Science.gov

Sample records for regulatory protein-dependent mechanism

  1. Identification of a regulatory loop for the synthesis of neurosteroids: a steroidogenic acute regulatory protein-dependent mechanism involving hypothalamic-pituitary-gonadal axis receptors

    PubMed Central

    Meethal, Sivan Vadakkadath; Liu, Tianbing; Chan, Hsien W.; Ginsburg, Erika; Wilson, Andrea C.; Gray, Danielle N.; Bowen, Richard L.; Vonderhaar, Barbara K.; Atwood, Craig S.

    2009-01-01

    Brain sex steroids are derived from both peripheral (primarily gonadal) and local (neurosteroids) sources and are crucial for neurogenesis, neural differentiation and neural function. The mechanism(s) regulating the production of neurosteroids is not understood. To determine whether hypothalamic-pituitary-gonadal axis components previously detected in the extra-hypothalamic brain comprise a feedback loop to regulate neuro-sex steroid (NSS) production, we assessed dynamic changes in expression patterns of steroidogenic acute regulatory (StAR) protein, a key regulator of steroidogenesis, and key hypothalamic-pituitary-gonadal endocrine receptors, by modulating peripheral sex hormone levels in female mice. Ovariectomy (OVX; high serum gonadotropins, low serum sex steroids) had a differential effect on StAR protein levels in the extrahypothalamic brain; increasing the 30- and 32-kDa variants but decreasing the 37-kDa variant and is indicative of cholesterol transport into mitochondria for steroidogenesis. Treatment of OVX animals with E2,P4,or E2 + P4 for 3 days, which decreases OVX-induced increases in GnRH/gonadotropin production, reversed this pattern. Suppression of gonadotropin levels in OVX mice using the GnRH agonist leuprolide acetate inhibited the processing of the 37-kDa StAR protein into the 30-kDa StAR protein, confirming that the differential processing of brain StAR protein is regulated by gonadotropins. OVX dramatically suppressed extra-hypothalamic brain gonadotropin-releasing hormone 1 receptor expression, and was further suppressed in E2- or P4-treated OVX mice. Together, these data indicate the existence of endocrine and autocrine/paracrine feedback loops that regulate NSS synthesis. Further delineation of these feedback loops that regulate NSS production will aid in developing therapies to maintain brain sex steroid levels and cognition. PMID:19493163

  2. GTP cyclohydrolase I feedback regulatory protein-dependent and -independent inhibitors of GTP cyclohydrolase I.

    PubMed

    Yoneyama, T; Wilson, L M; Hatakeyama, K

    2001-04-01

    GTP cyclohydrolase I feedback regulatory protein (GFRP) mediates the feedback inhibition of GTP cyclohydrolase I activity by (6R)-L-erythro-5,6,7,8-tetrahydrobiopterin (BH4) through protein complex formation. Since guanine and BH4 have a common pyrimidine ring structure, we examined the inhibitory effect of guanine and its analogs on the enzyme activity. Guanine, 8-hydroxyguanine, 8-methylguanine, and 8-bromoguanine inhibited the enzyme activity in a GFRP-dependent and pH-dependent manner and induced complex formation between GTP cyclohydrolase I and GFRP. The type of inhibition by this group is a mixed type. All these properties were shared with BH4. In striking contrast, inhibition by 8-azaguanine and 8-mercaptoguanine was GFRP-independent and pH-independent. The type of inhibition by 8-azaguanine and 8-mercaptoguanine was a competitive type. The two compounds did not induce complex formation between the enzyme and GFRP. These results demonstrate that guanine compounds of the first group bind to the BH4-binding site of the GTP cyclohydrolase I/GFRP complex, whereas 8-azaguanine and 8-mercaptoguanine bind to the active site of the enzyme. Finally, the possible implications in Lesch-Nyhan syndrome and Parkinson diseases of the inhibition of GTP cyclohydrolase I by guanine and 8-hydroxyguanine are discussed.

  3. E6-Associated Protein Dependent Estrogen Receptor Regulation of Protein Kinase A Regulatory Subunit R2A Expression in Neuroblastoma.

    PubMed

    Obeid, Jean-Pierre; Zeidan, Youssef H; Zafar, Nawal; El Hokayem, Jimmy

    2017-02-18

    E6ap is a known transcriptional coregulator for estrogen receptor alpha (Er, Erα) in the presence of estrogen. Protein kinase A (PKA) contains two regulatory subunits derived from four genes. Recent evidence demonstrates that PKA regulates E6ap activity. Data generated in our lab indicated estrogen dependent regulation of Pkar2a levels. Our project sets to investigate a possible feedback mechanism constituting of Erα and E6ap transcriptional regulation of Pkar2a expression. Western blot evaluated protein regulation correlations with E2 in mouse neuroblastoma lines. Bioinformatics detected estrogen response element (ERE) sequences. quantitative polymerase chain reaction (qPCR) validated the western blot results. ERE oligonucleotides were synthesized. Reporter gene transcriptional activity was evaluated via Luciferase assay output. Electromobility shift assay (EMSA) assessed direct binding between Erα relevant sequences. Chromatin immunoprecipitation (ChIP) and Re-ChIP were conducted in quantifying protein complex recruitment levels. Pkar2a protein expression directly correlated with E2, and four putative ERE sequences were identified. Pkar2a mRNA expression reverted to baseline with either E2 or E6ap absent. In the presence of E2, ERE-1 and ERE-4 possessed Luciferase reporter gene transcriptional capabilities. ERE-1 portrayed band shifts, representing direct binding to Erα with E2 supplementation. With E2, ERE-1 significantly enhanced Erα and E6ap recruitment levels to the Pkar2a promoter. Pkar2a is directly regulated by Erα and E6ap in the presence of estrogen stimulus. This work indicates a feedback mechanism in the interplay between PKA and E6ap, which may prove crucial for the role of both proteins in cancers and neurogenetic diseases like Angelman syndrome.

  4. Sterol regulatory element binding protein-dependent regulation of lipid synthesis supports cell survival and tumor growth

    PubMed Central

    2013-01-01

    Background Regulation of lipid metabolism via activation of sterol regulatory element binding proteins (SREBPs) has emerged as an important function of the Akt/mTORC1 signaling axis. Although the contribution of dysregulated Akt/mTORC1 signaling to cancer has been investigated extensively and altered lipid metabolism is observed in many tumors, the exact role of SREBPs in the control of biosynthetic processes required for Akt-dependent cell growth and their contribution to tumorigenesis remains unclear. Results We first investigated the effects of loss of SREBP function in non-transformed cells. Combined ablation of SREBP1 and SREBP2 by siRNA-mediated gene silencing or chemical inhibition of SREBP activation induced endoplasmic reticulum (ER)-stress and engaged the unfolded protein response (UPR) pathway, specifically under lipoprotein-deplete conditions in human retinal pigment epithelial cells. Induction of ER-stress led to inhibition of protein synthesis through increased phosphorylation of eIF2α. This demonstrates for the first time the importance of SREBP in the coordination of lipid and protein biosynthesis, two processes that are essential for cell growth and proliferation. SREBP ablation caused major changes in lipid composition characterized by a loss of mono- and poly-unsaturated lipids and induced accumulation of reactive oxygen species (ROS) and apoptosis. Alterations in lipid composition and increased ROS levels, rather than overall changes to lipid synthesis rate, were required for ER-stress induction. Next, we analyzed the effect of SREBP ablation in a panel of cancer cell lines. Importantly, induction of apoptosis following SREBP depletion was restricted to lipoprotein-deplete conditions. U87 glioblastoma cells were highly susceptible to silencing of either SREBP isoform, and apoptosis induced by SREBP1 depletion in these cells was rescued by antioxidants or by restoring the levels of mono-unsaturated fatty acids. Moreover, silencing of SREBP1

  5. Regulatory Mechanisms of Hsp90

    PubMed Central

    Prodromou, Chrisostomos

    2017-01-01

    The ability of Hsp90 to activate a disparate clientele implicates this chaperone in diverse biological processes. To accommodate such varied roles, Hsp90 requires a variety of regulatory mechanisms that are coordinated in order to modulate its activity appropriately. Amongst these, the master-regulator heat shock factor 1 (HSF1) is critically important in upregulating Hsp90 during stress, but is also responsible, through interaction with specific transcription factors (such as STAT1 and Strap/p300) for the integration of a variety of biological signals that ultimately modulate Hsp90 expression. Additionally, transcription factors, such as STAT1, STAT3 (including STAT1-STAT3 oligomers), NF-IL6, and NF-kB, are known to influence Hsp90 expression directly. Co-chaperones offer another mechanism for Hsp90 regulation, and these can modulate the chaperone cycle appropriately for specific clientele. Co-chaperones include those that deliver specific clients to Hsp90, and others that regulate the chaperone cycle for specific Hsp90-client complexes by modulating Hsp90s ATPase activity. Finally, post-translational modification (PTM) of Hsp90 and its co-chaperones helps too further regulate the variety of different Hsp90 complexes found in cells. PMID:28289734

  6. IA channels: diverse regulatory mechanisms.

    PubMed

    Carrasquillo, Yarimar; Nerbonne, Jeanne M

    2014-04-01

    In many peripheral and central neurons, A-type K(+) currents, IA, have been identified and shown to be key determinants in shaping action potential waveforms and repetitive firing properties, as well as in the regulation of synaptic transmission and synaptic plasticity. The functional properties and physiological roles of native neuronal IA, however, have been shown to be quite diverse in different types of neurons. Accumulating evidence suggests that this functional diversity is generated by multiple mechanisms, including the expression and subcellular distributions of IA channels encoded by different voltage-gated K(+) (Kv) channel pore-forming (α) subunits, interactions of Kv α subunits with cytosolic and/or transmembrane accessory subunits and regulatory proteins and post-translational modifications of channel subunits. Several recent reports further suggest that local protein translation in the dendrites of neurons and interactions between IA channels with other types of voltage-gated ion channels further expands the functional diversity of native neuronal IA channels. Here, we review the diverse molecular mechanisms that have been shown or proposed to underlie the functional diversity of native neuronal IA channels.

  7. Advances in Autophagy Regulatory Mechanisms

    PubMed Central

    Gallagher, Laura E.; Williamson, Leon E.; Chan, Edmond Y. W.

    2016-01-01

    Autophagy plays a critical role in cell metabolism by degrading and recycling internal components when challenged with limited nutrients. This fundamental and conserved mechanism is based on a membrane trafficking pathway in which nascent autophagosomes engulf cytoplasmic cargo to form vesicles that transport their content to the lysosome for degradation. Based on this simple scheme, autophagy modulates cellular metabolism and cytoplasmic quality control to influence an unexpectedly wide range of normal mammalian physiology and pathophysiology. In this review, we summarise recent advancements in three broad areas of autophagy regulation. We discuss current models on how autophagosomes are initiated from endogenous membranes. We detail how the uncoordinated 51-like kinase (ULK) complex becomes activated downstream of mechanistic target of rapamycin complex 1 (MTORC1). Finally, we summarise the upstream signalling mechanisms that can sense amino acid availability leading to activation of MTORC1. PMID:27187479

  8. Crystallographic studies with xenon and nitrous oxide provide evidence for protein-dependent processes in the mechanisms of general anesthesia.

    PubMed

    Abraini, Jacques H; Marassio, Guillaume; David, Helene N; Vallone, Beatrice; Prangé, Thierry; Colloc'h, Nathalie

    2014-11-01

    The mechanisms by which general anesthetics, including xenon and nitrous oxide, act are only beginning to be discovered. However, structural approaches revealed weak but specific protein-gas interactions. To improve knowledge, we performed x-ray crystallography studies under xenon and nitrous oxide pressure in a series of 10 binding sites within four proteins. Whatever the pressure, we show (1) hydrophobicity of the gas binding sites has a screening effect on xenon and nitrous oxide binding, with a threshold value of 83% beyond which and below which xenon and nitrous oxide, respectively, binds to their sites preferentially compared to each other; (2) xenon and nitrous oxide occupancies are significantly correlated respectively to the product and the ratio of hydrophobicity by volume, indicating that hydrophobicity and volume are binding parameters that complement and oppose each other's effects; and (3) the ratio of occupancy of xenon to nitrous oxide is significantly correlated to hydrophobicity of their binding sites. These data demonstrate that xenon and nitrous oxide obey different binding mechanisms, a finding that argues against all unitary hypotheses of narcosis and anesthesia, and indicate that the Meyer-Overton rule of a high correlation between anesthetic potency and solubility in lipids of general anesthetics is often overinterpreted. This study provides evidence that the mechanisms of gas binding to proteins and therefore of general anesthesia should be considered as the result of a fully reversible interaction between a drug ligand and a receptor as this occurs in classical pharmacology.

  9. Regulatory mechanisms for floral homeotic gene expression.

    PubMed

    Liu, Zhongchi; Mara, Chloe

    2010-02-01

    Proper regulation of floral homeotic gene (or ABCE gene) expression ensures the development of floral organs in the correct number, type, and precise spatial arrangement. This review summarizes recent advances on the regulation of floral homeotic genes, highlighting the variety and the complexity of the regulatory mechanisms involved. As flower development is one of the most well characterized developmental processes in higher plants, it facilitates the discovery of novel regulatory mechanisms. To date, mechanisms for the regulation of floral homeotic genes range from transcription to post-transcription, from activators to repressors, and from microRNA- to ubiquitin-mediated post-transcriptional regulation. Region-specific activation of floral homeotic genes is dependent on the integration of a flower-specific activity provided by LEAFY (LFY) and a region- and stage-specific activating function provided by one of the LFY cofactors. Two types of regulatory loops, the feed-forward and the feedback loop, provide properly timed gene activation and subsequent maintenance and refinement in proper spatial and temporal domains of ABCE genes. Two different microRNA/target modules may have been independently recruited in different plant species to regulate C gene expression. Additionally, competition among different MADS box proteins for common interacting partners may represent a mechanism in whorl boundary demarcation. Future work using systems approaches and the development of non-model plants will provide integrated views on floral homeotic gene regulation and insights into the evolution of morphological diversity in flowering plants. Copyright 2009 Elsevier Ltd. All rights reserved.

  10. Major regulatory mechanisms involved in sperm motility.

    PubMed

    Pereira, Rute; Sá, Rosália; Barros, Alberto; Sousa, Mário

    2017-01-01

    The genetic bases and molecular mechanisms involved in the assembly and function of the flagellum components as well as in the regulation of the flagellar movement are not fully understood, especially in humans. There are several causes for sperm immotility, of which some can be avoided and corrected, whereas other are related to genetic defects and deserve full investigation to give a diagnosis to patients. This review was performed after an extensive literature search on the online databases PubMed, ScienceDirect, and Web of Science. Here, we review the involvement of regulatory pathways responsible for sperm motility, indicating possible causes for sperm immotility. These included the calcium pathway, the cAMP-dependent protein kinase pathway, the importance of kinases and phosphatases, the function of reactive oxygen species, and how the regulation of cell volume and osmolarity are also fundamental components. We then discuss main gene defects associated with specific morphological abnormalities. Finally, we slightly discuss some preventive and treatments approaches to avoid development of conditions that are associated with unspecified sperm immotility. We believe that in the near future, with the development of more powerful techniques, the genetic causes of sperm immotility and the regulatory mechanisms of sperm motility will be better understand, thus enabling to perform a full diagnosis and uncover new therapies.

  11. Major regulatory mechanisms involved in sperm motility

    PubMed Central

    Pereira, Rute; Sá, Rosália; Barros, Alberto; Sousa, Mário

    2017-01-01

    The genetic bases and molecular mechanisms involved in the assembly and function of the flagellum components as well as in the regulation of the flagellar movement are not fully understood, especially in humans. There are several causes for sperm immotility, of which some can be avoided and corrected, whereas other are related to genetic defects and deserve full investigation to give a diagnosis to patients. This review was performed after an extensive literature search on the online databases PubMed, ScienceDirect, and Web of Science. Here, we review the involvement of regulatory pathways responsible for sperm motility, indicating possible causes for sperm immotility. These included the calcium pathway, the cAMP-dependent protein kinase pathway, the importance of kinases and phosphatases, the function of reactive oxygen species, and how the regulation of cell volume and osmolarity are also fundamental components. We then discuss main gene defects associated with specific morphological abnormalities. Finally, we slightly discuss some preventive and treatments approaches to avoid development of conditions that are associated with unspecified sperm immotility. We believe that in the near future, with the development of more powerful techniques, the genetic causes of sperm immotility and the regulatory mechanisms of sperm motility will be better understand, thus enabling to perform a full diagnosis and uncover new therapies. PMID:26680031

  12. Mechanisms of T regulatory cell function.

    PubMed

    Askenasy, Nadir; Kaminitz, Ayelet; Yarkoni, Shai

    2008-05-01

    Regulatory T cells (Treg) play a pivotal role in tolerance to self-antigens and tissue grafts, and suppression of autoimmune reactions. These cells modulate the intensity and quality of immune reactions through attenuation of the cytolytic activities of reactive immune cells. Treg cells operate primarily at the site of inflammation where they modulate the immune reaction through three major mechanisms: a) direct killing of cytotoxic cells through cell-to-cell contact, b) inhibition of cytokine production by cytotoxic cells, in particular interleukin-2, c) direct secretion of immunomodulatory cytokines, in particular TGF-beta and interleukin-10. In addition to differential contributions of these mechanisms under variable inflammatory conditions, mechanistic complexity and diversity evolves from the diverse tasks performed by various Treg cell subsets in different stages of the immune reaction. Here we attempt to integrate the current experimental evidence to delineate the major suppressive pathways of Treg cells.

  13. Multiphoton imaging of renal regulatory mechanisms.

    PubMed

    Peti-Peterdi, János; Toma, Ildikó; Sipos, Arnold; Vargas, Sarah L

    2009-04-01

    Most physiological functions of the kidneys, including the clearance of metabolic waste products, maintenance of body fluid, electrolyte homeostasis, and blood pressure, are achieved by complex interactions between multiple renal cell types and previously inaccessible structures in many organ parts that have been difficult to study. Multiphoton fluorescence microscopy offers a state-of-the-art imaging technique for deep optical sectioning of living tissues and organs with minimal deleterious effects. Dynamic regulatory processes and multiple functions in the intact kidney can be quantitatively visualized in real time, noninvasively, and with submicron resolution. This article reviews innovative multiphoton imaging technologies and their applications that provided the most complex, immediate, and dynamic portrayal of renal function-clearly depicting as well as analyzing the components and mechanisms involved in renal (patho)physiology.

  14. Regulatory mechanisms underlying C4 photosynthesis.

    PubMed

    Wang, Lin; Peterson, Richard B; Brutnell, Thomas P

    2011-04-01

    C4 photosynthesis is an adaptation that evolved to alleviate the detrimental effects of photorespiration as a result of the gradual decline in atmospheric carbon dioxide levels. In most C4 plants, two cell types, bundle sheath and mesophyll, cooperate in carbon fixation, and, in so doing, are able to alleviate photorespiratory losses. Although much of the biochemistry is well characterized, little is known about the genetic mechanisms underlying the cell-type specificity driving C4 . However, several studies have shown that regulation acts at multiple levels, including transcriptional, post-transcriptional, post-translational and epigenetic. One example of such a regulatory mechanism is the cell-specific accumulation of major photorespiratory transcripts/proteins in bundle sheath cells, where ribulose-1,5-bisphosphate carboxylase/oxygenase is localized. Although many of the genes are expressed in the bundle sheath, some are expressed in both cell types, implicating post-transcriptional control mechanisms. Recently, ultra-high-throughput sequencing techniques and sophisticated mass spectrometry instrumentation have provided new opportunities to further our understanding of C4 regulation. Computational pipelines are being developed to accommodate the mass of data associated with these techniques. Finally, we discuss a readily transformable C4 grass--Setaria viridis--that has great potential to serve as a model for the genetic dissection of C4 photosynthesis in the grasses. © 2011 The Authors. New Phytologist © 2011 New Phytologist Trust.

  15. Effects of Four Different Regulatory Mechanisms on the Dynamics of Gene Regulatory Cascades

    PubMed Central

    Hansen, Sabine; Krishna, Sandeep; Semsey, Szabolcs; Lo Svenningsen, Sine

    2015-01-01

    Gene regulatory cascades (GRCs) are common motifs in cellular molecular networks. A given logical function in these cascades, such as the repression of the activity of a transcription factor, can be implemented by a number of different regulatory mechanisms. The potential consequences for the dynamic performance of the GRC of choosing one mechanism over another have not been analysed systematically. Here, we report the construction of a synthetic GRC in Escherichia coli, which allows us for the first time to directly compare and contrast the dynamics of four different regulatory mechanisms, affecting the transcription, translation, stability, or activity of a transcriptional repressor. We developed a biologically motivated mathematical model which is sufficient to reproduce the response dynamics determined by experimental measurements. Using the model, we explored the potential response dynamics that the constructed GRC can perform. We conclude that dynamic differences between regulatory mechanisms at an individual step in a GRC are often concealed in the overall performance of the GRC, and suggest that the presence of a given regulatory mechanism in a certain network environment does not necessarily mean that it represents a single optimal evolutionary solution. PMID:26184971

  16. Carotenoid biosynthesis regulatory mechanisms in plants.

    PubMed

    Othman, Rashidi; Mohd Zaifuddin, Fatimah Azzahra; Hassan, Norazian Mohd

    2014-01-01

    Carotenoids are bioactive compounds with remarkably special properties produced by plants in response to internal and external stresses. In this review paper, we focus on the subject of carotenoid biosynthesis and several factors that have been reported to significantly enhance or reduce carotenoid accumulation in studied plant species. These factors include varietal aspects, location, growing season, and type of stress experienced by a plant. In addition, we propose that there are three stress resistance mechanisms in plants: avoidance, tolerance, and acclimation. Better understanding of the environmental factors affecting carotenoid biosynthesis will help researchers to develop methods for enhancing the production of carotenoids and other pigments to desired concentrations in plant crops.

  17. Identifying regulatory mechanisms underlying tumorigenesis using locus expression signature analysis.

    PubMed

    Lee, Eunjee; de Ridder, Jeroen; Kool, Jaap; Wessels, Lodewyk F A; Bussemaker, Harmen J

    2014-04-15

    Retroviral insertional mutagenesis is a powerful tool for identifying putative cancer genes in mice. To uncover the regulatory mechanisms by which common insertion loci affect downstream processes, we supplemented genotyping data with genome-wide mRNA expression profiling data for 97 tumors induced by retroviral insertional mutagenesis. We developed locus expression signature analysis, an algorithm to construct and interpret the differential gene expression signature associated with each common insertion locus. Comparing locus expression signatures to promoter affinity profiles allowed us to build a detailed map of transcription factors whose protein-level regulatory activity is modulated by a particular locus. We also predicted a large set of drugs that might mitigate the effect of the insertion on tumorigenesis. Taken together, our results demonstrate the potential of a locus-specific signature approach for identifying mammalian regulatory mechanisms in a cancer context.

  18. Detecting Regulatory Mechanisms in Endocrine Time Series Measurements

    PubMed Central

    Vis, Daniel J.; Westerhuis, Johan A.; Hoefsloot, Huub C. J.; Roelfsema, Ferdinand

    2012-01-01

    The regulatory mechanisms underlying pulsatile secretion are complex, especially as it is partly controlled by other hormones and the combined action of multiple agents. Regulatory relations between hormones are not directly observable but may be deduced from time series measurements of plasma hormone concentrations. Variation in plasma hormone levels are the resultant of secretion and clearance from the circulation. A strategy is proposed to extract inhibition, activation, thresholds and circadian synchronicity from concentration data, using particular association methods. Time delayed associations between hormone concentrations and/or extracted secretion pulse profiles reveal the information on regulatory mechanisms. The above mentioned regulatory mechanisms are illustrated with simulated data. Additionally, data from a lean cohort of healthy control subjects is used to illustrate activation (ACTH and cortisol) and circadian synchronicity (ACTH and TSH) in real data. The simulation and the real data both consist of 145 equidistant samples per individual, matching a 24-hr time span with 10 minute intervals. The results of the simulation and the real data are in concordance. PMID:22461889

  19. The hypothalamic GnRH pulse generator: multiple regulatory mechanisms.

    PubMed

    Krsmanovic, Lazar Z; Hu, Lian; Leung, Po-Ki; Feng, Hao; Catt, Kevin J

    2009-10-01

    Pulsatile secretion of gonadotropin-releasing hormone (GnRH) release is an intrinsic property of hypothalamic GnRH neurons. Pulse generation has been attributed to multiple specific mechanisms, including spontaneous electrical activity of GnRH neurons, calcium and cAMP signaling, a GnRH receptor autocrine regulatory component, a GnRH concentration-dependent switch in GnRH receptor (GnRH-R) coupling to specific G proteins, the expression of G protein-coupled receptors (GPCRs) and steroid receptors, and homologous and heterologous interactions between cell membrane receptors expressed in GnRH neurons. The coexistence of multiple regulatory mechanisms for pulsatile GnRH secretion provides a high degree of redundancy in maintaining this crucial component of the mammalian reproductive process. These studies provide insights into the basic cellular and molecular mechanisms involved in GnRH neuronal function.

  20. XB51 isoforms mediate Alzheimer's beta-amyloid peptide production by X11L (X11-like protein)-dependent and -independent mechanisms.

    PubMed

    Sumioka, Akio; Imoto, Seiyu; Martins, Ralph N; Kirino, Yutaka; Suzuki, Toshiharu

    2003-08-15

    XB51 (derived from X11-like binding protein of clone number 51) was isolated by yeast two-hybrid cDNA screening using the N-terminal domain of X11L (X11-like protein) as a bait. X11L is a neuron-specific adaptor protein that is known to down-regulate APP (beta-amyloid precursor protein) metabolism by associating with the cytoplasmic domain of APP, but the detailed mechanisms are still unknown. Thus the X11L-associated protein XB51 is believed to regulate APP metabolism by modifying X11L function through its interaction with X11L. Here we report that the hXB51 (human XB51 ) gene can yield two transcripts, one with exon 9 spliced out (resulting in the hXB51beta isoform) and the other containing exon 9 (yielding the hXB51alpha isoform). hXB51alpha binds to X11L to form a tripartite complex composed of hXB51alpha, X11L and APP. Complex-formation results in blocking X11L's suppression of Abeta (beta-amyloid) generation from APP. hXB51beta associates with X11L and inhibits its interaction with APP. However, hXB51beta suppresses Abeta generation and secretion in an X11L-independent manner. Thus the hXB51 isoforms regulate Abeta generation differently, either enhancing it by modifying the association of X11L with APP or suppressing it in an X11L-independent manner. These observations advance our understanding of the molecular mechanisms regulating intracellular Abeta production and the pathogenesis of Alzheimer's disease.

  1. Iron and ageing: an introduction to iron regulatory mechanisms.

    PubMed

    Levenson, Cathy W; Tassabehji, Nadine M

    2004-07-01

    While there have been significant advances made in our understanding of the cellular and molecular mechanisms that regulate iron absorption, transport, storage, and utilization, the effect of ageing on these mechanisms and the role of iron in the ageing process is not fully understood. Thus, this review will provide an overview of the iron regulatory mechanisms that may be a factor in the ageing process. Additional reviews in this volume represent an attempt to explore the very latest information on the regulation of iron with a particular emphasis on age-related pathology including mitochondrial function, Parkinson's disease, Alzheimer's disease, stroke, and cardiovascular disease.

  2. The spinal muscular atrophy with pontocerebellar hypoplasia gene VRK1 regulates neuronal migration through an amyloid-β precursor protein-dependent mechanism.

    PubMed

    Vinograd-Byk, Hadar; Sapir, Tamar; Cantarero, Lara; Lazo, Pedro A; Zeligson, Sharon; Lev, Dorit; Lerman-Sagie, Tally; Renbaum, Paul; Reiner, Orly; Levy-Lahad, Ephrat

    2015-01-21

    Spinal muscular atrophy with pontocerebellar hypoplasia (SMA-PCH) is an infantile SMA variant with additional manifestations, particularly severe microcephaly. We previously identified a nonsense mutation in Vaccinia-related kinase 1 (VRK1), R358X, as a cause of SMA-PCH. VRK1-R358X is a rare founder mutation in Ashkenazi Jews, and additional mutations in patients of different origins have recently been identified. VRK1 is a nuclear serine/threonine protein kinase known to play multiple roles in cellular proliferation, cell cycle regulation, and carcinogenesis. However, VRK1 was not known to have neuronal functions before its identification as a gene mutated in SMA-PCH. Here we show that VRK1-R358X homozygosity results in lack of VRK1 protein, and demonstrate a role for VRK1 in neuronal migration and neuronal stem cell proliferation. Using shRNA in utero electroporation in mice, we show that Vrk1 knockdown significantly impairs cortical neuronal migration, and affects the cell cycle of neuronal progenitors. Expression of wild-type human VRK1 rescues both proliferation and migration phenotypes. However, kinase-dead human VRK1 rescues only the migration impairment, suggesting the role of VRK1 in neuronal migration is partly noncatalytic. Furthermore, we found that VRK1 deficiency in human and mouse leads to downregulation of amyloid-β precursor protein (APP), a known neuronal migration gene. APP overexpression rescues the phenotype caused by Vrk1 knockdown, suggesting that VRK1 affects neuronal migration through an APP-dependent mechanism.

  3. Regulatory mechanisms underlying the differential growth of dendrites and axons.

    PubMed

    Wang, Xin; Sterne, Gabriella R; Ye, Bing

    2014-08-01

    A typical neuron is comprised of an information input compartment, or the dendrites, and an output compartment, known as the axon. These two compartments are the structural basis for functional neural circuits. However, little is known about how dendritic and axonal growth are differentially regulated. Recent studies have uncovered two distinct types of regulatory mechanisms that differentiate dendritic and axonal growth: dedicated mechanisms and bimodal mechanisms. Dedicated mechanisms regulate either dendritespecific or axon-specific growth; in contrast, bimodal mechanisms direct dendritic and axonal development in opposite manners. Here, we review the dedicated and bimodal regulators identified by recent Drosophila and mammalian studies. The knowledge of these underlying molecular mechanisms not only expands our understanding about how neural circuits are wired, but also provides insights that will aid in the rational design of therapies for neurological diseases.

  4. Regulatory mechanisms related to biofuel tolerance in producing microbes.

    PubMed

    Fu, Y; Chen, L; Zhang, W

    2016-08-01

    Production of renewable biofuels through either native or engineered microbes has drawn significant attention in recent years, mostly due to the increasing concerns on the energy crisis and the environmental consequences of the overutilization of petroleum-based fuels. Although significant progress has been achieved thus far, further advances are still necessary in order to decrease the manufacturing cost so that the producing processes can be more competitive to petroleum fuels. Among various possible approaches, the increase in biofuel tolerance in microbes has been suggested as one aspect which is important for the success of biofuel production at industry-scale. In this article, we critically summarize recent advances in deciphering regulatory mechanisms for enhancing biofuel tolerance in various micro-organisms, focusing on functions and utilization of several well-studied regulatory mechanisms in microbes, such as two-component signal transduction systems, sigma factors, transcription factors, noncoding RNA and other regulators. © 2016 The Society for Applied Microbiology.

  5. Secretory pattern and regulatory mechanism of growth hormone in cattle.

    PubMed

    Kasuya, Etsuko

    2016-02-01

    The ultradian rhythm of growth hormone (GH) secretion has been known in several animal species for years and has recently been observed in cattle. Although the physiological significance of the rhythm is not yet fully understood, it appears essential for normal growth. In this review, previous studies concerning the GH secretory pattern in cattle, including its ultradian rhythm, are introduced and the regulatory mechanism is discussed on the basis of recent findings.

  6. Conserved transcriptional regulatory mechanisms in aortic valve development and disease

    PubMed Central

    Wirrig, Elaine E.; Yutzey, Katherine E.

    2014-01-01

    There is increasing evidence for activation of developmental transcriptional regulatory pathways in heart valve disease. Here we review molecular regulatory mechanisms involved in heart valve progenitor development, leaflet morphogenesis, and extracellular matrix organization that also are active in diseased aortic valves. These include regulators of endothelial-to-mesenchymal transitions, such as the Notch pathway effector RBPJ, and the valve progenitor markers Twist1, Msx1/2, and Sox9. Little is known of the potential reparative or pathological functions of these developmental mechanisms in adult aortic valves, but it is tempting to speculate that valve progenitor cells could contribute to repair in the context of disease. Likewise, loss of either RBPJ or Sox9 leads to aortic valve calcification in mice, supporting a potential therapeutic role in prevention of disease. During aortic valve calcification, transcriptional regulators of osteogenic development are activated in addition to valve progenitor regulatory programs. Specifically, the transcription factor Runx2 and its downstream target genes are induced in calcified valves. Runx2 and osteogenic genes also are induced with vascular calcification, but activation of valve progenitor markers and the cellular context of expression are likely to be different for valve and vascular calcification. Additional research is necessary to determine if developmental mechanisms contribute to valve repair or if these pathways can be harnessed for new treatments of heart valve disease. PMID:24665126

  7. Gene regulatory network inference using out of equilibrium statistical mechanics

    PubMed Central

    Benecke, Arndt

    2008-01-01

    Spatiotemporal control of gene expression is fundamental to multicellular life. Despite prodigious efforts, the encoding of gene expression regulation in eukaryotes is not understood. Gene expression analyses nourish the hope to reverse engineer effector-target gene networks using inference techniques. Inference from noisy and circumstantial data relies on using robust models with few parameters for the underlying mechanisms. However, a systematic path to gene regulatory network reverse engineering from functional genomics data is still impeded by fundamental problems. Recently, Johannes Berg from the Theoretical Physics Institute of Cologne University has made two remarkable contributions that significantly advance the gene regulatory network inference problem. Berg, who uses gene expression data from yeast, has demonstrated a nonequilibrium regime for mRNA concentration dynamics and was able to map the gene regulatory process upon simple stochastic systems driven out of equilibrium. The impact of his demonstration is twofold, affecting both the understanding of the operational constraints under which transcription occurs and the capacity to extract relevant information from highly time-resolved expression data. Berg has used his observation to predict target genes of selected transcription factors, and thereby, in principle, demonstrated applicability of his out of equilibrium statistical mechanics approach to the gene network inference problem. PMID:19404429

  8. Gene regulatory network inference using out of equilibrium statistical mechanics.

    PubMed

    Benecke, Arndt

    2008-08-01

    Spatiotemporal control of gene expression is fundamental to multicellular life. Despite prodigious efforts, the encoding of gene expression regulation in eukaryotes is not understood. Gene expression analyses nourish the hope to reverse engineer effector-target gene networks using inference techniques. Inference from noisy and circumstantial data relies on using robust models with few parameters for the underlying mechanisms. However, a systematic path to gene regulatory network reverse engineering from functional genomics data is still impeded by fundamental problems. Recently, Johannes Berg from the Theoretical Physics Institute of Cologne University has made two remarkable contributions that significantly advance the gene regulatory network inference problem. Berg, who uses gene expression data from yeast, has demonstrated a nonequilibrium regime for mRNA concentration dynamics and was able to map the gene regulatory process upon simple stochastic systems driven out of equilibrium. The impact of his demonstration is twofold, affecting both the understanding of the operational constraints under which transcription occurs and the capacity to extract relevant information from highly time-resolved expression data. Berg has used his observation to predict target genes of selected transcription factors, and thereby, in principle, demonstrated applicability of his out of equilibrium statistical mechanics approach to the gene network inference problem.

  9. Sociocognitive self-regulatory mechanisms governing transgressive behavior.

    PubMed

    Bandura, A; Caprara, G V; Barbaranelli, C; Pastorelli, C; Regalia, C

    2001-01-01

    This longitudinal research examined a structural model of the self-regulatory mechanisms governing transgressive conduct. Perceived academic and self-regulatory efficacy concurrently and longitudinally deterred transgressiveness both directly and by fostering prosocialness and adherence to moral self-sanctions for harmful conduct. The impact of perceived social self-efficacy was mediated through prosocialness. Moral disengagement and prosocialness affected transgressiveness through the mediating influence of irascible affectivity and hostile rumination. Ruminative affectivity, in turn, both concurrently and longitudinally affected transgressiveness. Moral disengagement also contributed independently to variance in transgressiveness over time. This pattern of relations was obtained after controlling for prior transgressiveness. The structural model was replicated across gender and provided a better fit to the data than did several alternative models.

  10. Regulatory mechanisms of EGFR signalling during Drosophila eye development.

    PubMed

    Malartre, Marianne

    2016-05-01

    EGFR signalling is a well-conserved signalling pathway playing major roles during development and cancers. This review explores what studying the EGFR pathway during Drosophila eye development has taught us in terms of the diversity of its regulatory mechanisms. This model system has allowed the identification of numerous positive and negative regulators acting at specific time and place, thus participating to the tight control of signalling. EGFR signalling regulation is achieved by a variety of mechanisms, including the control of ligand processing, the availability of the receptor itself and the transduction of the cascade in the cytoplasm. Ultimately, the transcriptional responses contribute to the establishment of positive and negative feedback loops. The combination of these multiple mechanisms employed to regulate the EGFR pathway leads to specific cellular outcomes involved in functions as diverse as the acquisition of cell fate, proliferation, survival, adherens junction remodelling and morphogenesis.

  11. Molecular and Cellular Regulatory Mechanisms of Tongue Myogenesis

    PubMed Central

    Parada, C.; Han, D.; Chai, Y.

    2012-01-01

    The tongue exerts crucial functions in our daily life. However, we know very little about the regulatory mechanisms of mammalian tongue development. In this review, we summarize recent findings of the molecular and cellular mechanisms that control tissue-tissue interactions during tongue morphogenesis. Specifically, cranial neural crest cells (CNCC) lead the initiation of tongue bud formation and contribute to the interstitial connective tissue, which ultimately compartmentalizes tongue muscles and serves as their attachments. Occipital somite-derived cells migrate into the tongue primordium and give rise to muscle cells in the tongue. The intimate relationship between CNCC- and mesoderm-derived cells, as well as growth and transcription factors that have been shown to be crucial for tongue myogenesis, clearly indicate that tissue-tissue interactions play an important role in regulating tongue morphogenesis. PMID:22219210

  12. Ochratoxin A Producing Fungi, Biosynthetic Pathway and Regulatory Mechanisms.

    PubMed

    Wang, Yan; Wang, Liuqing; Liu, Fei; Wang, Qi; Selvaraj, Jonathan Nimal; Xing, Fuguo; Zhao, Yueju; Liu, Yang

    2016-03-21

    Ochratoxin A (OTA), mainly produced by Aspergillus and Penicillum species, is one of the most important mycotoxin contaminants in agricultural products. It is detrimental to human health because of its nephrotoxicity, hepatotoxicity, carcinogenicity, teratogenicity, and immunosuppression. OTA structurally consists of adihydrocoumarin moiety linked with l-phenylalanine via an amide bond. OTA biosynthesis has been putatively hypothesized, although several contradictions exist on some processes of the biosynthetic pathway. We discuss recent information on molecular studies of OTA biosynthesis despite insufficient genetic background in detail. Accordingly, genetic regulation has also been explored with regard to the interaction between the regulators and the environmental factors. In this review, we focus on three aspects of OTA: OTA-producing strains, OTA biosynthetic pathway and the regulation mechanisms of OTA production. This can pave the way to assist in protecting food and feed from OTA contamination by understanding OTA biosynthetic pathway and regulatory mechanisms.

  13. Ochratoxin A Producing Fungi, Biosynthetic Pathway and Regulatory Mechanisms

    PubMed Central

    Wang, Yan; Wang, Liuqing; Liu, Fei; Wang, Qi; Selvaraj, Jonathan Nimal; Xing, Fuguo; Zhao, Yueju; Liu, Yang

    2016-01-01

    Ochratoxin A (OTA), mainly produced by Aspergillus and Penicillum species, is one of the most important mycotoxin contaminants in agricultural products. It is detrimental to human health because of its nephrotoxicity, hepatotoxicity, carcinogenicity, teratogenicity, and immunosuppression. OTA structurally consists of adihydrocoumarin moiety linked with l-phenylalanine via an amide bond. OTA biosynthesis has been putatively hypothesized, although several contradictions exist on some processes of the biosynthetic pathway. We discuss recent information on molecular studies of OTA biosynthesis despite insufficient genetic background in detail. Accordingly, genetic regulation has also been explored with regard to the interaction between the regulators and the environmental factors. In this review, we focus on three aspects of OTA: OTA-producing strains, OTA biosynthetic pathway and the regulation mechanisms of OTA production. This can pave the way to assist in protecting food and feed from OTA contamination by understanding OTA biosynthetic pathway and regulatory mechanisms. PMID:27007394

  14. Gene regulatory mechanisms governing energy metabolism during cardiac hypertrophic growth.

    PubMed

    Lehman, John J; Kelly, Daniel P

    2002-04-01

    Studies in a variety of mammalian species, including humans, have demonstrated a reduction in fatty acid oxidation (FAO) and increased glucose utilization in pathologic cardiac hypertrophy, consistent with reinduction of the fetal energy metabolic program. This review describes results of recent molecular studies aimed at delineating the gene regulatory events which facilitate myocardial energy substrate switches during hypertrophic growth of the heart. Studies aimed at the characterization of transcriptional control mechanisms governing FAO enzyme gene expression in the cardiac myocyte have defined a central role for the fatty acid-activated nuclear receptor peroxisome proliferator-activated receptor alpha (PPAR(alpha)). Cardiac FAO enzyme gene expression was shown to be coordinately downregulated in murine models of ventricular pressure overload, consistent with the energy substrate switch away from fatty acid utilization in the hypertrophied heart. Nuclear protein levels of PPAR(alpha) decline in the ventricle in response to pressure overload, while several Sp and nuclear receptor transcription factors are induced to fetal levels, consistent with their binding to DNA as transcriptional repressors of rate-limiting FAO enzyme genes with hypertrophy. Knowledge of key components of this transcriptional regulatory pathway will allow for the development of genetic engineering strategies in mice that will modulate fatty acid oxidative flux and assist in defining whether energy metabolic derangements play a primary role in the development of pathologic cardiac hypertrophy and eventual progression to heart failure.

  15. Toxin-mediated gene regulatory mechanism in Staphylococcus aureus

    PubMed Central

    Joo, Hwang-Soo; Otto, Michael

    2016-01-01

    The dangerous human pathogen Staphylococcus aureus relies heavily on toxins to cause disease, but toxin production can put a strong burden on the bacteria’s energy balance. Thus, controlling the synthesis of proteins solely needed in times of toxin production represents a way for the bacteria to avoid wasting energy. One hypothetical manner to accomplish this sort of regulation is by gene regulatory functions of the toxins themselves. There have been several reports about gene regulation by toxins in S. aureus, but these were never verified on the molecular level. In our study published in MBio [Joo et al., 7(5). pii: e01579-16], we show that phenol-soluble modulins (PSMs), important peptide toxins of S. aureus, release a repressor from the promoter of the operon encoding the toxin export system, thereby enabling toxin secretion. This study describes the first molecular regulatory mechanism exerted by an S. aureus toxin, setting a paradigmatic example of how S. aureus toxins may influence cell functions to adjust them to times of toxin production.

  16. The Molecular Mechanisms of Regulatory T Cell Immunosuppression

    PubMed Central

    Pandiyan, Pushpa; Zheng, Lixin; Lenardo, Michael J.

    2011-01-01

    CD4+CD25+Foxp3+ T lymphocytes, known as regulatory T cells or Tregs, have been proposed to be a lineage of professional immune suppressive cells that exclusively counteract the effects of the immunoprotective “helper” and “cytotoxic” lineages of T lymphocytes. Here we discuss new concepts on the mechanisms and functions of Tregs. There are several key points we emphasize: 1. Tregs exert suppressive effects both directly on effector T cells and indirectly through antigen-presenting cells; 2. Regulation can occur through a novel mechanism of cytokine consumption to regulate as opposed to the usual mechanism of cytokine/chemokine production; 3. In cases where CD4+ effector T cells are directly inhibited by Tregs, it is chiefly through a mechanism of lymphokine withdrawal apoptosis leading to polyclonal deletion; and 4. Contrary to the current view, we discuss new evidence that Tregs, similar to other T-cells lineages, can promote protective immune responses in certain infectious contexts (Chen et al., 2011; Pandiyan et al., 2011). Although these points are at variance to varying degrees with the standard model of Treg behavior, we will recount developing findings that support these new concepts. PMID:22566849

  17. Glucose- and nitrogen sensing and regulatory mechanisms in Saccharomyces cerevisiae.

    PubMed

    Rødkaer, Steven V; Faergeman, Nils J

    2014-08-01

    Pro- and eukaryotic cells are constantly challenged by varying concentrations of nutrients in their environment. Perceiving and adapting to such changes are therefore crucial for cellular viability. Thus, numerous specialized cellular receptors continuously sense and react to the availability of nutrients such as glucose and nitrogen. When stimulated, these receptors initiate various cellular signaling pathways, which in concert constitute a complex regulatory network. To ensure a highly specific response, these pathways and networks cross-communicate with each other and are regulated at several steps and by numerous different regulators. As numerous of these regulating proteins, biochemical mechanisms, and cellular pathways are evolutionary conserved, complex biochemical information relevant to humans can be obtained by studying simple organisms. Thus, the yeast Saccharomyces cerevisiae has been recognized as a powerful model system to study fundamental biochemical processes. In the present review, we highlight central signaling pathways and molecular circuits conferring nitrogen- and glucose sensing in S. cerevisiae.

  18. Restricted autoantigen recognition associated with deletional and adaptive regulatory mechanisms.

    PubMed

    Gebe, John A; Yue, Betty B; Unrath, Kelly A; Falk, Ben A; Nepom, Gerald T

    2009-07-01

    Autoimmune diabetes (T1D) is characterized by CD4(+) T cell reactivity to a variety of islet-associated Ags. At-risk individuals, genetically predisposed to T1D, often have similar T cell reactivity, but nevertheless fail to progress to clinically overt disease. To study the immune tolerance and regulatory environment permissive for such autoreactive T cells, we expressed TCR transgenes derived from two autoreactive human T cells, 4.13 and 164, in HLA-DR4 transgenic mice on a C57BL/6-derived "diabetes-resistant" background. Both TCR are responsive to an immunodominant epitope of glutamic acid decarboxylase 65(555-567), which is identical in sequence between humans and mice, is restricted by HLA-DR4, and is a naturally processed self Ag associated with T1D. Although both TCR use the identical Valpha and Vbeta genes, differing only in CDR3, we found stark differences in the mechanisms utilized in vivo in the maintenance of immune tolerance. A combination of thymic deletion (negative selection), TCR down-regulation, and peripheral activation-induced cell death dominated the phenotype of 164 T cells, which nevertheless still maintain their Ag responsiveness in the periphery. In contrast, 4.13 T cells are much less influenced by central and deletional tolerance mechanisms, and instead display a peripheral immune deviation including differentiation into IL-10-secreting Tr1 cells. These findings indicate a distinct set of regulatory alternatives for autoreactive T cells, even within a single highly restricted HLA-peptide-TCR recognition profile.

  19. Regulatory Mechanisms and Physiological Significance of Reelin Function.

    PubMed

    Kohno, Takao

    2017-01-01

     Reelin is a large secreted glycoprotein that regulates embryonic neuronal lamination and adult synaptic function. Secreted Reelin binds to lipoprotein receptors expressed on neurons. The Reelin-receptor interaction induces phosphorylation of an intracellular adaptor protein Dab1, which is required for normal embryonic brain development and adult brain functions. It has been suggested that Reelin hypofunction plays a role in the pathogenesis of several neuropsychiatric diseases, such as schizophrenia, autism, and Alzheimer's disease. Thus upregulation of Reelin activity may ameliorate the symptoms of neuropsychiatric diseases. However, the regulatory mechanism underlying the functions of Reelin is largely unknown and there are no good animal models of Reelin malfunction; thus, causal relations between Reelin and neuropsychiatric diseases remain unclear. Recently, our studies have shown that proteolytic cleavage of the Reelin protein regulates its activity. Herein, we will review recent findings about relations between Reelin and Alzheimer's disease, and the mechanism underlying the regulation of Reelin function by proteolytic cleavage. Also, we will discuss the prospect of treating neuropsychiatric diseases by upregulation of Reelin activity.

  20. Regulatory mechanisms of growth hormone secretion are sexually dimorphic.

    PubMed Central

    Jaffe, C A; Ocampo-Lim, B; Guo, W; Krueger, K; Sugahara, I; DeMott-Friberg, R; Bermann, M; Barkan, A L

    1998-01-01

    Sexually dimorphic growth hormone (GH) secretory pattern is important in the determination of gender-specific patterns of growth and metabolism in rats. Whether GH secretion in humans is also sexually dimorphic and the neuroendocrine mechanisms governing this potential difference are not fully established. We have compared pulsatile GH secretion profiles in young men and women in the baseline state and during a continuous intravenous infusion of recombinant human insulin-like growth factor I (rhIGF-I). During the baseline study, men had large nocturnal GH pulses and relatively small pulses during the rest of the day. In contrast, women had more continuous GH secretion and more frequent GH pulses that were of more uniform size. The infusion of rhIGF-I (10 microg/kg/h) potently suppressed both spontaneous and growth hormone-releasing hormone (GHRH)-induced GH secretion in men. In women, however, rhIGF-I had less effect on pulsatile GH secretion and did not suppress the GH response to GHRH. These data demonstrate the existence of sexual dimorphism in the regulatory mechanisms involved in GH secretion in humans. The persistence of GH responses to GHRH in women suggests that negative feedback by IGF-I might be expressed, in part, through suppression of hypothalamic GHRH. PMID:9649569

  1. A conserved regulatory mechanism in bifunctional biotin protein ligases.

    PubMed

    Wang, Jingheng; Beckett, Dorothy

    2017-08-01

    Class II bifunctional biotin protein ligases (BirA), which catalyze post-translational biotinylation and repress transcription initiation, are broadly distributed in eubacteria and archaea. However, it is unclear if these proteins all share the same molecular mechanism of transcription regulation. In Escherichia coli the corepressor biotinoyl-5'-AMP (bio-5'-AMP), which is also the intermediate in biotin transfer, promotes operator binding and resulting transcription repression by enhancing BirA dimerization. Like E. coli BirA (EcBirA), Staphylococcus aureus, and Bacillus subtilis BirA (Sa and BsBirA) repress transcription in vivo in a biotin-dependent manner. In this work, sedimentation equilibrium measurements were performed to investigate the molecular basis of this biotin-responsive transcription regulation. The results reveal that, as observed for EcBirA, Sa, and BsBirA dimerization reactions are significantly enhanced by bio-5'-AMP binding. Thus, the molecular mechanism of the Biotin Regulatory System is conserved in the biotin repressors from these three organisms. © 2017 The Protein Society.

  2. Redox-switch regulatory mechanism of thiolase from Clostridium acetobutylicum

    PubMed Central

    Kim, Sangwoo; Jang, Yu-Sin; Ha, Sung-Chul; Ahn, Jae-Woo; Kim, Eun-Jung; Hong Lim, Jae; Cho, Changhee; Shin Ryu, Yong; Kuk Lee, Sung; Lee, Sang Yup; Kim, Kyung-Jin

    2015-01-01

    Thiolase is the first enzyme catalysing the condensation of two acetyl-coenzyme A (CoA) molecules to form acetoacetyl-CoA in a dedicated pathway towards the biosynthesis of n-butanol, an important solvent and biofuel. Here we elucidate the crystal structure of Clostridium acetobutylicum thiolase (CaTHL) in its reduced/oxidized states. CaTHL, unlike those from other aerobic bacteria such as Escherichia coli and Zoogloea ramegera, is regulated by the redox-switch modulation through reversible disulfide bond formation between two catalytic cysteine residues, Cys88 and Cys378. When CaTHL is overexpressed in wild-type C. acetobutylicum, butanol production is reduced due to the disturbance of acidogenic to solventogenic shift. The CaTHLV77Q/N153Y/A286K mutant, which is not able to form disulfide bonds, exhibits higher activity than wild-type CaTHL, and enhances butanol production upon overexpression. On the basis of these results, we suggest that CaTHL functions as a key enzyme in the regulation of the main metabolism of C. acetobutylicum through a redox-switch regulatory mechanism. PMID:26391388

  3. Redox-switch regulatory mechanism of thiolase from Clostridium acetobutylicum.

    PubMed

    Kim, Sangwoo; Jang, Yu-Sin; Ha, Sung-Chul; Ahn, Jae-Woo; Kim, Eun-Jung; Lim, Jae Hong; Cho, Changhee; Ryu, Yong Shin; Lee, Sung Kuk; Lee, Sang Yup; Kim, Kyung-Jin

    2015-09-22

    Thiolase is the first enzyme catalysing the condensation of two acetyl-coenzyme A (CoA) molecules to form acetoacetyl-CoA in a dedicated pathway towards the biosynthesis of n-butanol, an important solvent and biofuel. Here we elucidate the crystal structure of Clostridium acetobutylicum thiolase (CaTHL) in its reduced/oxidized states. CaTHL, unlike those from other aerobic bacteria such as Escherichia coli and Zoogloea ramegera, is regulated by the redox-switch modulation through reversible disulfide bond formation between two catalytic cysteine residues, Cys88 and Cys378. When CaTHL is overexpressed in wild-type C. acetobutylicum, butanol production is reduced due to the disturbance of acidogenic to solventogenic shift. The CaTHL(V77Q/N153Y/A286K) mutant, which is not able to form disulfide bonds, exhibits higher activity than wild-type CaTHL, and enhances butanol production upon overexpression. On the basis of these results, we suggest that CaTHL functions as a key enzyme in the regulation of the main metabolism of C. acetobutylicum through a redox-switch regulatory mechanism.

  4. Naturally occurring regulatory T cells: markers, mechanisms, and manipulation.

    PubMed

    Schmetterer, Klaus G; Neunkirchner, Alina; Pickl, Winfried F

    2012-06-01

    Naturally occurring CD4(+)CD25(high) forkhead box protein 3 (FOXP3)(+) regulatory T cells (nTregs) are key mediators of immunity, which orchestrate and maintain tolerance to self and foreign antigens. In the recent 1.5 decades, a multitude of studies have aimed to define the phenotype and function of nTregs and to assess their therapeutic potential for modulating immune mediated disorders such as autoimmunity, allergy, and episodes of transplant rejection. In this review, we summarize the current knowledge on the biology of nTregs. We address the exact definition of nTregs by specific markers and combinations thereof, which is a prerequisite for the state-of-the-art isolation of defined nTreg populations. Furthermore, we discuss the mechanism by which nTregs mediate immunosuppression and how this knowledge might translate into novel therapeutic modalities. With first clinical studies of nTreg-based therapies being finished, questions concerning the reliable sources of nTregs are becoming more and more eminent. Consequently, approaches allowing conversion of CD4(+) T cells into nTregs by coculture with antigen-presenting cells, cytokines, and/or pharmacological agents are discussed. In addition, genetic engineering approaches for the generation of antigen-specific nTregs are described.

  5. Regulatory and pathogenic mechanisms in human autoimmune myasthenia gravis.

    PubMed

    Le Panse, Rozen; Cizeron-Clairac, Géraldine; Cuvelier, Mélinée; Truffault, Frédérique; Bismuth, Jacky; Nancy, Patrice; De Rosbo, Nicole Kerlero; Berrih-Aknin, Sonia

    2008-01-01

    The thymus is frequently hyperplastic in young female myasthenia gravis (MG) patients presenting with anti-acetylcholine receptor (AChR) antibodies. This thymic pathology is characterized by the presence of ectopic germinal centers (GCs) containing B cells involved at least partially in the production of pathogenic anti-AChR antibodies. Our recent studies have furthered our understanding of the mechanisms leading to GC formation in the hyperplastic thymus. First, we showed that CXCL13 and CCL21, chemokines involved in GC formation, are overexpressed in MG thymus. Second, we demonstrated an increase in pro-inflammatory activity in the thymus from MG patients and its partial normalization by glucocorticoids, as evidenced by gene expression profile. Third, we found that pro-inflammatory cytokines are able to upregulate the expression of AChR subunits in thymic epithelial and myoid cells. Fourth, we showed that the function of T regulatory (Treg) cells, whose role is to downregulate the immune response, is severely impaired in the thymus of MG patients; such a defect could explain the chronic immune activation observed consistently in MG thymic hyperplasia. Altogether, these new data suggest that CXCL13 and CCL21, which are produced in excess in MG thymus, attract peripheral B cells and activated T cells, which are maintained chronically activated in the inflammatory thymic environment because of the defect in suppressive activity of Treg cells. Presence of AChR in the thymus and upregulation of its expression by the pro-inflammatory environment contribute to the triggering and maintenance of the anti-AChR autoimmune response.

  6. The human disease network in terms of dysfunctional regulatory mechanisms.

    PubMed

    Yang, Jing; Wu, Su-Juan; Dai, Wen-Tao; Li, Yi-Xue; Li, Yuan-Yuan

    2015-10-08

    Elucidation of human disease similarities has emerged as an active research area, which is highly relevant to etiology, disease classification, and drug repositioning. In pioneer studies, disease similarity was commonly estimated according to clinical manifestation. Subsequently, scientists started to investigate disease similarity based on gene-phenotype knowledge, which were inevitably biased to well-studied diseases. In recent years, estimating disease similarity according to transcriptomic behavior significantly enhances the probability of finding novel disease relationships, while the currently available studies usually mine expression data through differential expression analysis that has been considered to have little chance of unraveling dysfunctional regulatory relationships, the causal pathogenesis of diseases. We developed a computational approach to measure human disease similarity based on expression data. Differential coexpression analysis, instead of differential expression analysis, was employed to calculate differential coexpression level of every gene for each disease, which was then summarized to the pathway level. Disease similarity was eventually calculated as the partial correlation coefficients of pathways' differential coexpression values between any two diseases. The significance of disease relationships were evaluated by permutation test. Based on mRNA expression data and a differential coexpression analysis based method, we built a human disease network involving 1326 significant Disease-Disease links among 108 diseases. Compared with disease relationships captured by differential expression analysis based method, our disease links shared known disease genes and drugs more significantly. Some novel disease relationships were discovered, for example, Obesity and cancer, Obesity and Psoriasis, lung adenocarcinoma and S. pneumonia, which had been commonly regarded as unrelated to each other, but recently found to share similar molecular

  7. Symbiotic Nitrogen Fixation in Legume Nodules: Metabolism and Regulatory Mechanisms

    PubMed Central

    Sulieman, Saad; Tran, Lam-Son Phan

    2014-01-01

    The special issue “Symbiotic Nitrogen Fixation in Legume Nodules: Metabolism and Regulatory Mechanisms” aims to investigate the physiological and biochemical advances in the symbiotic process with an emphasis on nodule establishment, development and functioning. The original research articles included in this issue provide important information regarding novel aspects of nodule metabolism and various regulatory pathways, which could have important future implications. This issue also included one review article that highlights the importance of using legume trees in the production of renewable biofuels. PMID:25347276

  8. The Cellular and Molecular Mechanisms of Immuno-Suppression by Human Type 1 Regulatory T Cells

    PubMed Central

    Gregori, Silvia; Goudy, Kevin S.; Roncarolo, Maria Grazia

    2011-01-01

    The immuno-regulatory mechanisms of IL-10-producing type 1 regulatory T (Tr1) cells have been widely studied over the years. However, several recent discoveries have shed new light on the cellular and molecular mechanisms that human Tr1 cells use to control immune responses and induce tolerance. In this review we outline the well known and newly discovered regulatory properties of human Tr1 cells and provide an in-depth comparison of the known suppressor mechanisms of Tr1 cells with FOXP3+ Treg. We also highlight the role that Tr1 cells play in promoting and maintaining tolerance in autoimmunity, allergy, and transplantation. PMID:22566914

  9. Regulatory Mechanisms Controlling Maturation of Serotonin Neuron Identity and Function.

    PubMed

    Spencer, William C; Deneris, Evan S

    2017-01-01

    The brain serotonin (5-hydroxytryptamine; 5-HT) system has been extensively studied for its role in normal physiology and behavior, as well as, neuropsychiatric disorders. The broad influence of 5-HT on brain function, is in part due to the vast connectivity pattern of 5-HT-producing neurons throughout the CNS. 5-HT neurons are born and terminally specified midway through embryogenesis, then enter a protracted period of maturation, where they functionally integrate into CNS circuitry and then are maintained throughout life. The transcriptional regulatory networks controlling progenitor cell generation and terminal specification of 5-HT neurons are relatively well-understood, yet the factors controlling 5-HT neuron maturation are only recently coming to light. In this review, we first provide an update on the regulatory network controlling 5-HT neuron development, then delve deeper into the properties and regulatory strategies governing 5-HT neuron maturation. In particular, we discuss the role of the 5-HT neuron terminal selector transcription factor (TF) Pet-1 as a key regulator of 5-HT neuron maturation. Pet-1 was originally shown to positively regulate genes needed for 5-HT synthesis, reuptake and vesicular transport, hence 5-HT neuron-type transmitter identity. It has now been shown to regulate, both positively and negatively, many other categories of genes in 5-HT neurons including ion channels, GPCRs, transporters, neuropeptides, and other transcription factors. Its function as a terminal selector results in the maturation of 5-HT neuron excitability, firing characteristics, and synaptic modulation by several neurotransmitters. Furthermore, there is a temporal requirement for Pet-1 in the control of postmitotic gene expression trajectories thus indicating a direct role in 5-HT neuron maturation. Proper regulation of the maturation of cellular identity is critical for normal neuronal functioning and perturbations in the gene regulatory networks controlling

  10. Characterization and merger of oscillatory mechanisms in an artificial genetic regulatory network

    NASA Astrophysics Data System (ADS)

    Yang, D.; Li, Y.; Kuznetsov, A.

    2009-09-01

    Regulatory molecular networks have numerous pharmacological and medical applications. The oscillatory mechanisms and the role of oscillations in these regulatory networks are not fully understood. In this paper, we explore two oscillatory mechanisms: the hysteresis-based relaxation oscillator and the repressilator. We combine these mechanisms into one regulatory network so that only two parameters, the strength of an additional regulatory connection and the timescale separation for one of the variables, control the transition from one mechanism to the other. Our data support a qualitative difference between the oscillatory mechanisms, but in the parameter space, we found a single oscillatory region, suggesting that the two mechanisms support each other. We examine interactions in a basic population: that is, a pair of the composite oscillators. We found that the relaxation oscillation mechanism is much more resistant to oscillatory death as the cells are diffusively coupled in a population. Additionally, stationary pattern formation has been found to accompany the relaxation oscillation but not the repressilator mechanism. These properties may guide the identification of oscillatory mechanisms in complex natural regulatory networks.

  11. Mechanisms of Regulatory B cell Function in Autoimmune and Inflammatory Diseases beyond IL-10

    PubMed Central

    Ray, Avijit; Dittel, Bonnie N.

    2017-01-01

    In the past two decades it has become clear that in addition to antigen presentation and antibody production B cells play prominent roles in immune regulation. While B cell-derived IL-10 has garnered much attention, B cells also effectively regulate inflammation by a variety of IL-10-independent mechanisms. B cell regulation has been studied in both autoimmune and inflammatory diseases. While collectively called regulatory B cells (Breg), no definitive phenotype has emerged for B cells with regulatory potential. This has made their study challenging and thus unique B cell regulatory mechanisms have emerged in a disease-dependent manner. Thus to harness the therapeutic potential of Breg, further studies are needed to understand how they emerge and are induced to evoke their regulatory activities. PMID:28124981

  12. Modeling Transport and Flow Regulatory Mechanisms of the Kidney

    PubMed Central

    Layton, Anita T.

    2013-01-01

    The kidney plays an indispensable role in the regulation of whole-organism water balance, electrolyte balance, and acid-base balance, and in the excretion of metabolic wastes and toxins. In this paper, we review representative mathematical models that have been developed to better understand kidney physiology and pathophysiology, including the regulation of glomerular filtration, the regulation of renal blood flow by means of the tubuloglomerular feedback mechanisms and of the myogenic mechanism, the urine concentrating mechanism, and regulation of renal oxygen transport. We discuss how such modeling efforts have significantly expanded our understanding of renal function in both health and disease. PMID:23914303

  13. Structural imprints in vivo decode RNA regulatory mechanisms

    NASA Astrophysics Data System (ADS)

    Spitale, Robert C.; Flynn, Ryan A.; Zhang, Qiangfeng Cliff; Crisalli, Pete; Lee, Byron; Jung, Jong-Wha; Kuchelmeister, Hannes Y.; Batista, Pedro J.; Torre, Eduardo A.; Kool, Eric T.; Chang, Howard Y.

    2015-03-01

    Visualizing the physical basis for molecular behaviour inside living cells is a great challenge for biology. RNAs are central to biological regulation, and the ability of RNA to adopt specific structures intimately controls every step of the gene expression program. However, our understanding of physiological RNA structures is limited; current in vivo RNA structure profiles include only two of the four nucleotides that make up RNA. Here we present a novel biochemical approach, in vivo click selective 2'-hydroxyl acylation and profiling experiment (icSHAPE), which enables the first global view, to our knowledge, of RNA secondary structures in living cells for all four bases. icSHAPE of the mouse embryonic stem cell transcriptome versus purified RNA folded in vitro shows that the structural dynamics of RNA in the cellular environment distinguish different classes of RNAs and regulatory elements. Structural signatures at translational start sites and ribosome pause sites are conserved from in vitro conditions, suggesting that these RNA elements are programmed by sequence. In contrast, focal structural rearrangements in vivo reveal precise interfaces of RNA with RNA-binding proteins or RNA-modification sites that are consistent with atomic-resolution structural data. Such dynamic structural footprints enable accurate prediction of RNA-protein interactions and N6-methyladenosine (m6A) modification genome wide. These results open the door for structural genomics of RNA in living cells and reveal key physiological structures controlling gene expression.

  14. Potential self-regulatory mechanisms of yoga for psychological health

    PubMed Central

    Gard, Tim; Noggle, Jessica J.; Park, Crystal L.; Vago, David R.; Wilson, Angela

    2014-01-01

    Research suggesting the beneficial effects of yoga on myriad aspects of psychological health has proliferated in recent years, yet there is currently no overarching framework by which to understand yoga’s potential beneficial effects. Here we provide a theoretical framework and systems-based network model of yoga that focuses on integration of top-down and bottom-up forms of self-regulation. We begin by contextualizing yoga in historical and contemporary settings, and then detail how specific components of yoga practice may affect cognitive, emotional, behavioral, and autonomic output under stress through an emphasis on interoception and bottom-up input, resulting in physical and psychological health. The model describes yoga practice as a comprehensive skillset of synergistic process tools that facilitate bidirectional feedback and integration between high- and low-level brain networks, and afferent and re-afferent input from interoceptive processes (somatosensory, viscerosensory, chemosensory). From a predictive coding perspective we propose a shift to perceptual inference for stress modulation and optimal self-regulation. We describe how the processes that sub-serve self-regulation become more automatized and efficient over time and practice, requiring less effort to initiate when necessary and terminate more rapidly when no longer needed. To support our proposed model, we present the available evidence for yoga affecting self-regulatory pathways, integrating existing constructs from behavior theory and cognitive neuroscience with emerging yoga and meditation research. This paper is intended to guide future basic and clinical research, specifically targeting areas of development in the treatment of stress-mediated psychological disorders. PMID:25368562

  15. Biochemical Features and Functional Implications of the RNA-Based T-Box Regulatory Mechanism

    PubMed Central

    Gutiérrez-Preciado, Ana; Henkin, Tina M.; Grundy, Frank J.; Yanofsky, Charles; Merino, Enrique

    2009-01-01

    Summary: The T-box mechanism is a common regulatory strategy used for modulating the expression of genes of amino acid metabolism-related operons in gram-positive bacteria, especially members of the Firmicutes. T-box regulation is usually based on a transcription attenuation mechanism in which an interaction between a specific uncharged tRNA and the 5′ region of the transcript stabilizes an antiterminator structure in preference to a terminator structure, thereby preventing transcription termination. Although single T-box regulatory elements are common, double or triple T-box arrangements are also observed, expanding the regulatory range of these elements. In the present study, we predict the functional implications of T-box regulation in genes encoding aminoacyl-tRNA synthetases, proteins of amino acid biosynthetic pathways, transporters, and regulatory proteins. We also consider the global impact of the use of this regulatory mechanism on cell physiology. Novel biochemical relationships between regulated genes and their corresponding metabolic pathways were revealed. Some of the genes identified, such as the quorum-sensing gene luxS, in members of the Lactobacillaceae were not previously predicted to be regulated by the T-box mechanism. Our analyses also predict an imbalance in tRNA sensing during the regulation of operons containing multiple aminoacyl-tRNA synthetase genes or biosynthetic genes involved in pathways common to more than one amino acid. Based on the distribution of T-box regulatory elements, we propose that this regulatory mechanism originated in a common ancestor of members of the Firmicutes, Chloroflexi, Deinococcus-Thermus group, and Actinobacteria and was transferred into the Deltaproteobacteria by horizontal gene transfer. PMID:19258532

  16. Translational regulatory mechanisms in persistent forms of synaptic plasticity.

    PubMed

    Kelleher, Raymond J; Govindarajan, Arvind; Tonegawa, Susumu

    2004-09-30

    Memory and synaptic plasticity exhibit distinct temporal phases, with long-lasting forms distinguished by their dependence on macromolecular synthesis. Prevailing models for the molecular mechanisms underlying long-lasting synaptic plasticity have largely focused on transcriptional regulation. However, a growing body of evidence now supports a crucial role for neuronal activity-dependent mRNA translation, which may occur in dendrites for a subset of neuronal mRNAs. Recent work has begun to define the signaling mechanisms coupling synaptic activation to the protein synthesis machinery. The ERK and mTOR signaling pathways have been shown to regulate the activity of the general translational machinery, while the translation of particular classes of mRNAs is additionally controlled by gene-specific mechanisms. Rapid enhancement of the synthesis of a diverse array of neuronal proteins through such mechanisms provides the components necessary for persistent forms of LTP and LTD. These findings have important implications for the synapse specificity and associativity of protein synthesis-dependent changes in synaptic strength.

  17. Regulatory mechanisms for specification and patterning of plant vascular tissues.

    PubMed

    Caño-Delgado, Ana; Lee, Ji-Young; Demura, Taku

    2010-01-01

    Plant vascular tissues, the conduits of water, nutrients, and small molecules, play important roles in plant growth and development. Vascular tissues have allowed plants to successfully adapt to various environmental conditions since they evolved 450 Mya. The majority of plant biomass, an important source of renewable energy, comes from the xylem of the vascular tissues. Efforts have been made to identify the underlying mechanisms of cell specification and patterning of plant vascular tissues and their proliferation. The formation of the plant vascular system is a complex process that integrates signaling and gene regulation at transcriptional and posttranscriptional levels. Recently, a wealth of molecular genetic studies and the advent of cell biology and genomic tools have enabled important progress toward understanding its underlying mechanisms. Here, we provide a comprehensive review of the cell and developmental processes of plant vascular tissue and resources recently available for studying them that will enable the discovery of new ways to develop sustainable energy using plant biomass.

  18. Sociocognitive self-regulatory mechanisms governing judgments of the acceptability and likelihood of sport cheating.

    PubMed

    d'Arripe-Longueville, Fabienne; Corrion, Karine; Scoffier, Stéphanie; Roussel, Peggy; Chalabaev, Aïna

    2010-10-01

    This study extends previous psychosocial literature (Bandura et al., 2001, 2003) by examining a structural model of the self-regulatory mechanisms governing the acceptability and likelihood of cheating in a sport context. Male and female adolescents (N = 804), aged 15-20 years, took part in this study. Negative affective self-regulatory efficacy influenced the acceptability and likelihood of cheating through the mediating role of moral disengagement, in females and males. Affective efficacy positively influenced prosocial behavior through moral disengagement or through resistive self-regulatory efficacy and social efficacy, in both groups. The direct effects of affective efficacy on beliefs about cheating were only evident in females. These results extend the findings of Bandura et al. (2001, 2003) to the sport context and suggest that affective and resistive self-regulatory efficacy operate in concert in governing adolescents' moral disengagement and transgressive behaviors in sport.

  19. Calcium-regulatory mechanisms. Functional classification using skinned fibers

    PubMed Central

    1981-01-01

    The primary purpose of this study was to determine whether various agents (adenosine 3-thiotriphosphate [ATP gamma S], trifluoperazine [TFP], troponin I, the catalytic subunit of the cyclic adenosine 3',5'- monophosphate dependent protein kinase [C-subunit], and calmodulin [CaM]) could be used to classify skinned fiber types, and then to determine whether the proposed mechanisms for Ca2+ regulation were consistent with the results. Agents (ATP gamma S, TFP, C-subunit, CaM) expected to alter a light chain kinase-phosphatase system strongly affect the Ca2+-activated tension in skinned gizzard smooth muscle fibers, whereas these agents have no effect on skinned mammalian striated and scallop adductor fibers. Troponin I, which is known to bind strongly to troponin C and CaM, inhibits Ca2+ activation of skinned mammalian striated and gizzard fibers but not scallop adductor muscle. The results in different types of skinned fibers are consistent with proposed mechanisms for Ca2+ regulation. PMID:6267161

  20. Regulatory mechanisms of hemoglobin oxygen affinity in acidosis and alkalosis

    PubMed Central

    Bellingham, A. J.; Detter, J. C.; Lenfant, C.

    1971-01-01

    The recent reports of the effect of 2,3-diphosphoglycerate (2,3-DPG) on hemoglobin affinity for oxygen suggested that this substance may play a role in man's adaptation to acidosis and alkalosis. A study of the effect of induced acidosis and alkalosis on the oxyhemoglobin dissociation curve of normal man was therefore carried out, and the mechanisms involved in the physiological regulation of hemoglobin oxygen affinity examined. In acute changes of plasma pH there was no alteration in red cell 2,3-DPG content. However, there were changes in hemoglobin oxygen affinity and these correlated with changes in mean corpuscular hemoglobin concentration (MCHC). With maintained acidosis and alkalosis, red cell 2,3-DPG content was altered and correlated with the changes in hemoglobin oxygen affinity. Both of these mechanisms shift the hemoglobin oxygen dissociation curve opposite to the direct pH (Bohr) effect, and providing the rate of pH change is neither too rapid nor too large, they counteract the direct pH effect and the in vivo hemoglobin oxygen affinity remains unchanged. It is also shown that approximately 35% of the change in hemoglobin oxygen affinity resulting from an alteration in red cell 2,3-DPG, is explained by effect of 2,3-DPG on the red cell pH. PMID:5545127

  1. Ser/Thr phosphorylation as a regulatory mechanism in bacteria.

    PubMed

    Dworkin, Jonathan

    2015-04-01

    This review will discuss some recent work describing the role of Ser/Thr phosphorylation as a post-translational mechanism of regulation in bacteria. I will discuss the interaction between bacterial eukaryotic-like Ser/Thr kinases (eSTKs) and two-component systems as well as hints as to physiological function of eSTKs and their cognate eukaryotic-like phosphatases (eSTPs). In particular, I will highlight the role of eSTKs and eSTPs in the regulation of peptidoglycan metabolism and protein synthesis. In addition, I will discuss how data from phosphoproteomic surveys suggest that Ser/Thr phosphorylation plays a much more significant physiological role than would be predicted simply based on in vivo and in vitro analyses of individual kinases.

  2. Gap junction-mediated electrical transmission: regulatory mechanisms and plasticity

    PubMed Central

    Pereda, Alberto E.; Curti, Sebastian; Hoge, Gregory; Cachope, Roger; Flores, Carmen E.; Rash, John E.

    2012-01-01

    The term synapse applies to cellular specializations that articulate the processing of information within neural circuits by providing a mechanism for the transfer of information between two different neurons. There are two main modalities of synaptic transmission: chemical and electrical. While most efforts have been dedicated to the understanding of the properties and modifiability of chemical transmission, less is still known regarding the plastic properties of electrical synapses, whose structural correlate is the gap junction. A wealth of data indicates that, rather than passive intercellular channels, electrical synapses are more dynamic and modifiable than was generally perceived. This article will discuss the factors determining the strength of electrical transmission and review current evidence demonstrating its dynamic properties. Like their chemical counterparts, electrical synapses can also be plastic and modifiable. PMID:22659675

  3. Photosynthesis Control: An underrated short-term regulatory mechanism essential for plant viability.

    PubMed

    Colombo, Monica; Suorsa, Marjaana; Rossi, Fabio; Ferrari, Roberto; Tadini, Luca; Barbato, Roberto; Pesaresi, Paolo

    2016-01-01

    Regulation of photosynthetic electron transport provides efficient performance of oxygenic photosynthesis in plants. During the last 15 years, the molecular bases of various photosynthesis short-term regulatory processes have been elucidated, however the wild type-like phenotypes of mutants lacking of State Transitions, Non Photochemical Quenching, or Cyclic Electron Transport, when grown under constant light conditions, have also raised doubts about the acclimatory significance of these short-regulatory mechanisms on plant performance. Interestingly, recent studies performed by growing wild type and mutant plants under field conditions revealed a prominent role of State Transitions and Non Photochemical Quenching on plant fitness, with almost no effect on vegetative plant growth. Conversely, the analysis of plants lacking the regulation of electron transport by the cytochrome b6f complex, also known as Photosynthesis Control, revealed the fundamental role of this regulatory mechanism in the survival of young, developing seedlings under fluctuating light conditions.

  4. Thick filament mechano-sensing is a calcium-independent regulatory mechanism in skeletal muscle

    PubMed Central

    Fusi, L.; Brunello, E.; Yan, Z.; Irving, M.

    2016-01-01

    Recent X-ray diffraction studies on actively contracting fibres from skeletal muscle showed that the number of myosin motors available to interact with actin-containing thin filaments is controlled by the stress in the myosin-containing thick filaments. Those results suggested that thick filament mechano-sensing might constitute a novel regulatory mechanism in striated muscles that acts independently of the well-known thin filament-mediated calcium signalling pathway. Here we test that hypothesis using probes attached to the myosin regulatory light chain in demembranated muscle fibres. We show that both the extent and kinetics of thick filament activation depend on thick filament stress but are independent of intracellular calcium concentration in the physiological range. These results establish direct control of myosin motors by thick filament mechano-sensing as a general regulatory mechanism in skeletal muscle that is independent of the canonical calcium signalling pathway. PMID:27796302

  5. Photosynthesis Control: An underrated short-term regulatory mechanism essential for plant viability

    PubMed Central

    Colombo, Monica; Suorsa, Marjaana; Rossi, Fabio; Ferrari, Roberto; Tadini, Luca; Barbato, Roberto; Pesaresi, Paolo

    2016-01-01

    ABSTRACT Regulation of photosynthetic electron transport provides efficient performance of oxygenic photosynthesis in plants. During the last 15 years, the molecular bases of various photosynthesis short-term regulatory processes have been elucidated, however the wild type-like phenotypes of mutants lacking of State Transitions, Non Photochemical Quenching, or Cyclic Electron Transport, when grown under constant light conditions, have also raised doubts about the acclimatory significance of these short-regulatory mechanisms on plant performance. Interestingly, recent studies performed by growing wild type and mutant plants under field conditions revealed a prominent role of State Transitions and Non Photochemical Quenching on plant fitness, with almost no effect on vegetative plant growth. Conversely, the analysis of plants lacking the regulation of electron transport by the cytochrome b6f complex, also known as Photosynthesis Control, revealed the fundamental role of this regulatory mechanism in the survival of young, developing seedlings under fluctuating light conditions. PMID:27018523

  6. Transcriptional and Epigenetic Regulatory Mechanisms Affecting HTLV-1 Provirus.

    PubMed

    Miyazato, Paola; Matsuo, Misaki; Katsuya, Hiroo; Satou, Yorifumi

    2016-06-16

    Human T-cell leukemia virus type 1 (HTLV-1) is a retrovirus associated with human diseases, such as adult T-cell leukemia (ATL) and HTLV-1-associated myelopathy/Tropic spastic paraparesis (HAM/TSP). As a retrovirus, its life cycle includes a step where HTLV-1 is integrated into the host genomic DNA and forms proviral DNA. In the chronic phase of the infection, HTLV‑1 is known to proliferate as a provirus via the mitotic division of the infected host cells. There are generally tens of thousands of infected clones within an infected individual. They exist not only in peripheral blood, but also in various lymphoid organs. Viral proteins encoded in HTLV-1 genome play a role in the proliferation and survival of the infected cells. As is the case with other chronic viral infections, HTLV-1 gene expression induces the activation of the host immunity against the virus. Thus, the transcription from HTLV-1 provirus needs to be controlled in order to evade the host immune surveillance. There should be a dynamic and complex regulation in vivo, where an equilibrium between viral antigen expression and host immune surveillance is achieved. The mechanisms regulating viral gene expression from the provirus are a key to understanding the persistent/latent infection with HTLV-1 and its pathogenesis. In this article, we would like to review our current understanding on this topic.

  7. Cis-regulatory mechanisms governing stem and progenitor cell transitions

    PubMed Central

    Johnson, Kirby D.; Kong, Guangyao; Gao, Xin; Chang, Yuan-I; Hewitt, Kyle J.; Sanalkumar, Rajendran; Prathibha, Rajalekshmi; Ranheim, Erik A.; Dewey, Colin N.; Zhang, Jing; Bresnick, Emery H.

    2015-01-01

    Cis-element encyclopedias provide information on phenotypic diversity and disease mechanisms. Although cis-element polymorphisms and mutations are instructive, deciphering function remains challenging. Mutation of an intronic GATA motif (+9.5) in GATA2, encoding a master regulator of hematopoiesis, underlies an immunodeficiency associated with myelodysplastic syndrome (MDS) and acute myeloid leukemia (AML). Whereas an inversion relocalizes another GATA2 cis-element (−77) to the proto-oncogene EVI1, inducing EVI1 expression and AML, whether this reflects ectopic or physiological activity is unknown. We describe a mouse strain that decouples −77 function from proto-oncogene deregulation. The −77−/− mice exhibited a novel phenotypic constellation including late embryonic lethality and anemia. The −77 established a vital sector of the myeloid progenitor transcriptome, conferring multipotentiality. Unlike the +9.5−/− embryos, hematopoietic stem cell genesis was unaffected in −77−/− embryos. These results illustrate a paradigm in which cis-elements in a locus differentially control stem and progenitor cell transitions, and therefore the individual cis-element alterations cause unique and overlapping disease phenotypes. PMID:26601269

  8. Transcriptional and Epigenetic Regulatory Mechanisms Affecting HTLV-1 Provirus

    PubMed Central

    Miyazato, Paola; Matsuo, Misaki; Katsuya, Hiroo; Satou, Yorifumi

    2016-01-01

    Human T-cell leukemia virus type 1 (HTLV-1) is a retrovirus associated with human diseases, such as adult T-cell leukemia (ATL) and HTLV-1-associated myelopathy/Tropic spastic paraparesis (HAM/TSP). As a retrovirus, its life cycle includes a step where HTLV-1 is integrated into the host genomic DNA and forms proviral DNA. In the chronic phase of the infection, HTLV‑1 is known to proliferate as a provirus via the mitotic division of the infected host cells. There are generally tens of thousands of infected clones within an infected individual. They exist not only in peripheral blood, but also in various lymphoid organs. Viral proteins encoded in HTLV-1 genome play a role in the proliferation and survival of the infected cells. As is the case with other chronic viral infections, HTLV-1 gene expression induces the activation of the host immunity against the virus. Thus, the transcription from HTLV-1 provirus needs to be controlled in order to evade the host immune surveillance. There should be a dynamic and complex regulation in vivo, where an equilibrium between viral antigen expression and host immune surveillance is achieved. The mechanisms regulating viral gene expression from the provirus are a key to understanding the persistent/latent infection with HTLV-1 and its pathogenesis. In this article, we would like to review our current understanding on this topic. PMID:27322309

  9. BIOCHEMICAL ANALYSES OF TRANSCRIPTIONAL REGULATORY MECHANISMS IN A CHROMATIN CONTEXT

    PubMed Central

    KONESKY, KASEY L.; LAYBOURN, PAUL J.

    2007-01-01

    We have optimized a recombinant chromatin assembly system that properly incorporates core histones and histone H1 into a chromatin template containing a natural promoter sequence. This article provides a step-by-step procedure for expression and purification of the proteins required for assembling well-defined chromatin templates. We describe how the degree of chromatin assembly in the absence and presence of histone H1 is measured using topological analysis and the use of micrococcal nuclease digestion performed to confirm H1 incorporation and determine the quality of in vitro chromatin templates. Further we describe the use sucrose gradient ultracentrifugation to verify that no unincorporated H1 remains as a second means for deciding on the proper H1 to core histone ratio during assembly. Additionally, we discuss the use of both yeast and Drosophila NAP-1 (yNAP-1 and dNAP-1, respectively) in the assembly of H1-containing chromatin. Finally, we provide detailed description of functional assays for investigating the mechanism of transcriptional regulation in a chromatin context (transcription, histone acetyltransferase activity, and protein association with promoter-bound complexes using immobilized chromatin templates). PMID:17309835

  10. A new regulatory mechanism for bacterial lipoic acid synthesis

    PubMed Central

    Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun

    2015-01-01

    Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. PMID

  11. A new regulatory mechanism for bacterial lipoic acid synthesis.

    PubMed

    Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun

    2015-01-22

    Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis.

  12. Hospital closures and survivals: an analysis of operating characteristics and regulatory mechanisms in three states.

    PubMed Central

    Kennedy, L; Dumas, M B

    1983-01-01

    This article examines factors related to hospital closures, using a longitudinal sample of surviving and closed hospitals. The hospitals are drawn from three states with different regulatory programs. Size of hospital and occupancy rate are shown to be related to likelihood of closure, while ownership, length of stay, and expenditures are not. These findings are observed both in the aggregate and within the individual states between 1960 and 1980. The three states--Arizona, Pennsylvania, and Maryland--represent different population trends and regulatory mechanisms and goals. The findings indicate that some programs appear to guarantee survival, whereas others are more neutral. PMID:6668180

  13. Control and regulatory mechanisms associated with thermogenesis in flying insects and birds.

    PubMed

    Loli, Denise; Bicudo, José Eduardo P W

    2005-01-01

    Most insects and birds are able to fly. The chitin made exoskeleton of insects poses them several constraints, and this is one the reasons they are in general small sized animals. On the other hand, because birds possess an endoskeleton made of bones they may grow much larger when compared to insects. The two taxa are quite different with regards to their general "design" platform, in particular with respect to their respiratory and circulatory systems. However, because they fly, they may share in common several traits, namely those associated with the control and regulatory mechanisms governing thermogenesis. High core temperatures are essential for animal flight irrespective of the taxa they belong to. Birds and insects have thus evolved mechanisms which allowed them to control and regulate high rates of heat fluxes. This article discusses possible convergent thermogenic control and regulatory mechanisms associated with flight in insects and birds.

  14. Catecholamine Stress Hormones Regulate Cellular Iron Homeostasis by a Posttranscriptional Mechanism Mediated by Iron Regulatory Protein

    PubMed Central

    Tapryal, Nisha; Vivek G, Vishnu; Mukhopadhyay, Chinmay K.

    2015-01-01

    Adequate availability of iron is important for cellular energy metabolism. Catecholamines such as epinephrine and norepinephrine promote energy expenditure to adapt to conditions that arose due to stress. To restore the energy balance, epinephrine/norepinephrine-exposed cells may face higher iron demand. So far, no direct role of epinephrine/norepinephrine in cellular iron homeostasis has been reported. Here we show that epinephrine/norepinephrine regulates iron homeostasis components such as transferrin receptor-1 and ferritin-H in hepatic and skeletal muscle cells by promoting the binding of iron regulatory proteins to iron-responsive elements present in the UTRs of transferrin receptor-1 and ferritin-H transcripts. Increased transferrin receptor-1, decreased ferritin-H, and increased iron-responsive element-iron regulatory protein interaction are also observed in liver and muscle tissues of epinephrine/norepinephrine-injected mice. We demonstrate the role of epinephrine/norepinephrine-induced generation of reactive oxygen species in converting cytosolic aconitase (ACO1) into iron regulatory protein-1 to bind iron-responsive elements present in UTRs of transferrin receptor-1 and ferritin-H. Our study further reveals that mitochondrial iron content and mitochondrial aconitase (ACO2) activity are elevated by epinephrine/norepinephrine that are blocked by the antioxidant N-acetyl cysteine and iron regulatory protein-1 siRNA, suggesting involvement of reactive oxygen species and iron regulatory protein-1 in this mechanism. This study reveals epinephrine and norepinephrine as novel regulators of cellular iron homeostasis. PMID:25572399

  15. Identification of genes involved in regulatory mechanism of pigments in broiler chickens.

    PubMed

    Tarique, T M; Yang, S; Mohsina, Z; Qiu, J; Yan, Z; Chen, G; Chen, A

    2014-09-05

    Chicken is an important model organism that unites the evolutionary gap between mammals and other vertebrates and provide major source of protein from meat and eggs for all over the world population. However, specific genes underlying the regulatory mechanism of broiler pigmentation have not yet been determined. In order to better understand the genes involved in the mechanism of pigmentation in the muscle tissues of broilers, the Affymetrix microarray hybridization experiment platform was used to identify gene expression profiles at 7 weeks of age. Broilers fed canthaxanthin, natural lutein, and orangeII pigments (100 mg/kg) were used to explore gene expression profiles). Our data showed that the 7th week of age was a very important phase with regard to gene expression profiles. We identified a number of differentially expressed genes; in canthaxanthin, natural lutein, and orangeII, there were 54 (32 upregulated and 22 downregulated), 23 (15 upregulated and 8 downregulated), and 7 (5 upregulated and 2 downregulated) known genes, respectively. Our data indicate that the numbers of differentially expressed genes were more upregulated than downregulated, and several genes showed conserved signaling to previously known functions. Thus, functional characterization of differentially expressed genes revealed several categories that are involved in important biological processes, including pigmentation, growth, molecular mechanisms, fat metabolism, cell proliferation, immune response, lipid metabolism, and protein synthesis and degradation. The results of the present study demonstrate that the genes associated with canthaxanthin, natural lutein, and orangeII are key regulatory genes that control the regulatory mechanisms of pigmentation.

  16. Structural Instability Tuning as a Regulatory Mechanism in Protein-Protein Interactions

    PubMed Central

    Chen, Li; Balabanidou, Vassilia; Remeta, David P.; Minetti, Conceição A.S.A.; Portaliou, Athina G.; Economou, Anastassios; Kalodimos, Charalampos G.

    2011-01-01

    SUMMARY Protein-protein interactions mediate a vast number of cellular processes. Here we present a regulatory mechanism in protein-protein interactions mediated by finely-tuned structural instability coupled with molecular mimicry. We show that a set of type III secretion (TTS) autoinhibited homodimeric chaperones adopt a molten-globule-like state that transiently exposes the substrate binding site as a means to become rapidly poised for binding to their cognate protein substrates. Packing defects at the homodimeric interface stimulate binding whereas correction of these defects results in less labile chaperones that give rise to non-functional biological systems. The protein substrates use structural mimicry to offset the “weak spots” in the chaperones and to counteract their autoinhibitory conformation. This regulatory mechanism of protein activity is evolutionary conserved among several TSS systems and presents a lucid example of functional advantage conferred upon a biological system by finely-tuned structural instability. PMID:22152477

  17. Diversity of regulatory mechanisms of photosynthetic carbon metabolism in plants and algae.

    PubMed

    Tamoi, Masahiro; Shigeoka, Shigeru

    2015-01-01

    To clarify the regulatory mechanisms of the Calvin cycle in algae, we analyzed the molecular properties of the enzymes involved in this cycle. We demonstrated that these enzymes were not regulated by redox modulation through the ferredoxin/thioredoxin system under light/dark conditions and were not sensitive to treatments with hydrogen peroxide in vitro, unlike the chloroplastic thiol-modulated enzymes of plants. On the other hand, we found that cyanobacteria possessed a unique enzyme involved in the Calvin cycle. The CP12 protein played an important role in regulating carbon metabolism in the Calvin cycle in cyanobacteria and eukaryotic algae. This review described the regulatory mechanisms of the Calvin cycle in algae and also the effects of alterations to photosynthetic carbon metabolism on plant productivity, carbon partitioning, and the carbon/nitrogen balance using transgenic plants expressing algal genes.

  18. Gene regulatory mechanisms orchestrated by p63 in epithelial development and related disorders.

    PubMed

    Kouwenhoven, Evelyn N; van Bokhoven, Hans; Zhou, Huiqing

    2015-06-01

    The transcription factor p63 belongs to the p53 family and is a key regulator in epithelial commitment and development. Mutations in p63 give rise to several epithelial related disorders with defects in skin, limb and orofacial structures. Since the discovery of p63, efforts have been made to identify its target genes using individual gene approaches and to understand p63 function in normal epithelial development and related diseases. Recent genome-wide approaches have identified tens of thousands of potential p63-regulated target genes and regulatory elements, and reshaped the concept of gene regulation orchestrated by p63. These data also provide insights into p63-related disease mechanisms. In this review, we discuss the regulatory role of p63 in normal and diseased epithelial development in light of these novel findings. We also propose future perspectives for dissecting the molecular mechanism of p63-mediated epithelial development and related disorders as well as for potential therapeutic strategies.

  19. Exploring associations between self-regulatory mechanisms and neuropsychological functioning and driver behaviour after brain injury.

    PubMed

    Rike, Per-Ola; Johansen, Hans J; Ulleberg, Pål; Lundqvist, Anna; Schanke, Anne-Kristine

    2016-04-11

    The objective of this prospective one-year follow-up study was to explore the associations between self-regulatory mechanisms and neuropsychological tests as well as baseline and follow-up ratings of driver behaviour. The participants were a cohort of subjects with stroke and traumatic brain injury (TBI) who were found fit to drive after a multi-disciplinary driver assessment (baseline). Baseline measures included neuropsychological tests and ratings of self-regulatory mechanisms, i.e., executive functions (Behavior Rating Inventory of Executive Function-Adult Version; BRIEF-A) and impulsive personality traits (UPPS Impulsive Behavior Scale). The participants rated pre-injury driving behaviour on the Driver Behaviour Qestionnaire (DBQ) retrospectively at baseline and after one year of post-injury driving (follow-up). Better performance on neuropsychological tests was significantly associated with more post-injury DBQ Violations. The BRIEF-A main indexes were significantly associated with baseline and follow-up ratings of DBQ Mistakes and follow-up DBQ Inattention. UPPS (lack of) Perseverance was significantly associated with baseline DBQ Inattention, whereas UPPS Urgency was significantly associated with baseline DBQ Inexperience and post-injury DBQ Mistakes. There were no significant changes in DBQ ratings from baseline (pre-injury) to follow-up (post-injury). It was concluded that neuropsychological functioning and self-regulatory mechanisms are related to driver behaviour. Some aspects of driver behaviour do not necessarily change after brain injury, reflecting the influence of premorbid driving behaviour or impaired awareness of deficits on post-injury driving behaviour. Further evidence is required to predict the role of self-regulatory mechanisms on driver behaviour and crashes or near misses.

  20. Modeling the Regulatory Mechanisms by Which NLRX1 Modulates Innate Immune Responses to Helicobacter pylori Infection.

    PubMed

    Philipson, Casandra W; Bassaganya-Riera, Josep; Viladomiu, Monica; Kronsteiner, Barbara; Abedi, Vida; Hoops, Stefan; Michalak, Pawel; Kang, Lin; Girardin, Stephen E; Hontecillas, Raquel

    2015-01-01

    Helicobacter pylori colonizes half of the world's population as the dominant member of the gastric microbiota resulting in a lifelong chronic infection. Host responses toward the bacterium can result in asymptomatic, pathogenic or even favorable health outcomes; however, mechanisms underlying the dual role of H. pylori as a commensal versus pathogenic organism are not well characterized. Recent evidence suggests mononuclear phagocytes are largely involved in shaping dominant immunity during infection mediating the balance between host tolerance and succumbing to overt disease. We combined computational modeling, bioinformatics and experimental validation in order to investigate interactions between macrophages and intracellular H. pylori. Global transcriptomic analysis on bone marrow-derived macrophages (BMDM) in a gentamycin protection assay at six time points unveiled the presence of three sequential host response waves: an early transient regulatory gene module followed by sustained and late effector responses. Kinetic behaviors of pattern recognition receptors (PRRs) are linked to differential expression of spatiotemporal response waves and function to induce effector immunity through extracellular and intracellular detection of H. pylori. We report that bacterial interaction with the host intracellular environment caused significant suppression of regulatory NLRC3 and NLRX1 in a pattern inverse to early regulatory responses. To further delineate complex immune responses and pathway crosstalk between effector and regulatory PRRs, we built a computational model calibrated using time-series RNAseq data. Our validated computational hypotheses are that: 1) NLRX1 expression regulates bacterial burden in macrophages; and 2) early host response cytokines down-regulate NLRX1 expression through a negative feedback circuit. This paper applies modeling approaches to characterize the regulatory role of NLRX1 in mechanisms of host tolerance employed by macrophages to

  1. Modeling the Regulatory Mechanisms by Which NLRX1 Modulates Innate Immune Responses to Helicobacter pylori Infection

    PubMed Central

    Philipson, Casandra W.; Bassaganya-Riera, Josep; Viladomiu, Monica; Kronsteiner, Barbara; Abedi, Vida; Hoops, Stefan; Michalak, Pawel; Kang, Lin; Girardin, Stephen E.; Hontecillas, Raquel

    2015-01-01

    Helicobacter pylori colonizes half of the world’s population as the dominant member of the gastric microbiota resulting in a lifelong chronic infection. Host responses toward the bacterium can result in asymptomatic, pathogenic or even favorable health outcomes; however, mechanisms underlying the dual role of H. pylori as a commensal versus pathogenic organism are not well characterized. Recent evidence suggests mononuclear phagocytes are largely involved in shaping dominant immunity during infection mediating the balance between host tolerance and succumbing to overt disease. We combined computational modeling, bioinformatics and experimental validation in order to investigate interactions between macrophages and intracellular H. pylori. Global transcriptomic analysis on bone marrow-derived macrophages (BMDM) in a gentamycin protection assay at six time points unveiled the presence of three sequential host response waves: an early transient regulatory gene module followed by sustained and late effector responses. Kinetic behaviors of pattern recognition receptors (PRRs) are linked to differential expression of spatiotemporal response waves and function to induce effector immunity through extracellular and intracellular detection of H. pylori. We report that bacterial interaction with the host intracellular environment caused significant suppression of regulatory NLRC3 and NLRX1 in a pattern inverse to early regulatory responses. To further delineate complex immune responses and pathway crosstalk between effector and regulatory PRRs, we built a computational model calibrated using time-series RNAseq data. Our validated computational hypotheses are that: 1) NLRX1 expression regulates bacterial burden in macrophages; and 2) early host response cytokines down-regulate NLRX1 expression through a negative feedback circuit. This paper applies modeling approaches to characterize the regulatory role of NLRX1 in mechanisms of host tolerance employed by macrophages to

  2. Type 1 regulatory T cells: a new mechanism of peripheral immune tolerance.

    PubMed

    Zeng, Hanyu; Zhang, Rong; Jin, Boquan; Chen, Lihua

    2015-09-01

    The lack of immune response to an antigen, a process known as immune tolerance, is essential for the preservation of immune homeostasis. To date, two mechanisms that drive immune tolerance have been described extensively: central tolerance and peripheral tolerance. Under the new nomenclature, thymus-derived regulatory T (tT(reg)) cells are the major mediators of central immune tolerance, whereas peripherally derived regulatory T (pT(reg)) cells function to regulate peripheral immune tolerance. A third type of T(reg) cells, termed iT(reg), represents only the in vitro-induced T(reg) cells(1). Depending on whether the cells stably express Foxp3, pT(reg), and iT(reg) cells may be divided into two subsets: the classical CD4(+)Foxp3(+) T(reg) cells and the CD4(+)Foxp3(-) type 1 regulatory T (Tr1) cells(2). This review focuses on the discovery, associated biomarkers, regulatory functions, methods of induction, association with disease, and clinical trials of Tr1 cells.

  3. A SerpinB1 regulatory mechanism is essential for restricting NETosis

    PubMed Central

    Farley, Kalamo; Stolley, J Michael; Zhao, Picheng; Cooley, Jessica; Remold-O’Donnell, Eileen

    2014-01-01

    NETosis (NET generation), a programmed death pathway initiated in mature neutrophils by pathogens and inflammatory mediators, can be a protective process that sequesters microbes and prevents spread of infection, but can also be a pathological process that causes inflammation and serious tissue injury. Little is known about the regulatory mechanism. Previously we demonstrated that serpinb1-deficient mice are highly susceptible to pulmonary bacterial and viral infections due to inflammation and tissue injury associated with increased neutrophilic death. Here we used in vitro and in vivo approaches to investigate whether SerpinB1 regulates NETosis. We found that serpinb1-deficient bone marrow and lung neutrophils are hyper-susceptible to NETosis induced by multiple mediators in both NADPH-dependent and independent manner, indicating a deeply rooted regulatory role in NETosis. This role is further supported by increased nuclear expansion (representing chromatin decondensation) of PMA-treated serpinb-1-deficient neutrophils compared to wild-type, by migration of SerpinB1 from the cytoplasm to the nucleus of human neutrophils coincident with, or before, early conversion of lobulated (segmented) nuclei to delobulated (spherical) morphology, and by finding that exogenous rSerpinB1 abrogates NET production. NETosis of serpinb1-deficient neutrophils is also increased in vivo during Pseudomonas aeruginosa lung infection. The findings identify a previously unrecognized regulatory mechanism involving SerpinB1 that restricts the production of NETs. PMID:23002442

  4. A serpinB1 regulatory mechanism is essential for restricting neutrophil extracellular trap generation.

    PubMed

    Farley, Kalamo; Stolley, J Michael; Zhao, Picheng; Cooley, Jessica; Remold-O'Donnell, Eileen

    2012-11-01

    NETosis (neutrophil extracellular trap [NET] generation), a programmed death pathway initiated in mature neutrophils by pathogens and inflammatory mediators, can be a protective process that sequesters microbes and prevents spread of infection, but it can also be a pathological process that causes inflammation and serious tissue injury. Little is known about the regulatory mechanism. Previously, we demonstrated that serpinb1-deficient mice are highly susceptible to pulmonary bacterial and viral infections due to inflammation and tissue injury associated with increased neutrophilic death. In this study, we used in vitro and in vivo approaches to investigate whether SerpinB1 regulates NETosis. We found that serpinb1-deficient bone marrow and lung neutrophils are hypersusceptible to NETosis induced by multiple mediators in both an NADPH-dependent and -independent manner, indicating a deeply rooted regulatory role in NETosis. This role is further supported by increased nuclear expansion (representing chromatin decondensation) of PMA-treated serpinb1-deficient neutrophils compared with wild-type, by migration of SerpinB1 from the cytoplasm to the nucleus of human neutrophils that is coincident with or preceding early conversion of lobulated (segmented) nuclei to delobulated (spherical) morphology, as well as by the finding that exogenous human recombinant SerpinB1 abrogates NET production. NETosis of serpinb1-deficient neutrophils is also increased in vivo during Pseudomonas aeruginosa lung infection. The findings identify a previously unrecognized regulatory mechanism involving SerpinB1 that restricts the production of NETs.

  5. Architecture and Molecular Mechanism of PAN, the Archaeal Proteasome Regulatory ATPase*

    PubMed Central

    Medalia, Noa; Beer, Avital; Zwickl, Peter; Mihalache, Oana; Beck, Martin; Medalia, Ohad; Navon, Ami

    2009-01-01

    In Archaea, an hexameric ATPase complex termed PAN promotes proteins unfolding and translocation into the 20 S proteasome. PAN is highly homologous to the six ATPases of the eukaryotic 19 S proteasome regulatory complex. Thus, insight into the mechanism of PAN function may reveal a general mode of action mutual to the eukaryotic 19 S proteasome regulatory complex. In this study we generated a three-dimensional model of PAN from tomographic reconstruction of negatively stained particles. Surprisingly, this reconstruction indicated that the hexameric complex assumes a two-ring structure enclosing a large cavity. Assessment of distinct three-dimensional functional states of PAN in the presence of adenosine 5′-O-(thiotriphosphate) and ADP and in the absence of nucleotides outlined a possible mechanism linking nucleotide binding and hydrolysis to substrate recognition, unfolding, and translocation. A novel feature of the ATPase complex revealed in this study is a gate controlling the “exit port” of the regulatory complex and, presumably, translocation into the 20 S proteasome. Based on our structural and biochemical findings, we propose a possible model in which substrate binding and unfolding are linked to structural transitions driven by nucleotide binding and hydrolysis, whereas translocation into the proteasome only depends upon the presence of an unfolded substrate and binding but not hydrolysis of nucleotide. PMID:19363223

  6. Regulatory mechanism of human vascular smooth muscle cell phenotypic transformation induced by NELIN

    PubMed Central

    PEI, CHANGAN; QIN, SHIYONG; WANG, MINGHAI; ZHANG, SHUGUANG

    2015-01-01

    Vascular disorders, including hypertension, atherosclerosis and restenosis, arise from dysregulation of vascular smooth muscle cell (VSMC) differentiation, which can be controlled by regulatory factors. The present study investigated the regulatory mechanism of the phenotypic transformation of human VSMCs by NELIN in order to evaluate its potential as a preventive and therapeutic of vascular disorders. An in vitro model of NELIN-overexpressing VSMCs was prepared by transfection with a lentiviral (LV) vector (NELIN-VSMCs) and NELIN was slienced using an a lentiviral vector with small interfering (si)RNA in another group (LV-NELIN-siRNA-VSMCs). The effects of NELIN overexpression or knockdown on the phenotypic transformation of human VSMCs were observed, and its regulatory mechanism was studied. Compared with the control group, cells in the NELIN-VSMCs group presented a contractile phenotype with a significant increase of NELIN mRNA, NELIN protein, smooth muscle (SM)α-actin and total Ras homolog gene family member A (RhoA) protein expression. The intra-nuclear translocation of SMα-actin-serum response factor (SMα-actin-SRF) occurred in these cells simultaneously. Following exposure to Rho kinsase inhibitor Y-27632, SRF and SMα-actin expression decreased. However, cells in the LV-NELIN-siRNA-VSMCs group presented a synthetic phenotype, and the expression of NELIN mRNA, NELIN protein, SMα-actin protein and total RhoA protein was decreased. The occurrence of SRF extra-nuclear translocation was observed. In conclusion, the present study suggested that NELIN was able to activate regulatory factors of SMα-actin, RhoA and SRF successively in human VSMCs cultured in vitro. Furthermore, NELIN-induced phenotypic transformation of human VSMCs was regulated via the RhoA/SRF signaling pathway. The results of the present study provide a foundation for the use of NELIN in preventive and therapeutic treatment of vascular remodeling diseases, including varicosity and

  7. Latent Tuberculosis: Models, Computational Efforts and the Pathogen’s Regulatory Mechanisms during Dormancy

    PubMed Central

    Magombedze, Gesham; Dowdy, David; Mulder, Nicola

    2013-01-01

    Latent tuberculosis is a clinical syndrome that occurs after an individual has been exposed to the Mycobacterium tuberculosis (Mtb) Bacillus, the infection has been established and an immune response has been generated to control the pathogen and force it into a quiescent state. Mtb can exit this quiescent state where it is unresponsive to treatment and elusive to the immune response, and enter a rapid replicating state, hence causing infection reactivation. It remains a gray area to understand how the pathogen causes a persistent infection and it is unclear whether the organism will be in a slow replicating state or a dormant non-replicating state. The ability of the pathogen to adapt to changing host immune response mechanisms, in which it is exposed to hypoxia, low pH, nitric oxide (NO), nutrient starvation, and several other anti-microbial effectors, is associated with a high metabolic plasticity that enables it to metabolize under these different conditions. Adaptive gene regulatory mechanisms are thought to coordinate how the pathogen changes their metabolic pathways through mechanisms that sense changes in oxygen tension and other stress factors, hence stimulating the pathogen to make necessary adjustments to ensure survival. Here, we review studies that give insights into latency/dormancy regulatory mechanisms that enable infection persistence and pathogen adaptation to different stress conditions. We highlight what mathematical and computational models can do and what they should do to enhance our current understanding of TB latency. PMID:25023946

  8. Effects of a Regulatory Protocol for Mechanical Restraint and Coercion in a Spanish Psychiatric Ward.

    PubMed

    Guzman-Parra, Jose; Garcia-Sanchez, Juan A; Pino-Benitez, Isabel; Alba-Vallejo, Mercedes; Mayoral-Cleries, Fermin

    2015-10-01

    There is still limited information on what type of measures are most efficient to reduce coercion. The aim of this study was to determine if the introduction of a new regulatory protocol in a specific psychiatric ward in Andalusia (Spain) contributed to reducing the use of mechanical restraint. The study included a comparison of two time periods: 2005 (one year before the implementation of the new regulatory protocol) and 2012, in all hospitalized patients (N=1,094). The study also analyzes with logistic regression the variables related to a shorter duration of mechanical restraint. Mechanical restraint rate per year was reduced, not significantly, from 18.2% to 15.1%. The average duration of each mechanical restraint episode was significantly reduced from 27.91 to 15.33 hr. The following variables have been associated with a shorter period of coercion: being female and the year of restraint (2012). Specific plans are required, including different interventions, in order to achieve marked reduction in the use of coercive measures. © 2014 Wiley Periodicals, Inc.

  9. Defining Transcriptional Regulatory Mechanisms for Primary let-7 miRNAs.

    PubMed

    Gaeta, Xavier; Le, Luat; Lin, Ying; Xie, Yuan; Lowry, William E

    2017-01-01

    The let-7 family of miRNAs have been shown to control developmental timing in organisms from C. elegans to humans; their function in several essential cell processes throughout development is also well conserved. Numerous studies have defined several steps of post-transcriptional regulation of let-7 production; from pri-miRNA through pre-miRNA, to the mature miRNA that targets endogenous mRNAs for degradation or translational inhibition. Less-well defined are modes of transcriptional regulation of the pri-miRNAs for let-7. let-7 pri-miRNAs are expressed in polycistronic fashion, in long transcripts newly annotated based on chromatin-associated RNA-sequencing. Upon differentiation, we found that some let-7 pri-miRNAs are regulated at the transcriptional level, while others appear to be constitutively transcribed. Using the Epigenetic Roadmap database, we further annotated regulatory elements of each polycistron identified putative promoters and enhancers. Probing these regulatory elements for transcription factor binding sites identified factors that regulate transcription of let-7 in both promoter and enhancer regions, and identified novel regulatory mechanisms for this important class of miRNAs.

  10. Integrative functional genomics identifies regulatory mechanisms at coronary artery disease loci

    PubMed Central

    Miller, Clint L.; Pjanic, Milos; Wang, Ting; Nguyen, Trieu; Cohain, Ariella; Lee, Jonathan D.; Perisic, Ljubica; Hedin, Ulf; Kundu, Ramendra K.; Majmudar, Deshna; Kim, Juyong B.; Wang, Oliver; Betsholtz, Christer; Ruusalepp, Arno; Franzén, Oscar; Assimes, Themistocles L.; Montgomery, Stephen B.; Schadt, Eric E.; Björkegren, Johan L.M.; Quertermous, Thomas

    2016-01-01

    Coronary artery disease (CAD) is the leading cause of mortality and morbidity, driven by both genetic and environmental risk factors. Meta-analyses of genome-wide association studies have identified >150 loci associated with CAD and myocardial infarction susceptibility in humans. A majority of these variants reside in non-coding regions and are co-inherited with hundreds of candidate regulatory variants, presenting a challenge to elucidate their functions. Herein, we use integrative genomic, epigenomic and transcriptomic profiling of perturbed human coronary artery smooth muscle cells and tissues to begin to identify causal regulatory variation and mechanisms responsible for CAD associations. Using these genome-wide maps, we prioritize 64 candidate variants and perform allele-specific binding and expression analyses at seven top candidate loci: 9p21.3, SMAD3, PDGFD, IL6R, BMP1, CCDC97/TGFB1 and LMOD1. We validate our findings in expression quantitative trait loci cohorts, which together reveal new links between CAD associations and regulatory function in the appropriate disease context. PMID:27386823

  11. Defining Transcriptional Regulatory Mechanisms for Primary let-7 miRNAs

    PubMed Central

    Gaeta, Xavier; Le, Luat; Lin, Ying; Xie, Yuan; Lowry, William E.

    2017-01-01

    The let-7 family of miRNAs have been shown to control developmental timing in organisms from C. elegans to humans; their function in several essential cell processes throughout development is also well conserved. Numerous studies have defined several steps of post-transcriptional regulation of let-7 production; from pri-miRNA through pre-miRNA, to the mature miRNA that targets endogenous mRNAs for degradation or translational inhibition. Less-well defined are modes of transcriptional regulation of the pri-miRNAs for let-7. let-7 pri-miRNAs are expressed in polycistronic fashion, in long transcripts newly annotated based on chromatin-associated RNA-sequencing. Upon differentiation, we found that some let-7 pri-miRNAs are regulated at the transcriptional level, while others appear to be constitutively transcribed. Using the Epigenetic Roadmap database, we further annotated regulatory elements of each polycistron identified putative promoters and enhancers. Probing these regulatory elements for transcription factor binding sites identified factors that regulate transcription of let-7 in both promoter and enhancer regions, and identified novel regulatory mechanisms for this important class of miRNAs. PMID:28052101

  12. Autocrine/paracrine regulatory mechanisms in adrenocortical neoplasms responsible for primary adrenal hypercorticism.

    PubMed

    Lefebvre, H; Prévost, G; Louiset, E

    2013-11-01

    A wide variety of autocrine/paracrine bioactive signals are able to modulate corticosteroid secretion in the human adrenal gland. These regulatory factors, released in the vicinity of adrenocortical cells by diverse cell types comprising chromaffin cells, nerve terminals, cells of the immune system, endothelial cells, and adipocytes, include neuropeptides, biogenic amines, and cytokines. A growing body of evidence now suggests that paracrine mechanisms may also play an important role in the physiopathology of adrenocortical hyperplasias and tumors responsible for primary adrenal steroid excess. These intra-adrenal regulatory systems, although globally involving the same actors as those observed in the normal gland, display alterations at different levels, which reinforce the capacity of paracrine factors to stimulate the activity of adrenocortical cells. The main modifications in the adrenal local control systems reported by now include hyperplasia of cells producing the paracrine factors and abnormal expression of the latter and their receptors. Because steroid-secreting adrenal neoplasms are independent of the classical endocrine regulatory factors angiotensin II and ACTH, which are respectively suppressed by hyperaldosteronism and hypercortisolism, these lesions have long been considered as autonomous tissues. However, the presence of stimulatory substances within the neoplastic tissues suggests that steroid hypersecretion is driven by autocrine/paracrine loops that should be regarded as promising targets for pharmacological treatments of primary adrenal disorders. This new potential therapeutic approach may constitute an alternative to surgical removal of the lesions that is classically recommended in order to cure steroid excess.

  13. Timing Embryo Segmentation: Dynamics and Regulatory Mechanisms of the Vertebrate Segmentation Clock

    PubMed Central

    Resende, Tatiana P.; Andrade, Raquel P.; Palmeirim, Isabel

    2014-01-01

    All vertebrate species present a segmented body, easily observed in the vertebrate column and its associated components, which provides a high degree of motility to the adult body and efficient protection of the internal organs. The sequential formation of the segmented precursors of the vertebral column during embryonic development, the somites, is governed by an oscillating genetic network, the somitogenesis molecular clock. Herein, we provide an overview of the molecular clock operating during somite formation and its underlying molecular regulatory mechanisms. Human congenital vertebral malformations have been associated with perturbations in these oscillatory mechanisms. Thus, a better comprehension of the molecular mechanisms regulating somite formation is required in order to fully understand the origin of human skeletal malformations. PMID:24895605

  14. USP1 deubiquitinase: cellular functions, regulatory mechanisms and emerging potential as target in cancer therapy

    PubMed Central

    2013-01-01

    Reversible protein ubiquitination is emerging as a key process for maintaining cell homeostasis, and the enzymes that participate in this process, in particular E3 ubiquitin ligases and deubiquitinases (DUBs), are increasingly being regarded as candidates for drug discovery. Human DUBs are a group of approximately 100 proteins, whose cellular functions and regulatory mechanisms remain, with some exceptions, poorly characterized. One of the best-characterized human DUBs is ubiquitin-specific protease 1 (USP1), which plays an important role in the cellular response to DNA damage. USP1 levels, localization and activity are modulated through several mechanisms, including protein-protein interactions, autocleavage/degradation and phosphorylation, ensuring that USP1 function is carried out in a properly regulated spatio-temporal manner. Importantly, USP1 expression is deregulated in certain types of human cancer, suggesting that USP1 could represent a valid target in cancer therapy. This view has gained recent support with the finding that USP1 inhibition may contribute to revert cisplatin resistance in an in vitro model of non-small cell lung cancer (NSCLC). Here, we describe the current knowledge on the cellular functions and regulatory mechanisms of USP1. We also summarize USP1 alterations found in cancer, combining data from the literature and public databases with our own data. Finally, we discuss the emerging potential of USP1 as a target, integrating published data with our novel findings on the effects of the USP1 inhibitor pimozide in combination with cisplatin in NSCLC cells. PMID:23937906

  15. Regulatory T cells: Mechanisms of suppression and impairment in autoimmune liver disease.

    PubMed

    Liberal, Rodrigo; Grant, Charlotte R; Longhi, Maria Serena; Mieli-Vergani, Giorgina; Vergani, Diego

    2015-02-01

    There are three classic liver diseases with probable autoimmune etiology: primary biliary cirrhosis, primary sclerosing cholangitis, and autoimmune hepatitis. The occurrence of these autoimmune conditions is determined by the breakdown of immune-regulatory mechanisms that in health are responsible for maintaining immunological tolerance against self-antigens. Among the multiple T cell subsets with suppressive function, the regulatory T cells (Tregs), defined by the expression of CD4, the IL-2 receptor α chain (CD25), and the transcription factor FOXP3, have emerged as having a central role in maintaining immune-tolerance to autoantigens. Tregs are equipped with an array of mechanisms of suppression, including the modulation of antigen presenting cell maturation and function, the killing of target cells, the disruption of metabolic pathways, and the production of anti-inflammatory cytokines. In all the three autoimmune liver diseases mentioned above, there is evidence pointing for either a reduced frequency and/or function of Tregs. Here, we review the definition, phenotypic characteristics, and mechanisms of suppression employed by Tregs and then we discuss the evidence available pointing to their impairment in patients with autoimmune liver disease.

  16. Biosafety, biosecurity and internationally mandated regulatory regimes: compliance mechanisms for education and global health security

    PubMed Central

    Sture, Judi; Whitby, Simon; Perkins, Dana

    2015-01-01

    This paper highlights the biosafety and biosecurity training obligations that three international regulatory regimes place upon states parties. The duty to report upon the existence of such provisions as evidence of compliance is discussed in relation to each regime. We argue that such mechanisms can be regarded as building blocks for the development and delivery of complementary biosafety and biosecurity teaching and training materials. We show that such building blocks represent foundations upon which life and associated scientists – through greater awareness of biosecurity concerns – can better fulfil their responsibilities to guard their work from misuse in the future. PMID:24494580

  17. Distinct Regulatory Mechanisms Act to Establish and Maintain Pax3 Expression in the Developing Neural Tube

    PubMed Central

    Moore, Steven; Ribes, Vanessa; Terriente, Javier; Wilkinson, David; Relaix, Frédéric; Briscoe, James

    2013-01-01

    Pattern formation in developing tissues is driven by the interaction of extrinsic signals with intrinsic transcriptional networks that together establish spatially and temporally restricted profiles of gene expression. How this process is orchestrated at the molecular level by genomic cis-regulatory modules is one of the central questions in developmental biology. Here we have addressed this by analysing the regulation of Pax3 expression in the context of the developing spinal cord. Pax3 is induced early during neural development in progenitors of the dorsal spinal cord and is maintained as pattern is subsequently elaborated, resulting in the segregation of the tissue into dorsal and ventral subdivisions. We used a combination of comparative genomics and transgenic assays to define and dissect several functional cis-regulatory modules associated with the Pax3 locus. We provide evidence that the coordinated activity of two modules establishes and refines Pax3 expression during neural tube development. Mutational analyses of the initiating element revealed that in addition to Wnt signaling, Nkx family homeodomain repressors restrict Pax3 transcription to the presumptive dorsal neural tube. Subsequently, a second module mediates direct positive autoregulation and feedback to maintain Pax3 expression. Together, these data indicate a mechanism by which transient external signals are converted into a sustained expression domain by the activities of distinct regulatory elements. This transcriptional logic differs from the cross-repression that is responsible for the spatiotemporal patterns of gene expression in the ventral neural tube, suggesting that a variety of circuits are deployed within the neural tube regulatory network to establish and elaborate pattern formation. PMID:24098141

  18. Identifying miRNA regulatory mechanisms in preeclampsia by systems biology approaches.

    PubMed

    Biró, Orsolya; Nagy, Bálint; Rigó, János

    2017-02-01

    Preeclampsia (PE) is the major cause of maternal and fetal morbidity and mortality, affecting 3-8% of all pregnancies around the globe. miRNAs are small, noncoding RNA molecules, which negatively regulate gene expression. Abnormally expressed miRNAs contribute to pregnancy complications such as PE. The aim of our study was to find possible regulatory mechanisms by system biology approaches, which are connected to the pathogenesis of PE. We integrated publicly available miRNA and gene expression profiles and created a network from the significant miRNA-mRNA pairs with the help of MAGIA and Cytoscape softwares. Two subnetworks were expanded by adding protein-protein interactions. Differentially expressed miRNAs were identified for the evaluation of their regulatory effect. We analyzed the miRNAs and their targets using different bioinformatics tools and through literature research. Altogether, 52,603 miRNA-mRNA interactions were generated by the MAGIA web tool. The top 250 interactions were visualized and pairs with q < 0.0001 were analyzed, which included 85 nodes and 80 edges signalizing the connections between 52 regulated genes and 33 miRNAs. A total of 11 of the regulated genes are PE related and 9 of them were targeted by multiple miRNAs. A total of 8 miRNAs were associated with PE before, and 13 miRNAs regulated more than 1 mRNA. Hsa-mir-210 was the highest degree node in the network and its role in PE is well established. We identified several miRNA-mRNA regulatory mechanisms which may contribute to the pathogenesis of PE. Further investigations are needed to validate these miRNA-mRNA interactions and to enlighten the possibilities of developing potential therapeutic targets.

  19. [Influence of geomagnetic storms on the balance of autonomic regulatory mechanisms].

    PubMed

    Chichinadze, G; Tvildiani, L; Kvachadze, I; Tarkhan-Mouravi, I

    2005-09-01

    The investigation aimed to evaluate autonomic regulatory mechanisms in practically healthy persons during the geomagnetically quiet periods and during geomagnetic storms. The examinations were conducted among the volunteer young men (n=64) 18-22 years of age. The autonomic function was studied on the basis of the heart rate variability. The geomagnetically quiet periods were considered when the value of the K-index was no more then 2 and a geomagnetic storm was considered when the value of the index was 5 and more. It is ascertained that in the both cases the basic statistical indices of the heart rate were identical. The analysis of R-R intervals spectral power gave the possibility to sort the persons examined into the three different groups. The data obtained allowed to suggest that geomagnetic storms influence human organisms through the vagus centers by means of their excitation. This phenomenon may be considered as a self-regulatory physiologic mechanism of the adaptive character. The analysis of the spectral power of R-R intervals may be considered as a sensitive method for the detection of the magnitolabile persons.

  20. Comparative genetic screens in human cells reveal new regulatory mechanisms in WNT signaling

    PubMed Central

    Lebensohn, Andres M; Dubey, Ramin; Neitzel, Leif R; Tacchelly-Benites, Ofelia; Yang, Eungi; Marceau, Caleb D; Davis, Eric M; Patel, Bhaven B; Bahrami-Nejad, Zahra; Travaglini, Kyle J; Ahmed, Yashi; Lee, Ethan; Carette, Jan E; Rohatgi, Rajat

    2016-01-01

    The comprehensive understanding of cellular signaling pathways remains a challenge due to multiple layers of regulation that may become evident only when the pathway is probed at different levels or critical nodes are eliminated. To discover regulatory mechanisms in canonical WNT signaling, we conducted a systematic forward genetic analysis through reporter-based screens in haploid human cells. Comparison of screens for negative, attenuating and positive regulators of WNT signaling, mediators of R-spondin-dependent signaling and suppressors of constitutive signaling induced by loss of the tumor suppressor adenomatous polyposis coli or casein kinase 1α uncovered new regulatory features at most levels of the pathway. These include a requirement for the transcription factor AP-4, a role for the DAX domain of AXIN2 in controlling β-catenin transcriptional activity, a contribution of glycophosphatidylinositol anchor biosynthesis and glypicans to R-spondin-potentiated WNT signaling, and two different mechanisms that regulate signaling when distinct components of the β-catenin destruction complex are lost. The conceptual and methodological framework we describe should enable the comprehensive understanding of other signaling systems. DOI: http://dx.doi.org/10.7554/eLife.21459.001 PMID:27996937

  1. Studies on the regulatory mechanism of isocitrate dehydrogenase 2 using acetylation mimics.

    PubMed

    Xu, Yuqun; Liu, Lingwen; Nakamura, Akira; Someya, Shinichi; Miyakawa, Takuya; Tanokura, Masaru

    2017-08-29

    Mitochondrial isocitrate dehydrogenase 2 (IDH2) converts NADP(+) to NADPH and promotes regeneration of reduced glutathione (GSH) by supplying NADPH to glutathione reductase or thioredoxin reductase. We have previously shown that under calorie restriction, mitochondrial deacetylase Sirt3 deacetylates and activates IDH2, thereby regulating the mitochondrial glutathione antioxidant defense system in mice. To investigate the regulatory mechanism of mIDH2 (mouse mitochondrial IDH2), we used lysine-to-glutamine (KQ) mutants to mimic acetylated lysines and screened 15 KQ mutants. Among these mutants, the activities of the K256Q and K413Q proteins were less than 50% of the wild-type value. We then solved the crystal structures of the wild-type mIDH2 and the K256Q mutant proteins, revealing conformational changes in the substrate-binding pocket. Structural data suggested that positively charged Lys256 was important in stabilizing the pocket because it repelled a lysine cluster on the other side. Glutamine (or acetylated lysine) was neutral and thus caused the pocket size to decrease, which might be the main reason for the lower activity of the K256Q mutant. Together, our data provide the first structure of an acetylation mimic of mIDH2 and new insights into the regulatory mechanism of acetylation of mIDH2.

  2. Anti-Sigma Factors in E. coli: Common Regulatory Mechanisms Controlling Sigma Factors Availability

    PubMed Central

    Treviño-Quintanilla, Luis Gerardo; Freyre-González, Julio Augusto; Martínez-Flores, Irma

    2013-01-01

    In bacteria, transcriptional regulation is a key step in cellular gene expression. All bacteria contain a core RNA polymerase that is catalytically competent but requires an additional σ factor for specific promoter recognition and correct transcriptional initiation. The RNAP core is not able to selectively bind to a given σ factor. In contrast, different σ factors have different affinities for the RNAP core. As a consequence, the concentration of alternate σ factors requires strict regulation in order to properly control the delicate interplay among them, which favors the competence for the RNAP core. This control is archived by different σ/anti-σ controlling mechanisms that shape complex regulatory networks and cascades, and enable the response to sudden environmental cues, whose global understanding is a current challenge for systems biology. Although there have been a number of excellent studies on each of these σ/anti-σ post-transcriptional regulatory systems, no comprehensive comparison of these mechanisms in a single model organism has been conducted. Here, we survey all these systems in E. coli dissecting and analyzing their inner workings and highlightin their differences. Then, following an integral approach, we identify their commonalities and outline some of the principles exploited by the cell to effectively and globally reprogram the transcriptional machinery. These principles provide guidelines for developing biological synthetic circuits enabling an efficient and robust response to sudden stimuli. PMID:24396271

  3. Transancestral fine-mapping of four type 2 diabetes susceptibility loci highlights potential causal regulatory mechanisms.

    PubMed

    Horikoshi, Momoko; Pasquali, Lorenzo; Wiltshire, Steven; Huyghe, Jeroen R; Mahajan, Anubha; Asimit, Jennifer L; Ferreira, Teresa; Locke, Adam E; Robertson, Neil R; Wang, Xu; Sim, Xueling; Fujita, Hayato; Hara, Kazuo; Young, Robin; Zhang, Weihua; Choi, Sungkyoung; Chen, Han; Kaur, Ismeet; Takeuchi, Fumihiko; Fontanillas, Pierre; Thuillier, Dorothée; Yengo, Loic; Below, Jennifer E; Tam, Claudia H T; Wu, Ying; Abecasis, Gonçalo; Altshuler, David; Bell, Graeme I; Blangero, John; Burtt, Noél P; Duggirala, Ravindranath; Florez, Jose C; Hanis, Craig L; Seielstad, Mark; Atzmon, Gil; Chan, Juliana C N; Ma, Ronald C W; Froguel, Philippe; Wilson, James G; Bharadwaj, Dwaipayan; Dupuis, Josee; Meigs, James B; Cho, Yoon Shin; Park, Taesung; Kooner, Jaspal S; Chambers, John C; Saleheen, Danish; Kadowaki, Takashi; Tai, E Shyong; Mohlke, Karen L; Cox, Nancy J; Ferrer, Jorge; Zeggini, Eleftheria; Kato, Norihiro; Teo, Yik Ying; Boehnke, Michael; McCarthy, Mark I; Morris, Andrew P

    2016-05-15

    To gain insight into potential regulatory mechanisms through which the effects of variants at four established type 2 diabetes (T2D) susceptibility loci (CDKAL1, CDKN2A-B, IGF2BP2 and KCNQ1) are mediated, we undertook transancestral fine-mapping in 22 086 cases and 42 539 controls of East Asian, European, South Asian, African American and Mexican American descent. Through high-density imputation and conditional analyses, we identified seven distinct association signals at these four loci, each with allelic effects on T2D susceptibility that were homogenous across ancestry groups. By leveraging differences in the structure of linkage disequilibrium between diverse populations, and increased sample size, we localised the variants most likely to drive each distinct association signal. We demonstrated that integration of these genetic fine-mapping data with genomic annotation can highlight potential causal regulatory elements in T2D-relevant tissues. These analyses provide insight into the mechanisms through which T2D association signals are mediated, and suggest future routes to understanding the biology of specific disease susceptibility loci. © The Author 2016. Published by Oxford University Press.

  4. Transancestral fine-mapping of four type 2 diabetes susceptibility loci highlights potential causal regulatory mechanisms

    PubMed Central

    Horikoshi, Momoko; Pasquali, Lorenzo; Wiltshire, Steven; Huyghe, Jeroen R.; Mahajan, Anubha; Asimit, Jennifer L.; Ferreira, Teresa; Locke, Adam E.; Robertson, Neil R.; Wang, Xu; Sim, Xueling; Fujita, Hayato; Hara, Kazuo; Young, Robin; Zhang, Weihua; Choi, Sungkyoung; Chen, Han; Kaur, Ismeet; Takeuchi, Fumihiko; Fontanillas, Pierre; Thuillier, Dorothée; Yengo, Loic; Below, Jennifer E.; Tam, Claudia H.T.; Wu, Ying; Abecasis, Gonçalo; Altshuler, David; Bell, Graeme I.; Blangero, John; Burtt, Noél P.; Duggirala, Ravindranath; Florez, Jose C.; Hanis, Craig L.; Seielstad, Mark; Atzmon, Gil; Chan, Juliana C.N.; Ma, Ronald C.W.; Froguel, Philippe; Wilson, James G.; Bharadwaj, Dwaipayan; Dupuis, Josee; Meigs, James B.; Cho, Yoon Shin; Park, Taesung; Kooner, Jaspal S.; Chambers, John C.; Saleheen, Danish; Kadowaki, Takashi; Tai, E. Shyong; Mohlke, Karen L.; Cox, Nancy J.; Ferrer, Jorge; Zeggini, Eleftheria; Kato, Norihiro; Teo, Yik Ying; Boehnke, Michael; McCarthy, Mark I.; Morris, Andrew P.

    2016-01-01

    To gain insight into potential regulatory mechanisms through which the effects of variants at four established type 2 diabetes (T2D) susceptibility loci (CDKAL1, CDKN2A-B, IGF2BP2 and KCNQ1) are mediated, we undertook transancestral fine-mapping in 22 086 cases and 42 539 controls of East Asian, European, South Asian, African American and Mexican American descent. Through high-density imputation and conditional analyses, we identified seven distinct association signals at these four loci, each with allelic effects on T2D susceptibility that were homogenous across ancestry groups. By leveraging differences in the structure of linkage disequilibrium between diverse populations, and increased sample size, we localised the variants most likely to drive each distinct association signal. We demonstrated that integration of these genetic fine-mapping data with genomic annotation can highlight potential causal regulatory elements in T2D-relevant tissues. These analyses provide insight into the mechanisms through which T2D association signals are mediated, and suggest future routes to understanding the biology of specific disease susceptibility loci. PMID:26911676

  5. Anti-Sigma Factors in E. coli: Common Regulatory Mechanisms Controlling Sigma Factors Availability.

    PubMed

    Treviño-Quintanilla, Luis Gerardo; Freyre-González, Julio Augusto; Martínez-Flores, Irma

    2013-09-01

    In bacteria, transcriptional regulation is a key step in cellular gene expression. All bacteria contain a core RNA polymerase that is catalytically competent but requires an additional σ factor for specific promoter recognition and correct transcriptional initiation. The RNAP core is not able to selectively bind to a given σ factor. In contrast, different σ factors have different affinities for the RNAP core. As a consequence, the concentration of alternate σ factors requires strict regulation in order to properly control the delicate interplay among them, which favors the competence for the RNAP core. This control is archived by different σ/anti-σ controlling mechanisms that shape complex regulatory networks and cascades, and enable the response to sudden environmental cues, whose global understanding is a current challenge for systems biology. Although there have been a number of excellent studies on each of these σ/anti-σ post-transcriptional regulatory systems, no comprehensive comparison of these mechanisms in a single model organism has been conducted. Here, we survey all these systems in E. coli dissecting and analyzing their inner workings and highlightin their differences. Then, following an integral approach, we identify their commonalities and outline some of the principles exploited by the cell to effectively and globally reprogram the transcriptional machinery. These principles provide guidelines for developing biological synthetic circuits enabling an efficient and robust response to sudden stimuli.

  6. Regulatory RNAs and control of epigenetic mechanisms: expectations for cognition and cognitive dysfunction

    PubMed Central

    Butler, Anderson A; Webb, William M; Lubin, Farah D

    2016-01-01

    The diverse functions of noncoding RNAs (ncRNAs) can influence virtually every aspect of the transcriptional process including epigenetic regulation of genes. In the CNS, regulatory RNA networks and epigenetic mechanisms have broad relevance to gene transcription changes involved in long-term memory formation and cognition. Thus, it is becoming increasingly clear that multiple classes of ncRNAs impact neuronal development, neuroplasticity, and cognition. Currently, a large gap exists in our knowledge of how ncRNAs facilitate epigenetic processes, and how this phenomenon affects cognitive function. In this review, we discuss recent findings highlighting a provocative role for ncRNAs including lncRNAs and piRNAs in the control of epigenetic mechanisms involved in cognitive function. Furthermore, we discuss the putative roles for these ncRNAs in cognitive disorders such as schizophrenia and Alzheimer's disease. PMID:26366811

  7. Transcription factor abundance controlled by an auto-regulatory mechanism involving a transcription start site switch.

    PubMed

    Ngondo, Richard Patryk; Carbon, Philippe

    2014-02-01

    A transcriptional feedback loop is the simplest and most direct means for a transcription factor to provide an increased stability of gene expression. In this work performed in human cells, we reveal a new negative auto-regulatory mechanism involving an alternative transcription start site (TSS) usage. Using the activating transcription factor ZNF143 as a model, we show that the ZNF143 low-affinity binding sites, located downstream of its canonical TSS, play the role of protein sensors to induce the up- or down-regulation of ZNF143 gene expression. We uncovered that the TSS switch that mediates this regulation implies the differential expression of two transcripts with an opposite protein production ability due to their different 5' untranslated regions. Moreover, our analysis of the ENCODE data suggests that this mechanism could be used by other transcription factors to rapidly respond to their own aberrant expression level.

  8. An atlas of gene regulatory networks reveals multiple three-gene mechanisms for interpreting morphogen gradients

    PubMed Central

    Cotterell, James; Sharpe, James

    2010-01-01

    The interpretation of morphogen gradients is a pivotal concept in developmental biology, and several mechanisms have been proposed to explain how gene regulatory networks (GRNs) achieve concentration-dependent responses. However, the number of different mechanisms that may exist for cells to interpret morphogens, and the importance of design features such as feedback or local cell–cell communication, is unclear. A complete understanding of such systems will require going beyond a case-by-case analysis of real morphogen interpretation mechanisms and mapping out a complete GRN ‘design space.' Here, we generate a first atlas of design space for GRNs capable of patterning a homogeneous field of cells into discrete gene expression domains by interpreting a fixed morphogen gradient. We uncover multiple very distinct mechanisms distributed discretely across the atlas, thereby expanding the repertoire of morphogen interpretation network motifs. Analyzing this diverse collection of mechanisms also allows us to predict that local cell–cell communication will rarely be responsible for the basic dose-dependent response of morphogen interpretation networks. PMID:21045819

  9. Comparative genomic analysis of NAC transcriptional factors to dissect the regulatory mechanisms for cell wall biosynthesis.

    PubMed

    Yao, Dongxia; Wei, Qiang; Xu, Wenying; Syrenne, Ryan D; Yuan, Joshua S; Su, Zhen

    2012-01-01

    evolution and the gene regulatory network of a subgroup of the NAC gene family controlling cell wall composition through bioinformatics data mining and bench validation. Our work might benefit to elucidate the possible molecular mechanism underlying the regulation network of secondary cell wall biosynthesis.

  10. The nature and mechanisms of DN regulatory T-cell mediated suppression.

    PubMed

    Young, Kevin J; Zhang, Li

    2002-10-01

    Regulatory T cells have been reported to enhance survival of transplanted allografts. We have recently identified and cloned a novel CD3(+)CD4(-)CD8(-) (double negative, DN) regulatory T cell from mice that were given a single class I mismatched donor lymphocyte infusion and permanently accepted donor-specific skin allografts. When infused into naïve syngeneic mice, these DN T cells prolonged the survival of class I mismatched donor skin allografts. Here we further characterize the nature and mechanism of DN T-cell mediated suppression. This present study reveals that DN T cells are able to specifically eliminate activated syngeneic CD8(+) T cells that share the same T cell receptor (TCR) specificity as DN T cells in vitro. Similarly, we found that, along with an increase of recipient DN T cells in the peripheral blood, anti-donor CD8(+) T cells were also eliminated in vivo following a donor lymphocyte infusion. We further demonstrate that DN T regulatory cells do not mediate suppression by competition for growth factors or antigen presenting cells (APC) nor by modulation of APC, but require cell contact with the activated target CD8(+) T cells. This contact can be mediated either by the TCR on CD8(+) T cells that recognize constitutively expressed or acquired MHC molecules on DN T cells, or by the TCR on DN T cells that recognize constitutively expressed MHC molecules on CD8(+) T cells. Together, these data extend our previous findings, and expand the conditions in which DN T cells can potentially be used to specifically suppress allogeneic immune responses.

  11. Molecular mechanism underlying the regulatory specificity of a Drosophila homeodomain protein that specifies myoblast identity

    PubMed Central

    Busser, Brian W.; Shokri, Leila; Jaeger, Savina A.; Gisselbrecht, Stephen S.; Singhania, Aditi; Berger, Michael F.; Zhou, Bo; Bulyk, Martha L.; Michelson, Alan M.

    2012-01-01

    A subfamily of Drosophila homeodomain (HD) transcription factors (TFs) controls the identities of individual muscle founder cells (FCs). However, the molecular mechanisms by which these TFs generate unique FC genetic programs remain unknown. To investigate this problem, we first applied genome-wide mRNA expression profiling to identify genes that are activated or repressed by the muscle HD TFs Slouch (Slou) and Muscle segment homeobox (Msh). Next, we used protein-binding microarrays to define the sequences that are bound by Slou, Msh and other HD TFs that have mesodermal expression. These studies revealed that a large class of HDs, including Slou and Msh, predominantly recognize TAAT core sequences but that each HD also binds to unique sites that deviate from this canonical motif. To understand better the regulatory specificity of an individual FC identity HD, we evaluated the functions of atypical binding sites that are preferentially bound by Slou relative to other HDs within muscle enhancers that are either activated or repressed by this TF. These studies showed that Slou regulates the activities of particular myoblast enhancers through Slou-preferred sequences, whereas swapping these sequences for sites that are capable of binding to multiple HD family members does not support the normal regulatory functions of Slou. Moreover, atypical Slou-binding sites are overrepresented in putative enhancers associated with additional Slou-responsive FC genes. Collectively, these studies provide new insights into the roles of individual HD TFs in determining cellular identity, and suggest that the diversity of HD binding preferences can confer regulatory specificity. PMID:22296846

  12. Innovation of a Regulatory Mechanism Modulating Semi-determinate Stem Growth through Artificial Selection in Soybean

    PubMed Central

    Ping, Jieqing; Li, Shuai; Chen, Zhixiang; Ma, Jianxin

    2016-01-01

    It has been demonstrated that Terminal Flowering 1 (TFL1) in Arabidopsis and its functional orthologs in other plants specify indeterminate stem growth through their specific expression that represses floral identity genes in shoot apical meristems (SAMs), and that the loss-of-function mutations at these functional counterparts result in the transition of SAMs from the vegetative to reproductive state that is essential for initiation of terminal flowering and thus formation of determinate stems. However, little is known regarding how semi-determinate stems, which produce terminal racemes similar to those observed in determinate plants, are specified in any flowering plants. Here we show that semi-determinacy in soybean is modulated by transcriptional repression of Dt1, the functional ortholog of TFL1, in SAMs. Such repression is fulfilled by recently enabled spatiotemporal expression of Dt2, an ancestral form of the APETALA1/FRUITFULL orthologs, which encodes a MADS-box factor directly binding to the regulatory sequence of Dt1. In addition, Dt2 triggers co-expression of the putative SUPPRESSOR OF OVEREXPRESSION OF CONSTANS 1 (GmSOC1) in SAMs, where GmSOC1 interacts with Dt2, and also directly binds to the Dt1 regulatory sequence. Heterologous expression of Dt2 and Dt1 in determinate (tfl1) Arabidopsis mutants enables creation of semi-determinacy, but the same forms of the two genes in the tfl1 and soc1 background produce indeterminate stems, suggesting that Dt2 and SOC1 both are essential for transcriptional repression of Dt1. Nevertheless, the expression of Dt2 is unable to repress TFL1 in Arabidopsis, further demonstrating the evolutionary novelty of the regulatory mechanism underlying stem growth in soybean. PMID:26807727

  13. Regulatory Mechanisms Underlying the Expression of Prolactin Receptor in Chicken Granulosa Cells

    PubMed Central

    Hu, Shenqiang; Duggavathi, Raj; Zadworny, David

    2017-01-01

    Prolactin (PRL) has both pro- and anti-gonadal roles in the regulation of avian ovarian functions through its interaction with the receptor (PRLR). However, neither the pattern of expression of PRLR nor its regulatory mechanisms during follicle development have been clearly defined. The objective of the present study was to investigate mechanisms of PRLR expression in chicken granulosa cells. Levels of PRLR transcript were highest in the stroma and walls of follicles < 2 mm in diameter and progressively declined with the maturation of follicles. In preovulatory follicles, PRLR was expressed at higher levels in granulosa than theca layers. FSH exerted the greatest stimulatory effect on PRLR and StAR expression in cultured granulosa cells of the 6–8 mm follicles but this effect declined as follicles matured to F1. In contrast, LH did not alter the expression of PRLR in granulosa cells of all follicular classes but increased levels of StAR in F2 and F1 granulosa cells. Both non-glycosylated- (NG-) and glycosylated- (G-) PRL upregulated basal PRLR expression in granulosa cells of the 6–8 mm, F3 or F1 follicles but had little effect in F2 follicles. Furthermore, FSH-stimulated PRLR expression was reduced by the addition of either isoform of PRL especially in F2 granulosa cells. These results indicate that PRLR is differentially distributed and regulated by FSH or PRL variants independently or in combination in the follicular hierarchy. By using activators and inhibitors, we further demonstrated that multiple signaling pathways, including PKA, PKC, PI3K, mTOR and AMPK, are not only directly involved in, but they can also converge to modulate ERK2 activity to regulate FSH-mediated PRLR and StAR expression in undifferentiated granulosa cells. These data provide new insights into the regulatory mechanisms controlling the expression of PRLR in granulosa cells. PMID:28107515

  14. Putting theory to the test: which regulatory mechanisms can drive realistic growth of a root?

    PubMed

    De Vos, Dirk; Vissenberg, Kris; Broeckhove, Jan; Beemster, Gerrit T S

    2014-10-01

    In recent years there has been a strong development of computational approaches to mechanistically understand organ growth regulation in plants. In this study, simulation methods were used to explore which regulatory mechanisms can lead to realistic output at the cell and whole organ scale and which other possibilities must be discarded as they result in cellular patterns and kinematic characteristics that are not consistent with experimental observations for the Arabidopsis thaliana primary root. To aid in this analysis, a 'Uniform Longitudinal Strain Rule' (ULSR) was formulated as a necessary condition for stable, unidirectional, symplastic growth. Our simulations indicate that symplastic structures are robust to differences in longitudinal strain rates along the growth axis only if these differences are small and short-lived. Whereas simple cell-autonomous regulatory rules based on counters and timers can produce stable growth, it was found that steady developmental zones and smooth transitions in cell lengths are not feasible. By introducing spatial cues into growth regulation, those inadequacies could be avoided and experimental data could be faithfully reproduced. Nevertheless, a root growth model based on previous polar auxin-transport mechanisms violates the proposed ULSR due to the presence of lateral gradients. Models with layer-specific regulation or layer-driven growth offer potential solutions. Alternatively, a model representing the known cross-talk between auxin, as the cell proliferation promoting factor, and cytokinin, as the cell differentiation promoting factor, predicts the effect of hormone-perturbations on meristem size. By down-regulating PIN-mediated transport through the transcription factor SHY2, cytokinin effectively flattens the lateral auxin gradient, at the basal boundary of the division zone, (thereby imposing the ULSR) to signal the exit of proliferation and start of elongation. This model exploration underlines the value of

  15. Putting Theory to the Test: Which Regulatory Mechanisms Can Drive Realistic Growth of a Root?

    PubMed Central

    De Vos, Dirk; Vissenberg, Kris; Broeckhove, Jan; Beemster, Gerrit T. S.

    2014-01-01

    In recent years there has been a strong development of computational approaches to mechanistically understand organ growth regulation in plants. In this study, simulation methods were used to explore which regulatory mechanisms can lead to realistic output at the cell and whole organ scale and which other possibilities must be discarded as they result in cellular patterns and kinematic characteristics that are not consistent with experimental observations for the Arabidopsis thaliana primary root. To aid in this analysis, a ‘Uniform Longitudinal Strain Rule’ (ULSR) was formulated as a necessary condition for stable, unidirectional, symplastic growth. Our simulations indicate that symplastic structures are robust to differences in longitudinal strain rates along the growth axis only if these differences are small and short-lived. Whereas simple cell-autonomous regulatory rules based on counters and timers can produce stable growth, it was found that steady developmental zones and smooth transitions in cell lengths are not feasible. By introducing spatial cues into growth regulation, those inadequacies could be avoided and experimental data could be faithfully reproduced. Nevertheless, a root growth model based on previous polar auxin-transport mechanisms violates the proposed ULSR due to the presence of lateral gradients. Models with layer-specific regulation or layer-driven growth offer potential solutions. Alternatively, a model representing the known cross-talk between auxin, as the cell proliferation promoting factor, and cytokinin, as the cell differentiation promoting factor, predicts the effect of hormone-perturbations on meristem size. By down-regulating PIN-mediated transport through the transcription factor SHY2, cytokinin effectively flattens the lateral auxin gradient, at the basal boundary of the division zone, (thereby imposing the ULSR) to signal the exit of proliferation and start of elongation. This model exploration underlines the value of

  16. Regulatory mechanisms of metabolic flexibility in the dark-eyed junco (Junco hyemalis).

    PubMed

    Stager, Maria; Swanson, David L; Cheviron, Zachary A

    2015-03-01

    Small temperate birds reversibly modify their aerobic performance to maintain thermoregulatory homeostasis under seasonally changing environmental conditions and these physiological adjustments may be attributable to changes in the expression of genes in the underlying regulatory networks. Here, we report the results of an experimental procedure designed to gain insight into the fundamental mechanisms of metabolic flexibility in the dark-eyed junco (Junco hyemalis). We combined genomic transcriptional profiles with measures of metabolic enzyme activities and whole-animal thermogenic performance from juncos exposed to four 6-week acclimation treatments that varied in temperature (cold, 3°C; warm, 24°C) and photoperiod (short day, 8 h light:16 h dark; long day, 16 h light:8 h dark). Cold-acclimated birds increased thermogenic capacity compared with warm-acclimated birds, and this enhanced performance was associated with upregulation of genes involved in muscle hypertrophy, angiogenesis, and lipid transport and oxidation, as well as with catabolic enzyme activities. These physiological changes occurred over ecologically relevant timescales, suggesting that birds make regulatory adjustments to interacting, hierarchical pathways in order to seasonally enhance thermogenic capacity.

  17. Visual- and Vestibular-Autonomic Influence on Short-Term Cardiovascular Regulatory Mechanisms

    NASA Technical Reports Server (NTRS)

    Mullen, Thomas J.; Ramsdell, Craig D.

    1999-01-01

    This synergy project was a one-year effort conducted cooperatively by members of the NSBRI Cardiovascular Alterations and Neurovestibular Adaptation Teams in collaboration with NASA Johnson Space Center (JSC) colleagues. The objective of this study was to evaluate visual autonomic interactions on short-term cardiovascular regulatory mechanisms. Based on established visual-vestibular and vestibular-autonomic shared neural pathways, we hypothesized that visually induced changes in orientation will trigger autonomic cardiovascular reflexes. A second objective was to compare baroreflex changes during postural changes as measured with the new Cardiovascular System Identification (CSI) technique with those measured using a neck barocuff. While the neck barocuff stimulates only the carotid baroreceptors, CSI provides a measure of overall baroreflex responsiveness. This study involved a repeated measures design with 16 healthy human subjects (8 M, 8 F) to examine cardiovascular regulatory responses during actual and virtual head-upright tilts. Baroreflex sensitivity was first evaluated with subjects in supine and upright positions during actual tilt-table testing using both neck barocuff and CSI methods. The responses to actual tilts during this first session were then compared to responses during visually induced tilt and/or rotation obtained during a second session.

  18. Global analysis of p53-regulated transcription identifies its direct targets and unexpected regulatory mechanisms

    PubMed Central

    Allen, Mary Ann; Andrysik, Zdenek; Dengler, Veronica L; Mellert, Hestia S; Guarnieri, Anna; Freeman, Justin A; Sullivan, Kelly D; Galbraith, Matthew D; Luo, Xin; Kraus, W Lee; Dowell, Robin D; Espinosa, Joaquin M

    2014-01-01

    The p53 transcription factor is a potent suppressor of tumor growth. We report here an analysis of its direct transcriptional program using Global Run-On sequencing (GRO-seq). Shortly after MDM2 inhibition by Nutlin-3, low levels of p53 rapidly activate ∼200 genes, most of them not previously established as direct targets. This immediate response involves all canonical p53 effector pathways, including apoptosis. Comparative global analysis of RNA synthesis vs steady state levels revealed that microarray profiling fails to identify low abundance transcripts directly activated by p53. Interestingly, p53 represses a subset of its activation targets before MDM2 inhibition. GRO-seq uncovered a plethora of gene-specific regulatory features affecting key survival and apoptotic genes within the p53 network. p53 regulates hundreds of enhancer-derived RNAs. Strikingly, direct p53 targets harbor pre-activated enhancers highly transcribed in p53 null cells. Altogether, these results enable the study of many uncharacterized p53 target genes and unexpected regulatory mechanisms. DOI: http://dx.doi.org/10.7554/eLife.02200.001 PMID:24867637

  19. Use of lactobacilli and their pheromone-based regulatory mechanism in gene expression and drug delivery.

    PubMed

    Diep, D B; Mathiesen, G; Eijsink, V G H; Nes, I F

    2009-01-01

    Lactobacilli are common microorganisms in diverse vegetables and meat products and several of these are also indigenous inhabitants in the gastro-intestinal (GI) tract of humans and animals where they are believed to have health promoting effects on the host. One of the highly appreciated probiotic effects is their ability to inhibit the growth of pathogens by producing antimicrobial peptides, so-called bacteriocins. Production of some bacteriocins has been shown to be strictly regulated through a quorum-sensing based mechanism mediated by a secreted peptide-pheromone (also called induction peptide; IP), a membrane-located sensor (histidine protein kinase; HPK) and a cytoplasmic response regulator (RR). The interaction between an IP and its sensor, which is highly specific, leads to activation of the cognate RR which in turn binds to regulated promoters and activates gene expression. The HPKs and RRs are built up by conserved modules, and the signalling between them within a network is efficient and directional, and can easily be activated by exogenously added synthetic IPs. Consequently, components from such regulatory networks have successfully been exploited in construction of a number of inducible gene expression systems. In this review, we discuss some well-characterised quorum sensing networks involved in bacteriocin production in lactobacilli, with special focus on the use of the regulatory components in gene expression and on lactobacilli as potential delivery vehicle for therapeutic and vaccine purposes.

  20. Visual- and Vestibular-Autonomic Influence on Short-Term Cardiovascular Regulatory Mechanisms

    NASA Technical Reports Server (NTRS)

    Mullen, Thomas J.; Ramsdell, Craig D.

    1999-01-01

    This synergy project was a one-year effort conducted cooperatively by members of the NSBRI Cardiovascular Alterations and Neurovestibular Adaptation Teams in collaboration with NASA Johnson Space Center (JSC) colleagues. The objective of this study was to evaluate visual autonomic interactions on short-term cardiovascular regulatory mechanisms. Based on established visual-vestibular and vestibular-autonomic shared neural pathways, we hypothesized that visually induced changes in orientation will trigger autonomic cardiovascular reflexes. A second objective was to compare baroreflex changes during postural changes as measured with the new Cardiovascular System Identification (CSI) technique with those measured using a neck barocuff. While the neck barocuff stimulates only the carotid baroreceptors, CSI provides a measure of overall baroreflex responsiveness. This study involved a repeated measures design with 16 healthy human subjects (8 M, 8 F) to examine cardiovascular regulatory responses during actual and virtual head-upright tilts. Baroreflex sensitivity was first evaluated with subjects in supine and upright positions during actual tilt-table testing using both neck barocuff and CSI methods. The responses to actual tilts during this first session were then compared to responses during visually induced tilt and/or rotation obtained during a second session.

  1. A systems biology approach to defining regulatory mechanisms for cartilage and tendon cell phenotypes

    PubMed Central

    Mueller, A. J.; Tew, S. R.; Vasieva, O.; Clegg, P. D.; Canty-Laird, E. G.

    2016-01-01

    Phenotypic plasticity of adult somatic cells has provided emerging avenues for the development of regenerative therapeutics. In musculoskeletal biology the mechanistic regulatory networks of genes governing the phenotypic plasticity of cartilage and tendon cells has not been considered systematically. Additionally, a lack of strategies to effectively reproduce in vitro functional models of cartilage and tendon is retarding progress in this field. De- and redifferentiation represent phenotypic transitions that may contribute to loss of function in ageing musculoskeletal tissues. Applying a systems biology network analysis approach to global gene expression profiles derived from common in vitro culture systems (monolayer and three-dimensional cultures) this study demonstrates common regulatory mechanisms governing de- and redifferentiation transitions in cartilage and tendon cells. Furthermore, evidence of convergence of gene expression profiles during monolayer expansion of cartilage and tendon cells, and the expression of key developmental markers, challenges the physiological relevance of this culture system. The study also suggests that oxidative stress and PI3K signalling pathways are key modulators of in vitro phenotypes for cells of musculoskeletal origin. PMID:27670352

  2. Peripheral circadian rhythms and their regulatory mechanism in insects and some other arthropods: a review.

    PubMed

    Tomioka, Kenji; Uryu, Outa; Kamae, Yuichi; Umezaki, Yujiro; Yoshii, Taishi

    2012-08-01

    Many physiological functions of insects show a rhythmic change to adapt to daily environmental cycles. These rhythms are controlled by a multi-clock system. A principal clock located in the brain usually organizes the overall behavioral rhythms, so that it is called the "central clock". However, the rhythms observed in a variety of peripheral tissues are often driven by clocks that reside in those tissues. Such autonomous rhythms can be found in sensory organs, digestive and reproductive systems. Using Drosophila melanogaster as a model organism, researchers have revealed that the peripheral clocks are self-sustained oscillators with a molecular machinery slightly different from that of the central clock. However, individual clocks normally run in harmony with each other to keep a coordinated temporal structure within an animal. How can this be achieved? What is the molecular mechanism underlying the oscillation? Also how are the peripheral clocks entrained by light-dark cycles? There are still many questions remaining in this research field. In the last several years, molecular techniques have become available in non-model insects so that the molecular oscillatory mechanisms are comparatively investigated among different insects, which give us more hints to understand the essential regulatory mechanism of the multi-oscillatory system across insects and other arthropods. Here we review current knowledge on arthropod's peripheral clocks and discuss their physiological roles and molecular mechanisms.

  3. Regulatory mechanisms of nitric oxide and reactive oxygen species generation and their role in plant immunity.

    PubMed

    Yoshioka, Hirofumi; Mase, Keisuke; Yoshioka, Miki; Kobayashi, Michie; Asai, Shuta

    2011-08-01

    Rapid production of nitric oxide (NO) and reactive oxygen species (ROS) has been implicated in diverse physiological processes, such as programmed cell death, development, cell elongation and hormonal signaling, in plants. Much attention has been paid to the regulation of plant innate immunity by these signal molecules. Recent studies provide evidence that an NADPH oxidase, respiratory burst oxidase homolog, is responsible for pathogen-responsive ROS burst. However, we still do not know about NO-producing enzymes, except for nitrate reductase, although many studies suggest the existence of NO synthase-like activity responsible for NO burst in plants. Here, we introduce regulatory mechanisms of NO and ROS bursts by mitogen-activated protein kinase cascades, calcium-dependent protein kinase or riboflavin and its derivatives, flavin mononucleotide and flavin adenine dinucleotide, and we discuss the roles of the bursts in defense responses against plant pathogens.

  4. The Regulatory Mechanisms of Tumor Suppressor P16INK4A and Relevance to Cancer†

    PubMed Central

    Li, Junan; Poi, Ming Jye; Tsai, Ming-Daw

    2011-01-01

    P16INK4A (also known as P16 and MTS1), a protein consisting exclusively of four ankyrin repeats, is recognized as a tumor suppressor mainly due to the prevalence of genetic inactivation of the p16INK4A (or CDKN2A) gene in virtually all types of human cancers. However, it has also been shown that elevated expression (up-regulation) of P16 is involved in cellular senescence, aging, and cancer progression, indicating that the regulation of P16 is critical for its function. Here, we discuss the regulatory mechanisms of P16 function at the DNA level, the transcription level, and the posttranscriptional level, as well as their implications in the structure-function relationship of P16 and in human cancers. PMID:21619050

  5. Mechanistic Basis for Plant Responses to Drought Stress : Regulatory Mechanism of Abscisic Acid Signaling

    NASA Astrophysics Data System (ADS)

    Miyakawa, Takuya; Tanokura, Masaru

    The phytohormone abscisic acid (ABA) plays a key role in the rapid adaptation of plants to environmental stresses such as drought and high salinity. Accumulated ABA in plant cells promotes stomatal closure in guard cells and transcription of stress-tolerant genes. Our understanding of ABA responses dramatically improved by the discovery of both PYR/PYL/RCAR as a soluble ABA receptor and inhibitory complex of a protein phospatase PP2C and a protein kinase SnRK2. Moreover, several structural analyses of PYR/PYL/RCAR revealed the mechanistic basis for the regulatory mechanism of ABA signaling, which provides a rational framework for the design of alternative agonists in future.

  6. Regulatory mechanisms of tumor suppressor P16(INK4A) and their relevance to cancer.

    PubMed

    Li, Junan; Poi, Ming Jye; Tsai, Ming-Daw

    2011-06-28

    P16(INK4A) (also known as P16 and MTS1), a protein consisting exclusively of four ankyrin repeats, is recognized as a tumor suppressor mainly because of the prevalence of genetic inactivation of the p16(INK4A) (or CDKN2A) gene in virtually all types of human cancers. However, it has also been shown that an elevated level of expression (upregulation) of P16 is involved in cellular senescence, aging, and cancer progression, indicating that the regulation of P16 is critical for its function. Here, we discuss the regulatory mechanisms of P16 function at the DNA level, the transcription level, and the posttranscriptional level, as well as their implications for the structure-function relationship of P16 and for human cancers.

  7. Regulatory motifs on ISWI chromatin remodelers: molecular mechanisms and kinetic proofreading

    NASA Astrophysics Data System (ADS)

    Brysbaert, Guillaume; Lensink, Marc F.; Blossey, Ralf

    2015-02-01

    Recently, kinetic proofreading scenarios have been proposed for the regulation of chromatin remodeling, first on purely theoretical grounds (Blossey and Schiessel 2008 HFSP J. 2 167-70) and deduced from experiments on the ISWI/ACF system (Narlikar 2010 Curr. Opin. Chem. Biol. 14 660). In the kinetic proofreading scenario of chromatin remodeling, the combination of the recognition of a histone tail state and ATP-hydrolysis in the remodeler motor act together to select (i.e. proofread) a nucleosomal substrate. ISWI remodelers have recently been shown to have an additional level of regulation as they contain auto-inhibitory motifs which need to be inactivated through an interaction with the nucleosome. In this paper we show that the auto-regulatory effect enhances substrate recognition in kinetic proofreading. We further report some suggestive additional insights into the molecular mechanism underlying ISWI-autoregulation.

  8. Transcriptional control of photosynthesis genes: the evolutionarily conserved regulatory mechanism in plastid genome function.

    PubMed

    Puthiyaveetil, Sujith; Ibrahim, Iskander M; Jelicić, Branka; Tomasić, Ana; Fulgosi, Hrvoje; Allen, John F

    2010-01-01

    Chloroplast sensor kinase (CSK) is a bacterial-type sensor histidine kinase found in chloroplasts--photosynthetic plastids--in eukaryotic plants and algae. Using a yeast two-hybrid screen, we demonstrate recognition and interactions between: CSK, plastid transcription kinase (PTK), and a bacterial-type RNA polymerase sigma factor-1 (SIG-1). CSK interacts with itself, with SIG-1, and with PTK. PTK also interacts directly with SIG-1. PTK has previously been shown to catalyze phosphorylation of plastid-encoded RNA polymerase (PEP), suppressing plastid transcription nonspecifically. Phospho-PTK is inactive as a PEP kinase. Here, we propose that phospho-CSK acts as a PTK kinase, releasing PTK repression of chloroplast transcription, while CSK also acts as a SIG-1 kinase, blocking transcription specifically at the gene promoter of chloroplast photosystem I. Oxidation of the photosynthetic electron carrier plastoquinone triggers phosphorylation of CSK, inducing chloroplast photosystem II while suppressing photosystem I. CSK places photosystem gene transcription under the control of photosynthetic electron transport. This redox signaling pathway has its origin in cyanobacteria, photosynthetic prokaryotes from which chloroplasts evolved. The persistence of this mechanism in cytoplasmic organelles of photosynthetic eukaryotes is in precise agreement with the CoRR hypothesis for the function of organellar genomes: the plastid genome and its primary gene products are Co-located for Redox Regulation. Genes are retained in plastids primarily in order for their expression to be subject to this rapid and robust redox regulatory transcriptional control mechanism, whereas plastid genes also encode genetic system components, such as some ribosomal proteins and RNAs, that exist in order to support this primary, redox regulatory control of photosynthesis genes. Plastid genome function permits adaptation of the photosynthetic apparatus to changing environmental conditions of light

  9. Interplay of cis- and trans-regulatory mechanisms in the spliceosomal RNA helicase Brr2.

    PubMed

    Absmeier, Eva; Becke, Christian; Wollenhaupt, Jan; Santos, Karine F; Wahl, Markus C

    2017-01-02

    RNA helicase Brr2 is implicated in multiple phases of pre-mRNA splicing and thus requires tight regulation. Brr2 can be auto-inhibited via a large N-terminal region folding back onto its helicase core and auto-activated by a catalytically inactive C-terminal helicase cassette. Furthermore, it can be regulated in trans by the Jab1 domain of the Prp8 protein, which can inhibit Brr2 by intermittently inserting a C-terminal tail in the enzyme's RNA-binding tunnel or activate the helicase after removal of this tail. Presently it is unclear, whether these regulatory mechanisms functionally interact and to which extent they are evolutionarily conserved. Here, we report crystal structures of Saccharomyces cerevisiae and Chaetomium thermophilum Brr2-Jab1 complexes, demonstrating that Jab1-based inhibition of Brr2 presumably takes effect in all eukaryotes but is implemented via organism-specific molecular contacts. Moreover, the structures show that Brr2 auto-inhibition can act in concert with Jab1-mediated inhibition, and suggest that the N-terminal region influences how the Jab1 C-terminal tail interacts at the RNA-binding tunnel. Systematic RNA binding and unwinding studies revealed that the N-terminal region and the Jab1 C-terminal tail specifically interfere with accommodation of double-stranded and single-stranded regions of an RNA substrate, respectively, mutually reinforcing each other. Additionally, such analyses show that regulation based on the N-terminal region requires the presence of the inactive C-terminal helicase cassette. Together, our results outline an intricate system of regulatory mechanisms, which control Brr2 activities during snRNP assembly and splicing.

  10. Acute-Phase Serum Amyloid A in Osteoarthritis: Regulatory Mechanism and Proinflammatory Properties

    PubMed Central

    de Seny, Dominique; Cobraiville, Gaël; Charlier, Edith; Neuville, Sophie; Esser, Nathalie; Malaise, Denis; Malaise, Olivier; Calvo, Florence Quesada; Relic, Biserka; Malaise, Michel G.

    2013-01-01

    Objective To determine if serum amyloid A (A-SAA) could be detected in human osteoarthritic (OA) joints and further clarify if high A-SAA level in joints result from a local production or from a diffusion process from abnormally elevated plasma concentration. Regulatory mechanism of A-SAA expression and its pro-inflammatory properties were also investigated. Methods A-SAA levels in serum and synovial fluid of OA (n = 29) and rheumatoid arthritis (RA) (n = 27) patients were measured and compared to matched-healthy volunteers (HV) (n = 35). In vitro cell cultures were performed on primary joint cells provided from osteoarthritis patients. Regulatory mechanisms were studied using Western-blotting, ELISA and lentiviral transfections. Results A-SAA was statistically increased in OA plasma patients compared to HV. Moreover, A-SAA level in OA plasma and synovial fluid increased with the Kellgren & Lauwrence grade. For all OA and RA patients, A-SAA plasma level was higher and highly correlated with its corresponding level in the synovial fluid, therefore supporting that A-SAA was mainly due to the passive diffusion process from blood into the joint cavity. However, A-SAA expression was also observed in vitro under corticosteroid treatment and/or under IL-1beta stimuli. A-SAA expression was down-regulated by PPAR-γ agonists (genistein and rosiglitazone) and up-regulated by TGF-β1 through Alk1 (Smad1/5) pathway. RhSAA induced proinflammatory cytokines (IL-6, IL-8, GRO-α and MCP-1) and metalloproteinases (MMP-1, MMP-3 and MMP-13) expression in FLS and chondrocytes, which expression was downregulated by TAK242, a specific TLR4 inhibitor. Conclusion Systemic or local A-SAA expression inside OA joint cavity may play a key role in inflammatory process seen in osteoarthritis, which could be counteracted by TLR4 inhibition. PMID:23776697

  11. Restricted Autoantigen Recognition Associated With Deletional and Adaptive Regulatory Mechanisms1

    PubMed Central

    Gebe, John A.; Yue, Betty B.; Unrath, Kelly A; Falk, Ben A.; Nepom, Gerald T.

    2009-01-01

    Autoimmune diabetes (T1D) is characterized by CD4+ T cell reactivity to a variety of islet-associated antigens. At-risk individuals, genetically predisposed to T1D, often have similar T cell reactivity, but nevertheless fail to progress to clinically overt disease. In order to study the immune tolerance and regulatory environment permissive for such autoreactive T cells, we expressed TcR transgenes derived from two autoreactive human T cells, 4.13 and 164, in HLA-DR4 transgenic mice on a C57Bl/6-derived “diabetes-resistant” background. Both TcR are responsive to an immunodominant epitope of glutamic acid decarboxylase 65 (555–567), which is identical in sequence between humans and mice, is restricted by HLA-DR4, and is a naturally processed self antigen associated with T1D. Although both TcR use the identical Vα and Vβ genes, differing only in CDR3, we found stark differences in the mechanisms utilized in vivo in the maintenance of immune tolerance. A combination of thymic deletion (negative selection), TcR down-regulation, and peripheral activation-induced cell death dominated the phenotype of 164 T cells, which nevertheless still maintain their antigen responsiveness in the periphery. In contrast, 4.13 T cells are much less influenced by central and deletional tolerance mechanisms, and instead display a peripheral immune deviation including differentiation into IL-10 secreting Tr1 cells. These findings indicate a distinct set of regulatory alternatives for autoreactive T cells, even within a single highly restricted HLA-peptide-TcR recognition profile. PMID:19535636

  12. Systemic blood loss affects NF-kappa B regulatory mechanisms in the lungs.

    PubMed

    Moine, P; Shenkar, R; Kaneko, D; Le Tulzo, Y; Abraham, E

    1997-07-01

    The nuclear regulatory factor (NF)-kappa B is activated in the lungs of patients with acute respiratory distress syndrome (ARDS). In experimental models of acute lung injury, activation of NF-kappa B contributes to the increased expression of immunoregulatory cytokines and other proinflammatory mediators in the lungs. Because of the important role that NF-kappa B activation appears to play in the development of acute lung injury, we examined cytoplasmic and nuclear NF-kappa B counterregulatory mechanisms in lung mononuclear cells, using a murine model in which inflammatory lung injury develops after blood loss. Sustained activation of NF-kappa B was present in lung mononuclear cells over the 4-h period after blood loss. The activation of NF-kappa B after hemorrhage was accompanied by alterations in levels of the NF-kappa B regulatory proteins I kappa B alpha and Bcl-3. Cytoplasmic and nuclear I kappa B alpha were increased and nuclear Bcl-3 was decreased during the first hour after blood loss, but, by 4 h posthemorrhage, cytoplasmic and nuclear I kappa B alpha levels were decreased and nuclear levels of Bcl-3 were increased. Inhibition of xanthine oxidase activity in otherwise unmanipulated unhemorrhaged mice resulted in increased levels of I kappa B alpha and decreased amounts of Bcl-3 in nuclear extracts from lung mononuclear cells. No changes in the levels of nuclear I kappa B alpha or Bcl-3 occurred after hemorrhage when xanthine oxidase activity was inhibited. These results demonstrate that blood loss, at least partly through xanthine oxidase-dependent mechanisms, produces alterations in the levels of both I kappa B alpha and Bcl-3 in lung mononuclear cell populations. The effects of hemorrhage on proteins that regulate activation of NF-kappa B may contribute to the frequent development of inflammatory lung injury in this setting.

  13. Distinct regulatory mechanisms of eukaryotic transcriptional activation by SAGA and TFIID

    PubMed Central

    Bhaumik, Sukesh R.

    2010-01-01

    A growing number of human diseases are linked to abnormal gene expression which is largely controlled at the level of transcriptional initiation. The gene-specific activator promotes the initiation of transcription through its interaction with one or more components of the transcriptional initiation machinery, hence leading to stimulated transcriptional initiation or activation. However, all activator proteins do not target the same component(s) of the transcriptional initiation machinery. Rather, they can have different target specificities, and thus, can lead to distinct mechanisms of transcriptional activation. Two such distinct mechanisms of transcriptional activation in yeast are mediated by the SAGA (Spt-Ada-Gcn5-Acetyltransferase) and TFIID (Transcription factor IID) complexes, and are termed as “SAGA-dependent” and “TFIID-dependent” transcriptional activation, respectively. SAGA is the target of the activator in case of SAGA-dependent transcriptional activation, while the targeting of TFIID by the activator leads to TFIID-dependent transcriptional activation. Both the SAGA and TFIID complexes are highly conserved from yeast to human, and play crucial roles in gene activation among eukaryotes. The regulatory mechanisms of eukaryotic transcriptional activation by SAGA and TFIID are discussed here. PMID:20800707

  14. The regulatory mechanisms of myogenin expression in doxorubicin-treated rat cardiomyocytes.

    PubMed

    Liu, Shu-Ting; Huang, Shih-Ming; Ho, Ching-Liang; Yen, Li-Chen; Huang, Chi-Jung; Lin, Wei-Shiang; Chan, James Yi-Hsin

    2015-11-10

    Doxorubicin, an anthracycline antibiotic, has been used as an anti-neoplastic drug for almost 60 years. However, the mechanism(s) by which anthracyclines cause irreversible myocardial injury remains unclear. In order to delineate possible molecular signals involved in the myocardial toxicity, we assessed candidate genes using mRNA expression profiling in the doxorubicin-treated rat cardiomyocyte H9c2 cell line. In the study, it was confirmed that myogenin, an important transcriptional factor for muscle terminal differentiation, was significantly reduced by doxorubicin in a dose-dependent manner using both RT-PCR and western blot analyses. Also, it was identified that the doxorubicin-reduced myogenin gene level could not be rescued by most cardio-protectants. Furthermore, it was demonstrated how the signaling of the decreased myogenin expression by doxorubicin was altered at the transcriptional, post-transcriptional and translational levels. Based on these findings, a working model was proposed for relieving doxorubicin-associated myocardial toxicity by down-regulating miR-328 expression and increasing voltage-gated calcium channel β1 expression, which is a repressor of myogenin gene regulation. In summary, this study provides several lines of evidence indicating that myogenin is the target for doxorubicin-induced cardio-toxicity and a novel therapeutic strategy for doxorubicin clinical applications based on the regulatory mechanisms of myogenin expression.

  15. Adjunct Strategies for Tuberculosis Vaccines: Modulating Key Immune Cell Regulatory Mechanisms to Potentiate Vaccination

    PubMed Central

    Jayashankar, Lakshmi; Hafner, Richard

    2016-01-01

    Tuberculosis (TB) remains a global health threat of alarming proportions, resulting in 1.5 million deaths worldwide. The only available licensed vaccine, Bacillus Calmette–Guérin, does not confer lifelong protection against active TB. To date, development of an effective vaccine against TB has proven to be elusive, and devising newer approaches for improved vaccination outcomes is an essential goal. Insights gained over the last several years have revealed multiple mechanisms of immune manipulation by Mycobacterium tuberculosis (Mtb) in infected macrophages and dendritic cells that support disease progression and block development of protective immunity. This review provides an assessment of the known immunoregulatory mechanisms altered by Mtb, and how new interventions may reverse these effects. Examples include blocking of inhibitory immune cell coreceptor checkpoints (e.g., programed death-1). Conversely, immune mechanisms that strengthen immune cell effector functions may be enhanced by interventions, including stimulatory immune cell coreceptors (e.g., OX40). Modification of the activity of key cell “immunometabolism” signaling pathway molecules, including mechanistic target of rapamycin, glycogen synthase kinase-3β, wnt/β-catenin, adenosine monophosophate-activated protein kinase, and sirtuins, related epigenetic changes, and preventing induction of immune regulatory cells (e.g., regulatory T cells, myeloid-derived suppressor cells) are powerful new approaches to improve vaccine responses. Interventions to favorably modulate these components have been studied primarily in oncology to induce efficient antitumor immune responses, often by potentiation of cancer vaccines. These agents include antibodies and a rapidly increasing number of small molecule drug classes that have contributed to the dramatic immune-based advances in treatment of cancer and other diseases. Because immune responses to malignancies and to Mtb share many similar mechanisms

  16. Development of neurodevelopmental disorders: a regulatory mechanism involving bromodomain-containing proteins.

    PubMed

    Li, Junlin; Zhao, Guifang; Gao, Xiaocai

    2013-02-20

    Neurodevelopmental disorders are classified as diseases that cause abnormal functions of the brain or central nervous system. Children with neurodevelopmental disorders show impaired language and speech abilities, learning and memory damage, and poor motor skills. However, we still know very little about the molecular etiology of these disorders. Recent evidence implicates the bromodomain-containing proteins (BCPs) in the initiation and development of neurodevelopmental disorders. BCPs have a particular domain, the bromodomain (Brd), which was originally identified as specifically binding acetyl-lysine residues at the N-terminus of histone proteins in vitro and in vivo. Other domains of BCPs are responsible for binding partner proteins to form regulatory complexes. Once these complexes are assembled, BCPs alter chromosomal states and regulate gene expression. Some BCP complexes bind nucleosomes, are involved in basal transcription regulation, and influence the transcription of many genes. However, most BCPs are involved in targeting. For example, some BCPs function as a recruitment platform or scaffold through their Brds-binding targeting sites. Others are recruited to form a complex to bind the targeting sites of their partners. The regulation mediated by these proteins is especially critical during normal and abnormal development. Mutant BCPs or dysfunctional BCP-containing complexes are implicated in the initiation and development of neurodevelopmental disorders. However, the pathogenic molecular mechanisms are not fully understood. In this review, we focus on the roles of regulatory BCPs associated with neurodevelopmental disorders, including mental retardation, Fragile X syndrome (FRX), Williams syndrome (WS), Rett syndrome and Rubinstein-Taybi syndrome (RTS). A better understanding of the molecular pathogenesis, based upon the roles of BCPs, will lead to screening of targets for the treatment of neurodevelopmental disorders.

  17. Development of neurodevelopmental disorders: a regulatory mechanism involving bromodomain-containing proteins

    PubMed Central

    2013-01-01

    Neurodevelopmental disorders are classified as diseases that cause abnormal functions of the brain or central nervous system. Children with neurodevelopmental disorders show impaired language and speech abilities, learning and memory damage, and poor motor skills. However, we still know very little about the molecular etiology of these disorders. Recent evidence implicates the bromodomain-containing proteins (BCPs) in the initiation and development of neurodevelopmental disorders. BCPs have a particular domain, the bromodomain (Brd), which was originally identified as specifically binding acetyl-lysine residues at the N-terminus of histone proteins in vitro and in vivo. Other domains of BCPs are responsible for binding partner proteins to form regulatory complexes. Once these complexes are assembled, BCPs alter chromosomal states and regulate gene expression. Some BCP complexes bind nucleosomes, are involved in basal transcription regulation, and influence the transcription of many genes. However, most BCPs are involved in targeting. For example, some BCPs function as a recruitment platform or scaffold through their Brds-binding targeting sites. Others are recruited to form a complex to bind the targeting sites of their partners. The regulation mediated by these proteins is especially critical during normal and abnormal development. Mutant BCPs or dysfunctional BCP-containing complexes are implicated in the initiation and development of neurodevelopmental disorders. However, the pathogenic molecular mechanisms are not fully understood. In this review, we focus on the roles of regulatory BCPs associated with neurodevelopmental disorders, including mental retardation, Fragile X syndrome (FRX), Williams syndrome (WS), Rett syndrome and Rubinstein-Taybi syndrome (RTS). A better understanding of the molecular pathogenesis, based upon the roles of BCPs, will lead to screening of targets for the treatment of neurodevelopmental disorders. PMID:23425632

  18. NF-kappaB regulatory mechanisms in alveolar macrophages from patients with acute respiratory distress syndrome.

    PubMed

    Moine, P; McIntyre, R; Schwartz, M D; Kaneko, D; Shenkar, R; Le Tulzo, Y; Moore, E E; Abraham, E

    2000-02-01

    Activation of the nuclear regulatory factor NF-kappaB occurs in the lungs of patients with the acute respiratory distress syndrome (ARDS) and may contribute to the increased expression of immunoregulatory cytokines and other proinflammatory mediators in this setting. Because of the important role that NF-kappaB activation appears to play in the development of acute lung injury, we examined cytoplasmic and nuclear NF-kapppaB counterregulatory mechanisms, involving IkappaB proteins, in alveolar macrophages obtained from 7 control patients without lung injury and 11 patients with established ARDS. Cytoplasmic levels of the NF-kappaB subunits p50, p65, and c-Rel were significantly decreased in alveolar macrophages from patients with ARDS, consistent with enhanced migration of liberated NF-kappaB dimers from the cytoplasm to the nucleus. Cytoplasmic and nuclear levels of IkappaBalpha were not significantly altered in alveolar macrophages from patients with established ARDS, compared with controls. In contrast, nuclear levels of Bcl-3 were significantly decreased in patients with ARDS compared with controls (P = 0.02). No IkappaBgamma, IkappaBbeta, or p105 proteins were detected in the cytoplasm of alveolar macrophages from control patients or patients with ARDS. The presence of activated NF-kappaB in alveolar macrophages from patients with established ARDS implies the presence of an ongoing stimulus for NF-kappaB activation. In this setting, appropriate counterregulatory mechanisms to normalize nuclear levels of NF-kappaB and to suppress NF-kappaB-mediated transcription, such as increased cytoplasmic and nuclear IkappaBalpha levels or decreased Bcl-3 levels, appeared to be induced. Nevertheless, even though counterregulatory mechanisms to NF-kappaB activation are activated in lung macrophages of patients with ARDS, NF-kappaB remains activated. These results suggest that fundamental abnormalities in transcriptional mechanisms involving NF-kappaB and important in the

  19. Comprehensive population-based genome sequencing provides insight into hematopoietic regulatory mechanisms

    PubMed Central

    Guo, Michael H.; Nandakumar, Satish K.; Ulirsch, Jacob C.; Zekavat, Seyedeh M.; Buenrostro, Jason D.; Natarajan, Pradeep; Salem, Rany M.; Chiarle, Roberto; Mitt, Mario; Kals, Mart; Pärn, Kalle; Fischer, Krista; Milani, Lili; Mägi, Reedik; Palta, Priit; Gabriel, Stacey B.; Metspalu, Andres; Lander, Eric S.; Kathiresan, Sekar; Hirschhorn, Joel N.; Esko, Tõnu; Sankaran, Vijay G.

    2017-01-01

    Genetic variants affecting hematopoiesis can influence commonly measured blood cell traits. To identify factors that affect hematopoiesis, we performed association studies for blood cell traits in the population-based Estonian Biobank using high-coverage whole-genome sequencing (WGS) in 2,284 samples and SNP genotyping in an additional 14,904 samples. Using up to 7,134 samples with available phenotype data, our analyses identified 17 associations across 14 blood cell traits. Integration of WGS-based fine-mapping and complementary epigenomic datasets provided evidence for causal mechanisms at several loci, including at a previously undiscovered basophil count-associated locus near the master hematopoietic transcription factor CEBPA. The fine-mapped variant at this basophil count association near CEBPA overlapped an enhancer active in common myeloid progenitors and influenced its activity. In situ perturbation of this enhancer by CRISPR/Cas9 mutagenesis in hematopoietic stem and progenitor cells demonstrated that it is necessary for and specifically regulates CEBPA expression during basophil differentiation. We additionally identified basophil count-associated variation at another more pleiotropic myeloid enhancer near GATA2, highlighting regulatory mechanisms for ordered expression of master hematopoietic regulators during lineage specification. Our study illustrates how population-based genetic studies can provide key insights into poorly understood cell differentiation processes of considerable physiologic relevance. PMID:28031487

  20. Comprehensive population-based genome sequencing provides insight into hematopoietic regulatory mechanisms.

    PubMed

    Guo, Michael H; Nandakumar, Satish K; Ulirsch, Jacob C; Zekavat, Seyedeh M; Buenrostro, Jason D; Natarajan, Pradeep; Salem, Rany M; Chiarle, Roberto; Mitt, Mario; Kals, Mart; Pärn, Kalle; Fischer, Krista; Milani, Lili; Mägi, Reedik; Palta, Priit; Gabriel, Stacey B; Metspalu, Andres; Lander, Eric S; Kathiresan, Sekar; Hirschhorn, Joel N; Esko, Tõnu; Sankaran, Vijay G

    2017-01-17

    Genetic variants affecting hematopoiesis can influence commonly measured blood cell traits. To identify factors that affect hematopoiesis, we performed association studies for blood cell traits in the population-based Estonian Biobank using high-coverage whole-genome sequencing (WGS) in 2,284 samples and SNP genotyping in an additional 14,904 samples. Using up to 7,134 samples with available phenotype data, our analyses identified 17 associations across 14 blood cell traits. Integration of WGS-based fine-mapping and complementary epigenomic datasets provided evidence for causal mechanisms at several loci, including at a previously undiscovered basophil count-associated locus near the master hematopoietic transcription factor CEBPA The fine-mapped variant at this basophil count association near CEBPA overlapped an enhancer active in common myeloid progenitors and influenced its activity. In situ perturbation of this enhancer by CRISPR/Cas9 mutagenesis in hematopoietic stem and progenitor cells demonstrated that it is necessary for and specifically regulates CEBPA expression during basophil differentiation. We additionally identified basophil count-associated variation at another more pleiotropic myeloid enhancer near GATA2, highlighting regulatory mechanisms for ordered expression of master hematopoietic regulators during lineage specification. Our study illustrates how population-based genetic studies can provide key insights into poorly understood cell differentiation processes of considerable physiologic relevance.

  1. A model for the volume regulatory mechanism of the Airway Surface Layer

    NASA Astrophysics Data System (ADS)

    Lang, Michael; Rubinstein, Michael; Davis, C. William; Tarran, Robert; Boucher, Richard

    2006-03-01

    The airway surface layer (ASL) of a lung consists of two parts: a mucus layer with thickness of about 30 μm in contact with air and a periciliary layer (PCL) of about 7 μm below. Mucus collects dust and bacteria and is swept to throat by beating cilia, while riding on top of PCL. It is important that the thickness of PCL is matched with the length of cilia in order to optimize clearance of mucus. Decrease of PCL thickness would finally lead to an occlusion of the respiratory system. Experiments show that the height of PCL stays constant after removing mucus. When modifying height or composition of this open PCL by removing fluid or adding isotonic solution leads to the same final height of PCL. Thus, there must be a regulatory mechanism, that controls height, i.e. ASL volume. Additional experiments show that mechanical stimulus of the cells like shear leads to an increase of ASL volume, thus, the cell is able to actively adjust this volume. Based on these observations a class of models is introduced that describes the experiments and a specific minimum model for the given problem is proposed.

  2. A Cell-Regulatory Mechanism Involving Feedback between Contraction and Tissue Formation Guides Wound Healing Progression

    PubMed Central

    Valero, Clara; Javierre, Etelvina; García-Aznar, José Manuel; Gómez-Benito, María José

    2014-01-01

    Wound healing is a process driven by cells. The ability of cells to sense mechanical stimuli from the extracellular matrix that surrounds them is used to regulate the forces that cells exert on the tissue. Stresses exerted by cells play a central role in wound contraction and have been broadly modelled. Traditionally, these stresses are assumed to be dependent on variables such as the extracellular matrix and cell or collagen densities. However, we postulate that cells are able to regulate the healing process through a mechanosensing mechanism regulated by the contraction that they exert. We propose that cells adjust the contraction level to determine the tissue functions regulating all main activities, such as proliferation, differentiation and matrix production. Hence, a closed-regulatory feedback loop is proposed between contraction and tissue formation. The model consists of a system of partial differential equations that simulates the evolution of fibroblasts, myofibroblasts, collagen and a generic growth factor, as well as the deformation of the extracellular matrix. This model is able to predict the wound healing outcome without requiring the addition of phenomenological laws to describe the time-dependent contraction evolution. We have reproduced two in vivo experiments to evaluate the predictive capacity of the model, and we conclude that there is feedback between the level of cell contraction and the tissue regenerated in the wound. PMID:24681636

  3. Apoptosis as a mechanism of T-regulatory cell homeostasis and suppression.

    PubMed

    Yolcu, Esma S; Ash, Shifra; Kaminitz, Ayelet; Sagiv, Yuval; Askenasy, Nadir; Yarkoni, Shai

    2008-01-01

    Activation-induced cell death is a general mechanism of immune homeostasis through negative regulation of clonal expansion of activated immune cells. This mechanism is involved in the maintenance of self- and transplant tolerance through polarization of the immune responses. The Fas/Fas-ligand interaction is a major common executioner of apoptosis in lymphocytes, with a dual role in regulatory T cell (Treg) function: Treg cell homeostasis and Treg cell-mediated suppression. Sensitivity to apoptosis and the patterns of Treg-cell death are of outmost importance in immune homeostasis that affects the equilibrium between cytolytic and suppressor forces in activation and termination of immune activity. Naive innate (naturally occurring) Treg cells present variable sensitivities to apoptosis, related to their turnover rates in tissue under steady state conditions. Following activation, Treg cells are less sensitive to apoptosis than cytotoxic effector subsets. Their susceptibility to apoptosis is influenced by cytokines within the inflammatory environment (primarily interleukin-2), the mode of antigenic stimulation and the proliferation rates. Here, we attempt to resolve some controversies surrounding the sensitivity of Treg cells to apoptosis under various experimental conditions, to delineate the function of cell death in regulation of immunity.

  4. Unravelling the regulatory mechanisms that modulate the MEP pathway in higher plants.

    PubMed

    Cordoba, Elizabeth; Salmi, Mari; León, Patricia

    2009-01-01

    The methyl-D-erythritol 4-phosphate pathway is responsible for the biosynthesis of a substantial number of natural compounds of biological and biotechnological importance. In recent years, this pathway has become an obvious target to develop new herbicides and antimicrobial drugs. In addition, the production of a variety of compounds of medical and agricultural interest may be possible through the genetic manipulation of this pathway. To this end, a complete understanding of the molecular mechanisms that regulate this pathway is of tremendous importance. Recent data have accumulated that show some of the multiple mechanisms that regulate the methyl-D-erythritol 4-phosphate pathway in plants. In this review we will describe some of these and discuss their implications. It has been demonstrated that 1-deoxy-D-xylulose-5-phosphate synthase (DXS), the first enzyme of this route, plays a major role in the overall regulation of the pathway. A small gene family codes for this enzyme in most of the plants which have been analysed so far, and the members of these gene families belong to different phylogenetic groups. Each of these genes exhibits a distinct expression pattern, suggesting unique functions. One of the most interesting regulatory mechanisms recently described for this pathway is the post-transcriptional regulation of the level of DXS and DXR proteins. In the case of DXS, this regulation appears conserved among plants, supporting its importance. The evidence accumulated suggests that this regulation might link the activity of this pathway with the plant's physiological conditions and the metabolic demand for the final products of this route.

  5. Morphogenetic and Regulatory Mechanisms During Developmental Chondrogenesis: New Paradigms for Cartilage Tissue Engineering

    PubMed Central

    Quintana, Lluís; zur Nieden, Nicole I.

    2009-01-01

    Cartilage is the first skeletal tissue to be formed during embryogenesis leading to the creation of all mature cartilages and bones, with the exception of the flat bones in the skull. Therefore, errors occurring during the process of chondrogenesis, the formation of cartilage, often lead to severe skeletal malformations such as dysplasias. There are hundreds of skeletal dysplasias, and the molecular genetic etiology of some remains more elusive than of others. Many efforts have aimed at understanding the morphogenetic event of chondrogenesis in normal individuals, of which the main morphogenetic and regulatory mechanisms will be reviewed here. For instance, many signaling molecules that guide chondrogenesis—for example, transforming growth factor-β, bone morphogenetic proteins, fibroblast growth factors, and Wnts, as well as transcriptional regulators such as the Sox family—have already been identified. Moreover, extracellular matrix components also play an important role in this developmental event, as evidenced by the promotion of the chondrogenic potential of chondroprogenitor cells caused by collagen II and proteoglycans like versican. The growing evidence of the elements that control chondrogenesis and the increasing number of different sources of progenitor cells will, hopefully, help to create tissue engineering platforms that could overcome many developmental or degenerative diseases associated with cartilage defects. PMID:19063663

  6. Regulatory mechanism of protein metabolic pathway during the differentiation process of chicken male germ cell.

    PubMed

    Li, Dong; Zuo, Qisheng; Lian, Chao; Zhang, Lei; Shi, Qingqing; Zhang, Zhentao; Wang, Yingjie; Ahmed, Mahmoud F; Tang, Beibei; Xiao, Tianrong; Zhang, Yani; Li, Bichun

    2015-08-01

    We explored the regulatory mechanism of protein metabolism during the differentiation process of chicken male germ cells and provide a basis for improving the induction system of embryonic stem cell differentiation to male germ cells in vitro. We sequenced the transcriptome of embryonic stem cells, primordial germ cells, and spermatogonial stem cells with RNA sequencing (RNA-Seq), bioinformatics analysis methods, and detection of the key genes by quantitative reverse transcription PCR (qRT-PCR). Finally, we found 16 amino acid metabolic pathways enriched in the biological metabolism during the differentiation process of embryonic stem cells to primordial germ cells and 15 amino acid metabolic pathways enriched in the differentiation stage of primordial germ cells to spermatogonial stem cells. We found three pathways, arginine-proline metabolic pathway, tyrosine metabolic pathway, and tryptophan metabolic pathway, significantly enriched in the whole differentiation process of embryonic stem cells to spermatogonial stem cells. Moreover, for these three pathways, we screened key genes such as NOS2, ADC, FAH, and IDO. qRT-PCR results showed that the expression trend of these genes were the same to RNA-Seq. Our findings showed that the three pathways and these key genes play an important role in the differentiation process of embryonic stem cells to male germ cells. These results provide basic information for improving the induction system of embryonic stem cell differentiation to male germ cells in vitro.

  7. Cardiovascular Risk in Systemic Autoimmune Diseases: Epigenetic Mechanisms of Immune Regulatory Functions

    PubMed Central

    López-Pedrera, Chary; Pérez-Sánchez, Carlos; Ramos-Casals, Manuel; Santos-Gonzalez, Monica; Rodriguez-Ariza, Antonio; José Cuadrado, Ma

    2012-01-01

    Autoimmune diseases (AIDs) have been associated with accelerated atherosclerosis (AT) leading to increased cardio- and cerebrovascular disease risk. Traditional risk factors, as well as systemic inflammation mediators, including cytokines, chemokines, proteases, autoantibodies, adhesion receptors, and others, have been implicated in the development of these vascular pathologies. Yet, the characteristics of vasculopathies may significantly differ depending on the underlying disease. In recent years, many new genes and signalling pathways involved in autoimmunity with often overlapping patterns between different disease entities have been further detected. Epigenetics, the control of gene packaging and expression independent of alterations in the DNA sequence, is providing new directions linking genetics and environmental factors. Epigenetic regulatory mechanisms comprise DNA methylation, histone modifications, and microRNA activity, all of which act upon gene and protein expression levels. Recent findings have contributed to our understanding of how epigenetic modifications could influence AID development, not only showing differences between AID patients and healthy controls, but also showing how one disease differs from another and even how the expression of key proteins involved in the development of each disease is regulated. PMID:21941583

  8. Context-dependent regulatory mechanism of the splicing factor hnRNP L

    PubMed Central

    Motta-Mena, Laura B.; Heyd, Florian; Lynch, Kristen W.

    2010-01-01

    Splicing regulatory proteins often have distinct activities when bound to exons versus introns. However, less clear is whether variables besides location can influence activity. HnRNP L binds to a motif present in both CD45 variable exons 4 and 5 to affect their coordinate repression. Here we show that, in contrast to its direct repression of exon 4, hnRNP L represses exon 5 by countering the activity of a neighboring splicing enhancer. In the absence of the enhancer hnRNP L unexpectedly activates exon inclusion. As the splice sites flanking exon 4 and 5 are distinct, we directly examined the effect of varying splice site strength on the mechanism of hnRNP L function. Remarkably, binding of hnRNP L to an exon represses strong splice sites but enhances weak splice sites. A model in which hnRNP L stabilizes snRNP binding can explain both effects in a manner determined by the inherent snRNP-substrate affinity. PMID:20122404

  9. Expression of the large clostridial toxins is controlled by conserved regulatory mechanisms.

    PubMed

    Carter, Glen P; Larcombe, Sarah; Li, Lucy; Jayawardena, Darshani; Awad, Milena M; Songer, J Glenn; Lyras, Dena

    2014-11-01

    The clostridia cause many human and animal diseases, resulting in significant morbidity and mortality. Host damage results from the action of potent exotoxins, an important group of which is the large clostridial toxins (LCTs) produced by Clostridium difficile, Clostridium sordellii, Clostridium perfringens and Clostridium novyi. Knowledge of the structure and function of these toxins has been attained, however, apart from C. difficile, the regulatory pathways that control LCT production remain largely unknown. Here we show that LCT production in C. sordellii and C. perfringens is temporally regulated and repressed by glucose in a similar manner to C. difficile. Furthermore, we show that the TpeL-encoding gene of C. perfringens is located in an uncharacterized Pathogenicity Locus (PaLoc), along with accessory genes predicted to encode a bacteriophage holin-type protein and a TcdR-family alternative sigma factor, TpeR. Inactivation of tpeR demonstrated that TpeR is critical for C. perfringens TpeL production, in a similar manner to C. difficile TcdR and C. sordellii TcsR, but cross-complementation showed that TpeR is not functionally interchangeable with TcdR or TcsR. Although conserved mechanisms are employed by the clostridia to control LCT production there are important functional differences that distinguish members of the TcdR-family of clostridial alternative sigma factors. Copyright © 2014 Elsevier GmbH. All rights reserved.

  10. A novel regulatory mechanism couples deoxyribonucleotide synthesis and DNA replication in Escherichia coli.

    PubMed

    Gon, Stéphanie; Camara, Johanna E; Klungsøyr, Hege K; Crooke, Elliott; Skarstad, Kirsten; Beckwith, Jon

    2006-03-08

    We present evidence for a complex regulatory interplay between the initiation of DNA replication and deoxyribonucleotide synthesis. In Escherichia coli, the ATP-bound DnaA protein initiates chromosomal replication. Upon loading of the beta-clamp subunit (DnaN) of the replicase, DnaA is inactivated as its intrinsic ATPase activity is stimulated by the protein Hda. The beta-subunit acts as a matchmaker between Hda and DnaA. Chain elongation of DNA requires a sufficient supply of deoxyribonucleotides (dNTPs), which are produced by ribonucleotide reductase (RNR). We present evidence suggesting that the molecular switch from ATP-DnaA to ADP-DnaA is a critical step coordinating DNA replication with increased deoxyribonucleotide synthesis. Characterization of dnaA and dnaN mutations that result in a constitutively high expression of RNR reveal this mechanism. We propose that the nucleotide bound state of DnaA regulates the transcription of the genes encoding ribonucleotide reductase (nrdAB). Accordingly, the conversion of ATP-DnaA to ADP-DnaA after initiation and loading of the beta-subunit DnaN would allow increased nrdAB expression, and consequently, coordinated RNR synthesis and DNA replication during the cell cycle.

  11. A novel regulatory mechanism couples deoxyribonucleotide synthesis and DNA replication in Escherichia coli

    PubMed Central

    Gon, Stéphanie; Camara, Johanna E; Klungsøyr, Hege K; Crooke, Elliott; Skarstad, Kirsten; Beckwith, Jon

    2006-01-01

    We present evidence for a complex regulatory interplay between the initiation of DNA replication and deoxyribonucleotide synthesis. In Escherichia coli, the ATP-bound DnaA protein initiates chromosomal replication. Upon loading of the β-clamp subunit (DnaN) of the replicase, DnaA is inactivated as its intrinsic ATPase activity is stimulated by the protein Hda. The β-subunit acts as a matchmaker between Hda and DnaA. Chain elongation of DNA requires a sufficient supply of deoxyribonucleotides (dNTPs), which are produced by ribonucleotide reductase (RNR). We present evidence suggesting that the molecular switch from ATP-DnaA to ADP-DnaA is a critical step coordinating DNA replication with increased deoxyribonucleotide synthesis. Characterization of dnaA and dnaN mutations that result in a constitutively high expression of RNR reveal this mechanism. We propose that the nucleotide bound state of DnaA regulates the transcription of the genes encoding ribonucleotide reductase (nrdAB). Accordingly, the conversion of ATP-DnaA to ADP-DnaA after initiation and loading of the β-subunit DnaN would allow increased nrdAB expression, and consequently, coordinated RNR synthesis and DNA replication during the cell cycle. PMID:16482221

  12. Regulatory mechanisms and clinical perspectives of miRNA in tumor radiosensitivity

    PubMed Central

    Cao, Ya; Dong, Zigang

    2012-01-01

    MicroRNA (miRNA) influences carcinogenesis at multiple stages and it can effectively control tumor radiosensitivity by affecting DNA damage repair, cell cycle checkpoint, apoptosis, radio-related signal transduction pathways and tumor microenvironment. MiRNA also efficiently modulates tumor radiosensitivity at multiple levels by blocking the two essential non-homologous end-joining repair and homologous recombination repair pathways in the DNA damage response. It interferes with four radio-related pathways in ionizing radiation, including the PI3-K/Akt, NF-κB, MAPK and TGFβ signaling pathways. Moreover, the regulatory effect of miRNA in radiosensitivity can be enhanced when interacting with various key molecules, including H2AX, BRCA1, ATM, DNA-PK, RAD51, Chk1, Cdc25A, p53, PLK1, HIF-1 and VEGF, which are involved in these processes. Therefore, thoroughly understanding the mechanism of miRNA in tumor radiosensitivity could assist in finding novel targets to improve the radiotherapeutic effects and provide new clinical perspectives and insights for developing effective cancer treatments. PMID:22798379

  13. The regulatory mechanism of Tremella mesenterica on steroidogenesis in MA-10 mouse Leydig tumor cells.

    PubMed

    Chen, Yen-Wen; Lo, Hui-Chen; Yang, Jyuer-Ger; Chien, Chi-Hsien; Lee, Shi-Hsiung; Tseng, Chi-Yu; Huang, Bu-Miin

    2006-07-04

    Tremella mesenterica (TM), a yellow jelly mushroom, has been traditionally used as tonic food to improve body condition in Chinese society for a long time. We have previously demonstrated that TM reduced in vitro hCG-treated steroidogenesis in MA-10 mouse Leydig tumor cells without any toxicity effect. In the present study, the mechanism how TM suppressed hCG-treated steroidogenesis in MA-10 cells was investigated. MA-10 cells were treated with vehicle, human chorionic gonadotropin (hCG, 50 ng/ml), or different reagents with or without TM to clarify the effects. TM significantly suppressed progesterone production with the presences of forskolin (10 and 100 microM) or dbcAMP (0.5 and 1mM), respectively, in MA-10 cells (p<0.05), which indicated that TM suppressed steroidogenesis after PKA activation along the signal pathway. Beyond our expectation, TM induced the expression of steroidogenic acute regulatory (StAR) protein with or without hCG treatments. However, TM profoundly decreased P450 side chain cleavage (P450scc) and 3beta-hydroxysteroid dehydrogenase (3beta-HSD) enzyme activities without any influences on the expression of both enzymes. These inhibitions on steroidogenic enzyme activities might counteract the stimulation of StAR protein expression. In conclusion, results suggest that TM suppressed hCG-treated steroidogenesis in MA-10 cells by inhibiting PKA signal pathway and steroidogenic enzyme activities.

  14. A protein-dependent side-chain rotamer library

    PubMed Central

    2011-01-01

    Background Protein side-chain packing problem has remained one of the key open problems in bioinformatics. The three main components of protein side-chain prediction methods are a rotamer library, an energy function and a search algorithm. Rotamer libraries summarize the existing knowledge of the experimentally determined structures quantitatively. Depending on how much contextual information is encoded, there are backbone-independent rotamer libraries and backbone-dependent rotamer libraries. Backbone-independent libraries only encode sequential information, whereas backbone-dependent libraries encode both sequential and locally structural information. However, side-chain conformations are determined by spatially local information, rather than sequentially local information. Since in the side-chain prediction problem, the backbone structure is given, spatially local information should ideally be encoded into the rotamer libraries. Methods In this paper, we propose a new type of backbone-dependent rotamer library, which encodes structural information of all the spatially neighboring residues. We call it protein-dependent rotamer libraries. Given any rotamer library and a protein backbone structure, we first model the protein structure as a Markov random field. Then the marginal distributions are estimated by the inference algorithms, without doing global optimization or search. The rotamers from the given library are then re-ranked and associated with the updated probabilities. Results Experimental results demonstrate that the proposed protein-dependent libraries significantly outperform the widely used backbone-dependent libraries in terms of the side-chain prediction accuracy and the rotamer ranking ability. Furthermore, without global optimization/search, the side-chain prediction power of the protein-dependent library is still comparable to the global-search-based side-chain prediction methods. PMID:22373394

  15. A protein-dependent side-chain rotamer library.

    PubMed

    Bhuyan, Md Shariful Islam; Gao, Xin

    2011-12-14

    Protein side-chain packing problem has remained one of the key open problems in bioinformatics. The three main components of protein side-chain prediction methods are a rotamer library, an energy function and a search algorithm. Rotamer libraries summarize the existing knowledge of the experimentally determined structures quantitatively. Depending on how much contextual information is encoded, there are backbone-independent rotamer libraries and backbone-dependent rotamer libraries. Backbone-independent libraries only encode sequential information, whereas backbone-dependent libraries encode both sequential and locally structural information. However, side-chain conformations are determined by spatially local information, rather than sequentially local information. Since in the side-chain prediction problem, the backbone structure is given, spatially local information should ideally be encoded into the rotamer libraries. In this paper, we propose a new type of backbone-dependent rotamer library, which encodes structural information of all the spatially neighboring residues. We call it protein-dependent rotamer libraries. Given any rotamer library and a protein backbone structure, we first model the protein structure as a Markov random field. Then the marginal distributions are estimated by the inference algorithms, without doing global optimization or search. The rotamers from the given library are then re-ranked and associated with the updated probabilities. Experimental results demonstrate that the proposed protein-dependent libraries significantly outperform the widely used backbone-dependent libraries in terms of the side-chain prediction accuracy and the rotamer ranking ability. Furthermore, without global optimization/search, the side-chain prediction power of the protein-dependent library is still comparable to the global-search-based side-chain prediction methods.

  16. Dynamic responsiveness of the vascular bed as a regulatory mechanism in vasomotor control.

    PubMed

    Zamir, Mair; Norton, Katelyn; Fleischhauer, Arlene; Frances, Maria F; Goswami, Ruma; Usselman, Charlotte W; Nolan, Robert P; Shoemaker, J Kevin

    2009-07-01

    The dynamics of blood supply to a vascular bed depend on lumped mechanical properties of that bed, namely the compliance (C), resistance (R), viscoelasticity (K), and inertance (L). While the study of regulatory mechanisms has so far placed the emphasis largely on R, it is not known how the remaining properties contribute collectively to the play of dynamics in vasomotor control. To examine this question and to establish some benchmark values of these properties, simultaneous measurements of pressure and flow waveforms in the vascular bed of the forearm were obtained from three groups: young healthy individuals, older hypertensives with controlled blood pressure, and older hypertensives with uncontrolled blood pressure. The values of R and C were found to vary within a wide range in each of the three groups to the extent that neither R nor C could be used independently as an indicator of health or age of the subjects tested. However, higher level dynamic properties of the bed, such as the time constants and damping index, which depend on combinations of C,K, and L, and which may reflect measures of the dynamic responsiveness or "sluggishness" of the system, were found to be maintained over a wide range of pulse pressures. These findings support a hypothesis that the pulsatile dynamics of blood supply to a vascular bed are adapted to the individual baseline values of R and C in different subjects with the effect of optimizing the level of dynamic responsiveness to changes in pressure or flow, and that this dynamic property of the vascular bed may be a protected and/or regulated property.

  17. Dynamic responsiveness of the vascular bed as a regulatory mechanism in vasomotor control

    PubMed Central

    Norton, Katelyn; Fleischhauer, Arlene; Frances, Maria F.; Goswami, Ruma; Usselman, Charlotte W.; Nolan, Robert P.; Shoemaker, J. Kevin

    2009-01-01

    The dynamics of blood supply to a vascular bed depend on lumped mechanical properties of that bed, namely the compliance (C), resistance (R), viscoelasticity (K), and inertance (L). While the study of regulatory mechanisms has so far placed the emphasis largely on R, it is not known how the remaining properties contribute collectively to the play of dynamics in vasomotor control. To examine this question and to establish some benchmark values of these properties, simultaneous measurements of pressure and flow waveforms in the vascular bed of the forearm were obtained from three groups: young healthy individuals, older hypertensives with controlled blood pressure, and older hypertensives with uncontrolled blood pressure. The values of R and C were found to vary within a wide range in each of the three groups to the extent that neither R nor C could be used independently as an indicator of health or age of the subjects tested. However, higher level dynamic properties of the bed, such as the time constants and damping index, which depend on combinations of C,K, and L, and which may reflect measures of the dynamic responsiveness or “sluggishness” of the system, were found to be maintained over a wide range of pulse pressures. These findings support a hypothesis that the pulsatile dynamics of blood supply to a vascular bed are adapted to the individual baseline values of R and C in different subjects with the effect of optimizing the level of dynamic responsiveness to changes in pressure or flow, and that this dynamic property of the vascular bed may be a protected and/or regulated property. PMID:19528260

  18. Genome-wide annotation of microRNA primary transcript structures reveals novel regulatory mechanisms

    PubMed Central

    Chang, Tsung-Cheng; Pertea, Mihaela; Lee, Sungyul; Salzberg, Steven L.; Mendell, Joshua T.

    2015-01-01

    Precise regulation of microRNA (miRNA) expression is critical for diverse physiologic and pathophysiologic processes. Nevertheless, elucidation of the mechanisms through which miRNA expression is regulated has been greatly hindered by the incomplete annotation of primary miRNA (pri-miRNA) transcripts. While a subset of miRNAs are hosted in protein-coding genes, the majority of pri-miRNAs are transcribed as poorly characterized noncoding RNAs that are 10's to 100's of kilobases in length and low in abundance due to efficient processing by the endoribonuclease DROSHA, which initiates miRNA biogenesis. Accordingly, these transcripts are poorly represented in existing RNA-seq data sets and exhibit limited and inaccurate annotation in current transcriptome assemblies. To overcome these challenges, we developed an experimental and computational approach that allows genome-wide detection and mapping of pri-miRNA structures. Deep RNA-seq in cells expressing dominant-negative DROSHA resulted in much greater coverage of pri-miRNA transcripts compared with standard RNA-seq. A computational pipeline was developed that produces highly accurate pri-miRNA assemblies, as confirmed by extensive validation. This approach was applied to a panel of human and mouse cell lines, providing pri-miRNA transcript structures for 1291/1871 human and 888/1181 mouse miRNAs, including 594 human and 425 mouse miRNAs that fall outside protein-coding genes. These new assemblies uncovered unanticipated features and new potential regulatory mechanisms, including links between pri-miRNAs and distant protein-coding genes, alternative pri-miRNA splicing, and transcripts carrying subsets of miRNAs encoded by polycistronic clusters. These results dramatically expand our understanding of the organization of miRNA-encoding genes and provide a valuable resource for the study of mammalian miRNA regulation. PMID:26290535

  19. Differential regulation analysis reveals dysfunctional regulatory mechanism involving transcription factors and microRNAs in gastric carcinogenesis.

    PubMed

    Li, Quanxue; Li, Junyi; Dai, Wentao; Li, Yi-Xue; Li, Yuan-Yuan

    2017-03-01

    Gastric cancer (GC) is one of the most incident malignancies in the world. Although lots of featured genes and microRNAs (miRNAs) have been identified to be associated with gastric carcinogenesis, underlying regulatory mechanisms still remain unclear. In order to explore the dysfunctional mechanisms of GC, we developed a novel approach to identify carcinogenesis relevant regulatory relationships, which is characterized by quantifying the difference of regulatory relationships between stages. Firstly, we applied the strategy of differential coexpression analysis (DCEA) to transcriptomic datasets including paired mRNA and miRNA of gastric samples to identify a set of genes/miRNAs related to gastric cancer progression. Based on these genes/miRNAs, we constructed conditional combinatorial gene regulatory networks (cGRNs) involving both transcription factors (TFs) and miRNAs. Enrichment of known cancer genes/miRNAs and predicted prognostic genes/miRNAs was observed in each cGRN. Then we designed a quantitative method to measure differential regulation level of every regulatory relationship between normal and cancer, and the known cancer genes/miRNAs proved to be ranked significantly higher. Meanwhile, we defined differentially regulated link (DRL) by combining differential regulation, differential expression and the regulation contribution of the regulator to the target. By integrating survival analysis and DRL identification, three master regulators TCF7L1, TCF4, and MEIS1 were identified and testable hypotheses of dysfunctional mechanisms underlying gastric carcinogenesis related to them were generated. The fine-tuning effects of miRNAs were also observed. We propose that this differential regulation network analysis framework is feasible to gain insights into dysregulated mechanisms underlying tumorigenesis and other phenotypic changes. Copyright © 2017. Published by Elsevier B.V.

  20. Controlling the fire--tissue-specific mechanisms of effector regulatory T-cell homing.

    PubMed

    Chow, Zachary; Banerjee, Ashish; Hickey, Michael J

    2015-04-01

    Regulatory T cells have essential roles in regulating immune responses and limiting inappropriate inflammation. Evidence now indicates that to achieve this function, regulatory T cells must be able to migrate to the most appropriate locations within both lymphoid and non-lymphoid organs. This function is achieved via the spatiotemporally controlled expression of adhesion molecules and chemokine receptors, varying according to the developmental stage of the regulatory T cell and the location and environment where they undergo activation. In this Review, we summarise information on the roles of adhesion molecules and chemokine receptors in mediating regulatory T-cell migration and function throughout the body under homeostatic and inflammatory conditions. In addition, we review recent studies that have used in vivo imaging to examine the actions of regulatory T cells in vivo, in lymph nodes, in the microvasculature and in the interstitium of peripheral organs. These studies reveal that the capacity of regulatory T cells to undergo selective migration serves a critical role in their ability to suppress immune responses. As such, the cellular and molecular requirements of regulatory T-cell migration need to be completely understood to enable the most effective use of these cells in clinical settings.

  1. Heart Rate Variability: New Perspectives on Physiological Mechanisms, Assessment of Self-regulatory Capacity, and Health risk

    PubMed Central

    Shaffer, Fred

    2015-01-01

    Heart rate variability, the change in the time intervals between adjacent heartbeats, is an emergent property of interdependent regulatory systems that operates on different time scales to adapt to environmental and psychological challenges. This article briefly reviews neural regulation of the heart and offers some new perspectives on mechanisms underlying the very low frequency rhythm of heart rate variability. Interpretation of heart rate variability rhythms in the context of health risk and physiological and psychological self-regulatory capacity assessment is discussed. The cardiovascular regulatory centers in the spinal cord and medulla integrate inputs from higher brain centers with afferent cardiovascular system inputs to adjust heart rate and blood pressure via sympathetic and parasympathetic efferent pathways. We also discuss the intrinsic cardiac nervous system and the heart-brain connection pathways, through which afferent information can influence activity in the subcortical, frontocortical, and motor cortex areas. In addition, the use of real-time HRV feedback to increase self-regulatory capacity is reviewed. We conclude that the heart's rhythms are characterized by both complexity and stability over longer time scales that reflect both physiological and psychological functional status of these internal self-regulatory systems. PMID:25694852

  2. Heart Rate Variability: New Perspectives on Physiological Mechanisms, Assessment of Self-regulatory Capacity, and Health risk.

    PubMed

    McCraty, Rollin; Shaffer, Fred

    2015-01-01

    Heart rate variability, the change in the time intervals between adjacent heartbeats, is an emergent property of interdependent regulatory systems that operates on different time scales to adapt to environmental and psychological challenges. This article briefly reviews neural regulation of the heart and offers some new perspectives on mechanisms underlying the very low frequency rhythm of heart rate variability. Interpretation of heart rate variability rhythms in the context of health risk and physiological and psychological self-regulatory capacity assessment is discussed. The cardiovascular regulatory centers in the spinal cord and medulla integrate inputs from higher brain centers with afferent cardiovascular system inputs to adjust heart rate and blood pressure via sympathetic and parasympathetic efferent pathways. We also discuss the intrinsic cardiac nervous system and the heart-brain connection pathways, through which afferent information can influence activity in the subcortical, frontocortical, and motor cortex areas. In addition, the use of real-time HRV feedback to increase self-regulatory capacity is reviewed. We conclude that the heart's rhythms are characterized by both complexity and stability over longer time scales that reflect both physiological and psychological functional status of these internal self-regulatory systems.

  3. Acute inflammation in peritoneal dialysis: experimental studies in rats. Characterization of regulatory mechanisms.

    PubMed

    Bazargani, Farhan

    2005-01-01

    The predominant problems associated with peritoneal dialysis (PD) are ultrafiltration failure and peritonitis. PD maintains a state of intraperitoneal inflammation that affects the structure and function of the peritoneal membrane, potentially impairing ultrafiltration efficiency. Paradoxically, some PD fluids also have anti-inflammatory properties that may compromise the immune defense against peritonitis. This anti-inflammatory feature is mostly due to the glucose degradation products (GDPs), formed during heat-sterilization and storage of PD fluids. The main purpose of the present thesis was to study regulatory mechanisms behind the acute intraperitoneal inflammatory response in PD in the presence and absence of experimental peritonitis. Rats were exposed to a single dose of heat- or filter sterilized PD fluids either as an i.p. injection or as an infusion through an indwelling catheter, with or without supplementations, or pretreatment of the animals. The dwell fluid was analyzed zero, two and four hours later concerning activation of the complement and coagulation cascades, neutrophil recruitment and respiratory burst, ultrafiltration volumes, cytokine-induced neutrophil chemoattractant (CINC-1), rat mast cell protease 2 (RMCP-2), glucose, urea and histamine concentrations and ex vivo/in vitro intraperitoneal chemotactic activity. Exposure to filter sterilized PD fluid alone induced intraperitoneal complement activation and coagulation, neutrophil recruitment and increased the levels of CINC-1 during the dwell. Intraperitoneal concentrations of the mast cell markers histamine and RMCP-2 changed little during the dwells and did not indicate mast cell activation. Low molecular weight heparin (LMWH) and C5 blockade improved ultrafiltration. Pretreatment with cobra venom factor, known decomplementing agent, blocked the CINC-1 release and the neutrophil recruitment and improved ultrafiltration. In combination with experimental peritonitis, heat sterilized PD fluid

  4. microRNA regulatory mechanism by which PLLA aligned nanofibers influence PC12 cell differentiation

    NASA Astrophysics Data System (ADS)

    Yu, Yadong; Lü, Xiaoying; Ding, Fei

    2015-08-01

    Objective. Aligned nanofibers (AFs) are regarded as promising biomaterials in nerve tissue engineering. However, a full understanding of the biocompatibility of AFs at the molecular level is still challenging. Therefore, the present study focused on identifying the microRNA (miRNA)-mediated regulatory mechanism by which poly-L-lactic acid (PLLA) AFs influence PC12 cell differentiation. Approach. Firstly, the effects of PLLA random nanofibers (RFs)/AFs and PLLA films (control) on the biological responses of PC12 cells that are associated with neuronal differentiation were examined. Then, SOLiD sequencing and cDNA microarray were employed to profile the expressions of miRNAs and mRNAs. The target genes of the misregulated miRNAs were predicted and compared with the mRNA profile data. Functions of the matched target genes (the intersection between the predicted target genes and the experimentally-determined, misregulated genes) were analyzed. Main results. The results revealed that neurites spread in various directions in control and RF groups. In the AF group, most neurites extended in parallel with each other. The glucose consumption and lactic acid production in the RF and AF groups were higher than those in the control group. Compared with the control group, 42 and 94 miRNAs were significantly dysregulated in the RF and AF groups, respectively. By comparing the predicted target genes with the mRNA profile data, five and 87 matched target genes were found in the RF and AF groups, respectively. Three of the matched target genes in the AF group were found to be associated with neuronal differentiation, whereas none had this association in the RF group. The PLLA AFs induced the dysregulation of miRNAs that regulate many biological functions, including axonal guidance, lipid metabolism and long-term potentiation. In particular, two miRNA-matched target gene-biological function modules associated with neuronal differentiation were identified as follows: (1) miR-23b, mi

  5. RNA-Binding Proteins in Trichomonas vaginalis: Atypical Multifunctional Proteins Involved in a Posttranscriptional Iron Regulatory Mechanism

    PubMed Central

    Figueroa-Angulo, Elisa E.; Calla-Choque, Jaeson S.; Mancilla-Olea, Maria Inocente; Arroyo, Rossana

    2015-01-01

    Iron homeostasis is highly regulated in vertebrates through a regulatory system mediated by RNA-protein interactions between the iron regulatory proteins (IRPs) that interact with an iron responsive element (IRE) located in certain mRNAs, dubbed the IRE-IRP regulatory system. Trichomonas vaginalis, the causal agent of trichomoniasis, presents high iron dependency to regulate its growth, metabolism, and virulence properties. Although T. vaginalis lacks IRPs or proteins with aconitase activity, possesses gene expression mechanisms of iron regulation at the transcriptional and posttranscriptional levels. However, only one gene with iron regulation at the transcriptional level has been described. Recently, our research group described an iron posttranscriptional regulatory mechanism in the T. vaginalis tvcp4 and tvcp12 cysteine proteinase mRNAs. The tvcp4 and tvcp12 mRNAs have a stem-loop structure in the 5'-coding region or in the 3'-UTR, respectively that interacts with T. vaginalis multifunctional proteins HSP70, α-Actinin, and Actin under iron starvation condition, causing translation inhibition or mRNA stabilization similar to the previously characterized IRE-IRP system in eukaryotes. Herein, we summarize recent progress and shed some light on atypical RNA-binding proteins that may participate in the iron posttranscriptional regulation in T. vaginalis. PMID:26703754

  6. Genome-Wide Analysis of the Salmonella Fis Regulon and Its Regulatory Mechanism on Pathogenicity Islands

    PubMed Central

    Wang, Quan; Wang, Lei

    2013-01-01

    Fis, one of the most important nucleoid-associated proteins, functions as a global regulator of transcription in bacteria that has been comprehensively studied in Escherichia coli K12. Fis also influences the virulence of Salmonella enterica and pathogenic E. coli by regulating their virulence genes, however, the relevant mechanism is unclear. In this report, using combined RNA-seq and chromatin immunoprecipitation (ChIP)-seq technologies, we first identified 1646 Fis-regulated genes and 885 Fis-binding targets in the S. enterica serovar Typhimurium, and found a Fis regulon different from that in E. coli. Fis has been reported to contribute to the invasion ability of S. enterica. By using cell infection assays, we found it also enhances the intracellular replication ability of S. enterica within macrophage cell, which is of central importance for the pathogenesis of infections. Salmonella pathogenicity islands (SPI)-1 and SPI-2 are crucial for the invasion and survival of S. enterica in host cells. Using mutation and overexpression experiments, real-time PCR analysis, and electrophoretic mobility shift assays, we demonstrated that Fis regulates 63 of the 94 Salmonella pathogenicity island (SPI)-1 and SPI-2 genes, by three regulatory modes: i) binds to SPI regulators in the gene body or in upstream regions; ii) binds to SPI genes directly to mediate transcriptional activation of themselves and downstream genes; iii) binds to gene encoding OmpR which affects SPI gene expression by controlling SPI regulators SsrA and HilD. Our results provide new insights into the impact of Fis on SPI genes and the pathogenicity of S. enterica. PMID:23717649

  7. Deciphering Transcriptional Regulatory Mechanisms Associated with Hemicellulose Degradation in Neurospora crassa

    PubMed Central

    Sun, Jianping; Tian, Chaoguang; Diamond, Spencer

    2012-01-01

    Hemicellulose, the second most abundant plant biomass fraction after cellulose, is widely viewed as a potential substrate for the production of liquid fuels and other value-added materials. Degradation of hemicellulose by filamentous fungi requires production of many different enzymes, which are induced by biopolymers or its derivatives and regulated mainly at the transcriptional level through transcription factors (TFs). Neurospora crassa, a model filamentous fungus, expresses and secretes enzymes required for plant cell wall deconstruction. To better understand genes specifically associated with degradation of hemicellulose, we applied secretome and transcriptome analysis to N. crassa grown on beechwood xylan. We identified 34 secreted proteins and 353 genes with elevated transcription on xylan. The xylanolytic phenotype of strains with deletions in genes identified from the secretome and transcriptome analysis of the wild type was assessed, revealing functions for known and unknown proteins associated with hemicellulose degradation. By evaluating phenotypes of strains containing deletions of predicted TF genes in N. crassa, we identified a TF (XLR-1; xylan degradation regulator 1) essential for hemicellulose degradation that is an ortholog to XlnR/XYR1 in Aspergillus and Trichoderma species, respectively, a major transcriptional regulator of genes encoding both cellulases and hemicellulases. Deletion of xlr-1 in N. crassa abolished growth on xylan and xylose, but growth on cellulose and cellulolytic activity were only slightly affected. To determine the regulatory mechanisms for hemicellulose degradation, we explored the transcriptional regulon of XLR-1 under xylose, xylanolytic, and cellulolytic conditions. XLR-1 regulated only some predicted hemicellulase genes in N. crassa and was required for a full induction of several cellulase genes. Hemicellulase gene expression was induced by a combination of release from carbon catabolite repression (CCR) and induction

  8. Analysis of regulatory mechanism after ErbB4 gene mutation based on local modeling methodology.

    PubMed

    Chen, C L; Zhao, J W

    2016-05-13

    ErbB4 is an oncogene belonging to the epidermal growth factor receptor family and contributes to the occurrence and development of multiple cancers, such as gastric, breast, and colorectal cancers. Therefore, studies of the regulation of ErbB4 in cancerigenic pathway will advance molecular targeted therapy. Advanced bioinformatic analysis softwares, such as ExPASy, Predictprotei, QUARK, and I-TASSER, were used to analyze the regulatory mechanism after ErbB4 gene mutation in terms of amino acid sequence, primary, secondary, and tertiary structure of the protein and upstream-downstream receptor/ligands. Mutation of the 19th and 113th amino acids at the carboxyl terminus of ErbB4 protein did not affect its biological nature, but its secondary structure changed and protein binding sites were near 2 mutational sites; moreover, after mutation introduction, additional binding sites were observed. Tertiary structure modeling indicated that local structure of ErbB4 was changed from an α helical conformation into a β chain folding structure; the α helical conformation is the functional site of protein, while active sites are typically near junctions between helical regions, thus the helical structures are easily destroyed and change into folding structures or other structures after stretching. Mutable sites of ErbB4 is exact binding sites where dimer formed with other epidermal growth factor family proteins; mutation enabled the ErbB4 receptor to bind to neuregulin 1 ligand without dimer formation, disrupting the signal transduction pathway and affecting ErbB4 function.

  9. Nitrous Oxide Metabolism in Nitrate-Reducing Bacteria: Physiology and Regulatory Mechanisms.

    PubMed

    Torres, M J; Simon, J; Rowley, G; Bedmar, E J; Richardson, D J; Gates, A J; Delgado, M J

    2016-01-01

    Nitrous oxide (N2O) is an important greenhouse gas (GHG) with substantial global warming potential and also contributes to ozone depletion through photochemical nitric oxide (NO) production in the stratosphere. The negative effects of N2O on climate and stratospheric ozone make N2O mitigation an international challenge. More than 60% of global N2O emissions are emitted from agricultural soils mainly due to the application of synthetic nitrogen-containing fertilizers. Thus, mitigation strategies must be developed which increase (or at least do not negatively impact) on agricultural efficiency whilst decrease the levels of N2O released. This aim is particularly important in the context of the ever expanding population and subsequent increased burden on the food chain. More than two-thirds of N2O emissions from soils can be attributed to bacterial and fungal denitrification and nitrification processes. In ammonia-oxidizing bacteria, N2O is formed through the oxidation of hydroxylamine to nitrite. In denitrifiers, nitrate is reduced to N2 via nitrite, NO and N2O production. In addition to denitrification, respiratory nitrate ammonification (also termed dissimilatory nitrate reduction to ammonium) is another important nitrate-reducing mechanism in soil, responsible for the loss of nitrate and production of N2O from reduction of NO that is formed as a by-product of the reduction process. This review will synthesize our current understanding of the environmental, regulatory and biochemical control of N2O emissions by nitrate-reducing bacteria and point to new solutions for agricultural GHG mitigation. © 2016 Elsevier Ltd. All rights reserved.

  10. An examination of the regulatory mechanism of Pxdn mutation-induced eye disorders using microarray analysis

    PubMed Central

    YANG, YANG; XING, YIQIAO; LIANG, CHAOQUN; HU, LIYA; XU, FEI; MEI, QI

    2016-01-01

    The present study aimed to identify biomarkers for peroxidasin (Pxdn) mutation-induced eye disorders and study the underlying mechanisms involved in this process. The microarray dataset GSE49704 was used, which encompasses 4 mouse samples from embryos with Pxdn mutation and 4 samples from normal tissues. After data preprocessing, the differentially expressed genes (DEGs) between Pxdn mutation and normal tissues were identified using the t-test in the limma package, followed by functional enrichment analysis. The protein-protein interaction (PPI) network was constructed based on the STRING database, and the transcriptional regulatory (TR) network was established using the GeneCodis database. Subsequently, the overlapping DEGs with high degrees in two networks were identified, as well as the sub-network extracted from the TR network. In total, 121 (75 upregulated and 46 downregulated) DEGs were identified, and these DEGs play important roles in biological processes (BPs), including neuron development and differentiation. A PPI network containing 25 nodes such as actin, alpha 1, skeletal muscle (Acta1) and troponin C type 2 (fast) (Tnnc2), and a TR network including 120 nodes were built. By comparing the two networks, seven crucial genes which overlapped were identified, including cyclin-dependent kinase inhibitor 1B (Cdkn1b), Acta1 and troponin T type 3 (Tnnt3). In the sub-network, Cdkn1b was predicted as the target of miRNAs such as mmu-miR-24 and transcription factors (TFs) including forkhead box O4 (FOXO4) and activating enhancer binding protein 4 (AP4). Thus, we suggest that seven crucial genes, including Cdkn1b, Acta1 and Tnnt3, play important roles in the progression of eye disorders such as glaucoma. We suggest that Cdkn1b exert its effects via the inhibition of proliferation and is mediated by mmu-miR-24 and targeted by the TFs FOXO4 and AP4. PMID:27121343

  11. Regulatory mechanisms underlying sepsis progression in patients with tumor necrosis factor-α genetic variations

    PubMed Central

    LIU, YANGZHOU; HAN, NING; LI, QINCHUAN; LI, ZENGCHUN

    2016-01-01

    The present study aimed to investigate the regulatory mechanisms underlying sepsis progression in patients with tumor necrosis factor (TNF)-α genetic variations. The GSE5760 expression profile data, which was downloaded from the Gene Expression Omnibus database, contained 30 wild-type (WT) and 28 mutation (MUT) samples. Differentially expressed genes (DEGs) between the two types of samples were identified using the Student's t-test, and the corresponding microRNAs (miRNAs) were screened using WebGestalt software. An integrated miRNA-DEG network was constructed using the Cytoscape software, based on the interactions between the DEGs, as identified using the Search Tool for the Retrieval of Interacting Genes/Proteins database, and the correlation between miRNAs and their target genes. Furthermore, Gene Ontology and pathway enrichment analyses were conducted for the DEGs using the Database for Annotation, Visualization and Integrated Discovery and the KEGG Orthology Based Annotation System, respectively. A total of 390 DEGS between the WT and MUT samples, along with 11 -associated miRNAs, were identified. The integrated miRNA-DEG network consisted of 38 DEGs and 11 miRNAs. Within this network, COPS2 was found to be associated with transcriptional functions, while FUS was found to be involved in mRNA metabolic processes. Other DEGs, including FBXW7 and CUL3, were enriched in the ubiquitin-mediated proteolysis pathway. In addition, miR-15 was predicted to target COPS2 and CUL3. The results of the present study suggested that COPS2, FUS, FBXW7 and CUL3 may be associated with sepsis in patients with TNF-α genetic variations. In the progression of sepsis, FBXW7 and CUL3 may participate in the ubiquitin-mediated proteolysis pathway, whereas COPS2 may regulate the phosphorylation and ubiquitination of the FUS protein. Furthermore, COPS2 and CUL3 may be novel targets of miR-15. PMID:27347057

  12. High-risk medical devices, children and the FDA: regulatory challenges facing pediatric mechanical circulatory support devices.

    PubMed

    Almond, Christopher S D; Chen, Eric A; Berman, Michael R; Less, Joanne R; Baldwin, J Timothy; Linde-Feucht, Sarah R; Hoke, Tracey R; Pearson, Gail D; Jenkins, Kathy; Duncan, Brian W; Zuckerman, Bram D

    2007-01-01

    Pediatric mechanical circulatory support is a critical unmet need in the United States. Infant- and child-sized ventricular assist devices are currently being developed largely through federal contracts and grants through the National Heart, Lung, and Blood Institute (NHLBI). Human testing and marketing of high-risk devices for children raises epidemiologic and regulatory issues that will need to be addressed. Leaders from the US Food and Drug Administration (FDA), NHLBI, academic pediatric community, and industry convened in January 2006 for the first FDA Workshop on the Regulatory Process for Pediatric Mechanical Circulatory Support Devices. The purpose was to provide the pediatric community with an overview of the federal regulatory process for high-risk medical devices and to review the challenges specific to the development and regulation of pediatric mechanical circulatory support devices. Pediatric mechanical circulatory support present significant epidemiologic, logistic, and financial challenges to industry, federal regulators, and the pediatric community. Early interactions with the FDA, shared appreciation of challenges, and careful planning will be critical to avoid unnecessary delays in making potentially life-saving devices available for children. Collaborative efforts to address these challenges are warranted.

  13. Regulatory Mechanisms Involved in the Expression of Brain-Derived Neurotrophic Factor and Glial Cell Line-Derived Neurotrophic Factor

    DTIC Science & Technology

    1996-03-01

    of Philosophy, 1996 Dissertation Advisor: Gregory P. Mueller, PhD. Associate Professor Department of Physiology Brain-derived neurotrophic factor ( BDNF ...postsynaptic effects of BDNF and GDNF, very few have addressed the regulatory mechanisms involved in the expression of these factors. In phase 1 of the project...five alternate first exons contained in the rat BDNF gene, including a novel one termed exon la, were isolated and found to be individually spliced to

  14. Influence of visual impairment level on the regulatory mechanism used during the approach phase of a long jump.

    PubMed

    Theodorou, Apostolos; Skordilis, Emmanouil; Plainis, Sotiris; Panoutsakopoulos, Vassilios; Panteli, Flora

    2013-08-01

    The purpose of the study was to investigate the occurrence of stride regulation at the approach phase of the long jump in athletes with normal vision and visually deprived Class F12 and F13 athletes. All the athletes exhibited the presence of a regulatory mechanism. In the normal vision group this occurred on the fifth-to-last stride. In Class F12 athletes regulation commenced on the fourth-to-last stride for males and third-to-last stride for females. Class F13 males commenced regulation, like the control group, on the fifth-to-last stride; but females commenced on the fourth-to-last stride. The study demonstrated that reduced vision does not prevent Class F12 and F13 athletes from applying a regulatory mechanism similar to that observed in sighted athletes. However, the control mechanism of regulation emerged earlier in non-visually deprived long jumpers and the least visually impaired Class F13 athletes, signifying the importance of visual function in the regulatory stimuli.

  15. Regulatory mechanisms in arterial hypertension: role of microRNA in pathophysiology and therapy.

    PubMed

    Klimczak, Dominika; Jazdzewski, Krystian; Kuch, Marek

    2017-02-01

    Multiple factors underlie the pathophysiology of hypertension, involving endothelial dysregulation, vascular smooth muscle dysfunction, increased oxidative stress, sympathetic nervous system activation and altered renin -angiotensin -aldosterone regulatory activity. A class of non-coding RNA called microRNA, consisting of 17-25 nucleotides, exert regulatory function over these processes. This paper summarizes the currently available data from preclinical and clinical studies on miRNA in the development of hypertension as well as the impact of anti-hypertensive treatment on their plasma expression. We present microRNAs' characteristics, their biogenesis and role in the regulation of blood pressure together with their potential diagnostic and therapeutic application in clinical practice.

  16. Brucella BioR regulator defines a complex regulatory mechanism for bacterial biotin metabolism.

    PubMed

    Feng, Youjun; Xu, Jie; Zhang, Huimin; Chen, Zeliang; Srinivas, Swaminath

    2013-08-01

    The enzyme cofactor biotin (vitamin H or B7) is an energetically expensive molecule whose de novo biosynthesis requires 20 ATP equivalents. It seems quite likely that diverse mechanisms have evolved to tightly regulate its biosynthesis. Unlike the model regulator BirA, a bifunctional biotin protein ligase with the capability of repressing the biotin biosynthetic pathway, BioR has been recently reported by us as an alternative machinery and a new type of GntR family transcriptional factor that can repress the expression of the bioBFDAZ operon in the plant pathogen Agrobacterium tumefaciens. However, quite unusually, a closely related human pathogen, Brucella melitensis, has four putative BioR-binding sites (both bioR and bioY possess one site in the promoter region, whereas the bioBFDAZ [bio] operon contains two tandem BioR boxes). This raised the question of whether BioR mediates the complex regulatory network of biotin metabolism. Here, we report that this is the case. The B. melitensis BioR ortholog was overexpressed and purified to homogeneity, and its solution structure was found to be dimeric. Functional complementation in a bioR isogenic mutant of A. tumefaciens elucidated that Brucella BioR is a functional repressor. Electrophoretic mobility shift assays demonstrated that the four predicted BioR sites of Brucella plus the BioR site of A. tumefaciens can all interact with the Brucella BioR protein. In a reporter strain that we developed on the basis of a double mutant of A. tumefaciens (the ΔbioR ΔbioBFDA mutant), the β-galactosidase (β-Gal) activity of three plasmid-borne transcriptional fusions (bioBbme-lacZ, bioYbme-lacZ, and bioRbme-lacZ) was dramatically decreased upon overexpression of Brucella bioR. Real-time quantitative PCR analyses showed that the expression of bioBFDA and bioY is significantly elevated upon removal of bioR from B. melitensis. Together, we conclude that Brucella BioR is not only a negative autoregulator but also a repressor of

  17. Regulatory mechanisms of testosterone-stimulated song in the sensorimotor nucleus HVC of female songbirds.

    PubMed

    Dittrich, Falk; Ramenda, Claudia; Grillitsch, Doris; Frankl-Vilches, Carolina; Ko, Meng-Ching; Hertel, Moritz; Goymann, Wolfgang; ter Maat, Andries; Gahr, Manfred

    2014-12-02

    differentiation processes in the HVC that were partially similar to those seen in the HVC of testosterone-treated female canaries. Other modes of testosterone action, notably related to synaptic transmission, appeared to be regulated in a more species-specific manner in the female HVC. Divergent effects of testosterone on the HVC of different species might be related to differences between species in regulatory mechanisms of the singing behavior.

  18. Brucella BioR Regulator Defines a Complex Regulatory Mechanism for Bacterial Biotin Metabolism

    PubMed Central

    Xu, Jie; Zhang, Huimin; Srinivas, Swaminath

    2013-01-01

    The enzyme cofactor biotin (vitamin H or B7) is an energetically expensive molecule whose de novo biosynthesis requires 20 ATP equivalents. It seems quite likely that diverse mechanisms have evolved to tightly regulate its biosynthesis. Unlike the model regulator BirA, a bifunctional biotin protein ligase with the capability of repressing the biotin biosynthetic pathway, BioR has been recently reported by us as an alternative machinery and a new type of GntR family transcriptional factor that can repress the expression of the bioBFDAZ operon in the plant pathogen Agrobacterium tumefaciens. However, quite unusually, a closely related human pathogen, Brucella melitensis, has four putative BioR-binding sites (both bioR and bioY possess one site in the promoter region, whereas the bioBFDAZ [bio] operon contains two tandem BioR boxes). This raised the question of whether BioR mediates the complex regulatory network of biotin metabolism. Here, we report that this is the case. The B. melitensis BioR ortholog was overexpressed and purified to homogeneity, and its solution structure was found to be dimeric. Functional complementation in a bioR isogenic mutant of A. tumefaciens elucidated that Brucella BioR is a functional repressor. Electrophoretic mobility shift assays demonstrated that the four predicted BioR sites of Brucella plus the BioR site of A. tumefaciens can all interact with the Brucella BioR protein. In a reporter strain that we developed on the basis of a double mutant of A. tumefaciens (the ΔbioR ΔbioBFDA mutant), the β-galactosidase (β-Gal) activity of three plasmid-borne transcriptional fusions (bioBbme-lacZ, bioYbme-lacZ, and bioRbme-lacZ) was dramatically decreased upon overexpression of Brucella bioR. Real-time quantitative PCR analyses showed that the expression of bioBFDA and bioY is significantly elevated upon removal of bioR from B. melitensis. Together, we conclude that Brucella BioR is not only a negative autoregulator but also a repressor of

  19. Regulatory Mechanisms of the Molecular Pathways in Fibrosis Induced by MicroRNAs

    PubMed Central

    Yang, Cui; Zheng, Si-Dao; Wu, Hong-Jin; Chen, Shao-Jun

    2016-01-01

    Objective: MicroRNAs (miRNAs or miRs) play critical roles in the fibrotic process in different organs. We summarized the latest research progress on the roles and mechanisms of miRNAs in the regulation of the molecular signaling pathways involved in fibrosis. Data Sources: Papers published in English from January 2010 to August 2015 were selected from the PubMed and Web of Science databases using the search terms “microRNA”, “miR”, “transforming growth factor β”, “tgf β”, “mitogen-activated protein kinase”, “mapk”, “integrin”, “p38”, “c-Jun NH2-terminal kinase”, “jnk”, “extracellular signal-regulated kinase”, “erk”, and “fibrosis”. Study Selection: Articles were obtained and reviewed to analyze the regulatory effects of miRNAs on molecular signaling pathways involved in the fibrosis. Results: Recent evidence has shown that miRNAs are involved in regulating fibrosis by targeting different substrates in the molecular processes that drive fibrosis, such as immune cell sensitization, effector cell activation, and extracellular matrix remodeling. Moreover, several important molecular signaling pathways involve in fibrosis, such as the transforming growth factor-beta (TGF-β) pathway, mitogen-activated protein kinase (MAPK) pathways, and the integrin pathway are regulated by miRNAs. Third, regulation of the fibrotic pathways induced by miRNAs is found in many other tissues in addition to the heart, lung, liver, and kidney. Interestingly, the actions of many drugs on the human body are also induced by miRNAs. It is encouraging that the fibrotic process can be blocked or reversed by targeting specific miRNAs and their signaling pathways, thereby protecting the structures and functions of different organs. Conclusions: miRNAs not only regulate molecular signaling pathways in fibrosis but also serve as potential targets of novel therapeutic interventions for fibrosing diseases. PMID:27647197

  20. Analysis of weighted co-regulatory networks in maize provides insights into new genes and regulatory mechanisms related to inositol phosphate metabolism.

    PubMed

    Zhang, Shaojun; Yang, Wenzhu; Zhao, Qianqian; Zhou, Xiaojin; Jiang, Ling; Ma, Shuai; Liu, Xiaoqing; Li, Ye; Zhang, Chunyi; Fan, Yunliu; Chen, Rumei

    2016-02-24

    D-myo-inositol phosphates (IPs) are a series of phosphate esters. Myo-inositol hexakisphosphate (phytic acid, IP6) is the most abundant IP and has negative effects on animal and human nutrition. IPs play important roles in plant development, stress responses, and signal transduction. However, the metabolic pathways and possible regulatory mechanisms of IPs in maize are unclear. In this study, the B73 (high in phytic acid) and Qi319 (low in phytic acid) lines were selected for RNA-Seq analysis from 427 inbred lines based on a screening of IP levels. By integrating the metabolite data with the RNA-Seq data at three different kernel developmental stages (12, 21 and 30 days after pollination), co-regulatory networks were constructed to explore IP metabolism and its interactions with other pathways. Differentially expressed gene analyses showed that the expression of MIPS and ITPK was related to differences in IP metabolism in Qi319 and B73. Moreover, WRKY and ethylene-responsive transcription factors (TFs) were common among the differentially expressed TFs, and are likely to be involved in the regulation of IP metabolism. Six co-regulatory networks were constructed, and three were chosen for further analysis. Based on network analyses, we proposed that the GA pathway interacts with the IP pathway through the ubiquitination pathway, and that Ca(2+) signaling functions as a bridge between IPs and other pathways. IP pools were found to be transported by specific ATP-binding cassette (ABC) transporters. Finally, three candidate genes (Mf3, DH2 and CB5) were identified and validated using Arabidopsis lines with mutations in orthologous genes or RNA interference (RNAi)-transgenic maize lines. Some mutant or RNAi lines exhibited seeds with a low-phytic-acid phenotype, indicating perturbation of IP metabolism. Mf3 likely encodes an enzyme involved in IP synthesis, DH2 encodes a transporter responsible for IP transport across organs and CB5 encodes a transporter involved in IP

  1. [Peripheral blood circulation in the skin and the regulatory mechanisms in the course of primary transmural myocardial infarction].

    PubMed

    Khalepo, O V; Molotkov, O V; Eshkina, S L

    2009-01-01

    Laser Doppler flowmetry was used to study the indicators characterizing the peripheral blood circulation in the skin, regulatory mechanisms, and the compensatory capacities of the microcirculatory bed in 32 patients aged 45-60 years in the course of primary transmural myocardial infarction during exercise tests. Significant disturbances of the mechanism responsible for regulating the peripheral blood circulation system and chiefly its active components were detected in the presence of adequate blood filling of microvessels. There was a drastic decrease in the reserves of skin microvascular endothelial activity during ionophoresis of sodium nitroprusside and acetylcholine, the maximum degree of disturbances being observed on day 10 of myocardial infarction development.

  2. Leucine Facilitates Insulin Signaling through a Gαi Protein-dependent Signaling Pathway in Hepatocytes*

    PubMed Central

    Yang, Xuefeng; Mei, Shuang; Wang, Xiaolei; Li, Xiang; Liu, Rui; Ma, Yan; Hao, Liping; Yao, Ping; Liu, Liegang; Sun, Xiufa; Gu, Haihua; Liu, Zhenqi; Cao, Wenhong

    2013-01-01

    In this study, we addressed the direct effect of leucine on insulin signaling. In investigating the associated mechanisms, we found that leucine itself does not activate the classical Akt- or ERK1/2 MAP kinase-dependent signaling pathways but can facilitate the insulin-induced phosphorylations of Akt473 and ERK1/2 in a time- and dose-dependent manner in cultured hepatocytes. The leucine-facilitated insulin-induced phosphorylation of Akt at residue 473 was not affected by knocking down the key component of mTORC1 or -2 complexes but was blocked by inhibition of c-Src (PP2), PI3K (LY294002), Gαi protein (pertussis toxin or siRNA against Gαi1 gene, or β-arrestin 2 (siRNA)). Similarly, the leucine-facilitated insulin activation of ERK1/2 was also blunted by pertussis toxin. We further show that leucine facilitated the insulin-mediated suppression of glucose production and expression of key gluconeogenic genes in a Gαi1 protein-dependent manner in cultured primary hepatocytes. Together, these results show that leucine can directly facilitate insulin signaling through a Gαi protein-dependent intracellular signaling pathway. This is the first evidence showing that macronutrients like amino acid leucine can facilitate insulin signaling through G proteins directly. PMID:23404499

  3. Analysis of the Transcription Regulatory Mechanism of Otx During the Development of the Sensory Vesicle in Ciona intestinalis.

    PubMed

    Oonuma, Kouhei; Hirose, Dan; Takatori, Naohito; Saiga, Hidetoshi

    2014-09-01

    Establishment of the anterior-posterior axis is an important event in the development of bilateral animals. A homeodomain transcription factor, Otx, is important for the formation of the anterior part of the embryo, and its mRNA is expressed in a continuous manner in a wide range of animals. This pattern of expression is thought to be important for the formation of anterior neural structures, but the mechanism that regulates Otx expression remains largely unknown. Towards understanding how the transcription of Otx is maintained in the cells of anterior neural structure, the sensory vesicle, during embryogenesis, we examined transcription regulatory mechanisms of Otx, using embryos of the ascidian, Ciona intestinalis, from the gastrula to tailbud stages, which have not been studied previously. We identified two genomic regions capable of mimicking the Otx expression pattern from the gastrula to tailbud stages. Putative transcription factor binding sites required for this activity were identified. Notably, distinct sets of transcription factor binding sites were required at different developmental stages for the expression of Otx, suggesting that the continuity of Otx is supported by distinct transcriptional mechanisms in the gastrula and neurula stages. Along with previous studies using Halocynthia roretzi, the present results provide insight into the evolution of transcriptional regulatory mechanism of Otx.

  4. Biofilm formation by Bacillus subtilis: new insights into regulatory strategies and assembly mechanisms.

    PubMed

    Cairns, Lynne S; Hobley, Laura; Stanley-Wall, Nicola R

    2014-08-01

    Biofilm formation is a social behaviour that generates favourable conditions for sustained survival in the natural environment. For the Gram-positive bacterium Bacillus subtilis the process involves the differentiation of cell fate within an isogenic population and the production of communal goods that form the biofilm matrix. Here we review recent progress in understanding the regulatory pathways that control biofilm formation and highlight developments in understanding the composition, function and structure of the biofilm matrix.

  5. Biofilm formation by Bacillus subtilis: new insights into regulatory strategies and assembly mechanisms

    PubMed Central

    Cairns, Lynne S; Hobley, Laura; Stanley-Wall, Nicola R

    2014-01-01

    Biofilm formation is a social behaviour that generates favourable conditions for sustained survival in the natural environment. For the Gram-positive bacterium Bacillus subtilis the process involves the differentiation of cell fate within an isogenic population and the production of communal goods that form the biofilm matrix. Here we review recent progress in understanding the regulatory pathways that control biofilm formation and highlight developments in understanding the composition, function and structure of the biofilm matrix. PMID:24988880

  6. CHOOSING A CHEMICAL MECHANISM FOR REGULATORY AND RESEARCH AIR QUALITY MODELING APPLICATIONS

    EPA Science Inventory

    There are numerous, different chemical mechanisms currently available for use in air quality models, and new mechanisms and versions of mechanisms are continually being developed. The development of Morphecule-type mechanisms will add a near-infinite number of additional mecha...

  7. CHOOSING A CHEMICAL MECHANISM FOR REGULATORY AND RESEARCH AIR QUALITY MODELING APPLICATIONS

    EPA Science Inventory

    There are numerous, different chemical mechanisms currently available for use in air quality models, and new mechanisms and versions of mechanisms are continually being developed. The development of Morphecule-type mechanisms will add a near-infinite number of additional mecha...

  8. Activation of Vago by interferon regulatory factor (IRF) suggests an interferon system-like antiviral mechanism in shrimp

    PubMed Central

    Li, Chaozheng; Li, Haoyang; Chen, Yixiao; Chen, Yonggui; Wang, Sheng; Weng, Shao-Ping; Xu, Xiaopeng; He, Jianguo

    2015-01-01

    There is a debate on whether invertebrates possess an antiviral immunity similar to the interferon (IFN) system of vertebrates. The Vago gene from arthropods encodes a viral-activated secreted peptide that restricts virus infection through activating the JAK-STAT pathway and is considered to be a cytokine functionally similar to IFN. In this study, the first crustacean IFN regulatory factor (IRF)-like gene was identified in Pacific white shrimp, Litopenaeus vannamei. The L. vannamei IRF showed similar protein nature to mammalian IRFs and could be activated during virus infection. As a transcriptional regulatory factor, L. vannamei IRF could activate the IFN-stimulated response element (ISRE)-containing promoter to regulate the expression of mammalian type I IFNs and initiate an antiviral state in mammalian cells. More importantly, IRF could bind the 5′-untranslated region of L. vannamei Vago4 gene and activate its transcription, suggesting that shrimp Vago may be induced in a similar manner to that of IFNs and supporting the opinion that Vago might function as an IFN-like molecule in invertebrates. These suggested that shrimp might possess an IRF-Vago-JAK/STAT regulatory axis, which is similar to the IRF-IFN-JAK/STAT axis of vertebrates, indicating that invertebrates might possess an IFN system-like antiviral mechanism. PMID:26459861

  9. Activation of Vago by interferon regulatory factor (IRF) suggests an interferon system-like antiviral mechanism in shrimp.

    PubMed

    Li, Chaozheng; Li, Haoyang; Chen, Yixiao; Chen, Yonggui; Wang, Sheng; Weng, Shao-Ping; Xu, Xiaopeng; He, Jianguo

    2015-10-13

    There is a debate on whether invertebrates possess an antiviral immunity similar to the interferon (IFN) system of vertebrates. The Vago gene from arthropods encodes a viral-activated secreted peptide that restricts virus infection through activating the JAK-STAT pathway and is considered to be a cytokine functionally similar to IFN. In this study, the first crustacean IFN regulatory factor (IRF)-like gene was identified in Pacific white shrimp, Litopenaeus vannamei. The L. vannamei IRF showed similar protein nature to mammalian IRFs and could be activated during virus infection. As a transcriptional regulatory factor, L. vannamei IRF could activate the IFN-stimulated response element (ISRE)-containing promoter to regulate the expression of mammalian type I IFNs and initiate an antiviral state in mammalian cells. More importantly, IRF could bind the 5'-untranslated region of L. vannamei Vago4 gene and activate its transcription, suggesting that shrimp Vago may be induced in a similar manner to that of IFNs and supporting the opinion that Vago might function as an IFN-like molecule in invertebrates. These suggested that shrimp might possess an IRF-Vago-JAK/STAT regulatory axis, which is similar to the IRF-IFN-JAK/STAT axis of vertebrates, indicating that invertebrates might possess an IFN system-like antiviral mechanism.

  10. Role of Sodium Bicarbonate Cotransporters in Intracellular pH Regulation and Their Regulatory Mechanisms in Human Submandibular Glands.

    PubMed

    Namkoong, Eun; Shin, Yong-Hwan; Bae, Jun-Seok; Choi, Seulki; Kim, Minkyoung; Kim, Nahyun; Hwang, Sung-Min; Park, Kyungpyo

    2015-01-01

    Sodium bicarbonate cotransporters (NBCs) are involved in the pH regulation of salivary glands. However, the roles and regulatory mechanisms among different NBC isotypes have not been rigorously evaluated. We investigated the roles of two different types of NBCs, electroneutral (NBCn1) and electrogenic NBC (NBCe1), with respect to pH regulation and regulatory mechanisms using human submandibular glands (hSMGs) and HSG cells. Intracellular pH (pHi) was measured and the pHi recovery rate from cell acidification induced by an NH4Cl pulse was recorded. Subcellular localization and protein phosphorylation were determined using immunohistochemistry and co-immunoprecipitation techniques. We determined that NBCn1 is expressed on the basolateral side of acinar cells and the apical side of duct cells, while NBCe1 is exclusively expressed on the apical membrane of duct cells. The pHi recovery rate in hSMG acinar cells, which only express NBCn1, was not affected by pre-incubation with 5 μM PP2, an Src tyrosine kinase inhibitor. However, in HSG cells, which express both NBCe1 and NBCn1, the pHi recovery rate was inhibited by PP2. The apparent difference in regulatory mechanisms for NBCn1 and NBCe1 was evaluated by artificial overexpression of NBCn1 or NBCe1 in HSG cells, which revealed that the pHi recovery rate was only inhibited by PP2 in cells overexpressing NBCe1. Furthermore, only NBCe1 was significantly phosphorylated and translocated by NH4Cl, which was inhibited by PP2. Our results suggest that both NBCn1 and NBCe1 play a role in pHi regulation in hSMG acinar cells, and also that Src kinase does not regulate the activity of NBCn1.

  11. Mechanisms of diabetic autoimmunity: II--Is diabetes a central or peripheral disorder of effector and regulatory cells?

    PubMed

    Askenasy, Nadir

    2016-02-01

    Two competing hypotheses aiming to explain the onset of autoimmune reactions are discussed in the context of genetic and environmental predisposition to type 1 diabetes (T1D). The first hypothesis has evolved along characterization of the mechanisms of self-discrimination and attributes diabetic autoimmunity to escape of reactive T cells from central regulation in the thymus. The second considers frequent occurrence of autoimmune reactions within the immune homunculus, which are adequately suppressed by regulatory T cells originating from the thymus, and occasionally, insufficient suppression results in autoimmunity. Besides thymic dysfunction, deregulation of both effector and suppressor cells can in fact result from homeostatic aberrations at the peripheral level during initial stages of evolution of adaptive immunity. Pathogenic cells sensitized in the islets are efficiently expanded in the target tissue and pancreatic lymph nodes of lymphopenic neonates. In parallel, the same mechanisms of peripheral sensitization contribute to tolerization through education of naïve/effector T cells and expansion of regulatory T cells. Experimental evidence presented for each individual mechanism implies that T1D may result from a primary effector or suppressor immune abnormality. Disturbed self-tolerance leading to T1D may well result from peripheral deregulation of innate and adaptive immunity, with variable contribution of central thymic dysfunction.

  12. Thermo-mechanical study of bare 48Y UF6 containers exposed to the regulatory fire environment.

    SciTech Connect

    Ammerman, Douglas James; Lopez, Carlos; Morrow, Charles; Korbmacher, Tim; Charette, Marc-Andre

    2010-11-01

    Most of the regulatory agencies world-wide require that containers used for the transportation of natural UF6 and depleted UF6 must survive a fully-engulfing fire environment for 30 minutes as described in 10CFR71 and in TS-R-1. The primary objective of this project is to examine the thermo-mechanical performance of 48Y transportation cylinders when exposed to the regulatory hypothetical fire environment without the thermal protection that is currently used for shipments in those countries where required. Several studies have been performed in which UF6 cylinders have been analyzed to determine if the thermal protection currently used on UF6 cylinders of type 48Y is necessary for transport. However, none of them could clearly confirm neither the survival nor the failure of the 48Y cylinder when exposed to the regulatory fire environment without the additional thermal protection. A consortium of five companies that move UF6 is interested in determining if 48Y cylinders can be shipped without the thermal protection that is currently used. Sandia National Laboratories has outlined a comprehensive testing and analysis project to determine if these shipping cylinders are capable of withstanding the regulatory thermal environment without additional thermal protection. Sandia-developed coupled physics codes will be used for the analyses that are planned. A series of destructive and non-destructive tests will be performed to acquire the necessary material and behavior information to benchmark the models and to answer the question about the ability of these containers to survive the fire environment. Both the testing and the analysis phases of this project will consider the state of UF6 under thermal and pressure loads as well as the weakening of the steel container due to the thermal load. Experiments with UF6 are also planned to collect temperature- and pressure-dependent thermophysical properties of this material.

  13. Mosaic gene network modelling identified new regulatory mechanisms in HCV infection.

    PubMed

    Popik, Olga V; Petrovskiy, Evgeny D; Mishchenko, Elena L; Lavrik, Inna N; Ivanisenko, Vladimir A

    2016-06-15

    Modelling of gene networks is widely used in systems biology to study the functioning of complex biological systems. Most of the existing mathematical modelling techniques are useful for analysis of well-studied biological processes, for which information on rates of reactions is available. However, complex biological processes such as those determining the phenotypic traits of organisms or pathological disease processes, including pathogen-host interactions, involve complicated cross-talk between interacting networks. Furthermore, the intrinsic details of the interactions between these networks are often missing. In this study, we developed an approach, which we call mosaic network modelling, that allows the combination of independent mathematical models of gene regulatory networks and, thereby, description of complex biological systems. The advantage of this approach is that it allows us to generate the integrated model despite the fact that information on molecular interactions between parts of the model (so-called mosaic fragments) might be missing. To generate a mosaic mathematical model, we used control theory and mathematical models, written in the form of a system of ordinary differential equations (ODEs). In the present study, we investigated the efficiency of this method in modelling the dynamics of more than 10,000 simulated mosaic regulatory networks consisting of two pieces. Analysis revealed that this approach was highly efficient, as the mean deviation of the dynamics of mosaic network elements from the behaviour of the initial parts of the model was less than 10%. It turned out that for construction of the control functional, data on perturbation of one or two vertices of the mosaic piece are sufficient. Further, we used the developed method to construct a mosaic gene regulatory network including hepatitis C virus (HCV) as the first piece and the tumour necrosis factor (TNF)-induced apoptosis and NF-κB induction pathways as the second piece. Thus

  14. Comparative analysis of mutant plants impaired in the main regulatory mechanisms of photosynthetic light reactions - From biophysical measurements to molecular mechanisms.

    PubMed

    Tikkanen, Mikko; Rantala, Sanna; Grieco, Michele; Aro, Eva-Mari

    2017-03-01

    Chlorophyll (chl) fluorescence emission by photosystem II (PSII) and light absorption by P700 reaction center chl a of photosystem I (PSI) provide easy means to probe the function of the photosynthetic machinery. The exact relationship between the measured optical variables and the molecular processes have, however, remained elusive. Today, the availability of mutants with distinct molecular characterization of photosynthesis regulatory processes should make it possible to gain further insights into this relationship, yet a systematic comparative analysis of such regulatory mutants has been missing. Here we have systematically compared the behavior of Dual-PAM fluorescence and P700 variables from well-characterized photosynthesis regulation mutants. The analysis revealed a very convincing relationship between the given molecular deficiency in the photosynthetic apparatus and the original fluorescence and P700 signals obtained by using varying intensities of actinic light and by applying a saturating pulse. Importantly, the specific information on the underlying molecular mechanism, present in these authentic signals of a given photosynthesis mutant, was largely nullified when using the commonly accepted parameters that are based on further treatment of the original signals. Understanding the unique relationship between the investigated molecular process of photosynthesis and the measured variable is an absolute prerequisite for comprehensive interpretation of fluorescence and P700 measurements. The data presented here elucidates the relationships between the main regulatory mechanisms controlling the photosynthetic light reactions and the variables obtained by fluorescence and P700 measurements. It is discussed how the full potential of optical photosynthesis measurements can be utilized in investigation of a given molecular mechanism.

  15. Transcriptional regulatory network triggered by oxidative signals configures the early response mechanisms of japonica rice to chilling stress

    PubMed Central

    2010-01-01

    Background The transcriptional regulatory network involved in low temperature response leading to acclimation has been established in Arabidopsis. In japonica rice, which can only withstand transient exposure to milder cold stress (10°C), an oxidative-mediated network has been proposed to play a key role in configuring early responses and short-term defenses. The components, hierarchical organization and physiological consequences of this network were further dissected by a systems-level approach. Results Regulatory clusters responding directly to oxidative signals were prominent during the initial 6 to 12 hours at 10°C. Early events mirrored a typical oxidative response based on striking similarities of the transcriptome to disease, elicitor and wounding induced processes. Targets of oxidative-mediated mechanisms are likely regulated by several classes of bZIP factors acting on as1/ocs/TGA-like element enriched clusters, ERF factors acting on GCC-box/JAre-like element enriched clusters and R2R3-MYB factors acting on MYB2-like element enriched clusters. Temporal induction of several H2O2-induced bZIP, ERF and MYB genes coincided with the transient H2O2 spikes within the initial 6 to 12 hours. Oxidative-independent responses involve DREB/CBF, RAP2 and RAV1 factors acting on DRE/CRT/rav1-like enriched clusters and bZIP factors acting on ABRE-like enriched clusters. Oxidative-mediated clusters were activated earlier than ABA-mediated clusters. Conclusion Genome-wide, physiological and whole-plant level analyses established a holistic view of chilling stress response mechanism of japonica rice. Early response regulatory network triggered by oxidative signals is critical for prolonged survival under sub-optimal temperature. Integration of stress and developmental responses leads to modulated growth and vigor maintenance contributing to a delay of plastic injuries. PMID:20100339

  16. Regulatory mechanism of the three-component system HptRSA in glucose-6-phosphate uptake in Staphylococcus aureus.

    PubMed

    Yang, Yifan; Sun, Haipeng; Liu, Xiaoyu; Wang, Mingxing; Xue, Ting; Sun, Baolin

    2016-06-01

    Glucose-6-phosphate (G6P) is a common alternative carbon source for various bacteria, and its uptake usually relies on the hexose phosphate antiporter UhpT. In the human pathogenic bacterium Staphylococcus aureus, the ability to utilize different nutrients, particularly alternative carbon source uptake in glucose-limiting conditions, is essential for its fitness in the host environment during the infectious process. It has been reported that G6P uptake in S. aureus is regulated by the three-component system HptRSA. When G6P is provided as the only carbon source, HptRSA could sense extracellular G6P and activate uhpT expression to facilitate G6P utilization. However, the regulatory mechanism of HptRSA is still unclear. In this study, we further investigated the HptRSA system in S. aureus. First, we confirmed that HptRSA is necessary for the normal growth of this pathogen in chemically defined medium with G6P supplementation, and we discovered that HptRSA could exclusively sense extracellular G6P compared to the other organophosphates we tested. Next, using isothermal titration calorimetry, we found that HptA could bind to G6P, suggesting that it may be the G6P sensor. After that experiment, using an electrophoresis mobility shift assay, we verified that the response regulator HptR could directly bind to the uhpT promoter and identified a putative binding site from -67 to -96-bp. Subsequently, we created different point mutations in the putative binding site and revealed that the entire 30-bp sequence is essential for HptR regulation. In summary, we unveiled the regulatory mechanism of the HptRSA system in S. aureus, HptA most likely functions as the G6P sensor, and HptR could implement its regulatory function by directly binding to a conserved, approximately 30-bp sequence in the uhpT promoter.

  17. Potential Novel Mechanism for Axenfeld-Rieger Syndrome: Deletion of a Distant Region Containing Regulatory Elements of PITX2

    PubMed Central

    Volkmann, Bethany A.; Zinkevich, Natalya S.; Mustonen, Aki; Schilter, Kala F.; Bosenko, Dmitry V.; Reis, Linda M.; Broeckel, Ulrich; Link, Brian A.

    2011-01-01

    Purpose. Mutations in PITX2 are associated with Axenfeld-Rieger syndrome (ARS), which involves ocular, dental, and umbilical abnormalities. Identification of cis-regulatory elements of PITX2 is important to better understand the mechanisms of disease. Methods. Conserved noncoding elements surrounding PITX2/pitx2 were identified and examined through transgenic analysis in zebrafish; expression pattern was studied by in situ hybridization. Patient samples were screened for deletion/duplication of the PITX2 upstream region using arrays and probes. Results. Zebrafish pitx2 demonstrates conserved expression during ocular and craniofacial development. Thirteen conserved noncoding sequences positioned within a gene desert as far as 1.1 Mb upstream of the human PITX2 gene were identified; 11 have enhancer activities consistent with pitx2 expression. Ten elements mediated expression in the developing brain, four regions were active during eye formation, and two sequences were associated with craniofacial expression. One region, CE4, located approximately 111 kb upstream of PITX2, directed a complex pattern including expression in the developing eye and craniofacial region, the classic sites affected in ARS. Screening of ARS patients identified an approximately 7600-kb deletion that began 106 to 108 kb upstream of the PITX2 gene, leaving PITX2 intact while removing regulatory elements CE4 to CE13. Conclusions. These data suggest the presence of a complex distant regulatory matrix within the gene desert located upstream of PITX2 with an essential role in its activity and provides a possible mechanism for the previous reports of ARS in patients with balanced translocations involving the 4q25 region upstream of PITX2 and the current patient with an upstream deletion. PMID:20881290

  18. Function and mechanism by which interferon regulatory factor-1 inhibits oncogenesis

    PubMed Central

    CHEN, FEI-FEI; JIANG, GUAN; XU, KERUI; ZHENG, JUN-NIAN

    2013-01-01

    The present review focuses on recent advances in the understanding of the molecular mechnisms by which interferon regulatory factor (IRF)-1 inhibits oncogenesis. IRF-1 is associated with regulation of interferon α and β transcription. In addition, numerous clinical studies have indicated that IRF-1 gene deletion or rearrangement correlates with development of specific forms of human cancer. IRF-1 has been revealed to exhibit marked functional diversity in the regulation of oncogenesis. IRF-1 activates a set of target genes associated with regulation of the cell cycle, apoptosis and the immune response. The role of IRF-1 in the regulation of various types of human tumor has important implications for understanding the susceptibility and progression of cancer. In addition, an improved understanding of the role of IRF-1 in the pathological processes that lead to human malignant diseases may aid development of novel therapeutic strategies. PMID:23420765

  19. The Human Imprintome: Regulatory Mechanisms, Methods of Ascertainment, and Roles in Disease Susceptibility

    PubMed Central

    Skaar, David A.; Li, Yue; Bernal, Autumn J.; Hoyo, Cathrine; Murphy, Susan K.; Jirtle, Randy L.

    2012-01-01

    Imprinted genes form a special subset of the genome, exhibiting monoallelic expression in a parent-of-origin–dependent fashion. This monoallelic expression is controlled by parental-specific epigenetic marks, which are established in gametogenesis and early embryonic development and are persistent in all somatic cells throughout life. We define this specific set of cis-acting epigenetic regulatory elements as the imprintome, a distinct and specially tasked subset of the epigenome. Imprintome elements contain DNA methylation and histone modifications that regulate monoallelic expression by affecting promoter accessibility, chromatin structure, and chromatin configuration. Understanding their regulation is critical because a significant proportion of human imprinted genes are implicated in complex diseases. Significant species variation in the repertoire of imprinted genes and their epigenetic regulation, however, will not allow model organisms solely to be used for this crucial purpose. Ultimately, only the human will suffice to accurately define the human imprintome. PMID:23744971

  20. The Emerging Role of Protein Phosphorylation as a Critical Regulatory Mechanism Controlling Cellulose Biosynthesis

    PubMed Central

    Jones, Danielle M.; Murray, Christian M.; Ketelaar, KassaDee J.; Thomas, Joseph J.; Villalobos, Jose A.; Wallace, Ian S.

    2016-01-01

    Plant cell walls are extracellular matrices that surround plant cells and critically influence basic cellular processes, such as cell division and expansion. Cellulose is a major constituent of plant cell walls, and this paracrystalline polysaccharide is synthesized at the plasma membrane by a large protein complex known as the cellulose synthase complex (CSC). Recent efforts have identified numerous protein components of the CSC, but relatively little is known about regulation of cellulose biosynthesis. Numerous phosphoproteomic surveys have identified phosphorylation events in CSC associated proteins, suggesting that protein phosphorylation may represent an important regulatory control of CSC activity. In this review, we discuss the composition and dynamics of the CSC in vivo, the catalog of CSC phosphorylation sites that have been identified, the function of experimentally examined phosphorylation events, and potential kinases responsible for these phosphorylation events. Additionally, we discuss future directions in cellulose synthase kinase identification and functional analyses of CSC phosphorylation sites. PMID:27252710

  1. Biochemistry on a leash: Confinement as a regulatory mechanism for bimolecular reaction rates

    NASA Astrophysics Data System (ADS)

    Reeves, Daniel; Cheveralls, Keith; Kondev, Jane

    2009-03-01

    We describe two mechanisms by which confinement regulates diffusion-limited bimolecular reaction rates. The first mechanism, illustrated by the actin capping protein formin, uses a flexible polymer to tether ligand binding sites, which serve as intermediaries, to the reactive site. The second mechanism uses a potential (e.g. hard wall potential), to constrain the motion of a ligand receptor within a confining volume. We analyze both mechanisms theoretically, using a combination of analytic and numerical techniques, to obtain the steady state binding kinetics. We explore how the reaction rates are regulated by parameters of the model such as the length of the polymer tether, and use our findings to explain the key features of the formin system. Finally, we suggest other systems, both synthetic and biological, in which these mechanisms for regulating bimolecular reactions might be at play.

  2. Structure Reveals Regulatory Mechanisms of a MaoC-Like Hydratase from Phytophthora capsici Involved in Biosynthesis of Polyhydroxyalkanoates (PHAs)

    PubMed Central

    Wang, Huizheng; Zhang, Kai; Zhu, Jie; Song, Weiwei; Zhao, Li; Zhang, Xiuguo

    2013-01-01

    Background Polyhydroxyalkanoates (PHAs) have attracted increasing attention as “green plastic” due to their biodegradable, biocompatible, thermoplastic, and mechanical properties, and considerable research has been undertaken to develop low cost/high efficiency processes for the production of PHAs. MaoC-like hydratase (MaoC), which belongs to (R)-hydratase involved in linking the β-oxidation and the PHA biosynthetic pathways, has been identified recently. Understanding the regulatory mechanisms of (R)-hydratase catalysis is critical for efficient production of PHAs that promise synthesis an environment-friendly plastic. Methodology/Principal Findings We have determined the crystal structure of a new MaoC recognized from Phytophthora capsici. The crystal structure of the enzyme was solved at 2.00 Å resolution. The structure shows that MaoC has a canonical (R)-hydratase fold with an N-domain and a C-domain. Supporting its dimerization observed in structure, MaoC forms a stable homodimer in solution. Mutations that disrupt the dimeric MaoC result in a complete loss of activity toward crotonyl-CoA, indicating that dimerization is required for the enzymatic activity of MaoC. Importantly, structure comparison reveals that a loop unique to MaoC interacts with an α-helix that harbors the catalytic residues of MaoC. Deletion of the loop enhances the enzymatic activity of MaoC, suggesting its inhibitory role in regulating the activity of MaoC. Conclusions/Significance The data in our study reveal the regulatory mechanism of an (R)-hydratase, providing information on enzyme engineering to produce low cost PHAs. PMID:24244597

  3. Discovery of Novel Splice Variants and Regulatory Mechanisms for Microsomal Triglyceride Transfer Protein in Human Tissues

    PubMed Central

    Suzuki, Takashi; Swift, Larry L.

    2016-01-01

    Microsomal triglyceride transfer protein (MTP) is a unique lipid transfer protein essential for the assembly of triglyceride-rich lipoproteins by the liver and intestine. Previous studies in mice identified a splice variant of MTP with an alternate first exon. Splice variants of human MTP have not been reported. Using PCR approaches we have identified two splice variants in human tissues, which we have named MTP-B and MTP-C. MTP-B has a unique first exon (Ex1B) located 10.5 kb upstream of the first exon (Ex1A) for canonical MTP (MTP-A); MTP-C contains both first exons for MTP-A and MTP-B. MTP-B was found in a number of tissues, whereas MTP-C was prominent in brain and testis. MTP-B does not encode a protein; MTP-C encodes the same protein encoded by MTP-A, although MTP-C translation is strongly inhibited by regulatory elements within its 5′-UTR. Using luciferase assays, we demonstrate that the promoter region upstream of exon 1B is quite adequate to drive expression of MTP. We conclude that alternate splicing plays a key role in regulating cellular MTP levels by introducing distinct promoter regions and unique 5′-UTRs, which contain elements that alter translation efficiency, enabling the cell to optimize MTP activity. PMID:27256115

  4. Discovery of Novel Splice Variants and Regulatory Mechanisms for Microsomal Triglyceride Transfer Protein in Human Tissues.

    PubMed

    Suzuki, Takashi; Swift, Larry L

    2016-06-03

    Microsomal triglyceride transfer protein (MTP) is a unique lipid transfer protein essential for the assembly of triglyceride-rich lipoproteins by the liver and intestine. Previous studies in mice identified a splice variant of MTP with an alternate first exon. Splice variants of human MTP have not been reported. Using PCR approaches we have identified two splice variants in human tissues, which we have named MTP-B and MTP-C. MTP-B has a unique first exon (Ex1B) located 10.5 kb upstream of the first exon (Ex1A) for canonical MTP (MTP-A); MTP-C contains both first exons for MTP-A and MTP-B. MTP-B was found in a number of tissues, whereas MTP-C was prominent in brain and testis. MTP-B does not encode a protein; MTP-C encodes the same protein encoded by MTP-A, although MTP-C translation is strongly inhibited by regulatory elements within its 5'-UTR. Using luciferase assays, we demonstrate that the promoter region upstream of exon 1B is quite adequate to drive expression of MTP. We conclude that alternate splicing plays a key role in regulating cellular MTP levels by introducing distinct promoter regions and unique 5'-UTRs, which contain elements that alter translation efficiency, enabling the cell to optimize MTP activity.

  5. Immunomodulation of mesenchymal stromal cells on regulatory T cells and its possible mechanism.

    PubMed

    Yan, Zhidong; Zhuansun, Yongxun; Chen, Rui; Li, Jianguo; Ran, Pixin

    2014-05-15

    Mesenchymal stromal cells (MSCs) and regulatory T cells (Tregs) have both garnered abundant interests from immunologists worldwide, as both MSCs and Tregs can be considered immunosuppressive in their own right. But a little attention has been paid to the impacts of MSCs on Tregs. To clarify the effects of MSCs on Tregs, we performed the coculture systems within MSCs and Tregs. We confirmed that MSC-exposed Tregs are capable of more immunosuppressive than Tregs without coculturing with MSCs. And this augmenting suppressive capacity was accompanied with an upregulation of programmed cell death 1 receptor (PD-1) on Tregs. Importantly, we found that cell viability of Tregs was excluded from the influences of MSCs. Finally, we showed that PD-1/B7-H1 interactions and IL-10 might be responsible for the enhanced suppressive capability of MSC-exposed Tregs. Further analysis revealed that PD-1/B7-H1 interactions were not responsible for the productions of IL-10 and TGF-β1 in the MSC-Treg coculture systems; in contrast, IL-10 rather than TGF-β1 played a role in the upregualtion of PD-1. Furthermore, this is the first explorative study to evaluate the immunomodulation of MSCs on the suppressive capacity of Tregs in MSC-Treg in vitro coculture setting.

  6. Analysis of microRNA and Gene Expression Profiles in Multiple Sclerosis: Integrating Interaction Data to Uncover Regulatory Mechanisms

    PubMed Central

    Freiesleben, Sherry; Hecker, Michael; Zettl, Uwe Klaus; Fuellen, Georg; Taher, Leila

    2016-01-01

    MicroRNAs (miRNAs) have been reported to contribute to the pathophysiology of multiple sclerosis (MS), an inflammatory disorder of the central nervous system. Here, we propose a new consensus-based strategy to analyse and integrate miRNA and gene expression data in MS as well as other publically available data to gain a deeper understanding of the role of miRNAs in MS and to overcome the challenges posed by studies with limited patient sample sizes. We processed and analysed microarray datasets, and compared the expression of genes and miRNAs in the blood of MS patients and controls. We then used our consensus and integration approach to construct two molecular networks dysregulated in MS: a miRNA- and a gene-based network. We identified 18 differentially expressed (DE) miRNAs and 128 DE genes that may contribute to the regulatory alterations behind MS. The miRNAs were linked to immunological and neurological pathways, and we exposed let-7b-5p and miR-345-5p as promising blood-derived disease biomarkers in MS. The results suggest that DE miRNAs are more informative than DE genes in uncovering pathways potentially involved in MS. Our findings provide novel insights into the regulatory mechanisms and networks underlying MS. PMID:27694855

  7. Regulatory mechanisms of Hertwig׳s epithelial root sheath formation and anomaly correlated with root length.

    PubMed

    Kumakami-Sakano, Mika; Otsu, Keishi; Fujiwara, Naoki; Harada, Hidemitsu

    2014-07-15

    Teeth are composed of two domains, the enamel-covered crown and cementum-covered root. The mechanism for determining the transition from crown to root is important for understanding root anomaly diseases. Hertwig׳s epithelial root sheath (HERS) is derived from the dental epithelium and is known to drive the growth of root dentin and periodontal tissue. Some clinical cases of hypoplastic tooth root are caused by the cessation of HERS development. Understanding the mechanisms of HERS development will contribute to the study of the disease and dental regenerative medicine. However, the developmental biology of tooth root formation has not been fully studied, particularly regarding HERS formation. Here, we describe the mechanisms of HERS formation on the basis of analysis of cell dynamics using imaging and summarize how the growth factor and its receptor regulate cell behavior of the dental epithelium.

  8. Effect of radiologic contrast media on cell volume regulatory mechanisms in human red blood cells.

    PubMed

    Galtung, Hilde Kanli; Sørlundsengen, Vibeke; Sakariassen, Kjell S; Benestad, Haakon B

    2002-08-01

    The authors performed this study to evaluate cell volume regulation in human red blood cells (RBCs) after incubation in solutions of three contrast media: iohexol (830 mOsm), ioxaglate (520 mOsm), and iodixanol (300 mOsm). Whole blood sampled from six healthy subjects was exposed to Ringer solutions containing 25% or 5% vol/vol iohexol (final osmolality, 440 or 340 mOsm, respectively), ioxaglate (final osmolality, 395 or 335 mOsm, respectively), iodixanol (final osmolality, 330 or 315 mOsm, respectively), or NaCl (control solutions with the same osmolality as that of the contrast media). In some experiments, control RBCs were subjected to a hyposmotic solution (100 mOsm). RBC volumes were obtained with a Coulter counter. The RBCs showed normal regulatory cell shrinkage after hyposmotically induced swelling. All 25% vol/vol contrast material solutions and their control solutions induced RBC shrinkage (range, 6% +/- 1 [standard error] to 22% +/- 3). The same was true for cells exposed to 5% vol/vol contrast material (range, 4% +/- 1 to 7% +/- 1). The shrinkage phase was followed by cell swelling (10% +/- 2 to 20% +/- 2 for 25% contrast material and their control solutions and 8% +/- 1 to 15% +/- 2 for 5% contrast material and their control solutions). No contrast material-exposed RBCs increased their volumes to the level reached with their control solutions. RBCs exposed to hyperosmotic iohexol, ioxaglate, or iodixanol solutions shrank and then swelled. The degree of shrinkage and subsequent swelling could not be explained simply with the osmolality of the test solutions. Physicochemical properties of the contrast media must be involved, putatively affecting electrolyte fluxes over the RBC membrane. Possible targets of these effects are the K+/Cl- symporter, K+ channels, and the Na+/K+/Cl- symporter.

  9. Regulatory mechanisms differ in UMP kinases from gram-negative and gram-positive bacteria.

    PubMed

    Evrin, Cécile; Straut, Monica; Slavova-Azmanova, Neli; Bucurenci, Nadia; Onu, Adrian; Assairi, Liliane; Ionescu, Mihaela; Palibroda, Nicolae; Bârzu, Octavian; Gilles, Anne-Marie

    2007-03-09

    In this work, we examined the regulation by GTP and UTP of the UMP kinases from eight bacterial species. The enzyme from Gram-positive organisms exhibited cooperative kinetics with ATP as substrate. GTP decreased this cooperativity and increased the affinity for ATP. UTP had the opposite effect, as it decreased the enzyme affinity for ATP. The nucleotide analogs 5-bromo-UTP and 5-iodo-UTP were 5-10 times stronger inhibitors than the parent compound. On the other hand, UMP kinases from the Gram-negative organisms did not show cooperativity in substrate binding and catalysis. Activation by GTP resulted mainly from the reversal of inhibition caused by excess UMP, and inhibition by UTP was accompanied by a strong increase in the apparent K(m) for UMP. Altogether, these results indicate that, depending on the bacteria considered, GTP and UTP interact with different enzyme recognition sites. In Gram-positive bacteria, GTP and UTP bind to a single site or largely overlapping sites, shifting the T R equilibrium to either the R or T form, a scenario corresponding to almost all regulatory proteins, commonly called K systems. In Gram-negative organisms, the GTP-binding site corresponds to the unique allosteric site of the Gram-positive bacteria. In contrast, UTP interacts cooperatively with a site that overlaps the catalytic center, i.e. the UMP-binding site and part of the ATP-binding site. These characteristics make UTP an original regulator of UMP kinases from Gram-negative organisms, beyond the common scheme of allosteric control.

  10. [VEGETATIVE REGULATORY MECHANISMS IN DIFFERENT GEOMAGNETIC CONDITIONS DEPENDING ON A DEGREE OF PHYSICAL CONDITIONING].

    PubMed

    Kvachadze, I; Tsibadze, A; Sanadiradze, G; Mzhavanadze, D; Chichinadze, G

    2016-04-01

    The aim of the study was to evaluate the vegetative regulatory action in healthy, untrained and trained individuals in different geomagnetic conditions. The study involved 94 healthy untrained young men aged 18-22 years - I group (control), and 60 trained volunteers aged 18-25 years - II group, who during the period of the study and for at least three years prior have been following active regular physical exercise regimen(weight lifting), but were not professional athletes. In order to evaluate the heart rate variability the following statistical indicators were studied: arithmetic mean, the arithmetic mean of the error variance, dispersion, the arithmetic mean deviation, coefficient of skewness, kurtosis, standard deviation of the mean. Geometric analysis was performed using a variation pulsometry. All the individuals were studied in natural/tranquil conditions, during naturally occuring or a simulated geomagnetic storm, which provided the use of the characteristics of vegetative balance as a marker for differential assessment of the impact of electromagnetic field (EMF). The forecast of natural geomagnetic conditions had been made at least three days before the study. Under the conditions of simulated geomagnetic storm the test subjects were placed in a solenoid with non-magnetic equipment. EMF inductance in the solenoid corresponded to the geomagnetic storm frequencies. The study had a nature of social experiment and was carried out by a single blind method: tested subjects were unaware of geomagnetic conditions during the study. This was an open, three-step, cohort, prospective study with parallel character. The results showed that under the uniform qualitative conditions (balanced, in particular) of initial state of vegetative equilibrium, the level of fitness of the human body determines the differentiated response to EMF exposure. Thus, with the possible inclusion of the EMF in the complex of therapeutic or preventive measures, it is necessary to predict

  11. Catalytic control in the EGF Receptor and its connection to general kinase regulatory mechanisms

    PubMed Central

    Jura, Natalia; Zhang, Xuewu; Endres, Nicholas F.; Seeliger, Markus A.; Schindler, Thomas; Kuriyan, John

    2011-01-01

    Summary In contrast to the active conformations of protein kinases, which are essentially the same for all kinases, inactive kinase conformations are structurally diverse. Some inactive conformations are, however, observed repeatedly in different kinases, perhaps reflecting an important role in catalysis. In this review, we analyze one of these recurring conformations, first identified in CDK and Src kinases, which turned out to be central to understanding of how kinase domain of the EGF receptor is activated. This mechanism, which involves the stabilization of the active conformation of an α helix, has features in common with mechanisms operative in several other kinases. PMID:21474065

  12. Single-Nucleotide Mutations in FMR1 Reveal Novel Functions and Regulatory Mechanisms of the Fragile X Syndrome Protein FMRP

    PubMed Central

    Suhl, Joshua A.; Warren, Stephen T.

    2015-01-01

    Fragile X syndrome is a monogenic disorder and a common cause of intellectual disability. Despite nearly 25 years of research on FMR1, the gene underlying the syndrome, very few pathological mutations other than the typical CGG-repeat expansion have been reported. This is in contrast to other X-linked, monogenic, intellectual disability disorders, such as Rett syndrome, where many point mutations have been validated as causative of the disorder. As technology has improved and significantly driven down the cost of sequencing, allowing for whole genes to be sequenced with relative ease, in-depth sequencing studies on FMR1 have recently been performed. These studies have led to the identification of novel variants in FMR1, where some of which have been functionally evaluated and are likely pathogenic. In this review, we discuss recently identified FMR1 variants, the ways these novel variants cause dysfunction, and how they reveal new regulatory mechanisms and functionalities of the gene. PMID:26819560

  13. Reactive oxygen species regulatory mechanisms associated with rapid response of MC3T3-E1 cells for vibration stress.

    PubMed

    Zhang, Ling; Gan, Xueqi; Zhu, Zhuoli; Yang, Yang; He, Yuting; Yu, Haiyang

    2016-02-12

    Although many previous studies have shown that refractory period-dependent memory effect of vibration stress is anabolic for skeletal homeostasis, little is known about the rapid response of osteoblasts simply derived from vibration itself. In view of the potential role of reactive oxygen species (ROS) in mediating differentiated activity of osteoblasts, whether and how ROS regulates the rapid effect of vibration deserve to be demonstrated. Our findings indicated that MC3T3-E1 cells underwent decreased gene expression of Runx2, Col-I and ALP and impaired ALP activity accompanied by increased mitochondrial fission immediately after vibration loading. Moreover, we also revealed the involvement of ERK-Drp1 signal transduction in ROS regulatory mechanisms responsible for the rapid effect of vibration stress.

  14. Regulatory effect of caffeine on the acute and the chronic pain and its possible mechanisms.

    PubMed

    Zhang, Yu-Guan; Shen, Le; Xu, Li; Huang, Yu-Guang

    2014-12-01

    Caffeine,as an important component of refreshment beverage,has been used for a long history. In recent years,its effect on pain relief has been widely explored. As one of nonselective adenosine receptor blockers,caffeine plays different roles in the central and peripheral pain. This review explores the roles of caffeine in acute and chronic pain and the potential mechanisms.

  15. Large-scale profiling and identification of potential regulatory mechanisms for allelic gene expression in colorectal cancer cells.

    PubMed

    Lee, Robin Dong-Woo; Song, Min-Young; Lee, Jong-Keuk

    2013-01-01

    Allelic variation in gene expression is common in humans and this variation is associated with phenotypic variation. In this study, we employed high-density single nucleotide polymorphism (SNP) chips containing 13,900 exonic SNPs to identify genes with allelic gene expression in cells from colorectal cancer cell lines. We found 2 monoallelically expressed genes (ERAP2 and MYLK4), 32 genes with an allelic imbalance in their expression, and 13 genes showing allele substitution by RNA editing. Among a total of 34 allelically expressed genes in colorectal cancer cells, 15 genes (44.1%) were associated with cis-acting eQTL, indicating that large portions of allelically expressed genes are regulated by cis-acting mechanisms of gene expression. In addition, potential regulatory variants present in the proximal promoter regions of genes showing either monoallelic expression or allelic imbalance were not tightly linked with coding SNPs, which were detected with allelic gene expression. These results suggest that multiple rare variants could be involved in the cis-acting regulatory mechanism of allelic gene expression. In the comparison with allelic gene expression data from Centre d'Etude du Polymorphisme Humain (CEPH) family B cells, 12 genes showed B-cell specific allelic imbalance and 1 noncoding SNP showed colorectal cancer cell-specific allelic imbalance. In addition, different patterns of allele substitution were observed between B cells and colorectal cancer cells. Overall, our study not only indicates that allelic gene expression is common in colorectal cancer cells, but our study also provides a better understanding of allele-specific gene expression in colorectal cancer cells.

  16. Contraction-initiated NO-dependent lymphatic relaxation: a self-regulatory mechanism in rat thoracic duct.

    PubMed

    Gasheva, Olga Yu; Zawieja, David C; Gashev, Anatoliy A

    2006-09-15

    The objectives of this study were to evaluate the physiological importance of the flow and shear generated by phasic contractions of lymphatic vessels and the mechanisms responsible for the influences of such shear on lymphatic pumping. Lymphatic segments of the rat thoracic duct were isolated, cannulated and pressurized. The diastolic diameters were measured in phasically non-active segments. The diastolic and systolic diameters, half-relaxation time (HRT), contraction frequency, ejection fraction and fractional pump flow were determined in phasically active segments. Since imposed flow was excluded, flow and shear occurred only as a result of the intrinsic contractions in phasically active segments whereas in phasically non-active segments contraction-generated flow and shear were absent. The influences of incrementally increased transmural pressure (from 1 to 5 cmH(2)O) were examined in control conditions and after NO synthase blockade (l-NAME 10(-4) m) or cyclooxygenase blockade (indomethacin 10(-5) m). The spontaneous phasic contractions produced a flow-dependent diastolic relaxation. This reduction of the lymphatic tone is a regulatory mechanism that maintains pumping in thoracic duct in an energy-saving/efficient mode: it improves diastolic filling (enhanced lusitropy - lowering HRT), makes lymphatic contractions stronger (enhanced inotropy - higher contraction amplitude) and propels more fluid forward during each contraction (elevated ejection fraction) while decreasing contraction frequency (reduced chronotropy). The findings also demonstrated that the NO pathway, not the cyclooxygenase pathway is responsible for this reduction of lymphatic tone and is the prevailing pathway responsible for the self-regulatory adjustment of thoracic duct pumping to changes in lymph flow pattern.

  17. Transition into inflammatory cancer-associated adipocytes in breast cancer microenvironment requires microRNA regulatory mechanism

    PubMed Central

    Ryu, Han Suk; Lee, Han-Byoel; Lee, Minju; Park, In Ae; Kim, Jisun; Han, Wonshik; Noh, Dong-Young

    2017-01-01

    The role of adipocytes in cancer microenvironment has gained focus during the recent years. However, the characteristics of the cancer-associated adipocytes (CAA) in human breast cancer tissues and the underlying regulatory mechanism are not clearly understood. We reviewed pathology specimens of breast cancer patients to understand the morphologic characteristics of CAA, and profiled the mRNA and miRNA expression of CAA by using indirect co-culture system in vitro. The CAAs in human breast cancers showed heterogeneous topographic relationship with breast cancer cells within the breast microenvironment. The CAAs exhibited the characteristics of de-differentiation determined by their microscopic appearance and the expression levels of adipogenic markers. Additionally, the 3T3-L1 adipocytes indirectly co-cultured with breast cancer cells showed up-regulation of inflammation-related genes including Il6 and Ptx3. The up-regulation of IL6 in CAA was further observed in human breast cancer tissues. miRNA array of indirectly co-cultured 3T3-L1 cells showed increased expression of mmu-miR-5112 which may target Cpeb1. Cpeb1 is a negative regulator of Il6. The suppressive role of mmu-miR-5112 was confirmed by dual luciferase reporter assay, and mmu-miR-5112-treated adipocytes showed up-regulation of Il6. The transition of adipocytes into more inflammatory CAA resulted in proliferation-promoting effect in ER positive breast cancer cells such as MCF7 and ZR-75-1 but not in ER negative cells. In this study, we have determined the de-differentiated and inflammatory natures of CAA in breast cancer microenvironment. Additionally, we propose a miRNA-based regulatory mechanism underlying the process of acquiring inflammatory phenotypes in CAA. PMID:28333977

  18. Investigation of molecular mechanisms and regulatory pathways of pro-angiogenic nanorods

    NASA Astrophysics Data System (ADS)

    Nethi, Susheel Kumar; Veeriah, Vimal; Barui, Ayan Kumar; Rajendran, Saranya; Mattapally, Saidulu; Misra, Sanjay; Chatterjee, Suvro; Patra, Chitta Ranjan

    2015-05-01

    Angiogenesis, a process involving the growth of new blood vessels from the pre-existing vasculature, plays a crucial role in various pathophysiological conditions. We have previously demonstrated that europium hydroxide [EuIII(OH)3] nanorods (EHNs) exhibit pro-angiogenic properties through the generation of reactive oxygen species (ROS) and mitogen activated protein kinase (MAPK) activation. Considering the enormous implication of angiogenesis in cardiovascular diseases (CVDs) and cancer, it is essential to understand in-depth molecular mechanisms and signaling pathways in order to develop the most efficient and effective alternative treatment strategy for CVDs. However, the exact underlying mechanism and cascade signaling pathways behind the pro-angiogenic properties exhibited by EHNs still remain unclear. Herein, we report for the first time that the hydrogen peroxide (H2O2), a redox signaling molecule, generated by these EHNs activates the endothelial nitric oxide synthase (eNOS) that promotes the nitric oxide (NO) production in a PI3K (phosphoinositide 3-kinase)/Akt dependent manner, eventually triggering angiogenesis. We intensely believe that the investigation and understanding of the in-depth molecular mechanism and signaling pathways of EHNs induced angiogenesis will help us in developing an effective alternative treatment strategy for cardiovascular related and ischemic diseases where angiogenesis plays an important role.Angiogenesis, a process involving the growth of new blood vessels from the pre-existing vasculature, plays a crucial role in various pathophysiological conditions. We have previously demonstrated that europium hydroxide [EuIII(OH)3] nanorods (EHNs) exhibit pro-angiogenic properties through the generation of reactive oxygen species (ROS) and mitogen activated protein kinase (MAPK) activation. Considering the enormous implication of angiogenesis in cardiovascular diseases (CVDs) and cancer, it is essential to understand in-depth molecular

  19. Transport mechanism and regulatory properties of the human amino acid transporter ASCT2 (SLC1A5).

    PubMed

    Scalise, Mariafrancesca; Pochini, Lorena; Panni, Simona; Pingitore, Piero; Hedfalk, Kristina; Indiveri, Cesare

    2014-11-01

    The kinetic mechanism of the transport catalyzed by the human glutamine/neutral amino acid transporter hASCT2 over-expressed in P. pastoris was determined in proteoliposomes by pseudo-bi-substrate kinetic analysis of the Na(+)-glutamineex/glutaminein transport reaction. A random simultaneous mechanism resulted from the experimental analysis. Purified functional hASCT2 was chemically cross-linked to a stable dimeric form. The oligomeric structure correlated well with the kinetic mechanism of transport. Half-saturation constants (Km) of the transporter for the other substrates Ala, Ser, Asn and Thr were measured both on the external and internal side. External Km were much lower than the internal ones confirming the asymmetry of the transporter. The electric nature of the transport reaction was determined imposing a negative inside membrane potential generated by K(+) gradients in the presence of valinomycin. The transport reaction resulted to be electrogenic and the electrogenicity originated from external Na(+). Internal Na(+) exerted a stimulatory effect on the transport activity which could be explained by a regulatory, not a counter-transport, effect. Native and deglycosylated hASCT2 extracted from HeLa showed the same transport features demonstrating that the glycosyl moiety has no role in transport function. Both in vitro and in vivo interactions of hASCT2 with the scaffold protein PDZK1 were revealed.

  20. Mechanisms of autoimmunity in the non-obese diabetic mouse: effector/regulatory cell equilibrium during peak inflammation.

    PubMed

    Askenasy, Nadir

    2016-04-01

    Immune imbalance in autoimmune disorders such as type 1 diabetes may originate from aberrant activities of effector cells or dysfunction of suppressor cells. All possible defective mechanisms have been proposed for diabetes-prone species: (i) quantitative dominance of diabetogenic cells and decreased numbers of regulatory T cells, (ii) excessive aggression of effectors and defective function of suppressors, (iii) perturbed interaction between effector and suppressor cells, and (iv) variations in sensitivity to negative regulation. The experimental evidence available to date presents conflicting information on these mechanisms, with identification of perturbed equilibrium on the one hand and negation of critical role of each mechanism in propagation of diabetic autoimmunity on the other hand. In our analysis, there is no evidence that inherent abnormalities in numbers and function of effector and suppressor T cells are responsible for the immune imbalance responsible for propagation of type 1 diabetes as a chronic inflammatory process. Possibly, the experimental tools for investigation of these features of immune activity are still underdeveloped and lack sufficient resolution, in the presence of the extensive biological viability and functional versatility of effector and suppressor elements.

  1. [Research Progress of NOS3 Participation in Regulatory Mechanisms of Cardiovascular Diseases].

    PubMed

    Sun, Ting; Chi, Qingjia; Wang, Guixue

    2016-02-01

    Cardiovascular disease has been a major threat to human's health and lives for many years. It is of great importance to explore the mechanisms and develop strategies to prevent the pathogenesis. Generally, cardiovascular disease is associated with endothelial dysfunction, which is closely related to the nitric oxide (NO)-mediated vasodilatation. The release of NO is regulated by NOS3 gene in mammals' vascular system. A great deal of evidences have shown that the polymorphism and epigenetic of NOS3 gene play vital roles in the pathological process of cardiovascular disease. To gain insights into the role of NOS3 in the cardiovascular diseases, we reviewed the molecular mechanisms underlying the development of cardiovascular diseases in this paper, including the uncoupling of NOS3 protein, epigenetic and polymorphism of NOS3 gene. The review can also offer possible strategies to prevent and treat cardiovascular diseases.

  2. Transcriptome profiling of a curdlan-producing Agrobacterium reveals conserved regulatory mechanisms of exopolysaccharide biosynthesis

    PubMed Central

    2012-01-01

    Background The ability to synthesize exopolysaccharides (EPS) is widespread among microorganisms, and microbial EPS play important roles in biofilm formation, pathogen persistence, and applications in the food and medical industries. Although it is well established that EPS synthesis is invariably in response to environmental cues, it remains largely unknown how various environmental signals trigger activation of the biochemical synthesis machinery. Results We report here the transcriptome profiling of Agrobacterium sp. ATCC 31749, a microorganism that produces large amounts of a glucose polymer known as curdlan under nitrogen starvation. Transcriptome analysis revealed a nearly 100-fold upregulation of the curdlan synthesis operon upon transition to nitrogen starvation, thus establishing the prominent role that transcriptional regulation plays in the EPS synthesis. In addition to known mechanisms of EPS regulation such as activation by c-di-GMP, we identify novel mechanisms of regulation in ATCC 31749, including RpoN-independent NtrC regulation and intracellular pH regulation by acidocalcisomes. Furthermore, we show evidence that curdlan synthesis is also regulated by conserved cell stress responses, including polyphosphate accumulation and the stringent response. In fact, the stringent response signal, pppGpp, appears to be indispensible for transcriptional activation of curdlan biosynthesis. Conclusions This study identifies several mechanisms regulating the synthesis of curdlan, an EPS with numerous applications. These mechanisms are potential metabolic engineering targets for improving the industrial production of curdlan from Agrobacterium sp. ATCC 31749. Furthermore, many of the genes identified in this study are highly conserved across microbial genomes, and we propose that the molecular elements identified in this study may serve as universal regulators of microbial EPS synthesis. PMID:22305302

  3. Regulatory mechanisms of anthrax toxin receptor 1-dependent vascular and connective tissue homeostasis

    PubMed Central

    Besschetnova, Tatiana Y.; Ichimura, Takaharu; Katebi, Negin; St. Croix, Brad; Bonventre, Joseph V.; Olsen, Bjorn R.

    2015-01-01

    It is well known that angiogenesis is linked to fibrotic processes in fibroproliferative diseases, but insights into pathophysiological processes are limited, due to lack of understanding of molecular mechanisms controlling endothelial and fibroblastic homeostasis. We demonstrate here that the matrix receptor anthrax toxin receptor 1 (ANTXR1), also known as tumor endothelial marker 8 (TEM8), is an essential component of these mechanisms. Loss of TEM8 function in mice causes reduced synthesis of endothelial basement membrane components and hyperproliferative and leaky blood vessels in skin. In addition, endothelial cell alterations in mutants are almost identical to those of endothelial cells in infantile hemangioma lesions, including activated VEGF receptor signaling in endothelial cells, increased expression of the downstream targets VEGF and CXCL12, and increased numbers of macrophages and mast cells. In contrast, loss of TEM8 in fibroblasts leads to increased rates of synthesis of fiber-forming collagens, resulting in progressive fibrosis in skin and other organs. Compromised interactions between TEM8-deficient endothelial and fibroblastic cells cause dramatic reduction in the activity of the matrix-degrading enzyme MMP2. In addition to insights into mechanisms of connective tissue homeostasis, our data provide molecular explanations for vascular and connective tissue abnormalities in GAPO syndrome, caused by loss-of-function mutations in ANTXR1. Furthermore, the loss of MMP2 activity suggests that fibrotic skin abnormalities in GAPO syndrome are, in part, the consequence of pathophysiological mechanisms underlying syndromes (NAO, Torg and Winchester) with multicentric skin nodulosis and osteolysis caused by homozygous loss-of-function mutations in MMP2. PMID:25572963

  4. Investigation of molecular mechanisms and regulatory pathways of pro-angiogenic nanorods†

    PubMed Central

    Nethi, Susheel Kumar; Veeriah, Vimal; Barui, Ayan Kumar; Rajendran, Saranya; Mattapally, Saidulu; Misra, Sanjay

    2016-01-01

    Angiogenesis, a process involving the growth of new blood vessels from the pre-existing vasculature, plays a crucial role in various pathophysiological conditions. We have previously demonstrated that europium hydroxide [EuIII(OH)3] nanorods (EHNs) exhibit pro-angiogenic properties through the generation of reactive oxygen species (ROS) and mitogen activated protein kinase (MAPK) activation. Considering the enormous implication of angiogenesis in cardiovascular diseases (CVDs) and cancer, it is essential to understand in-depth molecular mechanisms and signaling pathways in order to develop the most efficient and effective alternative treatment strategy for CVDs. However, the exact underlying mechanism and cascade signaling pathways behind the pro-angiogenic properties exhibited by EHNs still remain unclear. Herein, we report for the first time that the hydrogen peroxide (H2O2), a redox signaling molecule, generated by these EHNs activates the endothelial nitric oxide synthase (eNOS) that promotes the nitric oxide (NO) production in a PI3K (phosphoinositide 3-kinase)/Akt dependent manner, eventually triggering angiogenesis. We intensely believe that the investigation and understanding of the in-depth molecular mechanism and signaling pathways of EHNs induced angiogenesis will help us in developing an effective alternative treatment strategy for cardiovascular related and ischemic diseases where angiogenesis plays an important role. PMID:25963768

  5. c-myc in whitefish (Coregonus lavaretus): structure, expression, and insights into possible posttranscriptional regulatory mechanism.

    PubMed

    Brzuzan, P; Kramer, C; Łakomiak, A; Jakimiuk, E; Florczyk, M; Woźny, M

    2015-10-01

    c-myc has a crucial function in growth control, differentiation, and apoptosis of vertebrate cells. Despite the important role of c-myc in mediating the biological effects, studies of c-myc gene expression and factors that control it in organisms other than mammals, such as fish, have been rare. In the current study, we asked whether c-myc mRNA of whitefish, a feasible organism for pollution monitoring in aquatic systems and a model in toxicological research, contains activity sites for regulatory motifs in its 5'- and 3'-UTRs, similar to those found in mammals. We were particularly interested in whether miRNA-34, a known negative regulator of c-myc's in mammals, is able to regulate c-myc in fish. To answer these questions, we determined the mRNA sequence of whitefish c-myc and inferred the structure of the protein that it codes for. We found that the active sites of mRNA and structures of the inferred c-myc protein are similar to those found in mammals and other fish. Remarkably, levels of c-myc mRNA expression were very high in ovaries compared to other tissues of whitefish, thus corroborating previous data in fish. Using bioinformatic searches on c-myc 3'-UTR, we confirmed the presence of two miRNA-34a (miR-34a) response elements. Luciferase reporter assay showed that activity of reporters containing either the miR response elements or entire c-myc 3'-UTR was significantly reduced (p < 0.001) by ectopic expression of miR-34a. Therefore, we further investigated possible involvement of miR-34a in c-myc gene silencing by profiling the expression of both genes in livers of whitefish treated for 8, 24, 48 h with MC-LR, a potent c-myc inducer in mammals. Although the difference was only significant at p = 0.08, the expression of c-myc mRNA in challenged whitefish after 24 h of the treatment was notably higher than that in livers of control fish. Concurrently, we noticed slight but significant up-regulation of miR-34a after 24 and 48 h of the challenge (p

  6. Novel Regulatory Mechanisms for Generation of the Soluble Leptin Receptor: Implications for Leptin Action

    PubMed Central

    Schaab, Michael; Kausch, Henriette; Klammt, Juergen; Nowicki, Marcin; Anderegg, Ulf; Gebhardt, Rolf; Rose-John, Stefan; Scheller, Juergen; Thiery, Joachim; Kratzsch, Juergen

    2012-01-01

    Background The adipokine leptin realizes signal transduction via four different membrane-anchored leptin receptor (Ob-R) isoforms in humans. However, the amount of functionally active Ob-R is affected by constitutive shedding of the extracellular domain via a so far unknown mechanism. The product of the cleavage process the so-called soluble leptin receptor (sOb-R) is the main binding protein for leptin in human blood and modulates its bioavailability. sOb-R levels are differentially regulated in metabolic disorders like type 1 diabetes mellitus or obesity and can, therefore, enhance or reduce leptin sensitivity. Methodology/Principal Findings To describe mechanisms of Ob-R cleavage and to investigate the functional significance of differential sOb-R levels we established a model of HEK293 cells transiently transfected with different human Ob-R isoforms. Using siRNA knockdown experiments we identified ADAM10 (A Disintegrin And Metalloproteinase 10) as a major protease for constitutive and activated Ob-R cleavage. Additionally, the induction of lipotoxicity and apoptosis led to enhanced shedding shown by increased levels of the soluble leptin receptor (sOb-R) in cell supernatants. Conversely, high leptin concentrations and ER stress reduced sOb-R levels. Decreased amounts of sOb-R due to ER stress were accompanied by impaired leptin signaling and reduced leptin binding. Conclusions Lipotoxicity and apoptosis increased Ob-R cleavage via ADAM10-dependent mechanisms. In contrast high leptin levels and ER stress led to reduced sOb-R levels. While increased sOb-R concentrations seem to directly block leptin action, reduced amounts of sOb-R may reflect decreased membrane expression of Ob-R. These findings could explain changes of leptin sensitivity which are associated with variations of serum sOb-R levels in metabolic diseases. PMID:22545089

  7. Regulatory players of DNA damage repair mechanisms: Role in Cancer Chemoresistance.

    PubMed

    Sakthivel, Kunnathur Murugesan; Hariharan, Sreedharan

    2017-09-01

    DNA damaging agents are most common in chemotherapeutic molecules that act against cancer. However, cancer cells possess inherent biological features to overcome DNA damages by activating various distinct repair mechanisms and pathways. Importantly, various oncogenes, cancer stem cells (CSCs), hypoxic environment, transcription factors and bystander signaling that are activated in the cancer cells influence DNA repair, thereby effectively repairing the DNA damage. Repaired cancer cells often become more resistance to further therapy and results in disease recurrence. In this review, we summarize how the various signaling pathways in cancer cells regulates DNA repair and induce chemoresistance. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  8. [Research progress in biofilm formation and regulatory mechanism of Campylobacter jejuni].

    PubMed

    Wu, Qingping; Zhong, Xian; Zhang, Jumei

    2016-02-04

    Biofilm of Campylobacter jejuni was formed by cross-linking its extracellular secretion, polysaccharides, various extracellular proteins, nucleic acids etc to enhance its survival in hostile environments, especially for detergents, antibiotics and disinfectants. This paper elaborated C. jejuni biofilm formation and regulation mechanisms in the surface properties of the media, temperatures, gas environment, the regulation of gene etc, also analysed and discussed a variety of biofilm removal practical applications. We hope it can provide a reference for studies on biofilm control of C. jejuni.

  9. Novel Sinorhizobium meliloti quorum sensing positive and negative regulatory feedback mechanisms respond to phosphate availability.

    PubMed

    McIntosh, Matthew; Meyer, Stefan; Becker, Anke

    2009-12-01

    The Sin quorum sensing system of Sinorhizobium meliloti depends upon at least three genes, sinR, sinI and expR, and N-acyl homoserine lactones (AHLs) as signals to regulate multiple processes in its free-living state in the rhizosphere and in the development towards symbiosis with its plant host. In this study, we have characterized novel mechanisms of transcription control through which the system regulates itself. At low AHL levels a positive feedback loop activates expression of sinI (AHL synthase), resulting in amplification of AHL levels. At high AHL levels, expression of sinI is reduced by a negative feedback loop. These feedback mechanisms are mediated by the LuxR-type regulators ExpR and SinR. Expression of sinR and expR is regulated by ExpR in the presence of AHLs. A novel ExpR binding site in the promoter of sinR is responsible for the reduction of expression of this gene. In addition, expression of sinR, upon which sinI expression is dependent, is induced by phoB during growth under phosphate-limiting conditions. This indicates that this response ensures quorum sensing in phosphate-restricted growth.

  10. Subchromoplast sequestration of carotenoids affects regulatory mechanisms in tomato lines expressing different carotenoid gene combinations.

    PubMed

    Nogueira, Marilise; Mora, Leticia; Enfissi, Eugenia M A; Bramley, Peter M; Fraser, Paul D

    2013-11-01

    Metabolic engineering of the carotenoid pathway in recent years has successfully enhanced the carotenoid contents of crop plants. It is now clear that only increasing biosynthesis is restrictive, as mechanisms to sequestrate these increased levels in the cell or organelle should be exploited. In this study, biosynthetic pathway genes were overexpressed in tomato (Solanum lycopersicum) lines and the effects on carotenoid formation and sequestration revealed. The bacterial Crt carotenogenic genes, independently or in combination, and their zygosity affect the production of carotenoids. Transcription of the pathway genes was perturbed, whereby the tissue specificity of transcripts was altered. Changes in the steady state levels of metabolites in unrelated sectors of metabolism were found. Of particular interest was a concurrent increase of the plastid-localized lipid monogalactodiacylglycerol with carotenoids along with membranous subcellular structures. The carotenoids, proteins, and lipids in the subchromoplast fractions of the transgenic tomato fruit with increased carotenoid content suggest that cellular structures can adapt to facilitate the sequestration of the newly formed products. Moreover, phytoene, the precursor of the pathway, was identified in the plastoglobule, whereas the biosynthetic enzymes were in the membranes. The implications of these findings with respect to novel pathway regulation mechanisms are discussed.

  11. Global regulatory mechanism underlying the activation of an exon network required for neurogenesis

    PubMed Central

    Raj, Bushra; Irimia, Manuel; Braunschweig, Ulrich; Sterne-Weiler, Timothy; O’Hanlon, Dave; Yuan-Lin, Zhen; Chen, Ginny I.; Easton, Laura; Ule, Jernej; Gingras, Anne-Claude; Eyras, Eduardo; Blencowe, Benjamin J.

    2015-01-01

    SUMMARY The vertebrate and neural-specific SR-related protein nSR100/SRRM4 regulates an extensive program of alternative splicing with critical roles in nervous system development. However, the mechanism by which nSR100 controls its target exons is poorly understood. We demonstrate that nSR100-dependent neural exons are associated with a unique configuration of intronic cis-elements that promote rapid switch-like regulation during neurogenesis. A key feature of this configuration is the insertion of specialized intronic enhancers between polypyrimidine tracts and acceptor sites that bind nSR100 to potently activate exon inclusion in neural cells, while weakening 3′ splice site recognition and contributing to exon skipping in non-neural cells. nSR100 further operates by forming multiple interactions with early spliceosome components bound proximal to 3′ splice sites. These multifaceted interactions achieve dominance over neural exon silencing mediated by the splicing regulator PTBP1. The results thus illuminate a widespread mechanism by which a critical neural exon network is activated during neurogenesis. PMID:25219497

  12. The Influence of Early Life Nutrition on Epigenetic Regulatory Mechanisms of the Immune System

    PubMed Central

    Paparo, Lorella; di Costanzo, Margherita; di Scala, Carmen; Cosenza, Linda; Leone, Ludovica; Nocerino, Rita; Berni Canani, Roberto

    2014-01-01

    The immune system is exquisitely sensitive to environmental changes. Diet constitutes one of the major environmental factors that exerts a profound effect on immune system development and function. Epigenetics is the study of mitotically heritable, yet potentially reversible, molecular modifications to DNA and chromatin without alteration to the underlying DNA sequence. Nutriepigenomics is an emerging discipline examining the role of dietary influences on gene expression. There is increasing evidence that the epigenetic mechanisms that regulate gene expression during immune differentiation are directly affected by dietary factors or indirectly through modifications in gut microbiota induced by different dietary habits. Short-chain fatty acids, in particular butyrate, produced by selected bacteria stains within gut microbiota, are crucial players in this network. PMID:25353665

  13. The T box mechanism: tRNA as a regulatory molecule

    PubMed Central

    Green, Nicholas J.; Grundy, Frank J.; Henkin, Tina M.

    2009-01-01

    The T box mechanism is widely used in Gram-positive bacteria to regulate expression of aminoacyl-tRNA synthetase genes and genes involved in amino acid biosynthesis and uptake. Binding of a specific uncharged tRNA to a riboswitch element in the nascent transcript causes a structural change in the transcript that promotes expression of the downstream coding sequence. In most cases, this occurs by stabilization of an antiterminator element that competes with formation of a terminator helix. Specific tRNA recognition by the nascent transcript results in increased expression of genes important for tRNA aminoacylation in response to decreased pools of charged tRNA. PMID:19932103

  14. Ocean warming and acidification modulate energy budget and gill ion regulatory mechanisms in Atlantic cod (Gadus morhua).

    PubMed

    Kreiss, C M; Michael, K; Lucassen, M; Jutfelt, F; Motyka, R; Dupont, S; Pörtner, H-O

    2015-10-01

    Ocean warming and acidification are threatening marine ecosystems. In marine animals, acidification is thought to enhance ion regulatory costs and thereby baseline energy demand, while elevated temperature also increases baseline metabolic rate. Here we investigated standard metabolic rates (SMR) and plasma parameters of Atlantic cod (Gadus morhua) after 3-4 weeks of exposure to ambient and future PCO2 levels (550, 1200 and 2200 µatm) and at two temperatures (10, 18 °C). In vivo branchial ion regulatory costs were studied in isolated, perfused gill preparations. Animals reared at 18 °C responded to increasing CO2 by elevating SMR, in contrast to specimens at 10 °C. Isolated gills at 10 °C and elevated PCO2 (≥1200 µatm) displayed increased soft tissue mass, in parallel to increased gill oxygen demand, indicating an increased fraction of gill in whole animal energy budget. Altered gill size was not found at 18 °C, where a shift in the use of ion regulation mechanisms occurred towards enhanced Na(+)/H(+)-exchange and HCO3 (-) transport at high PCO2 (2200 µatm), paralleled by higher Na(+)/K(+)-ATPase activities. This shift did not affect total gill energy consumption leaving whole animal energy budget unaffected. Higher Na(+)/K(+)-ATPase activities in the warmth might have compensated for enhanced branchial permeability and led to reduced plasma Na(+) and/or Cl(-) concentrations and slightly lowered osmolalities seen at 18 °C and 550 or 2200 µatm PCO2 in vivo. Overall, the gill as a key ion regulation organ seems to be highly effective in supporting the resilience of cod to effects of ocean warming and acidification.

  15. Ca2+ regulatory mechanisms of exercise protection against coronary artery disease in metabolic syndrome and diabetes

    PubMed Central

    2011-01-01

    Chronic exercise attenuates coronary artery disease (CAD) in humans largely independent of reductions in risk factors; thus major protective mechanisms of exercise are directly within the coronary vasculature. Further, tight control of diabetes, e.g., blood glucose, can be detrimental. Accordingly, knowledge of mechanisms by which exercise attenuates diabetic CAD could catalyze development of molecular therapies. Exercise attenuates CAD (atherosclerosis) and restenosis in miniature swine models, which enable precise control of exercise parameters (intensity, duration, and frequency) and characterization of the metabolic syndrome (MetS) and diabetic milieu. Intracellular Ca2+ is a pivotal second messenger for coronary smooth muscle (CSM) excitation-contraction and excitation-transcription coupling that modulates CSM proliferation, migration, and calcification. CSM of diabetic dyslipidemic Yucatan swine have impaired Ca2+ extrusion via the plasmalemma Ca2+ ATPase (PMCA), downregulation of L-type voltage-gated Ca2+ channels (VGCC), increased Ca2+ sequestration by the sarcoplasmic reticulum (SR) Ca2+ ATPase (SERCA), increased nuclear Ca2+ localization, and greater activation of K channels by Ca2+ release from the SR. Endurance exercise training prevents Ca2+ transport changes with virtually no effect on the diabetic milieu (glucose, lipids). In MetS Ossabaw swine transient receptor potential canonical (TRPC) channels are upregulated and exercise training reverses expression and TRPC-mediated Ca2+ influx with almost no change in the MetS milieu. Overall, exercise effects on Ca2+ signaling modulate CSM phenotype. Future studies should 1) selectively target key Ca2+ transporters to determine definitively their causal role in atherosclerosis and 2) combine mechanistic studies with clinical outcomes, e.g., reduction of myocardial infarction. PMID:21596923

  16. Gene Regulatory Mechanisms Underlying the Spatial and Temporal Regulation of Target-Dependent Gene Expression in Drosophila Neurons.

    PubMed

    Berndt, Anthony J E; Tang, Jonathan C Y; Ridyard, Marc S; Lian, Tianshun; Keatings, Kathleen; Allan, Douglas W

    2015-12-01

    Neuronal differentiation often requires target-derived signals from the cells they innervate. These signals typically activate neural subtype-specific genes, but the gene regulatory mechanisms remain largely unknown. Highly restricted expression of the FMRFa neuropeptide in Drosophila Tv4 neurons requires target-derived BMP signaling and a transcription factor code that includes Apterous. Using integrase transgenesis of enhancer reporters, we functionally dissected the Tv4-enhancer of FMRFa within its native cellular context. We identified two essential but discrete cis-elements, a BMP-response element (BMP-RE) that binds BMP-activated pMad, and a homeodomain-response element (HD-RE) that binds Apterous. These cis-elements have low activity and must be combined for Tv4-enhancer activity. Such combinatorial activity is often a mechanism for restricting expression to the intersection of cis-element spatiotemporal activities. However, concatemers of the HD-RE and BMP-RE cis-elements were found to independently generate the same spatiotemporal expression as the Tv4-enhancer. Thus, the Tv4-enhancer atypically combines two low-activity cis-elements that confer the same output from distinct inputs. The activation of target-dependent genes is assumed to 'wait' for target contact. We tested this directly, and unexpectedly found that premature BMP activity could not induce early FMRFa expression; also, we show that the BMP-insensitive HD-RE cis-element is activated at the time of target contact. This led us to uncover a role for the nuclear receptor, seven up (svp), as a repressor of FMRFa induction prior to target contact. Svp is normally downregulated immediately prior to target contact, and we found that maintaining Svp expression prevents cis-element activation, whereas reducing svp gene dosage prematurely activates cis-element activity. We conclude that the target-dependent FMRFa gene is repressed prior to target contact, and that target-derived BMP signaling directly

  17. Gene Regulatory Mechanisms Underlying the Spatial and Temporal Regulation of Target-Dependent Gene Expression in Drosophila Neurons

    PubMed Central

    Ridyard, Marc S.; Lian, Tianshun; Keatings, Kathleen; Allan, Douglas W.

    2015-01-01

    Neuronal differentiation often requires target-derived signals from the cells they innervate. These signals typically activate neural subtype-specific genes, but the gene regulatory mechanisms remain largely unknown. Highly restricted expression of the FMRFa neuropeptide in Drosophila Tv4 neurons requires target-derived BMP signaling and a transcription factor code that includes Apterous. Using integrase transgenesis of enhancer reporters, we functionally dissected the Tv4-enhancer of FMRFa within its native cellular context. We identified two essential but discrete cis-elements, a BMP-response element (BMP-RE) that binds BMP-activated pMad, and a homeodomain-response element (HD-RE) that binds Apterous. These cis-elements have low activity and must be combined for Tv4-enhancer activity. Such combinatorial activity is often a mechanism for restricting expression to the intersection of cis-element spatiotemporal activities. However, concatemers of the HD-RE and BMP-RE cis-elements were found to independently generate the same spatiotemporal expression as the Tv4-enhancer. Thus, the Tv4-enhancer atypically combines two low-activity cis-elements that confer the same output from distinct inputs. The activation of target-dependent genes is assumed to 'wait' for target contact. We tested this directly, and unexpectedly found that premature BMP activity could not induce early FMRFa expression; also, we show that the BMP-insensitive HD-RE cis-element is activated at the time of target contact. This led us to uncover a role for the nuclear receptor, seven up (svp), as a repressor of FMRFa induction prior to target contact. Svp is normally downregulated immediately prior to target contact, and we found that maintaining Svp expression prevents cis-element activation, whereas reducing svp gene dosage prematurely activates cis-element activity. We conclude that the target-dependent FMRFa gene is repressed prior to target contact, and that target-derived BMP signaling directly

  18. Intrinsic and extrinsic regulatory mechanisms are required to form and maintain a lens of the correct size and shape.

    PubMed

    McAvoy, J W; Dawes, L J; Sugiyama, Y; Lovicu, F J

    2017-03-01

    Understanding how tissues and organs acquire and maintain an appropriate size and shape remains one of the most challenging areas in developmental biology. The eye lens represents an excellent system to provide insights into regulatory mechanisms because in addition to its relative simplicity in cellular composition (being made up of only two forms of cells, epithelial and fiber cells), these cells must become organized to generate the precise spheroidal arrangement that delivers normal lens function. Epithelial and fiber cells also represent spatially distinct proliferation and differentiation compartments, respectively, and an ongoing balance between these domains must be tightly regulated so that the lens achieves and maintains appropriate dimensions during growth and ageing. Recent research indicates that reciprocal inductive interactions mediated by Wnt-Frizzled and Notch-Jagged signaling pathways are important for maintaining and organizing these compartments. The Hippo-Yap pathway has also been implicated in maintaining the epithelial progenitor compartment and regulating growth processes. Thus, whilst some molecules and mechanisms have been identified, further work in this important area is needed to provide a clearer understanding of how lens size and shape is regulated. Copyright © 2016 Elsevier Ltd. All rights reserved.

  19. PI(4,5)P2-Mediated Cell Signaling: Emerging Principles and PTEN as a Paradigm for Regulatory Mechanism

    PubMed Central

    Gericke, Arne; Leslie, Nicholas R.; Lösche, Mathias; Ross, Alonzo H.

    2013-01-01

    PI(4,5)P2 (phosphatidylinositol 4,5-bisphosphate) is a relatively common anionic lipid that regulates cellular functions by multiple mechanisms. Hydrolysis of PI(4,5)P2 by phospholipase C yields inositol trisphosphate and diacylglycerol. Phosphorylation by phosphoinositide 3-kinase yields PI(3,4,5)P3, which is a potent signal for survival and proliferation. Also, PI(4,5)P2 can bind directly to integral and peripheral membrane proteins. As an example of regulation by PI(4,5)P2, we discuss phosphatase and tensin homologue deleted on chromosome 10 (PTEN) in detail. PTEN is an important tumor suppressor and hydrolyzes PI(3,4,5)P3. PI(4,5)P2 enhances PTEN association with the plasma membrane and activates its phosphatase activity. This is a critical regulatory mechanism, but a detailed description of this process from a structural point of view is lacking. The disordered lipid bilayer environment hinders structural determinations of membrane-bound PTEN. A new method to analyze membrane-bound protein measures neutron reflectivity for proteins bound to tethered phospholipid membranes. These methods allow determination of the orientation and shape of membrane-bound proteins. In combination with molecular dynamics simulations, these studies will provide crucial structural information that can serve as a foundation for our understanding of PTEN regulation in normal and pathological processes. PMID:23775692

  20. Targeted mutagenesis of intergenic regions in the Neisseria gonorrhoeae gonococcal genetic island reveals multiple regulatory mechanisms controlling type IV secretion.

    PubMed

    Ramsey, Meghan E; Bender, Tobias; Klimowicz, Amy K; Hackett, Kathleen T; Yamamoto, Ami; Jolicoeur, Adrienne; Callaghan, Melanie M; Wassarman, Karen M; van der Does, Chris; Dillard, Joseph P

    2015-09-01

    Gonococci secrete chromosomal DNA into the extracellular environment using a type IV secretion system (T4SS). The secreted DNA acts in natural transformation and initiates biofilm development. Although the DNA and its effects are detectable, structural components of the T4SS are present at very low levels, suggestive of uncharacterized regulatory control. We sought to better characterize the expression and regulation of T4SS genes and found that the four operons containing T4SS genes are transcribed at very different levels. Increasing transcription of two of the operons through targeted promoter mutagenesis did not increase DNA secretion. The stability and steady-state levels of two T4SS structural proteins were affected by a homolog of tail-specific protease. An RNA switch was also identified that regulates translation of a third T4SS operon. The switch mechanism relies on two putative stem-loop structures contained within the 5' untranslated region of the transcript, one of which occludes the ribosome binding site and start codon. Mutational analysis of these stem loops supports a model in which induction of an alternative structure relieves repression. Taken together, these results identify multiple layers of regulation, including transcriptional, translational and post-translational mechanisms controlling T4SS gene expression and DNA secretion. © 2015 John Wiley & Sons Ltd.

  1. Evidence of unbalanced regulatory mechanism of heart rate and systolic pressure after acute myocardial infarction.

    PubMed

    Nollo, Giandomenico; Faes, Luca; Porta, Alberto; Pellegrini, Barbara; Ravelli, Flavia; Del Greco, Maurizio; Disertori, Marcello; Antolini, Renzo

    2002-09-01

    The interactions between systolic arterial pressure (SAP) and R-R interval (RR) fluctuations after acute myocardial infarction (AMI) were investigated by measures of synchronization separating the feedback from the feedforward control and capturing both linear and nonlinear contributions. The causal synchronization, evaluating the ability of RR to predict SAP (chi(s/t)) or vice versa (chi(t/s)), and the global synchronization (chi) were estimated at rest and after head-up tilt in 35 post-AMI patients, 20 young and 12 old. Significance and nonlinearity of the coupling were assessed by surrogate data analysis. Tilting increased the number of young subjects in which RR-SAP link was significant (from 17 to 19) and linear (from 11 to 18). In AMI, both significance and linearity of the coupling were low at rest (26 significant and 24 nonlinear) and further reduced after tilt (17 significant and 16 nonlinear). Old subjects showed a partial recovery of linearity after tilt (rest: 1 linear of 7 significant; tilt: 5 linear of 8 significant). In young subjects, the causal synchronization indexes were balanced and increased from rest (chi(t/s) = 0.072 +/- 0.037 and chi(s/t) = 0.054 +/- 0.028) to tilt (chi(t/s) = 0.125 +/- 0.071 and chi(s/t) = 0.108 +/- 0.053). On the contrary, in old subjects and AMI patients, the feedforward was prevalent to the feedback coupling at rest (old: chi(t/s) = 0.041 +/- 0.023 and chi(s/t) = 0.069 +/- 0.042; AMI: chi(t/s) = 0.050 +/- 0.030 and chi(s/t) = 0.089 +/- 0.053). Tilting blunted the unbalance in old subjects (chi(t/s) = 0.065 +/- 0.052 and chi(s/t) = 0.069 +/- 0.044) but not in AMI patients (chi(t/s) = 0.040 +/- 0.019 and chi(s/t) = 0.060 +/- 0.040). Thus, after AMI, nonlinear mechanisms are elicited in RR-SAP interactions. Furthermore, the neural regulation of the cardiovascular system resulted in imbalance as a consequence of impaired feedback and enhanced feedforward control mechanisms.

  2. A competitive regulatory mechanism discriminates between juxtaposed splice sites and pri-miRNA structures

    PubMed Central

    Mattioli, Chiara; Pianigiani, Giulia; Pagani, Franco

    2013-01-01

    We have explored the functional relationships between spliceosome and Microprocessor complex activities in a novel class of microRNAs (miRNAs), named Splice site Overlapping (SO) miRNAs, whose pri-miRNA hairpins overlap splice sites. We focused on the evolutionarily conserved SO miR-34b, and we identified two indispensable elements for recognition of its 3′ splice site: a branch point located in the hairpin and a downstream purine-rich exonic splicing enhancer. In minigene systems, splicing inhibition owing to exonic splicing enhancer deletion or AG 3′ss mutation increases miR-34b levels. Moreover, small interfering-mediated silencing of Drosha and/or DGCR8 improves splicing efficiency and abolishes miR-34b production. Thus, the processing of this 3′ SO miRNA is regulated in an antagonistic manner by the Microprocessor and the spliceosome owing to competition between these two machineries for the nascent transcript. We propose that this novel mechanism is commonly used to regulate the relative amount of SO miRNA and messenger RNA produced from primary transcripts. PMID:23863840

  3. Novel regulatory mechanisms for the Dbl family guanine nucleotide exchange factor Cool-2/alpha-Pix.

    PubMed

    Feng, Qiyu; Baird, Daniel; Cerione, Richard A

    2004-09-01

    The Cool-2 (cloned-out of library-2) protein (identical to alpha-Pix for Pak-interactive exchange factor) has been implicated in various biological responses including chemoattractant signaling and in certain forms of mental retardation. We show that when Cool-2 exists as a dimer, it functions as a Rac-specific guanine nucleotide exchange factor (GEF). Dimerization of Cool-2 enables its Dbl (diffuse B-cell lymphoma) and pleckstrin homology domains to work together (in trans) to bind specifically to Rac-GDP. Dissociation of dimeric Cool-2 into its monomeric form allows it to act as a GEF for Cdc42 as well as for Rac. The binding of either PAK (p21-activated kinase) or Cbl (Casitas B-lymphoma) to the SH3 domain of monomeric Cool-2 is necessary for the functional interactions between GDP-bound Cdc42 or Rac and the Cool-2 monomer. The betagamma subunit complex of large GTP-binding proteins, by interacting with PAK, stimulates the dissociation of the Cool-2 dimer and activates its GEF activity for Cdc42. Overall, these findings highlight novel mechanisms by which extracellular signals can direct the specific activation of Rac versus Cdc42 by Cool-2/alpha-Pix.

  4. Sweat, the driving force behind normal skin: an emerging perspective on functional biology and regulatory mechanisms.

    PubMed

    Murota, Hiroyuki; Matsui, Saki; Ono, Emi; Kijima, Akiko; Kikuta, Junichi; Ishii, Masaru; Katayama, Ichiro

    2015-01-01

    The various symptoms associated with excessive or insufficient perspiration can significantly reduce a patient's quality of life. If a versatile and minimally invasive method could be established for returning sweat activity to normalcy, there is no question that it could be used in the treatment of many diseases that are believed to involve perspiration. For this reason, based on an understanding of the sweat-gland control function and sweat activity, it was necessary to conduct a comprehensive search for the factors that control sweating, such as the central and peripheral nerves that control sweat-gland function, the microenvironment surrounding the sweat glands, and lifestyle. We focused on the mechanism by which atopic dermatitis leads to hypohidrosis and confirmed that histamine inhibits acetylcholinergic sweating. Acetylcholine promotes the phosphorylation of glycogen synthesis kinase 3β (GSK3β) in the sweat-gland secretory cells and leads to sensible perspiration. By suppressing the phosphorylation of GSK3β, histamine inhibits the movement of sweat from the sweat-gland secretory cells through the sweat ducts, which could presumably be demonstrated by dynamic observations of the sweat glands using two-photon microscopy. It is expected that the discovery of new factors that control sweat-gland function can contribute to the treatment of diseases associated with dyshidrosis.

  5. The Mechanisms of Water Exchange: The Regulatory Roles of Multiple Interactions in Social Wasps

    PubMed Central

    Agrawal, Devanshu; Karsai, Istvan

    2016-01-01

    Evolutionary benefits of task fidelity and improving information acquisition via multiple transfers of materials between individuals in a task partitioned system have been shown before, but in this paper we provide a mechanistic explanation of these phenomena. Using a simple mathematical model describing the individual interactions of the wasps, we explain the functioning of the common stomach, an information center, which governs construction behavior and task change. Our central hypothesis is a symmetry between foragers who deposit water and foragers who withdraw water into and out of the common stomach. We combine this with a trade-off between acceptance and resistance to water transfer. We ultimately derive a mathematical function that relates the number of interactions that foragers complete with common stomach wasps during a foraging cycle. We use field data and additional model assumptions to calculate values of our model parameters, and we use these to explain why the fullness of the common stomach stabilizes just below 50 percent, why the average number of successful interactions between foragers and the wasps forming the common stomach is between 5 and 7, and why there is a variation in this number of interactions over time. Our explanation is that our proposed water exchange mechanism places natural bounds on the number of successful interactions possible, water exchange is set to optimize mediation of water through the common stomach, and the chance that foragers abort their task prematurely is very low. PMID:26751076

  6. The Mechanisms of Water Exchange: The Regulatory Roles of Multiple Interactions in Social Wasps.

    PubMed

    Agrawal, Devanshu; Karsai, Istvan

    2016-01-01

    Evolutionary benefits of task fidelity and improving information acquisition via multiple transfers of materials between individuals in a task partitioned system have been shown before, but in this paper we provide a mechanistic explanation of these phenomena. Using a simple mathematical model describing the individual interactions of the wasps, we explain the functioning of the common stomach, an information center, which governs construction behavior and task change. Our central hypothesis is a symmetry between foragers who deposit water and foragers who withdraw water into and out of the common stomach. We combine this with a trade-off between acceptance and resistance to water transfer. We ultimately derive a mathematical function that relates the number of interactions that foragers complete with common stomach wasps during a foraging cycle. We use field data and additional model assumptions to calculate values of our model parameters, and we use these to explain why the fullness of the common stomach stabilizes just below 50 percent, why the average number of successful interactions between foragers and the wasps forming the common stomach is between 5 and 7, and why there is a variation in this number of interactions over time. Our explanation is that our proposed water exchange mechanism places natural bounds on the number of successful interactions possible, water exchange is set to optimize mediation of water through the common stomach, and the chance that foragers abort their task prematurely is very low.

  7. Inducible nitric oxide synthase (NOS-2) in subarachnoid hemorrhage: Regulatory mechanisms and therapeutic implications

    PubMed Central

    Iqbal, Sana; Hayman, Erik G; Hong, Caron; Stokum, Jesse A; Kurland, David B; Gerzanich, Volodymyr; Simard, J Marc

    2016-01-01

    Aneurysmal subarachnoid hemorrhage (SAH) typically carries a poor prognosis. Growing evidence indicates that overabundant production of nitric oxide (NO) may be responsible for a large part of the secondary injury that follows SAH. Although SAH modulates the activity of all three isoforms of nitric oxide synthase (NOS), the inducible isoform, NOS-2, accounts for a majority of NO-mediated secondary injuries after SAH. Here, we review the indispensable physiological roles of NO that must be preserved, even while attempting to downmodulate the pathophysiologic effects of NO that are induced by SAH. We examine the effects of SAH on the function of the various NOS isoforms, with a particular focus on the pathological effects of NOS-2 and on the mechanisms responsible for its transcriptional upregulation. Finally, we review interventions to block NOS-2 upregulation or to counteract its effects, with an emphasis on the potential therapeutic strategies to improve outcomes in patients afflicted with SAH. There is still much to be learned regarding the apparently maladaptive response of NOS-2 and its harmful product NO in SAH. However, the available evidence points to crucial effects that, on balance, are adverse, making the NOS-2/NO/peroxynitrite axis an attractive therapeutic target in SAH. PMID:27774520

  8. The route of passive chloride movement across amphibian skin: localization and regulatory mechanisms.

    PubMed

    Nagel, Wolfram; Somieski, Petra; Katz, Uri

    2002-11-13

    Transepithelial Cl(-) conductance (G(Cl)) in amphibian skin can be activated in several species by serosa positive potentials. Mitochondria-rich cells (MRC) or tight junctions (TJ) between the epithelial cells are possible sites for this pathway. The properties and the techniques used to investigate this pathway are reviewed in the present paper. In situ techniques are preferable, since specific properties of the MRC are apparently not maintained in isolated cells. Volume measurements and electronprobe microanalysis of intracellular ions suggest the localization of voltage-activated G(Cl) to MRC. G(Cl) correlates poorly with the density of MRC. The vibrating voltage probe allows quantitative correlation of the local Cl(-) current through morphologically identified structures and the transepithelial Cl(-) current. Our analysis shows that 80% of the voltage-activated Cl(-) current is accounted for by current through MRC or their immediate vicinity. The activation patterns of this current and the inhibition by the alpha(1)-adrenergic agonist, epinephrine, conform to those of the transepithelial current. However, less than 20% of the MRC are active at a certain moment and the activity is spontaneously variable with time. The molecular nature of this pathway, physiological control mechanisms and their relation to the temporal activity of MRC remain to be studied.

  9. The regulatory mechanism underlying light-inducible production of carotenoids in nonphototrophic bacteria.

    PubMed

    Takano, Hideaki

    2016-07-01

    Light is a ubiquitous environmental factor serving as an energy source and external stimulus. Here, I review the conserved molecular mechanism of light-inducible production of carotenoids in three nonphototrophic bacteria: Streptomyces coelicolor A3(2), Thermus thermophilus HB27, and Bacillus megaterium QM B1551. A MerR family transcriptional regulator, LitR, commonly plays a central role in their light-inducible carotenoid production. Genetic and biochemical studies on LitR proteins revealed a conserved function: LitR in complex with adenosyl B12 (AdoB12) has a light-sensitive DNA-binding activity and thus suppresses the expression of the Crt biosynthesis gene cluster. The in vitro DNA-binding and transcription assays showed that the LitR-AdoB12 complex serves as a repressor allowing transcription initiation by RNA polymerase in response to illumination. The existence of novel light-inducible genes and the unique role of the megaplasmid were revealed by the transcriptomic analysis of T. thermophilus. The findings suggest that LitR is a general regulator responsible for the light-inducible carotenoid production in the phylogenetically divergent nonphototrophic bacteria, and that LitR performs diverse physiological functions in bacteria.

  10. PP2A activation by beta2-adrenergic receptor agonists: novel regulatory mechanism of keratinocyte migration.

    PubMed

    Pullar, Christine E; Chen, Jin; Isseroff, R Rivkah

    2003-06-20

    Understanding the mechanisms that regulate cell migration is important for devising novel therapies to control metastasis or enhance wound healing. Previously, we demonstrated that beta2-adrenergic receptor (beta2-AR) activation in keratinocytes inhibited their migration by decreasing the phosphorylation of a critical promigratory signaling component, the extracellular signal-related kinase (ERK). Here we demonstrate that beta2-AR-induced inhibition of migration is mediated by the activation of the serine/threonine phosphatase PP2A. Pretreating human keratinocytes with the PP2A inhibitor, okadaic acid, prevented the beta2-AR-induced inhibition of migration, either as isolated cells or as a confluent sheet of cells repairing an in vitro "wound" and also prevented the beta2-AR-induced reduction in ERK phosphorylation. Similar results were obtained with human corneal epithelial cells. In keratinocytes, immunoprecipitation studies revealed that beta2-AR activation resulted in the rapid association of beta2-AR with PP2A as well as a 37% increase in association of PP2A with ERK2. Finally, beta2-AR activation resulted in a rapid and transient 2-fold increase in PP2A activity. Thus, we provide the first evidence that beta2-AR activation in keratinocytes modulates migration via a novel pathway utilizing PP2A to alter the promigratory signaling cascade. Exploiting this pathway may result in novel therapeutic approaches for control of epithelial cell migration.

  11. Inducible nitric oxide synthase (NOS-2) in subarachnoid hemorrhage: Regulatory mechanisms and therapeutic implications.

    PubMed

    Iqbal, Sana; Hayman, Erik G; Hong, Caron; Stokum, Jesse A; Kurland, David B; Gerzanich, Volodymyr; Simard, J Marc

    2016-01-01

    Aneurysmal subarachnoid hemorrhage (SAH) typically carries a poor prognosis. Growing evidence indicates that overabundant production of nitric oxide (NO) may be responsible for a large part of the secondary injury that follows SAH. Although SAH modulates the activity of all three isoforms of nitric oxide synthase (NOS), the inducible isoform, NOS-2, accounts for a majority of NO-mediated secondary injuries after SAH. Here, we review the indispensable physiological roles of NO that must be preserved, even while attempting to downmodulate the pathophysiologic effects of NO that are induced by SAH. We examine the effects of SAH on the function of the various NOS isoforms, with a particular focus on the pathological effects of NOS-2 and on the mechanisms responsible for its transcriptional upregulation. Finally, we review interventions to block NOS-2 upregulation or to counteract its effects, with an emphasis on the potential therapeutic strategies to improve outcomes in patients afflicted with SAH. There is still much to be learned regarding the apparently maladaptive response of NOS-2 and its harmful product NO in SAH. However, the available evidence points to crucial effects that, on balance, are adverse, making the NOS-2/NO/peroxynitrite axis an attractive therapeutic target in SAH.

  12. The regulatory mechanism of fungal elicitor-induced secondary metabolite biosynthesis in medical plants.

    PubMed

    Zhai, Xin; Jia, Min; Chen, Ling; Zheng, Cheng-Jian; Rahman, Khalid; Han, Ting; Qin, Lu-Ping

    2017-03-01

    A wide range of external stress stimuli trigger plant cells to undergo complex network of reactions that ultimately lead to the synthesis and accumulation of secondary metabolites. Accumulation of such metabolites often occurs in plants subjected to stresses including various elicitors or signal molecules. Throughout evolution, endophytic fungi, an important constituent in the environment of medicinal plants, have known to form long-term stable and mutually beneficial symbiosis with medicinal plants. The endophytic fungal elicitor can rapidly and specifically induce the expression of specific genes in medicinal plants which can result in the activation of a series of specific secondary metabolic pathways resulting in the significant accumulation of active ingredients. Here we summarize the progress made on the mechanisms of fungal elicitor including elicitor signal recognition, signal transduction, gene expression and activation of the key enzymes and its application. This review provides guidance on studies which may be conducted to promote the efficient synthesis and accumulation of active ingredients by the endogenous fungal elicitor in medicinal plant cells, and provides new ideas and methods of studying the regulation of secondary metabolism in medicinal plants.

  13. Seasonality of reproduction in mammals: intimate regulatory mechanisms and practical implications.

    PubMed

    Chemineau, P; Guillaume, D; Migaud, M; Thiéry, J C; Pellicer-Rubio, M T; Malpaux, B

    2008-07-01

    Farm mammals generally express seasonal variations in their production traits, thus inducing changing availability of fresh derived animal products (meat, milk and cheese) or performances (horses). This is due to a more or less marked seasonal birth distribution in sheep and goats, in horses but not cattle. Birth peak occurs at the end of winter-early spring, the most favourable period for the progeny to survive. Most species show seasonal variations in their ovulation frequency (presence or absence of ovulation), spermatogenic activity (from moderate decrease to complete absence of sperm production), gamete quality (variations in fertilization rates and embryo survival), and also sexual behaviour. The intimate mechanism involved is a complex combination of endogenous circannual rhythm driven and synchronized by light and melatonin. Profound and long-term neuroendocrine changes involving different neuromediator systems were described to play a role in these processes. In most species artificial photoperiodic treatments consisting of extra-light during natural short days (in sheep and goats and mares) or melatonin during long days (in sheep and goats) are extensively used to either adjust the breeding season to animal producer needs and/or to completely overcome seasonal variations of sperm production in artificial insemination centres. Pure light treatments (without melatonin), especially when applied in open barns, could be considered as non-invasive ones which fully respect animal welfare. Genetic selection could be one of the future ways to decrease seasonality in sheep and goats.

  14. Gastrointestinal regulatory peptides and central nervous system mechanisms of weight control.

    PubMed

    Ladenheim, Ellen E

    2012-02-01

    This review focuses on recent advances in understanding the multiple roles of gastrointestinal peptides in the control of food intake and body weight with specific emphasis on ghrelin, amylin and glucagon-like peptide 1. Recent studies support a role for ghrelin, amylin and glucagon-like peptide 1 in short-term and long-term effects on food intake and body weight. Apart from contributing to energy homeostasis, ghrelin's participation in reward and sensory processing has been the focus of much recent work. New findings on amylin's effects on food intake and energy balance provide further support for its role in meal-related food intake and suggest that it may also function as an adiposity signal. New investigations on the role of central and peripheral glucagon-like peptide 1 receptors in mediating the anorexic effects of glucagon-like peptide 1 have suggested that they differentially contribute to short-term and long term effects on food intake. Gastrointestinal peptides can influence food intake through mechanisms that involve short-term meal-related effects or through activation of central pathways involved in energy balance. An appreciation of the multiple actions of gastrointestinal peptides on food intake will aid in developing new strategies for weight management.

  15. Tuning of Redox Regulatory Mechanisms, Reactive Oxygen Species and Redox Homeostasis under Salinity Stress

    PubMed Central

    Hossain, M. Sazzad; Dietz, Karl-Josef

    2016-01-01

    Soil salinity is a crucial environmental constraint which limits biomass production at many sites on a global scale. Saline growth conditions cause osmotic and ionic imbalances, oxidative stress and perturb metabolism, e.g., the photosynthetic electron flow. The plant ability to tolerate salinity is determined by multiple biochemical and physiological mechanisms protecting cell functions, in particular by regulating proper water relations and maintaining ion homeostasis. Redox homeostasis is a fundamental cell property. Its regulation includes control of reactive oxygen species (ROS) generation, sensing deviation from and readjustment of the cellular redox state. All these redox related functions have been recognized as decisive factors in salinity acclimation and adaptation. This review focuses on the core response of plants to overcome the challenges of salinity stress through regulation of ROS generation and detoxification systems and to maintain redox homeostasis. Emphasis is given to the role of NADH oxidase (RBOH), alternative oxidase (AOX), the plastid terminal oxidase (PTOX) and the malate valve with the malate dehydrogenase isoforms under salt stress. Overwhelming evidence assigns an essential auxiliary function of ROS and redox homeostasis to salinity acclimation of plants. PMID:27242807

  16. Retinal proteomic changes under different ischemic conditions - implication of an epigenetic regulatory mechanism

    PubMed Central

    Stowell, Cheri; Wang, Lin; Arbogast, Brian; Lan, Jing-quan; Cioffi, George A; Burgoyne, Claude F; Zhou, An

    2010-01-01

    In retina, an ischemic injury-resistant condition (ischemic tolerance) can be induced by a sub-lethal ischemic treatment (preconditioning) prior to an otherwise injurious ischemic insult. In this work, we compared retinal proteomic changes under three different ischemic conditions, as a means to identify the effector mechanisms that underlie retinal ischemic tolerance. Transient retinal ischemia was induced by elevating the intraocular pressure (IOP) in three groups of adult rats as follows: Group 1, ischemic-preconditioned, 110 mmHg for 8 minutes followed by 48 hours reperfusion; Group 2, ischemic-injured, 110 mmHg for 60 minutes followed by 24 hours reperfusion; Group 3, ischemic-tolerant, preconditioning treatment followed by another 60 minutes of 110 mmHg and 24 hours reperfusion. Protein quantities in retinas from each of the afore-mentioned retinal ischemic conditions, as determined by quantitative mass spectrometry, were compared with that of the contralateral control eyes (sham-treated). As a result, a total of 328 proteins were identified and quantified; among them, 30–60% of proteins showed a change in abundance under one or more retinal ischemic conditions. In particular, in ischemic-tolerant retinas, histone proteins H2B, H3 and H4 demonstrated an increase in abundance, whereas histone H2A showed a decrease in abundance. Further immunohistochemical analyses confirmed the results of proteomic analyses, and detected an up regulation of tri-methylated histone H3, mono-ubiquitinated histone H2A and Polycomb group protein RING2. Together, these results suggest a role of epigenetic regulation in the induction of retinal ischemic tolerance that involves histone and polycomb proteins. PMID:20740046

  17. Anaerobic transcription activation in Bacillus subtilis: identification of distinct FNR-dependent and -independent regulatory mechanisms.

    PubMed Central

    Cruz Ramos, H; Boursier, L; Moszer, I; Kunst, F; Danchin, A; Glaser, P

    1995-01-01

    Bacillus subtilis is able to grow anaerobically using alternative electron acceptors, including nitrate or fumarate. We characterized an operon encoding the dissimilatory nitrate reductase subunits homologous to the Escherichia coli narGHJI operon and the narK gene encoding a protein with nitrite extrusion activity. Downstream from narK and co-transcribed with it a gene (fnr) encoding a protein homologous to E.coli FNR was found. Disruption of fnr abolished both nitrate and fumarate utilization as electron acceptors and anaerobic induction of narK. Four putative FNR binding sites were found in B.subtilis sequences. The consensus sequence, centred at position -41.5, is identical to the consensus for the DNA site for E.coli CAP. Bs-FNR contained a four cysteine residue cluster at its C-terminal end. This is in contrast to Ec-FNR, where a similar cluster is present at the N-terminal end. It is possible that oxygen modulates the activity of both activators by a similar mechanism involving iron. Unlike in E.coli, where fnr expression is weakly repressed by anaerobiosis, fnr gene expression in B.subtilis is strongly activated by anaerobiosis. We have identified in the narK-fnr intergenic region a promotor activated by anaerobiosis independently of FNR. Thus induction of genes involved in anaerobic respiration requires in B.subtilis at least two levels of regulation: activation of fnr transcription and activation of FNR to induce transcription of FNR-dependent promoters. Images PMID:8846791

  18. Phosphoproteomic analysis of interacting tumor and endothelial cells identifies regulatory mechanisms of transendothelial migration.

    PubMed

    Locard-Paulet, Marie; Lim, Lindsay; Veluscek, Giulia; McMahon, Kelly; Sinclair, John; van Weverwijk, Antoinette; Worboys, Jonathan D; Yuan, Yinyin; Isacke, Clare M; Jørgensen, Claus

    2016-02-09

    The exit of metastasizing tumor cells from the vasculature, extravasation, is regulated by their dynamic interactions with the endothelial cells that line the internal surface of vessels. To elucidate signals controlling tumor cell adhesion to the endothelium and subsequent transendothelial migration, we performed phosphoproteomic analysis to map cell-specific changes in protein phosphorylation that were triggered by contact between metastatic MDA-MB-231 breast cancer cells and endothelial cells. From the 2669 unique phosphorylation sites identified, 77 and 43 were differentially phosphorylated in the tumor cells and endothelial cells, respectively. The receptor tyrosine kinase ephrin type A receptor 2 (EPHA2) exhibited decreased Tyr(772) phosphorylation in the cancer cells upon endothelial contact. Knockdown of EPHA2 increased adhesion of the breast cancer cells to human umbilical vein endothelial cells (HUVECs) and their transendothelial migration in coculture cell assays, as well as early-stage lung colonization in vivo. EPHA2-mediated inhibition of transendothelial migration of breast cancer cells depended on interaction with the ligand ephrinA1 on HUVECs and phosphorylation of EPHA2-Tyr(772). When EPHA2 phosphorylation dynamics were compared between cell lines of different metastatic ability, EPHA2-Tyr(772) was rapidly dephosphorylated after ephrinA1 stimulation specifically in cells targeting the lung. Knockdown of the phosphatase LMW-PTP reduced adhesion and transendothelial migration of the breast cancer cells. Overall, cell-specific phosphoproteomic analysis provides a bidirectional map of contact-initiated signaling between tumor and endothelial cells that can be further investigated to identify mechanisms controlling the transendothelial cell migration of cancer cells.

  19. Molecular mechanism for differential recognition of membrane phosphatidylserine by the immune regulatory receptor Tim4.

    PubMed

    Tietjen, Gregory T; Gong, Zhiliang; Chen, Chiu-Hao; Vargas, Ernesto; Crooks, James E; Cao, Kathleen D; Heffern, Charles T R; Henderson, J Michael; Meron, Mati; Lin, Binhua; Roux, Benot; Schlossman, Mark L; Steck, Theodore L; Lee, Ka Yee C; Adams, Erin J

    2014-04-15

    Recognition of phosphatidylserine (PS) lipids exposed on the extracellular leaflet of plasma membranes is implicated in both apoptotic cell removal and immune regulation. The PS receptor T cell immunoglobulin and mucin-domain-containing molecule 4 (Tim4) regulates T-cell immunity via phagocytosis of both apoptotic (high PS exposure) and nonapoptotic (intermediate PS exposure) activated T cells. The latter population must be removed at lower efficiency to sensitively control immune tolerance and memory cell population size, but the molecular basis for how Tim4 achieves this sensitivity is unknown. Using a combination of interfacial X-ray scattering, molecular dynamics simulations, and membrane binding assays, we demonstrate how Tim4 recognizes PS in the context of a lipid bilayer. Our data reveal that in addition to the known Ca(2+)-coordinated, single-PS binding pocket, Tim4 has four weaker sites of potential ionic interactions with PS lipids. This organization makes Tim4 sensitive to PS surface concentration in a manner capable of supporting differential recognition on the basis of PS exposure level. The structurally homologous, but functionally distinct, Tim1 and Tim3 are significantly less sensitive to PS surface density, likely reflecting the differences in immunological function between the Tim proteins. These results establish the potential for lipid membrane parameters, such as PS surface density, to play a critical role in facilitating selective recognition of PS-exposing cells. Furthermore, our multidisciplinary approach overcomes the difficulties associated with characterizing dynamic protein/membrane systems to reveal the molecular mechanisms underlying Tim4's recognition properties, and thereby provides an approach capable of providing atomic-level detail to uncover the nuances of protein/membrane interactions.

  20. Regulatory mechanisms in the interaction between carbohydrate and lipid oxidation during exercise.

    PubMed

    Spriet, L L; Watt, M J

    2003-08-01

    At the onset of exercise, signals from inside and outside the muscle cell increase the availability of carbohydrate (CHO) and fat to provide the fuel required for ATP production. CHO and fat oxidation are the dominant sources of aerobic ATP production and both pathways must be heavily upregulated during exercise to meet the increased energy demand. Within this paradigm, there is room for shifts between the proportion of energy that is provided from CHO and fat. It has long been known that increasing the availability of endogenous or exogenous CHO can increase the oxidation of CHO and decrease the oxidation of fat. The opposite is also true. While descriptive studies documenting these changes are numerous, the mechanisms regulating these shifts in fuel use in the face of constant energy demand have not been thoroughly elucidated. It would be expected, for example, that any fat-induced shift in CHO metabolism would target the enzymes that play key roles in regulating CHO metabolism and oxidation. Inside the muscle these could include glucose uptake (GLUT4) and phosphorylation (hexokinase), glycogenolysis (glycogen phosphorylase), glycolysis (phosphofructokinase) and conversion to acetyl CoA (pyruvate dehydrogenase). The same would be expected for a CHO-induced down regulation of fat metabolism and oxidation and might target transport of long chain fatty acids into the cell (fatty acid translocase CD36), release of fatty acids from intramuscular triacylglycerol (hormone sensitive lipase) and transport into the mitochondria (carnitine palmitoyl transferase complex). This review summarizes the work describing the interaction between CHO and fat metabolism in human skeletal muscle during exercise and presents the theories that may account for CHO/fat interaction during exercise.

  1. Just-in-Time Control of Spo0A Synthesis in Bacillus subtilis by Multiple Regulatory Mechanisms ▿ §

    PubMed Central

    Chastanet, Arnaud; Losick, Richard

    2011-01-01

    The response regulator Spo0A governs multiple developmental processes in Bacillus subtilis, including most conspicuously sporulation. Spo0A is activated by phosphorylation via a multicomponent phosphorelay. Previous work has shown that the Spo0A protein is not rate limiting for sporulation. Rather, Spo0A is present at high levels in growing cells, rapidly rising to yet higher levels under sporulation-inducing conditions, suggesting that synthesis of the response regulator is subject to a just-in-time control mechanism. Transcription of spo0A is governed by a promoter switching mechanism, involving a vegetative, σA-recognized promoter, Pv, and a sporulation σH-recognized promoter, Ps, that is under phosphorylated Spo0A (Spo0A∼P) control. The spo0A regulatory region also contains four (including one identified in the present work) conserved elements that conform to the consensus binding site for Spo0A∼P binding sites. These are herein designated O1, O2, O3, and O4 in reverse order of their proximity to the coding sequence. Here we report that O1 is responsible for repressing Pv during the transition to stationary phase, that O2 is responsible for repressing Ps during growth, that O3 is responsible for activating Ps at the start of sporulation, and that O4 is dispensable for promoter switching. We also report that Spo0A synthesis is subject to a posttranscriptional control mechanism such that translation of mRNAs originating from Pv is impeded due to RNA secondary structure whereas mRNAs originating from Ps are fully competent for protein synthesis. We propose that the opposing actions of O2 and O3 and the enhanced translatability of mRNAs originating from Ps create a highly sensitive, self-reinforcing switch that is responsible for producing a burst of Spo0A synthesis at the start of sporulation. PMID:21949067

  2. Mechanisms underlying zoonotic success of Campylobacter jejuni: the CprRS two-component regulatory system influences essential processes, biofilm formation, and pathogenesis

    USDA-ARS?s Scientific Manuscript database

    Mechanisms underlying zoonotic success of Campylobacter jejuni: the CprRS two-component regulatory system influences essential processes, biofilm formation, and pathogenesis Campylobacter jejuni is a leading cause of food- and waterbourne bacterial gastroenteritis in the developed world. Although il...

  3. [Inductive effect of zinc oxide nanoparticles on interleukin 8 gene expression in human bronchial epithelial cells and its regulatory mechanism].

    PubMed

    Lu, Yang; Xu, Lei; Yan, Zhen; Wu, Yi-ming; Wu, Wei-dong

    2013-02-01

    To clarify the effect of zinc oxide nanoparticles (ZnO-NPs) (30 nm in diameter) on the interleukin 8 (IL-8) gene expression in human bronchial epithelial cells (BEAS-2B) and its regulatory mechanism. BEAS-2B cells were used in the study. The MTT assay was employed to evaluate the damage to BEAS-2B cells by ZnO-NPs. RT-PCR and ELISA were used to measure the mRNA and protein expression levels of IL-8 in the BEAS-2B cells exposed to ZnO-NPs. The IL-8 mRNA decay assay was used to determine the effect of ZnO-NPs on IL-8 mRNA stability. Exposure to ZnO-NPs significantly increased the level of IL-8 mRNA in BEAS-2B cells and the level of IL-8 protein in supernatant medium. The transcription inhibitor significantly reduced the mRNA expression of IL-8 induced by ZnO-NPs. ZnO-NPs significantly delayed IL-8 mRNA degradation in the BEAS-2B cells that were pretreated with actinomycin D for terminating IL-8 mRNA synthesis. ZnO-NPs can increase the mRNA and protein expression levels of IL-8 and IL-8 mRNA stability in BEAS-2B cells.

  4. Regulatory Mechanisms of the Ihh/PTHrP Signaling Pathway in Fibrochondrocytes in Entheses of Pig Achilles Tendon

    PubMed Central

    Han, Xuesong; Zhuang, Yanfeng; Zhang, Zhihong

    2016-01-01

    This study is aimed at exploring the effect of stress stimulation on the proliferation and differentiation of fibrochondrocytes in entheses mediated via the Indian hedgehog (Ihh)/parathyroid hormone-related protein (PTHrP) signaling pathway. Differential stress stimulation on fibrochondrocytes in entheses was imposed. Gene expression and protein levels of signaling molecules including collagen type I (Col I), Col II, Col X, Ihh, and PTHrP in the cytoplasm of fibrochondrocytes were detected. Ihh signal blocking group was set up using Ihh signaling pathway-specific blocking agent cyclopamine. PTHrP enhancement group was set up using PTHrP reagent. Ihh/PTHrP double intervention group, as well as control group, was included to study the regulatory mechanisms of the Ihh/PTHrP signaling pathway in fibrochondrocytes. Under low cyclic stress tensile (CTS), PTHrP, Col I, and Col II gene expression and protein synthesis increased. Under high CTS, Ihh and Col X gene expression and protein synthesis increased. Blocking Ihh signaling with cyclopamine resulted in reduced PTHrP gene expression and protein synthesis and increased Col X gene expression and protein synthesis. Ihh and PTHrP coregulate fibrochondrocyte proliferation and differentiation in entheses through negative feedback regulation. Fibrochondrocyte is affected by the CTS. This phenomenon is regulated by stress stimulation through the Ihh/PTHrP signaling pathway. PMID:27994624

  5. Auxin Response Factor SlARF2 Is an Essential Component of the Regulatory Mechanism Controlling Fruit Ripening in Tomato

    PubMed Central

    Hao, Yanwei; Hu, Guojian; Breitel, Dario; Liu, Mingchun; Mila, Isabelle; Frasse, Pierre; Fu, Yongyao; Aharoni, Asaph; Bouzayen, Mondher; Zouine, Mohamed

    2015-01-01

    Ethylene is the main regulator of climacteric fruit ripening, by contrast the putative role of other phytohormones in this process remains poorly understood. The present study brings auxin signaling components into the mechanism regulating tomato fruit ripening through the functional characterization of Auxin Response Factor2 (SlARF2) which encodes a downstream component of auxin signaling. Two paralogs, SlARF2A and SlARF2B, are found in the tomato genome, both displaying a marked ripening-associated expression but distinct responsiveness to ethylene and auxin. Down-regulation of either SlARF2A or SlARF2B resulted in ripening defects while simultaneous silencing of both genes led to severe ripening inhibition suggesting a functional redundancy among the two ARFs. Tomato fruits under-expressing SlARF2 produced less climacteric ethylene and exhibited a dramatic down-regulation of the key ripening regulators RIN, CNR, NOR and TAGL1. Ethylene treatment failed to reverse the non-ripening phenotype and the expression of ethylene signaling and biosynthesis genes was strongly altered in SlARF2 down-regulated fruits. Although both SlARF proteins are transcriptional repressors the data indicate they work as positive regulators of tomato fruit ripening. Altogether, the study defines SlARF2 as a new component of the regulatory network controlling the ripening process in tomato. PMID:26716451

  6. Auxin Response Factor SlARF2 Is an Essential Component of the Regulatory Mechanism Controlling Fruit Ripening in Tomato.

    PubMed

    Hao, Yanwei; Hu, Guojian; Breitel, Dario; Liu, Mingchun; Mila, Isabelle; Frasse, Pierre; Fu, Yongyao; Aharoni, Asaph; Bouzayen, Mondher; Zouine, Mohamed

    2015-12-01

    Ethylene is the main regulator of climacteric fruit ripening, by contrast the putative role of other phytohormones in this process remains poorly understood. The present study brings auxin signaling components into the mechanism regulating tomato fruit ripening through the functional characterization of Auxin Response Factor2 (SlARF2) which encodes a downstream component of auxin signaling. Two paralogs, SlARF2A and SlARF2B, are found in the tomato genome, both displaying a marked ripening-associated expression but distinct responsiveness to ethylene and auxin. Down-regulation of either SlARF2A or SlARF2B resulted in ripening defects while simultaneous silencing of both genes led to severe ripening inhibition suggesting a functional redundancy among the two ARFs. Tomato fruits under-expressing SlARF2 produced less climacteric ethylene and exhibited a dramatic down-regulation of the key ripening regulators RIN, CNR, NOR and TAGL1. Ethylene treatment failed to reverse the non-ripening phenotype and the expression of ethylene signaling and biosynthesis genes was strongly altered in SlARF2 down-regulated fruits. Although both SlARF proteins are transcriptional repressors the data indicate they work as positive regulators of tomato fruit ripening. Altogether, the study defines SlARF2 as a new component of the regulatory network controlling the ripening process in tomato.

  7. Reactive oxygen species regulatory mechanisms associated with rapid response of MC3T3-E1 cells for vibration stress

    SciTech Connect

    Zhang, Ling; Gan, Xueqi; Zhu, Zhuoli; Yang, Yang; He, Yuting; Yu, Haiyang

    2016-02-12

    Although many previous studies have shown that refractory period-dependent memory effect of vibration stress is anabolic for skeletal homeostasis, little is known about the rapid response of osteoblasts simply derived from vibration itself. In view of the potential role of reactive oxygen species (ROS) in mediating differentiated activity of osteoblasts, whether and how ROS regulates the rapid effect of vibration deserve to be demonstrated. Our findings indicated that MC3T3-E1 cells underwent decreased gene expression of Runx2, Col-I and ALP and impaired ALP activity accompanied by increased mitochondrial fission immediately after vibration loading. Moreover, we also revealed the involvement of ERK-Drp1 signal transduction in ROS regulatory mechanisms responsible for the rapid effect of vibration stress. - Highlights: • ROS contributed to the rapid response of MC3T3-E1 cells for vibration stress. • Imbalance of mitochondrial dynamics were linked to the LMHFV-derived rapid response. • The role of ERK-Drp1 signal pathway in the LMHFV-derived osteoblast rapid response.

  8. Transcriptome profiling reveals the regulatory mechanism underlying pollination dependent and parthenocarpic fruit set mainly mediated by auxin and gibberellin.

    PubMed

    Tang, Ning; Deng, Wei; Hu, Guojian; Hu, Nan; Li, Zhengguo

    2015-01-01

    Fruit set is a key process for crop production in tomato which occurs after successful pollination and fertilization naturally. However, parthenocarpic fruit development can be uncoupled from fertilization triggered by exogenous auxin or gibberellins (GAs). Global transcriptome knowledge during fruit initiation would help to characterize the molecular mechanisms by which these two hormones regulate pollination-dependent and -independent fruit set. In this work, digital gene expression tag profiling (DGE) technology was applied to compare the transcriptomes from pollinated and 2, 4-D/GA3-treated ovaries. Activation of carbohydrate metabolism, cell division and expansion as well as the down-regulation of MADS-box is a comprehensive regulatory pathway during pollination-dependent and parthenocarpic fruit set. The signaling cascades of auxin and GA are significantly modulated. The feedback regulations of Aux/IAAs and DELLA genes which functioned to fine-tune auxin and GA response respectively play fundamental roles in triggering fruit initiation. In addition, auxin regulates GA synthesis via up-regulation of GA20ox1 and down-regulation of KNOX. Accordingly, the effect of auxin on fruit set is mediated by GA via ARF2 and IAA9 down-regulation, suggesting that both pollination-dependent and parthenocarpic fruit set depend on the crosstalk between auxin and GA. This study characterizes the transcriptomic features of ovary development and more importantly unravels the integral roles of auxin and GA on pollination-dependent and parthenocarpic fruit set.

  9. Transcriptome Profiling Reveals the Regulatory Mechanism Underlying Pollination Dependent and Parthenocarpic Fruit Set Mainly Mediated by Auxin and Gibberellin

    PubMed Central

    Tang, Ning; Deng, Wei; Hu, Guojian; Hu, Nan; Li, Zhengguo

    2015-01-01

    Background Fruit set is a key process for crop production in tomato which occurs after successful pollination and fertilization naturally. However, parthenocarpic fruit development can be uncoupled from fertilization triggered by exogenous auxin or gibberellins (GAs). Global transcriptome knowledge during fruit initiation would help to characterize the molecular mechanisms by which these two hormones regulate pollination-dependent and -independent fruit set. Principal Findings In this work, digital gene expression tag profiling (DGE) technology was applied to compare the transcriptomes from pollinated and 2, 4-D/GA3-treated ovaries. Activation of carbohydrate metabolism, cell division and expansion as well as the down-regulation of MADS-box is a comprehensive regulatory pathway during pollination-dependent and parthenocarpic fruit set. The signaling cascades of auxin and GA are significantly modulated. The feedback regulations of Aux/IAAs and DELLA genes which functioned to fine-tune auxin and GA response respectively play fundamental roles in triggering fruit initiation. In addition, auxin regulates GA synthesis via up-regulation of GA20ox1 and down-regulation of KNOX. Accordingly, the effect of auxin on fruit set is mediated by GA via ARF2 and IAA9 down-regulation, suggesting that both pollination-dependent and parthenocarpic fruit set depend on the crosstalk between auxin and GA. Significance This study characterizes the transcriptomic features of ovary development and more importantly unravels the integral roles of auxin and GA on pollination-dependent and parthenocarpic fruit set. PMID:25909657

  10. Definition of the transcriptional activation domains of three human HOX proteins depends on the DNA-binding context.

    PubMed

    Viganò, M A; Di Rocco, G; Zappavigna, V; Mavilio, F

    1998-11-01

    Hox proteins control developmental patterns and cell differentiation in vertebrates by acting as positive or negative regulators of still unidentified downstream target genes. The homeodomain and other small accessory sequences encode the DNA-protein and protein-protein interaction functions which ultimately dictate target recognition and functional specificity in vivo. The effector domains responsible for either positive or negative interactions with the cell transcriptional machinery are unknown for most Hox proteins, largely due to a lack of physiological targets on which to carry out functional analysis. We report the identification of the transcriptional activation domains of three human Hox proteins, HOXB1, HOXB3, and HOXD9, which interact in vivo with the autoregulatory and cross-regulatory enhancers of the murine Hoxb-1 and human HOXD9 genes. Activation domains have been defined both in a homologous context, i.e., within a HOX protein binding as a monomer or as a HOX-PBX heterodimer to the specific target, and in a heterologous context, after translocation to the yeast Gal4 DNA-binding domain. Transfection analysis indicates that activation domains can be identified in different regions of the three HOX proteins depending on the context in which they interact with the DNA target. These results suggest that Hox proteins may be multifunctional transcriptional regulators, interacting with different cofactors and/or components of the transcriptional machinery depending on the structure of their target regulatory elements.

  11. Multistructure index in revealing complexity of regulatory mechanisms of human cardiovascular system at rest and orthostatic stress in healthy humans

    NASA Astrophysics Data System (ADS)

    Makowiec, Danuta; Graff, Beata; Struzik, Zbigniew R.

    2017-02-01

    Biological regulation is sufficiently complex to pose an enduring challenge for characterization of both its equilibrium and transient non-equilibrium dynamics. Two univariate but coupled observables, heart rate and systolic blood pressure, are commonly characterized in the benchmark example of the human cardiovascular regulatory system. Asymmetric distributions of accelerations and decelerations of heart rate, as well as rises and falls in systolic blood pressure, recorded in humans during a head-up tilt test provide insights into the dynamics of cardiovascular response to a rapid, controlled deregulation of the system's homeostasis. The baroreflex feedback loop is assumed to be the fundamental physiological mechanism for ensuring homeostatic blood supply to distant organs at rest and during orthostatic stress, captured in a classical beat-to-beat autoregressive model of baroreflex by de Boer et al. (1987). For model corroboration, a multistructure index statistic is proposed, seamlessly evaluating the size spectrum of magnitudes of neural reflexes such as baroreflex, responsible for maintaining the homeostatic dynamics. The multistructure index exposes a distinctly different dynamics of multiscale asymmetry between results obtained from real-life signals recorded from healthy subjects and those simulated using both the classical and perturbed versions of the model. Nonlinear effects observed suggest the pronounced presence of complex mechanisms resulting from baroreflex regulation when a human is at rest, which is aggravated in the system's response to orthostatic stress. Using our methodology of multistructure index, we therefore show a marked difference between model and real-life scenarios, which we attribute to multiscale asymmetry of non-linear origin in real-life signals, which we are not reproducible by the classical model.

  12. Simulations of cellulose translocation in the bacterial cellulose synthase suggest a regulatory mechanism for the dimeric structure of cellulose

    SciTech Connect

    Knott, Brandon C.; Crowley, Michael F.; Himmel, Michael E.; Zimmer, Jochen; Beckham, Gregg T.

    2016-01-29

    The processive cycle of the bacterial cellulose synthase (Bcs) includes the addition of a single glucose moiety to the end of a growing cellulose chain followed by the translocation of the nascent chain across the plasma membrane. The mechanism of this translocation and its precise location within the processive cycle are not well understood. In particular, the molecular details of how a polymer (cellulose) whose basic structural unit is a dimer (cellobiose) can be constructed by adding one monomer (glucose) at a time are yet to be elucidated. Here, we have utilized molecular dynamics simulations and free energy calculations to the shed light on these questions. We find that translocation forward by one glucose unit is quite favorable energetically, giving a free energy stabilization of greater than 10 kcal mol-1. In addition, there is only a small barrier to translocation, implying that translocation is not rate limiting within the Bcs processive cycle (given experimental rates for cellulose synthesis in vitro). Perhaps most significantly, our results also indicate that steric constraints at the transmembrane tunnel entrance regulate the dimeric structure of cellulose. Namely, when a glucose molecule is added to the cellulose chain in the same orientation as the acceptor glucose, the terminal glucose freely rotates upon forward motion, thus suggesting a regulatory mechanism for the dimeric structure of cellulose. We characterize both the conserved and non-conserved enzyme-polysaccharide interactions that drive translocation, and find that 20 of the 25 residues that strongly interact with the translocating cellulose chain in the simulations are well conserved, mostly with polar or aromatic side chains. Our results also allow for a dynamical analysis of the role of the so-called 'finger helix' in cellulose translocation that has been observed structurally. Taken together, these findings aid in the elucidation of the translocation steps of the Bcs processive cycle

  13. Selective intestinal decontamination with norfloxacin enhances a regulatory T cell-mediated inflammatory control mechanism in cirrhosis.

    PubMed

    Juanola, Oriol; Gómez-Hurtado, Isabel; Zapater, Pedro; Moratalla, Alba; Caparrós, Esther; Piñero, Paula; González-Navajas, José M; Giménez, Paula; Such, José; Francés, Rubén

    2016-12-01

    Norfloxacin exerts immunomodulatory effects in cirrhosis beyond its bactericidal activity. We aimed at identifying the role of regulatory T (Treg) cells in the norfloxacin mechanism that compensates the inflammatory environment in cirrhosis. Consecutively admitted patients with cirrhosis and ascitic fluid (AF) with: spontaneous bacterial peritonitis (SBP), non-infected AF, and norfloxacin as secondary SBP prophylaxis (SID group). Tregs were defined by flow-cytometry as CD4(+) CD25(+) FoxP3(+) cells. Dendritic cells (DCs) were purified for co-stimulatory signalling evaluation and norfloxacin and IL-10 levels were measured in serum. Wildtype and recombination activating gene 1 (Rag1)-deficient mice with CCl4 -induced cirrhosis were used for adoptive-transfer experiments using naïve CD4(+) T cells and Tregs. Eighty-four patients were included. Treg percentage was significantly increased in SID patients compared with SBP or non-infected AF patients. A positive correlation was observed between Tregs and serum norfloxacin and IL-10 levels. DCs from SID patients showed a significantly decreased expression of CD80 and CD86 compared with SBP and non-infected AF patients and correlated with norfloxacin levels. Modulation of co-stimulatory signalling by norfloxacin was not detected in Rag1-deficient mice and Rag1-deficient mice reconstituted with naïve T-cells. However, reconstitution with naïve T-cells and Tregs was associated with significantly downregulated CD80 and CD86 expression in the presence of norfloxacin. Norfloxacin immunomodulatory effect on IL-2 and IFN-gamma reduction and on the increase of IL-10 was significantly achieved only when the Tregs were restored in Rag1-deficient mice. These results provide a plausible mechanism for the immunomodulatory effects of norfloxacin in cirrhosis beyond its bactericidal effect. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  14. The function of the RNA-binding protein TEL1 in moss reveals ancient regulatory mechanisms of shoot development.

    PubMed

    Vivancos, Julien; Spinner, Lara; Mazubert, Christelle; Charlot, Florence; Paquet, Nicolas; Thareau, Vincent; Dron, Michel; Nogué, Fabien; Charon, Céline

    2012-03-01

    The shoot represents the basic body plan in land plants. It consists of a repeated structure composed of stems and leaves. Whereas vascular plants generate a shoot in their diploid phase, non-vascular plants such as mosses form a shoot (called the gametophore) in their haploid generation. The evolution of regulatory mechanisms or genetic networks used in the development of these two kinds of shoots is unclear. TERMINAL EAR1-like genes have been involved in diploid shoot development in vascular plants. Here, we show that disruption of PpTEL1 from the moss Physcomitrella patens, causes reduced protonema growth and gametophore initiation, as well as defects in gametophore development. Leafy shoots formed on ΔTEL1 mutants exhibit shorter stems with more leaves per shoot, suggesting an accelerated leaf initiation (shortened plastochron), a phenotype shared with the Poaceae vascular plants TE1 and PLA2/LHD2 mutants. Moreover, the positive correlation between plastochron length and leaf size observed in ΔTEL1 mutants suggests a conserved compensatory mechanism correlating leaf growth and leaf initiation rate that would minimize overall changes in plant biomass. The RNA-binding protein encoded by PpTEL1 contains two N-terminus RNA-recognition motifs, and a third C-terminus non-canonical RRM, specific to TEL proteins. Removal of the PpTEL1 C-terminus (including this third RRM) or only 16-18 amino acids within it seriously impairs PpTEL1 function, suggesting a critical role for this third RRM. These results show a conserved function of the RNA-binding PpTEL1 protein in the regulation of shoot development, from early ancestors to vascular plants, that depends on the third TEL-specific RRM.

  15. Gene regulatory network reveals oxidative stress as the underlying molecular mechanism of type 2 diabetes and hypertension

    PubMed Central

    2010-01-01

    Background The prevalence of diabetes is increasing worldwide. It has been long known that increased rates of inflammatory diseases, such as obesity (OBS), hypertension (HT) and cardiovascular diseases (CVD) are highly associated with type 2 diabetes (T2D). T2D and/or OBS can develop independently, due to genetic, behavioral or lifestyle-related variables but both lead to oxidative stress generation. The underlying mechanisms by which theses complications arise and manifest together remain poorly understood. Protein-protein interactions regulate nearly every living process. Availability of high-throughput genomic data has enabled unprecedented views of gene and protein co-expression, co-regulations and interactions in cellular systems. Methods The present work, applied a systems biology approach to develop gene interaction network models, comprised of high throughput genomic and PPI data for T2D. The genes differentially regulated through T2D were 'mined' and their 'wirings' were studied to get a more complete understanding of the overall gene network topology and their role in disease progression. Results By analyzing the genes related to T2D, HT and OBS, a highly regulated gene-disease integrated network model has been developed that provides useful functional linkages among groups of genes and thus addressing how different inflammatory diseases are connected and propagated at genetic level. Based on the investigations around the 'hubs' that provided more meaningful insights about the cross-talk within gene-disease networks in terms of disease phenotype association with oxidative stress and inflammation, a hypothetical co-regulation disease mechanism model been proposed. The results from this study revealed that the oxidative stress mediated regulation cascade is the common mechanistic link among the pathogenesis of T2D, HT and other inflammatory diseases such as OBS. Conclusion The findings provide a novel comprehensive approach for understanding the

  16. Simulations of cellulose translocation in the bacterial cellulose synthase suggest a regulatory mechanism for the dimeric structure of cellulose

    PubMed Central

    Knott, Brandon C.; Crowley, Michael F.; Himmel, Michael E.; Zimmer, Jochen; Beckham, Gregg T.

    2016-01-01

    The processive cycle of the bacterial cellulose synthase (Bcs) includes the addition of a single glucose moiety to the end of a growing cellulose chain followed by the translocation of the nascent chain across the plasma membrane. The mechanism of this translocation and its precise location within the processive cycle are not well understood. In particular, the molecular details of how a polymer (cellulose) whose basic structural unit is a dimer (cellobiose) can be constructed by adding one monomer (glucose) at a time are yet to be elucidated. Here, we have utilized molecular dynamics simulations and free energy calculations to the shed light on these questions. We find that translocation forward by one glucose unit is quite favorable energetically, giving a free energy stabilization of greater than 10 kcal/mol. In addition, there is only a small barrier to translocation, implying that translocation is not rate limiting within the Bcs processive cycle (given experimental rates for cellulose synthesis in vitro). Perhaps most significantly, our results also indicate that steric constraints at the transmembrane tunnel entrance regulate the dimeric structure of cellulose. Namely, when a glucose molecule is added to the cellulose chain in the same orientation as the acceptor glucose, the terminal glucose freely rotates upon forward motion, thus suggesting a regulatory mechanism for the dimeric structure of cellulose. We characterize both the conserved and non-conserved enzyme-polysaccharide interactions that drive translocation, and find that 20 of the 25 residues that strongly interact with the translocating cellulose chain in the simulations are well conserved, mostly with polar or aromatic side chains. Our results also allow for a dynamical analysis of the role of the so-called `finger helix' in cellulose translocation that has been observed structurally. Taken together, these findings aid in the elucidation of the translocation steps of the Bcs processive cycle and

  17. Simulations of cellulose translocation in the bacterial cellulose synthase suggest a regulatory mechanism for the dimeric structure of cellulose.

    PubMed

    Knott, Brandon C; Crowley, Michael F; Himmel, Michael E; Zimmer, Jochen; Beckham, Gregg T

    2016-05-01

    The processive cycle of the bacterial cellulose synthase (Bcs) includes the addition of a single glucose moiety to the end of a growing cellulose chain followed by the translocation of the nascent chain across the plasma membrane. The mechanism of this translocation and its precise location within the processive cycle are not well understood. In particular, the molecular details of how a polymer (cellulose) whose basic structural unit is a dimer (cellobiose) can be constructed by adding one monomer (glucose) at a time are yet to be elucidated. Here, we have utilized molecular dynamics simulations and free energy calculations to the shed light on these questions. We find that translocation forward by one glucose unit is quite favorable energetically, giving a free energy stabilization of greater than 10 kcal/mol. In addition, there is only a small barrier to translocation, implying that translocation is not rate limiting within the Bcs processive cycle (given experimental rates for cellulose synthesis in vitro). Perhaps most significantly, our results also indicate that steric constraints at the transmembrane tunnel entrance regulate the dimeric structure of cellulose. Namely, when a glucose molecule is added to the cellulose chain in the same orientation as the acceptor glucose, the terminal glucose freely rotates upon forward motion, thus suggesting a regulatory mechanism for the dimeric structure of cellulose. We characterize both the conserved and non-conserved enzyme-polysaccharide interactions that drive translocation, and find that 20 of the 25 residues that strongly interact with the translocating cellulose chain in the simulations are well conserved, mostly with polar or aromatic side chains. Our results also allow for a dynamical analysis of the role of the so-called `finger helix' in cellulose translocation that has been observed structurally. Taken together, these findings aid in the elucidation of the translocation steps of the Bcs processive cycle and

  18. Prefrontal and Striatal Glutamate Differently Relate to Striatal Dopamine: Potential Regulatory Mechanisms of Striatal Presynaptic Dopamine Function?

    PubMed

    Gleich, Tobias; Deserno, Lorenz; Lorenz, Robert Christian; Boehme, Rebecca; Pankow, Anne; Buchert, Ralph; Kühn, Simone; Heinz, Andreas; Schlagenhauf, Florian; Gallinat, Jürgen

    2015-07-01

    Theoretical and animal work has proposed that prefrontal cortex (PFC) glutamate inhibits dopaminergic inputs to the ventral striatum (VS) indirectly, whereas direct VS glutamatergic afferents have been suggested to enhance dopaminergic inputs to the VS. In the present study, we aimed to investigate relationships of glutamate and dopamine measures in prefrontostriatal circuitries of healthy humans. We hypothesized that PFC and VS glutamate, as well as their balance, are differently associated with VS dopamine. Glutamate concentrations in the left lateral PFC and left striatum were assessed using 3-Tesla proton magnetic resonance spectroscopy. Striatal presynaptic dopamine synthesis capacity was measured by fluorine-18-l-dihydroxyphenylalanine (F-18-FDOPA) positron emission tomography. First, a negative relationship was observed between glutamate concentrations in lateral PFC and VS dopamine synthesis capacity (n = 28). Second, a positive relationship was revealed between striatal glutamate and VS dopamine synthesis capacity (n = 26). Additionally, the intraindividual difference between PFC and striatal glutamate concentrations correlated negatively with VS dopamine synthesis capacity (n = 24). The present results indicate an involvement of a balance in PFC and striatal glutamate in the regulation of VS dopamine synthesis capacity. This notion points toward a potential mechanism how VS presynaptic dopamine levels are kept in a fine-tuned range. A disruption of this mechanism may account for alterations in striatal dopamine turnover as observed in mental diseases (e.g., in schizophrenia). The present work demonstrates complementary relationships between prefrontal and striatal glutamate and ventral striatal presynaptic dopamine using human imaging measures: a negative correlation between prefrontal glutamate and presynaptic dopamine and a positive relationship between striatal glutamate and presynaptic dopamine are revealed. The results may reflect a regulatory role

  19. Simulating molecular mechanisms of the MDM2-mediated regulatory interactions: a conformational selection model of the MDM2 lid dynamics.

    PubMed

    Verkhivker, Gennady M

    2012-01-01

    Diversity and complexity of MDM2 mechanisms govern its principal function as the cellular antagonist of the p53 tumor suppressor. Structural and biophysical studies have demonstrated that MDM2 binding could be regulated by the dynamics of a pseudo-substrate lid motif. However, these experiments and subsequent computational studies have produced conflicting mechanistic models of MDM2 function and dynamics. We propose a unifying conformational selection model that can reconcile experimental findings and reveal a fundamental role of the lid as a dynamic regulator of MDM2-mediated binding. In this work, structure, dynamics and energetics of apo-MDM2 are studied as a function of posttranslational modifications and length of the lid. We found that the dynamic equilibrium between "closed" and "semi-closed" lid forms may be a fundamental characteristic of MDM2 regulatory interactions, which can be modulated by phosphorylation, phosphomimetic mutation as well as by the lid size. Our results revealed that these factors may regulate p53-MDM2 binding by fine-tuning the thermodynamic equilibrium between preexisting conformational states of apo-MDM2. In agreement with NMR studies, the effect of phosphorylation on MDM2 interactions was more pronounced with the truncated lid variant that favored the thermodynamically dominant closed form. The phosphomimetic mutation S17D may alter the lid dynamics by shifting the thermodynamic equilibrium towards the ensemble of "semi-closed" conformations. The dominant "semi-closed" lid form and weakened dependence on the phosphorylation seen in simulations with the complete lid can provide a rationale for binding of small p53-based mimetics and inhibitors without a direct competition with the lid dynamics. The results suggested that a conformational selection model of preexisting MDM2 states may provide a robust theoretical framework for understanding MDM2 dynamics. Probing biological functions and mechanisms of MDM2 regulation would require

  20. Simulations of cellulose translocation in the bacterial cellulose synthase suggest a regulatory mechanism for the dimeric structure of cellulose

    DOE PAGES

    Knott, Brandon C.; Crowley, Michael F.; Himmel, Michael E.; ...

    2016-01-29

    The processive cycle of the bacterial cellulose synthase (Bcs) includes the addition of a single glucose moiety to the end of a growing cellulose chain followed by the translocation of the nascent chain across the plasma membrane. The mechanism of this translocation and its precise location within the processive cycle are not well understood. In particular, the molecular details of how a polymer (cellulose) whose basic structural unit is a dimer (cellobiose) can be constructed by adding one monomer (glucose) at a time are yet to be elucidated. Here, we have utilized molecular dynamics simulations and free energy calculations tomore » the shed light on these questions. We find that translocation forward by one glucose unit is quite favorable energetically, giving a free energy stabilization of greater than 10 kcal mol-1. In addition, there is only a small barrier to translocation, implying that translocation is not rate limiting within the Bcs processive cycle (given experimental rates for cellulose synthesis in vitro). Perhaps most significantly, our results also indicate that steric constraints at the transmembrane tunnel entrance regulate the dimeric structure of cellulose. Namely, when a glucose molecule is added to the cellulose chain in the same orientation as the acceptor glucose, the terminal glucose freely rotates upon forward motion, thus suggesting a regulatory mechanism for the dimeric structure of cellulose. We characterize both the conserved and non-conserved enzyme-polysaccharide interactions that drive translocation, and find that 20 of the 25 residues that strongly interact with the translocating cellulose chain in the simulations are well conserved, mostly with polar or aromatic side chains. Our results also allow for a dynamical analysis of the role of the so-called 'finger helix' in cellulose translocation that has been observed structurally. Taken together, these findings aid in the elucidation of the translocation steps of the Bcs processive

  1. Regulatory Mechanisms That Prevent Re-initiation of DNA Replication Can Be Locally Modulated at Origins by Nearby Sequence Elements

    PubMed Central

    Richardson, Christopher D.; Li, Joachim J.

    2014-01-01

    Eukaryotic cells must inhibit re-initiation of DNA replication at each of the thousands of origins in their genome because re-initiation can generate genomic alterations with extraordinary frequency. To minimize the probability of re-initiation from so many origins, cells use a battery of regulatory mechanisms that reduce the activity of replication initiation proteins. Given the global nature of these mechanisms, it has been presumed that all origins are inhibited identically. However, origins re-initiate with diverse efficiencies when these mechanisms are disabled, and this diversity cannot be explained by differences in the efficiency or timing of origin initiation during normal S phase replication. This observation raises the possibility of an additional layer of replication control that can differentially regulate re-initiation at distinct origins. We have identified novel genetic elements that are necessary for preferential re-initiation of two origins and sufficient to confer preferential re-initiation on heterologous origins when the control of re-initiation is partially deregulated. The elements do not enhance the S phase timing or efficiency of adjacent origins and thus are specifically acting as re-initiation promoters (RIPs). We have mapped the two RIPs to ∼60 bp AT rich sequences that act in a distance- and sequence-dependent manner. During the induction of re-replication, Mcm2-7 reassociates both with origins that preferentially re-initiate and origins that do not, suggesting that the RIP elements can overcome a block to re-initiation imposed after Mcm2-7 associates with origins. Our findings identify a local level of control in the block to re-initiation. This local control creates a complex genomic landscape of re-replication potential that is revealed when global mechanisms preventing re-replication are compromised. Hence, if re-replication does contribute to genomic alterations, as has been speculated for cancer cells, some regions of the genome

  2. ZNF148 modulates TOP2A expression and cell proliferation via ceRNA regulatory mechanism in colorectal cancer

    PubMed Central

    Gao, Xian Hua; Li, Juan; Liu, Yan; Liu, Qi Zhi; Hao, Li Qiang; Liu, Lian Jie; Zhang, Wei

    2017-01-01

    Abstract Background: Competing endogenous RNA (ceRNA) regulation is a novel hypothesized mechanism that states RNA molecules share common target microRNAs (miRNAs) and may competitively combine into the same miRNA pool. Methods: Zinc finger protein 148 (ZNF148) and TOP2A expression were analyzed in 742 colorectal cancer (CRC) tissues using immunohistochemistry (IHC). ZNF148 mRNA, TOP2A mRNA, miR101, miR144, miR335, and miR365 expression were estimated in 53 fresh frozen CRC tissues by reverse transcription polymerase chain reaction. Mechanisms underpinning ceRNA were examined using bioinformatics, correlation analysis, RNA interference, gene over-expression, and luciferase assays. Results: Protein levels of ZNF148 and TOP2A detected by IHC positively correlated (Spearman correlation coefficient [rs] = 0.431, P < 0.001); mRNA levels of ZNF148 and TOP2A also positively correlated (r = 0.591, P < 0.001). Bioinformatics analysis demonstrated that ZNF148 and TOP2A mRNA had 13 common target miRNAs, including miR101, miR144, miR335, and miR365. Correlation analysis demonstrated that levels of ZNF148 mRNA were negatively associated with levels of miR144, miR335, and miR365. Knockdown and overexpression tests showed that ZNF148 mRNA and TOP2A mRNA regulated each other in HCT116 cells, respectively, but not in Dicer-deficient HCT116 cells. Luciferase assays demonstrated that ZNF148 and TOP2A regulated each other through 3′UTR. Overexpression of ZNF148 mRNA and TOP2A mRNA caused significant downregulation of miR101, miR144, miR335, and miR365 in the HCT116 cells. We also found that knockdown of ZNF148 and TOP2A significantly promoted cell growth, and overexpression of ZNF148 and TOP2A inhibited cell proliferation, which was abrogated in Dicer-deficient HCT116 cells. Conclusion: ZNF148 and TOP2A regulate each other through ceRNA regulatory mechanism in CRC, which has biological effects on cell proliferation. PMID:28072746

  3. Just-in-time control of Spo0A synthesis in Bacillus subtilis by multiple regulatory mechanisms.

    PubMed

    Chastanet, Arnaud; Losick, Richard

    2011-11-01

    The response regulator Spo0A governs multiple developmental processes in Bacillus subtilis, including most conspicuously sporulation. Spo0A is activated by phosphorylation via a multicomponent phosphorelay. Previous work has shown that the Spo0A protein is not rate limiting for sporulation. Rather, Spo0A is present at high levels in growing cells, rapidly rising to yet higher levels under sporulation-inducing conditions, suggesting that synthesis of the response regulator is subject to a just-in-time control mechanism. Transcription of spo0A is governed by a promoter switching mechanism, involving a vegetative, σ(A)-recognized promoter, P(v), and a sporulation σ(H)-recognized promoter, P(s), that is under phosphorylated Spo0A (Spo0A∼P) control. The spo0A regulatory region also contains four (including one identified in the present work) conserved elements that conform to the consensus binding site for Spo0A∼P binding sites. These are herein designated O(1), O(2), O(3), and O(4) in reverse order of their proximity to the coding sequence. Here we report that O(1) is responsible for repressing P(v) during the transition to stationary phase, that O(2) is responsible for repressing P(s) during growth, that O(3) is responsible for activating P(s) at the start of sporulation, and that O(4) is dispensable for promoter switching. We also report that Spo0A synthesis is subject to a posttranscriptional control mechanism such that translation of mRNAs originating from P(v) is impeded due to RNA secondary structure whereas mRNAs originating from P(s) are fully competent for protein synthesis. We propose that the opposing actions of O(2) and O(3) and the enhanced translatability of mRNAs originating from P(s) create a highly sensitive, self-reinforcing switch that is responsible for producing a burst of Spo0A synthesis at the start of sporulation.

  4. Endocytosis and trafficking of BMP receptors: Regulatory mechanisms for fine-tuning the signaling response in different cellular contexts.

    PubMed

    Ehrlich, Marcelo

    2016-02-01

    Signaling by bone morphogenetic protein (BMP) receptors is regulated at multiple levels in order to ensure proper interpretation of BMP stimuli in different cellular settings. As with other signaling receptors, regulation of the amount of exposed and signaling-competent BMP receptors at the plasma-membrane is predicted to be a key mechanism in governing their signaling output. Currently, the endocytosis of BMP receptors is thought to resemble that of the structurally related transforming growth factor-β (TGF-β) receptors, as BMP receptors are constitutively internalized (independently of ligand binding), with moderate kinetics, and mostly via clathrin-mediated endocytosis. Also similar to TGF-β receptors, BMP receptors are able to signal from the plasma membrane, while internalization to endosomes may have a signal modulating effect. When at the plasma membrane, BMP receptors localize to different membrane domains including cholesterol rich domains and caveolae, suggesting a complex interplay between membrane distribution and internalization. An additional layer of complexity stems from the putative regulatory influence on the signaling and trafficking of BMP receptors exerted by ligand traps and/or co-receptors. Furthermore, the trafficking and signaling of BMP receptors are subject to alterations in cellular context. For example, genetic diseases involving changes in the expression of auxiliary factors of endocytic pathways hamper retrograde BMP signals in neurons, and perturb the regulation of synapse formation. This review summarizes current understanding of the trafficking of BMP receptors and discusses the role of trafficking in regulation of BMP signals. Copyright © 2015 Elsevier Ltd. All rights reserved.

  5. Ionic mechanisms of regulatory volume increase (RVI) in the human hepatoma cell-line HepG2.

    PubMed

    Wehner, Frank; Lawonn, Peter; Tinel, Hanna

    2002-03-01

    We studied the effects of hypertonic stress on ion transport and cell volume regulation (regulatory volume increase; RVI) in the human tumor cell-line HepG2. Ion conductances were monitored in intracellular current-clamp measurements with rapid ion-substitutions and in whole-cell patch-clamp recordings; intracellular pH buffering capacity and activation of Na(+)/H(+) antiport were determined fluorometrically; the rates of Na(+)-K(+)-2Cl(-) symport and Na(+)/K(+)-ATPase were quantified on the basis of time-dependent and furosemide- or ouabain-sensitive (86)Rb(+) uptake, respectively; changes in cell volume were recorded by means of confocal laser-scanning microscopy. It was found that hypertonic conditions led to the activation of a cation conductance that was inhibited by Gd(3+), flufenamate as well as amiloride, but not by benzamil or ethyl-isopropyl-amiloride (EIPA). Most likely, this cation conductance was non-selective for Na(+) over K(+). Hypertonic stress did not change K(+) conductance, whereas possible changes in Cl(-) conductance remain ambiguous. The contribution of Na(+)/H(+)antiport to the RVI process appeared to be minor. Under hypertonic conditions an approximately 3.5-fold stimulation of Na(+)-K(+)-2Cl(-)symport was observed but this transporter did not significantly contribute to the overall RVI process. Hypertonic stress did not increase the activity of Na(+)/K(+)-ATPase, which even under isotonic conditions appeared to be working at its limit. It is concluded that the main mechanism in the RVI of HepG2 cells is the activation of a novel non-selective cation conductance. In contrast, there is little if any contribution of K(+) conductance, Na(+)/H(+) antiport, Na(+)-K(+)-2Cl(-) symport, and Na(+)/K(+)-ATPase to this process.

  6. Bacillus subtilis as a platform for molecular characterisation of regulatory mechanisms of Enterococcus faecalis resistance against cell wall antibiotics.

    PubMed

    Fang, Chong; Stiegeler, Emanuel; Cook, Gregory M; Mascher, Thorsten; Gebhard, Susanne

    2014-01-01

    To combat antibiotic resistance of Enterococcus faecalis, a better understanding of the molecular mechanisms, particularly of antibiotic detection, signal transduction and gene regulation is needed. Because molecular studies in this bacterium can be challenging, we aimed at exploiting the genetically highly tractable Gram-positive model organism Bacillus subtilis as a heterologous host. Two fundamentally different regulators of E. faecalis resistance against cell wall antibiotics, the bacitracin sensor BcrR and the vancomycin-sensing two-component system VanSB-VanRB, were produced in B. subtilis and their functions were monitored using target promoters fused to reporter genes (lacZ and luxABCDE). The bacitracin resistance system BcrR-BcrAB of E. faecalis was fully functional in B. subtilis, both regarding regulation of bcrAB expression and resistance mediated by the transporter BcrAB. Removal of intrinsic bacitracin resistance of B. subtilis increased the sensitivity of the system. The lacZ and luxABCDE reporters were found to both offer sensitive detection of promoter induction on solid media, which is useful for screening of large mutant libraries. The VanSB-VanRB system displayed a gradual dose-response behaviour to vancomycin, but only when produced at low levels in the cell. Taken together, our data show that B. subtilis is a well-suited host for the molecular characterization of regulatory systems controlling resistance against cell wall active compounds in E. faecalis. Importantly, B. subtilis facilitates the careful adjustment of expression levels and genetic background required for full functionality of the introduced regulators.

  7. Total Expression and Dual Gene-regulatory Mechanisms Maintained in Deletions and Duplications of the Pcdha Cluster*

    PubMed Central

    Noguchi, Yukiko; Hirabayashi, Takahiro; Katori, Shota; Kawamura, Yoshimi; Sanbo, Makoto; Hirabayashi, Masumi; Kiyonari, Hiroshi; Nakao, Kazuki; Uchimura, Arikuni; Yagi, Takeshi

    2009-01-01

    The clustered protocadherin-α (Pcdha) genes, which are expressed in the vertebrate brain, encode diverse membrane proteins whose functions are involved in axonal projection and in learning and memory. The Pcdha cluster consists of 14 tandemly arranged genes (Pcdha1–Pcdha12, Pcdhac1, and Pcdhac2, from 5′ to 3′). Each first exon (the variable exons) is transcribed from its own promoter, and spliced to the constant exons, which are common to all the Pcdha genes. Cerebellar Purkinje cells show dual expression patterns for Pcdha. In individual Purkinje cells, different sets of the 5′ genes in the cluster, Pcdha1–12, are randomly expressed, whereas both 3′ genes, Pcdhac1 and Pcdhac2, are expressed constitutively. To elucidate the relationship between the genomic structure of the Pcdha cluster and their expression in Purkinje cells, we deleted or duplicated multiple variable exons and analyzed the expression of Pcdha genes in the mouse brain. In all mutant mice, transcript levels of the constant exons and the dual expression patterns were maintained. In the deletion mutants, the missing genes were flexibly compensated by the remaining variable exons. On the other hand, in duplication mutants, the levels of the duplicated genes were trimmed. These results indicate that the Pcdha genes are comprehensively regulated as a cluster unit, and that the regulators that randomly and constitutively drive Pcdha gene expression are intact in the deleted or duplicated mutant alleles. These dual regulatory mechanisms may play important roles in the diversity and fundamental functions of neurons. PMID:19797050

  8. Regulatory T Cells from Colon Cancer Patients Inhibit Effector T-cell Migration through an Adenosine-Dependent Mechanism.

    PubMed

    Sundström, Patrik; Stenstad, Hanna; Langenes, Veronica; Ahlmanner, Filip; Theander, Lisa; Ndah, Tapuka Gordon; Fredin, Kamilla; Börjesson, Lars; Gustavsson, Bengt; Bastid, Jérémy; Quiding-Järbrink, Marianne

    2016-03-01

    T cell-mediated immunity is a major component of antitumor immunity. In order to be efficient, effector T cells must leave the circulation and enter into the tumor tissue. Regulatory T cells (Treg) from gastric cancer patients, but not from healthy volunteers, potently inhibit migration of conventional T cells through activated endothelium. In this study, we compared T cells from colon cancer patients and healthy donors to determine the mechanisms used by Tregs from cancer patients to inhibit conventional T-cell migration. Our results showed that circulating Tregs from cancer patients expressed high levels of CD39, an ectoenzyme mediating hydrolysis of ATP to AMP, as a rate-determining first step in the generation of immunosuppressive adenosine. Tumor-associated Tregs expressed even more CD39, and we therefore examined the importance of adenosine in Treg-mediated inhibition of T-cell transendothelial migration in vitro. Exogenous adenosine significantly reduced migration of conventional T cells from healthy volunteers, and blocking either adenosine receptors or CD39 enzymatic activity during transmigration restored the ability of conventional T cells from cancer patients to migrate. Adenosine did not directly affect T cells or endothelial cells, but reduced the ability of monocytes to activate the endothelium. Taken together, our results indicate that Treg-derived adenosine acts on monocytes and contributes to reduced transendothelial migration of effector T cells into tumors. This effect of Tregs is specific for cancer patients, and our results indicate that Tregs may affect not only T-cell effector functions but also their migration into tumors.

  9. Morphological and molecular characterization of a spontaneously tuberizing potato mutant: an insight into the regulatory mechanisms of tuber induction

    PubMed Central

    Fischer, Lukas; Lipavska, Helena; Hausman, Jean-Francois; Opatrny, Zdenek

    2008-01-01

    Background Tuberization in potato (Solanum tuberosum L.) represents a morphogenetic transition of stolon growth to tuber formation, which is under complex environmental and endogenous regulation. In the present work, we studied the regulatory mechanisms and the role of different morphogenetic factors in a newly isolated potato mutant, which exhibited spontaneous tuberization (ST). The ST mutant was characterized in detail at morphological, physiological and biochemical levels. Results Tuberization of the ST mutant grown in the soil was photoperiod-insensitive; predominantly sessile tubers formed directly from axillary buds even under continuous light. Single-node cuttings of the ST mutant cultured in vitro frequently formed tubers or basal tuber-like swellings instead of normal shoots under conditions routinely used for shoot propagation. The tuberization response of ST cuttings under light was dependent on sucrose, the concentration of which had to exceed certain threshold that inversely correlated with irradiance. Gibberellic acid prevented tuberization of ST cuttings, but failed to restore normal shoot phenotype and caused severe malformations. Carbohydrate analysis showed increased levels of both soluble sugars and starch in ST plants, with altered carbohydrate partitioning and metabolism. Comparative proteomic analysis revealed only a few differences between ST- and wild-type plants, primary amongst which seemed to be the absence of an isoform of manganese-stabilizing protein, a key subunit of photosystem II. Conclusion ST mutant exhibits complex developmental and phenotypic modifications, with features that are typical for plants strongly induced to tuberize. These changes are likely to be related to altered regulation of photosynthesis and carbohydrate metabolism rather than impaired transduction of inhibitory gibberellin or photoperiod-based signals. The effect of gibberellins on tuberization of ST mutant suggests that gibberellins inhibit tuberization

  10. Simulating Molecular Mechanisms of the MDM2-Mediated Regulatory Interactions: A Conformational Selection Model of the MDM2 Lid Dynamics

    PubMed Central

    Verkhivker, Gennady M.

    2012-01-01

    Diversity and complexity of MDM2 mechanisms govern its principal function as the cellular antagonist of the p53 tumor suppressor. Structural and biophysical studies have demonstrated that MDM2 binding could be regulated by the dynamics of a pseudo-substrate lid motif. However, these experiments and subsequent computational studies have produced conflicting mechanistic models of MDM2 function and dynamics. We propose a unifying conformational selection model that can reconcile experimental findings and reveal a fundamental role of the lid as a dynamic regulator of MDM2-mediated binding. In this work, structure, dynamics and energetics of apo-MDM2 are studied as a function of posttranslational modifications and length of the lid. We found that the dynamic equilibrium between “closed” and “semi-closed” lid forms may be a fundamental characteristic of MDM2 regulatory interactions, which can be modulated by phosphorylation, phosphomimetic mutation as well as by the lid size. Our results revealed that these factors may regulate p53-MDM2 binding by fine-tuning the thermodynamic equilibrium between preexisting conformational states of apo-MDM2. In agreement with NMR studies, the effect of phosphorylation on MDM2 interactions was more pronounced with the truncated lid variant that favored the thermodynamically dominant closed form. The phosphomimetic mutation S17D may alter the lid dynamics by shifting the thermodynamic equilibrium towards the ensemble of “semi-closed” conformations. The dominant “semi-closed” lid form and weakened dependence on the phosphorylation seen in simulations with the complete lid can provide a rationale for binding of small p53-based mimetics and inhibitors without a direct competition with the lid dynamics. The results suggested that a conformational selection model of preexisting MDM2 states may provide a robust theoretical framework for understanding MDM2 dynamics. Probing biological functions and mechanisms of MDM2 regulation

  11. Awareness of Federal Regulatory Mechanisms Relevant to Community-Engaged Research: Survey of Health Disparities-Oriented NIH-Funded Investigators.

    PubMed

    Fullerton, Stephanie M; Anderson, Emily E; Cowan, Ketch; Malen, Rachel C; Brugge, Doug

    2015-02-01

    Few studies or investigators involved in community-engaged research or community-based participatory research have examined awareness and adoption of federal regulatory mechanisms. We conducted a survey of investigators affiliated with the 10 National Institutes of Health (NIH) Centers for Population Health and Health Disparities. A questionnaire designed to capture experience with the conduct and oversight of community-engaged research, and awareness of pertinent regulatory mechanisms, including Federalwide Assurances (FWAs), Individual Investigator Agreements (IIAs), and Institutional Review Board Authorization Agreements (IAAs), was completed by 101 respondents (68% response rate). Although most were aware of FWAs, only a minority of those surveyed reported knowledge of IAAs and IIAs and even fewer had used them in their research with community partners. Implications for future training and oversight are discussed. © The Author(s) 2014.

  12. Awareness of federal regulatory mechanisms relevant to community-engaged research: survey of health disparities-oriented NIH-funded investigators

    PubMed Central

    Fullerton, Stephanie M.; Anderson, Emily E.; Cowan, Ketch; Malen, Rachel C.; Brugge, Doug

    2015-01-01

    Few studies or investigators involved in community engaged research or community-based participatory research have examined awareness and adoption of federal regulatory mechanisms. We conducted a survey of investigators affiliated with the ten National Institutes of Health (NIH) Centers for Population Health and Health Disparities. A questionnaire designed to capture experience with the conduct and oversight of community engaged research, and awareness of pertinent regulatory mechanisms, including Federalwide Assurances (FWAs), Individual Investigator Agreements (IIAs), and Institutional Review Board Authorization Agreements (IAAs), was completed by 101 respondents (68% response rate). Although most were aware of FWAs, only a minority of those surveyed reported knowledge of IAAs and IIAs and even fewer had used them in their research with community partners. Implications for future training and oversight are discussed. PMID:25742662

  13. A conserved RNA structural element within the hepatitis B virus post-transcriptional regulatory element enhance nuclear export of intronless transcripts and repress the splicing mechanism.

    PubMed

    Visootsat, Akasit; Payungporn, Sunchai; T-Thienprasert, Nattanan P

    2015-12-01

    Hepatitis B virus (HBV) infection is a primary cause of hepatocellular carcinoma and liver cirrhosis worldwide. To develop novel antiviral drugs, a better understanding of HBV gene expression regulation is vital. One important aspect is to understand how HBV hijacks the cellular machinery to export unspliced RNA from the nucleus. The HBV post-transcriptional regulatory element (HBV PRE) has been proposed to be the HBV RNA nuclear export element. However, the function remains controversial, and the core element is unclear. This study, therefore, aimed to identify functional regulatory elements within the HBV PRE and investigate their functions. Using bioinformatics programs based on sequence conservation and conserved RNA secondary structures, three regulatory elements were predicted, namely PRE 1151-1410, PRE 1520-1620 and PRE 1650-1684. PRE 1151-1410 significantly increased intronless and unspliced luciferase activity in both HepG2 and COS-7 cells. Likewise, PRE 1151-1410 significantly elevated intronless and unspliced HBV surface transcripts in liver cancer cells. Moreover, motif analysis predicted that PRE 1151-1410 contains several regulatory motifs. This study reported the roles of PRE 1151-1410 in intronless transcript nuclear export and the splicing mechanism. Additionally, these results provide knowledge in the field of HBV RNA regulation. Moreover, PRE 1151-1410 may be used to enhance the expression of other mRNAs in intronless reporter plasmids.

  14. Combined chromatin and expression analysis reveals specific regulatory mechanisms within cytokine genes in the macrophage early immune response.

    PubMed

    Iglesias, Maria Jesus; Jesus Iglesias, Maria; Reilly, Sarah-Jayne; Emanuelsson, Olof; Sennblad, Bengt; Pirmoradian Najafabadi, Mohammad; Folkersen, Lasse; Mälarstig, Anders; Lagergren, Jens; Eriksson, Per; Hamsten, Anders; Odeberg, Jacob

    2012-01-01

    Macrophages play a critical role in innate immunity, and the expression of early response genes orchestrate much of the initial response of the immune system. Macrophages undergo extensive transcriptional reprogramming in response to inflammatory stimuli such as Lipopolysaccharide (LPS).To identify gene transcription regulation patterns involved in early innate immune responses, we used two genome-wide approaches--gene expression profiling and chromatin immunoprecipitation-sequencing (ChIP-seq) analysis. We examined the effect of 2 hrs LPS stimulation on early gene expression and its relation to chromatin remodeling (H3 acetylation; H3Ac) and promoter binding of Sp1 and RNA polymerase II phosphorylated at serine 5 (S5P RNAPII), which is a marker for transcriptional initiation. Our results indicate novel and alternative gene regulatory mechanisms for certain proinflammatory genes. We identified two groups of up-regulated inflammatory genes with respect to chromatin modification and promoter features. One group, including highly up-regulated genes such as tumor necrosis factor (TNF), was characterized by H3Ac, high CpG content and lack of TATA boxes. The second group, containing inflammatory mediators (interleukins and CCL chemokines), was up-regulated upon LPS stimulation despite lacking H3Ac in their annotated promoters, which were low in CpG content but did contain TATA boxes. Genome-wide analysis showed that few H3Ac peaks were unique to either +/-LPS condition. However, within these, an unpacking/expansion of already existing H3Ac peaks was observed upon LPS stimulation. In contrast, a significant proportion of S5P RNAPII peaks (approx 40%) was unique to either condition. Furthermore, data indicated a large portion of previously unannotated TSSs, particularly in LPS-stimulated macrophages, where only 28% of unique S5P RNAPII peaks overlap annotated promoters. The regulation of the inflammatory response appears to occur in a very specific manner at the chromatin

  15. Combined Chromatin and Expression Analysis Reveals Specific Regulatory Mechanisms within Cytokine Genes in the Macrophage Early Immune Response

    PubMed Central

    Emanuelsson, Olof; Sennblad, Bengt; Pirmoradian Najafabadi, Mohammad; Folkersen, Lasse; Mälarstig, Anders; Lagergren, Jens; Eriksson, Per; Hamsten, Anders; Odeberg, Jacob

    2012-01-01

    Macrophages play a critical role in innate immunity, and the expression of early response genes orchestrate much of the initial response of the immune system. Macrophages undergo extensive transcriptional reprogramming in response to inflammatory stimuli such as Lipopolysaccharide (LPS). To identify gene transcription regulation patterns involved in early innate immune responses, we used two genome-wide approaches - gene expression profiling and chromatin immunoprecipitation-sequencing (ChIP-seq) analysis. We examined the effect of 2 hrs LPS stimulation on early gene expression and its relation to chromatin remodeling (H3 acetylation; H3Ac) and promoter binding of Sp1 and RNA polymerase II phosphorylated at serine 5 (S5P RNAPII), which is a marker for transcriptional initiation. Our results indicate novel and alternative gene regulatory mechanisms for certain proinflammatory genes. We identified two groups of up-regulated inflammatory genes with respect to chromatin modification and promoter features. One group, including highly up-regulated genes such as tumor necrosis factor (TNF), was characterized by H3Ac, high CpG content and lack of TATA boxes. The second group, containing inflammatory mediators (interleukins and CCL chemokines), was up-regulated upon LPS stimulation despite lacking H3Ac in their annotated promoters, which were low in CpG content but did contain TATA boxes. Genome-wide analysis showed that few H3Ac peaks were unique to either +/−LPS condition. However, within these, an unpacking/expansion of already existing H3Ac peaks was observed upon LPS stimulation. In contrast, a significant proportion of S5P RNAPII peaks (approx 40%) was unique to either condition. Furthermore, data indicated a large portion of previously unannotated TSSs, particularly in LPS-stimulated macrophages, where only 28% of unique S5P RNAPII peaks overlap annotated promoters. The regulation of the inflammatory response appears to occur in a very specific manner at the

  16. Contrasting evolutionary dynamics of the developmental regulator PAX9, among bats, with evidence for a novel post-transcriptional regulatory mechanism.

    PubMed

    Phillips, Caleb D; Butler, Boyd; Fondon, John W; Mantilla-Meluk, Hugo; Baker, Robert J

    2013-01-01

    Morphological evolution can be the result of natural selection favoring modification of developmental signaling pathways. However, little is known about the genetic basis of such phenotypic diversity. Understanding these mechanisms is difficult for numerous reasons, yet studies in model organisms often provide clues about the major developmental pathways involved. The paired-domain gene, PAX9, is known to be a key regulator of development, particularly of the face and teeth. In this study, using a comparative genetics approach, we investigate PAX9 molecular evolution among mammals, focusing on craniofacially diversified (Phyllostomidae) and conserved (Vespertilionidae) bat families, and extend our comparison to other orders of mammal. Open-reading frame analysis disclosed signatures of selection, in which a small percentage of residues vary, and lineages acquire different combinations of variation through recurrent substitution and lineage specific changes. A few instances of convergence for specific residues were observed between morphologically convergent bat lineages. Bioinformatic analysis for unknown PAX9 regulatory motifs indicated a novel post-transcriptional regulatory mechanism involving a Musashi protein. This regulation was assessed through fluorescent reporter assays and gene knockdowns. Results are compatible with the hypothesis that the number of Musashi binding-elements in PAX9 mRNA proportionally regulates protein translation rate. Although a connection between morphology and binding element frequency was not apparent, results indicate this regulation would vary among craniofacially divergent bat species, but be static among conserved species. Under this model, Musashi's regulatory control of alternative human PAX9 isoforms would also vary. The presence of Musashi-binding elements within PAX9 of all mammals examined, chicken, zebrafish, and the fly homolog of PAX9, indicates this regulatory mechanism is ancient, originating basal to much of the

  17. Regulatory mechanisms underlying oil palm fruit mesocarp maturation, ripening, and functional specialization in lipid and carotenoid metabolism.

    PubMed

    Tranbarger, Timothy J; Dussert, Stéphane; Joët, Thierry; Argout, Xavier; Summo, Marilyne; Champion, Antony; Cros, David; Omore, Alphonse; Nouy, Bruno; Morcillo, Fabienne

    2011-06-01

    Fruit provide essential nutrients and vitamins for the human diet. Not only is the lipid-rich fleshy mesocarp tissue of the oil palm (Elaeis guineensis) fruit the main source of edible oil for the world, but it is also the richest dietary source of provitamin A. This study examines the transcriptional basis of these two outstanding metabolic characters in the oil palm mesocarp. Morphological, cellular, biochemical, and hormonal features defined key phases of mesocarp development. A 454 pyrosequencing-derived transcriptome was then assembled for the developmental phases preceding and during maturation and ripening, when high rates of lipid and carotenoid biosynthesis occur. A total of 2,629 contigs with differential representation revealed coordination of metabolic and regulatory components. Further analysis focused on the fatty acid and triacylglycerol assembly pathways and during carotenogenesis. Notably, a contig similar to the Arabidopsis (Arabidopsis thaliana) seed oil transcription factor WRINKLED1 was identified with a transcript profile coordinated with those of several fatty acid biosynthetic genes and the high rates of lipid accumulation, suggesting some common regulatory features between seeds and fruits. We also focused on transcriptional regulatory networks of the fruit, in particular those related to ethylene transcriptional and GLOBOSA/PISTILLATA-like proteins in the mesocarp and a central role for ethylene-coordinated transcriptional regulation of type VII ethylene response factors during ripening. Our results suggest that divergence has occurred in the regulatory components in this monocot fruit compared with those identified in the dicot tomato (Solanum lycopersicum) fleshy fruit model.

  18. Distinct regulatory mechanisms of the human ferritin gene by hypoxia and hypoxia mimetic cobalt chloride at the transcriptional and post-transcriptional levels.

    PubMed

    Huang, Bo-Wen; Miyazawa, Masaki; Tsuji, Yoshiaki

    2014-12-01

    Cobalt chloride has been used as a hypoxia mimetic because it stabilizes hypoxia inducible factor-1α (HIF1-α) and activates gene transcription through a hypoxia responsive element (HRE). However, differences between hypoxia and hypoxia mimetic cobalt chloride in gene regulation remain elusive. Expression of ferritin, the major iron storage protein, is regulated at the transcriptional and posttranscriptional levels through DNA and RNA regulatory elements. Here we demonstrate that hypoxia and cobalt chloride regulate ferritin heavy chain (ferritin H) expression by two distinct mechanisms. Both hypoxia and cobalt chloride increased HIF1-α but a putative HRE in the human ferritin H gene was not activated. Instead, cobalt chloride but not hypoxia activated ferritin H transcription through an antioxidant responsive element (ARE), to which Nrf2 was recruited. Intriguingly, cobalt chloride downregulated ferritin H protein expression while it upregulated other ARE-regulated antioxidant genes in K562 cells. Further characterization demonstrated that cobalt chloride increased interaction between iron regulatory proteins (IRP1 and IRP2) and iron responsive element (IRE) in the 5'UTR of ferritin H mRNA, resulting in translational block of the accumulated ferritin H mRNA. In contrast, hypoxia had marginal effect on ferritin H transcription but increased its translation through decreased IRP1-IRE interaction. These results suggest that hypoxia and hypoxia mimetic cobalt chloride employ distinct regulatory mechanisms through the interplay between DNA and mRNA elements at the transcriptional and post-transcriptional levels. Copyright © 2014 Elsevier Inc. All rights reserved.

  19. Distinct Regulatory Mechanisms of the Human Ferritin Gene by Hypoxia and Hypoxia Mimetic Cobalt Chloride at the Transcriptional and Post-transcriptional Levels

    PubMed Central

    Huang, Bo-Wen; Miyazawa, Masaki; Tsuji, Yoshiaki

    2014-01-01

    Cobalt chloride has been used as a hypoxia mimetic because it stabilizes hypoxia inducible factor-1α (HIF1-α) and activates gene transcription through a hypoxia responsive element (HRE). However, differences between hypoxia and hypoxia mimetic cobalt chloride in gene regulation remain elusive. Expression of ferritin, the major iron storage protein, is regulated at the transcriptional and posttranscriptional levels through DNA and RNA regulatory elements. Here we demonstrate that hypoxia and cobalt chloride regulate ferritin heavy chain (ferritin H) expression by two distinct mechanisms. Both hypoxia and cobalt chloride increased HIF1-α but a putative HRE in the human ferritin H gene was not activated. Instead, cobalt chloride but not hypoxia activated ferritin H transcription through an antioxidant responsive element (ARE), to which Nrf2 was recruited. Intriguingly, cobalt chloride downregulated ferritin H protein expression while upregulated other ARE-regulated antioxidant genes in K562 cells. Further characterization demonstrated that cobalt chloride increased interaction between iron regulatory proteins (IRP1 and IRP2) and iron responsive element (IRE) in the 5′UTR of ferritin H mRNA, resulting in translational block of the accumulated ferritin H mRNA. In contrast, hypoxia had marginal effect on ferritin H transcription but increased its translation through decreased IRP1-IRE interaction. These results suggest that hypoxia and hypoxia mimetic cobalt chloride employ distinct regulatory mechanisms through the interplay between DNA and mRNA elements at the transcriptional and post-transcriptional levels. PMID:25172425

  20. α -Actinin TvACTN3 of Trichomonas vaginalis is an RNA-binding protein that could participate in its posttranscriptional iron regulatory mechanism.

    PubMed

    Calla-Choque, Jaeson Santos; Figueroa-Angulo, Elisa Elvira; Ávila-González, Leticia; Arroyo, Rossana

    2014-01-01

    Trichomonas vaginalis is a sexually transmitted flagellated protist parasite responsible for trichomoniasis. This parasite is dependent on high levels of iron, favoring its growth and multiplication. Iron also differentially regulates some trichomonad virulence properties by unknown mechanisms. However, there is evidence to support the existence of gene regulatory mechanisms at the transcriptional and posttranscriptional levels that are mediated by iron concentration in T. vaginalis. Thus, the goal of this study was to identify an RNA-binding protein in T. vaginalis that interacts with the tvcp4 RNA stem-loop structure, which may participate in a posttranscriptional iron regulatory mechanism mediated by RNA-protein interactions. We performed RNA electrophoretic mobility shift assay (REMSA) and supershift, UV cross-linking, Northwestern blot, and western blot (WB) assays using cytoplasmic protein extracts from T. vaginalis with the tvcp4 RNA hairpin structure as a probe. We identified a 135-kDa protein isolated by the UV cross-linking assays as α-actinin 3 (TvACTN3) by MALDI-TOF-MS that was confirmed by LS-MS/MS and de novo sequencing. TvACTN3 is a cytoplasmic protein that specifically binds to hairpin RNA structures from trichomonads and humans when the parasites are grown under iron-depleted conditions. Thus, TvACTN3 could participate in the regulation of gene expression by iron in T. vaginalis through a parallel posttranscriptional mechanism similar to that of the IRE/IRP system.

  1. The Legionella pneumophila genome evolved to accommodate multiple regulatory mechanisms controlled by the CsrA-system

    PubMed Central

    Sahr, Tobias; Rusniok, Christophe; Impens, Francis; Oliva, Giulia; Sismeiro, Odile; Coppée, Jean-Yves

    2017-01-01

    The carbon storage regulator protein CsrA regulates cellular processes post-transcriptionally by binding to target-RNAs altering translation efficiency and/or their stability. Here we identified and analyzed the direct targets of CsrA in the human pathogen Legionella pneumophila. Genome wide transcriptome, proteome and RNA co-immunoprecipitation followed by deep sequencing of a wild type and a csrA mutant strain identified 479 RNAs with potential CsrA interaction sites located in the untranslated and/or coding regions of mRNAs or of known non-coding sRNAs. Further analyses revealed that CsrA exhibits a dual regulatory role in virulence as it affects the expression of the regulators FleQ, LqsR, LetE and RpoS but it also directly regulates the timely expression of over 40 Dot/Icm substrates. CsrA controls its own expression and the stringent response through a regulatory feedback loop as evidenced by its binding to RelA-mRNA and links it to quorum sensing and motility. CsrA is a central player in the carbon, amino acid, fatty acid metabolism and energy transfer and directly affects the biosynthesis of cofactors, vitamins and secondary metabolites. We describe the first L. pneumophila riboswitch, a thiamine pyrophosphate riboswitch whose regulatory impact is fine-tuned by CsrA, and identified a unique regulatory mode of CsrA, the active stabilization of RNA anti-terminator conformations inside a coding sequence preventing Rho-dependent termination of the gap operon through transcriptional polarity effects. This allows L. pneumophila to regulate the pentose phosphate pathway and the glycolysis combined or individually although they share genes in a single operon. Thus the L. pneumophila genome has evolved to acclimate at least five different modes of regulation by CsrA giving it a truly unique position in its life cycle. PMID:28212376

  2. The Legionella pneumophila genome evolved to accommodate multiple regulatory mechanisms controlled by the CsrA-system.

    PubMed

    Sahr, Tobias; Rusniok, Christophe; Impens, Francis; Oliva, Giulia; Sismeiro, Odile; Coppée, Jean-Yves; Buchrieser, Carmen

    2017-02-01

    The carbon storage regulator protein CsrA regulates cellular processes post-transcriptionally by binding to target-RNAs altering translation efficiency and/or their stability. Here we identified and analyzed the direct targets of CsrA in the human pathogen Legionella pneumophila. Genome wide transcriptome, proteome and RNA co-immunoprecipitation followed by deep sequencing of a wild type and a csrA mutant strain identified 479 RNAs with potential CsrA interaction sites located in the untranslated and/or coding regions of mRNAs or of known non-coding sRNAs. Further analyses revealed that CsrA exhibits a dual regulatory role in virulence as it affects the expression of the regulators FleQ, LqsR, LetE and RpoS but it also directly regulates the timely expression of over 40 Dot/Icm substrates. CsrA controls its own expression and the stringent response through a regulatory feedback loop as evidenced by its binding to RelA-mRNA and links it to quorum sensing and motility. CsrA is a central player in the carbon, amino acid, fatty acid metabolism and energy transfer and directly affects the biosynthesis of cofactors, vitamins and secondary metabolites. We describe the first L. pneumophila riboswitch, a thiamine pyrophosphate riboswitch whose regulatory impact is fine-tuned by CsrA, and identified a unique regulatory mode of CsrA, the active stabilization of RNA anti-terminator conformations inside a coding sequence preventing Rho-dependent termination of the gap operon through transcriptional polarity effects. This allows L. pneumophila to regulate the pentose phosphate pathway and the glycolysis combined or individually although they share genes in a single operon. Thus the L. pneumophila genome has evolved to acclimate at least five different modes of regulation by CsrA giving it a truly unique position in its life cycle.

  3. Human regulatory macrophages are potent in suppression of the xenoimmune response via indoleamine-2,3-dioxygenase-involved mechanism(s).

    PubMed

    Guo, Fei; Hu, Min; Huang, Dandan; Zhao, Yuanfei; Heng, Benjamin; Guillemin, Gilles; Lim, Chai K; Hawthorne, Wayne J; Yi, Shounan

    2017-08-02

    For xenotransplantation to truly succeed, we must develop immunomodulatory strategies to suppress the xenoimmune response but by minimizing immunosuppression over the long term. Regulatory macrophages (Mreg) have been shown to suppress polyclonal T-cell proliferation in vitro and prolong allograft survival in vivo. However, the question of whether they are capable of suppressing xenoimmune responses remains unknown. This study assessed the potential of human Mreg to be used as an effective immunomodulatory method in xenotransplantation. CD14+ monocytes selected from human peripheral blood mononuclear cells (PBMC) were cultured with macrophage colony-stimulating factor (M-CSF) for 7 days with IFN-γ added at day 6 for Mreg induction. Mreg phenotyping was performed by flow cytometric analysis, and the in vitro suppressive function was assessed by mixed lymphocyte reaction (MLR) using irradiated pig PBMC as the xenogeneic stimulator cells, human PBMC as responder cells, and autologous Mreg as suppressor cells. To assess mRNA expression of Mreg functional molecules indoleamine-2,3-dioxygenase (IDO), IL-10, inducible nitric oxide synthase (iNOS) and TGF-β were measured by real-time PCR. Supernatants were collected from the MLR cultures for IDO activity assay by high-performance liquid chromatography (HPLC). The effects of the IDO inhibitor 1-D/L-methyl-tryptophan (1-MT), iNOS inhibitor N(G) -monomethyl-l-arginine (L-NMMA), and anti-IFN-γ or anti-TGF-β monoclonal antibody (mAb) treatment on Mreg suppressive capacity were tested from the supernatants of the MLR assays. We demonstrated that induced Mreg with a phenotype of CD14(low) CD16(-/low) CD80(low) CD83(-/low) CD86(+/hi) HLA-DR(+/hi) were capable of suppressing proliferating human PBMC, CD4+, and CD8+ T cells, even at a higher responder:Mreg ratio of 32:1 in a pig-human xenogeneic MLR. The strong suppressive potency of Mreg was further correlated with their upregulated IDO expression and activity. The IDO

  4. Cis- and Trans-Regulatory Mechanisms of Gene Expression in the ASJ Sensory Neuron of Caenorhabditis elegans

    PubMed Central

    González-Barrios, María; Fierro-González, Juan Carlos; Krpelanova, Eva; Mora-Lorca, José Antonio; Pedrajas, José Rafael; Peñate, Xenia; Chavez, Sebastián; Swoboda, Peter; Jansen, Gert; Miranda-Vizuete, Antonio

    2015-01-01

    The identity of a given cell type is determined by the expression of a set of genes sharing common cis-regulatory motifs and being regulated by shared transcription factors. Here, we identify cis and trans regulatory elements that drive gene expression in the bilateral sensory neuron ASJ, located in the head of the nematode Caenorhabditis elegans. For this purpose, we have dissected the promoters of the only two genes so far reported to be exclusively expressed in ASJ, trx-1 and ssu-1. We hereby identify the ASJ motif, a functional cis-regulatory bipartite promoter region composed of two individual 6 bp elements separated by a 3 bp linker. The first element is a 6 bp CG-rich sequence that presumably binds the Sp family member zinc-finger transcription factor SPTF-1. Interestingly, within the C. elegans nervous system SPTF-1 is also found to be expressed only in ASJ neurons where it regulates expression of other genes in these neurons and ASJ cell fate. The second element of the bipartite motif is a 6 bp AT-rich sequence that is predicted to potentially bind a transcription factor of the homeobox family. Together, our findings identify a specific promoter signature and SPTF-1 as a transcription factor that functions as a terminal selector gene to regulate gene expression in C. elegans ASJ sensory neurons. PMID:25769980

  5. PARP-2 and PARP-3 are selectively activated by 5′ phosphorylated DNA breaks through an allosteric regulatory mechanism shared with PARP-1

    PubMed Central

    Langelier, Marie-France; Riccio, Amanda A.; Pascal, John M.

    2014-01-01

    PARP-1, PARP-2 and PARP-3 are DNA-dependent PARPs that localize to DNA damage, synthesize poly(ADP-ribose) (PAR) covalently attached to target proteins including themselves, and thereby recruit repair factors to DNA breaks to increase repair efficiency. PARP-1, PARP-2 and PARP-3 have in common two C-terminal domains—Trp-Gly-Arg (WGR) and catalytic (CAT). In contrast, the N-terminal region (NTR) of PARP-1 is over 500 residues and includes four regulatory domains, whereas PARP-2 and PARP-3 have smaller NTRs (70 and 40 residues, respectively) of unknown structural composition and function. Here, we show that PARP-2 and PARP-3 are preferentially activated by DNA breaks harboring a 5′ phosphate (5′P), suggesting selective activation in response to specific DNA repair intermediates, in particular structures that are competent for DNA ligation. In contrast to PARP-1, the NTRs of PARP-2 and PARP-3 are not strictly required for DNA binding or for DNA-dependent activation. Rather, the WGR domain is the central regulatory domain of PARP-2 and PARP-3. Finally, PARP-1, PARP-2 and PARP-3 share an allosteric regulatory mechanism of DNA-dependent catalytic activation through a local destabilization of the CAT. Collectively, our study provides new insights into the specialization of the DNA-dependent PARPs and their specific roles in DNA repair pathways. PMID:24928857

  6. PARP-2 and PARP-3 are selectively activated by 5' phosphorylated DNA breaks through an allosteric regulatory mechanism shared with PARP-1.

    PubMed

    Langelier, Marie-France; Riccio, Amanda A; Pascal, John M

    2014-07-01

    PARP-1, PARP-2 and PARP-3 are DNA-dependent PARPs that localize to DNA damage, synthesize poly(ADP-ribose) (PAR) covalently attached to target proteins including themselves, and thereby recruit repair factors to DNA breaks to increase repair efficiency. PARP-1, PARP-2 and PARP-3 have in common two C-terminal domains-Trp-Gly-Arg (WGR) and catalytic (CAT). In contrast, the N-terminal region (NTR) of PARP-1 is over 500 residues and includes four regulatory domains, whereas PARP-2 and PARP-3 have smaller NTRs (70 and 40 residues, respectively) of unknown structural composition and function. Here, we show that PARP-2 and PARP-3 are preferentially activated by DNA breaks harboring a 5' phosphate (5'P), suggesting selective activation in response to specific DNA repair intermediates, in particular structures that are competent for DNA ligation. In contrast to PARP-1, the NTRs of PARP-2 and PARP-3 are not strictly required for DNA binding or for DNA-dependent activation. Rather, the WGR domain is the central regulatory domain of PARP-2 and PARP-3. Finally, PARP-1, PARP-2 and PARP-3 share an allosteric regulatory mechanism of DNA-dependent catalytic activation through a local destabilization of the CAT. Collectively, our study provides new insights into the specialization of the DNA-dependent PARPs and their specific roles in DNA repair pathways. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  7. FarR regulates the farAB-encoded efflux pump of Neisseria gonorrhoeae via an MtrR regulatory mechanism.

    PubMed

    Lee, E-H; Rouquette-Loughlin, C; Folster, J P; Shafer, W M

    2003-12-01

    The farAB operon of Neisseria gonorrhoeae encodes an efflux pump which mediates gonococcal resistance to antibacterial fatty acids. It was previously observed that expression of the farAB operon was positively regulated by MtrR, which is a repressor of the mtrCDE-encoded efflux pump system (E.-H. Lee and W. M. Shafer, Mol. Microbiol. 33:839-845, 1999). This regulation was believed to be indirect since MtrR did not bind to the farAB promoter. In this study, computer analysis of the gonococcal genome sequence database, lacZ reporter fusions, and gel mobility shift assays were used to elucidate the regulatory mechanism by which expression of the farAB operon is modulated by MtrR in gonococci. We identified a regulatory protein belonging to the MarR family of transcriptional repressors and found that it negatively controls expression of farAB by directly binding to the farAB promoter. We designated this regulator FarR to signify its role in regulating the farAB operon. We found that MtrR binds to the farR promoter, thereby repressing farR expression. Hence, MtrR regulates farAB in a positive fashion by modulating farR expression. This MtrR regulatory cascade seems to play an important role in adjusting levels of the FarAB and MtrCDE efflux pumps to prevent their excess expression in gonococci.

  8. Signal Transduction and Regulatory Mechanisms Involved in Control of the σS (RpoS) Subunit of RNA Polymerase

    PubMed Central

    Hengge-Aronis, Regine

    2002-01-01

    The σS (RpoS) subunit of RNA polymerase is the master regulator of the general stress response in Escherichia coli and related bacteria. While rapidly growing cells contain very little σS, exposure to many different stress conditions results in rapid and strong σS induction. Consequently, transcription of numerous σS-dependent genes is activated, many of which encode gene products with stress-protective functions. Multiple signal integration in the control of the cellular σS level is achieved by rpoS transcriptional and translational control as well as by regulated σS proteolysis, with various stress conditions differentially affecting these levels of σS control. Thus, a reduced growth rate results in increased rpoS transcription whereas high osmolarity, low temperature, acidic pH, and some late-log-phase signals stimulate the translation of already present rpoS mRNA. In addition, carbon starvation, high osmolarity, acidic pH, and high temperature result in stabilization of σS, which, under nonstress conditions, is degraded with a half-life of one to several minutes. Important cis-regulatory determinants as well as trans-acting regulatory factors involved at all levels of σS regulation have been identified. rpoS translation is controlled by several proteins (Hfq and HU) and small regulatory RNAs that probably affect the secondary structure of rpoS mRNA. For σS proteolysis, the response regulator RssB is essential. RssB is a specific direct σS recognition factor, whose affinity for σS is modulated by phosphorylation of its receiver domain. RssB delivers σS to the ClpXP protease, where σS is unfolded and completely degraded. This review summarizes our current knowledge about the molecular functions and interactions of these components and tries to establish a framework for further research on the mode of multiple signal input into this complex regulatory system. PMID:12208995

  9. Mass Spectrometric Analysis of TRPM6 and TRPM7 Phosphorylation Reveals Regulatory Mechanisms of the Channel-Kinases

    PubMed Central

    Cai, Na; Bai, Zhiyong; Nanda, Vikas; Runnels, Loren W.

    2017-01-01

    TRPM7 and TRPM6 were the first identified bifunctional channels to contain their own kinase domains, but how these channel-kinases are regulated is poorly understood. Previous studies identified numerous phosphorylation sites on TRPM7, but very little is known about TRPM6 phosphorylation or sites on TRPM7 transphosphorylated by TRPM6. Our mass spectrometric analysis of homomeric and heteromeric TRPM7 and TRPM6 channels identified phosphorylation sites on both proteins, as well as several prominent sites on TRPM7 that are commonly modified through autophosphorylation and transphosphorylation by TRPM6. We conducted a series of amino acid substitution analyses and identified S1777, in TRPM7’s catalytic domain, and S1565, in TRPM7’s exchange domain that mediates kinase dimerization, as potential regulatory sites. The phosphomimetic S1777D substitution disrupted catalytic activity, most likely by causing an electrostatic perturbation at the active site. The S1565D phosphomimetic substitution also inactivated the kinase but did so without interfering with kinase dimerization. Molecular modeling indicates that phosphorylation of S1565 is predicted to structurally affect TRPM7’s functionally conserved N/D loop, which is thought to influence the access of substrate to the active site pocket. We propose that phosphorylation of S1565 within the exchange domain functions as a regulatory switch to control TRPM7 catalytic activity. PMID:28220887

  10. Mass Spectrometric Analysis of TRPM6 and TRPM7 Phosphorylation Reveals Regulatory Mechanisms of the Channel-Kinases.

    PubMed

    Cai, Na; Bai, Zhiyong; Nanda, Vikas; Runnels, Loren W

    2017-02-21

    TRPM7 and TRPM6 were the first identified bifunctional channels to contain their own kinase domains, but how these channel-kinases are regulated is poorly understood. Previous studies identified numerous phosphorylation sites on TRPM7, but very little is known about TRPM6 phosphorylation or sites on TRPM7 transphosphorylated by TRPM6. Our mass spectrometric analysis of homomeric and heteromeric TRPM7 and TRPM6 channels identified phosphorylation sites on both proteins, as well as several prominent sites on TRPM7 that are commonly modified through autophosphorylation and transphosphorylation by TRPM6. We conducted a series of amino acid substitution analyses and identified S1777, in TRPM7's catalytic domain, and S1565, in TRPM7's exchange domain that mediates kinase dimerization, as potential regulatory sites. The phosphomimetic S1777D substitution disrupted catalytic activity, most likely by causing an electrostatic perturbation at the active site. The S1565D phosphomimetic substitution also inactivated the kinase but did so without interfering with kinase dimerization. Molecular modeling indicates that phosphorylation of S1565 is predicted to structurally affect TRPM7's functionally conserved N/D loop, which is thought to influence the access of substrate to the active site pocket. We propose that phosphorylation of S1565 within the exchange domain functions as a regulatory switch to control TRPM7 catalytic activity.

  11. Positive and Negative Regulatory Mechanisms for Fine-Tuning Cellularity and Functions of Medullary Thymic Epithelial Cells

    PubMed Central

    Akiyama, Taishin; Tateishi, Ryosuke; Akiyama, Nobuko; Yoshinaga, Riko; Kobayashi, Tetsuya J.

    2015-01-01

    Self-tolerant T cells and regulatory T cells develop in the thymus. A wide variety of cell–cell interactions in the thymus is required for the differentiation, proliferation, and repertoire selection of T cells. Various secreted and cell surface molecules expressed in thymic epithelial cells (TECs) mediate these processes. Moreover, cytokines expressed by cells of hematopoietic origin regulate the cellularity of TECs. Tumor necrosis factor (TNF) family RANK ligand, lymphotoxin, and CD40 ligand, expressed in T cells and innate lymphoid cells (ILCs), promote the differentiation and proliferation of medullary TECs (mTECs) that play critical roles in the induction of immune tolerance. A recent study suggests that interleukin-22 (IL-22) produced by ILCs promotes regeneration of TECs after irradiation. Intriguingly, tumor growth factor-β and osteoprotegerin limit cellularity of mTECs, thereby attenuating regulatory T cell generation. We will review recent insights into the molecular basis for cell–cell interactions regulating differentiation and proliferation of mTECs and also discuss about a perspective on use of mathematical models for understanding this complicated system. PMID:26441966

  12. NMR binding and crystal structure reveal that intrinsically-unstructured regulatory domain auto-inhibits PAK4 by a mechanism different from that of PAK1.

    PubMed

    Wang, Wei; Lim, Liangzhong; Baskaran, Yohendran; Manser, Ed; Song, Jianxing

    2013-08-16

    Six human PAK members are classified into groups I (PAKs 1-3) and II (PAK4-6). Previously, only group I PAKs were thought to be auto-inhibited but very recently PAK4, the prototype of group II PAKs, has also been shown to be auto-inhibited by its N-terminal regulatory domain. However, the complete auto-inhibitory domain (AID) sequence remains undefined and the mechanism underlying its auto-inhibition is largely elusive. Here, the N-terminal regulatory domain of PAK4 sufficient for auto-inhibiting and binding Cdc42/Rac was characterized to be intrinsically unstructured, but nevertheless we identified the entire AID sequence by NMR. Strikingly, an AID peptide was derived by deleting the binding-unnecessary residues, which has a Kd of 320 nM to the PAK4 catalytic domain. Consequently, the PAK4 crystal structure complexed with the entire AID has been determined, which reveals that the complete kinase cleft is occupied by 20 AID residuescomposed of an N-terminal α-helix and a previously-identified pseudosubstrate motif, thus achieving auto-inhibition. Our study reveals that PAK4 is auto-inhibited by a novel mechanism which is completely different from that for PAK1, thus bearing critical implications for design of inhibitors specific for group II PAKs. Copyright © 2013 Elsevier Inc. All rights reserved.

  13. More than one way to control hair growth: regulatory mechanisms in enterobacteria that affect fimbriae assembled by the chaperone/usher pathway.

    PubMed

    Clegg, Steven; Wilson, Janet; Johnson, Jeremiah

    2011-05-01

    Many gram-negative enterobacteria produce surface-associated fimbriae that facilitate attachment and adherence to eucaryotic cells and tissues. These organelles are believed to play an important role during infection by enabling bacteria to colonize specific niches within their hosts. One class of these fimbriae is assembled using a periplasmic chaperone and membrane-associated scaffolding protein that has been referred to as an usher because of its function in fimbrial biogenesis. The presence of multiple types of fimbriae assembled by the chaperone/usher pathway can be found both within a single bacterial species and also among different genera. One way of controlling fimbrial assembly in these bacteria is at the genetic level by positively or negatively regulating fimbrial gene expression. This minireview considers the mechanisms that have been described to control fimbrial gene expression and uses specific examples to demonstrate both unique and shared properties of such regulatory mechanisms.

  14. More than One Way To Control Hair Growth: Regulatory Mechanisms in Enterobacteria That Affect Fimbriae Assembled by the Chaperone/Usher Pathway▿

    PubMed Central

    Clegg, Steven; Wilson, Janet; Johnson, Jeremiah

    2011-01-01

    Many Gram-negative enterobacteria produce surface-associated fimbriae that facilitate attachment and adherence to eucaryotic cells and tissues. These organelles are believed to play an important role during infection by enabling bacteria to colonize specific niches within their hosts. One class of these fimbriae is assembled using a periplasmic chaperone and membrane-associated scaffolding protein that has been referred to as an usher because of its function in fimbrial biogenesis. The presence of multiple types of fimbriae assembled by the chaperone/usher pathway can be found both within a single bacterial species and also among different genera. One way of controlling fimbrial assembly in these bacteria is at the genetic level by positively or negatively regulating fimbrial gene expression. This minireview considers the mechanisms that have been described to control fimbrial gene expression and uses specific examples to demonstrate both unique and shared properties of such regulatory mechanisms. PMID:21398554

  15. Impact of guided exploration and enactive exploration on self-regulatory mechanisms and information acquisition through electronic search.

    PubMed

    Debowski, S; Wood, R E; Bandura, A

    2001-12-01

    Following instruction in basic skills for electronic search, participants who practiced in a guided exploration mode developed stronger self-efficacy and greater satisfaction than those who practiced in a self-guided exploratory mode. Intrinsic motivation was not affected by exploration mode. On 2 post-training tasks, guided exploration participants produced more effective search strategies. expended less effort, made fewer errors, rejected fewer lines of search, and achieved higher performance. Relative lack of support for self-regulatory factors as mediators of exploration mode impacts was attributed to the uninformative feedback from electronic search, which causes most people to remain at a novice level and to require external guidance for development of self-efficacy and skills. Self-guided learning will be more effective on structured tasks with more informative feedback and for individuals with greater expertise on dynamic tasks.

  16. Whole brain-pituitary in vitro preparation of the transgenic medaka (Oryzias latipes) as a tool for analyzing the differential regulatory mechanisms of LH and FSH release.

    PubMed

    Karigo, Tomomi; Aikawa, Masato; Kondo, Chika; Abe, Hideki; Kanda, Shinji; Oka, Yoshitaka

    2014-02-01

    Two types of gonadotropins, luteinizing hormone (LH) and follicle stimulating hormone (FSH), are important pituitary hormones for sexual maturation and reproduction, and both of them are centrally regulated by gonadotropin-releasing hormone (GnRH) from the hypothalamus. In mammals, these two gonadotropins are secreted from a single type of gonadotrope. The mechanisms of differential regulation by GnRH of the release of two types of gonadotropins with different secretory profiles are still unknown. In teleosts, however, LH and FSH are secreted from separate cellular populations, unlike in mammals. This feature makes them useful for studying the regulatory mechanisms of LH and FSH secretions independently. Here, we generated transgenic medaka lines that express Ca(2+) indicator protein, inverse-pericam, specifically in the LH or FSH cells. We performed cell-type-specific Ca(2+) imaging of LH and FSH cells, respectively, using the whole brain-pituitary preparations of these transgenic fish in which all neural circuits and GnRH neuronal projection to the pituitary are kept intact. LH and FSH cells showed different Ca(2+) responses to GnRH. The results suggest differential regulation mechanisms for LH and FSH release by GnRH. Moreover, we also succeeded in detecting the effect on LH cells of endogenous GnRH peptide, which was released by electrical stimulation of the axons of GnRH1 neurons. Thus, our newly developed experimental model system using the whole brain-pituitary in vitro preparation of the transgenic medaka is a powerful tool for analyzing the differential regulatory mechanisms of the release of LH and FSH by multisynaptic neural inputs to the pituitary.

  17. Induction of Regulatory T Cells as a Novel Mechanism Underlying the Therapeutic Action of Kakkonto, a Traditional Japanese Herbal Medicine, in a Murine Food Allergy Model.

    PubMed

    Yamamoto, Takeshi; Fujiwara, Kanae; Tsubota, Yuma; Kageyama-Yahara, Natsuko; Hayashi, Shusaku; Kadowaki, Makoto

    2016-01-01

    The number of patients with food allergy (FA) has dramatically increased. Although satisfactory drug therapies for FA are not available, we have found that kakkonto, a traditional Japanese herbal medicine, suppressed the occurrence of allergic symptoms in an FA mouse model. Thus, we investigated whether kakkonto could regulate the activation and differentiation of T cells in the colon. BALB/c mice were systemically sensitized and then orally challenged with ovalbumin. FA mice were orally treated with kakkonto. Lamina propria (LP) cells from their colons were isolated and analyzed. Kakkonto significantly reduced the proportion of CD69+ cells and the elevated helper T cell type 2-specific transcription factor GATA-3 mRNA expression in the LP CD4+ T cells, showing that kakkonto has a suppressive effect on the activation and Th2 differentiation of LP effector CD4+ T cells of the FA mouse colon. Furthermore, kakkonto significantly increased the proportion of Foxp3+CD4+ regulatory T cells in the LP CD4+ T cells of the FA mouse colon. Similarly, the number of Foxp3-positive cells was dramatically increased in the colonic mucosa of kakkonto-administered FA mice. However, the pharmacological effect and Foxp3+CD4+ regulatory T cell-inducing ability of kakkonto were not attenuated by the administration of an anti-CD25 monoclonal antibody in the FA model. The induction of Foxp3+CD4+CD25- regulatory T cells in the colon as a novel mechanism underlying the therapeutic action of kakkonto could be utilized for the development of a novel anti-FA drug. © 2016 S. Karger AG, Basel.

  18. Post-translational hydroxylation by 2OG/Fe(II)-dependent oxygenases as a novel regulatory mechanism in bacteria.

    PubMed

    van Staalduinen, Laura M; Jia, Zongchao

    2014-01-01

    Protein hydroxylation has been well-studied in eukaryotic systems. The structural importance of hydroxylation of specific proline and lysine residues during collagen biosynthesis is well established. Recently, key roles for post-translational hydroxylation in signaling and degradation pathways have been discovered. The function of hydroxylation in signaling is highlighted by its role in the hypoxic response of eukaryotic cells, where oxygen dependent hydroxylation of the hypoxia inducible transcription factor both targets it for degradation and blocks its activation. In contrast, the role of protein hydroxylation has been largely understudied in prokaryotes. Recently, an evolutionarily conserved class of ribosomal oxygenases (ROX) that catalyze the hydroxylation of specific residues in the ribosome has been identified in bacteria. ROX activity has been linked to cell growth, and has been found to have a direct impact on bulk protein translation. This discovery of ribosomal protein hydroxylation in bacteria could lead to new therapeutic targets for regulating bacterial growth, as well as, shed light on new prokaryotic hydroxylation signaling pathways. In this review, recent structural and functional studies will be highlighted and discussed, underscoring the regulatory potential of post-translational hydroxylation in bacteria.

  19. Mechanisms by Which B Cells and Regulatory T Cells Influence Development of Murine Organ-Specific Autoimmune Diseases

    PubMed Central

    Ellis, Jason S.; Braley-Mullen, Helen

    2017-01-01

    Experiments with B cell-deficient (B−/−) mice indicate that a number of autoimmune diseases require B cells in addition to T cells for their development. Using B−/− Non-obese diabetic (NOD) and NOD.H-2h4 mice, we demonstrated that development of spontaneous autoimmune thyroiditis (SAT), Sjogren’s syndrome and diabetes do not develop in B−/− mice, whereas all three diseases develop in B cell-positive wild-type (WT) mice. B cells are required early in life, since reconstitution of adult mice with B cells or autoantibodies did not restore their ability to develop disease. B cells function as important antigen presenting cells (APC) to initiate activation of autoreactive CD4+ effector T cells. If B cells are absent or greatly reduced in number, other APC will present the antigen, such that Treg are preferentially activated and effector T cells are not activated. In these situations, B−/− or B cell-depleted mice develop the autoimmune disease when T regulatory cells (Treg) are transiently depleted. This review focuses on how B cells influence Treg activation and function, and briefly considers factors that influence the effectiveness of B cell depletion for treatment of autoimmune diseases. PMID:28134752

  20. Allergic contact dermatitis: epidemiology, molecular mechanisms, in vitro methods and regulatory aspects. Current knowledge assembled at an international workshop at BfR, Germany.

    PubMed

    Peiser, M; Tralau, T; Heidler, J; Api, A M; Arts, J H E; Basketter, D A; English, J; Diepgen, T L; Fuhlbrigge, R C; Gaspari, A A; Johansen, J D; Karlberg, A T; Kimber, I; Lepoittevin, J P; Liebsch, M; Maibach, H I; Martin, S F; Merk, H F; Platzek, T; Rustemeyer, T; Schnuch, A; Vandebriel, R J; White, I R; Luch, A

    2012-03-01

    Contact allergies are complex diseases, and one of the important challenges for public health and immunology. The German 'Federal Institute for Risk Assessment' hosted an 'International Workshop on Contact Dermatitis'. The scope of the workshop was to discuss new discoveries and developments in the field of contact dermatitis. This included the epidemiology and molecular biology of contact allergy, as well as the development of new in vitro methods. Furthermore, it considered regulatory aspects aiming to reduce exposure to contact sensitisers. An estimated 15-20% of the general population suffers from contact allergy. Workplace exposure, age, sex, use of consumer products and genetic predispositions were identified as the most important risk factors. Research highlights included: advances in understanding of immune responses to contact sensitisers, the importance of autoxidation or enzyme-mediated oxidation for the activation of chemicals, the mechanisms through which hapten-protein conjugates are formed and the development of novel in vitro strategies for the identification of skin-sensitising chemicals. Dendritic cell cultures and structure-activity relationships are being developed to identify potential contact allergens. However, the local lymph node assay (LLNA) presently remains the validated method of choice for hazard identification and characterisation. At the workshop the use of the LLNA for regulatory purposes and for quantitative risk assessment was also discussed.

  1. Structure of a Construct of a Human Poly(C)-binding Protein Containing the First and Second KH Domains Reveals Insights into Its Regulatory Mechanisms*

    PubMed Central

    Du, Zhihua; Fenn, Sebastian; Tjhen, Richard; James, Thomas L.

    2008-01-01

    Poly(C)-binding proteins (PCBPs) are important regulatory proteins that contain three KH (hnRNP K homology) domains. Binding poly(C) D/RNA sequences via KH domains is essential for multiple PCBP functions. To reveal the basis for PCBP-D/RNA interactions and function, we determined the structure of a construct containing the first two domains (KH1-KH2) of human PCBP2 by NMR. KH1 and KH2 form an intramolecular pseudodimer. The large hydrophobic dimerization surface of each KH domain is on the side opposite the D/RNA binding interface. Chemical shift mapping indicates both domains bind poly(C) DNA motifs without disrupting the KH1-KH2 interaction. Spectral comparison of KH1-KH2, KH3, and full-length PCBP2 constructs suggests that the KH1-KH2 pseudodimer forms, but KH3 does not interact with other parts of the protein. From NMR studies and modeling, we propose possible modes of cooperative binding tandem poly(C) motifs by the KH domains. D/RNA binding may induce pseudodimer dissociation or stabilize dissociated KH1 and KH2, making protein interaction surfaces available to PCBP-binding partners. This conformational change may represent a regulatory mechanism linking D/RNA binding to PCBP functions. PMID:18701464

  2. Inference of the Arabidopsis Lateral Root Gene Regulatory Network Suggests a Bifurcation Mechanism That Defines Primordia Flanking and Central Zones[OPEN

    PubMed Central

    Lavenus, Julien; Goh, Tatsuaki; Guyomarc’h, Soazig; Hill, Kristine; Lucas, Mikael; Voß, Ute; Kenobi, Kim; Wilson, Michael H.; Farcot, Etienne; Hagen, Gretchen; Guilfoyle, Thomas J.; Fukaki, Hidehiro; Laplaze, Laurent; Bennett, Malcolm J.

    2015-01-01

    A large number of genes involved in lateral root (LR) organogenesis have been identified over the last decade using forward and reverse genetic approaches in Arabidopsis thaliana. Nevertheless, how these genes interact to form a LR regulatory network largely remains to be elucidated. In this study, we developed a time-delay correlation algorithm (TDCor) to infer the gene regulatory network (GRN) controlling LR primordium initiation and patterning in Arabidopsis from a time-series transcriptomic data set. The predicted network topology links the very early-activated genes involved in LR initiation to later expressed cell identity markers through a multistep genetic cascade exhibiting both positive and negative feedback loops. The predictions were tested for the key transcriptional regulator AUXIN RESPONSE FACTOR7 node, and over 70% of its targets were validated experimentally. Intriguingly, the predicted GRN revealed a mutual inhibition between the ARF7 and ARF5 modules that would control an early bifurcation between two cell fates. Analyses of the expression pattern of ARF7 and ARF5 targets suggest that this patterning mechanism controls flanking and central zone specification in Arabidopsis LR primordia. PMID:25944102

  3. miRTrail--a comprehensive webserver for analyzing gene and miRNA patterns to enhance the understanding of regulatory mechanisms in diseases.

    PubMed

    Laczny, Cedric; Leidinger, Petra; Haas, Jan; Ludwig, Nicole; Backes, Christina; Gerasch, Andreas; Kaufmann, Michael; Vogel, Britta; Katus, Hugo A; Meder, Benjamin; Stähler, Cord; Meese, Eckart; Lenhof, Hans-Peter; Keller, Andreas

    2012-02-22

    Expression profiling provides new insights into regulatory and metabolic processes and in particular into pathogenic mechanisms associated with diseases. Besides genes, non-coding transcripts as microRNAs (miRNAs) gained increasing relevance in the last decade. To understand the regulatory processes of miRNAs on genes, integrative computer-aided approaches are essential, especially in the light of complex human diseases as cancer. Here, we present miRTrail, an integrative tool that allows for performing comprehensive analyses of interactions of genes and miRNAs based on expression profiles. The integrated analysis of mRNA and miRNA data should generate more robust and reliable results on deregulated pathogenic processes and may also offer novel insights into the regulatory interactions between miRNAs and genes. Our web-server excels in carrying out gene sets analysis, analysis of miRNA sets as well as the combination of both in a systems biology approach. To this end, miRTrail integrates information on 20.000 genes, almost 1.000 miRNAs, and roughly 280.000 putative interactions, for Homo sapiens and accordingly for Mus musculus and Danio rerio. The well-established, classical Chi-squared test is one of the central techniques of our tool for the joint consideration of miRNAs and their targets. For interactively visualizing obtained results, it relies on the network analyzers and viewers BiNA or Cytoscape-web, also enabling direct access to relevant literature. We demonstrated the potential of miRTrail by applying our tool to mRNA and miRNA data of malignant melanoma. MiRTrail identified several deregulated miRNAs that target deregulated mRNAs including miRNAs hsa-miR-23b and hsa-miR-223, which target the highest numbers of deregulated mRNAs and regulate the pathway "basal cell carcinoma". In addition, both miRNAs target genes like PTCH1 and RASA1 that are involved in many oncogenic processes. The application on melanoma samples demonstrates that the mi

  4. Functional anatomy and ion regulatory mechanisms of the antennal gland in a semi-terrestrial crab, Ocypode stimpsoni

    PubMed Central

    Tsai, Jyuan-Ru; Lin, Hui-Chen

    2014-01-01

    ABSTRACT Brachyuran crabs from diverse habitats show great differences in their osmoregulatory processes, especially in terms of the structural and physiological characteristics of the osmoregulatory organs. In crustaceans, the antennal glands are known to be important in osmoregulation, and they play a functional role analogous to that of the vertebrate kidney. Nevertheless, the detailed structure and function of the antennal glands in different species have rarely been described. The aim of this study is to investigate the role of the antennal gland in ion regulation by examining the ultrastructure of the cells and the distribution of the ion regulatory proteins in each cell type in the antennal gland of a semi-terrestrial crab. The results showed that Na+, K+-ATPase activity significantly increased in the antennal gland after a 4-day acclimation in dilute seawater and returned to its original (day 0) level after 7 days. Three major types of cells were identified in the antennal gland, including coelomic cells (COEs), labyrinthine cells (LBRs) and end-labyrinthine cells (ELBRs). The proximal tubular region (PT) and distal tubular region (DT) of the antennal gland consist of LBRs and COEs, whereas the end tubular region (ET) consists of all three types of cells, with fewer COEs and more ELBRs. We found a non-uniform distribution of NKA immunoreactivity, with increasing intensity from the proximal to the distal regions of the antennal gland. We summarise our study with a proposed model for the urine reprocessing pathway and the role of each cell type or segment of the antennal gland. PMID:24795144

  5. Autophagy Regulatory Network — A systems-level bioinformatics resource for studying the mechanism and regulation of autophagy

    PubMed Central

    Türei, Dénes; Földvári-Nagy, László; Fazekas, Dávid; Módos, Dezső; Kubisch, János; Kadlecsik, Tamás; Demeter, Amanda; Lenti, Katalin; Csermely, Péter; Vellai, Tibor; Korcsmáros, Tamás

    2015-01-01

    Autophagy is a complex cellular process having multiple roles, depending on tissue, physiological, or pathological conditions. Major post-translational regulators of autophagy are well known, however, they have not yet been collected comprehensively. The precise and context-dependent regulation of autophagy necessitates additional regulators, including transcriptional and post-transcriptional components that are listed in various datasets. Prompted by the lack of systems-level autophagy-related information, we manually collected the literature and integrated external resources to gain a high coverage autophagy database. We developed an online resource, Autophagy Regulatory Network (ARN; http://autophagy-regulation.org), to provide an integrated and systems-level database for autophagy research. ARN contains manually curated, imported, and predicted interactions of autophagy components (1,485 proteins with 4,013 interactions) in humans. We listed 413 transcription factors and 386 miRNAs that could regulate autophagy components or their protein regulators. We also connected the above-mentioned autophagy components and regulators with signaling pathways from the SignaLink 2 resource. The user-friendly website of ARN allows researchers without computational background to search, browse, and download the database. The database can be downloaded in SQL, CSV, BioPAX, SBML, PSI-MI, and in a Cytoscape CYS file formats. ARN has the potential to facilitate the experimental validation of novel autophagy components and regulators. In addition, ARN helps the investigation of transcription factors, miRNAs and signaling pathways implicated in the control of the autophagic pathway. The list of such known and predicted regulators could be important in pharmacological attempts against cancer and neurodegenerative diseases. PMID:25635527

  6. “Curcumin, the King of Spices”: Epigenetic Regulatory Mechanisms in the Prevention of Cancer, Neurological, and Inflammatory Diseases

    PubMed Central

    Boyanapalli, Sarandeep S. S.

    2015-01-01

    Curcumin (diferuloylmethane), a polyphenolic compound, is a component of Curcuma longa, commonly known as turmeric. It is a well-known anti-inflammatory, anti-oxidative, and anti-lipidemic agent and has recently been shown to modulate several diseases via epigenetic regulation. Many recent studies have demonstrated the role of epigenetic inactivation of pivotal genes that regulate human pathologies, such as neurocognitive disorders, inflammation, obesity, and cancers. Epigenetic changes involve changes in DNA methylation, histone modifications, or altered microRNA expression patterns which are known to be interconnected and play a key role in tumor progression and failure of conventional chemotherapy. The majority of epigenetic changes are influenced by lifestyle and diets. In this regard, dietary phytochemicals as dietary supplements have emerged as a promising source that are able to reverse these epigenetic alterations, to actively regulate gene expression and molecular targets that are known to promote tumorigenesis, and also to prevent age-related diseases through epigenetic modifications. There have been several studies which reported the role of curcumin as an epigenetic regulator in neurological disorders, inflammation, and in diabetes apart from cancers. The epigenetic regulatory roles of curcumin include (1) inhibition of DNA methyltransferases (DNMTs), which has been well defined from the recent studies on its function as a DNA hypomethylating agent; (2) regulation of histone modifications via regulation of histone acetyltransferases (HATs) and histone deacetylases (HDACs); and (3) regulation of micro RNAs (miRNA). This review summarizes the current knowledge on the effect of curcumin in the treatment and/or prevention of inflammation, neurodegenerative diseases, and cancers by regulating histone deacetylases, histone acetyltransferases, and DNA methyltransferases. PMID:26457241

  7. Control of liver size by RNAi-mediated multiplex knockdown and its application for discovery of regulatory mechanisms

    PubMed Central

    Yin, Hao; Bogorad, Roman L.; Barnes, Carmen; Walsha, Stephen; Zhuang, Iris; Nonaka, Hidenori; Ruda, Vera; Kuchimanchi, Satya; Nechev, Lubomir; Akinc, Akin; Xue, Wen; Zerial, Marino; Langer, Robert; Anderson, Daniel G.; Koteliansky, Victor

    2017-01-01

    Background and aims The Hippo pathway controls organ size through a negative regulation of the transcription co-activator Yap1. The overexpression of hyperactive mutant Yap1 or deletion of key components in the Hippo pathway leads to increased organ size in different species. Analysis of interactions of this pathway with other cellular signals corroborating organ size control is limited in part due to the difficulties associated with development of rodent models. Methods Here, we develop a new model of reversible induction of the liver size in mice using siRNA-nanoparticles targeting two kinases of Hippo pathway, namely, mammalian Ste20 family kinases 1 and 2 (Mst1 and Mst2), and an upstream regulator, neurofibromatosis type II (NF2). Results The triple siRNAs nanoparticle-induced hepatomegaly in mice phenocopies one observed with Mst1-/- Mst2-/- liver-specific depletion, as shown by extensive proliferation of hepatocytes and activation of Yap1. The simultaneous co-treatment with a fourth siRNA nanoparticle against Yap1 fully blocked the liver growth. Hippo pathway-induced liver enlargement is associated with p53 activation, evidenced by its accumulation in the nuclei and upregulation of its target genes. Moreover, injections of the triple siRNAs nanoparticle in p53LSL/LSL mice shows that livers lacking p53 expression grow faster and exceed the size of livers in p53 wild type animals, indicating a role of p53 in controlling Yap1-induced liver growth. Conclusion Our data show that siRNA-nanoparticulate manipulation of gene expression can provide the reversible control of organ size in adult animals, which presents a new avenue for the investigation of complex regulatory networks in liver. PMID:26658687

  8. Potential of acute phase proteins as predictor of postpartum uterine infections during transition period and its regulatory mechanism in dairy cattle

    PubMed Central

    Manimaran, A.; Kumaresan, A.; Jeyakumar, S.; Mohanty, T. K.; Sejian, V.; Kumar, Narender; Sreela, L.; Prakash, M. Arul; Mooventhan, P.; Anantharaj, A.; Das, D. N.

    2016-01-01

    Among the various systemic reactions against infection or injury, the acute phase response is the cascade of reaction and mostly coordinated by cytokines-mediated acute phase proteins (APPs) production. Since APPs are sensitive innate immune molecules, they are useful for early detection of inflammation in bovines and believed to be better discriminators than routine hematological parameters. Therefore, the possibility of using APPs as a diagnostic and prognostic marker of inflammation in major bovine health disorders including postpartum uterine infection has been explored by many workers. In this review, we discussed specifically importance of postpartum uterine infection, the role of energy balance in uterine infections and potential of APPs as a predictor of postpartum uterine infections during the transition period and its regulatory mechanism in dairy cattle. PMID:27051191

  9. Potential of acute phase proteins as predictor of postpartum uterine infections during transition period and its regulatory mechanism in dairy cattle.

    PubMed

    Manimaran, A; Kumaresan, A; Jeyakumar, S; Mohanty, T K; Sejian, V; Kumar, Narender; Sreela, L; Prakash, M Arul; Mooventhan, P; Anantharaj, A; Das, D N

    2016-01-01

    Among the various systemic reactions against infection or injury, the acute phase response is the cascade of reaction and mostly coordinated by cytokines-mediated acute phase proteins (APPs) production. Since APPs are sensitive innate immune molecules, they are useful for early detection of inflammation in bovines and believed to be better discriminators than routine hematological parameters. Therefore, the possibility of using APPs as a diagnostic and prognostic marker of inflammation in major bovine health disorders including postpartum uterine infection has been explored by many workers. In this review, we discussed specifically importance of postpartum uterine infection, the role of energy balance in uterine infections and potential of APPs as a predictor of postpartum uterine infections during the transition period and its regulatory mechanism in dairy cattle.

  10. Crosstalk between bone marrow-derived mesenchymal stem cells and regulatory T cells through a glucocorticoid-induced leucine zipper/developmental endothelial locus-1-dependent mechanism

    PubMed Central

    Yang, Nianlan; Baban, Babak; Isales, Carlos M.; Shi, Xing-Ming

    2015-01-01

    Bone marrow is a reservoir for regulatory T (Treg) cells, but how Treg cells are regulated in that environment remains poorly understood. We show that expression of glucocorticoid (GC)-induced leucine zipper (GILZ) in bone marrow mesenchymal lineage cells or bone marrow-derived mesenchymal stem cells (BMSCs) increases the production of Treg cells via a mechanism involving the up-regulation of developmental endothelial locus-1 (Del-1), an endogenous leukocyte-endothelial adhesion inhibitor. We found that the expression of Del-1 is increased ∼4-fold in the bone tissues of GILZ transgenic (Tg) mice, and this increase is coupled with a significant increase in the production of IL-10 (2.80 vs. 0.83) and decrease in the production of IL-6 (0.80 vs. 2.33) and IL-12 (0.25 vs. 1.67). We also show that GILZ-expressing BMSCs present antigen in a way that favors Treg cells. These results indicate that GILZ plays a critical role mediating the crosstalk between BMSCs and Treg in the bone marrow microenvironment. These data, together with our previous findings that overexpression of GILZ in BMSCs antagonizes TNF-α-elicited inflammatory responses, suggest that GILZ plays important roles in bone-immune cell communication and BMSC immune suppressive functions.—Yang, N., Baban, B., Isales, C. M., Shi, X.-M. Crosstalk between bone marrow-derived mesenchymal stem cells and regulatory T cells through a glucocorticoid-induced leucine zipper/developmental endothelial locus-1-dependent mechanism. PMID:26038125

  11. Equine CD4+ CD25high T cells exhibit regulatory activity by close contact and cytokine-dependent mechanisms in vitro

    PubMed Central

    Hamza, Eman; Gerber, Vinzenz; Steinbach, Falko; Marti, Eliane

    2011-01-01

    Horses are particularly prone to allergic and autoimmune diseases, but little information about equine regulatory T cells (Treg) is currently available. The aim of this study therefore was to investigate the existence of CD4+ Treg cells in horses, determine their suppressive function as well as their mechanism of action. Freshly isolated peripheral blood mononuclear cells (PBMC) from healthy horses were examined for CD4, CD25 and forkhead box P3 (FoxP3) expression. We show that equine FoxP3 is expressed constitutively by a population of CD4+ CD25+ T cells, mainly in the CD4+ CD25high subpopulation. Proliferation of CD4+ CD25− sorted cells stimulated with irradiated allogenic PBMC was significantly suppressed in co-culture with CD4+ CD25high sorted cells in a dose-dependent manner. The mechanism of suppression by the CD4+ CD25high cell population is mediated by close contact as well as interleukin (IL)-10 and transforming growth factor-β1 (TGF-β1) and probably other factors. In addition, we studied the in vitro induction of CD4+ Treg and their characteristics compared to those of freshly isolated CD4+ Treg cells. Upon stimulation with a combination of concanavalin A, TGF-β1 and IL-2, CD4+ CD25+ T cells which express FoxP3 and have suppressive capability were induced from CD4+ CD25− cells. The induced CD4+ CD25high express higher levels of IL-10 and TGF-β1 mRNA compared to the freshly isolated ones. Thus, in horses as in man, the circulating CD4+ CD25high subpopulation contains natural Treg cells and functional Treg can be induced in vitro upon appropriate stimulation. Our study provides the first evidence of the regulatory function of CD4+ CD25+ cells in horses and offers insights into ex vivo manipulation of Treg cells. PMID:21977999

  12. Studies of the lethargic (lh/lh) mouse model of absence seizures: regulatory mechanisms and identification of the lh gene.

    PubMed

    Hosford, D A; Lin, F H; Wang, Y; Caddick, S J; Rees, M; Parkinson, N J; Barclay, J; Cox, R D; Gardiner, R M; Hosford, D A; Denton, P; Wang, Y; Seldin, M F; Chen, B

    1999-01-01

    To understand the cellular and molecular mechanisms that underlie generalized absence seizures sufficiently well to design rational, efficacious new therapies for patients, it is necessary to turn to animal models to gain insights into these mechanisms. The lethargic (lh/lh) mutant mouse expresses spontaneous absence seizures that share behavioral, electrographic, and anticonvulsant profiles with absence seizures in patients. This validates its use to study the mechanisms that underlie absence seizures. This chapter discusses two scientific approaches that involve the use of lh/lh mice. The first part of the chapter discusses neurobiologic approaches used to investigate critical mechanisms that regulate the synchronized burst firing within the thalamocortical network that generates absence seizures. Two of these critical mechanisms have been studied in detail with lh/lh mice. The first critical mechanism involves the required activation of gamma-aminobutyric acid B (GABAB) receptors to generate absence seizures. Because the numbers of GABAB receptors are increased in thalamocortical populations among lh/lh mice compared with littermates without epilepsy, these receptors appear to play a pathophysiologic role in the expression of absence seizures among lh/lh mice. Moreover, there may be a role for GABAB receptors in the generation of absence seizures among humans, because administration of compounds that activate GABAB receptors can produce absence seizures among humans. These findings suggest that GABAB receptor antagonists may represent a new class of antiabsence compounds that will be efficacious against absence seizures among patients. A second critical mechanism that regulates generation of absence seizures involves GABAA receptors in the nucleus reticularis thalami (NRT), a nucleus that sends GABA-ergic afferents to thalamic relay nuclei. Activation of GABAA receptors in the NRT appears to suppress the generation of absence seizures among lh/lh mice and in

  13. Robustness and evolvability in natural chemical resistance: identification of novel systems properties, biochemical mechanisms and regulatory interactions.

    PubMed

    Venancio, Thiago M; Balaji, S; Geetha, S; Aravind, L

    2010-08-01

    A vast amount of data on the natural resistance of Saccharomyces cerevisiae to a diverse array of chemicals has been generated over the past decade (chemical genetics). We endeavored to use this data to better characterize the "systems" level properties of this phenomenon. By collating data from over 30 different genome-scale studies on growth of gene deletion mutants in presence of diverse chemicals, we assembled the largest currently available gene-chemical network. We also derived a second gene-gene network that links genes with significantly overlapping chemical-genetic profiles. We analyzed properties of these networks and investigated their significance by overlaying various sources of information, such as presence of TATA boxes in their promoters (which typically correlate with transcriptional noise), association with TFIID or SAGA, and propensity to function as phenotypic capacitors. We further combined these networks with ubiquitin and protein kinase-substrate networks to understand chemical tolerance in the context of major post-translational regulatory processes. Hubs in the gene-chemical network (multidrug resistance genes) are notably enriched for phenotypic capacitors (buffers against phenotypic variation), suggesting the generality of these players in buffering mechanistically unrelated deleterious forces impinging on the cell. More strikingly, analysis of the gene-gene network derived from the gene-chemical network uncovered another set of genes that appear to function in providing chemical tolerance in a cooperative manner. These appear to be enriched in lineage-specific and rapidly diverging members that also show a corresponding tendency for SAGA-dependent regulation, evolutionary divergence and noisy expression patterns. This set represents a previously underappreciated component of the chemical response that enables cells to explore alternative survival strategies. Thus, systems robustness and evolvability are simultaneously active as general

  14. Probing the chemical mechanism and critical regulatory amino acid residues of Drosophila melanogaster arylalkylamine N-acyltransferase like 2.

    PubMed

    Dempsey, Daniel R; Carpenter, Anne-Marie; Ospina, Santiago Rodriguez; Merkler, David J

    2015-11-01

    Arylalkylamine N-acyltransferase like 2 (AANATL2) catalyzes the formation of N-acylarylalkylamides from the corresponding acyl-CoA and arylalkylamine. The N-acylation of biogenic amines in Drosophila melanogaster is a critical step for the inactivation of neurotransmitters, cuticle sclerotization, and melatonin biosynthesis. In addition, D. melanogaster has been used as a model system to evaluate the biosynthesis of fatty acid amides: a family of potent cell signaling lipids. We have previously showed that AANATL2 catalyzes the formation of N-acylarylakylamides, including long-chain N-acylserotonins and N-acyldopamines. Herein, we define the kinetic mechanism for AANATL2 as an ordered sequential mechanism with acetyl-CoA binding first followed by tyramine to generate the ternary complex prior to catalysis. Bell shaped kcat,app - acetyl-CoA and (kcat/Km)app - acetyl-CoA pH-rate profiles identified two apparent pKa,app values of ∼7.4 and ∼8.9 that are critical to catalysis, suggesting the AANATL2-catalyzed formation of N-acetyltyramine occurs through an acid/base chemical mechanism. Site-directed mutagenesis of a conserved glutamate that corresponds to the catalytic base for other D. melanogaster AANATL enzymes did not produce a substantial depression in the kcat,app value nor did it abolish the pKa,app value attributed to the general base in catalysis (pKa ∼7.4). These data suggest that AANATL2 catalyzes the formation of N-acylarylalkylamides using either different catalytic residues or a different chemical mechanism relative to other D. melanogaster AANATL enzymes. In addition, we constructed other site-directed mutants of AANATL2 to help define the role of targeted amino acids in substrate binding and/or enzyme catalysis.

  15. Immune-Regulatory Mechanisms of Classical and Experimental Multiple Sclerosis Drugs: A Special Focus on Helminth-Derived Treatments.

    PubMed

    Peón, Alberto N; Terrazas, Luis I

    2016-01-01

    Multiple sclerosis (MS) is the most prevalent autoimmune disease affecting the central nervous system (CNS). Its pathophysiology is centered on neuron myelin sheath destruction in a manner largely dependent upon CD4+/CD8+ T-cell autoreactivity against myelin antigens, inducing Th1/Th17 pathogenic responses with the resulting production of free radicals and soluble mediators that exhibit the effector mechanisms of neurodegeneration. The immune response responsible for this disease is complex and challenges modern medicine. Consequently, many experimental therapies have been proposed in addition to the classical array of immunoregulatory/ immunosuppressive drugs that are normally used to treat MS. In this review, we will describe the effects and mechanisms of action of widely used disease-modifying MS drugs as well as those of select treatments that are currently in the experimental phase. Special emphasis is placed on helminth-derived immunoregulators, as some of them have shown promising results. Additionally, we will compare the mechanisms of action of both the MS drugs and the helminth-derived treatments to discuss the potential importance of some signaling pathways in the control of MS.

  16. The allosteric regulatory mechanism of the Escherichia coli MetNI methionine ATP binding cassette (ABC) transporter.

    PubMed

    Yang, Janet G; Rees, Douglas C

    2015-04-03

    The MetNI methionine importer of Escherichia coli, an ATP binding cassette (ABC) transporter, uses the energy of ATP binding and hydrolysis to catalyze the high affinity uptake of D- and L-methionine. Early in vivo studies showed that the uptake of external methionine is repressed by the level of the internal methionine pool, a phenomenon termed transinhibition. Our understanding of the MetNI mechanism has thus far been limited to a series of crystal structures in an inward-facing conformation. To understand the molecular mechanism of transinhibition, we studied the kinetics of ATP hydrolysis using detergent-solubilized MetNI. We find that transinhibition is due to noncompetitive inhibition by L-methionine, much like a negative feedback loop. Thermodynamic analyses revealed two allosteric methionine binding sites per transporter. This quantitative analysis of transinhibition, the first to our knowledge for a structurally defined transporter, builds upon the previously proposed structurally based model for regulation. This mechanism of regulation at the transporter activity level could be applicable to not only ABC transporters but other types of membrane transporters as well. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  17. Co-Expression Analysis of Blood Cell Genome Expression to Preliminary Investigation of Regulatory Mechanisms in Uremia

    PubMed Central

    Cheng, Liu; Yonggui, Wu

    2017-01-01

    Background Uremia involves a series of clinical manifestations and is a common syndrome that occurs in nearly all end-stage kidney diseases. However, the exact genetic and/or molecular mechanisms that underlie uremia remain poorly understood. Material/Methods In this case-control study, we analyzed whole-genome microarray of 75 uremia patients and 20 healthy controls to investigate changes in gene expression and cellular mechanisms relevant to uremia. Gene co-expression network analysis was performed to construct co-expression networks using differentially expressed genes (DEGs) in uremia. We then determined hub models of co-expressed gene networks by MCODE, and we used miRNA enrichment analysis to detect key miRNAs in each hub module. Results We found nine co-expressed hub modules implicated in uremia. These modules were enriched in specific biological functions, including “proteolysis”, “membrane-enclosed lumen”, and “apoptosis”. Finally, miRNA enrichment analysis to detect key miRNAs in each hub module found 15 miRNAs that were specifically targeted to uremia-related hub modules. Of these, miRNA-21-3p and miRNA-210-3p have been identified in other studies as being important for uremia. Conclusions In summary, our study connected biological functions, genes, and miRNAs that underpin the network modules that can be used to elucidate the molecular mechanisms involved in uremia. PMID:28050009

  18. Transcriptomes reveal the genetic mechanisms underlying ionic regulatory adaptations to salt in the crab-eating frog

    PubMed Central

    Shao, Yong; Wang, Li-Jun; Zhong, Li; Hong, Mei-Ling; Chen, Hong-Man; Murphy, Robert W.; Wu, Dong-Dong; Zhang, Ya-Ping; Che, Jing

    2015-01-01

    The crab-eating frog, Fejervarya cancrivora, is the only frog that lives near seas. It tolerates increased environmental concentrations of sodium, chloride and potassium partly by raising ion and urea levels in its blood plasma. The molecular mechanism of the adaptation remains rarely documented. Herein, we analyze transcriptomes of the crab-eating frog and its closely related saline-intolerant species, F. limnocharis, to explore the molecular basis of adaptations to such extreme environmental conditions. Analyses reveal the potential genetic mechanism underlying the adaptation to salinity for the crab-eating frog. Genes in categories associated with ion transport appear to have evolved rapidly in F. cancrivora. Both positively selected and differentially expressed genes exhibit enrichment in the GO category regulation of renal sodium excretion. In this category, the positively selected sites of ANPEP and AVPR2 encode CD13 and V2 receptors, respectively; they fall precisely on conserved domains. More differentially expressed rapidly evolved genes occur in the kidney of F. cancrivora than in F. limnocharis. Four genes involved in the regulation of body fluid levels show signs of positive selection and increased expression. Significant up-regulation occurs in several genes of F. cancrivora associated with renin-angiotensin system and aldosterone-regulated sodium reabsorption pathways, which relate to osmotic regulation. PMID:26619819

  19. Disparate Regulatory Mechanisms Control Fat3 and P75NTR Protein Transport through a Conserved Kif5-Interaction Domain

    PubMed Central

    Birkness, Jacqueline E.; Trinidad, Jonathan C.

    2016-01-01

    Directed transport delivers proteins to specific cellular locations and is one mechanism by which cells establish and maintain polarized cellular architectures. The atypical cadherin Fat3 directs the polarized extension of dendrites in retinal amacrine cells by influencing the distribution of cytoskeletal regulators during retinal development, however the mechanisms regulating the distribution of Fat3 remain unclear. We report a novel Kinesin/Kif5 Interaction domain (Kif5-ID) in Fat3 that facilitates Kif5B binding, and determines the distribution of Fat3 cytosolic domain constructs in neurons and MDCK cells. The Kif5-ID sequence is conserved in the neurotrophin receptor P75NTR, which also binds Kif5B, and Kif5-ID mutations similarly result in P75NTR mislocalization. Despite these similarities, Kif5B-mediated protein transport is differentially regulated by these two cargos. For Fat3, the Kif5-ID is regulated by alternative splicing, and the timecourse of splicing suggests that the distribution of Fat3 may switch between early and later stages of retinal development. In contrast, P75NTR binding to Kif5B is enhanced by tyrosine phosphorylation and thus has the potential to be dynamically regulated on a more rapid time scale. PMID:27788242

  20. Complementary vascular and matrix regulatory pathways underlie the beneficial mechanism of action of sorafenib in liver fibrosis

    PubMed Central

    Thabut, Dominique; Routray, Chittaranjan; Lomberk, Gwen; Shergill, Uday; Glaser, Kevin; Huebert, Robert; Patel, Leena; Masyuk, Tetyana; Blechacz, Boris; Vercnocke, Andrew; Ritman, Erik; Ehman, Richard; Urrutia, Raul; Shah, Vijay

    2011-01-01

    Background Paracrine signaling between hepatic stellate cells (HSC) and liver endothelial cells (LEC) modulates fibrogenesis, angiogenesis, and portal hypertension. However, mechanisms regulating these processes are not fully defined. Sorafenib is a receptor tyrosine kinase inhibitor that blocks growth factor signaling in tumor cells but also displays important and not yet fully characterized effects on liver nonparenchymal cells including HSC and LEC. The aim of this study was to test the hypothesis that sorafenib influences paracrine signaling between HSC and LEC and thereby regulates matrix and vascular changes associated with chronic liver injury. Results Complementary magnetic resonance elastography, micro-CT, and histochemical analyses indicate that sorafenib attenuates the changes in both matrix and vascular compartments that occur in response to bile-duct ligation induced liver injury in rats. Cell biology studies demonstrate that sorafenib markedly reduces cell to cell apposition and junctional complexes, thus reducing the proximity typically observed between these sinusoidal barrier cells. At the molecular level, sorafenib down-regulates angiopoietin-1 and fibronectin, both released by HSC in a manner dependent on the transcription factor KLF6, suggesting that this pathway underlies both matrix and vascular changes associated with chronic liver disease. Conclusion Collectively, our results demonstrate that sorafenib inhibits both matrix restructuring and vascular remodeling that accompany chronic liver diseases and characterize cell and molecular mechanisms underlying this effect. These data may help to refine future therapies for advanced gastrointestinal and liver diseases characterized by abundant fibrosis and neovascularization. PMID:21567441

  1. Subchromoplast Sequestration of Carotenoids Affects Regulatory Mechanisms in Tomato Lines Expressing Different Carotenoid Gene Combinations[C][W

    PubMed Central

    Nogueira, Marilise; Mora, Leticia; Enfissi, Eugenia M.A.; Bramley, Peter M.; Fraser, Paul D.

    2013-01-01

    Metabolic engineering of the carotenoid pathway in recent years has successfully enhanced the carotenoid contents of crop plants. It is now clear that only increasing biosynthesis is restrictive, as mechanisms to sequestrate these increased levels in the cell or organelle should be exploited. In this study, biosynthetic pathway genes were overexpressed in tomato (Solanum lycopersicum) lines and the effects on carotenoid formation and sequestration revealed. The bacterial Crt carotenogenic genes, independently or in combination, and their zygosity affect the production of carotenoids. Transcription of the pathway genes was perturbed, whereby the tissue specificity of transcripts was altered. Changes in the steady state levels of metabolites in unrelated sectors of metabolism were found. Of particular interest was a concurrent increase of the plastid-localized lipid monogalactodiacylglycerol with carotenoids along with membranous subcellular structures. The carotenoids, proteins, and lipids in the subchromoplast fractions of the transgenic tomato fruit with increased carotenoid content suggest that cellular structures can adapt to facilitate the sequestration of the newly formed products. Moreover, phytoene, the precursor of the pathway, was identified in the plastoglobule, whereas the biosynthetic enzymes were in the membranes. The implications of these findings with respect to novel pathway regulation mechanisms are discussed. PMID:24249831

  2. Complementary transcriptomic and proteomic analyses reveal regulatory mechanisms of milk protein production in dairy cows consuming different forages

    PubMed Central

    Dai, Wenting; Chen, Qiong; Wang, Quanjuan; White, Robin R.; Liu, Jianxin; Liu, Hongyun

    2017-01-01

    Forage plays a critical role in the milk production of dairy cows; however, the mechanisms regulating bovine milk synthesis in dairy cows fed high forage rations with different basal forage types are not well-understood. In the study, rice straw (RS, low-quality) and alfalfa hay (AH, high-quality) diets were fed to lactating cows to explore how forage quality affected the molecular mechanisms regulating milk production using RNA-seq transcriptomic method with iTRAQ proteomic technique. A total of 554 transcripts (423 increased and 131 decreased) and 517 proteins (231 up-regulated and 286 down-regulated) were differentially expressed in the mammary glands of the two groups. The correlation analysis demonstrated seven proteins (six up-regulated and one down-regulated) had consistent mRNA expression. Functional analysis of the differentially expressed transcripts/proteins suggested that enhanced capacity for energy and fatty acid metabolism, increased protein degradation, reduced protein synthesis, decreased amino acid metabolism and depressed cell growth were related to RS consumption. The results indicated cows consuming RS diets may have had depressed milk protein synthesis because these animals had decreased capacity for protein synthesis, enhanced proteolysis, inefficient energy generation and reduced cell growth. Additional work evaluating RS- and AH-based rations may help better isolate molecular adaptations to low nutrient availability during lactation. PMID:28290485

  3. First Insights into the Subterranean Crustacean Bathynellacea Transcriptome: Transcriptionally Reduced Opsin Repertoire and Evidence of Conserved Homeostasis Regulatory Mechanisms.

    PubMed

    Kim, Bo-Mi; Kang, Seunghyun; Ahn, Do-Hwan; Kim, Jin-Hyoung; Ahn, Inhye; Lee, Chi-Woo; Cho, Joo-Lae; Min, Gi-Sik; Park, Hyun

    2017-01-01

    Bathynellacea (Crustacea, Syncarida, Parabathynellidae) are subterranean aquatic crustaceans that typically inhabit freshwater interstitial spaces (e.g., groundwater) and are occasionally found in caves and even hot springs. In this study, we sequenced the whole transcriptome of Allobathynella bangokensis using RNA-seq. De novo sequence assembly produced 74,866 contigs including 28,934 BLAST hits. Overall, the gene sequences were most similar to those of the waterflea Daphnia pulex. In the A. bangokensis transcriptome, no opsin or related sequences were identified, and no contig aligned to the crustacean visual opsins and non-visual opsins (i.e. arthropsins, peropsins, and melaopsins), suggesting potential regressive adaptation to the dark environment. However, A. bangokensis expressed conserved gene family sets, such as heat shock proteins and those related to key innate immunity pathways and antioxidant defense systems, at the transcriptional level, suggesting that this species has evolved adaptations involving molecular mechanisms of homeostasis. The transcriptomic information of A. bangokensis will be useful for investigating molecular adaptations and response mechanisms to subterranean environmental conditions.

  4. First Insights into the Subterranean Crustacean Bathynellacea Transcriptome: Transcriptionally Reduced Opsin Repertoire and Evidence of Conserved Homeostasis Regulatory Mechanisms

    PubMed Central

    Kim, Bo-Mi; Kang, Seunghyun; Ahn, Do-Hwan; Kim, Jin-Hyoung; Ahn, Inhye; Lee, Chi-Woo; Cho, Joo-Lae; Min, Gi-Sik; Park, Hyun

    2017-01-01

    Bathynellacea (Crustacea, Syncarida, Parabathynellidae) are subterranean aquatic crustaceans that typically inhabit freshwater interstitial spaces (e.g., groundwater) and are occasionally found in caves and even hot springs. In this study, we sequenced the whole transcriptome of Allobathynella bangokensis using RNA-seq. De novo sequence assembly produced 74,866 contigs including 28,934 BLAST hits. Overall, the gene sequences were most similar to those of the waterflea Daphnia pulex. In the A. bangokensis transcriptome, no opsin or related sequences were identified, and no contig aligned to the crustacean visual opsins and non-visual opsins (i.e. arthropsins, peropsins, and melaopsins), suggesting potential regressive adaptation to the dark environment. However, A. bangokensis expressed conserved gene family sets, such as heat shock proteins and those related to key innate immunity pathways and antioxidant defense systems, at the transcriptional level, suggesting that this species has evolved adaptations involving molecular mechanisms of homeostasis. The transcriptomic information of A. bangokensis will be useful for investigating molecular adaptations and response mechanisms to subterranean environmental conditions. PMID:28107438

  5. Regulatory mechanisms of cAMP levels as a multiple target for antiplatelet activity and less bleeding risk.

    PubMed

    Fuentes, Eduardo; Palomo, Iván

    2014-08-01

    Platelet activation is a critical component of atherothrombosis. The multiple pathways of platelet activation limit the effect of specific receptor/pathway inhibitors, resulting in limited clinical efficacy. Recent research has confirmed that combination therapy results in enhanced antithrombotic efficacy without increasing bleeding risk. In this way, the best-known inhibitor and turn off signaling in platelet activation is cAMP. In this article we discuss the mechanisms of regulation of intraplatelet cAMP levels, a) platelet-dependent pathway: Gi/Gs protein-coupled receptors, phosphodiesterase inhibition and activation of PPARs and b) platelet-independent pathway: inhibition of adenosine uptake by erythrocytes. With respect to the association between intraplatelet cAMP levels and bleeding risk it is possible to establish that compounds/drugs with pleitropic effect for increased intraplatelet cAMP level could have an antithrombotic activity with less risk of bleeding.

  6. Regulatory Mechanisms of a Highly Pectinolytic Mutant of Penicillium occitanis and Functional Analysis of a Candidate Gene in the Plant Pathogen Fusarium oxysporum

    PubMed Central

    Bravo-Ruiz, Gustavo; Sassi, Azza Hadj; Marcet-Houben, Marina; Di Pietro, Antonio; Gargouri, Ali; Gabaldon, Toni; Roncero, M. Isabel G.

    2017-01-01

    Penicillium occitanis is a model system for enzymatic regulation. A mutant strain exhibiting constitutive overproduction of different pectinolytic enzymes both under inducing (pectin) or repressing conditions (glucose) was previously isolated after chemical mutagenesis. In order to identify the molecular basis of this regulatory mechanism, the genomes of the wild type and the derived mutant strain were sequenced and compared, providing the first reference genome for this species. We used a phylogenomic approach to compare P. occitanis with other pectinolytic fungi and to trace expansions of gene families involved in carbohydrate degradation. Genome comparison between wild type and mutant identified seven mutations associated with predicted proteins. The most likely candidate was a mutation in a highly conserved serine residue of a conserved fungal protein containing a GAL4-like Zn2Cys6 binuclear cluster DNA-binding domain and a fungus-specific transcription factor regulatory middle homology region. To functionally characterize the role of this candidate gene, the mutation was recapitulated in the predicted orthologue Fusarium oxysporum, a vascular wilt pathogen which secretes a wide array of plant cell wall degrading enzymes, including polygalacturonases, pectate lyases, xylanases and proteases, all of which contribute to infection. However, neither the null mutant nor a mutant carrying the analogous point mutation exhibited a deregulation of pectinolytic enzymes. The availability, annotation and phylogenomic analysis of the P. occitanis genome sequence represents an important resource for understanding the evolution and biology of this species, and sets the basis for the discovery of new genes of biotechnological interest for the degradation of complex polysaccharides. PMID:28951729

  7. Depletion of Foxp3+ regulatory T cells increases severity of mechanical allodynia and significantly alters systemic cytokine levels following peripheral nerve injury.

    PubMed

    Lees, Justin G; Duffy, Samuel S; Perera, Chamini J; Moalem-Taylor, Gila

    2015-02-01

    Neuropathic pain is a debilitating condition caused by damage to the somatosensory nervous system, such as peripheral nerve injury. The immune system, and in particular the adaptive T cell response, plays a key role in mediating such pain. Regulatory T (Treg) cells are a small subpopulation of inhibitory T cells that prevent autoimmunity, limit immunopathology and maintain immune homeostasis. Here, we investigated the effects of conditional depletion of Treg cells on mechanical allodynia and serum cytokines in mice with chronic constriction injury (CCI) of the sciatic nerve, an animal model of neuropathic pain. We demonstrate that CCI induced the infiltration of small numbers of Treg cells within effected neuronal tissue. Utilising the transgenic DEREG (DEpletion of REGulatory T cells) mice, we confirmed effective depletion of Foxp3+ Treg cells by diphtheria toxin injections. Following CCI we observed a transient, though significant, increase in pain hypersensitivity for Treg-depleted DEREG mice compared to non-Treg-depleted mice. Analysis of systemic cytokine levels demonstrated significant changes in serum cytokine expression profiles. In particular, we observed significant increases in systemic concentration of RANTES, IL-2 and IL-5, and significant decreases in IL-12 and IFN-γ in nerve-injured Treg-depleted DEREG mice. Further analysis indicated a substantial increase in the serum concentration of IL-12p40 as a direct result of Treg cell depletion. These results suggest that depletion of Foxp3+ Treg cells promote nerve injury-induced pain hypersensitivity, partially by inducing altered systemic concentrations of cytokines, which may act to regulate neuropathic pain.

  8. A mathematical model of cancer stem cell driven tumor initiation: implications of niche size and loss of homeostatic regulatory mechanisms.

    PubMed

    Gentry, Sara N; Jackson, Trachette L

    2013-01-01

    Hierarchical organized tissue structures, with stem cell driven cell differentiation, are critical to the homeostatic maintenance of most tissues, and this underlying cellular architecture is potentially a critical player in the development of a many cancers. Here, we develop a mathematical model of mutation acquisition to investigate how deregulation of the mechanisms preserving stem cell homeostasis contributes to tumor initiation. A novel feature of the model is the inclusion of both extrinsic and intrinsic chemical signaling and interaction with the niche to control stem cell self-renewal. We use the model to simulate the effects of a variety of types and sequences of mutations and then compare and contrast all mutation pathways in order to determine which ones generate cancer cells fastest. The model predicts that the sequence in which mutations occur significantly affects the pace of tumorigenesis. In addition, tumor composition varies for different mutation pathways, so that some sequences generate tumors that are dominated by cancerous cells with all possible mutations, while others are primarily comprised of cells that more closely resemble normal cells with only one or two mutations. We are also able to show that, under certain circumstances, healthy stem cells diminish due to the displacement by mutated cells that have a competitive advantage in the niche. Finally, in the event that all homeostatic regulation is lost, exponential growth of the cancer population occurs in addition to the depletion of normal cells. This model helps to advance our understanding of how mutation acquisition affects mechanisms that influence cell-fate decisions and leads to the initiation of cancers.

  9. Histone Deacetylases 6 and 9 and Sirtuin-1 Control Foxp3+ Regulatory T Cell Function Through Shared and Isotype-Specific Mechanisms

    PubMed Central

    Beier, Ulf H.; Wang, Liqing; Han, Rongxiang; Akimova, Tatiana; Liu, Yujie; Hancock, Wayne W.

    2013-01-01

    Therapeutic targeting of histone/protein deacetylase 6 (HDAC6), HDAC9, or the sirtuin-1 (Sirt1) augments the suppressive functions of regulatory T cells (Tregs) that contain the transcription factor Foxp3. However, it is unclear whether distinct mechanisms are involved or whether combined inhibition of these targets would be more beneficial. We compared the suppressive functions of Tregs from wild-type C57BL/6 mice with those from mice with either global (HDAC6−/−, HDAC9−/−, and HDAC6−/−HDAC9−/−), or conditional (fl-Sirt1/CD4-Cre or fl-Sirt1/Foxp3-Cre) HDAC deletion, as well as treatment with isoform-selective HDAC inhibitors. We found that the heat shock response was important for the improvement of Treg suppressive function mediated by HDAC6 inhibition, but not Sirt1 inhibition. Furthermore, although HDAC6, HDAC9, and Sirt1 all deacetylated Foxp3, each protein had diverse effects on transcription factors controlling Foxp3 gene expression. For example, loss of HDAC9 was associated with stabilization of the acetylation of signal transducer and activator of transcription 5 (STAT5) and of its transcriptional activity. Hence, targeting different HDACs increased Treg function by multiple and additive mechanisms, which indicates the therapeutic potential for combinations of HDAC inhibitors in the management of autoimmunity and organ transplantation. PMID:22715468

  10. A novel regulatory mechanism of the mitochondrial Ca2+ uniporter revealed by the p38 mitogen-activated protein kinase inhibitor SB202190.

    PubMed

    Montero, Mayte; Lobaton, Carmen D; Moreno, Alfredo; Alvarez, Javier

    2002-12-01

    It is widely acknowledged that mitochondrial Ca2+ uptake modulates the cytosolic [Ca2+] ([Ca2+]c) acting as a transient Ca2+ buffer. In addition, mitochondrial [Ca2+] ([Ca2+]M) regulates the rate of respiration and may trigger opening of the permeability transition pore and start apoptosis. However, no mechanism for the physiological regulation of mitochondrial Ca2+ uptake has been described. We show here that SB202190, an inhibitor of p38 mitogen-activated protein (MAP) kinase, strongly stimulates ruthenium red-sensitive mitochondrial Ca2+ uptake, both in intact and in permeabilized HeLa cells. The [Ca2+]M peak induced by agonists was increased about fourfold in the presence of the inhibitor, with a concomitant reduction in the [Ca2+]c peak. The stimulation occurred fast and was rapidly reversible. In addition, experiments in permeabilized cells perfused with controlled [Ca2+] showed that SB202190 stimulated mitochondrial Ca2+ uptake by more than 10-fold, but only in the physiological [Ca2+]c range (1-4 mM). Other structurally related p38 MAP kinase inhibitors (SB203580, PD169316, or SB220025) produced little or no effect. Our data suggest that in HeLa cells, a protein kinase sensitive to SB202190 tonically inhibits the mitochondrial Ca2+ uniporter. This novel regulatory mechanism may be of paramount importance to modulate mitochondrial Ca2+ uptake under different physiopathological conditions.

  11. GTP cyclohydrolase I inhibition by the prototypic inhibitor 2, 4-diamino-6-hydroxypyrimidine. Mechanisms and unanticipated role of GTP cyclohydrolase I feedback regulatory protein.

    PubMed

    Xie, L; Smith, J A; Gross, S S

    1998-08-14

    2,4-Diamino-6-hydroxypyrimidine (DAHP) is considered to be a selective and direct-acting inhibitor of GTP cyclohydrolase I (GTPCH), the first and rate-limiting enzyme in the pathway for synthesis of tetrahydrobiopterin (BH4). Accordingly, DAHP has been widely employed to distinguish whether de novo BH4 synthesis is required in a given biological system. Although it has been assumed that DAHP inhibits GTPCH by direct competition with substrate GTP, this has never been formally demonstrated. In view of apparent structural homology between DAHP and BH4, we questioned whether DAHP may mimic BH4 in its inhibition of GTPCH by an indirect mechanism, involving interaction with a recently cloned 9.5-kDa protein termed GTPCH Feedback Regulatory Protein (GFRP). We show by reverse transcription-polymerase chain reaction that GFRP mRNA is constitutively expressed in rat aortic smooth muscle cells and further induced by treatment with immunostimulants. Moreover, functional GFRP is expressed and immunostimulant-induced BH4 accumulates in sufficient quantity to trigger feedback inhibition of GTPCH. Studies with DAHP reveal that GFRP is also essential to achieve potent inhibition of GTPCH. Indeed, DAHP inhibits GTPCH by dual mechanisms. At a relatively low concentration, DAHP emulates BH4 and engages the GFRP-dependent feedback inhibitory system; at higher concentrations, DAHP competes directly for binding with GTP substrate. This knowledge predicts that DAHP would preferably target GTPCH in tissues with abundant GFRP.

  12. Insights into the mechanism of FTY720 and compatibility with regulatory T cells for the inhibition of graft-versus-host disease (GVHD).

    PubMed

    Taylor, Patricia A; Ehrhardt, Michael J; Lees, Christopher J; Tolar, Jakub; Weigel, Brenda J; Panoskaltsis-Mortari, Angela; Serody, Jonathan S; Brinkmann, Volker; Blazar, Bruce R

    2007-11-01

    The immunomodulator FTY720 (FTY) has been shown to be beneficial in experimental models of organ transplantation and autoimmunity. We show that FTY significantly inhibited but did not prevent graft-versus-host disease (GVHD) in lethally irradiated or nonirradiated allogeneic recipients. Although most studies implicate prevention of lymphocyte egress from lymphoid organs as the primary mechanism of action, our data indicate that FTY effects on the host are more likely to be responsible for GVHD inhibition. FTY reduced splenic CD11c+ cells by 50%, and similarly reduced CD4+ and CD8+ T-cell responder frequencies in the spleen early after transplantation. Imaging of GFP+ effectors indicated that FTY modified donor effector T-cell migration to secondary lymphoid organs, but did not uniformly trap T cells in lymph nodes or prevent early effector migration to GVHD parenchymal target organs. Administration of FTY only prior to transplantation inhibited GVHD, indicating that the primary function of FTY may be targeted to host cells. FTY was additive with regulatory T cells for GVHD inhibition. FTY slightly impaired but did not abrogate a graft-versus-leukemia (GVL) effect against C1498, a myeloid leukemia. Our data further define the mechanisms of action and provide insight as to the potential clinical uses of FTY in allogeneic bone marrow transplant recipients.

  13. See the forest for the trees: Whole-plant allocation patterns and regulatory mechanisms in Norway spruce

    NASA Astrophysics Data System (ADS)

    Huang, Jianbei; Behrendt, Thomas; Hammerbacher, Almuth; Weinhold, Alexander; Hellén, Heidi; Reichelt, Michael; Wisthaler, Armin; Dam, Nicole; Trumbore, Susan; Hartmann, Henrik

    2017-04-01

    acetone) decreased whereas monoterpene and sesquiterpene emissions slightly increased with decreasing [CO2]. Our experimental design provides an excellent platform for studying control mechanisms of C allocation. The range of C availabilities applied in our study will allow partitioning compensatory mechanisms (e.g., up-regulation of C storage due to sugar signalling at high C availability) from evolutionary programming (e.g., storage formation to increase long-term survival at expense of other functions with decreasing C availability). Such partitioning is corroborated via phytohormone and transcriptome analysis, and results will hopefully be available at the time of presentation.

  14. Genetic and regulatory mechanism of susceptibility to high-hyperdiploid acute lymphoblastic leukaemia at 10p21.2

    PubMed Central

    Studd, James B.; Vijayakrishnan, Jayaram; Yang, Minjun; Migliorini, Gabriele; Paulsson, Kajsa; Houlston, Richard S.

    2017-01-01

    Despite high-hyperdiploid acute lymphoblastic leukaemia (HD-ALL) being the most common subgroup of paediatric ALL, its aetiology remains unknown. Genome-wide association studies have demonstrated association at 10q21.2. Here, we sought to determine how this region influences HD-ALL risk. We impute genotypes across the locus, finding the single nucleotide polymorphism rs7090445 highly associated with HD-ALL (P=1.54 × 10−38), and residing in a predicted enhancer element. We show this region physically interacts with the transcription start site of ARID5B, that alleles of rs7090445 have differential enhancer activity and influence RUNX3 binding. RUNX3 knock-down reduces ARID5B expression and rs7090445 enhancer activity. Individuals carrying the rs7090445-C risk allele also have reduced ARID5B expression. Finally, the rs7090445-C risk allele is preferentially retained in HD-ALL blasts consistent with inherited genetic variation contributing to arrest of normal lymphocyte development, facilitating leukaemic clonal expansion. These data provide evidence for a biological mechanism underlying hereditary risk of HD-ALL at 10q21.2. PMID:28256501

  15. Deciphering the molecular mechanisms underlying the binding of the TWIST1/E12 complex to regulatory E-box sequences

    PubMed Central

    Bouard, Charlotte; Terreux, Raphael; Honorat, Mylène; Manship, Brigitte; Ansieau, Stéphane; Vigneron, Arnaud M.; Puisieux, Alain; Payen, Léa

    2016-01-01

    Abstract The TWIST1 bHLH transcription factor controls embryonic development and cancer processes. Although molecular and genetic analyses have provided a wealth of data on the role of bHLH transcription factors, very little is known on the molecular mechanisms underlying their binding affinity to the E-box sequence of the promoter. Here, we used an in silico model of the TWIST1/E12 (TE) heterocomplex and performed molecular dynamics (MD) simulations of its binding to specific (TE-box) and modified E-box sequences. We focused on (i) active E-box and inactive E-box sequences, on (ii) modified active E-box sequences, as well as on (iii) two box sequences with modified adjacent bases the AT- and TA-boxes. Our in silico models were supported by functional in vitro binding assays. This exploration highlighted the predominant role of protein side-chain residues, close to the heart of the complex, at anchoring the dimer to DNA sequences, and unveiled a shift towards adjacent ((-1) and (-1*)) bases and conserved bases of modified E-box sequences. In conclusion, our study provides proof of the predictive value of these MD simulations, which may contribute to the characterization of specific inhibitors by docking approaches, and their use in pharmacological therapies by blocking the tumoral TWIST1/E12 function in cancers. PMID:27151200

  16. Studies on the regulatory effect of Peony-Glycyrrhiza Decoction on prolactin hyperactivity and underlying mechanism in hyperprolactinemia rat model.

    PubMed

    Wang, Di; Wang, Wei; Zhou, Yulin; Wang, Juan; Jia, Dongxu; Wong, Hei Kiu; Zhang, Zhang-Jin

    2015-10-08

    Clinical trials have demonstrated the beneficial effects of Peony-Glycyrrhiza Decoction (PGD) in alleviating antipsychotic-induced hyperprolactinemia (hyperPRL) in schizophrenic patients. In previous experiment, PGD suppressed prolactin (PRL) level in MMQ cells, involving modulating the expression of D2 receptor (DRD2) and dopamine transporter (DAT). In the present study, hyperPRL female rat model induced by dopamine blocker metoclopramide (MCP) was applied to further confirm the anti-hyperpPRL activity of PGD and underlying mechanism. In MCP-induced hyperPRL rats, the elevated serum PRL level was significantly suppressed by either PGD (2.5-10 g/kg) or bromocriptine (BMT) (0.6 mg/kg) administration for 14 days. However, in MCP-induced rats, only PGD restored the under-expressed serum progesterone (P) to control level. Both PGD and BMT administration restore the under-expression of DRD2, DAT and TH resulted from MCP in pituitary gland and hypothalamus. Compared to untreated group, hyperPRL animals had a marked reduction on DRD2 and DAT expression in the arcuate nucleus. PGD (10 g/kg) and BMT (0.6 mg/kg) treatment significant reversed the expression of DRD2 and DAT. Collectively, the anti-hyperPRL activity of PGD associates with the modulation of dopaminergic neuronal system and the restoration of serum progesterone level. Our finding supports PGD as an effective agent against hyperPRL.

  17. Deciphering the molecular mechanisms underlying the binding of the TWIST1/E12 complex to regulatory E-box sequences.

    PubMed

    Bouard, Charlotte; Terreux, Raphael; Honorat, Mylène; Manship, Brigitte; Ansieau, Stéphane; Vigneron, Arnaud M; Puisieux, Alain; Payen, Léa

    2016-06-20

    The TWIST1 bHLH transcription factor controls embryonic development and cancer processes. Although molecular and genetic analyses have provided a wealth of data on the role of bHLH transcription factors, very little is known on the molecular mechanisms underlying their binding affinity to the E-box sequence of the promoter. Here, we used an in silico model of the TWIST1/E12 (TE) heterocomplex and performed molecular dynamics (MD) simulations of its binding to specific (TE-box) and modified E-box sequences. We focused on (i) active E-box and inactive E-box sequences, on (ii) modified active E-box sequences, as well as on (iii) two box sequences with modified adjacent bases the AT- and TA-boxes. Our in silico models were supported by functional in vitro binding assays. This exploration highlighted the predominant role of protein side-chain residues, close to the heart of the complex, at anchoring the dimer to DNA sequences, and unveiled a shift towards adjacent ((-1) and (-1*)) bases and conserved bases of modified E-box sequences. In conclusion, our study provides proof of the predictive value of these MD simulations, which may contribute to the characterization of specific inhibitors by docking approaches, and their use in pharmacological therapies by blocking the tumoral TWIST1/E12 function in cancers.

  18. Comparative transcriptome and metabolome provides new insights into the regulatory mechanisms of accelerated senescence in litchi fruit after cold storage

    PubMed Central

    Yun, Ze; Qu, Hongxia; Wang, Hui; Zhu, Feng; Zhang, Zhengke; Duan, Xuewu; Yang, Bao; Cheng, Yunjiang; Jiang, Yueming

    2016-01-01

    Litchi is a non-climacteric subtropical fruit of high commercial value. The shelf life of litchi fruit under ambient conditions (AC) is approximately 4–6 days. Post-harvest cold storage prolongs the life of litchi fruit for up to 30 days with few changes in pericarp browning and total soluble solids. However, the shelf life of litchi fruits at ambient temperatures after pre-cold storage (PCS) is only 1–2 days. To better understand the mechanisms involved in the rapid fruit senescence induced by pre-cold storage, a transcriptome of litchi pericarp was constructed to assemble the reference genes, followed by comparative transcriptomic and metabolomic analyses. Results suggested that the senescence of harvested litchi fruit was likely to be an oxidative process initiated by ABA, including oxidation of lipids, polyphenols and anthocyanins. After cold storage, PCS fruit exhibited energy deficiency, and respiratory burst was elicited through aerobic and anaerobic respiration, which was regulated specifically by an up-regulated calcium signal, G-protein-coupled receptor signalling pathway and small GTPase-mediated signal transduction. The respiratory burst was largely associated with increased production of reactive oxygen species, up-regulated peroxidase activity and initiation of the lipoxygenase pathway, which were closely related to the accelerated senescence of PCS fruit. PMID:26763309

  19. Comparative transcriptome and metabolome provides new insights into the regulatory mechanisms of accelerated senescence in litchi fruit after cold storage.

    PubMed

    Yun, Ze; Qu, Hongxia; Wang, Hui; Zhu, Feng; Zhang, Zhengke; Duan, Xuewu; Yang, Bao; Cheng, Yunjiang; Jiang, Yueming

    2016-01-14

    Litchi is a non-climacteric subtropical fruit of high commercial value. The shelf life of litchi fruit under ambient conditions (AC) is approximately 4-6 days. Post-harvest cold storage prolongs the life of litchi fruit for up to 30 days with few changes in pericarp browning and total soluble solids. However, the shelf life of litchi fruits at ambient temperatures after pre-cold storage (PCS) is only 1-2 days. To better understand the mechanisms involved in the rapid fruit senescence induced by pre-cold storage, a transcriptome of litchi pericarp was constructed to assemble the reference genes, followed by comparative transcriptomic and metabolomic analyses. Results suggested that the senescence of harvested litchi fruit was likely to be an oxidative process initiated by ABA, including oxidation of lipids, polyphenols and anthocyanins. After cold storage, PCS fruit exhibited energy deficiency, and respiratory burst was elicited through aerobic and anaerobic respiration, which was regulated specifically by an up-regulated calcium signal, G-protein-coupled receptor signalling pathway and small GTPase-mediated signal transduction. The respiratory burst was largely associated with increased production of reactive oxygen species, up-regulated peroxidase activity and initiation of the lipoxygenase pathway, which were closely related to the accelerated senescence of PCS fruit.

  20. A genome-wide analysis of the RNA-guided silencing pathway in coffee reveals insights into its regulatory mechanisms.

    PubMed

    Noronha Fernandes-Brum, Christiane; Marinho Rezende, Pâmela; Cherubino Ribeiro, Thales Henrique; Ricon de Oliveira, Raphael; Cunha de Sousa Cardoso, Thaís; Rodrigues do Amaral, Laurence; de Souza Gomes, Matheus; Chalfun-Junior, Antonio

    2017-01-01

    microRNAs (miRNAs) are derived from self-complementary hairpin structures, while small-interfering RNAs (siRNAs) are derived from double-stranded RNA (dsRNA) or hairpin precursors. The core mechanism of sRNA production involves DICER-like (DCL) in processing the smallRNAs (sRNAs) and ARGONAUTE (AGO) as effectors of silencing, and siRNA biogenesis also involves action of RNA-Dependent RNA Polymerase (RDR), Pol IV and Pol V in biogenesis. Several other proteins interact with the core proteins to guide sRNA biogenesis, action, and turnover. We aimed to unravel the components and functions of the RNA-guided silencing pathway in a non-model plant species of worldwide economic relevance. The sRNA-guided silencing complex members have been identified in the Coffea canephora genome, and they have been characterized at the structural, functional, and evolutionary levels by computational analyses. Eleven AGO proteins, nine DCL proteins (which include a DCL1-like protein that was not previously annotated), and eight RDR proteins were identified. Another 48 proteins implicated in smallRNA (sRNA) pathways were also identified. Furthermore, we identified 235 miRNA precursors and 317 mature miRNAs from 113 MIR families, and we characterized ccp-MIR156, ccp-MIR172, and ccp-MIR390. Target prediction and gene ontology analyses of 2239 putative targets showed that significant pathways in coffee are targeted by miRNAs. We provide evidence of the expansion of the loci related to sRNA pathways, insights into the activities of these proteins by domain and catalytic site analyses, and gene expression analysis. The number of MIR loci and their targeted pathways highlight the importance of miRNAs in coffee. We identified several roles of sRNAs in C. canephora, which offers substantial insight into better understanding the transcriptional and post-transcriptional regulation of this major crop.

  1. Antigen- and receptor-driven regulatory mechanisms. I. Induction of suppressor T cells with anti-idiotypic antibodies

    PubMed Central

    1979-01-01

    Delayed-type hypersensitivity (DTH) to the azobenzenearsonate (ABA) hapten can be readily induced in A/J mice injecting ABA-coupled syngeneic spleen cells subcutaneously. To further characterize this T- cell-dependent immunological phenomenon, the effect of passively administered anti-cross-reactive idiotype common to anti-ABA antibodies of A/J mice (CRI) antibodies on the development of ABA-specific DTH was investigated. Animals given daily injections (of minute amounts) of anti-CRI antibodies subsequent to immunization with ABA-coupled cells show significant reduction of ABA specific responses. This inhibition is antigen specific and requires the intact immunoglobulin molecule, as F(ab')2 treatments were ineffective in suppressing the reaction. Investigations of the mechanism of the anti-CRI-induced suppression of ABA DTH revealed that the observed suppression is a result of the activation of suppressor cells. Spleen cells taken from animals which received anti-CRI antibodies were able to adoptively transfer suppression to naive recipients. This suppression was shown to be mediated by T cells, as anti-Thy1.2 plus complement completely abrogated the transfer of suppression. In addition, animals pretreated with low doses of cyclophosphamide were not suppressed by the administration of anti-CRI antibodies. The genetic restriction of anti- CRI-induced suppression was demonstrated. Antibodies to the major cross- reactive idiotype, (CRI) associated with anti-ABA antibodies in A/J mice were unable to suppress the development of DTH to ABA in BALB/c mice (H-2d, Igh-1a). Such antibodies were, however, fully active in suppressing ABA DTH in the allotype-congenic C.AL-20 strain which has an allotype (Igh-1d) similar to that of A/J (Igh-1e) on a BALB/c background, and which produces humoral antibodies with the CRI. PMID:91656

  2. Lycopene treatment against loss of bone mass, microarchitecture and strength in relation to regulatory mechanisms in a postmenopausal osteoporosis model.

    PubMed

    Ardawi, Mohammed-Salleh M; Badawoud, Mohammed H; Hassan, Sherif M; Rouzi, Abdulrahim A; Ardawi, Jumanah M S; AlNosani, Nouf M; Qari, Mohammed H; Mousa, Shaker A

    2016-02-01

    Lycopene supplementation decreases oxidative stress and exhibits beneficial effects on bone health, but the mechanisms through which it alters bone metabolism in vivo remain unclear. The present study aims to evaluate the effects of lycopene treatment on postmenopausal osteoporosis. Six-month-old female Wistar rats (n=264) were sham-operated (SHAM) or ovariectomized (OVX). The SHAM group received oral vehicle only and the OVX rats were randomized into five groups receiving oral daily lycopene treatment (mg/kg body weight per day): 0 OVX (control), 15 OVX, 30 OVX, and 45 OVX, and one group receiving alendronate (ALN) (2μg/kg body weight per day), for 12weeks. Bone densitometry measurements, bone turnover markers, biomechanical testing, and histomorphometric analysis were conducted. Micro computed tomography was also used to evaluate changes in microarchitecture. Lycopene treatment suppressed the OVX-induced increase in bone turnover, as indicated by changes in biomarkers of bone metabolism: serum osteocalcin (s-OC), serum N-terminal propeptide of type 1 collagen (s-PINP), serum crosslinked carboxyterminal telopeptides (s-CTX-1), and urinary deoxypyridinoline (u-DPD). Significant improvement in OVX-induced loss of bone mass, bone strength, and microarchitectural deterioration was observed in lycopene-treated OVX animals. These effects were observed mainly at sites rich in trabecular bone, with less effect in cortical bone. Lycopene treatment down-regulated osteoclast differentiation concurrent with up-regulating osteoblast together with glutathione peroxidase (GPx) catalase (CAT) and superoxide dismutase (SOD) activities. These findings demonstrate that lycopene treatment in OVX rats primarily suppressed bone turnover to restore bone strength and microarchitecture.

  3. A Novel Regulatory Mechanism of Type II Collagen Expression via a SOX9-dependent Enhancer in Intron 6.

    PubMed

    Yasuda, Hideyo; Oh, Chun-do; Chen, Di; de Crombrugghe, Benoit; Kim, Jin-Hoi

    2017-01-13

    Type II collagen α1 is specific for cartilaginous tissues, and mutations in its gene are associated with skeletal diseases. Its expression has been shown to be dependent on SOX9, a master transcription factor required for chondrogenesis that binds to an enhancer region in intron 1. However, ChIP sequencing revealed that SOX9 does not strongly bind to intron 1, but rather it binds to intron 6 and a site 30 kb upstream of the transcription start site. Here, we aimed to determine the role of the novel SOX9-binding site in intron 6. We prepared reporter constructs that contain a Col2a1 promoter, intron 1 with or without intron 6, and the luciferase gene. Although the reporter constructs were not activated by SOX9 alone, the construct that contained both introns 1 and 6 was activated 5-10-fold by the SOX9/SOX5 or the SOX9/SOX6 combination in transient-transfection assays in 293T cells. This enhancement was also observed in rat chondrosarcoma cells that stably expressed the construct. CRISPR/Cas9-induced deletion of intron 6 in RCS cells revealed that a 10-bp region of intron 6 is necessary both for Col2a1 expression and SOX9 binding. Furthermore, SOX9, but not SOX5, binds to this region as demonstrated in an electrophoretic mobility shift assay, although both SOX9 and SOX5 bind to a larger 325-bp fragment of intron 6 containing this small sequence. These findings suggest a novel mechanism of action of SOX5/6; namely, the SOX9/5/6 combination enhances Col2a1 transcription through a novel enhancer in intron 6 together with the enhancer in intron 1.

  4. S-nitrosation of β-catenin and p120 catenin: a novel regulatory mechanism in endothelial hyperpermeability

    PubMed Central

    Marín, N.; Zamorano, P.; Carrasco, R.; Mujica, P.; González, FG.; Quezada, C.; Meininger, CJ.; Boric, MP.; Durán, WN.; Sánchez, FA.

    2014-01-01

    Rationale Endothelial adherens junction proteins constitute an important element in the control of microvascular permeability. Platelet-activating factor (PAF) increases permeability to macromolecules via translocation of eNOS to cytosol and stimulation of eNOS-derived NO signaling cascade. The mechanisms by which NO signaling regulates permeability at adherens junctions are still incompletely understood. Objective We explored the hypothesis that PAF stimulates hyperpermeability via S-nitrosation (SNO) of adherens junction proteins. Methods and Results We measured PAF-stimulated S-nitrosation of β-catenin and p120-catenin (p120) in three cell lines: ECV-eNOSGFP, EAhy926 (derived from human umbilical vein) and CVEC (derived from bovine heart endothelium) and in the mouse cremaster muscle in vivo. SNO correlated with diminished abundance of β-catenin and p120 at the adherens junction and with hyperpermeability. TNF-α increased NO production and caused similar increase in S-nitrosation as PAF. To ascertain the importance of eNOS subcellular location in this process, we used ECV-304 cells transfected with cytosolic eNOS (GFPeNOSG2A) and plasma membrane eNOS (GFPeNOSCAAX). PAF induced S-nitrosation of β-catenin and p120 and significantly diminished association between these proteins in cells with cytosolic eNOS but not in cells wherein eNOS is anchored to the cell membrane. Inhibitors of NO production and of S-nitrosation blocked PAF-induced S-nitrosation and hyperpermeability whereas inhibition of the cGMP pathway had no effect. Mass spectrometry analysis of purified p120 identified cysteine 579 as the main S-nitrosated residue in the region that putatively interacts with VE-cadherin. Conclusions Our results demonstrate that agonist-induced SNO contributes to junctional membrane protein changes that enhance endothelial permeability. PMID:22777005

  5. Overexpression of the rhamnose catabolism regulatory protein, RhaR: a novel mechanism for metronidazole resistance in Bacteroides thetaiotaomicron

    PubMed Central

    Patel, Ekta H.; Paul, Lynthia V.; Casanueva, Ana I.; Patrick, Sheila; Abratt, Valerie R.

    2009-01-01

    Objectives The aim of the investigation was to use in vitro transposon mutagenesis to generate metronidazole resistance in the obligately anaerobic pathogenic bacterium Bacteroides thetaiotaomicron, and to identify the genes involved to enable investigation of potential mechanisms for the generation of metronidazole resistance. Methods The genes affected by the transposon insertion were identified by plasmid rescue and sequencing. Expression levels of the relevant genes were determined by semi-quantitative RNA hybridization and catabolic activity by lactate dehydrogenase/pyruvate oxidoreductase assays. Results A metronidazole-resistant mutant was isolated and the transposon insertion site was identified in an intergenic region between the rhaO and rhaR genes of the gene cluster involved in the uptake and catabolism of rhamnose. Metronidazole resistance was observed during growth in defined medium containing either rhamnose or glucose. The metronidazole-resistant mutant showed improved growth in the presence of rhamnose as compared with the wild-type parent. There was increased transcription of all genes of the rhamnose gene cluster in the presence of rhamnose and glucose, likely due to the transposon providing an additional promoter for the rhaR gene, encoding the positive transcriptional regulator of the rhamnose operon. The B. thetaiotaomicron metronidazole resistance phenotype was recreated by overexpressing the rhaR gene in the B. thetaiotaomicron wild-type parent. Both the metronidazole-resistant transposon mutant and RhaR overexpression strains displayed a phenotype of higher lactate dehydrogenase and lower pyruvate oxidoreductase activity in comparison with the parent strain during growth in rhamnose. Conclusions These data indicate that overexpression of the rhaR gene generates metronidazole resistance in B. thetaiotaomicron PMID:19525515

  6. Regulatory mechanisms of interleukin-8 production induced by tumour necrosis factor-α in human hepatocellular carcinoma cells

    PubMed Central

    Wang, Yaohui; Wang, Weimin; Wang, Lingyan; Wang, Xiangdong; Xia, Jinglin

    2012-01-01

    Abstract Interleukin (IL)-8 plays the critical role in the initiation of micro-environmental inflammation responsible for tumour growth and patient prognosis. This study aimed at investigating the molecular mechanisms of IL-8 production from human hepatocellular carcinoma (HCC) cells. The levels of IL-8 and phosphorylation of p38 mitogen-activated protein kinase (MAPK), ERK1/2 and Akt in MHCC-97H cells were measured by ELISA, Western blot and immunofluorescence. NF-κB p65 protein nuclear translocation was determined by non-radioactive NF-κB p50/p65 transcription factor activity kit and cell bio-behaviours were detected by the real-time cell-monitoring system. Tumour necrosis factor-α (TNF-α) significantly induced phosphorylation of p38 MAPK, ERK, Akt and production of IL-8 from HCC cells, which were prevented by SB203580 (p38 MAPK inhibitor), PD98059 (ERK inhibitor), LY294002 and Wortmannin (PI3K inhibitor) and SB328437 (CCR3 inhibitor). TNF-α could significantly increase the translocation of NF-κB p65 protein into the nucleus in a dose-dependent manner, while SB203580 partially inhibited. In inflammatory micro-environment, HCC auto-produced IL-8 through p38 MAPK, ERK and PI3K/Akt signalling pathways, where the p38 MAPK is a central factor to activate the NF-κB pathway and regulate the expression of IL-8 production. There was a potential cross-talking between receptors. PMID:21545687

  7. Thermal clamping of temperature-regulating flowers reveals the precision and limits of the biochemical regulatory mechanism.

    PubMed

    Seymour, Roger S; Lindshau, Gemma; Ito, Kikukatsu

    2010-05-01

    The flowers of several families of seed plants warm themselves when they bloom. In some species, thermogenesis is regulated, increasing the rate of respiration at lower ambient temperature (T (a)) to maintain a somewhat stable floral temperature (T (f)). The precision of this regulation is usually measured by plotting T (f) over T (a). However, such measurements are influenced by environmental conditions, including wind speed, humidity, radiation, etc. This study eliminates environmental effects by experimentally 'clamping' T (f) at constant, selected levels and then measuring stabilized respiration rate. Regulating flowers show decreasing respiration with rising T (f) (Q (10) < 1). Q (10) therefore becomes a measure of the biochemical 'precision' of temperature regulation: lower Q (10) values indicate greater sensitivity of respiration to T (f) and a narrower range of regulated temperatures. At the lower end of the regulated range, respiration is maximal, and further decreases in floral temperature cause heat production to diminish. Below a certain tissue temperature ('switching temperature'), heat loss always exceeds heat production, so thermoregulation becomes impossible. This study compared three species of thermoregulatory flowers with distinct values of precision and switching temperature. Precision was highest in Nelumbo nucifera (Q (10) = 0.16) moderate in Symplocarpus renifolius (Q (10) = 0.48) and low in Dracunculus vulgaris (Q (10) = 0.74). Switching temperatures were approximately 30, 15 and 20 degrees C, respectively. There were no relationships between precision, switching temperature or maximum respiration rate. High precision reveals a powerful inhibitory mechanism that overwhelms the tendency of temperature to increase respiration. Variability in the shape and position of the respiration-temperature curves must be accounted for in any explanation of the control of respiration in thermoregulatory flowers.

  8. Defects in the regulatory clearance mechanisms favor the breakdown of self-tolerance during spontaneous autoimmune orchitis.

    PubMed

    Pelletier, R-Marc; Yoon, Suk Ran; Akpovi, Casimir D; Silvas, Emil; Vitale, María Leiza

    2009-03-01

    We identified aberrations leading to spontaneous autoimmune orchitis (AIO) in mink, a seasonal breeder and natural model for autoimmunity. This study provides evidence favoring the view that a malfunction of the clearance mechanisms for apoptotic cell debris arising from imbalances in phagocyte receptors or cytokines acting on Sertoli cells constitutes a major factor leading to breakdown of self-tolerance during spontaneous AIO. Serum anti-sperm antibody titers measured by ELISA reflected spermatogenic activity without causing immune inflammatory responses. Orchitic mink showed excess antibody production accompanied by spermatogenic arrest, testicular leukocyte infiltration, and infertility. AIO serum labeled the postacrosomal region, the mid and end piece of mink sperm, whereas normal mink serum did not. Normal serum labeled plasma membranes, whereas AIO serum reacted with germ cell nuclei. Western blot analyses revealed that AIO serum reacted specifically to a 23- and 50-kDa protein. The number of apostain-labeled apoptotic cells was significantly higher in orchitic compared with normal tubules. However, apoptosis levels measured by ELISA in seminiferous tubular fractions (STf) were not significantly different in normal and orchitic tubules. The levels of CD36, TNF-alpha, TNF-alpha RI, IL-6, and Fas but not Fas-ligand (L), and ATP-binding cassette transporter ABCA1 were changed in AIO STf. TNF-alpha and IL-6 serum levels were increased during AIO. Fas localized to germ cells, Sertoli cells, and the lamina propria of the tubules and Fas-L, to germ cells. Fas colocalized with Fas-L in residual bodies in normal testis and in giant cells and infiltrating leukocytes in orchitic tubules.

  9. Identification of a Novel Regulatory Mechanism of Nutrient Transport Controlled by TORC1-Npr1-Amu1/Par32

    PubMed Central

    Boeckstaens, Mélanie; Merhi, Ahmad; Llinares, Elisa; Van Vooren, Pascale; Springael, Jean-Yves; Wintjens, René; Marini, Anna Maria

    2015-01-01

    Fine-tuning the plasma-membrane permeability to essential nutrients is fundamental to cell growth optimization. Nutritional signals including nitrogen availability are integrated by the TORC1 complex which notably regulates arrestin-mediated endocytosis of amino-acid transporters. Ammonium is a ubiquitous compound playing key physiological roles in many, if not all, organisms. In yeast, it is a preferred nitrogen source transported by three Mep proteins which are orthologues of the mammalian Rhesus factors. By combining genetic, kinetic, biochemical and cell microscopy analyses, the current study reveals a novel mechanism enabling TORC1 to regulate the inherent activity of ammonium transport proteins, independently of arrestin-mediated endocytosis, identifying the still functional orphan Amu1/Par32 as a selective regulator intermediate. We show that, under poor nitrogen supply, the TORC1 effector kinase' Npr1' promotes phosphorylation of Amu1/Par32 which appears mainly cytosolic while ammonium transport proteins are active. Upon preferred nitrogen supplementation, like glutamine or ammonium addition, TORC1 upregulation enables Npr1 inhibition and Amu1/Par32 dephosphorylation. In these conditions, as in Npr1-lacking cells, hypophosphorylated Amu1/Par32 accumulates at the cell surface and mediates the inhibition of specific ammonium transport proteins. We show that the integrity of a conserved repeated motif of Amu1/Par32 is required for the interaction with these transport proteins. This study underscores the diversity of strategies enabling TORC1-Npr1 to selectively monitor cell permeability to nutrients by discriminating between transporters to be degraded or transiently inactivated and kept stable at the plasma membrane. This study further identifies the function of Amu1/Par32 in acute control of ammonium transport in response to variations in nitrogen availability. PMID:26172854

  10. Differential response of regulatory and conventional CD4⁺ lymphocytes to CD3 engagement: clues to a possible mechanism of anti-CD3 action?

    PubMed

    Li, Li; Nishio, Junko; van Maurik, André; Mathis, Diane; Benoist, Christophe

    2013-10-01

    Several clinical trials have shown anti-CD3 treatment to be a promising therapy for autoimmune diabetes, but its mechanism of action remains unclear. Foxp3(+) regulatory T cells (Tregs) are likely to be involved, but through unknown mechanistic pathways. We profiled the transcriptional consequences in CD4(+) Tregs and conventional T cells (Tconvs) in the first hours and days after anti-CD3 treatment of NOD mice. Anti-CD3 treatment led to a transient transcriptional response, terminating faster than most Ag-induced responses. Most transcripts were similarly induced in Tregs and Tconvs, but several were differential, in particular, those encoding the IL-7R and transcription factors Id2/3 and Gfi1, upregulated in Tregs but repressed in Tconvs. Because IL-7R was a plausible candidate for driving the homeostatic response of Tregs to anti-CD3, we tested its relevance by supplementation of anti-CD3 treatment with IL-7/anti-IL-7 complexes. Although ineffective alone, IL-7 significantly improved the rate of remission induced by anti-CD3. Four anti-human CD3 mAbs exhibited the same differential effect on IL-7R expression in human as in mouse cells, suggesting that the mechanism also underlies therapeutic effect in human cells, and perhaps a rationale for testing a combination of anti-CD3 and IL-7 for the treatment of recent-onset human type 1 diabetes. Thus, systems-level analysis of the response to anti-CD3 in the early phase of the treatment demonstrates different responses in Tregs and Tconvs, and provides new leads to a mechanistic understanding of its mechanism of action in reverting recent-onset diabetes.

  11. UVB Induces a Genome-Wide Acting Negative Regulatory Mechanism That Operates at the Level of Transcription Initiation in Human Cells

    PubMed Central

    Gyenis, Ákos; Umlauf, David; Újfaludi, Zsuzsanna; Boros, Imre; Ye, Tao; Tora, Làszlò

    2014-01-01

    Faithful transcription of DNA is constantly threatened by different endogenous and environmental genotoxic effects. Transcription coupled repair (TCR) has been described to stop transcription and quickly remove DNA lesions from the transcribed strand of active genes, permitting rapid resumption of blocked transcription. This repair mechanism has been well characterized in the past using individual target genes. Moreover, numerous efforts investigated the fate of blocked RNA polymerase II (Pol II) during DNA repair mechanisms and suggested that stopped Pol II complexes can either backtrack, be removed and degraded or bypass the lesions to allow TCR. We investigated the effect of a non-lethal dose of UVB on global DNA-bound Pol II distribution in human cells. We found that the used UVB dose did not induce Pol II degradation however surprisingly at about 93% of the promoters of all expressed genes Pol II occupancy was seriously reduced 2–4 hours following UVB irradiation. The presence of Pol II at these cleared promoters was restored 5–6 hours after irradiation, indicating that the negative regulation is very dynamic. We also identified a small set of genes (including several p53 regulated genes), where the UVB-induced Pol II clearing did not operate. Interestingly, at promoters, where Pol II promoter clearance occurs, TFIIH, but not TBP, follows the behavior of Pol II, suggesting that at these genes upon UVB treatment TFIIH is sequestered for DNA repair by the TCR machinery. In agreement, in cells where the TCR factor, the Cockayne Syndrome B protein, was depleted UVB did not induce Pol II and TFIIH clearance at promoters. Thus, our study reveals a UVB induced negative regulatory mechanism that targets Pol II transcription initiation on the large majority of transcribed gene promoters, and a small subset of genes, where Pol II escapes this negative regulation. PMID:25058334

  12. Regulatory Dendritic Cells Restrain NK Cell IFN-γ Production through Mechanisms Involving NKp46, IL-10, and MHC Class I-Specific Inhibitory Receptors.

    PubMed

    Spallanzani, Raúl G; Torres, Nicolás I; Avila, Damián E; Ziblat, Andrea; Iraolagoitia, Ximena L Raffo; Rossi, Lucas E; Domaica, Carolina I; Fuertes, Mercedes B; Rabinovich, Gabriel A; Zwirner, Norberto W

    2015-09-01

    Cross-talk between mature dendritic cells (mDC) and NK cells through the cell surface receptors NKp30 and DNAM-1 leads to their reciprocal activation. However, the impact of regulatory dendritic cells (regDC) on NK cell function remains unknown. As regDC constrain the immune response in different physiological and pathological conditions, the aim of this work was to investigate the functional outcome of the interaction between regDC and NK cells and the associated underlying mechanisms. RegDC generated from monocyte-derived DC treated either with LPS and dexamethasone, vitamin D3, or vitamin D3 and dexamethasone instructed NK cells to secrete lower amounts of IFN-γ than NK cells exposed to mDC. Although regDC triggered upregulation of the activation markers CD69 and CD25 on NK cells, they did not induce upregulation of CD56 as mDC, and silenced IFN-γ secretion through mechanisms involving insufficient secretion of IL-18, but not IL-12 or IL-15 and/or induction of NK cell apoptosis. Blocking experiments demonstrated that regDC curb IFN-γ secretion by NK cells through a dominant suppressive mechanism involving IL-10, NK cell inhibitory receptors, and, unexpectedly, engagement of the activating receptor NKp46. Our findings unveil a previously unrecognized cross-talk through which regDC shape NK cell function toward an alternative activated phenotype unable to secrete IFN-γ, highlighting the plasticity of NK cells in response to tolerogenic stimuli. In addition, our findings contribute to identify a novel inhibitory role for NKp46 in the control of NK cell function, and have broad implications in the resolution of inflammatory responses and evasion of antitumor responses.

  13. Integrative Modeling of eQTLs and Cis-Regulatory Elements Suggests Mechanisms Underlying Cell Type Specificity of eQTLs

    PubMed Central

    Brown, Christopher D.; Mangravite, Lara M.; Engelhardt, Barbara E.

    2013-01-01

    Genetic variants in cis-regulatory elements or trans-acting regulators frequently influence the quantity and spatiotemporal distribution of gene transcription. Recent interest in expression quantitative trait locus (eQTL) mapping has paralleled the adoption of genome-wide association studies (GWAS) for the analysis of complex traits and disease in humans. Under the hypothesis that many GWAS associations tag non-coding SNPs with small effects, and that these SNPs exert phenotypic control by modifying gene expression, it has become common to interpret GWAS associations using eQTL data. To fully exploit the mechanistic interpretability of eQTL-GWAS comparisons, an improved understanding of the genetic architecture and causal mechanisms of cell type specificity of eQTLs is required. We address this need by performing an eQTL analysis in three parts: first we identified eQTLs from eleven studies on seven cell types; then we integrated eQTL data with cis-regulatory element (CRE) data from the ENCODE project; finally we built a set of classifiers to predict the cell type specificity of eQTLs. The cell type specificity of eQTLs is associated with eQTL SNP overlap with hundreds of cell type specific CRE classes, including enhancer, promoter, and repressive chromatin marks, regions of open chromatin, and many classes of DNA binding proteins. These associations provide insight into the molecular mechanisms generating the cell type specificity of eQTLs and the mode of regulation of corresponding eQTLs. Using a random forest classifier with cell specific CRE-SNP overlap as features, we demonstrate the feasibility of predicting the cell type specificity of eQTLs. We then demonstrate that CREs from a trait-associated cell type can be used to annotate GWAS associations in the absence of eQTL data for that cell type. We anticipate that such integrative, predictive modeling of cell specificity will improve our ability to understand the mechanistic basis of human complex phenotypic

  14. Honeybee Colony Thermoregulation – Regulatory Mechanisms and Contribution of Individuals in Dependence on Age, Location and Thermal Stress

    PubMed Central

    Stabentheiner, Anton; Kovac, Helmut; Brodschneider, Robert

    2010-01-01

    Honeybee larvae and pupae are extremely stenothermic, i.e. they strongly depend on accurate regulation of brood nest temperature for proper development (33–36°C). Here we study the mechanisms of social thermoregulation of honeybee colonies under changing environmental temperatures concerning the contribution of individuals to colony temperature homeostasis. Beside migration activity within the nest, the main active process is “endothermy on demand” of adults. An increase of cold stress (cooling of the colony) increases the intensity of heat production with thoracic flight muscles and the number of endothermic individuals, especially in the brood nest. As endothermy means hard work for bees, this eases much burden of nestmates which can stay ectothermic. Concerning the active reaction to cold stress by endothermy, age polyethism is reduced to only two physiologically predetermined task divisions, 0 to ∼2 days and older. Endothermic heat production is the job of bees older than about two days. They are all similarly engaged in active heat production both in intensity and frequency. Their active heat production has an important reinforcement effect on passive heat production of the many ectothermic bees and of the brood. Ectothermy is most frequent in young bees (<∼2 days) both outside and inside of brood nest cells. We suggest young bees visit warm brood nest cells not only to clean them but also to speed up flight muscle development for proper endothermy and foraging later in their life. Young bees inside brood nest cells mostly receive heat from the surrounding cell wall during cold stress, whereas older bees predominantly transfer heat from the thorax to the cell wall. Endothermic bees regulate brood comb temperature more accurately than local air temperature. They apply the heat as close to the brood as possible: workers heating cells from within have a higher probability of endothermy than those on the comb surface. The findings show that thermal

  15. Regulatory effect and mechanisms of carbon monoxide-releasing molecule II on hepatic energy metabolism in septic mice

    PubMed Central

    Liang, Feng; Cao, Jie; Qin, Wei-Ting; Wang, Xu; Qiu, Xue-Feng; Sun, Bing-Wei

    2014-01-01

    AIM: To investigate the possible mechanisms of exogenous carbon monoxide-releasing molecule II (CORM-2) intervention on hepatic energy metabolism in experimental sepsis. METHODS: Forty-eight C57BL/6 mice were randomly divided into four groups (n = 12): sham group; cecal ligation and puncture (CLP) group; CLP + CORM-2 group and CLP + iCORM-2 (inactive CORM-2) group. Survival rates were determined after 72 h. Twenty-four similarly treated mice (n = 6 in each group) were assayed for post-operative continuous blood glucose in the first 36 h. Thirty-six similarly treated mice (n = 9 in each group) underwent micro-positron emission tomography (PET) scanning after tail vein injection of 18F-fluorodeoxyglucose (FDG) 24 h after operation. Plasma and liver specimens were collected for assay of liver pathology, alanine transaminase (ALT) and aspartate transaminase (AST) activities. Hepatic glucokinase activity, lactic acid levels and mitochondrial swelling were also determined. RESULTS: Improved survival was observed in CORM-2 treated mice. Both the CLP and CLP + CORM-2 groups had sustained low blood glucose levels within the first post-operative 36 h. 18F-FDG micro-PET images showed abnormally high levels of hepatic glucose metabolism (standardized uptake value) in the CLP group (2.76 ± 0.39 vs 0.84 ± 0.14, P < 0.01), which declined to normal levels after CORM-2 intervention (1.29 ± 0.32 vs 2.76 ± 0.39, P < 0.05). glucokinase activity was markedly increased in the CLP group (6.38 ± 0.56 U/g vs 4.60 ± 0.21 U/g, P < 0.01), but was normal after CORM-2 intervention (4.74 ± 0.14 U/g vs 6.38 ± 0.56 U/g, P < 0.05). CORM-2 suppressed plasma lactic acid levels (4.02 ± 0.02 mmol/L vs 7.72 ± 2.37 mmol/L, P < 0.05) and protected hepatic mitochondria in CLP mice. CORM-2 intervention also reduced elevated plasma AST (199.67 ± 11.08 U/L vs 379.67 ± 16.34 U/L, P < 0.05) and ALT (63.67 ± 12.23 U/L vs 112.67 ± 9.74 U/L, P < 0.05) activities in CLP mice. CONCLUSION: The release

  16. Mapping the Sinorhizobium meliloti 1021 solute-binding protein-dependent transportome

    PubMed Central

    Mauchline, T. H.; Fowler, J. E.; East, A. K.; Sartor, A. L.; Zaheer, R.; Hosie, A. H. F.; Poole, P. S.; Finan, T. M.

    2006-01-01

    The number of solute-binding protein-dependent transporters in rhizobia is dramatically increased compared with the majority of other bacteria so far sequenced. This increase may be due to the high affinity of solute-binding proteins for solutes, permitting the acquisition of a broad range of growth-limiting nutrients from soil and the rhizosphere. The transcriptional induction of these transporters was studied by creating a suite of plasmid and integrated fusions to nearly all ATP-binding cassette (ABC) and tripartite ATP-independent periplasmic (TRAP) transporters of Sinorhizobium meliloti. In total, specific inducers were identified for 76 transport systems, amounting to ≈47% of the ABC uptake systems and 53% of the TRAP transporters in S. meliloti. Of these transport systems, 64 are previously uncharacterized in Rhizobia and 24 were induced by solutes not known to be transported by ABC- or TRAP-uptake systems in any organism. This study provides a global expression map of one of the largest transporter families (transportome) and an invaluable tool to both understand their solute specificity and the relationships between members of large paralogous families. PMID:17101990

  17. A multilayered regulatory mechanism for the autoinhibition and activation of a plant CC-NB-LRR resistance protein with an extra N-terminal domain.

    PubMed

    Chen, Xiaojiao; Zhu, Min; Jiang, Lei; Zhao, Wenyang; Li, Jia; Wu, Jianyan; Li, Chun; Bai, Baohui; Lu, Gang; Chen, Hongyu; Moffett, Peter; Tao, Xiaorong

    2016-10-01

    The tomato resistance protein Sw-5b differs from the classical coiled-coil nucleotide-binding leucine-rich repeat (CC-NB-LRR) resistance proteins by having an extra N-terminal domain (NTD). To understand how NTD, CC and NB-LRR regulate autoinhibition and activation of Sw-5b, we dissected the function(s) of each domain. When viral elicitor was absent, Sw-5b LRR suppressed the central NB-ARC to maintain autoinhibition of the NB-LRR segment. The CC and NTD domains independently and additively enhanced the autoinhibition of NB-LRR. When viral elicitor was present, the NB-LRR segment of Sw-5b was specifically activated to trigger a hypersensitive response. Surprisingly, Sw-5b CC suppressed the activation of NB-LRR, whereas the extra NTD of Sw-5b became a positive regulator and fully activated the resistance protein, probably by relieving the inhibitory effects of the CC. In infection assays of transgenic plants, the NB-LRR segment alone was insufficient to confer resistance against Tomato spotted wilt tospovirus; the layers of NTD and CC regulation on NB-LRR were required for Sw-5b to confer resistance. Based on these findings, we propose that, to counter the negative regulation of the CC on NB-LRR, Sw-5b evolved an extra NTD to coordinate with the CC, thus developing a multilayered regulatory mechanism to control autoinhibition and activation.

  18. Endotoxic shock-expanded murine CD11clowCD45RB+ regulatory dendritic cells modulate inflammatory T cell responses through multiple mechanisms

    PubMed Central

    Wang, Xiaoqian; Wang, Qingyang; Zhang, Xueying; Li, Yajing; Wang, Jingyang; Hou, Chunmei; Chen, Juan; Shen, Beifen; Shi, Yanchun; Zhang, Jiyan

    2015-01-01

    Changes in the number and function of dendritic cells (DCs) have been reported to play an important role in endotoxin tolerance. It has been reported that expansion of splenic CD11clowCD45RB+ DCs occurs in mice injected with sublethal doses of lipopolysaccharide (LPS). However, the function of endotoxic shock-expanded CD11clowCD45RB+ DCs has not been examined. In this work, we show that endotoxic shock promotes the expansion of CD11clowCD45RB+ cells with dendritic morphology and the production of low levels of inflammatory cytokines and costimulatory molecules. The expanded cells induce the generation of regulatory T cells (Tregs), show incapability to stimulate T cells, and induce apoptosis of CD4+ T cells in vitro. As compared to CD11chiCD45RB− conventional DCs, the expanded cells exert better protection against colitis induction by CD4+ CD25− T cells, even though both subpopulations show similar ability to induce Tregs in vivo. The better control of proinflammatory cytokine responses in vivo by the expanded cells is associated with more apoptosis in the Payer’s patches and in colonic tissue-infiltrating cells. Thus, the expanded cells can modulate inflammatory T cell responses through multiple mechanisms. Our study facilitates a better understanding how innate immune responses may shape adaptive immunity and immune suppression following LPS-induced acute inflammation. PMID:26024301

  19. Endotoxic shock-expanded murine CD11c low CD45RB + regulatory dendritic cells modulate inflammatory T cell responses through multiple mechanisms.

    PubMed

    Wang, Xiaoqian; Wang, Qingyang; Zhang, Xueying; Li, Yajing; Wang, Jingyang; Hou, Chunmei; Chen, Juan; Shen, Beifen; Shi, Yanchun; Zhang, Jiyan

    2015-05-29

    Changes in the number and function of dendritic cells (DCs) have been reported to play an important role in endotoxin tolerance. It has been reported that expansion of splenic CD11c(low)CD45RB(+) DCs occurs in mice injected with sublethal doses of lipopolysaccharide (LPS). However, the function of endotoxic shock-expanded CD11c(low)CD45RB(+) DCs has not been examined. In this work, we show that endotoxic shock promotes the expansion of CD11c(low)CD45RB(+) cells with dendritic morphology and the production of low levels of inflammatory cytokines and costimulatory molecules. The expanded cells induce the generation of regulatory T cells (Tregs), show incapability to stimulate T cells, and induce apoptosis of CD4(+) T cells in vitro. As compared to CD11c(hi)CD45RB(-) conventional DCs, the expanded cells exert better protection against colitis induction by CD4(+) CD25(-) T cells, even though both subpopulations show similar ability to induce Tregs in vivo. The better control of proinflammatory cytokine responses in vivo by the expanded cells is associated with more apoptosis in the Payer's patches and in colonic tissue-infiltrating cells. Thus, the expanded cells can modulate inflammatory T cell responses through multiple mechanisms. Our study facilitates a better understanding how innate immune responses may shape adaptive immunity and immune suppression following LPS-induced acute inflammation.

  20. Stable Suppression of Lactate Dehydrogenase Activity during Anoxia in the Foot Muscle of Littorina littorea and the Potential Role of Acetylation as a Novel Posttranslational Regulatory Mechanism.

    PubMed

    Shahriari, Ali; Dawson, Neal J; Bell, Ryan A V; Storey, Kenneth B

    2013-01-01

    The intertidal marine snail, Littorina littorea, has evolved to withstand extended bouts of oxygen deprivation brought about by changing tides or other potentially harmful environmental conditions. Survival is dependent on a strong suppression of its metabolic rate and a drastic reorganization of its cellular biochemistry in order to maintain energy balance under fixed fuel reserves. Lactate dehydrogenase (LDH) is a crucial enzyme of anaerobic metabolism as it is typically responsible for the regeneration of NAD(+), which allows for the continued functioning of glycolysis in the absence of oxygen. This study compared the kinetic and structural characteristics of the D-lactate specific LDH (E.C. 1.1.1.28) from foot muscle of aerobic control versus 24 h anoxia-exposed L. littorea. Anoxic LDH displayed a near 50% decrease in V max (pyruvate-reducing direction) as compared to control LDH. These kinetic differences suggest that there may be a stable modification and regulation of LDH during anoxia, and indeed, subsequent dot-blot analyses identified anoxic LDH as being significantly less acetylated than the corresponding control enzyme. Therefore, acetylation may be the regulatory mechanism that is responsible for the suppression of LDH activity during anoxia, which could allow for the production of alternative glycolytic end products that in turn would increase the ATP yield under fixed fuel reserves.

  1. The mechanism of potent GTP cyclohydrolase I inhibition by 2,4-diamino-6-hydroxypyrimidine: requirement of the GTP cyclohydrolase I feedback regulatory protein.

    PubMed

    Kolinsky, Monica A; Gross, Steven S

    2004-09-24

    Inhibition of GTP cyclohydrolase I (GTPCH) has been used as a selective tool to assess the role of de novo synthesis of (6R)-5,6,7,8-tetrahydro-L-biopterin (BH4) in a biological system. Toward this end, 2,4-diamino-6-hydroxypyrimidine (DAHP) has been used as the prototypical GTPCH inhibitor. Using a novel real-time kinetic microplate assay for GTPCH activity and purified prokaryote-expressed recombinant proteins, we show that potent inhibition by DAHP is not the result of a direct interaction with GTPCH. Rather, inhibition by DAHP in phosphate buffer occurs via an indirect mechanism that requires the presence of GTPCH feedback regulatory protein (GFRP). Notably, GFRP was previously discovered as the essential factor that reconstitutes inhibition of pure recombinant GTPCH by the pathway end product BH4. Thus, DAHP inhibits GTPCH by engaging the endogenous feedback inhibitory system. We further demonstrate that L-Phe fully reverses the inhibition of GTPCH by DAHP/GFRP, which is also a feature in common with inhibition by BH4/GFRP. These findings suggest that DAHP is not an indiscriminate inhibitor of GTPCH in biological systems; instead, it is predicted to preferentially attenuate GTPCH activity in cells that most abundantly express GFRP and/or contain the lowest levels of L-Phe.

  2. The control of actin nucleotide exchange by thymosin beta 4 and profilin. A potential regulatory mechanism for actin polymerization in cells.

    PubMed Central

    Goldschmidt-Clermont, P J; Furman, M I; Wachsstock, D; Safer, D; Nachmias, V T; Pollard, T D

    1992-01-01

    We present evidence for a new mechanism by which two major actin monomer binding proteins, thymosin beta 4 and profilin, may control the rate and the extent of actin polymerization in cells. Both proteins bind actin monomers transiently with a stoichiometry of 1:1. When bound to actin, thymosin beta 4 strongly inhibits the exchange of the nucleotide bound to actin by blocking its dissociation, while profilin catalytically promotes nucleotide exchange. Because both proteins exchange rapidly between actin molecules, low concentrations of profilin can overcome the inhibitory effects of high concentrations of thymosin beta 4 on the nucleotide exchange. These reactions may allow variations in profilin concentration (which may be regulated by membrane polyphosphoinositide metabolism) to control the ratio of ATP-actin to ADP-actin. Because ATP-actin subunits polymerize more readily than ADP-actin subunits, this ratio may play a key regulatory role in the assembly of cellular actin structures, particularly under circumstances of rapid filament turnover. Images PMID:1330091

  3. Dissection of the regulatory mechanism of a heat-shock responsive promoter in Haloarchaea: a new paradigm for general transcription factor directed archaeal gene regulation

    PubMed Central

    Lu, Qiuhe; Han, Jing; Zhou, Ligang; Coker, James A.; DasSarma, Priya; DasSarma, Shiladitya; Xiang, Hua

    2008-01-01

    Multiple general transcription factors (GTFs), TBP and TFB, are present in many haloarchaea, and are deemed to accomplish global gene regulation. However, details and the role of GTF-directed transcriptional regulation in stress response are still not clear. Here, we report a comprehensive investigation of the regulatory mechanism of a heat-induced gene (hsp5) from Halobacterium salinarum. We demonstrated by mutation analysis that the sequences 5′ and 3′ to the core elements (TATA box and BRE) of the hsp5 promoter (Phsp5) did not significantly affect the basal and heat-induced gene expression, as long as the transcription initiation site was not altered. Moreover, the BRE and TATA box of Phsp5 were sufficient to render a nonheat-responsive promoter heat-inducible, in both Haloferax volcanii and Halobacterium sp. NRC-1. DNA–protein interactions revealed that two heat-inducible GTFs, TFB2 from H. volcanii and TFBb from Halobacterium sp. NRC-1, could specifically bind to Phsp5 likely in a temperature-dependent manner. Taken together, the heat-responsiveness of Phsp5 was mainly ascribed to the core promoter elements that were efficiently recognized by specific heat-induced GTFs at elevated temperature, thus providing a new paradigm for GTF-directed gene regulation in the domain of Archaea. PMID:18390887

  4. Stable Suppression of Lactate Dehydrogenase Activity during Anoxia in the Foot Muscle of Littorina littorea and the Potential Role of Acetylation as a Novel Posttranslational Regulatory Mechanism

    PubMed Central

    Shahriari, Ali; Dawson, Neal J.; Bell, Ryan A. V.; Storey, Kenneth B.

    2013-01-01

    The intertidal marine snail, Littorina littorea, has evolved to withstand extended bouts of oxygen deprivation brought about by changing tides or other potentially harmful environmental conditions. Survival is dependent on a strong suppression of its metabolic rate and a drastic reorganization of its cellular biochemistry in order to maintain energy balance under fixed fuel reserves. Lactate dehydrogenase (LDH) is a crucial enzyme of anaerobic metabolism as it is typically responsible for the regeneration of NAD+, which allows for the continued functioning of glycolysis in the absence of oxygen. This study compared the kinetic and structural characteristics of the D-lactate specific LDH (E.C. 1.1.1.28) from foot muscle of aerobic control versus 24 h anoxia-exposed L. littorea. Anoxic LDH displayed a near 50% decrease in Vmax (pyruvate-reducing direction) as compared to control LDH. These kinetic differences suggest that there may be a stable modification and regulation of LDH during anoxia, and indeed, subsequent dot-blot analyses identified anoxic LDH as being significantly less acetylated than the corresponding control enzyme. Therefore, acetylation may be the regulatory mechanism that is responsible for the suppression of LDH activity during anoxia, which could allow for the production of alternative glycolytic end products that in turn would increase the ATP yield under fixed fuel reserves. PMID:24233354

  5. Selective IL-2 responsiveness of regulatory T cells through multiple intrinsic mechanisms supports the use of low-dose IL-2 therapy in type 1 diabetes.

    PubMed

    Yu, Aixin; Snowhite, Isaac; Vendrame, Francesco; Rosenzwajg, Michelle; Klatzmann, David; Pugliese, Alberto; Malek, Thomas R

    2015-06-01

    Low-dose interleukin-2 (IL-2) inhibited unwanted immune responses in several clinical settings and is currently being tested in patients with type 1 diabetes (T1D). Low-dose IL-2 selectively targets regulatory T cells (Tregs), but the mechanisms underlying this selectivity are poorly understood. We show that IL-2-dependent STAT5 activation in Tregs from healthy individuals and patients with T1D occurred at an ∼10-fold lower concentration of IL-2 than that required by T memory (TM) cells or by in vitro-activated T cells. This selective Treg responsiveness is explained by their higher expression of IL-2 receptor subunit α (IL-2Rα) and γ chain and also endogenous serine/threonine phosphatase protein phosphates 1 and/or 2A activity. Genome-wide profiling identified an IL-2-dependent transcriptome in human Tregs. Quantitative assessment of selected targets indicated that most were optimally activated by a 100-fold lower concentration of IL-2 in Tregs versus CD4(+) TM cells. Two such targets were selectively increased in Tregs from T1D patients undergoing low-dose IL-2 therapy. Thus, human Tregs possess an IL-2-dependent transcriptional amplification mechanism that widens their selective responses to low IL-2. Our findings support a model where low-dose IL-2 selectively activates Tregs to broadly induce their IL-2/IL-2R gene program and provide a molecular underpinning for low-dose IL-2 therapy to enhance Tregs for immune tolerance in T1D. © 2015 by the American Diabetes Association. Readers may use this article as long as the work is properly cited, the use is educational and not for profit, and the work is not altered.

  6. Evolutionarily conserved regulatory mechanisms of abscisic acid signaling in land plants: characterization of ABSCISIC ACID INSENSITIVE1-like type 2C protein phosphatase in the liverwort Marchantia polymorpha.

    PubMed

    Tougane, Ken; Komatsu, Kenji; Bhyan, Salma Begum; Sakata, Yoichi; Ishizaki, Kimitsune; Yamato, Katsuyuki T; Kohchi, Takayuki; Takezawa, Daisuke

    2010-03-01

    Abscisic acid (ABA) is postulated to be a ubiquitous hormone that plays a central role in seed development and responses to environmental stresses of vascular plants. However, in liverworts (Marchantiophyta), which represent the oldest extant lineage of land plants, the role of ABA has been least emphasized; thus, very little information is available on the molecular mechanisms underlying ABA responses. In this study, we isolated and characterized MpABI1, an ortholog of ABSCISIC ACID INSENSITIVE1 (ABI1), from the liverwort Marchantia polymorpha. The MpABI1 cDNA encoded a 568-amino acid protein consisting of the carboxy-terminal protein phosphatase 2C (PP2C) domain and a novel amino-terminal regulatory domain. The MpABI1 transcript was detected in the gametophyte, and its expression level was increased by exogenous ABA treatment in the gemma, whose growth was strongly inhibited by ABA. Experiments using green fluorescent protein fusion constructs indicated that MpABI1 was mainly localized in the nucleus and that its nuclear localization was directed by the amino-terminal domain. Transient overexpression of MpABI1 in M. polymorpha and Physcomitrella patens cells resulted in suppression of ABA-induced expression of the wheat Em promoter fused to the beta -glucuronidase gene. Transgenic P. patens expressing MpABI1 and its mutant construct, MpABI1-d2, lacking the amino-terminal domain, had reduced freezing and osmotic stress tolerance, and associated with reduced accumulation of ABA-induced late embryogenesis abundant-like boiling-soluble proteins. Furthermore, ABA-induced morphological changes leading to brood cells were not prominent in these transgenic plants. These results suggest that MpABI1 is a negative regulator of ABA signaling, providing unequivocal molecular evidence of PP2C-mediated ABA response mechanisms functioning in liverworts.

  7. Cadmium-induced malignant transformation of rat liver cells: Potential key role and regulatory mechanism of altered apolipoprotein E expression in enhanced invasiveness.

    PubMed

    Suzuki, Masayo; Takeda, Shuso; Teraoka-Nishitani, Noriko; Yamagata, Akane; Tanaka, Takahiro; Sasaki, Marika; Yasuda, Natsuki; Oda, Makiko; Okano, Tatsuji; Yamahira, Kazuhiro; Nakamura, Yuta; Kobayashi, Takanobu; Kino, Katsuhito; Miyazawa, Hiroshi; Waalkes, Michael P; Takiguchi, Masufumi

    2017-05-01

    Cadmium is a transition metal that is classified as human carcinogen by the International Agency for Research on Cancer (IARC) with multiple target sites. Many studies using various model systems provide evidence of cadmium-induced malignancy formation in vivo or malignant cell transformation in vitro. Nonetheless, further studies are needed to completely understand the mechanisms of cadmium carcinogenicity. Our prior studies have utilized a rat liver epithelial cell line (TRL 1215) as a model for cadmium-induced malignant transformation. In the present study, we focused on the molecular mechanisms of this malignant transformation, especially with regard to hyper-invasiveness stimulated by cadmium transformation. By performing a series of biochemical analyses on cadmium transformed cells, it was determined that cadmium had significantly down-regulated the expression of apolipoprotein E (ApoE). ApoE was recently established as a suppressor of cell invasion. A key factor in the suppression of ApoE by cadmium appeared to be that the metal evoked a 5-aza-2'-deoxycytidine-sensitive hypermethylation of the regulatory region of ApoE, coupled with interference of the action of liver X receptor α (LXRα), a transcriptional regulator for ApoE. Furthermore, the expression of LXRα itself was suppressed by cadmium-mediated epigenetic modification. Re-expression of ApoE clearly abrogated the cell invasion stimulated by cadmium-induced malignant transformation. Together, the current results suggest that the cadmium-mediated enhanced cell invasion is linked to down-regulation of ApoE during malignant transformation these liver cells. Copyright © 2017 Elsevier B.V. All rights reserved.

  8. Mutually exclusive splicing regulates the Nav 1.6 sodium channel function through a combinatorial mechanism that involves three distinct splicing regulatory elements and their ligands

    PubMed Central

    Zubović, Lorena; Baralle, Marco; Baralle, Francisco E.

    2012-01-01

    Mutually exclusive splicing is a form of alternative pre-mRNA processing that consists in the use of only one of a set of two or more exons. We have investigated the mechanisms involved in this process for exon 18 of the Nav 1.6 sodium channel transcript and its significance regarding gene-expression regulation. The 18N exon (neonatal form) has a stop codon in phase and although the mRNA can be detected by amplification methods, the truncated protein has not been observed. The switch from 18N to 18A (adult form) occurs only in a restricted set of neural tissues producing the functional channel while other tissues display the mRNA with the 18N exon also in adulthood. We demonstrate that the mRNA species carrying the stop codon is subjected to Nonsense-Mediated Decay, providing a control mechanism of channel expression. We also map a string of cis-elements within the mutually exclusive exons and in the flanking introns responsible for their strict tissue and temporal specificity. These elements bind a series of positive (RbFox-1, SRSF1, SRSF2) and negative (hnRNPA1, PTB, hnRNPA2/B1, hnRNPD-like JKTBP) splicing regulatory proteins. These splicing factors, with the exception of RbFox-1, are ubiquitous but their levels vary during development and differentiation, ensuing unique sets of tissue and temporal levels of splicing factors. The combinatorial nature of these elements is highlighted by the dominance of the elements that bind the ubiquitous factors over the tissue specific RbFox-1. PMID:22434879

  9. REGULATORY MECHANISMS OF CELLULAR RESPIRATION

    PubMed Central

    Barron, E. S. Guzman; Nelson, Leonard; Ardao, Maria Isabel

    1948-01-01

    Oxidizing agents of sulfhydryl groups such as iodosobenzoate, alkylating agents such as iodoacetamide, and mercaptide-forming agents such as cadmium chloride, mercuric chloride, p-chloromercuribenzoate, sodium arsenite, and p-carboxyphenylarsine oxide, added in small concentrations to a suspension of sea urchin sperm produced an increase in respiration. When the concentration was increased there was an inhibition. These effects are explained by postulating the presence in the cells of two kinds of sulfhydryl groups: soluble sulfhydryl groups, which regulate cellular respiration, and fixed sulfhydryl groups, present in the protein moiety of enzymes. Small concentrations of sulfhydryl reagents combine only with the first, thus producing an increase in respiration; when the concentration is increased, the fixed sulfhydryl groups are also attacked and inhibition of respiration is the consequence. Other inhibitors of cell respiration, such as cyanide and urethanes, which do not combine with —SH groups, did not stimulate respiration in small concentration. PMID:18891144

  10. [Regulatory mechanism of calcium metabolism.

    PubMed

    Ozono, Keiichi

    It is often difficult for terrestrial animals to take enough calcium. To maintain serum or extracellular calcium levels is very important for muscle and nerve function. Two major regulators to increase the serum calcium levels are parathyroid hormone(PTH)and vitamin D. PTH binds to the G protein coupling receptor, PTH1R, and increases intracellular cAMP levels. Impirement in the PTH signalling causes many diseases such as pseudohypoparathyroidism and acrodysostosis with hormone resistance. Vitamin D is activated to 1,25-dihydroxyvitamin D[1,25(OH)2D]by two steps of hydroxylation which occurs in the Liver and Kidney. Then, 1,25(OH)2D binds to vitamin D receptor(VDR), which works as a ligand-dependent transcription factor. Hypocalcemia and hypercalcemia are caused by various disorders including abnormal regulation of PTH and vitamin D production and their signal transduction.

  11. Contribution of endoplasmic reticulum Ca2+ regulatory mechanisms to the inflammation-induced increase in the evoked Ca2+ transient in rat cutaneous dorsal root ganglion neurons

    PubMed Central

    Scheff, Nicole N.; Lu, Shao-Gang; Gold, Michael S.

    2013-01-01

    Persistent inflammation results in an increase in the magnitude and duration of high K+-evoked Ca2+ transients in putative nociceptive cutaneous dorsal root ganglion (DRG) neurons. The purpose of the present study was to determine whether recruitment of Ca2+-induced Ca2+ release (CICR) contributes to these inflammation-induced changes. Acutely dissociated, retrogradely labeled cutaneous DRG neurons from naïve and complete Freund’s adjuvant inflamed adult male Sprague Dawley rats were studied with ratiometric microfluorimetry. Ryanodine only attenuated the duration but not magnitude of the high K+-evoked Ca2+ transient in neurons from inflamed rats. However, there was no significant impact of inflammation on the potency or efficacy of ryanodine-induced block of the caffeine-evoked Ca2+ transient, or the impact of sarco-endoplasmic reticulum ATPase (SERCA) inhibition on the high K+-evoked Ca2+ transient. Furthermore, while there was no change in the magnitude, an inflammation-induced increase in the duration of the caffeine-evoked Ca2+ transient was only observed with a prolonged caffeine application. In contrast to the high K+-evoked Ca2+ transient, there was no evidence of direct mitrochondrial involvement or that of the Ca2+ extrusion mechanism, the Na+/Ca2+ exchanger, on the caffeine-evoked Ca2+ transient, and block of SERCA only increased the duration of this transient. These results indicate the presence of Ca2+ regulatory domains in cutaneous nociceptive DRG neurons within which cytosolic Ca2+ increased via influx and release are highly segregated. Furthermore, our results suggest that changes in neither CICR machinery nor the coupling between Ca2+ influx and CICR are primarily responsible for the inflammation-induced changes in the evoked Ca2+ transient. PMID:23642703

  12. Mathematical Model of a Telomerase Transcriptional Regulatory Network Developed by Cell-Based Screening: Analysis of Inhibitor Effects and Telomerase Expression Mechanisms

    PubMed Central

    Bilsland, Alan E.; Stevenson, Katrina; Liu, Yu; Hoare, Stacey; Cairney, Claire J.; Roffey, Jon; Keith, W. Nicol

    2014-01-01

    Cancer cells depend on transcription of telomerase reverse transcriptase (TERT). Many transcription factors affect TERT, though regulation occurs in context of a broader network. Network effects on telomerase regulation have not been investigated, though deeper understanding of TERT transcription requires a systems view. However, control over individual interactions in complex networks is not easily achievable. Mathematical modelling provides an attractive approach for analysis of complex systems and some models may prove useful in systems pharmacology approaches to drug discovery. In this report, we used transfection screening to test interactions among 14 TERT regulatory transcription factors and their respective promoters in ovarian cancer cells. The results were used to generate a network model of TERT transcription and to implement a dynamic Boolean model whose steady states were analysed. Modelled effects of signal transduction inhibitors successfully predicted TERT repression by Src-family inhibitor SU6656 and lack of repression by ERK inhibitor FR180204, results confirmed by RT-QPCR analysis of endogenous TERT expression in treated cells. Modelled effects of GSK3 inhibitor 6-bromoindirubin-3′-oxime (BIO) predicted unstable TERT repression dependent on noise and expression of JUN, corresponding with observations from a previous study. MYC expression is critical in TERT activation in the model, consistent with its well known function in endogenous TERT regulation. Loss of MYC caused complete TERT suppression in our model, substantially rescued only by co-suppression of AR. Interestingly expression was easily rescued under modelled Ets-factor gain of function, as occurs in TERT promoter mutation. RNAi targeting AR, JUN, MXD1, SP3, or TP53, showed that AR suppression does rescue endogenous TERT expression following MYC knockdown in these cells and SP3 or TP53 siRNA also cause partial recovery. The model therefore successfully predicted several aspects of TERT

  13. Exploring Regulatory Mechanisms of Atrial Myocyte Hypertrophy of Mitral Regurgitation through Gene Expression Profiling Analysis: Role of NFAT in Cardiac Hypertrophy

    PubMed Central

    Chang, Tzu-Hao; Chen, Mien-Cheng; Chang, Jen-Ping; Huang, Hsien-Da; Ho, Wan-Chun; Lin, Yu-Sheng; Pan, Kuo-Li; Huang, Yao-Kuang; Liu, Wen-Hao; Wu, Chia-Chen

    2016-01-01

    Background Left atrial enlargement in mitral regurgitation (MR) predicts a poor prognosis. The regulatory mechanisms of atrial myocyte hypertrophy of MR patients remain unknown. Methods and Results This study comprised 14 patients with MR, 7 patients with aortic valve disease (AVD), and 6 purchased samples from normal subjects (NC). We used microarrays, enrichment analysis and quantitative RT-PCR to study the gene expression profiles in the left atria. Microarray results showed that 112 genes were differentially up-regulated and 132 genes were differentially down-regulated in the left atria between MR patients and NC. Enrichment analysis of differentially expressed genes demonstrated that “NFAT in cardiac hypertrophy” pathway was not only one of the significant associated canonical pathways, but also the only one predicted with a non-zero score of 1.34 (i.e. activated) through Ingenuity Pathway Analysis molecule activity predictor. Ingenuity Pathway Analysis Global Molecular Network analysis exhibited that the highest score network also showed high association with cardiac related pathways and functions. Therefore, 5 NFAT associated genes (PPP3R1, PPP3CB, CAMK1, MEF2C, PLCE1) were studies for validation. The mRNA expressions of PPP3CB and MEF2C were significantly up-regulated, and CAMK1 and PPP3R1 were significantly down-regulated in MR patients compared to NC. Moreover, MR patients had significantly increased mRNA levels of PPP3CB, MEF2C and PLCE1 compared to AVD patients. The atrial myocyte size of MR patients significantly exceeded that of the AVD patients and NC. Conclusions Differentially expressed genes in the “NFAT in cardiac hypertrophy” pathway may play a critical role in the atrial myocyte hypertrophy of MR patients. PMID:27907007

  14. Analysis of tomato plasma membrane H(+)-ATPase gene family suggests a mycorrhiza-mediated regulatory mechanism conserved in diverse plant species.

    PubMed

    Liu, Junli; Liu, Jianjian; Chen, Aiqun; Ji, Minjie; Chen, Jiadong; Yang, Xiaofeng; Gu, Mian; Qu, Hongye; Xu, Guohua

    2016-10-01

    In plants, the plasma membrane H(+)-ATPase (HA) is considered to play a crucial role in regulating plant growth and respoding to environment stresses. Multiple paralogous genes encoding different isozymes of HA have been identified and characterized in several model plants, while limited information of the HA gene family is available to date for tomato. Here, we describe the molecular and expression features of eight HA-encoding genes (SlHA1-8) from tomato. All these genes are interrupted by multiple introns with conserved positions. SlHA1, 2, and 4 were widely expressed in all tissues, while SlHA5, 6, and 7 were almost only expressed in flowers. SlHA8, the transcripts of which were barely detectable under normal or nutrient-/salt-stress growth conditions, was strongly activated in arbuscular mycorrhizal (AM) fungal-colonized roots. Extreme lack of SlHA8 expression in M161, a mutant defective to AM fungal colonization, provided genetic evidence towards the dependence of its expression on AM symbiosis. A 1521-bp SlHA8 promoter could direct the GUS reporter expression specifically in colonized cells of transgenic tobacco, soybean, and rice mycorrhizal roots. Promoter deletion assay revealed a 223-bp promoter fragment of SlHA8 containing a variant of AM-specific cis-element MYCS (vMYCS) sufficient to confer the AM-induced activity. Targeted deletion of this motif in the corresponding promoter region causes complete abolishment of GUS staining in mycorrhizal roots. Together, these results lend cogent evidence towards the evolutionary conservation of a potential regulatory mechanism mediating the activation of AM-responsive HA genes in diverse mycorrhizal plant species.

  15. Rab27a negatively regulates CFTR chloride channel function in colonic epithelia: Involvement of the effector proteins in the regulatory mechanism

    SciTech Connect

    Saxena, Sunil K. . E-mail: ssaxena@stevens.edu; Kaur, Simarna

    2006-07-21

    Cystic fibrosis, an autosomal recessive disorder, is caused by the disruption of biosynthesis or function of CFTR. CFTR regulatory mechanisms include channel transport to plasma membrane and protein-protein interactions. Rab proteins are small GTPases involved in vesicle transport, docking, and fusion. The colorectal epithelial HT-29 cells natively express CFTR and respond to cAMP with an increase in CFTR-mediated currents. DPC-inhibited currents could be completely eliminated with CFTR-specific SiRNA. Over-expression of Rab27a inhibited, while isoform specific SiRNA and Rab27a antibody stimulated CFTR-mediated currents in HT-29 cells. CFTR activity is inhibited both by Rab27a (Q78L) (constitutive active GTP-bound form of Rab27a) and Rab27a (T23N) (constitutive negative form that mimics the GDP-bound form). Rab27a mediated effects could be reversed by Rab27a-binding proteins, the synaptotagmin-like protein (SLP-5) and Munc13-4 accessory protein (a putative priming factor for exocytosis). The SLP reversal of Rab27a effect was restricted to C2A/C2B domains while the SHD motif imparted little more inhibition. The CFTR-mediated currents remain unaffected by Rab3 though SLP-5 appears to weakly bind it. The immunoprecipitation experiments suggest protein-protein interactions between Rab27a and CFTR. Rab27a appears to impair CFTR appearance at the cell surface by trapping CFTR in the intracellular compartments. Munc13-4 and SLP-5, on the other hand, limit Rab27a availability to CFTR, thus minimizing its effect on channel function. These observations decisively prove that Rab27a is involved in CFTR channel regulation through protein-protein interactions involving Munc13-4 and SLP-5 effector proteins, and thus could be a potential target for cystic fibrosis therapy.

  16. Regulatory mechanism of the light-activable allosteric switch LOV-TAP for the control of DNA binding: a computer simulation study.

    PubMed

    Peter, Emanuel; Dick, Bernhard; Baeurle, Stephan A

    2013-03-01

    The spatio-temporal control of gene expression is fundamental to elucidate cell proliferation and deregulation phenomena in living systems. Novel approaches based on light-sensitive multiprotein complexes have recently been devised, showing promising perspectives for the noninvasive and reversible modulation of the DNA-transcriptional activity in vivo. This has lately been demonstrated in a striking way through the generation of the artificial protein construct light-oxygen-voltage (LOV)-tryptophan-activated protein (TAP), in which the LOV-2-Jα photoswitch of phototropin1 from Avena sativa (AsLOV2-Jα) has been ligated to the tryptophan-repressor (TrpR) protein from Escherichia coli. Although tremendous progress has been achieved on the generation of such protein constructs, a detailed understanding of their functioning as opto-genetical tools is still in its infancy. Here, we elucidate the early stages of the light-induced regulatory mechanism of LOV-TAP at the molecular level, using the noninvasive molecular dynamics simulation technique. More specifically, we find that Cys450-FMN-adduct formation in the AsLOV2-Jα-binding pocket after photoexcitation induces the cleavage of the peripheral Jα-helix from the LOV core, causing a change of its polarity and electrostatic attraction of the photoswitch onto the DNA surface. This goes along with the flexibilization through unfolding of a hairpin-like helix-loop-helix region interlinking the AsLOV2-Jα- and TrpR-domains, ultimately enabling the condensation of LOV-TAP onto the DNA surface. By contrast, in the dark state the AsLOV2-Jα photoswitch remains inactive and exerts a repulsive electrostatic force on the DNA surface. This leads to a distortion of the hairpin region, which finally relieves its tension by causing the disruption of LOV-TAP from the DNA. Copyright © 2012 Wiley Periodicals, Inc.

  17. The Functional and Regulatory Mechanisms of the Thellungiella salsuginea Ascorbate Peroxidase 6 (TsAPX6) in Response to Salinity and Water Deficit Stresses.

    PubMed

    Li, Zeqin; Zhang, Jilong; Li, Jingxiao; Li, Hongjie; Zhang, Genfa

    2016-01-01

    Soil salinization is a resource and ecological problem in the world. Thellungiella salsuginea is becoming a new model plant because it resembles its relative species, Arabidopsis thaliana, in small genome and short life cycle. It is highly tolerant to salinity and drought stresses. Ascorbate peroxidase (APX) is an enzyme that clears H2O2 in plants. The function and molecular and regulation mechanisms of APX in T. salsuginea have rarely been reported. In this study, an APX gene, TsApx6, was cloned from T. salsuginea and its responses to abiotic stresses in transgenic Arabidopsis were studied. Under high salinity treatment, the expression of TsApx6 was significantly induced. Under drought treatment, overexpression of TsApx6 increased the survival rate and reduced leaf water loss rate in Arabidopsis. Compared to the wild type plants, high salinity treatment reduced the concentrations of MDA, H2O2 and proline but elevated the activities of APX, GPX, CAT and SOD in the TsApx6-overexpressing plants. Meanwhile, germination rate, cotyledon greening, and root length were improved in the transgenic plants compared to the wild type plants under salt and water deficit conditions. Based on these findings, TsApx6 has an important function in the resistance of plants to certain abiotic stresses. The TsApx6 promoter sequence was obtained using Genome Walking technology. Bioinformatics analysis indicated that it contains some cis-acting elements related to stress response. The treatments of salt, dehydration, and ABA induced the expression of Gus gene under the regulation of the TsApx6 promoter. Mutation analysis showed that the MBS motif present in the TsApx6 promoter might be a key negative regulatory element which has an important effect on the growth and developmental process of plants.

  18. Cognitive regulatory control therapies.

    PubMed

    Bowins, Brad

    2013-01-01

    Cognitive regulatory control processes play an essential but typically unappreciated role in maintaining mental health. The purpose of the current paper is to identify this role and demonstrate how cognitive-behavioral and related techniques can compensate for impairments. Impaired cognitive regulation contributes to the overly intense emotional states present in anxiety disorders, depression, and personality disorders; progression of adaptive hypomania to mania; expression of psychosis in the conscious and awake state; dominance of immature defense mechanisms in borderline and other personality disorders. A wide variety of standard (monitoring, reappraisal, response inhibition, relaxation training) and more novel (suppression therapy, willful detachment, cost-benefit analysis, normalization, mature defense mechanism training) cognitive-behavioral and related techniques can be applied to compensate for cognitive regulatory control impairments, and their success probably aligns with this capacity.

  19. [On improvement of the mechanism for establishing and changing indicators of quality and food safety in the regulatory and legal acts of the Eurasian Economical Union].

    PubMed

    Arnautov, O V

    2016-01-01

    In accordance with the Treaty on the Eurasian Economic Union (EAEU) to ensure the sanitary and epidemiological welfare of the population within the Union, a coordinated policy in agreed policy in the sphere of application of sanitary measures is carried out. Sanitary measures are the obligatory requirements and procedures, including requirements for the final product, processing methods, production, transportation, storage and disposal, sampling procedures, methods of research (tests), risk assessment, the state registration, requirements for packaging directly aimed at ensuring the safety of products (goods) in order to protect human welfare, and they should be applied on the basis having a scientific explanation, and only to the extent that is necessary to protect human welfare. Sanitary measures applied within the Union should be based on international and regional standards, guidelines and (or) the recommendations, except when they based on appropriate scientific studies and explanations. In this case sanitary measures which could provide a higher level of sanitary protection are introduced. At present, the mechanism of the development, justification and approval of common sanitary and epidemiological requirements (ESR) and procedures of the Eurasian Economic Commission (the Commission) is not installed. The absence of a clear mechanism for the development, approval and implementation of the ESR to the products (goods) on the basis having a scientific explanation on the one hand could lead to the creation of unjustified barriers to foreign and mutual trade, on the other--to weaken the level of safety for human life and health of products (goods) placed on markets of the Union. In order to bring the regulatory legal acts of the Customs Union in accordance with the Treaty on the Eurasian Economic Union the Commission in cooperation with the competent authorities of the Member States in the field of sanitary and epidemiological welfare developed the project of

  20. Regulatory Forum.

    PubMed

    Peden, W Michael

    2016-12-01

    Revision of the International Council for Harmonization (ICH) S1 guidance for rat carcinogenicity studies to be more selective of compounds requiring a 2-year rat carcinogenicity study has been proposed following extensive evaluation of rat carcinogenicity and chronic toxicity studies by industry and drug regulatory authorities. To inform the ICH S1 expert working group in their potential revision of ICH S1, a prospective evaluation study was initiated in 2013, in which sponsors would assess the pharmacologic and toxicologic findings present in the chronic toxicity studies and predict a positive or negative carcinogenicity outcome using a weight of evidence argument (a carcinogenicity assessment document [CAD]). The Scientific and Regulatory Policy Committee was asked by the Society of Toxicology Pathology (STP) executive committee to track these changes with ICH S1 and inform the STP membership of status changes. This commentary is intended to provide a brief summary of recent changes to the CAD guidance and highlight the importance of STP membership participation in the process of CAD submissions.

  1. Expression of Proinflammatory and Regulatory Cytokines via NF-κB and MAPK-Dependent and IFN Regulatory Factor-3-Independent Mechanisms in Human Primary Monocytes Infected by Mycobacterium tuberculosis

    PubMed Central

    Giacomini, Elena; Remoli, Maria Elena; Scandurra, Marta; Gafa, Valérie; Pardini, Manuela; Fattorini, Lanfranco; Coccia, Eliana M.

    2011-01-01

    Knowledge of the molecular events regulating the innate response to Mycobacterium tuberculosis (Mtb) is critical for understanding immunological pathogenesis and protection from tuberculosis. To this aim, the regulation and the expression of regulatory and proinflammatory cytokines were investigated in human primary monocytes upon Mtb infection. We found that Mtb-infected monocytes preferentially express a proinflammatory cytokine profile, including IL-6, TNF-α, and IL-1β. Conversely, among the regulatory cytokines, Mtb elicited IL-10 and IL-23 release while no expression of IL-12p70, IL-27, and IFN-β was observed. The analysis of the signalling pathways leading to this selective cytokine expression showed that in monocytes Mtb activates MAPK and NF-κB but is unable to stimulate IRF-3 phosphorylation, a transcription factor required for IL-12p35 and IFN-β gene expression. Thus, by inducing a specific cytokine profile, Mtb can influence the immunoregulatory properties of monocytes, which represent important target of novel vaccinal strategies against Mtb infection. PMID:21197399

  2. Differential competence of redox-regulatory mechanism under extremes of temperature determines growth performances and cross tolerance in two indica rice cultivars.

    PubMed

    Chakraborty, Ananya; Bhattacharjee, Soumen

    2015-03-15

    The present study investigated the relationship between reactive oxygen species (ROS) accumulation (total and individual), antioxidant and radical scavenging capacity (total and individual), transcript abundance of some antioxidative genes and oxidative damages to membrane protein and lipid in germinating tissues of a salt resistant (SR26B) and salt sensitive (Ratna) rice cultivars under extremes of temperature to elucidate redox-regulatory mechanism governing differential oxidative stress tolerance associated with better growth and yield potential and identification of cross tolerance, if any. Imbibitional heat and chilling stress caused disruption of redox-homeostasis and oxidative damage to a newly assembled membrane system by increasing pro-oxidant/antioxidant ratio and by aggravating membrane lipid peroxidation and protein oxidation [measured in terms of accumulation of thiobarbituric acid reactive substances (TBARS), free carbonyl content (CO groups), and membrane protein thiol level (MPTL)]. A concomitant increase in accumulation of individual ROS (superoxide and hydrogen peroxide) and significant reduction of radical scavenging activity (assessed in terms of ABTS, FRAP and DPPH methods), non-enzymatic and enzymatic anti-oxidative defense [assessed in terms of total thiol content and activities of superoxide dismutase (EC 1.15.1.1), catalase (EC 1.11.1.6), ascorbate peroxidase (EC 1.11.1.11), and glutathione reductase (EC 1.6.4.2)] are also noticed in both the salt sensitive (Ratna) and resistant (SR26B) germinating tissues of rice cultivars. When compared, salt resistant cultivar SR26B was found to suffer significantly less redox-imbalance and related oxidative damages to membrane protein and lipid as compared to salt sensitive cultivar Ratna. The salt tolerant cultivar SR26B resisted imbibitional chilling and heat stress due to its early preparedness to combat oxidative stress by up-regulation of gene expression of anti-oxidative enzymes and better

  3. Regulatory Physiology

    NASA Technical Reports Server (NTRS)

    Lane, Helen W.; Whitson, Peggy A.; Putcha, Lakshmi; Baker, Ellen; Smith, Scott M.; Stewart, Karen; Gretebeck, Randall; Nimmagudda, R. R.; Schoeller, Dale A.; Davis-Street, Janis

    1999-01-01

    As noted elsewhere in this report, a central goal of the Extended Duration Orbiter Medical Project (EDOMP) was to ensure that cardiovascular and muscle function were adequate to perform an emergency egress after 16 days of spaceflight. The goals of the Regulatory Physiology component of the EDOMP were to identify and subsequently ameliorate those biochemical and nutritional factors that deplete physiological reserves or increase risk for disease, and to facilitate the development of effective muscle, exercise, and cardiovascular countermeasures. The component investigations designed to meet these goals focused on biochemical and physiological aspects of nutrition and metabolism, the risk of renal (kidney) stone formation, gastrointestinal function, and sleep in space. Investigations involved both ground-based protocols to validate proposed methods and flight studies to test those methods. Two hardware tests were also completed.

  4. Regulatory Anatomy

    PubMed Central

    2015-01-01

    This article proposes the term “safety logics” to understand attempts within the European Union (EU) to harmonize member state legislation to ensure a safe and stable supply of human biological material for transplants and transfusions. With safety logics, I refer to assemblages of discourses, legal documents, technological devices, organizational structures, and work practices aimed at minimizing risk. I use this term to reorient the analytical attention with respect to safety regulation. Instead of evaluating whether safety is achieved, the point is to explore the types of “safety” produced through these logics as well as to consider the sometimes unintended consequences of such safety work. In fact, the EU rules have been giving rise to complaints from practitioners finding the directives problematic and inadequate. In this article, I explore the problems practitioners face and why they arise. In short, I expose the regulatory anatomy of the policy landscape. PMID:26139952

  5. Regulatory Mechanisms Underlying Oil Palm Fruit Mesocarp Maturation, Ripening, and Functional Specialization in Lipid and Carotenoid Metabolism1[W][OA

    PubMed Central

    Tranbarger, Timothy J.; Dussert, Stéphane; Joët, Thierry; Argout, Xavier; Summo, Marilyne; Champion, Antony; Cros, David; Omore, Alphonse; Nouy, Bruno; Morcillo, Fabienne

    2011-01-01

    Fruit provide essential nutrients and vitamins for the human diet. Not only is the lipid-rich fleshy mesocarp tissue of the oil palm (Elaeis guineensis) fruit the main source of edible oil for the world, but it is also the richest dietary source of provitamin A. This study examines the transcriptional basis of these two outstanding metabolic characters in the oil palm mesocarp. Morphological, cellular, biochemical, and hormonal features defined key phases of mesocarp development. A 454 pyrosequencing-derived transcriptome was then assembled for the developmental phases preceding and during maturation and ripening, when high rates of lipid and carotenoid biosynthesis occur. A total of 2,629 contigs with differential representation revealed coordination of metabolic and regulatory components. Further analysis focused on the fatty acid and triacylglycerol assembly pathways and during carotenogenesis. Notably, a contig similar to the Arabidopsis (Arabidopsis thaliana) seed oil transcription factor WRINKLED1 was identified with a transcript profile coordinated with those of several fatty acid biosynthetic genes and the high rates of lipid accumulation, suggesting some common regulatory features between seeds and fruits. We also focused on transcriptional regulatory networks of the fruit, in particular those related to ethylene transcriptional and GLOBOSA/PISTILLATA-like proteins in the mesocarp and a central role for ethylene-coordinated transcriptional regulation of type VII ethylene response factors during ripening. Our results suggest that divergence has occurred in the regulatory components in this monocot fruit compared with those identified in the dicot tomato (Solanum lycopersicum) fleshy fruit model. PMID:21487046

  6. Regulatory Mechanisms for Nursing Training and Practice: Meeting Primary Health Care Needs. World Health Organization Technical Report Series No. 738. Report of a WHO Study Group.

    ERIC Educational Resources Information Center

    World Health Organization, Geneva (Switzerland).

    A report on laws and regulations governing nursing education and practice in 81 countries belonging to the World Health Organization and effects on primary health care is presented by an international group of experts. Suggestions for training and licensure are provided to national governments and nursing regulatory bodies to promote the goal of…

  7. How the folding rates of two- and multistate proteins depend on the amino acid properties.

    PubMed

    Huang, Jitao T; Huang, Wei; Huang, Shanran R; Li, Xin

    2014-10-01

    Proteins fold by either two-state or multistate kinetic mechanism. We observe that amino acids play different roles in different mechanism. Many residues that are easy to form regular secondary structures (α helices, β sheets and turns) can promote the two-state folding reactions of small proteins. Most of hydrophilic residues can speed up the multistate folding reactions of large proteins. Folding rates of large proteins are equally responsive to the flexibility of partial amino acids. Other properties of amino acids (including volume, polarity, accessible surface, exposure degree, isoelectric point, and phase transfer energy) have contributed little to folding kinetics of the proteins. Cysteine is a special residue, it triggers two-state folding reaction and but inhibits multistate folding reaction. These findings not only provide a new insight into protein structure prediction, but also could be used to direct the point mutations that can change folding rate. © 2014 Wiley Periodicals, Inc.

  8. Immunocytochemical evidence for SNARE protein-dependent transmitter release from guinea pig horizontal cells

    PubMed Central

    Lee, Helen; Brecha, Nicholas C.

    2013-01-01

    Horizontal cells are lateral interneurons that participate in visual processing in the outer retina but the cellular mechanisms underlying transmitter release from these cells are not fully understood. In non-mammalian horizontal cells, GABA release has been shown to occur by a non-vesicular mechanism. However, recent evidence in mammalian horizontal cells favors a vesicular mechanism as they lack plasmalemmal GABA transporters and some soluble NSF attachment protein receptor (SNARE) core proteins have been identified in rodent horizontal cells. Moreover, immunoreactivity for GABA and the molecular machinery to synthesize GABA have been found in guinea pig horizontal cells, suggesting that if components of the SNARE complex are expressed they could contribute to the vesicular release of GABA. In this study we investigated whether these vesicular and synaptic proteins are expressed by guinea pig horizontal cells using immunohistochemistry with well-characterized antibodies to evaluate their cellular distribution. Components of synaptic vesicles including vesicular GABA transporter, synapsin I and synaptic vesicle protein 2A were localized to horizontal cell processes and endings, along with the SNARE core complex proteins, syntaxin-1a, syntaxin-4 and synaptosomal-associated protein 25 (SNAP-25). Complexin I/II, a cytosolic protein that stabilizes the activated SNARE fusion core, strongly immunostained horizontal cell soma and processes. In addition, the vesicular Ca2+-sensor, synaptotagmin-2, which is essential for Ca2+-mediated vesicular release, was also localized to horizontal cell processes and somata. These morphological findings from guinea pig horizontal cells suggest that mammalian horizontal cells have the capacity to utilize a regulated Ca2+-dependent vesicular pathway to release neurotransmitter, and that this mechanism may be shared among many mammalian species. PMID:20384779

  9. Retinoblastoma tumor suppressor protein-dependent methylation of histone H3 lysine 27 is associated with irreversible cell cycle exit.

    PubMed

    Blais, Alexandre; van Oevelen, Chris J C; Margueron, Raphaël; Acosta-Alvear, Diego; Dynlacht, Brian David

    2007-12-31

    The retinoblastoma tumor suppressor protein (pRb) is involved in mitotic exit, promoting the arrest of myoblasts, and myogenic differentiation. However, it is unclear how permanent cell cycle exit is maintained in differentiated muscle. Using RNA interference, expression profiling, and chromatin immunoprecipitations, we show that pRb is essential for cell cycle exit and the differentiation of myoblasts and is also uniquely required to maintain this arrest in myotubes. Remarkably, we also uncover a function for the pRb-related proteins p107 and p130 as enforcers of a G2/M phase checkpoint that prevents progression into mitosis in cells that have lost pRb. We further demonstrate that pRb effects permanent cell cycle exit in part by maintaining trimethylation of histone H3 lysine 27 (H3K27) on cell cycle genes. H3K27 trimethylation silences other genes, including Cyclin D1, in a pRb-independent but polycomb-dependent manner. Thus, our data distinguish two distinct chromatin-based regulatory mechanisms that lead to terminal differentiation.

  10. Regulatory Snapshots: integrative mining of regulatory modules from expression time series and regulatory networks.

    PubMed

    Gonçalves, Joana P; Aires, Ricardo S; Francisco, Alexandre P; Madeira, Sara C

    2012-01-01

    Explaining regulatory mechanisms is crucial to understand complex cellular responses leading to system perturbations. Some strategies reverse engineer regulatory interactions from experimental data, while others identify functional regulatory units (modules) under the assumption that biological systems yield a modular organization. Most modular studies focus on network structure and static properties, ignoring that gene regulation is largely driven by stimulus-response behavior. Expression time series are key to gain insight into dynamics, but have been insufficiently explored by current methods, which often (1) apply generic algorithms unsuited for expression analysis over time, due to inability to maintain the chronology of events or incorporate time dependency; (2) ignore local patterns, abundant in most interesting cases of transcriptional activity; (3) neglect physical binding or lack automatic association of regulators, focusing mainly on expression patterns; or (4) limit the discovery to a predefined number of modules. We propose Regulatory Snapshots, an integrative mining approach to identify regulatory modules over time by combining transcriptional control with response, while overcoming the above challenges. Temporal biclustering is first used to reveal transcriptional modules composed of genes showing coherent expression profiles over time. Personalized ranking is then applied to prioritize prominent regulators targeting the modules at each time point using a network of documented regulatory associations and the expression data. Custom graphics are finally depicted to expose the regulatory activity in a module at consecutive time points (snapshots). Regulatory Snapshots successfully unraveled modules underlying yeast response to heat shock and human epithelial-to-mesenchymal transition, based on regulations documented in the YEASTRACT and JASPAR databases, respectively, and available expression data. Regulatory players involved in functionally enriched

  11. The role of polyamines in protein-dependent hypoxic tolerance of Drosophila

    PubMed Central

    Vigne, Paul; Frelin, Christian

    2008-01-01

    Background Chronic hypoxia is a major component of ischemic diseases such as stroke or myocardial infarction. Drosophila is more tolerant to hypoxia than most mammalian species. It is considered as a useful model organism to identify new mechanisms of hypoxic tolerance. The hypoxic tolerance of flies has previously been reported to be enhanced by low protein diets. This study analyses the mechanisms involved. Results Feeding adult Drosophila on a yeast diet dramatically reduced their longevities under chronic hypoxic conditions (5% O2). Mean and maximum longevities became close to the values observed for starving flies. The action of dietary yeast was mimicked by a whole casein hydrolysate and by anyone of the 20 natural amino acids that compose proteins. It was mimicked by amino acid intermediates of the urea cycle such as L-citrulline and L-ornithine, and by polyamines (putrescine, spermidine and spermine). α-difluoromethylornithine, a specific inhibitor of ornithine decarboxylase, partially protected hypoxic flies from amino acid toxicity but not from polyamine toxicity. N1-guanyl-1,7 diaminoheptane, a specific inhibitor of eIF5A hypusination, partially relieved the toxicities of both amino acids and polyamines. Conclusion Dietary amino acids reduced the longevity of chronically hypoxic flies fed on a sucrose diet. Pharmacological evidence suggests that the synthesis of polyamines and the hypusination of eIF5A contributed to the life-shortening effect of dietary amino acids. PMID:19055734

  12. The role of polyamines in protein-dependent hypoxic tolerance of Drosophila.

    PubMed

    Vigne, Paul; Frelin, Christian

    2008-12-02

    Chronic hypoxia is a major component of ischemic diseases such as stroke or myocardial infarction. Drosophila is more tolerant to hypoxia than most mammalian species. It is considered as a useful model organism to identify new mechanisms of hypoxic tolerance. The hypoxic tolerance of flies has previously been reported to be enhanced by low protein diets. This study analyses the mechanisms involved. Feeding adult Drosophila on a yeast diet dramatically reduced their longevities under chronic hypoxic conditions (5% O2). Mean and maximum longevities became close to the values observed for starving flies. The action of dietary yeast was mimicked by a whole casein hydrolysate and by anyone of the 20 natural amino acids that compose proteins. It was mimicked by amino acid intermediates of the urea cycle such as L-citrulline and L-ornithine, and by polyamines (putrescine, spermidine and spermine). alpha-difluoromethylornithine, a specific inhibitor of ornithine decarboxylase, partially protected hypoxic flies from amino acid toxicity but not from polyamine toxicity. N1-guanyl-1,7 diaminoheptane, a specific inhibitor of eIF5A hypusination, partially relieved the toxicities of both amino acids and polyamines. Dietary amino acids reduced the longevity of chronically hypoxic flies fed on a sucrose diet. Pharmacological evidence suggests that the synthesis of polyamines and the hypusination of eIF5A contributed to the life-shortening effect of dietary amino acids.

  13. Overlapping substrate specificity for sucrose and maltose of two binding protein-dependent sugar uptake systems in Streptococcus mutans.

    PubMed

    Kilic, Ali O; Honeyman, Allen L; Tao, Lin

    2007-01-01

    Sugar metabolism by Streptococcus mutans is associated with tooth decay. The most abundant sugars in the human diet are sucrose and maltose, a derivative of starch. Previously, we reported a binding protein-dependent transport system (msm) in S. mutans that transports sucrose and maltose, but its associated enzymes do not metabolize maltose. By searching the S. mutans genomic sequence for a maltose system (mal), we found a gene cluster encoding proteins with homology to those of msm and the Escherichia coli maltose system. Mutants were constructed by deleting msm or mal, or both, and tested for sugar utilization. Deletion of the mal system diminished the ability of S. mutans to ferment maltose, but deletion of only the mal transporter genes or msm showed reduced utilization of chromogenic maltosides. Maltose, sucrose, glucose, fructose, mannose, and N-acetyl glucosamine inhibited utilization of chromogenic maltosides by the wild-type strain and mutants. In conclusion, the two binding protein-dependent systems in S. mutans appear to transport collaboratively their common substrate sugars, notably sucrose and maltose.

  14. Emerging principles of regulatory evolution

    PubMed Central

    Prud'homme, Benjamin; Gompel, Nicolas; Carroll, Sean B.

    2007-01-01

    Understanding the genetic and molecular mechanisms governing the evolution of morphology is a major challenge in biology. Because most animals share a conserved repertoire of body-building and -patterning genes, morphological diversity appears to evolve primarily through changes in the deployment of these genes during development. The complex expression patterns of developmentally regulated genes are typically controlled by numerous independent cis-regulatory elements (CREs). It has been proposed that morphological evolution relies predominantly on changes in the architecture of gene regulatory networks and in particular on functional changes within CREs. Here, we discuss recent experimental studies that support this hypothesis and reveal some unanticipated features of how regulatory evolution occurs. From this growing body of evidence, we identify three key operating principles underlying regulatory evolution, that is, how regulatory evolution: (i) uses available genetic components in the form of preexisting and active transcription factors and CREs to generate novelty; (ii) minimizes the penalty to overall fitness by introducing discrete changes in gene expression; and (iii) allows interactions to arise among any transcription factor and downstream CRE. These principles endow regulatory evolution with a vast creative potential that accounts for both relatively modest morphological differences among closely related species and more profound anatomical divergences among groups at higher taxonomical levels. PMID:17494759

  15. Targeting regulatory T cells.

    PubMed

    Ménétrier-Caux, Christine; Curiel, Tyler; Faget, Julien; Manuel, Manuarii; Caux, Christophe; Zou, Weiping

    2012-03-01

    Cancers express tumor-associated antigens that should elicit immune response to antagonize the tumor growth, but spontaneous immune rejection of established cancer is rare, suggesting an immunosuppressive environment hindering host antitumor immunity. Among the specific and active tumor-mediated mechanisms, CD4(+)CD25(high) T regulatory cells (Treg) are important mediators of active immune evasion in cancer. In this review, we will discuss Treg subpopulations and the mechanisms of their suppressive functions. Treg depletion improves endogenous antitumor immunity and the efficacy of active immunotherapy in animal models for cancer, suggesting that inhibiting Treg function could also improve the limited successes of human cancer immunotherapy. We will also discuss specific strategies for devising effective cancer immunotherapy targeting Treg.

  16. Cardioprotective trafficking of caveolin to mitochondria is Gi-protein dependent.

    PubMed

    Wang, Jiawan; Schilling, Jan M; Niesman, Ingrid R; Headrick, John P; Finley, J Cameron; Kwan, Evan; Patel, Piyush M; Head, Brian P; Roth, David M; Yue, Yun; Patel, Hemal H

    2014-09-01

    Caveolae are a nexus for protective signaling. Trafficking of caveolin to mitochondria is essential for adaptation to cellular stress though the trafficking mechanisms remain unknown. The authors hypothesized that G protein-coupled receptor/inhibitory G protein (Gi) activation leads to caveolin trafficking to mitochondria. Mice were exposed to isoflurane or oxygen vehicle (30 min, ± 36 h pertussis toxin pretreatment, an irreversible Gi inhibitor). Caveolin trafficking, cardioprotective "survival kinase" signaling, mitochondrial function, and ultrastructure were assessed. Isoflurane increased cardiac caveolae (n = 8 per group; data presented as mean ± SD for Ctrl versus isoflurane; [caveolin-1: 1.78 ± 0.12 vs. 3.53 ± 0.77; P < 0.05]; [caveolin-3: 1.68 ± 0.29 vs. 2.67 ± 0.46; P < 0.05]) and mitochondrial caveolin levels (n = 16 per group; [caveolin-1: 0.87 ± 0.18 vs. 1.89 ± .19; P < 0.05]; [caveolin-3: 1.10 ± 0.29 vs. 2.26 ± 0.28; P < 0.05]), and caveolin-enriched mitochondria exhibited improved respiratory function (n = 4 per group; [state 3/complex I: 10.67 ± 1.54 vs. 37.6 ± 7.34; P < 0.05]; [state 3/complex II: 37.19 ± 4.61 vs. 71.48 ± 15.28; P < 0.05]). Isoflurane increased phosphorylation of survival kinases (n = 8 per group; [protein kinase B: 0.63 ± 0.20 vs. 1.47 ± 0.18; P < 0.05]; [glycogen synthase kinase 3β: 1.23 ± 0.20 vs. 2.35 ± 0.20; P < 0.05]). The beneficial effects were blocked by pertussis toxin. Gi proteins are involved in trafficking caveolin to mitochondria to enhance stress resistance. Agents that target Gi activation and caveolin trafficking may be viable cardioprotective agents.

  17. Emergence of new regulatory mechanisms in the Benson-Calvin pathway via protein-protein interactions: a glyceraldehyde-3-phosphate dehydrogenase/CP12/phosphoribulokinase complex.

    PubMed

    Graciet, Emmanuelle; Lebreton, Sandrine; Gontero, Brigitte

    2004-05-01

    Protein-protein interactions are involved in many metabolic pathways. This review will focus on the role of such associations in CO2 assimilation (Benson-Calvin cycle) and especially on the involvement of a GAPDH/CP12/PRK complex which has been identified in many photosynthetic organisms and may have an important role in the regulation of CO2 assimilation. The emergence of new kinetic and regulatory properties as a consequence of protein-protein interactions will be addressed as well as some of the questions raised by the existence of these supramolecular complexes such as composition, function, and assembly pathways. The presence and role of small intrinsically unstructured proteins like the 8.5 kDa protein CP12, involved in the regulation and/or assembly of these complexes will be discussed. Copyright 2004 Society for Experimental Biology

  18. Regulatory considerations for biosimilars.

    PubMed

    Nellore, Ranjani

    2010-01-01

    Currently there is considerable interest in the legislative debate around generic biological drugs or "biosimilars" in the EU and US due to the large, lucrative market that it offers to the industry. While some countries have issued a few regulatory guidelines as well as product specific requirements, there is no general consensus as to a single, simple mechanism similar to the bioequivalence determination that leads to approval of generic small molecules all over the world. The inherent complex nature of the molecules, along with complicated manufacturing and analytical techniques to characterize them make it difficult to rely on a single human pharmacokinetic study for assurance of safety and efficacy. In general, the concept of comparability has been used for evaluation of the currently approved "similar" biological where a step by step assessment on the quality, preclinical and clinical aspects is made. In India, the focus is primarily on the availability and affordability of life-saving drugs. In this context every product needs to be evaluated on its own merit irrespective of the innovator brand. The formation of the National Biotechnology Regulatory Authority may provide a step in the right direction for regulation of these complex molecules. However, in order to have an efficient machinery for initial approval and ongoing oversight with a country-specific focus, cooperation with international authorities for granting approvals and continuous risk-benefit review is essential. Several steps are still needed for India to be perceived as a country that leads the world in providing quality biological products.

  19. Regulatory physiology discipline science plan

    NASA Technical Reports Server (NTRS)

    1991-01-01

    The focus of the Regulatory Physiology discipline of the Space Physiology and Countermeasures Program is twofold. First, to determine and study how microgravity and associated factors of space flight affect the regulatory mechanisms by which humans adapt and achieve homeostasis and thereby regulate their ability to respond to internal and external signals; and, second, to study selected physiological systems that have been demonstrated to be influenced by gravity. The Regulatory Physiology discipline, as defined here, is composed of seven subdisciplines: (1) Circadian Rhythms, (2) Endocrinology, (3) Fluid and Electrolyte Regulation, (4) Hematology, (5) Immunology, (6) Metabolism and Nutrition, and (7) Temperature Regulation. The purpose of this Discipline Science Plan is to provide a conceptual strategy for NASA's Life Sciences Division research and development activities in the area of regulatory physiology. It covers the research areas critical to NASA's programmatic requirements for the Extended-Duration Orbiter, Space Station Freedom, and exploration mission science activities. These science activities include ground-based and flight; basic, applied, and operational; and animal and human research and development. This document summarizes the current status of the program, outlines available knowledge, establishes goals and objectives, identifies science priorities, and defines critical questions in regulatory physiology. It contains a general plan that will be used by both NASA Headquarters Program Offices and the field centers to review and plan basic, applied, and operational intramural and extramural research and development activities in this area.

  20. Biomolecular Cell-Signaling Mechanisms and Dental Implants: A Review on the Regulatory Molecular Biologic Patterns Under Functional and Immediate Loading.

    PubMed

    Romanos, Georgios E

    2016-01-01

    Bone tissue adapts its structure and mass to the stresses of mechanical loading. The purpose of this review article was to summarize recent advances on cell signaling relating to the phenomenon of bone remodeling, focused on bone ossification and healing at the interface of dental implants and bone under loading conditions. When a dental implant is placed within an osteotomy, osteocytes, osteoblasts, and osteoclasts are all present. As functional loads are imposed, the remodeling processes adapt the peri-implant bony tissues to mechanical stimuli over time and reestablish a steady state. Based on the current literature, this article demonstrates fundamental information to these remodeling processes, such as the conversion of mechanical cues to electrical or biochemical signals. Multiple intracellular signals are involved in cellular mechanotransduction; the two Wnt signaling pathways (the canonical, β-catenin-dependent and the noncanonical, β-catenin-independent Wnt pathway) are particularly significant. Knowledge of how these molecular signaling pathways are translated into intracellular signals that regulate cell behavior may provide new therapeutic approaches to enhancing osteogenesis, especially around implants with immediate function or placed in areas of poor bone quality. New knowledge about the primary cilia as an organelle and bone cellular mechanosensor is critical for endochondral ossification and proper signal transduction. Other mechanisms, such as the expression of sclerostin as a negative regulator of bone formation (due to deactivation of the Wnt receptor) and downregulation of sclerostin under loading conditions, also present new understanding of the cellular and pericellular mechanics of bone. The complexity of the cell signaling pathways and the mechanisms involved in the mechanoregulation of the bone formation provide new technologies and perspectives for mechanically induced cellular response. Future novel therapeutic approaches based on the

  1. Downregulation of Lnc-Spry1 mediates TGF-β-induced epithelial-mesenchymal transition by transcriptional and posttranscriptional regulatory mechanisms.

    PubMed

    Rodríguez-Mateo, Cristina; Torres, Belén; Gutiérrez, Gabriel; Pintor-Toro, José A

    2017-02-10

    Long non-coding RNAs (lncRNAs) are a class of regulatory genes that participate in a wide range of biological processes, including proliferation, differentiation and development, as well as in a broad spectrum of diseases. Although the role of lncRNAs in TGF-β-induced epithelial-to-mesenchymal transition (EMT) has been well established, little is known about the role of lncRNAs as immediate-early regulators of EMT. Here lnc-Spry1 is identified as an immediate-early regulator of EMT that is downregulated by TGF-β. It is also found that knockdown of lnc-Spry1 promotes a mesenchymal-like phenotype and results in increased cell migration and invasion. In addition, it is shown that lnc-Spry1 depletion preferentially affects the expression of TGF-β-regulated gene targets. Moreover, lnc-Spry1 associates with U2AF65 splicing factor, suggesting a role in alternative splicing. Depletion of lnc-Spry1 induces, as TGF-β, isoform switching of fibroblast growth factor receptors, resulting in FGF-2-sensitive cells. Taken together, these results show that lnc-Spry1 could act as an early mediator of TGF-β signaling and reveal different roles for a lncRNA in modulating transcriptional and posttranscriptional gene expressionCell Death and Differentiation advance online publication, 10 February 2017; doi:10.1038/cdd.2017.9.

  2. Heart rate variability indices as bio-markers of top-down self-regulatory mechanisms: A meta-analytic review.

    PubMed

    Holzman, Jacob B; Bridgett, David J

    2017-03-01

    Theoretical perspectives posit that heart-rate variability (HRV) reflects self-regulatory capacity and therefore can be employed as a bio-marker of top-down self-regulation (the ability to regulate behavioral, cognitive, and emotional processes). However, existing findings of relations between self-regulation and HRV indices are mixed. To clarify the nature of such relations, we conducted a meta-analysis of 123 studies (N=14,347) reporting relations between HRV indices and aspects of top-down self-regulation (e.g., executive functioning, emotion regulation, effortful control). A significant, albeit small, effect was observed (r=0.09) such that greater HRV was related to better top-down self-regulation. Differences in relations were negligible across aspects of self-regulation, self-regulation measurement methods, HRV computational techniques, at-risk compared with healthy samples, and the context of HRV measurement. Stronger relations were observed in older relative to younger samples and in published compared to unpublished studies. These findings generally support the notion that HRV indices can tentatively be employed as bio-markers of top-down self-regulation. Conceptual and theoretical implications, and critical gaps in current knowledge to be addressed by future work, are discussed.

  3. Eliminating roles for T-bet and IL-2 but revealing superior activation and proliferation as mechanisms underpinning dominance of regulatory T cells in tumors

    PubMed Central

    Smart, Kathryn; Jones, Emma; Bloom, Anja; Bridgeman, Hayley; McPherson, Rhoanne C.; Turner, Darryl G.; Ladell, Kristin; Price, David A.; O'Connor, Richard A.; Anderton, Stephen M.; Godkin, Andrew J.; Gallimore, Awen M.

    2015-01-01

    Foxp3+ regulatory T cells (Tregs) are often highly enriched within the tumor-infiltrating T cell pool. Using a well-characterised model of carcinogen-induced fibrosarcomas we show that the enriched tumor-infiltrating Treg population comprises largely of CXCR3+ T-bet+ ‘TH1-like’ Tregs which are thymus-derived Helios+ cells. Whilst IL-2 maintains homeostatic ratios of Tregs in lymphoid organs, we found that the perturbation in Treg frequencies in tumors is IL-2 independent. Moreover, we show that the TH1 phenotype of tumor-infiltrating Tregs is dispensable for their ability to influence tumor progression. We did however find that unlike Tconvs, the majority of intra-tumoral Tregs express the activation markers CD69, CD25, ICOS, CD103 and CTLA4 and are significantly more proliferative than Tconvs. Moreover, we have found that CD69+ Tregs are more suppressive than their CD69− counterparts. Collectively, these data indicate superior activation of Tregs in the tumor microenvironment, promoting their suppressive ability and selective proliferation at this site. PMID:26433463

  4. A systematic computational analysis of the rRNA–3′ UTR sequence complementarity suggests a regulatory mechanism influencing post-termination events in metazoan translation

    PubMed Central

    Pánek, Josef; Kolář, Michal; Herrmannová, Anna; Valášek, Leoš Shivaya

    2016-01-01

    Nucleic acid sequence complementarity underlies many fundamental biological processes. Although first noticed a long time ago, sequence complementarity between mRNAs and ribosomal RNAs still lacks a meaningful biological interpretation. Here we used statistical analysis of large-scale sequence data sets and high-throughput computing to explore complementarity between 18S and 28S rRNAs and mRNA 3′ UTR sequences. By the analysis of 27,646 full-length 3′ UTR sequences from 14 species covering both protozoans and metazoans, we show that the computed 18S rRNA complementarity creates an evolutionarily conserved localization pattern centered around the ribosomal mRNA entry channel, suggesting its biological relevance and functionality. Based on this specific pattern and earlier data showing that post-termination 80S ribosomes are not stably anchored at the stop codon and can migrate in both directions to codons that are cognate to the P-site deacylated tRNA, we propose that the 18S rRNA–mRNA complementarity selectively stabilizes post-termination ribosomal complexes to facilitate ribosome recycling. We thus demonstrate that the complementarity between 18S rRNA and 3′ UTRs has a non-random nature and very likely carries information with a regulatory potential for translational control. PMID:27190231

  5. Professional and Regulatory Search

    EPA Pesticide Factsheets

    Professional and Regulatory search are designed for people who use EPA web resources to do their job. You will be searching collections where information that is not relevant to Environmental and Regulatory professionals.

  6. Combinatorial readout of unmodified H3R2 and acetylated H3K14 by the tandem PHD finger of MOZ reveals a regulatory mechanism for HOXA9 transcription.

    PubMed

    Qiu, Yu; Liu, Lei; Zhao, Chen; Han, Chuanchun; Li, Fudong; Zhang, Jiahai; Wang, Yan; Li, Guohong; Mei, Yide; Wu, Mian; Wu, Jihui; Shi, Yunyu

    2012-06-15

    Histone acetylation is a hallmark for gene transcription. As a histone acetyltransferase, MOZ (monocytic leukemia zinc finger protein) is important for HOX gene expression as well as embryo and postnatal development. In vivo, MOZ forms a tetrameric complex with other subunits, including several chromatin-binding modules with regulatory functions. Here we report the solution structure of the tandem PHD (plant homeodomain) finger (PHD12) of human MOZ in a free state and the 1.47 Å crystal structure in complex with H3K14ac peptide, which reveals the structural basis for the recognition of unmodified R2 and acetylated K14 on histone H3. Moreover, the results of chromatin immunoprecipitation (ChIP) and RT-PCR assays indicate that PHD12 facilitates the localization of MOZ onto the promoter locus of the HOXA9 gene, thereby promoting the H3 acetylation around the promoter region and further up-regulating the HOXA9 mRNA level. Taken together, our findings suggest that the combinatorial readout of the H3R2/K14ac by PHD12 might represent an important epigenetic regulatory mechanism that governs transcription and also provide a clue of cross-talk between the MOZ complex and histone H3 modifications.

  7. The angiosperm gibberellin-GID1-DELLA growth regulatory mechanism: how an "inhibitor of an inhibitor" enables flexible response to fluctuating environments.

    PubMed

    Harberd, Nicholas P; Belfield, Eric; Yasumura, Yuki

    2009-05-01

    The phytohormone gibberellin (GA) has long been known to regulate the growth, development, and life cycle progression of flowering plants. However, the molecular GA-GID1-DELLA mechanism that enables plants to respond to GA has only recently been discovered. In addition, studies published in the last few years have highlighted previously unsuspected roles for the GA-GID1-DELLA mechanism in regulating growth response to environmental variables. Here, we review these advances within a general plant biology context and speculate on the answers to some remaining questions. We also discuss the hypothesis that the GA-GID1-DELLA mechanism enables flowering plants to maintain transient growth arrest, giving them the flexibility to survive periods of adversity.

  8. Sterol regulatory element binding protein-1 expression is suppressed by dietary polyunsaturated fatty acids. A mechanism for the coordinate suppression of lipogenic genes by polyunsaturated fats.

    PubMed

    Xu, J; Nakamura, M T; Cho, H P; Clarke, S D

    1999-08-13

    Polyunsaturated fatty acids (PUFA) coordinately suppress the transcription of a wide array of hepatic lipogenic genes including fatty acid synthase (FAS) and acetyl-CoA carboxylase. Interestingly, the over-expression of sterol regulatory element binding protein-1 (SREBP-1) induces the expression of all of the enzymes suppressed by PUFA. This observation led us to hypothesize that PUFA coordinately inhibit lipogenic gene transcription by suppressing the expression of SREBP-1. Our initial studies revealed that the SREBP-1 and FAS mRNA contents of HepG2 cells were reduced by 20:4(n-6) in a dose-dependent manner (i.e. EC(50) approximately 10 microM), whereas 18:1(n-9) had no effect. Similarly, supplementing a fat-free, high glucose diet with oils rich in (n-6) or (n-3) PUFA reduced the hepatic content of precursor and nuclear SREBP-1 60 and 85%, respectively; however, PUFA had no effect on the nuclear content of upstream stimulatory factor (USF)-1. The PUFA-dependent decrease in nuclear content of mature SREBP-1 was paralleled by a 70-90% suppression in FAS gene transcription. In contrast, dietary 18:1(n-9), i.e. triolein, had no inhibitory influence on the expression of SREBP-1 or FAS. The decrease in hepatic expression of SREBP-1 and FAS associated with PUFA ingestion was mimicked by supplementing the fat-free diet with the PPARalpha-activator, WY 14, 643. Interestingly, nuclear run-on assays revealed that changes in SREBP-1 mRNA abundance were not accompanied by changes in SREBP-1 gene transcription. These results support the concept that PUFA coordinately inhibit lipogenic gene transcription by suppressing the expression of SREBP-1 and that the PUFA regulation of SREBP-1 appears to occur at the post-transcriptional level.

  9. Characterization of regulatory mechanism of Poncirus trifoliata microRNAs on their target genes with an integrated strategy of newly developed PPM-RACE and RLM-RACE.

    PubMed

    Shangguan, Lingfei; Song, Changnian; Han, Jian; Leng, Xiangpeng; Kibet, Korir Nicholas; Mu, Qian; Kayesh, Emrul; Fang, Jinggui

    2014-02-01

    MicroRNAs (miRNAs) play an important role in post-transcriptional gene regulation that involved various biological and metabolic processes. Many extensive studies have been done in model plant species, to discover miRNAs' regulating expression of their target genes and analyze their functions. But, the function of Poncirus trifoliata miRNAs has not been properly investigated. In this study, we employed the RNA ligase-mediated 5' rapid amplification of cDNA ends (RLM-RACE) and the newly developed method called poly (A) polymerase-mediated 3' rapid amplification of cDNA ends (PPM-RACE), which mapped the cleavage site of target mRNAs and detected expression patterns of cleaved fragments that could in turn indicate the regulatory functions of the miRNAs on their target genes. Furthermore, the spatiotemporal expression levels of target genes were analyzed by qRT-PCR, with exhibiting different expression trends from their corresponding miRNAs, thus indicating the cleavage mode of miRNAs on their target genes. The expression patterns of miRNAs, their target mRNAs and cleaved target mRNAs in different organs of juvenile and adult trifoliate orange were studied. The results showed that the expression of miRNAs and their target mRNAs was in a trade-off trend. When the miRNA expression was high, its corresponding target mRNA expression was low, while the cleaved target mRNA expression was high; when the miRNA expression was low, its target mRNA expression was high, while the expression of cleaved target mRNAs follows that of the miRNA. The validation of the cleavage site of target mRNAs and the detection of expression patterns of cleaved fragments can further broaden the knowledge of small RNA-mediated regulation in P. trifoliate.

  10. [Alteration of metabolic characteristics on the masseter muscle fiber of unilateral chewing rats and its adenosine monophosphate activated protein kinase regulatory mechanism].

    PubMed

    Andi, Shi; Lin, Zeng; Jing, Liu

    2017-06-01

    This study aims to determine the influence of unilateral chewing on metabolic characteristics of masseter muscle fibers in rats and the regulatory effect of an adenosine monophosphate activated protein kinase (AMPK) signal pathway on metabolism. Rats were submitted to exodontia of all the right maxillary molars and divided into 2, 4, 6, and 8 weeks groups, and corresponding control groups were set as well. Sections were stained by nicotine adenine dinucleotide tetrazolim reductase(NADH-TRase) to demonstrate the types, proportion, and density of masseter muscle fibers. AMPKα1 and p-AMPK(Thr172) levels in bilateral masseter muscles were detected by Western blot. In the 2-week group, the percentage of dark fibers augmented in the ipsilateral side, whereas the percentage of intermediary fibers in the contralateral side was increased accompanied by a decrease of light fibers, compared with the control group (P<0.05). The percentage of dark fibers was increased in the bilateral sides, whereas the percentage of dark fiber in the ipsilateral sides surpassed that of the contralateral sides in the 4, 6, and 8-week groups. The percentage of intermediary fibers was decreased in the bilateral sides in the 6 and 8-week groups (P<0.05). The percentage of light fibers was reduced in the ipsilateral sides in the 8-week group, whereas no alteration was observed in contralateral sides (P>0.05). In the ipsilateral sides, p-AMPK (Thr172)/AMPKα1 levels were increased in the 2 and 4-week groups (P<0.05), whereas no change was observed in the contralateral sides in either group (P>0.05). Unilateral chewing increases the oxidative metabolic ability in bilateral masseter muscle fibers especially in the non-working side accompanied with change of muscle fiber types. The improvement of aerobic metabolism ability is related to the AMPK signal pathway.
.

  11. A kinetic approach towards understanding substrate interactions and the catalytic mechanism of the serine/threonine protein kinase ERK2: identifying a potential regulatory role for divalent magnesium.

    PubMed

    Waas, William F; Rainey, Mark A; Szafranska, Anna E; Cox, Kari; Dalby, Kevin N

    2004-03-11

    We are interested in the mechanism and regulation of the extracellular regulated protein kinases, ERK1 and ERK2, due to their key roles in cellular signal transduction and disease. Both enzymes phosphorylate a large number of structurally disparate proteins upon activation by phorbol esters, serum and growth factors, and are activated through a protein kinase cascade, termed the mitogen activated protein kinase (MAPK) pathway. ERK2 catalyses the transfer of the gamma-phosphate of adenosine triphosphate to serine or threonine residues found in Ser-Pro or Thr-Pro motifs on proteins. Its catalytic mechanism is intriguing, because it appears to predominantly rely on interactions outside of the active site cleft to specify a substrate. To study ERK2, we developed a recombinant protein called EtsDelta138, which comprises residues 1-138 of the transcription factor Ets-1, an excellent substrate of ERK2. Here we review several steady-state kinetic experiments that reveal details of the ERK2 mechanism and a hitherto unknown process of ERK2 activation by free magnesium. The physiological relevance of this mechanism is discussed.

  12. Transcription regulatory mechanism of Pitx in the papilla-forming region in the ascidian, Halocynthia roretzi, implies conserved involvement of Otx as the upstream gene in the adhesive organ development of chordates.

    PubMed

    Yoshida, Keita; Ueno, Motoko; Niwano, Tomoko; Saiga, Hidetoshi

    2012-08-01

    Pitx genes play important roles in a variety of developmental processes in vertebrates. In an ascidian species, Halocynthia roretzi, Hr-Pitx, the only Pitx gene of this species, has been reported to be expressed in the left epidermis at the tailbud stage. In the present study, first, we have shown that Hr-Pitx is also expressed in the papilla-forming region at the neurula to tailbud stages, and then we addressed transcription regulatory mechanisms for the expression of Hr-Pitx in the papilla-forming region. We have identified the genomic region ranging from 850 to 1211 bp upstream from the translation start site of the Hr-Pitx gene as an enhancer region that drives the transcription of Hr-Pitx in the papilla-forming region. Within the enhancer region, putative transcriptional factor binding sites for Otx as well as Fox were shown to be required for its activity. Finally, we carried out knocking down experiments of Hr-Otx function using an antisense morpholino oligonucleotide, in which the knocking down of Hr-Otx function resulted in reduction of the enhancer activity and loss of the expression of Hr-Pitx in the papilla-forming region. In Xenopus laevis, it has been reported that Pitx genes are expressed downstream of Otx function during development of the cement gland, an adhesive organ of its larva. Taken together, it is suggested that the expression regulatory mechanism of Pitx, involving Otx as the upstream gene, in the developing adhesive organ is conserved between ascidians and vertebrates.

  13. Temperature-sensitive Gbeta mutants discriminate between G protein-dependent and -independent signaling mediated by serpentine receptors.

    PubMed Central

    Jin, T; Soede, R D; Liu, J; Kimmel, A R; Devreotes, P N; Schaap, P

    1998-01-01

    Deletion of the single gene for the Dictyostelium G protein beta-subunit blocks development at an early stage. We have now isolated temperature-sensitive alleles of Gbeta to investigate its role in later development. We show that Gbeta is directly required for adenylyl cyclase A activation and for morphogenetic signaling during the entire developmental program. Gbeta was also essential for induction of aggregative gene expression by cAMP pulses, a process that is mediated by serpentine cAMP receptors (cARs). However, Gbeta was not required for cAR-mediated induction of prespore genes and repression of stalk genes, and neither was Gbeta needed for induction of prestalk genes by the differentiation inducing factor (DIF). cAMP induction of prespore genes and repression of stalk genes is mediated by the protein kinase GSK-3. GSK-3 also determines cell-type specification in insects and vertebrates and is regulated by the wingless/wnt morphogens that are detected by serpentine fz receptors. The G protein-dependent and -independent modes of cAR-mediated signaling reported here may also exist for the wingless/wnt signaling pathways in higher organisms. PMID:9724643

  14. Regulatory mechanisms in cell-mediated immune responses. VIII. Differential expression of I-region determinants by suppressor cells and their targets in suppression of mixed leukocyte reactions

    PubMed Central

    1979-01-01

    The phenotypic expression of I-region determinants on cells producing and responding to MLR suppressor factor (MLR-TsF) was established in these studies. Alloantigen-activated MLR suppressor T cells (MLR-Ts), which produce MLR-TsF bearing gene products of the I-C subregion, were exposed to anti-I subregion sera and complement (C) before in vitro culture for MLR-TsF production. Suppressor activity was prevented by removal of cells bearing I-C determinants, whereas elimination of cells expressing I-A/B determinants had no effect. Interestingly, cytotoxic elimination of cells displaying I-J determinants also prevented MLR-TsF production. Admixture of anti-I-J and I-C antiserum-treated cells for MLR-TsF production failed to reconstitute suppressor activity, indicating that I-C and I-J gene products are expressed on a single population of cells critical to MLR suppression, rather than on distinct interacting subpopulations. Anti-I-C serum activity specific for I-C+ MLR-Ts was removed by adsorption with nylon wool-nonadherent splenic T cells and concanavalin A-activated thymocytes; adsorption with splenic B cells from anti-Thy-1,2 serum and C-treated spleen failed to remove relevant anti-I-C activity. These data suggest that regulatory I-C molecules, like I-J molecules, are preferentially expressed on T lymphocytes. Expression of I-C, or other I-region molecules on responder cell targets of MLR-TsF activity was also investigated. Responder cells were pretreated with anti-I subregion- specific sera in blocking or complement-dependent cytotoxic protocols before addition to MLR with MLR-TsF. Neither blocking nor the cytotoxic removal of cells bearing I-C or other I-region determinants from MLR responder populations interfered with MLR-TsF suppression. Because it has previously been demonstrated that MLR-TsF interacts optimally with activated, I-C syngeneic target cells, blocking and cytotoxic studies with anti-I subregion sera were also performed with responder cells

  15. Inferring the Impact of Regulatory Mechanisms that Underpin CD8+ T Cell Control of B16 Tumor Growth In vivo Using Mechanistic Models and Simulation

    PubMed Central

    Klinke, David J.; Wang, Qing

    2017-01-01

    A major barrier for broadening the efficacy of immunotherapies for cancer is identifying key mechanisms that limit the efficacy of tumor infiltrating lymphocytes. Yet, identifying these mechanisms using human samples and mouse models for cancer remains a challenge. While interactions between cancer and the immune system are dynamic and non-linear, identifying the relative roles that biological components play in regulating anti-tumor immunity commonly relies on human intuition alone, which can be limited by cognitive biases. To assist natural intuition, modeling and simulation play an emerging role in identifying therapeutic mechanisms. To illustrate the approach, we developed a multi-scale mechanistic model to describe the control of tumor growth by a primary response of CD8+ T cells against defined tumor antigens using the B16 C57Bl/6 mouse model for malignant melanoma. The mechanistic model was calibrated to data obtained following adenovirus-based immunization and validated to data obtained following adoptive transfer of transgenic CD8+ T cells. More importantly, we use simulation to test whether the postulated network topology, that is the modeled biological components and their associated interactions, is sufficient to capture the observed anti-tumor immune response. Given the available data, the simulation results also provided a statistical basis for quantifying the relative importance of different mechanisms that underpin CD8+ T cell control of B16F10 growth. By identifying conditions where the postulated network topology is incomplete, we illustrate how this approach can be used as part of an iterative design-build-test cycle to expand the predictive power of the model. PMID:28101055

  16. Inferring the Impact of Regulatory Mechanisms that Underpin CD8+ T Cell Control of B16 Tumor Growth In vivo Using Mechanistic Models and Simulation.

    PubMed

    Klinke, David J; Wang, Qing

    2016-01-01

    A major barrier for broadening the efficacy of immunotherapies for cancer is identifying key mechanisms that limit the efficacy of tumor infiltrating lymphocytes. Yet, identifying these mechanisms using human samples and mouse models for cancer remains a challenge. While interactions between cancer and the immune system are dynamic and non-linear, identifying the relative roles that biological components play in regulating anti-tumor immunity commonly relies on human intuition alone, which can be limited by cognitive biases. To assist natural intuition, modeling and simulation play an emerging role in identifying therapeutic mechanisms. To illustrate the approach, we developed a multi-scale mechanistic model to describe the control of tumor growth by a primary response of CD8+ T cells against defined tumor antigens using the B16 C57Bl/6 mouse model for malignant melanoma. The mechanistic model was calibrated to data obtained following adenovirus-based immunization and validated to data obtained following adoptive transfer of transgenic CD8+ T cells. More importantly, we use simulation to test whether the postulated network topology, that is the modeled biological components and their associated interactions, is sufficient to capture the observed anti-tumor immune response. Given the available data, the simulation results also provided a statistical basis for quantifying the relative importance of different mechanisms that underpin CD8+ T cell control of B16F10 growth. By identifying conditions where the postulated network topology is incomplete, we illustrate how this approach can be used as part of an iterative design-build-test cycle to expand the predictive power of the model.

  17. Potential Nociceptive Regulatory Effect of Probiotic Lactobacillus rhamnosus PB01 (DSM 14870) on Mechanical Sensitivity in Diet-Induced Obesity Model

    PubMed Central

    Brandsborg, Erik

    2016-01-01

    Treatments for obesity have been shown to reduce pain secondary to weight loss. Intestinal microbiota, as an endogenous factor, influences obesity and pain sensitivity but the effect of oral probiotic supplementation on musculoskeletal pain perception has not been studied systematically. The present study examined the effect of a single daily oral dose (1 × 109 CFU) of probiotics (Lactobacillus rhamnosus PB01, DSM14870) supplement on mechanical pain thresholds in behaving diet-induced obese (DIO) mice and their normal weight (NW) controls. The mice (N = 24, 6-week-old male) were randomly divided into four groups on either standard or high fat diet with and without probiotic supplementation. Both DIO and NW groups with probiotic supplementation maintained an insignificant weight gain while the control groups gained significant weight (P < 0.05). Similarly, both DIO and NW probiotics supplemented groups demonstrated a significantly (P < 0.05) lower sensitivity to mechanical stimulation compared to their corresponding control. The results of this study suggest a protective effect of probiotics on nociception circuits, which propose a direct result of the weight reduction or an indirect result of anti-inflammatory properties of the probiotics. Deciphering the exact underlying mechanism of the weight loss and lowering nociception effect of the probiotic applied in this study require further investigation. PMID:27647980

  18. Regulatory Considerations for Biosimilars

    PubMed Central

    Nellore, Ranjani

    2010-01-01

    Currently there is considerable interest in the legislative debate around generic biological drugs or “biosimilars” in the EU and US due to the large, lucrative market that it offers to the industry. While some countries have issued a few regulatory guidelines as well as product specific requirements, there is no general consensus as to a single, simple mechanism similar to the bioequivalence determination that leads to approval of generic small molecules all over the world. The inherent complex nature of the molecules, along with complicated manufacturing and analytical techniques to characterize them make it difficult to rely on a single human pharmacokinetic study for assurance of safety and efficacy. In general, the concept of comparability has been used for evaluation of the currently approved “similar” biological where a step by step assessment on the quality, preclinical and clinical aspects is made. In India, the focus is primarily on the availability and affordability of life-saving drugs. In this context every product needs to be evaluated on its own merit irrespective of the innovator brand. The formation of the National Biotechnology Regulatory Authority may provide a step in the right direction f