimed to identify functional regulatory elements within the HBV PRE and investigate their functions. Using bioinformatics programs based on sequence conservation and conserved RNA secondary structures, three regulatory elements were predicted, namely PRE 1151-1410, PRE 1520-1620 and PRE 1650-1684. PRE 1151-1410 significantly increased intronless and unspliced luciferase activity in both HepG2 and COS-7 cells. Likewise, PRE 1151-1410 significantly elevated intronless and unspliced HBV surface transcripts in liver cancer cells. Moreover, motif analysis predicted that PRE 1151-1410 contains several regulatory motifs. This study reported the roles of PRE 1151-1410 in intronless transcript nuclear export and the splicing mechanism. Additionally, these results provide knowledge in the field of HBV RNA regulation. Moreover, PRE 1151-1410 may be used to enhance the expression of other mRNAs in intronless reporter plasmids.

  4. Dissection of Regulatory Elements During Direct Conversion of Somatic Cells into Neurons.


    Soleimani, Tahereh; Falsafi, Nafiseh; Fallahi, Hossein


    A revolutionary approach that involves direct conversion of somatic cells into almost any other types of cells showed promising results for regenerative medicine. Currently, producing valuable cell types including neurons, cardiomyocytes and hepatocytes through direct conversion of somatic cells appear to be a feasible option for regenerative medicine. The process involves inducing the cells by chemical cocktails or by expression of different types of transcription factors. In this concept, in vitro neurogenesis considered to be able to produce neuron cells to replace damaged neurons especially in Alzheimer and Parkinson disease. However, early successful experiments followed by major drawbacks such as low differentiation efficiency in producing neurons and detection of various undesirable types of cells in the culture. Therefore, there is not a single optimized common protocol for producing high quality neurons in vitro so far. This is partly due to the lack of our understanding about the precise cellular, genetic, and molecular mechanisms underlying neurogenesis via direct conversion. In the current work, we have employed meta-analysis tools and extensive gene regulatory network analysis on the high through put gene expression data obtained from previous reprogramming protocols to identify central gene regulatory components involved in direct conversion of fibroblasts into neurons. Our results identified miR-9, miR-30 as the most important miRNA and TP53, MYC, JUN, SP1 and SMAD2 considered to be the most important transcription factors. These findings would be useful for direct targeting these hub regulatory elements in order to increase the efficacy and specificity of the conversion protocols. This article is protected by copyright. All rights reserved.

  5. Pitx1 Broadly Associates with Limb Enhancers and is Enriched on Hindlimb cis-Regulatory Elements

    PubMed Central

    Infante, Carlos R.; Park, Sungdae; Mihala, Alexandra; Kingsley, David M.; Menke, Douglas B.


    Extensive functional analyses have demonstrated that the pituitary homeodomain transcription factor Pitx1 plays a critical role in specifying hindlimb morphology in vertebrates. However, much less is known regarding the target genes and cis-regulatory elements through which Pitx1 acts. Earlier studies suggested that the hindlimb transcription factors Tbx4, HoxC10, and HoxC11 might be transcriptional targets of Pitx1, but definitive evidence for direct regulatory interactions has been lacking. Using ChIP-Seq on embryonic mouse hindlimbs, we have pinpointed the genome-wide location of Pitx1 binding sites during mouse hindlimb development and identified potential gene targets for Pitx1. We determined that Pitx1 binding is significantly enriched near genes involved in limb morphogenesis, including Tbx4, HoxC10, and HoxC11. Notably, Pitx1 is bound to the previously identified HLEA and HLEB hindlimb enhancers of the Tbx4 gene and to a newly identified Tbx2 hindlimb enhancer. Moreover, Pitx1 binding is significantly enriched on hindlimb relative to forelimb-specific cis-regulatory features that are differentially marked by H3K27ac. However, our analysis revealed that Pitx1 also strongly associates with many functionally verified limb enhancers that exhibit similar levels of activity in the embryonic mesenchyme of forelimbs and hindlimbs. We speculate that Pitx1 influences hindlimb morphology both through the activation of hindlimb specific enhancers as well as through the hindlimb-specific modulation of enhancers that are active in both sets of limbs. PMID:23201014

  6. The identification of hematopoietic-specific regulatory elements for WASp gene expression

    PubMed Central

    Zhan, Jun; Johnson, Irudayam Maria; Wielgosz, Matthew; Nienhuis, Arthur W


    Chromosome Conformation Capture (3C) technology was used to identify physical interactions between the proximal Wiskott-Aldrich Syndrome protein (WASp) promoter and its distant DNA segments in Jurkat-T cells. We found that two hematopoietic specific DNase I hypersensitive (DHS) sites (proximal DHS-A, and distal DHS-B) which had high interaction frequencies with the proximal WASp promoter indicating potential regulatory activity for these DHS sites. Subsequently, we cloned several DNA fragments around the proximal DHS-A site into a luciferase reporter vector. Interestingly, no fragments showed enhancer activity, but two fragments exhibited strong silencing activity in Jurkat-T cells. After aligning the chromatin state profiling for hematopoietic and nonhematopoietic cells using the human genome browser (UCSC), we found a 5 kb putative hematopoietic specific enhancer region located 250 kb downstream of the WAS gene. This putative enhancer region contains two hematopoietic cell specific DHS sites. Subsequently, the hematopoietic specific DHS sites enhanced luciferase expression from the proximal WASp promoter in all hematopoietic cells we tested. Finally, using a lentiviral vector stable expression system, the hematopoietic specific-enhancer(s) increased GFP reporter gene expression in hematopoietic cells, and increased WASp gene expression in WASp deficient cells. This enhancer may have the potential to be used in gene therapy for hematological diseases. PMID:28035317

  7. Evolution of DNA-Binding Sites of a Floral Master Regulatory Transcription Factor

    PubMed Central

    Muiño, Jose M.; de Bruijn, Suzanne; Pajoro, Alice; Geuten, Koen; Vingron, Martin; Angenent, Gerco C.; Kaufmann, Kerstin


    Flower development is controlled by the action of key regulatory transcription factors of the MADS-domain family. The function of these factors appears to be highly conserved among species based on mutant phenotypes. However, the conservation of their downstream processes is much less well understood, mostly because the evolutionary turnover and variation of their DNA-binding sites (BSs) among plant species have not yet been experimentally determined. Here, we performed comparative ChIP (chromatin immunoprecipitation)-seq experiments of the MADS-domain transcription factor SEPALLATA3 (SEP3) in two closely related Arabidopsis species: Arabidopsis thaliana and A. lyrata which have very similar floral organ morphology. We found that BS conservation is associated with DNA sequence conservation, the presence of the CArG-box BS motif and on the relative position of the BS to its potential target gene. Differences in genome size and structure can explain that SEP3 BSs in A. lyrata can be located more distantly to their potential target genes than their counterparts in A. thaliana. In A. lyrata, we identified transposition as a mechanism to generate novel SEP3 binding locations in the genome. Comparative gene expression analysis shows that the loss/gain of BSs is associated with a change in gene expression. In summary, this study investigates the evolutionary dynamics of DNA BSs of a floral key-regulatory transcription factor and explores factors affecting this phenomenon. PMID:26429922

  8. Functional characterisation of cis-regulatory elements governing dynamic Eomes expression in the early mouse embryo.


    Simon, Claire S; Downes, Damien J; Gosden, Matthew E; Telenius, Jelena; Higgs, Douglas R; Hughes, Jim R; Costello, Ita; Bikoff, Elizabeth K; Robertson, Elizabeth J


    The T-box transcription factor (TF) Eomes is a key regulator of cell fate decisions during early mouse development. The cis-acting regulatory elements that direct expression in the anterior visceral endoderm (AVE), primitive streak (PS) and definitive endoderm (DE) have yet to be defined. Here, we identified three gene-proximal enhancer-like sequences (PSE_a, PSE_b and VPE) that faithfully activate tissue specific expression in transgenic embryos. However, targeted deletion experiments demonstrate that PSE_a and PSE_b are dispensable and only the VPE is required for optimal Eomes expression in vivo Embryos lacking this enhancer display variably penetrant defects in anterior-posterior axis orientation and DE formation. Chromosome conformation capture experiments reveal VPE-promoter interactions embryonic stem cells (ESC), prior to gene activation. The locus resides in a large (500kb) pre-formed compartment in ESC and activation during DE differentiation occurs in the absence of 3D structural changes. ATAC-seq analysis reveals that VPE, PSE_a, and four additional putative enhancers display increased chromatin accessibility in DE associated with Smad2/3 binding coincident with transcriptional activation. In contrast, activation of the Eomes target genes Foxa2 and Lhx1 is associated with higher order chromatin reorganisation. Thus diverse regulatory mechanisms govern activation of lineage specifying TFs during early development.

  9. The Interplay of cis-Regulatory Elements Rules Circadian Rhythms in Mouse Liver

    PubMed Central

    Korenčič, Anja; Bordyugov, Grigory; Košir, Rok; Rozman, Damjana; Goličnik, Marko; Herzel, Hanspeter


    The mammalian circadian clock is driven by cell-autonomous transcriptional feedback loops that involve E-boxes, D-boxes, and ROR-elements. In peripheral organs, circadian rhythms are additionally affected by systemic factors. We show that intrinsic combinatorial gene regulation governs the liver clock. With a temporal resolution of 2 h, we measured the expression of 21 clock genes in mouse liver under constant darkness and equinoctial light-dark cycles. Based on these data and known transcription factor binding sites, we develop a six-variable gene regulatory network. The transcriptional feedback loops are represented by equations with time-delayed variables, which substantially simplifies modelling of intermediate protein dynamics. Our model accurately reproduces measured phases, amplitudes, and waveforms of clock genes. Analysis of the network reveals properties of the clock: overcritical delays generate oscillations; synergy of inhibition and activation enhances amplitudes; and combinatorial modulation of transcription controls the phases. The agreement of measurements and simulations suggests that the intrinsic gene regulatory network primarily determines the circadian clock in liver, whereas systemic cues such as light-dark cycles serve to fine-tune the rhythms. PMID:23144788

  10. A mathematical model of the sterol regulatory element binding protein 2 cholesterol biosynthesis pathway.


    Bhattacharya, Bonhi S; Sweby, Peter K; Minihane, Anne-Marie; Jackson, Kim G; Tindall, Marcus J


    Cholesterol is one of the key constituents for maintaining the cellular membrane and thus the integrity of the cell itself. In contrast high levels of cholesterol in the blood are known to be a major risk factor in the development of cardiovascular disease. We formulate a deterministic nonlinear ordinary differential equation model of the sterol regulatory element binding protein 2 (SREBP-2) cholesterol genetic regulatory pathway in a hepatocyte. The mathematical model includes a description of genetic transcription by SREBP-2 which is subsequently translated to mRNA leading to the formation of 3-hydroxy-3-methylglutaryl coenzyme A reductase (HMGCR), a main regulator of cholesterol synthesis. Cholesterol synthesis subsequently leads to the regulation of SREBP-2 via a negative feedback formulation. Parameterised with data from the literature, the model is used to understand how SREBP-2 transcription and regulation affects cellular cholesterol concentration. Model stability analysis shows that the only positive steady-state of the system exhibits purely oscillatory, damped oscillatory or monotic behaviour under certain parameter conditions. In light of our findings we postulate how cholesterol homeostasis is maintained within the cell and the advantages of our model formulation are discussed with respect to other models of genetic regulation within the literature.

  11. Functionally conserved cis-regulatory elements of COL18A1 identified through zebrafish transgenesis.


    Kague, Erika; Bessling, Seneca L; Lee, Josephine; Hu, Gui; Passos-Bueno, Maria Rita; Fisher, Shannon


    Type XVIII collagen is a component of basement membranes, and expressed prominently in the eye, blood vessels, liver, and the central nervous system. Homozygous mutations in COL18A1 lead to Knobloch Syndrome, characterized by ocular defects and occipital encephalocele. However, relatively little has been described on the role of type XVIII collagen in development, and nothing is known about the regulation of its tissue-specific expression pattern. We have used zebrafish transgenesis to identify and characterize cis-regulatory sequences controlling expression of the human gene. Candidate enhancers were selected from non-coding sequence associated with COL18A1 based on sequence conservation among mammals. Although these displayed no overt conservation with orthologous zebrafish sequences, four regions nonetheless acted as tissue-specific transcriptional enhancers in the zebrafish embryo, and together recapitulated the major aspects of col18a1 expression. Additional post-hoc computational analysis on positive enhancer sequences revealed alignments between mammalian and teleost sequences, which we hypothesize predict the corresponding zebrafish enhancers; for one of these, we demonstrate functional overlap with the orthologous human enhancer sequence. Our results provide important insight into the biological function and regulation of COL18A1, and point to additional sequences that may contribute to complex diseases involving COL18A1. More generally, we show that combining functional data with targeted analyses for phylogenetic conservation can reveal conserved cis-regulatory elements in the large number of cases where computational alignment alone falls short.

  12. Genetic Analysis of Transvection Effects Involving Cis-Regulatory Elements of the Drosophila Ultrabithorax Gene

    PubMed Central

    Micol, J. L.; Castelli-Gair, J. E.; Garcia-Bellido, A.


    The Ultrabithorax (Ubx) gene of Drosophila melanogaster contains two functionally distinguishable regions: the protein-coding Ubx transcription unit and, upstream of it, the transcribed but non-protein-coding bxd region. Numerous recessive, partial loss-of-function mutations which appear to be regulatory mutations map within the bxd region and within the introns of the Ubx transcription unit. In addition, mutations within the Ubx unit exons are known and most of these behave as null alleles. Ubx(1) is one such allele. We have confirmed that, although the Ubx(1) allele does not produce detectable Ubx proteins (UBX), it does retain other genetic functions detectable by their effects on the expression of a paired, homologous Ubx allele, i.e., by transvection. We have extended previous analyses made by E. B. Lewis by mapping the critical elements of the Ubx gene which participate in transvection effects. Our results show that the Ubx(1) allele retains wild-type functions whose effectiveness can be reduced (1) by additional cis mutations in the bxd region or in introns of the Ubx transcription unit, as well as (2) by rearrangements disturbing pairing between homologous Ubx genes. Our results suggest that those remnant functions in Ubx(1) are able to modulate the activity of the allele located in the homologous chromosome. We discuss the normal cis regulatory role of these functions involved in trans interactions between homologous Ubx genes, as well as the implications of our results for the current models on transvection. PMID:2123161

  13. A mathematical model of the sterol regulatory element binding protein 2 cholesterol biosynthesis pathway

    PubMed Central

    Bhattacharya, Bonhi S.; Sweby, Peter K.; Minihane, Anne-Marie; Jackson, Kim G.; Tindall, Marcus J.


    Cholesterol is one of the key constituents for maintaining the cellular membrane and thus the integrity of the cell itself. In contrast high levels of cholesterol in the blood are known to be a major risk factor in the development of cardiovascular disease. We formulate a deterministic nonlinear ordinary differential equation model of the sterol regulatory element binding protein 2 (SREBP-2) cholesterol genetic regulatory pathway in a hepatocyte. The mathematical model includes a description of genetic transcription by SREBP-2 which is subsequently translated to mRNA leading to the formation of 3-hydroxy-3-methylglutaryl coenzyme A reductase (HMGCR), a main regulator of cholesterol synthesis. Cholesterol synthesis subsequently leads to the regulation of SREBP-2 via a negative feedback formulation. Parameterised with data from the literature, the model is used to understand how SREBP-2 transcription and regulation affects cellular cholesterol concentration. Model stability analysis shows that the only positive steady-state of the system exhibits purely oscillatory, damped oscillatory or monotic behaviour under certain parameter conditions. In light of our findings we postulate how cholesterol homeostasis is maintained within the cell and the advantages of our model formulation are discussed with respect to other models of genetic regulation within the literature. PMID:24444765

  14. Genomic divergence and brain evolution: How regulatory DNA influences development of the cerebral cortex

    PubMed Central

    Silver, Debra L.


    The cerebral cortex controls our most distinguishing higher cognitive functions. Human-specific gene expression differences are abundant in the cerebral cortex, yet we have only begun to understand how these variations impact brain function. This review discusses the current evidence linking non-coding regulatory DNA changes, including enhancers, with neocortical evolution. Functional interrogation using animal models reveals converging roles for our genome in key aspects of cortical development including progenitor cell cycle and neuronal signaling. New technologies, including iPS cells and organoids, offer potential alternatives to modeling evolutionary modifications in a relevant species context. Several diseases rooted in the cerebral cortex uniquely manifest in humans compared to other primates, thus highlighting the importance of understanding human brain differences. Future studies of regulatory loci, including those implicated in disease, will collectively help elucidate key cellular and genetic mechanisms underlying our distinguishing cognitive traits. PMID:26642006

  15. Tissue-specific SMARCA4 binding at active and repressed regulatory elements during embryogenesis.


    Attanasio, Catia; Nord, Alex S; Zhu, Yiwen; Blow, Matthew J; Biddie, Simon C; Mendenhall, Eric M; Dixon, Jesse; Wright, Crystal; Hosseini, Roya; Akiyama, Jennifer A; Holt, Amy; Plajzer-Frick, Ingrid; Shoukry, Malak; Afzal, Veena; Ren, Bing; Bernstein, Bradley E; Rubin, Edward M; Visel, Axel; Pennacchio, Len A


    The SMARCA4 (also known as BRG1 in humans) chromatin remodeling factor is critical for establishing lineage-specific chromatin states during early mammalian development. However, the role of SMARCA4 in tissue-specific gene regulation during embryogenesis remains poorly defined. To investigate the genome-wide binding landscape of SMARCA4 in differentiating tissues, we engineered a Smarca4(FLAG) knock-in mouse line. Using ChIP-seq, we identified ∼51,000 SMARCA4-associated regions across six embryonic mouse tissues (forebrain, hindbrain, neural tube, heart, limb, and face) at mid-gestation (E11.5). The majority of these regions was distal from promoters and showed dynamic occupancy, with most distal SMARCA4 sites (73%) confined to a single or limited subset of tissues. To further characterize these regions, we profiled active and repressive histone marks in the same tissues and examined the intersection of informative chromatin states and SMARCA4 binding. This revealed distinct classes of distal SMARCA4-associated elements characterized by activating and repressive chromatin signatures that were associated with tissue-specific up- or down-regulation of gene expression and relevant active/repressed biological pathways. We further demonstrate the predicted active regulatory properties of SMARCA4-associated elements by retrospective analysis of tissue-specific enhancers and direct testing of SMARCA4-bound regions in transgenic mouse assays. Our results indicate a dual active/repressive function of SMARCA4 at distal regulatory sequences in vivo and support its role in tissue-specific gene regulation during embryonic development.

  16. OTX2 Activity at Distal Regulatory Elements Shapes the Chromatin Landscape of Group 3 Medulloblastoma.


    Boulay, Gaylor; Awad, Mary E; Riggi, Nicolo; Archer, Tenley C; Iyer, Sowmya; Boonseng, Wannaporn E; Rossetti, Nikki E; Naigles, Beverly; Rengarajan, Shruthi; Volorio, Angela; Kim, James C; Mesirov, Jill P; Tamayo, Pablo; Pomeroy, Scott L; Aryee, Martin J; Rivera, Miguel N


    Medulloblastoma is the most frequent malignant pediatric brain tumor and is divided into at least four subgroups known as WNT, SHH, Group 3, and Group 4. Here, we characterized gene regulation mechanisms in the most aggressive subtype, Group 3 tumors, through genome-wide chromatin and expression profiling. Our results show that most active distal sites in these tumors are occupied by the transcription factor OTX2. Highly active OTX2-bound enhancers are often arranged as clusters of adjacent peaks and are also bound by the transcription factor NEUROD1. These sites are responsive to OTX2 and NEUROD1 knockdown and could also be generated de novo upon ectopic OTX2 expression in primary cells, showing that OTX2 cooperates with NEUROD1 and plays a major role in maintaining and possibly establishing regulatory elements as a pioneer factor. Among OTX2 target genes, we identified the kinase NEK2, whose knockdown and pharmacologic inhibition decreased cell viability. Our studies thus show that OTX2 controls the regulatory landscape of Group 3 medulloblastoma through cooperative activity at enhancer elements and contributes to the expression of critical target genes.SIGNIFICANCE: The gene regulation mechanisms that drive medulloblastoma are not well understood. Using chromatin profiling, we find that the transcription factor OTX2 acts as a pioneer factor and, in cooperation with NEUROD1, controls the Group 3 medulloblastoma active enhancer landscape. OTX2 itself or its target genes, including the mitotic kinase NEK2, represent attractive targets for future therapies. Cancer Discov; 7(3); 1-14. ©2017 AACR.

  17. Putative cis-regulatory elements in genes highly expressed in rice sperm cells

    PubMed Central


    Background The male germ line in flowering plants is initiated within developing pollen grains via asymmetric division. The smaller cell then becomes totally encased within a much larger vegetative cell, forming a unique "cell within a cell structure". The generative cell subsequently divides to give rise to two non-motile diminutive sperm cells, which take part in double fertilization and lead to the seed set. Sperm cells are difficult to investigate because of their presence within the confines of the larger vegetative cell. However, recently developed techniques for the isolation of rice sperm cells and the fully annotated rice genome sequence have allowed for the characterization of the transcriptional repertoire of sperm cells. Microarray gene expression data has identified a subset of rice genes that show unique or highly preferential expression in sperm cells. This information has led to the identification of cis-regulatory elements (CREs), which are conserved in sperm-expressed genes and are putatively associated with the control of cell-specific expression. Findings We aimed to identify the CREs associated with rice sperm cell-specific gene expression data using in silico prediction tools. We analyzed 1-kb upstream regions of the top 40 sperm cell co-expressed genes for over-represented conserved and novel motifs. Analysis of upstream regions with the SIGNALSCAN program with the PLACE database, MEME and the Mclip tool helped to find combinatorial sets of known transcriptional factor-binding sites along with two novel motifs putatively associated with the co-expression of sperm cell-specific genes. Conclusions Our data shows the occurrence of novel motifs, which are putative CREs and are likely targets of transcriptional factors regulating sperm cell gene expression. These motifs can be used to design the experimental verification of regulatory elements and the identification of transcriptional factors that regulate sperm cell-specific gene expression. PMID

  18. Characterization of a disease-associated mutation affecting a putative splicing regulatory element in intron 6b of the cystic fibrosis transmembrane conductance regulator (CFTR) gene.


    Faà, Valeria; Incani, Federica; Meloni, Alessandra; Corda, Denise; Masala, Maddalena; Baffico, A Maria; Seia, Manuela; Cao, Antonio; Rosatelli, M Cristina


    Cystic fibrosis (CF) is a common recessive disorder caused by >1600 mutations in the CF transmembrane conductance regulator (CFTR) gene. About 13% of CFTR mutations are classified as "splicing mutations," but for almost 40% of these, their role in affecting the pre-mRNA splicing of the gene is not yet defined. In this work, we describe a new splicing mutation detected in three unrelated Italian CF patients. By DNA analyses and mRNA studies, we identified the c.1002-1110_1113delTAAG mutation localized in intron 6b of the CFTR gene. At the mRNA level, this mutation creates an aberrant inclusion of a sequence of 101 nucleotides between exons 6b and 7. This sequence corresponds to a portion of intron 6b and resembles a cryptic exon because it is characterized by an upstream ag and a downstream gt sequence, which are most probably recognized as 5'- and 3'-splice sites by the spliceosome. Through functional analysis of this splicing defect, we show that this mutation abolishes the interaction of the splicing regulatory protein heterogeneous nuclear ribonucleoprotein A2/B1 with an intronic splicing regulatory element and creates a new recognition motif for the SRp75 splicing factor, causing activation of the cryptic exon. Our results show that the c.1002-1110_1113delTAAG mutation creates a new intronic splicing regulatory element in intron 6b of the CFTR gene exclusively recognized by SRp75.

  19. The Regulatory Properties of Autonomous Subtelomeric P Elements Are Sensitive to a Suppressor of Variegation in Drosophila Melanogaster

    PubMed Central

    Ronsseray, S.; Lehmann, M.; Nouaud, D.; Anxolabehere, D.


    Genetic recombination was used in Drosophila melanogaster to isolate P elements, inserted at the telomeres of X chromosomes (cytological site 1A) from natural populations, in a genetic background devoid of other P elements. We show that complete maternally inherited P repression in the germline (P cytotype) can be elicited by only two autonomous P elements at 1A and that a single element at this site has partial regulatory properties. The analysis of the surrounding chromosomal regions of the P elements at 1A shows that in all cases these elements are flanked by Telomeric Associated Sequences, tandemly repetitive noncoding sequences that have properties of heterochromatin. In addition, we show that the regulatory properties of P elements at 1A can be inhibited by some of the mutant alleles of the Su(var)205 gene and by a deficiency of this gene. However, the regulatory properties of reference P strains (Harwich and Texas 007) are not impaired by Su(var)205 mutations. Su(var)205 encodes Heterochromatin Protein 1 (HP1). These results suggest that the HP1 dosage effect on the P element properties is site-dependent and could involve the structure of the chromatin. PMID:8844154

  20. FOOTER: a web tool for finding mammalian DNA regulatory regions using phylogenetic footprinting

    PubMed Central

    Corcoran, David L.; Feingold, Eleanor; Benos, Panayiotis V.


    FOOTER is a newly developed algorithm that analyzes homologous mammalian promoter sequences in order to identify transcriptional DNA regulatory ‘signals’. FOOTER uses prior knowledge about the binding site preferences of the transcription factors (TFs) in the form of position-specific scoring matrices (PSSMs). The PSSM models are generated from known mammalian binding sites from the TRANSFAC database. In a test set of 72 confirmed binding sites (most of them not present in TRANSFAC) of 19 TFs, it exhibited 83% sensitivity and 72% specificity. FOOTER is accessible over the web at . PMID:15980508

  1. Identification of distal cis-regulatory elements at mouse mitoferrin loci using zebrafish transgenesis.


    Amigo, Julio D; Yu, Ming; Troadec, Marie-Berengere; Gwynn, Babette; Cooney, Jeffrey D; Lambert, Amy J; Chi, Neil C; Weiss, Mitchell J; Peters, Luanne L; Kaplan, Jerry; Cantor, Alan B; Paw, Barry H


    Mitoferrin 1 (Mfrn1; Slc25a37) and mitoferrin 2 (Mfrn2; Slc25a28) function as essential mitochondrial iron importers for heme and Fe/S cluster biogenesis. A genetic deficiency of Mfrn1 results in a profound hypochromic anemia in vertebrate species. To map the cis-regulatory modules (CRMs) that control expression of the Mfrn genes, we utilized genome-wide chromatin immunoprecipitation (ChIP) datasets for the major erythroid transcription factor GATA-1. We identified the CRMs that faithfully drive the expression of Mfrn1 during blood and heart development and Mfrn2 ubiquitously. Through in vivo analyses of the Mfrn-CRMs in zebrafish and mouse, we demonstrate their functional and evolutionary conservation. Using knockdowns with morpholinos and cell sorting analysis in transgenic zebrafish embryos, we show that GATA-1 directly regulates the expression of Mfrn1. Mutagenesis of individual GATA-1 binding cis elements (GBE) demonstrated that at least two of the three GBE within this CRM are functionally required for GATA-mediated transcription of Mfrn1. Furthermore, ChIP assays demonstrate switching from GATA-2 to GATA-1 at these elements during erythroid maturation. Our results provide new insights into the genetic regulation of mitochondrial function and iron homeostasis and, more generally, illustrate the utility of genome-wide ChIP analysis combined with zebrafish transgenesis for identifying long-range transcriptional enhancers that regulate tissue development.

  2. c/EBPbeta is a major regulatory element driving transcriptional activation of the CXCL12 promoter.


    Calonge, E; Alonso-Lobo, J M; Escandón, C; González, N; Bermejo, M; Santiago, B; Mestre, L; Pablos, J L; Caruz, A; Alcamí, J


    CXCL12 is considered a constitutively expressed chemokine with homeostatic functions. However, induction of CXCL12 expression and its potential role in several pathologic conditions have been reported, suggesting that CXCL12 gene expression can be induced by different stimuli. To elucidate the molecular mechanisms involved in the regulation of CXCL12 gene expression, we aim to define the molecular factors that operate at the transcriptional level. Basal, constitutive expression of CXCL12 was dependent on basic helix-loop-helix factors. Transcriptional up-regulation of the CXCL12 gene was induced by cellular confluence or inflammatory stimuli such as interleukin-1 and interleukin-6, in a CCAAT/enhancer binding protein beta (c/EBPbeta)-dependent manner. Chromatin immunoprecipitation assays confirmed c/EBPbeta binding to a specific response element located at -1171 of the promoter region of CXCL12. Our data show that c/EBPbeta is a major regulatory element driving transcription of the CXCL12 gene in response to cytokines and cell confluence.

  3. An Altered State of a Specific EN Regulatory Element Induced in a Maize Tiller

    PubMed Central

    Fowler, Robert G.; Peterson, Peter A.


    There are numerous states of the regulatory element, Enhancer (En). With specific receptor alleles, such as a2m(r-pa-pu) or a2m(r), specific mutability patterns are expressed. One specific derivative En allele, En-v (En-variable), was originally identified with a coarse pattern of mutability with the a2m(r-pa-pu) allele and giving progeny with varied En expression (standard to reduced within an ear progeny). Derivatives of En-v were subsequently found on numerous occasions to give only a very reduced expression (fewer mutant spots) with the a2m(r-pa-pu) allele in the ears derived from the main stalk of the corn plant. When a comparison is made of the effect of this changed En-v state between tiller ears and main stalk ears of the same plant, the tiller ears show an increased level of En-v expression (coarse pattern), while the main-stalk ears continue to show the very reduced level of En-v expression (low frequency of very late variegation). This increased level of mutability of the tiller ears is maintained when transmitted through the main-stalk ear in the subsequent generation. These results indicate that heritable alterations of controlling elements can be produced by endogenous environmental factors present during normal plant development. PMID:17248873

  4. Do pharmacological approaches that prevent opioid tolerance target different elements in the same regulatory machinery?


    Garzón, Javier; Rodríguez-Muñoz, María; Sánchez-Blázquez, Pilar


    In the nervous system, the interaction of opioids like heroin and morphine with the G protein-coupled Mu-opioid receptor (MOR) provokes the development of tolerance to these opioids, as well as physical dependence. Tolerance implies that higher doses of these drugs must be consumed in order to obtain an equivalent sensation, a situation that contributes notably to the social problems surrounding recreational opioid abuse. The mechanisms that promote opioid tolerance involve a series of adaptive changes in the MOR and in the post-receptor signalling elements. Pharmacological studies have consistently identified a number of signalling proteins relevant to morphine-induced tolerance, including the delta-opioid receptor (DOR), protein kinase C (PKC), protein kinase A (PKA), calcium/calmodulin-dependent kinase II (CaMKII), nitric oxide synthase (NOS), N-methyl-D-aspartate acid glutamate receptors (NMDAR), and regulators of G-signalling (RGS) proteins. Thus, it is feasible that these treatments which diminish morphine tolerance target distinct elements within the same regulatory machinery. In this scheme, the signals originated at the agonist-activated MORs would be recognised by elements such as the NMDARs, which in turn exert a negative feedback on MOR-evoked signalling. This process involves DOR regulation of MORs, MOR-induced activation of NMDARs (probably via the regulation of Src, recruiting PKC and Galpha subunits) and the NMDAR-mediated activation of CaMKII. The active CaMKII promotes the sequestering of morphine-activated Gbetagamma dimers by phosducin-like proteins (PhLP) and of Galpha subunits by RGS proteins and tolerance to opioids like morphine develops. Future efforts to study these phenomena should focus on fitting additional pieces into this puzzle in order to fully define the mechanism underlying the desensitization of MORs in neural cells.

  5. Maternal stress, preterm birth, and DNA methylation at imprint regulatory sequences in humans.


    Vidal, Adriana C; Benjamin Neelon, Sara E; Liu, Ying; Tuli, Abbas M; Fuemmeler, Bernard F; Hoyo, Cathrine; Murtha, Amy P; Huang, Zhiqing; Schildkraut, Joellen; Overcash, Francine; Kurtzberg, Joanne; Jirtle, Randy L; Iversen, Edwin S; Murphy, Susan K


    In infants exposed to maternal stress in utero, phenotypic plasticity through epigenetic events may mechanistically explain increased risk of preterm birth (PTB), which confers increased risk for neurodevelopmental disorders, cardiovascular disease, and cancers in adulthood. We examined associations between prenatal maternal stress and PTB, evaluating the role of DNA methylation at imprint regulatory regions. We enrolled women from prenatal clinics in Durham, NC. Stress was measured in 537 women at 12 weeks of gestation using the Perceived Stress Scale. DNA methylation at differentially methylated regions (DMRs) associated with H19, IGF2, MEG3, MEST, SGCE/PEG10, PEG3, NNAT, and PLAGL1 was measured from peripheral and cord blood using bisulfite pyrosequencing in a sub-sample of 79 mother-infant pairs. We examined associations between PTB and stress and evaluated differences in DNA methylation at each DMR by stress. Maternal stress was not associated with PTB (OR = 0.98; 95% CI, 0.40-2.40; P = 0.96), after adjustment for maternal body mass index (BMI), income, and raised blood pressure. However, elevated stress was associated with higher infant DNA methylation at the MEST DMR (2.8% difference, P < 0.01) after adjusting for PTB. Maternal stress may be associated with epigenetic changes at MEST, a gene relevant to maternal care and obesity. Reduced prenatal stress may support the epigenomic profile of a healthy infant.

  6. Identification and characterization of DNA sequences that prevent glucocorticoid receptor binding to nearby response elements.


    Telorac, Jonas; Prykhozhij, Sergey V; Schöne, Stefanie; Meierhofer, David; Sauer, Sascha; Thomas-Chollier, Morgane; Meijsing, Sebastiaan H


    Out of the myriad of potential DNA binding sites of the glucocorticoid receptor (GR) found in the human genome, only a cell-type specific minority is actually bound, indicating that the presence of a recognition sequence alone is insufficient to specify where GR binds. Cooperative interactions with other transcription factors (TFs) are known to contribute to binding specificity. Here, we reasoned that sequence signals preventing GR recruitment to certain loci provide an alternative means to confer specificity. Motif analyses uncovered candidate Negative Regulatory Sequences (NRSs) that interfere with genomic GR binding. Subsequent functional analyses demonstrated that NRSs indeed prevent GR binding to nearby response elements. We show that NRS activity is conserved across species, found in most tissues and that they also interfere with the genomic binding of other TFs. Interestingly, the effects of NRSs appear not to be a simple consequence of changes in chromatin accessibility. Instead, we find that NRSs interact with proteins found at sub-nuclear structures called paraspeckles and that these proteins might mediate the repressive effects of NRSs. Together, our studies suggest that the joint influence of positive and negative sequence signals partition the genome into regions where GR can bind and those where it cannot.

  7. Environmental mutagens induced transversions but not transitions in regulatory region of mitochondrial DNA.


    Partridge, Michael A; Huang, Sarah X L; Kibriya, Muhammad G; Ahsan, Habibul; Davidson, Mercy M; Hei, Tom K


    One of the long-term objectives of the research in our laboratory was to determine whether mitochondrial DNA (mtDNA) mutations were generated in cell lines exposed to a variety of known mutagens. Many of these mutagens are known to increase oxidative stress in the cell, and one potential outcome of this would be an increased incidence of point mutations in mtDNA. Recently, there has been some controversy regarding the validity of point mutations in the regulatory region of mtDNA as a predictive or causative marker for carcinogenesis. Studies were undertaken to assess whether nuclear mutagens such as arsenic (As), asbestos, and ultraviolet (UV) and gamma-radiation, induced both heteroplasmic and homoplasmic point mutations in mtDNA. A direct sequencing approach was used to reduce the occurrence of experimental errors and cross-checked all base changes with databases of known polymorphisms. Our results showed that, while base changes did occur, there was no marked difference between the number of changes in treated and untreated cells. Furthermore, in human lymphocyte samples from subjects exposed to As, most of these base changes were previously reported. Interestingly, there was an increase in the number of transversions (purine ( pyrimidine) in smokers from a human population study, but as with the findings in cell culture samples, there was no difference in the total number of base changes. Data suggest that only a change in the number of rare transversions would be indicative of an increase in point mutations in mtDNA after exposure to mutagens.

  8. Mapping Fifteen Trace Elements in Human Seminal Plasma and Sperm DNA.


    Ali, Sazan; Chaspoul, Florence; Anderson, Loundou; Bergé-Lefranc, David; Achard, Vincent; Perrin, Jeanne; Gallice, Philippe; Guichaoua, Marie


    Studies suggest a relationship between semen quality and the concentration of trace elements in serum or seminal plasma. However, trace elements may be linked to DNA and capable of altering the gene expression patterns. Thus, trace element interactions with DNA may contribute to the mechanisms for a trans-generational reproductive effect. We developed an analytical method to determine the amount of trace elements bound to the sperm DNA, and to estimate their affinity for the sperm DNA by the ratio: R = Log [metal concentration in the sperm DNA/metal concentration in seminal plasma]. We then analyzed the concentrations of 15 trace elements (Al, Cd, Cr, Cu, Hg, Mn, Mo, Ni, Pb, Ti, V, Zn, As, Sb, and Se) in the seminal plasma and the sperm DNA in 64 normal and 30 abnormal semen specimens with Inductively Coupled Plasma/Mass Spectrometry (ICP-MS). This study showed all trace elements were detected in the seminal plasma and only metals were detected in the sperm DNA. There was no correlation between the metals' concentrations in the seminal plasma and the sperm DNA. Al had the highest affinity for DNA followed by Pb and Cd. This strong affinity is consistent with the known mutagenic effects of these metals. The lowest affinity was observed for Zn and Ti. We observed a significant increase of Al linked to the sperm DNA of patients with oligozoospermia and teratozoospermia. Al's reproductive toxicity might be due to Al linked to DNA, by altering spermatogenesis and expression patterns of genes involved in the function of reproduction.

  9. Characterization of human glucocorticoid receptor complexes formed with DNA fragments containing or lacking glucocorticoid response elements

    SciTech Connect

    Tully, D.B.; Cidlowski, J.A. )


    Sucrose density gradient shift assays were used to study the interactions of human glucocorticoid receptors (GR) with small DNA fragments either containing or lacking glucocorticoid response element (GRE) DNA consensus sequences. When crude cytoplasmic extracts containing ({sup 3}H)triamcinolone acetonide (({sup 3}H)TA) labeled GR were incubated with unlabeled DNA under conditions of DNA excess, a GRE-containing DNA fragment obtained from the 5' long terminal repeat of mouse mammary tumor virus (MMTV LTR) formed a stable 12-16S complex with activated, but not nonactivated, ({sup 3}H)TA receptor. By contrast, if the cytosols were treated with calf thymus DNA-cellulose to deplete non-GR-DNA-binding proteins prior to heat activation, a smaller 7-10S complex was formed with the MMTV LTR DNA fragment. Activated ({sup 3}H)TA receptor from DNA-cellulose pretreated cytosols also interacted with two similarly sized fragments from pBR322 DNA. Stability of the complexes formed between GR and these three DNA fragments was strongly affected by even moderate alterations in either the salt concentration or the pH of the gradient buffer. Under all conditions tested, the complex formed with the MMTV LTR DNA fragment was more stable than the complexes formed with either of the pBR322 DNA fragments. Together these observations indicate that the formation of stable complexes between activated GR and isolated DNA fragments requires the presence of GRE consensus sequences in the DNA.

  10. Evaluation of phylogenetic footprint discovery for predicting bacterial cis-regulatory elements and revealing their evolution

    PubMed Central

    Janky, Rekin's; van Helden, Jacques


    Background The detection of conserved motifs in promoters of orthologous genes (phylogenetic footprints) has become a common strategy to predict cis-acting regulatory elements. Several software tools are routinely used to raise hypotheses about regulation. However, these tools are generally used as black boxes, with default parameters. A systematic evaluation of optimal parameters for a footprint discovery strategy can bring a sizeable improvement to the predictions. Results We evaluate the performances of a footprint discovery approach based on the detection of over-represented spaced motifs. This method is particularly suitable for (but not restricted to) Bacteria, since such motifs are typically bound by factors containing a Helix-Turn-Helix domain. We evaluated footprint discovery in 368 Escherichia coli K12 genes with annotated sites, under 40 different combinations of parameters (taxonomical level, background model, organism-specific filtering, operon inference). Motifs are assessed both at the levels of correctness and significance. We further report a detailed analysis of 181 bacterial orthologs of the LexA repressor. Distinct motifs are detected at various taxonomical levels, including the 7 previously characterized taxon-specific motifs. In addition, we highlight a significantly stronger conservation of half-motifs in Actinobacteria, relative to Firmicutes, suggesting an intermediate state in specificity switching between the two Gram-positive phyla, and thereby revealing the on-going evolution of LexA auto-regulation. Conclusion The footprint discovery method proposed here shows excellent results with E. coli and can readily be extended to predict cis-acting regulatory signals and propose testable hypotheses in bacterial genomes for which nothing is known about regulation. PMID:18215291

  11. Detection and Visualization of Compositionally Similar cis-Regulatory Element Clusters in Orthologous and Coordinately Controlled Genes

    PubMed Central

    Jegga, Anil G.; Sherwood, Shawn P.; Carman, James W.; Pinski, Andrew T.; Phillips, Jerry L.; Pestian, John P.; Aronow, Bruce J.


    Evolutionarily conserved noncoding genomic sequences represent a potentially rich source for the discovery of gene regulatory regions. However, detecting and visualizing compositionally similar cis-element clusters in the context of conserved sequences is challenging. We have explored potential solutions and developed an algorithm and visualization method that combines the results of conserved sequence analyses (BLASTZ) with those of transcription factor binding site analyses (MatInspector) ( We define hits as the density of co-occurring cis-element transcription factor (TF)-binding sites measured within a 200-bp moving average window through phylogenetically conserved regions. The results are depicted as a Regulogram, in which the hit count is plotted as a function of position within each of the two genomic regions of the aligned orthologs. Within a high-scoring region, the relative arrangement of shared cis-elements within compositionally similar TF-binding site clusters is depicted in a Trafacgram. On the basis of analyses of several training data sets, the approach also allows for the detection of similarities in composition and relative arrangement of cis-element clusters within nonorthologous genes, promoters, and enhancers that exhibit coordinate regulatory properties. Known functional regulatory regions of nonorthologous and less-conserved orthologous genes frequently showed cis-element shuffling, demonstrating that compositional similarity can be more sensitive than sequence similarity. These results show that combining sequence similarity with cis-element compositional similarity provides a powerful aid for the identification of potential control regions. PMID:12213778

  12. Detection and visualization of compositionally similar cis-regulatory element clusters in orthologous and coordinately controlled genes.


    Jegga, Anil G; Sherwood, Shawn P; Carman, James W; Pinski, Andrew T; Phillips, Jerry L; Pestian, John P; Aronow, Bruce J


    Evolutionarily conserved noncoding genomic sequences represent a potentially rich source for the discovery of gene regulatory regions. However, detecting and visualizing compositionally similar cis-element clusters in the context of conserved sequences is challenging. We have explored potential solutions and developed an algorithm and visualization method that combines the results of conserved sequence analyses (BLASTZ) with those of transcription factor binding site analyses (MatInspector) ( We define hits as the density of co-occurring cis-element transcription factor (TF)-binding sites measured within a 200-bp moving average window through phylogenetically conserved regions. The results are depicted as a Regulogram, in which the hit count is plotted as a function of position within each of the two genomic regions of the aligned orthologs. Within a high-scoring region, the relative arrangement of shared cis-elements within compositionally similar TF-binding site clusters is depicted in a Trafacgram. On the basis of analyses of several training data sets, the approach also allows for the detection of similarities in composition and relative arrangement of cis-element clusters within nonorthologous genes, promoters, and enhancers that exhibit coordinate regulatory properties. Known functional regulatory regions of nonorthologous and less-conserved orthologous genes frequently showed cis-element shuffling, demonstrating that compositional similarity can be more sensitive than sequence similarity. These results show that combining sequence similarity with cis-element compositional similarity provides a powerful aid for the identification of potential control regions.

  13. Magnetic particle-based sandwich sensor with DNA-modified carbon nanotubes as recognition elements for detection of DNA hybridization.


    Hu, Po; Huang, Cheng Zhi; Li, Yuan Fang; Ling, Jian; Liu, Yu Ling; Fei, Liang Run; Xie, Jian Ping


    In this contribution, we design a visual sensor for DNA hybridization with DNA probe-modified magnetic particles (MPs) and multiwalled carbon nanotubes (MWNTs) without involving a visual recognition element such as fluorescent/chemiluminescent reagents. It was found that DNA probe-modified MWNTs, which could be dispersed in aqueous medium and have strong light scattering signals under the excitation of a light beam in the UV-vis region, could connect with DNA probe-modified MPs together in the presence of perfectly complementary target DNA and form a sandwich structure. In a magnetic field, the formed MP-MWNT species can easily be removed from the solution, resulting in a decrease of light scattering signals. Thus, a magnetic particle-based sandwich sensor could be developed to detect DNA hybridization by measuring the light scattering signals with DNA-modified MWNTs as recognition elements. Experiments showed that the DNA-modified MPs sensor could be reused at least 17 times and was stable for more than 6 months.

  14. A Comparative Encyclopedia of DNA Elements in the Mouse Genome

    PubMed Central

    Yue, Feng; Cheng, Yong; Breschi, Alessandra; Vierstra, Jeff; Wu, Weisheng; Ryba, Tyrone; Sandstrom, Richard; Ma, Zhihai; Davis, Carrie; Pope, Benjamin D.; Shen, Yin; Pervouchine, Dmitri D.; Djebali, Sarah; Thurman, Bob; Kaul, Rajinder; Rynes, Eric; Kirilusha, Anthony; Marinov, Georgi K.; Williams, Brian A.; Trout, Diane; Amrhein, Henry; Fisher-Aylor, Katherine; Antoshechkin, Igor; DeSalvo, Gilberto; See, Lei-Hoon; Fastuca, Meagan; Drenkow, Jorg; Zaleski, Chris; Dobin, Alex; Prieto, Pablo; Lagarde, Julien; Bussotti, Giovanni; Tanzer, Andrea; Denas, Olgert; Li, Kanwei; Bender, M. A.; Zhang, Miaohua; Byron, Rachel; Groudine, Mark T.; McCleary, David; Pham, Long; Ye, Zhen; Kuan, Samantha; Edsall, Lee; Wu, Yi-Chieh; Rasmussen, Matthew D.; Bansal, Mukul S.; Keller, Cheryl A.; Morrissey, Christapher S.; Mishra, Tejaswini; Jain, Deepti; Dogan, Nergiz; Harris, Robert S.; Cayting, Philip; Kawli, Trupti; Boyle, Alan P.; Euskirchen, Ghia; Kundaje, Anshul; Lin, Shin; Lin, Yiing; Jansen, Camden; Malladi, Venkat S.; Cline, Melissa S.; Erickson, Drew T.; Kirkup, Vanessa M; Learned, Katrina; Sloan, Cricket A.; Rosenbloom, Kate R.; de Sousa, Beatriz Lacerda; Beal, Kathryn; Pignatelli, Miguel; Flicek, Paul; Lian, Jin; Kahveci, Tamer; Lee, Dongwon; Kent, W. James; Santos, Miguel Ramalho; Herrero, Javier; Notredame, Cedric; Johnson, Audra; Vong, Shinny; Lee, Kristen; Bates, Daniel; Neri, Fidencio; Diegel, Morgan; Canfield, Theresa; Sabo, Peter J.; Wilken, Matthew S.; Reh, Thomas A.; Giste, Erika; Shafer, Anthony; Kutyavin, Tanya; Haugen, Eric; Dunn, Douglas; Reynolds, Alex P.; Neph, Shane; Humbert, Richard; Hansen, R. Scott; De Bruijn, Marella; Selleri, Licia; Rudensky, Alexander; Josefowicz, Steven; Samstein, Robert; Eichler, Evan E.; Orkin, Stuart H.; Levasseur, Dana; Papayannopoulou, Thalia; Chang, Kai-Hsin; Skoultchi, Arthur; Gosh, Srikanta; Disteche, Christine; Treuting, Piper; Wang, Yanli; Weiss, Mitchell J.; Blobel, Gerd A.; Good, Peter J.; Lowdon, Rebecca F.; Adams, Leslie B.; Zhou, Xiao-Qiao; Pazin, Michael J.; Feingold, Elise A.; Wold, Barbara; Taylor, James; Kellis, Manolis; Mortazavi, Ali; Weissman, Sherman M.; Stamatoyannopoulos, John; Snyder, Michael P.; Guigo, Roderic; Gingeras, Thomas R.; Gilbert, David M.; Hardison, Ross C.; Beer, Michael A.; Ren, Bing


    Summary As the premier model organism in biomedical research, the laboratory mouse shares the majority of protein-coding genes with humans, yet the two mammals differ in significant ways. To gain greater insights into both shared and species-specific transcriptional and cellular regulatory programs in the mouse, the Mouse ENCODE Consortium has mapped transcription, DNase I hypersensitivity, transcription factor binding, chromatin modifications, and replication domains throughout the mouse genome in diverse cell and tissue types. By comparing with the human genome, we not only confirm substantial conservation in the newly annotated potential functional sequences, but also find a large degree of divergence of other sequences involved in transcriptional regulation, chromatin state and higher order chromatin organization. Our results illuminate the wide range of evolutionary forces acting on genes and their regulatory regions, and provide a general resource for research into mammalian biology and mechanisms of human diseases. PMID:25409824

  15. A comparative encyclopedia of DNA elements in the mouse genome.


    Yue, Feng; Cheng, Yong; Breschi, Alessandra; Vierstra, Jeff; Wu, Weisheng; Ryba, Tyrone; Sandstrom, Richard; Ma, Zhihai; Davis, Carrie; Pope, Benjamin D; Shen, Yin; Pervouchine, Dmitri D; Djebali, Sarah; Thurman, Robert E; Kaul, Rajinder; Rynes, Eric; Kirilusha, Anthony; Marinov, Georgi K; Williams, Brian A; Trout, Diane; Amrhein, Henry; Fisher-Aylor, Katherine; Antoshechkin, Igor; DeSalvo, Gilberto; See, Lei-Hoon; Fastuca, Meagan; Drenkow, Jorg; Zaleski, Chris; Dobin, Alex; Prieto, Pablo; Lagarde, Julien; Bussotti, Giovanni; Tanzer, Andrea; Denas, Olgert; Li, Kanwei; Bender, M A; Zhang, Miaohua; Byron, Rachel; Groudine, Mark T; McCleary, David; Pham, Long; Ye, Zhen; Kuan, Samantha; Edsall, Lee; Wu, Yi-Chieh; Rasmussen, Matthew D; Bansal, Mukul S; Kellis, Manolis; Keller, Cheryl A; Morrissey, Christapher S; Mishra, Tejaswini; Jain, Deepti; Dogan, Nergiz; Harris, Robert S; Cayting, Philip; Kawli, Trupti; Boyle, Alan P; Euskirchen, Ghia; Kundaje, Anshul; Lin, Shin; Lin, Yiing; Jansen, Camden; Malladi, Venkat S; Cline, Melissa S; Erickson, Drew T; Kirkup, Vanessa M; Learned, Katrina; Sloan, Cricket A; Rosenbloom, Kate R; Lacerda de Sousa, Beatriz; Beal, Kathryn; Pignatelli, Miguel; Flicek, Paul; Lian, Jin; Kahveci, Tamer; Lee, Dongwon; Kent, W James; Ramalho Santos, Miguel; Herrero, Javier; Notredame, Cedric; Johnson, Audra; Vong, Shinny; Lee, Kristen; Bates, Daniel; Neri, Fidencio; Diegel, Morgan; Canfield, Theresa; Sabo, Peter J; Wilken, Matthew S; Reh, Thomas A; Giste, Erika; Shafer, Anthony; Kutyavin, Tanya; Haugen, Eric; Dunn, Douglas; Reynolds, Alex P; Neph, Shane; Humbert, Richard; Hansen, R Scott; De Bruijn, Marella; Selleri, Licia; Rudensky, Alexander; Josefowicz, Steven; Samstein, Robert; Eichler, Evan E; Orkin, Stuart H; Levasseur, Dana; Papayannopoulou, Thalia; Chang, Kai-Hsin; Skoultchi, Arthur; Gosh, Srikanta; Disteche, Christine; Treuting, Piper; Wang, Yanli; Weiss, Mitchell J; Blobel, Gerd A; Cao, Xiaoyi; Zhong, Sheng; Wang, Ting; Good, Peter J; Lowdon, Rebecca F; Adams, Leslie B; Zhou, Xiao-Qiao; Pazin, Michael J; Feingold, Elise A; Wold, Barbara; Taylor, James; Mortazavi, Ali; Weissman, Sherman M; Stamatoyannopoulos, John A; Snyder, Michael P; Guigo, Roderic; Gingeras, Thomas R; Gilbert, David M; Hardison, Ross C; Beer, Michael A; Ren, Bing


    The laboratory mouse shares the majority of its protein-coding genes with humans, making it the premier model organism in biomedical research, yet the two mammals differ in significant ways. To gain greater insights into both shared and species-specific transcriptional and cellular regulatory programs in the mouse, the Mouse ENCODE Consortium has mapped transcription, DNase I hypersensitivity, transcription factor binding, chromatin modifications and replication domains throughout the mouse genome in diverse cell and tissue types. By comparing with the human genome, we not only confirm substantial conservation in the newly annotated potential functional sequences, but also find a large degree of divergence of sequences involved in transcriptional regulation, chromatin state and higher order chromatin organization. Our results illuminate the wide range of evolutionary forces acting on genes and their regulatory regions, and provide a general resource for research into mammalian biology and mechanisms of human diseases.

  16. Putative regulatory elements within the non-coding regions of Chrysomelidae Diapause Associated Transcript-1 (DAT-1) orthologs

    Technology Transfer Automated Retrieval System (TEKTRAN)

    To develop a more comprehensive understanding of diapause within Chrysomelidae, we are employing phylogenetic foot-printing to isolate and characterize the regulatory elements associated with the diapause-associated gene, DAT-1. Leptinotarsa decemlineata (Colorado potato beetle, CPB) DAT-1 has been ...

  17. Computational discovery of soybean promoter cis-regulatory elements for the construction of soybean cyst nematode inducible synthetic promoters

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Computational methods offer great hope but limited accuracy in the prediction of functional cis-regulatory elements; improvements are needed to enable synthetic promoter design. We applied an ensemble strategy for de novo soybean cyst nematode (SCN)-inducible motif discovery among promoters of 18 co...

  18. Integrated methylome and transcriptome analysis reveals novel regulatory elements in pediatric acute lymphoblastic leukemia

    PubMed Central

    Almamun, Md; Levinson, Benjamin T; van Swaay, Annette C; Johnson, Nathan T; McKay, Stephanie D; Arthur, Gerald L; Davis, J Wade; Taylor, Kristen H


    Acute lymphoblastic leukemia (ALL) is the most common cancer diagnosed in children under the age of 15. In addition to genetic aberrations, epigenetic modifications such as DNA methylation are altered in cancer and impact gene expression. To identify epigenetic alterations in ALL, genome-wide methylation profiles were generated using the methylated CpG island recovery assay followed by next-generation sequencing. More than 25,000 differentially methylated regions (DMR) were observed in ALL patients with ∼90% present within intronic or intergenic regions. To determine the regulatory potential of the DMR, whole-transcriptome analysis was performed and integrated with methylation data. Aberrant promoter methylation was associated with the altered expression of genes involved in transcriptional regulation, apoptosis, and proliferation. Novel enhancer-like sequences were identified within intronic and intergenic DMR. Aberrant methylation in these regions was associated with the altered expression of neighboring genes involved in cell cycle processes, lymphocyte activation and apoptosis. These genes include potential epi-driver genes, such as SYNE1, PTPRS, PAWR, HDAC9, RGCC, MCOLN2, LYN, TRAF3, FLT1, and MELK, which may provide a selective advantage to leukemic cells. In addition, the differential expression of epigenetic modifier genes, pseudogenes, and non-coding RNAs was also observed accentuating the role of erroneous epigenetic gene regulation in ALL. PMID:26308964

  19. Intrinsic characteristics of neighboring DNA modulate transposable element activity in Drosophila melanogaster.


    Esnault, Caroline; Palavesam, Azhahianambi; Pilitt, Kristina; O'Brochta, David A


    Identifying factors influencing transposable element activity is essential for understanding how these elements impact genomes and their evolution as well as for fully exploiting them as functional genomics tools and gene-therapy vectors. Using a genetics-based approach, the influence of genomic position on piggyBac mobility in Drosophila melanogaster was assessed while controlling for element structure, genetic background, and transposase concentration. The mobility of piggyBac elements varied over more than two orders of magnitude solely as a result of their locations within the genome. The influence of genomic position on element activities was independent of factors resulting in position-dependent transgene expression ("position effects"). Elements could be relocated to new genomic locations without altering their activity if ≥ 500 bp of genomic DNA originally flanking the element was also relocated. Local intrinsic factors within the neighboring DNA that determined the activity of piggyBac elements were portable not only within the genome but also when elements were moved to plasmids. The predicted bendability of the first 50 bp flanking the 5' and 3' termini of piggyBac elements could account for 60% of the variance in position-dependent activity observed among elements. These results are significant because positional influences on transposable element activities will impact patterns of accumulation of elements within genomes. Manipulating and controlling the local sequence context of piggyBac elements could be a powerful, novel way of optimizing gene vector activity.

  20. DNA.

    ERIC Educational Resources Information Center

    Felsenfeld, Gary


    Structural form, bonding scheme, and chromatin structure of and gene-modification experiments with deoxyribonucleic acid (DNA) are described. Indicates that DNA's double helix is variable and also flexible as it interacts with regulatory and other molecules to transfer hereditary messages. (DH)

  1. Characterization of an upstream regulatory element of adenovirus L1 poly (A) site.


    Liu, Li


    The transition from early to late stage infection by adenovirus involves a change in mRNA expression from the adenovirus major late transcription unit (AdMLTU). This early to late switch centers around alternative selection of one of five poly (A) sites (L1-L5) that code for the major structural proteins of Adenovirus. During the early stage of infection, steady state mRNA is primarily derived from the L1 poly (A) site. During the late stage of infection, each of the MLTU poly (A) sites is represented in the steady state mRNA pool (Falck-Pedersen, E., Logan, J., 1989. Regulation of poly(A) site selection in adenovirus. J. Virol. 63 (2), 532-541.). Using transient transfection of a plasmid expressing Chloramphenicol Acetyl Transferase with a tandem poly (A) minigene system (L13) (DeZazzo, J.D., Falck-Pedersen, E., Imperiale, M.J., 1991. Sequences regulating temporal poly(A) site switching in the adenovirus major late transcription unit. Mol. Cell. Biol. 11 (12), 5977-5984; Prescott, J., Falck-Pedersen, E., 1994. Sequence elements upstream of the 3' cleavage site confer substrate strength to the adenovirus L1 and L3 polyadenylation sites. Mol. Cell. Biol. 14 (7), 4682-4693.), it has been demonstrated that the promoter-proximal L1 poly (A) site which is poorly recognized by the 3' end processing machinery, contains an upstream repressor element (URE) that influences steady state levels of mRNA (Prescott, J.C., Liu, L., Falck-Pedersen, E., 1997. Sequence-mediated regulation of adenovirus gene expression by repression of mRNA accumulation. Mol. Cell. Biol. 17 (4), 2207-2216.). In this study, we have further characterized the elements that mediate L1URE function. These studies indicate that the L1 upstream regulatory element (L1 URE) contains a complex RNA architecture that serves to repress gene expression through multiple sub-effectors. The L1URE functions when located upstream of a heterologous poly (A) site, and is able to strongly suppress steady state m

  2. Candidate regulatory sequence elements for cell cycle-dependent transcription in Saccharomyces cerevisiae.


    Wolfsberg, T G; Gabrielian, A E; Campbell, M J; Cho, R J; Spouge, J L; Landsman, D


    Recent developments in genome-wide transcript monitoring have led to a rapid accumulation of data from gene expression studies. Such projects highlight the need for methods to predict the molecular basis of transcriptional coregulation. A microarray project identified the 420 yeast transcripts whose synthesis displays cell cycle-dependent periodicity. We present here a statistical technique we developed to identify the sequence elements that may be responsible for this cell cycle regulation. Because most gene regulatory sites contain a short string of highly conserved nucleotides, any such strings that are involved in gene regulation will occur frequently in the upstream regions of the genes that they regulate, and rarely in the upstream regions of other genes. Our strategy therefore utilizes statistical procedures to identify short oligomers, five or six nucleotides in length, that are over-represented in upstream regions of genes whose expression peaks at the same phase of the cell cycle. We report, with a high level of confidence, that 9 hexamers and 12 pentamers are over-represented in the upstream regions of genes whose expression peaks at the early G(1), late G(1), S, G(2), or M phase of the cell cycle. Some of these sequence elements show a preference for a particular orientation, and others, through a separate statistical test, for a particular position upstream of the ATG start codon. The finding that the majority of the statistically significant sequence elements are located in late G(1) upstream regions correlates with other experiments that identified the late G(1)/early S boundary as a vital cell cycle control point. Our results highlight the importance of MCB, an element implicated previously in late G(1)/early S gene regulation, as most of the late G(1) oligomers contain the MCB sequence or variations thereof. It is striking that most MCB-like sequences localize to a specific region upstream of the ATG start codon. Additional sequences that we have

  3. Myosin regulatory elements as vectors for gene transfer by intramuscular injection.


    Skarli, M; Kiri, A; Vrbova, G; Lee, C A; Goldspink, G


    Intramuscular injection of plasmid constructs promises to be an effective way of carrying out gene therapy for muscle disorders as well as using muscle as an in vivo expression system for disorders that involve the gene product being secreted into the bloodstream. The effectiveness of this method depends on the design of the cassette used for the expression of the cDNA of the introduced gene. We tested the levels of expression achieved by a number of muscle-specific promoters and a myosin light chain enhancer when spliced to the reporter gene chloramphenicol acetyltransferase (CAT), in vitro and in vivo by injection into fast and slow muscles of the mouse. The results show that the highest levels of expression are achieved by a combination of a truncated myosin heavy chain promoter and the enhancer, and that a whole range of expression levels is obtained with the other combinations tested. The data show that a cassette based on these elements should provide efficient vectors for the introduction and expression of genes following intramuscular injection of naked DNA.

  4. Heat shock regulatory elements are present in telomeric repeats of Chironomus thummi.


    Martinez, J L; Sanchez-Elsner, T; Morcillo, G; Diez, J L


    As in other Diptera, the telomeres of Chironomus thummi lack canonical short telomerase-specified repeats and instead contain complex sequences. They react to heat shock and other stress treatments by forming giant puffs at some chromosome termini, which are visible in polytene cells. All telomeres, except the telocentric end of chromosome four (4L), consist of large blocks of repeats, 176 bp in length. Three subfamilies of telomeric sequences have been found to show different distribution patterns between chromosome ends. TsA and TsC are characteristic of telomeres 3R and 4R, respectively, whereas TsB is present in the other non-telocentric telomeres. Heat shock transcription regulatory elements have been identified in the telomeric sequences, appearing differentially represented in the three subfamilies, but otherwise rather similar in size and sequence. Interestingly, TsA and TsB repeats share the well-conserved heat shock element (HSE) and GAGA motif, while the TATA box is only present in the former. Neither a HSE nor a TATA box appear in TsC repeats. Moreover, experimental data indicate that the HSE is functionally active in binding heat shock transcription factor (HSF). These results provide, for the first time, a molecular basis for the effect of heat shock on C.thummi telomeres and might also explain the different behaviour they show. A positive correlation between the presence of HSE and telomeric puffing and transcription under heat shock was demonstrated. This was also confirmed in the sibling species Chironomus piger. The significance of heat shock activation of telomeric repeats in relation to telomeric function is unknown at present, but it might be compared to the behaviour of other non-heat shock protein coding sequences, such as SINE-like and LINE-like retroelements, which have been reported to be activated by stress.

  5. A transcriptional regulatory element is associated with a nuclease-hypersensitive site in the pol gene of human immunodeficiency virus type 1.

    PubMed Central

    Van Lint, C; Ghysdael, J; Paras, P; Burny, A; Verdin, E


    Analysis of the chromatin organization of the integrated human immunodeficiency virus type 1 (HIV-1) genome has previously revealed a major constitutive DNase I-hypersensitive site associated with the pol gene (E. Verdin, J. Virol. 65:6790-6799, 1991). In the present report, high-resolution mapping of this site with DNase I and micrococcal nuclease identified a nucleosome-free region centered around nucleotides (nt) 4490 to 4766. A 500-bp fragment encompassing this hypersensitive site (nt 4481 to 4982) exhibited transcription-enhancing activity (two- to threefold) when it was cloned in its natural position with respect to the HIV-1 promoter after transient transfection in U937 and CEM cells. Using in vitro footprinting and gel shift assays, we have identified four distinct binding sites for nuclear proteins within this positive regulatory element. Site B (nt 4519 to 4545) specifically bound four distinct nuclear protein complexes: a ubiquitous factor, a T-cell-specific factor, a B-cell-specific factor, and the monocyte/macrophage- and B-cell-specific transcription factor PU.1/Spi-1. In most HIV-1 isolates in which this PU box was not conserved, it was replaced by a binding site for the related factor Ets1. Factors binding to site C (nt 4681 to 4701) had a DNA-binding specificity similar to that of factors binding to site B, except for PU.1/Spi-1. A GC box containing a binding site for Sp1 was identified (nt 4623 to 4631). Site D (nt 4816 to 4851) specifically bound a ubiquitously expressed factor. These results identify a transcriptional regulatory element associated with a nuclease-hypersensitive site in the pol gene of HIV-1 and suggest that its activity may be controlled by a complex interplay of cis-regulatory elements. Images PMID:8139041

  6. A Transposable Element within the Non-canonical Telomerase RNA of Arabidopsis thaliana Modulates Telomerase in Response to DNA Damage

    PubMed Central

    Xu, Hengyi; Nelson, Andrew D. L.; Shippen, Dorothy E.


    Long noncoding RNAs (lncRNAs) have emerged as critical factors in many biological processes, but little is known about how their regulatory functions evolved. One of the best-studied lncRNAs is TER, the essential RNA template for telomerase reverse transcriptase. We previously showed that Arabidopsis thaliana harbors three TER isoforms: TER1, TER2 and TER2S. TER1 serves as a canonical telomere template, while TER2 is a novel negative regulator of telomerase activity, induced in response to double-strand breaks (DSBs). TER2 contains a 529 nt intervening sequence that is removed along with 36 nt at the RNA 3’ terminus to generate TER2S, an RNA of unknown function. Here we investigate how A. thaliana TER2 acquired its regulatory function. Using data from the 1,001 Arabidopsis genomes project, we report that the intervening sequence within TER2 is derived from a transposable element termed DSB responsive element (DRE). DRE is found in the TER2 loci of most but not all A. thaliana accessions. By analyzing accessions with (TER2) and without DRE (TER2Δ) we demonstrate that this element is responsible for many of the unique properties of TER2, including its enhanced binding to TERT and telomerase inhibitory function. We show that DRE destabilizes TER2, and further that TER2 induction by DNA damage reflects increased RNA stability and not increased transcription. DRE-mediated changes in TER2 stability thus provide a rapid and sensitive switch to fine-tune telomerase enzyme activity. Altogether, our data shows that invasion of the TER2 locus by a small transposon converted this lncRNA into a DNA damage sensor that modulates telomerase enzyme activity in response to genome assault. PMID:26075395

  7. Isolation of Alcohol Dehydrogenase cDNA and Basal Regulatory Region from Metroxylon sagu

    PubMed Central

    Wee, Ching Ching; Roslan, Hairul Azman


    Alcohol dehydrogenase (Adh) is a versatile enzyme involved in many biochemical pathways in plants such as in germination and stress tolerance. Sago palm is plant with much importance to the state of Sarawak as one of the most important crops that bring revenue with the advantage of being able to withstand various biotic and abiotic stresses such as heat, pathogens, and water logging. Here we report the isolation of sago palm Adh cDNA and its putative promoter region via the use of rapid amplification of cDNA ends (RACE) and genomic walking. The isolated cDNA was characterized and determined to be 1464 bp long encoding for 380 amino acids. BLAST analysis showed that the Adh is similar to the Adh1 group with 91% and 85% homology with Elaeis guineensis and Washingtonia robusta, respectively. The putative basal msAdh1 regulatory region was further determined to contain promoter signals of TATA and AGGA boxes and predicted amino acids analyses showed several Adh-specific motifs such as the two zinc-binding domains that bind to the adenosine ribose of the coenzyme and binding to alcohol substrate. A phylogenetic tree was also constructed using the predicted amino acid showed clear separation of Adh from bacteria and clustered within the plant Adh group. PMID:27335670

  8. Drosophila gypsy insulator and yellow enhancers regulate activity of yellow promoter through the same regulatory element.


    Melnikova, Larisa; Kostuchenko, Margarita; Silicheva, Margarita; Georgiev, Pavel


    There is ample evidence that the enhancers of a promoterless yellow locus in one homologous chromosome can activate the yellow promoter in the other chromosome where the enhancers are inactive or deleted, which is indicative of a high specificity of the enhancer-promoter interaction in yellow. In this paper, we have found that the yellow sequence from -100 to -69 is essential for stimulation of the heterologous eve (TATA-containing) and white (TATA-less) promoters by the yellow enhancers from a distance. However, the presence of this sequence is not required when the yellow enhancers are directly fused to the heterologous promoters or are activated by the yeast GAL4 activator. Unexpectedly, the same promoter proximal region defines previously described promoter-specific, long-distance repression of the yellow promoter by the gypsy insulator on the mod(mdg4) ( u1 ) background. These finding suggest that proteins bound to the -100 to -69 sequence are essential for communication between the yellow promoter and upstream regulatory elements.

  9. MicroRNA-33 regulates sterol regulatory element-binding protein 1 expression in mice

    PubMed Central

    Horie, Takahiro; Nishino, Tomohiro; Baba, Osamu; Kuwabara, Yasuhide; Nakao, Tetsushi; Nishiga, Masataka; Usami, Shunsuke; Izuhara, Masayasu; Sowa, Naoya; Yahagi, Naoya; Shimano, Hitoshi; Matsumura, Shigenobu; Inoue, Kazuo; Marusawa, Hiroyuki; Nakamura, Tomoyuki; Hasegawa, Koji; Kume, Noriaki; Yokode, Masayuki; Kita, Toru; Kimura, Takeshi; Ono, Koh


    MicroRNAs (miRs) are small non-protein-coding RNAs that bind to specific mRNAs and inhibit translation or promote mRNA degradation. Recent reports have indicated that miR-33, which is located within the intron of sterol regulatory element-binding protein (SREBP) 2, controls cholesterol homoeostasis and may be a potential therapeutic target for the treatment of atherosclerosis. Here we show that deletion of miR-33 results in marked worsening of high-fat diet-induced obesity and liver steatosis. Using miR-33−/−Srebf1+/− mice, we demonstrate that SREBP-1 is a target of miR-33 and that the mechanisms leading to obesity and liver steatosis in miR-33−/− mice involve enhanced expression of SREBP-1. These results elucidate a novel interaction between SREBP-1 and SREBP-2 mediated by miR-33 in vivo. PMID:24300912

  10. Profiling of conserved non-coding elements upstream of SHOX and functional characterisation of the SHOX cis-regulatory landscape

    PubMed Central

    Verdin, Hannah; Fernández-Miñán, Ana; Benito-Sanz, Sara; Janssens, Sandra; Callewaert, Bert; Waele, Kathleen De; Schepper, Jean De; François, Inge; Menten, Björn; Heath, Karen E.; Gómez-Skarmeta, José Luis; Baere, Elfride De


    Genetic defects such as copy number variations (CNVs) in non-coding regions containing conserved non-coding elements (CNEs) outside the transcription unit of their target gene, can underlie genetic disease. An example of this is the short stature homeobox (SHOX) gene, regulated by seven CNEs located downstream and upstream of SHOX, with proven enhancer capacity in chicken limbs. CNVs of the downstream CNEs have been reported in many idiopathic short stature (ISS) cases, however, only recently have a few CNVs of the upstream enhancers been identified. Here, we set out to provide insight into: (i) the cis-regulatory role of these upstream CNEs in human cells, (ii) the prevalence of upstream CNVs in ISS, and (iii) the chromatin architecture of the SHOX cis-regulatory landscape in chicken and human cells. Firstly, luciferase assays in human U2OS cells, and 4C-seq both in chicken limb buds and human U2OS cells, demonstrated cis-regulatory enhancer capacities of the upstream CNEs. Secondly, CNVs of these upstream CNEs were found in three of 501 ISS patients. Finally, our 4C-seq interaction map of the SHOX region reveals a cis-regulatory domain spanning more than 1 Mb and harbouring putative new cis-regulatory elements. PMID:26631348

  11. Modular Utilization of Distal cis-Regulatory Elements Controls Ifng Gene Expression in T Cells Activated by Distinct Stimuli

    PubMed Central

    Balasubramani, Anand; Shibata, Yoichiro; Crawford, Gregory E.; Baldwin, Albert S.; Hatton, Robin D.; Weaver, Casey T.


    SUMMARY Distal cis-regulatory elements play essential roles in the T lineage-specific expression of cytokine genes. We have mapped interactions of three transacting factors – NF-κB, STAT4 and T-bet – with cis elements in the Ifng locus. We find that RelA is critical for optimal Ifng expression and is differentially recruited to multiple elements contingent upon T cell receptor (TCR) or interleukin-12 (IL-12) plus IL-18 signaling. RelA recruitment to at least four elements is dependent on T-bet-dependent remodeling of the Ifng locus and co-recruitment of STAT4. STAT4 and NF-κB therefore cooperate at multiple cis elements to enable NF-κB–dependent enhancement of Ifng expression. RelA recruitment to distal elements was similar in Th1 and Tc1 effector cells, although T-bet was dispensable in CD8 effectors. These results support a model of Ifng regulation in which distal cis-regulatory elements differentially recruit key transcription factors in a modular fashion to initiate gene transcription induced by distinct activation signals. PMID:20643337

  12. An arthropod cis-regulatory element functioning in sensory organ precursor development dates back to the Cambrian

    PubMed Central


    Background An increasing number of publications demonstrate conservation of function of cis-regulatory elements without sequence similarity. In invertebrates such functional conservation has only been shown for closely related species. Here we demonstrate the existence of an ancient arthropod regulatory element that functions during the selection of neural precursors. The activity of genes of the achaete-scute (ac-sc) family endows cells with neural potential. An essential, conserved characteristic of proneural genes is their ability to restrict their own activity to single or a small number of progenitor cells from their initially broad domains of expression. This is achieved through a process called lateral inhibition. A regulatory element, the sensory organ precursor enhancer (SOPE), is required for this process. First identified in Drosophila, the SOPE contains discrete binding sites for four regulatory factors. The SOPE of the Drosophila asense gene is situated in the 5' UTR. Results Through a manual comparison of consensus binding site sequences we have been able to identify a SOPE in UTR sequences of asense-like genes in species belonging to all four arthropod groups (Crustacea, Myriapoda, Chelicerata and Insecta). The SOPEs of the spider Cupiennius salei and the insect Tribolium castaneum are shown to be functional in transgenic Drosophila. This would place the origin of this regulatory sequence as far back as the last common ancestor of the Arthropoda, that is, in the Cambrian, 550 million years ago. Conclusions The SOPE is not detectable by inter-specific sequence comparison, raising the possibility that other ancient regulatory modules in invertebrates might have escaped detection. PMID:20868489

  13. Functional conservation of Pax6 regulatory elements in humans and mice demonstrated with a novel transgenic reporter mouse

    PubMed Central

    Tyas, David A; Simpson, T Ian; Carr, Catherine B; Kleinjan, Dirk A; van Heyningen, Veronica; Mason, John O; Price, David J


    Background The Pax6 transcription factor is expressed during development in the eyes and in specific CNS regions, where it is essential for normal cell proliferation and differentiation. Mice lacking one or both copies of the Pax6 gene model closely humans with loss-of-function mutations in the PAX6 locus. The sequence of the Pax6/PAX6 protein is identical in mice and humans and previous studies have shown structural conservation of the gene's regulatory regions. Results We generated a transgenic mouse expressing green fluorescent protein (GFP) and neomycin resistance under the control of the entire complement of human PAX6 regulatory elements using a modified yeast artificial chromosome (YAC). Expression of GFP was studied in embryos from 9.5 days on and was confined to cells known to express Pax6. GFP expression was sufficiently strong that expressing cells could be distinguished from non-expressing cells using flow cytometry. Conclusion This work demonstrates the functional conservation of the regulatory elements controlling Pax6/PAX6 expression in mice and humans. The transgene provides an excellent tool for studying the functions of different Pax6/PAX6 regulatory elements in controlling Pax6 expression in animals that are otherwise normal. It will allow the analysis and isolation of cells in which Pax6 is activated, irrespective of the status of the endogenous locus. PMID:16674807

  14. Identification of positive and negative regulatory elements involved in the retinoic acid/cAMP induction of Fgf-3 transcription in F9 cells.

    PubMed Central

    Murakami, A; Grinberg, D; Thurlow, J; Dickson, C


    The proto-oncogene Fgf-3 has been implicated as an important signalling molecule in vertebrate development. In the mouse, it is expressed for a limited time at a multitude of sites from embryonic day 7 to birth. Transcription of Fgf-3 initiates at three promoter regions resulting in the generation of various mRNAs which nevertheless all encode the same protein products. A 1.7kb DNA fragment which encompasses these regions was joined to the CAT reporter gene and shown to function as a promoter in embryonal carcinoma cells. In stable transfectants the promoter retains its retinoic acid inducibility, initiating transcription at the same cap-sites as the endogenous gene. In differentiated F9 cells, transient transfection of progressive and targeted deletion mutants of the promoter region has revealed at least two positive and three negative regulatory elements. With one exception, loss of these elements was shown to dramatically affect promoter activity in stable transfectants of F9 cells. However the promoter remained inducible by retinoic acid to differing degrees, apart from deletions encompassing PS-4A which essentially abolished promoter activity in both undifferentiated and differentiated cells. The sequences of these potential regulatory regions were further defined using DNase-I footprinting, revealing some similarities to consensus binding sites for known transcription factors. Images PMID:8265348

  15. Proteomics to study DNA-bound and chromatin-associated gene regulatory complexes

    PubMed Central

    Wierer, Michael; Mann, Matthias


    High-resolution mass spectrometry (MS)-based proteomics is a powerful method for the identification of soluble protein complexes and large-scale affinity purification screens can decode entire protein interaction networks. In contrast, protein complexes residing on chromatin have been much more challenging, because they are difficult to purify and often of very low abundance. However, this is changing due to recent methodological and technological advances in proteomics. Proteins interacting with chromatin marks can directly be identified by pulldowns with synthesized histone tails containing posttranslational modifications (PTMs). Similarly, pulldowns with DNA baits harbouring single nucleotide polymorphisms or DNA modifications reveal the impact of those DNA alterations on the recruitment of transcription factors. Accurate quantitation – either isotope-based or label free – unambiguously pinpoints proteins that are significantly enriched over control pulldowns. In addition, protocols that combine classical chromatin immunoprecipitation (ChIP) methods with mass spectrometry (ChIP-MS) target gene regulatory complexes in their in-vivo context. Similar to classical ChIP, cells are crosslinked with formaldehyde and chromatin sheared by sonication or nuclease digested. ChIP-MS baits can be proteins in tagged or endogenous form, histone PTMs, or lncRNAs. Locus-specific ChIP-MS methods would allow direct purification of a single genomic locus and the proteins associated with it. There, loci can be targeted either by artificial DNA-binding sites and corresponding binding proteins or via proteins with sequence specificity such as TAL or nuclease deficient Cas9 in combination with a specific guide RNA. We predict that advances in MS technology will soon make such approaches generally applicable tools in epigenetics. PMID:27402878

  16. Structure of a Thyroid Hormone Receptor DNA-Binding Domain Homodimer Bound to an Inverted Palindrome DNA Response Element

    SciTech Connect

    Chen, Yi; Young, Matthew A.


    Thyroid hormone receptor (TR), as a member of the nuclear hormone receptor family, can recognize and bind different classes of DNA response element targets as either a monomer, a homooligomer, or a heterooligomer. We report here the first crystal structure of a homodimer TR DNA-binding domain (DBD) in complex with an inverted repeat class of thyroid response element (TRE). The structure shows a nearly symmetric structure of the TR DBD assembled on the F2 TRE where the base recognition contacts in the homodimer DNA complex are conserved relative to the previously published structure of a TR-9-cis-retinoic acid receptor heterodimer DNA complex. The new structure also reveals that the T-box region of the DBD can function as a structural hinge that enables a large degree of flexibility in the position of the C-terminal extension helix that connects the DBD to the ligand-binding domain. Although the isolated TR DBDs exist as monomers in solution, we have measured highly cooperative binding of the two TR DBD subunits onto the inverted repeat DNA sequence. This suggests that elements of the DBD can influence the specific TR oligomerization at target genes, and it is not just interactions between the ligand-binding domains that are responsible for TR oligomerization at target genes. Mutational analysis shows that intersubunit contacts at the DBD C terminus account for some, but not all, of the cooperative homodimer TR binding to the inverted repeat class TRE.

  17. Deformed protein binding sites and cofactor binding sites are required for the function of a small segment-specific regulatory element in Drosophila embryos.

    PubMed Central

    Zeng, C; Pinsonneault, J; Gellon, G; McGinnis, N; McGinnis, W


    How each of the homeotic selector proteins can regulate distinct sets of DNA target elements in embryos is not understood. Here we describe a detailed functional dissection of a small element that is specifically regulated by the Deformed homeotic protein. This 120 bp element (module E) is part of a larger 2.7 kb autoregulatory enhancer that maintains Deformed (Dfd) transcription in the epidermis of the maxillary and mandibular segments of Drosophila embryos. In vitro binding assays show that module E contains only one Dfd protein binding site. Mutations in the Dfd binding site that increase or decrease its in vitro affinity for Dfd protein generate parallel changes in the regulatory activity of module E in transgenic embryos, strong evidence that the in vitro-defined binding site is a direct target of Dfd protein in embryos. However, a monomer or multimer of the Dfd binding region alone is not sufficient to supply Dfd-dependent, segment-specific reporter gene expression. An analysis of a systematic series of clustered point mutations in module E revealed that an additional region containing an imperfect inverted repeat sequence is also required for the function of this homeotic protein response element. The Dfd binding site and the putative cofactor binding site(s) in the region of the inverted repeat are both necessary and in combination sufficient for the function of module E. Images PMID:7910795

  18. Translating the ENCyclopedia Of DNA Elements Project findings to the clinic: ENCODE's implications for eye disease.


    Sanfilippo, Paul G; Hewitt, Alex W


    Approximately 10 years after the Human Genome Project unravelled the sequence of our DNA, the ENCyclopedia Of DNA Elements (ENCODE) Project sought to interpret it. Data from the recently completed project have shed new light on the proportion of biologically active human DNA, assigning a biochemical role to much of the sequence previously considered to be 'junk'. Many of these newly catalogued functional elements represent epigenetic mechanisms involved in regulation of gene expression. Analogous to an Ishihara plate, a gene-coding region of DNA (target dots) only comes into context when the non-coding DNA (surrounding dots) is appreciated. In this review we provide an overview of the ENCODE project, discussing the significance of these data for ophthalmic research and eye disease. The novel insights afforded by the ENCODE project will in time allow for the development of new therapeutic strategies in the management of common blinding disorders.

  19. Control of mRNA decapping by positive and negative regulatory elements in the Dcp2 C-terminal domain

    PubMed Central

    He, Feng; Jacobson, Allan


    Decapping commits an mRNA to complete degradation and promotes general 5′ to 3′ decay, nonsense-mediated decay (NMD), and transcript-specific degradation. In Saccharomyces cerevisiae, a single decapping enzyme composed of a regulatory subunit (Dcp1) and a catalytic subunit (Dcp2) targets thousands of distinct substrate mRNAs. However, the mechanisms controlling this enzyme's in vivo activity and substrate specificity remain elusive. Here, using a genetic approach, we show that the large C-terminal domain of Dcp2 includes a set of conserved negative and positive regulatory elements. A single negative element inhibits enzymatic activity and controls the downstream functions of several positive elements. The positive elements recruit the specific decapping activators Edc3, Pat1, and Upf1 to form distinct decapping complexes and control the enzyme's substrate specificity and final activation. Our results reveal unforeseen regulatory mechanisms that control decapping enzyme activity and function in vivo, and define roles for several decapping activators in the regulation of mRNA decapping. PMID:26184073

  20. Decoy approach using RNA-DNA chimera oligonucleotides to inhibit the regulatory function of human immunodeficiency virus type 1 Rev protein.

    PubMed Central

    Nakaya, T; Iwai, S; Fujinaga, K; Sato, Y; Otsuka, E; Ikuta, K


    Human immunodeficiency virus type 1 (HIV-1) encodes two regulatory proteins, Tat and Rev, that bind to target RNA sequences. These are the trans-activation responsive (TAR) RNA and the Rev-responsive element (RRE), respectively. The Rev protein shifts RNA synthesis to viral transcripts by binding to the RRE within the env gene. In the present study we prepared a RNA-DNA chimera consisting of 29 or 31 nucleotides to inhibit the Rev regulatory function by means of the decoy approach. The chimera oligonucleotides (anti-Rev oligonucleotides [AROs]) contained an RNA "bubble" structure (13 oligonucleotides; the Rev-binding element in RRE) that bound Rev with a high affinity in an in vitro assay. The controls were RNA-DNA chimera oligonucleotides (negative control oligonucleotides [NCOs]) similar to ARO, but without the bubble structure, that bound with considerably less affinity to Rev. When the inhibitory effects of these decoys on HIV-1 replication were examined, we found that AROs, but no NCOs, reduced more than 90% of the HIV-1 production generated by productively infected human T-cell lines. The production of primary HIV-1 isolates in healthy donor-derived peripheral blood mononuclear cells was also similarly inhibited by AROs. In addition, the induction of viral mRNAs and antigens in latently HIV-1-infected ACH-2 cells by tumor necrosis factor alpha was specifically inhibited by AROs, but not by NCOs. No apparent cytotoxicity was caused by either decoy. Thus, the use of a Rev-binding element-based decoy, the RNA-DNA chimera oligonucleotide, may represent a safer approach to gene therapy for reducing the virus load in HIV-1-infected individuals. PMID:9021186

  1. Diverse activities of viral cis-acting RNA regulatory elements revealed using multicolor, long-term, single-cell imaging.


    Pocock, Ginger M; Zimdars, Laraine L; Yuan, Ming; Eliceiri, Kevin W; Ahlquist, Paul; Sherer, Nathan M


    Cis-acting RNA structural elements govern crucial aspects of viral gene expression. How these structures and other posttranscriptional signals affect RNA trafficking and translation in the context of single cells is poorly understood. Herein we describe a multicolor, long-term (>24 h) imaging strategy for measuring integrated aspects of viral RNA regulatory control in individual cells. We apply this strategy to demonstrate differential mRNA trafficking behaviors governed by RNA elements derived from three retroviruses (HIV-1, murine leukemia virus, and Mason-Pfizer monkey virus), two hepadnaviruses (hepatitis B virus and woodchuck hepatitis virus), and an intron-retaining transcript encoded by the cellular NXF1 gene. Striking behaviors include "burst" RNA nuclear export dynamics regulated by HIV-1's Rev response element and the viral Rev protein; transient aggregations of RNAs into discrete foci at or near the nuclear membrane triggered by multiple elements; and a novel, pulsiform RNA export activity regulated by the hepadnaviral posttranscriptional regulatory element. We incorporate single-cell tracking and a data-mining algorithm into our approach to obtain RNA element-specific, high-resolution gene expression signatures. Together these imaging assays constitute a tractable, systems-based platform for studying otherwise difficult to access spatiotemporal features of viral and cellular gene regulation.

  2. Identification of regulatory elements that control expression of the tbpBA operon in Neisseria gonorrhoeae.


    Vélez Acevedo, Rosuany N; Ronpirin, Chalinee; Kandler, Justin L; Shafer, William M; Cornelissen, Cynthia Nau


    Iron is an essential nutrient for survival and establishment of infection by Neisseria gonorrhoeae. The neisserial transferrin binding proteins (Tbps) comprise a bipartite system for iron acquisition from human transferrin. TbpA is the TonB-dependent transporter that accomplishes iron internalization. TbpB is a surface-exposed lipoprotein that makes the iron uptake process more efficient. Previous studies have shown that the genes encoding these proteins are arranged in a bicistronic operon, with the tbpB gene located upstream of tbpA and separated from it by an inverted repeat. The operon is under the control of the ferric uptake regulator (Fur); however, promoter elements necessary for regulated expression of the genes have not been experimentally defined. In this study, putative regulatory motifs were identified and confirmed by mutagenesis. Further examination of the sequence upstream of these promoter/operator motifs led to the identification of several novel repeats. We hypothesized that these repeats are involved in additional regulation of the operon. Insertional mutagenesis of regions upstream of the characterized promoter region resulted in decreased tbpB and tbpA transcript levels but increased protein levels for both TbpA and TbpB. Using RNA sequencing (RNA-Seq) technology, we determined that a long RNA was produced from the region upstream of tbpB. We localized the 5' endpoint of this transcript to between the two upstream insertions by qualitative RT-PCR. We propose that expression of this upstream RNA leads to optimized expression of the gene products from within the tbpBA operon.

  3. The alr-groEL1 operon in Mycobacterium tuberculosis: an interplay of multiple regulatory elements

    PubMed Central

    Bhat, Aadil H.; Pathak, Deepika; Rao, Alka


    Threonylcarbamoyladenosine is a universally conserved essential modification of tRNA that ensures translational fidelity in cellular milieu. TsaD, TsaB and TsaE are identified as tRNA-A37-threonylcarbamoyl (t6A)-transferase enzymes that have been reconstituted in vitro, in few bacteria recently. However, transcriptional organization and regulation of these genes are not known in any of these organisms. This study describes the intricate architecture of a complex multicistronic alr-groEL1 operon, harboring essential genes, namely tsaD, tsaB, tsaE, groES, groEL1, and alr (required for cell wall synthesis), and rimI encoding an N-α- acetyltransferase in Mycobacterium tuberculosis. Using northern blotting, RT-PCR and in vivo fluorescence assays, genes alr to groEL1 were found to constitute an ~6.3 kb heptacistronic operon with multiple internal promoters and an I-shaped intrinsic hairpin-like cis-regulatory element. A strong promoter PtsaD within the coding sequence of rimI gene is identified in M. tuberculosis, in addition. The study further proposes an amendment in the known bicistronic groESL1 operon annotation by providing evidence that groESL1 is co-transcribed as sub-operon of alr-groEL1 operon. The architecture of alr-groEL1 operon, conservation of the genetic context and a mosaic transcriptional profile displayed under various stress conditions convincingly suggest the involvement of this operon in stress adaptation in M. tuberculosis. PMID:28256563

  4. Activation of Sterol Regulatory Element Binding Factors by Fenofibrate and Gemfibrozil Stimulates Myelination in Zebrafish

    PubMed Central

    Ashikawa, Yoshifumi; Nishimura, Yuhei; Okabe, Shiko; Sasagawa, Shota; Murakami, Soichiro; Yuge, Mizuki; Kawaguchi, Koki; Kawase, Reiko; Tanaka, Toshio


    Oligodendrocytes are major myelin-producing cells and play essential roles in the function of a healthy nervous system. However, they are also one of the most vulnerable neural cell types in the central nervous system (CNS), and myelin abnormalities in the CNS are found in a wide variety of neurological disorders, including multiple sclerosis, adrenoleukodystrophy, and schizophrenia. There is an urgent need to identify small molecular weight compounds that can stimulate myelination. In this study, we performed comparative transcriptome analysis to identify pharmacodynamic effects common to miconazole and clobetasol, which have been shown to stimulate myelination by mouse oligodendrocyte progenitor cells (OPCs). Of the genes differentially expressed in both miconazole- and clobetasol-treated mouse OPCs compared with untreated cells, we identified differentially expressed genes (DEGs) common to both drug treatments. Gene ontology analysis revealed that these DEGs are significantly associated with the sterol biosynthetic pathway, and further bioinformatics analysis suggested that sterol regulatory element binding factors (SREBFs) might be key upstream regulators of the DEGs. In silico screening of a public database for chemicals associated with SREBF activation identified fenofibrate, a peroxisome proliferator-activated receptor α (PPARα) agonist, as a drug that increases the expression of known SREBF targets, raising the possibility that fenofibrate may also stimulate myelination. To test this, we performed in vivo imaging of zebrafish expressing a fluorescent reporter protein under the control of the myelin basic protein (mbp) promoter. Treatment of zebrafish with fenofibrate significantly increased expression of the fluorescent reporter compared with untreated zebrafish. This increase was attenuated by co-treatment with fatostatin, a specific inhibitor of SREBFs, confirming that the fenofibrate effect was mediated via SREBFs. Furthermore, incubation of zebrafish

  5. Nucleotide-specific recognition of iron-responsive elements by iron regulatory protein 1.


    Selezneva, Anna I; Walden, William E; Volz, Karl W


    IRP1 [iron regulatory protein (IRP) 1] is a bifunctional protein with mutually exclusive end-states. In one mode of operation, IRP1 binds iron-responsive element (IRE) stem-loops in messenger RNAs encoding proteins of iron metabolism to control their rate of translation. In its other mode, IRP1 serves as cytoplasmic aconitase to correlate iron availability with the energy and oxidative stress status of the cell. IRP1/IRE binding occurs through two separate interfaces, which together contribute about two-dozen hydrogen bonds. Five amino acids make base-specific contacts and are expected to contribute significantly to binding affinity and specificity of this protein:RNA interaction. In this mutagenesis study, each of the five base-specific amino acids was changed to alter binding at each site. Analysis of IRE binding affinity and translational repression activity of the resulting IRP1 mutants showed that four of the five contact points contribute uniquely to the overall binding affinity of the IRP1:IRE interaction, while one site was found to be unimportant. The stronger-than-expected effect on binding affinity of mutations at Lys379 and Ser681, residues that make contact with the conserved nucleotides G16 and C8, respectively, identified them as particularly critical for providing specificity and stability to IRP1:IRE complex formation. We also show that even though the base-specific RNA-binding residues are not part of the aconitase active site, their substitutions can affect the aconitase activity of holo-IRP1, positively or negatively.

  6. Overview of regulatory strategies and molecular elements in metabolic engineering of bacteria.


    Wang, Tianwen; Ma, Xingyuan; Du, Guocheng; Chen, Jian


    From a viewpoint of biotechnology, metabolic engineering mainly aims to change the natural status of a pathway in a microorganism towards the overproduction of certain bioproducts. The biochemical nature of a pathway implies us that changed pathway is often the collective results of altered behavior of the metabolic enzymes encoded by corresponding genes. By finely modulating the expression of these genes or the properties of the enzyme, we can gain efficient control on the pathway. In this article, we reviewed the typical methods that have been applied to regulate the expression of genes in metabolic engineering. These methods are grouped according to the operation targets in a typical gene. The transcription of a gene is controlled by an indispensable promoter. By utilizing promoters with different strengths, expected levels of expression can be easily achieved, and screening a promoter library may find suitable mutant promoters that can provide tunable expression of a gene. Auto-responsive promoter (quorum sensing (QS)-based or oxygen-inducible) simplifies the induction process by driving the expression of a gene in an automated manner. Light responsive promoter enables reversible and noninvasive control on gene activity, providing a promising method in controlling gene expression with time and space resolution in metabolic engineering involving complicated genetic circuits. Through directed evolution and/or rational design, the encoding sequences of a gene can be altered, leading to the possibly most profound changes in properties of a metabolic enzyme. Introducing an engineered riboswitch in mRNA can make it a regulatory molecule at the same time; ribosomal binding site is commonly engineered to be more attractive for a ribosome through design. Terminator of a gene will affect the stability of an mRNA, and intergenic region will influence the expression of many related genes. Improving the performance of these elements are generally the main activities in

  7. DNA Methylation of Regulatory Regions of Imprinted Genes at Birth and Its Relation to Infant Temperament

    PubMed Central

    Fuemmeler, Bernard F.; Lee, Chien-Ti; Soubry, Adelheid; Iversen, Edwin S.; Huang, Zhiqing; Murtha, Amy P.; Schildkraut, Joellen M.; Jirtle, Randy L.; Murphy, Susan K.; Hoyo, Cathrine


    BACKGROUND DNA methylation of the differentially methylated regions (DMRs) of imprinted genes is relevant to neurodevelopment. METHODS DNA methylation status of the DMRs of nine imprinted genes in umbilical cord blood leukocytes was analyzed in relation to infant behaviors and temperament (n = 158). RESULTS MEG3 DMR levels were positively associated with internalizing (β = 0.15, P = 0.044) and surgency (β = 0.19, P = 0.018) behaviors, after adjusting for birth weight, gender, gestational age at birth, maternal age at delivery, race/ethnicity, education level, smoking status, parity, and a history of anxiety or depression. Higher methylation levels at the intergenic MEG3-IG methylation regions were associated with surgency (β = 0.28, P = 0.0003) and PEG3 was positively related to externalizing (β = 0.20, P = 0.01) and negative affectivity (β = 0.18, P = 0.02). CONCLUSION While the small sample size limits inference, these pilot data support gene-specific associations between epigenetic differences in regulatory regions of imprinted domains at birth and later infant temperament. PMID:27920589

  8. Chromatin Properties of Regulatory DNA Probed by Manipulation of Transcription Factors

    PubMed Central

    Sharov, Alexei A.; Nishiyama, Akira; Qian, Yong; Dudekula, Dawood B.; Longo, Dan L.; Schlessinger, David


    Abstract Transcription factors (TFs) bind to DNA and regulate the transcription of nearby genes. However, only a small fraction of TF binding sites have such regulatory effects. Here we search for the predictors of functional binding sites by carrying out a systematic computational screening of a variety of contextual factors (histone modifications, nuclear lamin-bindings, and cofactor bindings). We used regression analysis to test if contextual factors are associated with upregulation or downregulation of neighboring genes following the induction or knockdown of the 9 TFs in mouse embryonic stem (ES) cells. Functional TF binding sites appeared to be either active (i.e., bound by P300, CHD7, mediator, cohesin, and SWI/SNF) or repressed (i.e., with H3K27me3 histone marks and bound by Polycomb factors). Active binding sites mediated the downregulation of nearby genes upon knocking down the activating TFs or inducing repressors. Repressed TF binding sites mediated the upregulation of nearby genes (e.g., poised developmental regulators) upon inducing TFs. In addition, repressed binding sites mediated repressive effects of TFs, identified by the downregulation of target genes after the induction of TFs or by the upregulation of target genes after the knockdown of TFs. The contextual factors associated with functions of DNA-bound TFs were used to improve the identification of candidate target genes regulated by TFs. PMID:24918633

  9. Promoter elements of the PHR1 gene of Saccharomyces cerevisiae and their roles in the response to DNA damage.

    PubMed Central

    Sancar, G B; Ferris, R; Smith, F W; Vandeberg, B


    The PHR1 gene of Saccharomyces cerevisiae encodes the apoenzyme for the DNA repair enzyme photolyase. PHR1 transcription is induced in response to 254 nm radiation and a variety of chemical damaging agents. We report here the identification of promoter elements required for PHR1 expression. Transcription is regulated primarily through three sequence elements clustered within a 120 bp region immediately upstream of the translational start site. A 20 bp interrupted palindrome comprises UASPHR1 and is responsible for 80-90% of basal and induced expression. UASPHR1 alone can activate transcription of a CYC1 minimal promoter but does not confer damage responsiveness. In the intact PHR1 promoter UAS function is dependent upon an upstream essential sequence (UES). URSPHR1 contains a binding site for the damage-responsive repressor Prp; consistent with this role, deletion or specific mutations of the URS increase basal level expression and decrease the induction ratio. Deletion of URSPHR1 also eliminates the requirement for UESPHR1 for promoter activation, indicating that the UES attenuates Prp-mediated repression. Sequences within UASPHR1 are similar to regulatory sequences found upstream of both damage responsive and nonresponsive genes involved in DNA repair and metabolism. PMID:7501452

  10. Genome Sequencing of Autism-Affected Families Reveals Disruption of Putative Noncoding Regulatory DNA

    PubMed Central

    Turner, Tychele N.; Hormozdiari, Fereydoun; Duyzend, Michael H.; McClymont, Sarah A.; Hook, Paul W.; Iossifov, Ivan; Raja, Archana; Baker, Carl; Hoekzema, Kendra; Stessman, Holly A.; Zody, Michael C.; Nelson, Bradley J.; Huddleston, John; Sandstrom, Richard; Smith, Joshua D.; Hanna, David; Swanson, James M.; Faustman, Elaine M.; Bamshad, Michael J.; Stamatoyannopoulos, John; Nickerson, Deborah A.; McCallion, Andrew S.; Darnell, Robert; Eichler, Evan E.


    We performed whole-genome sequencing (WGS) of 208 genomes from 53 families affected by simplex autism. For the majority of these families, no copy-number variant (CNV) or candidate de novo gene-disruptive single-nucleotide variant (SNV) had been detected by microarray or whole-exome sequencing (WES). We integrated multiple CNV and SNV analyses and extensive experimental validation to identify additional candidate mutations in eight families. We report that compared to control individuals, probands showed a significant (p = 0.03) enrichment of de novo and private disruptive mutations within fetal CNS DNase I hypersensitive sites (i.e., putative regulatory regions). This effect was only observed within 50 kb of genes that have been previously associated with autism risk, including genes where dosage sensitivity has already been established by recurrent disruptive de novo protein-coding mutations (ARID1B, SCN2A, NR3C2, PRKCA, and DSCAM). In addition, we provide evidence of gene-disruptive CNVs (in DISC1, WNT7A, RBFOX1, and MBD5), as well as smaller de novo CNVs and exon-specific SNVs missed by exome sequencing in neurodevelopmental genes (e.g., CANX, SAE1, and PIK3CA). Our results suggest that the detection of smaller, often multiple CNVs affecting putative regulatory elements might help explain additional risk of simplex autism. PMID:26749308

  11. Plasticity in cell defence: access to and reactivity of critical protein residues and DNA response elements.


    Goldring, Chris; Kitteringham, Neil; Jenkins, Rosalind; Copple, Ian; Jeannin, Jean-Francois; Park, B Kevin


    Cellular and whole organ defence against pathogenic or chemical challenge is manifest as an adaptive response. Where appropriate, this may lead to induction of a cellular defence programme, thereby enhancing cell survival. When the challenge is overwhelming, the defence is breached and a switch is made to yield cell death, either by apoptosis or necrosis. Thus, a cell will defend itself where possible, but in extremis, it may recognise the futility of its resistance and allow itself to die. Transcription factor activation and access to the DNA regulatory elements that control a particular pattern of expression of defence genes is a major issue that may ultimately decide the fate of a cell in a changed environment. It is possible to visualise the access to the nucleus and to the genome, of paradigm gene loci or transcription factors, using a number of molecular techniques such as chromatin immunoprecipitation, in vivo footprinting and live/whole cell imaging. These methods are informative as to the array of transcription factors that may regulate a given gene, as well as the transitory nature of the transcriptional activation. The initial triggering of active transcription factor complexes typically occurs within the cytoplasm of the cell. Protein-protein interactions and signal transduction pathways, elucidated using a classical molecular genetics approach, have long been recognised as pivotal to the initial control of the levels and activity of transcription factors. We can now visualise modifications in critical residues of transcription factors and regulators during cellular response to chemical stress. These modifications may yield enhanced or repressed activity of transcription factors, they may be non-covalent or covalent, and they may occur in response to a variety of classes of chemicals. Such promiscuous signalling can provide plasticity in the cellular response to a wide array of chemical agents.

  12. The Responses of Arabidopsis Early Light-Induced Protein2 to Ultraviolet B, High Light, and Cold Stress Are Regulated by a Transcriptional Regulatory Unit Composed of Two Elements1[OPEN

    PubMed Central

    Hayami, Natsuki; Sakai, Yusaku; Kimura, Mitsuhiro; Saito, Tatsunori; Tokizawa, Mutsutomo; Iuchi, Satoshi; Kurihara, Yukio; Matsui, Minami; Nomoto, Mika; Tada, Yasuomi; Yamamoto, Yoshiharu Y.


    The Arabidopsis (Arabidopsis thaliana) Early Light-Induced Protein (ELIP) is thought to act as a photoprotectant, reducing the damaging effects of high light (HL). Expression of ELIP2 is activated by multiple environmental stresses related to photoinhibition. We have identified putative regulatory elements in an ELIP2 promoter using an octamer-based frequency comparison method, analyzed the role of these elements using synthetic promoters, and revealed a key transcriptional regulatory unit for ultraviolet B (UV-B) radiation, HL, and cold stress responses. The unit is composed of two elements, designated as Elements A (TACACACC) and B (GGCCACGCCA), and shows functionality only when paired. Our genome-wide correlation analysis between possession of these elements in the promoter region and expression profiles in response to UV-B, HL, and cold suggests that Element B receives and integrates these multiple stress signals. In vitro protein-DNA binding assays revealed that LONG HYPOCOTYL5 (HY5), a basic domain-Leucine zipper transcription factor, directly binds to Element B. In addition, mutant analysis of HY5 showed partial involvement in the UV-B and HL responses but not in the cold stress response. These results suggest that signals for UV-B, HL, and cold stress join at Element B, which recognizes the signals of multiple transcription factors, including HY5. PMID:26175515

  13. Evolutionary age of repetitive element subfamilies and sensitivity of DNA methylation to airborne pollutants

    PubMed Central


    Background Repetitive elements take up >40% of the human genome and can change distribution through transposition, thus generating subfamilies. Repetitive element DNA methylation has associated with several diseases and environmental exposures, including exposure to airborne pollutants. No systematic analysis has yet been conducted to examine the effects of exposures across different repetitive element subfamilies. The purpose of the study is to evaluate sensitivity of DNA methylation in differentially‒evolved LINE, Alu, and HERV subfamilies to different types of airborne pollutants. Methods We sampled a total of 120 male participants from three studies (20 high-, 20 low-exposure in each study) of steel workers exposed to metal-rich particulate matter (measured as PM10) (Study 1); gas-station attendants exposed to air benzene (Study 2); and truck drivers exposed to traffic-derived elemental carbon (Study 3). We measured methylation by bisulfite-PCR-pyrosequencing in 10 differentially‒evolved repetitive element subfamilies. Results High-exposure groups exhibited subfamily-specific methylation differences compared to low-exposure groups: L1PA2 showed lower DNA methylation in steel workers (P=0.04) and gas station attendants (P=0.03); L1Ta showed lower DNA methylation in steel workers (P=0.02); AluYb8 showed higher DNA methylation in truck drivers (P=0.05). Within each study, dose–response analyses showed subfamily-specific correlations of methylation with exposure levels. Interaction models showed that the effects of the exposures on DNA methylation were dependent on the subfamily evolutionary age, with stronger effects on older LINEs from PM10 (p‒interaction=0.003) and benzene (p‒interaction=0.04), and on younger Alus from PM10 (p-interaction=0.02). Conclusions The evolutionary age of repetitive element subfamilies determines differential susceptibility of DNA methylation to airborne pollutants. PMID:23855992

  14. Surveying DNA Elements within Functional Genes of Heterocyst-Forming Cyanobacteria.


    Hilton, Jason A; Meeks, John C; Zehr, Jonathan P


    Some cyanobacteria are capable of differentiating a variety of cell types in response to environmental factors. For instance, in low nitrogen conditions, some cyanobacteria form heterocysts, which are specialized for N2 fixation. Many heterocyst-forming cyanobacteria have DNA elements interrupting key N2 fixation genes, elements that are excised during heterocyst differentiation. While the mechanism for the excision of the element has been well-studied, many questions remain regarding the introduction of the elements into the cyanobacterial lineage and whether they have been retained ever since or have been lost and reintroduced. To examine the evolutionary relationships and possible function of DNA sequences that interrupt genes of heterocyst-forming cyanobacteria, we identified and compared 101 interruption element sequences within genes from 38 heterocyst-forming cyanobacterial genomes. The interruption element lengths ranged from about 1 kb (the minimum able to encode the recombinase responsible for element excision), up to nearly 1 Mb. The recombinase gene sequences served as genetic markers that were common across the interruption elements and were used to track element evolution. Elements were found that interrupted 22 different orthologs, only five of which had been previously observed to be interrupted by an element. Most of the newly identified interrupted orthologs encode proteins that have been shown to have heterocyst-specific activity. However, the presence of interruption elements within genes with no known role in N2 fixation, as well as in three non-heterocyst-forming cyanobacteria, indicates that the processes that trigger the excision of elements may not be limited to heterocyst development or that the elements move randomly within genomes. This comprehensive analysis provides the framework to study the history and behavior of these unique sequences, and offers new insight regarding the frequency and persistence of interruption elements in

  15. Surveying DNA Elements within Functional Genes of Heterocyst-Forming Cyanobacteria

    PubMed Central

    Hilton, Jason A.; Meeks, John C.; Zehr, Jonathan P.


    Some cyanobacteria are capable of differentiating a variety of cell types in response to environmental factors. For instance, in low nitrogen conditions, some cyanobacteria form heterocysts, which are specialized for N2 fixation. Many heterocyst-forming cyanobacteria have DNA elements interrupting key N2 fixation genes, elements that are excised during heterocyst differentiation. While the mechanism for the excision of the element has been well-studied, many questions remain regarding the introduction of the elements into the cyanobacterial lineage and whether they have been retained ever since or have been lost and reintroduced. To examine the evolutionary relationships and possible function of DNA sequences that interrupt genes of heterocyst-forming cyanobacteria, we identified and compared 101 interruption element sequences within genes from 38 heterocyst-forming cyanobacterial genomes. The interruption element lengths ranged from about 1 kb (the minimum able to encode the recombinase responsible for element excision), up to nearly 1 Mb. The recombinase gene sequences served as genetic markers that were common across the interruption elements and were used to track element evolution. Elements were found that interrupted 22 different orthologs, only five of which had been previously observed to be interrupted by an element. Most of the newly identified interrupted orthologs encode proteins that have been shown to have heterocyst-specific activity. However, the presence of interruption elements within genes with no known role in N2 fixation, as well as in three non-heterocyst-forming cyanobacteria, indicates that the processes that trigger the excision of elements may not be limited to heterocyst development or that the elements move randomly within genomes. This comprehensive analysis provides the framework to study the history and behavior of these unique sequences, and offers new insight regarding the frequency and persistence of interruption elements in

  16. The immunogenicity of viral haemorragic septicaemia rhabdovirus (VHSV) DNA vaccines can depend on plasmid regulatory sequences.


    Chico, V; Ortega-Villaizan, M; Falco, A; Tafalla, C; Perez, L; Coll, J M; Estepa, A


    A plasmid DNA encoding the viral hemorrhagic septicaemia virus (VHSV)-G glycoprotein under the control of 5' sequences (enhancer/promoter sequence plus both non-coding 1st exon and 1st intron sequences) from carp beta-actin gene (pAE6-G(VHSV)) was compared to the vaccine plasmid usually described the gene expression is regulated by the human cytomegalovirus (CMV) immediate-early promoter (pMCV1.4-G(VHSV)). We observed that these two plasmids produced a markedly different profile in the level and time of expression of the encoded-antigen, and this may have a direct effect upon the intensity and suitability of the in vivo immune response. Thus, fish genetic immunisation assays were carried out to study the immune response of both plasmids. A significantly enhanced specific-antibody response against the viral glycoprotein was found in the fish immunised with pAE6-G(VHSV). However, the protective efficacy against VHSV challenge conferred by both plasmids was similar. Later analysis of the transcription profile of a set of representative immune-related genes in the DNA immunized fish suggested that depending on the plasmid-related regulatory sequences controlling its expression, the plasmid might activate distinct patterns of the immune system. All together, the results from this study mainly point out that the selection of a determinate encoded-antigen/vector combination for genetic immunisation is of extraordinary importance in designing optimised DNA vaccines that, when required for inducing protective immune response, could elicit responses biased to antigen-specific antibodies or cytotoxic T cells generation.

  17. A Coxiella burnetti repeated DNA element resembling a bacterial insertion sequence.

    PubMed Central

    Hoover, T A; Vodkin, M H; Williams, J C


    A DNA fragment located on the 3' side of the Coxiella burnetii htpAB operon was determined by Southern blotting to exist in approximately 19 copies in the Nine Mile I genome. The DNA sequences of this htpAB-associated repetitive element and two other independent copies were analyzed to determine the size and nature of the element. The three copies of the element were 1,450, 1,452, and 1,458 bp long, with less than 2% divergence among the three sequences. Several features characteristic of bacterial insertion sequences were discovered. These included a single significant open reading frame that would encode a 367-amino-acid polypeptide which was predicted to be highly basic, to have a DNA-binding helix-turn-helix motif, to have a leucine zipper motif, and to have homology to polypeptides found in several other bacterial insertion sequences. Identical 7-bp inverted repeats were found at the ends of all three copies of the element. However, duplications generated by many bacterial mobile elements in the recipient DNA during insertion events did not flank the inverted repeats of any of the three C. burnetii elements examined. A second pair of inverted repeats that flanked the open reading frame was also found in all three copies of the element. Most of the divergence among the three copies of the element occurred in the region between the two inverted repeat sequences in the 3' end of the element. Despite the sequence changes, all three copies of the element have retained significant dyad symmetry in this region. Images PMID:1324903

  18. Invertrons, a class of structurally and functionally related genetic elements that includes linear DNA plasmids, transposable elements, and genomes of adeno-type viruses.

    PubMed Central

    Sakaguchi, K


    Invertrons are genetic elements composed of DNA with inverted terminal repeats at both ends, covalently bonded to terminal proteins involved in the initiation of DNA replication at both their 5' termini when they exist in the cytoplasm of their host in free form. They function as viruses, linear DNA plasmids, transposable elements, and sometimes combinations of two of these properties. They differ from retroviruses and related retro-type transposons which have direct repeats on both their genomic ends and exploit RNA intermediates for replication of their DNA. A model for replication and integration of invertrons is presented, as well as a model for transposition of transposable elements. PMID:2157134

  19. TFIIIC Bound DNA Elements in Nuclear Organization and Insulation

    PubMed Central

    Kirkland, Jacob G.; Raab, Jesse R.


    tRNA genes (tDNAs) have been known to have barrier insulator function in budding yeast, Saccharomyces cerevisiae, for over a decade. tDNAs also play a role in genome organization by clustering at sites in the nucleus and both of these functions are dependent on the transcription factor TFIIIC. More recently TFIIIC bound sites devoid of pol III, termed Extra-TFIIIC sites (ETC) have been identified in budding yeast and these sites also function as insulators and affect genome organization. Subsequent studies in Schizosaccharomyces pombe showed that TFIIIC bound sites were insulators and also functioned as Chromosome Organization Clamps (COC); tethering the sites to the nuclear periphery. Very recently studies have moved to mammalian systems where pol III genes and their associated factors have been investigated in both mouse and human cells. Short Interspersed Nuclear Elements (SINEs) that bind TFIIIC, function as insulator elements and tDNAs can also function as both enhancer -blocking and barrier insulators in these organisms. It was also recently shown that tDNAs cluster with other tDNAs and with ETCs but not with pol II transcribed genes. Intriguingly, TFIIIC is often found near pol II transcription start sites and it remains unclear what the consequences of TFIIIC based genomic organization are and what influence pol III factors have on pol II transcribed genes and vise versa. In this review we provide a comprehensive overview of the known data on pol III factors in insulation and genome organization and identify the many open questions that require further investigation. \\ PMID:23000638

  20. In Vitro Selection of a Single-Stranded DNA Molecular Recognition Element Specific for Bromacil

    PubMed Central

    Williams, Ryan M.; Kulick, Amanda R.; Yedlapalli, Srilakshmi; Battistella, Louisa; Hajiran, Cyrus J.; Sooter, Letha J.


    Bromacil is a widely used herbicide that is known to contaminate environmental systems. Due to the hazards it presents and inefficient detection methods, it is necessary to create a rapid and efficient sensing device. Towards this end, we have utilized a stringent in vitro selection method to identify single-stranded DNA molecular recognition elements (MRE) specific for bromacil. We have identified one MRE with high affinity (Kd = 9.6 nM) and specificity for bromacil compared to negative targets of selection and other pesticides. The selected ssDNA MRE will be useful as the sensing element in a field-deployable bromacil detection device. PMID:25400940

  1. DNA capture elements for rapid detection and identification of biological agents

    NASA Astrophysics Data System (ADS)

    Kiel, Johnathan L.; Parker, Jill E.; Holwitt, Eric A.; Vivekananda, Jeeva


    DNA capture elements (DCEs; aptamers) are artificial DNA sequences, from a random pool of sequences, selected for their specific binding to potential biological warfare agents. These sequences were selected by an affinity method using filters to which the target agent was attached and the DNA isolated and amplified by polymerase chain reaction (PCR) in an iterative, increasingly stringent, process. Reporter molecules were attached to the finished sequences. To date, we have made DCEs to Bacillus anthracis spores, Shiga toxin, Venezuelan Equine Encephalitis (VEE) virus, and Francisella tularensis. These DCEs have demonstrated specificity and sensitivity equal to or better than antibody.

  2. Differential contribution of cis-regulatory elements to higher order chromatin structure and expression of the CFTR locus

    PubMed Central

    Yang, Rui; Kerschner, Jenny L.; Gosalia, Nehal; Neems, Daniel; Gorsic, Lidija K.; Safi, Alexias; Crawford, Gregory E.; Kosak, Steven T.; Leir, Shih-Hsing; Harris, Ann


    Higher order chromatin structure establishes domains that organize the genome and coordinate gene expression. However, the molecular mechanisms controlling transcription of individual loci within a topological domain (TAD) are not fully understood. The cystic fibrosis transmembrane conductance regulator (CFTR) gene provides a paradigm for investigating these mechanisms. CFTR occupies a TAD bordered by CTCF/cohesin binding sites within which are cell-type-selective cis-regulatory elements for the locus. We showed previously that intronic and extragenic enhancers, when occupied by specific transcription factors, are recruited to the CFTR promoter by a looping mechanism to drive gene expression. Here we use a combination of CRISPR/Cas9 editing of cis-regulatory elements and siRNA-mediated depletion of architectural proteins to determine the relative contribution of structural elements and enhancers to the higher order structure and expression of the CFTR locus. We found the boundaries of the CFTR TAD are conserved among diverse cell types and are dependent on CTCF and cohesin complex. Removal of an upstream CTCF-binding insulator alters the interaction profile, but has little effect on CFTR expression. Within the TAD, intronic enhancers recruit cell-type selective transcription factors and deletion of a pivotal enhancer element dramatically decreases CFTR expression, but has minor effect on its 3D structure. PMID:26673704

  3. Identification of a non-canonical E-box motif as a regulatory element in the proximal promoter region of the apolipoprotein E gene.

    PubMed Central

    Salero, Enrique; Giménez, Cecilio; Zafra, Francisco


    We have used the yeast one-hybrid system to identify transcription factors with binding capability to specific sequences in proximal regions of the apolipoprotein E gene ( APOE ) promoter. The sequence between -113 and -80 nt, which contains regulatory elements in various cell types, was used as a bait to screen a human brain cDNA library. Four cDNA clones that encoded portions of the human upstream-stimulatory-factor (USF) transcription factor were isolated. Electrophoretic-mobility-shift assays ('EMSAs') using nuclear extracts from various human cell lines as well as from rat brain and liver revealed the formation of two DNA-protein complexes within the sequence CACCTCGTGAC (region -101/-91 of the APOE promoter) that show similarity to the E-box element. The retarded complexes contained USF1, as deduced from competition and supershift assays. Functional experiments using different APOE promoter-luciferase reporter constructs transiently transfected into U87, HepG2 or HeLa cell lines showed that mutations that precluded the formation of complexes decreased the basal activity of the promoter by about 50%. Overexpression of USF1 in U87 glioblastoma cells led to an increased activity of the promoter that was partially mediated by the atypical E-box. The stimulatory effect of USF1 was cell-type specific, as it was not observed in hepatoma HepG2 cells. Similarly, overexpression of a USF1 dominant-negative mutant decreased the basal activity of the promoter in glioblastoma, but not in hepatoma, cells. These data indicated that USF, and probably other related transcription factors, might be involved in the basal transcriptional machinery of APOE by binding to a non-canonical E-box motif within the proximal promoter. PMID:12444925

  4. Identification and characterization of promoters and cis-regulatory elements of genes involved in secondary metabolites production in hop (Humulus lupulus. L).


    Duraisamy, Ganesh Selvaraj; Mishra, Ajay Kumar; Kocabek, Tomas; Matoušek, Jaroslav


    Molecular and biochemical studies have shown that gene contains single or combination of different cis-acting regulatory elements are actively controlling the transcriptional regulation of associated genes, downstream effects of these result in the modulation of various biological pathways such as biotic/abiotic stress responses, hormonal responses to growth and development processes and secondary metabolite production. Therefore, the identification of promoters and their cis-regulatory elements is one of intriguing area to study the dynamic complex regulatory network of genes activities by integrating computational, comparative, structural and functional genomics. Several bioinformatics servers or database have been established to predict the cis-acting elements present in the promoter region of target gene and their association with the expression profiles in the TFs. The aim of this study is to predict possible cis-acting regulatory elements that have putative role in the transcriptional regulation of a dynamic network of metabolite gene activities controlling prenylflavonoid and bitter acids biosynthesis in hop (Humulus lupulus). Recent release of hop draft genome enabled us to predict the possible cis-acting regulatory elements by extracting 2kbp of 5' regulatory regions of genes important for lupulin metabolome biosynthesis, using Plant CARE, PLACE and Genomatix Matinspector professional databases. The result reveals the plausible role of cis-acting regulatory elements in the regulation of gene expression primarily involved in lupulin metabolome biosynthesis including under various stress conditions.

  5. MISCORE: a new scoring function for characterizing DNA regulatory motifs in promoter sequences

    PubMed Central


    Background Computational approaches for finding DNA regulatory motifs in promoter sequences are useful to biologists in terms of reducing the experimental costs and speeding up the discovery process of de novo binding sites. It is important for rule-based or clustering-based motif searching schemes to effectively and efficiently evaluate the similarity between a k-mer (a k-length subsequence) and a motif model, without assuming the independence of nucleotides in motif models or without employing computationally expensive Markov chain models to estimate the background probabilities of k-mers. Also, it is interesting and beneficial to use a priori knowledge in developing advanced searching tools. Results This paper presents a new scoring function, termed as MISCORE, for functional motif characterization and evaluation. Our MISCORE is free from: (i) any assumption on model dependency; and (ii) the use of Markov chain model for background modeling. It integrates the compositional complexity of motif instances into the function. Performance evaluations with comparison to the well-known Maximum a Posteriori (MAP) score and Information Content (IC) have shown that MISCORE has promising capabilities to separate and recognize functional DNA motifs and its instances from non-functional ones. Conclusions MISCORE is a fast computational tool for candidate motif characterization, evaluation and selection. It enables to embed priori known motif models for computing motif-to-motif similarity, which is more advantageous than IC and MAP score. In addition to these merits mentioned above, MISCORE can automatically filter out some repetitive k-mers from a motif model due to the introduction of the compositional complexity in the function. Consequently, the merits of our proposed MISCORE in terms of both motif signal modeling power and computational efficiency will make it more applicable in the development of computational motif discovery tools. PMID:23282090

  6. Potential Novel Mechanism for Axenfeld-Rieger Syndrome: Deletion of a Distant Region Containing Regulatory Elements of PITX2

    PubMed Central

    Volkmann, Bethany A.; Zinkevich, Natalya S.; Mustonen, Aki; Schilter, Kala F.; Bosenko, Dmitry V.; Reis, Linda M.; Broeckel, Ulrich; Link, Brian A.


    Purpose. Mutations in PITX2 are associated with Axenfeld-Rieger syndrome (ARS), which involves ocular, dental, and umbilical abnormalities. Identification of cis-regulatory elements of PITX2 is important to better understand the mechanisms of disease. Methods. Conserved noncoding elements surrounding PITX2/pitx2 were identified and examined through transgenic analysis in zebrafish; expression pattern was studied by in situ hybridization. Patient samples were screened for deletion/duplication of the PITX2 upstream region using arrays and probes. Results. Zebrafish pitx2 demonstrates conserved expression during ocular and craniofacial development. Thirteen conserved noncoding sequences positioned within a gene desert as far as 1.1 Mb upstream of the human PITX2 gene were identified; 11 have enhancer activities consistent with pitx2 expression. Ten elements mediated expression in the developing brain, four regions were active during eye formation, and two sequences were associated with craniofacial expression. One region, CE4, located approximately 111 kb upstream of PITX2, directed a complex pattern including expression in the developing eye and craniofacial region, the classic sites affected in ARS. Screening of ARS patients identified an approximately 7600-kb deletion that began 106 to 108 kb upstream of the PITX2 gene, leaving PITX2 intact while removing regulatory elements CE4 to CE13. Conclusions. These data suggest the presence of a complex distant regulatory matrix within the gene desert located upstream of PITX2 with an essential role in its activity and provides a possible mechanism for the previous reports of ARS in patients with balanced translocations involving the 4q25 region upstream of PITX2 and the current patient with an upstream deletion. PMID:20881290

  7. Changes in cis-regulatory elements of a key floral regulator are associated with divergence of inflorescence architectures.


    Kusters, Elske; Della Pina, Serena; Castel, Rob; Souer, Erik; Koes, Ronald


    Higher plant species diverged extensively with regard to the moment (flowering time) and position (inflorescence architecture) at which flowers are formed. This seems largely caused by variation in the expression patterns of conserved genes that specify floral meristem identity (FMI), rather than changes in the encoded proteins. Here, we report a functional comparison of the promoters of homologous FMI genes from Arabidopsis, petunia, tomato and Antirrhinum. Analysis of promoter-reporter constructs in petunia and Arabidopsis, as well as complementation experiments, showed that the divergent expression of leafy (LFY) and the petunia homolog aberrant leaf and flower (ALF) results from alterations in the upstream regulatory network rather than cis-regulatory changes. The divergent expression of unusual floral organs (UFO) from Arabidopsis, and the petunia homolog double top (DOT), however, is caused by the loss or gain of cis-regulatory promoter elements, which respond to trans-acting factors that are expressed in similar patterns in both species. Introduction of pUFO:UFO causes no obvious defects in Arabidopsis, but in petunia it causes the precocious and ectopic formation of flowers. This provides an example of how a change in a cis-regulatory region can account for a change in the plant body plan.

  8. Segregation of cardiac and skeletal muscle-specific regulatory elements of the beta-myosin heavy chain gene.

    PubMed Central

    Rindt, H; Knotts, S; Robbins, J


    The beta-myosin heavy chain (beta-MyHC) gene is expressed in cardiac and slow skeletal muscles. To examine the regulatory sequences that are required for the gene's expression in the two compartments in vivo, we analyzed the expression pattern of a transgene consisting of the beta-MyHC gene 5' upstream region linked to the chloramphenicol acetyltransferase reporter gene. By using 5600 bp of 5' upstream region, the transgene was expressed at high levels in the slow skeletal muscles. Decreased levels of thyroid hormone led to the up-regulation of the transgene in both cardiac and skeletal muscles, mimicking the behavior of the endogenous beta-MyHC gene. After deleting the distal 5000 bp, the level of reporter gene expression was strongly reduced. However, decreased levels of thyroid hormone led to an 80-fold skeletal muscle-specific increase in transgene expression, even upon the ablation of a conserved cis-regulatory element termed MCAT, which under normal (euthyroid) conditions abolishes muscle-specific expression. In contrast, cardiac-specific induction was not detected with the deletion construct. These observations indicate that the cardiac and skeletal muscle regulatory elements can be functionally segregated on the beta-MyHC gene promoter. Images Fig. 2 Fig. 3 Fig. 4 Fig. 5 PMID:7878016

  9. Segregation of cardiac and skeletal muscle-specific regulatory elements of the beta-myosin heavy chain gene.


    Rindt, H; Knotts, S; Robbins, J


    The beta-myosin heavy chain (beta-MyHC) gene is expressed in cardiac and slow skeletal muscles. To examine the regulatory sequences that are required for the gene's expression in the two compartments in vivo, we analyzed the expression pattern of a transgene consisting of the beta-MyHC gene 5' upstream region linked to the chloramphenicol acetyltransferase reporter gene. By using 5600 bp of 5' upstream region, the transgene was expressed at high levels in the slow skeletal muscles. Decreased levels of thyroid hormone led to the up-regulation of the transgene in both cardiac and skeletal muscles, mimicking the behavior of the endogenous beta-MyHC gene. After deleting the distal 5000 bp, the level of reporter gene expression was strongly reduced. However, decreased levels of thyroid hormone led to an 80-fold skeletal muscle-specific increase in transgene expression, even upon the ablation of a conserved cis-regulatory element termed MCAT, which under normal (euthyroid) conditions abolishes muscle-specific expression. In contrast, cardiac-specific induction was not detected with the deletion construct. These observations indicate that the cardiac and skeletal muscle regulatory elements can be functionally segregated on the beta-MyHC gene promoter.

  10. Use of H19 Gene Regulatory Sequences in DNA-Based Therapy for Pancreatic Cancer

    PubMed Central

    Scaiewicz, V.; Sorin, V.; Fellig, Y.; Birman, T.; Mizrahi, A.; Galula, J.; Abu-lail, R.; Shneider, T.; Ohana, P.; Buscail, L.; Hochberg, A.; Czerniak, A.


    Pancreatic cancer is the eighth most common cause of death from cancer in the world, for which palliative treatments are not effective and frequently accompanied by severe side effects. We propose a DNA-based therapy for pancreatic cancer using a nonviral vector, expressing the diphtheria toxin A chain under the control of the H19 gene regulatory sequences. The H19 gene is an oncofetal RNA expressed during embryo development and in several types of cancer. We tested the expression of H19 gene in patients, and found that 65% of human pancreatic tumors analyzed showed moderated to strong expression of the gene. In vitro experiments showed that the vector was effective in reducing Luciferase protein activity on pancreatic carcinoma cell lines. In vivo experiment results revealed tumor growth arrest in different animal models for pancreatic cancer. Differences in tumor size between control and treated groups reached a 75% in the heterotopic model (P = .037) and 50% in the orthotopic model (P = .007). In addition, no visible metastases were found in the treated group of the orthotopic model. These results indicate that the treatment with the vector DTA-H19 might be a viable new therapeutic option for patients with unresectable pancreatic cancer. PMID:21052499

  11. Identification and characterization of hepatocyte-specific regulatory regions of the rat pyruvate kinase L gene. The synergistic effect of multiple elements.


    Yamada, K; Noguchi, T; Matsuda, T; Takenaka, M; Monaci, P; Nicosia, A; Tanaka, T


    The rat pyruvate kinase L (PKL) gene produces the L- and R-type isozymes by alternative transcription that is regulated in a tissue-specific manner. To investigate which DNA elements are involved in hepatocyte-specific expression of the L-type isozyme, we performed transient DNA transfer experiments with PKL/chloramphenicol acetyltransferase fusion genes. We found three positive regulatory regions required for expression of the L-type isozyme in adult rat hepatocytes by functional analyses of a series of 5' and internal deletion constructs of the fusion genes. These regions, designated as PKL-I, PKL-II, and PKL-III, were located between nucleotides -76 and -94, -126 and -149, and -150 and -170, respectively. PKL-I showed enhancer-like activity alone, whereas PKL-II and PKL-III did not have any independent effect. Combinations of L-I + L-II and L-II + L-III, but not of L-I + L-III, showed synergistic enhancer activities when oriented in the same direction. The inclusion of all three elements oriented in the same direction had the maximum synergistic effect, indicating that these elements function as a unit. This unit enhanced expression from heterologous as well as homologous promoters in a manner that was independent of its orientation and position relative to the cap site. The activity of the unit was not detected in HeLa cells or K562 erythroleukemia cells, suggesting that this unit possessed cell-type specificity. PKL-I consists of a palindrome sequence 5'-CTGGTTATACTTTAACCAG-3', which contain a sequence homologous to the LF-B1-binding site. PKL-II contains the sequence 5'-TTCCTGGACTCTGGCCCCCAGTGT-3', which is similar to that of the LF-A1-binding site. PKL-III contains a palindrome sequence 5'-CCACGGGGCACTCCCGTGG-3', which include a sequence homologous to the binding site of the adenovirus major late transcription factor. Gel retardation assay indicated that the different trans-acting factors interacted with three elements and that the transacting protein bound

  12. Nonconsensus Protein Binding to Repetitive DNA Sequence Elements Significantly Affects Eukaryotic Genomes

    PubMed Central

    Barber-Zucker, Shiran; Gordân, Raluca; Lukatsky, David B.


    Recent genome-wide experiments in different eukaryotic genomes provide an unprecedented view of transcription factor (TF) binding locations and of nucleosome occupancy. These experiments revealed that a large fraction of TF binding events occur in regions where only a small number of specific TF binding sites (TFBSs) have been detected. Furthermore, in vitro protein-DNA binding measurements performed for hundreds of TFs indicate that TFs are bound with wide range of affinities to different DNA sequences that lack known consensus motifs. These observations have thus challenged the classical picture of specific protein-DNA binding and strongly suggest the existence of additional recognition mechanisms that affect protein-DNA binding preferences. We have previously demonstrated that repetitive DNA sequence elements characterized by certain symmetries statistically affect protein-DNA binding preferences. We call this binding mechanism nonconsensus protein-DNA binding in order to emphasize the point that specific consensus TFBSs do not contribute to this effect. In this paper, using the simple statistical mechanics model developed previously, we calculate the nonconsensus protein-DNA binding free energy for the entire C. elegans and D. melanogaster genomes. Using the available chromatin immunoprecipitation followed by sequencing (ChIP-seq) results on TF-DNA binding preferences for ~100 TFs, we show that DNA sequences characterized by low predicted free energy of nonconsensus binding have statistically higher experimental TF occupancy and lower nucleosome occupancy than sequences characterized by high free energy of nonconsensus binding. This is in agreement with our previous analysis performed for the yeast genome. We suggest therefore that nonconsensus protein-DNA binding assists the formation of nucleosome-free regions, as TFs outcompete nucleosomes at genomic locations with enhanced nonconsensus binding. In addition, here we perform a new, large-scale analysis using

  13. Scavenger receptor A gene regulatory elements target gene expression to macrophages and to foam cells of atherosclerotic lesions.

    PubMed Central

    Horvai, A; Palinski, W; Wu, H; Moulton, K S; Kalla, K; Glass, C K


    Transcription of the macrophage scavenger receptor A gene is markedly upregulated during monocyte to macrophage differentiation. In these studies, we demonstrate that 291 bp of the proximal scavenger receptor promoter, in concert with a 400-bp upstream enhancer element, is sufficient to direct macrophage-specific expression of a human growth hormone reporter in transgenic mice. These regulatory elements, which contain binding sites for PU.1, AP-1, and cooperating ets-domain transcription factors, are also sufficient to mediate regulation of transgene expression during the in vitro differentiation of bone marrow progenitor cells in response to macrophage colony-stimulating factor. Mutation of the PU.1 binding site within the scavenger receptor promoter severely impairs transgene expression, consistent with a crucial role of PU.1 in regulating the expression of the scavenger receptor gene. The ability of the scavenger receptor promoter and enhancer to target gene expression to macrophages in vivo, including foam cells of atherosclerotic lesions, suggests that these regulatory elements will be of general utility in the study of macrophage differentiation and function by permitting specific modifications of macrophage gene expression. Images Fig. 2 Fig. 3 Fig. 4 Fig. 5 PMID:7777517

  14. metagene Profiles Analyses Reveal Regulatory Element's Factor-Specific Recruitment Patterns.


    Joly Beauparlant, Charles; Lamaze, Fabien C; Deschênes, Astrid; Samb, Rawane; Lemaçon, Audrey; Belleau, Pascal; Bilodeau, Steve; Droit, Arnaud


    ChIP-Sequencing (ChIP-Seq) provides a vast amount of information regarding the localization of proteins across the genome. The aggregation of ChIP-Seq enrichment signal in a metagene plot is an approach commonly used to summarize data complexity and to obtain a high level visual representation of the general occupancy pattern of a protein. Here we present the R package metagene, the graphical interface Imetagene and the companion package similaRpeak. Together, they provide a framework to integrate, summarize and compare the ChIP-Seq enrichment signal from complex experimental designs. Those packages identify and quantify similarities or dissimilarities in patterns between large numbers of ChIP-Seq profiles. We used metagene to investigate the differential occupancy of regulatory factors at noncoding regulatory regions (promoters and enhancers) in relation to transcriptional activity in GM12878 B-lymphocytes. The relationships between occupancy patterns and transcriptional activity suggest two different mechanisms of action for transcriptional control: i) a "gradient effect" where the regulatory factor occupancy levels follow transcription and ii) a "threshold effect" where the regulatory factor occupancy levels max out prior to reaching maximal transcription. metagene, Imetagene and similaRpeak are implemented in R under the Artistic license 2.0 and are available on Bioconductor.

  15. Genomic matrix attachment region and chromosome conformation capture quantitative real time PCR assays identify novel putative regulatory elements at the imprinted Dlk1/Gtl2 locus.


    Braem, Caroline; Recolin, Bénédicte; Rancourt, Rebecca C; Angiolini, Christopher; Barthès, Pauline; Branchu, Priscillia; Court, Franck; Cathala, Guy; Ferguson-Smith, Anne C; Forné, Thierry


    We previously showed that genomic imprinting regulates matrix attachment region activities at the mouse Igf2 (insulin-like growth factor 2) locus and that these activities are functionally linked to neighboring differentially methylated regions (DMRs). Here, we investigate the similarly structured Dlk1/Gtl2 imprinted domain and show that in the mouse liver, the G/C-rich intergenic germ line-derived DMR, a sequence involved in domain-wide imprinting, is highly retained within the nuclear matrix fraction exclusively on the methylated paternal copy, reflecting its differential function on that chromosome. Therefore, not only "classical" A/T-rich matrix attachment region (MAR) sequences but also other important regulatory DNA elements (such as DMRs) can be recovered from genomic MAR assays following a high salt treatment. Interestingly, the recovery of one A/T-rich sequence (MAR4) from the "nuclear matrix" fraction is strongly correlated with gene expression. We show that this element possesses an intrinsic activity that favors transcription, and using chromosome conformation capture quantitative real time PCR assays, we demonstrate that the MAR4 interacts with the intergenic germ line-derived DMR specifically on the paternal allele but not with the Dlk1/Gtl2 promoters. Altogether, our findings shed a new light on gene regulation at this locus.

  16. Exposure to 3,3',5-triiodothyronine affects histone and RNA polymerase II modifications, but not DNA methylation status, in the regulatory region of the Xenopus laevis thyroid hormone receptor βΑ gene.


    Kasai, Kentaro; Nishiyama, Norihito; Izumi, Yushi; Otsuka, Shunsuke; Ishihara, Akinori; Yamauchi, Kiyoshi


    Thyroid hormones (THs) play a critical role in amphibian metamorphosis, during which the TH receptor (TR) gene, thrb, is upregulated in a tissue-specific manner. The Xenopus laevis thrb gene has 3 TH response elements (TREs) in the 5' flanking regulatory region and 1 TRE in the exon b region, around which CpG sites are highly distributed. To clarify whether exposure to 3,3',5-triiodothyronine (T3) affects histone and RNA polymerase II (RNAPII) modifications and the level of DNA methylation in the 5' regulatory region, we conducted reverse transcription-quantitative polymerase chain reaction, bisulfite sequencing and chromatin immunoprecipitation assay using X. laevis cultured cells and premetamorphic tadpoles treated with or without 2 nM T3. Exposure to T3 increased the amount of the thrb transcript, in parallel with enhanced histone H4 acetylation and RNAPII recruitment, and probably phosphorylation of RNAPII at serine 5, in the 5' regulatory and exon b regions. However, the 5' regulatory region remained hypermethylated even with exposure to T3, and there was no significant difference in the methylation status between DNAs from T3-untreated and -treated cultured cells or tadpole tissues. Our results demonstrate that exposure to T3 induced euchromatin-associated epigenetic marks by enhancing histone acetylation and RNAPII recruitment, but not by decreasing the level of DNA methylation, in the 5' regulatory region of the X. laevis thrb gene.

  17. A histone modification identifies a DNA element controlling slo BK channel gene expression in muscle

    PubMed Central

    Li, Xiaolei; Ghezzi, Alfredo; Krishnan, Harish R.; Pohl, Jascha B.; Bohm, Arun Y.; Atkinson, Nigel S.


    The slo gene encodes BK type Ca2+-activated K+ channels. In Drosophila, expression of slo is induced by organic solvent sedation (benzyl alcohol and ethanol) and this increase in neural slo expression contributes to the production of functional behavioral tolerance (inducible resistance) to these drugs. Within the slo promoter region, we observed that benzyl alcohol sedation produces a localized spike of histone acetylation over a 65 n conserved DNA element called 55b. Changes in histone acetylation are commonly the consequence of transcription factor activity and previously, a localized histone acetylation spike was used to successfully map a DNA element involved in benzyl alcohol-induced slo expression. To determine whether the 55b element was also involved in benzyl alcohol-induced neural expression of slo we deleted it from the endogenous slo gene by homologous recombination. Flies lacking the 55b element were normal with respect to basal and benzyl alcohol-induced neural slo expression, the capacity to acquire and maintain functional tolerance, their threshold for electrically-induced seizures and most slo-related behaviors. Removal of the 55b element did however increase the level of basal expression from the muscle/tracheal cell-specific slo core promoter and produced a slight increase in overall locomotor activity. We conclude that the 55b element is involved in control of slo expression from the muscle and tracheal-cell promoter but is not involved in the production of functional benzyl alcohol tolerance. PMID:25967280

  18. DNA Elements Reducing Transcriptional Gene Silencing Revealed by a Novel Screening Strategy

    PubMed Central

    Ueno, Keiichiro; Ohashi, Yuko; Mitsuhara, Ichiro


    Transcriptional gene silencing (TGS)–a phenomenon observed in endogenous genes/transgenes in eukaryotes–is a huge hindrance to transgenic technology and occurs mainly when the genes involved share sequence homology in their promoter regions. TGS depends on chromosomal position, suggesting the existence of genomic elements that suppress TGS. However, no systematic approach to identify such DNA elements has yet been reported. Here, we developed a successful novel screening strategy to identify such elements (anti-silencing regions–ASRs), based on their ability to protect a flanked transgene from TGS. A silenced transgenic tobacco plant in which a subsequently introduced transgene undergoes obligatory promoter-homology dependent TGS in trans allowed the ability of DNA elements to prevent TGS to be used as the screening criterion. We also identified ASRs in a genomic library from a different plant species (Lotus japonicus: a perennial legume); the ASRs include portions of Ty1/copia retrotransposon-like and pararetrovirus-like sequences; the retrotransposon-like sequences also showed interspecies anti-TGS activity in a TGS-induction system in Arabidopsis. Anti-TGS elements could provide effective tools to reduce TGS and ensure proper regulation of transgene expression. Furthermore, the screening strategy described here will also facilitate the efficient identification of new classes of anti-TGS elements. PMID:23382937

  19. A DNA unwinding element and an ARS consensus comprise a replication origin within a yeast chromosome.

    PubMed Central

    Huang, R Y; Kowalski, D


    We have defined a replication origin, ORI305, within chromosome III of Saccharomyces cerevisiae by means of mutational analysis. cis-acting elements required for origin activity in the chromosome, as assayed by two-dimensional gel electrophoresis of replication intermediates, are the same as those required for the function of an autonomously replicating sequence, ARS305, in a plasmid. Essential elements include (i) an 11 bp sequence that is a near match to the ARS consensus and (ii) a broad sequence directly 3' to the consensus near match. Origin function is inactivated by point mutations in the essential near match sequence, suggesting that the sequence contributes to specifying the origin in the chromosome. Other consensus near matches with different sequences are present but are not required. The essential 3'-flanking sequence exhibits DNA helical instability and is sensitive to deletion mutations that stabilize the DNA helix. The wild-type 3'-flanking sequence can be functionally substituted by dissimilar sequences that also exhibit helical instability. The requirement for DNA helical instability indicates that the essential 3'-flanking sequence serves as a DNA unwinding element in the chromosome. Images PMID:8223462

  20. The Role of Crowding Forces in Juxtaposing β-Globin Gene Domain Remote Regulatory Elements in Mouse Erythroid Cells

    PubMed Central

    Golov, Arkadiy K.; Gavrilov, Alexey A.; Razin, Sergey V.


    The extremely high concentration of macromolecules in a eukaryotic cell nucleus indicates that the nucleoplasm is a crowded macromolecular solution in which large objects tend to gather together due to crowding forces. It has been shown experimentally that crowding forces support the integrity of various nuclear compartments. However, little is known about their role in control of chromatin dynamics in vivo. Here, we experimentally addressed the possible role of crowding forces in spatial organization of the eukaryotic genome. Using the mouse β-globin domain as a model, we demonstrated that spatial juxtaposition of the remote regulatory elements of this domain in globin-expressing cells may be lost and restored by manipulation of the level of macromolecular crowding. In addition to proving the role of crowding forces in shaping interphase chromatin, our results suggest that the folding of the chromatin fiber is a major determinant in juxtaposing remote genomic elements. PMID:26436546

  1. An adaptive transposable element insertion in the regulatory region of the EO gene in the domesticated silkworm, Bombyx mori.


    Sun, Wei; Shen, Yi-Hong; Han, Min-Jin; Cao, Yun-Feng; Zhang, Ze


    Although there are many studies to show a key role of transposable elements (TEs) in adaptive evolution of higher organisms, little is known about the molecular mechanisms. In this study, we found that a partial TE (Taguchi) inserted in the cis-regulatory region of the silkworm ecdysone oxidase (EO) gene, which encodes a crucial enzyme to reduce the titer of molting hormone (20-hydroxyecdysone, 20E). The TE insertion occurred during domestication of silkworm and the frequency of the TE insertion in the domesticated silkworm (Bombyx mori) is high, 54.24%. The linkage disequilibrium in the TE inserted strains of the domesticated silkworm was elevated. Molecular population genetics analyses suggest that this TE insertion is adaptive for the domesticated silkworm. Luminescent reporter assay shows that the TE inserted in the cis-regulatory region of the EO gene functions as a 20E-induced enhancer of the gene expression. Further, phenotypic bioassay indicates that the silkworm with the TE insertion exhibited more stable developmental phenotype than the silkworm without the TE insertion when suffering from food shortage. Thus, the inserted TE in the cis-regulatory region of the EO gene increased developmental uniformity of silkworm individuals through regulating 20E metabolism, partially explaining transformation of a domestication developmental trait in the domesticated silkworm. Our results emphasize the exceptional role of gene expression regulation in developmental transition of domesticated animals.

  2. Phosphorylation of sterol regulatory element binding protein-1a by protein kinase A (PKA) regulates transcriptional activity.


    Dong, Qingming; Giorgianni, Francesco; Deng, Xiong; Beranova-Giorgianni, Sarka; Bridges, Dave; Park, Edwards A; Raghow, Rajendra; Elam, Marshall B


    The counter-regulatory hormone glucagon inhibits lipogenesis via downregulation of sterol regulatory element binding protein 1 (SREBP-1). The effect of glucagon is mediated via protein kinase A (PKA). To determine if SREBP-1 is a direct phosphorylation target of PKA, we conducted mass spectrometry analysis of recombinant n-terminal SREBP-1a following PKA treatment in vitro. This analysis identified serines 331/332 as bona-fide phosphorylation targets of PKA. To determine the functional consequences of phosphorylation at these sites, we constructed mammalian expression vector for both nSREBP-1a and 1c isoforms in which the candidate PKA phosphorylation sites were mutated to active phosphomimetic or non-phosphorylatable amino acids. The transcriptional activity of SREBP was reduced by the phosphomimetic mutation of S332 of nSREBP-1a and the corresponding serine (S308) of nSREBP-1c. This site is a strong candidate for mediating the negative regulatory effect of glucagon on SREBP-1 and lipogenesis.

  3. Mutagenesis of GATA motifs controlling the endoderm regulator elt-2 reveals distinct dominant and secondary cis-regulatory elements.


    Du, Lawrence; Tracy, Sharon; Rifkin, Scott A


    Cis-regulatory elements (CREs) are crucial links in developmental gene regulatory networks, but in many cases, it can be difficult to discern whether similar CREs are functionally equivalent. We found that despite similar conservation and binding capability to upstream activators, different GATA cis-regulatory motifs within the promoter of the C. elegans endoderm regulator elt-2 play distinctive roles in activating and modulating gene expression throughout development. We fused wild-type and mutant versions of the elt-2 promoter to a gfp reporter and inserted these constructs as single copies into the C. elegans genome. We then counted early embryonic gfp transcripts using single-molecule RNA FISH (smFISH) and quantified gut GFP fluorescence. We determined that a single primary dominant GATA motif located 527bp upstream of the elt-2 start codon was necessary for both embryonic activation and later maintenance of transcription, while nearby secondary GATA motifs played largely subtle roles in modulating postembryonic levels of elt-2. Mutation of the primary activating site increased low-level spatiotemporally ectopic stochastic transcription, indicating that this site acts repressively in non-endoderm cells. Our results reveal that CREs with similar GATA factor binding affinities in close proximity can play very divergent context-dependent roles in regulating the expression of a developmentally critical gene in vivo.

  4. PCR detection and DNA sequence analysis of the regulatory region of lymphotropic papovavirus in peripheral blood mononuclear cells of an immunocompromised rhesus macaque

    NASA Technical Reports Server (NTRS)

    Lednicky, John A.; Halvorson, Steven J.; Butel, Janet S.


    A lymphotropic papovavirus (LPV) archetypal regulatory region was amplified from DNA from the blood of an immunocompromised rhesus monkey. We believe this is the first nonserological evidence of LPV infection in rhesus monkeys.

  5. A DNA-binding-site landscape and regulatory network analysis for NAC transcription factors in Arabidopsis thaliana

    PubMed Central

    Lindemose, Søren; Jensen, Michael K.; de Velde, Jan Van; O'Shea, Charlotte; Heyndrickx, Ken S.; Workman, Christopher T.; Vandepoele, Klaas; Skriver, Karen; Masi, Federico De


    Target gene identification for transcription factors is a prerequisite for the systems wide understanding of organismal behaviour. NAM-ATAF1/2-CUC2 (NAC) transcription factors are amongst the largest transcription factor families in plants, yet limited data exist from unbiased approaches to resolve the DNA-binding preferences of individual members. Here, we present a TF-target gene identification workflow based on the integration of novel protein binding microarray data with gene expression and multi-species promoter sequence conservation to identify the DNA-binding specificities and the gene regulatory networks of 12 NAC transcription factors. Our data offer specific single-base resolution fingerprints for most TFs studied and indicate that NAC DNA-binding specificities might be predicted from their DNA-binding domain's sequence. The developed methodology, including the application of complementary functional genomics filters, makes it possible to translate, for each TF, protein binding microarray data into a set of high-quality target genes. With this approach, we confirm NAC target genes reported from independent in vivo analyses. We emphasize that candidate target gene sets together with the workflow associated with functional modules offer a strong resource to unravel the regulatory potential of NAC genes and that this workflow could be used to study other families of transcription factors. PMID:24914054

  6. A comparative analysis of the evolution, expression, and cis-regulatory element of polygalacturonase genes in grasses and dicots.


    Liang, Ying; Yu, Youjian; Cui, Jinlong; Lyu, Meiling; Xu, Liai; Cao, Jiashu


    Cell walls are a distinguishing characteristic of plants essential to their survival. The pectin content of primary cell walls in grasses and dicots is distinctly different. Polygalacturonases (PGs) can degrade pectins and participate in multiple developmental processes of plants. This study comprehensively compared the evolution, expression, and cis-regulatory element of PGs in grasses and dicots. A total of 577 PGs identified from five grasses and five dicots fell into seven clades. Evolutionary analysis demonstrated the distinct differences between grasses and dicots in patterns of gene duplication and loss, and evolutionary rates. Grasses generally contained much fewer clade C and F members than dicots. We found that this disparity was the result of less duplication and more gene losses in grasses. More duplications occurred in clades D and E, and expression analysis showed that most of clade E members were expressed ubiquitously at a high overall level and clade D members were closely related to male reproduction in both grasses and dicots, suggesting their biological functions were highly conserved across species. In addition to the general role in reproductive development, PGs of clades C and F specifically played roles in root development in dicots, shedding light on organ differentiation between the two groups of plants. A regulatory element analysis of clade C and F members implied that possible functions of PGs in specific biological responses contributed to their expansion and preservation. This work can improve the knowledge of PGs in plants generally and in grasses specifically and is beneficial to functional studies.

  7. Retinal Expression of the Drosophila eyes absent Gene Is Controlled by Several Cooperatively Acting Cis-regulatory Elements

    PubMed Central

    Neuman, Sarah D.; Bashirullah, Arash; Kumar, Justin P.


    The eyes absent (eya) gene of the fruit fly, Drosophila melanogaster, is a member of an evolutionarily conserved gene regulatory network that controls eye formation in all seeing animals. The loss of eya leads to the complete elimination of the compound eye while forced expression of eya in non-retinal tissues is sufficient to induce ectopic eye formation. Within the developing retina eya is expressed in a dynamic pattern and is involved in tissue specification/determination, cell proliferation, apoptosis, and cell fate choice. In this report we explore the mechanisms by which eya expression is spatially and temporally governed in the developing eye. We demonstrate that multiple cis-regulatory elements function cooperatively to control eya transcription and that spacing between a pair of enhancer elements is important for maintaining correct gene expression. Lastly, we show that the loss of eya expression in sine oculis (so) mutants is the result of massive cell death and a progressive homeotic transformation of retinal progenitor cells into head epidermis. PMID:27930646

  8. Exploiting a precise design of universal synthetic modular regulatory elements to unlock the microbial natural products in Streptomyces.


    Bai, Chaoxian; Zhang, Yang; Zhao, Xuejin; Hu, Yiling; Xiang, Sihai; Miao, Jin; Lou, Chunbo; Zhang, Lixin


    There is a great demand for precisely quantitating the expression of genes of interest in synthetic and systems biotechnology as new and fascinating insights into the genetics of streptomycetes have come to light. Here, we developed, for the first time to our knowledge, a quantitative method based on flow cytometry and a superfolder green fluorescent protein (sfGFP) at single-cell resolution in Streptomyces. Single cells of filamentous bacteria were obtained by releasing the protoplasts from the mycelium, and the dead cells could be distinguished from the viable ones by propidium iodide (PI) staining. With this sophisticated quantitative method, some 200 native or synthetic promoters and 200 ribosomal binding sites (RBSs) were characterized in a high-throughput format. Furthermore, an insulator (RiboJ) was recruited to eliminate the interference between promoters and RBSs and improve the modularity of regulatory elements. Seven synthetic promoters with gradient strength were successfully applied in a proof-of-principle approach to activate and overproduce the cryptic lycopene in a predictable manner in Streptomyces avermitilis. Our work therefore presents a quantitative strategy and universal synthetic modular regulatory elements, which will facilitate the functional optimization of gene clusters and the drug discovery process in Streptomyces.

  9. Distal regulatory element of the STAT1 gene potentially mediates positive feedback control of STAT1 expression.


    Yuasa, Katsutoshi; Hijikata, Takao


    We previously identified a distal regulatory element located approximately 5.5-kb upstream of the signal transducer and activator of transcription 1 (STAT1) gene, thereafter designating it as 5.5-kb upstream regulatory region (5.5URR). In this study, we investigated the functional roles of 5.5URR in the transcriptional regulation of STAT1 gene. A chromosome conformation capture assay indicated physical interaction of 5.5URR with the STAT1 core promoter. In luciferase reporter assays, 5.5URR-combined STAT1 core promoter exhibited significant increase in reporter activity enhanced by forced STAT1 expression or interferon (IFN) treatment, but STAT1 core promoter alone did not. The 5.5URR contained IFN-stimulated response element and GAS sites, which bound STAT1 complexes in electrophoretic mobility shift assays. Consistently, chromatin immunoprecipitation (ChIP) assays of HEK293 cells with Halo-tagged STAT1 expression indicated the association of Halo-tagged STAT1 with 5.5URR. ChIP assays with IFN treatment demonstrated that IFNs promoted the recruitment of Halo-tagged STAT1 to 5.5URR. Forced STAT1 expression or IFN treatment increased the expression of endogenous STAT1 and other IFN signaling pathway components, such as STAT2, IRF9 and IRF1, besides IFN-responsive genes. Collectively, the results suggest that 5.5URR may provide a regulatory platform for positive feedback control of STAT1 expression possibly to amplify or sustain the intracellular IFN signals.

  10. Cooperative binding of estrogen receptor to imperfect estrogen-responsive DNA elements correlates with their synergistic hormone-dependent enhancer activity.


    Martinez, E; Wahli, W


    The Xenopus vitellogenin (vit) gene B1 estrogen-inducible enhancer is formed by two closely adjacent 13 bp imperfect palindromic estrogen-responsive elements (EREs), i.e. ERE-2 and ERE-1, having one and two base substitutions respectively, when compared to the perfect palindromic consensus ERE (GGTCANNNTGACC). Gene transfer experiments indicate that these degenerated elements, on their own, have a low or no regulatory capacity at all, but in vivo act together synergistically to confer high receptor- and hormone-dependent transcription activation to the heterologous HSV thymidine kinase promoter. Thus, the DNA region upstream of the vitB1 gene comprising these two imperfect EREs separated by 7 bp, was called the vitB1 estrogen-responsive unit (vitB1 ERU). Using in vitro protein-DNA interaction techniques, we demonstrate that estrogen receptor dimers bind cooperatively to the imperfect EREs of the vitB1 ERU. Binding of a first receptor dimer to the more conserved ERE-2 increases approximately 4- to 8-fold the binding affinity of the receptor to the adjacent less conserved ERE-1. Thus, we suggest that the observed synergistic estrogen-dependent transcription activation conferred by the pair of hormone-responsive DNA elements of the vit B1 ERU is the result of cooperative binding of two estrogen receptor dimers to these two adjacent imperfect EREs.

  11. H-2RIIBP, a member of the nuclear hormone receptor superfamily that binds to both the regulatory element of major histocompatibility class I genes and the estrogen response element.

    PubMed Central

    Hamada, K; Gleason, S L; Levi, B Z; Hirschfeld, S; Appella, E; Ozato, K


    Transcription of major histocompatibility complex (MHC) class I genes is regulated by the conserved MHC class I regulatory element (CRE). The CRE has two factor-binding sites, region I and region II, both of which elicit enhancer function. By screening a mouse lambda gt 11 library with the CRE as a probe, we isolated a cDNA clone that encodes a protein capable of binding to region II of the CRE. This protein, H-2RIIBP (H-2 region II binding protein), bound to the native region II sequence, but not to other MHC cis-acting sequences or to mutant region II sequences, similar to the naturally occurring region II factor in mouse cells. The deduced amino acid sequence of H-2RIIBP revealed two putative zinc fingers homologous to the DNA-binding domain of steroid/thyroid hormone receptors. Although sequence similarity in other regions was minimal, H-2RIIBP has apparent modular domains characteristic of the nuclear hormone receptors. Further analyses showed that both H-2RIIBP and the natural region II factor bind to the estrogen response element (ERE) of the vitellogenin A2 gene. The ERE is composed of a palindrome, and half of this palindrome resembles the region II binding site of the MHC CRE. These results indicate that H-2RIIBP (i) is a member of the superfamily of nuclear hormone receptors and (ii) may regulate not only MHC class I genes but also genes containing the ERE and related sequences. Sequences homologous to the H-2RIIBP gene are widely conserved in the animal kingdom. H-2RIIBP mRNA is expressed in many mouse tissues, in agreement with the distribution of the natural region II factor. Images PMID:2554307

  12. The Function of the Conserved Regulatory Element within the Second Intron of the Mammalian Csf1r Locus

    PubMed Central

    O’Neal, Julie; Sester, David P.; Tagoh, Hiromi; Ingram, Richard M.; Pridans, Clare; Bonifer, Constanze; Hume, David A.


    The gene encoding the receptor for macrophage colony-stimulating factor (CSF-1R) is expressed exclusively in cells of the myeloid lineages as well as trophoblasts. A conserved element in the second intron, Fms-Intronic Regulatory Element (FIRE), is essential for macrophage-specific transcription of the gene. However, the molecular details of how FIRE activity is regulated and how it impacts the Csf1r promoter have not been characterised. Here we show that agents that down-modulate Csf1r mRNA transcription regulated promoter activity altered the occupancy of key FIRE cis-acting elements including RUNX1, AP1, and Sp1 binding sites. We demonstrate that FIRE acts as an anti-sense promoter in macrophages and reversal of FIRE orientation within its native context greatly reduced enhancer activity in macrophages. Mutation of transcription initiation sites within FIRE also reduced transcription. These results demonstrate that FIRE is an orientation-specific transcribed enhancer element. PMID:23383005

  13. Upstream Transcriptional Regulatory Elements of the S. cerevisiae CSG2 Gene

    DTIC Science & Technology


    dCfCCGTGGGGCCCAATGG, used for the double stranded DNA sequencing was prepared by Mike Flora of the USUHS Oligonucleotide Synthesizing Facility. MEmODS...laboralory’s standard rapid plasmid prep was purified with the Qiagen column prior to sequencing. CSG2 specific primers were synthesized by Mike Flora of the USUHS

  14. Rounding up active cis-elements in the triple C corral: combining conservation, cleavage and conformation capture for the analysis of regulatory gene domains.


    McBride, David J; Kleinjan, Dirk A


    Identification and functional analysis of potential cis-regulatory elements is a laborious process that often depends on removing putative elements from their natural context to study their activity. While such methods provide valuable information about the isolated element, they disregard the potential role of an element's interaction(s) with other regulatory sequences and the three-dimensional structure of an active gene locus. Here, two novel methods are discussed--chromosome conformation capture (3C) and RNA-TRAP--that can be used to detect interactions between distal regulatory sites and which thus indicate the chromosomal conformation that is adopted by a gene locus in various states of transcriptional activity. Combined with comparative genomics and traditional DNase I hypersensitive site mapping, these methods form a powerful approach for the study of the mechanisms of long-range transcriptional regulation.

  15. The Contribution of Alu Elements to Mutagenic DNA Double-Strand Break Repair

    PubMed Central

    Streva, Vincent A.; DeFreece, Cecily B.; Hedges, Dale J.; Deininger, Prescott L.


    Alu elements make up the largest family of human mobile elements, numbering 1.1 million copies and comprising 11% of the human genome. As a consequence of evolution and genetic drift, Alu elements of various sequence divergence exist throughout the human genome. Alu/Alu recombination has been shown to cause approximately 0.5% of new human genetic diseases and contribute to extensive genomic structural variation. To begin understanding the molecular mechanisms leading to these rearrangements in mammalian cells, we constructed Alu/Alu recombination reporter cell lines containing Alu elements ranging in sequence divergence from 0%-30% that allow detection of both Alu/Alu recombination and large non-homologous end joining (NHEJ) deletions that range from 1.0 to 1.9 kb in size. Introduction of as little as 0.7% sequence divergence between Alu elements resulted in a significant reduction in recombination, which indicates even small degrees of sequence divergence reduce the efficiency of homology-directed DNA double-strand break (DSB) repair. Further reduction in recombination was observed in a sequence divergence-dependent manner for diverged Alu/Alu recombination constructs with up to 10% sequence divergence. With greater levels of sequence divergence (15%-30%), we observed a significant increase in DSB repair due to a shift from Alu/Alu recombination to variable-length NHEJ which removes sequence between the two Alu elements. This increase in NHEJ deletions depends on the presence of Alu sequence homeology (similar but not identical sequences). Analysis of recombination products revealed that Alu/Alu recombination junctions occur more frequently in the first 100 bp of the Alu element within our reporter assay, just as they do in genomic Alu/Alu recombination events. This is the first extensive study characterizing the influence of Alu element sequence divergence on DNA repair, which will inform predictions regarding the effect of Alu element sequence divergence on both

  16. PARP-2 and PARP-3 are selectively activated by 5′ phosphorylated DNA breaks through an allosteric regulatory mechanism shared with PARP-1

    PubMed Central

    Langelier, Marie-France; Riccio, Amanda A.; Pascal, John M.


    PARP-1, PARP-2 and PARP-3 are DNA-dependent PARPs that localize to DNA damage, synthesize poly(ADP-ribose) (PAR) covalently attached to target proteins including themselves, and thereby recruit repair factors to DNA breaks to increase repair efficiency. PARP-1, PARP-2 and PARP-3 have in common two C-terminal domains—Trp-Gly-Arg (WGR) and catalytic (CAT). In contrast, the N-terminal region (NTR) of PARP-1 is over 500 residues and includes four regulatory domains, whereas PARP-2 and PARP-3 have smaller NTRs (70 and 40 residues, respectively) of unknown structural composition and function. Here, we show that PARP-2 and PARP-3 are preferentially activated by DNA breaks harboring a 5′ phosphate (5′P), suggesting selective activation in response to specific DNA repair intermediates, in particular structures that are competent for DNA ligation. In contrast to PARP-1, the NTRs of PARP-2 and PARP-3 are not strictly required for DNA binding or for DNA-dependent activation. Rather, the WGR domain is the central regulatory domain of PARP-2 and PARP-3. Finally, PARP-1, PARP-2 and PARP-3 share an allosteric regulatory mechanism of DNA-dependent catalytic activation through a local destabilization of the CAT. Collectively, our study provides new insights into the specialization of the DNA-dependent PARPs and their specific roles in DNA repair pathways. PMID:24928857

  17. PARP-2 and PARP-3 are selectively activated by 5' phosphorylated DNA breaks through an allosteric regulatory mechanism shared with PARP-1.


    Langelier, Marie-France; Riccio, Amanda A; Pascal, John M


    PARP-1, PARP-2 and PARP-3 are DNA-dependent PARPs that localize to DNA damage, synthesize poly(ADP-ribose) (PAR) covalently attached to target proteins including themselves, and thereby recruit repair factors to DNA breaks to increase repair efficiency. PARP-1, PARP-2 and PARP-3 have in common two C-terminal domains-Trp-Gly-Arg (WGR) and catalytic (CAT). In contrast, the N-terminal region (NTR) of PARP-1 is over 500 residues and includes four regulatory domains, whereas PARP-2 and PARP-3 have smaller NTRs (70 and 40 residues, respectively) of unknown structural composition and function. Here, we show that PARP-2 and PARP-3 are preferentially activated by DNA breaks harboring a 5' phosphate (5'P), suggesting selective activation in response to specific DNA repair intermediates, in particular structures that are competent for DNA ligation. In contrast to PARP-1, the NTRs of PARP-2 and PARP-3 are not strictly required for DNA binding or for DNA-dependent activation. Rather, the WGR domain is the central regulatory domain of PARP-2 and PARP-3. Finally, PARP-1, PARP-2 and PARP-3 share an allosteric regulatory mechanism of DNA-dependent catalytic activation through a local destabilization of the CAT. Collectively, our study provides new insights into the specialization of the DNA-dependent PARPs and their specific roles in DNA repair pathways.

  18. Prenatal exposure to mixtures of xenoestrogens and repetitive element DNA methylation changes in human placenta

    PubMed Central

    Vilahur, Nadia; Bustamante, Mariona; Byun, Hyang-Min; Fernandez, Mariana F.; Marina, Loreto Santa; Basterrechea, Mikel; Ballester, Ferran; Murcia, Mario; Tardón, Adonina; Fernández-Somoano, Ana; Estivill, Xavier; Olea, Nicolas; Sunyer, Jordi; Baccarelli, Andrea A.


    Background Prenatal exposure to endocrine disrupting compounds (EDCs) has previously shown to alter epigenetic marks. Objectives In this work we explore whether prenatal exposure to mixtures of xenoestrogens has the potential to alter the placenta epigenome, by studying DNA methylation in retrotransposons as a surrogate of global DNA methylation. Methods The biomarker Total Effective Xenoestrogen Burden (TEXB) was measured in 192 placentas from participants in the longitudinal INMA Project. DNA methylation was quantitatively assessed by bisulfite pyrosequencing on 10 different retrotransposons including 3 different long interspersed nuclear elements (LINEs), 4 short interspersed nuclear elements (SINEs) and 3 human endogenous retrovirus (HERVs). Associations were tested using linear mixed-effects regression models and sex interaction was evaluated. Results A significant sex interaction was observed for AluYb8 (p value for interaction <0.001, significant at Bonferroni corrected p-value threshold of 0.0025). Boys with the highest TEXB-alpha levels of exposure (third tertile) presented on average a decrease of 0.84% in methylation compared to those in the first tertile (p value<0.001), while no significant effects were found in girls (p value= 0.134). Conclusions Our findings suggest that boys may be more susceptible to the effect of exposure to xenoestrogens during prenatal development, producing shifts in DNA methylation of certain sensitive genomic repetitive sequences in a tissue important for fetal growth and development. PMID:24980756

  19. Nanoparticle-labeled DNA capture elements for detection and identification of biological agents

    NASA Astrophysics Data System (ADS)

    Kiel, Johnathan L.; Holwitt, Eric A.; Parker, Jill E.; Vivekananda, Jeevalatha; Franz, Veronica


    Aptamers, synthetic DNA capture elements (DCEs), can be made chemically or in genetically engineered bacteria. DNA capture elements are artificial DNA sequences, from a random pool of sequences, selected for their specific binding to potential biological warfare or terrorism agents. These sequences were selected by an affinity method using filters to which the target agent was attached and the DNA isolated and amplified by polymerase chain reaction (PCR) in an iterative, increasingly stringent, process. The probes can then be conjugated to Quantum Dots and super paramagnetic nanoparticles. The former provide intense, bleach-resistant fluorescent detection of bioagent and the latter provide a means to collect the bioagents with a magnet. The fluorescence can be detected in a flow cytometer, in a fluorescence plate reader, or with a fluorescence microscope. To date, we have made DCEs to Bacillus anthracis spores, Shiga toxin, Venezuelan Equine Encephalitis (VEE) virus, and Francisella tularensis. DCEs can easily distinguish Bacillus anthracis from its nearest relatives, Bacillus cereus and Bacillus thuringiensis. Development of a high through-put process is currently being investigated.

  20. The fission yeast CENP-B protein Abp1 prevents pervasive transcription of repetitive DNA elements.


    Daulny, Anne; Mejía-Ramírez, Eva; Reina, Oscar; Rosado-Lugo, Jesus; Aguilar-Arnal, Lorena; Auer, Herbert; Zaratiegui, Mikel; Azorin, Fernando


    It is well established that eukaryotic genomes are pervasively transcribed producing cryptic unstable transcripts (CUTs). However, the mechanisms regulating pervasive transcription are not well understood. Here, we report that the fission yeast CENP-B homolog Abp1 plays an important role in preventing pervasive transcription. We show that loss of abp1 results in the accumulation of CUTs, which are targeted for degradation by the exosome pathway. These CUTs originate from different types of genomic features, but the highest increase corresponds to Tf2 retrotransposons and rDNA repeats, where they map along the entire elements. In the absence of abp1, increased RNAPII-Ser5P occupancy is observed throughout the Tf2 coding region and, unexpectedly, RNAPII-Ser5P is enriched at rDNA repeats. Loss of abp1 also results in Tf2 derepression and increased nucleolus size. Altogether these results suggest that Abp1 prevents pervasive RNAPII transcription of repetitive DNA elements (i.e., Tf2 and rDNA repeats) from internal cryptic sites.

  1. Identification and Characterization of MYC Regulatory Elements: Links to Prostate Cancer

    DTIC Science & Technology


    single -nucleotide polymorphism in colorectal cancer cells. Mol Cell Biol 30, 1411 (Mar, 2010). 24. M. M. Pomerantz et al., Evaluation of the noncoding DNA, as exemplified by reports of multiple single nucleotide polymorphisms (SNPs) associated with prostate cancer in five independent...recent meta-analysis of ;1200 disease-associated single nucleotide polymorphisms (SNPs) found that in 40% of cases, known exonic sequences were absent

  2. Four major sequence elements of simian virus 40 large T antigen coordinate its specific and nonspecific DNA binding.

    PubMed Central

    Simmons, D T; Loeber, G; Tegtmeyer, P


    By mutational analysis, we have identified a motif critical to the proper recognition and binding of simian virus 40 large tumor antigen (T antigen) to virus DNA sequences at the origin of DNA replication. This motif is tripartite and consists of two elements (termed A1 and B2) that are necessary for sequence-specific binding of the origin and a central element (B1) which is required for nonspecific DNA-binding activity. Certain amino acids in elements A1 (residues 152 to 155) and B2 (203 to 207) may make direct contact with the GAGGC pentanucleotide sequences in binding sites I and II on the DNA. Alternatively, these two elements could determine the proper structure of the DNA-binding domain, although for a number of reasons we favor the first possibility. In contrast, element B1 (183 to 187) is most likely important for recognizing a general structural feature of DNA. Elements A1 and B2 are nearly identical in all known papovavirus T antigens, whereas B1 is identical only in the closely related papovaviruses simian virus 40, BK virus, and JC virus. In addition to these three elements, a fourth (B3; residues 215 to 219) is necessary for the binding of T antigen to site II but not to site I. We propose that additional contact sites on T antigen are involved in the interaction with site II to initiate the replication of the viral DNA. PMID:2157865

  3. The Hinge Region as a Key Regulatory Element of Androgen Receptor Dimerization, DNA Binding and Transactivation

    DTIC Science & Technology


    and Serine in the AR by Isoleucine and Glycine respectively. Much to our surprise, in transient transfection experiments, none of the mutations led ...02-1-0082 P.I. Frank Claessens expression plasmid (reviewed in Claessens et al. 2001). This led ...submission as manuscripts. This work also led to collaborations with: - 1. Dr. Adriaan Houtsmuller (Erasmus Rotterdam, The Netherlands) to analyse

  4. Functional Classification, Genomic Organization, Putatively cis-Acting Regulatory Elements, and Relationship to Quantitative Trait Loci, of Sorghum Genes with Rhizome-Enriched Expression1[W

    PubMed Central

    Jang, Cheol Seong; Kamps, Terry L.; Skinner, D. Neil; Schulze, Stefan R.; Vencill, William K.; Paterson, Andrew H.


    Rhizomes are organs of fundamental importance to plant competitiveness and invasiveness. We have identified genes expressed at substantially higher levels in rhizomes than other plant parts, and explored their functional categorization, genomic organization, regulatory motifs, and association with quantitative trait loci (QTLs) conferring rhizomatousness. The finding that genes with rhizome-enriched expression are distributed across a wide range of functional categories suggests some degree of specialization of individual members of many gene families in rhizomatous plants. A disproportionate share of genes with rhizome-enriched expression was implicated in secondary and hormone metabolism, and abiotic stimuli and development. A high frequency of unknown-function genes reflects our still limited knowledge of this plant organ. A putative oligosaccharyl transferase showed the highest degree of rhizome-specific expression, with several transcriptional or regulatory protein complex factors also showing high (but lesser) degrees of specificity. Inferred by the upstream sequences of their putative rice (Oryza sativa) homologs, sorghum (Sorghum bicolor) genes that were relatively highly expressed in rhizome tip tissues were enriched for cis-element motifs, including the pyrimidine box, TATCCA box, and CAREs box, implicating the gibberellins in regulation of many rhizome-specific genes. From cDNA clones showing rhizome-enriched expression, expressed sequence tags forming 455 contigs were plotted on the rice genome and aligned to QTL likelihood intervals for ratooning and rhizomatous traits in rice and sorghum. Highly expressed rhizome genes were somewhat enriched in QTL likelihood intervals for rhizomatousness or ratooning, with specific candidates including some of the most rhizome-specific genes. Some rhizomatousness and ratooning QTLs were shown to be potentially related to one another as a result of ancient duplication, suggesting long-term functional conservation of

  5. Preventing phosphorylation of sterol regulatory element-binding protein 1a by MAP-kinases protects mice from fatty liver and visceral obesity.


    Kotzka, Jorg; Knebel, Birgit; Haas, Jutta; Kremer, Lorena; Jacob, Sylvia; Hartwig, Sonja; Nitzgen, Ulrike; Muller-Wieland, Dirk


    The transcription factor sterol regulatory element binding protein (SREBP)-1a plays a pivotal role in lipid metabolism. Using the SREBP-1a expressing human hepatoma cell line HepG2 we have shown previously that human SREBP-1a is phosphorylated at serine 117 by ERK-mitogen-activated protein kinases (MAPK). Using a combination of cell biology and protein chemistry approach we show that SREBP-1a is also target of other MAPK-families, i.e. c-JUN N-terminal protein kinases (JNK) or p38 stress activated MAP kinases. Serine 117 is also the major phosphorylation site in SREBP-1a for JNK. In contrast to that the major phosphorylation sites of p38 MAPK family are serine 63 and threonine 426. Functional analyses reveal that phosphorylation of SREBP-1a does not alter protein/DNA interaction. The identified phosphorylation sites are specific for both kinase families also in cellular context. To provide direct evidence that phosphorylation of SREBP-1a is a regulatory principle of biological and clinical relevance, we generated transgenic mice expressing mature transcriptionally active N-terminal domain of human SREBP-1a variant lacking all identified phosphorylaton sites designed as alb-SREBP-1aΔP and wild type SREBP-1a designed as alb-SREBP-1a liver specific under control of the albumin promoter and a liver specific enhancer. In contrast to alb-SREBP-1a mice the phosphorylation-deficient mice develop no enlarged fatty livers under normocaloric conditions. Phenotypical examination reveales a massive accumulation of adipose tissue in alb-SREBP-1a but not in the phosphorylation deficient alb-SREBP-1aΔP mice. Moreover, preventing phosphorylation of SREBP-1a protects mice also from dyslipidemia. In conclusion, phosphorylation of SREBP-1a by ERK, JNK and p38 MAPK-families resembles a biological principle and plays a significant role, in vivo.

  6. Targeting a Regulatory Element in Human Thymidylate Synthase mRNA

    PubMed Central

    Brunn, Nicholas D.; Sega, Emily Garcia; Kao, Melody B.


    Thymidylate synthase (TS) is a key enzyme in the biosynthesis of thymidine. TS inhibitors, which are used in cancer chemotherapy, suffer from resistance development in tumors through upregulation of TS expression. Autoregulatory translation control has been implicated with TS overexpression. TS binding at its own mRNA, which leads to sequestration of the start codon, is abolished when the enzyme forms an inhibitor complex, thereby relieving translation suppression. We have used the protein binding site from the TS mRNA in the context of a bicistronic expression system to validate targeting the regulatory motif with stabilizing ligands that prevent ribosomal initiation. Stabilization of the RNA by mutations, which were studied as surrogates of ligand binding, suppresses translation of the TS protein. Compounds that stabilize the TS binding RNA motif and thereby inhibit ribosomal initiation might be used in combination with existing TS enzyme-targeting drugs to overcome resistance development during chemotherapy. PMID:23143777

  7. microRNAs and Alu elements in the p53-Mdm2-Mdm4 regulatory network.


    Hoffman, Yonit; Pilpel, Yitzhak; Oren, Moshe


    p53 is a transcription factor that governs numerous stress response pathways within the cell. Maintaining the right levels of p53 is crucial for cell survival and proper cellular homeostasis. The tight regulation of p53 involves many cellular components, most notably its major negative regulators Mdm2 and Mdm4, which maintain p53 protein amount and activity in tight check. microRNAs (miRNAs) are small non-coding RNAs that target specific mRNAs to translational arrest and degradation. miRNAs are also key components of the normal p53 pathway, joining forces with Mdm2 and Mdm4 to maintain proper p53 activity. Here we review the current knowledge of miRNAs targeting Mdm2 and Mdm4, and their importance in different tissues and in pathological states such as cancer. In addition, we address the role of Alu sequences-highly abundant retroelements spread throughout the human genome, and their impact on gene regulation via the miRNA machinery. Alus occupy a significant portion of genes' 3'UTR, and as such they have the potential to impact mRNA regulation. Since Alus are primate-specific, they introduce a new regulatory layer into primate genomes. Alus can influence and alter gene regulation, creating primate-specific cancer-preventive regulatory mechanisms to sustain the transition to longer life span in primates. We review the possible influence of Alu sequences on miRNA functionality in general and specifically within the p53 network.

  8. LINE-1 Retrotransposable Element DNA Accumulates in HIV-1-Infected Cells

    PubMed Central

    Song, Haihan; Xu, Yang; Garrison, Keith E.; Buzdin, Anton A.; Anwar, Naveed; Hunter, Diana V.; Mujib, Shariq; Mihajlovic, Vesna; Martin, Eric; Lee, Erika; Kuciak, Monika; Raposo, Rui André Saraiva; Bozorgzad, Ardalan; Meiklejohn, Duncan A.; Ndhlovu, Lishomwa C.; Nixon, Douglas F.; Ostrowski, Mario A.


    Type 1 long-interspersed nuclear elements (L1s) are autonomous retrotransposable elements that retain the potential for activity in the human genome but are suppressed by host factors. Retrotransposition of L1s into chromosomal DNA can lead to genomic instability, whereas reverse transcription of L1 in the cytosol has the potential to activate innate immune sensors. We hypothesized that HIV-1 infection would compromise cellular control of L1 elements, resulting in the induction of retrotransposition events. Here, we show that HIV-1 infection enhances L1 retrotransposition in Jurkat cells in a Vif- and Vpr-dependent manner. In primary CD4+ cells, HIV-1 infection results in the accumulation of L1 DNA, at least the majority of which is extrachromosomal. These data expose an unrecognized interaction between HIV-1 and endogenous retrotransposable elements, which may have implications for the innate immune response to HIV-1 infection, as well as for HIV-1-induced genomic instability and cytopathicity. PMID:24089548

  9. LINE-1 retrotransposable element DNA accumulates in HIV-1-infected cells.


    Jones, R Brad; Song, Haihan; Xu, Yang; Garrison, Keith E; Buzdin, Anton A; Anwar, Naveed; Hunter, Diana V; Mujib, Shariq; Mihajlovic, Vesna; Martin, Eric; Lee, Erika; Kuciak, Monika; Raposo, Rui André Saraiva; Bozorgzad, Ardalan; Meiklejohn, Duncan A; Ndhlovu, Lishomwa C; Nixon, Douglas F; Ostrowski, Mario A


    Type 1 long-interspersed nuclear elements (L1s) are autonomous retrotransposable elements that retain the potential for activity in the human genome but are suppressed by host factors. Retrotransposition of L1s into chromosomal DNA can lead to genomic instability, whereas reverse transcription of L1 in the cytosol has the potential to activate innate immune sensors. We hypothesized that HIV-1 infection would compromise cellular control of L1 elements, resulting in the induction of retrotransposition events. Here, we show that HIV-1 infection enhances L1 retrotransposition in Jurkat cells in a Vif- and Vpr-dependent manner. In primary CD4(+) cells, HIV-1 infection results in the accumulation of L1 DNA, at least the majority of which is extrachromosomal. These data expose an unrecognized interaction between HIV-1 and endogenous retrotransposable elements, which may have implications for the innate immune response to HIV-1 infection, as well as for HIV-1-induced genomic instability and cytopathicity.

  10. Renal Anemia Model Mouse Established by Transgenic Rescue with an Erythropoietin Gene Lacking Kidney-Specific Regulatory Elements.


    Hirano, Ikuo; Suzuki, Norio; Yamazaki, Shun; Sekine, Hiroki; Minegishi, Naoko; Shimizu, Ritsuko; Yamamoto, Masayuki


    The erythropoietin (Epo) gene is under tissue-specific inducible regulation. Because the kidney is the primary EPO-producing tissue in adults, impaired EPO production in chronic kidney disorders results in serious renal anemia. The Epo gene contains a liver-specific enhancer in the 3' region, but the kidney-specific enhancer for gene expression in renal EPO-producing (REP) cells remains elusive. Here, we examined a conserved upstream element for renal Epo regulation (CURE) region that spans 17.4 kb to 3.6 kb upstream of the Epo gene and harbors several phylogenetically conserved elements. We prepared various Epo gene-reporter constructs utilizing a bacterial artificial chromosome and generated a number of transgenic-mouse lines. We observed that deletion of the CURE region (δCURE) abrogated Epo gene expression in REP cells. Although transgenic expression of the δCURE construct rescued Epo-deficient mice from embryonic lethality, the rescued mice had severe EPO-dependent anemia. These mouse lines serve as an elaborate model for the search for erythroid stimulatory activity and are referred to as AnRED (anemic model with renal EPO deficiency) mice. We also dissected the CURE region by exploiting a minigene harboring four phylogenetically conserved elements in reporter transgenic-mouse analyses. Our analyses revealed that Epo gene regulation in REP cells is a complex process that utilizes multiple regulatory influences.

  11. Identification of sequence elements contributing to the intrinsic curvature of the mouse satellite DNA repeat.

    PubMed Central

    Carrera, P; Martínez-Balbás, M A; Portugal, J; Azorín, F


    In this paper, the contribution of different sequence elements to the intrisic curvature of the mouse satellite DNA repeat was investigated. This DNA fragment contains nineteen groups of three or more consecutive adenines which are only poorly phased with respect to the helical repeat. The mouse satellite DNA repeat shows a sinusoidal pattern of cleavage by the hydroxyl radical; the waves of reactivity are phased with respect to the A-tracts. Some interesting observations arise from a detailed analysis of these cleavage patterns: a) the maxima of hydroxyl radical cleavage are more periodically spaced along the DNA sequence than the A-tracts themselves. As a consequence, the position of each maximum with respect to the A-tract is variable; b) the sequence 5' TGGAATATG/AA 3' shows a sinusoidal pattern of hydroxyl radical cleavage. This sequence shows a retarded migration in polyacrylamide gels indicating that it is actually intrinsically curved. These results are discussed in view of the current models for DNA curvature. Images PMID:1658737

  12. Molecular cloning and functional characterization of porcine DNA-dependent activator of IFN-regulatory factors (DAI).


    Xie, Lilan; Fang, Liurong; Wang, Dang; Luo, Rui; Cai, Kaimei; Chen, Huanchun; Xiao, Shaobo


    The DNA-dependent activator of IFN-regulatory factors (DAI) is a recently identified DNA sensor for intracellular DNA that triggers a signal for the production of type I IFN. Here we report the cloning and characterization of porcine DAI (poDAI). The full-length of poDAI encodes 439 amino acids, contains two N-terminal DNA-binding domains and shows similarity to mouse, rat, dog, monkey, human, horse and cattle counterparts ranging from 44% to 67%. poDAI mRNA expression was mainly detected in spleen, lung, kidney and small intestine. Over-expression of poDAI activated transcription factors IRF3 and NF-kappaB and induced IFN-beta in different porcine cell lines, but to varying degrees. Deletion mutant analysis revealed that both the DNA-binding domains and the C-terminus are required for full activation of IFN-beta. siRNA targeting poDAI significantly decreased poly(dAT:dAT)- or Pseudorabies virus (PRV)-induced IFN-beta activation. These results indicate that DAI is an important immuno-regulator of the porcine innate immune system.

  13. Identification and Characterization of MYC Regulatory Elements: Links to Prostate Cancer

    DTIC Science & Technology


    mg/mL kanamycin and 20 mg/mL chloramphenicol. Positive colonies were first identified by polymerase chain reaction (PCR) using beta-globin and lacZ...purpose of this proposal is to identify and characterize prostate enhancers within the prostate cancer associated intervals on 8q24 using a combination of...the need to investigate the expression patterns of other nearby genes. Task 1b, 1c and 1d: Use progressively smaller DNA fragments in in vivo mouse

  14. Analysis of a DNase I-hypersensitive site in transgenic Drosophila reveals a key regulatory element of Sgs3.

    PubMed Central

    Ramain, P; Giangrande, A; Richards, G; Bellard, M


    We have undertaken chromatin studies on transformed Drosophila strains carrying DNA sequences modified in the region of the DNase I (EC sites -750 and -600 base pairs upstream from the Sgs3 start site. Although both sites are developmentally specific, modifications in the -750 site have little or no effect on Sgs3-encoded transcript levels, whereas either deletion or replacement of sequences at the -600 site causes an important reduction in transcript levels. The element associated with the -600 site enhances Sgs3 transcription when displaced with respect to the start site. This combined approach has defined sequence elements necessary both for normal transcript levels as well as the chromatin structure characteristic of Sgs3 activity in vivo. Images PMID:3128796

  15. Effects of trace elements and pesticides on dephosphorylation of RNA and DNA added to soils

    SciTech Connect

    Frankenberger, W.T. Jr.; Johanson, J.B.; Lund L.J.


    This study was carried out to assess the effects of 14 trace elements, 12 herbicides, and two fungicides on dephosphorylation of yeast ribonucleic acid (RNA) and deoxyribonucleic acid (DNA) added to soils (Xerollic Calciorthids and Typic Haploxeralfs). The cumulative amount of ortho phosphate (Pi) released from nucleic acids increased linearly with time of incubation (up to 72 h), decreased with profile depth, and was highly influenced by soil pH. When trace elements were applied and compared by using 2.5 mmol kg/sup -1/ of soil, the average inhibition in dephosphorylation of RNA and DNA in two soils ranged from 17% with Co(II) to 52% with Cu(II). The most effective inhibitors of nucleic acid dephosphorylation were Ag(I), Cu(I), Cd(II), Cu(II), Mn(II), Ni(II), and Pb(II) (avg inhibition greater than or equal to 35%). Other elements that inhibited dephosphorylation of RNA and DNA added to soils included Ba(II), Co(II), Hg(II), Zn(II), Ti(IV), V(IV), and W(VI). When the pesticides were compared by using 5 mg of active ingredient kg/sup -1/ of soil, the average inhibition in nucleic acid dephosphorylation ranged from 14% with butylate to 39% with chloramben. The most effective inhibitors (> 25%) were atrazine, naptalam, chloramben, dicamba, trifluralin, and maneb. Other pesticides that inhibited RNA and DNA dephosphorylation in soils included cyanazine, 2,4-D, dinitroamine, EPTC plus R-25788, alachlor, paraquat, butylate, and captan.

  16. Early and late periodic patterns of even skipped expression are controlled by distinct regulatory elements that respond to different spatial cues.


    Goto, T; Macdonald, P; Maniatis, T


    We have identified the regulatory sequences required for the periodic expression of the Drosophila pair rule gene even skipped (eve). We find that the gradually changing pattern of periodic eve expression during early embryogenesis is directed by two distinct regulatory programs. Initially, eve expression in individual stripes is established by different regulatory elements, each of which responds to nonperiodic spatial cues provided, at least in part, by the gap genes. Later, coordinate expression of eve in all seven stripes is directed by a single regulatory region that responds to periodic cues provided by primary pair rule genes, including eve itself. As a consequence of this two-step regulatory program, eve functions both in the establishment of the periodic pattern of gene expression and in the subsequent specification of parasegmental boundaries.

  17. Global identification of the genetic networks and cis-regulatory elements of the cold response in zebrafish

    PubMed Central

    Hu, Peng; Liu, Mingli; Zhang, Dong; Wang, Jinfeng; Niu, Hongbo; Liu, Yimeng; Wu, Zhichao; Han, Bingshe; Zhai, Wanying; Shen, Yu; Chen, Liangbiao


    The transcriptional programs of ectothermic teleosts are directly influenced by water temperature. However, the cis- and trans-factors governing cold responses are not well characterized. We profiled transcriptional changes in eight zebrafish tissues exposed to mildly and severely cold temperatures using RNA-Seq. A total of 1943 differentially expressed genes (DEGs) were identified, from which 34 clusters representing distinct tissue and temperature response expression patterns were derived using the k-means fuzzy clustering algorithm. The promoter regions of the clustered DEGs that demonstrated strong co-regulation were analysed for enriched cis-regulatory elements with a motif discovery program, DREME. Seventeen motifs, ten known and seven novel, were identified, which covered 23% of the DEGs. Two motifs predicted to be the binding sites for the transcription factors Bcl6 and Jun, respectively, were chosen for experimental verification, and they demonstrated the expected cold-induced and cold-repressed patterns of gene regulation. Protein interaction modeling of the network components followed by experimental validation suggested that Jun physically interacts with Bcl6 and might be a hub factor that orchestrates the cold response in zebrafish. Thus, the methodology used and the regulatory networks uncovered in this study provide a foundation for exploring the mechanisms of cold adaptation in teleosts. PMID:26227973

  18. Functional roles of Aves class-specific cis-regulatory elements on macroevolution of bird-specific features.


    Seki, Ryohei; Li, Cai; Fang, Qi; Hayashi, Shinichi; Egawa, Shiro; Hu, Jiang; Xu, Luohao; Pan, Hailin; Kondo, Mao; Sato, Tomohiko; Matsubara, Haruka; Kamiyama, Namiko; Kitajima, Keiichi; Saito, Daisuke; Liu, Yang; Gilbert, M Thomas P; Zhou, Qi; Xu, Xing; Shiroishi, Toshihiko; Irie, Naoki; Tamura, Koji; Zhang, Guojie


    Unlike microevolutionary processes, little is known about the genetic basis of macroevolutionary processes. One of these magnificent examples is the transition from non-avian dinosaurs to birds that has created numerous evolutionary innovations such as self-powered flight and its associated wings with flight feathers. By analysing 48 bird genomes, we identified millions of avian-specific highly conserved elements (ASHCEs) that predominantly (>99%) reside in non-coding regions. Many ASHCEs show differential histone modifications that may participate in regulation of limb development. Comparative embryonic gene expression analyses across tetrapod species suggest ASHCE-associated genes have unique roles in developing avian limbs. In particular, we demonstrate how the ASHCE driven avian-specific expression of gene Sim1 driven by ASHCE may be associated with the evolution and development of flight feathers. Together, these findings demonstrate regulatory roles of ASHCEs in the creation of avian-specific traits, and further highlight the importance of cis-regulatory rewiring during macroevolutionary changes.

  19. Computational Identification of Tissue-Specific Splicing Regulatory Elements in Human Genes from RNA-Seq Data

    PubMed Central

    Badr, Eman; ElHefnawi, Mahmoud; Heath, Lenwood S.


    Alternative splicing is a vital process for regulating gene expression and promoting proteomic diversity. It plays a key role in tissue-specific expressed genes. This specificity is mainly regulated by splicing factors that bind to specific sequences called splicing regulatory elements (SREs). Here, we report a genome-wide analysis to study alternative splicing on multiple tissues, including brain, heart, liver, and muscle. We propose a pipeline to identify differential exons across tissues and hence tissue-specific SREs. In our pipeline, we utilize the DEXSeq package along with our previously reported algorithms. Utilizing the publicly available RNA-Seq data set from the Human BodyMap project, we identified 28,100 differentially used exons across the four tissues. We identified tissue-specific exonic splicing enhancers that overlap with various previously published experimental and computational databases. A complicated exonic enhancer regulatory network was revealed, where multiple exonic enhancers were found across multiple tissues while some were found only in specific tissues. Putative combinatorial exonic enhancers and silencers were discovered as well, which may be responsible for exon inclusion or exclusion across tissues. Some of the exonic enhancers are found to be co-occurring with multiple exonic silencers and vice versa, which demonstrates a complicated relationship between tissue-specific exonic enhancers and silencers. PMID:27861625

  20. In vivo promoter analysis on refeeding response of hepatic sterol regulatory element-binding protein-1c expression

    SciTech Connect

    Takeuchi, Yoshinori; Yahagi, Naoya; Nakagawa, Yoshimi; Matsuzaka, Takashi; Shimizu, Ritsuko; Sekiya, Motohiro; Iizuka, Yoko; Ohashi, Ken; Gotoda, Takanari; Yamamoto, Masayuki; Nagai, Ryozo; Kadowaki, Takashi; Yamada, Nobuhiro; Osuga, Jun-ichi; Shimano, Hitoshi


    Sterol regulatory element-binding protein (SREBP)-1c is the master regulator of lipogenic gene expression in liver. The mRNA abundance of SREBP-1c is markedly induced when animals are refed after starvation, although the regulatory mechanism is so far unknown. To investigate the mechanism of refeeding response of SREBP-1c gene expression in vivo, we generated a transgenic mouse model that carries 2.2 kb promoter region fused to the luciferase reporter gene. These transgenic mice exhibited refeeding responses of the reporter in liver and adipose tissues with extents essentially identical to those of endogenous SREBP-1c mRNA. The same results were obtained from experiments using adenovirus-mediated SREBP-1c-promoter-luciferase fusion gene transduction to liver. These data demonstrate that the regulation of SREBP-1c gene expression is at the transcription level, and that the 2.2 kb 5'-flanking region is sufficient for this regulation. Moreover, when these transgenic or adenovirus-infected mice were placed on insulin-depleted state by streptozotocin treatment, the reporter expression was upregulated as strongly as in control mice, demonstrating that this regulation is not dominated by serum insulin level. These mice are the first models to provide the mechanistic insight into the transcriptional regulation of SREBP-1c gene in vivo.

  1. [The expression of tPA directed by the bovine BLG regulatory elements in the mammary gland of transgenic mice].


    Chen, H X; Chen, X; Yang, X; Deng, J X; Su, G F; Huang, P T


    In order to get the regulatory elements which are essential for generating mammary gland bioreactors, the whole 8.4 kb bovine BLG gene was obtained by PCR amplification. The 1.6 kb chicken lysozyme matrix attachment region (MAR) was used to overcome position effects. The bovine BLG-tPA expression vector was constructed and the BLG-tPA fusion gene was introduced into fertilized eggs of mice by microinjection to generate transgenic mouse. 170 offsprings were obtained, of which 9 were proved to be transgenic mice based on PCR and Southern-blot analysis. The tPA expression level amounted to 12 micrograms/mL in the milk of mice. The bovine BLG-tPA fusion gene integrated in the founders was inheritable.

  2. Demystifying the secret mission of enhancers: linking distal regulatory elements to target genes

    PubMed Central

    Yao, Lijing; Berman, Benjamin P.; Farnham, Peggy J.


    Abstract Enhancers are short regulatory sequences bound by sequence-specific transcription factors and play a major role in the spatiotemporal specificity of gene expression patterns in development and disease. While it is now possible to identify enhancer regions genomewide in both cultured cells and primary tissues using epigenomic approaches, it has been more challenging to develop methods to understand the function of individual enhancers because enhancers are located far from the gene(s) that they regulate. However, it is essential to identify target genes of enhancers not only so that we can understand the role of enhancers in disease but also because this information will assist in the development of future therapeutic options. After reviewing models of enhancer function, we discuss recent methods for identifying target genes of enhancers. First, we describe chromatin structure-based approaches for directly mapping interactions between enhancers and promoters. Second, we describe the use of correlation-based approaches to link enhancer state with the activity of nearby promoters and/or gene expression. Third, we describe how to test the function of specific enhancers experimentally by perturbing enhancer–target relationships using high-throughput reporter assays and genome editing. Finally, we conclude by discussing as yet unanswered questions concerning how enhancers function, how target genes can be identified, and how to distinguish direct from indirect changes in gene expression mediated by individual enhancers. PMID:26446758

  3. Protein phosphatase 2A and Cdc7 kinase regulate the DNA unwinding element-binding protein in replication initiation.


    Gao, Yanzhe; Yao, Jianhong; Poudel, Sumeet; Romer, Eric; Abu-Niaaj, Lubna; Leffak, Michael


    The DNA unwinding element (DUE)-binding protein (DUE-B) binds to replication origins coordinately with the minichromosome maintenance (MCM) helicase and the helicase activator Cdc45 in vivo, and loads Cdc45 onto chromatin in Xenopus egg extracts. Human DUE-B also retains the aminoacyl-tRNA proofreading function of its shorter orthologs in lower organisms. Here we report that phosphorylation of the DUE-B unstructured C-terminal domain unique to higher organisms regulates DUE-B intermolecular binding. Gel filtration analyses show that unphosphorylated DUE-B forms multiple high molecular weight (HMW) complexes. Several aminoacyl-tRNA synthetases and Mcm2-7 proteins were identified by mass spectrometry of the HMW complexes. Aminoacyl-tRNA synthetase binding is RNase A sensitive, whereas interaction with Mcm2-7 is nuclease resistant. Unphosphorylated DUE-B HMW complex formation is decreased by PP2A inhibition or direct DUE-B phosphorylation, and increased by inhibition of Cdc7. These results indicate that the state of DUE-B phosphorylation is maintained by the equilibrium between Cdc7-dependent phosphorylation and PP2A-dependent dephosphorylation, each previously shown to regulate replication initiation. Alanine mutation of the DUE-B C-terminal phosphorylation target sites increases MCM binding but blocks Cdc45 loading in vivo and inhibits cell division. In egg extracts alanine mutation of the DUE-B C-terminal phosphorylation sites blocks Cdc45 loading and inhibits DNA replication. The effects of DUE-B C-terminal phosphorylation reveal a novel S phase kinase regulatory mechanism for Cdc45 loading and MCM helicase activation.

  4. Regulatory elements involved in the bidirectional activity of an immunoglobulin promoter.

    PubMed Central

    Doyen, N; Dreyfus, M; Rougeon, F


    We show that the promoter from the mouse VH441 heavy-chain immunoglobulin gene, when present on plasmids transiently introduced into myeloma cells, promotes transcription bidirectionally, due to the presence on both strands of TATA-like sequences bracketing the highly conserved decanucleotide element. The two divergent promoters compete for the transcriptional machinery, their relative strength ultimately reflecting the likeness of the two TATA boxes to the consensus sequence. Moreover, their relative activity is also strongly influenced by certain point mutations within the distally located heavy-chain enhancer. The bearing of these results on current concepts of promoter function is discussed. Images PMID:2494644

  5. Menin and JunD regulate gastrin gene expression through proximal DNA elements.


    Mensah-Osman, Edith J; Veniaminova, Natalia A; Merchant, Juanita L


    Mutations in the MEN1 gene correlate with multiple endocrine neoplasia I (MEN1). Gastrinomas are the most malignant of the neuroendocrine tumors associated with MEN1. Because menin and JunD proteins interact, we examined whether JunD binds to and regulates the gastrin gene promoter. Both menin and JunD are ubiquitous nuclear proteins that we showed colocalize in the gastrin-expressing G cells of the mouse antrum. Transfection with a JunD expression vector alone induced endogenous gastrin mRNA in AGS human gastric cells, and the induction was blocked by menin overexpression. We mapped repression by menin to both a nonconsensus AP-1 site and proximal GC-rich elements within the human gastrin promoter. Chromatin immunoprecipitation assays, EMSAs, and DNA affinity precipitation assays documented that JunD and Sp1 proteins bind these two elements and are both targets for menin regulation. Consistent with menin forming a complex with histone deacetylases, we found that repression of gastrin gene expression by menin was reversed by trichostatin A. In conclusion, proximal DNA elements within the human gastrin gene promoter mediate interactions between JunD, which induces gastrin gene expression and menin, which suppresses JunD-mediated activation.

  6. Multiple Herbicide Resistance in Lolium multiflorum and Identification of Conserved Regulatory Elements of Herbicide Resistance Genes

    PubMed Central

    Mahmood, Khalid; Mathiassen, Solvejg K.; Kristensen, Michael; Kudsk, Per


    Herbicide resistance is a ubiquitous challenge to herbicide sustainability and a looming threat to control weeds in crops. Recently four genes were found constituently over-expressed in herbicide resistant individuals of Lolium rigidum, a close relative of Lolium multiflorum. These include two cytochrome P450s, one nitronate monooxygenase and one glycosyl-transferase. Higher expressions of these four herbicide metabolism related (HMR) genes were also observed after herbicides exposure in the gene expression databases, indicating them as reliable markers. In order to get an overview of herbicidal resistance status of L. multiflorum L, 19 field populations were collected. Among these populations, four populations were found to be resistant to acetolactate synthase (ALS) inhibitors while three exhibited resistance to acetyl-CoA carboxylase (ACCase) inhibitors in our initial screening and dose response study. The genotyping showed the presence of mutations Trp-574-Leu and Ile-2041-Asn in ALS and ACCase, respectively, and qPCR experiments revealed the enhanced expression of HMR genes in individuals of certain resistant populations. Moreover, co-expression networks and promoter analyses of HMR genes in O. sativa and A. thaliana resulted in the identification of a cis-regulatory motif and zinc finger transcription factors. The identified transcription factors were highly expressed similar to HMR genes in response to xenobiotics whereas the identified motif is known to play a vital role in coping with environmental stresses and maintaining genome stability. Overall, our findings provide an important step forward toward a better understanding of metabolism-based herbicide resistance that can be utilized to devise novel strategies of weed management. PMID:27547209

  7. Marsupial anti-Mullerian hormone gene structure, regulatory elements, and expression.


    Pask, Andrew J; Whitworth, Deanne J; Mao, Chai-An; Wei, Ke-Jun; Sankovic, Natasha; Graves, Jennifer A M; Shaw, Geoffrey; Renfree, Marilyn B; Behringer, Richard R


    During male sexual development in reptiles, birds, and mammals, anti-Müllerian hormone (AMH) induces the regression of the Müllerian ducts that normally form the primordia of the female reproductive tract. Whereas Müllerian duct regression occurs during fetal development in eutherian mammals, in marsupial mammals this process occurs after birth. To investigate AMH in a marsupial, we isolated an orthologue from the tammar wallaby (Macropus eugenii) and characterized its expression in the testes and ovaries during development. The wallaby AMH gene is highly conserved with the eutherian orthologues that have been studied, particularly within the encoded C-terminal mature domain. The N-terminus of marsupial AMH is divergent and larger than that of eutherian species. It is located on chromosome 3/4, consistent with its autosomal localization in other species. The wallaby 5' regulatory region, like eutherian AMH genes, contains binding sites for SF1, SOX9, and GATA factors but also contains a putative SRY-binding site. AMH expression in the developing testis begins at the time of seminiferous cord formation at 2 days post partum, and Müllerian duct regression begins shortly afterward. In the developing testis, AMH is localized in the cytoplasm of the Sertoli cells but is lost by adulthood. In the developing ovary, there is no detectable AMH expression, but in adults it is produced by the granulosa cells of primary and secondary follicles. It is not detectable in atretic follicles. Collectively, these studies suggest that AMH expression has been conserved during mammalian evolution and is intimately linked to upstream sex determination mechanisms.

  8. Molecular stripping in the NFκB / IκB / DNA genetic regulatory network

    NASA Astrophysics Data System (ADS)

    Potoyan, Davit; Wolynes, Peter

    Genetic switches based on the NFκB / IκB / DNA system are master regulators of an array of cellular responses. Recent kinetic experiments have shown that IκB can actively remove NF κB bound to its genetic sites via a process called ''molecular stripping''. This allows the NFκB / IκB / DNA switch to function under kinetic control rather than the thermodynamic control contemplated in the traditional models of gene switches. Using molecular dynamics simulations of coarse grained predictive energy landscape models for the constituent proteins by themselves and interacting with the DNA we explore the functional motions of the transcription factor NFκB and its various binary and ternary complexes with DNA and the inhibitor I κB. These studies show that the function of the NFκB / IκB / DNA genetic switch is realized via an allosteric mechanism. Molecular stripping occurs through the activation of a domain twist mode by the binding of IκB which occurs through conformational selection. Free energy calculations for DNA binding show that the binding of IκB not only results in a significant decrease of the affinity of the transcription factor for the DNA but also kinetically speeds DNA release. Projections of the

  9. In Vitro Selection of a Single-Stranded DNA Molecular Recognition Element against Atrazine

    PubMed Central

    Williams, Ryan M.; Crihfield, Cassandra L.; Gattu, Srikanth; Holland, Lisa A.; Sooter, Letha J.


    Widespread use of the chlorotriazine herbicide, atrazine, has led to serious environmental and human health consequences. Current methods of detecting atrazine contamination are neither rapid nor cost-effective. In this work, atrazine-specific single-stranded DNA (ssDNA) molecular recognition elements (MRE) were isolated. We utilized a stringent Systematic Evolution of Ligands by Exponential Enrichment (SELEX) methodology that placed the greatest emphasis on what the MRE should not bind to. After twelve rounds of SELEX, an atrazine-specific MRE with high affinity was obtained. The equilibrium dissociation constant (Kd) of the ssDNA sequence is 0.62 ± 0.21 nM. It also has significant selectivity for atrazine over atrazine metabolites and other pesticides found in environmentally similar locations and concentrations. Furthermore, we have detected environmentally relevant atrazine concentrations in river water using this MRE. The strong affinity and selectivity of the selected atrazine-specific ssDNA validated the stringent SELEX methodology and identified a MRE that will be useful for rapid atrazine detection in environmental samples. PMID:25196435

  10. Gene-specific factors determine mitotic expression and bookmarking via alternate regulatory elements

    PubMed Central

    Arampatzi, Panagiota; Gialitakis, Manolis; Makatounakis, Takis; Papamatheakis, Joseph


    Transcriptional silencing during mitosis is caused by inactivation of critical transcriptional regulators and/or chromatin condensation. Inheritance of gene expression patterns through cell division involves various bookmarking mechanisms. In this report, we have examined the mitotic and post-mitotic expression of the DRA major histocompatibility class II (MHCII) gene in different cell types. During mitosis the constitutively MHCII-expressing B lymphoblastoid cells showed sustained occupancy of the proximal promoter by the cognate enhanceosome and general transcription factors. In contrast, although mitotic epithelial cells were depleted of these proteins irrespectively of their MHCII transcriptional activity, a distal enhancer selectively recruited the PP2A phosphatase via NFY and maintained chromatin accessibility. Based on our data, we propose a novel chromatin anti-condensation role for this element in mitotic bookmarking and timing of post-mitotic transcriptional reactivation. PMID:23303784

  11. Active learning: effects of core training design elements on self-regulatory processes, learning, and adaptability.


    Bell, Bradford S; Kozlowski, Steve W J


    This article describes a comprehensive examination of the cognitive, motivational, and emotional processes underlying active learning approaches; their effects on learning and transfer; and the core training design elements (exploration, training frame, emotion control) and individual differences (cognitive ability, trait goal orientation, trait anxiety) that shape these processes. Participants (N = 350) were trained to operate a complex, computer-based simulation. Exploratory learning and error-encouragement framing had a positive effect on adaptive transfer performance and interacted with cognitive ability and dispositional goal orientation to influence trainees' metacognition and state goal orientation. Trainees who received the emotion-control strategy had lower levels of state anxiety. Implications for development of an integrated theory of active learning, learner-centered design, and research extensions are discussed.

  12. Identification and Characterization of a cis-Regulatory Element for Zygotic Gene Expression in Chlamydomonas reinhardtii

    PubMed Central

    Hamaji, Takashi; Lopez, David; Pellegrini, Matteo; Umen, James


    Upon fertilization Chlamydomonas reinhardtii zygotes undergo a program of differentiation into a diploid zygospore that is accompanied by transcription of hundreds of zygote-specific genes. We identified a distinct sequence motif we term a zygotic response element (ZYRE) that is highly enriched in promoter regions of C. reinhardtii early zygotic genes. A luciferase reporter assay was used to show that native ZYRE motifs within the promoter of zygotic gene ZYS3 or intron of zygotic gene DMT4 are necessary for zygotic induction. A synthetic luciferase reporter with a minimal promoter was used to show that ZYRE motifs introduced upstream are sufficient to confer zygotic upregulation, and that ZYRE-controlled zygotic transcription is dependent on the homeodomain transcription factor GSP1. We predict that ZYRE motifs will correspond to binding sites for the homeodomain proteins GSP1-GSM1 that heterodimerize and activate zygotic gene expression in early zygotes. PMID:27172209

  13. Identification and characterization of a cis-regulatory element for zygotic gene expression in Chlamydomonas reinhardtii


    Hamaji, Takashi; Lopez, David; Pellegrini, Matteo; ...


    Upon fertilization Chlamydomonas reinhardtii zygotes undergo a program of differentiation into a diploid zygospore that is accompanied by transcription of hundreds of zygote-specific genes. We identified a distinct sequence motif we term a zygotic response element (ZYRE) that is highly enriched in promoter regions of C. reinhardtii early zygotic genes. A luciferase reporter assay was used to show that native ZYRE motifs within the promoter of zygotic gene ZYS3 or intron of zygotic gene DMT4 are necessary for zygotic induction. A synthetic luciferase reporter with a minimal promoter was used to show that ZYRE motifs introduced upstream are sufficient tomore » confer zygotic upregulation, and that ZYRE-controlled zygotic transcription is dependent on the homeodomain transcription factor GSP1. Furthermore, we predict that ZYRE motifs will correspond to binding sites for the homeodomain proteins GSP1-GSM1 that heterodimerize and activate zygotic gene expression in early zygotes.« less

  14. An ensemble of regulatory elements controls Runx3 spatiotemporal expression in subsets of dorsal root ganglia proprioceptive neurons

    PubMed Central

    Appel, Elena; Weissmann, Sarit; Salzberg, Yehuda; Orlovsky, Kira; Negreanu, Varda; Tsoory, Michael; Raanan, Calanit; Feldmesser, Ester; Bernstein, Yael; Wolstein, Orit; Levanon, Ditsa; Groner, Yoram


    The Runx3 transcription factor is essential for development and diversification of the dorsal root ganglia (DRGs) TrkC sensory neurons. In Runx3-deficient mice, developing TrkC neurons fail to extend central and peripheral afferents, leading to cell death and disruption of the stretch reflex circuit, resulting in severe limb ataxia. Despite its central role, the mechanisms underlying the spatiotemporal expression specificities of Runx3 in TrkC neurons were largely unknown. Here we first defined the genomic transcription unit encompassing regulatory elements (REs) that mediate the tissue-specific expression of Runx3. Using transgenic mice expressing BAC reporters spanning the Runx3 locus, we discovered three REs—dubbed R1, R2, and R3—that cross-talk with promoter-2 (P2) to drive TrkC neuron-specific Runx3 transcription. Deletion of single or multiple elements either in the BAC transgenics or by CRISPR/Cas9-mediated endogenous ablation established the REs’ ability to promote and/or repress Runx3 expression in developing sensory neurons. Our analysis reveals that an intricate combinatorial interplay among the three REs governs Runx3 expression in distinct subtypes of TrkC neurons while concomitantly extinguishing its expression in non-TrkC neurons. These findings provide insights into the mechanism regulating cell type-specific expression and subtype diversification of TrkC neurons in developing DRGs. PMID:28007784

  15. An ensemble of regulatory elements controls Runx3 spatiotemporal expression in subsets of dorsal root ganglia proprioceptive neurons.


    Appel, Elena; Weissmann, Sarit; Salzberg, Yehuda; Orlovsky, Kira; Negreanu, Varda; Tsoory, Michael; Raanan, Calanit; Feldmesser, Ester; Bernstein, Yael; Wolstein, Orit; Levanon, Ditsa; Groner, Yoram


    The Runx3 transcription factor is essential for development and diversification of the dorsal root ganglia (DRGs) TrkC sensory neurons. In Runx3-deficient mice, developing TrkC neurons fail to extend central and peripheral afferents, leading to cell death and disruption of the stretch reflex circuit, resulting in severe limb ataxia. Despite its central role, the mechanisms underlying the spatiotemporal expression specificities of Runx3 in TrkC neurons were largely unknown. Here we first defined the genomic transcription unit encompassing regulatory elements (REs) that mediate the tissue-specific expression of Runx3. Using transgenic mice expressing BAC reporters spanning the Runx3 locus, we discovered three REs-dubbed R1, R2, and R3-that cross-talk with promoter-2 (P2) to drive TrkC neuron-specific Runx3 transcription. Deletion of single or multiple elements either in the BAC transgenics or by CRISPR/Cas9-mediated endogenous ablation established the REs' ability to promote and/or repress Runx3 expression in developing sensory neurons. Our analysis reveals that an intricate combinatorial interplay among the three REs governs Runx3 expression in distinct subtypes of TrkC neurons while concomitantly extinguishing its expression in non-TrkC neurons. These findings provide insights into the mechanism regulating cell type-specific expression and subtype diversification of TrkC neurons in developing DRGs.

  16. Structure of an RNA dimer of a regulatory element from human thymidylate synthase mRNA

    SciTech Connect

    Dibrov, Sergey; McLean, Jaime; Hermann, Thomas


    A sequence around the start codon of the mRNA of human thymidylate synthase (TS) folds into a secondary-structure motif in which the initiation site is sequestered in a metastable hairpin. Binding of the protein to its own mRNA at the hairpin prevents the production of TS through a translation-repression feedback mechanism. Stabilization of the mRNA hairpin by other ligands has been proposed as a strategy to reduce TS levels in anticancer therapy. Rapidly proliferating cells require high TS activity to maintain the production of thymidine as a building block for DNA synthesis. The crystal structure of a model oligonucleotide (TS1) that represents the TS-binding site of the mRNA has been determined. While fluorescence studies showed that the TS1 RNA preferentially adopts a hairpin structure in solution, even at high RNA concentrations, an asymmetric dimer of two hybridized TS1 strands was obtained in the crystal. The TS1 dimer contains an unusual S-turn motif that also occurs in the 'off' state of the human ribosomal decoding site RNA.

  17. A recent evolutionary change affects a regulatory element in the human FOXP2 gene.


    Maricic, Tomislav; Günther, Viola; Georgiev, Oleg; Gehre, Sabine; Curlin, Marija; Schreiweis, Christiane; Naumann, Ronald; Burbano, Hernán A; Meyer, Matthias; Lalueza-Fox, Carles; de la Rasilla, Marco; Rosas, Antonio; Gajovic, Srecko; Kelso, Janet; Enard, Wolfgang; Schaffner, Walter; Pääbo, Svante


    The FOXP2 gene is required for normal development of speech and language. By isolating and sequencing FOXP2 genomic DNA fragments from a 49,000-year-old Iberian Neandertal and 50 present-day humans, we have identified substitutions in the gene shared by all or nearly all present-day humans but absent or polymorphic in Neandertals. One such substitution is localized in intron 8 and affects a binding site for the transcription factor POU3F2, which is highly conserved among vertebrates. We find that the derived allele of this site is less efficient than the ancestral allele in activating transcription from a reporter construct. The derived allele also binds less POU3F2 dimers than POU3F2 monomers compared with the ancestral allele. Because the substitution in the POU3F2 binding site is likely to alter the regulation of FOXP2 expression, and because it is localized in a region of the gene associated with a previously described signal of positive selection, it is a plausible candidate for having caused a recent selective sweep in the FOXP2 gene.

  18. Polymorphism in the bovine BOLA-DRB3 upstream regulatory regions detected through PCR-SSCP and DNA sequencing.


    Ripoli, M V; Peral-García, P; Dulout, F N; Giovambattista, G


    In the present work, we describe through polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) and DNA sequencing the polymorphism within the URR-BoLA-DRB3 in 15 cattle breeds. In total, seven PCR-SSCP defined alleles were detected. The alignment of studied sequences showed six polymorphic sites (four transitions, one transversion and one deletion) in the interconsensus regions of the BoLA-DRB3 upstream regulatory region (URR), while the consensus boxes were invariant. Five out of six detected polymorphic sites were of one nucleotide substitution in the interconsensus regions. It is expected that these mutations do not affect significantly the level of expression. In contrast, the deletion observed in the sequence between CCAAT and TATA boxes could have some effect on affinity interactions between the promoter region and the transcription factors. The URR-BoLA-DRB3 DNA analyzed sequences showed moderate level of nucleotide diversity, high level of identity among them and were grouped in the same clade in the phylogenetic tree. In addition, the phylogenetic tree, the similarity analysis and the sequence structure confirmed that the fragment analyzed in this study corresponds to the URR-BoLA-DRB3. The functional role of the observed polymorphic sites among the regulatory motifs in bovine needs to be analyzed and confirmed by means of gene expression assays.

  19. The extended regulatory networks of SXT/R391 integrative and conjugative elements and IncA/C conjugative plasmids.


    Poulin-Laprade, Dominic; Carraro, Nicolas; Burrus, Vincent


    Nowadays, healthcare systems are challenged by a major worldwide drug resistance crisis caused by the massive and rapid dissemination of antibiotic resistance genes and associated emergence of multidrug resistant pathogenic bacteria, in both clinical and environmental settings. Conjugation is the main driving force of gene transfer among microorganisms. This mechanism of horizontal gene transfer mediates the translocation of large DNA fragments between two bacterial cells in direct contact. Integrative and conjugative elements (ICEs) of the SXT/R391 family (SRIs) and IncA/C conjugative plasmids (ACPs) are responsible for the dissemination of a broad spectrum of antibiotic resistance genes among diverse species of Enterobacteriaceae and Vibrionaceae. The biology, diversity, prevalence and distribution of these two families of conjugative elements have been the subject of extensive studies for the past 15 years. Recently, the transcriptional regulators that govern their dissemination through the expression of ICE- or plasmid-encoded transfer genes have been described. Unrelated repressors control the activation of conjugation by preventing the expression of two related master activator complexes in both types of elements, i.e., SetCD in SXT/R391 ICEs and AcaCD in IncA/C plasmids. Finally, in addition to activating ICE- or plasmid-borne genes, these master activators have been shown to specifically activate phylogenetically unrelated mobilizable genomic islands (MGIs) that also disseminate antibiotic resistance genes and other adaptive traits among a plethora of pathogens such as Vibrio cholerae and Salmonella enterica.

  20. The extended regulatory networks of SXT/R391 integrative and conjugative elements and IncA/C conjugative plasmids

    PubMed Central

    Poulin-Laprade, Dominic; Carraro, Nicolas; Burrus, Vincent


    Nowadays, healthcare systems are challenged by a major worldwide drug resistance crisis caused by the massive and rapid dissemination of antibiotic resistance genes and associated emergence of multidrug resistant pathogenic bacteria, in both clinical and environmental settings. Conjugation is the main driving force of gene transfer among microorganisms. This mechanism of horizontal gene transfer mediates the translocation of large DNA fragments between two bacterial cells in direct contact. Integrative and conjugative elements (ICEs) of the SXT/R391 family (SRIs) and IncA/C conjugative plasmids (ACPs) are responsible for the dissemination of a broad spectrum of antibiotic resistance genes among diverse species of Enterobacteriaceae and Vibrionaceae. The biology, diversity, prevalence and distribution of these two families of conjugative elements have been the subject of extensive studies for the past 15 years. Recently, the transcriptional regulators that govern their dissemination through the expression of ICE- or plasmid-encoded transfer genes have been described. Unrelated repressors control the activation of conjugation by preventing the expression of two related master activator complexes in both types of elements, i.e., SetCD in SXT/R391 ICEs and AcaCD in IncA/C plasmids. Finally, in addition to activating ICE- or plasmid-borne genes, these master activators have been shown to specifically activate phylogenetically unrelated mobilizable genomic islands (MGIs) that also disseminate antibiotic resistance genes and other adaptive traits among a plethora of pathogens such as Vibrio cholerae and Salmonella enterica. PMID:26347724

  1. Epstein–Barr virus transcription factor Zta acts through distal regulatory elements to directly control cellular gene expression

    PubMed Central

    Ramasubramanyan, Sharada; Osborn, Kay; Al-Mohammad, Rajaei; Naranjo Perez-Fernandez, Ijiel B.; Zuo, Jianmin; Balan, Nicolae; Godfrey, Anja; Patel, Harshil; Peters, Gordon; Rowe, Martin; Jenner, Richard G.; Sinclair, Alison J.


    Lytic replication of the human gamma herpes virus Epstein-Barr virus (EBV) is an essential prerequisite for the spread of the virus. Differential regulation of a limited number of cellular genes has been reported in B-cells during the viral lytic replication cycle. We asked whether a viral bZIP transcription factor, Zta (BZLF1, ZEBRA, EB1), drives some of these changes. Using genome-wide chromatin immunoprecipitation coupled to next-generation DNA sequencing (ChIP-seq) we established a map of Zta interactions across the human genome. Using sensitive transcriptome analyses we identified 2263 cellular genes whose expression is significantly changed during the EBV lytic replication cycle. Zta binds 278 of the regulated genes and the distribution of binding sites shows that Zta binds mostly to sites that are distal to transcription start sites. This differs from the prevailing view that Zta activates viral genes by binding exclusively at promoter elements. We show that a synthetic Zta binding element confers Zta regulation at a distance and that distal Zta binding sites from cellular genes can confer Zta-mediated regulation on a heterologous promoter. This leads us to propose that Zta directly reprograms the expression of cellular genes through distal elements. PMID:25779048

  2. DANIO-CODE: Toward an Encyclopedia of DNA Elements in Zebrafish.


    Tan, Haihan; Onichtchouk, Daria; Winata, Cecilia


    The zebrafish has emerged as a model organism for genomics studies. The symposium "Toward an encyclopedia of DNA elements in zebrafish" held in London in December 2014, was coorganized by Ferenc Müller and Fiona Wardle. This meeting is a follow-up of a similar previous workshop held 2 years earlier and represents a push toward the formalization of a community effort to annotate functional elements in the zebrafish genome. The meeting brought together zebrafish researchers, bioinformaticians, as well as members of established consortia, to exchange scientific findings and experience, as well as to discuss the initial steps toward the formation of a DANIO-CODE consortium. In this study, we provide the latest updates on the current progress of the consortium's efforts, opening up a broad invitation to researchers to join in and contribute to DANIO-CODE.

  3. DANIO-CODE: Toward an Encyclopedia of DNA Elements in Zebrafish

    PubMed Central


    Abstract The zebrafish has emerged as a model organism for genomics studies. The symposium “Toward an encyclopedia of DNA elements in zebrafish” held in London in December 2014, was coorganized by Ferenc Müller and Fiona Wardle. This meeting is a follow-up of a similar previous workshop held 2 years earlier and represents a push toward the formalization of a community effort to annotate functional elements in the zebrafish genome. The meeting brought together zebrafish researchers, bioinformaticians, as well as members of established consortia, to exchange scientific findings and experience, as well as to discuss the initial steps toward the formation of a DANIO-CODE consortium. In this study, we provide the latest updates on the current progress of the consortium's efforts, opening up a broad invitation to researchers to join in and contribute to DANIO-CODE. PMID:26671609

  4. Detecting the limits of regulatory element conservation and divergence estimation using pairwise and multiple alignments

    PubMed Central

    Pollard, Daniel A; Moses, Alan M; Iyer, Venky N; Eisen, Michael B


    Background Molecular evolutionary studies of noncoding sequences rely on multiple alignments. Yet how multiple alignment accuracy varies across sequence types, tree topologies, divergences and tools, and further how this variation impacts specific inferences, remains unclear. Results Here we develop a molecular evolution simulation platform, CisEvolver, with models of background noncoding and transcription factor binding site evolution, and use simulated alignments to systematically examine multiple alignment accuracy and its impact on two key molecular evolutionary inferences: transcription factor binding site conservation and divergence estimation. We find that the accuracy of multiple alignments is determined almost exclusively by the pairwise divergence distance of the two most diverged species and that additional species have a negligible influence on alignment accuracy. Conserved transcription factor binding sites align better than surrounding noncoding DNA yet are often found to be misaligned at relatively short divergence distances, such that studies of binding site gain and loss could easily be confounded by alignment error. Divergence estimates from multiple alignments tend to be overestimated at short divergence distances but reach a tool specific divergence at which they cease to increase, leading to underestimation at long divergences. Our most striking finding was that overall alignment accuracy, binding site alignment accuracy and divergence estimation accuracy vary greatly across branches in a tree and are most accurate for terminal branches connecting sister taxa and least accurate for internal branches connecting sub-alignments. Conclusion Our results suggest that variation in alignment accuracy can lead to errors in molecular evolutionary inferences that could be construed as biological variation. These findings have implications for which species to choose for analyses, what kind of errors would be expected for a given set of species and how

  5. Detecting the limits of regulatory element conservation anddivergence estimation using pairwise and multiple alignments

    SciTech Connect

    Pollard, Daniel A.; Moses, Alan M.; Iyer, Venky N.; Eisen,Michael B.


    Background: Molecular evolutionary studies of noncodingsequences rely on multiple alignments. Yet how multiple alignmentaccuracy varies across sequence types, tree topologies, divergences andtools, and further how this variation impacts specific inferences,remains unclear. Results: Here we develop a molecular evolutionsimulation platform, CisEvolver, with models of background noncoding andtranscription factor binding site evolution, and use simulated alignmentsto systematically examine multiple alignment accuracy and its impact ontwo key molecular evolutionary inferences: transcription factor bindingsite conservation and divergence estimation. We find that the accuracy ofmultiple alignments is determined almost exclusively by the pairwisedivergence distance of the two most diverged species and that additionalspecies have a negligible influence on alignment accuracy. Conservedtranscription factor binding sites align better than surroundingnoncoding DNA yet are often found to be misaligned at relatively shortdivergence distances, such that studies of binding site gain and losscould easily be confounded by alignment error. Divergence estimates frommultiple alignments tend to be overestimated at short divergencedistances but reach a tool specific divergence at which they cease toincrease, leading to underestimation at long divergences. Our moststriking finding was that overall alignment accuracy, binding sitealignment accuracy and divergence estimation accuracy vary greatly acrossbranches in a tree and are most accurate for terminal branches connectingsister taxa and least accurate for internal branches connectingsub-alignments. Conclusions: Our results suggest that variation inalignment accuracy can lead to errors in molecular evolutionaryinferences that could be construed as biological variation. Thesefindings have implications for which species to choose for analyses, whatkind of errors would be expected for a given set of species and howmultiple alignment tools and

  6. Origins of Cdx1 regulatory elements suggest roles in vertebrate evolution.


    Gaunt, Stephen J; Paul, Yu-Lee


    Cdx1, an upstream regulator of Hox genes, is best characterized for its homeotic effects upon the developing axial skeleton, particularly in the neck. It responds to retinoic acid (RA) in both mouse embryos and embryonal carcinoma (EC) cells. By use of beta-galactosidase chemiluminescence, we show that a mouse Cdx1/lacZ reporter expressed in P19 EC cells responds to RA by the combined activities of an intron retinoic acid response element (RARE) and an upstream RARE. In contrast, a chicken Cdx1/lacZ reporter responds only by activity of the intron RARE. Database analyses upon Cdx1 from twenty three vertebrate species reveal that the intron RARE is structurally conserved in amniotes (eutherian mammals, marsupials, birds and Anole lizard), but not in Xenopus or fish. The upstream RARE is structurally conserved only in eutherian mammals. We conclude that the intron RARE originated at around the amphibian/amniote division, and the upstream RARE appeared around the marsupial/eutherian mammal division. In view of the site of action of Cdx1, we propose that acquisition of the intron RARE may have facilitated the substantial changes that occurred in the neck and anterior thorax at the advent of the amniotes. We present evidence that Cdx1 is also a developmental regulator of the female urogenital system, and we suggest that acquisition of the upstream RARE may have contributed to morphological divergence of marsupial and eutherian mammals.

  7. DNA elements regulating alpha1-tubulin gene induction during regeneration of eukaryotic flagella.


    Periz, G; Keller, L R


    Eukaryotic flagella are complex organelles composed of more than 200 polypeptides. Little is known about the regulatory mechanisms governing synthesis of the flagellar protein subunits and their assembly into this complex organelle. The unicellular green alga Chlamydomonas reinhardtii is the premier experimental model system for studying such cellular processes. When acid shocked, C. reinhardtii excises its flagella, rapidly and coordinately activates transcription of a set of flagellar genes, and ultimately regenerates a new flagellar pair. To define functionally the regulatory sequences that govern induction of the set of genes after acid shock, we analyzed the alpha1-tubulin gene promoter. To simplify transcriptional analysis in vivo, we inserted the selectable marker gene ARG7 on the same plasmid with a tagged alpha1-tubulin gene and stably introduced it into C. reinhardtii cells. By deletion of various sequences, two promoter regions (-176 to -122 and -85 to -16) were identified as important for induction of the tagged alpha1-tubulin gene. Deleting the region between -176 and -122 from the transcription start site resulted in an induction level which was only 45 to 70% of that of the resident gene. Deleting the region upstream of -56 resulted in a complete loss of inducibility without affecting basal expression. The alpha1-tubulin promoter region from -85 to -16 conferred partial acid shock inducibility to an arylsulfatase (ARS) reporter gene. These results show that induction of the alpha1-tubulin gene after acid shock is a complex response that requires diverse sequence elements.

  8. Genomic Heat Shock Element Sequences Drive Cooperative Human Heat Shock Factor 1 DNA Binding and Selectivity*

    PubMed Central

    Jaeger, Alex M.; Makley, Leah N.; Gestwicki, Jason E.; Thiele, Dennis J.


    The heat shock transcription factor 1 (HSF1) activates expression of a variety of genes involved in cell survival, including protein chaperones, the protein degradation machinery, anti-apoptotic proteins, and transcription factors. Although HSF1 activation has been linked to amelioration of neurodegenerative disease, cancer cells exhibit a dependence on HSF1 for survival. Indeed, HSF1 drives a program of gene expression in cancer cells that is distinct from that activated in response to proteotoxic stress, and HSF1 DNA binding activity is elevated in cycling cells as compared with arrested cells. Active HSF1 homotrimerizes and binds to a DNA sequence consisting of inverted repeats of the pentameric sequence nGAAn, known as heat shock elements (HSEs). Recent comprehensive ChIP-seq experiments demonstrated that the architecture of HSEs is very diverse in the human genome, with deviations from the consensus sequence in the spacing, orientation, and extent of HSE repeats that could influence HSF1 DNA binding efficacy and the kinetics and magnitude of target gene expression. To understand the mechanisms that dictate binding specificity, HSF1 was purified as either a monomer or trimer and used to evaluate DNA-binding site preferences in vitro using fluorescence polarization and thermal denaturation profiling. These results were compared with quantitative chromatin immunoprecipitation assays in vivo. We demonstrate a role for specific orientations of extended HSE sequences in driving preferential HSF1 DNA binding to target loci in vivo. These studies provide a biochemical basis for understanding differential HSF1 target gene recognition and transcription in neurodegenerative disease and in cancer. PMID:25204655

  9. Regulatory elements necessary for termination of transcription within the immunoglobulin heavy chain gene locus

    SciTech Connect

    Moore, B.B.


    Previous experimentation demonstrated that regulation of the IgM only phenotype in both pre-B and immature B cells was primarily at the transcriptional level. Expression of IgD mRNA involves transcription of the entire 29 kilobase rearranged [mu]-[delta] locus. Mature B cells transcribe the [beta] exons at approximately half the level that they transcribe the [delta] gene. Early B cells however, transcribe the [mu] gene with approximately 90% more efficiency than they do the [delta] gene. Specifically, early B cells show a transcription termination event occurring within a 1 kilobase region of the [mu]-[delta] intron. This dissertation analyzes the sequence elements necessary to encode the transcription termination event within the [mu]-[delta] intron. This work shows that the termination motif consists of specific sequences within the [mu]m poly(A) site as well as a region of the [mu]-[delta] intron contained within a 1200 base pair fragment. The 1200 base pair fragment extends from the Pst I site within the intron and ends just prior to the C[delta]1 exon. This fragment contains a 162 base pair unique sequence inverted repeat (USIR). Furthermore, the [mu]m site is specifically required because the [mu]s site was unable to substitute, despite extensive usage. In addition, the USIR-containing intron functions in an orientation-dependent manner. Analysis of this termination motif in a variety of lymphoid and non-lymphoid cells suggests that this motif is an intrinsic polymerase II termination motif. This implies that transcription termination in early B cells is by a default model and that active regulation of this motif involves an anti-termination event in mature B cells.

  10. Regulatory interactions between phospholipid synthesis and DNA replication in Caulobacter crescentus.

    PubMed Central

    Loewy, B; Marczynski, G T; Dingwall, A; Shapiro, L


    Several Caulobacter crescentus mutants with lesions in phospholipid biosynthesis have DNA replication phenotypes. A C. crescentus mutant deficient in glycerol 3-phosphate dehydrogenase activity (gpsA) blocks phospholipid synthesis, ceases DNA replication, and loses viability in the absence of a glycerol phosphate supplement. To investigate the interaction between membrane synthesis and DNA replication during a single cell cycle, we moved the gpsA mutation into a synchronizable, but otherwise wild-type, strain. The first effect of withholding supplement was the cessation of synthesis of phosphatidylglycerol, a major component of the C. crescentus membrane. In the absence of glycerol 3-phosphate, DNA replication was initiated in the stalked cell at the correct time in the cell cycle and at the correct site on the chromosome. However, after replication proceeded bidirectionally for a short time, DNA synthesis dropped to a low level. The cell cycle blocked at a distinct middivision stalked cell, and this was followed by cell death. The "glycerol-less" death of the gpsA mutant could be prevented if the cells were treated with novobiocin to prevent the initiation of DNA replication. Our observations suggest that the processivity of C. crescentus replication requires concomitant phospholipid synthesis and that cell death results from incomplete replication of the chromosome. Images PMID:2211495

  11. Shared Enhancer Activity in the Limbs and Phallus and Functional Divergence of a Limb-Genital cis-Regulatory Element in Snakes.


    Infante, Carlos R; Mihala, Alexandra G; Park, Sungdae; Wang, Jialiang S; Johnson, Kenji K; Lauderdale, James D; Menke, Douglas B


    The amniote phallus and limbs differ dramatically in their morphologies but share patterns of signaling and gene expression in early development. Thus far, the extent to which genital and limb transcriptional networks also share cis-regulatory elements has remained unexplored. We show that many limb enhancers are retained in snake genomes, suggesting that these elements may function in non-limb tissues. Consistent with this, our analysis of cis-regulatory activity in mice and Anolis lizards reveals that patterns of enhancer activity in embryonic limbs and genitalia overlap heavily. In mice, deletion of HLEB, an enhancer of Tbx4, produces defects in hindlimbs and genitalia, establishing the importance of this limb-genital enhancer for development of these different appendages. Further analyses demonstrate that the HLEB of snakes has lost hindlimb enhancer function while retaining genital activity. Our findings identify roles for Tbx4 in genital development and highlight deep similarities in cis-regulatory activity between limbs and genitalia.

  12. Chemical Elemental Distribution and Soil DNA Fingerprints Provide the Critical Evidence in Murder Case Investigation

    PubMed Central

    Concheri, Giuseppe; Bertoldi, Daniela; Polone, Elisa; Otto, Stefan; Larcher, Roberto; Squartini, Andrea


    Background The scientific contribution to the solution of crime cases, or throughout the consequent forensic trials, is a crucial aspect of the justice system. The possibility to extract meaningful information from trace amounts of samples, and to match and validate evidences with robust and unambiguous statistical tests, are the key points of such process. The present report is the authorized disclosure of an investigation, carried out by Attorney General appointment, on a murder case in northern Italy, which yielded the critical supporting evidence for the judicial trial. Methodology/Principal Findings The proportional distribution of 54 chemical elements and the bacterial community DNA fingerprints were used as signature markers to prove the similarity of two soil samples. The first soil was collected on the crime scene, along a corn field, while the second was found in trace amounts on the carpet of a car impounded from the main suspect in a distant location. The matching similarity of the two soils was proven by crossing the results of two independent techniques: a) elemental analysis via inductively coupled plasma mass spectrometry (ICP-MS) and optical emission spectrometry (ICP-OES) approaches, and b) amplified ribosomal DNA restriction analysis by gel electrophoresis (ARDRA). Conclusions Besides introducing the novel application of these methods to forensic disciplines, the highly accurate level of resolution observed, opens new possibilities also in the fields of soil typing and tracking, historical analyses, geochemical surveys and global land mapping. PMID:21674041

  13. Population genetics and molecular evolution of DNA sequences in transposable elements. I. A simulation framework.


    Kijima, T E; Innan, Hideki


    A population genetic simulation framework is developed to understand the behavior and molecular evolution of DNA sequences of transposable elements. Our model incorporates random transposition and excision of transposable element (TE) copies, two modes of selection against TEs, and degeneration of transpositional activity by point mutations. We first investigated the relationships between the behavior of the copy number of TEs and these parameters. Our results show that when selection is weak, the genome can maintain a relatively large number of TEs, but most of them are less active. In contrast, with strong selection, the genome can maintain only a limited number of TEs but the proportion of active copies is large. In such a case, there could be substantial fluctuations of the copy number over generations. We also explored how DNA sequences of TEs evolve through the simulations. In general, active copies form clusters around the original sequence, while less active copies have long branches specific to themselves, exhibiting a star-shaped phylogeny. It is demonstrated that the phylogeny of TE sequences could be informative to understand the dynamics of TE evolution.

  14. A novel tumor necrosis factor-responsive transcription factor which recognizes a regulatory element in hemopoietic growth factor genes

    SciTech Connect

    Shannon, M.F.; Pell, L.M.; Kuczek, E.S.; Occhiodoro, F.S.; Dunn, S.M.; Vadas, M.A. ); Lenardo, M.J. )


    A conserved DNA sequence element, termed cytokine 1 (CK-1), is found in the promoter regions of many hemopoietic growth factor (HGF) genes. Mutational analyses and modification interference experiments show that this sequence specifically binds a nuclear transcription factor, NF-GMa, which is a protein with a molecular mass of 43 kilodaltons. It interacts with different affinities with the CK-1-like sequence from a number of HGF genes, including granulocyte macrophage colony-stimulating factor (GM-CSF), granulocyte (G)-CSF, interleukin 3 (IL-3), and IL-5. The authors show that the level of NF-GMa binding is induced in embryonic fibroblasts by tumor necrosis factor {alpha} (TNF-{alpha}) treatment and that the CK-1 sequence from the G-CSF gene is a TNF-{alpha}-responsive enhancer in these cells.

  15. Prolactin Regulatory Element Binding Protein Is Involved in Hepatitis C Virus Replication by Interaction with NS4B

    PubMed Central

    Kong, Lingbao; Fujimoto, Akira; Nakamura, Mariko; Aoyagi, Haruyo; Matsuda, Mami; Watashi, Koichi; Suzuki, Ryosuke; Arita, Minetaro; Yamagoe, Satoshi; Dohmae, Naoshi; Suzuki, Takehiro; Sakamaki, Yuriko; Ichinose, Shizuko; Suzuki, Tetsuro; Wakita, Takaji


    ABSTRACT It has been proposed that the hepatitis C virus (HCV) NS4B protein triggers the membranous HCV replication compartment, but the underlying molecular mechanism is not fully understood. Here, we screened for NS4B-associated membrane proteins by tandem affinity purification and proteome analysis and identified 202 host proteins. Subsequent screening of replicon cells with small interfering RNA identified prolactin regulatory element binding (PREB) to be a novel HCV host cofactor. The interaction between PREB and NS4B was confirmed by immunoprecipitation, immunofluorescence, and proximity ligation assays. PREB colocalized with double-stranded RNA and the newly synthesized HCV RNA labeled with bromouridine triphosphate in HCV replicon cells. Furthermore, PREB shifted to detergent-resistant membranes (DRMs), where HCV replication complexes reside, in the presence of NS4B expression in Huh7 cells. However, a PREB mutant lacking the NS4B-binding region (PREBd3) could not colocalize with double-stranded RNA and did not shift to the DRM in the presence of NS4B. These results indicate that PREB locates at the HCV replication complex by interacting with NS4B. PREB silencing inhibited the formation of the membranous HCV replication compartment and increased the protease and nuclease sensitivity of HCV replicase proteins and RNA in DRMs, respectively. Collectively, these data indicate that PREB promotes HCV RNA replication by participating in the formation of the membranous replication compartment and by maintaining its proper structure by interacting with NS4B. Furthermore, PREB was induced by HCV infection in vitro and in vivo. Our findings provide new insights into HCV host cofactors. IMPORTANCE The hepatitis C virus (HCV) protein NS4B can induce alteration of the endoplasmic reticulum and the formation of a membranous web structure, which provides a platform for the HCV replication complex. The molecular mechanism by which NS4B induces the membranous HCV replication

  16. Proteome-wide Structural Analysis of PTM Hotspots Reveals Regulatory Elements Predicted to Impact Biological Function and Disease*

    PubMed Central

    Dewhurst, Henry; Sundararaman, Niveda


    Post-translational modifications (PTMs) regulate protein behavior through modulation of protein-protein interactions, enzymatic activity, and protein stability essential in the translation of genotype to phenotype in eukaryotes. Currently, less than 4% of all eukaryotic PTMs are reported to have biological function - a statistic that continues to decrease with an increasing rate of PTM detection. Previously, we developed SAPH-ire (Structural Analysis of PTM Hotspots) - a method for the prioritization of PTM function potential that has been used effectively to reveal novel PTM regulatory elements in discrete protein families (Dewhurst et al., 2015). Here, we apply SAPH-ire to the set of eukaryotic protein families containing experimental PTM and 3D structure data - capturing 1,325 protein families with 50,839 unique PTM sites organized into 31,747 modified alignment positions (MAPs), of which 2010 (∼6%) possess known biological function. Here, we show that using an artificial neural network model (SAPH-ire NN) trained to identify MAP hotspots with biological function results in prediction outcomes that far surpass the use of single hotspot features, including nearest neighbor PTM clustering methods. We find the greatest enhancement in prediction for positions with PTM counts of five or less, which represent 98% of all MAPs in the eukaryotic proteome and 90% of all MAPs found to have biological function. Analysis of the top 1092 MAP hotspots revealed 267 of truly unknown function (containing 5443 distinct PTMs). Of these, 165 hotspots could be mapped to human KEGG pathways for normal and/or disease physiology. Many high-ranking hotspots were also found to be disease-associated pathogenic sites of amino acid substitution despite the lack of observable PTM in the human protein family member. Taken together, these experiments demonstrate that the functional relevance of a PTM can be predicted very effectively by neural network models, revealing a large but testable

  17. Structural optimization for heat detection of DNA thermosequencing platform using finite element analysis

    PubMed Central

    Esfandyarpour, Hesaam; Zheng, Bo; Pease, R. Fabian W.; Davis, Ronald W.


    For the past three decades, Sanger’s method has been the primary DNA sequencing technology; however, inherent limitations in cost and complexity have limited its usage in personalized medicine and ecological studies. A new technology called “thermosequencing” can potentially reduce both the cost and complexity of DNA sequencing by using a microfluidic platform [Esfandyarpour, Pease, and Davis, J. Vac. Sci. Technol. B26, 661 (2008)]. To optimize the efficiency of the technology, finite element analysis was used to model the thermosequencing system by simulating the DNA incorporation reaction series and the resulting product concentration and heat production. Different models of the thermosequencing platform were created to simulate the effects of the materials surrounding the system, to optimize the geometry of the system, and to concentrate reaction heat into specific regions for detection in the real system. The resulting concentrations of reaction products were used to calibrate the reaction speed and to design the heat sensors in the thermosequencing technology. We recommend a modified gated structure for the microfluidic detection platform by using control valves and show how this new platform could dramatically improve the detection efficiency. PMID:19693405

  18. Micro RNAs and DNA methylation are regulatory players in human cells with altered X chromosome to autosome balance

    PubMed Central

    Rajpathak, Shriram N.; Deobagkar, Deepti D.


    The gene balance hypothesis predicts that an imbalance in the dosage sensitive genes affects the cascade of gene networks that may influence the fitness of individuals. The phenotypes associated with chromosomal aneuploidies demonstrate the importance of gene dosage balance. We have employed untransformed human fibroblast cells with different number of X chromosomes to assess the expression of miRNAs and autosomal genes in addition to the DNA methylation status. High throughput NGS analysis using illumina Next seq500 has detected several autosomal as well as X linked miRNAs as differentially expressed in X monosomy and trisomy cells. Two of these miRNAs (hsa-miR-125a-5p and 335-5p) are likely to be involved in regulation of the autosomal gene expression. Additionally, our data demonstrates altered expression and DNA methylation signatures of autosomal genes in X monosomy and trisomy cells. In addition to miRNAs, expression of DNMT1 which is an important epigenetic player involved in many processes including cancer, is seen to be altered. Overall, present study provides a proof for regulatory roles of micro RNAs and DNA methylation in human X aneuploidy cells opening up possible new ways for designing therapeutic strategies. PMID:28233878

  19. A novel regulatory circuit in base excision repair involving AP endonuclease 1, Creb1 and DNA polymerase β

    PubMed Central

    Pei, De-Sheng; Yang, Xiao-Jie; Liu, Wei; Guikema, Jeroen E. J.; Schrader, Carol E.; Strauss, Phyllis R.


    DNA repair is required to maintain genome stability in stem cells and early embryos. At critical junctures, oxidative damage to DNA requires the base excision repair (BER) pathway. Since early zebrafish embryos lack the major polymerase in BER, DNA polymerase ß, repair proceeds via replicative polymerases, even though there is ample polb mRNA. Here, we report that Polb protein fails to appear at the appropriate time in development when AP endonuclease 1 (Apex), the upstream protein in BER, is knocked down. Because polb contains a Creb1 binding site, we examined whether knockdown of Apex affects creb1. Apex knockdown results in loss of Creb1 and Creb complex members but not Creb1 phosphorylation. This effect is independent of p53. Although both apex and creb1 mRNA rescue Creb1 and Polb after Apex knockdown, Apex is not a co-activator of creb1 transcription. This observation has broad significance, as similar results occur when Apex is inhibited in B cells from apex+/− mice. These results describe a novel regulatory circuit involving Apex, Creb1 and Polb and provide a mechanism for lethality of Apex loss in higher eukaryotes. PMID:21172930

  20. GTP cyclohydrolase I feedback regulatory protein is a pentamer of identical subunits. Purification, cDNA cloning, and bacterial expression.


    Yoneyama, T; Brewer, J M; Hatakeyama, K


    GTP cyclohydrolase I feedback regulatory protein (GFRP) mediates feedback inhibition of GTP cyclohydrolase I activity by tetrahydrobiopterin and also mediates the stimulatory effect of phenylalanine on the enzyme activity. To characterize the molecular structure of GFRP, we have purified it from rat liver using an efficient step of affinity chromatography and isolated cDNA clones, based on partial amino acid sequences of peptides derived from purified GFRP. Comparison between the amino acid sequence deduced from the cDNA and the N-terminal amino acid sequence of purified GFRP showed that the mature form of GFRP consists of 83 amino acid residues with a calculated Mr of 9,542. The isolated GFRP cDNA was expressed in Escherichia coli as a fusion protein with six consecutive histidine residues at its N terminus. The fusion protein was affinity-purified and digested with thrombin to remove the histidine tag. The resulting recombinant GFRP showed kinetic properties similar to those of GFRP purified from rat liver. Cross-linking experiments using dimethyl suberimidate indicated that GFRP was a pentamer of 52 kDa. Sedimentation equilibrium measurements confirmed the pentameric structure of GFRP by giving an average Mr of 49,734, which is 5 times the calculated molecular weight of the recombinant GFRP polypeptide. Based on the pentameric structure of GFRP, we have proposed a model for the quaternary structure of GFRP and GTP cyclohydrolase I complexes.

  1. Binding of estrogen receptors to switch sites and regulatory elements in the immunoglobulin heavy chain locus of activated B cells suggests a direct influence of estrogen on antibody expression.


    Jones, Bart G; Penkert, Rhiannon R; Xu, Beisi; Fan, Yiping; Neale, Geoff; Gearhart, Patricia J; Hurwitz, Julia L


    Females and males differ in antibody isotype expression patterns and in immune responses to foreign- and self-antigens. For example, systemic lupus erythematosus is a condition that associates with the production of isotype-skewed anti-self antibodies, and exhibits a 9:1 female:male disease ratio. To explain differences between B cell responses in males and females, we sought to identify direct interactions of the estrogen receptor (ER) with the immunoglobulin heavy chain locus. This effort was encouraged by our previous identification of estrogen response elements (ERE) in heavy chain switch (S) regions. We conducted a full-genome chromatin immunoprecipitation analysis (ChIP-seq) using DNA from LPS-activated B cells and an ERα-specific antibody. Results revealed ER binding to a wide region of DNA, spanning sequences from the JH cluster to Cδ, with peaks in Eμ and Sμ sites. Additional peaks of ERα binding were coincident with hs1,2 and hs4 sites in the 3' regulatory region (3'RR) of the heavy chain locus. This first demonstration of direct binding of ER to key regulatory elements in the immunoglobulin locus supports our hypothesis that estrogen and other nuclear hormone receptors and ligands may directly influence antibody expression and class switch recombination (CSR). Our hypothesis encourages the conduct of new experiments to evaluate the consequences of ER binding. A better understanding of ER:DNA interactions in the immunoglobulin heavy chain locus, and respective mechanisms, may ultimately translate to better control of antibody expression, better protection against pathogens, and prevention of pathologies caused by auto-immune disease.

  2. The plasmid replicon of EBV consists of multiple cis-acting elements that facilitate DNA synthesis by the cell and a viral maintenance element.

    PubMed Central

    Aiyar, A; Tyree, C; Sugden, B


    Plasmids containing oriP, the plasmid origin of Epstein-Barr virus (EBV), are replicated stably in human cells that express a single viral trans-acting factor, EBNA-1. Unlike plasmids of other viruses, but akin to human chromosomes, oriP plasmids are synthesized once per cell cycle, and are partitioned faithfully to daughter cells during mitosis. Although EBNA-1 binds multiple sites within oriP, its role in DNA synthesis and partitioning has been obscure. EBNA-1 lacks enzymatic activities that are present in the origin-binding proteins of other mammalian viruses, and does not interact with human cellular proteins that provide equivalent enzymatic functions. We demonstrate that plasmids with oriP or its constituent elements are synthesized efficiently in human cells in the absence of EBNA-1. Further, we show that human cells rapidly eliminate or destroy newly synthesized plasmids, and that both EBNA-1 and the family of repeats of oriP are required for oriP plasmids to escape this catastrophic loss. These findings indicate that EBV's plasmid replicon consists of genetic elements with distinct functions, multiple cis-acting elements that facilitate DNA synthesis and viral cis/trans elements that permit retention of replicated DNA in daughter cells. They also explain historical failures to identify mammalian origins of DNA synthesis as autonomously replicating sequences. PMID:9799247

  3. A Novel Pregnane X Receptor-mediated and Sterol Regulatory Element-binding Protein-independent Lipogenic Pathway*

    PubMed Central

    Zhou, Jie; Zhai, Yonggong; Mu, Ying; Gong, Haibiao; Uppal, Hirdesh; Toma, David; Ren, Songrong; Evans, Ronald M.; Xie, Wen


    The pregnane X receptor (PXR) was isolated as a xenosensor regulating xenobiotic responses. In this study, we show that PXR plays an endobiotic role by impacting lipid homeostasis. Expression of an activated PXR in the livers of transgenic mice resulted in an increased hepatic deposit of triglycerides. This PXR-mediated lipid accumulation was independent of the activation of the lipogenic transcriptional factor SREBP-1c (sterol regulatory element-binding protein 1c) and its primary lipogenic target enzymes, including fatty-acid synthase (FAS) and acetyl-CoA carboxylase 1 (ACC-1). Instead, the lipid accumulation in transgenic mice was associated with an increased expression of the free fatty acid transporter CD36 and several accessory lipogenic enzymes, such as stearoyl-CoA desaturase-1 (SCD-1) and long chain free fatty acid elongase. Studies using transgenic and knock-out mice showed that PXR is both necessary and sufficient for Cd36 activation. Promoter analyses revealed a DR-3-type of PXR-response element in the mouse Cd36 promoter, establishing Cd36 as a direct transcriptional target of PXR. The hepatic lipid accumulation and Cd36 induction were also seen in the hPXR “humanized” mice treated with the hPXR agonist rifampicin. The activation of PXR was also associated with an inhibition of pro-β-oxidative genes, such as peroxisome proliferator-activated receptor α (PPARα) and thiolase, and an up-regulation of PPARγ, a positive regulator of CD36. The cross-regulation of CD36 by PXR and PPARγ suggests that this fatty acid transporter may function as a common target of orphan nuclear receptors in their regulation of lipid homeostasis. PMID:16556603

  4. Control of Human PLP1 Expression Through Transcriptional Regulatory Elements and Alternatively Spliced Exons in Intron 1

    PubMed Central

    Hamdan, Hamdan; Kockara, Neriman T.; Jolly, Lee Ann; Haun, Shirley


    *These authors contributed equally to this work.Although the myelin proteolipid protein gene (PLP1) encodes the most abundant protein in central nervous system (CNS) myelin, not much is known about the mechanisms that govern expression of the human gene (hPLP1). Much more is known about the processes that regulate Plp1 gene expression in rodents. From studies with Plp1-lacZ transgenic mice, it was determined that the first intron of mouse Plp1 (mPlp1) is required to attain high levels of expression in brain, concurrent with the active myelination period. Other studies have suggested that within mPlp1 intron 1 (>8 kb) lie several regions with enhancer-like activity. To test whether these sequences (and possibly others) in hPLP1 intron 1 are functional, deletion-transfection analysis was performed with hPLP1-lacZ constructs that contain various portions of the intron, or lack it altogether. Results presented here demonstrate the importance of hPLP1 intron 1 in achieving maximal levels of expression in the immortalized oligodendroglial cell line, Oli-neu. Deletion analysis indicates that the intron contains multiple positive regulatory elements which are active in Oli-neu cells. Some of these elements appear to be functionally conserved between human and mouse, while others are not. Furthermore, our studies demonstrate that multiple splice variants can be formed due to inclusion of extra (supplementary) exons from what is classically thought of as hPLP1 intron 1. Thus, splicing of these novel exons (which are not recognized as such in mPlp1 due to lack of conserved splice sites) must utilize factors common to both human and mouse since Oli-neu cells are of mouse origin. PMID:25694552

  5. Conformational changes in the DNA-binding domains of the ecdysteroid receptor during the formation of a complex with the hsp27 response element.


    Pakuła, Szymon; Orłowski, Marek; Rymarczyk, Grzegorz; Krusiński, Tomasz; Jakób, Michał; Zoglowek, Anna; Ożyhar, Andrzej; Dobryszycki, Piotr


    The ecdysone receptor (EcR) and the ultraspiracle protein (Usp) form the functional receptor for ecdysteroids that initiates metamorphosis in insects. The Usp and EcR DNA-binding domains (UspDBD and EcRDBD, respectively) form a heterodimer on the natural pseudopalindromic element from the hsp27 gene promoter. The conformational changes in the protein-DNA during the formation of the UspDBD-EcRDBD-hsp27 complex were analyzed. Recombined UspDBD and EcRDBD proteins were purified and fluorescein labeled (FL) using the intein method at the C-ends of both proteins. The changes in the distances from the respective C-ends of EcRDBD and/or UspDBD to the 5'- and/or 3'-end of the response element were measured using fluorescence resonance energy transfer (FRET) methodology. The binding of EcRDBD induced a strong conformational change in UspDBD and caused the C-terminal fragment of the UspDBD molecule to move away from both ends of the regulatory element. UspDBD also induced a significant conformational change in the EcRDBD molecule. The EcRDBD C-terminus moved away from the 5'-end of the regulatory element and moved close to the 3'-end. An analysis was also done on the effect that DHR38DBD, the Drosophila ortholog of the mammalian NGFI-B, had on the interaction of UspDBD and EcRDBD with hsp27. FRET analysis demonstrated that hsp27 bending was induced by DHR38DBD. Fluorescence data revealed that hsp27 had a shorter end-to-end distance both in the presence of EcRDBD as well as in the presence of EcRDBD together with DHR38DBD, with DNA bend angles of about 36.2° and 33.6°, respectively. A model of how DHR38DBD binds to hsp27 in the presence of EcRDBD is presented.

  6. Multiple functions of nucleosomes and regulatory factors in transcription.


    Workman, J L; Buchman, A R


    The in vivo packaging of DNA with histone proteins to form chromatin makes its transcription a difficult process. Biochemical and genetic studies are beginning to reveal mechanistic details of how transcriptional regulatory factors confront at least two hurdles created by nucleosomes, the primary structural unit of chromatin. Regulatory factors must gain access to their respective binding sites and activate the formation of transcription complexes at core promoter elements. Distinct regulatory factors may be specialized to perform these functions.

  7. GAGA factor binding to DNA via a single trinucleotide sequence element.

    PubMed Central

    Wilkins, R C; Lis, J T


    GAGA transcription factor (GAF) is an essential protein in Drosophila , important for the transcriptional regulation of numerous genes. GAF binds to GA repeats in the promoters of these genes via a DNA-binding domain containing a single zinc finger. While GAF binding sites are typically composed of 3.5 GA repeats, the Drosophila hsp70 gene contains much smaller elements, some of which are as little as three bases (GAG) in length. Interestingly, the binding of GAF to more distant trinucleotide elements is relatively strong and not appreciably affected by the removal of larger GA arrays in the promoter. Moreover, a simple synthetic GAG sequence is sufficient to bind GAF in vitro . Here we directly compare the affinity of GAF for different sequence elements by immunoprecipitation and gel mobility shift analysis. Furthermore, our measures of the concentration of GAF in vivo indicate that it is a highly abundant nuclear protein, prevalent enough to occupy a sizable fraction of correspondingly abundant trinucleotide sites. PMID:9592153

  8. Control of tissue size and development by a regulatory element in the yorkie 3’UTR

    PubMed Central

    Umegawachi, Takanari; Yoshida, Hideki; Koshida, Hiromu; Yamada, Momoko; Ohkawa, Yasuyuki; Sato, Tetsuya; Suyama, Mikita; Krause, Henry M; Yamaguchi, Masamitsu


    Regulation of the Hippo pathway via phosphorylation of Yorkie (Yki), the Drosophila homolog of human Yes-associated protein 1, is conserved from Drosophila to humans. Overexpression of a non-phosphorylatable form of Yki induces severe overgrowth in adult fly eyes. Here, we show that yki mRNA associates with microsomal fractions and forms foci that partially colocalize to processing bodies in the vicinity of endoplasmic reticulum. This localization is dependent on a stem-loop (SL) structure in the 3’ untranslated region of yki. Surprisingly, expression of SL deleted yki in eye imaginal discs also results in severe overgrowth phenotypes. When the structure of the SL is disrupted, Yki protein levels increase without a significant effect on RNA levels. When the SL is completely removed, protein levels drastically increase, but in this case, due to increased RNA stability. In the latter case, we show that the increased RNA accumulation is due to removal of a putative miR-8 seed sequence in the SL. These data demonstrate the function of two novel regulatory mechanisms, both controlled by the yki SL element, that are essential for proper Hippo pathway mediated growth regulation.

  9. Pi class glutathione S-transferase genes are regulated by Nrf 2 through an evolutionarily conserved regulatory element in zebrafish

    PubMed Central

    Suzuki, Takafumi; Takagi, Yaeko; Osanai, Hitoshi; Li, Li; Takeuchi, Miki; Katoh, Yasutake; Kobayashi, Makoto; Yamamoto, Masayuki


    Pi class GSTs (glutathione S-transferases) are a member of the vertebrate GST family of proteins that catalyse the conjugation of GSH to electrophilic compounds. The expression of Pi class GST genes can be induced by exposure to electrophiles. We demonstrated previously that the transcription factor Nrf 2 (NF-E2 p45-related factor 2) mediates this induction, not only in mammals, but also in fish. In the present study, we have isolated the genomic region of zebrafish containing the genes gstp1 and gstp2. The regulatory regions of zebrafish gstp1 and gstp2 have been examined by GFP (green fluorescent protein)-reporter gene analyses using microinjection into zebrafish embryos. Deletion and point-mutation analyses of the gstp1 promoter showed that an ARE (antioxidant-responsive element)-like sequence is located 50 bp upstream of the transcription initiation site which is essential for Nrf 2 transactivation. Using EMSA (electrophoretic mobility-shift assay) analysis we showed that zebrafish Nrf 2–MafK heterodimer specifically bound to this sequence. All the vertebrate Pi class GST genes harbour a similar ARE-like sequence in their promoter regions. We propose that this sequence is a conserved target site for Nrf 2 in the Pi class GST genes. PMID:15654768

  10. Identification of a novel distal regulatory element of the human Neuroglobin gene by the chromosome conformation capture approach.


    Tam, Kin Tung; Chan, Ping Kei; Zhang, Wei; Law, Pui Pik; Tian, Zhipeng; Fung Chan, Godfrey Chi; Philipsen, Sjaak; Festenstein, Richard; Tan-Un, Kian Cheng


    Neuroglobin (NGB) is predominantly expressed in the brain and retina. Studies suggest that NGB exerts protective effects to neuronal cells and is implicated in reducing the severity of stroke and Alzheimer's disease. However, little is known about the mechanisms which regulate the cell type-specific expression of the gene. In this study, we hypothesized that distal regulatory elements (DREs) are involved in optimal expression of the NGB gene. By chromosome conformation capture we identified two novel DREs located -70 kb upstream and +100 kb downstream from the NGB gene. ENCODE database showed the presence of DNaseI hypersensitive and transcription factors binding sites in these regions. Further analyses using luciferase reporters and chromatin immunoprecipitation suggested that the -70 kb region upstream of the NGB gene contained a neuronal-specific enhancer and GATA transcription factor binding sites. Knockdown of GATA-2 caused NGB expression to drop dramatically, indicating GATA-2 as an essential transcription factor for the activation of NGB expression. The crucial role of the DRE in NGB expression activation was further confirmed by the drop in NGB level after CRISPR-mediated deletion of the DRE. Taken together, we show that the NGB gene is regulated by a cell type-specific loop formed between its promoter and the novel DRE.

  11. Regulation of steroid 5-{alpha} reductase type 2 (Srd5a2) by sterol regulatory element binding proteins and statin

    SciTech Connect

    Seo, Young-Kyo; Zhu, Bing; Jeon, Tae-Il; Osborne, Timothy F.


    In this study, we show that sterol regulatory element binding proteins (SREBPs) regulate expression of Srd5a2, an enzyme that catalyzes the irreversible conversion of testosterone to dihydroxytestosterone in the male reproductive tract and is highly expressed in androgen-sensitive tissues such as the prostate and skin. We show that Srd5a2 is induced in livers and prostate from mice fed a chow diet supplemented with lovastatin plus ezitimibe (L/E), which increases the activity of nuclear SREBP-2. The three fold increase in Srd5a2 mRNA mediated by L/E treatment was accompanied by the induction of SREBP-2 binding to the Srd5a2 promoter detected by a ChIP-chip assay in liver. We identified a SREBP-2 responsive region within the first 300 upstream bases of the mouse Srd5a2 promoter by co-transfection assays which contain a site that bound SREBP-2 in vitro by an EMSA. Srd5a2 protein was also induced in cells over-expressing SREBP-2 in culture. The induction of Srd5a2 through SREBP-2 provides a mechanistic explanation for why even though statin therapy is effective in reducing cholesterol levels in treating hypercholesterolemia it does not compromise androgen production in clinical studies.

  12. Combining Hi-C data with phylogenetic correlation to predict the target genes of distal regulatory elements in human genome.


    Lu, Yulan; Zhou, Yuanpeng; Tian, Weidong


    Defining the target genes of distal regulatory elements (DREs), such as enhancer, repressors and insulators, is a challenging task. The recently developed Hi-C technology is designed to capture chromosome conformation structure by high-throughput sequencing, and can be potentially used to determine the target genes of DREs. However, Hi-C data are noisy, making it difficult to directly use Hi-C data to identify DRE-target gene relationships. In this study, we show that DREs-gene pairs that are confirmed by Hi-C data are strongly phylogenetic correlated, and have thus developed a method that combines Hi-C read counts with phylogenetic correlation to predict long-range DRE-target gene relationships. Analysis of predicted DRE-target gene pairs shows that genes regulated by large number of DREs tend to have essential functions, and genes regulated by the same DREs tend to be functionally related and co-expressed. In addition, we show with a couple of examples that the predicted target genes of DREs can help explain the causal roles of disease-associated single-nucleotide polymorphisms located in the DREs. As such, these predictions will be of importance not only for our understanding of the function of DREs but also for elucidating the causal roles of disease-associated noncoding single-nucleotide polymorphisms.

  13. Xanthohumol Improves Diet-induced Obesity and Fatty Liver by Suppressing Sterol Regulatory Element-binding Protein (SREBP) Activation.


    Miyata, Shingo; Inoue, Jun; Shimizu, Makoto; Sato, Ryuichiro


    Sterol regulatory element-binding proteins (SREBPs) are key transcription factors that stimulate the expression of genes involved in fatty acid and cholesterol biosynthesis. Here, we demonstrate that a prenylated flavonoid in hops, xanthohumol (XN), is a novel SREBP inactivator that reduces the de novo synthesis of fatty acid and cholesterol. XN independently suppressed the maturation of SREBPs of insulin-induced genes in a manner different from sterols. Our results suggest that XN impairs the endoplasmic reticulum-to-Golgi translocation of the SREBP cleavage-activating protein (SCAP)-SREBP complex by binding to Sec23/24 and blocking SCAP/SREBP incorporation into common coated protein II vesicles. Furthermore, in diet-induced obese mice, dietary XN suppressed SREBP-1 target gene expression in the liver accompanied by a reduction of the mature form of hepatic SREBP-1, and it inhibited the development of obesity and hepatic steatosis. Altogether, our data suggest that XN attenuates the function of SREBP-1 by repressing its maturation and that it has the potential of becoming a nutraceutical food or pharmacological agent for improving metabolic syndrome.

  14. Xanthohumol Improves Diet-induced Obesity and Fatty Liver by Suppressing Sterol Regulatory Element-binding Protein (SREBP) Activation*

    PubMed Central

    Miyata, Shingo; Inoue, Jun; Shimizu, Makoto; Sato, Ryuichiro


    Sterol regulatory element-binding proteins (SREBPs) are key transcription factors that stimulate the expression of genes involved in fatty acid and cholesterol biosynthesis. Here, we demonstrate that a prenylated flavonoid in hops, xanthohumol (XN), is a novel SREBP inactivator that reduces the de novo synthesis of fatty acid and cholesterol. XN independently suppressed the maturation of SREBPs of insulin-induced genes in a manner different from sterols. Our results suggest that XN impairs the endoplasmic reticulum-to-Golgi translocation of the SREBP cleavage-activating protein (SCAP)-SREBP complex by binding to Sec23/24 and blocking SCAP/SREBP incorporation into common coated protein II vesicles. Furthermore, in diet-induced obese mice, dietary XN suppressed SREBP-1 target gene expression in the liver accompanied by a reduction of the mature form of hepatic SREBP-1, and it inhibited the development of obesity and hepatic steatosis. Altogether, our data suggest that XN attenuates the function of SREBP-1 by repressing its maturation and that it has the potential of becoming a nutraceutical food or pharmacological agent for improving metabolic syndrome. PMID:26140926

  15. Gentiana manshurica Kitagawa reverses acute alcohol-induced liver steatosis through blocking sterol regulatory element-binding protein-1 maturation.


    Lian, Li-Hua; Wu, Yan-Ling; Song, Shun-Zong; Wan, Ying; Xie, Wen-Xue; Li, Xin; Bai, Ting; Ouyang, Bing-Qing; Nan, Ji-Xing


    This study was undertaken to investigate the protective effects of Gentiana manshurica Kitagawa (GM) on acute alcohol-induced fatty liver. Mice were treated with ethanol (5 g/kg of body weight) by gavage every 12 h for a total of three doses to induce acute fatty liver. Methanol extract of GM (50, 100, or 200 mg/kg) or silymarin (100 mg/kg) was gavaged simultaneously with ethanol for three doses. GM administration significantly reduced the increases in serum ALT and AST levels, the serum and hepatic triglyceride levels, at 4 h after the last ethanol administration. GM was also found to prevent ethanol-induced hepatic steatosis and necrosis, as indicated by liver histopathological studies. Additionally, GM suppressed the elevation of malondialdehyde (MDA) levels, restored the glutathione (GSH) levels, and enhanced the superoxide dismutase (SOD), catalase (CAT), and glutathione peroxidase (GPX) activities. The concurrent administration of GM efficaciously abrogated cytochrome P450 2E1 (CYP2E1) induction. Moreover, GM significantly reduced the nuclear translocation of sterol regulatory element-binding protein-1 (nSREBP-1) in ethanol-treated mice. These data indicated that GM possessed the ability to prevent ethanol-induced acute liver steatosis, possibly through blocking CYP2E1-mediated free radical scavenging effects and SREBP-1-regulated fatty acid synthesis. Especially, GM may be developed as a potential therapeutic candidate for ethanol-induced oxidative damage in liver.

  16. Expression of the CDR1 efflux pump in clinical Candida albicans isolates is controlled by a negative regulatory element

    SciTech Connect

    Gaur, Naseem Akhtar; Manoharlal, Raman; Saini, Preeti; Prasad, Tulika; Mukhopadhyay, Gauranga; Hoefer, Milan; Morschhaeuser, Joachim; Prasad, Rajendra . E-mail:


    Resistance to azole antifungal drugs in clinical isolates of the human fungal pathogen Candida albicans is often caused by constitutive overexpression of the CDR1 gene, which encodes a multidrug efflux pump of the ABC transporter superfamily. To understand the relevance of a recently identified negative regulatory element (NRE) in the CDR1 promoter for the control of CDR1 expression in the clinical scenario, we investigated the effect of mutation or deletion of the NRE on CDR1 expression in two matched pairs of azole-sensitive and resistant clinical isolates of C. albicans. Expression of GFP or lacZ reporter genes from the wild type CDR1 promoter was much higher in the azole-resistant C. albicans isolates than in the azole-susceptible isolates, reflecting the known differences in CDR1 expression in these strains. Deletion or mutation of the NRE resulted in enhanced reporter gene expression in azole-sensitive strains, but did not further increase the already high CDR1 promoter activity in the azole-resistant strains. In agreement with these findings, electrophoretic mobility shift assays showed a reduced binding to the NRE of nuclear extracts from the resistant C. albicans isolates as compared with extracts from the sensitive isolates. These results demonstrate that the NRE is involved in maintaining CDR1 expression at basal levels and that this repression is overcome in azole-resistant clinical C. albicans isolates, resulting in constitutive CDR1 overexpression and concomitant drug resistance.

  17. Forkhead transcription factor 1 inhibits endometrial cancer cell proliferation via sterol regulatory element-binding protein 1

    PubMed Central

    Zhang, Yifang; Zhang, Lili; Sun, Hengzi; Lv, Qingtao; Qiu, Chunping; Che, Xiaoxia; Liu, Zhiming; Jiang, Jie


    The morbidity and mortality associated with endometrial cancer (EC) has increased in recent years. Regarded as a tumor suppressor, forkhead transcription factor 1 (FOXO1) has various biological activities and participates in cell cycle progression, apoptosis and differentiation. Notably, FOXO1 also functions in the regulation of lipogenesis and energy metabolism. Lipogenesis is a feature of cancer and is upregulated in EC. Sterol regulatory element-binding protein 1 (SREBP1) is a transcription factor that is also able to regulate lipogenesis. Increased expression of SREBP1 is directly correlated with malignant transformation of tumors. A previous study demonstrated that SREBP1 was highly expressed in EC and directly resulted in tumorigenesis. However, the association between FOXO1 and SREBP1 in EC is not clear. In the present study, lentiviruses overexpressing FOXO1 were used in cell transfection and transduction. Cell viability assays demonstrated that the overexpression of FOXO1 was able to suppress cell proliferation significantly in Ishikawa and AN3 CA cell lines. In addition, FOXO1 overexpression significantly inhibited cell migration and invasion ability in vitro. In xenograft models, overexpression of FOXO1 suppressed cell tumorigenesis, and western blot analysis demonstrated that SREBP1 expression was markedly reduced in the FOXO1-overexpressing cells. It may therefore be concluded that FOXO1 is able to inhibit the proliferative capacity of cells in vitro and in vivo, in addition to the migratory and invasive capacities in vitro by directly targeting SREBP1. PMID:28356952

  18. Enhancing Transgene Expression from Recombinant AAV8 Vectors in Different Tissues Using Woodchuck Hepatitis Virus Post-Transcriptional Regulatory Element

    PubMed Central

    Wang, Lizheng; Wang, Zixuan; Zhang, Fangfang; Zhu, Rui; Bi, Jinpeng; Wu, Jiaxin; Zhang, Haihong; Wu, Hui; Kong, Wei; Yu, Bin; Yu, Xianghui


    Adeno-associated virus (AAV) vectors have been utilized extensively in gene therapy and gene function studies, as strong transgene expression is a prerequisite for positive outcomes. AAV8 was reported as the most efficient AAV serotype for transduction of the liver, brain and muscle compared with other serotypes. However, AAV8-mediated transduction of human hepatocytes is rather poor with approximately 20-fold lower efficiency compared with that of mouse hepatocytes. Therefore, we applied the woodchuck hepatitis virus post-transcriptional regulatory element (WPRE) to enhance AAV8-mediated transgene expression driven by a combination promoter (CAG promoter) with a CMV-IE enhancer and chicken beta-actin promoter for a more efficient viral vector. Transgene expression from recombinant AAV8 (rAAV8) vectors harboring a red fluorescent protein (RFP) reporter gene with or without WPRE were evaluated in vitro and in vivo. The results demonstrated that WPRE improved AAV8-mediated RFP expression in different cell lines with clear increases of transgene expression in the liver, brain or muscle of animals. The findings of this study will help to substantially reduce the quantity of viral particles that must be injected in order to reach a therapeutic level of transgene expression in gene therapy. Consequently, such dose reductions may lessen the potential risks associated with high doses of viral vectors. PMID:27076785

  19. Identification of a novel distal regulatory element of the human Neuroglobin gene by the chromosome conformation capture approach

    PubMed Central

    Tam, Kin Tung; Chan, Ping Kei; Zhang, Wei; Law, Pui Pik; Tian, Zhipeng; Fung Chan, Godfrey Chi; Philipsen, Sjaak; Festenstein, Richard; Tan-Un, Kian Cheng


    Neuroglobin (NGB) is predominantly expressed in the brain and retina. Studies suggest that NGB exerts protective effects to neuronal cells and is implicated in reducing the severity of stroke and Alzheimer's disease. However, little is known about the mechanisms which regulate the cell type-specific expression of the gene. In this study, we hypothesized that distal regulatory elements (DREs) are involved in optimal expression of the NGB gene. By chromosome conformation capture we identified two novel DREs located −70 kb upstream and +100 kb downstream from the NGB gene. ENCODE database showed the presence of DNaseI hypersensitive and transcription factors binding sites in these regions. Further analyses using luciferase reporters and chromatin immunoprecipitation suggested that the −70 kb region upstream of the NGB gene contained a neuronal-specific enhancer and GATA transcription factor binding sites. Knockdown of GATA-2 caused NGB expression to drop dramatically, indicating GATA-2 as an essential transcription factor for the activation of NGB expression. The crucial role of the DRE in NGB expression activation was further confirmed by the drop in NGB level after CRISPR-mediated deletion of the DRE. Taken together, we show that the NGB gene is regulated by a cell type-specific loop formed between its promoter and the novel DRE. PMID:27651453

  20. Anti-Müllerian hormone (AMH/AMH) in the European sea bass: its gene structure, regulatory elements, and the expression of alternatively-spliced isoforms.


    Halm, S; Rocha, A; Miura, T; Prat, F; Zanuy, S


    In mammals, a multitude of studies have shown that anti-Müllerian hormone (AMH/AMH), apart from inducing Müllerian duct regression during male sexual differentiation, exerts inhibitory effects on male and female gonadal steroidogenesis and differentiation. However, in lower vertebrates like teleost fish, the function of AMH/AMH has been far less explored. As a first step to unravel its potential role in reproduction in teleost fish, we isolated and characterised the AMH gene in the European sea bass (sb), Dicentrachus labrax, determined putative regulatory elements of its 5'-flanking region, and analysed its gene expression and those of alternatively-spliced transcripts. The characterisation of sb-AMH revealed distinct features that distinguishes it from mammalian and bird AMH, suggesting a high rate of diversification of AMH during vertebrate evolution. It contained 7 exons that were divided by 6 introns, of which the last intron (intron vi) was localised only a few nucleotides upstream of the putative peptide cleavage site. The guanine and cytosine content of the open reading frame (ORF) was 52.7% and thus notably lower than that of bird and mammalian AMH. Sb-AMH cDNA was 2045 base pairs (bp) long, containing an ORF of 1599 bp encoding 533 amino acids. Deduced amino acid similarities of the conserved, carboxyterminal domain were highest with AMH in Japanese flounder (84.2%) and lowest with chicken AMH (45.5%). In the proximal promoter sequence of sb-AMH, a steroidogenic factor-1 (SF-1) binding site was present; however other regulatory sequences essential for transcriptional activation of AMH in mammals were absent. Likewise, there was no sequence homology to an SF3A2 sequence within the first 3200 bp upstream of the sb-AMH translation start site. Gene expression of sb-AMH and of alternatively-spliced sb-AMH transcripts were analysed in male and female juvenile and adult gonads as well as in somatic tissues of juvenile males. sb-AMH expression was highest in

  1. Independent and tight regulation of transcriptional units in Escherichia coli via the LacR/O, the TetR/O and AraC/I1-I2 regulatory elements.


    Lutz, R; Bujard, H


    Based on parameters governing promoter activity and using regulatory elements of the lac, ara and tet operon transcription control sequences were composed which permit the regulation in Escherichia coli of several gene activities independently and quantitatively. The novel promoter PLtetO-1 allows the regulation of gene expression over an up to 5000-fold range with anhydrotetracycline (aTc) whereas with IPTG and arabinose the activity of Plac/ara-1 may be controlled 1800-fold. Escherichia coli host strains which produce defined amounts of the regulatory proteins, Lac and Tet repressor as well as AraC from chromosomally located expression units provide highly reproducible in vivo conditions. Controlling the expression of the genes encoding luciferase, the low abundance E.coli protein DnaJ and restriction endonuclease Cfr9I not only demonstrates that high levels of expression can be achieved but also suggests that under conditions of optimal repression only around one mRNA every 3rd generation is produced. This potential of quantitative control will open up new approaches in the study of gene function in vivo, in particular with low abundance regulatory gene products. The system will also provide new opportunities for the controlled expression of heterologous genes.

  2. A Repetitive DNA Element Regulates Expression of the Helicobacter pylori Sialic Acid Binding Adhesin by a Rheostat-like Mechanism

    PubMed Central

    Vallström, Anna; Olofsson, Annelie; Öhman, Carina; Rakhimova, Lena; Borén, Thomas; Engstrand, Lars; Brännström, Kristoffer; Arnqvist, Anna


    During persistent infection, optimal expression of bacterial factors is required to match the ever-changing host environment. The gastric pathogen Helicobacter pylori has a large set of simple sequence repeats (SSR), which constitute contingency loci. Through a slipped strand mispairing mechanism, the SSRs generate heterogeneous populations that facilitate adaptation. Here, we present a model that explains, in molecular terms, how an intergenically located T-tract, via slipped strand mispairing, operates with a rheostat-like function, to fine-tune activity of the promoter that drives expression of the sialic acid binding adhesin, SabA. Using T-tract variants, in an isogenic strain background, we show that the length of the T-tract generates multiphasic output from the sabA promoter. Consequently, this alters the H. pylori binding to sialyl-Lewis x receptors on gastric mucosa. Fragment length analysis of post-infection isolated clones shows that the T-tract length is a highly variable feature in H. pylori. This mirrors the host-pathogen interplay, where the bacterium generates a set of clones from which the best-fit phenotypes are selected in the host. In silico and functional in vitro analyzes revealed that the length of the T-tract affects the local DNA structure and thereby binding of the RNA polymerase, through shifting of the axial alignment between the core promoter and UP-like elements. We identified additional genes in H. pylori, with T- or A-tracts positioned similar to that of sabA, and show that variations in the tract length likewise acted as rheostats to modulate cognate promoter output. Thus, we propose that this generally applicable mechanism, mediated by promoter-proximal SSRs, provides an alternative mechanism for transcriptional regulation in bacteria, such as H. pylori, which possesses a limited repertoire of classical trans-acting regulatory factors. PMID:24991812

  3. Transcriptional induction of IFN-gamma-responsive genes is modulated by DNA surrounding the interferon stimulation response element.

    PubMed Central

    Strehlow, I; Decker, T


    The 9/27 and GBP mRNAs are both inducible by Interferon-gamma (IFN-gamma). The promoters of both genes contain an Interferon Stimulation Response Element (ISRE), but while the GBP gene is strongly induced transcriptionally by IFN-gamma the response of the 9/27 promoter is very weak. We investigated the molecular basis for this difference. The different IFN-gamma-responsiveness was found to have more than one reason. First, 9/27 promoter DNA was unable to bind the Gamma Interferon Activation Factor (GAF) with a single high affinity site. It efficiently competed for the association of the GAF with the GBP promoter but this competition was due to the presence of two low affinity sites, the ISRE and an ISRE-like sequence, suggesting that the GAS and ISRE, though both having clear preferences for specific proteins, may nevertheless share a certain degree of structural homology. Second, the 9/27 and GBP ISREs differed markedly in their affinities for regulatory proteins (ISGFs 1,2,3) and the GBP ISRE was more potent in mediating IFN-gamma-induced promoter activity in transient transfection. Third and most importantly, however, the strong difference between the IFN-gamma response of the two promoters was mainly due to the sequences surrounding the ISRE: the positive-acting GAS on one side and sequences with silencing properties 5' and 3' of the 9/27 ISRE on the other side. The data thus show mechanisms to both up- and down-regulate the activity of the ISRE. Images PMID:1508672

  4. Satellite DNA and Transposable Elements in Seabuckthorn (Hippophae rhamnoides), a Dioecious Plant with Small Y and Large X Chromosomes

    PubMed Central

    Puterova, Janka; Razumova, Olga; Martinek, Tomas; Alexandrov, Oleg; Divashuk, Mikhail; Kubat, Zdenek; Hobza, Roman; Karlov, Gennady


    Seabuckthorn (Hippophae rhamnoides) is a dioecious shrub commonly used in the pharmaceutical, cosmetic, and environmental industry as a source of oil, minerals and vitamins. In this study, we analyzed the transposable elements and satellites in its genome. We carried out Illumina DNA sequencing and reconstructed the main repetitive DNA sequences. For data analysis, we developed a new bioinformatics approach for advanced satellite DNA analysis and showed that about 25% of the genome consists of satellite DNA and about 24% is formed of transposable elements, dominated by Ty3/Gypsy and Ty1/Copia LTR retrotransposons. FISH mapping revealed X chromosome-accumulated, Y chromosome-specific or both sex chromosomes-accumulated satellites but most satellites were found on autosomes. Transposable elements were located mostly in the subtelomeres of all chromosomes. The 5S rDNA and 45S rDNA were localized on one autosomal locus each. Although we demonstrated the small size of the Y chromosome of the seabuckthorn and accumulated satellite DNA there, we were unable to estimate the age and extent of the Y chromosome degeneration. Analysis of dioecious relatives such as Shepherdia would shed more light on the evolution of these sex chromosomes. PMID:28057732

  5. Crystal structure of a DNA aptamer bound to PvLDH elucidates novel single-stranded DNA structural elements for folding and recognition

    PubMed Central

    Choi, Sung-Jin; Ban, Changill


    Structural elements are key elements for understanding single-stranded nucleic acid folding. Although various RNA structural elements have been documented, structural elements of single-stranded DNA (ssDNA) have rarely been reported. Herein, we determined a crystal structure of PvLDH in complex with a DNA aptamer called pL1. This aptamer folds into a hairpin-bulge contact by adopting three novel structural elements, viz, DNA T-loop-like motif, base–phosphate zipper, and DNA G·G metal ion zipper. Moreover, the pL1:PvLDH complex shows unique properties compared with other protein:nucleic acid complexes. Generally, extensive intermolecular hydrogen bonds occur between unpaired nucleotides and proteins for specific recognitions. Although most protein-interacting nucleotides of pL1 are unpaired nucleotides, pL1 recognizes PvLDH by predominant shape complementarity with many bridging water molecules owing to the combination of three novel structural elements making protein-binding unpaired nucleotides stable. Moreover, the additional set of Plasmodium LDH residues which were shown to form extensive hydrogen bonds with unpaired nucleotides of 2008s does not participate in the recognition of pL1. Superimposition of the pL1:PvLDH complex with hLDH reveals steric clashes between pL1 and hLDH in contrast with no steric clashes between 2008s and hLDH. Therefore, specific protein recognition mode of pL1 is totally different from that of 2008s. PMID:27725738

  6. Mechanistic basis of plasmid-specific DNA binding of the F plasmid regulatory protein, TraM.


    Peng, Yun; Lu, Jun; Wong, Joyce J W; Edwards, Ross A; Frost, Laura S; Mark Glover, J N


    The conjugative transfer of bacterial F plasmids relies on TraM, a plasmid-encoded protein that recognizes multiple DNA sites to recruit the plasmid to the conjugative pore. In spite of the high degree of amino acid sequence conservation between TraM proteins, many of these proteins have markedly different DNA binding specificities that ensure the selective recruitment of a plasmid to its cognate pore. Here we present the structure of F TraM RHH (ribbon-helix-helix) domain bound to its sbmA site. The structure indicates that a pair of TraM tetramers cooperatively binds an underwound sbmA site containing 12 base pairs per turn. The sbmA is composed of 4 copies of a 5-base-pair motif, each of which is recognized by an RHH domain. The structure reveals that a single conservative amino acid difference in the RHH β-ribbon between F and pED208 TraM changes its specificity for its cognate 5-base-pair sequence motif. Specificity is also dictated by the positioning of 2-base-pair spacer elements within sbmA; in F sbmA, the spacers are positioned between motifs 1 and 2 and between motifs 3 and 4, whereas in pED208 sbmA, there is a single spacer between motifs 2 and 3. We also demonstrate that a pair of F TraM tetramers can cooperatively bind its sbmC site with an affinity similar to that of sbmA in spite of a lack of sequence similarity between these DNA elements. These results provide a basis for the prediction of the DNA binding properties of the family of TraM proteins.

  7. Identification of gene co-regulatory modules and associated cis-elements involved in degenerative heart disease

    PubMed Central


    Background Cardiomyopathies, degenerative diseases of cardiac muscle, are among the leading causes of death in the developed world. Microarray studies of cardiomyopathies have identified up to several hundred genes that significantly alter their expression patterns as the disease progresses. However, the regulatory mechanisms driving these changes, in particular the networks of transcription factors involved, remain poorly understood. Our goals are (A) to identify modules of co-regulated genes that undergo similar changes in expression in various types of cardiomyopathies, and (B) to reveal the specific pattern of transcription factor binding sites, cis-elements, in the proximal promoter region of genes comprising such modules. Methods We analyzed 149 microarray samples from human hypertrophic and dilated cardiomyopathies of various etiologies. Hierarchical clustering and Gene Ontology annotations were applied to identify modules enriched in genes with highly correlated expression and a similar physiological function. To discover motifs that may underly changes in expression, we used the promoter regions for genes in three of the most interesting modules as input to motif discovery algorithms. The resulting motifs were used to construct a probabilistic model predictive of changes in expression across different cardiomyopathies. Results We found that three modules with the highest degree of functional enrichment contain genes involved in myocardial contraction (n = 9), energy generation (n = 20), or protein translation (n = 20). Using motif discovery tools revealed that genes in the contractile module were found to contain a TATA-box followed by a CACC-box, and are depleted in other GC-rich motifs; whereas genes in the translation module contain a pyrimidine-rich initiator, Elk-1, SP-1, and a novel motif with a GCGC core. Using a naïve Bayes classifier revealed that patterns of motifs are statistically predictive of expression patterns, with odds ratios of 2

  8. Interferon regulatory factor 3 as key element of the interferon signature in plasmacytoid dendritic cells from systemic lupus erythematosus patients: novel genetic associations in the Mexican mestizo population

    PubMed Central

    Santana-de Anda, K; Gómez-Martín, D; Monsivais-Urenda, A E; Salgado-Bustamante, M; González-Amaro, R; Alcocer-Varela, J


    Many genetic studies have found an association between interferon regulatory factors (IRF) single nucleotide polymorphisms (SNPs) and systemic lupus erythematosus (SLE); however, specific dendritic cell (DC) alterations have not been assessed. The aim of the present study was to address the expression of IRF3 and IRF5 on different DC subsets from SLE patients, as well as their association with interferon (IFN)-α production and novel SNPs. For the genetic association analyses, 156 SLE patients and 272 healthy controls from the Mexican mestizo population were included. From these, 36 patients and 36 controls were included for functional analysis. Two IRF3 SNPs − rs2304206 and rs2304204 – were determined. We found an increased percentage of circulating pDC in SLE patients in comparison to controls (8·04 ± 1·48 versus 3·35 ± 0·8, P = 0·032). We also observed enhanced expression of IRF3 (64 ± 6·36 versus 36·1 ± 5·57, P = 0·004) and IRF5 (40 ± 5·25 versus 22·5 ± 2·6%, P = 0·010) restricted to this circulating pDC subset from SLE patients versus healthy controls. This finding was associated with higher IFN-α serum levels in SLE (160·2 ± 21 versus 106·1 ± 14 pg/ml, P = 0·036). Moreover, the IRF3 rs2304206 polymorphism was associated with increased susceptibility to SLE [odds ratio (OR), 95% confidence interval (CI) = 2·401 (1·187–4·858), P = 0·021] as well as enhanced levels of serum type I IFN in SLE patients who were positive for dsDNA autoantibodies. The IRF3 rs2304204 GG and AG genotypes conferred decreased risk for SLE. Our findings suggest that the predominant IRF3 expression on circulating pDC is a key element for the increased IFN-α activation based on the interplay between the rs2304206 gene variant and the presence of dsDNA autoantibodies in Mexican mestizo SLE patients. PMID:25130328

  9. The role of the largest RNA polymerase subunit lid element in preventing the formation of extended RNA-DNA hybrid.


    Naryshkina, Tatyana; Kuznedelov, Konstantin; Severinov, Konstantin


    Analysis of multi-subunit RNA polymerase (RNAP) structures revealed several distinct elements that may perform partial functions of the enzyme. One such element, the "lid", is formed by an evolutionarily conserved segment of the RNAP largest subunit (beta' in bacterial RNAP). The beta' lid contacts the nascent RNA at the upstream edge of the RNA-DNA hybrid, where the RNA gets separated from the DNA template-strand and double-stranded upstream DNA is formed. To test the beta' lid functions, we generated bacterial RNAP lacking the lid and studied the mutant enzyme's properties in vitro. Our results demonstrate that removal of the lid has minimal consequences on transcription elongation from double-stranded DNA. On single-stranded DNA, the mutant RNAP generates full-sized transcripts that remain annealed to the DNA throughout their length. In contrast, the wild-type enzyme produces short, 18-22 nucleotide transcripts that remain part of the transcription complex but cannot be further elongated. The cessation of transcription is apparently triggered by a clash between the lid and the nascent RNA 5' end. The results show that the lid's function is redundant in the presence of the non-template DNA strand, which alone can control the proper geometry of nucleic acids at the upstream edge of the transcription complex. Structural considerations suggest that in the absence of the non-template strand and the lid, a new channel opens within the RNAP molecule that allows continuous DNA-RNA hybrid to exit RNAP.

  10. Structural features of the murine dihydrofolate reductase transcription termination region: identification of a conserved DNA sequence element.

    PubMed Central

    Frayne, E G; Kellems, R E


    Structural features of the transcription termination region for the mouse dihydrofolate reductase gene have been determined and compared with those of several other known termination regions for protein coding genes. A common feature identified among these termination regions was the presence of a 20 bp consensus DNA sequence element (ATCAGAATATAGGAAAGTAGCAAT). The results imply that the 20 bp consensus DNA sequence element is important for signaling RNA polymerase II transcription termination at least in the several vertebrate species investigated. Furthermore, the results suggest that for the dhfr gene and possibly for other genes in mice as well, the potential termination consensus sequence can exist as part of a long interspersed repetitive DNA element. Images PMID:3714472

  11. Repetitive genomic elements and overall DNA methylation changes in acute myeloid and childhood B-cell lymphoblastic leukemia patients.


    Bujko, Mateusz; Musialik, Ewa; Olbromski, Rafał; Przestrzelska, Marta; Libura, Marta; Pastwińska, Anna; Juszczyński, Przemysław; Zwierzchowski, Lech; Baranowski, Paweł; Siedlecki, Janusz Aleksander


    Aberrant epigenetic regulation is a hallmark of neoplastic cells. Increased DNA methylation of individual genes' promoter regions and decreases in overall DNA methylation level are both generally observed in cancer. In solid tumors, this global DNA hypomethylation is related to reduced methylation of repeated DNA elements (REs) and contributes to genome instability. The aim of the present study was to assess methylation level of LINE-1 and ALU REs and total 5-methylcytosine (5metC) content in adult acute myeloid leukemia (AML) (n = 58), childhood B-cell acute lymphoblastic leukemia (ALL) (n = 32), as the most frequent acute leukemias in two age categories and in normal adult bone marrow and children's blood samples. DNA pyrosequencing and ELISA assays were used, respectively. Global DNA hypomethylation was not observed in leukemia patients. Results revealed higher DNA methylation of LINE-1 in AML and ALL samples compared to corresponding normal controls. Elevated methylation of ALU and overall 5metC level were also observed in B-cell ALL patients. Differences of REs and global DNA methylation between AML cytogenetic-risk groups were observed, with the lowest methylation levels in intermediate-risk/cytogenetically normal patients. B-cell ALL is characterized by the highest DNA methylation level compared to AML and controls and overall DNA methylation is correlated with leukocyte count.

  12. Proteins and DNA elements essential for the CRISPR adaptation process in Escherichia coli.


    Yosef, Ido; Goren, Moran G; Qimron, Udi


    The clustered regularly interspaced short palindromic repeats and their associated proteins (CRISPR/Cas) constitute a recently identified prokaryotic defense mechanism against invading nucleic acids. Activity of the CRISPR/Cas system comprises of three steps: (i) insertion of alien DNA sequences into the CRISPR array to prevent future attacks, in a process called 'adaptation', (ii) expression of the relevant proteins, as well as expression and processing of the array, followed by (iii) RNA-mediated interference with the alien nucleic acid. Here we describe a robust assay in Escherichia coli to explore the hitherto least-studied process, adaptation. We identify essential genes and DNA elements in the leader sequence and in the array which are essential for the adaptation step. We also provide mechanistic insights on the insertion of the repeat-spacer unit by showing that the first repeat serves as the template for the newly inserted repeat. Taken together, our results elucidate fundamental steps in the adaptation process of the CRISPR/Cas system.

  13. A novel transcriptional element in circular DNA monomers of the duck hepatitis B virus.

    PubMed Central

    Beckel-Mitchener, A; Summers, J


    We report the presence of two elements, pet and net, that are required for proper transcription of the duck hepatitis B virus (DHBV). These regions were previously identified by using plasmid clones of the virus in transient expression assays (M. Huang and J. Summers, J. Virol. 68:1564-1572, 1994). In this study, we further analyzed these regions by using in vitro-synthesized circular DHBV DNA monomers to mimic the authentic transcriptional template. We observed that pet was required for pregenome transcription from circular viral monomers, and in the absence of pet-dependent transcription, expression of the viral envelope genes was increased. We found that deletion of net in circularized DNA monomers led to the production of abnormally long transcripts due to a failure to form 3' ends during transcription. In addition, we report the presence of a net-like region in the mammalian hepadnavirus woodchuck hepatitis virus. These results are consistent with a model that net is a region involved in transcription termination and that in DHBV, pet is required for transcription complexes to read through this region during the first pass through net. PMID:9311882

  14. Cellular localization of the embryo-specific hybrid PRP from Zea mays, and characterization of promoter regulatory elements of its gene.


    Jose-Estanyol, M; Puigdomènech, P


    The expression, regulation and cellular localization of ZmHyPRP, a gene marker of embryo differentiation whose expression declines after ABA induction, was studied. ZmHyPRP is a proline-rich protein with a C-terminal domain having eight cysteines in a CM8 pattern. Transient expression in onion epidermal cells, transformed with a 2x35S::ZmHyPRP-GFP construction, indicated the protein is present in vesicles lining the membrane of the cell. The ZmHyPRP gene expression is under the control of classic promoter seed-specific regulatory elements such as Sph/RY and G-boxes, suggesting regulation by B3 and b-ZIP transcription factors. Promoter deletion analysis, by particle-bombardment transient transformation of maize immature embryos with serial deletions of the promoter fused to GUS, showed the presence of two negative regulatory elements, NE1 (-2070 to -1280) and NE2 (-232 to -178), in the ZmHyPRP promoter. By selective deletion or mutation of ZmHyPRP regulatory promoter elements we conclude that the promoter expression is attenuated by the NE2 element as well as by the G-box2 and the Sph1-2 box together with the G-box2.

  15. Repetitive element DNA methylation levels in white blood cell DNA from sisters discordant for breast cancer from the New York site of the Breast Cancer Family Registry.


    Wu, Hui-Chen; Delgado-Cruzata, Lissette; Flom, Julie D; Perrin, Mary; Liao, Yuyan; Ferris, Jennifer S; Santella, Regina M; Terry, Mary Beth


    Global decreases in DNA methylation, particularly in repetitive elements, have been associated with genomic instability and human cancer. Emerging, though limited, data suggest that in white blood cell (WBC) DNA levels of methylation, overall or in repetitive elements, may be associated with cancer risk. We measured methylation levels of three repetitive elements [Satellite 2 (Sat2)], long interspersed nuclear element-1 (LINE-1) and Alu) by MethyLight, and LINE-1 by pyrosequencing in a total of 282 breast cancer cases and 347 unaffected sisters from the New York site of the Breast Cancer Family Registry (BCFR) using DNA from both granulocytes and total WBC. We found that methylation levels in all markers were correlated between sisters (Spearman correlation coefficients ranged from 0.17 to 0.55). Sat2 methylation was statistically significantly associated with increased breast cancer risk [odds ratio (OR) = 2.09, 95% confidence interval (CI) = 1.09-4.03; for each unit decrease in the natural log of the methylation level, OR = 2.12, 95% CI = 0.88-5.11 for the lowest quartile compared with the highest quartile]. These associations were only observed in total WBC but not granulocyte DNA. There was no association between breast cancer and LINE-1 and Alu methylation. If replicated in larger prospective studies, these findings support that selected markers of epigenetic changes measured in WBC, such as Sat2, may be potential biomarkers of breast cancer risk.

  16. Spontaneous germline excision of Tol1, a DNA-based transposable element naturally occurring in the medaka fish genome.


    Watanabe, Kohei; Koga, Hajime; Nakamura, Kodai; Fujita, Akiko; Hattori, Akimasa; Matsuda, Masaru; Koga, Akihiko


    DNA-based transposable elements are ubiquitous constituents of eukaryotic genomes. Vertebrates are, however, exceptional in that most of their DNA-based elements appear to be inactivated. The Tol1 element of the medaka fish, Oryzias latipes, is one of the few elements for which copies containing an undamaged gene have been found. Spontaneous transposition of this element in somatic cells has previously been demonstrated, but there is only indirect evidence for its germline transposition. Here, we show direct evidence of spontaneous excision in the germline. Tyrosinase is the key enzyme in melanin biosynthesis. In an albino laboratory strain of medaka fish, which is homozygous for a mutant tyrosinase gene in which a Tol1 copy is inserted, we identified de novo reversion mutations related to melanin pigmentation. The gamete-based reversion rate was as high as 0.4%. The revertant fish carried the tyrosinase gene from which the Tol1 copy had been excised. We previously reported the germline transposition of Tol2, another DNA-based element that is thought to be a recent invader of the medaka fish genome. Tol1 is an ancient resident of the genome. Our results indicate that even an old element can contribute to genetic variation in the host genome as a natural mutator.

  17. Relaxase DNA binding and cleavage are two distinguishable steps in conjugative DNA processing that involve different sequence elements of the nic site.


    Lucas, María; González-Pérez, Blanca; Cabezas, Matilde; Moncalian, Gabriel; Rivas, Germán; de la Cruz, Fernando


    TrwC, the relaxase of plasmid R388, catalyzes a series of concerted DNA cleavage and strand transfer reactions on a specific site (nic) of its origin of transfer (oriT). nic contains the cleavage site and an adjacent inverted repeat (IR(2)). Mutation analysis in the nic region indicated that recognition of the IR(2) proximal arm and the nucleotides located between IR(2) and the cleavage site were essential for supercoiled DNA processing, as judged either by in vitro nic cleavage or by mobilization of a plasmid containing oriT. Formation of the IR(2) cruciform and recognition of the distal IR(2) arm and loop were not necessary for these reactions to take place. On the other hand, IR(2) was not involved in TrwC single-stranded DNA processing in vitro. For single-stranded DNA nic cleavage, TrwC recognized a sequence embracing six nucleotides upstream of the cleavage site and two nucleotides downstream. This suggests that TrwC DNA binding and cleavage are two distinguishable steps in conjugative DNA processing and that different sequence elements are recognized by TrwC in each step. IR(2)-proximal arm recognition was crucial for the initial supercoiled DNA binding. Subsequent recognition of the adjacent single-stranded DNA binding site was required to position the cleavage site in the active center of the protein so that the nic cleavage reaction could take place.

  18. Chromatin Heterogeneity and Distribution of Regulatory Elements in the Late-Replicating Intercalary Heterochromatin Domains of Drosophila melanogaster Chromosomes

    PubMed Central

    Khoroshko, Varvara A.; Levitsky, Viktor G.; Zykova, Tatyana Yu.; Antonenko, Oksana V.; Belyaeva, Elena S.; Zhimulev, Igor F.


    Late-replicating domains (intercalary heterochromatin) in the Drosophila genome display a number of features suggesting their organization is quite unique. Typically, they are quite large and encompass clusters of functionally unrelated tissue-specific genes. They correspond to the topologically associating domains and conserved microsynteny blocks. Our study aims at exploring further details of molecular organization of intercalary heterochromatin and has uncovered surprising heterogeneity of chromatin composition in these regions. Using the 4HMM model developed in our group earlier, intercalary heterochromatin regions were found to host chromatin fragments with a particular epigenetic profile. Aquamarine chromatin fragments (spanning 0.67% of late-replicating regions) are characterized as a class of sequences that appear heterogeneous in terms of their decompactization. These fragments are enriched with enhancer sequences and binding sites for insulator proteins. They likely mark the chromatin state that is related to the binding of cis-regulatory proteins. Malachite chromatin fragments (11% of late-replicating regions) appear to function as universal transitional regions between two contrasting chromatin states. Namely, they invariably delimit intercalary heterochromatin regions from the adjacent active chromatin of interbands. Malachite fragments also flank aquamarine fragments embedded in the repressed chromatin of late-replicating regions. Significant enrichment of insulator proteins CP190, SU(HW), and MOD2.2 was observed in malachite chromatin. Neither aquamarine nor malachite chromatin types appear to correlate with the positions of highly conserved non-coding elements (HCNE) that are typically replete in intercalary heterochromatin. Malachite chromatin found on the flanks of intercalary heterochromatin regions tends to replicate earlier than the malachite chromatin embedded in intercalary heterochromatin. In other words, there exists a gradient of

  19. A common element involved in transcriptional regulation of two DNA alkylation repair genes (MAG and MGT1) of Saccharomyces cerevisiae.

    PubMed Central

    Xiao, W; Singh, K K; Chen, B; Samson, L


    The Saccharomyces cerevisiae MAG gene encodes a 3-methyladenine DNA glycosylase that protects cells from killing by alkylating agents. MAG mRNA levels are induced not only by alkylating agents but also by DNA-damaging agents that do not produce alkylated DNA. We constructed a MAG-lacZ gene fusion to help identify the cis-acting promoter elements involved in regulating MAG expression. Deletion analysis defined the presence of one upstream activating sequence and one upstream repressing sequence (URS) and suggested the presence of a second URS. One of the MAG URS elements matches a decamer consensus sequence present in the promoters of 11 other S. cerevisiae DNA repair and metabolism genes, including the MGT1 gene, which encodes an O6-methylguanine DNA repair methyltransferase. Two proteins of 26 and 39 kDa bind specifically to the MAG and MGT1 URS elements. We suggest that the URS-binding proteins may play an important role in the coordinate regulation of these S. cerevisiae DNA repair genes. Images PMID:8246943

  20. Negative regulatory element associated with potentially functional promoter and enhancer elements in the long terminal repeats of endogenous murine leukemia virus-related proviral sequences

    SciTech Connect

    Ch'ang, L.Y.; Yang, W.K.; Myer, F.E.; Yang, D.M.


    Three series of recombinant DNA clones were constructed, with the bacterial chloramphenical acetyltransferase (CAT) gene as a quantitative indicator, to examine the activities of promoter and enhancer sequence elements in the 5' long terminal repeat (LTR) of murine leukemia virus (MuLV)-related proviral sequences isolated from the mouse genome. Transient CAT expression was determined in mouse NIH 3T3, human HT1080, and mink CCL64 cultured cells transfected with the LTR-CAT constructs. The 700-base pair (bp) LTRs of three polytropic MuLV-related proviral clones and the 750-bp LTRs of four modified polytropic proviral clones, in complete structures either with or without the adjacent downstream sequences, all showed very little or negligible activities for CAT expression, while ecotropic MuLV LTRs were highly active. The MuLV-related LTRs were divided into three portions and examined separately. The 3' portion of the MuLV-related LTRs that contains the CCAAC and TATAA boxes was found to be a functional promoter, being about one-half to one-third as active as the corresponding portion of the ecotropic MuLV LTRs. A MboI-Bg/II fragment, representing the distinct 190- to 200-pb inserted segment in the middle, was found to be a potential enhancer, especially when examined in combination with the simian virus 40 promoter in CCL64 cells. A PstI-MboI fragment of the 5' portion, which contains the protein-binding motifs on the enhancer segment as well as the upstream LTF sequences, showed moderate enhancer activities in CCL6 cells but was virtually inactive in NIH 3T3 cells and HT1080 cells; addition of this fragment to the ecotropic LTR-CAT constructs depressed CAT expression.

  1. A possible aid in targeted insertion of large DNA elements by CRISPR/Cas in mouse zygotes.


    Nakao, Harumi; Harada, Takeshi; Nakao, Kazuki; Kiyonari, Hiroshi; Inoue, Kenichi; Furuta, Yasuhide; Aiba, Atsu


    The CRISPR/Cas system has rapidly emerged recently as a new tool for genome engineering, and is expected to allow for controlled manipulation of specific genomic elements in a variety of species. A number of recent studies have reported the use of CRISPR/Cas for gene disruption (knockout) or targeted insertion of foreign DNA elements (knock-in). Despite the ease of simple gene knockout and small insertions or nucleotide substitutions in mouse zygotes by the CRISPR/Cas system, targeted insertion of large DNA elements remains an apparent challenge. Here the generation of knock-in mice with successful targeted insertion of large donor DNA elements ranged from 3.0 to 7.1 kb at the ROSA26 locus using the CRISPR/Cas system was achieved. Multiple independent knock-in founder mice were obtained by injection of hCas9 mRNA/sgRNA/donor vector mixtures into the cytoplasm of C57BL/6N zygotes when the injected zygotes were treated with an inhibitor of actin polymerization, cytochalasin. Successful germ line transmission of three of these knock-in alleles was also confirmed. The results suggested that treatment of zygotes with actin polymerization inhibitors following microinjection could be a viable method to facilitate targeted insertion of large DNA elements by the CRISPR/Cas system, enabling targeted knock-in readily attainable in zygotes.

  2. Dead element replicating: degenerate R2 element replication and rDNA genomic turnover in the Bacillus rossius stick insect (Insecta: Phasmida).


    Martoni, Francesco; Eickbush, Danna G; Scavariello, Claudia; Luchetti, Andrea; Mantovani, Barbara


    R2 is an extensively investigated non-LTR retrotransposon that specifically inserts into the 28S rRNA gene sequences of a wide range of metazoans, disrupting its functionality. During R2 integration, first strand synthesis can be incomplete so that 5' end deleted copies are occasionally inserted. While active R2 copies repopulate the locus by retrotransposing, the non-functional truncated elements should frequently be eliminated by molecular drive processes leading to the concerted evolution of the rDNA array(s). Although, multiple R2 lineages have been discovered in the genome of many animals, the rDNA of the stick insect Bacillus rossius exhibits a peculiar situation: it harbors both a canonical, functional R2 element (R2Brfun) as well as a full-length but degenerate element (R2Brdeg). An intensive sequencing survey in the present study reveals that all truncated variants in stick insects are present in multiple copies suggesting they were duplicated by unequal recombination. Sequencing results also demonstrate that all R2Brdeg copies are full-length, i. e. they have no associated 5' end deletions, and functional assays indicate they have lost the active ribozyme necessary for R2 RNA maturation. Although it cannot be completely ruled out, it seems unlikely that the degenerate elements replicate via reverse transcription, exploiting the R2Brfun element enzymatic machinery, but rather via genomic amplification of inserted 28S by unequal recombination. That inactive copies (both R2Brdeg or 5'-truncated elements) are not eliminated in a short term in stick insects contrasts with findings for the Drosophila R2, suggesting a widely different management of rDNA loci and a lower efficiency of the molecular drive while achieving the concerted evolution.

  3. Identification of Predictive Cis-Regulatory Elements Using a Discriminative Objective Function and a Dynamic Search Space

    PubMed Central

    Karnik, Rahul; Beer, Michael A.


    The generation of genomic binding or accessibility data from massively parallel sequencing technologies such as ChIP-seq and DNase-seq continues to accelerate. Yet state-of-the-art computational approaches for the identification of DNA binding motifs often yield motifs of weak predictive power. Here we present a novel computational algorithm called MotifSpec, designed to find predictive motifs, in contrast to over-represented sequence elements. The key distinguishing feature of this algorithm is that it uses a dynamic search space and a learned threshold to find discriminative motifs in combination with the modeling of motifs using a full PWM (position weight matrix) rather than k-mer words or regular expressions. We demonstrate that our approach finds motifs corresponding to known binding specificities in several mammalian ChIP-seq datasets, and that our PWMs classify the ChIP-seq signals with accuracy comparable to, or marginally better than motifs from the best existing algorithms. In other datasets, our algorithm identifies novel motifs where other methods fail. Finally, we apply this algorithm to detect motifs from expression datasets in C. elegans using a dynamic expression similarity metric rather than fixed expression clusters, and find novel predictive motifs. PMID:26465884

  4. Maize regulatory gene opaque-2 encodes a protein with a "leucine-zipper" motif that binds to zein DNA.


    Schmidt, R J; Burr, F A; Aukerman, M J; Burr, B


    The opaque-2 locus (o2) in maize regulates the expression of many members of the zein multigene family of storage proteins. cDNA clones for a wild-type allele of the (o2) locus (O2) were isolated from a maize endosperm cDNA library and sequenced. We found a 258-nucleotide 5' leader sequence containing three short open reading frames followed by a sequence specifying a protein of 437 amino acids. The presumptive amino acid sequence of the protein (O2) specified by the O2 cDNA contains a "leucine-zipper" domain characteristic of some mammalian and fungal transcription activation factors. lacZ-O2 fusion constructs, using nearly the entire coding region of O2 or only a fragment specifying the leucine-zipper domain, were expressed in Escherichia coli. In an in vitro binding assay, the beta-galactosidase-O2 fusion proteins bound to two specific regions on the 5' side of the coding sequence in a zein genomic clone. This suggests that the O2 protein affects zein transcription through direct interaction with one or more zein promoter elements.

  5. Humans and chimpanzees differ in their cellular response to DNA damage and non-coding sequence elements of DNA repair-associated genes.


    Weis, E; Galetzka, D; Herlyn, H; Schneider, E; Haaf, T


    both species. Genetic differences in non-coding sequence elements may affect gene regulation in the DNA repair network and thus contribute to species differences in DNA repair and cancer susceptibility.

  6. Vertebrate mRNAs with a 5'-terminal pyrimidine tract are candidates for translational repression in quiescent cells: characterization of the translational cis-regulatory element.

    PubMed Central

    Avni, D; Shama, S; Loreni, F; Meyuhas, O


    The translation of mammalian ribosomal protein (rp) mRNAs is selectively repressed in nongrowing cells. This response is mediated through a regulatory element residing in the 5' untranslated region of these mRNAs and includes a 5' terminal oligopyrimidine tract (5' TOP). To further characterize the translational cis-regulatory element, we monitored the translational behavior of various endogenous and heterologous mRNAs or hybrid transcripts derived from transfected chimeric genes. The translational efficiency of these mRNAs was assessed in cells that either were growing normally or were growth arrested under various physiological conditions. Our experiments have yielded the following results: (i) the translation of mammalian rp mRNAs is properly regulated in amphibian cells, and likewise, amphibian rp mRNA is regulated in mammalian cells, indicating that all of the elements required for translation control of rp mRNAs are conserved among vertebrate classes; (ii) selective translational control is not confined to rp mRNAs, as mRNAs encoding the naturally occurring ubiquitin-rp fusion protein and elongation factor 1 alpha, which contain a 5' TOP, also conform this mode of regulation; (iii) rat rpP2 mRNA contains only five pyrimidines in its 5' TOP, yet this mRNA is translationally controlled in the same fashion as other rp mRNAs with a 5' TOP of eight or more pyrimidines; (iv) full manifestation of this mode of regulation seems to require both the 5' TOP and sequences immediately downstream; and (v) an intact translational regulatory element from rpL32 mRNA fails to exert its regulatory properties even when preceded by a single A residue. Images PMID:8196625

  7. Improved recombinant antibody production by CHO cells using a production enhancer DNA element with repeated transgene integration at a predetermined chromosomal site.


    Kawabe, Yoshinori; Inao, Takanori; Komatsu, Shodai; Huang, Guan; Ito, Akira; Omasa, Takeshi; Kamihira, Masamichi


    Chinese hamster ovary (CHO) cells are one of the most useful host cell lines for the production of biopharmaceutical proteins. Although a series of production processes have been refined to improve protein productivity and cost performance, establishing producer cells is still time-consuming and labor-intensive. Recombinase-mediated site-specific gene integration into a predetermined chromosomal locus may enable predictable protein expression, reducing the laborious process of cell screening. We previously developed an accumulative site-specific gene integration system (AGIS) using Cre recombinase and mutated loxP sites for transgene integration and amplification in the CHO cell genome. Epigenetic modifier elements such as insulators are effective DNA cis-regulatory elements for stabilizing transgene expression. Here, we attempted to enhance transgene expression in recombinant CHO cells generated by AGIS using a production enhancer DNA element (PE) derived from the CHO genome. The PE was introduced into an expression unit for a recombinant scFv-Fc antibody. The effect on scFv-Fc productivity of PE position and orientation within the transgene was evaluated, while keeping the background chromosomal structure constant. For the optimal PE arrangement, scFv-Fc productivity was enhanced 2.6-fold compared with an expression unit without a PE. The enhancing effect of the PE on transgene expression was also observed when two or three PE-flanked expression units were inserted as tandem repeats. These results indicate that AGIS using the PE-flanked expression unit is a promising approach for establishing producer cell lines for biopharmaceutical protein production.

  8. Regulatory elements in the first intron contribute to transcriptional regulation of the beta 3 tubulin gene by 20-hydroxyecdysone in Drosophila Kc cells.

    PubMed Central

    Bruhat, A; Tourmente, S; Chapel, S; Sobrier, M L; Couderc, J L; Dastugue, B


    We have studied the transcriptional regulation of the beta 3 tubulin gene by the steroid hormone 20-hydroxyecdysone (20-OH-E) in Drosophila Kc cells. A series of hybrid genes with varying tubulin gene lengths driving the bacterial chloramphenicol acetyl transferase (CAT) gene were constructed. The promoter activity was assayed after transient expression in Kc cells, in the presence or absence of 20-OH-E. We find that 0.91Kb upstream from the transcription start site contain one or several hormone independent positive cis-acting elements, responsible for the constitutive expression of the beta 3 tubulin gene. In the large (4.5 Kb) first intron of this gene, we identified additional hormone dependent negative and positive regulatory elements, which can act in both directions and in a position-independence manner. Then, the negative intron element(s), which repress the transcription in the absence of 20-OH-E has characteristics of silencer. Images PMID:2349088

  9. High constitutive activity of a broad panel of housekeeping and tissue-specific cis-regulatory elements depends on a subset of ETS proteins.


    Curina, Alessia; Termanini, Alberto; Barozzi, Iros; Prosperini, Elena; Simonatto, Marta; Polletti, Sara; Silvola, Alessio; Soldi, Monica; Austenaa, Liv; Bonaldi, Tiziana; Ghisletti, Serena; Natoli, Gioacchino


    Enhancers and promoters that control the transcriptional output of terminally differentiated cells include cell type-specific and broadly active housekeeping elements. Whether the high constitutive activity of these two groups of cis-regulatory elements relies on entirely distinct or instead also on shared regulators is unknown. By dissecting the cis-regulatory repertoire of macrophages, we found that the ELF subfamily of ETS proteins selectively bound within 60 base pairs (bp) from the transcription start sites of highly active housekeeping genes. ELFs also bound constitutively active, but not poised, macrophage-specific enhancers and promoters. The role of ELFs in promoting high-level constitutive transcription was suggested by multiple evidence: ELF sites enabled robust transcriptional activation by endogenous and minimal synthetic promoters, ELF recruitment was stabilized by the transcriptional machinery, and ELF proteins mediated recruitment of transcriptional and chromatin regulators to core promoters. These data suggest that the co-optation of a limited number of highly active transcription factors represents a broadly adopted strategy to equip both cell type-specific and housekeeping cis-regulatory elements with the ability to efficiently promote transcription.

  10. A cis-acting regulatory element that affects the alternative splicing of a muscle-specific exon in the mouse NCAM gene.


    Kawahigashi, H; Harada, Y; Asano, A; Nakamura, M


    The pre-mRNA encoding the neural cell adhesion molecule (NCAM) is spliced to generate NCAM isoforms containing the muscle-specific domain (MSD) during myogenesis. Utilizing chimeric NCAM minigenes, we searched for cis-acting elements that contribute to the alternative selection of exon MSDb, one of the four exons encoding MSD, and identified an intronic cis-element located downstream of exon MSDb. The cis-element acted as a negative regulator for the selection of exon MSDb in nonmuscle fibroblasts but not in myoblasts, that are already destined to differentiate into muscle cells. The suppressive effect of this cis-element on the selection of exon MSDb was released in the process of myogenesis. When MyoD was co-expressed with a minigene containing this element in fibroblasts, the suppressive effect of the cis-element was released as the cells underwent differentiation. We propose that this cis-element contributes at least as one of the regulatory elements in the differentiation state-dependent selection of MSD exons in vivo.

  11. Structure and function of the c-myc DNA-unwinding element-binding protein DUE-B.


    Kemp, Michael; Bae, Brian; Yu, John Paul; Ghosh, Maloy; Leffak, Michael; Nair, Satish K


    Local zones of easily unwound DNA are characteristic of prokaryotic and eukaryotic replication origins. The DNA-unwinding element of the human c-myc replication origin is essential for replicator activity and is a target of the DNA-unwinding element-binding protein DUE-B in vivo. We present here the 2.0A crystal structure of DUE-B and complementary biochemical characterization of its biological activity. The structure corresponds to a dimer of the N-terminal domain of the full-length protein and contains many of the structural elements of the nucleotide binding fold. A single magnesium ion resides in the putative active site cavity, which could serve to facilitate ATP hydrolytic activity of this protein. The structure also demonstrates a notable similarity to those of tRNA-editing enzymes. Consistent with this structural homology, the N-terminal core of DUE-B is shown to display both D-aminoacyl-tRNA deacylase activity and ATPase activity. We further demonstrate that the C-terminal portion of the enzyme is disordered and not essential for dimerization. However, this region is essential for DNA binding in vitro and becomes ordered in the presence of DNA.

  12. Capicua DNA-binding sites are general response elements for RTK signaling in Drosophila.


    Ajuria, Leiore; Nieva, Claudia; Winkler, Clint; Kuo, Dennis; Samper, Núria; Andreu, María José; Helman, Aharon; González-Crespo, Sergio; Paroush, Ze'ev; Courey, Albert J; Jiménez, Gerardo


    RTK/Ras/MAPK signaling pathways play key functions in metazoan development, but how they control expression of downstream genes is not well understood. In Drosophila, it is generally assumed that most transcriptional responses to RTK signal activation depend on binding of Ets-family proteins to specific cis-acting sites in target enhancers. Here, we show that several Drosophila RTK pathways control expression of downstream genes through common octameric elements that are binding sites for the HMG-box factor Capicua, a transcriptional repressor that is downregulated by RTK signaling in different contexts. We show that Torso RTK-dependent regulation of terminal gap gene expression in the early embryo critically depends on Capicua octameric sites, and that binding of Capicua to these sites is essential for recruitment of the Groucho co-repressor to the huckebein enhancer in vivo. We then show that subsequent activation of the EGFR RTK pathway in the neuroectodermal region of the embryo controls dorsal-ventral gene expression by downregulating the Capicua protein, and that this control also depends on Capicua octameric motifs. Thus, a similar mechanism of RTK regulation operates during subdivision of the anterior-posterior and dorsal-ventral embryonic axes. We also find that identical DNA octamers mediate Capicua-dependent regulation of another EGFR target in the developing wing. Remarkably, a simple combination of activator-binding sites and Capicua motifs is sufficient to establish complex patterns of gene expression in response to both Torso and EGFR activation in different tissues. We conclude that Capicua octamers are general response elements for RTK signaling in Drosophila.

  13. Dynamics of R1 and R2 elements in the rDNA locus of Drosophila simulans.

    PubMed Central

    Pérez-González, C E; Eickbush, T H


    The mobile elements R1 and R2 insert specifically into the rRNA gene locus (rDNA locus) of arthropods, a locus known to undergo concerted evolution, the recombinational processes that preserve the sequence homogeneity of all repeats. To monitor how rapidly individual R1 and R2 insertions are turned over in the rDNA locus by these processes, we have taken advantage of the many 5' truncation variants that are generated during the target-primed reverse transcription mechanism used by these non-LTR retrotransposons for their integration. A simple PCR assay was designed to reveal the pattern of the 5' variants present in the rDNA loci of individual X chromosomes in a population of Drosophila simulans. Each rDNA locus in this population was found to have a large, unique collection of 5' variants. Each variant was present at low copy number, usually one copy per chromosome, and was seldom distributed to other chromosomes in the population. The failure of these variants to spread to other units in the same rDNA locus suggests a strong recombinational bias against R1 and R2 that results in the individual copies of these elements being rapidly lost from the rDNA locus. This bias suggests a significantly higher frequency of R1 and R2 retrotransposition than we have previously suggested. PMID:11514447

  14. The Schizosaccharomyces pombe inv1+ regulatory region is unusually large and contains redundant cis-acting elements that function in a SAGA- and Swi/Snf-dependent fashion.


    Ahn, Sejin; Spatt, Dan; Winston, Fred


    The Schizosaccharomyces pombe inv1(+) gene encodes invertase, the enzyme required for hydrolysis of sucrose and raffinose. Transcription of inv1(+) is regulated by glucose levels, with transcription tightly repressed in high glucose and strongly induced in low glucose. To understand this regulation, we have analyzed the inv1(+) cis-regulatory region and the requirement for the trans-acting coactivators SAGA and Swi/Snf. Surprisingly, deletion of the entire 1-kilobase intergenic region between the inv1(+) TATA element and the upstream open reading frame SPCC191.10 does not significantly alter regulation of inv1(+) transcription. However, a longer deletion that extends through SPCC191.10 abolishes inv1(+) induction in low glucose. Additional analysis demonstrates that there are multiple, redundant regulatory regions spread over 1.5 kb 5' of inv1(+), including within SPCC191.10, that can confer glucose-mediated transcriptional regulation to inv1(+). Furthermore, SPCC191.10 can regulate inv1(+) transcription in an orientation-independent fashion and from a distance as great as 3 kb. With respect to trans-acting factors, both SAGA and Swi/Snf are recruited to SPCC191.10 and to other locations in the large inv1(+) regulatory region in a glucose-dependent fashion, and both are required for inv1(+) derepression. Taken together, these results demonstrate that inv1(+) regulation in S. pombe occurs via the use of multiple regulatory elements and that activation can occur over a great distance, even from elements within other open reading frames.

  15. Fine-scale map of encyclopedia of DNA elements regions in the Korean population.


    Yoo, Yeon-Kyeong; Ke, Xiayi; Hong, Sungwoo; Jang, Hye-Yoon; Park, Kyunghee; Kim, Sook; Ahn, TaeJin; Lee, Yeun-Du; Song, Okryeol; Rho, Na-Young; Lee, Moon Sue; Lee, Yeon-Su; Kim, Jaeheup; Kim, Young J; Yang, Jun-Mo; Song, Kyuyoung; Kimm, Kyuchan; Weir, Bruce; Cardon, Lon R; Lee, Jong-Eun; Hwang, Jung-Joo


    The International HapMap Project aims to generate detailed human genome variation maps by densely genotyping single-nucleotide polymorphisms (SNPs) in CEPH, Chinese, Japanese, and Yoruba samples. This will undoubtedly become an important facility for genetic studies of diseases and complex traits in the four populations. To address how the genetic information contained in such variation maps is transferable to other populations, the Korean government, industries, and academics have launched the Korean HapMap project to genotype high-density Encyclopedia of DNA Elements (ENCODE) regions in 90 Korean individuals. Here we show that the LD pattern, block structure, haplotype diversity, and recombination rate are highly concordant between Korean and the two HapMap Asian samples, particularly Japanese. The availability of information from both Chinese and Japanese samples helps to predict more accurately the possible performance of HapMap markers in Korean disease-gene studies. Tagging SNPs selected from the two HapMap Asian maps, especially the Japanese map, were shown to be very effective for Korean samples. These results demonstrate that the HapMap variation maps are robust in related populations and will serve as an important resource for the studies of the Korean population in particular.

  16. Hundreds of Circular Novel Plasmids and DNA Elements Identified in a Rat Cecum Metamobilome

    PubMed Central

    Jørgensen, Tue Sparholt; Xu, Zhuofei; Hansen, Martin Asser; Sørensen, Søren Johannes; Hansen, Lars Hestbjerg


    Metagenomic approaches are widespread in microbiological research, but so far, the knowledge on extrachromosomal DNA diversity and composition has largely remained dependant on cultivating host organisms. Even with the emergence of metagenomics, complete circular sequences are rarely identified, and have required manual curation. We propose a robust in silico procedure for identifying complete small plasmids in metagenomic datasets from whole genome shotgun sequencing. From one very pure and exhaustively sequenced metamobilome from rat cecum, we identified a total of 616 circular sequences, 160 of which were carrying a gene with plasmid replication domain. Further homology analyses indicated that the majority of these plasmid sequences are novel. We confirmed the circularity of the complete plasmid candidates using an inverse-type PCR approach on a subset of sequences with 95% success, confirming the existence and length of discrete sequences. The implication of these findings is a broadened understanding of the traits of circular elements in nature and the possibility of massive data mining in existing metagenomic datasets to discover novel pools of complete plasmids thus vastly expanding the current plasmid database. PMID:24503942

  17. A novel cis-acting element required for DNA damage-inducible expression of yeast DIN7

    SciTech Connect

    Yoshitani, Ayako; Yoshida, Minoru; Ling Feng


    Din7 is a DNA damage-inducible mitochondrial nuclease that modulates the stability of mitochondrial DNA (mtDNA) in Saccharomyces cerevisiae. How DIN7 gene expression is regulated, however, has remained largely unclear. Using promoter sequence alignment, we found a highly conserved 19-bp sequence in the promoter regions of DIN7 and NTG1, which encodes an oxidative stress-inducible base-excision-repair enzyme. Deletion of the 19-bp sequence markedly reduced the hydroxyurea (HU)-enhanced DIN7 promoter activity. In addition, nuclear fractions prepared from HU-treated cells were used in in vitro band shift assays to reveal the presence of currently unidentified trans-acting factor(s) that preferentially bound to the 19-bp region. These results suggest that the 19-bp sequence is a novel cis-acting element that is required for the regulation of DIN7 expression in response to HU-induced DNA damage.

  18. Development of two highly sensitive forensic sex determination assays based on human DYZ1 and Alu repetitive DNA elements.


    Fazi, Amanda; Gobeski, Brianne; Foran, David


    Sex determination is a critical component of forensic identification, the standard genetic method for which is detection of the single copy amelogenin gene that has differing homologues on the X and Y chromosomes. However, this assay may not be sensitive enough when DNA samples are minute or highly compromised, thus other strategies for sex determination are needed. In the current research, two ultrasensitive sexing assays, based on real-time PCR and pyrosequencing, were developed targeting the highly repetitive elements DYZ1 on the Y chromosome and Alu on the autosomes. The DYZ1/Alu strategy was compared to amelogenin for overall sensitivity based on high molecular weight and degraded DNA, followed by assaying the sex of 34 touch DNA samples and DNA from 30 hair shafts. The real-time DYZ1/Alu assay proved to be approximately 1500 times more sensitive than its amelogenin counterpart based on high molecular weight DNA, and even more sensitive when sexing degraded DNA. The pyrosequencing DYZ1/Alu assay correctly sexed 26 of the touch DNAs, compared to six using amelogenin. Hair shaft DNAs showed equally improved sexing results using the DYZ1/Alu assays. Overall, both DYZ1/Alu assays were far more sensitive and accurate than was the amelogenin assay, and thus show great utility for sexing poor quality and low quantity DNA evidence.

  19. Rapid proliferation of repetitive palindromic elements in mtDNA of the endemic Baikalian sponge Lubomirskia baicalensis.


    Lavrov, Dennis V


    Animal mitochondrial DNA (mtDNA) is a remarkably compact molecule largely because of the scarcity of noncoding "selfish" DNA. Recently, however, we found that mitochondrial genomes of several phylogenetically diverse species of demosponges contain small repetitive palindromic sequences, interspersed within intergenic regions and fused in protein and ribosomal RNA genes. Here, I report and analyze the proliferation of such elements in the mitochondrial genome of the endemic sponge of Lake Baikal Lubomirskia baicalensis. Because Baikal sponges are closely related to the circumglobally distributed freshwater sponge Ephydatia muelleri with which they shared a common ancestor approximately 3-10 Ma, both the rate of single nucleotide substitutions and the rate of palindromic repeat insertions can be calculated in this system. I found the rate of nucleotide substitutions in mtDNA of freshwater sponges to be extremely low (0.5-1.6 x 10(-9) per site per year), more similar to that in plants than bilaterian animals. By contrast, the per/nucleotide rate of insertions of repetitive elements is at least four times higher. This rapid rate of proliferation combined with the broad phylogenetic distribution of hairpin elements can make them a defining force in the evolution of mitochondrial genomes of demosponges.

  20. MAP kinases Erk1/2 phosphorylate sterol regulatory element-binding protein (SREBP)-1a at serine 117 in vitro.


    Roth, G; Kotzka, J; Kremer, L; Lehr, S; Lohaus, C; Meyer, H E; Krone, W; Müller-Wieland, D


    Sterol regulatory element-binding protein (SREBP)-1a is a transcription factor sensing cellular cholesterol levels and integrating gene regulatory signals mediated by MAP kinase cascades. Here we report the identification of serine 117 in SREBP-1a as the major phosphorylation site of the MAP kinases Erk1/2. This site was identified by nanoelectrospray mass spectrometry and peptide sequencing of recombinant fusion proteins phosphorylated by Erk1/2 in vitro. Serine 117 was verified as the major phosphorylation site by in vitro mutagenesis. Mutation of serine 117 to alanine abolished Erk2-mediated phosphorylation in vitro and the MAP kinase-related transcriptional activation of SREBP-1a by insulin and platelet-derived growth factor in vivo. Our data indicate that the MAP kinase-mediated effects on SREBP-1a-regulated target genes are linked to this phosphorylation site.

  1. Massively parallel quantification of the regulatory effects of noncoding genetic variation in a human cohort.


    Vockley, Christopher M; Guo, Cong; Majoros, William H; Nodzenski, Michael; Scholtens, Denise M; Hayes, M Geoffrey; Lowe, William L; Reddy, Timothy E


    We report a novel high-throughput method to empirically quantify individual-specific regulatory element activity at the population scale. The approach combines targeted DNA capture with a high-throughput reporter gene expression assay. As demonstration, we measured the activity of more than 100 putative regulatory elements from 95 individuals in a single experiment. In agreement with previous reports, we found that most genetic variants have weak effects on distal regulatory element activity. Because haplotypes are typically maintained within but not between assayed regulatory elements, the approach can be used to identify causal regulatory haplotypes that likely contribute to human phenotypes. Finally, we demonstrate the utility of the method to functionally fine map causal regulatory variants in regions of high linkage disequilibrium identified by expression quantitative trait loci (eQTL) analyses.

  2. Massively parallel quantification of the regulatory effects of noncoding genetic variation in a human cohort

    PubMed Central

    Vockley, Christopher M.; Guo, Cong; Majoros, William H.; Nodzenski, Michael; Scholtens, Denise M.; Hayes, M. Geoffrey; Lowe, William L.; Reddy, Timothy E.


    We report a novel high-throughput method to empirically quantify individual-specific regulatory element activity at the population scale. The approach combines targeted DNA capture with a high-throughput reporter gene expression assay. As demonstration, we measured the activity of more than 100 putative regulatory elements from 95 individuals in a single experiment. In agreement with previous reports, we found that most genetic variants have weak effects on distal regulatory element activity. Because haplotypes are typically maintained within but not between assayed regulatory elements, the approach can be used to identify causal regulatory haplotypes that likely contribute to human phenotypes. Finally, we demonstrate the utility of the method to functionally fine map causal regulatory variants in regions of high linkage disequilibrium identified by expression quantitative trait loci (eQTL) analyses. PMID:26084464

  3. A duplication/paracentric inversion associated with familial X-linked deafness (DFN3) suggests the presence of a regulatory element more than 400 kb upstream of the POU3F4 gene.


    de Kok, Y J; Merkx, G F; van der Maarel, S M; Huber, I; Malcolm, S; Ropers, H H; Cremers, F P


    X-linked deafness with stapes fixation (DFN3) is caused by mutations in the POU3F4 gene at Xq21.1. By employing pulsed field gel electrophoresis (PFGE) we identified a chromosomal aberration in the DNA of a DFN3 patient who did not show alterations in the open reading frame (ORF) of POU3F4. Southern blot analysis indicated that a DNA segment of 150 kb, located 170 kb proximal to the POU3F4 gene, was duplicated. Fluorescence in situ hybridization (FISH) analysis, PFGE, and detailed Southern analysis revealed that this duplication is part of a more complex rearrangement including a paracentric inversion involving the Xq21.1 region, and presumably the Xq21.3 region. Since at least two DFN3-associated minideletions are situated proximal to the duplicated segment, the inversion most likely disconnects the POU3F4 gene from a regulatory element which is located at a distance of at least 400 kb upstream of the POU3F4 gene.

  4. Identification of novel regulatory NFAT and TFII-I binding elements in the calbindin-D28k promoter in response to serum deprivation*

    PubMed Central

    Guo, Jianfei; Öz, Orhan K.


    Calbindin-D28k, a key regulator of calcium homeostasis plays a cytoprotective role in various tissues. We used serum free (SFM) and charcoal stripped serum (csFBS) culture media as models of cellular stress to modulate calbindin D28k expression and identify regulatory cis-elements and trans-acting factors in kidney and beta cells. The murine calbindin-D28k promoter activity was significantly upregulated under SFM or csFBS condition. Promoter analysis revealed evolutionary conserved regulatory cis-elements and deletion of 23nt from +117/+139 as critical for basal transcription. Bioinformatics analysis of the promoter revealed conserved NFAT and TFII regulators elements. Forced expression of NFAT stimulated promoter activity. Inhibition of NFAT transcriptional activity by FK506 attenuated calbindin-D28k expression. TFII-I was shown to be necessary for basal promoter activity and to act cooperatively with NFAT. Using chromatin immunoprecipitation (ChIP) assays, NFAT was shown to bind to both proximal and distal promoter regions. ChIP assays also revealed recruitment of TFII to the −36/+139 region. Knockdown of TFII-I decreased promoter activity. In summary, calbindin-D28k expression during serum deprivation is partly regulated by NFAT and TF-II. This regulation may be important in vivo during ischemia and growth factor withdrawal to regulate cellular function and maintenance. PMID:26260319

  5. Identification of novel regulatory NFAT and TFII-I binding elements in the calbindin-D28k promoter in response to serum deprivation.


    Hajibeigi, Asghar; Dioum, Elhadji M; Guo, Jianfei; Öz, Orhan K


    Calbindin-D28k, a key regulator of calcium homeostasis plays a cytoprotective role in various tissues. We used serum free (SFM) and charcoal stripped serum (csFBS) culture media as models of cellular stress to modulate calbindin D28k expression and identify regulatory cis-elements and trans-acting factors in kidney and beta cells. The murine calbindin-D28k promoter activity was significantly upregulated under SFM or csFBS condition. Promoter analysis revealed evolutionary conserved regulatory cis-elements and deletion of 23 nt from +117/+139 as critical for basal transcription. Bioinformatics analysis of the promoter revealed conserved NFAT and TFII regulators elements. Forced expression of NFAT stimulated promoter activity. Inhibition of NFAT transcriptional activity by FK506 attenuated calbindin-D28k expression. TFII-I was shown to be necessary for basal promoter activity and to act cooperatively with NFAT. Using chromatin immunoprecipitation (ChIP) assays, NFAT was shown to bind to both proximal and distal promoter regions. ChIP assays also revealed recruitment of TFII to the -36/+139 region. Knockdown of TFII-I decreased promoter activity. In summary, calbindin-D28k expression during serum deprivation is partly regulated by NFAT and TF-II. This regulation may be important in vivo during ischemia and growth factor withdrawal to regulate cellular function and maintenance.

  6. Integration of distinct intracellular signaling pathways at distal regulatory elements directs T-bet expression in human CD4+ T cells.


    Placek, Katarzyna; Gasparian, Sona; Coffre, Maryaline; Maiella, Sylvie; Sechet, Emmanuel; Bianchi, Elisabetta; Rogge, Lars


    T-bet is a key regulator controlling Th1 cell development. This factor is not expressed in naive CD4(+) T cells, and the mechanisms controlling expression of T-bet are incompletely understood. In this study, we defined regulatory elements at the human T-bet locus and determined how signals originating at the TCR and at cytokine receptors are integrated to induce chromatin modifications and expression of this gene during human Th1 cell differentiation. We found that T cell activation induced two strong DNase I-hypersensitive sites (HS) and rapid histone acetylation at these elements in CD4(+) T cells. Histone acetylation and T-bet expression were strongly inhibited by cyclosporine A, and we detected binding of NF-AT to a HS in vivo. IL-12 and IFN-gamma signaling alone were not sufficient to induce T-bet expression in naive CD4(+) T cells, but enhanced T-bet expression in TCR/CD28-stimulated cells. We detected a third HS 12 kb upstream of the mRNA start site only in developing Th1 cells, which was bound by IL-12-induced STAT4. Our data suggest that T-bet locus remodeling and gene expression are initiated by TCR-induced NF-AT recruitment and amplified by IL-12-mediated STAT4 binding to distinct distal regulatory elements during human Th1 cell differentiation.

  7. Activation of sterol regulatory element-binding protein 1c and fatty acid synthase transcription by hepatitis C virus non-structural protein 2.


    Oem, Jae-Ku; Jackel-Cram, Candice; Li, Yi-Ping; Zhou, Yan; Zhong, Jin; Shimano, Hitoshi; Babiuk, Lorne A; Liu, Qiang


    Transcriptional factor sterol regulatory element-binding protein 1c (SREBP-1c) activates the transcription of lipogenic genes, including fatty acid synthase (FAS). Hepatitis C virus (HCV) infection is often associated with lipid accumulation within the liver, known as steatosis in the clinic. The molecular mechanisms of HCV-associated steatosis are not well characterized. Here, we showed that HCV non-structural protein 2 (NS2) activated SREBP-1c transcription in human hepatic Huh-7 cells as measured by using a human SREBP-1c promoter-luciferase reporter plasmid. We further showed that sterol regulatory element (SRE) and liver X receptor element (LXRE) in the SREBP-1c promoter were involved in SREBP-1c activation by HCV NS2. Furthermore, expression of HCV NS2 resulted in the upregulation of FAS transcription. We also showed that FAS upregulation by HCV NS2 was SREBP-1-dependent since deleting the SRE sequence in a FAS promoter and expressing a dominant-negative SREBP-1 abrogated FAS promoter upregulation by HCV NS2. Taken together, our results suggest that HCV NS2 can upregulate the transcription of SREBP-1c and FAS, and thus is probably a contributing factor for HCV-associated steatosis.

  8. The bcr1 DNA Repeat Element Is Specific to the Bacillus cereus Group and Exhibits Mobile Element Characteristics

    PubMed Central

    Økstad, Ole Andreas; Tourasse, Nicolas J.; Stabell, Fredrik B.; Sundfær, Cathrine K.; Egge-Jacobsen, Wolfgang; Risøen, Per Arne; Read, Timothy D.; Kolstø, Anne-Brit


    Bacillus cereus strains ATCC 10987 and ATCC 14579 harbor a ∼155-bp repeated element, bcr1, which is conserved in B. cereus, B. anthracis, B. thuringiensis, and B. mycoides but not in B. subtilis and B. licheniformis. In this study, we show by Southern blot hybridizations that bcr1 is present in all 54 B. cereus group strains tested but absent in 11 Bacillus strains outside the group, suggesting that bcr1 may be specific and ubiquitous to the B. cereus group. By comparative analysis of the complete genome sequences of B. cereus ATCC 10987, B. cereus ATCC 14579, and B. anthracis Ames, we show that bcr1 is exclusively present in the chromosome but absent from large plasmids carried by these strains and that the numbers of full-length bcr1 repeats for these strains are 79, 54, and 12, respectively. Numerous copies of partial bcr1 elements are also present in the three genomes (91, 128, and 53, respectively). Furthermore, the genomic localization of bcr1 is not conserved between strains with respect to chromosomal position or organization of gene neighbors, as only six full-length bcr1 loci are common to at least two of the three strains. However, the intergenic sequence surrounding a specific bcr1 repeat in one of the three strains is generally strongly conserved in the other two, even in loci where bcr1 is found exclusively in one strain. This finding indicates that bcr1 either has evolved by differential deletion from a very high number of repeats in a common ancestor to the B. cereus group or is moving around the chromosome. The identification of bcr1 repeats interrupting genes in B. cereus ATCC 10987 and ATCC 14579 and the presence of a flanking TTTAT motif in each end show that bcr1 exhibits features characteristic of a mobile element. PMID:15516586

  9. A view of an elemental naturalist at the DNA world (base composition, sequences, methylation).


    Vanyushin, B F


    The pioneering data on base composition and pyrimidine sequences in DNA of pro- and eukaryotes are considered, and their significance for the origin of genosystematics is discussed. The modern views on specificity and functional role of enzymatic DNA methylation in eukaryotes are described. DNA methylation controls all genetic functions and is a mechanism of cellular differentiation and gene silencing. A model of regulation of DNA replication by methylation is suggested. Adenine DNA methylation in higher eukaryotes (higher plants) was first observed, and it was established that one and the same gene can be methylated at both cytosine and adenine moieties. Thus, there are at least two different and seemingly interdependent DNA methylation systems present in eukaryotic cells. The first eukaryotic adenine DNA-methyltransferase is isolated from wheat seedlings and described: the enzyme methylates DNA with formation of N6-methyladenine in the sequence TGATCA-->TGm6ATCA. It is found that higher plants have endonucleases that are dependent on S-adenosyl-L-methionine (SAM) and sensitive to DNA methylation status. Therefore, as in bacteria, plants seem to have a restriction-modification (R-M) system. A system of conjugated up- and down-regulation of SAM-dependent endonucleases by SAM modulations is found in plants. Revelation of an essential role of DNA methylation in regulation of genetic processes is a fundament of materialization of epigenetics and epigenomics.

  10. Identification of a regulatory element responsible for salt induction of rice OsRAV2 through ex situ and in situ promoter analysis.


    Duan, Yong-Bo; Li, Juan; Qin, Rui-Ying; Xu, Rong-Fang; Li, Hao; Yang, Ya-Chun; Ma, Hui; Li, Li; Wei, Peng-Cheng; Yang, Jian-Bo


    Salt is a major environmental stress factor that can affect rice growth and yields. Recent studies suggested that members of the AP2/ERF domain-containing RAV (related to ABI3/VP1) TF family are involved in abiotic stress adaptation. However, the transcriptional response of rice RAV genes (OsRAVs) to salt has not yet been fully characterized. In this study, the expression patterns of all five OsRAVs were examined under salt stress. Only one gene, OsRAV2, was stably induced by high-salinity treatment. Further expression profile analyses indicated that OsRAV2 is transcriptionally regulated by salt, but not KCl, osmotic stress, cold or ABA (abscisic acid) treatment. To elucidate the regulatory mechanism of the stress response at the transcriptional level, we isolated and characterized the promoter region of OsRAV2 (P OsRAV2 ). Transgenic analysis indicated that P OsRAV2 is induced by salt stress but not osmotic stress or ABA treatment. Serial 5' deletions and site-specific mutations in P OsRAV2 revealed that a GT-1 element located at position -664 relative to the putative translation start site is essential for the salt induction of P OsRAV2 . The regulatory function of the GT-1 element in the salt induction of OsRAV2 was verified in situ in plants with targeted mutations generated using the CRISPR/Cas9 (clustered regularly interspaced short palindromic repeats/CRISPR-associated protein 9) system. Taken together, our results indicate that the GT-1 element directly controls the salt response of OsRAV2. This study provides a better understanding of the putative functions of OsRAVs and the molecular regulatory mechanisms of plant genes under salt stress.

  11. ABO alleles are linked with haplotypes of an erythroid cell-specific regulatory element in intron 1 with a few exceptions attributable to genetic recombination.


    Nakajima, T; Sano, R; Takahashi, Y; Watanabe, K; Kubo, R; Kobayashi, M; Takahashi, K; Takeshita, H; Kominato, Y


    Recent investigation of transcriptional regulation of the ABO genes has identified a candidate erythroid cell-specific regulatory element, named the +5·8-kb site, in the first intron of ABO. Six haplotypes of the site have been reported previously. The present genetic population study demonstrated that each haplotype was mostly linked with specific ABO alleles with a few exceptions, possibly as a result of hybrid formation between common ABO alleles. Thus, investigation of these haplotypes could provide a clue to further elucidation of ABO alleles.

  12. Common and distinct DNA-binding and regulatory activities of the BEN-solo transcription factor family

    PubMed Central

    Dai, Qi; Ren, Aiming; Westholm, Jakub O.; Duan, Hong; Patel, Dinshaw J.


    Recently, the BEN (BANP, E5R, and NAC1) domain was recognized as a new class of conserved DNA-binding domain. The fly genome encodes three proteins that bear only a single BEN domain (“BEN-solo” factors); namely, Insensitive (Insv), Bsg25A (Elba1), and CG9883 (Elba2). Insv homodimers preferentially bind CCAATTGG palindromes throughout the genome to mediate transcriptional repression, whereas Bsg25A and Elba2 heterotrimerize with their obligate adaptor, Elba3 (i.e., the ELBA complex), to recognize a CCAATAAG motif in the Fab-7 insulator. While these data suggest distinct DNA-binding properties of BEN-solo proteins, we performed reporter assays that indicate that both Bsg25A and Elba2 can individually recognize Insv consensus sites efficiently. We confirmed this by solving the structure of Bsg25A complexed to the Insv site, which showed that key aspects of the BEN:DNA recognition strategy are similar between these proteins. We next show that both Insv and ELBA proteins are competent to mediate transcriptional repression via Insv consensus sequences but that the ELBA complex appears to be selective for the ELBA site. Reciprocally, genome-wide analysis reveals that Insv exhibits significant cobinding to class I insulator elements, indicating that it may also contribute to insulator function. Indeed, we observed abundant Insv binding within the Hox complexes with substantial overlaps with class I insulators, many of which bear Insv consensus sites. Moreover, Insv coimmunoprecipitates with the class I insulator factor CP190. Finally, we observed that Insv harbors exclusive activity among fly BEN-solo factors with respect to regulation of Notch-mediated cell fate choices in the peripheral nervous system. This in vivo activity is recapitulated by BEND6, a mammalian BEN-solo factor that conserves the Notch corepressor function of Insv but not its capacity to bind Insv consensus sites. Altogether, our data define an array of common and distinct biochemical and functional

  13. Genome wide analysis reveals Zic3 interaction with distal regulatory elements of stage specific developmental genes in zebrafish.


    Winata, Cecilia L; Kondrychyn, Igor; Kumar, Vibhor; Srinivasan, Kandhadayar G; Orlov, Yuriy; Ravishankar, Ashwini; Prabhakar, Shyam; Stanton, Lawrence W; Korzh, Vladimir; Mathavan, Sinnakaruppan


    Zic3 regulates early embryonic patterning in vertebrates. Loss of Zic3 function is known to disrupt gastrulation, left-right patterning, and neurogenesis. However, molecular events downstream of this transcription factor are poorly characterized. Here we use the zebrafish as a model to study the developmental role of Zic3 in vivo, by applying a combination of two powerful genomics approaches--ChIP-seq and microarray. Besides confirming direct regulation of previously implicated Zic3 targets of the Nodal and canonical Wnt pathways, analysis of gastrula stage embryos uncovered a number of novel candidate target genes, among which were members of the non-canonical Wnt pathway and the neural pre-pattern genes. A similar analysis in zic3-expressing cells obtained by FACS at segmentation stage revealed a dramatic shift in Zic3 binding site locations and identified an entirely distinct set of target genes associated with later developmental functions such as neural development. We demonstrate cis-regulation of several of these target genes by Zic3 using in vivo enhancer assay. Analysis of Zic3 binding sites revealed a distribution biased towards distal intergenic regions, indicative of a long distance regulatory mechanism; some of these binding sites are highly conserved during evolution and act as functional enhancers. This demonstrated that Zic3 regulation of developmental genes is achieved predominantly through long distance regulatory mechanism and revealed that developmental transitions could be accompanied by dramatic changes in regulatory landscape.

  14. Genome Wide Analysis Reveals Zic3 Interaction with Distal Regulatory Elements of Stage Specific Developmental Genes in Zebrafish

    PubMed Central

    Kumar, Vibhor; Srinivasan, Kandhadayar G.; Orlov, Yuriy; Ravishankar, Ashwini; Prabhakar, Shyam; Stanton, Lawrence W.; Korzh, Vladimir; Mathavan, Sinnakaruppan


    Zic3 regulates early embryonic patterning in vertebrates. Loss of Zic3 function is known to disrupt gastrulation, left-right patterning, and neurogenesis. However, molecular events downstream of this transcription factor are poorly characterized. Here we use the zebrafish as a model to study the developmental role of Zic3 in vivo, by applying a combination of two powerful genomics approaches – ChIP-seq and microarray. Besides confirming direct regulation of previously implicated Zic3 targets of the Nodal and canonical Wnt pathways, analysis of gastrula stage embryos uncovered a number of novel candidate target genes, among which were members of the non-canonical Wnt pathway and the neural pre-pattern genes. A similar analysis in zic3-expressing cells obtained by FACS at segmentation stage revealed a dramatic shift in Zic3 binding site locations and identified an entirely distinct set of target genes associated with later developmental functions such as neural development. We demonstrate cis-regulation of several of these target genes by Zic3 using in vivo enhancer assay. Analysis of Zic3 binding sites revealed a distribution biased towards distal intergenic regions, indicative of a long distance regulatory mechanism; some of these binding sites are highly conserved during evolution and act as functional enhancers. This demonstrated that Zic3 regulation of developmental genes is achieved predominantly through long distance regulatory mechanism and revealed that developmental transitions could be accompanied by dramatic changes in regulatory landscape. PMID:24204288

  15. Identification of Cis-regulatory elements in the mouse Pax9/Nkx2-9 genomic region: implication for evolutionary conserved synteny.

    PubMed Central

    Santagati, Fabio; Abe, Kuniya; Schmidt, Volker; Schmitt-John, Thomas; Suzuki, Misao; Yamamura, Ken-Ichi; Imai, Kenji


    We previously reported close physical linkage between Pax9 and Nkx2-9 in the human, mouse, and pufferfish (Fugu rubripes) genomes. In this study, we analyzed cis-regulatory elements of the two genes by comparative sequencing in the three species and by transgenesis in the mouse. We identified two regions including conserved noncoding sequences that possessed specific enhancer activities for expression of Pax9 in the medial nasal process and of Nkx2-9 in the ventral neural tube. Remarkably, the latter contained the consensus Gli-binding motif. Interestingly, the identified Pax9 cis-regulatory sequences were located in an intron of the neighboring gene Slc25a21. Close examination of an extended genomic interval around Pax9 revealed the presence of strong synteny conservation in the human, mouse, and Fugu genomes. We propose such an intersecting organization of cis-regulatory sequences in multigenic regions as a possible mechanism that maintains evolutionary conserved synteny. PMID:14504231

  16. Differential distribution and association of repeat DNA sequences in the lateral element of the synaptonemal complex in rat spermatocytes.


    Hernández-Hernández, Abrahan; Rincón-Arano, Héctor; Recillas-Targa, Félix; Ortiz, Rosario; Valdes-Quezada, Christian; Echeverría, Olga M; Benavente, Ricardo; Vázquez-Nin, Gerardo H


    The synaptonemal complex (SC) is an evolutionarily conserved structure that mediates synapsis of homologous chromosomes during meiotic prophase I. Previous studies have established that the chromatin of homologous chromosomes is organized in loops that are attached to the lateral elements (LEs) of the SC. The characterization of the genomic sequences associated with LEs of the SC represents an important step toward understanding meiotic chromosome organization and function. To isolate these genomic sequences, we performed chromatin immunoprecipitation assays in rat spermatocytes using an antibody against SYCP3, a major structural component of the LEs of the SC. Our results demonstrated the reproducible and exclusive isolation of repeat deoxyribonucleic acid (DNA) sequences, in particular long interspersed elements, short interspersed elements, long terminal direct repeats, satellite, and simple repeats. The association of these repeat sequences to the LEs of the SC was confirmed by in situ hybridization of meiotic nuclei shown by both light and electron microscopy. Signals were also detected over the chromatin surrounding SCs and in small loops protruding from the lateral elements into the SC central region. We propose that genomic repeat DNA sequences play a key role in anchoring the chromosome to the protein scaffold of the SC.

  17. US regulatory system for genetically modified [genetically modified organism (GMO), rDNA or transgenic] crop cultivars.


    McHughen, Alan; Smyth, Stuart


    This paper reviews the history of the federal regulatory oversight of plant agricultural biotechnology in the USA, focusing on the scientific and political forces moulding the continually evolving regulatory structure in place today. Unlike most other jurisdictions, the USA decided to adapt pre-existing legislation to encompass products of biotechnology. In so doing, it established an overarching committee (Office of Science and Technology Policy) to study and distribute various regulatory responsibilities amongst relevant agencies: the Food and Drug Administration, Environmental Protection Agency and US Department of Agriculture. This paper reviews the history and procedures of each agency in the execution of its regulatory duties and investigates the advantages and disadvantages of the US regulatory strategy.

  18. Surface Plasmon Resonance Study of Cooperative Interactions of Estrogen Receptor α and Specificity Protein 1 with Composite DNA Elements.


    Su, Xiaodi; Song, Hong Yan


    Estrogen receptor α (ERα) and Specificity protein 1 (Sp1) are transcription factors (TF) that are involved in regulating progesterone receptor (PR) gene expression through cooperative interactions with DNA. The natural composite DNA +571 ERE/Sp1 site in promoter A of the progesterone receptor contains a half-site of estrogen response elements (½ERE) upstream of two Sp1 binding sites (the proximal Sp1 (Sp1/P) and distal Sp1 (Sp1/D)) with a 4 bp spacer. Here, we have developed a protocol for studying the cooperative interaction of Sp1 and ERα with the composite DNA of +571 ERE/Sp1 site using Biacore T200, a high sensitivity surface plasmon resonance spectroscopy. With this protocol, we have concluded that Sp1 binding enhances the overall ERα binding to the composite DNA. We have also determined the optimal spacer distance between the ½ERE and Sp1/D for the best cooperative protein binding. This study is pivotal in guiding the bioinformatics simulation to yield an exact model of the spacer dependency of the transcription factor/cofactor-DNA interactions, which is important for understanding the nuclear receptor regulating activity through other coactivators.

  19. Differential nuclease sensitivity profiling of chromatin reveals biochemical footprints coupled to gene expression and functional DNA elements in maize.


    Vera, Daniel L; Madzima, Thelma F; Labonne, Jonathan D; Alam, Mohammad P; Hoffman, Gregg G; Girimurugan, S B; Zhang, Jinfeng; McGinnis, Karen M; Dennis, Jonathan H; Bass, Hank W


    The eukaryotic genome is organized into nucleosomes, the fundamental units of chromatin. The positions of nucleosomes on DNA regulate protein-DNA interactions and in turn influence DNA-templated events. Despite the increasing number of genome-wide maps of nucleosome position, how global changes in gene expression relate to changes in nucleosome position is poorly understood. We show that in nucleosome occupancy mapping experiments in maize (Zea mays), particular genomic regions are highly susceptible to variation introduced by differences in the extent to which chromatin is digested with micrococcal nuclease (MNase). We exploited this digestion-linked variation to identify protein footprints that are hypersensitive to MNase digestion, an approach we term differential nuclease sensitivity profiling (DNS-chip). Hypersensitive footprints were enriched at the 5' and 3' ends of genes, associated with gene expression levels, and significantly overlapped with conserved noncoding sequences and the binding sites of the transcription factor KNOTTED1. We also found that the tissue-specific regulation of gene expression was linked to tissue-specific hypersensitive footprints. These results reveal biochemical features of nucleosome organization that correlate with gene expression levels and colocalize with functional DNA elements. This approach to chromatin profiling should be broadly applicable to other species and should shed light on the relationships among chromatin organization, protein-DNA interactions, and genome regulation.

  20. Long-range DNase I hypersensitivity mapping reveals the imprinted Igf2r and Air promoters share cis-regulatory elements

    PubMed Central

    Pauler, Florian M.; Stricker, Stefan H.; Warczok, Katarzyna E.; Barlow, Denise P.


    Epigenetic mechanisms restrict the expression of imprinted genes to one parental allele in diploid cells. At the Igf2r/Air imprinted cluster on mouse chromosome 17, paternal-specific expression of the Air noncoding RNA has been shown to silence three genes in cis: Igf2r, Slc22a2, and Slc22a3. By an unbiased mapping of DNase I hypersensitive sites (DHS) in a 192-kb region flanking Igf2r and Air, we identified 21 DHS, of which nine mapped to evolutionarily conserved sequences. Based on the hypothesis that silencing effects of Air would be directed towards cis regulatory elements used to activate genes, DHS are potential key players in the control of imprinted expression. However, in this 192-kb region only the two DHS mapping to the Igf2r and Air promoters show parental specificity. The remaining 19 DHS were present on both parental alleles and, thus, have the potential to activate Igf2r on the maternal allele and Air on the paternal allele. The possibility that the Igf2r and Air promoters share the same cis-acting regulatory elements, albeit on opposite parental chromosomes, was supported by the similar expression profiles of Igf2r and Air in vivo. These results refine our understanding of the onset of imprinted silencing at this cluster and indicate the Air noncoding RNA may specifically target silencing to the Igf2r promoter. PMID:16204191

  1. Germline deletion of Igh 3′ regulatory region elements hs5-7 affects B cell specific regulation, rearrangement and insulation of the Igh locus1

    PubMed Central

    Volpi, Sabrina A.; Verma-Gaur, Jiyoti; Hassan, Rabih; Ju, Zhongliang; Roa, Sergio; Chatterjee, Sanjukta; Werling, Uwe; Hou, Harry; Will, Britta; Steidl, Ulrich; Scharff, Matthew; Edelman, Winfried; Feeney, Ann J.; Birshtein, Barbara K.


    Regulatory elements located within a ~28 kb region 3′ of the Igh gene cluster (3′ regulatory region, 3′ RR) are required for class switch recombination and for high levels of IgH expression in plasma cells. We previously defined novel DNase I hypersensitive (hs) sites, i.e. hs5-7, immediately downstream of this region. Hs5-7 contains a high density of binding sites for CTCF, a zinc finger protein associated with mammalian insulator activity and is an anchor for interactions with CTCF sites flanking the DH region. To test the function of hs5-7, we have generated mice with an 8 kb deletion encompassing all three hs elements. B cells from hs5-7 KO mice showed a modest increase in expression of the nearest downstream gene. In addition, Igh alleles in hs5-7 KO mice were in a less contracted configuration compared to WT Igh alleles and showed a two-fold increase in the usage of proximal VH7183 gene families. Hs5-7 KO mice were essentially indistinguishable from wild type mice in B cell development, allelic regulation, class switch recombination, and chromosomal looping. We conclude that hs5-7--a high-density CTCF binding region at the 3′ end of the Igh locus--impacts usage of VH regions as far as 500 kb away. PMID:22345664

  2. Identification of cis-acting regulatory elements in the promoter region of the rat brain creatine kinase gene.

    PubMed Central

    Hobson, G M; Molloy, G R; Benfield, P A


    The functional organization of the rat brain creatine kinase (ckb) promoter was analyzed by deletion, linker scanning, and substitution mutagenesis. Mutations were introduced into the ckb promoter of hybrid ckb/neo (neomycin resistance gene) genes, and the mutant genes were expressed transiently in HeLa cells. Expression was assayed by primer extension analysis of neo RNA, which allowed the transcription start sites and the amount of transcription to be determined. Transfections and primer extension reactions were internally controlled by simultaneous analysis of transcription from the adenovirus VA gene located on the same plasmid as the hybrid ckb/neo gene. We demonstrate that 195 bp of the ckb promoter is sufficient for efficient in vivo expression in HeLa cells. A nonconsensus TTAA element at -28 bp ap