Science.gov

Sample records for regulatory protein-dependent mechanism

  1. Identification of a regulatory loop for the synthesis of neurosteroids: a steroidogenic acute regulatory protein-dependent mechanism involving hypothalamic-pituitary-gonadal axis receptors.

    PubMed

    Meethal, Sivan Vadakkadath; Liu, Tianbing; Chan, Hsien W; Ginsburg, Erika; Wilson, Andrea C; Gray, Danielle N; Bowen, Richard L; Vonderhaar, Barbara K; Atwood, Craig S

    2009-08-01

    Brain sex steroids are derived from both peripheral (primarily gonadal) and local (neurosteroids) sources and are crucial for neurogenesis, neural differentiation and neural function. The mechanism(s) regulating the production of neurosteroids is not understood. To determine whether hypothalamic-pituitary-gonadal axis components previously detected in the extra-hypothalamic brain comprise a feedback loop to regulate neuro-sex steroid (NSS) production, we assessed dynamic changes in expression patterns of steroidogenic acute regulatory (StAR) protein, a key regulator of steroidogenesis, and key hypothalamic-pituitary-gonadal endocrine receptors, by modulating peripheral sex hormone levels in female mice. Ovariectomy (OVX; high serum gonadotropins, low serum sex steroids) had a differential effect on StAR protein levels in the extrahypothalamic brain; increasing the 30- and 32-kDa variants but decreasing the 37-kDa variant and is indicative of cholesterol transport into mitochondria for steroidogenesis. Treatment of OVX animals with E(2), P(4), or E(2) + P(4) for 3 days, which decreases OVX-induced increases in GnRH/gonadotropin production, reversed this pattern. Suppression of gonadotropin levels in OVX mice using the GnRH agonist leuprolide acetate inhibited the processing of the 37-kDa StAR protein into the 30-kDa StAR protein, confirming that the differential processing of brain StAR protein is regulated by gonadotropins. OVX dramatically suppressed extra-hypothalamic brain gonadotropin-releasing hormone 1 receptor expression, and was further suppressed in E(2)- or P(4)-treated OVX mice. Together, these data indicate the existence of endocrine and autocrine/paracrine feedback loops that regulate NSS synthesis. Further delineation of these feedback loops that regulate NSS production will aid in developing therapies to maintain brain sex steroid levels and cognition.

  2. Sterol regulatory element binding protein-dependent regulation of lipid synthesis supports cell survival and tumor growth

    PubMed Central

    2013-01-01

    Background Regulation of lipid metabolism via activation of sterol regulatory element binding proteins (SREBPs) has emerged as an important function of the Akt/mTORC1 signaling axis. Although the contribution of dysregulated Akt/mTORC1 signaling to cancer has been investigated extensively and altered lipid metabolism is observed in many tumors, the exact role of SREBPs in the control of biosynthetic processes required for Akt-dependent cell growth and their contribution to tumorigenesis remains unclear. Results We first investigated the effects of loss of SREBP function in non-transformed cells. Combined ablation of SREBP1 and SREBP2 by siRNA-mediated gene silencing or chemical inhibition of SREBP activation induced endoplasmic reticulum (ER)-stress and engaged the unfolded protein response (UPR) pathway, specifically under lipoprotein-deplete conditions in human retinal pigment epithelial cells. Induction of ER-stress led to inhibition of protein synthesis through increased phosphorylation of eIF2α. This demonstrates for the first time the importance of SREBP in the coordination of lipid and protein biosynthesis, two processes that are essential for cell growth and proliferation. SREBP ablation caused major changes in lipid composition characterized by a loss of mono- and poly-unsaturated lipids and induced accumulation of reactive oxygen species (ROS) and apoptosis. Alterations in lipid composition and increased ROS levels, rather than overall changes to lipid synthesis rate, were required for ER-stress induction. Next, we analyzed the effect of SREBP ablation in a panel of cancer cell lines. Importantly, induction of apoptosis following SREBP depletion was restricted to lipoprotein-deplete conditions. U87 glioblastoma cells were highly susceptible to silencing of either SREBP isoform, and apoptosis induced by SREBP1 depletion in these cells was rescued by antioxidants or by restoring the levels of mono-unsaturated fatty acids. Moreover, silencing of SREBP1

  3. Advances in Autophagy Regulatory Mechanisms

    PubMed Central

    Gallagher, Laura E.; Williamson, Leon E.; Chan, Edmond Y. W.

    2016-01-01

    Autophagy plays a critical role in cell metabolism by degrading and recycling internal components when challenged with limited nutrients. This fundamental and conserved mechanism is based on a membrane trafficking pathway in which nascent autophagosomes engulf cytoplasmic cargo to form vesicles that transport their content to the lysosome for degradation. Based on this simple scheme, autophagy modulates cellular metabolism and cytoplasmic quality control to influence an unexpectedly wide range of normal mammalian physiology and pathophysiology. In this review, we summarise recent advancements in three broad areas of autophagy regulation. We discuss current models on how autophagosomes are initiated from endogenous membranes. We detail how the uncoordinated 51-like kinase (ULK) complex becomes activated downstream of mechanistic target of rapamycin complex 1 (MTORC1). Finally, we summarise the upstream signalling mechanisms that can sense amino acid availability leading to activation of MTORC1. PMID:27187479

  4. [Proposals for economic regulatory mechanisms].

    PubMed

    Bruppacher, R

    1978-12-01

    Economic mechanisms are needed to guarantee that longterm needs are not forgotten over short term benefits and desires. In traffic, variable costs (cost per mile) should be increased relative to fixed costs, traffic education should be supported and--where needed--fines for undesirable behavior should be introduced. Toxic substances should be taxed. As far as tobacco and alcohol consumption is concerned, abstinence or temperance should be rewarded. In medical care and medical education, prevention should be promoted by increased financial support.

  5. Regulatory mechanisms link phenotypic plasticity to evolvability

    PubMed Central

    van Gestel, Jordi; Weissing, Franz J.

    2016-01-01

    Organisms have a remarkable capacity to respond to environmental change. They can either respond directly, by means of phenotypic plasticity, or they can slowly adapt through evolution. Yet, how phenotypic plasticity links to evolutionary adaptability is largely unknown. Current studies of plasticity tend to adopt a phenomenological reaction norm (RN) approach, which neglects the mechanisms underlying plasticity. Focusing on a concrete question – the optimal timing of bacterial sporulation – we here also consider a mechanistic approach, the evolution of a gene regulatory network (GRN) underlying plasticity. Using individual-based simulations, we compare the RN and GRN approach and find a number of striking differences. Most importantly, the GRN model results in a much higher diversity of responsive strategies than the RN model. We show that each of the evolved strategies is pre-adapted to a unique set of unseen environmental conditions. The regulatory mechanisms that control plasticity therefore critically link phenotypic plasticity to the adaptive potential of biological populations. PMID:27087393

  6. Regulatory mechanisms of cardiac development and repair.

    PubMed

    Chinchilla, Ana; Franco, Diego

    2006-06-01

    The heart originates from bilateral primordia that eventually fuse in the embryonic midline leading to a linear tube. Soon after, the heart bends to the right and atrial and ventricular chambers are formed. Progressively each embryonic compartment initiates a process of septation that eventually leads to a four chambered heart with a double circuitry and synchronous contraction. During these developmental events, the growth of the heart and in particular of its myocardial component gradually increases. However, as the heart gets into its mature stage, myocardial growth ceases and concomitantly the myocardium looses its proliferative capacity. In the adult human population, the most frequent cardiac pathologies emanate from a decompensated lost of myocardial function. Therapeutical approaches aiming to add or replace new myocytes to the failing heart are thus highly desired. Embryonic stem cells have a high capacity to give rise to multiple cell types, including myocardial cells, opening new therapeutical possibilities. Unexpectedly discrete adult cell populations have also shown a greater cell plasticity than previously thought, earning therefore much attention as therapeutic targets. These observations have launched initial clinical trials with great hope of clinical benefit. However, it is essential in this respect to initially understand, and eventually control myogenic cell fate determination. Developmental biology of the heart provides a very suitable model for this end. Over the last decade there has been a considerable advance in the understanding of the molecular mechanisms that lead to the determination of the cardiomyocyte lineage and the regulatory mechanisms by which morphogenesis of the heart takes place. Growth factor signalling and transcriptional events controlling cardiac myogenesis have been progressively unravelled. In this review we aim to summarise current data concerning the cardiomyogenic cell fate determination pathways occurring during the

  7. A systematic evaluation of mechanisms, material effects, and protein-dependent differences on friction-related protein particle formation in formulation and filling steps.

    PubMed

    Brückl, Lukas; Hahn, Rainer; Sergi, Mauro; Scheler, Stefan

    2016-09-25

    Particle formation by physical degradation during the compounding step of biopharmaceuticals is a common concern and found in vessels with bottom mounted stirrers. It was potentially linked to sliding bearings, however, the exact mechanism was still unclear. In this study, custom designed small scale bearings in combination with an IgG1 antibody as model protein were used for investigations of the degradation mechanism inside a bearing. Thereby, abrasion of adsorbed proteins by contact sliding was identified as prevailing protein degradation mechanism and was quantified by an increase in turbidity and by monomer loss. As the protein degradation was highly dependent on combinations of the material of the bearing and the buffer solution, a test system was introduced which allowed to study these effects. Results from the test system using IgG1 and recombinant human growth hormone confirmed a protective effect of Polysorbate 80 by a reduction of protein adsorption, which was strongest in combination with a highly hydrophobic sliding material (PTFE). Finally, a comparison of degradation products from various stresses by ATR-FTIR revealed a high similarity between friction-related degradation products. Therefore, abrasion of adsorbed proteins is very likely the prevailing physical degradation mechanism in processing steps where contact sliding occurs. PMID:27497997

  8. Effects of Four Different Regulatory Mechanisms on the Dynamics of Gene Regulatory Cascades

    NASA Astrophysics Data System (ADS)

    Hansen, Sabine; Krishna, Sandeep; Semsey, Szabolcs; Lo Svenningsen, Sine

    2015-07-01

    Gene regulatory cascades (GRCs) are common motifs in cellular molecular networks. A given logical function in these cascades, such as the repression of the activity of a transcription factor, can be implemented by a number of different regulatory mechanisms. The potential consequences for the dynamic performance of the GRC of choosing one mechanism over another have not been analysed systematically. Here, we report the construction of a synthetic GRC in Escherichia coli, which allows us for the first time to directly compare and contrast the dynamics of four different regulatory mechanisms, affecting the transcription, translation, stability, or activity of a transcriptional repressor. We developed a biologically motivated mathematical model which is sufficient to reproduce the response dynamics determined by experimental measurements. Using the model, we explored the potential response dynamics that the constructed GRC can perform. We conclude that dynamic differences between regulatory mechanisms at an individual step in a GRC are often concealed in the overall performance of the GRC, and suggest that the presence of a given regulatory mechanism in a certain network environment does not necessarily mean that it represents a single optimal evolutionary solution.

  9. Nucleotide sequences of the fecBCDE genes and locations of the proteins suggest a periplasmic-binding-protein-dependent transport mechanism for iron(III) dicitrate in Escherichia coli.

    PubMed Central

    Staudenmaier, H; Van Hove, B; Yaraghi, Z; Braun, V

    1989-01-01

    The fec region of the Escherichia coli chromosome determines a citrate-dependent iron(III) transport system. The nucleotide sequence of fec revealed five genes, fecABCDE, which are transcribed from fecA to fecE. The fecA gene encodes a previously described outer membrane receptor protein. The fecB gene product is formed as a precursor protein with a signal peptide of 21 amino acids; the mature form, with a molecular weight of 30,815, was previously found in the periplasm. The fecB genes of E. coli B and E. coli K-12 differed in 3 nucleotides, of which 2 gave rise to conservative amino acid exchanges. The fecC and fecD genes were found to encode very hydrophobic polypeptides with molecular weights of 35,367 and 34,148, respectively, both of which are localized in the cytoplasmic membrane. The fecE product was a rather hydrophilic but cytoplasmic membrane-bound protein of Mr 28,189 and contained regions of extensive homology to ATP-binding proteins. The number, structural characteristics, and locations of the FecBCDE proteins were typical for a periplasmic-binding-protein-dependent transport system. It is proposed that after FecA- and TonB-dependent transport of iron(III) dicitrate across the outer membrane, uptake through the cytoplasmic membrane follows the binding-protein-dependent transport mechanism. FecC and FecD exhibited homologies to each other, to the N- and C-terminal halves of FhuB of the iron(III) hydroxamate transport system, and to BtuC of the vitamin B12 transport system. FecB showed some homology to FhuD, suggesting that the latter may function in the same manner as a binding protein in iron(III) hydroxamate transport. The close homology between the proteins of the two iron transport systems and of the vitamin B12 transport system indicates a common evolution for all three systems. Images PMID:2651410

  10. Mathematical models of regulatory mechanisms of sleep-wake rhythms.

    PubMed

    Nakao, M; Karashima, A; Katayama, N

    2007-05-01

    Studies of regulatory mechanisms of sleep-wake rhythms have benefited greatly from mathematical modeling. There are two major frameworks of modeling: one integrates homeostatic and circadian regulations and the other consists of multiple interacting oscillators. In this article, model constructions based on these respective frameworks and their characteristics are reviewed. The two-process model and the multioscillator model are explained in detail. An appropriate mathematical abstraction is also shown to provide a viewpoint unifying the model structures, which might seem to be distinct. Recently acquired knowledge of neural regulatory mechanisms of sleep-wake rhythm has prompted modeling at the neural network level. Such a detailed model is also reviewed, and could be used to explore a possible neural mechanism underlying a pathological state of sleep-wake rhythm. PMID:17364138

  11. Regulatory mechanisms related to biofuel tolerance in producing microbes.

    PubMed

    Fu, Y; Chen, L; Zhang, W

    2016-08-01

    Production of renewable biofuels through either native or engineered microbes has drawn significant attention in recent years, mostly due to the increasing concerns on the energy crisis and the environmental consequences of the overutilization of petroleum-based fuels. Although significant progress has been achieved thus far, further advances are still necessary in order to decrease the manufacturing cost so that the producing processes can be more competitive to petroleum fuels. Among various possible approaches, the increase in biofuel tolerance in microbes has been suggested as one aspect which is important for the success of biofuel production at industry-scale. In this article, we critically summarize recent advances in deciphering regulatory mechanisms for enhancing biofuel tolerance in various micro-organisms, focusing on functions and utilization of several well-studied regulatory mechanisms in microbes, such as two-component signal transduction systems, sigma factors, transcription factors, noncoding RNA and other regulators. PMID:27123568

  12. Secretory pattern and regulatory mechanism of growth hormone in cattle

    PubMed Central

    2016-01-01

    Abstract The ultradian rhythm of growth hormone (GH) secretion has been known in several animal species for years and has recently been observed in cattle. Although the physiological significance of the rhythm is not yet fully understood, it appears essential for normal growth. In this review, previous studies concerning the GH secretory pattern in cattle, including its ultradian rhythm, are introduced and the regulatory mechanism is discussed on the basis of recent findings. PMID:26260675

  13. Mechanism of action of regulatory proteins encoded by complex retroviruses.

    PubMed Central

    Cullen, B R

    1992-01-01

    Complex retroviruses are distinguished by their ability to control the expression of their gene products through the action of virally encoded regulatory proteins. These viral gene products modulate both the quantity and the quality of viral gene expression through regulation at both the transcriptional and posttranscriptional levels. The most intensely studied retroviral regulatory proteins, termed Tat and Rev, are encoded by the prototypic complex retrovirus human immunodeficiency virus type 1. However, considerable information also exists on regulatory proteins encoded by human T-cell leukemia virus type I, as well as several other human and animal complex retroviruses. In general, these data demonstrate that retrovirally encoded transcriptional trans-activators can exert a similar effect by several very different mechanisms. In contrast, posttranscriptional regulation of retroviral gene expression appears to occur via a single pathway that is probably dependent on the recruitment of a highly conserved cellular cofactor. These two shared regulatory pathways are proposed to be critical to the ability of complex retroviruses to establish chronic infections in the face of an ongoing host immune response. Images PMID:1406488

  14. Molecular regulatory mechanisms of osteoclastogenesis through cytoprotective enzymes

    PubMed Central

    Kanzaki, Hiroyuki; Shinohara, Fumiaki; Kanako, Itohiya; Yamaguchi, Yuuki; Fukaya, Sari; Miyamoto, Yutaka; Wada, Satoshi; Nakamura, Yoshiki

    2016-01-01

    It has been reported that reactive oxygen species (ROS), such as hydrogen peroxide and superoxide, take part in osteoclast differentiation as intra-cellular signaling molecules. The current assumed signaling cascade from RANK to ROS production is RANK, TRAF6, Rac1, and then Nox. The target molecules of ROS in RANKL signaling remain unclear; however, several reports support the theory that NF-κB signaling could be the crucial downstream signaling molecule of RANKL-mediated ROS signaling. Furthermore, ROS exert cytotoxic effects such as peroxidation of lipids and phospholipids and oxidative damage to proteins and DNA. Therefore, cells have several protective mechanisms against oxidative stressors that mainly induce cytoprotective enzymes and ROS scavenging. Three well-known mechanisms regulate cytoprotective enzymes including Nrf2-, FOXO-, and sirtuin-dependent mechanisms. Several reports have indicated a crosslink between FOXO- and sirtuin-dependent regulatory mechanisms. The agonists against the regulatory mechanisms are reported to induce these cytoprotective enzymes successfully. Some of them inhibit osteoclast differentiation and bone destruction via attenuation of intracellular ROS signaling. In this review article, we discuss the above topics and summarize the current information available on the relationship between cytoprotective enzymes and osteoclastogenesis. PMID:26795736

  15. Regulatory mechanisms of EGFR signalling during Drosophila eye development.

    PubMed

    Malartre, Marianne

    2016-05-01

    EGFR signalling is a well-conserved signalling pathway playing major roles during development and cancers. This review explores what studying the EGFR pathway during Drosophila eye development has taught us in terms of the diversity of its regulatory mechanisms. This model system has allowed the identification of numerous positive and negative regulators acting at specific time and place, thus participating to the tight control of signalling. EGFR signalling regulation is achieved by a variety of mechanisms, including the control of ligand processing, the availability of the receptor itself and the transduction of the cascade in the cytoplasm. Ultimately, the transcriptional responses contribute to the establishment of positive and negative feedback loops. The combination of these multiple mechanisms employed to regulate the EGFR pathway leads to specific cellular outcomes involved in functions as diverse as the acquisition of cell fate, proliferation, survival, adherens junction remodelling and morphogenesis. PMID:26935860

  16. Regulatory mechanisms of EGFR signalling during Drosophila eye development.

    PubMed

    Malartre, Marianne

    2016-05-01

    EGFR signalling is a well-conserved signalling pathway playing major roles during development and cancers. This review explores what studying the EGFR pathway during Drosophila eye development has taught us in terms of the diversity of its regulatory mechanisms. This model system has allowed the identification of numerous positive and negative regulators acting at specific time and place, thus participating to the tight control of signalling. EGFR signalling regulation is achieved by a variety of mechanisms, including the control of ligand processing, the availability of the receptor itself and the transduction of the cascade in the cytoplasm. Ultimately, the transcriptional responses contribute to the establishment of positive and negative feedback loops. The combination of these multiple mechanisms employed to regulate the EGFR pathway leads to specific cellular outcomes involved in functions as diverse as the acquisition of cell fate, proliferation, survival, adherens junction remodelling and morphogenesis.

  17. Ochratoxin A Producing Fungi, Biosynthetic Pathway and Regulatory Mechanisms.

    PubMed

    Wang, Yan; Wang, Liuqing; Liu, Fei; Wang, Qi; Selvaraj, Jonathan Nimal; Xing, Fuguo; Zhao, Yueju; Liu, Yang

    2016-03-01

    Ochratoxin A (OTA), mainly produced by Aspergillus and Penicillum species, is one of the most important mycotoxin contaminants in agricultural products. It is detrimental to human health because of its nephrotoxicity, hepatotoxicity, carcinogenicity, teratogenicity, and immunosuppression. OTA structurally consists of adihydrocoumarin moiety linked with l-phenylalanine via an amide bond. OTA biosynthesis has been putatively hypothesized, although several contradictions exist on some processes of the biosynthetic pathway. We discuss recent information on molecular studies of OTA biosynthesis despite insufficient genetic background in detail. Accordingly, genetic regulation has also been explored with regard to the interaction between the regulators and the environmental factors. In this review, we focus on three aspects of OTA: OTA-producing strains, OTA biosynthetic pathway and the regulation mechanisms of OTA production. This can pave the way to assist in protecting food and feed from OTA contamination by understanding OTA biosynthetic pathway and regulatory mechanisms. PMID:27007394

  18. Ochratoxin A Producing Fungi, Biosynthetic Pathway and Regulatory Mechanisms

    PubMed Central

    Wang, Yan; Wang, Liuqing; Liu, Fei; Wang, Qi; Selvaraj, Jonathan Nimal; Xing, Fuguo; Zhao, Yueju; Liu, Yang

    2016-01-01

    Ochratoxin A (OTA), mainly produced by Aspergillus and Penicillum species, is one of the most important mycotoxin contaminants in agricultural products. It is detrimental to human health because of its nephrotoxicity, hepatotoxicity, carcinogenicity, teratogenicity, and immunosuppression. OTA structurally consists of adihydrocoumarin moiety linked with l-phenylalanine via an amide bond. OTA biosynthesis has been putatively hypothesized, although several contradictions exist on some processes of the biosynthetic pathway. We discuss recent information on molecular studies of OTA biosynthesis despite insufficient genetic background in detail. Accordingly, genetic regulation has also been explored with regard to the interaction between the regulators and the environmental factors. In this review, we focus on three aspects of OTA: OTA-producing strains, OTA biosynthetic pathway and the regulation mechanisms of OTA production. This can pave the way to assist in protecting food and feed from OTA contamination by understanding OTA biosynthetic pathway and regulatory mechanisms. PMID:27007394

  19. Laminin alters Fyn regulatory mechanisms and promotes oligodendrocyte development

    PubMed Central

    Relucio, Jenne; Tzvetanova, Iva D.; Ao, Wei; Lindquist, Sabine; Colognato, Holly

    2009-01-01

    Mutations in LAMA2, the gene for the extracellular matrix protein laminin-α2, cause a severe muscular dystrophy termed MDC1A. MDC1A patients have accompanying CNS neural dysplasias and white matter abnormalities for which the underlying mechanisms remain unknown. Here we report that in laminin-deficient mice oligodendrocyte development was delayed such that oligodendrocyte progenitors accumulated inappropriately in adult brains. Conversely, laminin substrates were found to promote the transition of oligodendrocyte progenitors to newly-formed oligodendrocytes. Laminin-enhanced differentiation was Src Family Kinase –dependent and resulted in the activation of the Src Family Kinase Fyn. In laminin-deficient brains, however, increased Fyn repression was accompanied by elevated levels of the Src Family Kinase negative regulatory proteins, C-terminal Src kinase (Csk) and its transmembrane adaptor, Csk-binding protein (Cbp). These findings indicate that laminin deficiencies delay oligodendrocyte maturation by causing dysregulation of signaling pathways critical for oligodendrocyte development, and suggest that a normal role for CNS laminin is to promote the development of oligodendrocyte progenitors into myelin-forming oligodendrocytes via modulation of Fyn regulatory molecules. PMID:19776266

  20. Glucose- and nitrogen sensing and regulatory mechanisms in Saccharomyces cerevisiae.

    PubMed

    Rødkaer, Steven V; Faergeman, Nils J

    2014-08-01

    Pro- and eukaryotic cells are constantly challenged by varying concentrations of nutrients in their environment. Perceiving and adapting to such changes are therefore crucial for cellular viability. Thus, numerous specialized cellular receptors continuously sense and react to the availability of nutrients such as glucose and nitrogen. When stimulated, these receptors initiate various cellular signaling pathways, which in concert constitute a complex regulatory network. To ensure a highly specific response, these pathways and networks cross-communicate with each other and are regulated at several steps and by numerous different regulators. As numerous of these regulating proteins, biochemical mechanisms, and cellular pathways are evolutionary conserved, complex biochemical information relevant to humans can be obtained by studying simple organisms. Thus, the yeast Saccharomyces cerevisiae has been recognized as a powerful model system to study fundamental biochemical processes. In the present review, we highlight central signaling pathways and molecular circuits conferring nitrogen- and glucose sensing in S. cerevisiae.

  1. Regulatory mechanisms of microRNAs involvement in cancer.

    PubMed

    Fabbri, Muller; Ivan, Mircea; Cimmino, Amelia; Negrini, Massimo; Calin, George A

    2007-07-01

    MicroRNAs (miRNAs) are 19-24 nucleotide noncoding RNAs that regulate the translation and degradation of target mRNAs and are extensively involved in human cancers. One unexpected conclusion of the profiling and functional studies in tumourigenesis is that some miRNAs behave in cancer cells in a dual mode, resembling the 'Dr Jekyll and Mr Hyde' story, which centers on a conception of humanity as dual in nature. The authors and others have found that onco-miRNAs and suppressor-miRNAs can represent two different looks of the same gene, behaving as oncogenes or tumour suppressors depending on tissue type and specific targets. In this review, the authors analyse the regulatory mechanisms of the main miRNA genes involved in human tumourigenesis. PMID:17665990

  2. Homopolymeric tracts represent a general regulatory mechanism in prokaryotes

    PubMed Central

    2010-01-01

    Background While, traditionally, regulation of gene expression can be grouped into transcriptional, translational, and post-translational mechanisms, some mechanisms of rapid genetic variation can also contribute to regulation of gene expression, e.g., phase variation. Results We show here that prokaryotes evolved to include homopolymeric tracts (HTs) within coding genes as a system that allows for efficient gene inactivation. Analyses of 81 bacterial and 18 archaeal genomes showed that poly(A) and poly(T) HTs are overrepresented in these genomes and preferentially located at the 5' end of coding genes. Location of HTs at the 5' end is not driven by a preferential placement of aminoacids encoded by the AAA and TTT codons at the N-terminal of proteins. The inlA gene of the pathogen L. monocytogenes was used as a model to further study the role of HTs in reversible gene inactivation. In a number of L. monocytogenes strains, inlA harbors a 5' poly(A) HT, which regularly shows frameshift mutation leading to expression of a truncated 8 aa InlA protein. Translational fusions of the inlA 5' end allowed us to estimate that the frequency of variation in this HT is about 1,000 fold higher than the estimated average point mutation frequency. Conclusions As frameshift mutations in HTs can occur at high frequencies and enable efficient gene inactivation, hypermutable HTs appear to represent a universal system for regulation of gene expression in prokaryotes. Combined with other studies indicating that HTs also enable rapid diversification of both coding and regulatory genetic sequences in eukaryotes, our data suggest that hypermutable HTs represent a general and rapid evolutionary mechanism facilitating adaptation and gene regulation across diverse organisms. PMID:20144225

  3. Redox-switch regulatory mechanism of thiolase from Clostridium acetobutylicum

    PubMed Central

    Kim, Sangwoo; Jang, Yu-Sin; Ha, Sung-Chul; Ahn, Jae-Woo; Kim, Eun-Jung; Hong Lim, Jae; Cho, Changhee; Shin Ryu, Yong; Kuk Lee, Sung; Lee, Sang Yup; Kim, Kyung-Jin

    2015-01-01

    Thiolase is the first enzyme catalysing the condensation of two acetyl-coenzyme A (CoA) molecules to form acetoacetyl-CoA in a dedicated pathway towards the biosynthesis of n-butanol, an important solvent and biofuel. Here we elucidate the crystal structure of Clostridium acetobutylicum thiolase (CaTHL) in its reduced/oxidized states. CaTHL, unlike those from other aerobic bacteria such as Escherichia coli and Zoogloea ramegera, is regulated by the redox-switch modulation through reversible disulfide bond formation between two catalytic cysteine residues, Cys88 and Cys378. When CaTHL is overexpressed in wild-type C. acetobutylicum, butanol production is reduced due to the disturbance of acidogenic to solventogenic shift. The CaTHLV77Q/N153Y/A286K mutant, which is not able to form disulfide bonds, exhibits higher activity than wild-type CaTHL, and enhances butanol production upon overexpression. On the basis of these results, we suggest that CaTHL functions as a key enzyme in the regulation of the main metabolism of C. acetobutylicum through a redox-switch regulatory mechanism. PMID:26391388

  4. The Cellular and Molecular Mechanisms of Immuno-Suppression by Human Type 1 Regulatory T Cells

    PubMed Central

    Gregori, Silvia; Goudy, Kevin S.; Roncarolo, Maria Grazia

    2011-01-01

    The immuno-regulatory mechanisms of IL-10-producing type 1 regulatory T (Tr1) cells have been widely studied over the years. However, several recent discoveries have shed new light on the cellular and molecular mechanisms that human Tr1 cells use to control immune responses and induce tolerance. In this review we outline the well known and newly discovered regulatory properties of human Tr1 cells and provide an in-depth comparison of the known suppressor mechanisms of Tr1 cells with FOXP3+ Treg. We also highlight the role that Tr1 cells play in promoting and maintaining tolerance in autoimmunity, allergy, and transplantation. PMID:22566914

  5. Modeling Transport and Flow Regulatory Mechanisms of the Kidney

    PubMed Central

    Layton, Anita T.

    2013-01-01

    The kidney plays an indispensable role in the regulation of whole-organism water balance, electrolyte balance, and acid-base balance, and in the excretion of metabolic wastes and toxins. In this paper, we review representative mathematical models that have been developed to better understand kidney physiology and pathophysiology, including the regulation of glomerular filtration, the regulation of renal blood flow by means of the tubuloglomerular feedback mechanisms and of the myogenic mechanism, the urine concentrating mechanism, and regulation of renal oxygen transport. We discuss how such modeling efforts have significantly expanded our understanding of renal function in both health and disease. PMID:23914303

  6. Structural imprints in vivo decode RNA regulatory mechanisms

    NASA Astrophysics Data System (ADS)

    Spitale, Robert C.; Flynn, Ryan A.; Zhang, Qiangfeng Cliff; Crisalli, Pete; Lee, Byron; Jung, Jong-Wha; Kuchelmeister, Hannes Y.; Batista, Pedro J.; Torre, Eduardo A.; Kool, Eric T.; Chang, Howard Y.

    2015-03-01

    Visualizing the physical basis for molecular behaviour inside living cells is a great challenge for biology. RNAs are central to biological regulation, and the ability of RNA to adopt specific structures intimately controls every step of the gene expression program. However, our understanding of physiological RNA structures is limited; current in vivo RNA structure profiles include only two of the four nucleotides that make up RNA. Here we present a novel biochemical approach, in vivo click selective 2'-hydroxyl acylation and profiling experiment (icSHAPE), which enables the first global view, to our knowledge, of RNA secondary structures in living cells for all four bases. icSHAPE of the mouse embryonic stem cell transcriptome versus purified RNA folded in vitro shows that the structural dynamics of RNA in the cellular environment distinguish different classes of RNAs and regulatory elements. Structural signatures at translational start sites and ribosome pause sites are conserved from in vitro conditions, suggesting that these RNA elements are programmed by sequence. In contrast, focal structural rearrangements in vivo reveal precise interfaces of RNA with RNA-binding proteins or RNA-modification sites that are consistent with atomic-resolution structural data. Such dynamic structural footprints enable accurate prediction of RNA-protein interactions and N6-methyladenosine (m6A) modification genome wide. These results open the door for structural genomics of RNA in living cells and reveal key physiological structures controlling gene expression.

  7. Structural imprints in vivo decode RNA regulatory mechanisms

    PubMed Central

    Spitale, Robert C.; Flynn, Ryan A.; Zhang, Qiangfeng Cliff; Crisalli, Pete; Lee, Byron; Jung, Jong-Wha; Kuchelmeister, Hannes Y.; Batista, Pedro J.; Torre, Eduardo A.; Kool, Eric T.; Chang, Howard Y.

    2015-01-01

    Visualizing the physical basis for molecular behavior inside living cells is a grand challenge in biology. RNAs are central to biological regulation, and RNA’s ability to adopt specific structures intimately controls every step of the gene expression program1. However, our understanding of physiological RNA structures is limited; current in vivo RNA structure profiles view only two of four nucleotides that make up RNA2,3. Here we present a novel biochemical approach, In Vivo Click SHAPE (icSHAPE), that enables the first global view of RNA secondary structures of all four bases in living cells. icSHAPE of mouse embryonic stem cell transcriptome versus purified RNA folded in vitro shows that the structural dynamics of RNA in the cellular environment distinguishes different classes of RNAs and regulatory elements. Structural signatures at translational start sites and ribosome pause sites are conserved from in vitro, suggesting that these RNA elements are programmed by sequence. In contrast, focal structural rearrangements in vivo reveal precise interfaces of RNA with RNA binding proteins or RNA modification sites that are consistent with atomic-resolution structural data. Such dynamic structural footprints enable accurate prediction of RNA-protein interactions and N6-methyladenosine (m6A) modification genome-wide. These results open the door for structural genomics of RNA in living cells and reveal key physiological structures controlling gene expression. PMID:25799993

  8. Potential self-regulatory mechanisms of yoga for psychological health

    PubMed Central

    Gard, Tim; Noggle, Jessica J.; Park, Crystal L.; Vago, David R.; Wilson, Angela

    2014-01-01

    Research suggesting the beneficial effects of yoga on myriad aspects of psychological health has proliferated in recent years, yet there is currently no overarching framework by which to understand yoga’s potential beneficial effects. Here we provide a theoretical framework and systems-based network model of yoga that focuses on integration of top-down and bottom-up forms of self-regulation. We begin by contextualizing yoga in historical and contemporary settings, and then detail how specific components of yoga practice may affect cognitive, emotional, behavioral, and autonomic output under stress through an emphasis on interoception and bottom-up input, resulting in physical and psychological health. The model describes yoga practice as a comprehensive skillset of synergistic process tools that facilitate bidirectional feedback and integration between high- and low-level brain networks, and afferent and re-afferent input from interoceptive processes (somatosensory, viscerosensory, chemosensory). From a predictive coding perspective we propose a shift to perceptual inference for stress modulation and optimal self-regulation. We describe how the processes that sub-serve self-regulation become more automatized and efficient over time and practice, requiring less effort to initiate when necessary and terminate more rapidly when no longer needed. To support our proposed model, we present the available evidence for yoga affecting self-regulatory pathways, integrating existing constructs from behavior theory and cognitive neuroscience with emerging yoga and meditation research. This paper is intended to guide future basic and clinical research, specifically targeting areas of development in the treatment of stress-mediated psychological disorders. PMID:25368562

  9. Translational regulatory mechanisms in persistent forms of synaptic plasticity.

    PubMed

    Kelleher, Raymond J; Govindarajan, Arvind; Tonegawa, Susumu

    2004-09-30

    Memory and synaptic plasticity exhibit distinct temporal phases, with long-lasting forms distinguished by their dependence on macromolecular synthesis. Prevailing models for the molecular mechanisms underlying long-lasting synaptic plasticity have largely focused on transcriptional regulation. However, a growing body of evidence now supports a crucial role for neuronal activity-dependent mRNA translation, which may occur in dendrites for a subset of neuronal mRNAs. Recent work has begun to define the signaling mechanisms coupling synaptic activation to the protein synthesis machinery. The ERK and mTOR signaling pathways have been shown to regulate the activity of the general translational machinery, while the translation of particular classes of mRNAs is additionally controlled by gene-specific mechanisms. Rapid enhancement of the synthesis of a diverse array of neuronal proteins through such mechanisms provides the components necessary for persistent forms of LTP and LTD. These findings have important implications for the synapse specificity and associativity of protein synthesis-dependent changes in synaptic strength. PMID:15450160

  10. Regulatory mechanisms for specification and patterning of plant vascular tissues.

    PubMed

    Caño-Delgado, Ana; Lee, Ji-Young; Demura, Taku

    2010-01-01

    Plant vascular tissues, the conduits of water, nutrients, and small molecules, play important roles in plant growth and development. Vascular tissues have allowed plants to successfully adapt to various environmental conditions since they evolved 450 Mya. The majority of plant biomass, an important source of renewable energy, comes from the xylem of the vascular tissues. Efforts have been made to identify the underlying mechanisms of cell specification and patterning of plant vascular tissues and their proliferation. The formation of the plant vascular system is a complex process that integrates signaling and gene regulation at transcriptional and posttranscriptional levels. Recently, a wealth of molecular genetic studies and the advent of cell biology and genomic tools have enabled important progress toward understanding its underlying mechanisms. Here, we provide a comprehensive review of the cell and developmental processes of plant vascular tissue and resources recently available for studying them that will enable the discovery of new ways to develop sustainable energy using plant biomass.

  11. 'Cold cuts' added to the circadian smorgasbord of regulatory mechanisms.

    PubMed

    Green, Carla B

    2016-09-01

    In mammals, rhythms in body temperature help to entrain and synchronize circadian rhythms throughout the organism, and the cold-inducible RNA-binding protein (CIRBP) is one of the mediators of these daily temperature changes. Cirbp mRNA expression is regulated by the daily subtle rhythms in body temperature, and a new study by Gotic and colleagues (pp. 2005-2017) reveals a surprising and novel mechanism that involves temperature-dependent enhancement of splicing efficiency. PMID:27664233

  12. The beginning of a seed: regulatory mechanisms of double fertilization

    PubMed Central

    Bleckmann, Andrea; Alter, Svenja; Dresselhaus, Thomas

    2014-01-01

    The launch of seed development in flowering plants (angiosperms) is initiated by the process of double fertilization: two male gametes (sperm cells) fuse with two female gametes (egg and central cell) to form the precursor cells of the two major seed components, the embryo and endosperm, respectively. The immobile sperm cells are delivered by the pollen tube toward the ovule harboring the female gametophyte by species-specific pollen tube guidance and attraction mechanisms. After pollen tube burst inside the female gametophyte, the two sperm cells fuse with the egg and central cell initiating seed development. The fertilized central cell forms the endosperm while the fertilized egg cell, the zygote, will form the actual embryo and suspensor. The latter structure connects the embryo with the sporophytic maternal tissues of the developing seed. The underlying mechanisms of double fertilization are tightly regulated to ensure delivery of functional sperm cells and the formation of both, a functional zygote and endosperm. In this review we will discuss the current state of knowledge about the processes of directed pollen tube growth and its communication with the synergid cells resulting in pollen tube burst, the interaction of the four gametes leading to cell fusion and finally discuss mechanisms how flowering plants prevent multiple sperm cell entry (polyspermy) to maximize their reproductive success. PMID:25309552

  13. Genetic control and regulatory mechanisms of succinoglycan and curdlan biosynthesis in genus Agrobacterium.

    PubMed

    Wu, Dan; Li, Ang; Ma, Fang; Yang, Jixian; Xie, Yutong

    2016-07-01

    Agrobacterium is a genus of gram-negative bacteria that can produce several typical exopolysaccharides with commercial uses in the food and pharmaceutical fields. In particular, succinoglycan and curdlan, due to their good quality in high yield, have been employed on an industrial scale comparatively early. Exopolysaccharide biosynthesis is a multiple-step process controlled by different functional genes, and various environmental factors cause changes in exopolysaccharide biosynthesis through regulatory mechanisms. In this mini-review, we focus on the genetic control and regulatory mechanisms of succinoglycan and curdlan produced by Agrobacterium. Some key functional genes and regulatory mechanisms for exopolysaccharide biosynthesis are described, possessing a high potential for application in metabolic engineering to modify exopolysaccharide production and physicochemical properties. This review may contribute to the understanding of exopolysaccharide biosynthesis and exopolysaccharide modification by metabolic engineering methods in Agrobacterium. PMID:27255488

  14. Structure of the TRPA1 ion channel suggests regulatory mechanisms

    PubMed Central

    Paulsen, Candice E.; Armache, Jean-Paul; Gao, Yuan; Cheng, Yifan; Julius, David

    2015-01-01

    The TRPA1 ion channel (a.k.a the ‘wasabi receptor’) is a detector of noxious chemical agents encountered in our environment or produced endogenously during tissue injury or drug metabolism. These include a broad class of electrophiles that activate the channel through covalent protein modification. TRPA1 antagonists hold potential for treating neurogenic inflammatory conditions provoked or exacerbated by irritant exposure. Despite compelling reasons to understand TRPA1 function, structural mechanisms underlying channel regulation remain obscure. Here, we use single-particle electron cryo-microscopy to determine the structure of full-length human TRPA1 to ~4Å resolution in the presence of pharmacophores, including a potent antagonist. A number of unexpected features are revealed, including an extensive coiled-coil assembly domain stabilized by polyphosphate co-factors and a highly integrated nexus that converges on an unpredicted TRP-like allosteric domain. These findings provide novel insights into mechanisms of TRPA1 regulation, and establish a blueprint for structure-based design of analgesic and anti-inflammatory agents. PMID:25855297

  15. Sociocognitive self-regulatory mechanisms governing judgments of the acceptability and likelihood of sport cheating.

    PubMed

    d'Arripe-Longueville, Fabienne; Corrion, Karine; Scoffier, Stéphanie; Roussel, Peggy; Chalabaev, Aïna

    2010-10-01

    This study extends previous psychosocial literature (Bandura et al., 2001, 2003) by examining a structural model of the self-regulatory mechanisms governing the acceptability and likelihood of cheating in a sport context. Male and female adolescents (N = 804), aged 15-20 years, took part in this study. Negative affective self-regulatory efficacy influenced the acceptability and likelihood of cheating through the mediating role of moral disengagement, in females and males. Affective efficacy positively influenced prosocial behavior through moral disengagement or through resistive self-regulatory efficacy and social efficacy, in both groups. The direct effects of affective efficacy on beliefs about cheating were only evident in females. These results extend the findings of Bandura et al. (2001, 2003) to the sport context and suggest that affective and resistive self-regulatory efficacy operate in concert in governing adolescents' moral disengagement and transgressive behaviors in sport.

  16. Gap junction-mediated electrical transmission: regulatory mechanisms and plasticity

    PubMed Central

    Pereda, Alberto E.; Curti, Sebastian; Hoge, Gregory; Cachope, Roger; Flores, Carmen E.; Rash, John E.

    2012-01-01

    The term synapse applies to cellular specializations that articulate the processing of information within neural circuits by providing a mechanism for the transfer of information between two different neurons. There are two main modalities of synaptic transmission: chemical and electrical. While most efforts have been dedicated to the understanding of the properties and modifiability of chemical transmission, less is still known regarding the plastic properties of electrical synapses, whose structural correlate is the gap junction. A wealth of data indicates that, rather than passive intercellular channels, electrical synapses are more dynamic and modifiable than was generally perceived. This article will discuss the factors determining the strength of electrical transmission and review current evidence demonstrating its dynamic properties. Like their chemical counterparts, electrical synapses can also be plastic and modifiable. PMID:22659675

  17. Cis-regulatory mechanisms governing stem and progenitor cell transitions

    PubMed Central

    Johnson, Kirby D.; Kong, Guangyao; Gao, Xin; Chang, Yuan-I; Hewitt, Kyle J.; Sanalkumar, Rajendran; Prathibha, Rajalekshmi; Ranheim, Erik A.; Dewey, Colin N.; Zhang, Jing; Bresnick, Emery H.

    2015-01-01

    Cis-element encyclopedias provide information on phenotypic diversity and disease mechanisms. Although cis-element polymorphisms and mutations are instructive, deciphering function remains challenging. Mutation of an intronic GATA motif (+9.5) in GATA2, encoding a master regulator of hematopoiesis, underlies an immunodeficiency associated with myelodysplastic syndrome (MDS) and acute myeloid leukemia (AML). Whereas an inversion relocalizes another GATA2 cis-element (−77) to the proto-oncogene EVI1, inducing EVI1 expression and AML, whether this reflects ectopic or physiological activity is unknown. We describe a mouse strain that decouples −77 function from proto-oncogene deregulation. The −77−/− mice exhibited a novel phenotypic constellation including late embryonic lethality and anemia. The −77 established a vital sector of the myeloid progenitor transcriptome, conferring multipotentiality. Unlike the +9.5−/− embryos, hematopoietic stem cell genesis was unaffected in −77−/− embryos. These results illustrate a paradigm in which cis-elements in a locus differentially control stem and progenitor cell transitions, and therefore the individual cis-element alterations cause unique and overlapping disease phenotypes. PMID:26601269

  18. Transcriptional and Epigenetic Regulatory Mechanisms Affecting HTLV-1 Provirus

    PubMed Central

    Miyazato, Paola; Matsuo, Misaki; Katsuya, Hiroo; Satou, Yorifumi

    2016-01-01

    Human T-cell leukemia virus type 1 (HTLV-1) is a retrovirus associated with human diseases, such as adult T-cell leukemia (ATL) and HTLV-1-associated myelopathy/Tropic spastic paraparesis (HAM/TSP). As a retrovirus, its life cycle includes a step where HTLV-1 is integrated into the host genomic DNA and forms proviral DNA. In the chronic phase of the infection, HTLV‑1 is known to proliferate as a provirus via the mitotic division of the infected host cells. There are generally tens of thousands of infected clones within an infected individual. They exist not only in peripheral blood, but also in various lymphoid organs. Viral proteins encoded in HTLV-1 genome play a role in the proliferation and survival of the infected cells. As is the case with other chronic viral infections, HTLV-1 gene expression induces the activation of the host immunity against the virus. Thus, the transcription from HTLV-1 provirus needs to be controlled in order to evade the host immune surveillance. There should be a dynamic and complex regulation in vivo, where an equilibrium between viral antigen expression and host immune surveillance is achieved. The mechanisms regulating viral gene expression from the provirus are a key to understanding the persistent/latent infection with HTLV-1 and its pathogenesis. In this article, we would like to review our current understanding on this topic. PMID:27322309

  19. Novel RNA regulatory mechanisms revealed in the epitranscriptome.

    PubMed

    Saletore, Yogesh; Chen-Kiang, Selina; Mason, Christopher E

    2013-03-01

    Methyl-6-adenosine (m (6)A) has been hypothesized to exist since the 1970s, (1) but little has been known about the specific RNAs, or sites within them, that are affected by this RNA modification. Here, we report that recent work has shown RNA modifications like m (6)A, collectively called the "epitranscriptome," are a pervasive feature of mammalian cells and likely play a role in development and disease. An enrichment of m (6)A near the last CDS of thousands of genes has implicated m (6)A in transcript processing, translational regulation and potentially a mechanism for regulating miRNA maturation. Also, because the sites of m (6)A show strong evolutionary conservation and have been replicated in nearly identical sites between mouse and human, strong evolutionary pressures are likely being maintained for this mark. (2)(,) (3) Finally, we note that m (6)A is one of over 100 modifications of RNA that have been reported, (4) and with the combination of high-throughput, next-generation sequencing (NGS) techniques, immunoprecipitation with appropriate antibodies and splicing-aware peak-finding, the dynamics of the epitranscriptome can now be mapped and characterized to discern their specific cellular roles. PMID:23434792

  20. Transcriptional and Epigenetic Regulatory Mechanisms Affecting HTLV-1 Provirus.

    PubMed

    Miyazato, Paola; Matsuo, Misaki; Katsuya, Hiroo; Satou, Yorifumi

    2016-01-01

    Human T-cell leukemia virus type 1 (HTLV-1) is a retrovirus associated with human diseases, such as adult T-cell leukemia (ATL) and HTLV-1-associated myelopathy/Tropic spastic paraparesis (HAM/TSP). As a retrovirus, its life cycle includes a step where HTLV-1 is integrated into the host genomic DNA and forms proviral DNA. In the chronic phase of the infection, HTLV‑1 is known to proliferate as a provirus via the mitotic division of the infected host cells. There are generally tens of thousands of infected clones within an infected individual. They exist not only in peripheral blood, but also in various lymphoid organs. Viral proteins encoded in HTLV-1 genome play a role in the proliferation and survival of the infected cells. As is the case with other chronic viral infections, HTLV-1 gene expression induces the activation of the host immunity against the virus. Thus, the transcription from HTLV-1 provirus needs to be controlled in order to evade the host immune surveillance. There should be a dynamic and complex regulation in vivo, where an equilibrium between viral antigen expression and host immune surveillance is achieved. The mechanisms regulating viral gene expression from the provirus are a key to understanding the persistent/latent infection with HTLV-1 and its pathogenesis. In this article, we would like to review our current understanding on this topic. PMID:27322309

  1. [Labor pain--physiologal basis and regulatory mechanisms].

    PubMed

    Kojić, Zvezdana; Arsenijević, Ljubica; Sćepanović, Ljiljana; Popović, Nada

    2007-01-01

    Clinically, labor (visceral) pain is extremely prevalent in general population, yet its mechanisms have been poorly understood. With development of new electrophysiological techniques and molecular biology technologies, our understanding of physiological bases of labor pain has been markedly improved; in that way possibilities for therapeutic modulation of labor pain are expanded. The aim of this study was to describe the new insight into this topic. In this paper, the theory was exposed that the reason for labor pain had been found in sensitization at the levels of the uterus, dorsal root neurones and phychologic factors. Peripheral sensitization occurs due to cervical inflammatory reaction, associated with cervical ripening and remodeling. Chemical inflammatory mediators (notably prostaglandins, cytokines, granulocytes, enzymes such as metalloproteinases, integrines) activate nociceptive nerve fibers. Nociceptive threshold is reduced (resulting in primary hyperalgesia) and because of that there occurs the total number of action potentials generated and propagated by nociceptive peripheral nerves (visceral hypersensitivity). Central sensitization arises due to phosphorylation of N-methyl-D-aspartate (NMDA) receptors of dorsal root neurones. Numerous receptors, ion channels and signaling molecules, which, together with opioid peptides participate in spinal pain control, represent, at the level of central sensitization, possible therapeutic goals for labor pain modulation. Some of them are: DREAM which constitututively suppresses transcription of mRNA for opioid peptides, oncostatin M, COX-2 inhibitors, cFOS protein, tachykinins, gamma-butyric acid agonist, L-type Ca++ channels. Fear, as one of the most frequent phychologic factors, does (not) provide good control in transmision of pain sensitization by descendent nerve fibers. Some of the candidates for objective pain marker are also described. This article outlines the factors that, based on the contemporary

  2. A new regulatory mechanism for bacterial lipoic acid synthesis

    PubMed Central

    Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun

    2015-01-01

    Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. PMID

  3. Hospital closures and survivals: an analysis of operating characteristics and regulatory mechanisms in three states.

    PubMed Central

    Kennedy, L; Dumas, M B

    1983-01-01

    This article examines factors related to hospital closures, using a longitudinal sample of surviving and closed hospitals. The hospitals are drawn from three states with different regulatory programs. Size of hospital and occupancy rate are shown to be related to likelihood of closure, while ownership, length of stay, and expenditures are not. These findings are observed both in the aggregate and within the individual states between 1960 and 1980. The three states--Arizona, Pennsylvania, and Maryland--represent different population trends and regulatory mechanisms and goals. The findings indicate that some programs appear to guarantee survival, whereas others are more neutral. PMID:6668180

  4. Multiple regulatory mechanisms in the chloroplast of green algae: relation to hydrogen production.

    PubMed

    Antal, Taras K; Krendeleva, Tatyana E; Tyystjärvi, Esa

    2015-09-01

    A complex regulatory network in the chloroplast of green algae provides an efficient tool for maintenance of energy and redox balance in the cell under aerobic and anaerobic conditions. In this review, we discuss the structural and functional organizations of electron transport pathways in the chloroplast, and regulation of photosynthesis in the green microalga Chlamydomonas reinhardtii. The focus is on the regulatory mechanisms induced in response to nutrient deficiency stress and anoxia and especially on the role of a hydrogenase-mediated reaction in adaptation to highly reducing conditions and ATP deficiency in the cell. PMID:25986411

  5. Control and regulatory mechanisms associated with thermogenesis in flying insects and birds.

    PubMed

    Loli, Denise; Bicudo, José Eduardo P W

    2005-01-01

    Most insects and birds are able to fly. The chitin made exoskeleton of insects poses them several constraints, and this is one the reasons they are in general small sized animals. On the other hand, because birds possess an endoskeleton made of bones they may grow much larger when compared to insects. The two taxa are quite different with regards to their general "design" platform, in particular with respect to their respiratory and circulatory systems. However, because they fly, they may share in common several traits, namely those associated with the control and regulatory mechanisms governing thermogenesis. High core temperatures are essential for animal flight irrespective of the taxa they belong to. Birds and insects have thus evolved mechanisms which allowed them to control and regulate high rates of heat fluxes. This article discusses possible convergent thermogenic control and regulatory mechanisms associated with flight in insects and birds. PMID:16283551

  6. Control and regulatory mechanisms associated with thermogenesis in flying insects and birds.

    PubMed

    Loli, Denise; Bicudo, José Eduardo P W

    2005-01-01

    Most insects and birds are able to fly. The chitin made exoskeleton of insects poses them several constraints, and this is one the reasons they are in general small sized animals. On the other hand, because birds possess an endoskeleton made of bones they may grow much larger when compared to insects. The two taxa are quite different with regards to their general "design" platform, in particular with respect to their respiratory and circulatory systems. However, because they fly, they may share in common several traits, namely those associated with the control and regulatory mechanisms governing thermogenesis. High core temperatures are essential for animal flight irrespective of the taxa they belong to. Birds and insects have thus evolved mechanisms which allowed them to control and regulate high rates of heat fluxes. This article discusses possible convergent thermogenic control and regulatory mechanisms associated with flight in insects and birds.

  7. Regulatory mechanisms of immune tolerance in type 1 diabetes and their failures.

    PubMed

    Kuhn, Chantal; Besançon, Alix; Lemoine, Sébastien; You, Sylvaine; Marquet, Cindy; Candon, Sophie; Chatenoud, Lucienne

    2016-07-01

    In this brief review we propose to discuss salient data showing the importance of immune regulatory mechanisms, and in particular of Treg, for the control of pathogenic anti-β-cell response in autoimmune diabetes. Disease progression that culminates with the massive destruction of insulin-secreting β-cells and advent of hyperglycemia and glycosuria tightly correlates with a functional deficit in immune regulation. Better dissection of the cellular and molecular mechanisms through which the immune system normally sustains tolerance to "self", and which become defective when autoimmune aggression is overt, is the only direct and robust way to learn how to harness these effectively, so as to restore immune tolerance in patients with insulin-dependent type 1 diabetes. No doubt that regulatory T cells are a privileged mechanism underlying this self-tolerance in the periphery. The discovery of the key role of the transcription factor FoxP3, represented the cornerstone leading to the great advances in the field we are witnessing today. Type 1 diabetes is certainly one of the prototypic T cell-mediated autoimmune diseases where immune regulatory mechanisms relying on specialized subsets of T cells have been the most thoroughly analyzed from the fundamental point of view and also largely exploited in a translational therapeutic perspective. PMID:27216249

  8. Identification of genes involved in regulatory mechanism of pigments in broiler chickens.

    PubMed

    Tarique, T M; Yang, S; Mohsina, Z; Qiu, J; Yan, Z; Chen, G; Chen, A

    2014-01-01

    Chicken is an important model organism that unites the evolutionary gap between mammals and other vertebrates and provide major source of protein from meat and eggs for all over the world population. However, specific genes underlying the regulatory mechanism of broiler pigmentation have not yet been determined. In order to better understand the genes involved in the mechanism of pigmentation in the muscle tissues of broilers, the Affymetrix microarray hybridization experiment platform was used to identify gene expression profiles at 7 weeks of age. Broilers fed canthaxanthin, natural lutein, and orangeII pigments (100 mg/kg) were used to explore gene expression profiles). Our data showed that the 7th week of age was a very important phase with regard to gene expression profiles. We identified a number of differentially expressed genes; in canthaxanthin, natural lutein, and orangeII, there were 54 (32 upregulated and 22 downregulated), 23 (15 upregulated and 8 downregulated), and 7 (5 upregulated and 2 downregulated) known genes, respectively. Our data indicate that the numbers of differentially expressed genes were more upregulated than downregulated, and several genes showed conserved signaling to previously known functions. Thus, functional characterization of differentially expressed genes revealed several categories that are involved in important biological processes, including pigmentation, growth, molecular mechanisms, fat metabolism, cell proliferation, immune response, lipid metabolism, and protein synthesis and degradation. The results of the present study demonstrate that the genes associated with canthaxanthin, natural lutein, and orangeII are key regulatory genes that control the regulatory mechanisms of pigmentation.

  9. Regulatory mechanisms of immune tolerance in type 1 diabetes and their failures.

    PubMed

    Kuhn, Chantal; Besançon, Alix; Lemoine, Sébastien; You, Sylvaine; Marquet, Cindy; Candon, Sophie; Chatenoud, Lucienne

    2016-07-01

    In this brief review we propose to discuss salient data showing the importance of immune regulatory mechanisms, and in particular of Treg, for the control of pathogenic anti-β-cell response in autoimmune diabetes. Disease progression that culminates with the massive destruction of insulin-secreting β-cells and advent of hyperglycemia and glycosuria tightly correlates with a functional deficit in immune regulation. Better dissection of the cellular and molecular mechanisms through which the immune system normally sustains tolerance to "self", and which become defective when autoimmune aggression is overt, is the only direct and robust way to learn how to harness these effectively, so as to restore immune tolerance in patients with insulin-dependent type 1 diabetes. No doubt that regulatory T cells are a privileged mechanism underlying this self-tolerance in the periphery. The discovery of the key role of the transcription factor FoxP3, represented the cornerstone leading to the great advances in the field we are witnessing today. Type 1 diabetes is certainly one of the prototypic T cell-mediated autoimmune diseases where immune regulatory mechanisms relying on specialized subsets of T cells have been the most thoroughly analyzed from the fundamental point of view and also largely exploited in a translational therapeutic perspective.

  10. Structural Instability Tuning as a Regulatory Mechanism in Protein-Protein Interactions

    PubMed Central

    Chen, Li; Balabanidou, Vassilia; Remeta, David P.; Minetti, Conceição A.S.A.; Portaliou, Athina G.; Economou, Anastassios; Kalodimos, Charalampos G.

    2011-01-01

    SUMMARY Protein-protein interactions mediate a vast number of cellular processes. Here we present a regulatory mechanism in protein-protein interactions mediated by finely-tuned structural instability coupled with molecular mimicry. We show that a set of type III secretion (TTS) autoinhibited homodimeric chaperones adopt a molten-globule-like state that transiently exposes the substrate binding site as a means to become rapidly poised for binding to their cognate protein substrates. Packing defects at the homodimeric interface stimulate binding whereas correction of these defects results in less labile chaperones that give rise to non-functional biological systems. The protein substrates use structural mimicry to offset the “weak spots” in the chaperones and to counteract their autoinhibitory conformation. This regulatory mechanism of protein activity is evolutionary conserved among several TSS systems and presents a lucid example of functional advantage conferred upon a biological system by finely-tuned structural instability. PMID:22152477

  11. Diversity of regulatory mechanisms of photosynthetic carbon metabolism in plants and algae.

    PubMed

    Tamoi, Masahiro; Shigeoka, Shigeru

    2015-01-01

    To clarify the regulatory mechanisms of the Calvin cycle in algae, we analyzed the molecular properties of the enzymes involved in this cycle. We demonstrated that these enzymes were not regulated by redox modulation through the ferredoxin/thioredoxin system under light/dark conditions and were not sensitive to treatments with hydrogen peroxide in vitro, unlike the chloroplastic thiol-modulated enzymes of plants. On the other hand, we found that cyanobacteria possessed a unique enzyme involved in the Calvin cycle. The CP12 protein played an important role in regulating carbon metabolism in the Calvin cycle in cyanobacteria and eukaryotic algae. This review described the regulatory mechanisms of the Calvin cycle in algae and also the effects of alterations to photosynthetic carbon metabolism on plant productivity, carbon partitioning, and the carbon/nitrogen balance using transgenic plants expressing algal genes.

  12. A qrr noncoding RNA deploys four different regulatory mechanisms to optimize quorum-sensing dynamics.

    PubMed

    Feng, Lihui; Rutherford, Steven T; Papenfort, Kai; Bagert, John D; van Kessel, Julia C; Tirrell, David A; Wingreen, Ned S; Bassler, Bonnie L

    2015-01-15

    Quorum sensing is a cell-cell communication process that bacteria use to transition between individual and social lifestyles. In vibrios, homologous small RNAs called the Qrr sRNAs function at the center of quorum-sensing pathways. The Qrr sRNAs regulate multiple mRNA targets including those encoding the quorum-sensing regulatory components luxR, luxO, luxM, and aphA. We show that a representative Qrr, Qrr3, uses four distinct mechanisms to control its particular targets: the Qrr3 sRNA represses luxR through catalytic degradation, represses luxM through coupled degradation, represses luxO through sequestration, and activates aphA by revealing the ribosome binding site while the sRNA itself is degraded. Qrr3 forms different base-pairing interactions with each mRNA target, and the particular pairing strategy determines which regulatory mechanism occurs. Combined mathematical modeling and experiments show that the specific Qrr regulatory mechanism employed governs the potency, dynamics, and competition of target mRNA regulation, which in turn, defines the overall quorum-sensing response.

  13. Regulatory T Cells in Autoimmune Diabetes: Mechanisms of Action and Translational Potential.

    PubMed

    Ovcinnikovs, Vitalijs; Walker, Lucy S K

    2015-01-01

    Since the discovery of specialized T cells with regulatory function, harnessing the power of these cells to ameliorate autoimmunity has been a major goal. Here we collate the evidence that regulatory T cells (Treg) can inhibit Type 1 diabetes in animal models and humans. We discuss the anatomical sites and molecular mechanisms of Treg suppressive function in the Type 1 diabetes setting, citing evidence that Treg can function in both the pancreatic lymph nodes and within the pancreatic lesion. Involvement of the CTLA-4 pathway, as well as TGF-β and IL-2 deprivation will be considered. Finally, we summarize current efforts to manipulate Treg therapeutically in individuals with Type 1 diabetes. The translation of this research area from bench to bedside is still in its infancy, but the remarkable therapeutic potential of successfully manipulating Treg populations is clear to see. PMID:26615100

  14. Latent Tuberculosis: Models, Computational Efforts and the Pathogen’s Regulatory Mechanisms during Dormancy

    PubMed Central

    Magombedze, Gesham; Dowdy, David; Mulder, Nicola

    2013-01-01

    Latent tuberculosis is a clinical syndrome that occurs after an individual has been exposed to the Mycobacterium tuberculosis (Mtb) Bacillus, the infection has been established and an immune response has been generated to control the pathogen and force it into a quiescent state. Mtb can exit this quiescent state where it is unresponsive to treatment and elusive to the immune response, and enter a rapid replicating state, hence causing infection reactivation. It remains a gray area to understand how the pathogen causes a persistent infection and it is unclear whether the organism will be in a slow replicating state or a dormant non-replicating state. The ability of the pathogen to adapt to changing host immune response mechanisms, in which it is exposed to hypoxia, low pH, nitric oxide (NO), nutrient starvation, and several other anti-microbial effectors, is associated with a high metabolic plasticity that enables it to metabolize under these different conditions. Adaptive gene regulatory mechanisms are thought to coordinate how the pathogen changes their metabolic pathways through mechanisms that sense changes in oxygen tension and other stress factors, hence stimulating the pathogen to make necessary adjustments to ensure survival. Here, we review studies that give insights into latency/dormancy regulatory mechanisms that enable infection persistence and pathogen adaptation to different stress conditions. We highlight what mathematical and computational models can do and what they should do to enhance our current understanding of TB latency. PMID:25023946

  15. Functional Genomic Insights into Regulatory Mechanisms of High-Altitude Adaptation.

    PubMed

    Storz, Jay F; Cheviron, Zachary A

    2016-01-01

    Recent studies of indigenous human populations at high altitude have provided proof-of-principle that genome scans of DNA polymorphism can be used to identify candidate loci for hypoxia adaptation. When integrated with experimental analyses of physiological phenotypes, genome-wide surveys of DNA polymorphism and tissue-specific transcriptional profiles can provide insights into actual mechanisms of adaptation. It has been suggested that adaptive phenotypic evolution is largely mediated by cis-regulatory changes in genes that are located at integrative control points in regulatory networks. This hypothesis can be tested by conducting transcriptomic analyses of hypoxic signaling pathways in conjunction with experimental measures of vascular oxygen supply and metabolic pathway flux. Such studies may reveal whether the architecture of gene regulatory networks can be used to predict which loci (and which types of loci) are likely to be "hot spots" for adaptive physiological evolution. Functional genomic studies of deer mice (Peromyscus maniculatus) demonstrate how the integrated analysis of variation in tissue-specific transcriptomes, whole-animal physiological performance, and various subordinate traits can yield insights into the mechanistic underpinnings of high-altitude adaptation. PMID:27343092

  16. Integrative functional genomics identifies regulatory mechanisms at coronary artery disease loci

    PubMed Central

    Miller, Clint L.; Pjanic, Milos; Wang, Ting; Nguyen, Trieu; Cohain, Ariella; Lee, Jonathan D.; Perisic, Ljubica; Hedin, Ulf; Kundu, Ramendra K.; Majmudar, Deshna; Kim, Juyong B.; Wang, Oliver; Betsholtz, Christer; Ruusalepp, Arno; Franzén, Oscar; Assimes, Themistocles L.; Montgomery, Stephen B.; Schadt, Eric E.; Björkegren, Johan L.M.; Quertermous, Thomas

    2016-01-01

    Coronary artery disease (CAD) is the leading cause of mortality and morbidity, driven by both genetic and environmental risk factors. Meta-analyses of genome-wide association studies have identified >150 loci associated with CAD and myocardial infarction susceptibility in humans. A majority of these variants reside in non-coding regions and are co-inherited with hundreds of candidate regulatory variants, presenting a challenge to elucidate their functions. Herein, we use integrative genomic, epigenomic and transcriptomic profiling of perturbed human coronary artery smooth muscle cells and tissues to begin to identify causal regulatory variation and mechanisms responsible for CAD associations. Using these genome-wide maps, we prioritize 64 candidate variants and perform allele-specific binding and expression analyses at seven top candidate loci: 9p21.3, SMAD3, PDGFD, IL6R, BMP1, CCDC97/TGFB1 and LMOD1. We validate our findings in expression quantitative trait loci cohorts, which together reveal new links between CAD associations and regulatory function in the appropriate disease context. PMID:27386823

  17. Using Xenopus Embryos to Study Transcriptional and Posttranscriptional Gene Regulatory Mechanisms of Intermediate Filaments.

    PubMed

    Wang, Chen; Szaro, Ben G

    2016-01-01

    Intermediate filament genes exhibit highly regulated, tissue-specific patterns of expression during development and in response to injury. Identifying the responsible cis-regulatory gene elements thus holds great promise for revealing insights into fundamental gene regulatory mechanisms controlling tissue differentiation and repair. Because much of this regulation occurs in response to signals from surrounding cells, characterizing them requires a model system in which their activity can be tested within the context of an intact organism conveniently. We describe methods for doing so by injecting plasmid DNAs into fertilized Xenopus embryos. A prokaryotic element for site-specific recombination and two dual HS4 insulator elements flanking the reporter gene promote penetrant, promoter-typic expression that persists through early swimming tadpole stages, permitting the observation of fluorescent reporter protein expression in live embryos. In addition to describing cloning strategies for generating these plasmids, we present methods for coinjecting test and reference plasmids to identify the best embryos for analysis, for analyzing reporter protein and RNA expression, and for characterizing the trafficking of expressed reporter RNAs from the nucleus to polysomes. Thus, this system can be used to study the activities of cis-regulatory elements of intermediate filament genes at multiple levels of transcriptional and posttranscriptional control within an intact vertebrate embryo, from early stages of embryogenesis through later stages of organogenesis and tissue differentiation.

  18. Integrative functional genomics identifies regulatory mechanisms at coronary artery disease loci.

    PubMed

    Miller, Clint L; Pjanic, Milos; Wang, Ting; Nguyen, Trieu; Cohain, Ariella; Lee, Jonathan D; Perisic, Ljubica; Hedin, Ulf; Kundu, Ramendra K; Majmudar, Deshna; Kim, Juyong B; Wang, Oliver; Betsholtz, Christer; Ruusalepp, Arno; Franzén, Oscar; Assimes, Themistocles L; Montgomery, Stephen B; Schadt, Eric E; Björkegren, Johan L M; Quertermous, Thomas

    2016-01-01

    Coronary artery disease (CAD) is the leading cause of mortality and morbidity, driven by both genetic and environmental risk factors. Meta-analyses of genome-wide association studies have identified >150 loci associated with CAD and myocardial infarction susceptibility in humans. A majority of these variants reside in non-coding regions and are co-inherited with hundreds of candidate regulatory variants, presenting a challenge to elucidate their functions. Herein, we use integrative genomic, epigenomic and transcriptomic profiling of perturbed human coronary artery smooth muscle cells and tissues to begin to identify causal regulatory variation and mechanisms responsible for CAD associations. Using these genome-wide maps, we prioritize 64 candidate variants and perform allele-specific binding and expression analyses at seven top candidate loci: 9p21.3, SMAD3, PDGFD, IL6R, BMP1, CCDC97/TGFB1 and LMOD1. We validate our findings in expression quantitative trait loci cohorts, which together reveal new links between CAD associations and regulatory function in the appropriate disease context. PMID:27386823

  19. Regulatory role of collagen V in establishing mechanical properties of tendons and ligaments is tissue dependent.

    PubMed

    Connizzo, Brianne K; Freedman, Benjamin R; Fried, Joanna H; Sun, Mei; Birk, David E; Soslowsky, Louis J

    2015-06-01

    Patients with classic (type I) Ehlers-Danlos syndrome (EDS), characterized by heterozygous mutations in the Col5a1 and Col5a2 genes, exhibit connective tissue hyperelasticity and recurrent joint dislocations, indicating a potential regulatory role for collagen V in joint stabilizing soft tissues. This study asked whether the contribution of collagen V to the establishment of mechanical properties is tissue dependent. We mechanically tested four different tissues from wild type and targeted collagen V-null mice: the flexor digitorum longus (FDL) tendon, Achilles tendon (ACH), the anterior cruciate ligament (ACL), and the supraspinatus tendon (SST). Area was significantly reduced in the Col5a1(ΔTen/ΔTen) group in the FDL, ACH, and SST. Maximum load and stiffness were reduced in the Col5a1(ΔTen/ΔTen) group for all tissues. However, insertion site and midsubstance modulus were reduced only for the ACL and SST. This study provides evidence that the regulatory role of collagen V in extracellular matrix assembly is tissue dependent and that joint instability in classic EDS may be caused in part by insufficient mechanical properties of the tendons and ligaments surrounding each joint. PMID:25876927

  20. Recent Topics on the Regulatory Mechanism of Ecdysteroidogenesis by the Prothoracic Glands in Insects

    PubMed Central

    Tanaka, Yoshiaki

    2011-01-01

    Molting and metamorphosis are strictly regulated by steroid hormones known as ecdysteroids. It is now widely recognized that ecdysteroid biosynthesis (ecdysteroidogenesis) in the prothoracic gland (PG) is regulated by the tropic factor prothoracicotropic hormone (PTTH). However, the importance of PTTH in the induction of molting and metamorphosis remains unclear, and other mechanisms are thought to be involved in the regulation of ecdysteroidogenesis by the PG. Recently, new regulatory mechanisms, prothoracicostatic factors, and neural regulation have been explored using the silkworm, Bombyx mori, and two circulating prothoracicostatic factors, prothoracicostatic peptide (PTSP) and Bommo-myosuppressin (BMS), have been identified. Whereas PTTH and BMS are secreted from the brain, PTSP is secreted from the peripheral neurosecretory system – the epiproctodeal gland – during the molting stage. The molecular basis of neural regulation of ecdysteroidogenesis has been revealed for the first time in B. mori. The innervating neurons supply both Bommo-FMRF related peptide (BRFa) and orcokinin to maintain low levels of ecdysteroids during the feeding stage. These complex regulatory mechanisms – involving tropic and static factors, peripheral neurosecretory cells as well as the central neuroendocrine system, and neural regulation in addition to circulating factors collaborate to regulate ecdysteroidogenesis. Thus, together they create the finely tuned fluctuations in ecdysteroid titers needed in the hemolymph during insect development. PMID:22645515

  1. Biosafety, biosecurity and internationally mandated regulatory regimes: compliance mechanisms for education and global health security

    PubMed Central

    Sture, Judi; Whitby, Simon; Perkins, Dana

    2015-01-01

    This paper highlights the biosafety and biosecurity training obligations that three international regulatory regimes place upon states parties. The duty to report upon the existence of such provisions as evidence of compliance is discussed in relation to each regime. We argue that such mechanisms can be regarded as building blocks for the development and delivery of complementary biosafety and biosecurity teaching and training materials. We show that such building blocks represent foundations upon which life and associated scientists – through greater awareness of biosecurity concerns – can better fulfil their responsibilities to guard their work from misuse in the future. PMID:24494580

  2. Distinct regulatory mechanisms act to establish and maintain Pax3 expression in the developing neural tube.

    PubMed

    Moore, Steven; Ribes, Vanessa; Terriente, Javier; Wilkinson, David; Relaix, Frédéric; Briscoe, James

    2013-01-01

    Pattern formation in developing tissues is driven by the interaction of extrinsic signals with intrinsic transcriptional networks that together establish spatially and temporally restricted profiles of gene expression. How this process is orchestrated at the molecular level by genomic cis-regulatory modules is one of the central questions in developmental biology. Here we have addressed this by analysing the regulation of Pax3 expression in the context of the developing spinal cord. Pax3 is induced early during neural development in progenitors of the dorsal spinal cord and is maintained as pattern is subsequently elaborated, resulting in the segregation of the tissue into dorsal and ventral subdivisions. We used a combination of comparative genomics and transgenic assays to define and dissect several functional cis-regulatory modules associated with the Pax3 locus. We provide evidence that the coordinated activity of two modules establishes and refines Pax3 expression during neural tube development. Mutational analyses of the initiating element revealed that in addition to Wnt signaling, Nkx family homeodomain repressors restrict Pax3 transcription to the presumptive dorsal neural tube. Subsequently, a second module mediates direct positive autoregulation and feedback to maintain Pax3 expression. Together, these data indicate a mechanism by which transient external signals are converted into a sustained expression domain by the activities of distinct regulatory elements. This transcriptional logic differs from the cross-repression that is responsible for the spatiotemporal patterns of gene expression in the ventral neural tube, suggesting that a variety of circuits are deployed within the neural tube regulatory network to establish and elaborate pattern formation.

  3. Anti-Sigma Factors in E. coli: Common Regulatory Mechanisms Controlling Sigma Factors Availability

    PubMed Central

    Treviño-Quintanilla, Luis Gerardo; Freyre-González, Julio Augusto; Martínez-Flores, Irma

    2013-01-01

    In bacteria, transcriptional regulation is a key step in cellular gene expression. All bacteria contain a core RNA polymerase that is catalytically competent but requires an additional σ factor for specific promoter recognition and correct transcriptional initiation. The RNAP core is not able to selectively bind to a given σ factor. In contrast, different σ factors have different affinities for the RNAP core. As a consequence, the concentration of alternate σ factors requires strict regulation in order to properly control the delicate interplay among them, which favors the competence for the RNAP core. This control is archived by different σ/anti-σ controlling mechanisms that shape complex regulatory networks and cascades, and enable the response to sudden environmental cues, whose global understanding is a current challenge for systems biology. Although there have been a number of excellent studies on each of these σ/anti-σ post-transcriptional regulatory systems, no comprehensive comparison of these mechanisms in a single model organism has been conducted. Here, we survey all these systems in E. coli dissecting and analyzing their inner workings and highlightin their differences. Then, following an integral approach, we identify their commonalities and outline some of the principles exploited by the cell to effectively and globally reprogram the transcriptional machinery. These principles provide guidelines for developing biological synthetic circuits enabling an efficient and robust response to sudden stimuli. PMID:24396271

  4. Transancestral fine-mapping of four type 2 diabetes susceptibility loci highlights potential causal regulatory mechanisms

    PubMed Central

    Horikoshi, Momoko; Pasquali, Lorenzo; Wiltshire, Steven; Huyghe, Jeroen R.; Mahajan, Anubha; Asimit, Jennifer L.; Ferreira, Teresa; Locke, Adam E.; Robertson, Neil R.; Wang, Xu; Sim, Xueling; Fujita, Hayato; Hara, Kazuo; Young, Robin; Zhang, Weihua; Choi, Sungkyoung; Chen, Han; Kaur, Ismeet; Takeuchi, Fumihiko; Fontanillas, Pierre; Thuillier, Dorothée; Yengo, Loic; Below, Jennifer E.; Tam, Claudia H.T.; Wu, Ying; Abecasis, Gonçalo; Altshuler, David; Bell, Graeme I.; Blangero, John; Burtt, Noél P.; Duggirala, Ravindranath; Florez, Jose C.; Hanis, Craig L.; Seielstad, Mark; Atzmon, Gil; Chan, Juliana C.N.; Ma, Ronald C.W.; Froguel, Philippe; Wilson, James G.; Bharadwaj, Dwaipayan; Dupuis, Josee; Meigs, James B.; Cho, Yoon Shin; Park, Taesung; Kooner, Jaspal S.; Chambers, John C.; Saleheen, Danish; Kadowaki, Takashi; Tai, E. Shyong; Mohlke, Karen L.; Cox, Nancy J.; Ferrer, Jorge; Zeggini, Eleftheria; Kato, Norihiro; Teo, Yik Ying; Boehnke, Michael; McCarthy, Mark I.; Morris, Andrew P.

    2016-01-01

    To gain insight into potential regulatory mechanisms through which the effects of variants at four established type 2 diabetes (T2D) susceptibility loci (CDKAL1, CDKN2A-B, IGF2BP2 and KCNQ1) are mediated, we undertook transancestral fine-mapping in 22 086 cases and 42 539 controls of East Asian, European, South Asian, African American and Mexican American descent. Through high-density imputation and conditional analyses, we identified seven distinct association signals at these four loci, each with allelic effects on T2D susceptibility that were homogenous across ancestry groups. By leveraging differences in the structure of linkage disequilibrium between diverse populations, and increased sample size, we localised the variants most likely to drive each distinct association signal. We demonstrated that integration of these genetic fine-mapping data with genomic annotation can highlight potential causal regulatory elements in T2D-relevant tissues. These analyses provide insight into the mechanisms through which T2D association signals are mediated, and suggest future routes to understanding the biology of specific disease susceptibility loci. PMID:26911676

  5. Deletional and regulatory mechanisms coalesce to drive transplantation tolerance through mixed chimerism.

    PubMed

    Hock, Karin; Mahr, Benedikt; Schwarz, Christoph; Wekerle, Thomas

    2015-09-01

    Establishing donor-specific immunological tolerance could improve long-term outcome by obviating the need for immunosuppressive drug therapy, which is currently required to control alloreactivity after organ transplantation. Mixed chimerism is defined as the engraftment of donor hematopoietic stem cells in the recipient, leading to viable coexistence of both donor and recipient leukocytes. In numerous experimental models, cotransplantation of donor bone marrow (BM) into preconditioned (e.g., through irradiation or cytotoxic drugs) recipients leads to transplantation tolerance through (mixed) chimerism. Mixed chimerism offers immunological advantages for clinical translation; pilot trials have established proof of concept by deliberately inducing tolerance in humans. Widespread clinical application is prevented, however, by the harsh preconditioning currently necessary for permitting BM engraftment. Recently, the immunological mechanisms inducing and maintaining tolerance in experimental mixed chimerism have been defined, revealing a more prominent role for regulation than historically assumed. The evidence from murine models suggests that both deletional and regulatory mechanisms are critical in promoting complete tolerance, encompassing also the minor histocompatibility antigens. Here, we review the current understanding of tolerance through mixed chimerism and provide an outlook on how to realize widespread clinical translation based on mechanistic insights gained from chimerism protocols, including cell therapy with polyclonal regulatory T cells.

  6. Structure-based elucidation of the regulatory mechanism for aminopeptidase activity.

    PubMed

    Ta, Hai Minh; Bae, Sangsu; Han, Seungsu; Song, Jihyuck; Ahn, Tae Kyu; Hohng, Sungchul; Lee, Sangho; Kim, Kyeong Kyu

    2013-09-01

    The specificity of proteases for the residues in and length of substrates is key to understanding their regulatory mechanism, but little is known about length selectivity. Crystal structure analyses of the bacterial aminopeptidase PepS, combined with functional and single-molecule FRET assays, have elucidated a molecular basis for length selectivity. PepS exists in open and closed conformations. Substrates can access the binding hole in the open conformation, but catalytic competency is only achieved in the closed conformation by formation of the S1 binding pocket and proximal movement of Glu343, a general base, to the cleavage site. Hence, peptides longer than the depth of the binding hole block the transition from the open to the closed conformation, and thus length selection is a prerequisite for catalytic activation. A triple-sieve interlock mechanism is proposed featuring the coupling of length selectivity with residue specificity and active-site positioning.

  7. Transcription factor abundance controlled by an auto-regulatory mechanism involving a transcription start site switch

    PubMed Central

    Ngondo, Richard Patryk; Carbon, Philippe

    2014-01-01

    A transcriptional feedback loop is the simplest and most direct means for a transcription factor to provide an increased stability of gene expression. In this work performed in human cells, we reveal a new negative auto-regulatory mechanism involving an alternative transcription start site (TSS) usage. Using the activating transcription factor ZNF143 as a model, we show that the ZNF143 low-affinity binding sites, located downstream of its canonical TSS, play the role of protein sensors to induce the up- or down-regulation of ZNF143 gene expression. We uncovered that the TSS switch that mediates this regulation implies the differential expression of two transcripts with an opposite protein production ability due to their different 5′ untranslated regions. Moreover, our analysis of the ENCODE data suggests that this mechanism could be used by other transcription factors to rapidly respond to their own aberrant expression level. PMID:24234445

  8. Mechanisms of regulatory T-cell suppression – a diverse arsenal for a moving target

    PubMed Central

    Sojka, Dorothy K; Huang, Yu-Hui; Fowell, Deborah J

    2008-01-01

    Naturally-occurring regulatory T cells (Tregs) are emerging as key regulators of immune responses to self-tissues and infectious agents. Insight has been gained into the cell types and the cellular events that are regulated by Tregs. Indeed, Tregs have been implicated in the control of initial activation events, proliferation, differentiation and effector function. However, the mechanisms by which Tregs disable their cellular targets are not well understood. Here we review recent advances in the identification of distinct mechanisms of Treg action and of signals that enable cellular targets to escape regulation. Roles for inhibitory cytokines, cytotoxic molecules, modulators of cAMP and cytokine competition have all been demonstrated. The growing number of inhibitory mechanisms ascribed to Tregs suggests that Tregs take a multi-pronged approach to immune regulation. It is likely that the relative importance of each inhibitory mechanism is context dependent and modulated by the inflammatory milieu and the magnitude of the immune response. In addition, the target cell may be differentially susceptible or resistant to distinct Treg mechanisms depending on their activation or functional status at the time of the Treg encounter. Understanding when and where each suppressive tool is most effective will help to fine tune therapeutic strategies to promote or constrain specific arms of Treg suppression. PMID:18346152

  9. An atlas of gene regulatory networks reveals multiple three-gene mechanisms for interpreting morphogen gradients

    PubMed Central

    Cotterell, James; Sharpe, James

    2010-01-01

    The interpretation of morphogen gradients is a pivotal concept in developmental biology, and several mechanisms have been proposed to explain how gene regulatory networks (GRNs) achieve concentration-dependent responses. However, the number of different mechanisms that may exist for cells to interpret morphogens, and the importance of design features such as feedback or local cell–cell communication, is unclear. A complete understanding of such systems will require going beyond a case-by-case analysis of real morphogen interpretation mechanisms and mapping out a complete GRN ‘design space.' Here, we generate a first atlas of design space for GRNs capable of patterning a homogeneous field of cells into discrete gene expression domains by interpreting a fixed morphogen gradient. We uncover multiple very distinct mechanisms distributed discretely across the atlas, thereby expanding the repertoire of morphogen interpretation network motifs. Analyzing this diverse collection of mechanisms also allows us to predict that local cell–cell communication will rarely be responsible for the basic dose-dependent response of morphogen interpretation networks. PMID:21045819

  10. Innovation of a Regulatory Mechanism Modulating Semi-determinate Stem Growth through Artificial Selection in Soybean

    PubMed Central

    Ping, Jieqing; Li, Shuai; Chen, Zhixiang; Ma, Jianxin

    2016-01-01

    It has been demonstrated that Terminal Flowering 1 (TFL1) in Arabidopsis and its functional orthologs in other plants specify indeterminate stem growth through their specific expression that represses floral identity genes in shoot apical meristems (SAMs), and that the loss-of-function mutations at these functional counterparts result in the transition of SAMs from the vegetative to reproductive state that is essential for initiation of terminal flowering and thus formation of determinate stems. However, little is known regarding how semi-determinate stems, which produce terminal racemes similar to those observed in determinate plants, are specified in any flowering plants. Here we show that semi-determinacy in soybean is modulated by transcriptional repression of Dt1, the functional ortholog of TFL1, in SAMs. Such repression is fulfilled by recently enabled spatiotemporal expression of Dt2, an ancestral form of the APETALA1/FRUITFULL orthologs, which encodes a MADS-box factor directly binding to the regulatory sequence of Dt1. In addition, Dt2 triggers co-expression of the putative SUPPRESSOR OF OVEREXPRESSION OF CONSTANS 1 (GmSOC1) in SAMs, where GmSOC1 interacts with Dt2, and also directly binds to the Dt1 regulatory sequence. Heterologous expression of Dt2 and Dt1 in determinate (tfl1) Arabidopsis mutants enables creation of semi-determinacy, but the same forms of the two genes in the tfl1 and soc1 background produce indeterminate stems, suggesting that Dt2 and SOC1 both are essential for transcriptional repression of Dt1. Nevertheless, the expression of Dt2 is unable to repress TFL1 in Arabidopsis, further demonstrating the evolutionary novelty of the regulatory mechanism underlying stem growth in soybean. PMID:26807727

  11. Putting theory to the test: which regulatory mechanisms can drive realistic growth of a root?

    PubMed

    De Vos, Dirk; Vissenberg, Kris; Broeckhove, Jan; Beemster, Gerrit T S

    2014-10-01

    In recent years there has been a strong development of computational approaches to mechanistically understand organ growth regulation in plants. In this study, simulation methods were used to explore which regulatory mechanisms can lead to realistic output at the cell and whole organ scale and which other possibilities must be discarded as they result in cellular patterns and kinematic characteristics that are not consistent with experimental observations for the Arabidopsis thaliana primary root. To aid in this analysis, a 'Uniform Longitudinal Strain Rule' (ULSR) was formulated as a necessary condition for stable, unidirectional, symplastic growth. Our simulations indicate that symplastic structures are robust to differences in longitudinal strain rates along the growth axis only if these differences are small and short-lived. Whereas simple cell-autonomous regulatory rules based on counters and timers can produce stable growth, it was found that steady developmental zones and smooth transitions in cell lengths are not feasible. By introducing spatial cues into growth regulation, those inadequacies could be avoided and experimental data could be faithfully reproduced. Nevertheless, a root growth model based on previous polar auxin-transport mechanisms violates the proposed ULSR due to the presence of lateral gradients. Models with layer-specific regulation or layer-driven growth offer potential solutions. Alternatively, a model representing the known cross-talk between auxin, as the cell proliferation promoting factor, and cytokinin, as the cell differentiation promoting factor, predicts the effect of hormone-perturbations on meristem size. By down-regulating PIN-mediated transport through the transcription factor SHY2, cytokinin effectively flattens the lateral auxin gradient, at the basal boundary of the division zone, (thereby imposing the ULSR) to signal the exit of proliferation and start of elongation. This model exploration underlines the value of

  12. Visual- and Vestibular-Autonomic Influence on Short-Term Cardiovascular Regulatory Mechanisms

    NASA Technical Reports Server (NTRS)

    Mullen, Thomas J.; Ramsdell, Craig D.

    1999-01-01

    This synergy project was a one-year effort conducted cooperatively by members of the NSBRI Cardiovascular Alterations and Neurovestibular Adaptation Teams in collaboration with NASA Johnson Space Center (JSC) colleagues. The objective of this study was to evaluate visual autonomic interactions on short-term cardiovascular regulatory mechanisms. Based on established visual-vestibular and vestibular-autonomic shared neural pathways, we hypothesized that visually induced changes in orientation will trigger autonomic cardiovascular reflexes. A second objective was to compare baroreflex changes during postural changes as measured with the new Cardiovascular System Identification (CSI) technique with those measured using a neck barocuff. While the neck barocuff stimulates only the carotid baroreceptors, CSI provides a measure of overall baroreflex responsiveness. This study involved a repeated measures design with 16 healthy human subjects (8 M, 8 F) to examine cardiovascular regulatory responses during actual and virtual head-upright tilts. Baroreflex sensitivity was first evaluated with subjects in supine and upright positions during actual tilt-table testing using both neck barocuff and CSI methods. The responses to actual tilts during this first session were then compared to responses during visually induced tilt and/or rotation obtained during a second session.

  13. A systems biology approach to defining regulatory mechanisms for cartilage and tendon cell phenotypes

    PubMed Central

    Mueller, A. J.; Tew, S. R.; Vasieva, O.; Clegg, P. D.; Canty-Laird, E. G.

    2016-01-01

    Phenotypic plasticity of adult somatic cells has provided emerging avenues for the development of regenerative therapeutics. In musculoskeletal biology the mechanistic regulatory networks of genes governing the phenotypic plasticity of cartilage and tendon cells has not been considered systematically. Additionally, a lack of strategies to effectively reproduce in vitro functional models of cartilage and tendon is retarding progress in this field. De- and redifferentiation represent phenotypic transitions that may contribute to loss of function in ageing musculoskeletal tissues. Applying a systems biology network analysis approach to global gene expression profiles derived from common in vitro culture systems (monolayer and three-dimensional cultures) this study demonstrates common regulatory mechanisms governing de- and redifferentiation transitions in cartilage and tendon cells. Furthermore, evidence of convergence of gene expression profiles during monolayer expansion of cartilage and tendon cells, and the expression of key developmental markers, challenges the physiological relevance of this culture system. The study also suggests that oxidative stress and PI3K signalling pathways are key modulators of in vitro phenotypes for cells of musculoskeletal origin. PMID:27670352

  14. Regulatory motifs on ISWI chromatin remodelers: molecular mechanisms and kinetic proofreading

    NASA Astrophysics Data System (ADS)

    Brysbaert, Guillaume; Lensink, Marc F.; Blossey, Ralf

    2015-02-01

    Recently, kinetic proofreading scenarios have been proposed for the regulation of chromatin remodeling, first on purely theoretical grounds (Blossey and Schiessel 2008 HFSP J. 2 167-70) and deduced from experiments on the ISWI/ACF system (Narlikar 2010 Curr. Opin. Chem. Biol. 14 660). In the kinetic proofreading scenario of chromatin remodeling, the combination of the recognition of a histone tail state and ATP-hydrolysis in the remodeler motor act together to select (i.e. proofread) a nucleosomal substrate. ISWI remodelers have recently been shown to have an additional level of regulation as they contain auto-inhibitory motifs which need to be inactivated through an interaction with the nucleosome. In this paper we show that the auto-regulatory effect enhances substrate recognition in kinetic proofreading. We further report some suggestive additional insights into the molecular mechanism underlying ISWI-autoregulation.

  15. Potential impact of gene regulatory mechanisms on the evolution of multicellularity in the volvocine algae.

    PubMed

    Kianianmomeni, Arash

    2015-01-01

    A fundamental question in biology is how multicellular organisms can arise from their single-celled precursors. The evolution of multicellularity requires the adoption of new traits in unicellular ancestors that allows the generation of form by, for example, increasing the size and developing new cell types. But what are the genetic, cellular and biochemical bases underlying the evolution of multicellularity? Recent advances in evolutionary developmental biology suggest that the regulation of gene expression by cis-regulatory factors, gene duplication and alternative splicing contribute to phenotypic evolution. These mechanisms enable different degrees of phenotypic divergence and complexity with variation in traits from genomes with similar gene contents. In addition, signaling pathways specific to cell types are developed to guarantee the modulation of cellular and developmental processes matched to the cell types as well as the maintenance of multicellularity. PMID:26479715

  16. High commitment of embryonic keratinocytes to terminal differentiation through a Notch1-caspase 3 regulatory mechanism.

    PubMed

    Okuyama, Ryuhei; Nguyen, Bach-Cuc; Talora, Claudio; Ogawa, Eisaku; Tommasi di Vignano, Alice; Lioumi, Maria; Chiorino, Giovanna; Tagami, Hachiro; Woo, Minna; Dotto, G Paolo

    2004-04-01

    Embryonic cells are expected to possess high growth/differentiation potential, required for organ morphogenesis and expansion during development. However, little is known about the intrinsic properties of embryonic epithelial cells due to difficulties in their isolation and cultivation. We report here that pure keratinocyte populations from E15.5 mouse embryos commit irreversibly to differentiation much earlier than newborn cells. Notch signaling, which promotes keratinocyte differentiation, is upregulated in embryonic keratinocyte and epidermis, and elevated caspase 3 expression, which we identify as a transcriptional Notch1 target, accounts in part for the high commitment of embryonic keratinocytes to terminal differentiation. In vivo, lack of caspase 3 results in increased proliferation and decreased differentiation of interfollicular embryonic keratinocytes, together with decreased activation of PKC-delta, a caspase 3 substrate which functions as a positive regulator of keratinocyte differentiation. Thus, a Notch1-caspase 3 regulatory mechanism underlies the intrinsically high commitment of embryonic keratinocytes to terminal differentiation.

  17. Regulatory motifs on ISWI chromatin remodelers: molecular mechanisms and kinetic proofreading.

    PubMed

    Brysbaert, Guillaume; Lensink, Marc F; Blossey, Ralf

    2015-02-18

    Recently, kinetic proofreading scenarios have been proposed for the regulation of chromatin remodeling, first on purely theoretical grounds (Blossey and Schiessel 2008 HFSP J. 2 167-70) and deduced from experiments on the ISWI/ACF system (Narlikar 2010 Curr. Opin. Chem. Biol. 14 660). In the kinetic proofreading scenario of chromatin remodeling, the combination of the recognition of a histone tail state and ATP-hydrolysis in the remodeler motor act together to select (i.e. proofread) a nucleosomal substrate. ISWI remodelers have recently been shown to have an additional level of regulation as they contain auto-inhibitory motifs which need to be inactivated through an interaction with the nucleosome. In this paper we show that the auto-regulatory effect enhances substrate recognition in kinetic proofreading. We further report some suggestive additional insights into the molecular mechanism underlying ISWI-autoregulation. PMID:25563573

  18. Mechanistic Basis for Plant Responses to Drought Stress : Regulatory Mechanism of Abscisic Acid Signaling

    NASA Astrophysics Data System (ADS)

    Miyakawa, Takuya; Tanokura, Masaru

    The phytohormone abscisic acid (ABA) plays a key role in the rapid adaptation of plants to environmental stresses such as drought and high salinity. Accumulated ABA in plant cells promotes stomatal closure in guard cells and transcription of stress-tolerant genes. Our understanding of ABA responses dramatically improved by the discovery of both PYR/PYL/RCAR as a soluble ABA receptor and inhibitory complex of a protein phospatase PP2C and a protein kinase SnRK2. Moreover, several structural analyses of PYR/PYL/RCAR revealed the mechanistic basis for the regulatory mechanism of ABA signaling, which provides a rational framework for the design of alternative agonists in future.

  19. The regulatory mechanisms of myogenin expression in doxorubicin-treated rat cardiomyocytes

    PubMed Central

    Yen, Li-Chen; Huang, Chi-Jung; Lin, Wei-Shiang; Chan, James Yi-Hsin

    2015-01-01

    Doxorubicin, an anthracycline antibiotic, has been used as an anti-neoplastic drug for almost 60 years. However, the mechanism(s) by which anthracyclines cause irreversible myocardial injury remains unclear. In order to delineate possible molecular signals involved in the myocardial toxicity, we assessed candidate genes using mRNA expression profiling in the doxorubicin-treated rat cardiomyocyte H9c2 cell line. In the study, it was confirmed that myogenin, an important transcriptional factor for muscle terminal differentiation, was significantly reduced by doxorubicin in a dose-dependent manner using both RT-PCR and western blot analyses. Also, it was identified that the doxorubicin-reduced myogenin gene level could not be rescued by most cardio-protectants. Furthermore, it was demonstrated how the signaling of the decreased myogenin expression by doxorubicin was altered at the transcriptional, post-transcriptional and translational levels. Based on these findings, a working model was proposed for relieving doxorubicin-associated myocardial toxicity by down-regulating miR-328 expression and increasing voltage-gated calcium channel β1 expression, which is a repressor of myogenin gene regulation. In summary, this study provides several lines of evidence indicating that myogenin is the target for doxorubicin-induced cardio-toxicity and a novel therapeutic strategy for doxorubicin clinical applications based on the regulatory mechanisms of myogenin expression. PMID:26452256

  20. Heritability of symbiont density reveals distinct regulatory mechanisms in a tripartite symbiosis.

    PubMed

    Parkinson, Jasmine F; Gobin, Bruno; Hughes, William O H

    2016-04-01

    Beneficial eukaryotic-bacterial partnerships are integral to animal and plant evolution. Understanding the density regulation mechanisms behind bacterial symbiosis is essential to elucidating the functional balance between hosts and symbionts. Citrus mealybugs, Planococcus citri (Risso), present an excellent model system for investigating the mechanisms of symbiont density regulation. They contain two obligate nutritional symbionts, Moranella endobia, which resides inside Tremblaya princeps, which has been maternally transmitted for 100-200 million years. We investigate whether host genotype may influence symbiont density by crossing mealybugs from two inbred laboratory-reared populations that differ substantially in their symbiont density to create hybrids. The density of the M. endobia symbiont in the hybrid hosts matched that of the maternal parent population, in keeping with density being determined either by the symbiont or the maternal genotype. However, the density of the T. princeps symbiont was influenced by the paternal host genotype. The greater dependency of T. princeps on its host may be due to its highly reduced genome. The decoupling of T. princeps and M. endobia densities, in spite of their intimate association, suggests that distinct regulatory mechanisms can be at work in symbiotic partnerships, even when they are obligate and mutualistic. PMID:27099709

  1. Distinct regulatory mechanisms of eukaryotic transcriptional activation by SAGA and TFIID.

    PubMed

    Bhaumik, Sukesh R

    2011-02-01

    A growing number of human diseases are linked to abnormal gene expression which is largely controlled at the level of transcriptional initiation. The gene-specific activator promotes the initiation of transcription through its interaction with one or more components of the transcriptional initiation machinery, hence leading to stimulated transcriptional initiation or activation. However, all activator proteins do not target the same component(s) of the transcriptional initiation machinery. Rather, they can have different target specificities, and thus, can lead to distinct mechanisms of transcriptional activation. Two such distinct mechanisms of transcriptional activation in yeast are mediated by the SAGA (Spt-Ada-Gcn5-Acetyltransferase) and TFIID (Transcription factor IID) complexes, and are termed as "SAGA-dependent" and "TFIID-dependent" transcriptional activation, respectively. SAGA is the target of the activator in case of SAGA-dependent transcriptional activation, while the targeting of TFIID by the activator leads to TFIID-dependent transcriptional activation. Both the SAGA and TFIID complexes are highly conserved from yeast to human, and play crucial roles in gene activation among eukaryotes. The regulatory mechanisms of eukaryotic transcriptional activation by SAGA and TFIID are discussed here. This article is part of a Special Issue entitled The 26S Proteasome: When degradation is just not enough!

  2. Regulatory mechanisms that modulate signalling by G-protein-coupled receptors.

    PubMed Central

    Böhm, S K; Grady, E F; Bunnett, N W

    1997-01-01

    The large and functionally diverse group of G-protein-coupled receptors includes receptors for many different signalling molecules, including peptide and non-peptide hormones and neuro-transmitters, chemokines, prostanoids and proteinases. Their principal function is to transmit information about the extracellular environment to the interior of the cell by interacting with the heterotrimeric G-proteins, and they thereby participate in many aspects of regulation. Cellular responses to agonists of these receptors are usually rapidly attenuated. Mechanisms of signal attenuation include removal of agonists from the extracellular fluid, receptor desensitization, endocytosis and down-regulation. Agonists are removed by dilution, uptake by transporters and enzymic degradation. Receptor desensitization is mediated by receptor phosphorylation by G-protein receptor kinases and second-messenger kinases, interaction of phosphorylated receptors with arrestins and receptor uncoupling from G-proteins. Agonist-induced receptor endocytosis also contributes to desensitization by depleting the cell surface of high-affinity receptors, and recycling of internalized receptors contributes to resensitization of cellular responses. Receptor down-regulation is a form of desensitization that occurs during continuous, long-term exposure of cells to receptor agonists. Down-regulation, which may occur during the development of drug tolerance, is characterized by depletion of the cellular receptor content, and is probably mediated by alterations in the rates of receptor degradation and synthesis. These regulatory mechanisms are important, as they govern the ability of cells to respond to agonists. A greater understanding of the mechanisms that modulate signalling may lead to the development of new therapies and may help to explain the mechanism of drug tolerance. PMID:9078236

  3. MYCN-driven regulatory mechanisms controlling LIN28B in neuroblastoma

    PubMed Central

    Beckers, Anneleen; Van Peer, Gert; Carter, Daniel R.; Gartlgruber, Moritz; Herrmann, Carl; Agarwal, Saurabh; Helsmoortel, Hetty H.; Althoff, Kristina; Molenaar, Jan J.; Cheung, Belamy B.; Schulte, Johannes H.; Benoit, Yves; Shohet, Jason M.; Westermann, Frank; Marshall, Glenn M.; Vandesompele, Jo; De Preter, Katleen; Speleman, Frank

    2016-01-01

    LIN28B has been identified as an oncogene in various tumor entities, including neuroblastoma, a childhood cancer that originates from neural crest-derived cells, and is characterized by amplification of the MYCN oncogene. Recently, elevated LIN28B expression levels were shown to contribute to neuroblastoma tumorigenesis via let-7 dependent de-repression of MYCN. However, additional insight in the regulation of LIN28B in neuroblastoma is lacking. Therefore, we have performed a comprehensive analysis of the regulation of LIN28B in neuroblastoma, with a specific focus on the contribution of miRNAs. We show that MYCN regulates LIN28B expression in neuroblastoma tumors via two distinct parallel mechanisms. First, through an unbiased LIN28B-3′UTR reporter screen, we found that miR-26a-5p and miR-26b-5p regulate LIN28B expression. Next, we demonstrated that MYCN indirectly affects the expression of miR-26a-5p, and hence regulates LIN28B, therefor establishing a MYCN-miR-26a-5p-LIN28B regulatory axis. Second, we provide evidence that MYCN regulates LIN28B expression via interaction with the LIN28B promotor, establishing a direct MYCN-LIN28B regulatory axis. We believe that these findings mark LIN28B as an important effector of the MYCN oncogenic phenotype and underlines the importance of MYCN-regulated miRNAs in establishing the MYCN-driven oncogenic process. PMID:26123663

  4. Structural insights into the regulatory mechanism of the Pseudomonas aeruginosa YfiBNR system.

    PubMed

    Xu, Min; Yang, Xuan; Yang, Xiu-An; Zhou, Lei; Liu, Tie-Zheng; Fan, Zusen; Jiang, Tao

    2016-06-01

    YfiBNR is a recently identified bis-(3'-5')-cyclic dimeric GMP (c-di-GMP) signaling system in opportunistic pathogens. It is a key regulator of biofilm formation, which is correlated with prolonged persistence of infection and antibiotic drug resistance. In response to cell stress, YfiB in the outer membrane can sequester the periplasmic protein YfiR, releasing its inhibition of YfiN on the inner membrane and thus provoking the diguanylate cyclase activity of YfiN to induce c-di-GMP production. However, the detailed regulatory mechanism remains elusive. Here, we report the crystal structures of YfiB alone and of an active mutant YfiB(L43P) complexed with YfiR with 2:2 stoichiometry. Structural analyses revealed that in contrast to the compact conformation of the dimeric YfiB alone, YfiB(L43P) adopts a stretched conformation allowing activated YfiB to penetrate the peptidoglycan (PG) layer and access YfiR. YfiB(L43P) shows a more compact PG-binding pocket and much higher PG binding affinity than wild-type YfiB, suggesting a tight correlation between PG binding and YfiB activation. In addition, our crystallographic analyses revealed that YfiR binds Vitamin B6 (VB6) or L-Trp at a YfiB-binding site and that both VB6 and L-Trp are able to reduce YfiB(L43P)-induced biofilm formation. Based on the structural and biochemical data, we propose an updated regulatory model of the YfiBNR system. PMID:27113583

  5. A Cell-Regulatory Mechanism Involving Feedback between Contraction and Tissue Formation Guides Wound Healing Progression

    PubMed Central

    Valero, Clara; Javierre, Etelvina; García-Aznar, José Manuel; Gómez-Benito, María José

    2014-01-01

    Wound healing is a process driven by cells. The ability of cells to sense mechanical stimuli from the extracellular matrix that surrounds them is used to regulate the forces that cells exert on the tissue. Stresses exerted by cells play a central role in wound contraction and have been broadly modelled. Traditionally, these stresses are assumed to be dependent on variables such as the extracellular matrix and cell or collagen densities. However, we postulate that cells are able to regulate the healing process through a mechanosensing mechanism regulated by the contraction that they exert. We propose that cells adjust the contraction level to determine the tissue functions regulating all main activities, such as proliferation, differentiation and matrix production. Hence, a closed-regulatory feedback loop is proposed between contraction and tissue formation. The model consists of a system of partial differential equations that simulates the evolution of fibroblasts, myofibroblasts, collagen and a generic growth factor, as well as the deformation of the extracellular matrix. This model is able to predict the wound healing outcome without requiring the addition of phenomenological laws to describe the time-dependent contraction evolution. We have reproduced two in vivo experiments to evaluate the predictive capacity of the model, and we conclude that there is feedback between the level of cell contraction and the tissue regenerated in the wound. PMID:24681636

  6. Core level regulatory network of osteoblast as molecular mechanism for osteoporosis and treatment

    PubMed Central

    Zhu, Xiaomei; Li, Jun; Liang, Yuhong; Liu, Tao; Zhu, Yanxia; Zhang, Bingbing; Tan, Shuang; Guo, Huajie; Guan, Shuguang; Ao, Ping; Zhou, Guangqian

    2016-01-01

    To develop and evaluate the long-term prophylactic treatment for chronic diseases such as osteoporosis requires a clear view of mechanism at the molecular and systems level. While molecular signaling pathway studies for osteoporosis are extensive, a unifying mechanism is missing. In this work, we provide experimental and systems-biology evidences that a tightly connected top-level regulatory network may exist, which governs the normal and osteoporotic phenotypes of osteoblast. Specifically, we constructed a hub-like interaction network from well-documented cross-talks among estrogens, glucocorticoids, retinoic acids, peroxisome proliferator-activated receptor, vitamin D receptor and calcium-signaling pathways. The network was verified with transmission electron microscopy and gene expression profiling for bone tissues of ovariectomized (OVX) rats before and after strontium gluconate (GluSr) treatment. Based on both the network structure and the experimental data, the dynamical modeling predicts calcium and glucocorticoids signaling pathways as targets for GluSr treatment. Modeling results further reveal that in the context of missing estrogen signaling, the GluSr treated state may be an outcome that is closest to the healthy state. PMID:26783964

  7. A LINE-1-encoded reverse transcriptase-dependent regulatory mechanism is active in embryogenesis and tumorigenesis.

    PubMed

    Spadafora, Corrado

    2015-04-01

    LINE-1 (long interspersed nuclear elements) retrotransposons constitute a large family of retrotransposable elements, accounting for 17% of the human genome. They encode proteins required for their own mobilization, including a reverse transcriptase (RT) enzyme highly expressed in mouse embryos and mouse and human cancer cells and repressed in somatic differentiated healthy cells. We have found that reverse transcription takes place in early murine embryos, yielding an increase in LINE-1 copy number during preimplantation development, which also occurs in tumor progression. RT inhibition irreversibly arrests embryo development, reduces cancer cell proliferation, promotes differentiation, antagonizes tumor growth, and causes a global reprogramming of transcription profiles. These results strongly suggest that a previously unrecognized RT-dependent regulatory mechanism operates during preimplantation development, is repressed during differentiation to normal tissues, and, when erroneously reactivated in adult life, promotes cell transformation and cancer progression by "resurrecting" embryonic transcriptional pathways. The RT-dependent mechanism emerges as a major source of genetic and epigenetic changes with physiological, pathological, and evolutionary implications.

  8. Core level regulatory network of osteoblast as molecular mechanism for osteoporosis and treatment.

    PubMed

    Yuan, Ruoshi; Ma, Shengfei; Zhu, Xiaomei; Li, Jun; Liang, Yuhong; Liu, Tao; Zhu, Yanxia; Zhang, Bingbing; Tan, Shuang; Guo, Huajie; Guan, Shuguang; Ao, Ping; Zhou, Guangqian

    2016-01-26

    To develop and evaluate the long-term prophylactic treatment for chronic diseases such as osteoporosis requires a clear view of mechanism at the molecular and systems level. While molecular signaling pathway studies for osteoporosis are extensive, a unifying mechanism is missing. In this work, we provide experimental and systems-biology evidences that a tightly connected top-level regulatory network may exist, which governs the normal and osteoporotic phenotypes of osteoblast. Specifically, we constructed a hub-like interaction network from well-documented cross-talks among estrogens, glucocorticoids, retinoic acids, peroxisome proliferator-activated receptor, vitamin D receptor and calcium-signaling pathways. The network was verified with transmission electron microscopy and gene expression profiling for bone tissues of ovariectomized (OVX) rats before and after strontium gluconate (GluSr) treatment. Based on both the network structure and the experimental data, the dynamical modeling predicts calcium and glucocorticoids signaling pathways as targets for GluSr treatment. Modeling results further reveal that in the context of missing estrogen signaling, the GluSr treated state may be an outcome that is closest to the healthy state. PMID:26783964

  9. Up-regulation of miR-98 and unraveling regulatory mechanisms in gestational diabetes mellitus

    PubMed Central

    Cao, Jing-Li; Zhang, Lu; Li, Jian; Tian, Shi; Lv, Xiao-Dan; Wang, Xue-Qin; Su, Xing; Li, Ying; Hu, Yi; Ma, Xu; Xia, Hong-Fei

    2016-01-01

    MiR-98 expression was up-regulated in kidney in response to early diabetic nephropathy in mouse and down-regulated in muscle in type 2 diabetes in human. However, the expression prolife and functional role of miR-98 in human gestational diabetes mellitus (GDM) remained unclear. Here, we investigated its expression and function in placental tissues from GDM patients and the possible molecular mechanisms. The results showed that miR-98 was up-regulated in placentas from GDM patients compared with normal placentas. MiR-98 over-expression increased global DNA methylational level and miR-98 knockdown reduced global DNA methylational level. Further investigation revealed that miR-98 could inhibit Mecp2 expression by binding the 3′-untranslated region (UTR) of methyl CpG binding protein 2 (Mecp2), and then led to the expression dysregulation of canonical transient receptor potential 3 (Trpc3), a glucose uptake related gene. More importantly, in vivo analysis found that the expression level of Mecp2 and Trpc3 in placental tissues from GDM patients, relative to the increase of miR-98, was diminished, especially for GDM patients over the age of 35 years. Collectively, up-regulation of miR-98 in the placental tissues of human GDM is linked to the global DNA methylation via targeting Mecp2, which may imply a novel regulatory mechanism in GDM. PMID:27573367

  10. Functional role of regulatory T cells in B cell lymphoma and related mechanisms.

    PubMed

    Wu, Wei; Wan, Jun; Xia, Ruixiang; Huang, Zhenqi; Ni, Jing; Yang, Mingzhen

    2015-01-01

    B cell lymphoma (BCL) has a higher degree of malignancy and complicated pathogenic mechanism. Regulatory T cells (Treg cells) are known to exert certain immune suppression functions, in addition to immune mediating effects. Recent studies have revealed the role of Treg cells in pathogenesis and progression of multiple malignant tumors. This study therefore investigated the functional role and related mechanism of Treg cells in BCL. A cohort of thirty patients who were diagnosed with BCL in our hospital between January 2013 and December 2014. Another thirty healthy individuals were recruited. Peripheral blood mononuclear cells (PBMCs) were separated and analyzed for the ratio of CD4+/CD25+ Treg cells. The mRNA expression levels of Foxp3, transforming growth factor (TGF)-β1 and interleukin (IL)-10 genes were quantified by real-time PCR, while their serum levels were determined by enzyme-linked immunosorbent assay (ELISA). Meanwhile all laboratory indexes for patients were monitored during the complete remission (CR) stage. BCL patients significantly elevated ratio of CD4+/CD25+ Treg cells, which were decreased at CR stage. mRNA levels of Foxp3, TGF-β1 and IL-10, in addition to protein levels of TGF-β1 and IL-10 were potentiated in lymphoma patients but decreased in CR patients (P<0.05 in all cases). CD4+/CD25+ Treg cells exert immune suppressing functions in BCL via regulating cytokines, thereby facilitating the pathogenesis and progression of lymphoma. PMID:26464657

  11. Cardiovascular Risk in Systemic Autoimmune Diseases: Epigenetic Mechanisms of Immune Regulatory Functions

    PubMed Central

    López-Pedrera, Chary; Pérez-Sánchez, Carlos; Ramos-Casals, Manuel; Santos-Gonzalez, Monica; Rodriguez-Ariza, Antonio; José Cuadrado, Ma

    2012-01-01

    Autoimmune diseases (AIDs) have been associated with accelerated atherosclerosis (AT) leading to increased cardio- and cerebrovascular disease risk. Traditional risk factors, as well as systemic inflammation mediators, including cytokines, chemokines, proteases, autoantibodies, adhesion receptors, and others, have been implicated in the development of these vascular pathologies. Yet, the characteristics of vasculopathies may significantly differ depending on the underlying disease. In recent years, many new genes and signalling pathways involved in autoimmunity with often overlapping patterns between different disease entities have been further detected. Epigenetics, the control of gene packaging and expression independent of alterations in the DNA sequence, is providing new directions linking genetics and environmental factors. Epigenetic regulatory mechanisms comprise DNA methylation, histone modifications, and microRNA activity, all of which act upon gene and protein expression levels. Recent findings have contributed to our understanding of how epigenetic modifications could influence AID development, not only showing differences between AID patients and healthy controls, but also showing how one disease differs from another and even how the expression of key proteins involved in the development of each disease is regulated. PMID:21941583

  12. Molecular interactions of the Saccharomyces cerevisiae Atg1 complex provide insights into assembly and regulatory mechanisms

    PubMed Central

    Chew, Leon H; Lu, Shan; Liu, Xu; Li, Franco Kk; Yu, Angela Yh; Klionsky, Daniel J; Dong, Meng-Qiu; Yip, Calvin K

    2015-01-01

    The Atg1 complex, which contains 5 major subunits: Atg1, Atg13, Atg17, Atg29, and Atg31, regulates the induction of autophagy and autophagosome formation. To gain a better understanding of the overall architecture and assembly mechanism of this essential autophagy regulatory complex, we have reconstituted a core assembly of the Saccharomyces cerevisiae Atg1 complex composed of full-length Atg17, Atg29, and Atg31, along with the C-terminal domains of Atg1 (Atg1[CTD]) and Atg13 (Atg13[CTD]). Using chemical-crosslinking coupled with mass spectrometry (CXMS) analysis we systematically mapped the intersubunit interaction interfaces within this complex. Our data revealed that the intrinsically unstructured C-terminal domain of Atg29 interacts directly with Atg17, whereas Atg17 interacts with Atg13 in 2 distinct intrinsically unstructured regions, including a previously unknown motif that encompasses several putative phosphorylation sites. The Atg1[CTD] crosslinks exclusively to the Atg13[CTD] and does not appear to make direct contact with the Atg17-Atg31-Atg29 scaffold. Finally, single-particle electron microscopy analysis revealed that both the Atg13[CTD] and Atg1[CTD] localize to the tip regions of Atg17-Atg31-Atg29 and do not alter the distinct curvature of this scaffolding subcomplex. This work provides a comprehensive understanding of the subunit interactions in the fully assembled Atg1 core complex, and uncovers the potential role of intrinsically disordered regions in regulating complex integrity. PMID:25998554

  13. Regulatory mechanism of protein metabolic pathway during the differentiation process of chicken male germ cell.

    PubMed

    Li, Dong; Zuo, Qisheng; Lian, Chao; Zhang, Lei; Shi, Qingqing; Zhang, Zhentao; Wang, Yingjie; Ahmed, Mahmoud F; Tang, Beibei; Xiao, Tianrong; Zhang, Yani; Li, Bichun

    2015-08-01

    We explored the regulatory mechanism of protein metabolism during the differentiation process of chicken male germ cells and provide a basis for improving the induction system of embryonic stem cell differentiation to male germ cells in vitro. We sequenced the transcriptome of embryonic stem cells, primordial germ cells, and spermatogonial stem cells with RNA sequencing (RNA-Seq), bioinformatics analysis methods, and detection of the key genes by quantitative reverse transcription PCR (qRT-PCR). Finally, we found 16 amino acid metabolic pathways enriched in the biological metabolism during the differentiation process of embryonic stem cells to primordial germ cells and 15 amino acid metabolic pathways enriched in the differentiation stage of primordial germ cells to spermatogonial stem cells. We found three pathways, arginine-proline metabolic pathway, tyrosine metabolic pathway, and tryptophan metabolic pathway, significantly enriched in the whole differentiation process of embryonic stem cells to spermatogonial stem cells. Moreover, for these three pathways, we screened key genes such as NOS2, ADC, FAH, and IDO. qRT-PCR results showed that the expression trend of these genes were the same to RNA-Seq. Our findings showed that the three pathways and these key genes play an important role in the differentiation process of embryonic stem cells to male germ cells. These results provide basic information for improving the induction system of embryonic stem cell differentiation to male germ cells in vitro.

  14. Dynamic responsiveness of the vascular bed as a regulatory mechanism in vasomotor control.

    PubMed

    Zamir, Mair; Norton, Katelyn; Fleischhauer, Arlene; Frances, Maria F; Goswami, Ruma; Usselman, Charlotte W; Nolan, Robert P; Shoemaker, J Kevin

    2009-07-01

    The dynamics of blood supply to a vascular bed depend on lumped mechanical properties of that bed, namely the compliance (C), resistance (R), viscoelasticity (K), and inertance (L). While the study of regulatory mechanisms has so far placed the emphasis largely on R, it is not known how the remaining properties contribute collectively to the play of dynamics in vasomotor control. To examine this question and to establish some benchmark values of these properties, simultaneous measurements of pressure and flow waveforms in the vascular bed of the forearm were obtained from three groups: young healthy individuals, older hypertensives with controlled blood pressure, and older hypertensives with uncontrolled blood pressure. The values of R and C were found to vary within a wide range in each of the three groups to the extent that neither R nor C could be used independently as an indicator of health or age of the subjects tested. However, higher level dynamic properties of the bed, such as the time constants and damping index, which depend on combinations of C,K, and L, and which may reflect measures of the dynamic responsiveness or "sluggishness" of the system, were found to be maintained over a wide range of pulse pressures. These findings support a hypothesis that the pulsatile dynamics of blood supply to a vascular bed are adapted to the individual baseline values of R and C in different subjects with the effect of optimizing the level of dynamic responsiveness to changes in pressure or flow, and that this dynamic property of the vascular bed may be a protected and/or regulated property.

  15. Insights into the inhibitory mechanisms of the regulatory protein IIA(Glc) on melibiose permease activity.

    PubMed

    Hariharan, Parameswaran; Guan, Lan

    2014-11-21

    The phosphotransfer protein IIA(Glc) of the bacterial phosphoenolpyruvate:carbohydrate phosphotransferase system plays a key role in the regulation of carbohydrate metabolism. Melibiose permease (MelB) is one among several permeases subject to IIA(Glc) regulation. The regulatory mechanisms are poorly understood; in addition, thermodynamic features of IIA(Glc) binding to other proteins are also unknown. Applying isothermal titration calorimetry and amine-specific cross-linking, we show that IIA(Glc) directly binds to MelB of Salmonella typhimurium (MelB(St)) and Escherichia coli MelB (MelB(Ec)) at a stoichiometry of unity in the absence or presence of melibiose. The dissociation constant values are 3-10 μM for MelB(St) and 25 μM for MelB(Ec). All of the binding is solely driven by favorable enthalpy forces. IIA(Glc) binding to MelB(St) in the absence or presence of melibiose yields a large negative heat capacity change; in addition, the conformational entropy is constrained upon the binding. We further found that the IIA(Glc)-bound MelB(St) exhibits a decreased binding affinity for melibiose or nitrophenyl-α-galactoside. It is believed that sugar binding to the permease is involved in an induced fit mechanism, and the transport process requires conformational cycling between different states. Thus, the thermodynamic data are consistent with the interpretation that IIA(Glc) inhibits the induced fit process and restricts the conformational dynamics of MelB(St). PMID:25296751

  16. An insight into the various regulatory mechanisms modulating human DNA methyltransferase 1 stability and function

    PubMed Central

    Kar, Swayamsiddha; Deb, Moonmoon; Sengupta, Dipta; Shilpi, Arunima; Parbin, Sabnam; Torrisani, Jérôme; Pradhan, Sriharsa; Patra, Samir Kumar

    2012-01-01

    DNA methylation is one of the principal epigenetic signals that participate in cell specific gene expression in vertebrates. DNA methylation plays a quintessential role in the control of gene expression, cellular differentiation and development. It also plays a central role in the preservation of chromatin structure and chromosomal integrity, parental imprinting, X-chromosome inactivation, aging and carcinogenesis. The foremost contributor in the mammalian methylation scheme is DNMT1, a maintenance methyltransferase that faithfully copies the pre-existing methyl marks onto hemimethylated daughter strands during DNA replication to maintain the established methylation patterns across successive cell divisions. The ever-changing cellular physiology and the significant part that DNA methylation plays in genome regulation necessitate rigid management of this enzyme. In mammalian cells, a host of intrinsic and extrinsic mechanisms regulate the expression, activity and stability of DNMT1. Transcriptional regulation, post-transcriptional auto-inhibitory controls and post-translational modifications of the enzyme are responsible for the efficient inheritance of DNA methylation patterns. Also, a large number of intra- and intercellular signaling cascades and numerous interactions with other modulator molecules that affect the catalytic activity of the enzyme at multiple levels function as major checkpoints of the DNMT1 control system. An in-depth understanding of the DNMT1 enzyme, its targeting and function is crucial for comprehending how DNA methylation is coordinated with other critical developmental and physiological processes. This review aims to provide a comprehensive account of the various regulatory mechanisms and interactions of DNMT1 so as to elucidate its function at the molecular level and understand the dynamics of DNA methylation at the cellular level. PMID:22894906

  17. Luteal regression vs. prepartum luteolysis: regulatory mechanisms governing canine corpus luteum function.

    PubMed

    Kowalewski, Mariusz P

    2014-04-01

    Canine reproductive physiology exhibits several unusual features. Among the most interesting of these are the lack of an acute luteolytic mechanism, coinciding with the apparent luteal independency of a uterine luteolysin in absence of pregnancy, contrasting with the acute prepartum luteolysis observed in pregnant animals. These features indicate the existence of mechanisms different from those in other species for regulating the extended luteal regression observed in non-pregnant dogs, and the actively regulated termination of luteal function observed prepartum as a prerequisite for parturition. Nevertheless, the supply of progesterone (P4) depends on corpora lutea (CL) as its primary source in both conditions, resulting in P4 levels that are similar in pregnant and non-pregnant bitches during almost the entire luteal life span prior to the prepartum luteolysis. Consequently, the duration of the prolonged luteal phase in non-pregnant bitches frequently exceeds that of pregnant ones, which is a peculiarity when compared with other domestic animal species. Both LH and prolactin (PRL) are endocrine luteotrophic factors in the dog, the latter being the predominant one. In spite of increased availability of these hormones, luteal regression/luteolysis still takes place. Recently, possible mechanisms regulating the expression and function of PRL receptor have been implicated in the local, i.e., intraluteal regulation of PRL bioavailability and thus its steroidogenic potential. Similar mechanisms may relate to the luteal LH receptor. Most recently, evidence has been provided for an autocrine/paracrine role of prostaglandin E2 (PGE2) as a luteotrophic factor in the canine CL acting at the level of steroidogenic acute regulatory (STAR)-protein mediated supply of steroidogenic substrate, without having a significant impact on the enzymatic activity of the respective steroidogenic enzymes, 3β-hydroxysteroid-dehydrogenase (3βHSD, HSD3B2) and cytochrome P450 side

  18. Binding-protein-dependent lactose transport in Agrobacterium radiobacter.

    PubMed

    Greenwood, J A; Cornish, A; Jones, C W

    1990-04-01

    Agrobacterium radiobacter NCIB 11883 was grown in lactose-limited continuous culture at a dilution rate of 0.045/h. Washed cells transported [14C]lactose and [methyl-14C]beta-D-thiogalactoside, a nonmetabolisable analog of lactose, at similar rates and with similar affinities (Km for transport, less than 1 microM). Transport was inhibited to various extents by the uncoupling agent carbonyl cyanide p-trifluoromethoxyphenylhydrazone, by unlabeled beta-galactosides and D-galactose, and by osmotic shock. The accumulation ratio for methyl-beta-D-thiogalactoside was greater than or equal to 4,100. An abundant protein (molecular weight, 41,000) was purified from osmotic-shock fluid and shown by equilibrium dialysis to bind lactose and methyl-beta-D-thiogalactoside, the former with very high affinity (binding constant, 0.14 microM). The N-terminal amino acid sequence of this lactose-binding protein exhibited some homology with several other sugar-binding proteins from bacteria. Antiserum raised against the lactose-binding protein did not cross-react with two glucose-binding proteins from A. radiobacter or with extracts of other bacteria grown under lactose limitation. Lactose transport and beta-galactosidase were induced in batch cultures by lactose, melibiose [O-alpha-D-galactoside-(1----6)alpha-D-glucose], and isopropyl-beta-D-thiogalactoside and were subject to catabolite repression by glucose, galactose, and succinate which was not alleviated by cyclic AMP. We conclude that lactose is transported into A. radiobacter via a binding protein-dependent active transport system (in contrast to the H+ symport and phosphotransferase systems found in other bacteria) and that the expression of this transport system is closely linked to that of beta-galactosidase.

  19. Mutational analysis of structural elements in a class-I cyclic di-GMP riboswitch to elucidate its regulatory mechanism.

    PubMed

    Inuzuka, Saki; Nishimura, Kei-Ichiro; Kakizawa, Hitoshi; Fujita, Yuki; Furuta, Hiroyuki; Matsumura, Shigeyoshi; Ikawa, Yoshiya

    2016-09-01

    The Vc2 riboswitch possesses an aptamer domain belonging to the class-I c-di-GMP riboswitch family. This domain has been analysed and the molecular mechanism by which it recognizes the c-di-GMP ligand has been elucidated. On the other hand, the regulatory mechanism of the full-length Vc2 riboswitch to control its downstream open reading frame (ORF) remains largely unknown. In this study, we performed in vivo reporter assays and in vitro biochemical analyses of the full-length riboswitch and its aptamer domain. We evaluated the results of in vivo and in vitro analyses to elucidate the regulatory mechanism of the Vc2 riboswitch. The present results suggest that recognition of c-di-GMP ligand by the Vc2 riboswitch aptamer domain downregulates expression of its downstream ORF primarily at the translational level.

  20. Acute inflammation in peritoneal dialysis: experimental studies in rats. Characterization of regulatory mechanisms.

    PubMed

    Bazargani, Farhan

    2005-01-01

    The predominant problems associated with peritoneal dialysis (PD) are ultrafiltration failure and peritonitis. PD maintains a state of intraperitoneal inflammation that affects the structure and function of the peritoneal membrane, potentially impairing ultrafiltration efficiency. Paradoxically, some PD fluids also have anti-inflammatory properties that may compromise the immune defense against peritonitis. This anti-inflammatory feature is mostly due to the glucose degradation products (GDPs), formed during heat-sterilization and storage of PD fluids. The main purpose of the present thesis was to study regulatory mechanisms behind the acute intraperitoneal inflammatory response in PD in the presence and absence of experimental peritonitis. Rats were exposed to a single dose of heat- or filter sterilized PD fluids either as an i.p. injection or as an infusion through an indwelling catheter, with or without supplementations, or pretreatment of the animals. The dwell fluid was analyzed zero, two and four hours later concerning activation of the complement and coagulation cascades, neutrophil recruitment and respiratory burst, ultrafiltration volumes, cytokine-induced neutrophil chemoattractant (CINC-1), rat mast cell protease 2 (RMCP-2), glucose, urea and histamine concentrations and ex vivo/in vitro intraperitoneal chemotactic activity. Exposure to filter sterilized PD fluid alone induced intraperitoneal complement activation and coagulation, neutrophil recruitment and increased the levels of CINC-1 during the dwell. Intraperitoneal concentrations of the mast cell markers histamine and RMCP-2 changed little during the dwells and did not indicate mast cell activation. Low molecular weight heparin (LMWH) and C5 blockade improved ultrafiltration. Pretreatment with cobra venom factor, known decomplementing agent, blocked the CINC-1 release and the neutrophil recruitment and improved ultrafiltration. In combination with experimental peritonitis, heat sterilized PD fluid

  1. Heart Rate Variability: New Perspectives on Physiological Mechanisms, Assessment of Self-regulatory Capacity, and Health risk.

    PubMed

    McCraty, Rollin; Shaffer, Fred

    2015-01-01

    Heart rate variability, the change in the time intervals between adjacent heartbeats, is an emergent property of interdependent regulatory systems that operates on different time scales to adapt to environmental and psychological challenges. This article briefly reviews neural regulation of the heart and offers some new perspectives on mechanisms underlying the very low frequency rhythm of heart rate variability. Interpretation of heart rate variability rhythms in the context of health risk and physiological and psychological self-regulatory capacity assessment is discussed. The cardiovascular regulatory centers in the spinal cord and medulla integrate inputs from higher brain centers with afferent cardiovascular system inputs to adjust heart rate and blood pressure via sympathetic and parasympathetic efferent pathways. We also discuss the intrinsic cardiac nervous system and the heart-brain connection pathways, through which afferent information can influence activity in the subcortical, frontocortical, and motor cortex areas. In addition, the use of real-time HRV feedback to increase self-regulatory capacity is reviewed. We conclude that the heart's rhythms are characterized by both complexity and stability over longer time scales that reflect both physiological and psychological functional status of these internal self-regulatory systems.

  2. Heart Rate Variability: New Perspectives on Physiological Mechanisms, Assessment of Self-regulatory Capacity, and Health risk

    PubMed Central

    Shaffer, Fred

    2015-01-01

    Heart rate variability, the change in the time intervals between adjacent heartbeats, is an emergent property of interdependent regulatory systems that operates on different time scales to adapt to environmental and psychological challenges. This article briefly reviews neural regulation of the heart and offers some new perspectives on mechanisms underlying the very low frequency rhythm of heart rate variability. Interpretation of heart rate variability rhythms in the context of health risk and physiological and psychological self-regulatory capacity assessment is discussed. The cardiovascular regulatory centers in the spinal cord and medulla integrate inputs from higher brain centers with afferent cardiovascular system inputs to adjust heart rate and blood pressure via sympathetic and parasympathetic efferent pathways. We also discuss the intrinsic cardiac nervous system and the heart-brain connection pathways, through which afferent information can influence activity in the subcortical, frontocortical, and motor cortex areas. In addition, the use of real-time HRV feedback to increase self-regulatory capacity is reviewed. We conclude that the heart's rhythms are characterized by both complexity and stability over longer time scales that reflect both physiological and psychological functional status of these internal self-regulatory systems. PMID:25694852

  3. microRNA regulatory mechanism by which PLLA aligned nanofibers influence PC12 cell differentiation

    NASA Astrophysics Data System (ADS)

    Yu, Yadong; Lü, Xiaoying; Ding, Fei

    2015-08-01

    Objective. Aligned nanofibers (AFs) are regarded as promising biomaterials in nerve tissue engineering. However, a full understanding of the biocompatibility of AFs at the molecular level is still challenging. Therefore, the present study focused on identifying the microRNA (miRNA)-mediated regulatory mechanism by which poly-L-lactic acid (PLLA) AFs influence PC12 cell differentiation. Approach. Firstly, the effects of PLLA random nanofibers (RFs)/AFs and PLLA films (control) on the biological responses of PC12 cells that are associated with neuronal differentiation were examined. Then, SOLiD sequencing and cDNA microarray were employed to profile the expressions of miRNAs and mRNAs. The target genes of the misregulated miRNAs were predicted and compared with the mRNA profile data. Functions of the matched target genes (the intersection between the predicted target genes and the experimentally-determined, misregulated genes) were analyzed. Main results. The results revealed that neurites spread in various directions in control and RF groups. In the AF group, most neurites extended in parallel with each other. The glucose consumption and lactic acid production in the RF and AF groups were higher than those in the control group. Compared with the control group, 42 and 94 miRNAs were significantly dysregulated in the RF and AF groups, respectively. By comparing the predicted target genes with the mRNA profile data, five and 87 matched target genes were found in the RF and AF groups, respectively. Three of the matched target genes in the AF group were found to be associated with neuronal differentiation, whereas none had this association in the RF group. The PLLA AFs induced the dysregulation of miRNAs that regulate many biological functions, including axonal guidance, lipid metabolism and long-term potentiation. In particular, two miRNA-matched target gene-biological function modules associated with neuronal differentiation were identified as follows: (1) miR-23b, mi

  4. Deciphering Transcriptional Regulatory Mechanisms Associated with Hemicellulose Degradation in Neurospora crassa

    PubMed Central

    Sun, Jianping; Tian, Chaoguang; Diamond, Spencer

    2012-01-01

    Hemicellulose, the second most abundant plant biomass fraction after cellulose, is widely viewed as a potential substrate for the production of liquid fuels and other value-added materials. Degradation of hemicellulose by filamentous fungi requires production of many different enzymes, which are induced by biopolymers or its derivatives and regulated mainly at the transcriptional level through transcription factors (TFs). Neurospora crassa, a model filamentous fungus, expresses and secretes enzymes required for plant cell wall deconstruction. To better understand genes specifically associated with degradation of hemicellulose, we applied secretome and transcriptome analysis to N. crassa grown on beechwood xylan. We identified 34 secreted proteins and 353 genes with elevated transcription on xylan. The xylanolytic phenotype of strains with deletions in genes identified from the secretome and transcriptome analysis of the wild type was assessed, revealing functions for known and unknown proteins associated with hemicellulose degradation. By evaluating phenotypes of strains containing deletions of predicted TF genes in N. crassa, we identified a TF (XLR-1; xylan degradation regulator 1) essential for hemicellulose degradation that is an ortholog to XlnR/XYR1 in Aspergillus and Trichoderma species, respectively, a major transcriptional regulator of genes encoding both cellulases and hemicellulases. Deletion of xlr-1 in N. crassa abolished growth on xylan and xylose, but growth on cellulose and cellulolytic activity were only slightly affected. To determine the regulatory mechanisms for hemicellulose degradation, we explored the transcriptional regulon of XLR-1 under xylose, xylanolytic, and cellulolytic conditions. XLR-1 regulated only some predicted hemicellulase genes in N. crassa and was required for a full induction of several cellulase genes. Hemicellulase gene expression was induced by a combination of release from carbon catabolite repression (CCR) and induction

  5. Regulatory mechanisms underlying sepsis progression in patients with tumor necrosis factor-α genetic variations

    PubMed Central

    LIU, YANGZHOU; HAN, NING; LI, QINCHUAN; LI, ZENGCHUN

    2016-01-01

    The present study aimed to investigate the regulatory mechanisms underlying sepsis progression in patients with tumor necrosis factor (TNF)-α genetic variations. The GSE5760 expression profile data, which was downloaded from the Gene Expression Omnibus database, contained 30 wild-type (WT) and 28 mutation (MUT) samples. Differentially expressed genes (DEGs) between the two types of samples were identified using the Student's t-test, and the corresponding microRNAs (miRNAs) were screened using WebGestalt software. An integrated miRNA-DEG network was constructed using the Cytoscape software, based on the interactions between the DEGs, as identified using the Search Tool for the Retrieval of Interacting Genes/Proteins database, and the correlation between miRNAs and their target genes. Furthermore, Gene Ontology and pathway enrichment analyses were conducted for the DEGs using the Database for Annotation, Visualization and Integrated Discovery and the KEGG Orthology Based Annotation System, respectively. A total of 390 DEGS between the WT and MUT samples, along with 11 -associated miRNAs, were identified. The integrated miRNA-DEG network consisted of 38 DEGs and 11 miRNAs. Within this network, COPS2 was found to be associated with transcriptional functions, while FUS was found to be involved in mRNA metabolic processes. Other DEGs, including FBXW7 and CUL3, were enriched in the ubiquitin-mediated proteolysis pathway. In addition, miR-15 was predicted to target COPS2 and CUL3. The results of the present study suggested that COPS2, FUS, FBXW7 and CUL3 may be associated with sepsis in patients with TNF-α genetic variations. In the progression of sepsis, FBXW7 and CUL3 may participate in the ubiquitin-mediated proteolysis pathway, whereas COPS2 may regulate the phosphorylation and ubiquitination of the FUS protein. Furthermore, COPS2 and CUL3 may be novel targets of miR-15. PMID:27347057

  6. Nitrous Oxide Metabolism in Nitrate-Reducing Bacteria: Physiology and Regulatory Mechanisms.

    PubMed

    Torres, M J; Simon, J; Rowley, G; Bedmar, E J; Richardson, D J; Gates, A J; Delgado, M J

    2016-01-01

    Nitrous oxide (N2O) is an important greenhouse gas (GHG) with substantial global warming potential and also contributes to ozone depletion through photochemical nitric oxide (NO) production in the stratosphere. The negative effects of N2O on climate and stratospheric ozone make N2O mitigation an international challenge. More than 60% of global N2O emissions are emitted from agricultural soils mainly due to the application of synthetic nitrogen-containing fertilizers. Thus, mitigation strategies must be developed which increase (or at least do not negatively impact) on agricultural efficiency whilst decrease the levels of N2O released. This aim is particularly important in the context of the ever expanding population and subsequent increased burden on the food chain. More than two-thirds of N2O emissions from soils can be attributed to bacterial and fungal denitrification and nitrification processes. In ammonia-oxidizing bacteria, N2O is formed through the oxidation of hydroxylamine to nitrite. In denitrifiers, nitrate is reduced to N2 via nitrite, NO and N2O production. In addition to denitrification, respiratory nitrate ammonification (also termed dissimilatory nitrate reduction to ammonium) is another important nitrate-reducing mechanism in soil, responsible for the loss of nitrate and production of N2O from reduction of NO that is formed as a by-product of the reduction process. This review will synthesize our current understanding of the environmental, regulatory and biochemical control of N2O emissions by nitrate-reducing bacteria and point to new solutions for agricultural GHG mitigation. PMID:27134026

  7. RNA-Binding Proteins in Trichomonas vaginalis: Atypical Multifunctional Proteins Involved in a Posttranscriptional Iron Regulatory Mechanism

    PubMed Central

    Figueroa-Angulo, Elisa E.; Calla-Choque, Jaeson S.; Mancilla-Olea, Maria Inocente; Arroyo, Rossana

    2015-01-01

    Iron homeostasis is highly regulated in vertebrates through a regulatory system mediated by RNA-protein interactions between the iron regulatory proteins (IRPs) that interact with an iron responsive element (IRE) located in certain mRNAs, dubbed the IRE-IRP regulatory system. Trichomonas vaginalis, the causal agent of trichomoniasis, presents high iron dependency to regulate its growth, metabolism, and virulence properties. Although T. vaginalis lacks IRPs or proteins with aconitase activity, possesses gene expression mechanisms of iron regulation at the transcriptional and posttranscriptional levels. However, only one gene with iron regulation at the transcriptional level has been described. Recently, our research group described an iron posttranscriptional regulatory mechanism in the T. vaginalis tvcp4 and tvcp12 cysteine proteinase mRNAs. The tvcp4 and tvcp12 mRNAs have a stem-loop structure in the 5'-coding region or in the 3'-UTR, respectively that interacts with T. vaginalis multifunctional proteins HSP70, α-Actinin, and Actin under iron starvation condition, causing translation inhibition or mRNA stabilization similar to the previously characterized IRE-IRP system in eukaryotes. Herein, we summarize recent progress and shed some light on atypical RNA-binding proteins that may participate in the iron posttranscriptional regulation in T. vaginalis. PMID:26703754

  8. Regulatory Mechanisms of the Molecular Pathways in Fibrosis Induced by MicroRNAs

    PubMed Central

    Yang, Cui; Zheng, Si-Dao; Wu, Hong-Jin; Chen, Shao-Jun

    2016-01-01

    Objective: MicroRNAs (miRNAs or miRs) play critical roles in the fibrotic process in different organs. We summarized the latest research progress on the roles and mechanisms of miRNAs in the regulation of the molecular signaling pathways involved in fibrosis. Data Sources: Papers published in English from January 2010 to August 2015 were selected from the PubMed and Web of Science databases using the search terms “microRNA”, “miR”, “transforming growth factor β”, “tgf β”, “mitogen-activated protein kinase”, “mapk”, “integrin”, “p38”, “c-Jun NH2-terminal kinase”, “jnk”, “extracellular signal-regulated kinase”, “erk”, and “fibrosis”. Study Selection: Articles were obtained and reviewed to analyze the regulatory effects of miRNAs on molecular signaling pathways involved in the fibrosis. Results: Recent evidence has shown that miRNAs are involved in regulating fibrosis by targeting different substrates in the molecular processes that drive fibrosis, such as immune cell sensitization, effector cell activation, and extracellular matrix remodeling. Moreover, several important molecular signaling pathways involve in fibrosis, such as the transforming growth factor-beta (TGF-β) pathway, mitogen-activated protein kinase (MAPK) pathways, and the integrin pathway are regulated by miRNAs. Third, regulation of the fibrotic pathways induced by miRNAs is found in many other tissues in addition to the heart, lung, liver, and kidney. Interestingly, the actions of many drugs on the human body are also induced by miRNAs. It is encouraging that the fibrotic process can be blocked or reversed by targeting specific miRNAs and their signaling pathways, thereby protecting the structures and functions of different organs. Conclusions: miRNAs not only regulate molecular signaling pathways in fibrosis but also serve as potential targets of novel therapeutic interventions for fibrosing diseases. PMID:27647197

  9. Identification and characterization of the novel Col10a1 regulatory mechanism during chondrocyte hypertrophic differentiation

    PubMed Central

    Gu, J; Lu, Y; Li, F; Qiao, L; Wang, Q; Li, N; Borgia, J A; Deng, Y; Lei, G; Zheng, Q

    2014-01-01

    hypertrophic MCT cells. Electrophoretic mobility shift assay and chromatin immunoprecipitation assays confirmed the interaction between Cox-2 and Col10a1 cis-enhancer, supporting its role as a candidate Col10a1 regulator. Together, our data support a Cox-2-containing, Runx2-centered Col10a1 regulatory mechanism, during chondrocyte hypertrophic differentiation. PMID:25321476

  10. [Peripheral blood circulation in the skin and the regulatory mechanisms in the course of primary transmural myocardial infarction].

    PubMed

    Khalepo, O V; Molotkov, O V; Eshkina, S L

    2009-01-01

    Laser Doppler flowmetry was used to study the indicators characterizing the peripheral blood circulation in the skin, regulatory mechanisms, and the compensatory capacities of the microcirculatory bed in 32 patients aged 45-60 years in the course of primary transmural myocardial infarction during exercise tests. Significant disturbances of the mechanism responsible for regulating the peripheral blood circulation system and chiefly its active components were detected in the presence of adequate blood filling of microvessels. There was a drastic decrease in the reserves of skin microvascular endothelial activity during ionophoresis of sodium nitroprusside and acetylcholine, the maximum degree of disturbances being observed on day 10 of myocardial infarction development.

  11. Regulatory T cells and dendritic cells in transplantation tolerance: molecular markers and mechanisms.

    PubMed

    Cobbold, Stephen P; Nolan, Kathleen F; Graca, Luis; Castejon, Raquel; Le Moine, Alain; Frewin, Mark; Humm, Susan; Adams, Elizabeth; Thompson, Sara; Zelenika, Diana; Paterson, Alison; Yates, Stephen; Fairchild, Paul J; Waldmann, Herman

    2003-12-01

    Transplantation tolerance can be induced in adult rodents using monoclonal antibodies against coreceptor or costimulation molecules on the surface of T cells. There are currently two well-characterized populations of T cells, demonstrating regulatory capacity: the "natural" CD4+CD25+ T cells and the interleukin (IL)-10-producing Tr1 cells. Although both types of regulatory T cells can induce transplantation tolerance under appropriate conditions, it is not clear whether either one plays any role in drug-induced dominant tolerance, primarily due to a lack of clear-cut molecular or functional markers. Similarly, although dendritic cells (DCs) can be pharmacologically manipulated to promote tolerance, the phenotype of such populations remains poorly defined. We have used serial analysis of gene expression (SAGE) with 29 different T-cell and antigen-presenting cell libraries to identify gene-expression signatures associated with immune regulation. We found that independently derived, regulatory Tr1-like clones were highly concordant in their patterns of gene expression but were quite distinct from CD4+CD25+ regulatory T cells from the spleen. DCs that were treated with the tolerance-enhancing agents IL-10 or vitamin D3 expressed a gene signature reflecting a functional specification in common with the most immature DCs derived from embryonic stem cells. PMID:14617201

  12. Biofilm formation by Bacillus subtilis: new insights into regulatory strategies and assembly mechanisms

    PubMed Central

    Cairns, Lynne S; Hobley, Laura; Stanley-Wall, Nicola R

    2014-01-01

    Biofilm formation is a social behaviour that generates favourable conditions for sustained survival in the natural environment. For the Gram-positive bacterium Bacillus subtilis the process involves the differentiation of cell fate within an isogenic population and the production of communal goods that form the biofilm matrix. Here we review recent progress in understanding the regulatory pathways that control biofilm formation and highlight developments in understanding the composition, function and structure of the biofilm matrix. PMID:24988880

  13. De Novo Evolution of Complex, Global and Hierarchical Gene Regulatory Mechanisms

    PubMed Central

    Jenkins, Dafyd J.

    2010-01-01

    Gene regulatory networks exhibit complex, hierarchical features such as global regulation and network motifs. There is much debate about whether the evolutionary origins of such features are the results of adaptation, or the by-products of non-adaptive processes of DNA replication. The lack of availability of gene regulatory networks of ancestor species on evolutionary timescales makes this a particularly difficult problem to resolve. Digital organisms, however, can be used to provide a complete evolutionary record of lineages. We use a biologically realistic evolutionary model that includes gene expression, regulation, metabolism and biosynthesis, to investigate the evolution of complex function in gene regulatory networks. We discover that: (i) network architecture and complexity evolve in response to environmental complexity, (ii) global gene regulation is selected for in complex environments, (iii) complex, inter-connected, hierarchical structures evolve in stages, with energy regulation preceding stress responses, and stress responses preceding growth rate adaptations and (iv) robustness of evolved models to mutations depends on hierarchical level: energy regulation and stress responses tend not to be robust to mutations, whereas growth rate adaptations are more robust and non-lethal when mutated. These results highlight the adaptive and incremental evolution of complex biological networks, and the value and potential of studying realistic in silico evolutionary systems as a way of understanding living systems. Electronic supplementary material The online version of this article (doi:10.1007/s00239-010-9369-4) contains supplementary material, which is available to authorized users. PMID:20680619

  14. CHOOSING A CHEMICAL MECHANISM FOR REGULATORY AND RESEARCH AIR QUALITY MODELING APPLICATIONS

    EPA Science Inventory

    There are numerous, different chemical mechanisms currently available for use in air quality models, and new mechanisms and versions of mechanisms are continually being developed. The development of Morphecule-type mechanisms will add a near-infinite number of additional mecha...

  15. Role of Sodium Bicarbonate Cotransporters in Intracellular pH Regulation and Their Regulatory Mechanisms in Human Submandibular Glands.

    PubMed

    Namkoong, Eun; Shin, Yong-Hwan; Bae, Jun-Seok; Choi, Seulki; Kim, Minkyoung; Kim, Nahyun; Hwang, Sung-Min; Park, Kyungpyo

    2015-01-01

    Sodium bicarbonate cotransporters (NBCs) are involved in the pH regulation of salivary glands. However, the roles and regulatory mechanisms among different NBC isotypes have not been rigorously evaluated. We investigated the roles of two different types of NBCs, electroneutral (NBCn1) and electrogenic NBC (NBCe1), with respect to pH regulation and regulatory mechanisms using human submandibular glands (hSMGs) and HSG cells. Intracellular pH (pHi) was measured and the pHi recovery rate from cell acidification induced by an NH4Cl pulse was recorded. Subcellular localization and protein phosphorylation were determined using immunohistochemistry and co-immunoprecipitation techniques. We determined that NBCn1 is expressed on the basolateral side of acinar cells and the apical side of duct cells, while NBCe1 is exclusively expressed on the apical membrane of duct cells. The pHi recovery rate in hSMG acinar cells, which only express NBCn1, was not affected by pre-incubation with 5 μM PP2, an Src tyrosine kinase inhibitor. However, in HSG cells, which express both NBCe1 and NBCn1, the pHi recovery rate was inhibited by PP2. The apparent difference in regulatory mechanisms for NBCn1 and NBCe1 was evaluated by artificial overexpression of NBCn1 or NBCe1 in HSG cells, which revealed that the pHi recovery rate was only inhibited by PP2 in cells overexpressing NBCe1. Furthermore, only NBCe1 was significantly phosphorylated and translocated by NH4Cl, which was inhibited by PP2. Our results suggest that both NBCn1 and NBCe1 play a role in pHi regulation in hSMG acinar cells, and also that Src kinase does not regulate the activity of NBCn1.

  16. Activation of Vago by interferon regulatory factor (IRF) suggests an interferon system-like antiviral mechanism in shrimp.

    PubMed

    Li, Chaozheng; Li, Haoyang; Chen, Yixiao; Chen, Yonggui; Wang, Sheng; Weng, Shao-Ping; Xu, Xiaopeng; He, Jianguo

    2015-01-01

    There is a debate on whether invertebrates possess an antiviral immunity similar to the interferon (IFN) system of vertebrates. The Vago gene from arthropods encodes a viral-activated secreted peptide that restricts virus infection through activating the JAK-STAT pathway and is considered to be a cytokine functionally similar to IFN. In this study, the first crustacean IFN regulatory factor (IRF)-like gene was identified in Pacific white shrimp, Litopenaeus vannamei. The L. vannamei IRF showed similar protein nature to mammalian IRFs and could be activated during virus infection. As a transcriptional regulatory factor, L. vannamei IRF could activate the IFN-stimulated response element (ISRE)-containing promoter to regulate the expression of mammalian type I IFNs and initiate an antiviral state in mammalian cells. More importantly, IRF could bind the 5'-untranslated region of L. vannamei Vago4 gene and activate its transcription, suggesting that shrimp Vago may be induced in a similar manner to that of IFNs and supporting the opinion that Vago might function as an IFN-like molecule in invertebrates. These suggested that shrimp might possess an IRF-Vago-JAK/STAT regulatory axis, which is similar to the IRF-IFN-JAK/STAT axis of vertebrates, indicating that invertebrates might possess an IFN system-like antiviral mechanism.

  17. Activation of Vago by interferon regulatory factor (IRF) suggests an interferon system-like antiviral mechanism in shrimp

    PubMed Central

    Li, Chaozheng; Li, Haoyang; Chen, Yixiao; Chen, Yonggui; Wang, Sheng; Weng, Shao-Ping; Xu, Xiaopeng; He, Jianguo

    2015-01-01

    There is a debate on whether invertebrates possess an antiviral immunity similar to the interferon (IFN) system of vertebrates. The Vago gene from arthropods encodes a viral-activated secreted peptide that restricts virus infection through activating the JAK-STAT pathway and is considered to be a cytokine functionally similar to IFN. In this study, the first crustacean IFN regulatory factor (IRF)-like gene was identified in Pacific white shrimp, Litopenaeus vannamei. The L. vannamei IRF showed similar protein nature to mammalian IRFs and could be activated during virus infection. As a transcriptional regulatory factor, L. vannamei IRF could activate the IFN-stimulated response element (ISRE)-containing promoter to regulate the expression of mammalian type I IFNs and initiate an antiviral state in mammalian cells. More importantly, IRF could bind the 5′-untranslated region of L. vannamei Vago4 gene and activate its transcription, suggesting that shrimp Vago may be induced in a similar manner to that of IFNs and supporting the opinion that Vago might function as an IFN-like molecule in invertebrates. These suggested that shrimp might possess an IRF-Vago-JAK/STAT regulatory axis, which is similar to the IRF-IFN-JAK/STAT axis of vertebrates, indicating that invertebrates might possess an IFN system-like antiviral mechanism. PMID:26459861

  18. Mosaic gene network modelling identified new regulatory mechanisms in HCV infection.

    PubMed

    Popik, Olga V; Petrovskiy, Evgeny D; Mishchenko, Elena L; Lavrik, Inna N; Ivanisenko, Vladimir A

    2016-06-15

    Modelling of gene networks is widely used in systems biology to study the functioning of complex biological systems. Most of the existing mathematical modelling techniques are useful for analysis of well-studied biological processes, for which information on rates of reactions is available. However, complex biological processes such as those determining the phenotypic traits of organisms or pathological disease processes, including pathogen-host interactions, involve complicated cross-talk between interacting networks. Furthermore, the intrinsic details of the interactions between these networks are often missing. In this study, we developed an approach, which we call mosaic network modelling, that allows the combination of independent mathematical models of gene regulatory networks and, thereby, description of complex biological systems. The advantage of this approach is that it allows us to generate the integrated model despite the fact that information on molecular interactions between parts of the model (so-called mosaic fragments) might be missing. To generate a mosaic mathematical model, we used control theory and mathematical models, written in the form of a system of ordinary differential equations (ODEs). In the present study, we investigated the efficiency of this method in modelling the dynamics of more than 10,000 simulated mosaic regulatory networks consisting of two pieces. Analysis revealed that this approach was highly efficient, as the mean deviation of the dynamics of mosaic network elements from the behaviour of the initial parts of the model was less than 10%. It turned out that for construction of the control functional, data on perturbation of one or two vertices of the mosaic piece are sufficient. Further, we used the developed method to construct a mosaic gene regulatory network including hepatitis C virus (HCV) as the first piece and the tumour necrosis factor (TNF)-induced apoptosis and NF-κB induction pathways as the second piece. Thus

  19. Mosaic gene network modelling identified new regulatory mechanisms in HCV infection.

    PubMed

    Popik, Olga V; Petrovskiy, Evgeny D; Mishchenko, Elena L; Lavrik, Inna N; Ivanisenko, Vladimir A

    2016-06-15

    Modelling of gene networks is widely used in systems biology to study the functioning of complex biological systems. Most of the existing mathematical modelling techniques are useful for analysis of well-studied biological processes, for which information on rates of reactions is available. However, complex biological processes such as those determining the phenotypic traits of organisms or pathological disease processes, including pathogen-host interactions, involve complicated cross-talk between interacting networks. Furthermore, the intrinsic details of the interactions between these networks are often missing. In this study, we developed an approach, which we call mosaic network modelling, that allows the combination of independent mathematical models of gene regulatory networks and, thereby, description of complex biological systems. The advantage of this approach is that it allows us to generate the integrated model despite the fact that information on molecular interactions between parts of the model (so-called mosaic fragments) might be missing. To generate a mosaic mathematical model, we used control theory and mathematical models, written in the form of a system of ordinary differential equations (ODEs). In the present study, we investigated the efficiency of this method in modelling the dynamics of more than 10,000 simulated mosaic regulatory networks consisting of two pieces. Analysis revealed that this approach was highly efficient, as the mean deviation of the dynamics of mosaic network elements from the behaviour of the initial parts of the model was less than 10%. It turned out that for construction of the control functional, data on perturbation of one or two vertices of the mosaic piece are sufficient. Further, we used the developed method to construct a mosaic gene regulatory network including hepatitis C virus (HCV) as the first piece and the tumour necrosis factor (TNF)-induced apoptosis and NF-κB induction pathways as the second piece. Thus

  20. Nicotiana tabacum protoplasts secretome can evidence relations among regulatory elements of exocytosis mechanisms.

    PubMed

    Ul-Rehman, Reiaz; Rinalducci, Sara; Zolla, Lello; Dalessandro, Giuseppe; Di Sansebastiano, Gian Pietro

    2011-08-01

    An alternative study involving proteome analysis of the 24 hour Nicotiana tabacum protoplast culture medium was performed with the aim to confirm relations among regulatory elements of exocytotic processes. Protoplasts present many convenient features to study cellular processes during transient over-expression or suppression of specific gene's products. We performed a proteomic analysis of the culture medium fraction of protoplasts transiently expressing transgenes for 24 hours to characterize the effect of various regulatory proteins dominant negative mutants. A total number of 49 spots were found reproducible in the medium. 24 of these spots were identified with nano RP-HPLC-ESI-MS/MS. Only three and six spots were respectively identified as canonical and non-canonical secreted cell wall proteins. The low number of spots present in the culture medium fraction allowed us the ambitious experiment to analyze the influence of various SNAREs (SYP121, SYP122, SNAP33) and Rab (Rab11) dominant negative mutants. Missing a reasonable number of identified proteins the analyses gave rise to a similarity matrix statistically analyzed considering variation within the presence of 24 spots reproducible in presence of transient over-expression of SNAREs (SYP121 and SYP122) and Rab11 native cDNAs. The similarity confirmed the closer relation between the function of SYP122 and Rab11 as evidenced by the secRGUS based analysis. This analysis included the effect of SNAP33 DN mutant and showed that this Qb-c-SNARE influence both SYP121 and SYP122 SNARE complexes.

  1. High-precision, in vitro validation of the sequestration mechanism for generating ultrasensitive dose-response curves in regulatory networks.

    PubMed

    Ricci, Francesco; Vallée-Bélisle, Alexis; Plaxco, Kevin W

    2011-10-01

    Our ability to recreate complex biochemical mechanisms in designed, artificial systems provides a stringent test of our understanding of these mechanisms and opens the door to their exploitation in artificial biotechnologies. Motivated by this philosophy, here we have recapitulated in vitro the "target sequestration" mechanism used by nature to improve the sensitivity (the steepness of the input/output curve) of many regulatory cascades. Specifically, we have employed molecular beacons, a commonly employed optical DNA sensor, to recreate the sequestration mechanism and performed an exhaustive, quantitative study of its key determinants (e.g., the relative concentrations and affinities of probe and depletant). We show that, using sequestration, we can narrow the pseudo-linear range of a traditional molecular beacon from 81-fold (i.e., the transition from 10% to 90% target occupancy spans an 81-fold change in target concentration) to just 1.5-fold. This narrowing of the dynamic range improves the sensitivity of molecular beacons to that equivalent of an oligomeric, allosteric receptor with a Hill coefficient greater than 9. Following this we have adapted the sequestration mechanism to steepen the binding-site occupancy curve of a common transcription factor by an order of magnitude over the sensitivity observed in the absence of sequestration. Given the success with which the sequestration mechanism has been employed by nature, we believe that this strategy could dramatically improve the performance of synthetic biological systems and artificial biosensors.

  2. Potential Novel Mechanism for Axenfeld-Rieger Syndrome: Deletion of a Distant Region Containing Regulatory Elements of PITX2

    PubMed Central

    Volkmann, Bethany A.; Zinkevich, Natalya S.; Mustonen, Aki; Schilter, Kala F.; Bosenko, Dmitry V.; Reis, Linda M.; Broeckel, Ulrich; Link, Brian A.

    2011-01-01

    Purpose. Mutations in PITX2 are associated with Axenfeld-Rieger syndrome (ARS), which involves ocular, dental, and umbilical abnormalities. Identification of cis-regulatory elements of PITX2 is important to better understand the mechanisms of disease. Methods. Conserved noncoding elements surrounding PITX2/pitx2 were identified and examined through transgenic analysis in zebrafish; expression pattern was studied by in situ hybridization. Patient samples were screened for deletion/duplication of the PITX2 upstream region using arrays and probes. Results. Zebrafish pitx2 demonstrates conserved expression during ocular and craniofacial development. Thirteen conserved noncoding sequences positioned within a gene desert as far as 1.1 Mb upstream of the human PITX2 gene were identified; 11 have enhancer activities consistent with pitx2 expression. Ten elements mediated expression in the developing brain, four regions were active during eye formation, and two sequences were associated with craniofacial expression. One region, CE4, located approximately 111 kb upstream of PITX2, directed a complex pattern including expression in the developing eye and craniofacial region, the classic sites affected in ARS. Screening of ARS patients identified an approximately 7600-kb deletion that began 106 to 108 kb upstream of the PITX2 gene, leaving PITX2 intact while removing regulatory elements CE4 to CE13. Conclusions. These data suggest the presence of a complex distant regulatory matrix within the gene desert located upstream of PITX2 with an essential role in its activity and provides a possible mechanism for the previous reports of ARS in patients with balanced translocations involving the 4q25 region upstream of PITX2 and the current patient with an upstream deletion. PMID:20881290

  3. Transcriptional regulatory network triggered by oxidative signals configures the early response mechanisms of japonica rice to chilling stress

    PubMed Central

    2010-01-01

    Background The transcriptional regulatory network involved in low temperature response leading to acclimation has been established in Arabidopsis. In japonica rice, which can only withstand transient exposure to milder cold stress (10°C), an oxidative-mediated network has been proposed to play a key role in configuring early responses and short-term defenses. The components, hierarchical organization and physiological consequences of this network were further dissected by a systems-level approach. Results Regulatory clusters responding directly to oxidative signals were prominent during the initial 6 to 12 hours at 10°C. Early events mirrored a typical oxidative response based on striking similarities of the transcriptome to disease, elicitor and wounding induced processes. Targets of oxidative-mediated mechanisms are likely regulated by several classes of bZIP factors acting on as1/ocs/TGA-like element enriched clusters, ERF factors acting on GCC-box/JAre-like element enriched clusters and R2R3-MYB factors acting on MYB2-like element enriched clusters. Temporal induction of several H2O2-induced bZIP, ERF and MYB genes coincided with the transient H2O2 spikes within the initial 6 to 12 hours. Oxidative-independent responses involve DREB/CBF, RAP2 and RAV1 factors acting on DRE/CRT/rav1-like enriched clusters and bZIP factors acting on ABRE-like enriched clusters. Oxidative-mediated clusters were activated earlier than ABA-mediated clusters. Conclusion Genome-wide, physiological and whole-plant level analyses established a holistic view of chilling stress response mechanism of japonica rice. Early response regulatory network triggered by oxidative signals is critical for prolonged survival under sub-optimal temperature. Integration of stress and developmental responses leads to modulated growth and vigor maintenance contributing to a delay of plastic injuries. PMID:20100339

  4. A meta-analysis of caloric restriction gene expression profiles to infer common signatures and regulatory mechanisms.

    PubMed

    Plank, Michael; Wuttke, Daniel; van Dam, Sipko; Clarke, Susan A; de Magalhães, João Pedro

    2012-04-01

    Caloric restriction, a reduction in calorie intake without malnutrition, retards age-related degeneration and extends lifespan in several organisms. CR induces multiple changes, yet its underlying mechanisms remain poorly understood. In this work, we first performed a meta-analysis of microarray CR studies in mammals and identified genes and processes robustly altered due to CR. Our results reveal a complex array of CR-induced changes and we re-identified several genes and processes previously associated with CR, such as growth hormone signalling, lipid metabolism and immune response. Moreover, our results highlight novel associations with CR, such as retinol metabolism and copper ion detoxification, as well as hint of a strong effect of CR on circadian rhythms that in turn may contribute to metabolic changes. Analyses of our signatures by integrating co-expression data, information on genetic mutants, and transcription factor binding site analysis revealed candidate regulators of transcriptional modules in CR. Our results hint at a transcriptional module involved in sterol metabolism regulated by Srebf1. A putative regulatory role of Ppara was also identified. Overall, our conserved molecular signatures of CR provide a comprehensive picture of CR-induced changes and help understand its regulatory mechanisms.

  5. Antigen-specific expansion of human regulatory T cells as a major tolerance mechanism against mucosal fungi.

    PubMed

    Bacher, P; Kniemeyer, O; Schönbrunn, A; Sawitzki, B; Assenmacher, M; Rietschel, E; Steinbach, A; Cornely, O A; Brakhage, A A; Thiel, A; Scheffold, A

    2014-07-01

    Foxp3(+) regulatory T cells (Treg) have a central role for keeping the balance between pro- and anti-inflammatory immune responses against chronically encountered antigens at mucosal sites. However, their antigen specificity especially in humans is largely unknown. Here we used a sensitive enrichment technology for antigen-reactive T cells to directly compare the conventional vs. regulatory CD4(+) T-cell response directed against two ubiquitous mucosal fungi, Aspergillus fumigatus and Candida albicans. In healthy humans, fungus-specific CD4(+)CD25(+)CD127(-)Foxp3(+) Treg are strongly expanded in peripheral blood and possess phenotypic, epigenetic and functional features of thymus-derived Treg. Intriguingly, for A. fumigatus, the strong Treg response contrasts with minimal conventional T-cell memory, indicating selective Treg expansion as an effective mechanism to prevent inappropriate immune activation in healthy individuals. By contrast, in subjects with A. fumigatus allergies, specific Th2 cells were strongly expanded despite the presence of specific Treg. Taken together, we demonstrate a largely expanded Treg population specific for mucosal fungi as part of the physiological human T-cell repertoire and identify a unique capacity of A. fumigatus to selectively generate Treg responses as a potentially important mechanism for the prevention of allergic reactions.

  6. Evolution of chorion structural genes and regulatory mechanisms in two wild silkmoths: a preliminary analysis.

    PubMed

    Moschonas, N K; Thireos, G; Kafatos, F C

    1988-01-01

    We report a preliminary analysis of structural and regulatory evolution of the A and B chorion gene families in two wild silkmoths, Antheraea pernyi and Antheraea polyphemus. Homospecific and heterospecific dot hybridizations were performed between previously characterized A. polyphemus complementary DNA clones and total or stage-specific follicular mRNAs from the two species. The hybridization patterns indicated substantial interspecies changes in the abundance of corresponding mRNA sequences (heteroposic evolution) without substantial changes in their developmental specificities (heterochronic evolution). In addition, the proteins encoded in the two species by corresponding mRNAs were determined by hybrid-selected translation followed by electrophoretic analysis. The results suggested that the proteins evolve in size, presumably through internal deletions and duplications.

  7. The Emerging Role of Protein Phosphorylation as a Critical Regulatory Mechanism Controlling Cellulose Biosynthesis.

    PubMed

    Jones, Danielle M; Murray, Christian M; Ketelaar, KassaDee J; Thomas, Joseph J; Villalobos, Jose A; Wallace, Ian S

    2016-01-01

    Plant cell walls are extracellular matrices that surround plant cells and critically influence basic cellular processes, such as cell division and expansion. Cellulose is a major constituent of plant cell walls, and this paracrystalline polysaccharide is synthesized at the plasma membrane by a large protein complex known as the cellulose synthase complex (CSC). Recent efforts have identified numerous protein components of the CSC, but relatively little is known about regulation of cellulose biosynthesis. Numerous phosphoproteomic surveys have identified phosphorylation events in CSC associated proteins, suggesting that protein phosphorylation may represent an important regulatory control of CSC activity. In this review, we discuss the composition and dynamics of the CSC in vivo, the catalog of CSC phosphorylation sites that have been identified, the function of experimentally examined phosphorylation events, and potential kinases responsible for these phosphorylation events. Additionally, we discuss future directions in cellulose synthase kinase identification and functional analyses of CSC phosphorylation sites. PMID:27252710

  8. The Emerging Role of Protein Phosphorylation as a Critical Regulatory Mechanism Controlling Cellulose Biosynthesis

    PubMed Central

    Jones, Danielle M.; Murray, Christian M.; Ketelaar, KassaDee J.; Thomas, Joseph J.; Villalobos, Jose A.; Wallace, Ian S.

    2016-01-01

    Plant cell walls are extracellular matrices that surround plant cells and critically influence basic cellular processes, such as cell division and expansion. Cellulose is a major constituent of plant cell walls, and this paracrystalline polysaccharide is synthesized at the plasma membrane by a large protein complex known as the cellulose synthase complex (CSC). Recent efforts have identified numerous protein components of the CSC, but relatively little is known about regulation of cellulose biosynthesis. Numerous phosphoproteomic surveys have identified phosphorylation events in CSC associated proteins, suggesting that protein phosphorylation may represent an important regulatory control of CSC activity. In this review, we discuss the composition and dynamics of the CSC in vivo, the catalog of CSC phosphorylation sites that have been identified, the function of experimentally examined phosphorylation events, and potential kinases responsible for these phosphorylation events. Additionally, we discuss future directions in cellulose synthase kinase identification and functional analyses of CSC phosphorylation sites. PMID:27252710

  9. Control of hepatic nitrogen metabolism and glutathione release by cell volume regulatory mechanisms.

    PubMed

    Hüssinger, D; Lang, F; Bauers, K; Gerok, W

    1990-11-13

    1. Urea synthesis was studied in isolated perfused rat liver during cell volume regulatory ion fluxes following exposure of the liver to anisotonic perfusion media. Lowering of the osmolarity in influent perfusate from 305 mOsm/l to 225 mOsm/l (by decreasing influent [NaCl] by 40 mmol/l) led to an inhibition of urea synthesis from NH4Cl (0.5 mmol/l) by about 60% and a decrease of hepatic oxygen uptake by 0.43 +/- 0.03 mumol g-1 min-1 [from 3.09 +/- 0.13 mumol g-1 min-1 to 2.66 +/- 0.12 mumol g-1 min-1 (n = 9)]. The effects on urea synthesis and oxygen uptake were observed throughout hypotonic exposure (225 mOsm/l). They persisted although volume regulatory K+ efflux from the liver was complete within 8 min and were fully reversible upon reexposure to normotonic perfusion media (305 mOsm/l). A 42% inhibition of urea synthesis from NH4Cl (0.5 mmol/l) during hypotonicity was also observed when the perfusion medium was supplemented with glucose (5 mmol/l). Urea synthesis was inhibited by only 10-20% in livers from fed rats, and was even stimulated in those from starved rats when an amino acid mixture (twice the physiological concentration) plus NH4Cl (0.2 mmol/l) was infused. 2. The inhibition of urea synthesis from NH4Cl (0.5 mmol/l) during hypotonicity was accompanied by a threefold increase of citrulline tissue levels, a 50-70% decrease of the tissue contents of glutamate, aspartate, citrate and malate, whereas 2-oxoglutarate, ATP and ornithine tissue levels, and the [3H]inulin extracellular space remained almost unaltered. Further, hypotonic exposure stimulated hepatic glutathione (GSH) release with a time course roughly paralleling volume regulatory K+ efflux. NH4Cl stimulated lactate release from the liver during hypotonic but not during normotonic perfusion. In the absence of NH4Cl, hypotonicity did not significantly affect the lactate/pyruvate ratio in effluent perfusate. With NH4Cl (0.5 mmol/l) present, the lactate/pyruvate ratio increased from 4.3 to 8.2 in

  10. Regulatory mechanisms of ethylene biosynthesis in response to various stimuli during maturation and ripening in fig fruit (Ficus carica L.).

    PubMed

    Owino, W O; Manabe, Y; Mathooko, F M; Kubo, Y; Inaba, A

    2006-01-01

    In order to obtain a greater uniformity of maturation, the growth of the fig fruit (Ficus carica L.) can be stimulated by the application of either olive oil, ethrel/ethephon or auxin. The three treatments induce ethylene production in figs. In this study, we investigated the regulatory mechanisms responsible for oil, auxin and ethylene induced ethylene production in figs. The ethylene production in response to olive oil, auxin, and propylene treatments and during ripening were all induced by 1-methylcyclopropene (1-MCP) and inhibited by propylene indicating a negative feedback regulation mechanism. Three 1-aminocyclopropane-1-carboxylic acid (ACC) synthase genes (Fc-ACS1, Fc-ACS2 and Fc-ACS3) and one ACC oxidase gene (Fc-ACO1) were isolated and their expression patterns in response to either oil, propylene or auxin treatment in figs determined. The expression patterns of Fc-ACS1 and Fc-ACO1 were clearly inhibited by 1-MCP and induced by propylene in oil treated and ripe fruits indicating positive regulation by ethylene, whereas Fc-ACS2 gene expression was induced by 1-MCP and inhibited by propylene indicating negative regulation by ethylene. The Fc-ACS3 mRNA showed high level accumulation in the auxin treated fruit. The inhibition of Fc-ACS3 gene by 1-MCP in oil treated and in ripe fruits suggests that auxin and ethylene modulate the expression of this gene by multi-responsive signal transduction pathway mechanisms. We further report that the olive oil-induced ethylene in figs involves the ACC-dependent pathway and that multiple ethylene regulatory pathways are involved during maturation and ripening in figs and each specific pathway depends on the inducer/stimulus. PMID:16889975

  11. The effect of callosotomy on testicular steroidogenesis in hemiorchidectomized rats: a pituitary-independent regulatory mechanism.

    PubMed

    Banczerowski, P; Csaba, Z; Csernus, V; Gerendai, I

    2000-09-15

    In recent years, increasing number of data indicate that cerebral structures exert a direct, pituitary-independent, neural regulatory action on the endocrine glands. In addition, both experimental and clinical observations indicate functional asymmetry of the control system. Therefore, the objective of the present study was to study the effect of callosotomy on testicular steroidogenesis and serum gonadotrop concentrations in rats subjected to left- or right-sided orchidectomy. In animals underwent callosotomy plus left-sided orchidectomy the basal testosterone secretion in vitro of the remaining (right) testis was significantly higher than that of intact controls, and of rats subjected to sham surgery plus left orchidectomy. In contrast, either sham operation or callosotomy plus right-sided orchidectomy did not interfere with testicular steroidogenesis. Sham surgery or callosotomy plus left orchidectomy induced a significant rise in serum follicle-stimulating hormone concentration while right orchidectomy combined either with sham surgery or callosotomy did not alter this parameter. There was no statistically significant difference between experimental groups in serum testosterone and luteinizing hormone concentrations. The results indicate the involvement of the corpus callosum in a pituitary-independent neural control of testicular steroidogenesis. The data further suggest a different response in steroidogenesis of the left and the right testis following hemicastration and callosotomy. PMID:11044600

  12. Transcriptome analysis reveals novel regulatory mechanisms in a genome-reduced bacterium

    PubMed Central

    Mazin, Pavel V.; Fisunov, Gleb Y.; Gorbachev, Alexey Y.; Kapitskaya, Kristina Y.; Altukhov, Ilya A.; Semashko, Tatiana A.; Alexeev, Dmitry G.; Govorun, Vadim M.

    2014-01-01

    The avian bacterial pathogen Mycoplasma gallisepticum is a good model for systems studies due to small genome and simplicity of regulatory pathways. In this study, we used RNA-Seq and MS-based proteomics to accurately map coding sequences, transcription start sites (TSSs) and transcript 3′-ends (T3Es). We used obtained data to investigate roles of TSSs and T3Es in stress-induced transcriptional responses. We identified 1061 TSSs at a false discovery rate of 10% and showed that almost all transcription in M. gallisepticum is initiated from classic TATAAT promoters surrounded by A/T-rich sequences. Our analysis revealed the pronounced operon structure complexity: on average, each coding operon has one internal TSS and T3Es in addition to the primary ones. Our transcriptomic approach based on the intervals between the two nearest transcript ends allowed us to identify two classes of T3Es: strong, unregulated, hairpin-containing T3Es and weak, heat shock-regulated, hairpinless T3Es. Comparing gene expression levels under different conditions revealed widespread and divergent transcription regulation in M. gallisepticum. Modeling suggested that the core promoter structure plays an important role in gene expression regulation. We have shown that the heat stress activation of cryptic promoters combined with the hairpinless T3Es suppression leads to widespread, seemingly non-functional transcription. PMID:25361977

  13. Effects of radiation on T regulatory cells in normal states and cancer: mechanisms and clinical implications.

    PubMed

    Liu, Shu; Sun, Xiangdong; Luo, Jinhua; Zhu, Hongcheng; Yang, Xi; Guo, Qing; Song, Yaqi; Sun, Xinchen

    2015-01-01

    Radiation remains an important component of cancer treatment. In addition to inducing tumor cell death through direct cytotoxic effects, radiation can also promote the regression of tumor via augment of immune response. Regulatory T cells (Tregs) are a unique subpopulation of CD4 positive cells, which are characterized by expression of the forkhead box P3 (Foxp3) transcription factor and high levels of CD25. Mounting evidence has shown that Tregs are implicated in the development and progression of various types of cancer, which makes Tregs an important target in cancer therapeutics. Generally, lymphocytes are regarded as radiosensitive. However, Tregs have been demonstrated to be relatively resistant to radiotherapy, which is partly mediated by downregulation of pro-apoptotic proteins and upregulation of anti-apoptotic proteins. Moreover, radiotherapy can increase the production of Tregs and the recruitment of Tregs to local tumor microenvironment. Tregs can attenuate radiation-induced tumor death, which cause the resistance of tumor to radiotherapy. Recent experimental studies and clinical trails have demonstrated that the combination of radiation with medications that target Tregs is promising in the treatment of several types of neoplasms. In this review, we discussed the effect of radiation on Tregs in physiological states and cancer. Further, we presented an overview of therapies that target Tregs to enhance the efficacy of radiation in cancer therapeutics. PMID:26807310

  14. Pyruvate dehydrogenase kinase regulatory mechanisms and inhibition in treating diabetes, heart ischemia, and cancer.

    PubMed

    Roche, T E; Hiromasa, Y

    2007-04-01

    The fraction of pyruvate dehydrogenase complex (PDC) in the active form is reduced by the activities of dedicated PD kinase isozymes (PDK1, PDK2, PDK3 and PDK4). Via binding to the inner lipoyl domain (L2) of the dihydrolipoyl acetyltransferase (E2 60mer), PDK rapidly access their E2-bound PD substrate. The E2-enhanced activity of the widely distributed PDK2 is limited by dissociation of ADP from its C-terminal catalytic domain, and this is further slowed by pyruvate binding to the N-terminal regulatory (R) domain. Via the reverse of the PDC reaction, NADH and acetyl-CoA reductively acetylate lipoyl group of L2, which binds to the R domain and stimulates PDK2 activity by speeding up ADP dissociation. Activation of PDC by synthetic PDK inhibitors binding at the pyruvate or lipoyl binding sites decreased damage during heart ischemia and lowered blood glucose in insulin-resistant animals. PDC activation also triggers apoptosis in cancer cells that selectively convert glucose to lactate. PMID:17310282

  15. Immunomodulation of mesenchymal stromal cells on regulatory T cells and its possible mechanism.

    PubMed

    Yan, Zhidong; Zhuansun, Yongxun; Chen, Rui; Li, Jianguo; Ran, Pixin

    2014-05-15

    Mesenchymal stromal cells (MSCs) and regulatory T cells (Tregs) have both garnered abundant interests from immunologists worldwide, as both MSCs and Tregs can be considered immunosuppressive in their own right. But a little attention has been paid to the impacts of MSCs on Tregs. To clarify the effects of MSCs on Tregs, we performed the coculture systems within MSCs and Tregs. We confirmed that MSC-exposed Tregs are capable of more immunosuppressive than Tregs without coculturing with MSCs. And this augmenting suppressive capacity was accompanied with an upregulation of programmed cell death 1 receptor (PD-1) on Tregs. Importantly, we found that cell viability of Tregs was excluded from the influences of MSCs. Finally, we showed that PD-1/B7-H1 interactions and IL-10 might be responsible for the enhanced suppressive capability of MSC-exposed Tregs. Further analysis revealed that PD-1/B7-H1 interactions were not responsible for the productions of IL-10 and TGF-β1 in the MSC-Treg coculture systems; in contrast, IL-10 rather than TGF-β1 played a role in the upregualtion of PD-1. Furthermore, this is the first explorative study to evaluate the immunomodulation of MSCs on the suppressive capacity of Tregs in MSC-Treg in vitro coculture setting.

  16. Discovery of Novel Splice Variants and Regulatory Mechanisms for Microsomal Triglyceride Transfer Protein in Human Tissues

    PubMed Central

    Suzuki, Takashi; Swift, Larry L.

    2016-01-01

    Microsomal triglyceride transfer protein (MTP) is a unique lipid transfer protein essential for the assembly of triglyceride-rich lipoproteins by the liver and intestine. Previous studies in mice identified a splice variant of MTP with an alternate first exon. Splice variants of human MTP have not been reported. Using PCR approaches we have identified two splice variants in human tissues, which we have named MTP-B and MTP-C. MTP-B has a unique first exon (Ex1B) located 10.5 kb upstream of the first exon (Ex1A) for canonical MTP (MTP-A); MTP-C contains both first exons for MTP-A and MTP-B. MTP-B was found in a number of tissues, whereas MTP-C was prominent in brain and testis. MTP-B does not encode a protein; MTP-C encodes the same protein encoded by MTP-A, although MTP-C translation is strongly inhibited by regulatory elements within its 5′-UTR. Using luciferase assays, we demonstrate that the promoter region upstream of exon 1B is quite adequate to drive expression of MTP. We conclude that alternate splicing plays a key role in regulating cellular MTP levels by introducing distinct promoter regions and unique 5′-UTRs, which contain elements that alter translation efficiency, enabling the cell to optimize MTP activity. PMID:27256115

  17. Structure of the Yeast Polarity Protein Sro7 Reveals a SNARE Regulatory Mechanism

    SciTech Connect

    Hattendorf, D.A.; Andreeva, A.; Gangar, A.; Brennwald, P.J.; Weis, W.I.; /Stanford U., Med. School /North Carolina U.

    2007-07-09

    Polarized exocytosis requires coordination between the actin cytoskeleton and the exocytic machinery responsible for fusion of secretory vesicles at specific sites on the plasma membrane. Fusion requires formation of a complex between a vesicle-bound R-SNARE and plasma membrane Qa, Qb and Qc SNARE proteins. Proteins in the lethal giant larvae protein family, including lethal giant larvae and tomosyn in metazoans and Sro7 in yeast, interact with Q-SNAREs and are emerging as key regulators of polarized exocytosis. The crystal structure of Sro7 reveals two seven-bladed WD40 {beta}-propellers followed by a 60-residue-long 'tail', which is bound to the surface of the amino-terminal propeller. Deletion of the Sro7 tail enables binding to the Qbc SNARE region of Sec9 and this interaction inhibits SNARE complex assembly. The N-terminal domain of Sec9 provides a second, high-affinity Sro7 interaction that is unaffected by the tail. The results suggest that Sro7 acts as an allosteric regulator of exocytosis through interactions with factors that control the tail. Sequence alignments indicate that lethal giant larvae and tomosyn have a two-{beta}-propeller fold similar to that of Sro7, but only tomosyn appears to retain the regulatory tail.

  18. Discovery of Novel Splice Variants and Regulatory Mechanisms for Microsomal Triglyceride Transfer Protein in Human Tissues.

    PubMed

    Suzuki, Takashi; Swift, Larry L

    2016-01-01

    Microsomal triglyceride transfer protein (MTP) is a unique lipid transfer protein essential for the assembly of triglyceride-rich lipoproteins by the liver and intestine. Previous studies in mice identified a splice variant of MTP with an alternate first exon. Splice variants of human MTP have not been reported. Using PCR approaches we have identified two splice variants in human tissues, which we have named MTP-B and MTP-C. MTP-B has a unique first exon (Ex1B) located 10.5 kb upstream of the first exon (Ex1A) for canonical MTP (MTP-A); MTP-C contains both first exons for MTP-A and MTP-B. MTP-B was found in a number of tissues, whereas MTP-C was prominent in brain and testis. MTP-B does not encode a protein; MTP-C encodes the same protein encoded by MTP-A, although MTP-C translation is strongly inhibited by regulatory elements within its 5'-UTR. Using luciferase assays, we demonstrate that the promoter region upstream of exon 1B is quite adequate to drive expression of MTP. We conclude that alternate splicing plays a key role in regulating cellular MTP levels by introducing distinct promoter regions and unique 5'-UTRs, which contain elements that alter translation efficiency, enabling the cell to optimize MTP activity. PMID:27256115

  19. Regulatory Light Chain Mutations Associated with Cardiomyopathy Affect Myosin Mechanics and Kinetics

    PubMed Central

    Greenberg, Michael J.; Watt, James D.; Jones, Michelle; Kazmierczak, Katarzyna; Szczesna-Cordary, Danuta; Moore, Jeffrey R.

    2009-01-01

    The myosin regulatory light chain (RLC) wraps around the alpha helical neck region of myosin. This neck region has been proposed to act as a lever arm, amplifying small conformational changes in the myosin head to generate motion. The RLC serves an important structural role, supporting the myosin neck region and a modulatory role, tuning the kinetics of the actin myosin interaction. Given the importance of the RLC, it is not surprising that mutations of the RLC can lead to familial hypertrophic cardiomyopathy (FHC), the leading cause of sudden cardiac death in people under 30. Population studies identified two FHC mutations located near the cationic binding site of the RLC, R58Q and N47K. Although these mutations are close in sequence, they differ in clinical presentation and prognosis with R58Q showing a more severe phenotype. We examined the molecular based changes in myosin that are responsible for the disease phenotype by purifying myosin from transgenic mouse hearts expressing mutant myosins and examining actin filament sliding using the in vitro motility assay. We found that both R58Q and N47K showed reductions in force compared to the wild type that could result in compensatory hypertrophy. Furthermore, we observed a higher ATPase rate and an increased activation at submaximal calcium levels for the R58Q myosin that could lead to decreased efficiency and incomplete cardiac relaxation, potentially explaining the more severe phenotype for the R58Q mutation. PMID:18929571

  20. On multiple regulatory mechanisms in the tryptophan operon system in Escherichia coli: in silico study of perturbation dynamics.

    PubMed

    Nguyen, Lan K; Kulasiri, Don

    2008-01-01

    Living organisms often exist in uncertain environments where changes are the norm. Cellular systems therefore require resilient regulatory mechanisms for timely and stable adaptation. Among various regulation motifs, multiple feedback control emerges as a common theme. The tryptophan operon system in Escherichia coli regulates the production ofintracellular tryptophan using an apparatus of three feedback mechanisms: repression, attenuation and enzyme inhibition; each provides essentially the same function but operates in distinctly different ways. Here we aim to understand the roles of each loop by studying transient dynamics of the system to perturbations of different types; to reveal the underlying relationships between individual control mechanisms and macroscopic behaviour. We develop an S-systems approximation of an existing model for the system and characterise transient dynamics by introducing two measurable quantities: maximum disturbance (MD) and recovery time (RT). Our simulation results showed that combined regulation using all three feedback mechanisms significantly increases system stability, broadening the range of kinetic parameters for stable behaviour. Enzyme inhibition was shown to directly control the disturbance level in system variables after perturbations. Attenuation, on the other hand, was found to speed up system recovery whereas repression lengthens recovery time. The method developed in this paper and the defined transient dynamics measurements can be applied to other cellular systems. PMID:19374133

  1. Analysis of microRNA and Gene Expression Profiles in Multiple Sclerosis: Integrating Interaction Data to Uncover Regulatory Mechanisms

    PubMed Central

    Freiesleben, Sherry; Hecker, Michael; Zettl, Uwe Klaus; Fuellen, Georg; Taher, Leila

    2016-01-01

    MicroRNAs (miRNAs) have been reported to contribute to the pathophysiology of multiple sclerosis (MS), an inflammatory disorder of the central nervous system. Here, we propose a new consensus-based strategy to analyse and integrate miRNA and gene expression data in MS as well as other publically available data to gain a deeper understanding of the role of miRNAs in MS and to overcome the challenges posed by studies with limited patient sample sizes. We processed and analysed microarray datasets, and compared the expression of genes and miRNAs in the blood of MS patients and controls. We then used our consensus and integration approach to construct two molecular networks dysregulated in MS: a miRNA- and a gene-based network. We identified 18 differentially expressed (DE) miRNAs and 128 DE genes that may contribute to the regulatory alterations behind MS. The miRNAs were linked to immunological and neurological pathways, and we exposed let-7b-5p and miR-345-5p as promising blood-derived disease biomarkers in MS. The results suggest that DE miRNAs are more informative than DE genes in uncovering pathways potentially involved in MS. Our findings provide novel insights into the regulatory mechanisms and networks underlying MS. PMID:27694855

  2. Catalytic control in the EGF Receptor and its connection to general kinase regulatory mechanisms

    PubMed Central

    Jura, Natalia; Zhang, Xuewu; Endres, Nicholas F.; Seeliger, Markus A.; Schindler, Thomas; Kuriyan, John

    2011-01-01

    Summary In contrast to the active conformations of protein kinases, which are essentially the same for all kinases, inactive kinase conformations are structurally diverse. Some inactive conformations are, however, observed repeatedly in different kinases, perhaps reflecting an important role in catalysis. In this review, we analyze one of these recurring conformations, first identified in CDK and Src kinases, which turned out to be central to understanding of how kinase domain of the EGF receptor is activated. This mechanism, which involves the stabilization of the active conformation of an α helix, has features in common with mechanisms operative in several other kinases. PMID:21474065

  3. Regulatory mechanisms differ in UMP kinases from gram-negative and gram-positive bacteria.

    PubMed

    Evrin, Cécile; Straut, Monica; Slavova-Azmanova, Neli; Bucurenci, Nadia; Onu, Adrian; Assairi, Liliane; Ionescu, Mihaela; Palibroda, Nicolae; Bârzu, Octavian; Gilles, Anne-Marie

    2007-03-01

    In this work, we examined the regulation by GTP and UTP of the UMP kinases from eight bacterial species. The enzyme from Gram-positive organisms exhibited cooperative kinetics with ATP as substrate. GTP decreased this cooperativity and increased the affinity for ATP. UTP had the opposite effect, as it decreased the enzyme affinity for ATP. The nucleotide analogs 5-bromo-UTP and 5-iodo-UTP were 5-10 times stronger inhibitors than the parent compound. On the other hand, UMP kinases from the Gram-negative organisms did not show cooperativity in substrate binding and catalysis. Activation by GTP resulted mainly from the reversal of inhibition caused by excess UMP, and inhibition by UTP was accompanied by a strong increase in the apparent K(m) for UMP. Altogether, these results indicate that, depending on the bacteria considered, GTP and UTP interact with different enzyme recognition sites. In Gram-positive bacteria, GTP and UTP bind to a single site or largely overlapping sites, shifting the T R equilibrium to either the R or T form, a scenario corresponding to almost all regulatory proteins, commonly called K systems. In Gram-negative organisms, the GTP-binding site corresponds to the unique allosteric site of the Gram-positive bacteria. In contrast, UTP interacts cooperatively with a site that overlaps the catalytic center, i.e. the UMP-binding site and part of the ATP-binding site. These characteristics make UTP an original regulator of UMP kinases from Gram-negative organisms, beyond the common scheme of allosteric control.

  4. TGF-β-Induced Regulatory T Cells Directly Suppress B Cell Responses through a Noncytotoxic Mechanism.

    PubMed

    Xu, Anping; Liu, Ya; Chen, Weiqian; Wang, Julie; Xue, Youqiu; Huang, Feng; Rong, Liming; Lin, Jin; Liu, Dahai; Yan, Mei; Li, Quan-Zhen; Li, Bin; Song, Jianxun; Olsen, Nancy; Zheng, Song Guo

    2016-05-01

    Foxp3(+) regulatory T cells (Treg) playing a crucial role in the maintenance of immune tolerance and prevention of autoimmune diseases consist of thymus-derived naturally occurring CD4(+)Foxp3(+) Treg cells (nTreg) and those that can be induced ex vivo with TGF-β (iTreg). Although both Treg subsets share similar phenotypes and functional characteristics, they also have potential biologic differences on their biology. The role of iTreg in regulating B cells remains unclear so far. The suppression assays of Treg subsets on activation, proliferation, and Abs production of B cells were measured using a Treg and B cell coculture system in vitro. Transwell and Ab blockade experiments were performed to assess the roles of cell contact and soluble cytokines. Treg were adoptively transferred to lupus mice to assess in vivo effects on B cells. Like nTreg, iTreg subset also directly suppressed activation and proliferation of B cells. nTreg subset suppressed B cell responses through cytotoxic manner related to expression of granzyme A, granzyme B, and perforin, whereas the role of iTreg subset on B cells did not involve in cytotoxic action but depending on TGF-β signaling. Furthermore, iTreg subset can significantly suppress Ab produced by lupus B cells in vitro. Comparison experiments using autoantibodies microarrays demonstrated that adoptive transfer of iTreg had a superior effect than nTreg subset on suppressing lupus B cell responses in vivo. Our data implicate a role and advantage of iTreg subset in treating B cell-mediated autoimmune diseases, boosting the translational potential of these findings. PMID:27001954

  5. [Regulatory role of mechanical stress response in cellular function: development of new drugs and tissue engineering].

    PubMed

    Momose, Kazutaka; Matsuda, Takehisa; Oike, Masahiro; Obara, Kazuo; Laher, Ismail; Sugiura, Seiryo; Ohata, Hisayuki; Nakayama, Koichi

    2003-02-01

    The investigation of mechanotransduction in the cardiovascular system is essentially important for elucidating the cellular and molecular mechanisms involved in not only the maintenance of hemodynamic homeostasis but also etiology of cardiovascular diseases including arteriosclerosis. The present review summarizes the latest research performed by six academic groups, and presented at the 75th Annual Meeting of the Japanese Pharmacological Society. Technology of cellular biomechanics is also required for research and clinical application of a vascular hybrid tissue responding to pulsatile stress. 1) Vascular tissue engineering: Design of pulsatile stress-responsive scaffold and in vivo vascular wall reconstruction (T. Matsuda); 2) Cellular mechanisms of mechanosensitive calcium transients in vascular endothelium (M. Oike et al.); 3) Cross-talk of stimulation with fluid flow and lysophosphatidic acid in vascular endothelial cells (K. Momose et al.); 4) Mechanotransduction of vascular smooth muscles: Rate-dependent stretch-induced protein phosphorylations and contractile activation (K. Obara et al.); 5) Lipid mediators in vascular myogenic tone (I. Laher et al.); and 6) Caldiomyocyte regulates its mechanical output in response to mechanical load (S. Sugiura et al.).

  6. Reactive oxygen species regulatory mechanisms associated with rapid response of MC3T3-E1 cells for vibration stress.

    PubMed

    Zhang, Ling; Gan, Xueqi; Zhu, Zhuoli; Yang, Yang; He, Yuting; Yu, Haiyang

    2016-02-12

    Although many previous studies have shown that refractory period-dependent memory effect of vibration stress is anabolic for skeletal homeostasis, little is known about the rapid response of osteoblasts simply derived from vibration itself. In view of the potential role of reactive oxygen species (ROS) in mediating differentiated activity of osteoblasts, whether and how ROS regulates the rapid effect of vibration deserve to be demonstrated. Our findings indicated that MC3T3-E1 cells underwent decreased gene expression of Runx2, Col-I and ALP and impaired ALP activity accompanied by increased mitochondrial fission immediately after vibration loading. Moreover, we also revealed the involvement of ERK-Drp1 signal transduction in ROS regulatory mechanisms responsible for the rapid effect of vibration stress.

  7. Reactive oxygen species regulatory mechanisms associated with rapid response of MC3T3-E1 cells for vibration stress.

    PubMed

    Zhang, Ling; Gan, Xueqi; Zhu, Zhuoli; Yang, Yang; He, Yuting; Yu, Haiyang

    2016-02-12

    Although many previous studies have shown that refractory period-dependent memory effect of vibration stress is anabolic for skeletal homeostasis, little is known about the rapid response of osteoblasts simply derived from vibration itself. In view of the potential role of reactive oxygen species (ROS) in mediating differentiated activity of osteoblasts, whether and how ROS regulates the rapid effect of vibration deserve to be demonstrated. Our findings indicated that MC3T3-E1 cells underwent decreased gene expression of Runx2, Col-I and ALP and impaired ALP activity accompanied by increased mitochondrial fission immediately after vibration loading. Moreover, we also revealed the involvement of ERK-Drp1 signal transduction in ROS regulatory mechanisms responsible for the rapid effect of vibration stress. PMID:26802466

  8. Single-Nucleotide Mutations in FMR1 Reveal Novel Functions and Regulatory Mechanisms of the Fragile X Syndrome Protein FMRP

    PubMed Central

    Suhl, Joshua A.; Warren, Stephen T.

    2015-01-01

    Fragile X syndrome is a monogenic disorder and a common cause of intellectual disability. Despite nearly 25 years of research on FMR1, the gene underlying the syndrome, very few pathological mutations other than the typical CGG-repeat expansion have been reported. This is in contrast to other X-linked, monogenic, intellectual disability disorders, such as Rett syndrome, where many point mutations have been validated as causative of the disorder. As technology has improved and significantly driven down the cost of sequencing, allowing for whole genes to be sequenced with relative ease, in-depth sequencing studies on FMR1 have recently been performed. These studies have led to the identification of novel variants in FMR1, where some of which have been functionally evaluated and are likely pathogenic. In this review, we discuss recently identified FMR1 variants, the ways these novel variants cause dysfunction, and how they reveal new regulatory mechanisms and functionalities of the gene. PMID:26819560

  9. Reversible oxidation of vicinal-thiols motif in sarcoplasmic reticulum calcium regulatory proteins is involved in muscle fatigue mechanism.

    PubMed

    Vázquez, Pável; Tirado-Cortés, Aldo; Álvarez, Rocío; Ronjat, Michel; Amaya, Araceli; Ortega, Alicia

    2016-10-01

    The mechanism underlying fatigue in skeletal muscle (SM) related to the redox-potential hypothesis, ranges from a direct effect of oxygen reactive species, to a number of other free radical intermediates targeting specific amino acids in the Ca(2+)-regulatory proteins of the sarcoplasmic reticulum (SR). In the present study, we investigate the selective oxidation/reduction of the protein motif Cys-(Xn=2-6)-Cys, known as a vicinal thiol group (VTG), present in the SR Ca(2+)-ATPase (SERCA) and in the Ca(2+)-channel ryanodine receptor (RyR) which are modified during muscle fatigue in SM. Selective oxidation of VTG with phenyl arsine oxide (PAO) increases fatigue in rat isolated SM and fatigue is prevented when muscle is previously incubated with a VTG selective reducing agent, 2,3-dimercaptopropanol (British anti-Lewisite (BAL)). In isolated SR membranes, PAO [<0.1mM] modifies SERCA conformation and inhibits ATPase activity but does not affect Ca(2+)-release. However, PAO at [>0.1mM] inhibits SERCA and RyR activities in a reversible manner by selectively reducing them. Interestingly, as observed by differential scanning calorimetry, the conformation of SERCA from fatigued muscle changed in a similar manner as when SERCA VTG where oxidized. The addition of BAL to fatigued muscle restored the structural conformation and activity of SERCA with full recovery of muscle force production after fatigue. We conclude that VTG reversible oxidation of SR Ca(2+) regulatory proteins are involved in muscle contraction/relaxation and are a molecular mechanism to be considered for muscle fatigue.

  10. Investigation of molecular mechanisms and regulatory pathways of pro-angiogenic nanorods

    NASA Astrophysics Data System (ADS)

    Nethi, Susheel Kumar; Veeriah, Vimal; Barui, Ayan Kumar; Rajendran, Saranya; Mattapally, Saidulu; Misra, Sanjay; Chatterjee, Suvro; Patra, Chitta Ranjan

    2015-05-01

    Angiogenesis, a process involving the growth of new blood vessels from the pre-existing vasculature, plays a crucial role in various pathophysiological conditions. We have previously demonstrated that europium hydroxide [EuIII(OH)3] nanorods (EHNs) exhibit pro-angiogenic properties through the generation of reactive oxygen species (ROS) and mitogen activated protein kinase (MAPK) activation. Considering the enormous implication of angiogenesis in cardiovascular diseases (CVDs) and cancer, it is essential to understand in-depth molecular mechanisms and signaling pathways in order to develop the most efficient and effective alternative treatment strategy for CVDs. However, the exact underlying mechanism and cascade signaling pathways behind the pro-angiogenic properties exhibited by EHNs still remain unclear. Herein, we report for the first time that the hydrogen peroxide (H2O2), a redox signaling molecule, generated by these EHNs activates the endothelial nitric oxide synthase (eNOS) that promotes the nitric oxide (NO) production in a PI3K (phosphoinositide 3-kinase)/Akt dependent manner, eventually triggering angiogenesis. We intensely believe that the investigation and understanding of the in-depth molecular mechanism and signaling pathways of EHNs induced angiogenesis will help us in developing an effective alternative treatment strategy for cardiovascular related and ischemic diseases where angiogenesis plays an important role.Angiogenesis, a process involving the growth of new blood vessels from the pre-existing vasculature, plays a crucial role in various pathophysiological conditions. We have previously demonstrated that europium hydroxide [EuIII(OH)3] nanorods (EHNs) exhibit pro-angiogenic properties through the generation of reactive oxygen species (ROS) and mitogen activated protein kinase (MAPK) activation. Considering the enormous implication of angiogenesis in cardiovascular diseases (CVDs) and cancer, it is essential to understand in-depth molecular

  11. [Research Progress of NOS3 Participation in Regulatory Mechanisms of Cardiovascular Diseases].

    PubMed

    Sun, Ting; Chi, Qingjia; Wang, Guixue

    2016-02-01

    Cardiovascular disease has been a major threat to human's health and lives for many years. It is of great importance to explore the mechanisms and develop strategies to prevent the pathogenesis. Generally, cardiovascular disease is associated with endothelial dysfunction, which is closely related to the nitric oxide (NO)-mediated vasodilatation. The release of NO is regulated by NOS3 gene in mammals' vascular system. A great deal of evidences have shown that the polymorphism and epigenetic of NOS3 gene play vital roles in the pathological process of cardiovascular disease. To gain insights into the role of NOS3 in the cardiovascular diseases, we reviewed the molecular mechanisms underlying the development of cardiovascular diseases in this paper, including the uncoupling of NOS3 protein, epigenetic and polymorphism of NOS3 gene. The review can also offer possible strategies to prevent and treat cardiovascular diseases. PMID:27382763

  12. Transport mechanism and regulatory properties of the human amino acid transporter ASCT2 (SLC1A5).

    PubMed

    Scalise, Mariafrancesca; Pochini, Lorena; Panni, Simona; Pingitore, Piero; Hedfalk, Kristina; Indiveri, Cesare

    2014-11-01

    The kinetic mechanism of the transport catalyzed by the human glutamine/neutral amino acid transporter hASCT2 over-expressed in P. pastoris was determined in proteoliposomes by pseudo-bi-substrate kinetic analysis of the Na(+)-glutamineex/glutaminein transport reaction. A random simultaneous mechanism resulted from the experimental analysis. Purified functional hASCT2 was chemically cross-linked to a stable dimeric form. The oligomeric structure correlated well with the kinetic mechanism of transport. Half-saturation constants (Km) of the transporter for the other substrates Ala, Ser, Asn and Thr were measured both on the external and internal side. External Km were much lower than the internal ones confirming the asymmetry of the transporter. The electric nature of the transport reaction was determined imposing a negative inside membrane potential generated by K(+) gradients in the presence of valinomycin. The transport reaction resulted to be electrogenic and the electrogenicity originated from external Na(+). Internal Na(+) exerted a stimulatory effect on the transport activity which could be explained by a regulatory, not a counter-transport, effect. Native and deglycosylated hASCT2 extracted from HeLa showed the same transport features demonstrating that the glycosyl moiety has no role in transport function. Both in vitro and in vivo interactions of hASCT2 with the scaffold protein PDZK1 were revealed.

  13. Regulatory mechanisms of RNA function: emerging roles of DNA repair enzymes.

    PubMed

    Jobert, Laure; Nilsen, Hilde

    2014-07-01

    The acquisition of an appropriate set of chemical modifications is required in order to establish correct structure of RNA molecules, and essential for their function. Modification of RNA bases affects RNA maturation, RNA processing, RNA quality control, and protein translation. Some RNA modifications are directly involved in the regulation of these processes. RNA epigenetics is emerging as a mechanism to achieve dynamic regulation of RNA function. Other modifications may prevent or be a signal for degradation. All types of RNA species are subject to processing or degradation, and numerous cellular mechanisms are involved. Unexpectedly, several studies during the last decade have established a connection between DNA and RNA surveillance mechanisms in eukaryotes. Several proteins that respond to DNA damage, either to process or to signal the presence of damaged DNA, have been shown to participate in RNA quality control, turnover or processing. Some enzymes that repair DNA damage may also process modified RNA substrates. In this review, we give an overview of the DNA repair proteins that function in RNA metabolism. We also discuss the roles of two base excision repair enzymes, SMUG1 and APE1, in RNA quality control.

  14. [Research progress in biofilm formation and regulatory mechanism of Campylobacter jejuni].

    PubMed

    Wu, Qingping; Zhong, Xian; Zhang, Jumei

    2016-02-01

    Biofilm of Campylobacter jejuni was formed by cross-linking its extracellular secretion, polysaccharides, various extracellular proteins, nucleic acids etc to enhance its survival in hostile environments, especially for detergents, antibiotics and disinfectants. This paper elaborated C. jejuni biofilm formation and regulation mechanisms in the surface properties of the media, temperatures, gas environment, the regulation of gene etc, also analysed and discussed a variety of biofilm removal practical applications. We hope it can provide a reference for studies on biofilm control of C. jejuni. PMID:27373066

  15. A global regulatory mechanism for activating an exon network required for neurogenesis.

    PubMed

    Raj, Bushra; Irimia, Manuel; Braunschweig, Ulrich; Sterne-Weiler, Timothy; O'Hanlon, Dave; Lin, Zhen-Yuan; Chen, Ginny I; Easton, Laura E; Ule, Jernej; Gingras, Anne-Claude; Eyras, Eduardo; Blencowe, Benjamin J

    2014-10-01

    The vertebrate and neural-specific Ser/Arg (SR)-related protein nSR100/SRRM4 regulates an extensive program of alternative splicing with critical roles in nervous system development. However, the mechanism by which nSR100 controls its target exons is poorly understood. We demonstrate that nSR100-dependent neural exons are associated with a unique configuration of intronic cis-elements that promote rapid switch-like regulation during neurogenesis. A key feature of this configuration is the insertion of specialized intronic enhancers between polypyrimidine tracts and acceptor sites that bind nSR100 to potently activate exon inclusion in neural cells while weakening 3' splice site recognition and contributing to exon skipping in nonneural cells. nSR100 further operates by forming multiple interactions with early spliceosome components bound proximal to 3' splice sites. These multifaceted interactions achieve dominance over neural exon silencing mediated by the splicing regulator PTBP1. The results thus illuminate a widespread mechanism by which a critical neural exon network is activated during neurogenesis. PMID:25219497

  16. The Influence of Early Life Nutrition on Epigenetic Regulatory Mechanisms of the Immune System

    PubMed Central

    Paparo, Lorella; di Costanzo, Margherita; di Scala, Carmen; Cosenza, Linda; Leone, Ludovica; Nocerino, Rita; Berni Canani, Roberto

    2014-01-01

    The immune system is exquisitely sensitive to environmental changes. Diet constitutes one of the major environmental factors that exerts a profound effect on immune system development and function. Epigenetics is the study of mitotically heritable, yet potentially reversible, molecular modifications to DNA and chromatin without alteration to the underlying DNA sequence. Nutriepigenomics is an emerging discipline examining the role of dietary influences on gene expression. There is increasing evidence that the epigenetic mechanisms that regulate gene expression during immune differentiation are directly affected by dietary factors or indirectly through modifications in gut microbiota induced by different dietary habits. Short-chain fatty acids, in particular butyrate, produced by selected bacteria stains within gut microbiota, are crucial players in this network. PMID:25353665

  17. The T box mechanism: tRNA as a regulatory molecule

    PubMed Central

    Green, Nicholas J.; Grundy, Frank J.; Henkin, Tina M.

    2009-01-01

    The T box mechanism is widely used in Gram-positive bacteria to regulate expression of aminoacyl-tRNA synthetase genes and genes involved in amino acid biosynthesis and uptake. Binding of a specific uncharged tRNA to a riboswitch element in the nascent transcript causes a structural change in the transcript that promotes expression of the downstream coding sequence. In most cases, this occurs by stabilization of an antiterminator element that competes with formation of a terminator helix. Specific tRNA recognition by the nascent transcript results in increased expression of genes important for tRNA aminoacylation in response to decreased pools of charged tRNA. PMID:19932103

  18. [The defense and regulatory mechanisms during development of legume-Rhizobium symbiosis].

    PubMed

    Glian'ko, A K; Akimova, G P; Sokolova, M G; Makarova, L E; Vasil'eva, G G

    2007-01-01

    The roles of indolylacetic acid, the peroxidase system, catalase, active oxygen species, and phenolic compounds in the physiological and biochemical mechanisms involved in the autoregulation of nodulation in the developing legume-Rhizobium symbiosis were studied. It was inferred that the concentration of indolylacetic acid in the roots of inoculated plants, controlled by the enzymes of the peroxidase complex, is the signal permitting or limiting nodulation at the initial stages of symbiotic interaction. Presumably, the change in the level of active oxygen species is determined by an antioxidant activity of phenolic compounds. During the development of symbiosis, phytohormones, antioxidant enzymes, and active oxygen species may be involved in the regulation of infection via both a direct antibacterial action and regulation of functional activity of the host plant defense systems. PMID:17619575

  19. New effector functions and regulatory mechanisms of BCL6 in normal and malignant lymphocytes

    PubMed Central

    Bunting, Karen L.; Melnick, Ari M.

    2014-01-01

    The BCL6 oncogenic repressor is a master regulator of humoral immunity and B-cell lymphoma survival. Whereas much research has focused on its regulation and function in germinal center B-cells, its role in other mature lymphoid cell compartments is less clear. A novel role for BCL6 in follicular T helper cell development was recently uncovered. The latest discoveries reveal that BCL6 is also an important regulator of other specialized helper T-cell subsets within germinal centers, pre-germinal center events, and peripheral T-cells effector functions. Here, we review newly discovered roles for BCL6 in lymphocyte subsets residing within and outside of germinal centers, and discuss their implications with respect to the molecular mechanisms of BCL6 regulation and potential links to B and T-cell lymphomas. PMID:23725655

  20. Gene Regulatory Mechanisms Underlying the Spatial and Temporal Regulation of Target-Dependent Gene Expression in Drosophila Neurons.

    PubMed

    Berndt, Anthony J E; Tang, Jonathan C Y; Ridyard, Marc S; Lian, Tianshun; Keatings, Kathleen; Allan, Douglas W

    2015-12-01

    Neuronal differentiation often requires target-derived signals from the cells they innervate. These signals typically activate neural subtype-specific genes, but the gene regulatory mechanisms remain largely unknown. Highly restricted expression of the FMRFa neuropeptide in Drosophila Tv4 neurons requires target-derived BMP signaling and a transcription factor code that includes Apterous. Using integrase transgenesis of enhancer reporters, we functionally dissected the Tv4-enhancer of FMRFa within its native cellular context. We identified two essential but discrete cis-elements, a BMP-response element (BMP-RE) that binds BMP-activated pMad, and a homeodomain-response element (HD-RE) that binds Apterous. These cis-elements have low activity and must be combined for Tv4-enhancer activity. Such combinatorial activity is often a mechanism for restricting expression to the intersection of cis-element spatiotemporal activities. However, concatemers of the HD-RE and BMP-RE cis-elements were found to independently generate the same spatiotemporal expression as the Tv4-enhancer. Thus, the Tv4-enhancer atypically combines two low-activity cis-elements that confer the same output from distinct inputs. The activation of target-dependent genes is assumed to 'wait' for target contact. We tested this directly, and unexpectedly found that premature BMP activity could not induce early FMRFa expression; also, we show that the BMP-insensitive HD-RE cis-element is activated at the time of target contact. This led us to uncover a role for the nuclear receptor, seven up (svp), as a repressor of FMRFa induction prior to target contact. Svp is normally downregulated immediately prior to target contact, and we found that maintaining Svp expression prevents cis-element activation, whereas reducing svp gene dosage prematurely activates cis-element activity. We conclude that the target-dependent FMRFa gene is repressed prior to target contact, and that target-derived BMP signaling directly

  1. Gene Regulatory Mechanisms Underlying the Spatial and Temporal Regulation of Target-Dependent Gene Expression in Drosophila Neurons

    PubMed Central

    Ridyard, Marc S.; Lian, Tianshun; Keatings, Kathleen; Allan, Douglas W.

    2015-01-01

    Neuronal differentiation often requires target-derived signals from the cells they innervate. These signals typically activate neural subtype-specific genes, but the gene regulatory mechanisms remain largely unknown. Highly restricted expression of the FMRFa neuropeptide in Drosophila Tv4 neurons requires target-derived BMP signaling and a transcription factor code that includes Apterous. Using integrase transgenesis of enhancer reporters, we functionally dissected the Tv4-enhancer of FMRFa within its native cellular context. We identified two essential but discrete cis-elements, a BMP-response element (BMP-RE) that binds BMP-activated pMad, and a homeodomain-response element (HD-RE) that binds Apterous. These cis-elements have low activity and must be combined for Tv4-enhancer activity. Such combinatorial activity is often a mechanism for restricting expression to the intersection of cis-element spatiotemporal activities. However, concatemers of the HD-RE and BMP-RE cis-elements were found to independently generate the same spatiotemporal expression as the Tv4-enhancer. Thus, the Tv4-enhancer atypically combines two low-activity cis-elements that confer the same output from distinct inputs. The activation of target-dependent genes is assumed to 'wait' for target contact. We tested this directly, and unexpectedly found that premature BMP activity could not induce early FMRFa expression; also, we show that the BMP-insensitive HD-RE cis-element is activated at the time of target contact. This led us to uncover a role for the nuclear receptor, seven up (svp), as a repressor of FMRFa induction prior to target contact. Svp is normally downregulated immediately prior to target contact, and we found that maintaining Svp expression prevents cis-element activation, whereas reducing svp gene dosage prematurely activates cis-element activity. We conclude that the target-dependent FMRFa gene is repressed prior to target contact, and that target-derived BMP signaling directly

  2. Ocean warming and acidification modulate energy budget and gill ion regulatory mechanisms in Atlantic cod (Gadus morhua).

    PubMed

    Kreiss, C M; Michael, K; Lucassen, M; Jutfelt, F; Motyka, R; Dupont, S; Pörtner, H-O

    2015-10-01

    Ocean warming and acidification are threatening marine ecosystems. In marine animals, acidification is thought to enhance ion regulatory costs and thereby baseline energy demand, while elevated temperature also increases baseline metabolic rate. Here we investigated standard metabolic rates (SMR) and plasma parameters of Atlantic cod (Gadus morhua) after 3-4 weeks of exposure to ambient and future PCO2 levels (550, 1200 and 2200 µatm) and at two temperatures (10, 18 °C). In vivo branchial ion regulatory costs were studied in isolated, perfused gill preparations. Animals reared at 18 °C responded to increasing CO2 by elevating SMR, in contrast to specimens at 10 °C. Isolated gills at 10 °C and elevated PCO2 (≥1200 µatm) displayed increased soft tissue mass, in parallel to increased gill oxygen demand, indicating an increased fraction of gill in whole animal energy budget. Altered gill size was not found at 18 °C, where a shift in the use of ion regulation mechanisms occurred towards enhanced Na(+)/H(+)-exchange and HCO3 (-) transport at high PCO2 (2200 µatm), paralleled by higher Na(+)/K(+)-ATPase activities. This shift did not affect total gill energy consumption leaving whole animal energy budget unaffected. Higher Na(+)/K(+)-ATPase activities in the warmth might have compensated for enhanced branchial permeability and led to reduced plasma Na(+) and/or Cl(-) concentrations and slightly lowered osmolalities seen at 18 °C and 550 or 2200 µatm PCO2 in vivo. Overall, the gill as a key ion regulation organ seems to be highly effective in supporting the resilience of cod to effects of ocean warming and acidification. PMID:26219611

  3. Glucocorticoid receptor-mediated cell cycle arrest is achieved through distinct cell-specific transcriptional regulatory mechanisms.

    PubMed Central

    Rogatsky, I; Trowbridge, J M; Garabedian, M J

    1997-01-01

    Glucocorticoids inhibit proliferation of many cell types, but the events leading from the activated glucocorticoid receptor (GR) to growth arrest are not understood. Ectopic expression and activation of GR in human osteosarcoma cell lines U2OS and SAOS2, which lack endogenous receptors, result in a G1 cell cycle arrest. GR activation in U2OS cells represses expression of the cyclin-dependent kinases (CDKs) CDK4 and CDK6 as well as their regulatory partner, cyclin D3, leading to hypophosphorylation of the retinoblastoma protein (Rb). We also demonstrate a ligand-dependent reduction in the expression of E2F-1 and c-Myc, transcription factors involved in the G1-to-S-phase transition. Mitogen-activated protein kinase, CDK2, cyclin E, and the CDK inhibitors (CDIs) p27 and p21 are unaffected by receptor activation in U2OS cells. The receptor's N-terminal transcriptional activation domain is not required for growth arrest in U2OS cells. In Rb-deficient SAOS2 cells, however, the expression of p27 and p21 is induced upon receptor activation. Remarkably, in SAOS2 cells that express a GR deletion derivative lacking the N-terminal transcriptional activation domain, induction of CDI expression is abolished and the cells fail to undergo ligand-dependent cell cycle arrest. Similarly, murine S49 lymphoma cells, which, like SAOS2 cells, lack Rb, require the N-terminal activation domain for growth arrest and induce CDI expression upon GR activation. These cell-type-specific differences in receptor domains and cellular targets linking GR activation to cell cycle machinery suggest two distinct regulatory mechanisms of GR-mediated cell cycle arrest: one involving transcriptional repression of G1 cyclins and CDKs and the other involving enhanced transcription of CDIs by the activated receptor. PMID:9154817

  4. Ocean warming and acidification modulate energy budget and gill ion regulatory mechanisms in Atlantic cod (Gadus morhua).

    PubMed

    Kreiss, C M; Michael, K; Lucassen, M; Jutfelt, F; Motyka, R; Dupont, S; Pörtner, H-O

    2015-10-01

    Ocean warming and acidification are threatening marine ecosystems. In marine animals, acidification is thought to enhance ion regulatory costs and thereby baseline energy demand, while elevated temperature also increases baseline metabolic rate. Here we investigated standard metabolic rates (SMR) and plasma parameters of Atlantic cod (Gadus morhua) after 3-4 weeks of exposure to ambient and future PCO2 levels (550, 1200 and 2200 µatm) and at two temperatures (10, 18 °C). In vivo branchial ion regulatory costs were studied in isolated, perfused gill preparations. Animals reared at 18 °C responded to increasing CO2 by elevating SMR, in contrast to specimens at 10 °C. Isolated gills at 10 °C and elevated PCO2 (≥1200 µatm) displayed increased soft tissue mass, in parallel to increased gill oxygen demand, indicating an increased fraction of gill in whole animal energy budget. Altered gill size was not found at 18 °C, where a shift in the use of ion regulation mechanisms occurred towards enhanced Na(+)/H(+)-exchange and HCO3 (-) transport at high PCO2 (2200 µatm), paralleled by higher Na(+)/K(+)-ATPase activities. This shift did not affect total gill energy consumption leaving whole animal energy budget unaffected. Higher Na(+)/K(+)-ATPase activities in the warmth might have compensated for enhanced branchial permeability and led to reduced plasma Na(+) and/or Cl(-) concentrations and slightly lowered osmolalities seen at 18 °C and 550 or 2200 µatm PCO2 in vivo. Overall, the gill as a key ion regulation organ seems to be highly effective in supporting the resilience of cod to effects of ocean warming and acidification.

  5. Targeted mutagenesis of intergenic regions in the Neisseria gonorrhoeae gonococcal genetic island reveals multiple regulatory mechanisms controlling type IV secretion

    PubMed Central

    Ramsey, Meghan E.; Bender, Tobias; Klimowicz, Amy K.; Hackett, Kathleen T.; Yamamoto, Ami; Jolicoeur, Adrienne; Callaghan, Melanie M.; Wassarman, Karen M.; van der Does, Chris; Dillard, Joseph P.

    2015-01-01

    Summary Gonococci secrete chromosomal DNA into the extracellular environment using a type IV secretion system (T4SS). The secreted DNA acts in natural transformation and initiates biofilm development. Although the DNA and its effects are detectable, structural components of the T4SS are present at very low levels, suggestive of uncharacterized regulatory control. We sought to better characterize the expression and regulation of T4SS genes and found that the four operons containing T4SS genes are transcribed at very different levels. Increasing transcription of two of the operons through targeted promoter mutagenesis did not increase DNA secretion. The stability and steady-state levels of two T4SS structural proteins were affected by a homolog of tail-specific protease. An RNA switch was also identified that regulates translation of a third T4SS operon. The switch mechanism relies on two putative stem-loop structures contained within the 5’ untranslated region of the transcript, one of which occludes the ribosome binding site and start codon. Mutational analysis of these stem-loops supports a model in which induction of an alternative structure relieves repression. Taken together, these results identify multiple layers of regulation, including transcriptional, translational, and post-translational mechanisms controlling T4SS gene expression and DNA secretion. PMID:26076069

  6. Targeted mutagenesis of intergenic regions in the Neisseria gonorrhoeae gonococcal genetic island reveals multiple regulatory mechanisms controlling type IV secretion.

    PubMed

    Ramsey, Meghan E; Bender, Tobias; Klimowicz, Amy K; Hackett, Kathleen T; Yamamoto, Ami; Jolicoeur, Adrienne; Callaghan, Melanie M; Wassarman, Karen M; van der Does, Chris; Dillard, Joseph P

    2015-09-01

    Gonococci secrete chromosomal DNA into the extracellular environment using a type IV secretion system (T4SS). The secreted DNA acts in natural transformation and initiates biofilm development. Although the DNA and its effects are detectable, structural components of the T4SS are present at very low levels, suggestive of uncharacterized regulatory control. We sought to better characterize the expression and regulation of T4SS genes and found that the four operons containing T4SS genes are transcribed at very different levels. Increasing transcription of two of the operons through targeted promoter mutagenesis did not increase DNA secretion. The stability and steady-state levels of two T4SS structural proteins were affected by a homolog of tail-specific protease. An RNA switch was also identified that regulates translation of a third T4SS operon. The switch mechanism relies on two putative stem-loop structures contained within the 5' untranslated region of the transcript, one of which occludes the ribosome binding site and start codon. Mutational analysis of these stem loops supports a model in which induction of an alternative structure relieves repression. Taken together, these results identify multiple layers of regulation, including transcriptional, translational and post-translational mechanisms controlling T4SS gene expression and DNA secretion.

  7. Targeted mutagenesis of intergenic regions in the Neisseria gonorrhoeae gonococcal genetic island reveals multiple regulatory mechanisms controlling type IV secretion.

    PubMed

    Ramsey, Meghan E; Bender, Tobias; Klimowicz, Amy K; Hackett, Kathleen T; Yamamoto, Ami; Jolicoeur, Adrienne; Callaghan, Melanie M; Wassarman, Karen M; van der Does, Chris; Dillard, Joseph P

    2015-09-01

    Gonococci secrete chromosomal DNA into the extracellular environment using a type IV secretion system (T4SS). The secreted DNA acts in natural transformation and initiates biofilm development. Although the DNA and its effects are detectable, structural components of the T4SS are present at very low levels, suggestive of uncharacterized regulatory control. We sought to better characterize the expression and regulation of T4SS genes and found that the four operons containing T4SS genes are transcribed at very different levels. Increasing transcription of two of the operons through targeted promoter mutagenesis did not increase DNA secretion. The stability and steady-state levels of two T4SS structural proteins were affected by a homolog of tail-specific protease. An RNA switch was also identified that regulates translation of a third T4SS operon. The switch mechanism relies on two putative stem-loop structures contained within the 5' untranslated region of the transcript, one of which occludes the ribosome binding site and start codon. Mutational analysis of these stem loops supports a model in which induction of an alternative structure relieves repression. Taken together, these results identify multiple layers of regulation, including transcriptional, translational and post-translational mechanisms controlling T4SS gene expression and DNA secretion. PMID:26076069

  8. TRIENNIAL LACTATION SYMPOSIUM: Systems biology of regulatory mechanisms of nutrient metabolism in lactation.

    PubMed

    McNamara, J P

    2015-12-01

    A major role of the dairy cow is to convert low-quality plant materials into high-quality protein and other nutrients for humans. We must select and manage cows with the goal of having animals of the greatest efficiency matched to their environment. We have increased efficiency tremendously over the years, yet the variation in productive and reproductive efficiency among animals is still large. In part, this is because of a lack of full integration of genetic, nutritional, and reproductive biology into management decisions. However, integration across these disciplines is increasing as the biological research findings show specific control points at which genetics, nutrition, and reproduction interact. An ordered systems biology approach that focuses on why and how cells regulate energy and N use and on how and why organs interact through endocrine and neurocrine mechanisms will speed improvements in efficiency. More sophisticated dairy managers will demand better information to improve the efficiency of their animals. Using genetic improvement and animal management to improve milk productive and reproductive efficiency requires a deeper understanding of metabolic processes throughout the life cycle. Using existing metabolic models, we can design experiments specifically to integrate data from global transcriptional profiling into models that describe nutrient use in farm animals. A systems modeling approach can help focus our research to make faster and larger advances in efficiency and determine how this knowledge can be applied on the farms.

  9. TRIENNIAL LACTATION SYMPOSIUM: Systems biology of regulatory mechanisms of nutrient metabolism in lactation.

    PubMed

    McNamara, J P

    2015-12-01

    A major role of the dairy cow is to convert low-quality plant materials into high-quality protein and other nutrients for humans. We must select and manage cows with the goal of having animals of the greatest efficiency matched to their environment. We have increased efficiency tremendously over the years, yet the variation in productive and reproductive efficiency among animals is still large. In part, this is because of a lack of full integration of genetic, nutritional, and reproductive biology into management decisions. However, integration across these disciplines is increasing as the biological research findings show specific control points at which genetics, nutrition, and reproduction interact. An ordered systems biology approach that focuses on why and how cells regulate energy and N use and on how and why organs interact through endocrine and neurocrine mechanisms will speed improvements in efficiency. More sophisticated dairy managers will demand better information to improve the efficiency of their animals. Using genetic improvement and animal management to improve milk productive and reproductive efficiency requires a deeper understanding of metabolic processes throughout the life cycle. Using existing metabolic models, we can design experiments specifically to integrate data from global transcriptional profiling into models that describe nutrient use in farm animals. A systems modeling approach can help focus our research to make faster and larger advances in efficiency and determine how this knowledge can be applied on the farms. PMID:26641166

  10. Inducible nitric oxide synthase (NOS-2) in subarachnoid hemorrhage: Regulatory mechanisms and therapeutic implications

    PubMed Central

    Iqbal, Sana; Hayman, Erik G; Hong, Caron; Stokum, Jesse A; Kurland, David B; Gerzanich, Volodymyr; Simard, J Marc

    2016-01-01

    Aneurysmal subarachnoid hemorrhage (SAH) typically carries a poor prognosis. Growing evidence indicates that overabundant production of nitric oxide (NO) may be responsible for a large part of the secondary injury that follows SAH. Although SAH modulates the activity of all three isoforms of nitric oxide synthase (NOS), the inducible isoform, NOS-2, accounts for a majority of NO-mediated secondary injuries after SAH. Here, we review the indispensable physiological roles of NO that must be preserved, even while attempting to downmodulate the pathophysiologic effects of NO that are induced by SAH. We examine the effects of SAH on the function of the various NOS isoforms, with a particular focus on the pathological effects of NOS-2 and on the mechanisms responsible for its transcriptional upregulation. Finally, we review interventions to block NOS-2 upregulation or to counteract its effects, with an emphasis on the potential therapeutic strategies to improve outcomes in patients afflicted with SAH. There is still much to be learned regarding the apparently maladaptive response of NOS-2 and its harmful product NO in SAH. However, the available evidence points to crucial effects that, on balance, are adverse, making the NOS-2/NO/peroxynitrite axis an attractive therapeutic target in SAH. PMID:27774520

  11. Tuning of Redox Regulatory Mechanisms, Reactive Oxygen Species and Redox Homeostasis under Salinity Stress.

    PubMed

    Hossain, M Sazzad; Dietz, Karl-Josef

    2016-01-01

    Soil salinity is a crucial environmental constraint which limits biomass production at many sites on a global scale. Saline growth conditions cause osmotic and ionic imbalances, oxidative stress and perturb metabolism, e.g., the photosynthetic electron flow. The plant ability to tolerate salinity is determined by multiple biochemical and physiological mechanisms protecting cell functions, in particular by regulating proper water relations and maintaining ion homeostasis. Redox homeostasis is a fundamental cell property. Its regulation includes control of reactive oxygen species (ROS) generation, sensing deviation from and readjustment of the cellular redox state. All these redox related functions have been recognized as decisive factors in salinity acclimation and adaptation. This review focuses on the core response of plants to overcome the challenges of salinity stress through regulation of ROS generation and detoxification systems and to maintain redox homeostasis. Emphasis is given to the role of NADH oxidase (RBOH), alternative oxidase (AOX), the plastid terminal oxidase (PTOX) and the malate valve with the malate dehydrogenase isoforms under salt stress. Overwhelming evidence assigns an essential auxiliary function of ROS and redox homeostasis to salinity acclimation of plants. PMID:27242807

  12. Social dominance-related major urinary proteins and the regulatory mechanism in mice.

    PubMed

    Guo, Huifen; Fang, Qi; Huo, Ying; Zhang, Yaohua; Zhang, Jianxu

    2015-11-01

    Major urinary proteins (MUPs) have been proven to be non-volatile male pheromones in mice. Here, we aimed to elucidate the relationship between MUPs and dominance hierarchy, and the underlying molecular mechanisms. Dominance-submission relationship was established by chronic dyadic encountering. We found that at the urinary protein level and hepatic mRNA level, the expression of major MUPs, including Mup20, was enhanced in dominant males compared with subordinate males, indicating that MUPs might signal the social status of male mice. Meanwhile, the mRNA level of hepatic corticotropin releasing hormone receptor 2 (CRHR2) was higher in subordinate male mice than in dominant male mice. Castration also enhanced the expression of CRHR2, but suppressed that of MUPs. CRHR2 agonist treatment reduced the expression of MUPs in liver. However, male social status failed to exert significant influence on serum testosterone and corticosterone as well as the mRNA expression of their receptors. These findings reveal that some MUPs, especially Mup20, might constitute potential dominance pheromones and could be downregulated by hepatic CRHR2, which is possibly independent of androgen or corticosterone systems.

  13. Familial autoinflammation with neutrophilic dermatosis reveals a regulatory mechanism of pyrin activation.

    PubMed

    Masters, Seth L; Lagou, Vasiliki; Jéru, Isabelle; Baker, Paul J; Van Eyck, Lien; Parry, David A; Lawless, Dylan; De Nardo, Dominic; Garcia-Perez, Josselyn E; Dagley, Laura F; Holley, Caroline L; Dooley, James; Moghaddas, Fiona; Pasciuto, Emanuela; Jeandel, Pierre-Yves; Sciot, Raf; Lyras, Dena; Webb, Andrew I; Nicholson, Sandra E; De Somer, Lien; van Nieuwenhove, Erika; Ruuth-Praz, Julia; Copin, Bruno; Cochet, Emmanuelle; Medlej-Hashim, Myrna; Megarbane, Andre; Schroder, Kate; Savic, Sinisa; Goris, An; Amselem, Serge; Wouters, Carine; Liston, Adrian

    2016-03-30

    Pyrin responds to pathogen signals and loss of cellular homeostasis by forming an inflammasome complex that drives the cleavage and secretion of interleukin-1β (IL-1β). Mutations in the B30.2/SPRY domain cause pathogen-independent activation of pyrin and are responsible for the autoinflammatory disease familial Mediterranean fever (FMF). We studied a family with a dominantly inherited autoinflammatory disease, distinct from FMF, characterized by childhood-onset recurrent episodes of neutrophilic dermatosis, fever, elevated acute-phase reactants, arthralgia, and myalgia/myositis. The disease was caused by a mutation in MEFV, the gene encoding pyrin (S242R). The mutation results in the loss of a 14-3-3 binding motif at phosphorylated S242, which was not perturbed by FMF mutations in the B30.2/SPRY domain. However, loss of both S242 phosphorylation and 14-3-3 binding was observed for bacterial effectors that activate the pyrin inflammasome, such as Clostridium difficile toxin B (TcdB). The S242R mutation thus recapitulated the effect of pathogen sensing, triggering inflammasome activation and IL-1β production. Successful therapy targeting IL-1β has been initiated in one patient, resolving pyrin-associated autoinflammation with neutrophilic dermatosis. This disease provides evidence that a guard-like mechanism of pyrin regulation, originally identified for Nod-like receptors in plant innate immunity, also exists in humans.

  14. Tuning of Redox Regulatory Mechanisms, Reactive Oxygen Species and Redox Homeostasis under Salinity Stress

    PubMed Central

    Hossain, M. Sazzad; Dietz, Karl-Josef

    2016-01-01

    Soil salinity is a crucial environmental constraint which limits biomass production at many sites on a global scale. Saline growth conditions cause osmotic and ionic imbalances, oxidative stress and perturb metabolism, e.g., the photosynthetic electron flow. The plant ability to tolerate salinity is determined by multiple biochemical and physiological mechanisms protecting cell functions, in particular by regulating proper water relations and maintaining ion homeostasis. Redox homeostasis is a fundamental cell property. Its regulation includes control of reactive oxygen species (ROS) generation, sensing deviation from and readjustment of the cellular redox state. All these redox related functions have been recognized as decisive factors in salinity acclimation and adaptation. This review focuses on the core response of plants to overcome the challenges of salinity stress through regulation of ROS generation and detoxification systems and to maintain redox homeostasis. Emphasis is given to the role of NADH oxidase (RBOH), alternative oxidase (AOX), the plastid terminal oxidase (PTOX) and the malate valve with the malate dehydrogenase isoforms under salt stress. Overwhelming evidence assigns an essential auxiliary function of ROS and redox homeostasis to salinity acclimation of plants. PMID:27242807

  15. Fluorescence single-molecule imaging of actin turnover and regulatory mechanisms.

    PubMed

    Watanabe, Naoki

    2012-01-01

    Cells must rapidly remodel the actin filament network to achieve various cellular functions. Actin filament turnover is a dynamic process that plays crucial roles in cell adhesion, locomotion, cytokinesis, endocytosis, phagocytosis, tissue remodeling, etc., and is regulated by cell signaling cascades. Success in elucidating dynamic biological processes such as actin-based motility relies on the means enabling real time monitoring of the process. The invention of live-cell fluorescence single-molecule imaging has opened a window for direct viewing of various actin remodeling processes. In general, assembly and dissociation of actin and its regulators turned out to occur at the faster rates than previously estimated by biochemical and structural analyses. Cells undergo such fast continuous exchange of the components perhaps not only to drive actin remodeling but also to facilitate rapid response in many other cell mechanics and signaling cascades. This chapter describes how epifluorescence single-molecule imaging which visualizes deeper area than the TIRF microscopy is achieved in XTC cells, the currently best platform for this approach.

  16. The Mechanisms of Water Exchange: The Regulatory Roles of Multiple Interactions in Social Wasps

    PubMed Central

    Agrawal, Devanshu; Karsai, Istvan

    2016-01-01

    Evolutionary benefits of task fidelity and improving information acquisition via multiple transfers of materials between individuals in a task partitioned system have been shown before, but in this paper we provide a mechanistic explanation of these phenomena. Using a simple mathematical model describing the individual interactions of the wasps, we explain the functioning of the common stomach, an information center, which governs construction behavior and task change. Our central hypothesis is a symmetry between foragers who deposit water and foragers who withdraw water into and out of the common stomach. We combine this with a trade-off between acceptance and resistance to water transfer. We ultimately derive a mathematical function that relates the number of interactions that foragers complete with common stomach wasps during a foraging cycle. We use field data and additional model assumptions to calculate values of our model parameters, and we use these to explain why the fullness of the common stomach stabilizes just below 50 percent, why the average number of successful interactions between foragers and the wasps forming the common stomach is between 5 and 7, and why there is a variation in this number of interactions over time. Our explanation is that our proposed water exchange mechanism places natural bounds on the number of successful interactions possible, water exchange is set to optimize mediation of water through the common stomach, and the chance that foragers abort their task prematurely is very low. PMID:26751076

  17. Phosphorylation regulates myo-inositol-3-phosphate synthase: a novel regulatory mechanism of inositol biosynthesis.

    PubMed

    Deranieh, Rania M; He, Quan; Caruso, Joseph A; Greenberg, Miriam L

    2013-09-13

    myo-Inositol-3-phosphate synthase (MIPS) plays a crucial role in inositol homeostasis. Transcription of the coding gene INO1 is highly regulated. However, regulation of the enzyme is not well defined. We previously showed that MIPS is indirectly inhibited by valproate, suggesting that the enzyme is post-translationally regulated. Using (32)Pi labeling and phosphoamino acid analysis, we show that yeast MIPS is a phosphoprotein. Mass spectrometry analysis identified five phosphosites, three of which are conserved in the human MIPS. Analysis of phosphorylation-deficient and phosphomimetic site mutants indicated that the three conserved sites in yeast (Ser-184, Ser-296, and Ser-374) and humans (Ser-177, Ser-279, and Ser-357) affect MIPS activity. Both S296A and S296D yeast mutants and S177A and S177D human mutants exhibited decreased enzymatic activity, suggesting that a serine residue is critical at that location. The phosphomimetic mutations S184D (human S279D) and S374D (human S357D) but not the phosphodeficient mutations decreased activity, suggesting that phosphorylation of these two sites is inhibitory. The double mutation S184A/S374A caused an increase in MIPS activity, conferred a growth advantage, and partially rescued sensitivity to valproate. Our findings identify a novel mechanism of regulation of inositol synthesis by phosphorylation of MIPS.

  18. Seasonality of reproduction in mammals: intimate regulatory mechanisms and practical implications.

    PubMed

    Chemineau, P; Guillaume, D; Migaud, M; Thiéry, J C; Pellicer-Rubio, M T; Malpaux, B

    2008-07-01

    Farm mammals generally express seasonal variations in their production traits, thus inducing changing availability of fresh derived animal products (meat, milk and cheese) or performances (horses). This is due to a more or less marked seasonal birth distribution in sheep and goats, in horses but not cattle. Birth peak occurs at the end of winter-early spring, the most favourable period for the progeny to survive. Most species show seasonal variations in their ovulation frequency (presence or absence of ovulation), spermatogenic activity (from moderate decrease to complete absence of sperm production), gamete quality (variations in fertilization rates and embryo survival), and also sexual behaviour. The intimate mechanism involved is a complex combination of endogenous circannual rhythm driven and synchronized by light and melatonin. Profound and long-term neuroendocrine changes involving different neuromediator systems were described to play a role in these processes. In most species artificial photoperiodic treatments consisting of extra-light during natural short days (in sheep and goats and mares) or melatonin during long days (in sheep and goats) are extensively used to either adjust the breeding season to animal producer needs and/or to completely overcome seasonal variations of sperm production in artificial insemination centres. Pure light treatments (without melatonin), especially when applied in open barns, could be considered as non-invasive ones which fully respect animal welfare. Genetic selection could be one of the future ways to decrease seasonality in sheep and goats. PMID:18638103

  19. Sweat, the driving force behind normal skin: an emerging perspective on functional biology and regulatory mechanisms.

    PubMed

    Murota, Hiroyuki; Matsui, Saki; Ono, Emi; Kijima, Akiko; Kikuta, Junichi; Ishii, Masaru; Katayama, Ichiro

    2015-01-01

    The various symptoms associated with excessive or insufficient perspiration can significantly reduce a patient's quality of life. If a versatile and minimally invasive method could be established for returning sweat activity to normalcy, there is no question that it could be used in the treatment of many diseases that are believed to involve perspiration. For this reason, based on an understanding of the sweat-gland control function and sweat activity, it was necessary to conduct a comprehensive search for the factors that control sweating, such as the central and peripheral nerves that control sweat-gland function, the microenvironment surrounding the sweat glands, and lifestyle. We focused on the mechanism by which atopic dermatitis leads to hypohidrosis and confirmed that histamine inhibits acetylcholinergic sweating. Acetylcholine promotes the phosphorylation of glycogen synthesis kinase 3β (GSK3β) in the sweat-gland secretory cells and leads to sensible perspiration. By suppressing the phosphorylation of GSK3β, histamine inhibits the movement of sweat from the sweat-gland secretory cells through the sweat ducts, which could presumably be demonstrated by dynamic observations of the sweat glands using two-photon microscopy. It is expected that the discovery of new factors that control sweat-gland function can contribute to the treatment of diseases associated with dyshidrosis.

  20. The Mechanisms of Water Exchange: The Regulatory Roles of Multiple Interactions in Social Wasps.

    PubMed

    Agrawal, Devanshu; Karsai, Istvan

    2016-01-01

    Evolutionary benefits of task fidelity and improving information acquisition via multiple transfers of materials between individuals in a task partitioned system have been shown before, but in this paper we provide a mechanistic explanation of these phenomena. Using a simple mathematical model describing the individual interactions of the wasps, we explain the functioning of the common stomach, an information center, which governs construction behavior and task change. Our central hypothesis is a symmetry between foragers who deposit water and foragers who withdraw water into and out of the common stomach. We combine this with a trade-off between acceptance and resistance to water transfer. We ultimately derive a mathematical function that relates the number of interactions that foragers complete with common stomach wasps during a foraging cycle. We use field data and additional model assumptions to calculate values of our model parameters, and we use these to explain why the fullness of the common stomach stabilizes just below 50 percent, why the average number of successful interactions between foragers and the wasps forming the common stomach is between 5 and 7, and why there is a variation in this number of interactions over time. Our explanation is that our proposed water exchange mechanism places natural bounds on the number of successful interactions possible, water exchange is set to optimize mediation of water through the common stomach, and the chance that foragers abort their task prematurely is very low.

  1. The Mechanisms of Water Exchange: The Regulatory Roles of Multiple Interactions in Social Wasps.

    PubMed

    Agrawal, Devanshu; Karsai, Istvan

    2016-01-01

    Evolutionary benefits of task fidelity and improving information acquisition via multiple transfers of materials between individuals in a task partitioned system have been shown before, but in this paper we provide a mechanistic explanation of these phenomena. Using a simple mathematical model describing the individual interactions of the wasps, we explain the functioning of the common stomach, an information center, which governs construction behavior and task change. Our central hypothesis is a symmetry between foragers who deposit water and foragers who withdraw water into and out of the common stomach. We combine this with a trade-off between acceptance and resistance to water transfer. We ultimately derive a mathematical function that relates the number of interactions that foragers complete with common stomach wasps during a foraging cycle. We use field data and additional model assumptions to calculate values of our model parameters, and we use these to explain why the fullness of the common stomach stabilizes just below 50 percent, why the average number of successful interactions between foragers and the wasps forming the common stomach is between 5 and 7, and why there is a variation in this number of interactions over time. Our explanation is that our proposed water exchange mechanism places natural bounds on the number of successful interactions possible, water exchange is set to optimize mediation of water through the common stomach, and the chance that foragers abort their task prematurely is very low. PMID:26751076

  2. Endocannabinoids are Involved in Male Vertebrate Reproduction: Regulatory Mechanisms at Central and Gonadal Level.

    PubMed

    Bovolin, Patrizia; Cottone, Erika; Pomatto, Valentina; Fasano, Silvia; Pierantoni, Riccardo; Cobellis, Gilda; Meccariello, Rosaria

    2014-01-01

    Endocannabinoids (eCBs) are natural lipids regulating a large array of physiological functions and behaviors in vertebrates. The eCB system is highly conserved in evolution and comprises several specific receptors (type-1 and type-2 cannabinoid receptors), their endogenous ligands (e.g., anandamide and 2-arachidonoylglycerol), and a number of biosynthetic and degradative enzymes. In the last few years, eCBs have been described as critical signals in the control of male and female reproduction at multiple levels: centrally, by targeting hypothalamic gonadotropin-releasing-hormone-secreting neurons and pituitary, and locally, with direct effects on the gonads. These functions are supported by the extensive localization of cannabinoid receptors and eCB metabolic enzymes at different levels of the hypothalamic-pituitary-gonadal axis in mammals, as well as bonyfish and amphibians. In vivo and in vitro studies indicate that eCBs centrally regulate gonadal functions by modulating the gonadotropin-releasing hormone-gonadotropin-steroid network through direct and indirect mechanisms. Several proofs of local eCB regulation have been found in the testis and male genital tracts, since eCBs control Sertoli and Leydig cells activity, germ cell progression, as well as the acquisition of sperm functions. A comparative approach usually is a key step in the study of physiological events leading to the building of a general model. Thus, in this review, we summarize the action of eCBs at different levels of the male reproductive axis, with special emphasis, where appropriate, on data from non-mammalian vertebrates.

  3. Regulatory mechanisms of the acrosome reaction revealed by multiview microscopy of single starfish sperm

    PubMed Central

    1995-01-01

    The acrosome reaction in many animals is a coupled reaction involving an exocytotic step and a dramatic change in cell shape. It has been proposed that these morphological changes are regulated by intracellular ions such as Ca2+ and H+. We report here simultaneous visualization, under a multiview microscope, of intracellular free Ca2+ concentration ([Ca2+]i), intracellular pH (pHi), and morphological changes in a single starfish sperm (Asterina pectinifera). [Ca2+]i and pHi were monitored with the fluorescent probes indo-1 and SNARF-1, respectively. The acrosome reaction was induced with ionomycin. After the introduction of ionomycin in the medium, [Ca2+]i increased gradually and reached a plateau in approximately 30 s. The fusion of the acrosomal vacuole took place abruptly before the plateau, during the rising phase. Although the speed of the [Ca2+]i increase varied among the many sperm tested, exocytosis in all cases occurred at the same [Ca2+]i of approximately 2 microM (estimated using the dissociation constant of indo-1 for Ca2+ of 1.1 microM). This result suggests that the exocytotic mechanism in starfish sperm responds to [Ca2+]i rapidly, with a reaction time of the order of one second or less. Unlike the change in [Ca2+]i, an abrupt increase in pHi was observed immediately after exocytosis, suggesting the presence of a proton mobilizing system that is triggered by exocytosis. The rapid increase in pHi coincided with the formation of the acrosomal rod and the beginning of vigorous movement of the flagellum, both of which have been proposed to be pHi dependent. The exocytotic event itself was visualized with the fluorescent membrane probe RH292. The membrane of the acrosomal vacuole, concealed from the external medium in an unreacted sperm, was seen to fuse with the plasma membrane. PMID:7490297

  4. Endocannabinoids are Involved in Male Vertebrate Reproduction: Regulatory Mechanisms at Central and Gonadal Level

    PubMed Central

    Bovolin, Patrizia; Cottone, Erika; Pomatto, Valentina; Fasano, Silvia; Pierantoni, Riccardo; Cobellis, Gilda; Meccariello, Rosaria

    2014-01-01

    Endocannabinoids (eCBs) are natural lipids regulating a large array of physiological functions and behaviors in vertebrates. The eCB system is highly conserved in evolution and comprises several specific receptors (type-1 and type-2 cannabinoid receptors), their endogenous ligands (e.g., anandamide and 2-arachidonoylglycerol), and a number of biosynthetic and degradative enzymes. In the last few years, eCBs have been described as critical signals in the control of male and female reproduction at multiple levels: centrally, by targeting hypothalamic gonadotropin-releasing-hormone-secreting neurons and pituitary, and locally, with direct effects on the gonads. These functions are supported by the extensive localization of cannabinoid receptors and eCB metabolic enzymes at different levels of the hypothalamic–pituitary–gonadal axis in mammals, as well as bonyfish and amphibians. In vivo and in vitro studies indicate that eCBs centrally regulate gonadal functions by modulating the gonadotropin-releasing hormone–gonadotropin–steroid network through direct and indirect mechanisms. Several proofs of local eCB regulation have been found in the testis and male genital tracts, since eCBs control Sertoli and Leydig cells activity, germ cell progression, as well as the acquisition of sperm functions. A comparative approach usually is a key step in the study of physiological events leading to the building of a general model. Thus, in this review, we summarize the action of eCBs at different levels of the male reproductive axis, with special emphasis, where appropriate, on data from non-mammalian vertebrates. PMID:24782832

  5. Anaerobic transcription activation in Bacillus subtilis: identification of distinct FNR-dependent and -independent regulatory mechanisms.

    PubMed Central

    Cruz Ramos, H; Boursier, L; Moszer, I; Kunst, F; Danchin, A; Glaser, P

    1995-01-01

    Bacillus subtilis is able to grow anaerobically using alternative electron acceptors, including nitrate or fumarate. We characterized an operon encoding the dissimilatory nitrate reductase subunits homologous to the Escherichia coli narGHJI operon and the narK gene encoding a protein with nitrite extrusion activity. Downstream from narK and co-transcribed with it a gene (fnr) encoding a protein homologous to E.coli FNR was found. Disruption of fnr abolished both nitrate and fumarate utilization as electron acceptors and anaerobic induction of narK. Four putative FNR binding sites were found in B.subtilis sequences. The consensus sequence, centred at position -41.5, is identical to the consensus for the DNA site for E.coli CAP. Bs-FNR contained a four cysteine residue cluster at its C-terminal end. This is in contrast to Ec-FNR, where a similar cluster is present at the N-terminal end. It is possible that oxygen modulates the activity of both activators by a similar mechanism involving iron. Unlike in E.coli, where fnr expression is weakly repressed by anaerobiosis, fnr gene expression in B.subtilis is strongly activated by anaerobiosis. We have identified in the narK-fnr intergenic region a promotor activated by anaerobiosis independently of FNR. Thus induction of genes involved in anaerobic respiration requires in B.subtilis at least two levels of regulation: activation of fnr transcription and activation of FNR to induce transcription of FNR-dependent promoters. Images PMID:8846791

  6. Vpu Mediates Depletion of Interferon Regulatory Factor 3 during HIV Infection by a Lysosome-Dependent Mechanism

    PubMed Central

    Doehle, Brian P.; Chang, Kristina; Rustagi, Arjun; McNevin, John; McElrath, M. Juliana

    2012-01-01

    HIV has evolved sophisticated mechanisms to avoid restriction by intracellular innate immune defenses that otherwise serve to control acute viral infection and virus dissemination. Innate defenses are triggered when pattern recognition receptor (PRR) proteins of the host cell engage pathogen-associated molecule patterns (PAMPs) present in viral products. Interferon regulatory factor 3 (IRF3) plays a central role in PRR signaling of innate immunity to drive the expression of type I interferon (IFN) and interferon-stimulated genes (ISGs), including a variety of HIV restriction factors, that serve to limit viral replication directly and/or program adaptive immunity. Productive infection of T cells by HIV is dependent upon the targeted proteolysis of IRF3 that occurs through a virus-directed mechanism that results in suppression of innate immune defenses. However, the mechanisms by which HIV controls innate immune signaling and IRF3 function are not defined. Here, we examined the innate immune response induced by HIV strains identified through their differential control of PRR signaling. We identified viruses that, unlike typical circulating HIV strains, lack the ability to degrade IRF3. Our studies show that IRF3 regulation maps specifically to the HIV accessory protein Vpu. We define a molecular interaction between Vpu and IRF3 that redirects IRF3 to the endolysosome for proteolytic degradation, thus allowing HIV to avoid the innate antiviral immune response. Our studies reveal that Vpu is an important IRF3 regulator that supports acute HIV infection through innate immune suppression. These observations define the Vpu-IRF3 interface as a novel target for therapeutic strategies aimed at enhancing the immune response to HIV. PMID:22593165

  7. Vpu mediates depletion of interferon regulatory factor 3 during HIV infection by a lysosome-dependent mechanism.

    PubMed

    Doehle, Brian P; Chang, Kristina; Rustagi, Arjun; McNevin, John; McElrath, M Juliana; Gale, Michael

    2012-08-01

    HIV has evolved sophisticated mechanisms to avoid restriction by intracellular innate immune defenses that otherwise serve to control acute viral infection and virus dissemination. Innate defenses are triggered when pattern recognition receptor (PRR) proteins of the host cell engage pathogen-associated molecule patterns (PAMPs) present in viral products. Interferon regulatory factor 3 (IRF3) plays a central role in PRR signaling of innate immunity to drive the expression of type I interferon (IFN) and interferon-stimulated genes (ISGs), including a variety of HIV restriction factors, that serve to limit viral replication directly and/or program adaptive immunity. Productive infection of T cells by HIV is dependent upon the targeted proteolysis of IRF3 that occurs through a virus-directed mechanism that results in suppression of innate immune defenses. However, the mechanisms by which HIV controls innate immune signaling and IRF3 function are not defined. Here, we examined the innate immune response induced by HIV strains identified through their differential control of PRR signaling. We identified viruses that, unlike typical circulating HIV strains, lack the ability to degrade IRF3. Our studies show that IRF3 regulation maps specifically to the HIV accessory protein Vpu. We define a molecular interaction between Vpu and IRF3 that redirects IRF3 to the endolysosome for proteolytic degradation, thus allowing HIV to avoid the innate antiviral immune response. Our studies reveal that Vpu is an important IRF3 regulator that supports acute HIV infection through innate immune suppression. These observations define the Vpu-IRF3 interface as a novel target for therapeutic strategies aimed at enhancing the immune response to HIV.

  8. Frequency, Suppressive Capacity, Recruitment and Induction Mechanisms of Regulatory T Cells in Sinonasal Squamous Cell Carcinoma and Nasal Inverted Papilloma

    PubMed Central

    Li, Pingdong; Zhou, Weiguo; Wang, Yang; Fan, Erzhong; Li, Ying; Wang, Hong; Liu, Zhongyan; Xiao, Lei; Wang, Chengshuo; Zhang, Luo

    2015-01-01

    Background Sinonasal squamous cell carcinoma (SSCC) and nasal inverted papilloma (NIP) represent the predominant type of malignant and benign tumors in sinonasal tract, respectively. CD4+CD25+Foxp3+ natural regulatory T (Treg) cells might play critical role(s) in the suppression of anti-tumor immune response and thus shed light on tumor progression from benign to malignant. Objective This study aimed to evaluate the frequency and suppressive capacity of Treg cells in SSCC compared to NIP and further to explore the underlying mechanisms. Patients and Methods Frequencies of Treg, Th1 and Th2 cells were evaluated by flow cytometry in tissue homogenate and peripheral blood from 31 SSCC patients, 32 NIP patients and 35 normal controls. Treg cells were tested for regulatory function by co-culture with effector T cells. CCR4 and its ligands, CCL22 and CCL17, were analyzed by flow cytometry and Luminex, respectively. The chemoattractant properties of CCR4/CCL22 and CCR4/CCL17 for Treg cells were assessed using the Boyden chamber technique, to elucidate the potential mechanisms of Treg recruitment in tumor microenvironment. Treg cells induction via TGF-β was assessed with transwells after local CD4+Foxp3+ T cells were assessed by immunohistochemistry and TGF-β concentration was measured by Luminex. Results Tumor-infiltrating Treg cells increased significantly from normal to NIP to SSCC (P ≤ 0.001 for normal vs. NIP and P = 0.004 for NIP vs. SSCC). Significantly elevated frequency and enhanced suppression capacity of circulating Treg cells in SSCC were detected compared to NIP and healthy controls, concomitant with Th1 decrease and Th2 increase. Apparently increased CCL22 attracted CCR4-expressing Treg cells to tumor microenvironment in SSCC, compared to NIP. SSCC produced significantly more TGF-β than NIP and thus possessed greater potential for Treg cell induction. Conclusion Frequency and suppressive capacity of Treg cells enhanced with progression of malignancy from

  9. Mechanisms underlying zoonotic success of Campylobacter jejuni: the CprRS two-component regulatory system influences essential processes, biofilm formation, and pathogenesis

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Mechanisms underlying zoonotic success of Campylobacter jejuni: the CprRS two-component regulatory system influences essential processes, biofilm formation, and pathogenesis Campylobacter jejuni is a leading cause of food- and waterbourne bacterial gastroenteritis in the developed world. Although il...

  10. Myosin light chain kinase (MLCK) regulates cell migration in a myosin regulatory light chain phosphorylation-independent mechanism.

    PubMed

    Chen, Chen; Tao, Tao; Wen, Cheng; He, Wei-Qi; Qiao, Yan-Ning; Gao, Yun-Qian; Chen, Xin; Wang, Pei; Chen, Cai-Ping; Zhao, Wei; Chen, Hua-Qun; Ye, An-Pei; Peng, Ya-Jing; Zhu, Min-Sheng

    2014-10-10

    Myosin light chain kinase (MLCK) has long been implicated in the myosin phosphorylation and force generation required for cell migration. Here, we surprisingly found that the deletion of MLCK resulted in fast cell migration, enhanced protrusion formation, and no alteration of myosin light chain phosphorylation. The mutant cells showed reduced membrane tether force and fewer membrane F-actin filaments. This phenotype was rescued by either kinase-dead MLCK or five-DFRXXL motif, a MLCK fragment with potent F-actin-binding activity. Pull-down and co-immunoprecipitation assays showed that the absence of MLCK led to attenuated formation of transmembrane complexes, including myosin II, integrins and fibronectin. We suggest that MLCK is not required for myosin phosphorylation in a migrating cell. A critical role of MLCK in cell migration involves regulating the cell membrane tension and protrusion necessary for migration, thereby stabilizing the membrane skeleton through F-actin-binding activity. This finding sheds light on a novel regulatory mechanism of protrusion during cell migration.

  11. Auxin Response Factor SlARF2 Is an Essential Component of the Regulatory Mechanism Controlling Fruit Ripening in Tomato.

    PubMed

    Hao, Yanwei; Hu, Guojian; Breitel, Dario; Liu, Mingchun; Mila, Isabelle; Frasse, Pierre; Fu, Yongyao; Aharoni, Asaph; Bouzayen, Mondher; Zouine, Mohamed

    2015-12-01

    Ethylene is the main regulator of climacteric fruit ripening, by contrast the putative role of other phytohormones in this process remains poorly understood. The present study brings auxin signaling components into the mechanism regulating tomato fruit ripening through the functional characterization of Auxin Response Factor2 (SlARF2) which encodes a downstream component of auxin signaling. Two paralogs, SlARF2A and SlARF2B, are found in the tomato genome, both displaying a marked ripening-associated expression but distinct responsiveness to ethylene and auxin. Down-regulation of either SlARF2A or SlARF2B resulted in ripening defects while simultaneous silencing of both genes led to severe ripening inhibition suggesting a functional redundancy among the two ARFs. Tomato fruits under-expressing SlARF2 produced less climacteric ethylene and exhibited a dramatic down-regulation of the key ripening regulators RIN, CNR, NOR and TAGL1. Ethylene treatment failed to reverse the non-ripening phenotype and the expression of ethylene signaling and biosynthesis genes was strongly altered in SlARF2 down-regulated fruits. Although both SlARF proteins are transcriptional repressors the data indicate they work as positive regulators of tomato fruit ripening. Altogether, the study defines SlARF2 as a new component of the regulatory network controlling the ripening process in tomato. PMID:26716451

  12. Transcriptome Profiling Reveals the Regulatory Mechanism Underlying Pollination Dependent and Parthenocarpic Fruit Set Mainly Mediated by Auxin and Gibberellin

    PubMed Central

    Tang, Ning; Deng, Wei; Hu, Guojian; Hu, Nan; Li, Zhengguo

    2015-01-01

    Background Fruit set is a key process for crop production in tomato which occurs after successful pollination and fertilization naturally. However, parthenocarpic fruit development can be uncoupled from fertilization triggered by exogenous auxin or gibberellins (GAs). Global transcriptome knowledge during fruit initiation would help to characterize the molecular mechanisms by which these two hormones regulate pollination-dependent and -independent fruit set. Principal Findings In this work, digital gene expression tag profiling (DGE) technology was applied to compare the transcriptomes from pollinated and 2, 4-D/GA3-treated ovaries. Activation of carbohydrate metabolism, cell division and expansion as well as the down-regulation of MADS-box is a comprehensive regulatory pathway during pollination-dependent and parthenocarpic fruit set. The signaling cascades of auxin and GA are significantly modulated. The feedback regulations of Aux/IAAs and DELLA genes which functioned to fine-tune auxin and GA response respectively play fundamental roles in triggering fruit initiation. In addition, auxin regulates GA synthesis via up-regulation of GA20ox1 and down-regulation of KNOX. Accordingly, the effect of auxin on fruit set is mediated by GA via ARF2 and IAA9 down-regulation, suggesting that both pollination-dependent and parthenocarpic fruit set depend on the crosstalk between auxin and GA. Significance This study characterizes the transcriptomic features of ovary development and more importantly unravels the integral roles of auxin and GA on pollination-dependent and parthenocarpic fruit set. PMID:25909657

  13. Auxin Response Factor SlARF2 Is an Essential Component of the Regulatory Mechanism Controlling Fruit Ripening in Tomato

    PubMed Central

    Hao, Yanwei; Hu, Guojian; Breitel, Dario; Liu, Mingchun; Mila, Isabelle; Frasse, Pierre; Fu, Yongyao; Aharoni, Asaph; Bouzayen, Mondher; Zouine, Mohamed

    2015-01-01

    Ethylene is the main regulator of climacteric fruit ripening, by contrast the putative role of other phytohormones in this process remains poorly understood. The present study brings auxin signaling components into the mechanism regulating tomato fruit ripening through the functional characterization of Auxin Response Factor2 (SlARF2) which encodes a downstream component of auxin signaling. Two paralogs, SlARF2A and SlARF2B, are found in the tomato genome, both displaying a marked ripening-associated expression but distinct responsiveness to ethylene and auxin. Down-regulation of either SlARF2A or SlARF2B resulted in ripening defects while simultaneous silencing of both genes led to severe ripening inhibition suggesting a functional redundancy among the two ARFs. Tomato fruits under-expressing SlARF2 produced less climacteric ethylene and exhibited a dramatic down-regulation of the key ripening regulators RIN, CNR, NOR and TAGL1. Ethylene treatment failed to reverse the non-ripening phenotype and the expression of ethylene signaling and biosynthesis genes was strongly altered in SlARF2 down-regulated fruits. Although both SlARF proteins are transcriptional repressors the data indicate they work as positive regulators of tomato fruit ripening. Altogether, the study defines SlARF2 as a new component of the regulatory network controlling the ripening process in tomato. PMID:26716451

  14. Inhibition of protein synthesis by TOR inactivation revealed a conserved regulatory mechanism of the BiP chaperone in Chlamydomonas.

    PubMed

    Díaz-Troya, Sandra; Pérez-Pérez, María Esther; Pérez-Martín, Marta; Moes, Suzette; Jeno, Paul; Florencio, Francisco J; Crespo, José L

    2011-10-01

    The target of rapamycin (TOR) kinase integrates nutritional and stress signals to coordinately control cell growth in all eukaryotes. TOR associates with highly conserved proteins to constitute two distinct signaling complexes termed TORC1 and TORC2. Inactivation of TORC1 by rapamycin negatively regulates protein synthesis in most eukaryotes. Here, we report that down-regulation of TOR signaling by rapamycin in the model green alga Chlamydomonas reinhardtii resulted in pronounced phosphorylation of the endoplasmic reticulum chaperone BiP. Our results indicated that Chlamydomonas TOR regulates BiP phosphorylation through the control of protein synthesis, since rapamycin and cycloheximide have similar effects on BiP modification and protein synthesis inhibition. Modification of BiP by phosphorylation was suppressed under conditions that require the chaperone activity of BiP, such as heat shock stress or tunicamycin treatment, which inhibits N-linked glycosylation of nascent proteins in the endoplasmic reticulum. A phosphopeptide localized in the substrate-binding domain of BiP was identified in Chlamydomonas cells treated with rapamycin. This peptide contains a highly conserved threonine residue that might regulate BiP function, as demonstrated by yeast functional assays. Thus, our study has revealed a regulatory mechanism of BiP in Chlamydomonas by phosphorylation/dephosphorylation events and assigns a role to the TOR pathway in the control of BiP modification.

  15. Auxin Response Factor SlARF2 Is an Essential Component of the Regulatory Mechanism Controlling Fruit Ripening in Tomato.

    PubMed

    Hao, Yanwei; Hu, Guojian; Breitel, Dario; Liu, Mingchun; Mila, Isabelle; Frasse, Pierre; Fu, Yongyao; Aharoni, Asaph; Bouzayen, Mondher; Zouine, Mohamed

    2015-12-01

    Ethylene is the main regulator of climacteric fruit ripening, by contrast the putative role of other phytohormones in this process remains poorly understood. The present study brings auxin signaling components into the mechanism regulating tomato fruit ripening through the functional characterization of Auxin Response Factor2 (SlARF2) which encodes a downstream component of auxin signaling. Two paralogs, SlARF2A and SlARF2B, are found in the tomato genome, both displaying a marked ripening-associated expression but distinct responsiveness to ethylene and auxin. Down-regulation of either SlARF2A or SlARF2B resulted in ripening defects while simultaneous silencing of both genes led to severe ripening inhibition suggesting a functional redundancy among the two ARFs. Tomato fruits under-expressing SlARF2 produced less climacteric ethylene and exhibited a dramatic down-regulation of the key ripening regulators RIN, CNR, NOR and TAGL1. Ethylene treatment failed to reverse the non-ripening phenotype and the expression of ethylene signaling and biosynthesis genes was strongly altered in SlARF2 down-regulated fruits. Although both SlARF proteins are transcriptional repressors the data indicate they work as positive regulators of tomato fruit ripening. Altogether, the study defines SlARF2 as a new component of the regulatory network controlling the ripening process in tomato.

  16. Simulations of cellulose translocation in the bacterial cellulose synthase suggest a regulatory mechanism for the dimeric structure of cellulose

    DOE PAGESBeta

    Knott, Brandon C.; Crowley, Michael F.; Himmel, Michael E.; Zimmer, Jochen; Beckham, Gregg T.

    2016-01-29

    The processive cycle of the bacterial cellulose synthase (Bcs) includes the addition of a single glucose moiety to the end of a growing cellulose chain followed by the translocation of the nascent chain across the plasma membrane. The mechanism of this translocation and its precise location within the processive cycle are not well understood. In particular, the molecular details of how a polymer (cellulose) whose basic structural unit is a dimer (cellobiose) can be constructed by adding one monomer (glucose) at a time are yet to be elucidated. Here, we have utilized molecular dynamics simulations and free energy calculations tomore » the shed light on these questions. We find that translocation forward by one glucose unit is quite favorable energetically, giving a free energy stabilization of greater than 10 kcal mol-1. In addition, there is only a small barrier to translocation, implying that translocation is not rate limiting within the Bcs processive cycle (given experimental rates for cellulose synthesis in vitro). Perhaps most significantly, our results also indicate that steric constraints at the transmembrane tunnel entrance regulate the dimeric structure of cellulose. Namely, when a glucose molecule is added to the cellulose chain in the same orientation as the acceptor glucose, the terminal glucose freely rotates upon forward motion, thus suggesting a regulatory mechanism for the dimeric structure of cellulose. We characterize both the conserved and non-conserved enzyme-polysaccharide interactions that drive translocation, and find that 20 of the 25 residues that strongly interact with the translocating cellulose chain in the simulations are well conserved, mostly with polar or aromatic side chains. Our results also allow for a dynamical analysis of the role of the so-called 'finger helix' in cellulose translocation that has been observed structurally. Taken together, these findings aid in the elucidation of the translocation steps of the Bcs processive

  17. Simulations of cellulose translocation in the bacterial cellulose synthase suggest a regulatory mechanism for the dimeric structure of cellulose

    PubMed Central

    Knott, Brandon C.; Crowley, Michael F.; Himmel, Michael E.; Zimmer, Jochen; Beckham, Gregg T.

    2016-01-01

    The processive cycle of the bacterial cellulose synthase (Bcs) includes the addition of a single glucose moiety to the end of a growing cellulose chain followed by the translocation of the nascent chain across the plasma membrane. The mechanism of this translocation and its precise location within the processive cycle are not well understood. In particular, the molecular details of how a polymer (cellulose) whose basic structural unit is a dimer (cellobiose) can be constructed by adding one monomer (glucose) at a time are yet to be elucidated. Here, we have utilized molecular dynamics simulations and free energy calculations to the shed light on these questions. We find that translocation forward by one glucose unit is quite favorable energetically, giving a free energy stabilization of greater than 10 kcal/mol. In addition, there is only a small barrier to translocation, implying that translocation is not rate limiting within the Bcs processive cycle (given experimental rates for cellulose synthesis in vitro). Perhaps most significantly, our results also indicate that steric constraints at the transmembrane tunnel entrance regulate the dimeric structure of cellulose. Namely, when a glucose molecule is added to the cellulose chain in the same orientation as the acceptor glucose, the terminal glucose freely rotates upon forward motion, thus suggesting a regulatory mechanism for the dimeric structure of cellulose. We characterize both the conserved and non-conserved enzyme-polysaccharide interactions that drive translocation, and find that 20 of the 25 residues that strongly interact with the translocating cellulose chain in the simulations are well conserved, mostly with polar or aromatic side chains. Our results also allow for a dynamical analysis of the role of the so-called `finger helix' in cellulose translocation that has been observed structurally. Taken together, these findings aid in the elucidation of the translocation steps of the Bcs processive cycle and

  18. Mechanisms of immune suppression by interleukin-10 and transforming growth factor-β: the role of T regulatory cells

    PubMed Central

    Taylor, Alison; Verhagen, Johan; Blaser, Kurt; Akdis, Mübeccel; Akdis, Cezmi A

    2006-01-01

    Specific immune suppression and induction of tolerance are essential processes in the regulation and circumvention of immune defence. The balance between allergen-specific type 1 regulatory (Tr1) cells and T helper (Th) 2 cells appears to be decisive in the development of allergy. Tr1 cells consistently represent the dominant subset specific for common environmental allergens in healthy individuals. In contrast, there is a high frequency of allergen-specific interleukin-4 (IL-4)-secreting T cells in allergic individuals. Allergen-specific immunotherapy can induce specific Tr1 cells that abolish allergen-induced proliferation of Th1 and Th2 cells, as well as their cytokine production. Tr1 cells utilize multiple suppressor mechanisms, such as IL-10 and transforming growth factor-β (TGF-β) as secreted cytokines and various surface molecules, such as cytotoxic T-lymphocyte antigen 4 and programmed death-1. IL-10 only inhibits T cells stimulated by low numbers of triggered T-cell receptors, which depend on CD28 costimulation. IL-10 inhibits CD28 tyrosine phosphorylation, preventing the binding of phosphatidylinositol 3-kinase p85 and consequently inhibiting the CD28 signalling pathway. In addition, IL-10 and TGF-β secreted by Tr1 cells skew the antibody production from immunoglobulin E (IgE) towards the non-inflammatory isotypes IgG4 and IgA, respectively. Induction of antigen-specific Tr1 cells can thus re-direct an inappropriate immune response against allergens or auto-antigens using a broad range of suppressor mechanisms. PMID:16556256

  19. The function of the RNA-binding protein TEL1 in moss reveals ancient regulatory mechanisms of shoot development.

    PubMed

    Vivancos, Julien; Spinner, Lara; Mazubert, Christelle; Charlot, Florence; Paquet, Nicolas; Thareau, Vincent; Dron, Michel; Nogué, Fabien; Charon, Céline

    2012-03-01

    The shoot represents the basic body plan in land plants. It consists of a repeated structure composed of stems and leaves. Whereas vascular plants generate a shoot in their diploid phase, non-vascular plants such as mosses form a shoot (called the gametophore) in their haploid generation. The evolution of regulatory mechanisms or genetic networks used in the development of these two kinds of shoots is unclear. TERMINAL EAR1-like genes have been involved in diploid shoot development in vascular plants. Here, we show that disruption of PpTEL1 from the moss Physcomitrella patens, causes reduced protonema growth and gametophore initiation, as well as defects in gametophore development. Leafy shoots formed on ΔTEL1 mutants exhibit shorter stems with more leaves per shoot, suggesting an accelerated leaf initiation (shortened plastochron), a phenotype shared with the Poaceae vascular plants TE1 and PLA2/LHD2 mutants. Moreover, the positive correlation between plastochron length and leaf size observed in ΔTEL1 mutants suggests a conserved compensatory mechanism correlating leaf growth and leaf initiation rate that would minimize overall changes in plant biomass. The RNA-binding protein encoded by PpTEL1 contains two N-terminus RNA-recognition motifs, and a third C-terminus non-canonical RRM, specific to TEL proteins. Removal of the PpTEL1 C-terminus (including this third RRM) or only 16-18 amino acids within it seriously impairs PpTEL1 function, suggesting a critical role for this third RRM. These results show a conserved function of the RNA-binding PpTEL1 protein in the regulation of shoot development, from early ancestors to vascular plants, that depends on the third TEL-specific RRM.

  20. Regulatory Mechanisms That Prevent Re-initiation of DNA Replication Can Be Locally Modulated at Origins by Nearby Sequence Elements

    PubMed Central

    Richardson, Christopher D.; Li, Joachim J.

    2014-01-01

    Eukaryotic cells must inhibit re-initiation of DNA replication at each of the thousands of origins in their genome because re-initiation can generate genomic alterations with extraordinary frequency. To minimize the probability of re-initiation from so many origins, cells use a battery of regulatory mechanisms that reduce the activity of replication initiation proteins. Given the global nature of these mechanisms, it has been presumed that all origins are inhibited identically. However, origins re-initiate with diverse efficiencies when these mechanisms are disabled, and this diversity cannot be explained by differences in the efficiency or timing of origin initiation during normal S phase replication. This observation raises the possibility of an additional layer of replication control that can differentially regulate re-initiation at distinct origins. We have identified novel genetic elements that are necessary for preferential re-initiation of two origins and sufficient to confer preferential re-initiation on heterologous origins when the control of re-initiation is partially deregulated. The elements do not enhance the S phase timing or efficiency of adjacent origins and thus are specifically acting as re-initiation promoters (RIPs). We have mapped the two RIPs to ∼60 bp AT rich sequences that act in a distance- and sequence-dependent manner. During the induction of re-replication, Mcm2-7 reassociates both with origins that preferentially re-initiate and origins that do not, suggesting that the RIP elements can overcome a block to re-initiation imposed after Mcm2-7 associates with origins. Our findings identify a local level of control in the block to re-initiation. This local control creates a complex genomic landscape of re-replication potential that is revealed when global mechanisms preventing re-replication are compromised. Hence, if re-replication does contribute to genomic alterations, as has been speculated for cancer cells, some regions of the genome

  1. Review: regulatory mechanisms of gonadotropin-inhibitory hormone (GnIH) synthesis and release in photoperiodic animals

    PubMed Central

    Tsutsui, Kazuyoshi; Ubuka, Takayoshi; Bentley, George E.; Kriegsfeld, Lance J.

    2013-01-01

    Gonadotropin-inhibitory hormone (GnIH) is a novel hypothalamic neuropeptide that was discovered in quail as an inhibitory factor for gonadotropin release. GnIH inhibits gonadotropin synthesis and release in birds through actions on gonadotropin-releasing hormone (GnRH) neurons and gonadotropes, mediated via the GnIH receptor (GnIH-R), GPR147. Subsequently, GnIH was identified in mammals and other vertebrates. As in birds, mammalian GnIH inhibits gonadotropin secretion, indicating a conserved role for this neuropeptide in the control of the hypothalamic-pituitary-gonadal (HPG) axis across species. Identification of the regulatory mechanisms governing GnIH expression and release is important in understanding the physiological role of the GnIH system. A nocturnal hormone, melatonin, appears to act directly on GnIH neurons through its receptor to induce expression and release of GnIH in quail, a photoperiodic bird. Recently, a similar, but opposite, action of melatonin on the inhibition of expression of mammalian GnIH was shown in hamsters and sheep, photoperiodic mammals. These results in photoperiodic animals demonstrate that GnIH expression is photoperiodically modulated via a melatonin-dependent process. Recent findings indicate that GnIH may be a mediator of stress-induced reproductive disruption in birds and mammals, pointing to a broad role for this neuropeptide in assessing physiological state and modifying reproductive effort accordingly. This paper summarizes the advances made in our knowledge regarding the regulation of GnIH synthesis and release in photoperiodic birds and mammals. This paper also discusses the neuroendocrine integration of environmental signals, such as photoperiods and stress, and internal signals, such as GnIH, melatonin, and glucocorticoids, to control avian and mammalian reproduction. PMID:23596387

  2. Review: regulatory mechanisms of gonadotropin-inhibitory hormone (GnIH) synthesis and release in photoperiodic animals.

    PubMed

    Tsutsui, Kazuyoshi; Ubuka, Takayoshi; Bentley, George E; Kriegsfeld, Lance J

    2013-01-01

    Gonadotropin-inhibitory hormone (GnIH) is a novel hypothalamic neuropeptide that was discovered in quail as an inhibitory factor for gonadotropin release. GnIH inhibits gonadotropin synthesis and release in birds through actions on gonadotropin-releasing hormone (GnRH) neurons and gonadotropes, mediated via the GnIH receptor (GnIH-R), GPR147. Subsequently, GnIH was identified in mammals and other vertebrates. As in birds, mammalian GnIH inhibits gonadotropin secretion, indicating a conserved role for this neuropeptide in the control of the hypothalamic-pituitary-gonadal (HPG) axis across species. Identification of the regulatory mechanisms governing GnIH expression and release is important in understanding the physiological role of the GnIH system. A nocturnal hormone, melatonin, appears to act directly on GnIH neurons through its receptor to induce expression and release of GnIH in quail, a photoperiodic bird. Recently, a similar, but opposite, action of melatonin on the inhibition of expression of mammalian GnIH was shown in hamsters and sheep, photoperiodic mammals. These results in photoperiodic animals demonstrate that GnIH expression is photoperiodically modulated via a melatonin-dependent process. Recent findings indicate that GnIH may be a mediator of stress-induced reproductive disruption in birds and mammals, pointing to a broad role for this neuropeptide in assessing physiological state and modifying reproductive effort accordingly. This paper summarizes the advances made in our knowledge regarding the regulation of GnIH synthesis and release in photoperiodic birds and mammals. This paper also discusses the neuroendocrine integration of environmental signals, such as photoperiods and stress, and internal signals, such as GnIH, melatonin, and glucocorticoids, to control avian and mammalian reproduction.

  3. Bacillus subtilis as a platform for molecular characterisation of regulatory mechanisms of Enterococcus faecalis resistance against cell wall antibiotics.

    PubMed

    Fang, Chong; Stiegeler, Emanuel; Cook, Gregory M; Mascher, Thorsten; Gebhard, Susanne

    2014-01-01

    To combat antibiotic resistance of Enterococcus faecalis, a better understanding of the molecular mechanisms, particularly of antibiotic detection, signal transduction and gene regulation is needed. Because molecular studies in this bacterium can be challenging, we aimed at exploiting the genetically highly tractable Gram-positive model organism Bacillus subtilis as a heterologous host. Two fundamentally different regulators of E. faecalis resistance against cell wall antibiotics, the bacitracin sensor BcrR and the vancomycin-sensing two-component system VanSB-VanRB, were produced in B. subtilis and their functions were monitored using target promoters fused to reporter genes (lacZ and luxABCDE). The bacitracin resistance system BcrR-BcrAB of E. faecalis was fully functional in B. subtilis, both regarding regulation of bcrAB expression and resistance mediated by the transporter BcrAB. Removal of intrinsic bacitracin resistance of B. subtilis increased the sensitivity of the system. The lacZ and luxABCDE reporters were found to both offer sensitive detection of promoter induction on solid media, which is useful for screening of large mutant libraries. The VanSB-VanRB system displayed a gradual dose-response behaviour to vancomycin, but only when produced at low levels in the cell. Taken together, our data show that B. subtilis is a well-suited host for the molecular characterization of regulatory systems controlling resistance against cell wall active compounds in E. faecalis. Importantly, B. subtilis facilitates the careful adjustment of expression levels and genetic background required for full functionality of the introduced regulators.

  4. Spectral changes of near-infrared spectroscopy signals in migraineurs with aura reveal an impaired carbon dioxide-regulatory mechanism.

    PubMed

    Liboni, William; Molinari, Filippo; Allais, Gianni; Mana, Ornella; Negri, Emanuela; Bussone, Gennaro; D'Andrea, Giovanni; Benedetto, Chiara

    2009-05-01

    Subjects suffering from migraine with aura (MwA) present an altered cerebral autoregulation during migraine attacks. It is still unclear whether MwA sufferers present a normal autoregulation during attack-free periods. In this study, we characterized cerebral autoregulation in the frequency domain by analyzing the spontaneous oscillations superimposed on the cerebral hemodynamic signals, as detected by near-infrared spectroscopy (NIRS). Ten healthy women (age: 38.4 +/- 9.5 years) and ten women suffering from MwA (age: 35.2 +/- 10.5 years) underwent NIRS recording in resting conditions and during breath-holding (BH). Being the NIRS signals during BH nonstationary, we used the Choi-Williams time-frequency distribution to perform spectral analysis. We considered 256 s of signals and quantified the variation in the power of the very-low frequencies (VLF: 20-40 mHz) and of the low frequencies (LF: 40-140 mHz) as response to BH. Results showed that BH increases the power in the LF band both in healthy and MwA subjects. Considering the signal of the deoxygenated hemoglobin, the average power increase in the LF band was equal to 20% +/- 15.4% for the healthy group and significantly lower, 4.8% +/- 8.3%, in the MwA group (Student's t test, P < 0.02). No significant difference was observed in the VLF band or in the oxygenated hemoglobin signal power variations of the LF and VLF bands. The resulting data reveal a possible impairment in the carbon dioxide-regulatory mechanism in MwA subjects.

  5. Regulatory mechanisms and the role of calcium and potassium channels controlling supercontractile crop muscles in adult Phormia regina.

    PubMed

    Solari, Paolo; Stoffolano, John G; Fitzpatrick, Joanna; Gelperin, Alan; Thomson, Alan; Talani, Giuseppe; Sanna, Enrico; Liscia, Anna

    2013-09-01

    Bioassays and electrophysiological recordings were conducted in the adult blowfly Phormia regina to provide new insights into the regulatory mechanisms governing the crop filling and emptying processes of the supercontractile crop muscles. The cibarial pump drives ingestion. Simultaneous multisite extracellular recordings show that crop lobe (P5) distension during ingestion of a 4.7 μl sugar meal does not require muscle activity by any of the other pumps of the system. Conversely, pumping of fluids toward the anterior of the crop system during crop emptying is brought about by active muscle contraction, in the form of a highly coordinated peristaltic wave starting from P5 and progressively propagating to P6, P4 and P3 pumps, with P5 contracting with a frequency about 3.4 times higher than the other pumps. The crop contraction rate is also modulated by hemolymph-borne factors such as sugars, through ligand recognition at a presumptive receptor site rather than by an osmotic effect, as assessed by both behavioural and electrophysiological experiments. In this respect, sugars of equal osmolarity produce different effects, glucose being inhibitory and mannose ineffective for crop muscles, while trehalose enhances crop activity. Finally, voltage and current clamp experiments show that the muscle action potentials (mAPs) at the P4 pump are sustained by a serotonin-sensitive calcium conductance. Serotonin enhances calcium entry into the muscle cells and this could lead, as an indirect modulatory effect, to activation of a Ca(2+)-activated K(+) conductance (IK(Ca)), which sustains the following mAP repolarization phase in such a way that further mAPs can be generated early and the frequency consequently increased. PMID:23834826

  6. Awareness of federal regulatory mechanisms relevant to community-engaged research: survey of health disparities-oriented NIH-funded investigators

    PubMed Central

    Fullerton, Stephanie M.; Anderson, Emily E.; Cowan, Ketch; Malen, Rachel C.; Brugge, Doug

    2015-01-01

    Few studies or investigators involved in community engaged research or community-based participatory research have examined awareness and adoption of federal regulatory mechanisms. We conducted a survey of investigators affiliated with the ten National Institutes of Health (NIH) Centers for Population Health and Health Disparities. A questionnaire designed to capture experience with the conduct and oversight of community engaged research, and awareness of pertinent regulatory mechanisms, including Federalwide Assurances (FWAs), Individual Investigator Agreements (IIAs), and Institutional Review Board Authorization Agreements (IAAs), was completed by 101 respondents (68% response rate). Although most were aware of FWAs, only a minority of those surveyed reported knowledge of IAAs and IIAs and even fewer had used them in their research with community partners. Implications for future training and oversight are discussed. PMID:25742662

  7. Contrasting Evolutionary Dynamics of the Developmental Regulator PAX9, among Bats, with Evidence for a Novel Post-Transcriptional Regulatory Mechanism

    PubMed Central

    Phillips, Caleb D.; Butler, Boyd; Fondon, John W.; Mantilla-Meluk, Hugo; Baker, Robert J.

    2013-01-01

    Morphological evolution can be the result of natural selection favoring modification of developmental signaling pathways. However, little is known about the genetic basis of such phenotypic diversity. Understanding these mechanisms is difficult for numerous reasons, yet studies in model organisms often provide clues about the major developmental pathways involved. The paired-domain gene, PAX9, is known to be a key regulator of development, particularly of the face and teeth. In this study, using a comparative genetics approach, we investigate PAX9 molecular evolution among mammals, focusing on craniofacially diversified (Phyllostomidae) and conserved (Vespertilionidae) bat families, and extend our comparison to other orders of mammal. Open-reading frame analysis disclosed signatures of selection, in which a small percentage of residues vary, and lineages acquire different combinations of variation through recurrent substitution and lineage specific changes. A few instances of convergence for specific residues were observed between morphologically convergent bat lineages. Bioinformatic analysis for unknown PAX9 regulatory motifs indicated a novel post-transcriptional regulatory mechanism involving a Musashi protein. This regulation was assessed through fluorescent reporter assays and gene knockdowns. Results are compatible with the hypothesis that the number of Musashi binding-elements in PAX9 mRNA proportionally regulates protein translation rate. Although a connection between morphology and binding element frequency was not apparent, results indicate this regulation would vary among craniofacially divergent bat species, but be static among conserved species. Under this model, Musashi’s regulatory control of alternative human PAX9 isoforms would also vary. The presence of Musashi-binding elements within PAX9 of all mammals examined, chicken, zebrafish, and the fly homolog of PAX9, indicates this regulatory mechanism is ancient, originating basal to much of the

  8. Distinct regulatory mechanisms of the human ferritin gene by hypoxia and hypoxia mimetic cobalt chloride at the transcriptional and post-transcriptional levels.

    PubMed

    Huang, Bo-Wen; Miyazawa, Masaki; Tsuji, Yoshiaki

    2014-12-01

    Cobalt chloride has been used as a hypoxia mimetic because it stabilizes hypoxia inducible factor-1α (HIF1-α) and activates gene transcription through a hypoxia responsive element (HRE). However, differences between hypoxia and hypoxia mimetic cobalt chloride in gene regulation remain elusive. Expression of ferritin, the major iron storage protein, is regulated at the transcriptional and posttranscriptional levels through DNA and RNA regulatory elements. Here we demonstrate that hypoxia and cobalt chloride regulate ferritin heavy chain (ferritin H) expression by two distinct mechanisms. Both hypoxia and cobalt chloride increased HIF1-α but a putative HRE in the human ferritin H gene was not activated. Instead, cobalt chloride but not hypoxia activated ferritin H transcription through an antioxidant responsive element (ARE), to which Nrf2 was recruited. Intriguingly, cobalt chloride downregulated ferritin H protein expression while it upregulated other ARE-regulated antioxidant genes in K562 cells. Further characterization demonstrated that cobalt chloride increased interaction between iron regulatory proteins (IRP1 and IRP2) and iron responsive element (IRE) in the 5'UTR of ferritin H mRNA, resulting in translational block of the accumulated ferritin H mRNA. In contrast, hypoxia had marginal effect on ferritin H transcription but increased its translation through decreased IRP1-IRE interaction. These results suggest that hypoxia and hypoxia mimetic cobalt chloride employ distinct regulatory mechanisms through the interplay between DNA and mRNA elements at the transcriptional and post-transcriptional levels.

  9. Comprehensive analysis of microRNA-Seq and target mRNAs of rice sheath blight pathogen provides new insights into pathogenic regulatory mechanisms

    PubMed Central

    Lin, Runmao; He, Liye; He, Jiayu; Qin, Peigang; Wang, Yanran; Deng, Qiming; Yang, Xiaoting; Li, Shuangcheng; Wang, Shiquan; Wang, Wenming; Liu, Huainian; Li, Ping; Zheng, Aiping

    2016-01-01

    MicroRNAs (miRNAs) are ∼22 nucleotide non-coding RNAs that regulate gene expression by targeting mRNAs for degradation or inhibiting protein translation. To investigate whether miRNAs regulate the pathogenesis in necrotrophic fungus Rhizoctonia solani AG1 IA, which causes significant yield loss in main economically important crops, and to determine the regulatory mechanism occurring during pathogenesis, we constructed hyphal small RNA libraries from six different infection periods of the rice leaf. Through sequencing and analysis, 177 miRNA-like small RNAs (milRNAs) were identified, including 15 candidate pathogenic novel milRNAs predicted by functional annotations of their target mRNAs and expression patterns of milRNAs and mRNAs during infection. Reverse transcription-quantitative polymerase chain reaction results for randomly selected milRNAs demonstrated that our novel comprehensive predictions had a high level of accuracy. In our predicted pathogenic protein-protein interaction network of R. solani, we added the related regulatory milRNAs of these core coding genes into the network, and could understand the relationships among these regulatory factors more clearly at the systems level. Furthermore, the putative pathogenic Rhi-milR-16, which negatively regulates target gene expression, was experimentally validated to have regulatory functions by a dual-luciferase reporter assay. Additionally, 23 candidate rice miRNAs that may involve in plant immunity against R. solani were discovered. This first study on novel pathogenic milRNAs of R. solani AG1 IA and the recognition of target genes involved in pathogenicity, as well as rice miRNAs, participated in defence against R. solani could provide new insights into revealing the pathogenic mechanisms of the severe rice sheath blight disease. PMID:27374612

  10. α -Actinin TvACTN3 of Trichomonas vaginalis is an RNA-binding protein that could participate in its posttranscriptional iron regulatory mechanism.

    PubMed

    Calla-Choque, Jaeson Santos; Figueroa-Angulo, Elisa Elvira; Ávila-González, Leticia; Arroyo, Rossana

    2014-01-01

    Trichomonas vaginalis is a sexually transmitted flagellated protist parasite responsible for trichomoniasis. This parasite is dependent on high levels of iron, favoring its growth and multiplication. Iron also differentially regulates some trichomonad virulence properties by unknown mechanisms. However, there is evidence to support the existence of gene regulatory mechanisms at the transcriptional and posttranscriptional levels that are mediated by iron concentration in T. vaginalis. Thus, the goal of this study was to identify an RNA-binding protein in T. vaginalis that interacts with the tvcp4 RNA stem-loop structure, which may participate in a posttranscriptional iron regulatory mechanism mediated by RNA-protein interactions. We performed RNA electrophoretic mobility shift assay (REMSA) and supershift, UV cross-linking, Northwestern blot, and western blot (WB) assays using cytoplasmic protein extracts from T. vaginalis with the tvcp4 RNA hairpin structure as a probe. We identified a 135-kDa protein isolated by the UV cross-linking assays as α-actinin 3 (TvACTN3) by MALDI-TOF-MS that was confirmed by LS-MS/MS and de novo sequencing. TvACTN3 is a cytoplasmic protein that specifically binds to hairpin RNA structures from trichomonads and humans when the parasites are grown under iron-depleted conditions. Thus, TvACTN3 could participate in the regulation of gene expression by iron in T. vaginalis through a parallel posttranscriptional mechanism similar to that of the IRE/IRP system. PMID:24719864

  11. α -Actinin TvACTN3 of Trichomonas vaginalis is an RNA-binding protein that could participate in its posttranscriptional iron regulatory mechanism.

    PubMed

    Calla-Choque, Jaeson Santos; Figueroa-Angulo, Elisa Elvira; Ávila-González, Leticia; Arroyo, Rossana

    2014-01-01

    Trichomonas vaginalis is a sexually transmitted flagellated protist parasite responsible for trichomoniasis. This parasite is dependent on high levels of iron, favoring its growth and multiplication. Iron also differentially regulates some trichomonad virulence properties by unknown mechanisms. However, there is evidence to support the existence of gene regulatory mechanisms at the transcriptional and posttranscriptional levels that are mediated by iron concentration in T. vaginalis. Thus, the goal of this study was to identify an RNA-binding protein in T. vaginalis that interacts with the tvcp4 RNA stem-loop structure, which may participate in a posttranscriptional iron regulatory mechanism mediated by RNA-protein interactions. We performed RNA electrophoretic mobility shift assay (REMSA) and supershift, UV cross-linking, Northwestern blot, and western blot (WB) assays using cytoplasmic protein extracts from T. vaginalis with the tvcp4 RNA hairpin structure as a probe. We identified a 135-kDa protein isolated by the UV cross-linking assays as α-actinin 3 (TvACTN3) by MALDI-TOF-MS that was confirmed by LS-MS/MS and de novo sequencing. TvACTN3 is a cytoplasmic protein that specifically binds to hairpin RNA structures from trichomonads and humans when the parasites are grown under iron-depleted conditions. Thus, TvACTN3 could participate in the regulation of gene expression by iron in T. vaginalis through a parallel posttranscriptional mechanism similar to that of the IRE/IRP system.

  12. α-Actinin TvACTN3 of Trichomonas vaginalis Is an RNA-Binding Protein That Could Participate in Its Posttranscriptional Iron Regulatory Mechanism

    PubMed Central

    Calla-Choque, Jaeson Santos; Figueroa-Angulo, Elisa Elvira; Ávila-González, Leticia; Arroyo, Rossana

    2014-01-01

    Trichomonas vaginalis is a sexually transmitted flagellated protist parasite responsible for trichomoniasis. This parasite is dependent on high levels of iron, favoring its growth and multiplication. Iron also differentially regulates some trichomonad virulence properties by unknown mechanisms. However, there is evidence to support the existence of gene regulatory mechanisms at the transcriptional and posttranscriptional levels that are mediated by iron concentration in T. vaginalis. Thus, the goal of this study was to identify an RNA-binding protein in T. vaginalis that interacts with the tvcp4 RNA stem-loop structure, which may participate in a posttranscriptional iron regulatory mechanism mediated by RNA-protein interactions. We performed RNA electrophoretic mobility shift assay (REMSA) and supershift, UV cross-linking, Northwestern blot, and western blot (WB) assays using cytoplasmic protein extracts from T. vaginalis with the tvcp4 RNA hairpin structure as a probe. We identified a 135-kDa protein isolated by the UV cross-linking assays as α-actinin 3 (TvACTN3) by MALDI-TOF-MS that was confirmed by LS-MS/MS and de novo sequencing. TvACTN3 is a cytoplasmic protein that specifically binds to hairpin RNA structures from trichomonads and humans when the parasites are grown under iron-depleted conditions. Thus, TvACTN3 could participate in the regulation of gene expression by iron in T. vaginalis through a parallel posttranscriptional mechanism similar to that of the IRE/IRP system. PMID:24719864

  13. Genome-Wide Analysis of Wilms’ Tumor 1-Controlled Gene Expression in Podocytes Reveals Key Regulatory Mechanisms

    PubMed Central

    Kann, Martin; Ettou, Sandrine; Jung, Youngsook L.; Lenz, Maximilian O.; Taglienti, Mary E.; Park, Peter J.; Schermer, Bernhard

    2015-01-01

    The transcription factor Wilms’ tumor suppressor 1 (WT1) is key to podocyte development and viability; however, WT1 transcriptional networks in podocytes remain elusive. We provide a comprehensive analysis of the genome-wide WT1 transcriptional network in podocytes in vivo using chromatin immunoprecipitation followed by sequencing (ChIPseq) and RNA sequencing techniques. Our data show a specific role for WT1 in regulating the podocyte-specific transcriptome through binding to both promoters and enhancers of target genes. Furthermore, we inferred a podocyte transcription factor network consisting of WT1, LMX1B, TCF21, Fox-class and TEAD family transcription factors, and MAFB that uses tissue-specific enhancers to control podocyte gene expression. In addition to previously described WT1-dependent target genes, ChIPseq identified novel WT1-dependent signaling systems. These targets included components of the Hippo signaling system, underscoring the power of genome-wide transcriptional-network analyses. Together, our data elucidate a comprehensive gene regulatory network in podocytes suggesting that WT1 gene regulatory function and podocyte cell-type specification can best be understood in the context of transcription factor-regulatory element network interplay. PMID:25636411

  14. Cis- and Trans-Regulatory Mechanisms of Gene Expression in the ASJ Sensory Neuron of Caenorhabditis elegans

    PubMed Central

    González-Barrios, María; Fierro-González, Juan Carlos; Krpelanova, Eva; Mora-Lorca, José Antonio; Pedrajas, José Rafael; Peñate, Xenia; Chavez, Sebastián; Swoboda, Peter; Jansen, Gert; Miranda-Vizuete, Antonio

    2015-01-01

    The identity of a given cell type is determined by the expression of a set of genes sharing common cis-regulatory motifs and being regulated by shared transcription factors. Here, we identify cis and trans regulatory elements that drive gene expression in the bilateral sensory neuron ASJ, located in the head of the nematode Caenorhabditis elegans. For this purpose, we have dissected the promoters of the only two genes so far reported to be exclusively expressed in ASJ, trx-1 and ssu-1. We hereby identify the ASJ motif, a functional cis-regulatory bipartite promoter region composed of two individual 6 bp elements separated by a 3 bp linker. The first element is a 6 bp CG-rich sequence that presumably binds the Sp family member zinc-finger transcription factor SPTF-1. Interestingly, within the C. elegans nervous system SPTF-1 is also found to be expressed only in ASJ neurons where it regulates expression of other genes in these neurons and ASJ cell fate. The second element of the bipartite motif is a 6 bp AT-rich sequence that is predicted to potentially bind a transcription factor of the homeobox family. Together, our findings identify a specific promoter signature and SPTF-1 as a transcription factor that functions as a terminal selector gene to regulate gene expression in C. elegans ASJ sensory neurons. PMID:25769980

  15. Simple models for the analysis of binding protein-dependent transport systems.

    PubMed Central

    Shilton, B. H.; Mowbray, S. L.

    1995-01-01

    Mathematical modeling was used to evaluate experimental data for bacterial binding protein-dependent transport systems. Two simple models were considered in which ligand-free periplasmic binding protein interacts with the membrane-bound components of transport. In one, this interaction was viewed as a competition with the ligand-bound binding protein, whereas in the other, it was considered to be a consequence of the complexes formed during the transport process itself. Two sets of kinetic parameters were derived for each model that fit the available experimental results for the maltose system. By contrast, a model that omitted the interaction of ligand-free binding protein did not fit the experimental data. Some applications of the successful models for the interpretation of existing mutant data are illustrated, as well as the possibilities of using mutant data to test the original models and sets of kinetic parameters. Practical suggestions are given for further experimental design. PMID:7670377

  16. The Regulatory T Cell Lineage Factor Foxp3 Regulates Gene Expression through Several Distinct Mechanisms Mostly Independent of Direct DNA Binding

    PubMed Central

    Andersen, Kristian G.; Hebenstreit, Daniel; Teichmann, Sarah A.; Betz, Alexander G.

    2015-01-01

    The lineage factor Foxp3 is essential for the development and maintenance of regulatory T cells, but little is known about the mechanisms involved. Here, we demonstrate that an N-terminal proline-rich interaction region is crucial for Foxp3’s function. Subdomains within this key region link Foxp3 to several independent mechanisms of transcriptional regulation. Our study suggests that Foxp3, even in the absence of its DNA-binding forkhead domain, acts as a bridge between DNA-binding interaction partners and proteins with effector function permitting it to regulate a large number of genes. We show that, in one such mechanism, Foxp3 recruits class I histone deacetylases to the promoters of target genes, counteracting activation-induced histone acetylation and thereby suppressing their expression. PMID:26107960

  17. PARP-2 and PARP-3 are selectively activated by 5' phosphorylated DNA breaks through an allosteric regulatory mechanism shared with PARP-1.

    PubMed

    Langelier, Marie-France; Riccio, Amanda A; Pascal, John M

    2014-07-01

    PARP-1, PARP-2 and PARP-3 are DNA-dependent PARPs that localize to DNA damage, synthesize poly(ADP-ribose) (PAR) covalently attached to target proteins including themselves, and thereby recruit repair factors to DNA breaks to increase repair efficiency. PARP-1, PARP-2 and PARP-3 have in common two C-terminal domains-Trp-Gly-Arg (WGR) and catalytic (CAT). In contrast, the N-terminal region (NTR) of PARP-1 is over 500 residues and includes four regulatory domains, whereas PARP-2 and PARP-3 have smaller NTRs (70 and 40 residues, respectively) of unknown structural composition and function. Here, we show that PARP-2 and PARP-3 are preferentially activated by DNA breaks harboring a 5' phosphate (5'P), suggesting selective activation in response to specific DNA repair intermediates, in particular structures that are competent for DNA ligation. In contrast to PARP-1, the NTRs of PARP-2 and PARP-3 are not strictly required for DNA binding or for DNA-dependent activation. Rather, the WGR domain is the central regulatory domain of PARP-2 and PARP-3. Finally, PARP-1, PARP-2 and PARP-3 share an allosteric regulatory mechanism of DNA-dependent catalytic activation through a local destabilization of the CAT. Collectively, our study provides new insights into the specialization of the DNA-dependent PARPs and their specific roles in DNA repair pathways.

  18. Regulatory RNAs

    PubMed Central

    Vazquez-Anderson, Jorge; Contreras, Lydia M

    2013-01-01

    RNAs have many important functional properties, including that they are independently controllable and highly tunable. As a result of these advantageous properties, their use in a myriad of sophisticated devices has been widely explored. Yet, the exploitation of RNAs for synthetic applications is highly dependent on the ability to characterize the many new molecules that continue to be discovered by large-scale sequencing and high-throughput screening techniques. In this review, we present an exhaustive survey of the most recent synthetic bacterial riboswitches and small RNAs while emphasizing their virtues in gene expression management. We also explore the use of these RNA components as building blocks in the RNA synthetic biology toolbox and discuss examples of synthetic RNA components used to rewire bacterial regulatory circuitry. We anticipate that this field will expand its catalog of smart devices by mimicking and manipulating natural RNA mechanisms and functions. PMID:24356572

  19. Positive and Negative Regulatory Mechanisms for Fine-Tuning Cellularity and Functions of Medullary Thymic Epithelial Cells

    PubMed Central

    Akiyama, Taishin; Tateishi, Ryosuke; Akiyama, Nobuko; Yoshinaga, Riko; Kobayashi, Tetsuya J.

    2015-01-01

    Self-tolerant T cells and regulatory T cells develop in the thymus. A wide variety of cell–cell interactions in the thymus is required for the differentiation, proliferation, and repertoire selection of T cells. Various secreted and cell surface molecules expressed in thymic epithelial cells (TECs) mediate these processes. Moreover, cytokines expressed by cells of hematopoietic origin regulate the cellularity of TECs. Tumor necrosis factor (TNF) family RANK ligand, lymphotoxin, and CD40 ligand, expressed in T cells and innate lymphoid cells (ILCs), promote the differentiation and proliferation of medullary TECs (mTECs) that play critical roles in the induction of immune tolerance. A recent study suggests that interleukin-22 (IL-22) produced by ILCs promotes regeneration of TECs after irradiation. Intriguingly, tumor growth factor-β and osteoprotegerin limit cellularity of mTECs, thereby attenuating regulatory T cell generation. We will review recent insights into the molecular basis for cell–cell interactions regulating differentiation and proliferation of mTECs and also discuss about a perspective on use of mathematical models for understanding this complicated system. PMID:26441966

  20. Analysis of functional selectivity through G protein-dependent and -independent signaling pathways at the adrenergic α(2C) receptor.

    PubMed

    Kurko, Dalma; Kapui, Zoltán; Nagy, József; Lendvai, Balázs; Kolok, Sándor

    2014-08-01

    Although G protein-coupled receptors (GPCRs) are traditionally categorized as Gs-, Gq-, or Gi/o-coupled, their signaling is regulated by multiple mechanisms. GPCRs can couple to several effector pathways, having the capacity to interact not only with more than one G protein subtype but also with alternative signaling or effector proteins such as arrestins. Moreover, GPCR ligands can have different efficacies for activating these signaling pathways, a characteristic referred to as biased agonism or functional selectivity. In this work our aim was to detect differences in the ability of various agonists acting at the α2C type of adrenergic receptors (α2C-ARs) to modulate cAMP accumulation, cytoplasmic Ca(2+) release, β-arrestin recruitment and receptor internalization. A detailed comparative pharmacological characterization of G protein-dependent and -independent signaling pathways was carried out using adrenergic agonists (norepinephrine, phenylephrine, brimonidine, BHT-920, oxymetazoline, clonidine, moxonidine, guanabenz) and antagonists (MK912, yohimbine). As initial analysis of agonist Emax and EC50 values suggested possible functional selectivity, ligand bias was quantified by applying the relative activity scale and was compared to that of the endogenous agonist norepinephrine. Values significantly different from 0 between pathways indicated an agonist that promoted different level of activation of diverse effector pathways most likely due to the stabilization of a subtly different receptor conformation from that induced by norepinephrine. Our results showed that a series of agonists acting at the α2C-AR displayed different degree of functional selectivity (bias factors ranging from 1.6 to 36.7) through four signaling pathways. As signaling via these pathways seems to have distinct functional and physiological outcomes, studying all these stages of receptor activation could have further implications for the development of more selective therapeutics with

  1. Analysis of functional selectivity through G protein-dependent and -independent signaling pathways at the adrenergic α(2C) receptor.

    PubMed

    Kurko, Dalma; Kapui, Zoltán; Nagy, József; Lendvai, Balázs; Kolok, Sándor

    2014-08-01

    Although G protein-coupled receptors (GPCRs) are traditionally categorized as Gs-, Gq-, or Gi/o-coupled, their signaling is regulated by multiple mechanisms. GPCRs can couple to several effector pathways, having the capacity to interact not only with more than one G protein subtype but also with alternative signaling or effector proteins such as arrestins. Moreover, GPCR ligands can have different efficacies for activating these signaling pathways, a characteristic referred to as biased agonism or functional selectivity. In this work our aim was to detect differences in the ability of various agonists acting at the α2C type of adrenergic receptors (α2C-ARs) to modulate cAMP accumulation, cytoplasmic Ca(2+) release, β-arrestin recruitment and receptor internalization. A detailed comparative pharmacological characterization of G protein-dependent and -independent signaling pathways was carried out using adrenergic agonists (norepinephrine, phenylephrine, brimonidine, BHT-920, oxymetazoline, clonidine, moxonidine, guanabenz) and antagonists (MK912, yohimbine). As initial analysis of agonist Emax and EC50 values suggested possible functional selectivity, ligand bias was quantified by applying the relative activity scale and was compared to that of the endogenous agonist norepinephrine. Values significantly different from 0 between pathways indicated an agonist that promoted different level of activation of diverse effector pathways most likely due to the stabilization of a subtly different receptor conformation from that induced by norepinephrine. Our results showed that a series of agonists acting at the α2C-AR displayed different degree of functional selectivity (bias factors ranging from 1.6 to 36.7) through four signaling pathways. As signaling via these pathways seems to have distinct functional and physiological outcomes, studying all these stages of receptor activation could have further implications for the development of more selective therapeutics with

  2. FarR regulates the farAB-encoded efflux pump of Neisseria gonorrhoeae via an MtrR regulatory mechanism.

    PubMed

    Lee, E-H; Rouquette-Loughlin, C; Folster, J P; Shafer, W M

    2003-12-01

    The farAB operon of Neisseria gonorrhoeae encodes an efflux pump which mediates gonococcal resistance to antibacterial fatty acids. It was previously observed that expression of the farAB operon was positively regulated by MtrR, which is a repressor of the mtrCDE-encoded efflux pump system (E.-H. Lee and W. M. Shafer, Mol. Microbiol. 33:839-845, 1999). This regulation was believed to be indirect since MtrR did not bind to the farAB promoter. In this study, computer analysis of the gonococcal genome sequence database, lacZ reporter fusions, and gel mobility shift assays were used to elucidate the regulatory mechanism by which expression of the farAB operon is modulated by MtrR in gonococci. We identified a regulatory protein belonging to the MarR family of transcriptional repressors and found that it negatively controls expression of farAB by directly binding to the farAB promoter. We designated this regulator FarR to signify its role in regulating the farAB operon. We found that MtrR binds to the farR promoter, thereby repressing farR expression. Hence, MtrR regulates farAB in a positive fashion by modulating farR expression. This MtrR regulatory cascade seems to play an important role in adjusting levels of the FarAB and MtrCDE efflux pumps to prevent their excess expression in gonococci. PMID:14645274

  3. Characterization of microRNA expression in bovine adipose tissues: a potential regulatory mechanism of subcutaneous adipose tissue development

    PubMed Central

    2010-01-01

    Background MicroRNAs (miRNAs), a family of small non-coding RNA molecules, appear to regulate animal lipid metabolism and preadipocyte conversion to form lipid-assimilating adipocytes (i.e. adipogenesis). However, no miRNA to date has been reported to modulate adipogenesis and lipid deposition in beef cattle. Results The expression patterns of 89 miRNAs including four bovine specific miRNAs in subcutaneous adipose tissues from three groups of crossbred steers differing in backfat thickness were compared using qRT-PCR analysis. Eighty-six miRNAs were detectable in all samples, with 42 miRNAs differing among crossbreds (P < 0.05) and 15 miRNAs differentially expressed between tissues with high and low backfat thickness (P < 0.05). The expression levels of 18 miRNAs were correlated with backfat thickness (P < 0.05). The miRNA most differentially expressed and the most strongly associated with backfat thickness was miR-378, with a 1.99-fold increase in high backfat thickness tissues (r = 0.72). Conclusions MiRNA expression patterns differed significantly in response to host genetic components. Approximately 20% of the miRNAs in this study were identified as being correlated with backfat thickness. This result suggests that miRNAs may play a regulatory role in white adipose tissue development in beef animals. PMID:20423511

  4. Digestive cells from Mytilus galloprovincialis show a partial regulatory volume decrease following acute hypotonic stress through mechanisms involving inorganic ions.

    PubMed

    Torre, Agata; Trischitta, Francesca; Corsaro, Carmelo; Mallamace, Domenico; Faggio, Caterina

    2013-08-01

    The response of isolated digestive cells of the digestive gland of Mytilus galloprovincialis to hypotonic shock was studied using videometric methods. The isolated cells exposed to a rapid change (from 1100 to 800 mosmol kg(-1) ) of the bathing solution osmolality swelled but thereafter underwent a regulatory volume decrease (RVD), tending to recover the original size. When the hypotonic stress was applied in the presence of quinine and glibenclamide, known inhibitors of swelling activated ion channels, the cells did not exhibit an RVD response; in addition, they showed a larger increase in size in respect to control cells. These observations suggest that the digestive cells of the digestive gland have the machinery to cope with the hyposmotic shock allowing them to exhibit a small but significant RVD preventing an excessive increase in cell size. The pharmacological treatment of digestive cells during the RVD experiments suggests that cell volume is regulated by K(+) and Cl(-) efflux followed by an obliged water efflux from the cell. The involvement of organic osmolytes such as taurine and betaine seems to be excluded by NMR measurement on digestive cells.

  5. Temperature controls on the basal emission rate of isoprene in a tropical tree Ficus septica: exploring molecular regulatory mechanisms.

    PubMed

    Mutanda, Ishmael; Inafuku, Masashi; Saitoh, Seikoh; Iwasaki, Hironori; Fukuta, Masakazu; Watanabe, Keiichi; Oku, Hirosuke

    2016-10-01

    Isoprene emission from plants is very sensitive to environmental temperature both at short-term and long-term scales. Our previous study demonstrated suppression of isoprene emission by cold temperatures in a high emitting tropical tree Ficus septica and revealed a strong correlation of emission to isoprene synthase (IspS) protein levels. When challenged with decreasing daily temperatures from 30 to 12 °C, F. septica completely stopped isoprene emission at 12 °C, only to recover on the second day after re-exposure to 30 °C. Here, we explored this regulation of isoprene emission in response to environmental temperature by a comprehensive analysis of transcriptome data, gene expressions and metabolite pools of the 2-C-methyl-D-erythritol 4-phosphate (MEP) pathway. MEP pathway genes and metabolites dynamics did not support substrate-level limitations as major control over observed basal emission, but transcriptome data, network inferences and putative regulatory elements on IspS promoter suggested transcriptional regulation of IspS gene through circadian rhythm and phytohormone signalling processes. Expression levels of 29 genes involved in these pathways were examined by quantitative real-time PCR. We propose that temperature controls over basal isoprene emission at a time-scale of hours to few days are regulated by phytohormone-mediated transcriptional modulation of IspS gene under synchronization by the circadian clock. PMID:27425779

  6. Inference of the Arabidopsis Lateral Root Gene Regulatory Network Suggests a Bifurcation Mechanism That Defines Primordia Flanking and Central Zones[OPEN

    PubMed Central

    Lavenus, Julien; Goh, Tatsuaki; Guyomarc’h, Soazig; Hill, Kristine; Lucas, Mikael; Voß, Ute; Kenobi, Kim; Wilson, Michael H.; Farcot, Etienne; Hagen, Gretchen; Guilfoyle, Thomas J.; Fukaki, Hidehiro; Laplaze, Laurent; Bennett, Malcolm J.

    2015-01-01

    A large number of genes involved in lateral root (LR) organogenesis have been identified over the last decade using forward and reverse genetic approaches in Arabidopsis thaliana. Nevertheless, how these genes interact to form a LR regulatory network largely remains to be elucidated. In this study, we developed a time-delay correlation algorithm (TDCor) to infer the gene regulatory network (GRN) controlling LR primordium initiation and patterning in Arabidopsis from a time-series transcriptomic data set. The predicted network topology links the very early-activated genes involved in LR initiation to later expressed cell identity markers through a multistep genetic cascade exhibiting both positive and negative feedback loops. The predictions were tested for the key transcriptional regulator AUXIN RESPONSE FACTOR7 node, and over 70% of its targets were validated experimentally. Intriguingly, the predicted GRN revealed a mutual inhibition between the ARF7 and ARF5 modules that would control an early bifurcation between two cell fates. Analyses of the expression pattern of ARF7 and ARF5 targets suggest that this patterning mechanism controls flanking and central zone specification in Arabidopsis LR primordia. PMID:25944102

  7. [Triggering and regulatory mechanisms of ciliary motion in the ctenophore Bolinopsis. III. Electric excitability and inherent contractility of ciliated cells].

    PubMed

    Labas, Iu A; Mashanskiĭ, V F

    1977-01-01

    Rhythmical electrostimulation is able to produce in a tissue strip of Bolinopsis series of beats of combs-plates. However, the beat frequency, within one series, is only poorly controlled by electrical stimuli. Isolated comb-plate cells with a cilium cut off maintain rhythmical contractions stimulated both mechanically and electrically. A lot of microtubules has been found in the apical region of these cells. It is supposed that it is these microtubules, probably together with the associated root filaments, that are responsible for cell motility. Mutual mechanical stimulation of ciliary cells in these motions is, presumably, a signal providing intratissue propagation of metachronal wave.

  8. Autophagy Regulatory Network - a systems-level bioinformatics resource for studying the mechanism and regulation of autophagy.

    PubMed

    Türei, Dénes; Földvári-Nagy, László; Fazekas, Dávid; Módos, Dezső; Kubisch, János; Kadlecsik, Tamás; Demeter, Amanda; Lenti, Katalin; Csermely, Péter; Vellai, Tibor; Korcsmáros, Tamás

    2015-01-01

    Autophagy is a complex cellular process having multiple roles, depending on tissue, physiological, or pathological conditions. Major post-translational regulators of autophagy are well known, however, they have not yet been collected comprehensively. The precise and context-dependent regulation of autophagy necessitates additional regulators, including transcriptional and post-transcriptional components that are listed in various datasets. Prompted by the lack of systems-level autophagy-related information, we manually collected the literature and integrated external resources to gain a high coverage autophagy database. We developed an online resource, Autophagy Regulatory Network (ARN; http://autophagy-regulation.org), to provide an integrated and systems-level database for autophagy research. ARN contains manually curated, imported, and predicted interactions of autophagy components (1,485 proteins with 4,013 interactions) in humans. We listed 413 transcription factors and 386 miRNAs that could regulate autophagy components or their protein regulators. We also connected the above-mentioned autophagy components and regulators with signaling pathways from the SignaLink 2 resource. The user-friendly website of ARN allows researchers without computational background to search, browse, and download the database. The database can be downloaded in SQL, CSV, BioPAX, SBML, PSI-MI, and in a Cytoscape CYS file formats. ARN has the potential to facilitate the experimental validation of novel autophagy components and regulators. In addition, ARN helps the investigation of transcription factors, miRNAs and signaling pathways implicated in the control of the autophagic pathway. The list of such known and predicted regulators could be important in pharmacological attempts against cancer and neurodegenerative diseases.

  9. Autophagy Regulatory Network - a systems-level bioinformatics resource for studying the mechanism and regulation of autophagy.

    PubMed

    Türei, Dénes; Földvári-Nagy, László; Fazekas, Dávid; Módos, Dezső; Kubisch, János; Kadlecsik, Tamás; Demeter, Amanda; Lenti, Katalin; Csermely, Péter; Vellai, Tibor; Korcsmáros, Tamás

    2015-01-01

    Autophagy is a complex cellular process having multiple roles, depending on tissue, physiological, or pathological conditions. Major post-translational regulators of autophagy are well known, however, they have not yet been collected comprehensively. The precise and context-dependent regulation of autophagy necessitates additional regulators, including transcriptional and post-transcriptional components that are listed in various datasets. Prompted by the lack of systems-level autophagy-related information, we manually collected the literature and integrated external resources to gain a high coverage autophagy database. We developed an online resource, Autophagy Regulatory Network (ARN; http://autophagy-regulation.org), to provide an integrated and systems-level database for autophagy research. ARN contains manually curated, imported, and predicted interactions of autophagy components (1,485 proteins with 4,013 interactions) in humans. We listed 413 transcription factors and 386 miRNAs that could regulate autophagy components or their protein regulators. We also connected the above-mentioned autophagy components and regulators with signaling pathways from the SignaLink 2 resource. The user-friendly website of ARN allows researchers without computational background to search, browse, and download the database. The database can be downloaded in SQL, CSV, BioPAX, SBML, PSI-MI, and in a Cytoscape CYS file formats. ARN has the potential to facilitate the experimental validation of novel autophagy components and regulators. In addition, ARN helps the investigation of transcription factors, miRNAs and signaling pathways implicated in the control of the autophagic pathway. The list of such known and predicted regulators could be important in pharmacological attempts against cancer and neurodegenerative diseases. PMID:25635527

  10. Functional anatomy and ion regulatory mechanisms of the antennal gland in a semi-terrestrial crab, Ocypode stimpsoni

    PubMed Central

    Tsai, Jyuan-Ru; Lin, Hui-Chen

    2014-01-01

    ABSTRACT Brachyuran crabs from diverse habitats show great differences in their osmoregulatory processes, especially in terms of the structural and physiological characteristics of the osmoregulatory organs. In crustaceans, the antennal glands are known to be important in osmoregulation, and they play a functional role analogous to that of the vertebrate kidney. Nevertheless, the detailed structure and function of the antennal glands in different species have rarely been described. The aim of this study is to investigate the role of the antennal gland in ion regulation by examining the ultrastructure of the cells and the distribution of the ion regulatory proteins in each cell type in the antennal gland of a semi-terrestrial crab. The results showed that Na+, K+-ATPase activity significantly increased in the antennal gland after a 4-day acclimation in dilute seawater and returned to its original (day 0) level after 7 days. Three major types of cells were identified in the antennal gland, including coelomic cells (COEs), labyrinthine cells (LBRs) and end-labyrinthine cells (ELBRs). The proximal tubular region (PT) and distal tubular region (DT) of the antennal gland consist of LBRs and COEs, whereas the end tubular region (ET) consists of all three types of cells, with fewer COEs and more ELBRs. We found a non-uniform distribution of NKA immunoreactivity, with increasing intensity from the proximal to the distal regions of the antennal gland. We summarise our study with a proposed model for the urine reprocessing pathway and the role of each cell type or segment of the antennal gland. PMID:24795144

  11. Trypanosoma cruzi Infection Imparts a Regulatory Program in Dendritic Cells and T Cells via Galectin-1-Dependent Mechanisms.

    PubMed

    Poncini, Carolina V; Ilarregui, Juan M; Batalla, Estela I; Engels, Steef; Cerliani, Juan P; Cucher, Marcela A; van Kooyk, Yvette; González-Cappa, Stella M; Rabinovich, Gabriel A

    2015-10-01

    Galectin-1 (Gal-1), an endogenous glycan-binding protein, is widely distributed at sites of inflammation and microbial invasion. Despite considerable progress regarding the immunoregulatory activity of this lectin, the role of endogenous Gal-1 during acute parasite infections is uncertain. In this study, we show that Gal-1 functions as a negative regulator to limit host-protective immunity following intradermal infection with Trypanosoma cruzi. Concomitant with the upregulation of immune inhibitory mediators, including IL-10, TGF-β1, IDO, and programmed death ligand 2, T. cruzi infection induced an early increase of Gal-1 expression in vivo. Compared to their wild-type (WT) counterpart, Gal-1-deficient (Lgals1(-/-)) mice exhibited reduced mortality and lower parasite load in muscle tissue. Resistance of Lgals1(-/-) mice to T. cruzi infection was associated with a failure in the activation of Gal-1-driven tolerogenic circuits, otherwise orchestrated by WT dendritic cells, leading to secondary dysfunction in the induction of CD4(+)CD25(+)Foxp3(+) regulatory T cells. This effect was accompanied by an increased number of CD8(+) T cells and higher frequency of IFN-γ-producing CD4(+) T cells in muscle tissues and draining lymph nodes as well as reduced parasite burden in heart and hindlimb skeletal muscle. Moreover, dendritic cells lacking Gal-1 interrupted the Gal-1-mediated tolerogenic circuit and reinforced T cell-dependent anti-parasite immunity when adoptively transferred into WT mice. Thus, endogenous Gal-1 may influence T. cruzi infection by fueling tolerogenic circuits that hinder anti-parasite immunity.

  12. Potential of acute phase proteins as predictor of postpartum uterine infections during transition period and its regulatory mechanism in dairy cattle

    PubMed Central

    Manimaran, A.; Kumaresan, A.; Jeyakumar, S.; Mohanty, T. K.; Sejian, V.; Kumar, Narender; Sreela, L.; Prakash, M. Arul; Mooventhan, P.; Anantharaj, A.; Das, D. N.

    2016-01-01

    Among the various systemic reactions against infection or injury, the acute phase response is the cascade of reaction and mostly coordinated by cytokines-mediated acute phase proteins (APPs) production. Since APPs are sensitive innate immune molecules, they are useful for early detection of inflammation in bovines and believed to be better discriminators than routine hematological parameters. Therefore, the possibility of using APPs as a diagnostic and prognostic marker of inflammation in major bovine health disorders including postpartum uterine infection has been explored by many workers. In this review, we discussed specifically importance of postpartum uterine infection, the role of energy balance in uterine infections and potential of APPs as a predictor of postpartum uterine infections during the transition period and its regulatory mechanism in dairy cattle. PMID:27051191

  13. Crosstalk between bone marrow-derived mesenchymal stem cells and regulatory T cells through a glucocorticoid-induced leucine zipper/developmental endothelial locus-1-dependent mechanism

    PubMed Central

    Yang, Nianlan; Baban, Babak; Isales, Carlos M.; Shi, Xing-Ming

    2015-01-01

    Bone marrow is a reservoir for regulatory T (Treg) cells, but how Treg cells are regulated in that environment remains poorly understood. We show that expression of glucocorticoid (GC)-induced leucine zipper (GILZ) in bone marrow mesenchymal lineage cells or bone marrow-derived mesenchymal stem cells (BMSCs) increases the production of Treg cells via a mechanism involving the up-regulation of developmental endothelial locus-1 (Del-1), an endogenous leukocyte-endothelial adhesion inhibitor. We found that the expression of Del-1 is increased ∼4-fold in the bone tissues of GILZ transgenic (Tg) mice, and this increase is coupled with a significant increase in the production of IL-10 (2.80 vs. 0.83) and decrease in the production of IL-6 (0.80 vs. 2.33) and IL-12 (0.25 vs. 1.67). We also show that GILZ-expressing BMSCs present antigen in a way that favors Treg cells. These results indicate that GILZ plays a critical role mediating the crosstalk between BMSCs and Treg in the bone marrow microenvironment. These data, together with our previous findings that overexpression of GILZ in BMSCs antagonizes TNF-α-elicited inflammatory responses, suggest that GILZ plays important roles in bone-immune cell communication and BMSC immune suppressive functions.—Yang, N., Baban, B., Isales, C. M., Shi, X.-M. Crosstalk between bone marrow-derived mesenchymal stem cells and regulatory T cells through a glucocorticoid-induced leucine zipper/developmental endothelial locus-1-dependent mechanism. PMID:26038125

  14. Probing the chemical mechanism and critical regulatory amino acid residues of Drosophila melanogaster arylalkylamine N-acyltransferase like 2.

    PubMed

    Dempsey, Daniel R; Carpenter, Anne-Marie; Ospina, Santiago Rodriguez; Merkler, David J

    2015-11-01

    Arylalkylamine N-acyltransferase like 2 (AANATL2) catalyzes the formation of N-acylarylalkylamides from the corresponding acyl-CoA and arylalkylamine. The N-acylation of biogenic amines in Drosophila melanogaster is a critical step for the inactivation of neurotransmitters, cuticle sclerotization, and melatonin biosynthesis. In addition, D. melanogaster has been used as a model system to evaluate the biosynthesis of fatty acid amides: a family of potent cell signaling lipids. We have previously showed that AANATL2 catalyzes the formation of N-acylarylakylamides, including long-chain N-acylserotonins and N-acyldopamines. Herein, we define the kinetic mechanism for AANATL2 as an ordered sequential mechanism with acetyl-CoA binding first followed by tyramine to generate the ternary complex prior to catalysis. Bell shaped kcat,app - acetyl-CoA and (kcat/Km)app - acetyl-CoA pH-rate profiles identified two apparent pKa,app values of ∼7.4 and ∼8.9 that are critical to catalysis, suggesting the AANATL2-catalyzed formation of N-acetyltyramine occurs through an acid/base chemical mechanism. Site-directed mutagenesis of a conserved glutamate that corresponds to the catalytic base for other D. melanogaster AANATL enzymes did not produce a substantial depression in the kcat,app value nor did it abolish the pKa,app value attributed to the general base in catalysis (pKa ∼7.4). These data suggest that AANATL2 catalyzes the formation of N-acylarylalkylamides using either different catalytic residues or a different chemical mechanism relative to other D. melanogaster AANATL enzymes. In addition, we constructed other site-directed mutants of AANATL2 to help define the role of targeted amino acids in substrate binding and/or enzyme catalysis.

  15. Immune-Regulatory Mechanisms of Classical and Experimental Multiple Sclerosis Drugs: A Special Focus on Helminth-Derived Treatments.

    PubMed

    Peón, Alberto N; Terrazas, Luis I

    2016-01-01

    Multiple sclerosis (MS) is the most prevalent autoimmune disease affecting the central nervous system (CNS). Its pathophysiology is centered on neuron myelin sheath destruction in a manner largely dependent upon CD4+/CD8+ T-cell autoreactivity against myelin antigens, inducing Th1/Th17 pathogenic responses with the resulting production of free radicals and soluble mediators that exhibit the effector mechanisms of neurodegeneration. The immune response responsible for this disease is complex and challenges modern medicine. Consequently, many experimental therapies have been proposed in addition to the classical array of immunoregulatory/ immunosuppressive drugs that are normally used to treat MS. In this review, we will describe the effects and mechanisms of action of widely used disease-modifying MS drugs as well as those of select treatments that are currently in the experimental phase. Special emphasis is placed on helminth-derived immunoregulators, as some of them have shown promising results. Additionally, we will compare the mechanisms of action of both the MS drugs and the helminth-derived treatments to discuss the potential importance of some signaling pathways in the control of MS.

  16. To Gate, or Not to Gate: Regulatory Mechanisms for Intercellular Protein Transport and Virus Movement in Plants

    PubMed Central

    Ueki, Shoko; Citovsky, Vitaly

    2011-01-01

    Cell-to-cell signal transduction is vital for orchestrating the whole-body physiology of multi-cellular organisms, and many endogenous macromolecules, proteins, and nucleic acids function as such transported signals. In plants, many of these molecules are transported through plasmodesmata (Pd), the cell wall-spanning channel structures that interconnect plant cells. Furthermore, Pd also act as conduits for cell-to-cell movement of most plant viruses that have evolved to pirate these channels to spread the infection. Pd transport is presumed to be highly selective, and only a limited repertoire of molecules is transported through these channels. Recent studies have begun to unravel mechanisms that actively regulate the opening of the Pd channel to allow traffic. This macromolecular transport between cells comprises two consecutive steps: intracellular targeting to Pd and translocation through the channel to the adjacent cell. Here, we review the current knowledge of molecular species that are transported though Pd and the mechanisms that control this traffic. Generally, Pd traffic can occur by passive diffusion through the trans-Pd cytoplasm or through the membrane/lumen of the trans-Pd ER, or by active transport that includes protein–protein interactions. It is this latter mode of Pd transport that is involved in intercellular traffic of most signal molecules and is regulated by distinct and sometimes interdependent mechanisms, which represent the focus of this article. PMID:21746703

  17. Binding-protein-dependent sugar transport by Agrobacterium radiobacter and A. tumefaciens grown in continuous culture.

    PubMed

    Cornish, A; Greenwood, J A; Jones, C W

    1989-11-01

    Binding-protein-dependent sugar transport has been investigated in Agrobacterium radiobacter and A. tumefaciens. A. radiobacter contained two high-affinity glucose-binding proteins (GBP1 and GBP2) that additionally bound D-galactose (KD 0.26 microM) and D-xylose (KD 0.04 microM) respectively and were involved in the transport of these sugars. Partial sequencing of GBP1 and GBP2 showed that GBP2 exhibited significant homology with both the arabinose-binding protein (ABP) and the galactose-binding protein (GalBP) from Escherichia coli, whereas GBP1 exhibited significant homology only with ABP. Antiserum raised against GBP1 cross-reacted with GBP1 but not with GBP2, and vice versa. Anti-GBP1 and anti-GBP2 also cross-reacted with proteins corresponding to GBP1 and GBP2 respectively in A. tumefaciens, but little or no cross-reaction was observed with selected members of the Enterobacteriaceae, Rhizobiaceae and Pseudomonadaceae families grown under glucose limitation. GBP1 was less strongly repressed than GBP2 following batch growth of A. radiobacter on various carbon sources. The growth of A. radiobacter for more than approximately 10 generations in continuous culture under galactose or xylose limitation (D 0.045 h-1) led to the emergence of new strains which exhibited increased rates of glucose/galactose or glucose/xylose uptake, and which respectively hyperproduced GBP1 (strain AR18a) or GBP2 (strain AR9a). Similarly, growth of A. tumefaciens for more than approximately 15 generations under glucose or galactose limitation produced new strains which exhibited increased rates of glucose/xylose or glucose/galactose uptake and which respectively hyperproduced proteins analogous to GBP2 (strain AT9) or GBP1 (strain AT18a). It is concluded that growth of Agrobacterium species under carbon-limited conditions leads to the predictable emergence of new strains which specifically hyperproduce the transport system for the limiting nutrient. The GBP1-dependent system of A

  18. Disparate Regulatory Mechanisms Control Fat3 and P75NTR Protein Transport through a Conserved Kif5-Interaction Domain

    PubMed Central

    Birkness, Jacqueline E.; Trinidad, Jonathan C.

    2016-01-01

    Directed transport delivers proteins to specific cellular locations and is one mechanism by which cells establish and maintain polarized cellular architectures. The atypical cadherin Fat3 directs the polarized extension of dendrites in retinal amacrine cells by influencing the distribution of cytoskeletal regulators during retinal development, however the mechanisms regulating the distribution of Fat3 remain unclear. We report a novel Kinesin/Kif5 Interaction domain (Kif5-ID) in Fat3 that facilitates Kif5B binding, and determines the distribution of Fat3 cytosolic domain constructs in neurons and MDCK cells. The Kif5-ID sequence is conserved in the neurotrophin receptor P75NTR, which also binds Kif5B, and Kif5-ID mutations similarly result in P75NTR mislocalization. Despite these similarities, Kif5B-mediated protein transport is differentially regulated by these two cargos. For Fat3, the Kif5-ID is regulated by alternative splicing, and the timecourse of splicing suggests that the distribution of Fat3 may switch between early and later stages of retinal development. In contrast, P75NTR binding to Kif5B is enhanced by tyrosine phosphorylation and thus has the potential to be dynamically regulated on a more rapid time scale. PMID:27788242

  19. Transcriptomes reveal the genetic mechanisms underlying ionic regulatory adaptations to salt in the crab-eating frog

    PubMed Central

    Shao, Yong; Wang, Li-Jun; Zhong, Li; Hong, Mei-Ling; Chen, Hong-Man; Murphy, Robert W.; Wu, Dong-Dong; Zhang, Ya-Ping; Che, Jing

    2015-01-01

    The crab-eating frog, Fejervarya cancrivora, is the only frog that lives near seas. It tolerates increased environmental concentrations of sodium, chloride and potassium partly by raising ion and urea levels in its blood plasma. The molecular mechanism of the adaptation remains rarely documented. Herein, we analyze transcriptomes of the crab-eating frog and its closely related saline-intolerant species, F. limnocharis, to explore the molecular basis of adaptations to such extreme environmental conditions. Analyses reveal the potential genetic mechanism underlying the adaptation to salinity for the crab-eating frog. Genes in categories associated with ion transport appear to have evolved rapidly in F. cancrivora. Both positively selected and differentially expressed genes exhibit enrichment in the GO category regulation of renal sodium excretion. In this category, the positively selected sites of ANPEP and AVPR2 encode CD13 and V2 receptors, respectively; they fall precisely on conserved domains. More differentially expressed rapidly evolved genes occur in the kidney of F. cancrivora than in F. limnocharis. Four genes involved in the regulation of body fluid levels show signs of positive selection and increased expression. Significant up-regulation occurs in several genes of F. cancrivora associated with renin-angiotensin system and aldosterone-regulated sodium reabsorption pathways, which relate to osmotic regulation. PMID:26619819

  20. Subchromoplast Sequestration of Carotenoids Affects Regulatory Mechanisms in Tomato Lines Expressing Different Carotenoid Gene Combinations[C][W

    PubMed Central

    Nogueira, Marilise; Mora, Leticia; Enfissi, Eugenia M.A.; Bramley, Peter M.; Fraser, Paul D.

    2013-01-01

    Metabolic engineering of the carotenoid pathway in recent years has successfully enhanced the carotenoid contents of crop plants. It is now clear that only increasing biosynthesis is restrictive, as mechanisms to sequestrate these increased levels in the cell or organelle should be exploited. In this study, biosynthetic pathway genes were overexpressed in tomato (Solanum lycopersicum) lines and the effects on carotenoid formation and sequestration revealed. The bacterial Crt carotenogenic genes, independently or in combination, and their zygosity affect the production of carotenoids. Transcription of the pathway genes was perturbed, whereby the tissue specificity of transcripts was altered. Changes in the steady state levels of metabolites in unrelated sectors of metabolism were found. Of particular interest was a concurrent increase of the plastid-localized lipid monogalactodiacylglycerol with carotenoids along with membranous subcellular structures. The carotenoids, proteins, and lipids in the subchromoplast fractions of the transgenic tomato fruit with increased carotenoid content suggest that cellular structures can adapt to facilitate the sequestration of the newly formed products. Moreover, phytoene, the precursor of the pathway, was identified in the plastoglobule, whereas the biosynthetic enzymes were in the membranes. The implications of these findings with respect to novel pathway regulation mechanisms are discussed. PMID:24249831

  1. Control of the Inflammatory Response Mechanisms Mediated by Natural and Induced Regulatory T-Cells in HCV-, HTLV-1-, and EBV-Associated Cancers

    PubMed Central

    Moralès, Olivier; Delhem, Nadira

    2014-01-01

    Virus infections are involved in chronic inflammation and, in some cases, cancer development. Although a viral infection activates the immune system's response that eradicates the pathogen mainly through inflammatory mechanisms, it is now recognized that this inflammatory condition is also favorable to the development of tumors. Indeed, it is well described that viruses, such as hepatitis C virus (HCV), Epstein Barr virus (EBV), human papillomavirus (HPV) or human T-cell lymphotropic virus type-1 (HTLV-1), are important risk factors for tumor malignancies. The inflammatory response is a fundamental immune mechanism which involves several molecular and cellular components consisting of cytokines and chemokines that are released by various proinflammatory cells. In parallel to this process, some endogenous recruited components release anti-inflammatory mediators to restore homeostasis. The development of tools and strategies using viruses to hijack the immune response is mostly linked to the presence of regulatory T-cells (Treg) that can inhibit inflammation and antiviral responses of other effector cells. In this review, we will focus on current understanding of the role of natural and induced Treg in the control and the resolution of inflammatory response in HCV-, HTLV-1-, and EBV-associated cancers. PMID:25525301

  2. Deciphering the molecular mechanisms underlying the binding of the TWIST1/E12 complex to regulatory E-box sequences.

    PubMed

    Bouard, Charlotte; Terreux, Raphael; Honorat, Mylène; Manship, Brigitte; Ansieau, Stéphane; Vigneron, Arnaud M; Puisieux, Alain; Payen, Léa

    2016-06-20

    The TWIST1 bHLH transcription factor controls embryonic development and cancer processes. Although molecular and genetic analyses have provided a wealth of data on the role of bHLH transcription factors, very little is known on the molecular mechanisms underlying their binding affinity to the E-box sequence of the promoter. Here, we used an in silico model of the TWIST1/E12 (TE) heterocomplex and performed molecular dynamics (MD) simulations of its binding to specific (TE-box) and modified E-box sequences. We focused on (i) active E-box and inactive E-box sequences, on (ii) modified active E-box sequences, as well as on (iii) two box sequences with modified adjacent bases the AT- and TA-boxes. Our in silico models were supported by functional in vitro binding assays. This exploration highlighted the predominant role of protein side-chain residues, close to the heart of the complex, at anchoring the dimer to DNA sequences, and unveiled a shift towards adjacent ((-1) and (-1*)) bases and conserved bases of modified E-box sequences. In conclusion, our study provides proof of the predictive value of these MD simulations, which may contribute to the characterization of specific inhibitors by docking approaches, and their use in pharmacological therapies by blocking the tumoral TWIST1/E12 function in cancers. PMID:27151200

  3. Studies on the regulatory effect of Peony-Glycyrrhiza Decoction on prolactin hyperactivity and underlying mechanism in hyperprolactinemia rat model.

    PubMed

    Wang, Di; Wang, Wei; Zhou, Yulin; Wang, Juan; Jia, Dongxu; Wong, Hei Kiu; Zhang, Zhang-Jin

    2015-10-01

    Clinical trials have demonstrated the beneficial effects of Peony-Glycyrrhiza Decoction (PGD) in alleviating antipsychotic-induced hyperprolactinemia (hyperPRL) in schizophrenic patients. In previous experiment, PGD suppressed prolactin (PRL) level in MMQ cells, involving modulating the expression of D2 receptor (DRD2) and dopamine transporter (DAT). In the present study, hyperPRL female rat model induced by dopamine blocker metoclopramide (MCP) was applied to further confirm the anti-hyperpPRL activity of PGD and underlying mechanism. In MCP-induced hyperPRL rats, the elevated serum PRL level was significantly suppressed by either PGD (2.5-10 g/kg) or bromocriptine (BMT) (0.6 mg/kg) administration for 14 days. However, in MCP-induced rats, only PGD restored the under-expressed serum progesterone (P) to control level. Both PGD and BMT administration restore the under-expression of DRD2, DAT and TH resulted from MCP in pituitary gland and hypothalamus. Compared to untreated group, hyperPRL animals had a marked reduction on DRD2 and DAT expression in the arcuate nucleus. PGD (10 g/kg) and BMT (0.6 mg/kg) treatment significant reversed the expression of DRD2 and DAT. Collectively, the anti-hyperPRL activity of PGD associates with the modulation of dopaminergic neuronal system and the restoration of serum progesterone level. Our finding supports PGD as an effective agent against hyperPRL.

  4. Comparative transcriptome and metabolome provides new insights into the regulatory mechanisms of accelerated senescence in litchi fruit after cold storage

    PubMed Central

    Yun, Ze; Qu, Hongxia; Wang, Hui; Zhu, Feng; Zhang, Zhengke; Duan, Xuewu; Yang, Bao; Cheng, Yunjiang; Jiang, Yueming

    2016-01-01

    Litchi is a non-climacteric subtropical fruit of high commercial value. The shelf life of litchi fruit under ambient conditions (AC) is approximately 4–6 days. Post-harvest cold storage prolongs the life of litchi fruit for up to 30 days with few changes in pericarp browning and total soluble solids. However, the shelf life of litchi fruits at ambient temperatures after pre-cold storage (PCS) is only 1–2 days. To better understand the mechanisms involved in the rapid fruit senescence induced by pre-cold storage, a transcriptome of litchi pericarp was constructed to assemble the reference genes, followed by comparative transcriptomic and metabolomic analyses. Results suggested that the senescence of harvested litchi fruit was likely to be an oxidative process initiated by ABA, including oxidation of lipids, polyphenols and anthocyanins. After cold storage, PCS fruit exhibited energy deficiency, and respiratory burst was elicited through aerobic and anaerobic respiration, which was regulated specifically by an up-regulated calcium signal, G-protein-coupled receptor signalling pathway and small GTPase-mediated signal transduction. The respiratory burst was largely associated with increased production of reactive oxygen species, up-regulated peroxidase activity and initiation of the lipoxygenase pathway, which were closely related to the accelerated senescence of PCS fruit. PMID:26763309

  5. Deciphering the molecular mechanisms underlying the binding of the TWIST1/E12 complex to regulatory E-box sequences

    PubMed Central

    Bouard, Charlotte; Terreux, Raphael; Honorat, Mylène; Manship, Brigitte; Ansieau, Stéphane; Vigneron, Arnaud M.; Puisieux, Alain; Payen, Léa

    2016-01-01

    The TWIST1 bHLH transcription factor controls embryonic development and cancer processes. Although molecular and genetic analyses have provided a wealth of data on the role of bHLH transcription factors, very little is known on the molecular mechanisms underlying their binding affinity to the E-box sequence of the promoter. Here, we used an in silico model of the TWIST1/E12 (TE) heterocomplex and performed molecular dynamics (MD) simulations of its binding to specific (TE-box) and modified E-box sequences. We focused on (i) active E-box and inactive E-box sequences, on (ii) modified active E-box sequences, as well as on (iii) two box sequences with modified adjacent bases the AT- and TA-boxes. Our in silico models were supported by functional in vitro binding assays. This exploration highlighted the predominant role of protein side-chain residues, close to the heart of the complex, at anchoring the dimer to DNA sequences, and unveiled a shift towards adjacent ((-1) and (-1*)) bases and conserved bases of modified E-box sequences. In conclusion, our study provides proof of the predictive value of these MD simulations, which may contribute to the characterization of specific inhibitors by docking approaches, and their use in pharmacological therapies by blocking the tumoral TWIST1/E12 function in cancers. PMID:27151200

  6. Nek2A phosphorylates and stabilizes SuFu: A new strategy of Gli2/Hedgehog signaling regulatory mechanism.

    PubMed

    Wang, Yao; Li, Yong; Hu, Guanghui; Huang, Xuan; Rao, Hai; Xiong, Xiangyang; Luo, Zhijun; Lu, Quqin; Luo, Shiwen

    2016-09-01

    Suppressor of Fused (SuFu) plays a conservative role in the regulation of the Gli transcription factors within the Hedgehog (Hh) signaling pathway. Despite the central importance of SuFu in the Hh pathway, little is known about its regulation. Here, we performed a GAL4-based yeast two-hybrid screen using human SuFu as bait, and identified NIMA-related expressed kinase 2A (Nek2A) as a new SuFu-interacting protein, which was also confirmed by glutathione-S-transferase pull-down and co-immunoprecipitation assays. Intriguingly, Nek2A is found to stabilize SuFu at least partly depending on its kinase activity, thereby triggering phosphorylation of the SuFu protein. Moreover, the phosphorylated SuFu inhibits the nuclear localization and transcriptional activity of Gli2/Hh signaling. These findings reveal a new mechanism of mammalian SuFu regulation, and offers novel insights into Hh signaling regulation in development and human disease. PMID:27297360

  7. Comparative transcriptome and metabolome provides new insights into the regulatory mechanisms of accelerated senescence in litchi fruit after cold storage.

    PubMed

    Yun, Ze; Qu, Hongxia; Wang, Hui; Zhu, Feng; Zhang, Zhengke; Duan, Xuewu; Yang, Bao; Cheng, Yunjiang; Jiang, Yueming

    2016-01-01

    Litchi is a non-climacteric subtropical fruit of high commercial value. The shelf life of litchi fruit under ambient conditions (AC) is approximately 4-6 days. Post-harvest cold storage prolongs the life of litchi fruit for up to 30 days with few changes in pericarp browning and total soluble solids. However, the shelf life of litchi fruits at ambient temperatures after pre-cold storage (PCS) is only 1-2 days. To better understand the mechanisms involved in the rapid fruit senescence induced by pre-cold storage, a transcriptome of litchi pericarp was constructed to assemble the reference genes, followed by comparative transcriptomic and metabolomic analyses. Results suggested that the senescence of harvested litchi fruit was likely to be an oxidative process initiated by ABA, including oxidation of lipids, polyphenols and anthocyanins. After cold storage, PCS fruit exhibited energy deficiency, and respiratory burst was elicited through aerobic and anaerobic respiration, which was regulated specifically by an up-regulated calcium signal, G-protein-coupled receptor signalling pathway and small GTPase-mediated signal transduction. The respiratory burst was largely associated with increased production of reactive oxygen species, up-regulated peroxidase activity and initiation of the lipoxygenase pathway, which were closely related to the accelerated senescence of PCS fruit. PMID:26763309

  8. Study on the molecular regulatory mechanism of MicroRNA-195 in the invasion and metastasis of colorectal carcinoma

    PubMed Central

    Yang, Bin; Tan, Zhigang; Song, Yan

    2015-01-01

    Objective: This study aims to identify the target gene of hsa-miR-195 and to research the molecular mechanism of hsa-miR-195 which is through its target genes in the colorectal cancer invasion and metastasis. Methods: We used biological informatics (RNAhybrid and Target Scan analysis database) to predict the target genes of hsa-miR-195. Collected colon cancer tissues from clinical colorectal cancer patients by surgical removal of the carcinoma and control tissues, and researched the expression of Bcl-2 in tissues by immunohistochemical. Next, Real-time PCR was used to research the expression of hsa-miR-195 in Caco-2 and NCM460 cell line. hsa -miR-195 Mimics was transient transfered to Caco-2 cells, western blot was used to analysis the expression changes of Bcl-2. To analysis the possibility that hsa-miR-195 can affect the invasive ability of tumor cells by Bcl-2, we transferred hsa-miR-195 Mimics and Bcl-2 expression plasmid, and used the cell invasion experiment to discusses hsa-miR-195 effect on the ability of tumor cell invasion. Results: the immunohistochemical results showed that, the semi-quantitative parameters for the Bcl-2: control by 0.89 ± 0.51, 6 colon cancer by 31 ± 0.79. The expression of has-miR-195 in Caco-2 is 0.39 ± 1.5 while the value in control is2.01 ± 0.2, **P < 0.01. Conclusion: In colorectal cancer, has-miR-195 can promote cell apoptosis and inhibit the invasion and metastasis by inhibiting the expression of Bcl-2. PMID:26064276

  9. S-nitrosation of β-catenin and p120 catenin: a novel regulatory mechanism in endothelial hyperpermeability

    PubMed Central

    Marín, N.; Zamorano, P.; Carrasco, R.; Mujica, P.; González, FG.; Quezada, C.; Meininger, CJ.; Boric, MP.; Durán, WN.; Sánchez, FA.

    2014-01-01

    Rationale Endothelial adherens junction proteins constitute an important element in the control of microvascular permeability. Platelet-activating factor (PAF) increases permeability to macromolecules via translocation of eNOS to cytosol and stimulation of eNOS-derived NO signaling cascade. The mechanisms by which NO signaling regulates permeability at adherens junctions are still incompletely understood. Objective We explored the hypothesis that PAF stimulates hyperpermeability via S-nitrosation (SNO) of adherens junction proteins. Methods and Results We measured PAF-stimulated S-nitrosation of β-catenin and p120-catenin (p120) in three cell lines: ECV-eNOSGFP, EAhy926 (derived from human umbilical vein) and CVEC (derived from bovine heart endothelium) and in the mouse cremaster muscle in vivo. SNO correlated with diminished abundance of β-catenin and p120 at the adherens junction and with hyperpermeability. TNF-α increased NO production and caused similar increase in S-nitrosation as PAF. To ascertain the importance of eNOS subcellular location in this process, we used ECV-304 cells transfected with cytosolic eNOS (GFPeNOSG2A) and plasma membrane eNOS (GFPeNOSCAAX). PAF induced S-nitrosation of β-catenin and p120 and significantly diminished association between these proteins in cells with cytosolic eNOS but not in cells wherein eNOS is anchored to the cell membrane. Inhibitors of NO production and of S-nitrosation blocked PAF-induced S-nitrosation and hyperpermeability whereas inhibition of the cGMP pathway had no effect. Mass spectrometry analysis of purified p120 identified cysteine 579 as the main S-nitrosated residue in the region that putatively interacts with VE-cadherin. Conclusions Our results demonstrate that agonist-induced SNO contributes to junctional membrane protein changes that enhance endothelial permeability. PMID:22777005

  10. Lycopene treatment against loss of bone mass, microarchitecture and strength in relation to regulatory mechanisms in a postmenopausal osteoporosis model.

    PubMed

    Ardawi, Mohammed-Salleh M; Badawoud, Mohammed H; Hassan, Sherif M; Rouzi, Abdulrahim A; Ardawi, Jumanah M S; AlNosani, Nouf M; Qari, Mohammed H; Mousa, Shaker A

    2016-02-01

    Lycopene supplementation decreases oxidative stress and exhibits beneficial effects on bone health, but the mechanisms through which it alters bone metabolism in vivo remain unclear. The present study aims to evaluate the effects of lycopene treatment on postmenopausal osteoporosis. Six-month-old female Wistar rats (n=264) were sham-operated (SHAM) or ovariectomized (OVX). The SHAM group received oral vehicle only and the OVX rats were randomized into five groups receiving oral daily lycopene treatment (mg/kg body weight per day): 0 OVX (control), 15 OVX, 30 OVX, and 45 OVX, and one group receiving alendronate (ALN) (2μg/kg body weight per day), for 12weeks. Bone densitometry measurements, bone turnover markers, biomechanical testing, and histomorphometric analysis were conducted. Micro computed tomography was also used to evaluate changes in microarchitecture. Lycopene treatment suppressed the OVX-induced increase in bone turnover, as indicated by changes in biomarkers of bone metabolism: serum osteocalcin (s-OC), serum N-terminal propeptide of type 1 collagen (s-PINP), serum crosslinked carboxyterminal telopeptides (s-CTX-1), and urinary deoxypyridinoline (u-DPD). Significant improvement in OVX-induced loss of bone mass, bone strength, and microarchitectural deterioration was observed in lycopene-treated OVX animals. These effects were observed mainly at sites rich in trabecular bone, with less effect in cortical bone. Lycopene treatment down-regulated osteoclast differentiation concurrent with up-regulating osteoblast together with glutathione peroxidase (GPx) catalase (CAT) and superoxide dismutase (SOD) activities. These findings demonstrate that lycopene treatment in OVX rats primarily suppressed bone turnover to restore bone strength and microarchitecture.

  11. Regulatory Dendritic Cells Restrain NK Cell IFN-γ Production through Mechanisms Involving NKp46, IL-10, and MHC Class I-Specific Inhibitory Receptors.

    PubMed

    Spallanzani, Raúl G; Torres, Nicolás I; Avila, Damián E; Ziblat, Andrea; Iraolagoitia, Ximena L Raffo; Rossi, Lucas E; Domaica, Carolina I; Fuertes, Mercedes B; Rabinovich, Gabriel A; Zwirner, Norberto W

    2015-09-01

    Cross-talk between mature dendritic cells (mDC) and NK cells through the cell surface receptors NKp30 and DNAM-1 leads to their reciprocal activation. However, the impact of regulatory dendritic cells (regDC) on NK cell function remains unknown. As regDC constrain the immune response in different physiological and pathological conditions, the aim of this work was to investigate the functional outcome of the interaction between regDC and NK cells and the associated underlying mechanisms. RegDC generated from monocyte-derived DC treated either with LPS and dexamethasone, vitamin D3, or vitamin D3 and dexamethasone instructed NK cells to secrete lower amounts of IFN-γ than NK cells exposed to mDC. Although regDC triggered upregulation of the activation markers CD69 and CD25 on NK cells, they did not induce upregulation of CD56 as mDC, and silenced IFN-γ secretion through mechanisms involving insufficient secretion of IL-18, but not IL-12 or IL-15 and/or induction of NK cell apoptosis. Blocking experiments demonstrated that regDC curb IFN-γ secretion by NK cells through a dominant suppressive mechanism involving IL-10, NK cell inhibitory receptors, and, unexpectedly, engagement of the activating receptor NKp46. Our findings unveil a previously unrecognized cross-talk through which regDC shape NK cell function toward an alternative activated phenotype unable to secrete IFN-γ, highlighting the plasticity of NK cells in response to tolerogenic stimuli. In addition, our findings contribute to identify a novel inhibitory role for NKp46 in the control of NK cell function, and have broad implications in the resolution of inflammatory responses and evasion of antitumor responses. PMID:26232426

  12. Integrative Modeling of eQTLs and Cis-Regulatory Elements Suggests Mechanisms Underlying Cell Type Specificity of eQTLs

    PubMed Central

    Brown, Christopher D.; Mangravite, Lara M.; Engelhardt, Barbara E.

    2013-01-01

    Genetic variants in cis-regulatory elements or trans-acting regulators frequently influence the quantity and spatiotemporal distribution of gene transcription. Recent interest in expression quantitative trait locus (eQTL) mapping has paralleled the adoption of genome-wide association studies (GWAS) for the analysis of complex traits and disease in humans. Under the hypothesis that many GWAS associations tag non-coding SNPs with small effects, and that these SNPs exert phenotypic control by modifying gene expression, it has become common to interpret GWAS associations using eQTL data. To fully exploit the mechanistic interpretability of eQTL-GWAS comparisons, an improved understanding of the genetic architecture and causal mechanisms of cell type specificity of eQTLs is required. We address this need by performing an eQTL analysis in three parts: first we identified eQTLs from eleven studies on seven cell types; then we integrated eQTL data with cis-regulatory element (CRE) data from the ENCODE project; finally we built a set of classifiers to predict the cell type specificity of eQTLs. The cell type specificity of eQTLs is associated with eQTL SNP overlap with hundreds of cell type specific CRE classes, including enhancer, promoter, and repressive chromatin marks, regions of open chromatin, and many classes of DNA binding proteins. These associations provide insight into the molecular mechanisms generating the cell type specificity of eQTLs and the mode of regulation of corresponding eQTLs. Using a random forest classifier with cell specific CRE-SNP overlap as features, we demonstrate the feasibility of predicting the cell type specificity of eQTLs. We then demonstrate that CREs from a trait-associated cell type can be used to annotate GWAS associations in the absence of eQTL data for that cell type. We anticipate that such integrative, predictive modeling of cell specificity will improve our ability to understand the mechanistic basis of human complex phenotypic

  13. 75 FR 61531 - Issuance of Regulatory Guide

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-10-05

    ... E. Norris, Component Integrity Branch, Division of Engineering, Office of Nuclear Regulatory... acceptable alternatives to requirements in the American Society of Mechanical Engineers (ASME) Boiler and.... Harriet Karagiannis, Acting Chief, Regulatory Guide Development Branch, Division of Engineering, Office...

  14. Microhomology-mediated mechanisms underlie non-recurrent disease-causing microdeletions of the FOXL2 gene or its regulatory domain.

    PubMed

    Verdin, Hannah; D'haene, Barbara; Beysen, Diane; Novikova, Yana; Menten, Björn; Sante, Tom; Lapunzina, Pablo; Nevado, Julian; Carvalho, Claudia M B; Lupski, James R; De Baere, Elfride

    2013-01-01

    Genomic disorders are often caused by recurrent copy number variations (CNVs), with nonallelic homologous recombination (NAHR) as the underlying mechanism. Recently, several microhomology-mediated repair mechanisms--such as microhomology-mediated end-joining (MMEJ), fork stalling and template switching (FoSTeS), microhomology-mediated break-induced replication (MMBIR), serial replication slippage (SRS), and break-induced SRS (BISRS)--were described in the etiology of non-recurrent CNVs in human disease. In addition, their formation may be stimulated by genomic architectural features. It is, however, largely unexplored to what extent these mechanisms contribute to rare, locus-specific pathogenic CNVs. Here, fine-mapping of 42 microdeletions of the FOXL2 locus, encompassing FOXL2 (32) or its regulatory domain (10), serves as a model for rare, locus-specific CNVs implicated in genetic disease. These deletions lead to blepharophimosis syndrome (BPES), a developmental condition affecting the eyelids and the ovary. For breakpoint mapping we used targeted array-based comparative genomic hybridization (aCGH), quantitative PCR (qPCR), long-range PCR, and Sanger sequencing of the junction products. Microhomology, ranging from 1 bp to 66 bp, was found in 91.7% of 24 characterized breakpoint junctions, being significantly enriched in comparison with a random control sample. Our results show that microhomology-mediated repair mechanisms underlie at least 50% of these microdeletions. Moreover, genomic architectural features, like sequence motifs, non-B DNA conformations, and repetitive elements, were found in all breakpoint regions. In conclusion, the majority of these microdeletions result from microhomology-mediated mechanisms like MMEJ, FoSTeS, MMBIR, SRS, or BISRS. Moreover, we hypothesize that the genomic architecture might drive their formation by increasing the susceptibility for DNA breakage or promote replication fork stalling. Finally, our locus-centered study

  15. Genome-wide analysis of the H-NS and Sfh regulatory networks in Salmonella Typhimurium identifies a plasmid-encoded transcription silencing mechanism.

    PubMed

    Dillon, Shane C; Cameron, Andrew D S; Hokamp, Karsten; Lucchini, Sacha; Hinton, Jay C D; Dorman, Charles J

    2010-06-01

    The conjugative IncHI1 plasmid pSfR27 from Shigella flexneri 2a strain 2457T encodes the Sfh protein, a paralogue of the global transcriptional repressor H-NS. Sfh allows pSfR27 to be transmitted to new bacterial hosts with minimal impact on host fitness, providing a 'stealth' function whose molecular mechanism has yet to be determined. The impact of the Sfh protein on the Salmonella enterica serovar Typhimurium transcriptome was assessed and binding sites for Sfh in the Salmonella Typhimurium genome were identified by chromatin immunoprecipitation. Sfh did not bind uniquely to any sites. Instead, it bound to a subset of the larger H-NS regulatory network. Analysis of Sfh binding in the absence of H-NS revealed a greatly expanded population of Sfh binding sites that included the majority of H-NS target genes. Furthermore, the presence of plasmid pSfR27 caused a decrease in H-NS interactions with the S. Typhimurium chromosome, suggesting that the A + T-rich DNA of this large plasmid acts to titrate H-NS, removing it from chromosomal locations. It is proposed that Sfh acts as a molecular backup for H-NS and that it provides its 'stealth' function by replacing H-NS on the chromosome, thus minimizing disturbances to the H-NS-DNA binding pattern in cells that acquire pSfR27.

  16. A multilayered regulatory mechanism for the autoinhibition and activation of a plant CC-NB-LRR resistance protein with an extra N-terminal domain.

    PubMed

    Chen, Xiaojiao; Zhu, Min; Jiang, Lei; Zhao, Wenyang; Li, Jia; Wu, Jianyan; Li, Chun; Bai, Baohui; Lu, Gang; Chen, Hongyu; Moffett, Peter; Tao, Xiaorong

    2016-10-01

    The tomato resistance protein Sw-5b differs from the classical coiled-coil nucleotide-binding leucine-rich repeat (CC-NB-LRR) resistance proteins by having an extra N-terminal domain (NTD). To understand how NTD, CC and NB-LRR regulate autoinhibition and activation of Sw-5b, we dissected the function(s) of each domain. When viral elicitor was absent, Sw-5b LRR suppressed the central NB-ARC to maintain autoinhibition of the NB-LRR segment. The CC and NTD domains independently and additively enhanced the autoinhibition of NB-LRR. When viral elicitor was present, the NB-LRR segment of Sw-5b was specifically activated to trigger a hypersensitive response. Surprisingly, Sw-5b CC suppressed the activation of NB-LRR, whereas the extra NTD of Sw-5b became a positive regulator and fully activated the resistance protein, probably by relieving the inhibitory effects of the CC. In infection assays of transgenic plants, the NB-LRR segment alone was insufficient to confer resistance against Tomato spotted wilt tospovirus; the layers of NTD and CC regulation on NB-LRR were required for Sw-5b to confer resistance. Based on these findings, we propose that, to counter the negative regulation of the CC on NB-LRR, Sw-5b evolved an extra NTD to coordinate with the CC, thus developing a multilayered regulatory mechanism to control autoinhibition and activation.

  17. Dissection of the regulatory mechanism of a heat-shock responsive promoter in Haloarchaea: a new paradigm for general transcription factor directed archaeal gene regulation

    PubMed Central

    Lu, Qiuhe; Han, Jing; Zhou, Ligang; Coker, James A.; DasSarma, Priya; DasSarma, Shiladitya; Xiang, Hua

    2008-01-01

    Multiple general transcription factors (GTFs), TBP and TFB, are present in many haloarchaea, and are deemed to accomplish global gene regulation. However, details and the role of GTF-directed transcriptional regulation in stress response are still not clear. Here, we report a comprehensive investigation of the regulatory mechanism of a heat-induced gene (hsp5) from Halobacterium salinarum. We demonstrated by mutation analysis that the sequences 5′ and 3′ to the core elements (TATA box and BRE) of the hsp5 promoter (Phsp5) did not significantly affect the basal and heat-induced gene expression, as long as the transcription initiation site was not altered. Moreover, the BRE and TATA box of Phsp5 were sufficient to render a nonheat-responsive promoter heat-inducible, in both Haloferax volcanii and Halobacterium sp. NRC-1. DNA–protein interactions revealed that two heat-inducible GTFs, TFB2 from H. volcanii and TFBb from Halobacterium sp. NRC-1, could specifically bind to Phsp5 likely in a temperature-dependent manner. Taken together, the heat-responsiveness of Phsp5 was mainly ascribed to the core promoter elements that were efficiently recognized by specific heat-induced GTFs at elevated temperature, thus providing a new paradigm for GTF-directed gene regulation in the domain of Archaea. PMID:18390887

  18. Stable Suppression of Lactate Dehydrogenase Activity during Anoxia in the Foot Muscle of Littorina littorea and the Potential Role of Acetylation as a Novel Posttranslational Regulatory Mechanism.

    PubMed

    Shahriari, Ali; Dawson, Neal J; Bell, Ryan A V; Storey, Kenneth B

    2013-01-01

    The intertidal marine snail, Littorina littorea, has evolved to withstand extended bouts of oxygen deprivation brought about by changing tides or other potentially harmful environmental conditions. Survival is dependent on a strong suppression of its metabolic rate and a drastic reorganization of its cellular biochemistry in order to maintain energy balance under fixed fuel reserves. Lactate dehydrogenase (LDH) is a crucial enzyme of anaerobic metabolism as it is typically responsible for the regeneration of NAD(+), which allows for the continued functioning of glycolysis in the absence of oxygen. This study compared the kinetic and structural characteristics of the D-lactate specific LDH (E.C. 1.1.1.28) from foot muscle of aerobic control versus 24 h anoxia-exposed L. littorea. Anoxic LDH displayed a near 50% decrease in V max (pyruvate-reducing direction) as compared to control LDH. These kinetic differences suggest that there may be a stable modification and regulation of LDH during anoxia, and indeed, subsequent dot-blot analyses identified anoxic LDH as being significantly less acetylated than the corresponding control enzyme. Therefore, acetylation may be the regulatory mechanism that is responsible for the suppression of LDH activity during anoxia, which could allow for the production of alternative glycolytic end products that in turn would increase the ATP yield under fixed fuel reserves. PMID:24233354

  19. Stable Suppression of Lactate Dehydrogenase Activity during Anoxia in the Foot Muscle of Littorina littorea and the Potential Role of Acetylation as a Novel Posttranslational Regulatory Mechanism

    PubMed Central

    Shahriari, Ali; Dawson, Neal J.; Bell, Ryan A. V.; Storey, Kenneth B.

    2013-01-01

    The intertidal marine snail, Littorina littorea, has evolved to withstand extended bouts of oxygen deprivation brought about by changing tides or other potentially harmful environmental conditions. Survival is dependent on a strong suppression of its metabolic rate and a drastic reorganization of its cellular biochemistry in order to maintain energy balance under fixed fuel reserves. Lactate dehydrogenase (LDH) is a crucial enzyme of anaerobic metabolism as it is typically responsible for the regeneration of NAD+, which allows for the continued functioning of glycolysis in the absence of oxygen. This study compared the kinetic and structural characteristics of the D-lactate specific LDH (E.C. 1.1.1.28) from foot muscle of aerobic control versus 24 h anoxia-exposed L. littorea. Anoxic LDH displayed a near 50% decrease in Vmax (pyruvate-reducing direction) as compared to control LDH. These kinetic differences suggest that there may be a stable modification and regulation of LDH during anoxia, and indeed, subsequent dot-blot analyses identified anoxic LDH as being significantly less acetylated than the corresponding control enzyme. Therefore, acetylation may be the regulatory mechanism that is responsible for the suppression of LDH activity during anoxia, which could allow for the production of alternative glycolytic end products that in turn would increase the ATP yield under fixed fuel reserves. PMID:24233354

  20. A multilayered regulatory mechanism for the autoinhibition and activation of a plant CC-NB-LRR resistance protein with an extra N-terminal domain.

    PubMed

    Chen, Xiaojiao; Zhu, Min; Jiang, Lei; Zhao, Wenyang; Li, Jia; Wu, Jianyan; Li, Chun; Bai, Baohui; Lu, Gang; Chen, Hongyu; Moffett, Peter; Tao, Xiaorong

    2016-10-01

    The tomato resistance protein Sw-5b differs from the classical coiled-coil nucleotide-binding leucine-rich repeat (CC-NB-LRR) resistance proteins by having an extra N-terminal domain (NTD). To understand how NTD, CC and NB-LRR regulate autoinhibition and activation of Sw-5b, we dissected the function(s) of each domain. When viral elicitor was absent, Sw-5b LRR suppressed the central NB-ARC to maintain autoinhibition of the NB-LRR segment. The CC and NTD domains independently and additively enhanced the autoinhibition of NB-LRR. When viral elicitor was present, the NB-LRR segment of Sw-5b was specifically activated to trigger a hypersensitive response. Surprisingly, Sw-5b CC suppressed the activation of NB-LRR, whereas the extra NTD of Sw-5b became a positive regulator and fully activated the resistance protein, probably by relieving the inhibitory effects of the CC. In infection assays of transgenic plants, the NB-LRR segment alone was insufficient to confer resistance against Tomato spotted wilt tospovirus; the layers of NTD and CC regulation on NB-LRR were required for Sw-5b to confer resistance. Based on these findings, we propose that, to counter the negative regulation of the CC on NB-LRR, Sw-5b evolved an extra NTD to coordinate with the CC, thus developing a multilayered regulatory mechanism to control autoinhibition and activation. PMID:27558751

  1. BosR (BB0647) Controls the RpoN-RpoS Regulatory Pathway and Virulence Expression in Borrelia burgdorferi by a Novel DNA-Binding Mechanism

    PubMed Central

    Ouyang, Zhiming; Deka, Ranjit K.; Norgard, Michael V.

    2011-01-01

    In Borrelia burgdorferi (Bb), the Lyme disease spirochete, the alternative σ factor σ54 (RpoN) directly activates transcription of another alternative σ factor, σS (RpoS) which, in turn, controls the expression of virulence-associated membrane lipoproteins. As is customary in σ54-dependent gene control, a putative NtrC-like enhancer-binding protein, Rrp2, is required to activate the RpoN-RpoS pathway. However, recently it was found that rpoS transcription in Bb also requires another regulator, BosR, which was previously designated as a Fur or PerR homolog. Given this unexpected requirement for a second activator to promote σ54-dependent gene transcription, and the fact that regulatory mechanisms among similar species of pathogenic bacteria can be strain-specific, we sought to confirm the regulatory role of BosR in a second virulent strain (strain 297) of Bb. Indeed, BosR displayed the same influence over lipoprotein expression and mammalian infectivity for strain Bb 297 that were previously noted for Bb strain B31. We subsequently found that recombinant BosR (rBosR) bound to the rpoS gene at three distinct sites, and that binding occurred despite the absence of consensus Fur or Per boxes. This led to the identification of a novel direct repeat sequence (TAAATTAAAT) critical for rBosR binding in vitro. Mutations in the repeat sequence markedly inhibited or abolished rBosR binding. Taken together, our studies provide new mechanistic insights into how BosR likely acts directly on rpoS as a positive transcriptional activator. Additional novelty is engendered by the facts that, although BosR is a Fur or PerR homolog and it contains zinc (like Fur and PerR), it has other unique features that clearly set it apart from these other regulators. Our findings also have broader implications regarding a previously unappreciated layer of control that can be involved in σ54–dependent gene regulation in bacteria. PMID:21347346

  2. Viral complement regulatory proteins.

    PubMed

    Rosengard, A M; Ahearn, J M

    1999-05-01

    The inactivation of complement provides cells and tissues critical protection from complement-mediated attack and decreases the associated recruitment of other inflammatory mediators. In an attempt to evade the host immune response, viruses have evolved two mechanisms to acquire complement regulatory proteins. They can directly seize the host cell complement regulators onto their outer envelope and/or they can produce their own proteins which are either secreted into the neighboring intercellular space or expressed as membrane-bound proteins on the infected host cell. The following review will concentrate on the viral homologues of the mammalian complement regulatory proteins, specifically those containing complement control protein (CCP) repeats. PMID:10408371

  3. How the folding rates of two- and multistate proteins depend on the amino acid properties.

    PubMed

    Huang, Jitao T; Huang, Wei; Huang, Shanran R; Li, Xin

    2014-10-01

    Proteins fold by either two-state or multistate kinetic mechanism. We observe that amino acids play different roles in different mechanism. Many residues that are easy to form regular secondary structures (α helices, β sheets and turns) can promote the two-state folding reactions of small proteins. Most of hydrophilic residues can speed up the multistate folding reactions of large proteins. Folding rates of large proteins are equally responsive to the flexibility of partial amino acids. Other properties of amino acids (including volume, polarity, accessible surface, exposure degree, isoelectric point, and phase transfer energy) have contributed little to folding kinetics of the proteins. Cysteine is a special residue, it triggers two-state folding reaction and but inhibits multistate folding reaction. These findings not only provide a new insight into protein structure prediction, but also could be used to direct the point mutations that can change folding rate.

  4. Immunocytochemical evidence for SNARE protein-dependent transmitter release from guinea pig horizontal cells

    PubMed Central

    Lee, Helen; Brecha, Nicholas C.

    2013-01-01

    Horizontal cells are lateral interneurons that participate in visual processing in the outer retina but the cellular mechanisms underlying transmitter release from these cells are not fully understood. In non-mammalian horizontal cells, GABA release has been shown to occur by a non-vesicular mechanism. However, recent evidence in mammalian horizontal cells favors a vesicular mechanism as they lack plasmalemmal GABA transporters and some soluble NSF attachment protein receptor (SNARE) core proteins have been identified in rodent horizontal cells. Moreover, immunoreactivity for GABA and the molecular machinery to synthesize GABA have been found in guinea pig horizontal cells, suggesting that if components of the SNARE complex are expressed they could contribute to the vesicular release of GABA. In this study we investigated whether these vesicular and synaptic proteins are expressed by guinea pig horizontal cells using immunohistochemistry with well-characterized antibodies to evaluate their cellular distribution. Components of synaptic vesicles including vesicular GABA transporter, synapsin I and synaptic vesicle protein 2A were localized to horizontal cell processes and endings, along with the SNARE core complex proteins, syntaxin-1a, syntaxin-4 and synaptosomal-associated protein 25 (SNAP-25). Complexin I/II, a cytosolic protein that stabilizes the activated SNARE fusion core, strongly immunostained horizontal cell soma and processes. In addition, the vesicular Ca2+-sensor, synaptotagmin-2, which is essential for Ca2+-mediated vesicular release, was also localized to horizontal cell processes and somata. These morphological findings from guinea pig horizontal cells suggest that mammalian horizontal cells have the capacity to utilize a regulated Ca2+-dependent vesicular pathway to release neurotransmitter, and that this mechanism may be shared among many mammalian species. PMID:20384779

  5. A Novel Sinorhizobium meliloti Operon Encodes an α-Glucosidase and a Periplasmic-Binding-Protein-Dependent Transport System for α-Glucosides

    PubMed Central

    Willis, Laura B.; Walker, Graham C.

    1999-01-01

    The most abundant carbon source transported into legume root nodules is photosynthetically produced sucrose, yet the importance of its metabolism by rhizobia in planta is not yet known. To identify genes involved in sucrose uptake and hydrolysis, we screened a Sinorhizobium meliloti genomic library and discovered a segment of S. meliloti DNA which allows Ralstonia eutropha to grow on the α-glucosides sucrose, maltose, and trehalose. Tn5 mutagenesis localized the required genes to a 6.8-kb region containing five open reading frames which were named agl, for α-glucoside utilization. Four of these (aglE, aglF, aglG, and aglK) appear to encode a periplasmic-binding-protein-dependent sugar transport system, and one (aglA) appears to encode an α-glucosidase with homology to family 13 of glycosyl hydrolases. Cosmid-borne agl genes permit uptake of radiolabeled sucrose into R. eutropha cells. Analysis of the properties of agl mutants suggests that S. meliloti possesses at least one additional α-glucosidase as well as a lower-affinity transport system for α-glucosides. It is possible that the Fix+ phenotype of agl mutants on alfalfa is due to these additional functions. Loci found by DNA sequencing to be adjacent to aglEFGAK include a probable regulatory gene (aglR), zwf and edd, which encode the first two enzymes of the Entner-Doudoroff pathway, pgl, which shows homology to a gene encoding a putative phosphogluconolactonase, and a novel Rhizobium-specific repeat element. PMID:10400573

  6. Study on the regulatory mechanism of the lipid metabolism pathways during chicken male germ cell differentiation based on RNA-seq.

    PubMed

    Zuo, Qisheng; Li, Dong; Zhang, Lei; Elsayed, Ahmed Kamel; Lian, Chao; Shi, Qingqing; Zhang, Zhentao; Zhu, Rui; Wang, Yinjie; Jin, Kai; Zhang, Yani; Li, Bichun

    2015-01-01

    Here, we explore the regulatory mechanism of lipid metabolic signaling pathways and related genes during differentiation of male germ cells in chickens, with the hope that better understanding of these pathways may improve in vitro induction. Fluorescence-activated cell sorting was used to obtain highly purified cultures of embryonic stem cells (ESCs), primitive germ cells (PGCs), and spermatogonial stem cells (SSCs). The total RNA was then extracted from each type of cell. High-throughput analysis methods (RNA-seq) were used to sequence the transcriptome of these cells. Gene Ontology (GO) analysis and the KEGG database were used to identify lipid metabolism pathways and related genes. Retinoic acid (RA), the end-product of the retinol metabolism pathway, induced in vitro differentiation of ESC into male germ cells. Quantitative real-time PCR (qRT-PCR) was used to detect changes in the expression of the genes involved in the retinol metabolic pathways. From the results of RNA-seq and the database analyses, we concluded that there are 328 genes in 27 lipid metabolic pathways continuously involved in lipid metabolism during the differentiation of ESC into SSC in vivo, including retinol metabolism. Alcohol dehydrogenase 5 (ADH5) and aldehyde dehydrogenase 1 family member A1 (ALDH1A1) are involved in RA synthesis in the cell. ADH5 was specifically expressed in PGC in our experiments and aldehyde dehydrogenase 1 family member A1 (ALDH1A1) persistently increased throughout development. CYP26b1, a member of the cytochrome P450 superfamily, is involved in the degradation of RA. Expression of CYP26b1, in contrast, decreased throughout development. Exogenous RA in the culture medium induced differentiation of ESC to SSC-like cells. The expression patterns of ADH5, ALDH1A1, and CYP26b1 were consistent with RNA-seq results. We conclude that the retinol metabolism pathway plays an important role in the process of chicken male germ cell differentiation.

  7. Analysis of tomato plasma membrane H(+)-ATPase gene family suggests a mycorrhiza-mediated regulatory mechanism conserved in diverse plant species.

    PubMed

    Liu, Junli; Liu, Jianjian; Chen, Aiqun; Ji, Minjie; Chen, Jiadong; Yang, Xiaofeng; Gu, Mian; Qu, Hongye; Xu, Guohua

    2016-10-01

    In plants, the plasma membrane H(+)-ATPase (HA) is considered to play a crucial role in regulating plant growth and respoding to environment stresses. Multiple paralogous genes encoding different isozymes of HA have been identified and characterized in several model plants, while limited information of the HA gene family is available to date for tomato. Here, we describe the molecular and expression features of eight HA-encoding genes (SlHA1-8) from tomato. All these genes are interrupted by multiple introns with conserved positions. SlHA1, 2, and 4 were widely expressed in all tissues, while SlHA5, 6, and 7 were almost only expressed in flowers. SlHA8, the transcripts of which were barely detectable under normal or nutrient-/salt-stress growth conditions, was strongly activated in arbuscular mycorrhizal (AM) fungal-colonized roots. Extreme lack of SlHA8 expression in M161, a mutant defective to AM fungal colonization, provided genetic evidence towards the dependence of its expression on AM symbiosis. A 1521-bp SlHA8 promoter could direct the GUS reporter expression specifically in colonized cells of transgenic tobacco, soybean, and rice mycorrhizal roots. Promoter deletion assay revealed a 223-bp promoter fragment of SlHA8 containing a variant of AM-specific cis-element MYCS (vMYCS) sufficient to confer the AM-induced activity. Targeted deletion of this motif in the corresponding promoter region causes complete abolishment of GUS staining in mycorrhizal roots. Together, these results lend cogent evidence towards the evolutionary conservation of a potential regulatory mechanism mediating the activation of AM-responsive HA genes in diverse mycorrhizal plant species.

  8. Rab27a negatively regulates CFTR chloride channel function in colonic epithelia: Involvement of the effector proteins in the regulatory mechanism

    SciTech Connect

    Saxena, Sunil K. . E-mail: ssaxena@stevens.edu; Kaur, Simarna

    2006-07-21

    Cystic fibrosis, an autosomal recessive disorder, is caused by the disruption of biosynthesis or function of CFTR. CFTR regulatory mechanisms include channel transport to plasma membrane and protein-protein interactions. Rab proteins are small GTPases involved in vesicle transport, docking, and fusion. The colorectal epithelial HT-29 cells natively express CFTR and respond to cAMP with an increase in CFTR-mediated currents. DPC-inhibited currents could be completely eliminated with CFTR-specific SiRNA. Over-expression of Rab27a inhibited, while isoform specific SiRNA and Rab27a antibody stimulated CFTR-mediated currents in HT-29 cells. CFTR activity is inhibited both by Rab27a (Q78L) (constitutive active GTP-bound form of Rab27a) and Rab27a (T23N) (constitutive negative form that mimics the GDP-bound form). Rab27a mediated effects could be reversed by Rab27a-binding proteins, the synaptotagmin-like protein (SLP-5) and Munc13-4 accessory protein (a putative priming factor for exocytosis). The SLP reversal of Rab27a effect was restricted to C2A/C2B domains while the SHD motif imparted little more inhibition. The CFTR-mediated currents remain unaffected by Rab3 though SLP-5 appears to weakly bind it. The immunoprecipitation experiments suggest protein-protein interactions between Rab27a and CFTR. Rab27a appears to impair CFTR appearance at the cell surface by trapping CFTR in the intracellular compartments. Munc13-4 and SLP-5, on the other hand, limit Rab27a availability to CFTR, thus minimizing its effect on channel function. These observations decisively prove that Rab27a is involved in CFTR channel regulation through protein-protein interactions involving Munc13-4 and SLP-5 effector proteins, and thus could be a potential target for cystic fibrosis therapy.

  9. The Functional and Regulatory Mechanisms of the Thellungiella salsuginea Ascorbate Peroxidase 6 (TsAPX6) in Response to Salinity and Water Deficit Stresses

    PubMed Central

    Li, Zeqin; Zhang, Jilong; Li, Jingxiao; Li, Hongjie; Zhang, Genfa

    2016-01-01

    Soil salinization is a resource and ecological problem in the world. Thellungiella salsuginea is becoming a new model plant because it resembles its relative species, Arabidopsis thaliana, in small genome and short life cycle. It is highly tolerant to salinity and drought stresses. Ascorbate peroxidase (APX) is an enzyme that clears H2O2 in plants. The function and molecular and regulation mechanisms of APX in T. salsuginea have rarely been reported. In this study, an APX gene, TsApx6, was cloned from T. salsuginea and its responses to abiotic stresses in transgenic Arabidopsis were studied. Under high salinity treatment, the expression of TsApx6 was significantly induced. Under drought treatment, overexpression of TsApx6 increased the survival rate and reduced leaf water loss rate in Arabidopsis. Compared to the wild type plants, high salinity treatment reduced the concentrations of MDA, H2O2 and proline but elevated the activities of APX, GPX, CAT and SOD in the TsApx6-overexpressing plants. Meanwhile, germination rate, cotyledon greening, and root length were improved in the transgenic plants compared to the wild type plants under salt and water deficit conditions. Based on these findings, TsApx6 has an important function in the resistance of plants to certain abiotic stresses. The TsApx6 promoter sequence was obtained using Genome Walking technology. Bioinformatics analysis indicated that it contains some cis-acting elements related to stress response. The treatments of salt, dehydration, and ABA induced the expression of Gus gene under the regulation of the TsApx6 promoter. Mutation analysis showed that the MBS motif present in the TsApx6 promoter might be a key negative regulatory element which has an important effect on the growth and developmental process of plants. PMID:27097028

  10. Integrated proteomic and transcriptomic analysis reveals novel genes and regulatory mechanisms involved in salt stress responses in Synechocystis sp. PCC 6803.

    PubMed

    Qiao, Jianjun; Huang, Siqiang; Te, Rigen; Wang, Jiangxin; Chen, Lei; Zhang, Weiwen

    2013-09-01

    Salt stress is a common stress that limits growth and productivity of photosynthetic microbes in natural environments. Although cellular responses of a model cyanobacterium Synechocystis sp. PCC6803 to high and changing salt concentration have been studied, it remains undefined of the gene components and their regulation in the long-term salt acclimation networks. In this study, we performed an integrated study coupling a quantitative iTRAQ-LC-MS/MS proteomics and a next-generation sequencing-based RNA-seq transcriptomics on Synechocystis under salt stress for an extended period of time. Comparative quantification of protein abundances led to the identification of 68 and 108 proteins differentially regulated by salt treatment at 24 and 48 h, respectively. RNA-seq transcriptomic analysis showed that genes involved in energy metabolism and protein synthesis, and genes encoding hypothetical proteins responded to salt stress in a phase-dependent pattern. Notably, a gene encoding CO2-uptake-related protein (CupA) and three genes encoding hypothetical proteins were induced significantly at either transcript or protein level after long-term salt stress. Gene knockout and comparative growth analysis demonstrated that these four genes were involved in salt tolerance in Synechocystis. In addition, a complementary proteome and transcriptome analysis showed that concordance between protein abundances and their corresponding mRNAs varied significantly between various gene-protein pairs, indicating divergent regulation of transcriptional and post-transcriptional processes during salt stress adaptation in Synechocystis. The study provided new insights on genes and regulatory mechanism involved in salt stress response in Synechocystis.

  11. Regulatory mechanism of the light-activable allosteric switch LOV-TAP for the control of DNA binding: a computer simulation study.

    PubMed

    Peter, Emanuel; Dick, Bernhard; Baeurle, Stephan A

    2013-03-01

    The spatio-temporal control of gene expression is fundamental to elucidate cell proliferation and deregulation phenomena in living systems. Novel approaches based on light-sensitive multiprotein complexes have recently been devised, showing promising perspectives for the noninvasive and reversible modulation of the DNA-transcriptional activity in vivo. This has lately been demonstrated in a striking way through the generation of the artificial protein construct light-oxygen-voltage (LOV)-tryptophan-activated protein (TAP), in which the LOV-2-Jα photoswitch of phototropin1 from Avena sativa (AsLOV2-Jα) has been ligated to the tryptophan-repressor (TrpR) protein from Escherichia coli. Although tremendous progress has been achieved on the generation of such protein constructs, a detailed understanding of their functioning as opto-genetical tools is still in its infancy. Here, we elucidate the early stages of the light-induced regulatory mechanism of LOV-TAP at the molecular level, using the noninvasive molecular dynamics simulation technique. More specifically, we find that Cys450-FMN-adduct formation in the AsLOV2-Jα-binding pocket after photoexcitation induces the cleavage of the peripheral Jα-helix from the LOV core, causing a change of its polarity and electrostatic attraction of the photoswitch onto the DNA surface. This goes along with the flexibilization through unfolding of a hairpin-like helix-loop-helix region interlinking the AsLOV2-Jα- and TrpR-domains, ultimately enabling the condensation of LOV-TAP onto the DNA surface. By contrast, in the dark state the AsLOV2-Jα photoswitch remains inactive and exerts a repulsive electrostatic force on the DNA surface. This leads to a distortion of the hairpin region, which finally relieves its tension by causing the disruption of LOV-TAP from the DNA.

  12. The Functional and Regulatory Mechanisms of the Thellungiella salsuginea Ascorbate Peroxidase 6 (TsAPX6) in Response to Salinity and Water Deficit Stresses.

    PubMed

    Li, Zeqin; Zhang, Jilong; Li, Jingxiao; Li, Hongjie; Zhang, Genfa

    2016-01-01

    Soil salinization is a resource and ecological problem in the world. Thellungiella salsuginea is becoming a new model plant because it resembles its relative species, Arabidopsis thaliana, in small genome and short life cycle. It is highly tolerant to salinity and drought stresses. Ascorbate peroxidase (APX) is an enzyme that clears H2O2 in plants. The function and molecular and regulation mechanisms of APX in T. salsuginea have rarely been reported. In this study, an APX gene, TsApx6, was cloned from T. salsuginea and its responses to abiotic stresses in transgenic Arabidopsis were studied. Under high salinity treatment, the expression of TsApx6 was significantly induced. Under drought treatment, overexpression of TsApx6 increased the survival rate and reduced leaf water loss rate in Arabidopsis. Compared to the wild type plants, high salinity treatment reduced the concentrations of MDA, H2O2 and proline but elevated the activities of APX, GPX, CAT and SOD in the TsApx6-overexpressing plants. Meanwhile, germination rate, cotyledon greening, and root length were improved in the transgenic plants compared to the wild type plants under salt and water deficit conditions. Based on these findings, TsApx6 has an important function in the resistance of plants to certain abiotic stresses. The TsApx6 promoter sequence was obtained using Genome Walking technology. Bioinformatics analysis indicated that it contains some cis-acting elements related to stress response. The treatments of salt, dehydration, and ABA induced the expression of Gus gene under the regulation of the TsApx6 promoter. Mutation analysis showed that the MBS motif present in the TsApx6 promoter might be a key negative regulatory element which has an important effect on the growth and developmental process of plants. PMID:27097028

  13. Cytoplasmic polyadenylation element binding protein-dependent protein synthesis is regulated by calcium/calmodulin-dependent protein kinase II.

    PubMed

    Atkins, Coleen M; Nozaki, Naohito; Shigeri, Yasushi; Soderling, Thomas R

    2004-06-01

    Phosphorylation of cytoplasmic polyadenylation element binding protein (CPEB) regulates protein synthesis in hippocampal dendrites. CPEB binds the 3' untranslated region (UTR) of cytoplasmic mRNAs and, when phosphorylated, initiates mRNA polyadenylation and translation. We report that, of the protein kinases activated in the hippocampus during synaptic plasticity, calcium/calmodulin-dependent protein kinase II (CaMKII) robustly phosphorylated the regulatory site (threonine 171) in CPEB in vitro. In postsynaptic density fractions or hippocampal neurons, CPEB phosphorylation increased when CaMKII was activated. These increases in CPEB phosphorylation were attenuated by a specific peptide inhibitor of CaMKII and by the general CaM-kinase inhibitor KN-93. Inhibitors of protein phosphatase 1 increased basal CPEB phosphorylation in neurons; this was also attenuated by a CaM-kinase inhibitor. To determine whether CaM-kinase activity regulates CPEB-dependent mRNA translation, hippocampal neurons were transfected with luciferase fused to a 3' UTR containing CPE-binding elements. Depolarization of neurons stimulated synthesis of luciferase; this was abrogated by inhibitors of protein synthesis, mRNA polyadenylation, and CaMKII. These results demonstrate that CPEB phosphorylation and translation are regulated by CaMKII activity and provide a possible mechanism for how dendritic protein synthesis in the hippocampus may be stimulated during synaptic plasticity.

  14. [On improvement of the mechanism for establishing and changing indicators of quality and food safety in the regulatory and legal acts of the Eurasian Economical Union].

    PubMed

    Arnautov, O V

    2016-01-01

    In accordance with the Treaty on the Eurasian Economic Union (EAEU) to ensure the sanitary and epidemiological welfare of the population within the Union, a coordinated policy in agreed policy in the sphere of application of sanitary measures is carried out. Sanitary measures are the obligatory requirements and procedures, including requirements for the final product, processing methods, production, transportation, storage and disposal, sampling procedures, methods of research (tests), risk assessment, the state registration, requirements for packaging directly aimed at ensuring the safety of products (goods) in order to protect human welfare, and they should be applied on the basis having a scientific explanation, and only to the extent that is necessary to protect human welfare. Sanitary measures applied within the Union should be based on international and regional standards, guidelines and (or) the recommendations, except when they based on appropriate scientific studies and explanations. In this case sanitary measures which could provide a higher level of sanitary protection are introduced. At present, the mechanism of the development, justification and approval of common sanitary and epidemiological requirements (ESR) and procedures of the Eurasian Economic Commission (the Commission) is not installed. The absence of a clear mechanism for the development, approval and implementation of the ESR to the products (goods) on the basis having a scientific explanation on the one hand could lead to the creation of unjustified barriers to foreign and mutual trade, on the other--to weaken the level of safety for human life and health of products (goods) placed on markets of the Union. In order to bring the regulatory legal acts of the Customs Union in accordance with the Treaty on the Eurasian Economic Union the Commission in cooperation with the competent authorities of the Member States in the field of sanitary and epidemiological welfare developed the project of

  15. [On improvement of the mechanism for establishing and changing indicators of quality and food safety in the regulatory and legal acts of the Eurasian Economical Union].

    PubMed

    Arnautov, O V

    2016-01-01

    In accordance with the Treaty on the Eurasian Economic Union (EAEU) to ensure the sanitary and epidemiological welfare of the population within the Union, a coordinated policy in agreed policy in the sphere of application of sanitary measures is carried out. Sanitary measures are the obligatory requirements and procedures, including requirements for the final product, processing methods, production, transportation, storage and disposal, sampling procedures, methods of research (tests), risk assessment, the state registration, requirements for packaging directly aimed at ensuring the safety of products (goods) in order to protect human welfare, and they should be applied on the basis having a scientific explanation, and only to the extent that is necessary to protect human welfare. Sanitary measures applied within the Union should be based on international and regional standards, guidelines and (or) the recommendations, except when they based on appropriate scientific studies and explanations. In this case sanitary measures which could provide a higher level of sanitary protection are introduced. At present, the mechanism of the development, justification and approval of common sanitary and epidemiological requirements (ESR) and procedures of the Eurasian Economic Commission (the Commission) is not installed. The absence of a clear mechanism for the development, approval and implementation of the ESR to the products (goods) on the basis having a scientific explanation on the one hand could lead to the creation of unjustified barriers to foreign and mutual trade, on the other--to weaken the level of safety for human life and health of products (goods) placed on markets of the Union. In order to bring the regulatory legal acts of the Customs Union in accordance with the Treaty on the Eurasian Economic Union the Commission in cooperation with the competent authorities of the Member States in the field of sanitary and epidemiological welfare developed the project of

  16. Protein dependent fate of hepatic cells under nicotine induced stress and curcumin ameliorated condition.

    PubMed

    Banerjee, Satyam; Chattopadhyay, Krishna; Chhabra, Jasmeet Kaur; Chattopadhyay, Brajadulal

    2012-06-01

    Nicotine is mainly metabolized in liver. Its abuse elicits acute phase response by activating macrophages to produce pro-inflammatory cytokines, which play critical role in apoptosis or cell proliferation. The protective pharmacological mechanism of curcumin against nicotine-induced toxicity on protein malnourished liver is still remaining unclear. This study investigated the ameliorative mechanism of curcumin against nicotine-induced toxicity and also fate of liver particularly under protein restricted condition. Female Albino-rats maintained under normal/protein-restricted diets, were subcutaneously injected with nicotine tartrate (2.5 mg/kg body weight/day) and orally supplemented with curcumin (80 mg/kg body weight/day) for 21 days. The animals were then sacrificed to dissect out liver and proceed with further experiments. Interactions of nicotine with DNA both in vivo and in vitro were observed by thermal denaturation and DNA laddering assays. Effects of nicotine on hepatic cells were monitored by differential staining, comet assay, cytokine profiling, mRNA and protein expression. Nicotine caused more intense DNA damage, promoted hepatic cell death through up-regulating pro-apoptotic proteins and signaling molecules in protein malnourished individuals. Through up-regulation of anti-apoptotic proteins and proliferation promoting molecules, nicotine dysregulated homeostasis in normal protein condition. Curcumin significantly ameliorated the nicotine-induced toxicity in both conditions and regulated the imbalance between cell survival and death induced by nicotine. The protein content present in the nicotine induced hepatic cell decides either cell-survival pathway or cytotoxic pathway. PMID:22381069

  17. Differential competence of redox-regulatory mechanism under extremes of temperature determines growth performances and cross tolerance in two indica rice cultivars.

    PubMed

    Chakraborty, Ananya; Bhattacharjee, Soumen

    2015-03-15

    The present study investigated the relationship between reactive oxygen species (ROS) accumulation (total and individual), antioxidant and radical scavenging capacity (total and individual), transcript abundance of some antioxidative genes and oxidative damages to membrane protein and lipid in germinating tissues of a salt resistant (SR26B) and salt sensitive (Ratna) rice cultivars under extremes of temperature to elucidate redox-regulatory mechanism governing differential oxidative stress tolerance associated with better growth and yield potential and identification of cross tolerance, if any. Imbibitional heat and chilling stress caused disruption of redox-homeostasis and oxidative damage to a newly assembled membrane system by increasing pro-oxidant/antioxidant ratio and by aggravating membrane lipid peroxidation and protein oxidation [measured in terms of accumulation of thiobarbituric acid reactive substances (TBARS), free carbonyl content (CO groups), and membrane protein thiol level (MPTL)]. A concomitant increase in accumulation of individual ROS (superoxide and hydrogen peroxide) and significant reduction of radical scavenging activity (assessed in terms of ABTS, FRAP and DPPH methods), non-enzymatic and enzymatic anti-oxidative defense [assessed in terms of total thiol content and activities of superoxide dismutase (EC 1.15.1.1), catalase (EC 1.11.1.6), ascorbate peroxidase (EC 1.11.1.11), and glutathione reductase (EC 1.6.4.2)] are also noticed in both the salt sensitive (Ratna) and resistant (SR26B) germinating tissues of rice cultivars. When compared, salt resistant cultivar SR26B was found to suffer significantly less redox-imbalance and related oxidative damages to membrane protein and lipid as compared to salt sensitive cultivar Ratna. The salt tolerant cultivar SR26B resisted imbibitional chilling and heat stress due to its early preparedness to combat oxidative stress by up-regulation of gene expression of anti-oxidative enzymes and better

  18. Regulatory Mechanisms Underlying Oil Palm Fruit Mesocarp Maturation, Ripening, and Functional Specialization in Lipid and Carotenoid Metabolism1[W][OA

    PubMed Central

    Tranbarger, Timothy J.; Dussert, Stéphane; Joët, Thierry; Argout, Xavier; Summo, Marilyne; Champion, Antony; Cros, David; Omore, Alphonse; Nouy, Bruno; Morcillo, Fabienne

    2011-01-01

    Fruit provide essential nutrients and vitamins for the human diet. Not only is the lipid-rich fleshy mesocarp tissue of the oil palm (Elaeis guineensis) fruit the main source of edible oil for the world, but it is also the richest dietary source of provitamin A. This study examines the transcriptional basis of these two outstanding metabolic characters in the oil palm mesocarp. Morphological, cellular, biochemical, and hormonal features defined key phases of mesocarp development. A 454 pyrosequencing-derived transcriptome was then assembled for the developmental phases preceding and during maturation and ripening, when high rates of lipid and carotenoid biosynthesis occur. A total of 2,629 contigs with differential representation revealed coordination of metabolic and regulatory components. Further analysis focused on the fatty acid and triacylglycerol assembly pathways and during carotenogenesis. Notably, a contig similar to the Arabidopsis (Arabidopsis thaliana) seed oil transcription factor WRINKLED1 was identified with a transcript profile coordinated with those of several fatty acid biosynthetic genes and the high rates of lipid accumulation, suggesting some common regulatory features between seeds and fruits. We also focused on transcriptional regulatory networks of the fruit, in particular those related to ethylene transcriptional and GLOBOSA/PISTILLATA-like proteins in the mesocarp and a central role for ethylene-coordinated transcriptional regulation of type VII ethylene response factors during ripening. Our results suggest that divergence has occurred in the regulatory components in this monocot fruit compared with those identified in the dicot tomato (Solanum lycopersicum) fleshy fruit model. PMID:21487046

  19. Regulatory Anatomy

    PubMed Central

    2015-01-01

    This article proposes the term “safety logics” to understand attempts within the European Union (EU) to harmonize member state legislation to ensure a safe and stable supply of human biological material for transplants and transfusions. With safety logics, I refer to assemblages of discourses, legal documents, technological devices, organizational structures, and work practices aimed at minimizing risk. I use this term to reorient the analytical attention with respect to safety regulation. Instead of evaluating whether safety is achieved, the point is to explore the types of “safety” produced through these logics as well as to consider the sometimes unintended consequences of such safety work. In fact, the EU rules have been giving rise to complaints from practitioners finding the directives problematic and inadequate. In this article, I explore the problems practitioners face and why they arise. In short, I expose the regulatory anatomy of the policy landscape. PMID:26139952

  20. Regulatory Physiology

    NASA Technical Reports Server (NTRS)

    Lane, Helen W.; Whitson, Peggy A.; Putcha, Lakshmi; Baker, Ellen; Smith, Scott M.; Stewart, Karen; Gretebeck, Randall; Nimmagudda, R. R.; Schoeller, Dale A.; Davis-Street, Janis

    1999-01-01

    As noted elsewhere in this report, a central goal of the Extended Duration Orbiter Medical Project (EDOMP) was to ensure that cardiovascular and muscle function were adequate to perform an emergency egress after 16 days of spaceflight. The goals of the Regulatory Physiology component of the EDOMP were to identify and subsequently ameliorate those biochemical and nutritional factors that deplete physiological reserves or increase risk for disease, and to facilitate the development of effective muscle, exercise, and cardiovascular countermeasures. The component investigations designed to meet these goals focused on biochemical and physiological aspects of nutrition and metabolism, the risk of renal (kidney) stone formation, gastrointestinal function, and sleep in space. Investigations involved both ground-based protocols to validate proposed methods and flight studies to test those methods. Two hardware tests were also completed.

  1. Binding-protein-dependent alanine transport in Rhodobacter sphaeroides is regulated by the internal pH.

    PubMed

    Abee, T; van der Wal, F J; Hellingwerf, K J; Konings, W N

    1989-09-01

    The properties of an L-alanine uptake system in Rhodobacter sphaeroides were studied and compared with those of H+/lactose symport in R. sphaeroides 4P1, a strain in which the lactose carrier of Escherichia coli has been cloned and functionally expressed (F. E. Nano, Ph.D. thesis, University of Illinois, Urbana, 1984). Previous studies indicated that both transport systems were active only when electron transfer took place in the respiratory or cyclic electron transfer chain, while uptake of L-alanine also required the presence of K+ (M. G. L. Elferink, Ph.D. thesis, University of Groningen, Groningen, The Netherlands, 1986). The results presented in this paper offer an explanation for these findings. Transport of the nonmetabolizable L-alanine analog 2-alpha-aminoisobutyric acid (AIB) is mediated by a shock-sensitive transport system. The apparently unidirectional uptake of AIB results in accumulation levels which exceed 7 x 10(3). The finding of L-alanine-binding activity in the concentrated crude shock fluid indicates that L-alanine is taken up by a binding-protein-dependent transport system. Transport of the nonmetabolizable lactose analog methyl-beta-D-thiogalactopyranoside (TMG) by the lactose carrier under anaerobic conditions in the dark was observed in cells and membrane vesicles. This indicates that the H+/lactose symport system is active without electron transfer. Uptake of AIB, but not that of TMG, is inhibited by vanadate with a 50% inhibitory concentration of 50 microM, which suggests a role of a phosphorylated intermediate in AIB transport. Uptake of TMG and AIB is regulated by the internal pH. The initial rates of uptake increased with the internal pH, and and pKa values of 7.2 for TMG and 7.8 for AIB. At an internal pH of 7, no AIB uptake occurred, and the rate of TMG uptake was only 30% of the rate at an internal pH of 8. In a previous study, we found that K+ plays an essential role in regulating the internal pH (T. Abee, K. J. Hellingwerf, and W

  2. Regulatory Snapshots: integrative mining of regulatory modules from expression time series and regulatory networks.

    PubMed

    Gonçalves, Joana P; Aires, Ricardo S; Francisco, Alexandre P; Madeira, Sara C

    2012-01-01

    Explaining regulatory mechanisms is crucial to understand complex cellular responses leading to system perturbations. Some strategies reverse engineer regulatory interactions from experimental data, while others identify functional regulatory units (modules) under the assumption that biological systems yield a modular organization. Most modular studies focus on network structure and static properties, ignoring that gene regulation is largely driven by stimulus-response behavior. Expression time series are key to gain insight into dynamics, but have been insufficiently explored by current methods, which often (1) apply generic algorithms unsuited for expression analysis over time, due to inability to maintain the chronology of events or incorporate time dependency; (2) ignore local patterns, abundant in most interesting cases of transcriptional activity; (3) neglect physical binding or lack automatic association of regulators, focusing mainly on expression patterns; or (4) limit the discovery to a predefined number of modules. We propose Regulatory Snapshots, an integrative mining approach to identify regulatory modules over time by combining transcriptional control with response, while overcoming the above challenges. Temporal biclustering is first used to reveal transcriptional modules composed of genes showing coherent expression profiles over time. Personalized ranking is then applied to prioritize prominent regulators targeting the modules at each time point using a network of documented regulatory associations and the expression data. Custom graphics are finally depicted to expose the regulatory activity in a module at consecutive time points (snapshots). Regulatory Snapshots successfully unraveled modules underlying yeast response to heat shock and human epithelial-to-mesenchymal transition, based on regulations documented in the YEASTRACT and JASPAR databases, respectively, and available expression data. Regulatory players involved in functionally enriched

  3. Identification of specific ligands for orphan olfactory receptors. G protein-dependent agonism and antagonism of odorants.

    PubMed

    Shirokova, Elena; Schmiedeberg, Kristin; Bedner, Peter; Niessen, Heiner; Willecke, Klaus; Raguse, Jan-Dirk; Meyerhof, Wolfgang; Krautwurst, Dietmar

    2005-03-25

    Olfactory receptors are the largest group of orphan G protein-coupled receptors with an infinitely small number of agonists identified out of thousands of odorants. The de-orphaning of olfactory receptor (OR) is complicated by its combinatorial odorant coding and thus requires large scale odorant and receptor screening and establishing receptor-specific odorant profiles. Here, we report on the stable reconstitution of OR-specific signaling in HeLa/Olf cells via G protein alphaolf and adenylyl cyclase type-III to the Ca2+ influx-mediating olfactory cyclic nucleotide-gated CNGA2 channel. We demonstrate the central role of Galphaolf in odorant-specific signaling out of OR. The employment of the non-typical G protein alpha15 dramatically altered the odorant specificities of 3 of 7 receptors that had been characterized previously by different groups. We further show for two OR that an odorant may be an agonist or antagonist, depending on the G protein used. HeLa/Olf cells proved suitable for high-throughput screening in fluorescence-imaging plate reader experiments, resulting in the de-orphaning of two new OR for the odorant (-)citronellal from an expression library of 93 receptors. To demonstrate the G protein dependence of its odorant response pattern, we screened the most sensitive (-)citronellal receptor Olfr43 versus 94 odorants simultaneously in the presence of Galpha15 or Galphaolf. We finally established an EC50-ranking odorant profile for Olfr43 in HeLa/Olf cells. In summary, we conclude that, in heterologous systems, odorants may function as agonists or antagonists, depending on the G protein used. HeLa/Olf cells provide an olfactory model system for functional expression and de-orphaning of OR.

  4. Agrobacterium radiobacter and related organisms take up fructose via a binding-protein-dependent active-transport system.

    PubMed

    Williams, S G; Greenwood, J A; Jones, C W

    1995-10-01

    Washed cells of Agrobacterium radiobacter prepared from a fructose-limited continuous culture (D 0.045 h-1) transported D(-)[U-14C]fructose in a linear manner for up to 4 min at a rate several-fold higher than the rate of fructose utilization by the growing culture. D(-)[U-14C]Fructose transport exhibited a high affinity for fructose (KT < 1 microM) and was inhibited to varying extents by osmotic shock, by the uncoupling agent carbonyl cyanide p-trifluoromethoxyphenylhydrazone, and by unlabelled sugars (D-fructose/D-mannose > D-ribose > D-sorbose > D-glucose/D-galactose/D-xylose; no inhibition by D-arabinose). Prolonged growth of A. radiobacter in fructose-limited continuous culture led to the selection of a novel strain (AR100) which overproduced a fructose-binding protein (FBP) and showed an increased rate of fructose transport. FBP was purified from osmotic-shock fluid using anion-exchange fast protein liquid chromatography (FPLC). The monomeric protein (M(r) 34,200 by SDS-PAGE and 37,700 by gel-filtration FPLC) bound D-[U-14C]-fructose stoichiometrically (1.17 nmol nmol FBP-1) and with high affinity (KD 0.49 microM) as shown by equilibrium dialysis. Binding of D-[U-14C]fructose by FBP was variably inhibited by unlabelled sugars (D-fructose/D-mannose > D-ribose > D-sorbose; no inhibition by D-glucose, D-galactose or D-arabinose). The N-terminal amino acid sequence of FBP (ADTSVCLI-) was similar to that of several sugar-binding proteins from other species of bacteria. Fructose transport and FBP were variably induced in batch cultures of A. radiobacter by growth on different carbon sources (D-fructose > D-ribose/D-mannose > D-glucose; no induction by succinate). An immunologically similar protein to FBP was produced by Agrobacterium tumefaciens and various species of Rhizobium following growth on fructose. It is concluded that fructose is transported into A. radiobacter and related organisms via a periplasmic fructose/mannose-binding-protein-dependent active

  5. Silymarin suppresses the PGE2 -induced cell migration through inhibition of EP2 activation; G protein-dependent PKA-CREB and G protein-independent Src-STAT3 signal pathways.

    PubMed

    Woo, Seon Min; Min, Kyoung-Jin; Chae, In Gyeong; Chun, Kyung-Soo; Kwon, Taeg Kyu

    2015-03-01

    Silymarin has been known as a chemopreventive agent, and possesses multiple anti-cancer activities including induction of apoptosis, inhibition of proliferation and growth, and blockade of migration and invasion. However, whether silymarin could inhibit prostaglandin (PG) E2 -induced renal cell carcinoma (RCC) migration and what are the underlying mechanisms are not well elucidated. Here, we found that silymarin markedly inhibited PGE2 -stimulated migration. PGE2 induced G protein-dependent CREB phosphorylation via protein kinase A (PKA) signaling, and PKA inhibitor (H89) inhibited PGE2 -mediated migration. Silymarin reduced PGE2 -induced CREB phosphorylation and CRE-promoter activity. PGE2 also activated G protien-independent signaling pathways (Src and STAT3) and silymarin reduced PGE2 -induced phosphorylation of Src and STAT3. Inhibitor of Src (Saracatinib) markedly reduced PGE2 -mediated migration. We found that EP2, a PGE2 receptor, is involved in PGE2 -mediated cell migration. Down regulation of EP2 by EP2 siRNA and EP2 antagonist (AH6809) reduced PGE2 -inudced migration. In contrast, EP2 agonist (Butaprost) increased cell migration and silymarin effectively reduced butaprost-mediated cell migration. Moreover, PGE2 increased EP2 expression through activation of positive feedback mechanism, and PGE2 -induced EP2 expression, as well as basal EP2 levels, were reduced in silymarin-treated cells. Taken together, our study demonstrates that silymarin inhibited PGE2 -induced cell migration through inhibition of EP2 signaling pathways (G protein dependent PKA-CREB and G protein-independent Src-STAT3).

  6. Fine-mapping analysis revealed complex pleiotropic effect and tissue-specific regulatory mechanism of TNFSF15 in primary biliary cholangitis, Crohn's disease and leprosy.

    PubMed

    Sun, Yonghu; Irwanto, Astrid; Toyo-Oka, Licht; Hong, Myunghee; Liu, Hong; Andiappan, Anand Kumar; Choi, Hyunchul; Hitomi, Yuki; Yu, Gongqi; Yu, Yongxiang; Bao, Fangfang; Wang, Chuan; Fu, Xian; Yue, Zhenhua; Wang, Honglei; Zhang, Huimin; Kawashima, Minae; Kojima, Kaname; Nagasaki, Masao; Nakamura, Minoru; Yang, Suk-Kyun; Ye, Byong Duk; Denise, Yosua; Rotzschke, Olaf; Song, Kyuyoung; Tokunaga, Katsushi; Zhang, Furen; Liu, Jianjun

    2016-01-01

    Genetic polymorphism within the 9q32 locus is linked with increased risk of several diseases, including Crohn's disease (CD), primary biliary cholangitis (PBC) and leprosy. The most likely disease-causing gene within 9q32 is TNFSF15, which encodes the pro-inflammatory cytokine TNF super-family member 15, but it was unknown whether these disparate diseases were associated with the same genetic variance in 9q32, and how variance within this locus might contribute to pathology. Using genetic data from published studies on CD, PBC and leprosy we revealed that bearing a T allele at rs6478108/rs6478109 (r(2) = 1) or rs4979462 was significantly associated with increased risk of CD and decreased risk of leprosy, while the T allele at rs4979462 was associated with significantly increased risk of PBC. In vitro analyses showed that the rs6478109 genotype significantly affected TNFSF15 expression in cells from whole blood of controls, while functional annotation using publicly-available data revealed the broad cell type/tissue-specific regulatory potential of variance at rs6478109 or rs4979462. In summary, we provide evidence that variance within TNFSF15 has the potential to affect cytokine expression across a range of tissues and thereby contribute to protection from infectious diseases such as leprosy, while increasing the risk of immune-mediated diseases including CD and PBC. PMID:27507062

  7. Tissue- and stage-specific modulation of RNA editing of the psbF and psbL transcript from spinach plastids--a new regulatory mechanism?

    PubMed

    Bock, R; Hagemann, R; Kössel, H; Kudla, J

    1993-08-01

    The psbE operon of spinach chloroplasts, which includes the genes psbE, psbF, psbL and psbJ, encodes two RNA editing sites. One site corresponds to the initiation codon of the psbL transcript, as has been described earlier for the homologous transcript from tobacco, while at a second editing site, newly reported here, an internal phenylalanine codon of the psbF transcript is restored. Both these sites were investigated with respect to the extent of editing in spinach plastids at various developmental stages. The apparent existence of only completely edited transcripts in etioplasts and chloroplasts, indicates that light-induced processes are not acting as determinants in eliciting the editing process. Reduced editing is, however, observed in the psbF and psbL transcript from seeds and roots. This finding suggests that the RNA editing process is differentially down-regulated in leucoplasts and proplastids and that editing may, therefore, function as a regulatory device in plastid gene expression. PMID:8355656

  8. Fine-mapping analysis revealed complex pleiotropic effect and tissue-specific regulatory mechanism of TNFSF15 in primary biliary cholangitis, Crohn’s disease and leprosy

    PubMed Central

    Sun, Yonghu; Irwanto, Astrid; Toyo-oka, Licht; Hong, Myunghee; Liu, Hong; Andiappan, Anand Kumar; Choi, Hyunchul; Hitomi, Yuki; Yu, Gongqi; Yu, Yongxiang; Bao, Fangfang; Wang, Chuan; Fu, Xian; Yue, Zhenhua; Wang, Honglei; Zhang, Huimin; Kawashima, Minae; Kojima, Kaname; Nagasaki, Masao; Nakamura, Minoru; Yang, Suk-Kyun; Ye, Byong Duk; Denise, Yosua; Rotzschke, Olaf; Song, Kyuyoung; Tokunaga, Katsushi; Zhang, Furen; Liu, Jianjun

    2016-01-01

    Genetic polymorphism within the 9q32 locus is linked with increased risk of several diseases, including Crohn’s disease (CD), primary biliary cholangitis (PBC) and leprosy. The most likely disease-causing gene within 9q32 is TNFSF15, which encodes the pro-inflammatory cytokine TNF super-family member 15, but it was unknown whether these disparate diseases were associated with the same genetic variance in 9q32, and how variance within this locus might contribute to pathology. Using genetic data from published studies on CD, PBC and leprosy we revealed that bearing a T allele at rs6478108/rs6478109 (r2 = 1) or rs4979462 was significantly associated with increased risk of CD and decreased risk of leprosy, while the T allele at rs4979462 was associated with significantly increased risk of PBC. In vitro analyses showed that the rs6478109 genotype significantly affected TNFSF15 expression in cells from whole blood of controls, while functional annotation using publicly-available data revealed the broad cell type/tissue-specific regulatory potential of variance at rs6478109 or rs4979462. In summary, we provide evidence that variance within TNFSF15 has the potential to affect cytokine expression across a range of tissues and thereby contribute to protection from infectious diseases such as leprosy, while increasing the risk of immune-mediated diseases including CD and PBC. PMID:27507062

  9. Mechanisms of action of hormone-sensitive lipase in mouse Leydig cells: its role in the regulation of the steroidogenic acute regulatory protein.

    PubMed

    Manna, Pulak R; Cohen-Tannoudji, Joëlle; Counis, Raymond; Garner, Charles W; Huhtaniemi, Ilpo; Kraemer, Fredric B; Stocco, Douglas M

    2013-03-22

    Hormone-sensitive lipase (HSL) catalyzes the hydrolysis of cholesteryl esters in steroidogenic tissues and, thus, facilitates cholesterol availability for steroidogenesis. The steroidogenic acute regulatory protein (StAR) controls the rate-limiting step in steroid biosynthesis. However, the modes of action of HSL in the regulation of StAR expression remain obscure. We demonstrate in MA-10 mouse Leydig cells that activation of the protein kinase A (PKA) pathway, by a cAMP analog Bt2cAMP, enhanced expression of HSL and its phosphorylation (P) at Ser-660 and Ser-563, but not at Ser-565, concomitant with increased HSL activity. Phosphorylation and activation of HSL coincided with increases in StAR, P-StAR (Ser-194), and progesterone levels. Inhibition of HSL activity by CAY10499 effectively suppressed Bt2cAMP-induced StAR expression and progesterone synthesis. Targeted silencing of endogenous HSL, with siRNAs, resulted in increased cholesteryl ester levels and decreased cholesterol content in MA-10 cells. Depletion of HSL affected lipoprotein-derived cellular cholesterol influx, diminished the supply of cholesterol to the mitochondria, and resulted in the repression of StAR and P-StAR levels. Cells overexpressing HSL increased the efficacy of liver X receptor (LXR) ligands on StAR expression and steroid synthesis, suggesting HSL-mediated steroidogenesis entails enhanced oxysterol production. Conversely, cells deficient in LXRs exhibited decreased HSL responsiveness. Furthermore, an increase in HSL was correlated with the LXR target genes, steroid receptor element-binding protein 1c and ATP binding cassette transporter A1, demonstrating HSL-dependent regulation of steroidogenesis predominantly involves LXR signaling. LXRs interact/cooperate with RXRs and result in the activation of StAR gene transcription. These findings provide novel insight and demonstrate the molecular events by which HSL acts to drive cAMP/PKA-mediated regulation of StAR expression and

  10. Regulatory physiology discipline science plan

    NASA Technical Reports Server (NTRS)

    1991-01-01

    The focus of the Regulatory Physiology discipline of the Space Physiology and Countermeasures Program is twofold. First, to determine and study how microgravity and associated factors of space flight affect the regulatory mechanisms by which humans adapt and achieve homeostasis and thereby regulate their ability to respond to internal and external signals; and, second, to study selected physiological systems that have been demonstrated to be influenced by gravity. The Regulatory Physiology discipline, as defined here, is composed of seven subdisciplines: (1) Circadian Rhythms, (2) Endocrinology, (3) Fluid and Electrolyte Regulation, (4) Hematology, (5) Immunology, (6) Metabolism and Nutrition, and (7) Temperature Regulation. The purpose of this Discipline Science Plan is to provide a conceptual strategy for NASA's Life Sciences Division research and development activities in the area of regulatory physiology. It covers the research areas critical to NASA's programmatic requirements for the Extended-Duration Orbiter, Space Station Freedom, and exploration mission science activities. These science activities include ground-based and flight; basic, applied, and operational; and animal and human research and development. This document summarizes the current status of the program, outlines available knowledge, establishes goals and objectives, identifies science priorities, and defines critical questions in regulatory physiology. It contains a general plan that will be used by both NASA Headquarters Program Offices and the field centers to review and plan basic, applied, and operational intramural and extramural research and development activities in this area.

  11. Potential Nociceptive Regulatory Effect of Probiotic Lactobacillus rhamnosus PB01 (DSM 14870) on Mechanical Sensitivity in Diet-Induced Obesity Model.

    PubMed

    Dardmeh, Fereshteh; Nielsen, Hans Ingolf; Alipour, Hiva; Kjærgaard, Benedict; Brandsborg, Erik; Gazerani, Parisa

    2016-01-01

    Treatments for obesity have been shown to reduce pain secondary to weight loss. Intestinal microbiota, as an endogenous factor, influences obesity and pain sensitivity but the effect of oral probiotic supplementation on musculoskeletal pain perception has not been studied systematically. The present study examined the effect of a single daily oral dose (1 × 10(9) CFU) of probiotics (Lactobacillus rhamnosus PB01, DSM14870) supplement on mechanical pain thresholds in behaving diet-induced obese (DIO) mice and their normal weight (NW) controls. The mice (N = 24, 6-week-old male) were randomly divided into four groups on either standard or high fat diet with and without probiotic supplementation. Both DIO and NW groups with probiotic supplementation maintained an insignificant weight gain while the control groups gained significant weight (P < 0.05). Similarly, both DIO and NW probiotics supplemented groups demonstrated a significantly (P < 0.05) lower sensitivity to mechanical stimulation compared to their corresponding control. The results of this study suggest a protective effect of probiotics on nociception circuits, which propose a direct result of the weight reduction or an indirect result of anti-inflammatory properties of the probiotics. Deciphering the exact underlying mechanism of the weight loss and lowering nociception effect of the probiotic applied in this study require further investigation. PMID:27647980

  12. Potential Nociceptive Regulatory Effect of Probiotic Lactobacillus rhamnosus PB01 (DSM 14870) on Mechanical Sensitivity in Diet-Induced Obesity Model

    PubMed Central

    Brandsborg, Erik

    2016-01-01

    Treatments for obesity have been shown to reduce pain secondary to weight loss. Intestinal microbiota, as an endogenous factor, influences obesity and pain sensitivity but the effect of oral probiotic supplementation on musculoskeletal pain perception has not been studied systematically. The present study examined the effect of a single daily oral dose (1 × 109 CFU) of probiotics (Lactobacillus rhamnosus PB01, DSM14870) supplement on mechanical pain thresholds in behaving diet-induced obese (DIO) mice and their normal weight (NW) controls. The mice (N = 24, 6-week-old male) were randomly divided into four groups on either standard or high fat diet with and without probiotic supplementation. Both DIO and NW groups with probiotic supplementation maintained an insignificant weight gain while the control groups gained significant weight (P < 0.05). Similarly, both DIO and NW probiotics supplemented groups demonstrated a significantly (P < 0.05) lower sensitivity to mechanical stimulation compared to their corresponding control. The results of this study suggest a protective effect of probiotics on nociception circuits, which propose a direct result of the weight reduction or an indirect result of anti-inflammatory properties of the probiotics. Deciphering the exact underlying mechanism of the weight loss and lowering nociception effect of the probiotic applied in this study require further investigation. PMID:27647980

  13. Potential Nociceptive Regulatory Effect of Probiotic Lactobacillus rhamnosus PB01 (DSM 14870) on Mechanical Sensitivity in Diet-Induced Obesity Model

    PubMed Central

    Brandsborg, Erik

    2016-01-01

    Treatments for obesity have been shown to reduce pain secondary to weight loss. Intestinal microbiota, as an endogenous factor, influences obesity and pain sensitivity but the effect of oral probiotic supplementation on musculoskeletal pain perception has not been studied systematically. The present study examined the effect of a single daily oral dose (1 × 109 CFU) of probiotics (Lactobacillus rhamnosus PB01, DSM14870) supplement on mechanical pain thresholds in behaving diet-induced obese (DIO) mice and their normal weight (NW) controls. The mice (N = 24, 6-week-old male) were randomly divided into four groups on either standard or high fat diet with and without probiotic supplementation. Both DIO and NW groups with probiotic supplementation maintained an insignificant weight gain while the control groups gained significant weight (P < 0.05). Similarly, both DIO and NW probiotics supplemented groups demonstrated a significantly (P < 0.05) lower sensitivity to mechanical stimulation compared to their corresponding control. The results of this study suggest a protective effect of probiotics on nociception circuits, which propose a direct result of the weight reduction or an indirect result of anti-inflammatory properties of the probiotics. Deciphering the exact underlying mechanism of the weight loss and lowering nociception effect of the probiotic applied in this study require further investigation.

  14. A fundamental regulatory mechanism operating through OmpR and DNA topology controls expression of Salmonella pathogenicity islands SPI-1 and SPI-2.

    PubMed

    Cameron, Andrew D S; Dorman, Charles J

    2012-01-01

    DNA topology has fundamental control over the ability of transcription factors to access their target DNA sites at gene promoters. However, the influence of DNA topology on protein-DNA and protein-protein interactions is poorly understood. For example, relaxation of DNA supercoiling strongly induces the well-studied pathogenicity gene ssrA (also called spiR) in Salmonella enterica, but neither the mechanism nor the proteins involved are known. We have found that relaxation of DNA supercoiling induces expression of the Salmonella pathogenicity island (SPI)-2 regulator ssrA as well as the SPI-1 regulator hilC through a mechanism that requires the two-component regulator OmpR-EnvZ. Additionally, the ompR promoter is autoregulated in the same fashion. Conversely, the SPI-1 regulator hilD is induced by DNA relaxation but is repressed by OmpR. Relaxation of DNA supercoiling caused an increase in OmpR binding to DNA and a concomitant decrease in binding by the nucleoid-associated protein FIS. The reciprocal occupancy of DNA by OmpR and FIS was not due to antagonism between these transcription factors, but was instead a more intrinsic response to altered DNA topology. Surprisingly, DNA relaxation had no detectable effect on the binding of the global repressor H-NS. These results reveal the underlying molecular mechanism that primes SPI genes for rapid induction at the onset of host invasion. Additionally, our results reveal novel features of the archetypal two-component regulator OmpR. OmpR binding to relaxed DNA appears to generate a locally supercoiled state, which may assist promoter activation by relocating supercoiling stress-induced destabilization of DNA strands. Much has been made of the mechanisms that have evolved to regulate horizontally-acquired genes such as SPIs, but parallels among the ssrA, hilC, and ompR promoters illustrate that a fundamental form of regulation based on DNA topology coordinates the expression of these genes regardless of their origins.

  15. Deep Sequencing-Based Transcriptome Analysis Reveals the Regulatory Mechanism of Bemisia tabaci (Hemiptera: Aleyrodidae) Nymph Parasitized by Encarsia sophia (Hymenoptera: Aphelinidae)

    PubMed Central

    Wang, Ran; Li, Fei; Zhang, Fan; Wang, Su

    2016-01-01

    The whitefly Bemisia tabaci is a genetically diverse complex with multiple cryptic species, and some are the most destructive invasive pests of many ornamentals and crops worldwide. Encarsia sophia is an autoparasitoid wasp that demonstrated high efficiency as bio-control agent of whiteflies. However, the immune mechanism of B. tabaci parasitization by E. sophia is unknown. In order to investigate immune response of B. tabaci to E. Sophia parasitization, the transcriptome of E. sophia parasitized B. tabaci nymph was sequenced by Illumina sequencing. De novo assembly generated 393,063 unigenes with average length of 616 bp, in which 46,406 unigenes (15.8% of all unigenes) were successfully mapped. Parasitization by E. sophia had significant effects on the transcriptome profile of B. tabaci nymph. A total of 1482 genes were significantly differentially expressed, of which 852 genes were up-regulated and 630 genes were down-regulated. These genes were mainly involved in immune response, development, metabolism and host signaling pathways. At least 52 genes were found to be involved in the host immune response, 33 genes were involved in the development process, and 29 genes were involved in host metabolism. Taken together, the assembled and annotated transcriptome sequences provided a valuable genomic resource for further understanding the molecular mechanism of immune response of B. tabaci parasitization by E. sophia. PMID:27332546

  16. Genome-Wide Mapping of Targets of Maize Histone Deacetylase HDA101 Reveals Its Function and Regulatory Mechanism during Seed Development[OPEN

    PubMed Central

    Yang, Hua; Liu, Xinye; Xin, Mingming; Du, Jinkun; Hu, Zhaorong; Peng, HuiRu; Sun, Qixin; Ni, Zhongfu; Yao, Yingyin

    2016-01-01

    Histone deacetylases (HDACs) regulate histone acetylation levels by removing the acetyl group from lysine residues. The maize (Zea mays) HDAC HDA101 influences several aspects of development, including kernel size; however, the molecular mechanism by which HDA101 affects kernel development remains unknown. In this study, we find that HDA101 regulates the expression of transfer cell-specific genes, suggesting that their misregulation may be associated with the defects in differentiation of endosperm transfer cells and smaller kernels observed in hda101 mutants. To investigate HDA101 function during the early stages of seed development, we performed genome-wide mapping of HDA101 binding sites. We observed that, like mammalian HDACs, HDA101 mainly targets highly and intermediately expressed genes. Although loss of HDA101 can induce histone hyperacetylation of its direct targets, this often does not involve variation in transcript levels. A small subset of inactive genes that must be negatively regulated during kernel development is also targeted by HDA101 and its loss leads to hyperacetylation and increased expression of these inactive genes. Finally, we report that HDA101 interacts with members of different chromatin remodeling complexes, such as NFC103/MSI1 and SNL1/SIN3-like protein corepressors. Taken together, our results reveal a complex genetic network regulated by HDA101 during seed development and provide insight into the different mechanisms of HDA101-mediated regulation of transcriptionally active and inactive genes. PMID:26908760

  17. A Negative Regulatory Mechanism Involving 14-3-3ζ Limits Signaling Downstream of ROCK to Regulate Tissue Stiffness in Epidermal Homeostasis.

    PubMed

    Kular, Jasreen; Scheer, Kaitlin G; Pyne, Natasha T; Allam, Amr H; Pollard, Anthony N; Magenau, Astrid; Wright, Rebecca L; Kolesnikoff, Natasha; Moretti, Paul A; Wullkopf, Lena; Stomski, Frank C; Cowin, Allison J; Woodcock, Joanna M; Grimbaldeston, Michele A; Pitson, Stuart M; Timpson, Paul; Ramshaw, Hayley S; Lopez, Angel F; Samuel, Michael S

    2015-12-21

    ROCK signaling causes epidermal hyper-proliferation by increasing ECM production, elevating dermal stiffness, and enhancing Fak-mediated mechano-transduction signaling. Elevated dermal stiffness in turn causes ROCK activation, establishing mechano-reciprocity, a positive feedback loop that can promote tumors. We have identified a negative feedback mechanism that limits excessive ROCK signaling during wound healing and is lost in squamous cell carcinomas (SCCs). Signal flux through ROCK was selectively tuned down by increased levels of 14-3-3ζ, which interacted with Mypt1, a ROCK signaling antagonist. In 14-3-3ζ(-/-) mice, unrestrained ROCK signaling at wound margins elevated ECM production and reduced ECM remodeling, increasing dermal stiffness and causing rapid wound healing. Conversely, 14-3-3ζ deficiency enhanced cutaneous SCC size. Significantly, inhibiting 14-3-3ζ with a novel pharmacological agent accelerated wound healing 2-fold. Patient samples of chronic non-healing wounds overexpressed 14-3-3ζ, while cutaneous SCCs had reduced 14-3-3ζ. These results reveal a novel 14-3-3ζ-dependent mechanism that negatively regulates mechano-reciprocity, suggesting new therapeutic opportunities.

  18. A Negative Regulatory Mechanism Involving 14-3-3ζ Limits Signaling Downstream of ROCK to Regulate Tissue Stiffness in Epidermal Homeostasis.

    PubMed

    Kular, Jasreen; Scheer, Kaitlin G; Pyne, Natasha T; Allam, Amr H; Pollard, Anthony N; Magenau, Astrid; Wright, Rebecca L; Kolesnikoff, Natasha; Moretti, Paul A; Wullkopf, Lena; Stomski, Frank C; Cowin, Allison J; Woodcock, Joanna M; Grimbaldeston, Michele A; Pitson, Stuart M; Timpson, Paul; Ramshaw, Hayley S; Lopez, Angel F; Samuel, Michael S

    2015-12-21

    ROCK signaling causes epidermal hyper-proliferation by increasing ECM production, elevating dermal stiffness, and enhancing Fak-mediated mechano-transduction signaling. Elevated dermal stiffness in turn causes ROCK activation, establishing mechano-reciprocity, a positive feedback loop that can promote tumors. We have identified a negative feedback mechanism that limits excessive ROCK signaling during wound healing and is lost in squamous cell carcinomas (SCCs). Signal flux through ROCK was selectively tuned down by increased levels of 14-3-3ζ, which interacted with Mypt1, a ROCK signaling antagonist. In 14-3-3ζ(-/-) mice, unrestrained ROCK signaling at wound margins elevated ECM production and reduced ECM remodeling, increasing dermal stiffness and causing rapid wound healing. Conversely, 14-3-3ζ deficiency enhanced cutaneous SCC size. Significantly, inhibiting 14-3-3ζ with a novel pharmacological agent accelerated wound healing 2-fold. Patient samples of chronic non-healing wounds overexpressed 14-3-3ζ, while cutaneous SCCs had reduced 14-3-3ζ. These results reveal a novel 14-3-3ζ-dependent mechanism that negatively regulates mechano-reciprocity, suggesting new therapeutic opportunities. PMID:26702834

  19. Regulatory cells and transplantation tolerance.

    PubMed

    Cobbold, Stephen P; Waldmann, Herman

    2013-06-01

    Transplantation tolerance is a continuing therapeutic goal, and it is now clear that a subpopulation of T cells with regulatory activity (Treg) that express the transcription factor foxp3 are crucial to this aspiration. Although reprogramming of the immune system to donor-specific transplantation tolerance can be readily achieved in adult mouse models, it has yet to be successfully translated in human clinical practice. This requires that we understand the fundamental mechanisms by which donor antigen-specific Treg are induced and function to maintain tolerance, so that we can target therapies to enhance rather than impede these regulatory processes. Our current understanding is that Treg act via numerous molecular mechanisms, and critical underlying components such as mTOR inhibition, are only now emerging. PMID:23732858

  20. Regulatory mechanisms controlling expression of the DAN/TIR mannoprotein genes during anaerobic remodeling of the cell wall in Saccharomyces cerevisiae.

    PubMed Central

    Abramova, N E; Cohen, B D; Sertil, O; Kapoor, R; Davies, K J; Lowry, C V

    2001-01-01

    The DAN/TIR genes of Saccharomyces cerevisiae encode homologous mannoproteins, some of which are essential for anaerobic growth. Expression of these genes is induced during anaerobiosis and in some cases during cold shock. We show that several heme-responsive mechanisms combine to regulate DAN/TIR gene expression. The first mechanism employs two repression factors, Mox1 and Mox2, and an activation factor, Mox4 (for mannoprotein regulation by oxygen). The genes encoding these proteins were identified by selecting for recessive mutants with altered regulation of a dan1::ura3 fusion. MOX4 is identical to UPC2, encoding a binucleate zinc cluster protein controlling expression of an anaerobic sterol transport system. Mox4/Upc2 is required for expression of all the DAN/TIR genes. It appears to act through a consensus sequence termed the AR1 site, as does Mox2. The noninducible mox4Delta allele was epistatic to the constitutive mox1 and mox2 mutations, suggesting that Mox1 and Mox2 modulate activation by Mox4 in a heme-dependent fashion. Mutations in a putative repression domain in Mox4 caused constitutive expression of the DAN/TIR genes, indicating a role for this domain in heme repression. MOX4 expression is induced both in anaerobic and cold-shocked cells, so heme may also regulate DAN/TIR expression through inhibition of expression of MOX4. Indeed, ectopic expression of MOX4 in aerobic cells resulted in partially constitutive expression of DAN1. Heme also regulates expression of some of the DAN/TIR genes through the Rox7 repressor, which also controls expression of the hypoxic gene ANB1. In addition Rox1, another heme-responsive repressor, and the global repressors Tup1 and Ssn6 are also required for full aerobic repression of these genes. PMID:11238402

  1. Regulatory mechanisms controlling expression of the DAN/TIR mannoprotein genes during anaerobic remodeling of the cell wall in Saccharomyces cerevisiae.

    PubMed

    Abramova, N E; Cohen, B D; Sertil, O; Kapoor, R; Davies, K J; Lowry, C V

    2001-03-01

    The DAN/TIR genes of Saccharomyces cerevisiae encode homologous mannoproteins, some of which are essential for anaerobic growth. Expression of these genes is induced during anaerobiosis and in some cases during cold shock. We show that several heme-responsive mechanisms combine to regulate DAN/TIR gene expression. The first mechanism employs two repression factors, Mox1 and Mox2, and an activation factor, Mox4 (for mannoprotein regulation by oxygen). The genes encoding these proteins were identified by selecting for recessive mutants with altered regulation of a dan1::ura3 fusion. MOX4 is identical to UPC2, encoding a binucleate zinc cluster protein controlling expression of an anaerobic sterol transport system. Mox4/Upc2 is required for expression of all the DAN/TIR genes. It appears to act through a consensus sequence termed the AR1 site, as does Mox2. The noninducible mox4Delta allele was epistatic to the constitutive mox1 and mox2 mutations, suggesting that Mox1 and Mox2 modulate activation by Mox4 in a heme-dependent fashion. Mutations in a putative repression domain in Mox4 caused constitutive expression of the DAN/TIR genes, indicating a role for this domain in heme repression. MOX4 expression is induced both in anaerobic and cold-shocked cells, so heme may also regulate DAN/TIR expression through inhibition of expression of MOX4. Indeed, ectopic expression of MOX4 in aerobic cells resulted in partially constitutive expression of DAN1. Heme also regulates expression of some of the DAN/TIR genes through the Rox7 repressor, which also controls expression of the hypoxic gene ANB1. In addition Rox1, another heme-responsive repressor, and the global repressors Tup1 and Ssn6 are also required for full aerobic repression of these genes.

  2. HER2 Stabilizes EGFR and Itself by Altering Autophosphorylation Patterns in a Manner That Overcomes Regulatory Mechanisms and Promotes Proliferative and Transformation Signaling

    PubMed Central

    Hartman, Zachary; Zhao, Hua; Agazie, Yehenew M.

    2012-01-01

    One of the causes of breast cancer is overexpression of the human epidermal growth factor receptor 2 (HER2). Enhanced receptor autophosphorylation and resistance to activation-induced down regulation have been suggested as mechanisms for HER2-induced sustained signaling and cell transformation. However, the molecular mechanisms underlying these possibilities remain incompletely understood. In the current report, we present evidence that show that HER2 overexpression does not lead to receptor hyper-autophosphorylation, but alters patterns in a manner that favors receptor stability and sustained signaling. Specifically, HER2 overexpression blocks EGFR tyrosine phosphorylation on Y1045 and Y1068, the known docking sites of c-Cbl and Grb2, respectively, while promoting phosphorylation on Y1173, the known docking site of the Gab adaptor proteins and phospholipase C gamma (PLCγ). Under these conditions, HER2 itself is phosphorylated on Y1221/1222, with no known role, and on Y1248 that corresponds to Y1173 of EGFR. Interestingly, suppressed EGFR autophosphorylation on the Grb2 and c-Cbl binding sites correlated with receptor stability and sustained signaling, suggesting that HER2 accomplishes these tasks by altering autophosphorylation patterns. In conformity with these findings, mutation of the Grb2 binding site on EGFR (Y1068F-EGFR) conferred resistance to ligand-induced degradation which in turn induced sustained signaling, and increased cell proliferation and transformation. These findings suggest that the Grb2 binding site on EGFR is redundant for signaling, but critical for receptor regulation. On the other hand, mutation of the putative Grb2 binding site in HER2 (Y1139) did not affect stability, signaling or transformation, suggesting that Y1139 in HER2 may not serve as a Grb2 binding site. In agreement with the role of EGFR in HER2 signaling, inhibition of EGFR expression reduced HER2-induced anchorage-independent growth and tumorigenesis. These results imply

  3. Regulatory Considerations for Biosimilars

    PubMed Central

    Nellore, Ranjani

    2010-01-01

    Currently there is considerable interest in the legislative debate around generic biological drugs or “biosimilars” in the EU and US due to the large, lucrative market that it offers to the industry. While some countries have issued a few regulatory guidelines as well as product specific requirements, there is no general consensus as to a single, simple mechanism similar to the bioequivalence determination that leads to approval of generic small molecules all over the world. The inherent complex nature of the molecules, along with complicated manufacturing and analytical techniques to characterize them make it difficult to rely on a single human pharmacokinetic study for assurance of safety and efficacy. In general, the concept of comparability has been used for evaluation of the currently approved “similar” biological where a step by step assessment on the quality, preclinical and clinical aspects is made. In India, the focus is primarily on the availability and affordability of life-saving drugs. In this context every product needs to be evaluated on its own merit irrespective of the innovator brand. The formation of the National Biotechnology Regulatory Authority may provide a step in the right direction for regulation of these complex molecules. However, in order to have an efficient machinery for initial approval and ongoing oversight with a country-specific focus, cooperation with international authorities for granting approvals and continuous risk-benefit review is essential. Several steps are still needed for India to be perceived as a country that leads the world in providing quality biological products. PMID:21829775

  4. Apoptotic Response through a High Mobility Box 1 Protein-Dependent Mechanism in LPS/GalN-Induced Mouse Liver Failure and Glycyrrhizin-Mediated Inhibition

    PubMed Central

    Kuroda, Noriyuki; Inoue, Kouji; Ikeda, Tadayuki; Hara, Yaiko; Wake, Kenjiro; Sato, Tetsuji

    2014-01-01

    HMGB1 is a nuclear component involved in nucleosome stabilization and transcription regulation, but extracellularly it is able to serve as a potential late mediator of lethality. In the present study, we explored inflammation-promoting activity of HMGB1 and blockade of extracellular release of HMGB1 by glycyrrhizin (GL) in LPS/GalN-triggered mouse liver injury. At 1 to 10 h after LPS/GalN-treatment, mice were anesthetized to collect blood from heart puncture, and serum transaminase and HMGB1 were evaluated. Administration of LPS/GalN precipitated tissue injury associated with time-dependent alteration in HMGB1 serum levels. At 8 h nuclear immunoreactive products were remarkably reduced and extracellular HMGB1 expression was found exclusively in the pericentral foci. The treatment with GL significantly down-regulated the serum levels of ALT, AST, and HMGB1 in addition to the strong inhibition of tissue injury and extracellular immunoreactivity to HMGB1 and to acetylated-lysine. Furthermore, GL brought about a significant decrease in the number of apoptotic hepatocytes labeled with TUNEL-method. On the basis of these results, three apoptosis-associated genes were identified with microarray analysis and real-time PCR. The ChIP-assay revealed the binding of HMGB1 protein to Gsto1 promoter sequence in LPS/GalN-treated mice and the remarkable decrease in combined HMGB1 protein by GL. The current findings claim that a single injection of LPS/GalN might stimulate apoptosis of hepatocytes through the binding of HMGB1 protein to Gsto1 promoter region and that GL-treatment might prevent the apoptosis and inflammatory infiltrates caused with LPS/GalN-injection by disturbing the binding of HMGB1 protein to Gsto1 promoter sequence. PMID:24690901

  5. A New Regulatory Mechanism for Kv7.2 Protein During Neuropathy: Enhanced Transport from the Soma to Axonal Terminals of Injured Sensory Neurons.

    PubMed

    Cisneros, Elsa; Roza, Carolina; Jackson, Nieka; López-García, José Antonio

    2015-01-01

    Kv7.2 channel expression has been reported to decrease in dorsal root ganglia (DRG) following the induction of a peripheral neuropathy while other experiments show that Kv7.2 accumulates in peripheral neuromas. The mechanisms underlying these novel expression patterns are poorly understood. Here we use immunofluorescence methods to analyze Kv7.2 protein expression changes in sensory neurons following peripheral axotomy and the potential role of axonal transport. Results indicate that DRG neurons express Kv7.2 in ~16% of neurons and that this number decreases by about 65% after axotomy. Damaged neurons were identified in DRG by application of the tracer Fluoro-ruby at the site of injury during surgery. Reduction of Kv7.2 expression was particularly strong in damaged neurons although some loss was also found in putative uninjured neurons. In parallel to the decrease in the soma of axotomized sensory neurons, Kv7.2 accumulated at neuromatose fiber endings. Blockade of axonal transport with either vinblastine (VLB) or colchicine (COL) abolished Kv7.2 redistribution in neuropathic animals. Channel distribution rearrangements did not occur following induction of inflammation in the hind paw. Behavioral tests indicate that protein rearrangements within sensory afferents are essential to the development of allodynia under neuropathic conditions. These results suggest that axotomy enhances axonal transport in injured sensory neurons, leading to a decrease of somatic expression of Kv7.2 protein and a concomitant accumulation in damaged fiber endings. Localized changes in channel expression patterns under pathological conditions may create novel opportunities for Kv7.2 channel openers to act as analgesics. PMID:26696829

  6. A New Regulatory Mechanism for Kv7.2 Protein During Neuropathy: Enhanced Transport from the Soma to Axonal Terminals of Injured Sensory Neurons

    PubMed Central

    Cisneros, Elsa; Roza, Carolina; Jackson, Nieka; López-García, José Antonio

    2015-01-01

    Kv7.2 channel expression has been reported to decrease in dorsal root ganglia (DRG) following the induction of a peripheral neuropathy while other experiments show that Kv7.2 accumulates in peripheral neuromas. The mechanisms underlying these novel expression patterns are poorly understood. Here we use immunofluorescence methods to analyze Kv7.2 protein expression changes in sensory neurons following peripheral axotomy and the potential role of axonal transport. Results indicate that DRG neurons express Kv7.2 in ~16% of neurons and that this number decreases by about 65% after axotomy. Damaged neurons were identified in DRG by application of the tracer Fluoro-ruby at the site of injury during surgery. Reduction of Kv7.2 expression was particularly strong in damaged neurons although some loss was also found in putative uninjured neurons. In parallel to the decrease in the soma of axotomized sensory neurons, Kv7.2 accumulated at neuromatose fiber endings. Blockade of axonal transport with either vinblastine (VLB) or colchicine (COL) abolished Kv7.2 redistribution in neuropathic animals. Channel distribution rearrangements did not occur following induction of inflammation in the hind paw. Behavioral tests indicate that protein rearrangements within sensory afferents are essential to the development of allodynia under neuropathic conditions. These results suggest that axotomy enhances axonal transport in injured sensory neurons, leading to a decrease of somatic expression of Kv7.2 protein and a concomitant accumulation in damaged fiber endings. Localized changes in channel expression patterns under pathological conditions may create novel opportunities for Kv7.2 channel openers to act as analgesics. PMID:26696829

  7. Dynamic Changes in the MicroRNA Expression Profile Reveal Multiple Regulatory Mechanisms in the Spinal Nerve Ligation Model of Neuropathic Pain

    PubMed Central

    von Schack, David; Agostino, Michael J.; Murray, B. Stuart; Li, Yizheng; Reddy, Padmalatha S.; Chen, Jin; Choe, Sung E.; Strassle, Brian W.; Li, Christine; Bates, Brian; Zhang, Lynn; Hu, Huijuan; Kotnis, Smita; Bingham, Brendan; Liu, Wei; Whiteside, Garth T.; Samad, Tarek A.; Kennedy, Jeffrey D.; Ajit, Seena K.

    2011-01-01

    Neuropathic pain resulting from nerve lesions or dysfunction represents one of the most challenging neurological diseases to treat. A better understanding of the molecular mechanisms responsible for causing these maladaptive responses can help develop novel therapeutic strategies and biomarkers for neuropathic pain. We performed a miRNA expression profiling study of dorsal root ganglion (DRG) tissue from rats four weeks post spinal nerve ligation (SNL), a model of neuropathic pain. TaqMan low density arrays identified 63 miRNAs whose level of expression was significantly altered following SNL surgery. Of these, 59 were downregulated and the ipsilateral L4 DRG, not the injured L5 DRG, showed the most significant downregulation suggesting that miRNA changes in the uninjured afferents may underlie the development and maintenance of neuropathic pain. TargetScan was used to predict mRNA targets for these miRNAs and it was found that the transcripts with multiple predicted target sites belong to neurologically important pathways. By employing different bioinformatic approaches we identified neurite remodeling as a significantly regulated biological pathway, and some of these predictions were confirmed by siRNA knockdown for genes that regulate neurite growth in differentiated Neuro2A cells. In vitro validation for predicted target sites in the 3′-UTR of voltage-gated sodium channel Scn11a, alpha 2/delta1 subunit of voltage-dependent Ca-channel, and purinergic receptor P2rx ligand-gated ion channel 4 using luciferase reporter assays showed that identified miRNAs modulated gene expression significantly. Our results suggest the potential for miRNAs to play a direct role in neuropathic pain. PMID:21423802

  8. Multiple regulatory mechanisms of hepatocyte growth factor expression in malignant cells with a short poly(dA) sequence in the HGF gene promoter.

    PubMed

    Sakai, Kazuko; Takeda, Masayuki; Okamoto, Isamu; Nakagawa, Kazuhiko; Nishio, Kazuto

    2015-01-01

    Hepatocyte growth factor (HGF) expression is a poor prognostic factor in various types of cancer. Expression levels of HGF have been reported to be regulated by shorter poly(dA) sequences in the promoter region. In the present study, the poly(dA) mononucleotide tract in various types of human cancer cell lines was examined and compared with the HGF expression levels in those cells. Short deoxyadenosine repeat sequences were detected in five of the 55 cell lines used in the present study. The H69, IM95, CCK-81, Sui73 and H28 cells exhibited a truncated poly(dA) sequence in which the number of poly(dA) repeats was reduced by ≥5 bp. Two of the cell lines exhibited high HGF expression, determined by reverse transcription quantitative polymerase chain reaction and enzyme-linked immunosorbent assay. The CCK-81, Sui73 and H28 cells with shorter poly(dA) sequences exhibited low HGF expression. The cause of the suppression of HGF expression in the CCK-81, Sui73 and H28 cells was clarified by two approaches, suppression by methylation and single nucleotide polymorphisms in the HGF gene. Exposure to 5-Aza-dC, an inhibitor of DNA methyltransferase 1, induced an increased expression of HGF in the CCK-81 cells, but not in the other cells. Single-nucleotide polymorphism (SNP) rs72525097 in intron 1 was detected in the Sui73 and H28 cells. Taken together, it was found that the defect of poly(dA) in the HGF promoter was present in various types of cancer, including lung, stomach, colorectal, pancreas and mesothelioma. The present study proposes the negative regulation mechanisms by methylation and SNP in intron 1 of HGF for HGF expression in cancer cells with short poly(dA).

  9. Genomics in the land of regulatory science.

    PubMed

    Tong, Weida; Ostroff, Stephen; Blais, Burton; Silva, Primal; Dubuc, Martine; Healy, Marion; Slikker, William

    2015-06-01

    Genomics science has played a major role in the generation of new knowledge in the basic research arena, and currently question arises as to its potential to support regulatory processes. However, the integration of genomics in the regulatory decision-making process requires rigorous assessment and would benefit from consensus amongst international partners and research communities. To that end, the Global Coalition for Regulatory Science Research (GCRSR) hosted the fourth Global Summit on Regulatory Science (GSRS2014) to discuss the role of genomics in regulatory decision making, with a specific emphasis on applications in food safety and medical product development. Challenges and issues were discussed in the context of developing an international consensus for objective criteria in the analysis, interpretation and reporting of genomics data with an emphasis on transparency, traceability and "fitness for purpose" for the intended application. It was recognized that there is a need for a global path in the establishment of a regulatory bioinformatics framework for the development of transparent, reliable, reproducible and auditable processes in the management of food and medical product safety risks. It was also recognized that training is an important mechanism in achieving internationally consistent outcomes. GSRS2014 provided an effective venue for regulators andresearchers to meet, discuss common issues, and develop collaborations to address the challenges posed by the application of genomics to regulatory science, with the ultimate goal of wisely integrating novel technical innovations into regulatory decision-making.

  10. [Regulatory B cells in human autoimmune diseases].

    PubMed

    Miyagaki, Tomomitsu

    2015-01-01

    B cells have been generally considered to be positive regulators of immune responses because of their ability to produce antigen-specific antibodies and to activate T cells through antigen presentation. Impairment of B cell development and function may cause autoimmune diseases. Recently, specific B cell subsets that can negatively regulate immune responses have been described in mouse models of a wide variety of autoimmune diseases. The concept of those B cells, termed regulatory B cells, is now recognized as important in the murine immune system. Among several regulatory B cell subsets, IL-10-producing regulatory B cells are the most widely investigated. On the basis of discoveries from studies of such mice, human regulatory B cells that produce IL-10 in most cases are becoming an active area of research. There have been emerging data suggesting the importance of human regulatory B cells in various diseases. Revealing the immune regulation mechanisms of human regulatory B cells in human autoimmune diseases could lead to the development of novel B cell targeted therapies. This review highlights the current knowledge on regulatory B cells, mainly IL-10-producing regulatory B cells, in clinical research using human samples. PMID:26725860

  11. Ontogeny of regulatory mechanisms for beta-adrenoceptor control of rat cardiac adenylyl cyclase: targeting of G-proteins and the cyclase catalytic subunit.

    PubMed

    Zeiders, J L; Seidler, F J; Slotkin, T A

    1997-02-01

    Fetal and neonatal tissues are resistant to catecholamine-induced desensitization of essential physiological responses. We examined the mechanisms underlying the ontogeny of desensitization in neonatal rat heart for the beta-adrenergic receptor/adenylyl cyclase signaling cascade. Animals of different ages received isoproterenol daily or 4 days and cardiac membrane preparations were evaluated on the 5th day (6, 15, 25 days old and adults). Measurements were made of basal activity, activity stimulated by two agonists (isoproterenol or glucagon) that operate at different receptors but that share Gs as the transduction intermediate, or by forskolin-Mn' to assess total catalytic capacity of the cyclase subunit; we also assessed inhibition of activity by carbachol which acts via muscarinic cholinergic receptors and G. Adult rats exhibited robust desensitization of the adenylyl cyclase response but the effect was heterologous in that equivalent loss of activity was seen for basal, isoproterenol- and glucagon-stimulated activity forskolin-Mn(2+)-stimulated activity was also decreased. Two factors contributed to desensitization; generalized reduction in membrane protein concentrations caused by cell enlargement (reduced surface-to-volume ratio), and specific interference with the G-protein component that couples receptors to the cyclase. Thus, after adjustment for changes in membrane protein, the desensitization of the forskolin-Mn2, response was no longer evident, but the effects on the other measures were still present. In addition, isoproterenol treatment produced crosstalk with the carbachol/Gi signaling pathway, with significant reductions in the ability of carbachol to inhibit adenylyl cyclase activity. Heterologous desensitization by isoproterenol was also present in 15 and 25 day old rats, but involved only selective components of the effects seen in adults. At 25 days, uncoupling of signals operating through Gs and Gi was obtained without a reduction in forskolin

  12. Environmental regulatory update table

    SciTech Connect

    Brown, K.J.; Langston, M.E.; Tucker, C.S.; Reed, R.M.

    1987-06-01

    The Environmental Regulatory Update Table provides information on regulatory initiatives of interest to DOE operations and contractor staff with environmental management responsibilities. The table is updated each month with information from the Federal Register and other sources, including direct contact with regulatory agencies. Each table entry provides a chronological record of the rulemaking process for that initiative with an abstract and a projection of further action.

  13. Effects of Sodium Butyrate Treatment on Histone Modifications and the Expression of Genes Related to Epigenetic Regulatory Mechanisms and Immune Response in European Sea Bass (Dicentrarchus Labrax) Fed a Plant-Based Diet.

    PubMed

    Terova, Genciana; Díaz, Noelia; Rimoldi, Simona; Ceccotti, Chiara; Gliozheni, Emi; Piferrer, Francesc

    2016-01-01

    Bacteria that inhabit the epithelium of the animals' digestive tract provide the essential biochemical pathways for fermenting otherwise indigestible dietary fibers, leading to the production of short-chain fatty acids (SCFAs). Of the major SCFAs, butyrate has received particular attention due to its numerous positive effects on the health of the intestinal tract and peripheral tissues. The mechanisms of action of this four-carbon chain organic acid are different; many of these are related to its potent regulatory effect on gene expression since butyrate is a histone deacetylase inhibitor that play a predominant role in the epigenetic regulation of gene expression and cell function. In the present work, we investigated in the European sea bass (Dicentrarchus labrax) the effects of butyrate used as a feed additive on fish epigenetics as well as its regulatory role in mucosal protection and immune homeostasis through impact on gene expression. Seven target genes related to inflammatory response and reinforcement of the epithelial defense barrier [tnfα (tumor necrosis factor alpha) il1β, (interleukin 1beta), il-6, il-8, il-10, and muc2 (mucin 2)] and five target genes related to epigenetic modifications [dicer1(double-stranded RNA-specific endoribonuclease), ehmt2 (euchromatic histone-lysine-N-methyltransferase 2), pcgf2 (polycomb group ring finger 2), hdac11 (histone deacetylase-11), and jarid2a (jumonji)] were analyzed in fish intestine and liver. We also investigated the effect of dietary butyrate supplementation on histone acetylation, by performing an immunoblotting analysis on liver core histone extracts. Results of the eight-week-long feeding trial showed no significant differences in weight gain or SGR (specific growth rate) of sea bass that received 0.2% sodium butyrate supplementation in the diet in comparison to control fish that received a diet without Na-butyrate. Dietary butyrate led to a twofold increase in the acetylation level of histone H4 at

  14. Effects of Sodium Butyrate Treatment on Histone Modifications and the Expression of Genes Related to Epigenetic Regulatory Mechanisms and Immune Response in European Sea Bass (Dicentrarchus Labrax) Fed a Plant-Based Diet.

    PubMed

    Terova, Genciana; Díaz, Noelia; Rimoldi, Simona; Ceccotti, Chiara; Gliozheni, Emi; Piferrer, Francesc

    2016-01-01

    Bacteria that inhabit the epithelium of the animals' digestive tract provide the essential biochemical pathways for fermenting otherwise indigestible dietary fibers, leading to the production of short-chain fatty acids (SCFAs). Of the major SCFAs, butyrate has received particular attention due to its numerous positive effects on the health of the intestinal tract and peripheral tissues. The mechanisms of action of this four-carbon chain organic acid are different; many of these are related to its potent regulatory effect on gene expression since butyrate is a histone deacetylase inhibitor that play a predominant role in the epigenetic regulation of gene expression and cell function. In the present work, we investigated in the European sea bass (Dicentrarchus labrax) the effects of butyrate used as a feed additive on fish epigenetics as well as its regulatory role in mucosal protection and immune homeostasis through impact on gene expression. Seven target genes related to inflammatory response and reinforcement of the epithelial defense barrier [tnfα (tumor necrosis factor alpha) il1β, (interleukin 1beta), il-6, il-8, il-10, and muc2 (mucin 2)] and five target genes related to epigenetic modifications [dicer1(double-stranded RNA-specific endoribonuclease), ehmt2 (euchromatic histone-lysine-N-methyltransferase 2), pcgf2 (polycomb group ring finger 2), hdac11 (histone deacetylase-11), and jarid2a (jumonji)] were analyzed in fish intestine and liver. We also investigated the effect of dietary butyrate supplementation on histone acetylation, by performing an immunoblotting analysis on liver core histone extracts. Results of the eight-week-long feeding trial showed no significant differences in weight gain or SGR (specific growth rate) of sea bass that received 0.2% sodium butyrate supplementation in the diet in comparison to control fish that received a diet without Na-butyrate. Dietary butyrate led to a twofold increase in the acetylation level of histone H4 at

  15. Effects of Sodium Butyrate Treatment on Histone Modifications and the Expression of Genes Related to Epigenetic Regulatory Mechanisms and Immune Response in European Sea Bass (Dicentrarchus Labrax) Fed a Plant-Based Diet

    PubMed Central

    Díaz, Noelia; Rimoldi, Simona; Ceccotti, Chiara; Gliozheni, Emi; Piferrer, Francesc

    2016-01-01

    Bacteria that inhabit the epithelium of the animals’ digestive tract provide the essential biochemical pathways for fermenting otherwise indigestible dietary fibers, leading to the production of short-chain fatty acids (SCFAs). Of the major SCFAs, butyrate has received particular attention due to its numerous positive effects on the health of the intestinal tract and peripheral tissues. The mechanisms of action of this four-carbon chain organic acid are different; many of these are related to its potent regulatory effect on gene expression since butyrate is a histone deacetylase inhibitor that play a predominant role in the epigenetic regulation of gene expression and cell function. In the present work, we investigated in the European sea bass (Dicentrarchus labrax) the effects of butyrate used as a feed additive on fish epigenetics as well as its regulatory role in mucosal protection and immune homeostasis through impact on gene expression. Seven target genes related to inflammatory response and reinforcement of the epithelial defense barrier [tnfα (tumor necrosis factor alpha) il1β, (interleukin 1beta), il-6, il-8, il-10, and muc2 (mucin 2)] and five target genes related to epigenetic modifications [dicer1(double-stranded RNA-specific endoribonuclease), ehmt2 (euchromatic histone-lysine-N-methyltransferase 2), pcgf2 (polycomb group ring finger 2), hdac11 (histone deacetylase-11), and jarid2a (jumonji)] were analyzed in fish intestine and liver. We also investigated the effect of dietary butyrate supplementation on histone acetylation, by performing an immunoblotting analysis on liver core histone extracts. Results of the eight-week-long feeding trial showed no significant differences in weight gain or SGR (specific growth rate) of sea bass that received 0.2% sodium butyrate supplementation in the diet in comparison to control fish that received a diet without Na-butyrate. Dietary butyrate led to a twofold increase in the acetylation level of histone H4 at

  16. Structural Basis for the 14-3-3 Protein-dependent Inhibition of the Regulator of G Protein Signaling 3 (RGS3) Function*

    PubMed Central

    Rezabkova, Lenka; Man, Petr; Novak, Petr; Herman, Petr; Vecer, Jaroslav; Obsilova, Veronika; Obsil, Tomas

    2011-01-01

    Regulator of G protein signaling (RGS) proteins function as GTPase-activating proteins for the α-subunit of heterotrimeric G proteins. The function of certain RGS proteins is negatively regulated by 14-3-3 proteins, a family of highly conserved regulatory molecules expressed in all eukaryotes. In this study, we provide a structural mechanism for 14-3-3-dependent inhibition of RGS3-Gα interaction. We have used small angle x-ray scattering, hydrogen/deuterium exchange kinetics, and Förster resonance energy transfer measurements to determine the low-resolution solution structure of the 14-3-3ζ·RGS3 complex. The structure shows the RGS domain of RGS3 bound to the 14-3-3ζ dimer in an as-yet-unrecognized manner interacting with less conserved regions on the outer surface of the 14-3-3 dimer outside its central channel. Our results suggest that the 14-3-3 protein binding affects the structure of the Gα interaction portion of RGS3 as well as sterically blocks the interaction between the RGS domain and the Gα subunit of heterotrimeric G proteins. PMID:22027839

  17. Nuclear Regulatory Commission Semiannual Regulatory Agenda

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-12-20

    ... agenda on April 26, 2010 (75 FR 21960). For this edition of the NRC's regulatory agenda, the most... publication of the last NRC semiannual agenda on April 26, 2010 (75 FR 21960). Within each group, the rules... regulations to improve the control over the distribution of source material to exempt persons and to...

  18. Interaction of Gram-negative bacteria with cationic proteins: Dependence on the surface characteristics of the bacterial cell

    PubMed Central

    Prokhorenko, Isabella R; Zubova, Svetlana V; Ivanov, Alexandr Yu; Grachev, Sergey V

    2009-01-01

    Gram-negative bacteria can enter the bloodstream and interact with serum cationic proteins. The character of interaction will depend on the surface characteristics of bacterial cells, which are determined by bacterial chemotype and density of lipopolysaccharide (LPS) packing in the cell wall. It was shown that the lysozyme treatment resulted in the increase sensitivity to hypotonic shock. Significant differences to this effect were found between Escherichia coli strain D21 and D21f2 under treatment with physiological protein concentration. On the basis of electrokinetic measurements and studies of the interaction of cells with lysozyme, the hypothesis was formed that the cell wall of the E. coli strain D21f2 contains more LPS and has a higher density of their packing than the cell wall of the E. coli D21 cells. The effect of lysozyme and lactoferrin on the viability of E. coli cells of two different strains was examined. Lysozyme was found to more effectively inhibit the growth of the E. coli D21 bacteria, and lactoferrin suppressed mainly the growth of the E. coli D21f2 bacteria. These results indicate that the differences in LPS core structure of bacterial R-chemotype, which determines surface charge and density of LPS packing, plays an essential role in the mechanisms of interaction of the cationic proteins with the cell wall. PMID:20360884

  19. Gene Regulatory Networks Elucidating Huanglongbing Disease Mechanisms

    PubMed Central

    Martinelli, Federico; Reagan, Russell L.; Uratsu, Sandra L.; Phu, My L.; Albrecht, Ute; Zhao, Weixiang; Davis, Cristina E.; Bowman, Kim D.; Dandekar, Abhaya M.

    2013-01-01

    Next-generation sequencing was exploited to gain deeper insight into the response to infection by Candidatus liberibacter asiaticus (CaLas), especially the immune disregulation and metabolic dysfunction caused by source-sink disruption. Previous fruit transcriptome data were compared with additional RNA-Seq data in three tissues: immature fruit, and young and mature leaves. Four categories of orchard trees were studied: symptomatic, asymptomatic, apparently healthy, and healthy. Principal component analysis found distinct expression patterns between immature and mature fruits and leaf samples for all four categories of trees. A predicted protein – protein interaction network identified HLB-regulated genes for sugar transporters playing key roles in the overall plant responses. Gene set and pathway enrichment analyses highlight the role of sucrose and starch metabolism in disease symptom development in all tissues. HLB-regulated genes (glucose-phosphate-transporter, invertase, starch-related genes) would likely determine the source-sink relationship disruption. In infected leaves, transcriptomic changes were observed for light reactions genes (downregulation), sucrose metabolism (upregulation), and starch biosynthesis (upregulation). In parallel, symptomatic fruits over-expressed genes involved in photosynthesis, sucrose and raffinose metabolism, and downregulated starch biosynthesis. We visualized gene networks between tissues inducing a source-sink shift. CaLas alters the hormone crosstalk, resulting in weak and ineffective tissue-specific plant immune responses necessary for bacterial clearance. Accordingly, expression of WRKYs (including WRKY70) was higher in fruits than in leaves. Systemic acquired responses were inadequately activated in young leaves, generally considered the sites where most new infections occur. PMID:24086326

  20. Self-Regulatory Mechanisms Governing Gender Development.

    ERIC Educational Resources Information Center

    Bussey, Kay; Bandura, Albert

    1992-01-01

    Groups of younger and older children in a sample of two to five year olds were assessed for gender knowledge, gender standards, and gender-linked behavior. All children exhibited more same- than cross-sex typed behavior. Older children expressed self-approval for same-sex behavior and self-criticism for cross-sex behavior. (BC)

  1. Mechanical stimulation of skeletal muscle increases prostaglandin F2(alpha) synthesis and cyclooxygenase activity by a pertussis toxin sensitive mechanism

    NASA Technical Reports Server (NTRS)

    Vandenburgh, Herman H.; Shansky, Janet; Solerssi, Rosa; Chromiak, Joseph

    1992-01-01

    Repetitive mechanical stimulation of differentiated skeletal muscle in tissue culture increases the production of prostaglandin F(sub 2(alpha)), an anabolic stimulator of myofiber growth. Within 4 h of initiating mechanical activity, the activity of cyclooxygenase, a regulatory enzyme in prostaglandin synthesis, was increased 82% (P is less than .005), and this increase was maintained for at least 24 h. Kinetic analysis of the stretch-activated cyclooxygenase indicated a two to three-fold decrease in the enzyme's K(sub m) with no change in V(sub max). The stretch-induced increase in enzymatic activity was not inhibited by cycloheximide, was independent of cellular electrical activity (tetrodotoxin-insensitive), but was prevented by the G protein inhibitor pertussis toxin. Pertussis toxin also inhibited the stretch-induced increases in PGF(sub 2(alpha)) production, and cell growth. It is concluded that stretch of skeletal muscle increases the synthesis of the anabolic modulator PGF(sub 2(alpha)) by a G protein-dependent process which involves activation of cyclooxygenase by a posttranslational mechanism.

  2. EVOLUTIONARY BIOSCIENCE AS REGULATORY SYSTEMS BIOLOGY

    PubMed Central

    Davidson, Eric H.

    2011-01-01

    At present several entirely different explanatory approaches compete to illuminate the mechanisms by which animal body plans have evolved. Their respective relevance is briefly considered here in the light of modern knowledge of genomes and the regulatory processes by which development is controlled. Just as development is a system property of the regulatory genome, so causal explanation of evolutionary change in developmental process must be considered at a system level. Here I enumerate some mechanistic consequences that follow from the conclusion that evolution of the body plan has occurred by alteration of the structure of developmental gene regulatory networks. The hierarchy and multiple additional design features of these networks act to produce Boolean regulatory state specification functions at upstream phases of development of the body plan. These are created by the logic outputs of network subcircuits, and in modern animals these outputs are impervious to continuous adaptive variation unlike genes operating more peripherally in the network. PMID:21320483

  3. Regulatory guidance document

    SciTech Connect

    1994-05-01

    The Office of Civilian Radioactive Waste Management (OCRWM) Program Management System Manual requires preparation of the OCRWM Regulatory Guidance Document (RGD) that addresses licensing, environmental compliance, and safety and health compliance. The document provides: regulatory compliance policy; guidance to OCRWM organizational elements to ensure a consistent approach when complying with regulatory requirements; strategies to achieve policy objectives; organizational responsibilities for regulatory compliance; guidance with regard to Program compliance oversight; and guidance on the contents of a project-level Regulatory Compliance Plan. The scope of the RGD includes site suitability evaluation, licensing, environmental compliance, and safety and health compliance, in accordance with the direction provided by Section 4.6.3 of the PMS Manual. Site suitability evaluation and regulatory compliance during site characterization are significant activities, particularly with regard to the YW MSA. OCRWM`s evaluation of whether the Yucca Mountain site is suitable for repository development must precede its submittal of a license application to the Nuclear Regulatory Commission (NRC). Accordingly, site suitability evaluation is discussed in Chapter 4, and the general statements of policy regarding site suitability evaluation are discussed in Section 2.1. Although much of the data and analyses may initially be similar, the licensing process is discussed separately in Chapter 5. Environmental compliance is discussed in Chapter 6. Safety and Health compliance is discussed in Chapter 7.

  4. Regulatory sequence analysis tools.

    PubMed

    van Helden, Jacques

    2003-07-01

    The web resource Regulatory Sequence Analysis Tools (RSAT) (http://rsat.ulb.ac.be/rsat) offers a collection of software tools dedicated to the prediction of regulatory sites in non-coding DNA sequences. These tools include sequence retrieval, pattern discovery, pattern matching, genome-scale pattern matching, feature-map drawing, random sequence generation and other utilities. Alternative formats are supported for the representation of regulatory motifs (strings or position-specific scoring matrices) and several algorithms are proposed for pattern discovery. RSAT currently holds >100 fully sequenced genomes and these data are regularly updated from GenBank.

  5. Regulatory bioinformatics for food and drug safety.

    PubMed

    Healy, Marion J; Tong, Weida; Ostroff, Stephen; Eichler, Hans-Georg; Patak, Alex; Neuspiel, Margaret; Deluyker, Hubert; Slikker, William

    2016-10-01

    "Regulatory Bioinformatics" strives to develop and implement a standardized and transparent bioinformatic framework to support the implementation of existing and emerging technologies in regulatory decision-making. It has great potential to improve public health through the development and use of clinically important medical products and tools to manage the safety of the food supply. However, the application of regulatory bioinformatics also poses new challenges and requires new knowledge and skill sets. In the latest Global Coalition on Regulatory Science Research (GCRSR) governed conference, Global Summit on Regulatory Science (GSRS2015), regulatory bioinformatics principles were presented with respect to global trends, initiatives and case studies. The discussion revealed that datasets, analytical tools, skills and expertise are rapidly developing, in many cases via large international collaborative consortia. It also revealed that significant research is still required to realize the potential applications of regulatory bioinformatics. While there is significant excitement in the possibilities offered by precision medicine to enhance treatments of serious and/or complex diseases, there is a clear need for further development of mechanisms to securely store, curate and share data, integrate databases, and standardized quality control and data analysis procedures. A greater understanding of the biological significance of the data is also required to fully exploit vast datasets that are becoming available. The application of bioinformatics in the microbiological risk analysis paradigm is delivering clear benefits both for the investigation of food borne pathogens and for decision making on clinically important treatments. It is recognized that regulatory bioinformatics will have many beneficial applications by ensuring high quality data, validated tools and standardized processes, which will help inform the regulatory science community of the requirements

  6. Regulatory bioinformatics for food and drug safety.

    PubMed

    Healy, Marion J; Tong, Weida; Ostroff, Stephen; Eichler, Hans-Georg; Patak, Alex; Neuspiel, Margaret; Deluyker, Hubert; Slikker, William

    2016-10-01

    "Regulatory Bioinformatics" strives to develop and implement a standardized and transparent bioinformatic framework to support the implementation of existing and emerging technologies in regulatory decision-making. It has great potential to improve public health through the development and use of clinically important medical products and tools to manage the safety of the food supply. However, the application of regulatory bioinformatics also poses new challenges and requires new knowledge and skill sets. In the latest Global Coalition on Regulatory Science Research (GCRSR) governed conference, Global Summit on Regulatory Science (GSRS2015), regulatory bioinformatics principles were presented with respect to global trends, initiatives and case studies. The discussion revealed that datasets, analytical tools, skills and expertise are rapidly developing, in many cases via large international collaborative consortia. It also revealed that significant research is still required to realize the potential applications of regulatory bioinformatics. While there is significant excitement in the possibilities offered by precision medicine to enhance treatments of serious and/or complex diseases, there is a clear need for further development of mechanisms to securely store, curate and share data, integrate databases, and standardized quality control and data analysis procedures. A greater understanding of the biological significance of the data is also required to fully exploit vast datasets that are becoming available. The application of bioinformatics in the microbiological risk analysis paradigm is delivering clear benefits both for the investigation of food borne pathogens and for decision making on clinically important treatments. It is recognized that regulatory bioinformatics will have many beneficial applications by ensuring high quality data, validated tools and standardized processes, which will help inform the regulatory science community of the requirements

  7. Bezafibrate at clinically relevant doses decreases serum/liver triglycerides via down-regulation of sterol regulatory element-binding protein-1c in mice: a novel peroxisome proliferator-activated receptor alpha-independent mechanism.

    PubMed

    Nakajima, Takero; Tanaka, Naoki; Kanbe, Hiroki; Hara, Atsushi; Kamijo, Yuji; Zhang, Xiaowei; Gonzalez, Frank J; Aoyama, Toshifumi

    2009-04-01

    The triglyceride-lowering effect of bezafibrate in humans has been attributed to peroxisome proliferator-activated receptor (PPAR) alpha activation based on results from rodent studies. However, the bezafibrate dosages used in conventional rodent experiments are typically higher than those in clinical use (> or =50 versus < or =10 mg/kg/day), and thus it remains unclear whether such data can be translated to humans. Furthermore, because bezafibrate is a pan-PPAR activator, the actual contribution of PPARalpha to its triglyceride-lowering properties remains undetermined. To address these issues, bezafibrate at clinically relevant doses (10 mg/kg/day; low) was administered to wild-type and Ppara-null mice, and its effects were compared with those from conventionally used doses (100 mg/kg/day; high). Pharmacokinetic analyses showed that maximum plasma concentration and area under the concentration-time curve in bezafibrate-treated mice were similar to those in humans at low doses, but not at high doses. Low-dose bezafibrate decreased serum/liver triglycerides in a PPARalpha-independent manner by attenuation of hepatic lipogenesis and triglyceride secretion. It is noteworthy that instead of PPAR activation, down-regulation of sterol regulatory element-binding protein (SREBP)-1c was observed in mice undergoing low-dose treatment. High-dose bezafibrate decreased serum/liver triglycerides by enhancement of hepatic fatty acid uptake and beta-oxidation via PPARalpha activation, as expected. In conclusion, clinically relevant doses of bezafibrate exert a triglyceride-lowering effect by suppression of the SREBP-1c-regulated pathway in mice and not by PPARalpha activation. Our results may provide novel information about the pharmacological mechanism of bezafibrate action and new insights into the treatment of disorders involving SREBP-1c. PMID:19124612

  8. Evolution of splicing regulatory networks in Drosophila

    PubMed Central

    McManus, C. Joel; Coolon, Joseph D.; Eipper-Mains, Jodi; Wittkopp, Patricia J.; Graveley, Brenton R.

    2014-01-01

    The proteome expanding effects of alternative pre-mRNA splicing have had a profound impact on eukaryotic evolution. The events that create this diversity can be placed into four major classes: exon skipping, intron retention, alternative 5′ splice sites, and alternative 3′ splice sites. Although the regulatory mechanisms and evolutionary pressures among alternative splicing classes clearly differ, how these differences affect the evolution of splicing regulation remains poorly characterized. We used RNA-seq to investigate splicing differences in D. simulans, D. sechellia, and three strains of D. melanogaster. Regulation of exon skipping and tandem alternative 3′ splice sites (NAGNAGs) were more divergent than other splicing classes. Splicing regulation was most divergent in frame-preserving events and events in noncoding regions. We further determined the contributions of cis- and trans-acting changes in splicing regulatory networks by comparing allele-specific splicing in F1 interspecific hybrids, because differences in allele-specific splicing reflect changes in cis-regulatory element activity. We find that species-specific differences in intron retention and alternative splice site usage are primarily attributable to changes in cis-regulatory elements (median ∼80% cis), whereas species-specific exon skipping differences are driven by both cis- and trans-regulatory divergence (median ∼50% cis). These results help define the mechanisms and constraints that influence splicing regulatory evolution and show that networks regulating the four major classes of alternative splicing diverge through different genetic mechanisms. We propose a model in which differences in regulatory network architecture among classes of alternative splicing affect the evolution of splicing regulation. PMID:24515119

  9. Influence of simulated microgravity on clock genes expression rhythmicity and underlying blood circulating miRNAs-mRNA co-expression regulatory mechanism in C57BL/6J mice

    NASA Astrophysics Data System (ADS)

    Lv, Ke; Qu, Lina

    Purpose: It is vital for astronauts to maintain the optimal alertness and neurobehavioral function. Among various factors that exist in the space flight and long-duration mission environment, gravity changes may probably an essential environmental factor to interfere with internal circadian rhythms homeostasis and sleep quality, but the underlying mechanism is unclear. Mammals' biological clock is controlled by the suprachiasmatic nucleus (SCN), and peripheral organs adjust their own rhythmicity with the central signals. Nevertheless,the mechanism underlying this synchronizition process is still unknown. microRNAs (miRNAs) are about 19~22nt long regulatory RNAs that serve as critical modulators of post-transcriptional gene regulation. Recently, circulating miRNAs were found to have the regulatory role between cells and peripheral tissues, besides its function inside the cells. This study aims to investigate the regulatory signal transduction role of miRNAs between SCN and peripheral biological clock effecter tissues and to further decipher the mechanism of circadian disturbance under microgravity. Method: Firstly, based on the assumption that severe alterations in the expression of genes known to be involved in circadian rhythms may affect the expression of other genes, the labeled cDNA from liver and suprachiasmatic nucleus (SCN) of clock-knockout mice and control mice in different time points were cohybridized to microarrays. The fold change exceeding 2 (FC>2) was used to identify genes with altered expression levels in the knockout mice compared with control mice. Secondly, male C57BL/6J mice at 8 weeks of age were individually caged and acclimatized to the laboratory conditions (12h light/dark cycle) before being used for continuous core body temperature and activity monitoring. The mice were individually caged and tail suspended using a strip of adhesive surgical tape attached to a chain hanging from a pulley. Peripheral blood and liver tissues collection

  10. 3 CFR - Regulatory Review

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... been learned since that time. Far more is now known about regulation—not only about when it is... interests of future generations; identify methods of ensuring that regulatory review does not produce...

  11. Assessing the regulatory picture

    SciTech Connect

    Not Available

    1994-02-01

    This article addresses the safety of the nation's drinking water supply and discusses compliance of the Clean Water Act. Right now, the shape of the regulatory future is uncertain. The results of the D-DBP regulatory negotiation are imminent. Congress is ready to begin debating reauthorization of the Safe Drinking Water Act, and utilities are trying to comply with the regulations while trying not to price water out of the reach of some of their customers.

  12. NRC regulatory initiatives

    SciTech Connect

    Johnson, T.C.

    1989-11-01

    The US Nuclear Regulatory Commission (NRC) is addressing several low-level waste disposal issues that will be important to waste generators and to States and Compacts developing new disposal capacity. These issues include Greater-Than-Class C (GTCC) waste, mixed waste, below regulatory concern (BRC) waste, and the low-level waste data base. This paper discusses these issues and their current status.

  13. Influence of simulated microgravity on clock genes expression rhythmicity and underlying blood circulating miRNAs-mRNA co-expression regulatory mechanism in C57BL/6J mice

    NASA Astrophysics Data System (ADS)

    Lv, Ke; Qu, Lina

    Purpose: It is vital for astronauts to maintain the optimal alertness and neurobehavioral function. Among various factors that exist in the space flight and long-duration mission environment, gravity changes may probably an essential environmental factor to interfere with internal circadian rhythms homeostasis and sleep quality, but the underlying mechanism is unclear. Mammals' biological clock is controlled by the suprachiasmatic nucleus (SCN), and peripheral organs adjust their own rhythmicity with the central signals. Nevertheless,the mechanism underlying this synchronizition process is still unknown. microRNAs (miRNAs) are about 19~22nt long regulatory RNAs that serve as critical modulators of post-transcriptional gene regulation. Recently, circulating miRNAs were found to have the regulatory role between cells and peripheral tissues, besides its function inside the cells. This study aims to investigate the regulatory signal transduction role of miRNAs between SCN and peripheral biological clock effecter tissues and to further decipher the mechanism of circadian disturbance under microgravity. Method: Firstly, based on the assumption that severe alterations in the expression of genes known to be involved in circadian rhythms may affect the expression of other genes, the labeled cDNA from liver and suprachiasmatic nucleus (SCN) of clock-knockout mice and control mice in different time points were cohybridized to microarrays. The fold change exceeding 2 (FC>2) was used to identify genes with altered expression levels in the knockout mice compared with control mice. Secondly, male C57BL/6J mice at 8 weeks of age were individually caged and acclimatized to the laboratory conditions (12h light/dark cycle) before being used for continuous core body temperature and activity monitoring. The mice were individually caged and tail suspended using a strip of adhesive surgical tape attached to a chain hanging from a pulley. Peripheral blood and liver tissues collection

  14. Antibodies: Protective, destructive and regulatory role

    SciTech Connect

    Milgrom, F.; Abeyounis, C.J.; Albini, B.

    1985-01-01

    This book contains papers under 10 subject headings. The headings are: Production and Function of Antibodies, Protective Role of Antibodies, Antibodies to Foreign and Neoplastic Cells, Autoantibodies, Regulatory Mechanisms, Allergy, Immune Complexes, Antibodies in Pregnancy and Aging, Administration of Antibodies for Prevention and Therapy, and Abstracts of Poster Presentations.

  15. Negative feedback buffers effects of regulatory variants

    PubMed Central

    Bader, Daniel M; Wilkening, Stefan; Lin, Gen; Tekkedil, Manu M; Dietrich, Kim; Steinmetz, Lars M; Gagneur, Julien

    2015-01-01

    Mechanisms conferring robustness against regulatory variants have been controversial. Previous studies suggested widespread buffering of RNA misexpression on protein levels during translation. We do not find evidence that translational buffering is common. Instead, we find extensive buffering at the level of RNA expression, exerted through negative feedback regulation acting in trans, which reduces the effect of regulatory variants on gene expression. Our approach is based on a novel experimental design in which allelic differential expression in a yeast hybrid strain is compared to allelic differential expression in a pool of its spores. Allelic differential expression in the hybrid is due to cis-regulatory differences only. Instead, in the pool of spores allelic differential expression is not only due to cis-regulatory differences but also due to local trans effects that include negative feedback. We found that buffering through such local trans regulation is widespread, typically compensating for about 15% of cis-regulatory effects on individual genes. Negative feedback is stronger not only for essential genes, indicating its functional relevance, but also for genes with low to middle levels of expression, for which tight regulation matters most. We suggest that negative feedback is one mechanism of Waddington's canalization, facilitating the accumulation of genetic variants that might give selective advantage in different environments. PMID:25634765

  16. Rationales for regulatory activity

    SciTech Connect

    Perhac, R.M.

    1997-02-01

    The author provides an outline which touches on the types of concerns about risk evaluation which are addressed in the process of establishing regulatory guides. Broadly he says regulatory activity serves three broad constituents: (1) Paternalism (private risk); (2) Promotion of social welfare (public risks); (3) Protection of individual rights (public risks). He then discusses some of the major issues encountered in reaching a decision on what is an acceptable level of risk within each of these areas, and how one establishes such a level.

  17. EPAct Transportation Regulatory Activities

    SciTech Connect

    2011-11-21

    The U.S. Department of Energy's (DOE) Vehicle Technologies Program manages several transportation regulatory activities established by the Energy Policy Act of 1992 (EPAct), as amended by the Energy Conservation Reauthorization Act of 1998, EPAct 2005, and the Energy Independence and Security Act of 2007 (EISA).

  18. The regulatory horizon

    NASA Technical Reports Server (NTRS)

    Cook, ED

    1987-01-01

    The author briefly discusses the FAA's position as it relates to cockpit resource management. For example, if Cockpit Resource Management (CRM) is a positive concept, why isn't everyone required to implement it? The regulatory practice of the FAA is discussed and questions and answers are presented.

  19. Transcriptional Regulatory Elements in Fungal Secondary Metabolism

    PubMed Central

    Yin, Wenbing; Keller, Nancy P.

    2013-01-01

    Filamentous fungi produce a variety of secondary metabolites of diverse beneficial and detrimental activities to humankind. The genes encoding the enzymatic machinery required to make these metabolites are typically clustered in fungal genomes. There is considerable evidence that secondary metabolite gene regulation is, in part, by transcriptional control through hierarchical levels of transcriptional regulatory elements involved in secondary metabolite cluster regulation. Identification of secondary metabolism regulatory elements could potentially provide a means of increasing production of beneficial metabolites, decreasing production of detrimental metabolites, aid in the identification of ‘silent’ natural products and also contribute to a broader understanding of molecular mechanisms by which secondary metabolites are produced. This review summarizes regulation of secondary metabolism associated on transcriptional regulatory elements from a broad view as well as tremendous advances in discovery of cryptic or novel secondary metabolites by genomic mining in the basis of this knowledge. PMID:21717315

  20. Regulatory principles governing Salmonella and Yersinia virulence

    PubMed Central

    Erhardt, Marc; Dersch, Petra

    2015-01-01

    Enteric pathogens such as Salmonella and Yersinia evolved numerous strategies to survive and proliferate in different environmental reservoirs and mammalian hosts. Deciphering common and pathogen-specific principles for how these bacteria adjust and coordinate spatiotemporal expression of virulence determinants, stress adaptation, and metabolic functions is fundamental to understand microbial pathogenesis. In order to manage sudden environmental changes, attacks by the host immune systems and microbial competition, the pathogens employ a plethora of transcriptional and post-transcriptional control elements, including transcription factors, sensory and regulatory RNAs, RNAses, and proteases, to fine-tune and control complex gene regulatory networks. Many of the contributing global regulators and the molecular mechanisms of regulation are frequently conserved between Yersinia and Salmonella. However, the interplay, arrangement, and composition of the control elements vary between these closely related enteric pathogens, which generate phenotypic differences leading to distinct pathogenic properties. In this overview we present common and different regulatory networks used by Salmonella and Yersinia to coordinate the expression of crucial motility, cell adhesion and invasion determinants, immune defense strategies, and metabolic adaptation processes. We highlight evolutionary changes of the gene regulatory circuits that result in different properties of the regulatory elements and how this influences the overall outcome of the infection process. PMID:26441883

  1. Regulatory focus affects physician risk tolerance.

    PubMed

    Veazie, Peter J; McIntosh, Scott; Chapman, Benjamin P; Dolan, James G

    2014-01-01

    Risk tolerance is a source of variation in physician decision-making. This variation, if independent of clinical concerns, can result in mistaken utilization of health services. To address such problems, it will be helpful to identify nonclinical factors of risk tolerance, particularly those amendable to intervention-regulatory focus theory suggests such a factor. This study tested whether regulatory focus affects risk tolerance among primary care physicians. Twenty-seven primary care physicians were assigned to promotion-focused or prevention-focused manipulations and compared on the Risk Taking Attitudes in Medical Decision Making scale using a randomization test. Results provide evidence that physicians assigned to the promotion-focus manipulation adopted an attitude of greater risk tolerance than the physicians assigned to the prevention-focused manipulation (p = 0.01). The Cohen's d statistic was conventionally large at 0.92. Results imply that situational regulatory focus in primary care physicians affects risk tolerance and may thereby be a nonclinical source of practice variation. Results also provide marginal evidence that chronic regulatory focus is associated with risk tolerance (p = 0.05), but the mechanism remains unclear. Research and intervention targeting physician risk tolerance may benefit by considering situational regulatory focus as an explanatory factor.

  2. Transmembrane AMPAR regulatory protein γ-2 is required for the modulation of GABA release by presynaptic AMPARs.

    PubMed

    Rigby, Mark; Cull-Candy, Stuart G; Farrant, Mark

    2015-03-11

    Presynaptic ionotropic glutamate receptors (iGluRs) play important roles in the control of synaptogenesis and neurotransmitter release, yet their regulation is poorly understood. In particular, the contribution of transmembrane auxiliary proteins, which profoundly shape the trafficking and gating of somatodendritic iGluRs, is unknown. Here we examined the influence of transmembrane AMPAR regulatory proteins (TARPs) on presynaptic AMPARs in cerebellar molecular layer interneurons (MLIs). 6-cyano-7-nitroquinoxaline-2,3-dione (CNQX), a partial agonist at TARP-associated AMPARs, enhanced spontaneous GABA release in wild-type mice but not in stargazer mice that lack the prototypical TARP stargazin (γ-2). These findings were replicated in mechanically dissociated Purkinje cells with functional adherent synaptic boutons, demonstrating the presynaptic locus of modulation. In dissociated Purkinje cells from stargazer mice, AMPA was able to enhance mIPSC frequency, but only in the presence of the positive allosteric modulator cyclothiazide. Thus, ordinarily, presynaptic AMPARs are unable to enhance spontaneous release without γ-2, which is required predominantly for its effects on channel gating. Presynaptic AMPARs are known to reduce action potential-driven GABA release from MLIs. Although a G-protein-dependent non-ionotropic mechanism has been suggested to underlie this inhibition, paradoxically we found that γ-2, and thus AMPAR gating, was required. Following glutamate spillover from climbing fibers or application of CNQX, evoked GABA release was reduced; in stargazer mice such effects were markedly attenuated in acute slices and abolished in the dissociated Purkinje cell-nerve bouton preparation. We suggest that γ-2 association, by increasing charge transfer, allows presynaptic AMPARs to depolarize the bouton membrane sufficiently to modulate both phasic and spontaneous release. PMID:25762667

  3. Transmembrane AMPAR Regulatory Protein γ-2 Is Required for the Modulation of GABA Release by Presynaptic AMPARs

    PubMed Central

    Cull-Candy, Stuart G.

    2015-01-01

    Presynaptic ionotropic glutamate receptors (iGluRs) play important roles in the control of synaptogenesis and neurotransmitter release, yet their regulation is poorly understood. In particular, the contribution of transmembrane auxiliary proteins, which profoundly shape the trafficking and gating of somatodendritic iGluRs, is unknown. Here we examined the influence of transmembrane AMPAR regulatory proteins (TARPs) on presynaptic AMPARs in cerebellar molecular layer interneurons (MLIs). 6-cyano-7-nitroquinoxaline-2,3-dione (CNQX), a partial agonist at TARP-associated AMPARs, enhanced spontaneous GABA release in wild-type mice but not in stargazer mice that lack the prototypical TARP stargazin (γ-2). These findings were replicated in mechanically dissociated Purkinje cells with functional adherent synaptic boutons, demonstrating the presynaptic locus of modulation. In dissociated Purkinje cells from stargazer mice, AMPA was able to enhance mIPSC frequency, but only in the presence of the positive allosteric modulator cyclothiazide. Thus, ordinarily, presynaptic AMPARs are unable to enhance spontaneous release without γ-2, which is required predominantly for its effects on channel gating. Presynaptic AMPARs are known to reduce action potential-driven GABA release from MLIs. Although a G-protein-dependent non-ionotropic mechanism has been suggested to underlie this inhibition, paradoxically we found that γ-2, and thus AMPAR gating, was required. Following glutamate spillover from climbing fibers or application of CNQX, evoked GABA release was reduced; in stargazer mice such effects were markedly attenuated in acute slices and abolished in the dissociated Purkinje cell-nerve bouton preparation. We suggest that γ-2 association, by increasing charge transfer, allows presynaptic AMPARs to depolarize the bouton membrane sufficiently to modulate both phasic and spontaneous release. PMID:25762667

  4. Transmembrane AMPAR regulatory protein γ-2 is required for the modulation of GABA release by presynaptic AMPARs.

    PubMed

    Rigby, Mark; Cull-Candy, Stuart G; Farrant, Mark

    2015-03-11

    Presynaptic ionotropic glutamate receptors (iGluRs) play important roles in the control of synaptogenesis and neurotransmitter release, yet their regulation is poorly understood. In particular, the contribution of transmembrane auxiliary proteins, which profoundly shape the trafficking and gating of somatodendritic iGluRs, is unknown. Here we examined the influence of transmembrane AMPAR regulatory proteins (TARPs) on presynaptic AMPARs in cerebellar molecular layer interneurons (MLIs). 6-cyano-7-nitroquinoxaline-2,3-dione (CNQX), a partial agonist at TARP-associated AMPARs, enhanced spontaneous GABA release in wild-type mice but not in stargazer mice that lack the prototypical TARP stargazin (γ-2). These findings were replicated in mechanically dissociated Purkinje cells with functional adherent synaptic boutons, demonstrating the presynaptic locus of modulation. In dissociated Purkinje cells from stargazer mice, AMPA was able to enhance mIPSC frequency, but only in the presence of the positive allosteric modulator cyclothiazide. Thus, ordinarily, presynaptic AMPARs are unable to enhance spontaneous release without γ-2, which is required predominantly for its effects on channel gating. Presynaptic AMPARs are known to reduce action potential-driven GABA release from MLIs. Although a G-protein-dependent non-ionotropic mechanism has been suggested to underlie this inhibition, paradoxically we found that γ-2, and thus AMPAR gating, was required. Following glutamate spillover from climbing fibers or application of CNQX, evoked GABA release was reduced; in stargazer mice such effects were markedly attenuated in acute slices and abolished in the dissociated Purkinje cell-nerve bouton preparation. We suggest that γ-2 association, by increasing charge transfer, allows presynaptic AMPARs to depolarize the bouton membrane sufficiently to modulate both phasic and spontaneous release.

  5. Toxicogenomics and the Regulatory Framework

    EPA Science Inventory

    Toxicogenomics presents regulatory agencies with the opportunity to revolutionize their analyses by enabling the collection of information on a broader range of responses than currently considered in traditional regulatory decision making. Analyses of genomic responses are expec...

  6. Understanding the molecular mechanism of transcriptional regulation of banana Sucrose phosphate synthase (SPS) gene during fruit ripening: an insight into the functions of various cis-acting regulatory elements.

    PubMed

    Choudhury, Swarup Roy; Roy, Sujit; Singh, Sanjay Kumar; Sengupta, Dibyendu N

    2010-05-01

    Recently, we have reported the characterization of promoter region of Sucrose phosphate synthase (SPS) gene in banana and investigated the role of some cis-elements/motifs, present in the promoter of SPS, in the transcriptional regulation of the gene. DNA-protein interaction studies have demonstrated the presence of specific trans-acting factors which showed specific interactions with ethylene, auxin, low temperature and light responsive elements in regulating SPS transcription. Transient expression analyses have demonstrated the functional significance of the various cis-acting regulatory elements present in banana SPS promoter in regulating SPS expression during ripening. (1) Here, we have further discussed the possible role of these regulatory sequences in the regulation of transcriptional network and comment on their function in relation to sucrose metabolism during banana fruit ripening. PMID:20139735

  7. Nuclear Regulatory Commission information digest

    SciTech Connect

    None,

    1990-03-01

    The Nuclear Regulatory Commission information digest provides summary information regarding the US Nuclear Regulatory Commission, its regulatory responsibilities, and areas licensed by the commission. This is an annual publication for the general use of the NRC Staff and is available to the public. The digest is divided into two parts: the first presents an overview of the US Nuclear Regulatory Commission and the second provides data on NRC commercial nuclear reactor licensees and commercial nuclear power reactors worldwide.

  8. 12 CFR 562.2 - Regulatory reports.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... of the special supervisory, regulatory, and economic policy needs served by such reports. Regulatory... reflects the underlying economic substance of the transaction at issue. Regulatory reporting...

  9. 78 FR 44329 - Regulatory Agenda

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-07-23

    ....nasa.gov/open . Timetable: Action Date FR Cite NPRM 10/00/13 Regulatory Flexibility Analysis Required... Administration (NASA). ACTION: Semiannual regulatory agenda. SUMMARY: NASA's regulatory agenda describes those regulations being considered for development or amendment by NASA, the need and legal basis for the...

  10. 75 FR 79759 - Regulatory Agenda

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-12-20

    ... Action 04/16/10 75 FR 2012 Regulatory Flexibility Analysis Required: Yes Agency Contact: Mohammed Khan... ``Regulatory Planning and Review,'' 58 FR 51735, and the Regulatory Flexibility Act, 5 U.S.C. 601 et seq... use throughout the rulemaking process. Timetable: Action Date FR Cite Notice: Public Meeting...

  11. Regulator of G protein signaling 2 (RGS2) and RGS4 form distinct G protein-dependent complexes with protease activated-receptor 1 (PAR1) in live cells.

    PubMed

    Ghil, Sungho; McCoy, Kelly L; Hepler, John R

    2014-01-01

    Protease-activated receptor 1 (PAR1) is a G-protein coupled receptor (GPCR) that is activated by natural proteases to regulate many physiological actions. We previously reported that PAR1 couples to Gi, Gq and G12 to activate linked signaling pathways. Regulators of G protein signaling (RGS) proteins serve as GTPase activating proteins to inhibit GPCR/G protein signaling. Some RGS proteins interact directly with certain GPCRs to modulate their signals, though cellular mechanisms dictating selective RGS/GPCR coupling are poorly understood. Here, using bioluminescence resonance energy transfer (BRET), we tested whether RGS2 and RGS4 bind to PAR1 in live COS-7 cells to regulate PAR1/Gα-mediated signaling. We report that PAR1 selectively interacts with either RGS2 or RGS4 in a G protein-dependent manner. Very little BRET activity is observed between PAR1-Venus (PAR1-Ven) and either RGS2-Luciferase (RGS2-Luc) or RGS4-Luc in the absence of Gα. However, in the presence of specific Gα subunits, BRET activity was markedly enhanced between PAR1-RGS2 by Gαq/11, and PAR1-RGS4 by Gαo, but not by other Gα subunits. Gαq/11-YFP/RGS2-Luc BRET activity is promoted by PAR1 and is markedly enhanced by agonist (TFLLR) stimulation. However, PAR1-Ven/RGS-Luc BRET activity was blocked by a PAR1 mutant (R205A) that eliminates PAR1-Gq/11 coupling. The purified intracellular third loop of PAR1 binds directly to purified His-RGS2 or His-RGS4. In cells, RGS2 and RGS4 inhibited PAR1/Gα-mediated calcium and MAPK/ERK signaling, respectively, but not RhoA signaling. Our findings indicate that RGS2 and RGS4 interact directly with PAR1 in Gα-dependent manner to modulate PAR1/Gα-mediated signaling, and highlight a cellular mechanism for selective GPCR/G protein/RGS coupling.

  12. The Michigan regulatory incentives study for electric utilities

    SciTech Connect

    Reid, M.W.; Weaver, E.M. )

    1991-06-17

    This is the final report of Phase I of the Michigan Regulatory Incentives Study for Electric Utilities, a three-phase review of Michigan's regulatory system and its effects on resource selection by electric utilities. The goal of Phase I is to identify and analyze financial incentive mechanisms that encourage selection of resources in accord with the principles of integrated resource planning (IRP) or least-cost planning (LCP). Subsequent study phases will involve further analysis of options and possibly a collaborative formal effort to propose regulatory changes. The Phase I analysis proceeded in three steps: (1) identification and review of existing regulatory practices that affect utilities; selection of resources, particularly DSM; (2) preliminary analysis of ten financial mechanisms, and selection of three for further study; (3) detailed analysis of the three mechanisms, including consideration of how they could be implemented in Michigan and financial modeling of their likely impacts on utilities and ratepayers.

  13. Establishing regulatory priorities

    SciTech Connect

    Pontius, F.W.

    1995-12-01

    Statutory deadlines for setting regulations under the 1986 Safe Drinking Water Act (SDWA) have not been met. Faced with limited resources, the US Environmental Protection Agency (USEPA) has historically set regulatory priorities based on perceived need, politics, and legal deadlines. This has resulted in a fragmented regulatory program and confusion on the part of the regulated community and on the part of other stakeholders. Even though the agency has been subject to court-imposed deadlines for most new regulations, resource limitations have caused these deadlines to be missed, resulting in new court-imposed deadlines. In 1994, the agency began considering a new approach for determining how many regulations can be developed and in what order. A draft strategic plan was prepared in December 1994. Based on discussion of this plan, USEPA requested the US District Court for Oregon to extend certain regulatory deadlines so that new priorities could be set for the highest-risk substances. An extension was granted until Aug. 1, 1995, and was subsequently extended to Dec. 15, 1995.

  14. Regulatory aspects on nanomedicines.

    PubMed

    Sainz, Vanessa; Conniot, João; Matos, Ana I; Peres, Carina; Zupancic, Eva; Moura, Liane; Silva, Liana C; Florindo, Helena F; Gaspar, Rogério S

    2015-12-18

    Nanomedicines have been in the forefront of pharmaceutical research in the last decades, creating new challenges for research community, industry, and regulators. There is a strong demand for the fast development of scientific and technological tools to address unmet medical needs, thus improving human health care and life quality. Tremendous advances in the biomaterials and nanotechnology fields have prompted their use as promising tools to overcome important drawbacks, mostly associated to the non-specific effects of conventional therapeutic approaches. However, the wide range of application of nanomedicines demands a profound knowledge and characterization of these complex products. Their properties need to be extensively understood to avoid unpredicted effects on patients, such as potential immune reactivity. Research policy and alliances have been bringing together scientists, regulators, industry, and, more frequently in recent years, patient representatives and patient advocacy institutions. In order to successfully enhance the development of new technologies, improved strategies for research-based corporate organizations, more integrated research tools dealing with appropriate translational requirements aiming at clinical development, and proactive regulatory policies are essential in the near future. This review focuses on the most important aspects currently recognized as key factors for the regulation of nanomedicines, discussing the efforts under development by industry and regulatory agencies to promote their translation into the market. Regulatory Science aspects driving a faster and safer development of nanomedicines will be a central issue for the next years.

  15. MISAE: a new approach for regulatory motif extraction.

    PubMed

    Sun, Zhaohui; Yang, Jingyi; Deogun, Jitender S

    2004-01-01

    The recognition of regulatory motifs of co-regulated genes is essential for understanding the regulatory mechanisms. However, the automatic extraction of regulatory motifs from a given data set of the upstream non-coding DNA sequences of a family of co-regulated genes is difficult because regulatory motifs are often subtle and inexact. This problem is further complicated by the corruption of the data sets. In this paper, a new approach called Mismatch-allowed Probabilistic Suffix Tree Motif Extraction (MISAE) is proposed. It combines the mismatch-allowed probabilistic suffix tree that is a probabilistic model and local prediction for the extraction of regulatory motifs. The proposed approach is tested on 15 co-regulated gene families and compares favorably with other state-of-the-art approaches. Moreover, MISAE performs well on "corrupted" data sets. It is able to extract the motif from a "corrupted" data set with less than one fourth of the sequences containing the real motif.

  16. YTRP: a repository for yeast transcriptional regulatory pathways.

    PubMed

    Yang, Tzu-Hsien; Wang, Chung-Ching; Wang, Yu-Chao; Wu, Wei-Sheng

    2014-01-01

    Regulatory targets of transcription factors (TFs) can be identified by the TF perturbation experiments, which reveal the expression changes owing to the perturbation (deletion or overexpression) of TFs. But the identified targets of a given TF consist of both direct and indirect regulatory targets. It has been shown that most of the TFPE-identified regulatory targets are indirect, indicating that TF-gene regulation is mainly through transcriptional regulatory pathways (TRPs) consisting of intermediate TFs. Without identification of these TRPs, it is not easy to understand how a TF regulates its indirect targets. Because there is no such database depositing the potential TRPs for Saccharomyces cerevisiae now, this motivates us to construct the YTRP (Yeast Transcriptional Regulatory Pathway) database. For each TF-gene regulatory pair under different experimental conditions, all possible TRPs in two underlying networks (constructed using experimentally verified TF-gene binding pairs and TF-gene regulatory pairs from the literature) for the specified experimental conditions were automatically enumerated by TRP mining procedures developed from the graph theory. The enumerated TRPs of a TF-gene regulatory pair provide experimentally testable hypotheses for the molecular mechanisms behind a TF and its regulatory target. YTRP is available online at http://cosbi3.ee.ncku.edu.tw/YTRP/. We believe that the TRPs deposited in this database will greatly improve the usefulness of TFPE data for yeast biologists to study the regulatory mechanisms between a TF and its knocked-out targets. Database URL: http://cosbi3.ee.ncku.edu.tw/YTRP/.

  17. Regulatory network rewiring for secondary metabolism in Arabidopsis thaliana under various conditions

    PubMed Central

    2014-01-01

    Background Plant secondary metabolites are critical to various biological processes. However, the regulations of these metabolites are complex because of regulatory rewiring or crosstalk. To unveil how regulatory behaviors on secondary metabolism reshape biological processes, we constructed and analyzed a dynamic regulatory network of secondary metabolic pathways in Arabidopsis. Results The dynamic regulatory network was constructed through integrating co-expressed gene pairs and regulatory interactions. Regulatory interactions were either predicted by conserved transcription factor binding sites (TFBSs) or proved by experiments. We found that integrating two data (co-expression and predicted regulatory interactions) enhanced the number of highly confident regulatory interactions by over 10% compared with using single data. The dynamic changes of regulatory network systematically manifested regulatory rewiring to explain the mechanism of regulation, such as in terpenoids metabolism, the regulatory crosstalk of RAV1 (AT1G13260) and ATHB1 (AT3G01470) on HMG1 (hydroxymethylglutaryl-CoA reductase, AT1G76490); and regulation of RAV1 on epoxysqualene biosynthesis and sterol biosynthesis. Besides, we investigated regulatory rewiring with expression, network topology and upstream signaling pathways. Regulatory rewiring was revealed by the variability of genes’ expression: pathway genes and transcription factors (TFs) were significantly differentially expressed under different conditions (such as terpenoids biosynthetic genes in tissue experiments and E2F/DP family members in genotype experiments). Both network topology and signaling pathways supported regulatory rewiring. For example, we discovered correlation among the numbers of pathway genes, TFs and network topology: one-gene pathways (such as δ-carotene biosynthesis) were regulated by a fewer TFs, and were not critical to metabolic network because of their low degrees in topology. Upstream signaling pathways of 50

  18. Toxicogenomics in regulatory ecotoxicology

    USGS Publications Warehouse

    Ankley, Gerald T.; Daston, George P.; Degitz, Sigmund J.; Denslow, Nancy D.; Hoke, Robert A.; Kennedy, Sean W.; Miracle, Ann L.; Perkins, Edward J.; Snape, Jason; Tillitt, Donald E.; Tyler, Charles R.; Versteeg, Donald

    2006-01-01

    Recently, we have witnessed an explosion of different genomic approaches that, through a combination of advanced biological, instrumental, and bioinformatic techniques, can yield a previously unparalleled amount of data concerning the molecular and biochemical status of organisms. Fueled partially by large, well-publicized efforts such as the Human Genome Project, genomic research has become a rapidly growing topical area in multiple biological disciplines. Since 1999, when the term “toxicogenomics” was coined to describe the application of genomics to toxicology (1), a rapid increase in publications on the topic has occurred (Figure 1). The potential utility of toxicogenomics in toxicological research and regulatory activities has been the subject of scientific discussions and, as with any new technology, has evoked a wide range of opinion (2–6). VIEWPOINT © 2006 american chemical Society july 1, 2006 / EnvironmEntal SciEncE & tEchnology n 4055 The purpose of this feature article is to consider the roles of toxicogenomics in the field of regulatory ecotoxicology, explore current limitations in the science and practice of genomics, and propose possible avenues to approach and resolve some of the major challenges. A significant amount of input to our analysis came from a workshop sponsored by the Society of Environmental Toxicology and Chemistry (SETAC) in Pellston, Mich., in September 2005. A complete list of names and affiliations of the experts participating in that workshop is provided online in Table 1 of the Supporting Information for this paper.

  19. Genetic Regulatory Networks in Embryogenesis and Evolution

    NASA Technical Reports Server (NTRS)

    1998-01-01

    The article introduces a series of papers that were originally presented at a workshop titled Genetic Regulatory Network in Embryogenesis and Evaluation. Contents include the following: evolution of cleavage programs in relationship to axial specification and body plan evolution, changes in cell lineage specification elucidate evolutionary relations in spiralia, axial patterning in the leech: developmental mechanisms and evolutionary implications, hox genes in arthropod development and evolution, heterochronic genes in development and evolution, a common theme for LIM homeobox gene function across phylogeny, and mechanisms of specification in ascidian embryos.

  20. Radiation and the regulatory landscape of neo2-Darwinism.

    PubMed

    Rollo, C David

    2006-05-11

    Several recently revealed features of eukaryotic genomes were not predicted by earlier evolutionary paradigms, including the relatively small number of genes, the very large amounts of non-functional code and its quarantine in heterochromatin, the remarkable conservation of many functionally important genes across relatively enormous phylogenetic distances, and the prevalence of extra-genomic information associated with chromatin structure and histone proteins. All of these emphasize a paramount role for regulatory evolution, which is further reinforced by recent perspectives highlighting even higher-order regulation governing epigenetics and development (EVO-DEVO). Modern neo2-Darwinism, with its emphasis on regulatory mechanisms and regulatory evolution provides new vision for understanding radiation biology, particularly because free radicals and redox states are central to many regulatory mechanisms and free radicals generated by radiation mimic and amplify endogenous signalling. This paper explores some of these aspects and their implications for low-dose radiation biology.

  1. (Q)SAR modeling and safety assessment in regulatory review.

    PubMed

    Kruhlak, N L; Benz, R D; Zhou, H; Colatsky, T J

    2012-03-01

    The ability to predict clinical safety based on chemical structures is becoming an increasingly important part of regulatory decision making. (Quantitative) structure-activity relationship ((Q)SAR) models are currently used to evaluate late-arising safety concerns and possible nonclinical effects of a drug and its related compounds when adequate safety data are absent or equivocal. Regulatory use will likely increase with the standardization of analytical approaches, more complete and reliable data collection methods, and a better understanding of toxicity mechanisms.

  2. Regulatory Streamlining and Improvement

    SciTech Connect

    Mark A. Carl

    2006-07-11

    The Interstate Oil and Gas Compact Commission (IOGCC) engaged in numerous projects outlined under the scope of work discussed in the United States Department of Energy (DOE) grant number DE-FC26-04NT15456 awarded to the IOGCC. Numerous projects were completed that were extremely valuable to state oil and gas agencies as a result of work performed utilizing resources provided by the grant. There are numerous areas in which state agencies still need assistance. This additional assistance will need to be addressed under future scopes of work submitted annually to DOE's Project Officer for this grant. This report discusses the progress of the projects outlined under the grant scope of work for the 2005-2006 areas of interest, which are as follows: Area of Interest No. 1--Regulatory Streamlining and Improvement: This area of interest continues to support IOGCC's regulatory streamlining efforts that include the identification and elimination of unnecessary duplications of efforts between and among state and federal programs dealing with exploration and production on public lands. Area of Interest No. 2--Technology: This area of interest seeks to improve efficiency in states through the identification of technologies that can reduce costs. Area of Interest No. 3--Training and Education: This area of interest is vital to upgrading the skills of regulators and industry alike. Within the National Energy Policy, there are many appropriate training and education opportunities. Education was strongly endorsed by the President's National Energy Policy Development group. Acting through the governors offices, states are very effective conduits for the dissemination of energy education information. While the IOGCC favors the development of a comprehensive, long-term energy education plan, states are also supportive of immediate action on important concerns, such as energy prices, availability and conservation. Area of Interest No. 4--Resource Assessment and Development: This area

  3. Autonomous Boolean Models of Regulatory Networks

    NASA Astrophysics Data System (ADS)

    Sun, Mengyang; Cheng, Xianrui; Socolar, Joshua

    2013-03-01

    Autonomous Boolean network (ABN) models have been developed to represent directly the connectivity, logic, and timing of updates in regulatory networks. An ABN is a Boolean network in which the sequence of updates of nodes is determined internally by time delay parameters associated with each link. We propose a method to convert a given ODE model into an ABN that is applicable when the ODE dynamics produces clearly separated high and low values at each node. The ODE parameters are mapped into ABN logic and delay parameters using only local information about each link. Using the example of Ingolia's ODE model of the regulatory network that maintains segment boundaries in the Drosophila embryo, we show that the resulting ABN model captures both the biologically relevant outcomes and the transient dynamics of the ODE model, and that the ABN framework provides direct insights into the mechanism supporting the biological function.

  4. Autonomous Boolean modeling of gene regulatory networks

    NASA Astrophysics Data System (ADS)

    Socolar, Joshua; Sun, Mengyang; Cheng, Xianrui

    2014-03-01

    In cases where the dynamical properties of gene regulatory networks are important, a faithful model must include three key features: a network topology; a functional response of each element to its inputs; and timing information about the transmission of signals across network links. Autonomous Boolean network (ABN) models are efficient representations of these elements and are amenable to analysis. We present an ABN model of the gene regulatory network governing cell fate specification in the early sea urchin embryo, which must generate three bands of distinct tissue types after several cell divisions, beginning from an initial condition with only two distinct cell types. Analysis of the spatial patterning problem and the dynamics of a network constructed from available experimental results reveals that a simple mechanism is at work in this case. Supported by NSF Grant DMS-10-68602

  5. Metabolic constraint-based refinement of transcriptional regulatory networks.

    PubMed

    Chandrasekaran, Sriram; Price, Nathan D

    2013-01-01

    There is a strong need for computational frameworks that integrate different biological processes and data-types to unravel cellular regulation. Current efforts to reconstruct transcriptional regulatory networks (TRNs) focus primarily on proximal data such as gene co-expression and transcription factor (TF) binding. While such approaches enable rapid reconstruction of TRNs, the overwhelming combinatorics of possible networks limits identification of mechanistic regulatory interactions. Utilizing growth phenotypes and systems-level constraints to inform regulatory network reconstruction is an unmet challenge. We present our approach Gene Expression and Metabolism Integrated for Network Inference (GEMINI) that links a compendium of candidate regulatory interactions with the metabolic network to predict their systems-level effect on growth phenotypes. We then compare predictions with experimental phenotype data to select phenotype-consistent regulatory interactions. GEMINI makes use of the observation that only a small fraction of regulatory network states are compatible with a viable metabolic network, and outputs a regulatory network that is simultaneously consistent with the input genome-scale metabolic network model, gene expression data, and TF knockout phenotypes. GEMINI preferentially recalls gold-standard interactions (p-value = 10(-172)), significantly better than using gene expression alone. We applied GEMINI to create an integrated metabolic-regulatory network model for Saccharomyces cerevisiae involving 25,000 regulatory interactions controlling 1597 metabolic reactions. The model quantitatively predicts TF knockout phenotypes in new conditions (p-value = 10(-14)) and revealed potential condition-specific regulatory mechanisms. Our results suggest that a metabolic constraint-based approach can be successfully used to help reconstruct TRNs from high-throughput data, and highlights the potential of using a biochemically-detailed mechanistic framework to

  6. Metabolic constraint-based refinement of transcriptional regulatory networks.

    PubMed

    Chandrasekaran, Sriram; Price, Nathan D

    2013-01-01

    There is a strong need for computational frameworks that integrate different biological processes and data-types to unravel cellular regulation. Current efforts to reconstruct transcriptional regulatory networks (TRNs) focus primarily on proximal data such as gene co-expression and transcription factor (TF) binding. While such approaches enable rapid reconstruction of TRNs, the overwhelming combinatorics of possible networks limits identification of mechanistic regulatory interactions. Utilizing growth phenotypes and systems-level constraints to inform regulatory network reconstruction is an unmet challenge. We present our approach Gene Expression and Metabolism Integrated for Network Inference (GEMINI) that links a compendium of candidate regulatory interactions with the metabolic network to predict their systems-level effect on growth phenotypes. We then compare predictions with experimental phenotype data to select phenotype-consistent regulatory interactions. GEMINI makes use of the observation that only a small fraction of regulatory network states are compatible with a viable metabolic network, and outputs a regulatory network that is simultaneously consistent with the input genome-scale metabolic network model, gene expression data, and TF knockout phenotypes. GEMINI preferentially recalls gold-standard interactions (p-value = 10(-172)), significantly better than using gene expression alone. We applied GEMINI to create an integrated metabolic-regulatory network model for Saccharomyces cerevisiae involving 25,000 regulatory interactions controlling 1597 metabolic reactions. The model quantitatively predicts TF knockout phenotypes in new conditions (p-value = 10(-14)) and revealed potential condition-specific regulatory mechanisms. Our results suggest that a metabolic constraint-based approach can be successfully used to help reconstruct TRNs from high-throughput data, and highlights the potential of using a biochemically-detailed mechanistic framework to

  7. 77 FR 7972 - Regulatory Agenda

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-02-13

    ... agenda pursuant to Executive Order 12866, ``Regulatory Planning and Review,'' 58 FR 51735, and the... Identifier No. 396 National Standards to 1105-AB34 Prevent, Detect, and Respond to Prison Rape (Reg Plan Seq... Prevent, Detect, and Respond to Prison Rape Regulatory Plan: This entry is Seq. No. 85 in part II of...

  8. 78 FR 1634 - Regulatory Agenda

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-01-08

    ... Administration (NASA). ACTION: Semiannual regulatory agenda. SUMMARY: NASA's regulatory agenda describes those regulations being considered for development or amendment by NASA, the need and legal basis for the actions... Controls and Management Systems, Office of Management Systems Division, NASA Headquarters, Washington,...

  9. 78 FR 1574 - Regulatory Agenda

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-01-08

    ... and stability to receive opioid addiction treatment medication. Timetable: Action Date FR Cite NPRM 06/19/09 74 FR 29153 NPRM Comment Period End 08/18/09 Final Action 12/06/12 77 FR 72752 Regulatory... FR Cite NPRM 03/00/13 Regulatory Flexibility Analysis Required: Yes. Agency Contact: Charles...

  10. Regulatory Foci and Organizational Commitment

    ERIC Educational Resources Information Center

    Markovits, Yannis; Ullrich, Johannes; van Dick, Rolf; Davis, Ann J.

    2008-01-01

    We use regulatory focus theory to derive specific predictions regarding the differential relationships between regulatory focus and commitment. We estimated a structural equation model using a sample of 520 private and public sector employees and found in line with our hypotheses that (a) promotion focus related more strongly to affective…

  11. Conjugated Bilirubin Differentially Regulates CD4+ T Effector Cells and T Regulatory Cell Function through Outside-In and Inside-Out Mechanisms: The Effects of HAV Cell Surface Receptor and Intracellular Signaling.

    PubMed

    Corral-Jara, Karla F; Trujillo-Ochoa, Jorge L; Realpe, Mauricio; Panduro, Arturo; Gómez-Leyva, Juan F; Rosenstein, Yvonne; Jose-Abrego, Alexis; Roman, Sonia; Fierro, Nora A

    2016-01-01

    We recently reported an immune-modulatory role of conjugated bilirubin (CB) in hepatitis A virus (HAV) infection. During this infection the immune response relies on CD4+ T lymphocytes (TLs) and it may be affected by the interaction of HAV with its cellular receptor (HAVCR1/TIM-1) on T cell surface. How CB might affect T cell function during HAV infection remains to be elucidated. Herein, in vitro stimulation of CD4+ TLs from healthy donors with CB resulted in a decrease in the degree of intracellular tyrosine phosphorylation and an increase in the activity of T regulatory cells (Tregs) expressing HAVCR1/TIM-1. A comparison between CD4+ TLs from healthy donors and HAV-infected patients revealed changes in the TCR signaling pathway relative to changes in CB levels. The proportion of CD4+CD25+ TLs increased in patients with low CB serum levels and an increase in the percentage of Tregs expressing HAVCR1/TIM-1 was found in HAV-infected patients relative to controls. A low frequency of 157insMTTTVP insertion in the viral receptor gene HAVCR1/TIM-1 was found in patients and controls. Our data revealed that, during HAV infection, CB differentially regulates CD4+ TLs and Tregs functions by modulating intracellular pathways and by inducing changes in the proportion of Tregs expressing HAVCR1/TIM-1. PMID:27578921

  12. IL-2 regulates FOXP3 expression in human CD4+CD25+ regulatory T cells through a STAT-dependent mechanism and induces the expansion of these cells in vivo

    PubMed Central

    Zorn, Emmanuel; Nelson, Erik A.; Mohseni, Mehrdad; Porcheray, Fabrice; Kim, Haesook; Litsa, Despina; Bellucci, Roberto; Raderschall, Elke; Canning, Christine; Soiffer, Robert J.; Frank, David A.; Ritz, Jerome

    2006-01-01

    IL-2 plays a critical role in the maintenance of CD4+CD25+ FOXP3+ regulatory T cells (Tregs) in vivo. We examined the effects of IL-2 signaling in human Tregs. In vitro, IL-2 selectively up-regulated the expression of FOXP3 in purified CD4+CD25+ T cells but not in CD4+CD25- cells. This regulation involved the binding of STAT3 and STAT5 proteins to a highly conserved STAT-binding site located in the first intron of the FOXP3 gene. We also examined the effects of low-dose IL-2 treatment in 12 patients with metastatic cancer and 9 patients with chronic myelogenous leukemia after allogeneic hematopoietic stem cell transplantation. Overall, IL-2 treatment resulted in a 1.9 median fold increase in the frequency of CD4+CD25+ cells in peripheral blood as well as a 9.7 median fold increase in FOXP3 expression in CD3+ T cells. CD56+CD3- natural killer (NK) cells also expanded during IL-2 therapy but did not express FOXP3. In vitro treatment of NK cells with 5-aza-2′-deoxycytidine restored the IL-2 signaling pathway leading to FOXP3 expression, suggesting that this gene was constitutively repressed by DNA methylation in these cells. Our findings support the clinical evaluation of low-dose IL-2 to selectively modulate CD4+CD25+ Tregs and increase expression of FOXP3 in vivo. PMID:16645171

  13. Conjugated Bilirubin Differentially Regulates CD4+ T Effector Cells and T Regulatory Cell Function through Outside-In and Inside-Out Mechanisms: The Effects of HAV Cell Surface Receptor and Intracellular Signaling

    PubMed Central

    Corral-Jara, Karla F.; Gómez-Leyva, Juan F.; Rosenstein, Yvonne; Jose-Abrego, Alexis; Roman, Sonia

    2016-01-01

    We recently reported an immune-modulatory role of conjugated bilirubin (CB) in hepatitis A virus (HAV) infection. During this infection the immune response relies on CD4+ T lymphocytes (TLs) and it may be affected by the interaction of HAV with its cellular receptor (HAVCR1/TIM-1) on T cell surface. How CB might affect T cell function during HAV infection remains to be elucidated. Herein, in vitro stimulation of CD4+ TLs from healthy donors with CB resulted in a decrease in the degree of intracellular tyrosine phosphorylation and an increase in the activity of T regulatory cells (Tregs) expressing HAVCR1/TIM-1. A comparison between CD4+ TLs from healthy donors and HAV-infected patients revealed changes in the TCR signaling pathway relative to changes in CB levels. The proportion of CD4+CD25+ TLs increased in patients with low CB serum levels and an increase in the percentage of Tregs expressing HAVCR1/TIM-1 was found in HAV-infected patients relative to controls. A low frequency of 157insMTTTVP insertion in the viral receptor gene HAVCR1/TIM-1 was found in patients and controls. Our data revealed that, during HAV infection, CB differentially regulates CD4+ TLs and Tregs functions by modulating intracellular pathways and by inducing changes in the proportion of Tregs expressing HAVCR1/TIM-1. PMID:27578921

  14. Conjugated Bilirubin Differentially Regulates CD4+ T Effector Cells and T Regulatory Cell Function through Outside-In and Inside-Out Mechanisms: The Effects of HAV Cell Surface Receptor and Intracellular Signaling.

    PubMed

    Corral-Jara, Karla F; Trujillo-Ochoa, Jorge L; Realpe, Mauricio; Panduro, Arturo; Gómez-Leyva, Juan F; Rosenstein, Yvonne; Jose-Abrego, Alexis; Roman, Sonia; Fierro, Nora A

    2016-01-01

    We recently reported an immune-modulatory role of conjugated bilirubin (CB) in hepatitis A virus (HAV) infection. During this infection the immune response relies on CD4+ T lymphocytes (TLs) and it may be affected by the interaction of HAV with its cellular receptor (HAVCR1/TIM-1) on T cell surface. How CB might affect T cell function during HAV infection remains to be elucidated. Herein, in vitro stimulation of CD4+ TLs from healthy donors with CB resulted in a decrease in the degree of intracellular tyrosine phosphorylation and an increase in the activity of T regulatory cells (Tregs) expressing HAVCR1/TIM-1. A comparison between CD4+ TLs from healthy donors and HAV-infected patients revealed changes in the TCR signaling pathway relative to changes in CB levels. The proportion of CD4+CD25+ TLs increased in patients with low CB serum levels and an increase in the percentage of Tregs expressing HAVCR1/TIM-1 was found in HAV-infected patients relative to controls. A low frequency of 157insMTTTVP insertion in the viral receptor gene HAVCR1/TIM-1 was found in patients and controls. Our data revealed that, during HAV infection, CB differentially regulates CD4+ TLs and Tregs functions by modulating intracellular pathways and by inducing changes in the proportion of Tregs expressing HAVCR1/TIM-1.

  15. Tempo and mode of regulatory evolution in Drosophila.

    PubMed

    Coolon, Joseph D; McManus, C Joel; Stevenson, Kraig R; Graveley, Brenton R; Wittkopp, Patricia J

    2014-05-01

    Genetic changes affecting gene expression contribute to phenotypic divergence; thus, understanding how regulatory networks controlling gene expression change over time is critical for understanding evolution. Prior studies of expression differences within and between species have identified properties of regulatory divergence, but technical and biological differences among these studies make it difficult to assess the generality of these properties or to understand how regulatory changes accumulate with divergence time. Here, we address these issues by comparing gene expression among strains and species of Drosophila with a range of divergence times and use F1 hybrids to examine inheritance patterns and disentangle cis- and trans-regulatory changes. We find that the fixation of compensatory changes has caused the regulation of gene expression to diverge more rapidly than gene expression itself. Specifically, we observed that the proportion of genes with evidence of cis-regulatory divergence has increased more rapidly with divergence time than the proportion of genes with evidence of expression differences. Surprisingly, the amount of expression divergence explained by cis-regulatory changes did not increase steadily with divergence time, as was previously proposed. Rather, one species (Drosophila sechellia) showed an excess of cis-regulatory divergence that we argue most likely resulted from positive selection in this lineage. Taken together, this work reveals not only the rate at which gene expression evolves, but also the molecular and evolutionary mechanisms responsible for this evolution.

  16. Tempo and mode of regulatory evolution in Drosophila

    PubMed Central

    Coolon, Joseph D.; McManus, C. Joel; Stevenson, Kraig R.; Graveley, Brenton R.; Wittkopp, Patricia J.

    2014-01-01

    Genetic changes affecting gene expression contribute to phenotypic divergence; thus, understanding how regulatory networks controlling gene expression change over time is critical for understanding evolution. Prior studies of expression differences within and between species have identified properties of regulatory divergence, but technical and biological differences among these studies make it difficult to assess the generality of these properties or to understand how regulatory changes accumulate with divergence time. Here, we address these issues by comparing gene expression among strains and species of Drosophila with a range of divergence times and use F1 hybrids to examine inheritance patterns and disentangle cis- and trans-regulatory changes. We find that the fixation of compensatory changes has caused the regulation of gene expression to diverge more rapidly than gene expression itself. Specifically, we observed that the proportion of genes with evidence of cis-regulatory divergence has increased more rapidly with divergence time than the proportion of genes with evidence of expression differences. Surprisingly, the amount of expression divergence explained by cis-regulatory changes did not increase steadily with divergence time, as was previously proposed. Rather, one species (Drosophila sechellia) showed an excess of cis-regulatory divergence that we argue most likely resulted from positive selection in this lineage. Taken together, this work reveals not only the rate at which gene expression evolves, but also the molecular and evolutionary mechanisms responsible for this evolution. PMID:24567308

  17. Re-evaluation of Non-regulatory Asbestos Group Minerals for Regulatory Agencies

    NASA Astrophysics Data System (ADS)

    Dogan, M.; Dogan, A.

    2013-05-01

    There are established rules and regulations for some asbestos group minerals - amphibole group minerals of actinolite, amosite, anthophyllite, crocidolite, tremolite; and serpentine group minerals of chrysotile- called "regulatory". There are also "non-regulatory" naturally occurring asbestos (NOA) group minerals as constituent of rocks and soil, including richterite, winchite, fluoro-edenite, balangeroite, carlosturanite, gageite, arfvedsonite, and magnesio-arfvedsonite. Strong evidences for carcinogenicity of these NOA minerals in later cohorts of cancer patients demonstrated the risks associated with these minerals. In addition, although the chrysotile asbestos regulated by some organizations such as WHO, World Trade Organization, United Nations, US EPA, International Labour Organization, and EU Countries; however, controversies still continue surrounding the use of chrysotile. Determinations of polymineralic fibrous veins, mixed particles, amphibole cleavage fragments, and genetic predisposition are also important issues (i.e. Dogan et al., 2006).Therefore, accurate characterizations of chemical composition, morphology, structure, and defects are necessary in order to find out mechanism(s) of carcinogenicity of all asbestos group minerals. Calculation methods of chemical composition are still under debate because of assumption of no vacancies at any sites and intergrowth of minerals. Substitution(s) may cause deviations from the ideal chemical formula and wide variations in chemical compositions. Detail morphological and chemical quantification of individual asbestos group minerals in micro- and nano-scale may help to evaluate its true carcinogenetic mechanism(s), and consequently prevention and possibly treatment of related diseases. we propose that nonregulatory asbestos minerals and the chrysotile should be re-evaluated. The amount of fibers inhaled, in terms of weight percent and number, need also be re-evaluated by mineralogists. Finally, Regulatory

  18. T follicular regulatory cells.

    PubMed

    Sage, Peter T; Sharpe, Arlene H

    2016-05-01

    Pathogen exposure elicits production of high-affinity antibodies stimulated by T follicular helper (Tfh) cells in the germinal center reaction. Tfh cells provide both costimulation and stimulatory cytokines to B cells to facilitate affinity maturation, class switch recombination, and plasma cell differentiation within the germinal center. Under normal circumstances, the germinal center reaction results in antibodies that precisely target foreign pathogens while limiting autoimmunity and excessive inflammation. In order to have this degree of control, the immune system ensures Tfh-mediated B-cell help is regulated locally in the germinal center. The recently identified T follicular regulatory (Tfr) cell subset can migrate to the germinal center and inhibit Tfh-mediated B-cell activation and antibody production. Although many aspects of Tfr cell biology are still unclear, recent data have begun to delineate the specialized roles of Tfr cells in controlling the germinal center reaction. Here we discuss the current understanding of Tfr-cell differentiation and function and how this knowledge is providing new insights into the dynamic regulation of germinal centers, and suggesting more efficacious vaccine strategies and ways to treat antibody-mediated diseases.

  19. Internationalization of regulatory requirements.

    PubMed

    Juillet, Y

    2003-02-01

    The aim of harmonisation of medicines regulatory requirements is to allow the patient quicker access to new drugs and to avoid animal and human duplications. Harmonisation in the European Union (EU) is now completed, and has led to the submission of one dossier in one language study leading to European marketing authorizations, thanks in particular to efficacy guidelines published at the European level. With the benefit of the European experience since 1989, more than 40 guidelines have been harmonised amongst the EU, Japan and the USA through the International Conference on Harmonisation (ICH). ICH is a unique process gathering regulators and industry experts from the three regions. Its activity is built on expertise and trust. The Common Technical Document (CTD), an agreed common format for application in the three regions, is a logical follow-up to the ICH first phase harmonising the content of the dossier. The CTD final implementation in July 2003 will have considerable influence on the review process and on the exchange of information in the three regions.

  20. Functional evolution of a cis-regulatory module.

    PubMed

    Ludwig, Michael Z; Palsson, Arnar; Alekseeva, Elena; Bergman, Casey M; Nathan, Janaki; Kreitman, Martin

    2005-04-01

    Lack of knowledge about how regulatory regions evolve in relation to their structure-function may limit the utility of comparative sequence analysis in deciphering cis-regulatory sequences. To address this we applied reverse genetics to carry out a functional genetic complementation analysis of a eukaryotic cis-regulatory module-the even-skipped stripe 2 enhancer-from four Drosophila species. The evolution of this enhancer is non-clock-like, with important functional differences between closely related species and functional convergence between distantly related species. Functional divergence is attributable to differences in activation levels rather than spatiotemporal control of gene expression. Our findings have implications for understanding enhancer structure-function, mechanisms of speciation and computational identification of regulatory modules.

  1. The architectural organization of human stem cell cycle regulatory machinery.

    PubMed

    Stein, Gary S; Stein, Janet L; van J Wijnen, Andre; Lian, Jane B; Montecino, Martin; Medina, Ricardo; Kapinas, Kristie; Ghule, Prachi; Grandy, Rodrigo; Zaidi, Sayyed K; Becker, Klaus A

    2012-01-01

    Two striking features of human embryonic stem cells that support biological activity are an abbreviated cell cycle and reduced complexity to nuclear organization. The potential implications for rapid proliferation of human embryonic stem cells within the context of sustaining pluripotency, suppressing phenotypic gene expression and linkage to simplicity in the architectural compartmentalization of regulatory machinery in nuclear microenvironments is explored. Characterization of the molecular and architectural commitment steps that license human embryonic stem cells to initiate histone gene expression is providing understanding of the principal regulatory mechanisms that control the G1/S phase transition in primitive pluripotent cells. From both fundamental regulatory and clinical perspectives, further understanding of the pluripotent cell cycle in relation to compartmentalization of regulatory machinery in nuclear microenvironments is relevant to applications of stem cells for regenerative medicine and new dimensions to therapy where traditional drug discovery strategies have been minimally effective.

  2. [Progress of RNA interference mechanism].

    PubMed

    Yan, Fei; Cheng, Zhuo-Min

    2005-01-01

    RNA interference (RNAi) is a phenomenon that the double-stranded RNA (dsRNA) intermediates the degradation of complementary mRNA found in many organisms. This is a specifically mechanism involved in kinds of proteins to complete the interference function. Structure of siRNA affects which strand will be assembled into RISC. Another role of siRNA is directing RITS complex to bind with homologue chromosome, and then induces heterochromatinization. Although systemic silence induced by dsRNA is observed in Caenorhabditis elegans and plants, this progress is probably transmembrane protein-dependent, and mostly, the systemic silencing is controlled by multi-factors.

  3. Regulatory treatment of allowances and compliance costs

    SciTech Connect

    Rose, K.

    1993-07-01

    The Clean Air Act Amendments of 1990 (CAAA) established a national emission allowance trading system, a market-based form of environmental regulation designed to reduce and limit sulfur dioxide emissions. However, the allowance trading system is being applied primarily to an economically regulated electric utility industry. The combining of the new form of environmental regulation and economic regulation of electric utilities has raised a number of questions including what the role should be of the federal and state utility regulating commissions and how those actions will affect the decision making process of the utilities and the allowance market. There are several dimensions to the regulatory problems that commissions face. Allowances and utility compliance expenditures have implications for least-cost/IPR (integrated resource planning), prudence review procedures, holding company and multistate utility regulation and ratemaking treatment. The focus of this paper is on the ratemaking treatment. The following topics are covered: ratemaking treatment of allowances and compliance costs; Traditional cost-recovery mechanisms; limitations to the traditional approach; traditional approach and the allowance trading market; market-based cost recovery mechanisms; methods of determining the benchmark; determining the split between ratepayers and the utility; other regulatory approaches; limitations of incentive mechanisms.

  4. Healthcare regulatory concepts in Brazil.

    PubMed

    Oliveira, Robson Rocha de; Elias, Paulo Eduardo Mangeon

    2012-06-01

    The healthcare regulatory concepts used in Brazilian scientific publications on healthcare management were reviewed. A typo-logical classification for regulatory concepts was developed from the most current ideas in five disciplines: life sciences, law, economics, sociology and political science. Four ideas stood out: control, balance, adaptation and direction, with greatest emphasis on the technical nature of regulation. The political nature of regulation was secondary. It was considered that dis-cussion of healthcare regulatory concepts was connected with comprehension of the role that the state plays in this sector. De-finition of the forms of state intervention is the key convergence point between the different ways of conceptualizing healthcare regulation.

  5. Population Dynamics of Genetic Regulatory Networks

    NASA Astrophysics Data System (ADS)

    Braun, Erez

    2005-03-01

    Unlike common objects in physics, a biological cell processes information. The cell interprets its genome and transforms the genomic information content, through the action of genetic regulatory networks, into proteins which in turn dictate its metabolism, functionality and morphology. Understanding the dynamics of a population of biological cells presents a unique challenge. It requires to link the intracellular dynamics of gene regulation, through the mechanism of cell division, to the level of the population. We present experiments studying adaptive dynamics of populations of genetically homogeneous microorganisms (yeast), grown for long durations under steady conditions. We focus on population dynamics that do not involve random genetic mutations. Our experiments follow the long-term dynamics of the population distributions and allow to quantify the correlations among generations. We focus on three interconnected issues: adaptation of genetically homogeneous populations following environmental changes, selection processes on the population and population variability and expression distributions. We show that while the population exhibits specific short-term responses to environmental inputs, it eventually adapts to a robust steady-state, largely independent of external conditions. Cycles of medium-switch show that the adapted state is imprinted in the population and that this memory is maintained for many generations. To further study population adaptation, we utilize the process of gene recruitment whereby a gene naturally regulated by a specific promoter is placed under a different regulatory system. This naturally occurring process has been recognized as a major driving force in evolution. We have recruited an essential gene to a foreign regulatory network and followed the population long-term dynamics. Rewiring of the regulatory network allows us to expose their complex dynamics and phase space structure.

  6. [Regional differences in the level of ERK1/2 phosphorylation and expression of the myogenic regulatory factors following electrostimulation with different mechanic and metabolic action on the gastrocnemius muscle].

    PubMed

    Borzykh, A A; Kuz'min, I V; Lysenko, E A; Vinogradova, O L

    2014-01-01

    Effect of high-frequency electrical stimulation of the sciatic nerve on ERK1/2 kinase phosphorylation and mRNA expression in MyoD (myogenic regulation factor) and myogenin in the red (RGM) and white (WGM) parts of the medial head in rat's m. gastrocnemius was studied. Two stimulation regimes were equalized both lengthwise and in total effort but differed in duration and number of contractions and, therefore, in mechanic and metabolic effects on the muscle. It was shown that growth of the number of phosphorylated ERK1/2 was particularly high in WCM due to application of the protocol for multiple short-time contractions. Whatever the stimulation regime, MyoD mRNA expression in RGM and WGM increases to the same extent, whereas myogenin mRNA expression does not change. Consequently, the regime with the predominantly mechanic effect is favorable to activation of the ERK signaling pathway in glycolytic myofibers.

  7. Regulatory facility guide for Ohio

    SciTech Connect

    Anderson, S.S.; Bock, R.E.; Francis, M.W.; Gove, R.M.; Johnson, P.E.; Kovac, F.M.; Mynatt, J.O.; Rymer, A.C.

    1994-02-28

    The Regulatory Facility Guide (RFG) has been developed for the DOE and contractor facilities located in the state of Ohio. It provides detailed compilations of international, federal, and state transportation-related regulations applicable to shipments originating at destined to Ohio facilities. This RFG was developed as an additional resource tool for use both by traffic managers who must ensure that transportation operations are in full compliance with all applicable regulatory requirements and by oversight personnel who must verify compliance activities.

  8. The limits of regulatory toxicology

    SciTech Connect

    Carrington, Clark D.; Bolger, P. Michael

    2010-03-01

    The Acceptable Daily Intake (ADI) has been used by regulatory and public health organizations (e.g., the U.S. Food and Drug and Administration, and the World Health Organization) for chemicals for more than 50 years. The ADI concept was also initially employed at the U.S. Environmental Protection Agency at its inception in 1971, although with the adoption of newer terminology, it later became known as the Reference Dose (RfD). It is clear from the literature that both were first devised as instruments of regulatory policy. In the intervening years, it has become common to use language that implies that these standards are statements of scientific fact. Similarly, some of the discretionary or default values that are used to derive regulatory standards are represented as scientific assumptions when in fact they also represent regulatory policy. This confusion impedes both the best use of the available science and informed public participation in policy making. In addition, the misconception of the ADI or the RfD as statements of scientific fact may impede the consideration of alternative means to reduce exposure to chemicals that may be harmful, including regulatory measures that do not involve prescribing a regulatory concentration limit.

  9. A cis-regulatory module activating transcription in the suspensor contains five cis-regulatory elements.

    PubMed

    Henry, Kelli F; Kawashima, Tomokazu; Goldberg, Robert B

    2015-06-01

    Little is known about the molecular mechanisms by which the embryo proper and suspensor of plant embryos activate specific gene sets shortly after fertilization. We analyzed the upstream region of the Scarlet Runner Bean (Phaseolus coccineus) G564 gene in order to understand how genes are activated specifically in the suspensor during early embryo development. Previously, we showed that a 54-bp fragment of the G564 upstream region is sufficient for suspensor transcription and contains at least three required cis-regulatory sequences, including the 10-bp motif (5'-GAAAAGCGAA-3'), the 10 bp-like motif (5'-GAAAAACGAA-3'), and Region 2 motif (partial sequence 5'-TTGGT-3'). Here, we use site-directed mutagenesis experiments in transgenic tobacco globular-stage embryos to identify two additional cis-regulatory elements within the 54-bp cis-regulatory module that are required for G564 suspensor transcription: the Fifth motif (5'-GAGTTA-3') and a third 10-bp-related sequence (5'-GAAAACCACA-3'). Further deletion of the 54-bp fragment revealed that a 47-bp fragment containing the five motifs (the 10-bp, 10-bp-like, 10-bp-related, Region 2 and Fifth motifs) is sufficient for suspensor transcription, and represents a cis-regulatory module. A consensus sequence for each type of motif was determined by comparing motif sequences shown to activate suspensor transcription. Phylogenetic analyses suggest that the regulation of G564 is evolutionarily conserved. A homologous cis-regulatory module was found upstream of the G564 ortholog in the Common Bean (Phaseolus vulgaris), indicating that the regulation of G564 is evolutionarily conserved in closely related bean species.

  10. Steam Generator tube integrity -- US Nuclear Regulatory Commission perspective

    SciTech Connect

    Murphy, E.L.; Sullivan, E.J.

    1997-02-01

    In the US, the current regulatory framework was developed in the 1970s when general wall thinning was the dominant degradation mechanism; and, as a result of changes in the forms of degradation being observed and improvements in inspection and tube repair technology, the regulatory framework needs to be updated. Operating experience indicates that the current U.S. requirements should be more stringent in some areas, while in other areas they are overly conservative. To date, this situation has been dealt with on a plant-specific basis in the US. However, the NRC staff is now developing a proposed steam generator rule as a generic framework for ensuring that the steam generator tubes are capable of performing their intended safety functions. This paper discusses the current U.S. regulatory framework for assuring steam generator (SG) tube integrity, the need to update this regulatory framework, the objectives of the new proposed rule, the US Nuclear Regulatory Commission (NRC) regulatory guide (RG) that will accompany the rule, how risk considerations affect the development of the new rule, and some outstanding issues relating to the rule that the NRC is still dealing with.

  11. Regulatory T Cells and Their Role in Animal Disease.

    PubMed

    Veiga-Parga, T

    2016-07-01

    In humans and mouse models, Foxp3(+) regulatory T cells are known to control all aspects of immune responses. However, only limited information exists on these cells' role in diseases of other animals. In this review, we cover the most important features and different types of regulatory T cells, which include those that are thymus-derived and peripherally induced, the mechanisms by which they control immune responses by targeting effector T cells and antigen-presenting cells, and most important, their role in animal health and diseases including cancer, infections, and other conditions such as hypersensitivities and autoimmunity. Although the literature regarding regulatory T cells in domestic animal species is still limited, multiple articles have recently emerged and are discussed. Moreover, we also discuss the evidence suggesting that regulatory T cells might limit the magnitude of effector responses, which can have either a positive or negative result, depending on the context of animal and human disease. In addition, the issue of plasticity is discussed because plasticity in regulatory T cells can result in the loss of their protective function in some microenvironments during disease. Lastly, the manipulation of regulatory T cells is discussed in assessing the possibility of their use as a treatment in the future.

  12. Regulatory T Cells and Their Role in Animal Disease.

    PubMed

    Veiga-Parga, T

    2016-07-01

    In humans and mouse models, Foxp3(+) regulatory T cells are known to control all aspects of immune responses. However, only limited information exists on these cells' role in diseases of other animals. In this review, we cover the most important features and different types of regulatory T cells, which include those that are thymus-derived and peripherally induced, the mechanisms by which they control immune responses by targeting effector T cells and antigen-presenting cells, and most important, their role in animal health and diseases including cancer, infections, and other conditions such as hypersensitivities and autoimmunity. Although the literature regarding regulatory T cells in domestic animal species is still limited, multiple articles have recently emerged and are discussed. Moreover, we also discuss the evidence suggesting that regulatory T cells might limit the magnitude of effector responses, which can have either a positive or negative result, depending on the context of animal and human disease. In addition, the issue of plasticity is discussed because plasticity in regulatory T cells can result in the loss of their protective function in some microenvironments during disease. Lastly, the manipulation of regulatory T cells is discussed in assessing the possibility of their use as a treatment in the future. PMID:26945003

  13. Regulatory T cells in allergic diseases.

    PubMed

    Noval Rivas, Magali; Chatila, Talal A

    2016-09-01

    The pathogenesis of allergic diseases entails an ineffective tolerogenic immune response to allergens. Regulatory T (Treg) cells play a key role in sustaining immune tolerance to allergens, yet mechanisms by which Treg cells fail to maintain tolerance in patients with allergic diseases are not well understood. We review current concepts and established mechanisms regarding how Treg cells regulate different components of allergen-triggered immune responses to promote and maintain tolerance. We will also discuss more recent advances that emphasize the "dual" functionality of Treg cells in patients with allergic diseases: how Treg cells are essential in promoting tolerance to allergens but also how a proallergic inflammatory environment can skew Treg cells toward a pathogenic phenotype that aggravates and perpetuates disease. These advances highlight opportunities for novel therapeutic strategies that aim to re-establish tolerance in patients with chronic allergic diseases by promoting Treg cell stability and function. PMID:27596705

  14. Regulatory T cells and transplantation tolerance.

    PubMed

    Cobbold, S P

    2008-01-01

    Rodent models of transplantation have demonstrated that it is possible to induce specific immunological tolerance of donor antigens and indefinite graft survival in the absence of any continued immunosuppression. If this situation could be achieved clinically it would avoid many of the longer term complications of organ grafting, such as the increased risk of infection and cancer and the nephrotoxicity of many immunosuppressive agents. In this review we shall consider the interplay between regulatory T cells, dendritic cells and the graft itself and the resulting local protective mechanisms that are coordinated to maintain the tolerant state. We will discuss how both anti-inflammatory cytokines and negative costimulatory interactions can elicit a number of interrelated mechanisms to regulate both T cell and antigen-presenting cell activity. The induction and maintenance of tolerance via acquired local immune privilege has implications for the design of therapeutic regimens and the monitoring of the tolerant status of patients being weaned off immunosuppression. PMID:18651537

  15. Steam generators regulatory practices and issues in Spain

    SciTech Connect

    Mendoza, C.; Castelao, C.; Ruiz-Colino, J.; Figueras, J.M.

    1997-02-01

    This paper presents the actual status of Spanish Steam Generator tubes, actions developed by PWR plant owners and submitted to CSN, and regulatory activities related to tube degradation mechanisms analysis; NDT tube inspection techniques; tube, tubesheet and TSPs integrity studies; tube plugging/repair criteria; preventive and corrective measures including whole SGs replacement; tube leak measurement methods and other operational aspects.

  16. The expanding universe of regulatory T cell subsets in cancer.

    PubMed

    Gajewski, Thomas F

    2007-08-01

    Evidence has indicated that failed antitumor immunity is dominated by immunosuppressive mechanisms within the tumor microenvironment. In this issue of Immunity, Peng et al. (2007) add to this list by describing tumor-infiltrating gammadelta T cells that have regulatory function.

  17. 75 FR 79929 - Semiannual Regulatory Agenda

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-12-20

    ... Commission ###Semiannual Regulatory Agenda### ] FEDERAL TRADE COMMISSION (FTC) FEDERAL TRADE COMMISSION 16 CFR Ch. I Semiannual Regulatory Agenda AGENCY: Federal Trade Commission. ACTION: Semiannual regulatory... 22(d)(1) of the Federal Trade Commission Act, 15 U.S.C. 57b-3(d)(1), and the Regulatory......

  18. Department of Energy Semiannual Regulatory Agenda

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-12-20

    ... Semiannual Regulatory Agenda 10 CFR Chs. II, III, and X 48 CFR Ch. 9 Regulatory Agenda AGENCY: Department of... ``Regulatory Planning and Review,'' 58 FR 51735, and the Regulatory Flexibility Act, 5 U.S.C. 601 et seq... use throughout the rulemaking process. Timetable: Action Date FR Cite Notice: Public Meeting...

  19. Regulatory Monitoring of Fortified Foods: Identifying Barriers and Good Practices

    PubMed Central

    Rowe, Laura A; Vossenaar, Marieke; Garrett, Greg S

    2015-01-01

    While fortification of staple foods and condiments has gained enormous global traction, poor performance persists throughout many aspects of implementation, most notably around the critical element of regulatory monitoring, which is essential for ensuring foods meet national fortification standards. Where coverage of fortified foods is high, limited nutritional impact of fortification programs largely exists due to regulatory monitoring that insufficiently identifies and holds producers accountable for underfortified products. Based on quality assurance data from 20 national fortification programs in 12 countries, we estimate that less than half of the samples are adequately fortified against relevant national standards. In this paper, we outline key findings from a literature review, key informant interviews with 11 fortification experts, and semi-quantitative surveys with 39 individuals from regulatory agencies and the food fortification industry in 17 countries on the perceived effectiveness of regulatory monitoring systems and barriers to compliance against national fortification standards. Findings highlight that regulatory agencies and industry disagree on the value that enforcement mechanisms have in ensuring compliance against standards. Perceived political risk of enforcement and poorly resourced inspectorate capacity appear to adversely reinforce each other within an environment of unclear legislation to create a major hurdle for improving overall compliance of fortification programs against national standards. Budget constraints affect the ability of regulatory agencies to create a well-trained inspector cadre and improve the detection and enforcement of non-compliant and underfortified products. Recommendations to improve fortification compliance include improving technical capacity; ensuring sustained leadership, accountability, and funding in both the private and the public sectors; and removing political barriers to ensure consistent detection of

  20. Regulatory Monitoring of Fortified Foods: Identifying Barriers and Good Practices.

    PubMed

    Luthringer, Corey L; Rowe, Laura A; Vossenaar, Marieke; Garrett, Greg S

    2015-09-01

    While fortification of staple foods and condiments has gained enormous global traction, poor performance persists throughout many aspects of implementation, most notably around the critical element of regulatory monitoring, which is essential for ensuring foods meet national fortification standards. Where coverage of fortified foods is high, limited nutritional impact of fortification programs largely exists due to regulatory monitoring that insufficiently identifies and holds producers accountable for underfortified products. Based on quality assurance data from 20 national fortification programs in 12 countries, we estimate that less than half of the samples are adequately fortified against relevant national standards. In this paper, we outline key findings from a literature review, key informant interviews with 11 fortification experts, and semi-quantitative surveys with 39 individuals from regulatory agencies and the food fortification industry in 17 countries on the perceived effectiveness of regulatory monitoring systems and barriers to compliance against national fortification standards. Findings highlight that regulatory agencies and industry disagree on the value that enforcement mechanisms have in ensuring compliance against standards. Perceived political risk of enforcement and poorly resourced inspectorate capacity appear to adversely reinforce each other within an environment of unclear legislation to create a major hurdle for improving overall compliance of fortification programs against national standards. Budget constraints affect the ability of regulatory agencies to create a well-trained inspector cadre and improve the detection and enforcement of non-compliant and underfortified products. Recommendations to improve fortification compliance include improving technical capacity; ensuring sustained leadership, accountability, and funding in both the private and the public sectors; and removing political barriers to ensure consistent detection of

  1. Regulatory component analysis: a semi-blind extraction approach to infer gene regulatory networks with imperfect biological knowledge.

    PubMed

    Wang, Chen; Xuan, Jianhua; Shih, Ie-Ming; Clarke, Robert; Wang, Yue

    2012-08-01

    With the advent of high-throughput biotechnology capable of monitoring genomic signals, it becomes increasingly promising to understand molecular cellular mechanisms through systems biology approaches. One of the active research topics in systems biology is to infer gene transcriptional regulatory networks using various genomic data; this inference problem can be formulated as a linear model with latent signals associated with some regulatory proteins called transcription factors (TFs). As common statistical assumptions may not hold for genomic signals, typical latent variable algorithms such as independent component analysis (ICA) are incapable to reveal underlying true regulatory signals. Liao et al. [1] proposed to perform inference using an approach named network component analysis (NCA), the optimization of which is achieved by a least-squares fitting approach with biological knowledge constraints. However, the incompleteness of biological knowledge and its inconsistency with gene expression data are not considered in the original NCA solution, which could greatly affect the inference accuracy. To overcome these limitations, we propose a linear extraction scheme, namely regulatory component analysis (RCA), to infer underlying regulatory signals even with partial biological knowledge. Numerical simulations show a significant improvement of our proposed RCA over NCA, not only when signal-to-noise-ratio (SNR) is low, but also when the given biological knowledge is incomplete and inconsistent to gene expression data. Furthermore, real biological experiments on E. coli are performed for regulatory network inference in comparison with several typical linear latent variable methods, which again demonstrates the effectiveness and improved performance of the proposed algorithm.

  2. Potential role of PCTAIRE-2, PCTAIRE-3 and P-Histone H4 in amyloid precursor protein-dependent Alzheimer pathology

    PubMed Central

    Chaput, Dale; Kirouac, Lisa; Stevens, Stanley M.; Padmanabhan, Jaya

    2016-01-01

    Amyloid Precursor Protein (APP) is regulated in a mitosis-specific manner and plays a role in proliferative signaling in cells. Though APP-derived Aβ generation has a well-established role in neurodegeneration, the mechanistic role of APP in this process is not fully understood. Here, we performed an unbiased, comprehensive analysis of the phosphoproteome signature in APP-null neuroblastoma cells (B103) compared to those expressing APP-695 isoform (B103-695) to determine if APP expression affects protein phosphorylation. Stable isotope labeling by amino acids in cell culture (SILAC) followed by mass spectrometry-based phosphoproteomic analysis with PolyMAC identified a total of 2,478 phosphopeptides in the B103 and B103-695 cell culture model system. We observed that phosphorylation of PCTAIRE-2 (CDK17), PCTAIRE-3 (CDK18), and Histone H4 are significantly elevated in B103-695 cells; western blot analysis confirmed overexpression of PCTAIREs and increased phosphorylation of Histone H4. More importantly, analysis of primary neurons treated with Aβ, as well as brain samples from MCI (mild cognitive impaired) and AD patients recapitulated these results, showing increased levels of PCTAIREs and P-Histone H4. These novel findings identify a hitherto uncharacterized mechanism by which APP and/or Aβ may promote AD neurodegeneration, and raises the possibility that their inhibition may protect against pathology development in AD. PMID:26885753

  3. Photosystem II Subunit PsbS Is Involved in the Induction of LHCSR Protein-dependent Energy Dissipation in Chlamydomonas reinhardtii.

    PubMed

    Correa-Galvis, Viviana; Redekop, Petra; Guan, Katharine; Griess, Annika; Truong, Thuy B; Wakao, Setsuko; Niyogi, Krishna K; Jahns, Peter

    2016-08-12

    Non-photochemical quenching of excess excitation energy is an important photoprotective mechanism in photosynthetic organisms. In Arabidopsis thaliana, a high quenching capacity is constitutively present and depends on the PsbS protein. In the green alga Chlamydomonas reinhardtii, non-photochemical quenching becomes activated upon high light acclimation and requires the accumulation of light harvesting complex stress-related (LHCSR) proteins. Expression of the PsbS protein in C. reinhardtii has not been reported yet. Here, we show that PsbS is a light-induced protein in C. reinhardtii, whose accumulation under high light is further controlled by CO2 availability. PsbS accumulated after several hours of high light illumination at low CO2 At high CO2, however, PsbS was only transiently expressed under high light and was degraded after 1 h of high light exposure. PsbS accumulation correlated with an enhanced non-photochemical quenching capacity in high light-acclimated cells grown at low CO2 However, PsbS could not compensate for the function of LHCSR in an LHCSR-deficient mutant. Knockdown of PsbS accumulation led to reduction of both non-photochemical quenching capacity and LHCSR3 accumulation. Our data suggest that PsbS is essential for the activation of non-photochemical quenching in C. reinhardtii, possibly by promoting conformational changes required for activation of LHCSR3-dependent quenching in the antenna of photosystem II. PMID:27358399

  4. Sequence-based model of gap gene regulatory network

    PubMed Central

    2014-01-01

    Background The detailed analysis of transcriptional regulation is crucially important for understanding biological processes. The gap gene network in Drosophila attracts large interest among researches studying mechanisms of transcriptional regulation. It implements the most upstream regulatory layer of the segmentation gene network. The knowledge of molecular mechanisms involved in gap gene regulation is far less complete than that of genetics of the system. Mathematical modeling goes beyond insights gained by genetics and molecular approaches. It allows us to reconstruct wild-type gene expression patterns in silico, infer underlying regulatory mechanism and prove its sufficiency. Results We developed a new model that provides a dynamical description of gap gene regulatory systems, using detailed DNA-based information, as well as spatial transcription factor concentration data at varying time points. We showed that this model correctly reproduces gap gene expression patterns in wild type embryos and is able to predict gap expression patterns in Kr mutants and four reporter constructs. We used four-fold cross validation test and fitting to random dataset to validate the model and proof its sufficiency in data description. The identifiability analysis showed that most model parameters are well identifiable. We reconstructed the gap gene network topology and studied the impact of individual transcription factor binding sites on the model output. We measured this impact by calculating the site regulatory weight as a normalized difference between the residual sum of squares error for the set of all annotated sites and for the set with the site of interest excluded. Conclusions The reconstructed topology of the gap gene network is in agreement with previous modeling results and data from literature. We showed that 1) the regulatory weights of transcription factor binding sites show very weak correlation with their PWM score; 2) sites with low regulatory weight are

  5. Incidental experiences of regulatory fit and the processing of persuasive appeals.

    PubMed

    Koenig, Anne M; Cesario, Joseph; Molden, Daniel C; Kosloff, Spee; Higgins, E Tory

    2009-10-01

    This article examines how the subjective experiences of "feeling right" from regulatory fit and of "feeling wrong" from regulatory non-fit influence the way people process persuasive messages. Across three studies, incidental experiences of regulatory fit increased reliance on source expertise and decreased resistance to counterpersuasion, whereas incidental experiences of regulatory non-fit increased reliance on argument strength and increased resistance to counterpersuasion. These results suggest that incidental fit and non-fit experiences can produce, respectively, more superficial or more thorough processing of persuasive messages. The mechanisms underlying these effects, and the conditions under which they should and should not be expected, are discussed.

  6. Finding regulatory elements and regulatory motifs: a general probabilistic framework

    PubMed Central

    van Nimwegen, Erik

    2007-01-01

    Over the last two decades a large number of algorithms has been developed for regulatory motif finding. Here we show how many of these algorithms, especially those that model binding specificities of regulatory factors with position specific weight matrices (WMs), naturally arise within a general Bayesian probabilistic framework. We discuss how WMs are constructed from sets of regulatory sites, how sites for a given WM can be discovered by scanning of large sequences, how to cluster WMs, and more generally how to cluster large sets of sites from different WMs into clusters. We discuss how 'regulatory modules', clusters of sites for subsets of WMs, can be found in large intergenic sequences, and we discuss different methods for ab initio motif finding, including expectation maximization (EM) algorithms, and motif sampling algorithms. Finally, we extensively discuss how module finding methods and ab initio motif finding methods can be extended to take phylogenetic relations between the input sequences into account, i.e. we show how motif finding and phylogenetic footprinting can be integrated in a rigorous probabilistic framework. The article is intended for readers with a solid background in applied mathematics, and preferably with some knowledge of general Bayesian probabilistic methods. The main purpose of the article is to elucidate that all these methods are not a disconnected set of individual algorithmic recipes, but that they are just different facets of a single integrated probabilistic theory. PMID:17903285

  7. The rise of regulatory RNA

    PubMed Central

    Morris, K.V.; Mattick, J.S.

    2015-01-01

    Discoveries over the last decade portend a paradigm shift in molecular biology. Evidence suggests that RNA is not only functional as a messenger between DNA and protein but also in the regulation of genome organization and gene expression, which is increasingly elaborated in complex organisms. Regulatory RNAs appear to operate at many levels, but in particular to play an important role in the epigenetic processes that control differentiation and development. These discoveries suggest a central role for RNA in human evolution and ontogeny. Here we survey the emergence of the previously unsuspected world of regulatory RNAs from an historical perspective. PMID:24776770

  8. Below Regulatory Concern Owners Group:

    SciTech Connect

    Smith, C.F.; Phillips, L.B.; Williams, W.J.

    1988-03-01

    The US Nuclear Regulatory Commission has indicated that Below Regulatory Concern (BRC) exemption of waste streams from the disposal requirements for low level radioactive waste should be based on actual expected nuclide concentration and variability. Because of variations in the importance and relative abundance of nuclides in waste, one or a small number of nuclides may control the detemination of a waste steam as BRC. This study wasconducted to evaluate the relative importance of the major radionucldies in dose assessments for the disposal options and geographic regions under consideration for BRC waste. 6 refs., 25 tabs.

  9. Glycoconjugate Vaccines: The Regulatory Framework.

    PubMed

    Jones, Christopher

    2015-01-01

    Most vaccines, including the currently available glycoconjugate vaccines, are administered to healthy infants, to prevent future disease. The safety of a prospective vaccine is a key prerequisite for approval. Undesired side effects would not only have the potential to damage the individual infant but also lead to a loss of confidence in the respective vaccine-or vaccines in general-on a population level. Thus, regulatory requirements, particularly with regard to safety, are extremely rigorous. This chapter highlights regulatory aspects on carbohydrate-based vaccines with an emphasis on analytical approaches to ensure the consistent quality of successive manufacturing lots.

  10. Recruitment of a hedgehog regulatory circuit in butterfly eyespot evolution.

    PubMed

    Keys, D N; Lewis, D L; Selegue, J E; Pearson, B J; Goodrich, L V; Johnson, R L; Gates, J; Scott, M P; Carroll, S B

    1999-01-22

    The origin of new morphological characters is a long-standing problem in evolutionary biology. Novelties arise through changes in development, but the nature of these changes is largely unknown. In butterflies, eyespots have evolved as new pattern elements that develop from special organizers called foci. Formation of these foci is associated with novel expression patterns of the Hedgehog signaling protein, its receptor Patched, the transcription factor Cubitus interruptus, and the engrailed target gene that break the conserved compartmental restrictions on this regulatory circuit in insect wings. Redeployment of preexisting regulatory circuits may be a general mechanism underlying the evolution of novelties. PMID:9915699

  11. Recruitment of a hedgehog regulatory circuit in butterfly eyespot evolution.

    PubMed

    Keys, D N; Lewis, D L; Selegue, J E; Pearson, B J; Goodrich, L V; Johnson, R L; Gates, J; Scott, M P; Carroll, S B

    1999-01-22

    The origin of new morphological characters is a long-standing problem in evolutionary biology. Novelties arise through changes in development, but the nature of these changes is largely unknown. In butterflies, eyespots have evolved as new pattern elements that develop from special organizers called foci. Formation of these foci is associated with novel expression patterns of the Hedgehog signaling protein, its receptor Patched, the transcription factor Cubitus interruptus, and the engrailed target gene that break the conserved compartmental restrictions on this regulatory circuit in insect wings. Redeployment of preexisting regulatory circuits may be a general mechanism underlying the evolution of novelties.

  12. Regulatory immune cells in regulation of intestinal inflammatory response to microbiota

    PubMed Central

    Cong, Y; Liu, Z

    2015-01-01

    The intestinal lumen harbors nearly 100 trillion commensal bacteria that exert crucial function for health. An elaborate balance between immune responses and tolerance to intestinal microbiota is required to maintain intestinal homeostasis. This process depends on diverse regulatory mechanisms, including both innate and adaptive immunity. Dysregulation of the homeostasis between intestinal immune systems and microbiota has been shown to be associated with the development of inflammatory bowel diseases (IBD) in genetically susceptible populations. In this review, we discuss the recent progress reported in studies of distinct types of regulatory immune cells in the gut, including intestinal intraepithelial lymphocytes, Foxp3+ regulatory T cells, regulatory B cells, alternatively activated macrophages, dendritic cells, and innate lymphoid cells, and how dysfunction of this immune regulatory system contributes to intestinal diseases such as IBD. Moreover, we discuss the manipulation of these regulatory immune cells as a potential therapeutic method for management of intestinal inflammatory disorders. PMID:26080708

  13. Induction of mitochondrial uncoupling enhances VEGF₁₂₀ but reduces MCP-1 release in mature 3T3-L1 adipocytes: possible regulatory mechanism through endogenous ER stress and AMPK-related pathways.

    PubMed

    Miyokawa-Gorin, Kaoru; Takahashi, Kazuto; Handa, Keiko; Kitahara, Atsuko; Sumitani, Yoshikazu; Katsuta, Hidenori; Tanaka, Toshiaki; Nishida, Susumu; Yoshimoto, Katsuhiko; Ohno, Hideki; Ishida, Hitoshi

    2012-03-01

    mechanism might reveal novel therapeutic targets for ameliorating obesity-associated insulin resistance in metabolic syndrome and type 2 diabetes.

  14. Favorable genomic environments for cis-regulatory evolution: A novel theoretical framework.

    PubMed

    Maeso, Ignacio; Tena, Juan J

    2016-09-01

    Cis-regulatory changes are arguably the primary evolutionary source of animal morphological diversity. With the recent explosion of genome-wide comparisons of the cis-regulatory content in different animal species is now possible to infer general principles underlying enhancer evolution. However, these studies have also revealed numerous discrepancies and paradoxes, suggesting that the mechanistic causes and modes of cis-regulatory evolution are still not well understood and are probably much more complex than generally appreciated. Here, we argue that the mutational mechanisms and genomic regions generating new regulatory activities must comply with the constraints imposed by the molecular properties of cis-regulatory elements (CREs) and the organizational features of long-range chromatin interactions. Accordingly, we propose a new integrative evolutionary framework for cis-regulatory evolution based on two major premises for the origin of novel enhancer activity: (i) an accessible chromatin environment and (ii) compatibility with the 3D structure and interactions of pre-existing CREs. Mechanisms and DNA sequences not fulfilling these premises, will be less likely to have a measurable impact on gene expression and as such, will have a minor contribution to the evolution of gene regulation. Finally, we discuss current comparative cis-regulatory data under the light of this new evolutionary model, and propose that the two most prominent mechanisms for the evolution of cis-regulatory changes are the overprinting of ancestral CREs and the exaptation of transposable elements.

  15. 75 FR 79799 - Regulatory Agenda

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-12-20

    ... Hinchman, Senior Counsel, Office of Legal Policy, Department of Justice, Room 4252, 950 Pennsylvania Avenue... Department of Justice and the Access Board have each gathered a great deal of information regarding the... Justice ###Semiannual Regulatory Agenda### ] DEPARTMENT OF JUSTICE (DOJ) DEPARTMENT OF JUSTICE 8 CFR Ch....

  16. 78 FR 44279 - Regulatory Agenda

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-07-23

    ... agenda pursuant to Executive Order 12866, ``Regulatory Planning and Review,'' 58 FR 51735, and the... destruction of controlled substances consistent with the Controlled Substances Act. Timetable: Action Date FR Cite ANPRM 01/21/09 74 FR 3480 ANPRM Comment Period End 03/23/09 Notice of Public Meeting 12/22/10...

  17. Cell cycle control by oscillating regulatory proteins in Caulobacter crescentus.

    PubMed

    Holtzendorff, Julia; Reinhardt, Jens; Viollier, Patrick H

    2006-04-01

    Significant strides have been made in recent years towards understanding the molecular basis of cell cycle progression in the model bacterium Caulobacter crescentus. At the heart of cell cycle regulation is a multicomponent transcriptional feedback loop, governing the production of successive regulatory waves or pulses of at least three master regulatory proteins. These oscillating master regulators direct the execution of phase-specific events and, importantly, through intrinsic genetic switches not only determine the length of a given phase, but also provide the driving force that catapults the cell into the next stage of the cell cycle. The genetic switches act as fail safe mechanisms that prevent the cell cycle from relapsing and thus govern the ordered production and the periodicity of these regulatory waves. Here, we detail how the master regulators CtrA, GcrA and DnaA coordinate cell cycle progression and polar development in Caulobacter. PMID:16547950

  18. Cell cycle control by oscillating regulatory proteins in Caulobacter crescentus.

    PubMed

    Holtzendorff, Julia; Reinhardt, Jens; Viollier, Patrick H

    2006-04-01

    Significant strides have been made in recent years towards understanding the molecular basis of cell cycle progression in the model bacterium Caulobacter crescentus. At the heart of cell cycle regulation is a multicomponent transcriptional feedback loop, governing the production of successive regulatory waves or pulses of at least three master regulatory proteins. These oscillating master regulators direct the execution of phase-specific events and, importantly, through intrinsic genetic switches not only determine the length of a given phase, but also provide the driving force that catapults the cell into the next stage of the cell cycle. The genetic switches act as fail safe mechanisms that prevent the cell cycle from relapsing and thus govern the ordered production and the periodicity of these regulatory waves. Here, we detail how the master regulators CtrA, GcrA and DnaA coordinate cell cycle progression and polar development in Caulobacter.

  19. Fur-mediated global regulatory circuits in pathogenic Neisseria species.

    PubMed

    Yu, Chunxiao; Genco, Caroline Attardo

    2012-12-01

    The ferric uptake regulator (Fur) protein has been shown to function as a repressor of transcription in a number of diverse microorganisms. However, recent studies have established that Fur can function at a global level as both an activator and a repressor of transcription through both direct and indirect mechanisms. Fur-mediated indirect activation occurs via the repression of additional repressor proteins, or small regulatory RNAs, thereby activating transcription of a previously silent gene. Fur mediates direct activation through binding of Fur to the promoter regions of genes. Whereas the repressive mechanism of Fur has been thoroughly investigated, emerging studies on direct and indirect Fur-mediated activation mechanisms have revealed novel global regulatory circuits.

  20. Fur-Mediated Global Regulatory Circuits in Pathogenic Neisseria Species

    PubMed Central

    Yu, Chunxiao

    2012-01-01

    The ferric uptake regulator (Fur) protein has been shown to function as a repressor of transcription in a number of diverse microorganisms. However, recent studies have established that Fur can function at a global level as both an activator and a repressor of transcription through both direct and indirect mechanisms. Fur-mediated indirect activation occurs via the repression of additional repressor proteins, or small regulatory RNAs, thereby activating transcription of a previously silent gene. Fur mediates direct activation through binding of Fur to the promoter regions of genes. Whereas the repressive mechanism of Fur has been thoroughly investigated, emerging studies on direct and indirect Fur-mediated activation mechanisms have revealed novel global regulatory circuits. PMID:22885296

  1. Regulatory T Cells: Molecular Actions on Effector Cells in Immune Regulation

    PubMed Central

    Arce-Sillas, Asiel; Álvarez-Luquín, Diana Denisse; Tamaya-Domínguez, Beatriz; Gomez-Fuentes, Sandra; Trejo-García, Abel; Melo-Salas, Marlene; Cárdenas, Graciela; Rodríguez-Ramírez, Juan; Adalid-Peralta, Laura

    2016-01-01

    T regulatory cells play a key role in the control of the immune response, both in health and during illness. While the mechanisms through which T regulatory cells exert their function have been extensively described, their molecular effects on effector cells have received little attention. Thus, this revision is aimed at summarizing our current knowledge on those regulation mechanisms on the target cells from a molecular perspective. PMID:27298831

  2. Differential Regulatory Analysis Based on Coexpression Network in Cancer Research

    PubMed Central

    2016-01-01

    With rapid development of high-throughput techniques and accumulation of big transcriptomic data, plenty of computational methods and algorithms such as differential analysis and network analysis have been proposed to explore genome-wide gene expression characteristics. These efforts are aiming to transform underlying genomic information into valuable knowledges in biological and medical research fields. Recently, tremendous integrative research methods are dedicated to interpret the development and progress of neoplastic diseases, whereas differential regulatory analysis (DRA) based on gene coexpression network (GCN) increasingly plays a robust complement to regular differential expression analysis in revealing regulatory functions of cancer related genes such as evading growth suppressors and resisting cell death. Differential regulatory analysis based on GCN is prospective and shows its essential role in discovering the system properties of carcinogenesis features. Here we briefly review the paradigm of differential regulatory analysis based on GCN. We also focus on the applications of differential regulatory analysis based on GCN in cancer research and point out that DRA is necessary and extraordinary to reveal underlying molecular mechanism in large-scale carcinogenesis studies.

  3. Differential Regulatory Analysis Based on Coexpression Network in Cancer Research

    PubMed Central

    2016-01-01

    With rapid development of high-throughput techniques and accumulation of big transcriptomic data, plenty of computational methods and algorithms such as differential analysis and network analysis have been proposed to explore genome-wide gene expression characteristics. These efforts are aiming to transform underlying genomic information into valuable knowledges in biological and medical research fields. Recently, tremendous integrative research methods are dedicated to interpret the development and progress of neoplastic diseases, whereas differential regulatory analysis (DRA) based on gene coexpression network (GCN) increasingly plays a robust complement to regular differential expression analysis in revealing regulatory functions of cancer related genes such as evading growth suppressors and resisting cell death. Differential regulatory analysis based on GCN is prospective and shows its essential role in discovering the system properties of carcinogenesis features. Here we briefly review the paradigm of differential regulatory analysis based on GCN. We also focus on the applications of differential regulatory analysis based on GCN in cancer research and point out that DRA is necessary and extraordinary to reveal underlying molecular mechanism in large-scale carcinogenesis studies. PMID:27597964

  4. Differential Regulatory Analysis Based on Coexpression Network in Cancer Research.

    PubMed

    Li, Junyi; Li, Yi-Xue; Li, Yuan-Yuan

    2016-01-01

    With rapid development of high-throughput techniques and accumulation of big transcriptomic data, plenty of computational methods and algorithms such as differential analysis and network analysis have been proposed to explore genome-wide gene expression characteristics. These efforts are aiming to transform underlying genomic information into valuable knowledges in biological and medical research fields. Recently, tremendous integrative research methods are dedicated to interpret the development and progress of neoplastic diseases, whereas differential regulatory analysis (DRA) based on gene coexpression network (GCN) increasingly plays a robust complement to regular differential expression analysis in revealing regulatory functions of cancer related genes such as evading growth suppressors and resisting cell death. Differential regulatory analysis based on GCN is prospective and shows its essential role in discovering the system properties of carcinogenesis features. Here we briefly review the paradigm of differential regulatory analysis based on GCN. We also focus on the applications of differential regulatory analysis based on GCN in cancer research and point out that DRA is necessary and extraordinary to reveal underlying molecular mechanism in large-scale carcinogenesis studies. PMID:27597964

  5. Refinement, reduction, and replacement of animal use for regulatory testing: future improvements and implementation within the regulatory framework.

    PubMed

    Richmond, Jon

    2002-01-01

    Many are critical of how regulatory testing practices have evolved and become established--critical both of the scientific rational and the animal welfare costs. The test of whether we are more enlightened than our predecessors will be whether, armed with more powerful scientific insights and a better understanding of animal welfare, we can ensure that the best animal welfare and the best science drive and shape future developments in regulatory testing. Conducting the most humane animal-based regulatory testing requires establishing and maintaining a constructive dialogue between stakeholders and acknowledging the common ground that unites. Inclusive processes with stakeholders prepared to offer public, rational justifications for their policies and processes are essential if best practice is to be identified and implemented. There is general agreement that the best animal welfare results in the best science; that regulatory requirements based on an understanding of mechanisms and early relevant biomarkers result in elegant and valid science. Thus, "alternative" methods enabling replacement, reduction, or refinement (the 3Rs) are in reality often more scientifically "advanced" and scientifically valid methods. These principles provided the incentive and framework for recent initiatives in the United Kingdom to enhance the quality of the data prepared for regulatory submission while better protecting the welfare of the animals used. Some remaining 3R opportunities are explored in this paper, and some of the commonly encountered myths about regulatory testing and perceived barriers to change are challenged. Current "threats" may indeed offer opportunities for ensuring that sound science and the best animal welfare underpin developments in regulatory testing.

  6. Physiologically based pharmacokinetic modeling: from regulatory science to regulatory policy.

    PubMed

    Sinha, V; Zhao, P; Huang, S M; Zineh, I

    2014-05-01

    Assessment of controllable sources of intra- and interpatient variability in drug response is of critical importance in the regulatory evaluation of new drugs.(1) Although determinants of response variability would ideally be understood and accounted for before approval of a new pharmaceutical product, this is rarely the case for all; clinical trials in specific populations that definitively test optimal dosing in patient management strategies are not routinely performed prior to drug approval.

  7. Regulatory T Cells: Differentiation and Function.

    PubMed

    Plitas, George; Rudensky, Alexander Y

    2016-09-01

    The immune system of vertebrate animals has evolved to mount an effective defense against a diverse set of pathogens while minimizing transient or lasting impairment in tissue function that could result from the inflammation caused by immune responses to infectious agents. In addition, misguided immune responses to "self" and dietary antigens, as well as to commensal microorganisms, can lead to a variety of inflammatory disorders, including autoimmunity, metabolic syndrome, allergies, and cancer. Regulatory T cells expressing the X chromosome-linked transcription factor Foxp3 suppress inflammatory responses in diverse biological settings and serve as a vital mechanism of negative regulation of immune-mediated inflammation. Cancer Immunol Res; 4(9); 721-5. ©2016 AACR. PMID:27590281

  8. Regulatory Circuits Controlling Vascular Cell Calcification

    PubMed Central

    Sallam, Tamer; Cheng, Henry; Demer, Linda L.; Tintut, Yin

    2013-01-01

    Vascular calcification is a common feature of chronic kidney disease, cardiovascular disease, and aging. Such abnormal calcium deposition occurs in medial and/or intimal layers of blood vessels as well as in cardiac valves. Once considered a passive and inconsequential finding, the presence of calcium deposits in the vasculature is widely accepted as a predictor of increased morbidity and mortality. Recognition of the importance of vascular calcification in health is driving research into mechanisms that govern its development, progression, and regression. Diverse, but highly interconnected factors, have been implicated, including disturbances in lipid metabolism, oxidative stress, inflammatory cytokines, and mineral and hormonal balances, which can lead to formation of osteoblast-like cells in the artery wall. A tight balance of procalcific and anticalcific regulators dictates the extent of disease. In this review, we focus on the main regulatory circuits modulating vascular cell calcification. PMID:23269436

  9. Regulatory applications of sediment criteria. Final report

    SciTech Connect

    Not Available

    1987-06-23

    The report briefly describes the development of sediment criteria, discusses their utility and appropriate regulatory applications, and recommends steps to enhance the acceptance of sediment criteria by the regulatory and regulated communities.

  10. Plant Evolution: Evolving Antagonistic Gene Regulatory Networks.

    PubMed

    Cooper, Endymion D

    2016-06-20

    Developing a structurally complex phenotype requires a complex regulatory network. A new study shows how gene duplication provides a potential source of antagonistic interactions, an important component of gene regulatory networks. PMID:27326708

  11. Small Business Administration Semiannual Regulatory Agenda

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-04-26

    ... businesses. Timetable: Action Date FR Cite NPRM 08/00/10 Regulatory Flexibility Analysis Required: Yes Agency... Manufacturing Assistance Act of 2004 (Reauthorization Act) to regulate Small Business Lending Companies (SBLCs... Part XVI Small Business Administration Semiannual Regulatory Agenda ] SMALL...

  12. Plant Evolution: Evolving Antagonistic Gene Regulatory Networks.

    PubMed

    Cooper, Endymion D

    2016-06-20

    Developing a structurally complex phenotype requires a complex regulatory network. A new study shows how gene duplication provides a potential source of antagonistic interactions, an important component of gene regulatory networks.

  13. Nuclear Regulatory Commission 1989 Information Digest

    SciTech Connect

    None,

    1989-03-01

    The Nuclear Regulatory Commission 1989 Information Digest provides summary information regarding the US Nuclear Regulatory Commission, its regulatory responsibilities, and areas licensed by the Commission. This is the first of an annual publication for the general use of the NRC staff and is available to the public. The Digest is divided into two parts: the first presents an overview of the US Nuclear Regulatory Commission and the second provides data on NRC commercial nuclear reactor licensees and commercial nuclear power reactors worldwide.

  14. The Proline Regulatory Axis and Cancer

    PubMed Central

    Phang, James Ming; Liu, Wei; Hancock, Chad; Christian, Kyle J.

    2012-01-01

    Studies in metabolism and cancer have characterized changes in core pathways involving glucose and glutamine, emphasizing the provision of substrates for building cell mass. But recent findings suggest that pathways previously considered peripheral may play a critical role providing mechanisms for cell regulation. Several of these mechanisms involve the metabolism of non-essential amino acids, for example, the channeling of glycolytic intermediates into the serine pathway for one-carbon transfers. Historically, we proposed that the proline biosynthetic pathway participated in a metabolic interlock with glucose metabolism. The discovery that proline degradation is activated by p53 directed our attention to the initiation of apoptosis by proline oxidase/dehydrogenase. Now, however, we find that the biosynthetic mechanisms and the metabolic interlock may depend on the pathway from glutamine to proline, and it is markedly activated by the oncogene MYC. These findings add a new dimension to the proline regulatory axis in cancer and present attractive potential targets for cancer treatment. PMID:22737668

  15. Biological photoreceptors of light-dependent regulatory processes.

    PubMed

    Fraikin, G Ya; Strakhovskaya, M G; Rubin, A B

    2013-11-01

    Progress in understanding primary mechanisms of light reception in photoregulatory processes is achieved through discovering new biological photoreceptors, chiefly the regulatory sensors of blue/UV-A light. Among them are LOV domain-containing proteins and DNA photolyase-like cryptochromes, which constitute two widespread groups of photoreceptors that use flavin cofactors (FMN or FAD) as the photoactive chromophores. Bacterial LOV domain modules are connected in photoreceptor proteins with regulatory domains such as diguanylate cyclases/phosphodiesterases, histidine kinases, and DNA-binding domains that are activated by photoconversions of flavin. Identification of red/far-red light sensors in chemotrophic bacteria (bacteriophytochromes) and crystal structures of their photosensor module with bilin chromophore are significant for decoding the mechanisms of phytochrome receptor photoconversion and early step mechanisms of phytochrome-mediated signaling. The only UV-B regulatory photon sensor, UVR8, recently identified in plants, unlike other photoreceptors functions without a prosthetic chromophore: tryptophans of the unique UVR8 protein structure provide a "UV-B antenna". Our analysis of new data on photosensory properties of the identified photoreceptors in conjunction with their structure opens insight on the influence of the molecular microenvironment on light-induced chromophore reactions, the mechanisms by which the photoactivated chromophores trigger conformational changes in the surrounding protein structure, and structural bases of propagation of these changes to the interacting effector domains/proteins.

  16. Genetic flexibility of regulatory networks.

    PubMed

    Hunziker, Alexander; Tuboly, Csaba; Horváth, Péter; Krishna, Sandeep; Semsey, Szabolcs

    2010-07-20

    Gene regulatory networks are based on simple building blocks such as promoters, transcription factors (TFs) and their binding sites on DNA. But how diverse are the functions that can be obtained by different arrangements of promoters and TF binding sites? In this work we constructed synthetic regulatory regions using promoter elements and binding sites of two noninteracting TFs, each sensing a single environmental input signal. We show that simply by combining these three kinds of elements, we can obtain 11 of the 16 Boolean logic gates that integrate two environmental signals in vivo. Further, we demonstrate how combination of logic gates can result in new logic functions. Our results suggest that simple elements of transcription regulation form a highly flexible toolbox that can generate diverse functions under natural selection.

  17. 21 CFR 500.88 - Regulatory method.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 21 Food and Drugs 6 2011-04-01 2011-04-01 false Regulatory method. 500.88 Section 500.88 Food and... § 500.88 Regulatory method. (a) The sponsor shall submit for evaluation and validation a regulatory method developed to monitor compliance with FDA's operational definition of no residue. (b)...

  18. 78 FR 44399 - Semiannual Regulatory Flexibility Agenda

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-07-23

    ... Capital, Implementation of Basel III, Minimum Regulatory Capital Ratios, Capital Adequacy, and Transition... leverage capital requirements. Timetable: Action Date FR Cite Board Requested Comment 08/30/12 77 FR 53059... Capital Rules: Regulatory Capital, Implementation of Basel III, Minimum Regulatory Capital Ratios,......

  19. Department of Energy Semiannual Regulatory Agenda

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-04-26

    ... OF ENERGY Semiannual Regulatory Agenda 10 CFR Chs. II, III, and X 48 CFR Ch. 9 Regulatory Agenda... Review,'' 58 FR 51735, and the Regulatory Flexibility Act, 5 U.S.C. 601 et seq. SUPPLEMENTARY INFORMATION... and direct heating equipment. This is the second review for water heaters. Timetable: Action Date...

  20. 78 FR 1624 - Fall 2012 Regulatory Agenda

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-01-08

    ... and not to existing residential wood-heating appliances. Timetable: Action Date FR Cite NPRM 06/00/13... that start up after the regulatory agenda is signed? H. What tools are available for mining regulatory..., ``Regulatory Planning and Review'' (58 FR 51735, Oct. 4, 1993), as supplemented by Executive Order (EO)...

  1. 78 FR 1594 - Semiannual Regulatory Agenda

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-01-08

    .... Timetable: Action Date FR Cite ANPRM 01/00/13 Regulatory Flexibility Analysis Required: Yes. Agency Contact...: Action Date FR Cite Final Action 12/00/12 Regulatory Flexibility Analysis Required: Yes. Agency Contact... idle facilities. Completed: Reason Date FR Cite Withdrawn 10/18/12 Regulatory Flexibility...

  2. 78 FR 23507 - Notice of Regulatory Review

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-04-19

    ... regulations may be made more effective and less burdensome. \\1\\ Regulatory Review Plan, 77 FR 10351 (Feb. 22...'s Director. \\2\\ Notice of Regulatory Review Plan, 76 FR 59066 (Sept. 23, 2011). \\3\\ Regulatory Review Plan, 77 FR 10351 (Feb. 22, 2012). This Notice initiates the first such review. II. Request...

  3. 21 CFR 500.88 - Regulatory method.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Regulatory method. 500.88 Section 500.88 Food and... § 500.88 Regulatory method. (a) The sponsor shall submit for evaluation and validation a regulatory method developed to monitor compliance with FDA's operational definition of no residue. (b)...

  4. Securities and Exchange Commission Semiannual Regulatory Agenda

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-04-26

    .... Timetable: Action Date FR Cite NPRM 03/00/11 Regulatory Flexibility Analysis Required: Yes Agency Contact...: Action Date FR Cite NPRM 12/00/10 Regulatory Flexibility Analysis Required: Yes Agency Contact: Jennifer... Date FR Cite NPRM 09/00/10 Regulatory Flexibility Analysis Required: Yes Agency Contact: Anthony...

  5. Summation from a regulatory perspective

    SciTech Connect

    Ohanian, E.V.; Cotruvo, J.A.

    1986-11-01

    There is an urgent need to discuss the Office of Drinking Water's standard-setting or rule making process since most of the researchers whose papers are presented here directly or indirectly play a crucial role in this complex undertaking. Therefore, this paper will address the research data required to support policy making and regulatory decisions pertaining to health effects of disinfectants and disinfection by-products.

  6. Regulatory motifs in Chk1

    PubMed Central

    Caparelli, Michael L.; O’Connell, Matthew J.

    2013-01-01

    Chk1 is the effector kinase of the G2 DNA damage checkpoint. Chk1 homologs possess a highly conserved N-terminal kinase domain and a less conserved C-terminal regulatory domain. In response to DNA damage, Chk1 is recruited to mediator proteins assembled at lesions on replication protein A (RPA)-coated single-stranded DNA (ssDNA). Chk1 is then activated by phosphorylation on S345 in the C-terminal regulatory domain by the PI3 kinase-related kinases ATM and ATR to enforce a G2 cell cycle arrest to allow time for DNA repair. Models have emerged in which this C-terminal phosphorylation relieves auto-inhibitory regulation of the kinase domain by the regulatory domain. However, experiments in fission yeast have shown that deletion of this putative auto-inhibitory domain actually inactivates Chk1 function. We show here that Chk1 homologs possess a kinase-associated 1 (KA1) domain that possesses residues previously implicated in Chk1 auto-inhibition. In addition, all Chk1 homologs have a small and highly conserved C-terminal extension (CTE domain). In fission yeast, both of these motifs are essential for Chk1 activation through interaction with the mediator protein Crb2, the homolog of human 53BP1. Thus, through different intra- and intermolecular interactions, these motifs explain why the regulatory domain exerts both positive and negative control over Chk1 activation. Such motifs may provide alternative targets to the ATP-binding pocket on which to dock Chk1 inhibitors as anticancer therapeutics. PMID:23422000

  7. Regulatory aspects of neutron radiography

    NASA Astrophysics Data System (ADS)

    Hammer, J.

    1999-11-01

    While full legislation for industrial radiography with gamma and X-rays already exists in many countries, the situation is different for neutron radiography. Therefore, the licensing for equipment and procedures in this field has to be based on basic principles of national and international rules. This contribution will explain how the regulatory body in Switzerland deals with neutron radiography installations in order to maintain national standards of health and safety.

  8. Modeling human cancer-related regulatory modules by GA-RNN hybrid algorithms

    PubMed Central

    Chiang, Jung-Hsien; Chao, Shih-Yi

    2007-01-01

    Background Modeling cancer-related regulatory modules from gene expression profiling of cancer tissues is expected to contribute to our understanding of cancer biology as well as developments of new diagnose and therapies. Several mathematical models have been used to explore the phenomena of transcriptional regulatory mechanisms in Saccharomyces cerevisiae. However, the contemplating on controlling of feed-forward and feedback loops in transcriptional regulatory mechanisms is not resolved adequately in Saccharomyces cerevisiae, nor is in human cancer cells. Results In this study, we introduce a Genetic Algorithm-Recurrent Neural Network (GA-RNN) hybrid method for finding feed-forward regulated genes when given some transcription factors to construct cancer-related regulatory modules in human cancer microarray data. This hybrid approach focuses on the construction of various kinds of regulatory modules, that is, Recurrent Neural Network has the capability of controlling feed-forward and feedback loops in regulatory modules and Genetic Algorithms provide the ability of global searching of common regulated genes. This approach unravels new feed-forward connections in regulatory models by modified multi-layer RNN architectures. We also validate our approach by demonstrating that the connections in our cancer-related regulatory modules have been most identified and verified by previously-published biological documents. Conclusion The major contribution provided by this approach is regarding the chain influences upon a set of genes sequentially. In addition, this inverse modeling correctly identifies known oncogenes and their interaction genes in a purely data-driven way. PMID:17359522

  9. Neural regulatory mechanism of desire for food: revealed by magnetoencephalography.

    PubMed

    Yoshikawa, Takahiro; Tanaka, Masaaki; Ishii, Akira; Fujimoto, Shigeo; Watanabe, Yasuyoshi

    2014-01-16

    Currently, little is known about the brain function that allows individuals to suppress eating behavior. The present study used magnetoencephalography (MEG) to examine changes in neural activity over time that were related to suppression of motivation to eat in 11 healthy males. The MEG experiment consisted of four motivation sessions and four suppression sessions in an alternating and counterbalanced order. During MEG recordings, participants viewed a set of food pictures and mosaic pictures projected onto a screen, and were then asked to rate their motivation to eat and the suppression of the motivation to eat during the recordings. The present study demonstrated a higher β-band (13-25 Hz) event-related synchronization (ERS) level during the suppression sessions relative to the motivation sessions in the left supplementary motor area (SMA) 200-300 ms after the start of food picture presentation. Similar differences were also observed in θ-band (4-8 Hz) event-related desynchronization (ERD) in the left dorsolateral prefrontal cortex (DLPFC) after 500-600 ms. Negative relationships were observed between these levels of MEG responses and the number of food items for which the participants reported the motivation to eat during the MEG recordings. These findings indicate that the left DLPFC and SMA, particularly the DLPFC, play prominent roles in the suppression of motivation to eat. This may help to clarify the temporal aspects of the neural basis of self-control of appetitive motivation as well as aid development of self-control strategies such as cognitive behavioral therapy for patients with disordered appetite.

  10. [Current views of activating and regulatory mechanisms of blood coagulation].

    PubMed

    Osaki, Tsukasa; Ichinose, Akitada

    2014-07-01

    Coagulation factors play essential roles in not only hemostasis but also thrombosis. The coagulation reaction consists of a stepwise sequence of proteolytic reactions of the coagulation factors, and is generally divided into two pathways, a tissue factor(TF)-dependent "extrinsic pathway" and a contact factor-dependent "intrinsic pathway". The extrinsic pathway is responsible for the initiation of the clotting reaction, while the intrinsic pathway most likely amplifies it. Elevated levels of various coagulation factors such as TF, factor VIII and prothrombin have been linked to an increased thrombotic risk. To prevent thrombus formation, endothelial cells express several receptors and activators for anticoagulant factors such as antithrombin, TF-pathway inhibitor, protein C and protein S. Defects in this anticoagulant system also increase the risk of thrombosis.

  11. SUCROSE SYNTHASE: ELUCIDATION OF COMPLEX POST-TRANSLATIONAL REGULATORY MECHANISMS

    SciTech Connect

    Steven C. Huber

    2009-05-12

    Studies have focused on the enzyme sucrose synthase, which plays an important role in the metabolism of sucrose in seeds and tubers. There are three isoforms of SUS in maize, referred to as SUS1, SUS-SH1, and SUS2. SUS is generally considered to be tetrameric protein but recent evidence suggests that SUS can also occur as a dimeric protein. The formation of tetrameric SUS is regulated by sucrose concentration in vitro and this could also be an important factor in the cellular localization of the protein. We found that high sucrose concentrations, which promote tetramer formation, also inhibit the binding of SUS1 to actin filaments in vitro. Previously, high sucrose concentrations were shown to promote SUS association with the plasma membrane. The specific regions of the SUS molecule involved in oligomerization are not known, but we identified a region of the SUS1 moelcule by bioinformatic analysis that was predicted to form a coiled coil. We demonstrated that this sequence could, in fact, self-associate as predicted for a coiled coil, but truncation analysis with the full-length recombinant protein suggested that it was not responsible for formation of dimers or tetramers. However, the coiled coil may function in binding of other proteins to SUS1. Overall, sugar availability may differentially influence the binding of SUS to cellular structures, and these effects may be mediated by changes in the oligomeric nature of the enzyme.

  12. Phosphoproteomic Analysis Reveals Regulatory Mechanisms at the Kidney Filtration Barrier

    PubMed Central

    Rinschen, Markus M.; Wu, Xiongwu; König, Tim; Pisitkun, Trairak; Hagmann, Henning; Pahmeyer, Caroline; Lamkemeyer, Tobias; Kohli, Priyanka; Schnell, Nicole; Schermer, Bernhard; Dryer, Stuart; Brooks, Bernard R.; Beltrao, Pedro; Krueger, Marcus

    2014-01-01

    Diseases of the kidney filtration barrier are a leading cause of ESRD. Most disorders affect the podocytes, polarized cells with a limited capacity for self-renewal that require tightly controlled signaling to maintain their integrity, viability, and function. Here, we provide an atlas of in vivo phosphorylated, glomerulus-expressed proteins, including podocyte-specific gene products, identified in an unbiased tandem mass spectrometry–based approach. We discovered 2449 phosphorylated proteins corresponding to 4079 identified high-confidence phosphorylated residues and performed a systematic bioinformatics analysis of this dataset. We discovered 146 phosphorylation sites on proteins abundantly expressed in podocytes. The prohibitin homology domain of the slit diaphragm protein podocin contained one such site, threonine 234 (T234), located within a phosphorylation motif that is mutated in human genetic forms of proteinuria. The T234 site resides at the interface of podocin dimers. Free energy calculation through molecular dynamic simulations revealed a role for T234 in regulating podocin dimerization. We show that phosphorylation critically regulates formation of high molecular weight complexes and that this may represent a general principle for the assembly of proteins containing prohibitin homology domains. PMID:24511133

  13. Regulatory Mechanism of Muscle Disuse Atrophy in Adult Rats

    NASA Technical Reports Server (NTRS)

    1993-01-01

    During the last phase of NAG 2-386 we completed three studies. The effects of 14 days of weightlessness; the vastus medialis (VM) from flight rats in COSMOS 2044 was compared with the VM from tail suspended rats and other controls. The type I and II fibers in the mixed fiber portion of the VM were significantly reduced in flight rats and capillary densities paralleled the fiber density changes. The results of this project compared favorably with those in the extensor digitorum longus following seven days of flight in SL 3. The cardiovascular projects focused on the blood pressure changes in head down tilted rats (HDT) and non-head down tilted (N-HDT) rats. Blood pressures (MAP, SP and DP) were significantly elevated through seven days of HDT and rapidly returned to control levels within one day after removal from the HDT position. The N-HDT showed some slight rise in blood pressure but these were not as great and they were not as rapid. The HDT rats were characterized as exhibiting transient hypertension. These results led to some of the microvascular and vascular graduate student projects of Dr. Bernhard Stepke. Also our results refute or, at least, do not agree with previous reports from other laboratories. Each animal, in our blood pressure projects, served as its own control thereby providing more accurate results. Also, our experiments focused on recovery studies which can, in and of themselves, provide guidelines for flight experiments concerned with blood pressure changes. Another experiment was conducted to examine the role of testicular atrophy in whole body suspended (WBS) and tail suspended (TS) rats. We worked in conjunction with Dr. D.R. Deaver's laboratory at Pennsylvania State University and Dr. R. P. Amann at Colorado State University. In the TS rats the testes are retracted into the abdominal cavity, unless a ligature is placed to maintain them in the external scrotal sac. The cryptorchid condition in TS rats results in atrophy of the testes and lowered levels of spermatid formation. Hormonal changes due to testes atrophy must be considered in future experiments where related effects may modify muscle, bone or other tissue changes. Also, some new assessments of past results (published by many researchers) may warrant revised interpretations. The blood pressure studies and the testicular function results were presented and reviewed during an invited lecture at the University of Bordeaux II during the Animals in Space Symposium in March 1993. In summary, each of these three projects complied with the objectives of the proposal and serve to demonstrate the utility of animal models in preparations and interpretations of space flight results. All funding has been expended in accordance with the approved budget.

  14. Regulatory Actions of Glucocorticoid Hormones: From Organisms to Mechanisms.

    PubMed

    Granner, Daryl K; Wang, Jen-Chywan; Yamamoto, Keith R

    2015-01-01

    The history of glucocorticoid hormone research is an excellent example of "bedside to bench" investigation. It started with two very insightful clinical observations. Thomas Addison described the syndrome of what came to be known as adrenal hormone insufficiency and Harvey Cushing the syndrome of glucocorticoid hormone excess. These dramatic and life-threatening conditions spawned 150 years of active research that has involved many disciplines; indeed some of the fundamental observations of molecular biology are the result of this work. We have a fundamental knowledge of how glucocorticoids regulate gene transcription, their major effect. The challenge facing current and future investigators is to discern how to use this information to make these powerful therapeutic agents safer and more effective. PMID:26215988

  15. Regulatory mechanisms of group distributions in a gregarious arthropod.

    PubMed

    Broly, Pierre; Mullier, Romain; Devigne, Cédric; Deneubourg, Jean-Louis

    2015-11-01

    In a patchy environment, how social animals manage conspecific and environmental cues in their choice of habitat is a leading issue for understanding their spatial distribution and their exploitation of resources. Here, we experimentally tested the effects of environmental heterogeneities (artificial shelters) and some of their characteristics (size and fragmentation) on the aggregation process of a common species of terrestrial isopod (Crustacea). One hundred individuals were introduced into three different heterogeneous set-ups and in a homogeneous set-up. In the four set-ups, the populations split into two aggregates: one large (approx. 70 individuals) and one smaller (approx. 20 individuals). These aggregates were not randomly distributed in the arena but were formed diametrically opposite from one another. The similarity of the results among the four set-ups shows that under experimental conditions, the environmental heterogeneities have a low impact on the aggregation dynamics and spatial patterns of the isopod, merely serving to increase the probability of nucleation of the larger aggregation at these points. By contrast, the regulation of aggregate sizes and the regular distribution of groups are signatures of local amplification processes, in agreement with the short-range activator and long-range inhibitor model (scale-dependent feedbacks). In other words, we show how small-scale interactions may govern large-scale spatial patterns. This experimental illustration of spatial self-organization is an important step towards comprehension of the complex game of competition among groups in social species. PMID:26715999

  16. Effects of Environment on Animal Health: Mechanisms and Regulatory Inputs

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A functional model was developed and presented here to identify critical control points in associated biochemical pathways and further understand that how environmental factors impact the immune system to affect animal health.. A general comparison of the differences in cellular responses to mild v...

  17. Tissue factor activation: is disulfide bond switching a regulatory mechanism?

    PubMed Central

    Ghosh, Samit; Mandal, Samir K.

    2007-01-01

    A majority of tissue factor (TF) on cell surfaces exists in a cryptic form (ie, coagulation function inactive) but retains its functionality in cell signaling. Recent studies have suggested that cryptic TF contains unpaired cysteine thiols and that activation involves the formation of the disulfide bond Cys186-Cys 209 and that protein disulfide isomerase (PDI) regulates TF coagulant and signaling activities by targeting this disulfide bond. This study was carried out to investigate the validity of this novel concept. Although treatment of MDA 231 tumor cells, fibroblasts, and stimulated endothelial cells with the oxidizing agent HgCl2 markedly increased the cell-surface TF coagulant activity, the increase is associated with increased anionic phospholipids at the cell surface. Annexin V, which binds to anionic phospholipids, attenuated the increased TF coagulant activity. It is noteworthy that treatment of cells with reducing agents also increased the cell surface TF activity. No evidence was found for either detectable expression of PDI at the cell surface or association of TF with PDI. Furthermore, reduction of PDI with the gene silencing had no effect on either TF coagulant or cell signaling functions. Overall, the present data undermine the recently proposed hypothesis that PDI-mediated disulfide exchange plays a role in regulating TF procoagulant and cell signaling functions. PMID:17726162

  18. Regulatory mechanisms of group distributions in a gregarious arthropod

    PubMed Central

    Broly, Pierre; Mullier, Romain; Devigne, Cédric; Deneubourg, Jean-Louis

    2015-01-01

    In a patchy environment, how social animals manage conspecific and environmental cues in their choice of habitat is a leading issue for understanding their spatial distribution and their exploitation of resources. Here, we experimentally tested the effects of environmental heterogeneities (artificial shelters) and some of their characteristics (size and fragmentation) on the aggregation process of a common species of terrestrial isopod (Crustacea). One hundred individuals were introduced into three different heterogeneous set-ups and in a homogeneous set-up. In the four set-ups, the populations split into two aggregates: one large (approx. 70 individuals) and one smaller (approx. 20 individuals). These aggregates were not randomly distributed in the arena but were formed diametrically opposite from one another. The similarity of the results among the four set-ups shows that under experimental conditions, the environmental heterogeneities have a low impact on the aggregation dynamics and spatial patterns of the isopod, merely serving to increase the probability of nucleation of the larger aggregation at these points. By contrast, the regulation of aggregate sizes and the regular distribution of groups are signatures of local amplification processes, in agreement with the short-range activator and long-range inhibitor model (scale-dependent feedbacks). In other words, we show how small-scale interactions may govern large-scale spatial patterns. This experimental illustration of spatial self-organization is an important step towards comprehension of the complex game of competition among groups in social species. PMID:26715999

  19. The Michigan regulatory incentives study for electric utilities. Phase 1, Final report

    SciTech Connect

    Reid, M.W.; Weaver, E.M.

    1991-06-17

    This is the final report of Phase I of the Michigan Regulatory Incentives Study for Electric Utilities, a three-phase review of Michigan`s regulatory system and its effects on resource selection by electric utilities. The goal of Phase I is to identify and analyze financial incentive mechanisms that encourage selection of resources in accord with the principles of integrated resource planning (IRP) or least-cost planning (LCP). Subsequent study phases will involve further analysis of options and possibly a collaborative formal effort to propose regulatory changes. The Phase I analysis proceeded in three steps: (1) identification and review of existing regulatory practices that affect utilities; selection of resources, particularly DSM; (2) preliminary analysis of ten financial mechanisms, and selection of three for further study; (3) detailed analysis of the three mechanisms, including consideration of how they could be implemented in Michigan and financial modeling of their likely impacts on utilities and ratepayers.

  20. Conservation and evolution of cis-regulatory systems in ascomycete fungi

    SciTech Connect

    Gasch, Audrey P.; Moses, Alan M.; Chiang, Derek Y.; Fraser, Hunter B.; Berardini, Mark; Eisen, Michael B.

    2004-03-15

    Relatively little is known about the mechanisms through which gene expression regulation evolves. To investigate this, we systematically explored the conservation of regulatory networks in fungi by examining the cis-regulatory elements that govern the expression of coregulated genes. We first identified groups of coregulated Saccharomyces cerevisiae genes enriched for genes with known upstream or downstream cis-regulatory sequences. Reasoning that many of these gene groups are coregulated in related species as well, we performed similar analyses on orthologs of coregulated S. cerevisiae genes in 13 other ascomycete species. We find that many species-specific gene groups are enriched for the same flanking regulatory sequences as those found in the orthologous gene groups from S. cerevisiae, indicating that those regulatory systems have been conserved in multiple ascomycete species. In addition to these clear cases of regulatory conservation, we find examples of cis-element evolution that suggest multiple modes of regulatory diversification, including alterations in transcription factor-binding specificity, incorporation of new gene targets into an existing regulatory system, and cooption of regulatory systems to control a different set of genes. We investigated one example in greater detail by measuring the in vitro activity of the S. cerevisiae transcription factor Rpn4p and its orthologs from Candida albicans and Neurospora crassa. Our results suggest that the DNA binding specificity of these proteins has coevolved with the sequences found upstream of the Rpn4p target genes and suggest that Rpn4p has a different function in N. crassa.

  1. Regulatory and Catalytic Domain Dynamics of Smooth Muscle Myosin Filaments†

    PubMed Central

    Li, Hui-Chun; Song, Likai; Salzameda, Bridget; Cremo, Christine R.; Fajer, Piotr G.

    2016-01-01

    Domain dynamics of the chicken gizzard smooth muscle myosin catalytic domain (heavy chain Cys-717) and regulatory domain (regulatory light chain Cys-108) were determined in the absence of nucleotides using saturation-transfer electron paramagnetic resonance. In unphosphorylated synthetic filaments, the effective rotational correlation times, τr, were 24 ± 6 μs and 441 ± 79 μs for the catalytic and regulatory domains, respectively. The corresponding amplitudes of motion were 42 ± 4° and 24 ± 9° as determined from steady-state phosphorescence anisotropy. These results suggest that the two domains have independent mobility due to a hinge between the two domains. Although a similar hinge was observed for skeletal myosin (Adhikari and Fajer (1997) Proc. Natl. Acad. Sci. U.S.A. 94, 9643–9647. Brown et al. (2001) Biochemistry 40, 8283–8291), the latter displayed higher regulatory domain mobility, τr = 40 ± 3 μs, suggesting a smooth muscle specific mechanism of constraining regulatory domain dynamics. In the myosin monomers the correlation times for both domains were the same (~4 μs) for both smooth and skeletal myosin, suggesting that the motional difference between the two isoforms in the filaments was not due to intrinsic variation of hinge stiffness. Heavy chain/regulatory light chain chimeras of smooth and skeletal myosin pinpointed the origin of the restriction to the heavy chain and established correlation between the regulatory domain dynamics with the ability of myosin to switch off but not to switch on the ATPase and the actin sliding velocity. Phosphorylation of smooth muscle myosin filaments caused a small increase in the amplitude of motion of the regulatory domain (from 24 ± 4° to 36 ± 7°) but did not significantly affect the rotational correlation time of the regulatory domain (441 to 408 μs) or the catalytic domain (24 to 17 μs). These data are not consistent with a stable interaction between the two catalytic domains in

  2. 77 FR 56686 - Self-Regulatory Organizations; Financial Industry Regulatory Authority, Inc.; Notice of Filing of...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-09-13

    ... COMMISSION Self-Regulatory Organizations; Financial Industry Regulatory Authority, Inc.; Notice of Filing of... interested persons. \\1\\ 15 U.S.C. 78s(b)(1). \\2\\ 17 CFR 240.19b-4. I. Self-Regulatory Organization's... FINRA and at the Commission's Public Reference Room. II. Self-Regulatory Organization's Statement of...

  3. 78 FR 70602 - Self-Regulatory Organizations; Financial Industry Regulatory Authority, Inc.; Notice of Filing of...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-11-26

    ... COMMISSION Self-Regulatory Organizations; Financial Industry Regulatory Authority, Inc.; Notice of Filing of... 240.19b-4. I. Self-Regulatory Organization's Statement of the Terms of Substance of the Proposed Rule... of the rules in accordance with the requirements of Form 19b-4. II. Self-Regulatory...

  4. Riboswitches: Structures and Mechanisms

    PubMed Central

    Garst, Andrew D.; Edwards, Andrea L.; Batey, Robert T.

    2011-01-01

    SUMMARY A critical feature of the hypothesized RNA world would have been the ability to control chemical processes in response to environmental cues. Riboswitches present themselves as viable candidates for a sophisticated mechanism of regulatory control in RNA-based life. These regulatory elements in the modern world are most commonly found in the 5′-untranslated regions of bacterial mRNAs, directly interacting with metabolites as a means of regulating expression of the coding region via a secondary structural switch. In this review, we focus on recent insights into how these RNAs fold into complex architectures capable of both recognizing a specific small molecule compound and exerting regulatory control over downstream sequences, with an emphasis on transcriptional regulation. PMID:20943759

  5. Riboswitches: structures and mechanisms.

    PubMed

    Garst, Andrew D; Edwards, Andrea L; Batey, Robert T

    2011-06-01

    A critical feature of the hypothesized RNA world would have been the ability to control chemical processes in response to environmental cues. Riboswitches present themselves as viable candidates for a sophisticated mechanism of regulatory control in RNA-based life. These regulatory elements in the modern world are most commonly found in the 5'-untranslated regions of bacterial mRNAs, directly interacting with metabolites as a means of regulating expression of the coding region via a secondary structural switch. In this review, we focus on recent insights into how these RNAs fold into complex architectures capable of both recognizing a specific small molecule compound and exerting regulatory control over downstream sequences, with an emphasis on transcriptional regulation. PMID:20943759

  6. Regulatory pathways for vaccines for developing countries.

    PubMed

    Milstien, Julie; Belgharbi, Lahouari

    2004-02-01

    Vaccines that are designed for use only in developing countries face regulatory hurdles that may restrict their use. There are two primary reasons for this: most regulatory authorities are set up to address regulation of products for use only within their jurisdictions and regulatory authorities in developing countries traditionally have been considered weak. Some options for regulatory pathways for such products have been identified: licensing in the country of manufacture, file review by the European Medicines Evaluation Agency on behalf of WHO, export to a country with a competent national regulatory authority (NRA) that could handle all regulatory functions for the developing country market, shared manufacturing and licensing in a developing country with competent manufacturing and regulatory capacity, and use of a contracted independent entity for global regulatory approval. These options have been evaluated on the basis of five criteria: assurance of all regulatory functions for the life of the product, appropriateness of epidemiological assessment, applicability to products no longer used in the domestic market of the manufacturing country, reduction of regulatory risk for the manufacturer, and existing rules and regulations for implementation. No one option satisfies all criteria. For all options, national infrastructures (including the underlying regulatory legislative framework, particularly to formulate and implement local evidence-based vaccine policy) must be developed. WHO has led work to develop this capacity with some success. The paper outlines additional areas of action required by the international community to assure development and use of vaccines needed for the developing world. PMID:15042235

  7. Regulatory pathways for vaccines for developing countries.

    PubMed Central

    Milstien, Julie; Belgharbi, Lahouari

    2004-01-01

    Vaccines that are designed for use only in developing countries face regulatory hurdles that may restrict their use. There are two primary reasons for this: most regulatory authorities are set up to address regulation of products for use only within their jurisdictions and regulatory authorities in developing countries traditionally have been considered weak. Some options for regulatory pathways for such products have been identified: licensing in the country of manufacture, file review by the European Medicines Evaluation Agency on behalf of WHO, export to a country with a competent national regulatory authority (NRA) that could handle all regulatory functions for the developing country market, shared manufacturing and licensing in a developing country with competent manufacturing and regulatory capacity, and use of a contracted independent entity for global regulatory approval. These options have been evaluated on the basis of five criteria: assurance of all regulatory functions for the life of the product, appropriateness of epidemiological assessment, applicability to products no longer used in the domestic market of the manufacturing country, reduction of regulatory risk for the manufacturer, and existing rules and regulations for implementation. No one option satisfies all criteria. For all options, national infrastructures (including the underlying regulatory legislative framework, particularly to formulate and implement local evidence-based vaccine policy) must be developed. WHO has led work to develop this capacity with some success. The paper outlines additional areas of action required by the international community to assure development and use of vaccines needed for the developing world. PMID:15042235

  8. 75 FR 28073 - Draft Regulatory Guide: Issuance, Availability

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-05-19

    ... From the Federal Register Online via the Government Publishing Office NUCLEAR REGULATORY COMMISSION Draft Regulatory Guide: Issuance, Availability AGENCY: Nuclear Regulatory Commission. ACTION: Notice of Issuance and Availability of Draft Regulatory Guide, DG-3039, ``Standard Format and Content...

  9. 75 FR 48382 - Draft Regulatory Guide: Issuance, Availability

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-08-10

    ... From the Federal Register Online via the Government Publishing Office NUCLEAR REGULATORY COMMISSION Draft Regulatory Guide: Issuance, Availability AGENCY: Nuclear Regulatory Commission. ACTION: Notice of Issuance and Availability of Draft Regulatory Guide, DG-1228, ``Standard Format and Content...

  10. 78 FR 44165 - Nuclear Regulatory Commission Enforcement Policy

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-07-23

    ... From the Federal Register Online via the Government Publishing Office NUCLEAR REGULATORY COMMISSION Nuclear Regulatory Commission Enforcement Policy AGENCY: Nuclear Regulatory Commission. ACTION: Enforcement policy; request for comment. SUMMARY: The U.S. Nuclear Regulatory Commission (NRC) is...

  11. 75 FR 16525 - Notice of Issuance of Regulatory Guide

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-04-01

    ... From the Federal Register Online via the Government Publishing Office NUCLEAR REGULATORY COMMISSION Notice of Issuance of Regulatory Guide AGENCY: Nuclear Regulatory Commission. ACTION: Notice of... Branch, Division of Engineering, Office of Nuclear Regulatory Research, U.S. Nuclear...

  12. 75 FR 36715 - Final Regulatory Guide: Issuance, Availability

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-06-28

    ... From the Federal Register Online via the Government Publishing Office NUCLEAR REGULATORY COMMISSION Final Regulatory Guide: Issuance, Availability AGENCY: Nuclear Regulatory Commission. ACTION.... Sturzebecher, U.S. Nuclear Regulatory Commission, Washington, DC 20555-0001, telephone: (301) 251- 7494 or...

  13. A global regulatory science agenda for vaccines.

    PubMed

    Elmgren, Lindsay; Li, Xuguang; Wilson, Carolyn; Ball, Robert; Wang, Junzhi; Cichutek, Klaus; Pfleiderer, Michael; Kato, Atsushi; Cavaleri, Marco; Southern, James; Jivapaisarnpong, Teeranart; Minor, Philip; Griffiths, Elwyn; Sohn, Yeowon; Wood, David

    2013-04-18

    The Decade of Vaccines Collaboration and development of the Global Vaccine Action Plan provides a catalyst and unique opportunity for regulators worldwide to develop and propose a global regulatory science agenda for vaccines. Regulatory oversight is critical to allow access to vaccines that are safe, effective, and of assured quality. Methods used by regulators need to constantly evolve so that scientific and technological advances are applied to address challenges such as new products and technologies, and also to provide an increased understanding of benefits and risks of existing products. Regulatory science builds on high-quality basic research, and encompasses at least two broad categories. First, there is laboratory-based regulatory science. Illustrative examples include development of correlates of immunity; or correlates of safety; or of improved product characterization and potency assays. Included in such science would be tools to standardize assays used for regulatory purposes. Second, there is science to develop regulatory processes. Illustrative examples include adaptive clinical trial designs; or tools to analyze the benefit-risk decision-making process of regulators; or novel pharmacovigilance methodologies. Included in such science would be initiatives to standardize regulatory processes (e.g., definitions of terms for adverse events [AEs] following immunization). The aim of a global regulatory science agenda is to transform current national efforts, mainly by well-resourced regulatory agencies, into a coordinated action plan to support global immunization goals. This article provides examples of how regulatory science has, in the past, contributed to improved access to vaccines, and identifies gaps that could be addressed through a global regulatory science agenda. The article also identifies challenges to implementing a regulatory science agenda and proposes strategies and actions to fill these gaps. A global regulatory science agenda will enable

  14. Regulatory Oversight Program, July 1, 1993--March 3, 1997. Volume 3

    SciTech Connect

    1997-12-31

    On July, 1993, a Regulatory Oversight (RO) organization was established within the US DOE, Oak Ridge Operations (ORO) to provide regulatory oversight of the DOE uranium enrichment facilities leased to the United States Enrichment Corporation (USEC). The purpose of the OR program was to ensure continued plant safety, safeguards and security while the plants were transitioned to regulatory oversight by the Nuclear Regulatory Commission (NRC). Volume 3 contains copies of two reports that document the DOE/ORO regulatory oversight inspection and enforcement history for each gaseous diffusion plant site. Each report provides a formal mechanism by which DOE/ORO could communicate the inspection and enforcement history to NRC. The reports encompass the inspection activities that occurred during July 1, 1993 through March 2, 1997.

  15. Generation of oscillating gene regulatory network motifs

    NASA Astrophysics Data System (ADS)

    van Dorp, M.; Lannoo, B.; Carlon, E.

    2013-07-01

    Using an improved version of an evolutionary algorithm originally proposed by François and Hakim [Proc. Natl. Acad. Sci. USAPNASA60027-842410.1073/pnas.0304532101 101, 580 (2004)], we generated small gene regulatory networks in which the concentration of a target protein oscillates in time. These networks may serve as candidates for oscillatory modules to be found in larger regulatory networks and protein interaction networks. The algorithm was run for 105 times to produce a large set of oscillating modules, which were systematically classified and analyzed. The robustness of the oscillations against variations of the kinetic rates was also determined, to filter out the least robust cases. Furthermore, we show that the set of evolved networks can serve as a database of models whose behavior can be compared to experimentally observed oscillations. The algorithm found three smallest (core) oscillators in which nonlinearities and number of components are minimal. Two of those are two-gene modules: the mixed feedback loop, already discussed in the literature, and an autorepressed gene coupled with a heterodimer. The third one is a single gene module which is competitively regulated by a monomer and a dimer. The evolutionary algorithm also generated larger oscillating networks, which are in part extensions of the three core modules and in part genuinely new modules. The latter includes oscillators which do not rely on feedback induced by transcription factors, but are purely of post-transcriptional type. Analysis of post-transcriptional mechanisms of oscillation may provide useful information for circadian clock research, as recent experiments showed that circadian rhythms are maintained even in the absence of transcription.

  16. Wetlands: The changing regulatory landscape

    SciTech Connect

    Glick, R.M. )

    1993-05-01

    Protection of wetlands became a national issue in 1988 when President George Bush pledged no net loss of wetlands in the US under his [open quotes]environmental presidency.[close quotes] As wetlands became a national issue, the job of protecting them became an obligation for many groups, including hydro-power developers. Now, when a site selected for development includes an area that may be classified as a wetland, the developer quickly discovers the importance of recognizing and protecting these natural habitats. Federal legislation severely limits development of wetland, and most states increase the restrictions with their own wetlands regulations. The difficulty of defining wetlands complicates federal and state enforcement. Land that appears to be dry may in fact be classified as a wetland. So, even if a site appears dry, potential hydro developers must confirm whether or not any jurisdictional wetlands are present. Regulated lands include much more than marshes and swamps. Further complicating the definition of wetlands, a recent court decision found that even artificially created wetlands, such as man-made ponds, may be subject to regulation. Hydro developers must be aware of current regulatory requirements before they consider development of any site that may contain wetlands. To be certain that a site is [open quotes]buildable[close quotes] from the standpoint of wetlands regulation, a developer must verify (with the help of state agencies) that the property does not contain any jurisdictional wetlands. If it does, the regulatory process before development becomes much more complicated. For the short term, uncertainty abounds and extreme caution is in order. Because the regulatory process has become so complex and an agreeable definition of wetlands so elusive, the trend among the Corps and collaborating agencies is to constrict nationwide permits in favor of narrowing the jurisdictional definition of wetlands.

  17. Target activation by regulatory RNAs in bacteria

    PubMed Central

    Papenfort, Kai; Vanderpool, Carin K.

    2015-01-01

    Bacterial small regulatory RNAs (sRNAs) are commonly known to repress gene expression by base pairing to target mRNAs. In many cases, sRNAs base pair with and sequester mRNA ribosome-binding sites, resulting in translational repression and accelerated transcript decay. In contrast, a growing number of examples of translational activation and mRNA stabilization by sRNAs have now been documented. A given sRNA often employs a conserved region to interact with and regulate both repressed and activated targets. However, the mechanisms underlying activation differ substantially from repression. Base pairing resulting in target activation can involve sRNA interactions with the 5′ untranslated region (UTR), the coding sequence or the 3′ UTR of the target mRNAs. Frequently, the activities of protein factors such as cellular ribonucleases and the RNA chaperone Hfq are required for activation. Bacterial sRNAs, including those that function as activators, frequently control stress response pathways or virulence-associated functions required for immediate responses to changing environments. This review aims to summarize recent advances in knowledge regarding target mRNA activation by bacterial sRNAs, highlighting the molecular mechanisms and biological relevance of regulation. PMID:25934124

  18. Human System Integration: Regulatory Analysis

    NASA Technical Reports Server (NTRS)

    2005-01-01

    This document was intended as an input to the Access 5 Policy Integrated Product team. Using a Human System Integration (HIS) perspective, a regulatory analyses of the FARS (specifically Part 91), the Airman s Information Manual (AIM) and the FAA Controllers Handbook (7110.65) was conducted as part of a front-end approach needed to derive HSI requirements for Unmanned Aircraft Systems (UAS) operations in the National Airspace System above FL430. The review of the above aviation reference materials yielded eighty-four functions determined to be necessary or highly desirable for flight within the Air Traffic Management System. They include categories for Flight, Communications, Navigation, Surveillance, and Hazard Avoidance.

  19. CREME: Cis-Regulatory Module Explorer for the Human Genome

    SciTech Connect

    Loots, G G; Sharan, R; Ovcharenko, I; Ben-Hur, A

    2004-02-11

    The binding of transcription factors to specific regulatory sequence elements is a primary mechanism for controlling gene transcription. Eukaryotic genes are often regulated by several transcription factors, whose binding sites are tightly clustered and form cis-regulatory modules. In this paper we present a web-server, CREME, for identifying and visualizing cis-regulatory modules in the promoter regions of a given set of potentially co-regulated genes. CREME relies on a database of putative transcription factor binding sites that have been annotated across the human genome using a library of position weight matrices and evolutionary conservation with the mouse and rat genomes. A search algorithm is applied to this dataset to identify combinations of transcription factors whose binding sites tend to co-occur in close proximity in the promoter regions of the input gene set. The identified cis-regulatory modules are statistically scored and significant combinations are reported and graphically visualized. Our web-server is available at http://creme.dcode.org/.

  20. Regulatory RNAs in photosynthetic cyanobacteria.

    PubMed

    Kopf, Matthias; Hess, Wolfgang R

    2015-05-01

    Regulatory RNAs play versatile roles in bacteria in the coordination of gene expression during various physiological processes, especially during stress adaptation. Photosynthetic bacteria use sunlight as their major energy source. Therefore, they are particularly vulnerable to the damaging effects of excess light or UV irradiation. In addition, like all bacteria, photosynthetic bacteria must adapt to limiting nutrient concentrations and abiotic and biotic stress factors. Transcriptome analyses have identified hundreds of potential regulatory small RNAs (sRNAs) in model cyanobacteria such as Synechocystis sp. PCC 6803 or Anabaena sp. PCC 7120, and in environmentally relevant genera such as Trichodesmium, Synechococcus and Prochlorococcus. Some sRNAs have been shown to actually contain μORFs and encode short proteins. Examples include the 40-amino-acid product of the sml0013 gene, which encodes the NdhP subunit of the NDH1 complex. In contrast, the functional characterization of the non-coding sRNA PsrR1 revealed that the 131 nt long sRNA controls photosynthetic functions by targeting multiple mRNAs, providing a paradigm for sRNA functions in photosynthetic bacteria. We suggest that actuatons comprise a new class of genetic elements in which an sRNA gene is inserted upstream of a coding region to modify or enable transcription of that region.

  1. RSAT: regulatory sequence analysis tools.

    PubMed

    Thomas-Chollier, Morgane; Sand, Olivier; Turatsinze, Jean-Valéry; Janky, Rekin's; Defrance, Matthieu; Vervisch, Eric; Brohée, Sylvain; van Helden, Jacques

    2008-07-01

    The regulatory sequence analysis tools (RSAT, http://rsat.ulb.ac.be/rsat/) is a software suite that integrates a wide collection of modular tools for the detection of cis-regulatory elements in genome sequences. The suite includes programs for sequence retrieval, pattern discovery, phylogenetic footprint detection, pattern matching, genome scanning and feature map drawing. Random controls can be performed with random gene selections or by generating random sequences according to a variety of background models (Bernoulli, Markov). Beyond the original word-based pattern-discovery tools (oligo-analysis and dyad-analysis), we recently added a battery of tools for matrix-based detection of cis-acting elements, with some original features (adaptive background models, Markov-chain estimation of P-values) that do not exist in other matrix-based scanning tools. The web server offers an intuitive interface, where each program can be accessed either separately or connected to the other tools. In addition, the tools are now available as web services, enabling their integration in programmatic workflows. Genomes are regularly updated from various genome repositories (NCBI and EnsEMBL) and 682 organisms are currently supported. Since 1998, the tools have been used by several hundreds of researchers from all over the world. Several predictions made with RSAT were validated experimentally and published.

  2. [Advanced therapy: from European regulatory framework to national regulatory framework].

    PubMed

    Lucas-Samuel, S

    2013-05-01

    The European regulation n(o) 1394/2007/CE published on the 13th of November 2007 defined and harmonized the European regulatory framework for advanced therapy medicinal products. It creates a specialized committee located at the European Medicine Agency, in charge of the assessment of these medicinal products. The consequences of this regulation are introduced in the French regulation by the law n(o) 2011-302 published on the 22nd of March 2011. It detailed notably the possibility for public establishments (except health establishments) and nonprofit organisms to create pharmaceutical establishments. This law defined also a specific category of advanced therapy medicinal products, which fall under the "hospital exemption" framework. The rules regarding the authorizations of the establishments able to prepare these types of medicinal products and the authorization of the products are defined by the n(o) 2012-1236 decree published on the 6th of November 2012.

  3. Global Summit on Regulatory Science 2013.

    PubMed

    Howard, Paul C; Tong, Weida; Weichold, Frank; Healy, Marion; Slikker, William

    2014-12-01

    Regulatory science has been defined as the science that is used to develop regulatory decisions by government bodies. Regulatory science encompasses many scientific disciplines that oversee many studies producing a wide array of data. These may include fundamental research into the cellular interaction or response to a particular chemical or substance, hazard-assessment and dose-response studies in animal species, neurophysiological or neurobehavioral studies, best practices for the generation and analysis of genomics data, bioinformatics approaches, and mathematical modeling of risk. The Global Summit on Regulatory Science is an international conference with a mission to explore emerging and innovative technologies, and provide a platform to enhance translation of basic science into regulatory applications. The Third Global Summit on Regulatory Science which focused on nanotechnology is discussed.

  4. Serial analysis of gene expression provides new insights into regulatory T cells.

    PubMed

    Cobbold, Stephen P; Adams, Elizabeth; Graca, Luis; Waldmann, Herman

    2003-08-01

    It is now possible to induce donor-specific transplantation tolerance in adult rodents using a number of therapeutic strategies. Such peripheral tolerance is maintained by regulatory CD4+ T cells, not only in transplantation models, but also in autoimmunity. Differential gene expression analyses have been used to identify potential new markers for regulatory T cells, aiming to reveal new insights into their mechanisms of action, and to find novel targets for therapeutic manipulation of the immune system. PMID:14690045

  5. Environmental Regulatory Update Table, January 1991

    SciTech Connect

    Hawkins, G.T.; Houlberg, L.M.; Salk, M.S.

    1991-02-01

    The Environmental Regulatory Update Table provides information on regulatory initiatives of interest to DOE operations and contractor staff with environmental management responsibilities. The table is updated each month with information from the Federal Register and other sources, including direct contact with regulatory agencies. Each table entry provides a chronological record of the rulemaking process for that initiative with an abstract and a projection of further action.

  6. Environmental regulatory update table, March 1989

    SciTech Connect

    Houlberg, L.; Langston, M.E.; Nikbakht, A.; Salk, M.S.

    1989-04-01

    The Environmental Regulatory Update Table provides information on regulatory initiatives of interest to DOE operations and contractor staff with environmental management responsibilities. The table is updated each month with information from the Federal Register and other sources, including direct contact with regulatory agencies. Each table entry provides a chronological record of the rulemaking process for that initiative with an abstract and a projection of further action.

  7. Environmental regulatory update table, July 1991

    SciTech Connect

    Houlberg, L.M.; Hawkins, G.T.; Salk, M.S.

    1991-08-01

    This Environmental Regulatory Update Table (July 1991) provides information on regulatory initiatives of interest to DOE operations and contractor staff with environmental management responsibilities. The table is updated each month with information from the Federal Register and other sources, including direct contact with regulatory agencies. Each table entry provides a chronological record of the rulemaking process for that initiative with an abstract and a projection of further action.

  8. Environmental Regulatory Update Table, December 1990

    SciTech Connect

    Hawkins, G.T.; Houlberg, L.M.; Noghrei-Nikbakht, P.A.; Salk, M.S.

    1991-01-01

    The Environmental Regulatory Update Table provides information on regulatory initiatives of interest to DOE operations and contractor staff with environmental management responsibilities. The table is updated each month with information from the Federal Register and other sources, including direct contact with regulatory agencies. Each table entry provides a chronological record of the rulemaking process for that initiative with an abstract and a projection of further action.

  9. Environmental Regulatory Update Table, November 1990

    SciTech Connect

    Hawkins, G.T.; Houlberg, L.M.; Noghrei-Nikbakht, P.A.; Salk, M.S.

    1990-12-01

    The Environmental Regulatory Update Table provides information on regulatory initiatives of interest to DOE operations and contractor staff with environmental management responsibilities. The table is updated each month with information from the Federal Register and other sources, including direct contact with regulatory agencies. Each table entry provides a chronological record of the rulemaking process for that initiative with an abstract and a projection of further action.

  10. Environmental Regulatory Update Table, September 1990

    SciTech Connect

    Houlberg, L.M.; Nikbakht, A.; Salk, M.S.

    1990-10-01

    The Environmental Regulatory Update Table provides information on regulatory initiatives of interest to DOE operations and contractor staff with environmental management responsibilities. The table is updated each month with information from the Federal Register and other sources, including direct contact with regulatory agencies. Each table entry provides a chronological record of the rulemaking process for that initiative with an abstract and a projection of further action.

  11. Environmental Regulatory Update Table, October 1991

    SciTech Connect

    Houlberg, L.M.; Hawkins, G.T.; Salk, M.S.

    1991-11-01

    The Environmental Regulatory Update Table provides information on regulatory initiatives of interest to DOE operations and contractor staff with environmental management responsibilities. The table is updated each month with information from the Federal Register and other sources, including direct contact with regulatory agencies. Each table entry provides a chronological record of the rulemaking process for that initiative with an abstract and a projection of further action.

  12. Environmental Regulatory Update Table, October 1990

    SciTech Connect

    Houlberg, L.M.; Noghrei-Nikbakht, P.A.; Salk, M.S.

    1990-11-01

    The Environmental Regulatory Update Table provides information on regulatory initiatives of interest to DOE operations and contractor staff with environmental management responsibilities. The table is updated each month with information from the Federal Register and other sources, including direct contact with regulatory agencies. Each table entry provides a chronological record of the rulemaking process for that initiative with an abstract and a projection of further action.

  13. Environmental Regulatory Update Table, April 1989

    SciTech Connect

    Houlberg, L.; Langston, M.E.; Nikbakht, A.; Salk, M.S.

    1989-05-01

    The Environmental Regulatory Update Table provides information on regulatory initiatives of interest to DOE operations and contractor staff with environmental management responsibilities. The table is updated each month with information from the Federal Register and other sources, including direct contact with regulatory agencies. Each table entry provides a chronological record of the rulemaking process for that initiative with an abstract and a projection of further action.

  14. Environmental Regulatory Update Table, December 1989

    SciTech Connect

    Houlbert, L.M.; Langston, M.E. ); Nikbakht, A.; Salk, M.S. )

    1990-01-01

    The Environmental Regulatory Update Table provides information on regulatory initiatives of interest to DOE operations and contractor staff with environmental management responsibilities. The table is updated each month with information from the Federal Register and other sources, including direct contact with regulatory agencies. Each table entry provides a chronological record of the rulemaking process for that initiative with an abstract and a projection of further action.

  15. Environmental Regulatory Update Table, August 1991

    SciTech Connect

    Houlberg, L.M., Hawkins, G.T.; Salk, M.S.

    1991-09-01

    This Environmental Regulatory Update Table (August 1991) provides information on regulatory initiatives of interest to DOE operations and contractor staff with environmental management responsibilities. The table is updated each month with information from the Federal Register and other sources, including direct contact with regulatory agencies. Each table entry provides a chronological record of the rulemaking process for that initiative with an abstract and a projection of further action.

  16. Environmental Regulatory Update Table, December 1991

    SciTech Connect

    Houlberg, L.M.; Hawkins, G.T.; Salk, M.S.

    1992-01-01

    The Environmental Regulatory Update Table provides information on regulatory initiatives of interest to DOE operations and contractor staff with environmental management responsibilities. The table is updated each month with information from the Federal Register and other sources, including direct contact with regulatory agencies. Each table entry provides a chronological record of the rulemaking process for that initiative with an abstract and a projection of further action.

  17. Environmental Regulatory Update Table, November 1991

    SciTech Connect

    Houlberg, L.M.; Hawkins, G.T.; Salk, M.S.

    1991-12-01

    The Environmental Regulatory Update Table provides information on regulatory initiatives of interest to DOE operations and contractor staff with environmental management responsibilities. The table is updated each month with information from the Federal Register and other sources, including direct contact with regulatory agencies. Each table entry provides a chronological record of the rulemaking process for that initiative with an abstract and a projection of further action.

  18. Environmental Regulatory Update Table, September 1991

    SciTech Connect

    Houlberg, L.M.; Hawkins, G.T.; Salk, M.S.

    1991-10-01

    The Environmental Regulatory Update Table provides information on regulatory initiatives of interest to DOE operations and contractor staff with environmental management responsibilities. The table is updated each month with information from the Federal Register and other sources, including direct contact with regulatory agencies. Each table entry provides a chronological record of the rulemaking process for that initiative with an abstract and a projection of further action.

  19. 21 CFR 26.18 - Regulatory collaboration.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... RECOGNITION OF PHARMACEUTICAL GOOD MANUFACTURING PRACTICE REPORTS, MEDICAL DEVICE QUALITY SYSTEM AUDIT REPORTS... Specific Sector Provisions for Pharmaceutical Good Manufacturing Practices § 26.18 Regulatory...

  20. A genomic regulatory network for development

    NASA Technical Reports Server (NTRS)

    Davidson, Eric H.; Rast, Jonathan P.; Oliveri, Paola; Ransick, Andrew; Calestani, Cristina; Yuh, Chiou-Hwa; Minokawa, Takuya; Amore, Gabriele; Hinman, Veronica; Arenas-Mena, Cesar; Otim, Ochan; Brown, C. Titus; Livi, Carolina B.; Lee, Pei Yun; Revilla, Roger; Rust, Alistair G.; Pan, Zheng jun; Schilstra, Maria J.; Clarke, Peter J C.; Arnone, Maria I.; Rowen, Lee; Cameron, R. Andrew; McClay, David R.; Hood, Leroy; Bolouri, Hamid

    2002-01-01

    Development of the body plan is controlled by large networks of regulatory genes. A gene regulatory network that controls the specification of endoderm and mesoderm in the sea urchin embryo is summarized here. The network was derived from large-scale perturbation analyses, in combination with computational methodologies, genomic data, cis-regulatory analysis, and molecular embryology. The network contains over 40 genes at present, and each node can be directly verified at the DNA sequence level by cis-regulatory analysis. Its architecture reveals specific and general aspects of development, such as how given cells generate their ordained fates in the embryo and why the process moves inexorably forward in developmental time.