Science.gov

Sample records for regulatory rna production

  1. The rise of regulatory RNA

    PubMed Central

    Morris, K.V.; Mattick, J.S.

    2015-01-01

    Discoveries over the last decade portend a paradigm shift in molecular biology. Evidence suggests that RNA is not only functional as a messenger between DNA and protein but also in the regulation of genome organization and gene expression, which is increasingly elaborated in complex organisms. Regulatory RNAs appear to operate at many levels, but in particular to play an important role in the epigenetic processes that control differentiation and development. These discoveries suggest a central role for RNA in human evolution and ontogeny. Here we survey the emergence of the previously unsuspected world of regulatory RNAs from an historical perspective. PMID:24776770

  2. Modular arrangement of regulatory RNA elements.

    PubMed

    Roßmanith, Johanna; Narberhaus, Franz

    2017-03-04

    Due to their simple architecture and control mechanism, regulatory RNA modules are attractive building blocks in synthetic biology. This is especially true for riboswitches, which are natural ligand-binding regulators of gene expression. The discovery of various tandem riboswitches inspired the design of combined RNA modules with activities not yet found in nature. Riboswitches were placed in tandem or in combination with a ribozyme or temperature-responsive RNA thermometer resulting in new functionalities. Here, we compare natural examples of tandem riboswitches with recently designed artificial RNA regulators suggesting substantial modularity of regulatory RNA elements. Challenges associated with modular RNA design are discussed.

  3. Modular arrangement of regulatory RNA elements

    PubMed Central

    Roßmanith, Johanna; Narberhaus, Franz

    2017-01-01

    ABSTRACT Due to their simple architecture and control mechanism, regulatory RNA modules are attractive building blocks in synthetic biology. This is especially true for riboswitches, which are natural ligand-binding regulators of gene expression. The discovery of various tandem riboswitches inspired the design of combined RNA modules with activities not yet found in nature. Riboswitches were placed in tandem or in combination with a ribozyme or temperature-responsive RNA thermometer resulting in new functionalities. Here, we compare natural examples of tandem riboswitches with recently designed artificial RNA regulators suggesting substantial modularity of regulatory RNA elements. Challenges associated with modular RNA design are discussed. PMID:28010165

  4. Regulatory BC1 RNA in Cognitive Control

    ERIC Educational Resources Information Center

    Iacoangeli, Anna; Dosunmu, Aderemi; Eom, Taesun; Stefanov, Dimitre G.; Tiedge, Henri

    2017-01-01

    Dendritic regulatory BC1 RNA is a non-protein-coding (npc) RNA that operates in the translational control of gene expression. The absence of BC1 RNA in BC1 knockout (KO) animals causes translational dysregulation that entails neuronal phenotypic alterations including prolonged epileptiform discharges, audiogenic seizure activity in vivo, and…

  5. microRNA Decay: Refining microRNA Regulatory Activity.

    PubMed

    Pepin, Genevieve; Gantier, Michael P

    2016-01-01

    MicroRNAs (miRNAs) are short 19-25 nucleotide RNA molecules that impact on most biological processes by regulating the efficiency of messenger RNA (mRNA) translation. To date, most research activities have been focused on the control of miRNA expression and its functional consequences. Nonetheless, much remains unknown about the mechanisms affecting the level of specific miRNAs in the cell, a critical feature impacting their regulatory activity. This review focuses on the factors that regulate the abundance of miRNAs, including synthesis, post-transcriptional modifications, nucleases, target binding, and secretion.

  6. SRD: a Staphylococcus regulatory RNA database

    PubMed Central

    Sassi, Mohamed; Augagneur, Yoann; Mauro, Tony; Ivain, Lorraine; Chabelskaya, Svetlana; Hallier, Marc; Sallou, Olivier; Felden, Brice

    2015-01-01

    An overflow of regulatory RNAs (sRNAs) was identified in a wide range of bacteria. We designed and implemented a new resource for the hundreds of sRNAs identified in Staphylococci, with primary focus on the human pathogen Staphylococcus aureus. The “Staphylococcal Regulatory RNA Database” (SRD, http://srd.genouest.org/) compiled all published data in a single interface including genetic locations, sequences and other features. SRD proposes novel and simplified identifiers for Staphylococcal regulatory RNAs (srn) based on the sRNA's genetic location in S. aureus strain N315 which served as a reference. From a set of 894 sequences and after an in-depth cleaning, SRD provides a list of 575 srn exempt of redundant sequences. For each sRNA, their experimental support(s) is provided, allowing the user to individually assess their validity and significance. RNA-seq analysis performed on strains N315, NCTC8325, and Newman allowed us to provide further details, upgrade the initial annotation, and identified 159 RNA-seq independent transcribed sRNAs. The lists of 575 and 159 sRNAs sequences were used to predict the number and location of srns in 18 S. aureus strains and 10 other Staphylococci. A comparison of the srn contents within 32 Staphylococcal genomes revealed a poor conservation between species. In addition, sRNA structure predictions obtained with MFold are accessible. A BLAST server and the intaRNA program, which is dedicated to target prediction, were implemented. SRD is the first sRNA database centered on a genus; it is a user-friendly and scalable device with the possibility to submit new sequences that should spread in the literature. PMID:25805861

  7. Regulatory network controlling extracellular proteins in Erwinia carotovora subsp. carotovora: FlhDC, the master regulator of flagellar genes, activates rsmB regulatory RNA production by affecting gacA and hexA (lrhA) expression.

    PubMed

    Cui, Yaya; Chatterjee, Asita; Yang, Hailian; Chatterjee, Arun K

    2008-07-01

    Erwinia carotovora subsp. carotovora produces an array of extracellular proteins (i.e., exoproteins), including plant cell wall-degrading enzymes and Harpin, an effector responsible for eliciting hypersensitive reaction. Exoprotein genes are coregulated by the quorum-sensing signal, N-acyl homoserine lactone, plant signals, an assortment of transcriptional factors/regulators (GacS/A, ExpR1, ExpR2, KdgR, RpoS, HexA, and RsmC) and posttranscriptional regulators (RsmA, rsmB RNA). rsmB RNA production is positively regulated by GacS/A, a two-component system, and negatively regulated by HexA (PecT in Erwinia chrysanthemi; LrhA [LysR homolog A] in Escherichia coli) and RsmC, a putative transcriptional adaptor. While free RsmA, an RNA-binding protein, promotes decay of mRNAs of exoprotein genes, binding of RsmA with rsmB RNA neutralizes the RsmA effect. In the course of studies of GacA regulation, we discovered that a locus bearing strong homology to the flhDC operon of E. coli also controls extracellular enzyme production. A transposon insertion FlhDC(-) mutant produces very low levels of pectate lyase, polygalacturonase, cellulase, protease, and E. carotovora subsp. carotovora Harpin (Harpin(Ecc)) and is severely attenuated in its plant virulence. The production of these exoproteins is restored in the mutant carrying an FlhDC(+) plasmid. Sequence analysis and transcript assays disclosed that the flhD operon of E. carotovora subsp. carotovora, like those of other enterobacteria, consists of flhD and flhC. Complementation analysis revealed that the regulatory effect requires functions of both flhD and flhC products. The data presented here show that FlhDC positively regulates gacA, rsmC, and fliA and negatively regulates hexA (lrhA). Evidence shows that FlhDC controls extracellular protein production through cumulative effects on hexA and gacA. Reduced levels of GacA and elevated levels of HexA in the FlhDC(-) mutant are responsible for the inhibition of rsmB RNA

  8. Transcription factor trapping by RNA in gene regulatory elements.

    PubMed

    Sigova, Alla A; Abraham, Brian J; Ji, Xiong; Molinie, Benoit; Hannett, Nancy M; Guo, Yang Eric; Jangi, Mohini; Giallourakis, Cosmas C; Sharp, Phillip A; Young, Richard A

    2015-11-20

    Transcription factors (TFs) bind specific sequences in promoter-proximal and -distal DNA elements to regulate gene transcription. RNA is transcribed from both of these DNA elements, and some DNA binding TFs bind RNA. Hence, RNA transcribed from regulatory elements may contribute to stable TF occupancy at these sites. We show that the ubiquitously expressed TF Yin-Yang 1 (YY1) binds to both gene regulatory elements and their associated RNA species across the entire genome. Reduced transcription of regulatory elements diminishes YY1 occupancy, whereas artificial tethering of RNA enhances YY1 occupancy at these elements. We propose that RNA makes a modest but important contribution to the maintenance of certain TFs at gene regulatory elements and suggest that transcription of regulatory elements produces a positive-feedback loop that contributes to the stability of gene expression programs. Copyright © 2015, American Association for the Advancement of Science.

  9. The pivotal regulatory landscape of RNA modifications.

    PubMed

    Li, Sheng; Mason, Christopher E

    2014-01-01

    Posttranscriptionally modified nucleosides in RNA play integral roles in the cellular control of biological information that is encoded in DNA. The modifications of RNA span all three phylogenetic domains (Archaea, Bacteria, and Eukarya) and are pervasive across RNA types, including messenger RNA (mRNA), transfer RNA (tRNA), ribosomal RNA (rRNA), and (less frequently) small nuclear RNA (snRNA) and microRNA (miRNA). Nucleotide modifications are also one of the most evolutionarily conserved properties of RNAs, and the sites of modification are under strong selective pressure. However, many of these modifications, as well as their prevalence and impact, have only recently been discovered. Here, we examine both labile and permanent modifications, from simple methylation to complex transcript alteration (RNA editing and intron retention); detail the models for their processing; and highlight remaining questions in the field of the epitranscriptome.

  10. Regulatory Circuit of Human MicroRNA Biogenesis

    PubMed Central

    Lee, Ji; Li, Zhihua; Brower-Sinning, Rachel; John, Bino

    2007-01-01

    miRNAs (microRNAs) are a class of endogenous small RNAs that are thought to negatively regulate protein production. Aberrant expression of many miRNAs is linked to cancer and other diseases. Little is known about the factors that regulate the expression of miRNAs. We have identified numerous regulatory elements upstream of miRNA genes that are likely to be essential to the transcriptional and posttranscriptional regulation of miRNAs. Newly identified regulatory motifs occur frequently and in multiple copies upstream of miRNAs. The motifs are highly enriched in G and C nucleotides, in comparison with the nucleotide composition of miRNA upstream sequences. Although the motifs were predicted using sequences that are upstream of miRNAs, we find that 99% of the top-predicted motifs preferentially occur within the first 500 nucleotides upstream of the transcription start sites of protein-coding genes; the observed preference in location underscores the validity and importance of the motifs identified in this study. Our study also raises the possibility that a considerable number of well-characterized, disease-associated transcription factors (TFs) of protein-coding genes contribute to the abnormal miRNA expression in diseases such as cancer. Further analysis of predicted miRNA–protein interactions lead us to hypothesize that TFs that include c-Myb, NF-Y, Sp-1, MTF-1, and AP-2α are master-regulators of miRNA expression. Our predictions are a solid starting point for the systematic elucidation of the causative basis for aberrant expression patterns of disease-related (e.g., cancer) miRNAs. Thus, we point out that focused studies of the TFs that regulate miRNAs will be paramount in developing cures for miRNA-related diseases. The identification of the miRNA regulatory motifs was facilitated by a new computational method, K-Factor. K-Factor predicts regulatory motifs in a set of functionally related sequences, without relying on evolutionary conservation. PMID:17447837

  11. 7SK small nuclear RNA, a multifunctional transcriptional regulatory RNA with gene-specific features.

    PubMed

    Egloff, Sylvain; Studniarek, Cécilia; Kiss, Tamás

    2017-08-18

    The 7SK small nuclear RNA is a multifunctional transcriptional regulatory RNA that controls the nuclear activity of the positive transcription elongation factor b (P-TEFb), specifically targets P-TEFb to the promoter regions of selected protein-coding genes and promotes transcription of RNA polymerase II-specific spliceosomal small nuclear RNA genes.

  12. Movement of regulatory RNA between animal cells

    PubMed Central

    Jose, Antony M.

    2015-01-01

    Summary Recent studies suggest that RNA can move from one cell to another and regulate genes through specific base-pairing. Mechanisms that modify or select RNA for secretion from a cell are unclear. Secreted RNA can be stable enough to be detected in the extracellular environment and can enter the cytosol of distant cells to regulate genes. Mechanisms that import RNA into the cytosol of an animal cell can enable uptake of RNA from many sources including other organisms. This role of RNA is akin to that of steroid hormones, which cross cell membranes to regulate genes. The potential diagnostic use of RNA in human extracellular fluids has ignited interest in understanding mechanisms that enable the movement of RNA between animal cells. Genetic model systems will be essential to gain more confidence in proposed mechanisms of RNA transport and to connect an extracellular RNA with a specific biological function. Studies in the worm C. elegans and in other animals have begun to reveal parts of this novel mechanism of cell-to-cell communication. Here, I summarize the current state of this nascent field, highlight the many unknowns, and suggest future directions. PMID:26138457

  13. MicroRNA-mediated regulatory circuits: outlook and perspectives

    NASA Astrophysics Data System (ADS)

    Cora', Davide; Re, Angela; Caselle, Michele; Bussolino, Federico

    2017-08-01

    MicroRNAs have been found to be necessary for regulating genes implicated in almost all signaling pathways, and consequently their dysfunction influences many diseases, including cancer. Understanding of the complexity of the microRNA-mediated regulatory network has grown in terms of size, connectivity and dynamics with the development of computational and, more recently, experimental high-throughput approaches for microRNA target identification. Newly developed studies on recurrent microRNA-mediated circuits in regulatory networks, also known as network motifs, have substantially contributed to addressing this complexity, and therefore to helping understand the ways by which microRNAs achieve their regulatory role. This review provides a summarizing view of the state-of-the-art, and perspectives of research efforts on microRNA-mediated regulatory motifs. In this review, we discuss the topological properties characterizing different types of circuits, and the regulatory features theoretically enabled by such properties, with a special emphasis on examples of circuits typifying their biological significance in experimentally validated contexts. Finally, we will consider possible future developments, in particular regarding microRNA-mediated circuits involving long non-coding RNAs and epigenetic regulators.

  14. MicroRNA-mediated regulatory circuits: outlook and perspectives.

    PubMed

    Cora', Davide; Re, Angela; Caselle, Michele; Bussolino, Federico

    2017-06-06

    MicroRNAs have been found to be necessary for regulating genes implicated in almost all signaling pathways, and consequently their dysfunction influences many diseases, including cancer. Understanding of the complexity of the microRNA-mediated regulatory network has grown in terms of size, connectivity and dynamics with the development of computational and, more recently, experimental high-throughput approaches for microRNA target identification. Newly developed studies on recurrent microRNA-mediated circuits in regulatory networks, also known as network motifs, have substantially contributed to addressing this complexity, and therefore to helping understand the ways by which microRNAs achieve their regulatory role. This review provides a summarizing view of the state-of-the-art, and perspectives of research efforts on microRNA-mediated regulatory motifs. In this review, we discuss the topological properties characterizing different types of circuits, and the regulatory features theoretically enabled by such properties, with a special emphasis on examples of circuits typifying their biological significance in experimentally validated contexts. Finally, we will consider possible future developments, in particular regarding microRNA-mediated circuits involving long non-coding RNAs and epigenetic regulators.

  15. Structural imprints in vivo decode RNA regulatory mechanisms

    NASA Astrophysics Data System (ADS)

    Spitale, Robert C.; Flynn, Ryan A.; Zhang, Qiangfeng Cliff; Crisalli, Pete; Lee, Byron; Jung, Jong-Wha; Kuchelmeister, Hannes Y.; Batista, Pedro J.; Torre, Eduardo A.; Kool, Eric T.; Chang, Howard Y.

    2015-03-01

    Visualizing the physical basis for molecular behaviour inside living cells is a great challenge for biology. RNAs are central to biological regulation, and the ability of RNA to adopt specific structures intimately controls every step of the gene expression program. However, our understanding of physiological RNA structures is limited; current in vivo RNA structure profiles include only two of the four nucleotides that make up RNA. Here we present a novel biochemical approach, in vivo click selective 2'-hydroxyl acylation and profiling experiment (icSHAPE), which enables the first global view, to our knowledge, of RNA secondary structures in living cells for all four bases. icSHAPE of the mouse embryonic stem cell transcriptome versus purified RNA folded in vitro shows that the structural dynamics of RNA in the cellular environment distinguish different classes of RNAs and regulatory elements. Structural signatures at translational start sites and ribosome pause sites are conserved from in vitro conditions, suggesting that these RNA elements are programmed by sequence. In contrast, focal structural rearrangements in vivo reveal precise interfaces of RNA with RNA-binding proteins or RNA-modification sites that are consistent with atomic-resolution structural data. Such dynamic structural footprints enable accurate prediction of RNA-protein interactions and N6-methyladenosine (m6A) modification genome wide. These results open the door for structural genomics of RNA in living cells and reveal key physiological structures controlling gene expression.

  16. Modernizing the Regulatory System for Biotechnology Products

    EPA Pesticide Factsheets

    This Web page describes the continuing effort to modernize the federal regulatory system for biotechnology products as well as clarify various roles of EPA, FDA and USDA in evaluating new biotechnology products.

  17. Recurrent rewiring and emergence of RNA regulatory networks.

    PubMed

    Wilinski, Daniel; Buter, Natascha; Klocko, Andrew D; Lapointe, Christopher P; Selker, Eric U; Gasch, Audrey P; Wickens, Marvin

    2017-04-04

    Alterations in regulatory networks contribute to evolutionary change. Transcriptional networks are reconfigured by changes in the binding specificity of transcription factors and their cognate sites. The evolution of RNA-protein regulatory networks is far less understood. The PUF (Pumilio and FBF) family of RNA regulatory proteins controls the translation, stability, and movements of hundreds of mRNAs in a single species. We probe the evolution of PUF-RNA networks by direct identification of the mRNAs bound to PUF proteins in budding and filamentous fungi and by computational analyses of orthologous RNAs from 62 fungal species. Our findings reveal that PUF proteins gain and lose mRNAs with related and emergent biological functions during evolution. We demonstrate at least two independent rewiring events for PUF3 orthologs, independent but convergent evolution of PUF4/5 binding specificity and the rewiring of the PUF4/5 regulons in different fungal lineages. These findings demonstrate plasticity in RNA regulatory networks and suggest ways in which their rewiring occurs.

  18. Current status of herbal product: Regulatory overview.

    PubMed

    Sharma, Sanjay

    2015-01-01

    A review of the regulatory status of herbal drugs/products was done for few countries forming part of Asia, Africa, America, Europe, and Australia, to understand various categories under which the trade of herbal products is permitted and their premarketing requirements. A critical assessment was done, to know the hindrances in the process of harmonization of herbal products. It has been found that there is a lack of harmonization in the regulatory requirements of herbal products internationally, besides the issues of availability of herbs and their conservation. These are hindering the international trade and growth of the herbal products segment.

  19. Current status of herbal product: Regulatory overview

    PubMed Central

    Sharma, Sanjay

    2015-01-01

    A review of the regulatory status of herbal drugs/products was done for few countries forming part of Asia, Africa, America, Europe, and Australia, to understand various categories under which the trade of herbal products is permitted and their premarketing requirements. A critical assessment was done, to know the hindrances in the process of harmonization of herbal products. It has been found that there is a lack of harmonization in the regulatory requirements of herbal products internationally, besides the issues of availability of herbs and their conservation. These are hindering the international trade and growth of the herbal products segment. PMID:26681886

  20. Regulatory RNA design through evolutionary computation and strand displacement.

    PubMed

    Rostain, William; Landrain, Thomas E; Rodrigo, Guillermo; Jaramillo, Alfonso

    2015-01-01

    The discovery and study of a vast number of regulatory RNAs in all kingdoms of life over the past decades has allowed the design of new synthetic RNAs that can regulate gene expression in vivo. Riboregulators, in particular, have been used to activate or repress gene expression. However, to accelerate and scale up the design process, synthetic biologists require computer-assisted design tools, without which riboregulator engineering will remain a case-by-case design process requiring expert attention. Recently, the design of RNA circuits by evolutionary computation and adapting strand displacement techniques from nanotechnology has proven to be suited to the automated generation of DNA sequences implementing regulatory RNA systems in bacteria. Herein, we present our method to carry out such evolutionary design and how to use it to create various types of riboregulators, allowing the systematic de novo design of genetic control systems in synthetic biology.

  1. Identification of miRNAs and miRNA-mediated regulatory pathways in Carica papaya.

    PubMed

    Liang, Gang; Li, Yang; He, Hua; Wang, Fang; Yu, Diqiu

    2013-10-01

    Plant microRNAs (miRNAs) post-transcriptionally regulate target gene expression to modulate growth and development and biotic and abiotic stress responses. By analyzing small RNA deep sequencing data in combination with the genome sequence, we identified 75 conserved miRNAs and 11 novel miRNAs. Their target genes were also predicted. For most conserved miRNAs, the miRNA-target pairs were conserved across plant species. In addition to these conserved miRNA-target pairs, we also identified some papaya-specific miRNA-target regulatory pathways. Both miR168 and miR530 target the Argonaute 1 gene, indicating a second autoregulatory mechanism for miRNA regulation. A non-conserved miRNA was mapped within an intron of Dicer-like 1 (DCL1), suggesting a conserved homeostatic autoregulatory mechanism for DCL1 expression. A 21-nt miRNA triggers secondary siRNA production from its target genes, nucleotide-binding site leucine-rich repeat protein genes. Certain phased-miRNAs were processed from their conserved miRNA precursors, indicating a putative miRNA evolution mechanism. In addition, we identified a Carica papaya-specific miRNA that targets an ethylene receptor gene, implying its function in the ethylene signaling pathway. This work will also advance our understanding of miRNA functions and evolution in plants.

  2. Identification of common microRNA-mRNA regulatory biomodules in human epithelial cancers

    PubMed Central

    Yang, Xinan; Lee, Younghee; Fan, Hong; Sun, Xiao; Lussier, Yves A

    2010-01-01

    The complex regulatory network between microRNAs and gene expression remains unclear domain of active research. We proposed to address in part this complex regulation with a novel approach for the genome-wide identification of biomodules derived from paired microRNA and mRNA profiles, which could reveal correlations associated with a complex network of de-regulation in human cancer. Two published expression datasets for 68 samples with 11 distinct types of epithelial cancers and 21 samples of normal tissues were used, containing microRNA expression (Lu et al. Nature Letters 2005) and gene expression (Ramaswarmy et al. PNAS 2001) profiles, respectively. As results, the microRNA expression used jointly with mRNA expression can provide better classifiers of epithelial cancers against normal epithelial tissue than either dataset alone (p=1×10-10, F-Test). We identified a combination of six microRNA-mRNA biomodules that optimally classified epithelial cancers from normal epithelial tissue (total accuracy = 93.3%; 95% confidence intervals: 86% - 97%), using penalized logistic regression (PLR) algorithm and three-fold cross-validation. Three of these biomodules are individually sufficient to cluster epithelial cancers from normal tissue using mutual information distance. The biomodules contain 10 distinct microRNAs and 98 distinct genes, including well known tumor markers such as miR-15a, miR-30e, IRAK1, TGFBR2, DUSP16, CDC25B and PDCD2. In addition, there is a significant enrichment (Fisher’s exact test p=3×10-10) between putative microRNA-target gene pairs reported in five microRNA target databases and the inversely correlated micro-RNA-mRNA pairs in the biomodules. Further, microRNAs and genes in the biomodules were found in abstracts mentioning epithelial cancers (Fisher Exact Test, unadjusted p<0.05). Taken together, these results strongly suggest that the discovered microRNA-mRNA biomodules correspond to regulatory mechanisms common to human epithelial cancer

  3. The Spot 42 RNA: A regulatory small RNA with roles in the central metabolism

    PubMed Central

    Bækkedal, Cecilie; Haugen, Peik

    2015-01-01

    The Spot 42 RNA is a 109 nucleotide long (in Escherichia coli) noncoding small regulatory RNA (sRNA) encoded by the spf (spot fourty-two) gene. spf is found in gamma-proteobacteria and the majority of experimental work on Spot 42 RNA has been performed using E. coli, and recently Aliivibrio salmonicida. In the cell Spot 42 RNA plays essential roles as a regulator in carbohydrate metabolism and uptake, and its expression is activated by glucose, and inhibited by the cAMP-CRP complex. Here we summarize the current knowledge on Spot 42, and present the natural distribution of spf, show family-specific secondary structural features of Spot 42, and link highly conserved structural regions to mRNA target binding. PMID:26327359

  4. Coordinated activities of human dicer domains in regulatory RNA processing.

    PubMed

    Ma, Enbo; Zhou, Kaihong; Kidwell, Mary Anne; Doudna, Jennifer A

    2012-09-28

    The conserved ribonuclease Dicer generates microRNAs and short-interfering RNAs that guide gene silencing in eukaryotes. The specific contributions of human Dicer's structural domains to RNA product length and substrate preference are incompletely understood, due in part to the difficulties of Dicer purification. Here, we show that active forms of human Dicer can be assembled from recombinant polypeptides expressed in bacteria. Using this system, we find that three distinct modes of RNA recognition give rise to Dicer's fidelity and product length specificity. The first involves anchoring one end of a double-stranded RNA helix within the PAZ domain, which can assemble in trans with Dicer's catalytic domains to reconstitute an accurate but non-substrate-selective dicing activity. The second entails nonspecific RNA binding by the double-stranded RNA binding domain, an interaction that is essential for substrate recruitment in the absence of the PAZ domain. The third mode of recognition involves hairpin RNA loop recognition by the helicase domain, which ensures efficient processing of specific substrates. These results reveal distinct interactions of each Dicer domain with different RNA structural features and provide a facile system for investigating the molecular mechanisms of human microRNA biogenesis.

  5. Regulatory aspects of total product life cycle.

    PubMed

    Hausman, Ethan D; Altaie, Sousan S

    2004-12-01

    Total Product Life Cycle (TPLC) is a conceptual framework for assessing any product or service (medical or otherwise). This article will address how the Center for Devices and Radiological Health of the U.S. Food and Drug Administration utilizes TPLC in a regulatory paradigm. TPLC will help guide the regulation of market-driven evolution of medical devices and radiation-emitting products from conception, through pre-market development, to widespread market use, and finally to obsolescence and replacement by subsequent generations of products.

  6. Regulatory Roles for Long ncRNA and mRNA

    PubMed Central

    Karapetyan, Armen R.; Buiting, Coen; Kuiper, Renske A.; Coolen, Marcel W.

    2013-01-01

    Recent advances in high-throughput sequencing technology have identified the transcription of a much larger portion of the genome than previously anticipated. Especially in the context of cancer it has become clear that aberrant transcription of both protein-coding and long non-coding RNAs (lncRNAs) are frequent events. The current dogma of RNA function describes mRNA to be responsible for the synthesis of proteins, whereas non-coding RNA can have regulatory or epigenetic functions. However, this distinction between protein coding and regulatory ability of transcripts may not be that strict. Here, we review the increasing body of evidence for the existence of multifunctional RNAs that have both protein-coding and trans-regulatory roles. Moreover, we demonstrate that coding transcripts bind to components of the Polycomb Repressor Complex 2 (PRC2) with similar affinities as non-coding transcripts, revealing potential epigenetic regulation by mRNAs. We hypothesize that studies on the regulatory ability of disease-associated mRNAs will form an important new field of research. PMID:24216986

  7. Cis-regulatory RNA elements that regulate specialized ribosome activity

    PubMed Central

    Xue, Shifeng; Barna, Maria

    2015-01-01

    Recent evidence has shown that the ribosome itself can play a highly regulatory role in the specialized translation of specific subpools of mRNAs, in particular at the level of ribosomal proteins (RP). However, the mechanism(s) by which this selection takes place has remained poorly understood. In our recent study, we discovered a combination of unique RNA elements in the 5′UTRs of mRNAs that allows for such control by the ribosome. These mRNAs contain a Translation Inhibitory Element (TIE) that inhibits general cap-dependent translation, and an Internal Ribosome Entry Site (IRES) that relies on a specific RP for activation. The unique combination of an inhibitor of general translation and an activator of specialized translation is key to ribosome-mediated control of gene expression. Here we discuss how these RNA regulatory elements provide a new level of control to protein expression and their implications for gene expression, organismal development and evolution. PMID:26327194

  8. Integrated analysis of miRNA and mRNA during differentiation of human CD34+ cells delineates the regulatory roles of microRNA in hematopoiesis.

    PubMed

    Raghavachari, Nalini; Liu, Poching; Barb, Jennifer J; Yang, Yanqin; Wang, Richard; Nguyen, Quang Tri; Munson, Peter J

    2014-01-01

    In the process of human hematopoiesis, precise regulation of the expression of lineage-specific gene products is critical for multiple cell-fate decisions that govern cell differentiation, proliferation, and self-renewal. Given the important role of microRNAs (miRNAs) in development and differentiation, we examined the global expression of miRNA in CD34(+) cells during lineage specific hematopoiesis and found 49 miRNAs to be differentially expressed, with functional roles in cellular growth and proliferation, and apoptosis. miR-18a was upregulated during erythropoiesis and downregulated during megakaryopoiesis. miR-145 was upregulated during granulopoiesis and down regulated during erythropoiesis. Megakaryopoitic differentiation resulted in significant alteration in the expression of many miRNAs that are believed to play critical roles in the regulation of B and T cell differentiation. Target prediction analyses on three different miRNA databases indicated that TargetScan outperformed microCosm and miRDB in identifying potential miRNA targets associated with hematopoietic differentiation process. An integrated analysis of the observed miRNAs and messenger RNAs (mRNAs) resulted in 87 highly correlated miRNA-mRNA pairs that have major functional roles in cellular growth and proliferation, hematopoietic system development, and Wnt/B-catenin and Flt 3 signaling pathways. We believe that this study will enhance our understanding on the regulatory roles of miRNA in hematopoiesis by providing a library of mRNA-miRNA networks.

  9. Powerplant productivity improvements and regulatory incentives

    SciTech Connect

    Hardy, D; Brown, D

    1980-10-27

    The purpose of this study was to examine the benefits to be gained from increased powerplant productivity and to validate and demonstrate the use of incentives within the regulatory process to promote the improvement of powerplant productivity. The system-wide costs savings to be gained from given productivity improvement scenarios are estimated in both the short and long term. Numerous reports and studies exist which indicate that productivity improvements at the powerplant level are feasible and cost effective. The efforts of this study widen this focus and relate system-wide productivity improvements with system-wide cost savings. The initial thrust of the regulatory section of this study is to validate the existence of reasonable incentive procedures which would enable regulatory agencies to better motivate electric utilities to improve productivity on both the powerplant and system levels. The voluntary incentive format developed in this study was designed to facilitate the link between profit and efficiency which is typically not clear in most regulated market environments. It is concluded that at the present time, many electric utilities in this country could significantly increase the productivity of their base load units, and the adoption of an incentive program of the general type recommended in this study would add to rate of return regulation the needed financial incentives to enable utilities to make such improvements without losing long-run profit. In light of the upcoming oil import target levels and mandatory cutbacks of oil and gas as boiler fuels for electric utilities, the use of incentive programs to encourage more efficient utilization of coal and nuclear base load capacity will become far more inviting over the next two decades.

  10. National Strategy for Modernizing the Regulatory System for Biotechnology Products

    EPA Pesticide Factsheets

    This National Strategy for Modernizing the Regulatory System for Biotechnology Products sets forth a vision for ensuring that the federal regulatory system is prepared to efficiently assess the risks, if any, of the future products of biotechnology.

  11. Deep sequencing of RNA from immune cell-derived vesicles uncovers the selective incorporation of small non-coding RNA biotypes with potential regulatory functions

    PubMed Central

    Nolte-’t Hoen, Esther N. M.; Buermans, Henk P. J.; Waasdorp, Maaike; Stoorvogel, Willem; Wauben, Marca H. M.; ’t Hoen, Peter A. C.

    2012-01-01

    Cells release RNA-carrying vesicles and membrane-free RNA/protein complexes into the extracellular milieu. Horizontal vesicle-mediated transfer of such shuttle RNA between cells allows dissemination of genetically encoded messages, which may modify the function of target cells. Other studies used array analysis to establish the presence of microRNAs and mRNA in cell-derived vesicles from many sources. Here, we used an unbiased approach by deep sequencing of small RNA released by immune cells. We found a large variety of small non-coding RNA species representing pervasive transcripts or RNA cleavage products overlapping with protein coding regions, repeat sequences or structural RNAs. Many of these RNAs were enriched relative to cellular RNA, indicating that cells destine specific RNAs for extracellular release. Among the most abundant small RNAs in shuttle RNA were sequences derived from vault RNA, Y-RNA and specific tRNAs. Many of the highly abundant small non-coding transcripts in shuttle RNA are evolutionary well-conserved and have previously been associated to gene regulatory functions. These findings allude to a wider range of biological effects that could be mediated by shuttle RNA than previously expected. Moreover, the data present leads for unraveling how cells modify the function of other cells via transfer of specific non-coding RNA species. PMID:22821563

  12. Identify signature regulatory network for glioblastoma prognosis by integrative mRNA and miRNA co-expression analysis.

    PubMed

    Bing, Zhi-Tong; Yang, Guang-Hui; Xiong, Jie; Guo, Ling; Yang, Lei

    2016-12-01

    Glioblastoma multiforme (GBM) is the most common and aggressive type of primary brain tumor in adults. Patients with this disease have a poor prognosis. The objective of this study is to identify survival-related individual genes (or miRNAs) and miRNA -mRNA pairs in GBM using a multi-step approach. First, the weighted gene co-expression network analysis and survival analysis are applied to identify survival-related modules from mRNA and miRNA expression profiles, respectively. Subsequently, the role of individual genes (or miRNAs) within these modules in GBM prognosis are highlighted using survival analysis. Finally, the integration analysis of miRNA and mRNA expression as well as miRNA target prediction is used to identify survival-related miRNA -mRNA regulatory network. In this study, five genes and two miRNA modules that significantly correlated to patient's survival. In addition, many individual genes (or miRNAs) assigned to these modules were found to be closely linked with survival. For instance, increased expression of neuropilin-1 gene (a member of module turquoise) indicated poor prognosis for patients and a group of miRNA -mRNA regulatory networks that comprised 38 survival-related miRNA -mRNA pairs. These findings provide a new insight into the underlying molecular regulatory mechanisms of GBM.

  13. Structure of an RNA dimer of a regulatory element from human thymidylate synthase mRNA

    SciTech Connect

    Dibrov, Sergey; McLean, Jaime; Hermann, Thomas

    2011-09-27

    A sequence around the start codon of the mRNA of human thymidylate synthase (TS) folds into a secondary-structure motif in which the initiation site is sequestered in a metastable hairpin. Binding of the protein to its own mRNA at the hairpin prevents the production of TS through a translation-repression feedback mechanism. Stabilization of the mRNA hairpin by other ligands has been proposed as a strategy to reduce TS levels in anticancer therapy. Rapidly proliferating cells require high TS activity to maintain the production of thymidine as a building block for DNA synthesis. The crystal structure of a model oligonucleotide (TS1) that represents the TS-binding site of the mRNA has been determined. While fluorescence studies showed that the TS1 RNA preferentially adopts a hairpin structure in solution, even at high RNA concentrations, an asymmetric dimer of two hybridized TS1 strands was obtained in the crystal. The TS1 dimer contains an unusual S-turn motif that also occurs in the 'off' state of the human ribosomal decoding site RNA.

  14. Regulatory Requirements for PET Drug Production.

    PubMed

    Schwarz, Sally W; Dick, David; VanBrocklin, Henry F; Hoffman, John M

    2014-07-01

    The Food and Drug Administration (FDA) issued the final rule for title 21 of Code of Federal Regulations part 212 regarding the regulations on current good manufacturing practice for PET drugs. The regulations are intended to ensure that PET drugs meet the safety and quality assurance requirements of the Federal Food, Drug, and Cosmetic Act. The new regulation became effective December 12, 2011, but the FDA used regulatory discretion to allow new drug applications and abbreviated new drug applications to be filed until June 12, 2012, without interruption of the existing PET drug production for human use. The production of PET drugs for both clinical use and clinical research use are outlined in this continuing education module, including an overview of specific requirements for compliance. Additionally, FDA preapproval inspections and postapproval reporting requirements are reviewed. © 2014 by the Society of Nuclear Medicine and Molecular Imaging, Inc.

  15. Epigenetic engineering of ribosomal RNA genes enhances protein production.

    PubMed

    Santoro, Raffaella; Lienemann, Philipp; Fussenegger, Martin

    2009-08-14

    Selection of mammalian high-producer cell lines remains a major challenge for the biopharmaceutical manufacturing industry. Ribosomal RNA (rRNA) genes encode the major component of the ribosome but many rRNA gene copies are not transcribed due to epigenetic silencing by the nucleolar remodelling complex (NoRC) [6], which may limit the cell's full production capacity. Here we show that the knockdown of TIP5, a subunit of NoRC, decreases the number of silent rRNA genes, upregulates rRNA transcription, enhances ribosome synthesis and increases production of recombinant proteins. However, general enhancement of rRNA transcription rate did not stimulate protein synthesis. Our data demonstrates that the number of transcriptionally competent rRNA genes limits efficient ribosome synthesis. Epigenetic engineering of ribosomal RNA genes offers new possibilities for improving biopharmaceutical manufacturing and provides novel insights into the complex regulatory network which governs the translation machinery in normal cellular processes as well as in pathological conditions like cancer.

  16. Yersinia pestis and Yersinia pseudotuberculosis infection: a regulatory RNA perspective

    PubMed Central

    Martínez-Chavarría, Luary C.; Vadyvaloo, Viveka

    2015-01-01

    Yersinia pestis, responsible for causing fulminant plague, has evolved clonally from the enteric pathogen, Y. pseudotuberculosis, which in contrast, causes a relatively benign enteric illness. An ~97% nucleotide identity over 75% of their shared protein coding genes is maintained between these two pathogens, leaving much conjecture regarding the molecular determinants responsible for producing these vastly different disease etiologies, host preferences and transmission routes. One idea is that coordinated production of distinct factors required for host adaptation and virulence in response to specific environmental cues could contribute to the distinct pathogenicity distinguishing these two species. Small non-coding RNAs that direct posttranscriptional regulation have recently been identified as key molecules that may provide such timeous expression of appropriate disease enabling factors. Here the burgeoning field of small non-coding regulatory RNAs in Yersinia pathogenesis is reviewed from the viewpoint of adaptive colonization, virulence and divergent evolution of these pathogens. PMID:26441890

  17. Changes of microRNA profile and microRNA-mRNA regulatory network in bones of ovariectomized mice.

    PubMed

    An, Jee Hyun; Ohn, Jung Hun; Song, Jung Ah; Yang, Jae-Yeon; Park, Hyojung; Choi, Hyung Jin; Kim, Sang Wan; Kim, Seong Yeon; Park, Woog-Yang; Shin, Chan Soo

    2014-03-01

    Growing evidence shows the possibility of a role of microRNAs (miRNA) in regulating bone mass. We investigated the change of miRNAs and mRNA expression profiles in bone tissue in an ovariectomized mice model and evaluated the regulatory mechanism of bone mass mediated by miRNAs in an estrogen-deficiency state. Eight-week-old female C3H/HeJ mice underwent ovariectomy (OVX) or sham operation (Sham-op), and their femur and tibia were harvested to extract total bone RNAs after 4 weeks for microarray analysis. Eight miRNAs (miR-127, -133a, -133a*, -133b, -136, -206, -378, -378*) were identified to be upregulated after OVX, whereas one miRNA (miR-204) was downregulated. Concomitant analysis of mRNA microarray revealed that 658 genes were differentially expressed between OVX and Sham-op mice. Target prediction of differentially expressed miRNAs identified potential targets, and integrative analysis using the mRNA microarray results showed that PPARγ and CREB pathways are activated in skeletal tissues after ovariectomy. Among the potential candidates of miRNA, we further studied the role of miR-127 in vitro, which exhibited the greatest changes after OVX. We also studied the effects of miR-136, which has not been studied in the context of bone mass regulation. Transfection of miR-127 inhibitor has enhanced osteoblastic differentiation in UAMS-32 cells as measured by alkaline phosphatase activities and mRNA expression of osteoblast-specific genes, whereas miR-136 precursor has inhibited osteoblastic differentiation. Furthermore, transfection of both miR-127 and miR-136 inhibitors enhanced the osteocyte-like morphological changes and survival in MLO-Y4 cells, whereas precursors of miR-127 and -136 have aggravated dexamethasone-induced cell death. Both of the precursors enhanced osteoclastic differentiation in bone marrow macrophages, indicating that both miR-127 and -136 are negatively regulating bone mass. Taken together, these results suggest a novel insight into the

  18. What's the Regulatory Value of a Target Product Profile?

    PubMed

    Breder, Christopher D; Du, Wenny; Tyndall, Adria

    2017-07-01

    Target product profiles (TPPs) are used as a regulatory tool for dialog on clinical development or manufacturing plans. Drugs and biologics approved by the FDA that mention TPPs are associated with more efficient regulatory review times, perhaps as a result of increased planning or because the TPP promotes well-organized regulatory dialog. Published by Elsevier Ltd.

  19. Antibody production by in vivo RNA transfection.

    PubMed

    Romani, Bizhan; Kavyanifard, Amirarsalan; Allahbakhshi, Elham

    2017-09-07

    Monoclonal antibodies have a variety of applications in research and medicine. Here, we report development of a new method for production of monoclonal antibodies. Our method relies on in vivo RNA transfection rather than peptide vaccination. We took advantage of RNA transcripts complexed with DOTMA and DOPE lipids to transfect mice. Intravenous administration of our RNA vaccine to mice resulted in expression of the antigenic peptides by splenic dendritic cells and detection of the antigens in the serum. The RNA vaccine stimulated production of specific antibodies against the RNA-encoded peptides. We produced monoclonal antibodies against viral, bacterial, and human antigens. In addition, we showed that our RNA vaccine stimulated humoral immunity and rescued mice infected with influenza A virus. Our method could be used as an efficient tool to generate monoclonal antibodies and to stimulate humoral immunity for research and medical purposes.

  20. Identification of high-confidence RNA regulatory elements by combinatorial classification of RNA-protein binding sites.

    PubMed

    Li, Yang Eric; Xiao, Mu; Shi, Binbin; Yang, Yu-Cheng T; Wang, Dong; Wang, Fei; Marcia, Marco; Lu, Zhi John

    2017-09-08

    Crosslinking immunoprecipitation sequencing (CLIP-seq) technologies have enabled researchers to characterize transcriptome-wide binding sites of RNA-binding protein (RBP) with high resolution. We apply a soft-clustering method, RBPgroup, to various CLIP-seq datasets to group together RBPs that specifically bind the same RNA sites. Such combinatorial clustering of RBPs helps interpret CLIP-seq data and suggests functional RNA regulatory elements. Furthermore, we validate two RBP-RBP interactions in cell lines. Our approach links proteins and RNA motifs known to possess similar biochemical and cellular properties and can, when used in conjunction with additional experimental data, identify high-confidence RBP groups and their associated RNA regulatory elements.

  1. Deciphering RNA Regulatory Elements Involved in the Developmental and Environmental Gene Regulation of Trypanosoma brucei.

    PubMed

    Gazestani, Vahid H; Salavati, Reza

    2015-01-01

    Trypanosoma brucei is a vector-borne parasite with intricate life cycle that can cause serious diseases in humans and animals. This pathogen relies on fine regulation of gene expression to respond and adapt to variable environments, with implications in transmission and infectivity. However, the involved regulatory elements and their mechanisms of actions are largely unknown. Here, benefiting from a new graph-based approach for finding functional regulatory elements in RNA (GRAFFER), we have predicted 88 new RNA regulatory elements that are potentially involved in the gene regulatory network of T. brucei. We show that many of these newly predicted elements are responsive to both transcriptomic and proteomic changes during the life cycle of the parasite. Moreover, we found that 11 of predicted elements strikingly resemble previously identified regulatory elements for the parasite. Additionally, comparison with previously predicted motifs on T. brucei suggested the superior performance of our approach based on the current limited knowledge of regulatory elements in T. brucei.

  2. Regulatory mechanisms of exoribonuclease PNPase and regulatory small RNA on T3SS of dickeya dadantii

    USDA-ARS?s Scientific Manuscript database

    The type III secretion system (T3SS) is an essential virulence factor for many bacterial pathogens. Polynucleotide phosphorylase (PNPase) is one of the major exoribonucleases in bacteria and plays important roles in mRNA degradation, tRNA processing, and small RNA (sRNA) turnover. In this study, we ...

  3. Regulatory mechanisms in arterial hypertension: role of microRNA in pathophysiology and therapy.

    PubMed

    Klimczak, Dominika; Jazdzewski, Krystian; Kuch, Marek

    2017-02-01

    Multiple factors underlie the pathophysiology of hypertension, involving endothelial dysregulation, vascular smooth muscle dysfunction, increased oxidative stress, sympathetic nervous system activation and altered renin -angiotensin -aldosterone regulatory activity. A class of non-coding RNA called microRNA, consisting of 17-25 nucleotides, exert regulatory function over these processes. This paper summarizes the currently available data from preclinical and clinical studies on miRNA in the development of hypertension as well as the impact of anti-hypertensive treatment on their plasma expression. We present microRNAs' characteristics, their biogenesis and role in the regulation of blood pressure together with their potential diagnostic and therapeutic application in clinical practice.

  4. Expression of natural killer cell regulatory microRNA by uveal melanoma cancer stem cells.

    PubMed

    Joshi, Powrnima; Kooshki, Mitra; Aldrich, Wayne; Varghai, Daniel; Zborowski, Maciej; Singh, Arun D; Triozzi, Pierre L

    2016-12-01

    Natural killer (NK) cells are implicated in the control of metastasis in uveal melanoma, a process that has been ascribed to its cancer stem cell subpopulation. NK cell activation is regulated by specific microRNA (miR). The NK cell sensitivity and regulatory miR production of uveal melanoma cancer stem cells was examined. Cancer stem cells enriched from aggressively metastatic MUM2B uveal melanoma cells by selecting CD271(+) cells or propagating as non-adherent spheres in stem-cell supportive were more resistant to NK cell cytolysis than cancer stem cells enriched from less aggressively metastatic OCM1 uveal melanoma cells. Both MUM2B and OCM1 cells expressed and secreted NK cell regulatory miRs, including miR 146a, 181a, 20a, and 223. MUM2B cells expressed and secreted miR-155; OCM1 cells did not. Transfecting MUM2B cells with anti-miR-155 increased NK cell sensitivity. CD271(+) cells were identified in the blood of patients with metastatic uveal melanoma and were characterized by low expression of melanocyte differentiation determinants and by the ability to form non-adherent spheres in stem-cell supportive media. These cells also expressed NK cell regulatory miRs, including miR-155. These results indicate that uveal melanoma cancer stem cells can vary in their sensitivity to NK cell lysis and their expression of NK cell regulatory miRs. Circulating CD271(+) cells from patients with metastatic uveal melanoma manifest cancer stem cell features and express miRs associated with NK cell suppression, including miR-155, that may contribute to metastatic progression.

  5. Regulatory factors governing adenosine-to-inosine (A-to-I) RNA editing.

    PubMed

    Hong, HuiQi; Lin, Jaymie Siqi; Chen, Leilei

    2015-03-31

    Adenosine-to-inosine (A-to-I) RNA editing, the most prevalent mode of transcript modification in higher eukaryotes, is catalysed by the adenosine deaminases acting on RNA (ADARs). A-to-I editing imposes an additional layer of gene regulation as it dictates various aspects of RNA metabolism, including RNA folding, processing, localization and degradation. Furthermore, editing events in exonic regions contribute to proteome diversity as translational machinery decodes inosine as guanosine. Although it has been demonstrated that dysregulated A-to-I editing contributes to various diseases, the precise regulatory mechanisms governing this critical cellular process have yet to be fully elucidated. However, integration of previous studies revealed that regulation of A-to-I editing is multifaceted, weaving an intricate network of auto- and transregulations, including the involvement of virus-originated factors like adenovirus-associated RNA. Taken together, it is apparent that tipping of any regulatory components will have profound effects on A-to-I editing, which in turn contributes to both normal and aberrant physiological conditions. A complete understanding of this intricate regulatory network may ultimately be translated into new therapeutic strategies against diseases driven by perturbed RNA editing events. Herein, we review the current state of knowledge on the regulatory mechanisms governing A-to-I editing and propose the role of other co-factors that may be involved in this complex regulatory process.

  6. A tri-component conservation strategy reveals highly confident microRNA-mRNA interactions and evolution of microRNA regulatory networks.

    PubMed

    Lin, Chen-Ching; Mitra, Ramkrishna; Zhao, Zhongming

    2014-01-01

    MicroRNAs are small non-coding RNAs that can regulate expressions of their target genes at the post-transcriptional level. In this study, we propose a tri-component strategy that combines the conservation of microRNAs, homology of mRNA coding regions, and conserved microRNA binding sites in the 3' untranslated regions to discover conserved microRNA-mRNA interactions. To validate the performance of our conservation strategy, we collected the experimentally validated microRNA-mRNA interactions from three databases as the golden standard. We found that the proposed strategy can improve the performance of existing target prediction algorithms by approximately 2-4 fold. In addition, we demonstrated that the proposed strategy could efficiently retain highly confident interactions from the intersection results of the existing algorithms and filter out the possible false positive predictions in the union one. Furthermore, this strategy can facilitate our ability to trace the homologues in different species that are targeted by the same miRNA family because it combines these three features to identify the conserved miRNA-mRNA interactions during evolution. Through an extensive application of the proposed conservation strategy to a study of the miR-1/206 regulatory network, we demonstrate that the target mRNA recruiting process could be associated with expansion of miRNA family during its evolution. We also uncovered the functional evolution of the miR-1/206 regulatory network. In this network, the early targeted genes tend to participate in more general and development-related functions. In summary, the conservation strategy is capable of helping to highlight the highly confident miRNA-mRNA interactions and can be further applied to reveal the evolutionary features of miRNA regulatory network and functions.

  7. Predicting gene regulatory networks of soybean nodulation from RNA-Seq transcriptome data

    PubMed Central

    2013-01-01

    Background High-throughput RNA sequencing (RNA-Seq) is a revolutionary technique to study the transcriptome of a cell under various conditions at a systems level. Despite the wide application of RNA-Seq techniques to generate experimental data in the last few years, few computational methods are available to analyze this huge amount of transcription data. The computational methods for constructing gene regulatory networks from RNA-Seq expression data of hundreds or even thousands of genes are particularly lacking and urgently needed. Results We developed an automated bioinformatics method to predict gene regulatory networks from the quantitative expression values of differentially expressed genes based on RNA-Seq transcriptome data of a cell in different stages and conditions, integrating transcriptional, genomic and gene function data. We applied the method to the RNA-Seq transcriptome data generated for soybean root hair cells in three different development stages of nodulation after rhizobium infection. The method predicted a soybean nodulation-related gene regulatory network consisting of 10 regulatory modules common for all three stages, and 24, 49 and 70 modules separately for the first, second and third stage, each containing both a group of co-expressed genes and several transcription factors collaboratively controlling their expression under different conditions. 8 of 10 common regulatory modules were validated by at least two kinds of validations, such as independent DNA binding motif analysis, gene function enrichment test, and previous experimental data in the literature. Conclusions We developed a computational method to reliably reconstruct gene regulatory networks from RNA-Seq transcriptome data. The method can generate valuable hypotheses for interpreting biological data and designing biological experiments such as ChIP-Seq, RNA interference, and yeast two hybrid experiments. PMID:24053776

  8. Regulatory microRNA Network Identification in Bovine Blastocyst Development

    PubMed Central

    Mestdagh, Pieter; Lefever, Steve; Van Poucke, Mario; Van Zeveren, Alex; Van Soom, Ann; Vandesompele, Jo; Peelman, Luc

    2013-01-01

    Mammalian blastocyst formation is characterized by two lineage segregations resulting in the formation of the trophectoderm, the hypoblast, and the epiblast cell lineages. Cell fate determination during these early lineage segregations is associated with changes in the expression of specific transcription factors. In addition to the transcription factor-based control, it has become clear that also microRNAs (miRNAs) play an important role in the post-transcriptional regulation of pluripotency and differentiation. To elucidate the role of miRNAs in early lineage segregation, we compared the miRNA expression in early bovine blastocysts with the more advanced stage of hatched blastocysts. Reverse transcription–quantitative PCR-based miRNA expression profiling revealed eight upregulated miRNAs (miR-127, miR-130a, miR-155, miR-196a, miR-203, miR-28, miR-29c, and miR-376a) and four downregulated miRNAs (miR-135a, miR-218, miR-335, and miR-449b) in hatched blastocysts. Through an integrative analysis of matching miRNA and mRNA expression data, candidate miRNA-mRNA interaction pairs were prioritized for validation. Using an in vitro luciferase reporter assay, we confirmed a direct interaction between miR-218 and CDH2, miR-218 and NANOG, and miR-449b and NOTCH1. By interfering with the FGF signaling pathway, we found functional evidence that miR-218, mainly expressed in the inner cell mass, regulates the NANOG expression in the bovine blastocyst in response to FGF signaling. The results of this study expand our knowledge about the miRNA signature of the bovine blastocyst and of the interactions between miRNAs and cell fate regulating transcription factors. PMID:23398486

  9. Two regulatory RNA elements affect TisB-dependent depolarization and persister formation.

    PubMed

    Berghoff, Bork A; Hoekzema, Mirthe; Aulbach, Lena; Wagner, E Gerhart H

    2017-03-01

    Bacterial survival strategies involve phenotypic diversity which is generated by regulatory factors and noisy expression of effector proteins. The question of how bacteria exploit regulatory RNAs to make decisions between phenotypes is central to a general understanding of these universal regulators. We investigated the TisB/IstR-1 toxin-antitoxin system of Escherichia coli to appreciate the role of the RNA antitoxin IstR-1 in TisB-dependent depolarization of the inner membrane and persister formation. Persisters are phenotypic variants that have become transiently drug-tolerant by arresting growth. The RNA antitoxin IstR-1 sets a threshold for TisB-dependent depolarization under DNA-damaging conditions, resulting in two sub-populations: polarized and depolarized cells. Furthermore, our data indicate that an inhibitory 5' UTR structure in the tisB mRNA serves as a regulatory RNA element that delays TisB translation to avoid inappropriate depolarization when DNA damage is low. Investigation of the persister sub-population further revealed that both regulatory RNA elements affect persister levels as well as persistence time. This work provides an intriguing example of how bacteria exploit regulatory RNAs to control phenotypic heterogeneity.

  10. Predicting miRNA Targets by Integrating Gene Regulatory Knowledge with Expression Profiles

    PubMed Central

    Zhang, Weijia; Le, Thuc Duy; Liu, Lin; Zhou, Zhi-Hua; Li, Jiuyong

    2016-01-01

    Motivation microRNAs (miRNAs) play crucial roles in post-transcriptional gene regulation of both plants and mammals, and dysfunctions of miRNAs are often associated with tumorigenesis and development through the effects on their target messenger RNAs (mRNAs). Identifying miRNA functions is critical for understanding cancer mechanisms and determining the efficacy of drugs. Computational methods analyzing high-throughput data offer great assistance in understanding the diverse and complex relationships between miRNAs and mRNAs. However, most of the existing methods do not fully utilise the available knowledge in biology to reduce the uncertainty in the modeling process. Therefore it is desirable to develop a method that can seamlessly integrate existing biological knowledge and high-throughput data into the process of discovering miRNA regulation mechanisms. Results In this article we present an integrative framework, CIDER (Causal miRNA target Discovery with Expression profile and Regulatory knowledge), to predict miRNA targets. CIDER is able to utilise a variety of gene regulation knowledge, including transcriptional and post-transcriptional knowledge, and to exploit gene expression data for the discovery of miRNA-mRNA regulatory relationships. The benefits of our framework is demonstrated by both simulation study and the analysis of the epithelial-to-mesenchymal transition (EMT) and the breast cancer (BRCA) datasets. Our results reveal that even a limited amount of either Transcription Factor (TF)-miRNA or miRNA-mRNA regulatory knowledge improves the performance of miRNA target prediction, and the combination of the two types of knowledge enhances the improvement further. Another useful property of the framework is that its performance increases monotonically with the increase of regulatory knowledge. PMID:27064982

  11. Architecture and dynamics of overlapped RNA regulatory networks.

    PubMed

    Lapointe, Christopher P; Preston, Melanie A; Wilinski, Daniel; Saunders, Harriet A J; Campbell, Zachary T; Wickens, Marvin

    2017-08-02

    A single protein can bind and regulate many mRNAs. Multiple proteins with similar specificities often bind and control overlapping sets of mRNAs. Yet, little is known about the architecture or dynamics of overlapped networks. We focused on three proteins with similar structures and related RNA-binding specificities ‒ Puf3p, Puf4p, and Puf5p of S. cerevisiae. Using RNA Tagging, we identified a "super-network" comprised of four sub-networks: Puf3p, Puf4p, and Puf5p sub-networks, and one controlled by both Puf4p and Puf5p. The architecture of individual sub-networks, and thus the super-network, are determined by competition among particular PUF proteins to bind mRNAs, their affinities for binding elements, and the abundances of the proteins. The super-network responds dramatically: the remaining network can either expand or contract. These strikingly opposite outcomes are determined by an interplay between the relative abundance of the RNAs and proteins, and their affinities for one another. The diverse interplay between overlapping RNA-protein networks provides versatile opportunities for regulation and evolution. Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  12. European regulatory tools for advanced therapy medicinal products.

    PubMed

    Flory, Egbert; Reinhardt, Jens

    2013-12-01

    Increasing scientific knowledge and technical innovations in the areas of cell biology, biotechnology and medicine resulted in the development of promising therapeutic approaches for the prevention and treatment of human diseases. Advanced therapy medicinal products (ATMPs) reflect a complex and innovative class of biopharmaceuticals as these products are highly research-driven, characterised by innovative manufacturing processes and heterogeneous with regard to their origin, type and complexity. This class of ATMP integrates gene therapy medicinal products, somatic cell therapy medicinal products and tissue engineering products and are often individualized and patient-specific products. Multiple challenges arise from the nature of ATMPs, which are often developed by micro, small and medium sized enterprises, university and academia, for whom regulatory experiences are limited and regulatory requirements are challenging. Regulatory guidance such as the reflection paper on classification of ATMPs and guidelines highlighting product-specific issues support academic research groups and pharmaceutical companies to foster the development of safe and effective ATMPs. This review provides an overview on the European regulatory aspects of ATMPs and highlights specific regulatory tools such as the ATMP classification procedure, a discussion on the hospital exemption for selected ATMPs as well as borderline issues towards transplants/transfusion products.

  13. European Regulatory Tools for Advanced Therapy Medicinal Products

    PubMed Central

    Flory, Egbert; Reinhardt, Jens

    2013-01-01

    Summary Increasing scientific knowledge and technical innovations in the areas of cell biology, biotechnology and medicine resulted in the development of promising therapeutic approaches for the prevention and treatment of human diseases. Advanced therapy medicinal products (ATMPs) reflect a complex and innovative class of biopharmaceuticals as these products are highly research-driven, characterised by innovative manufacturing processes and heterogeneous with regard to their origin, type and complexity. This class of ATMP integrates gene therapy medicinal products, somatic cell therapy medicinal products and tissue engineering products and are often individualized and patient-specific products. Multiple challenges arise from the nature of ATMPs, which are often developed by micro, small and medium sized enterprises, university and academia, for whom regulatory experiences are limited and regulatory requirements are challenging. Regulatory guidance such as the reflection paper on classification of ATMPs and guidelines highlighting product-specific issues support academic research groups and pharmaceutical companies to foster the development of safe and effective ATMPs. This review provides an overview on the European regulatory aspects of ATMPs and highlights specific regulatory tools such as the ATMP classification procedure, a discussion on the hospital exemption for selected ATMPs as well as borderline issues towards transplants/transfusion products. PMID:24474890

  14. Identifying miRNA regulatory mechanisms in preeclampsia by systems biology approaches.

    PubMed

    Biró, Orsolya; Nagy, Bálint; Rigó, János

    2017-02-01

    Preeclampsia (PE) is the major cause of maternal and fetal morbidity and mortality, affecting 3-8% of all pregnancies around the globe. miRNAs are small, noncoding RNA molecules, which negatively regulate gene expression. Abnormally expressed miRNAs contribute to pregnancy complications such as PE. The aim of our study was to find possible regulatory mechanisms by system biology approaches, which are connected to the pathogenesis of PE. We integrated publicly available miRNA and gene expression profiles and created a network from the significant miRNA-mRNA pairs with the help of MAGIA and Cytoscape softwares. Two subnetworks were expanded by adding protein-protein interactions. Differentially expressed miRNAs were identified for the evaluation of their regulatory effect. We analyzed the miRNAs and their targets using different bioinformatics tools and through literature research. Altogether, 52,603 miRNA-mRNA interactions were generated by the MAGIA web tool. The top 250 interactions were visualized and pairs with q < 0.0001 were analyzed, which included 85 nodes and 80 edges signalizing the connections between 52 regulated genes and 33 miRNAs. A total of 11 of the regulated genes are PE related and 9 of them were targeted by multiple miRNAs. A total of 8 miRNAs were associated with PE before, and 13 miRNAs regulated more than 1 mRNA. Hsa-mir-210 was the highest degree node in the network and its role in PE is well established. We identified several miRNA-mRNA regulatory mechanisms which may contribute to the pathogenesis of PE. Further investigations are needed to validate these miRNA-mRNA interactions and to enlighten the possibilities of developing potential therapeutic targets.

  15. microRNA regulatory mechanism by which PLLA aligned nanofibers influence PC12 cell differentiation

    NASA Astrophysics Data System (ADS)

    Yu, Yadong; Lü, Xiaoying; Ding, Fei

    2015-08-01

    Objective. Aligned nanofibers (AFs) are regarded as promising biomaterials in nerve tissue engineering. However, a full understanding of the biocompatibility of AFs at the molecular level is still challenging. Therefore, the present study focused on identifying the microRNA (miRNA)-mediated regulatory mechanism by which poly-L-lactic acid (PLLA) AFs influence PC12 cell differentiation. Approach. Firstly, the effects of PLLA random nanofibers (RFs)/AFs and PLLA films (control) on the biological responses of PC12 cells that are associated with neuronal differentiation were examined. Then, SOLiD sequencing and cDNA microarray were employed to profile the expressions of miRNAs and mRNAs. The target genes of the misregulated miRNAs were predicted and compared with the mRNA profile data. Functions of the matched target genes (the intersection between the predicted target genes and the experimentally-determined, misregulated genes) were analyzed. Main results. The results revealed that neurites spread in various directions in control and RF groups. In the AF group, most neurites extended in parallel with each other. The glucose consumption and lactic acid production in the RF and AF groups were higher than those in the control group. Compared with the control group, 42 and 94 miRNAs were significantly dysregulated in the RF and AF groups, respectively. By comparing the predicted target genes with the mRNA profile data, five and 87 matched target genes were found in the RF and AF groups, respectively. Three of the matched target genes in the AF group were found to be associated with neuronal differentiation, whereas none had this association in the RF group. The PLLA AFs induced the dysregulation of miRNAs that regulate many biological functions, including axonal guidance, lipid metabolism and long-term potentiation. In particular, two miRNA-matched target gene-biological function modules associated with neuronal differentiation were identified as follows: (1) miR-23b, mi

  16. Modulation of neoplastic gene regulatory pathways by the RNA-binding factor AUF1

    PubMed Central

    Zucconi, Beth E.; Wilson, Gerald M.

    2013-01-01

    The mRNA-binding protein AUF1 regulates the expression of many key players in cancer including proto-oncogenes, regulators of apoptosis and the cell cycle, and pro-inflammatory cytokines, principally by directing the decay kinetics of their encoded mRNAs. Most studies support an mRNA-destabilizing role for AUF1, although other findings suggest additional functions for this factor. In this review, we explore how changes in AUF1 isoform distribution, subcellular localization, and post-translational protein modifications can influence the metabolism of targeted mRNAs. However, several lines of evidence also support a role for AUF1 in the initiation and/or development of cancer. Many AUF1-targeted transcripts encode products that control pro- and anti-oncogenic processes. Also, overexpression of AUF1 enhances tumorigenesis in murine models, and AUF1 levels are enhanced in some tumors. Finally, signaling cascades that modulate AUF1 function are deregulated in some cancerous tissues. Together, these features suggest that AUF1 may play a prominent role in regulating the expression of many genes that can contribute to tumorigenic phenotypes, and that this post-transcriptional regulatory control point may be subverted by diverse mechanisms in neoplasia. PMID:21622178

  17. Messenger RNA fluctuations and regulatory RNAs shape the dynamics of a negative feedback loop

    NASA Astrophysics Data System (ADS)

    Rodríguez Martínez, María; Soriano, Jordi; Tlusty, Tsvi; Pilpel, Yitzhak; Furman, Itay

    2010-03-01

    Single-cell experiments of simple regulatory networks can markedly differ from cell population experiments. Such differences arise from stochastic events in individual cells that are averaged out in cell populations. For instance, while individual cells may show sustained oscillations in the concentrations of some proteins, such oscillations may appear damped in the population average. In this paper we investigate the role of RNA stochastic fluctuations as a leading force to produce a sustained excitatory behavior at the single-cell level. As opposed to some previous models, we build a fully stochastic model of a negative feedback loop that explicitly takes into account the RNA stochastic dynamics. We find that messenger RNA random fluctuations can be amplified during translation and produce sustained pulses of protein expression. Motivated by the recent appreciation of the importance of noncoding regulatory RNAs in post-transcription regulation, we also consider the possibility that a regulatory RNA transcript could bind to the messenger RNA and repress translation. Our findings show that the regulatory transcript helps reducing gene expression variability both at the single-cell level and at the cell population level.

  18. Mapping Transcription Regulatory Networks with ChIP-seq and RNA-seq.

    PubMed

    Wade, Joseph T

    2015-01-01

    Bacterial genomes encode numerous transcription factors, DNA-binding proteins that regulate transcription initiation. Identifying the regulatory targets of transcription factors is a major challenge of systems biology. Here I describe the use of two genome-scale approaches, ChIP-seq and RNA-seq, that are used to map transcription factor regulons. ChIP-seq maps the association of transcription factors with DNA, and RNA-seq determines changes in RNA levels associated with transcription factor perturbation. I discuss the strengths and weaknesses of these and related approaches, and I describe how ChIP-seq and RNA-seq can be combined to map individual transcription factor regulons and entire regulatory networks.

  19. Comparative genomics of small RNA regulatory pathway components in vector mosquitoes

    PubMed Central

    Campbell, Corey L; Black, William C; Hess, Ann M; Foy, Brian D

    2008-01-01

    Background Small RNA regulatory pathways (SRRPs) control key aspects of development and anti-viral defense in metazoans. Members of the Argonaute family of catalytic enzymes degrade target RNAs in each of these pathways. SRRPs include the microRNA, small interfering RNA (siRNA) and PIWI-type gene silencing pathways. Mosquitoes generate viral siRNAs when infected with RNA arboviruses. However, in some mosquitoes, arboviruses survive antiviral RNA interference (RNAi) and are transmitted via mosquito bite to a subsequent host. Increased knowledge of these pathways and functional components should increase understanding of the limitations of anti-viral defense in vector mosquitoes. To do this, we compared the genomic structure of SRRP components across three mosquito species and three major small RNA pathways. Results The Ae. aegypti, An. gambiae and Cx. pipiens genomes encode putative orthologs for all major components of the miRNA, siRNA, and piRNA pathways. Ae. aegypti and Cx. pipiens have undergone expansion of Argonaute and PIWI subfamily genes. Phylogenetic analyses were performed for these protein families. In addition, sequence pattern recognition algorithms MEME, MDScan and Weeder were used to identify upstream regulatory motifs for all SRRP components. Statistical analyses confirmed enrichment of species-specific and pathway-specific cis-elements over the rest of the genome. Conclusion Analysis of Argonaute and PIWI subfamily genes suggests that the small regulatory RNA pathways of the major arbovirus vectors, Ae. aegypti and Cx. pipiens, are evolving faster than those of the malaria vector An. gambiae and D. melanogaster. Further, protein and genomic features suggest functional differences between subclasses of PIWI proteins and provide a basis for future analyses. Common UCR elements among SRRP components indicate that 1) key components from the miRNA, siRNA, and piRNA pathways contain NF-kappaB-related and Broad complex transcription factor binding sites

  20. Cardiac-targeted delivery of regulatory RNA molecules and genes for the treatment of heart failure

    PubMed Central

    Poller, Wolfgang; Hajjar, Roger; Schultheiss, Heinz-Peter; Fechner, Henry

    2010-01-01

    Ribonucleic acid (RNA) in its many facets of structure and function is becoming more fully understood, and, therefore, it is possible to design and use RNAs as valuable tools in molecular biology and medicine. Understanding of the role of RNAs within the cell has changed dramatically during the past few years. Therapeutic strategies based on non-coding regulatory RNAs include RNA interference (RNAi) for the silencing of specific genes, and microRNA (miRNA) modulations to alter complex gene expression patterns. Recent progress has allowed the targeting of therapeutic RNAi to the heart for the treatment of heart failure, and we discuss current strategies in this field. Owing to the peculiar biochemical properties of small RNA molecules, the actual therapeutic translation of findings in vitro or in cell cultures is more demanding than with small molecule drugs or proteins. The critical requirement for animal studies after pre-testing of RNAi tools in vitro likewise applies for miRNA modulations, which also have complex consequences for the recipient that are dependent on stability and distribution of the RNA tools. Problems in the field that are not yet fully solved are the prediction of targets and specificity of the RNA tools as well as their tissue-specific and regulatable expression. We discuss analogies and differences between regulatory RNA therapy and classical gene therapy, since recent breakthroughs in vector technology are of importance for both. Recent years have witnessed parallel progress in the fields of gene-based and regulatory RNA-based therapies that are likely to significantly expand the cardiovascular therapeutic repertoire within the next decade. PMID:20176815

  1. Using shRNA experiments to validate gene regulatory networks.

    PubMed

    Olsen, Catharina; Fleming, Kathleen; Prendergast, Niall; Rubio, Renee; Emmert-Streib, Frank; Bontempi, Gianluca; Quackenbush, John; Haibe-Kains, Benjamin

    2015-06-01

    Quantitative validation of gene regulatory networks (GRNs) inferred from observational expression data is a difficult task usually involving time intensive and costly laboratory experiments. We were able to show that gene knock-down experiments can be used to quantitatively assess the quality of large-scale GRNs via a purely data-driven approach (Olsen et al. 2014). Our new validation framework also enables the statistical comparison of multiple network inference techniques, which was a long-standing challenge in the field. In this Data in Brief we detail the contents and quality controls for the gene expression data (available from NCBI Gene Expression Omnibus repository with accession number GSE53091) associated with our study published in Genomics (Olsen et al. 2014). We also provide R code to access the data and reproduce the analysis presented in this article.

  2. Biochemical Features and Functional Implications of the RNA-Based T-Box Regulatory Mechanism

    PubMed Central

    Gutiérrez-Preciado, Ana; Henkin, Tina M.; Grundy, Frank J.; Yanofsky, Charles; Merino, Enrique

    2009-01-01

    Summary: The T-box mechanism is a common regulatory strategy used for modulating the expression of genes of amino acid metabolism-related operons in gram-positive bacteria, especially members of the Firmicutes. T-box regulation is usually based on a transcription attenuation mechanism in which an interaction between a specific uncharged tRNA and the 5′ region of the transcript stabilizes an antiterminator structure in preference to a terminator structure, thereby preventing transcription termination. Although single T-box regulatory elements are common, double or triple T-box arrangements are also observed, expanding the regulatory range of these elements. In the present study, we predict the functional implications of T-box regulation in genes encoding aminoacyl-tRNA synthetases, proteins of amino acid biosynthetic pathways, transporters, and regulatory proteins. We also consider the global impact of the use of this regulatory mechanism on cell physiology. Novel biochemical relationships between regulated genes and their corresponding metabolic pathways were revealed. Some of the genes identified, such as the quorum-sensing gene luxS, in members of the Lactobacillaceae were not previously predicted to be regulated by the T-box mechanism. Our analyses also predict an imbalance in tRNA sensing during the regulation of operons containing multiple aminoacyl-tRNA synthetase genes or biosynthetic genes involved in pathways common to more than one amino acid. Based on the distribution of T-box regulatory elements, we propose that this regulatory mechanism originated in a common ancestor of members of the Firmicutes, Chloroflexi, Deinococcus-Thermus group, and Actinobacteria and was transferred into the Deltaproteobacteria by horizontal gene transfer. PMID:19258532

  3. Uncovering MicroRNA and Transcription Factor Mediated Regulatory Networks in Glioblastoma

    PubMed Central

    Sun, Jingchun; Gong, Xue; Purow, Benjamin; Zhao, Zhongming

    2012-01-01

    Glioblastoma multiforme (GBM) is the most common and lethal brain tumor in humans. Recent studies revealed that patterns of microRNA (miRNA) expression in GBM tissue samples are different from those in normal brain tissues, suggesting that a number of miRNAs play critical roles in the pathogenesis of GBM. However, little is yet known about which miRNAs play central roles in the pathology of GBM and their regulatory mechanisms of action. To address this issue, in this study, we systematically explored the main regulation format (feed-forward loops, FFLs) consisting of miRNAs, transcription factors (TFs) and their impacting GBM-related genes, and developed a computational approach to construct a miRNA-TF regulatory network. First, we compiled GBM-related miRNAs, GBM-related genes, and known human TFs. We then identified 1,128 3-node FFLs and 805 4-node FFLs with statistical significance. By merging these FFLs together, we constructed a comprehensive GBM-specific miRNA-TF mediated regulatory network. Then, from the network, we extracted a composite GBM-specific regulatory network. To illustrate the GBM-specific regulatory network is promising for identification of critical miRNA components, we specifically examined a Notch signaling pathway subnetwork. Our follow up topological and functional analyses of the subnetwork revealed that six miRNAs (miR-124, miR-137, miR-219-5p, miR-34a, miR-9, and miR-92b) might play important roles in GBM, including some results that are supported by previous studies. In this study, we have developed a computational framework to construct a miRNA-TF regulatory network and generated the first miRNA-TF regulatory network for GBM, providing a valuable resource for further understanding the complex regulatory mechanisms in GBM. The observation of critical miRNAs in the Notch signaling pathway, with partial verification from previous studies, demonstrates that our network-based approach is promising for the identification of new and important

  4. The Regulatory Effects of Long Noncoding RNA-ANCR on Dental Tissue-Derived Stem Cells

    PubMed Central

    Jia, Qian; Chen, Xiaolin; Jiang, Wenkai; Wang, Wei

    2016-01-01

    Long noncoding RNAs (lncRNA) have been recognized as important regulators in diverse biological processes, such as transcriptional regulation, stem cell proliferation, and differentiation. Previous study has demonstrated that lncRNA-ANCR (antidifferentiation ncRNA) plays a key role in regulating the proliferation and osteogenic differentiation of periodontal ligament stem cells (PDLSCs). However, little is known about the role of ANCR in regulating other types of dental tissue-derived stem cells (DTSCs) behaviours (including proliferation and multiple-potential of differentiation). In this study, we investigated the regulatory effects of lncRNA-ANCR on the proliferation and differentiation (including osteogenic, adipogenic, and neurogenic differentiation) of DTSCs, including dental pulp stem cells (DPSCs), PDLSCs, and stem cells from the apical papilla (SCAP) by downregulation of lncRNA-ANCR. We found that downregulation of ANCR exerted little effect on proliferation of DPSCs and SCAP but promoted the osteogenic, adipogenic, and neurogenic differentiation of DTSCs. These data provide an insight into the regulatory effects of long noncoding RNA-ANCR on DTSCs and indicate that ANCR is a very important regulatory factor in stem cell differentiation. PMID:27648074

  5. Genome-wide annotation of microRNA primary transcript structures reveals novel regulatory mechanisms

    PubMed Central

    Chang, Tsung-Cheng; Pertea, Mihaela; Lee, Sungyul; Salzberg, Steven L.; Mendell, Joshua T.

    2015-01-01

    Precise regulation of microRNA (miRNA) expression is critical for diverse physiologic and pathophysiologic processes. Nevertheless, elucidation of the mechanisms through which miRNA expression is regulated has been greatly hindered by the incomplete annotation of primary miRNA (pri-miRNA) transcripts. While a subset of miRNAs are hosted in protein-coding genes, the majority of pri-miRNAs are transcribed as poorly characterized noncoding RNAs that are 10's to 100's of kilobases in length and low in abundance due to efficient processing by the endoribonuclease DROSHA, which initiates miRNA biogenesis. Accordingly, these transcripts are poorly represented in existing RNA-seq data sets and exhibit limited and inaccurate annotation in current transcriptome assemblies. To overcome these challenges, we developed an experimental and computational approach that allows genome-wide detection and mapping of pri-miRNA structures. Deep RNA-seq in cells expressing dominant-negative DROSHA resulted in much greater coverage of pri-miRNA transcripts compared with standard RNA-seq. A computational pipeline was developed that produces highly accurate pri-miRNA assemblies, as confirmed by extensive validation. This approach was applied to a panel of human and mouse cell lines, providing pri-miRNA transcript structures for 1291/1871 human and 888/1181 mouse miRNAs, including 594 human and 425 mouse miRNAs that fall outside protein-coding genes. These new assemblies uncovered unanticipated features and new potential regulatory mechanisms, including links between pri-miRNAs and distant protein-coding genes, alternative pri-miRNA splicing, and transcripts carrying subsets of miRNAs encoded by polycistronic clusters. These results dramatically expand our understanding of the organization of miRNA-encoding genes and provide a valuable resource for the study of mammalian miRNA regulation. PMID:26290535

  6. Cycling of the Sm-like protein Hfq on the DsrA small regulatory RNA.

    PubMed

    Lease, Richard A; Woodson, Sarah A

    2004-12-10

    Small RNAs (sRNAs) regulate bacterial genes involved in environmental adaptation. This RNA regulation requires Hfq, a bacterial Sm-like protein that stabilizes sRNAs and enhances RNA-RNA interactions. To understand the mechanism of target recognition by sRNAs, we investigated the interactions between Hfq, the sRNA DsrA, and its regulatory target rpoS mRNA, which encodes the stress response sigma factor. Nuclease footprinting revealed that Hfq recognized multiple sites in rpoS mRNA without significantly perturbing secondary structure in the 5' leader that inhibits translation initiation. Base-pairing with DsrA, however, made the rpoS ribosome binding site fully accessible, as predicted by genetic data. Hfq bound DsrA four times more tightly than the DsrA.rpoS RNA complex in gel mobility-shift assays. Consequently, Hfq is displaced rapidly from its high-affinity binding site on DsrA by conformational changes in DsrA, when DsrA base-pairs with rpoS mRNA. Hfq accelerated DsrA.rpoS RNA association and stabilized the RNA complex up to twofold. Hybridization of DsrA and rpoS mRNA was optimal when Hfq occupied its primary binding site on free DsrA, but was inhibited when Hfq associated with the DsrA.rpoS RNA complex. We conclude that recognition of rpoS mRNA is stimulated by binding of Hfq to free DsrA sRNA, followed by release of Hfq from the sRNA.mRNA complex.

  7. Advantages of mixing bioinformatics and visualization approaches for analyzing sRNA-mediated regulatory bacterial networks

    PubMed Central

    Bourqui, Romain; Benchimol, William; Gaspin, Christine; Sirand-Pugnet, Pascal; Uricaru, Raluca; Dutour, Isabelle

    2015-01-01

    The revolution in high-throughput sequencing technologies has enabled the acquisition of gigabytes of RNA sequences in many different conditions and has highlighted an unexpected number of small RNAs (sRNAs) in bacteria. Ongoing exploitation of these data enables numerous applications for investigating bacterial transacting sRNA-mediated regulation networks. Focusing on sRNAs that regulate mRNA translation in trans, recent works have noted several sRNA-based regulatory pathways that are essential for key cellular processes. Although the number of known bacterial sRNAs is increasing, the experimental validation of their interactions with mRNA targets remains challenging and involves expensive and time-consuming experimental strategies. Hence, bioinformatics is crucial for selecting and prioritizing candidates before designing any experimental work. However, current software for target prediction produces a prohibitive number of candidates because of the lack of biological knowledge regarding the rules governing sRNA–mRNA interactions. Therefore, there is a real need to develop new approaches to help biologists focus on the most promising predicted sRNA–mRNA interactions. In this perspective, this review aims at presenting the advantages of mixing bioinformatics and visualization approaches for analyzing predicted sRNA-mediated regulatory bacterial networks. PMID:25477348

  8. Identification of candidate miRNA biomarkers from miRNA regulatory network with application to prostate cancer

    PubMed Central

    2014-01-01

    Background MicroRNAs (miRNAs) are a class of non-coding regulatory RNAs approximately 22 nucleotides in length that play a role in a wide range of biological processes. Abnormal miRNA function has been implicated in various human cancers including prostate cancer (PCa). Altered miRNA expression may serve as a biomarker for cancer diagnosis and treatment. However, limited data are available on the role of cancer-specific miRNAs. Integrative computational bioinformatics approaches are effective for the detection of potential outlier miRNAs in cancer. Methods The human miRNA-mRNA target network was reconstructed by integrating multiple miRNA-mRNA interaction datasets. Paired miRNA and mRNA expression profiling data in PCa versus benign prostate tissue samples were used as another source of information. These datasets were analyzed with an integrated bioinformatics framework to identify potential PCa miRNA signatures. In vitro q-PCR experiments and further systematic analysis were used to validate these prediction results. Results Using this bioinformatics framework, we identified 39 miRNAs as potential PCa miRNA signatures. Among these miRNAs, 20 had previously been identified as PCa aberrant miRNAs by low-throughput methods, and 16 were shown to be deregulated in other cancers. In vitro q-PCR experiments verified the accuracy of these predictions. miR-648 was identified as a novel candidate PCa miRNA biomarker. Further functional and pathway enrichment analysis confirmed the association of the identified miRNAs with PCa progression. Conclusions Our analysis revealed the scale-free features of the human miRNA-mRNA interaction network and showed the distinctive topological features of existing cancer miRNA biomarkers from previously published studies. A novel cancer miRNA biomarker prediction framework was designed based on these observations and applied to prostate cancer study. This method could be applied for miRNA biomarker prediction in other cancers. PMID

  9. Co-evolution of Bacterial Ribosomal Protein S15 with Diverse mRNA Regulatory Structures.

    PubMed

    Slinger, Betty L; Newman, Hunter; Lee, Younghan; Pei, Shermin; Meyer, Michelle M

    2015-12-01

    RNA-protein interactions are critical in many biological processes, yet how such interactions affect the evolution of both partners is still unknown. RNA and protein structures are impacted very differently by mechanisms of genomic change. While most protein families are identifiable at the nucleotide level across large phylogenetic distances, RNA families display far less nucleotide similarity and are often only shared by closely related bacterial species. Ribosomal protein S15 has two RNA binding functions. First, it is a ribosomal protein responsible for organizing the rRNA during ribosome assembly. Second, in many bacterial species S15 also interacts with a structured portion of its own transcript to negatively regulate gene expression. While the first interaction is conserved in most bacteria, the second is not. Four distinct mRNA structures interact with S15 to enable regulation, each of which appears to be independently derived in different groups of bacteria. With the goal of understanding how protein-binding specificity may influence the evolution of such RNA regulatory structures, we examine whether examples of these mRNA structures are able to interact with, and regulate in response to, S15 homologs from organisms containing distinct mRNA structures. We find that despite their shared RNA binding function in the rRNA, S15 homologs have distinct RNA recognition profiles. We present a model to explain the specificity patterns observed, and support this model by with further mutagenesis. After analyzing the patterns of conservation for the S15 protein coding sequences, we also identified amino acid changes that alter the binding specificity of an S15 homolog. In this work we demonstrate that homologous RNA-binding proteins have different specificity profiles, and minor changes to amino acid sequences, or to RNA structural motifs, can have large impacts on RNA-protein recognition.

  10. Co-evolution of Bacterial Ribosomal Protein S15 with Diverse mRNA Regulatory Structures

    PubMed Central

    Slinger, Betty L.; Newman, Hunter; Lee, Younghan; Pei, Shermin; Meyer, Michelle M.

    2015-01-01

    RNA-protein interactions are critical in many biological processes, yet how such interactions affect the evolution of both partners is still unknown. RNA and protein structures are impacted very differently by mechanisms of genomic change. While most protein families are identifiable at the nucleotide level across large phylogenetic distances, RNA families display far less nucleotide similarity and are often only shared by closely related bacterial species. Ribosomal protein S15 has two RNA binding functions. First, it is a ribosomal protein responsible for organizing the rRNA during ribosome assembly. Second, in many bacterial species S15 also interacts with a structured portion of its own transcript to negatively regulate gene expression. While the first interaction is conserved in most bacteria, the second is not. Four distinct mRNA structures interact with S15 to enable regulation, each of which appears to be independently derived in different groups of bacteria. With the goal of understanding how protein-binding specificity may influence the evolution of such RNA regulatory structures, we examine whether examples of these mRNA structures are able to interact with, and regulate in response to, S15 homologs from organisms containing distinct mRNA structures. We find that despite their shared RNA binding function in the rRNA, S15 homologs have distinct RNA recognition profiles. We present a model to explain the specificity patterns observed, and support this model by with further mutagenesis. After analyzing the patterns of conservation for the S15 protein coding sequences, we also identified amino acid changes that alter the binding specificity of an S15 homolog. In this work we demonstrate that homologous RNA-binding proteins have different specificity profiles, and minor changes to amino acid sequences, or to RNA structural motifs, can have large impacts on RNA-protein recognition. PMID:26675164

  11. Identifying miRNA synergistic regulatory networks in heterogeneous human data via network motifs.

    PubMed

    Zhang, Junpeng; Duy Le, Thuc; Liu, Lin; He, Jianfeng; Li, Jiuyong

    2016-02-01

    Understanding the synergism of multiple microRNAs (miRNAs) in gene regulation can provide important insights into the mechanisms of complex human diseases caused by miRNA regulation. Therefore, it is important to identify miRNA synergism and study miRNA characteristics in miRNA synergistic regulatory networks. A number of methods have been proposed to identify miRNA synergism. However, most of the methods only use downstream target genes of miRNAs to infer miRNA synergism when miRNAs can also be regulated by upstream transcription factors (TFs) at the transcriptional level. Additionally, most methods are based on statistical associations identified from data without considering the causal nature of gene regulation. In this paper, we present a causality based framework, called mirSRN (miRNA synergistic regulatory network), to infer miRNA synergism in human molecular systems by considering both downstream miRNA targets and upstream TF regulation. We apply the proposed framework to two real world datasets and discover that almost all the top 10 miRNAs with the largest node degree in the mirSRNs are associated with different human diseases, including cancer, and that the mirSRNs are approximately scale-free and small-world networks. We also find that most miRNAs in the networks are frequently synergistic with other miRNAs, and miRNAs related to the same disease are likely to be synergistic and in a cluster linked to a biological function. Synergistic miRNA pairs show higher co-expression level, and may have potential functional relationships indicating collaboration between the miRNAs. Functional validation of the identified synergistic miRNAs demonstrates that these miRNAs cause different kinds of diseases. These results deepen our understanding of the biological meaning of miRNA synergism.

  12. Advancing the use of noncoding RNA in regulatory toxicology: Report of an ECETOC workshop.

    PubMed

    Aigner, Achim; Buesen, Roland; Gant, Tim; Gooderham, Nigel; Greim, Helmut; Hackermüller, Jörg; Hubesch, Bruno; Laffont, Madeleine; Marczylo, Emma; Meister, Gunter; Petrick, Jay S; Rasoulpour, Reza J; Sauer, Ursula G; Schmidt, Kerstin; Seitz, Hervé; Slack, Frank; Sukata, Tokuo; van der Vies, Saskia M; Verhaert, Jan; Witwer, Kenneth W; Poole, Alan

    2016-12-01

    The European Centre for the Ecotoxicology and Toxicology of Chemicals (ECETOC) organised a workshop to discuss the state-of-the-art research on noncoding RNAs (ncRNAs) as biomarkers in regulatory toxicology and as analytical and therapeutic agents. There was agreement that ncRNA expression profiling data requires careful evaluation to determine the utility of specific ncRNAs as biomarkers. To advance the use of ncRNA in regulatory toxicology, the following research priorities were identified: (1) Conduct comprehensive literature reviews to identify possibly suitable ncRNAs and areas of toxicology where ncRNA expression profiling could address prevailing scientific deficiencies. (2) Develop consensus on how to conduct ncRNA expression profiling in a toxicological context. (3) Conduct experimental projects, including, e.g., rat (90-day) oral toxicity studies, to evaluate the toxicological relevance of the expression profiles of selected ncRNAs. Thereby, physiological ncRNA expression profiles should be established, including the biological variability of healthy individuals. To substantiate the relevance of key ncRNAs for cell homeostasis or pathogenesis, molecular events should be dose-dependently linked with substance-induced apical effects. Applying a holistic approach, knowledge on ncRNAs, 'omics and epigenetics technologies should be integrated into adverse outcome pathways to improve the understanding of the functional roles of ncRNAs within a regulatory context.

  13. MicroRNA regulatory networks in idiopathic pulmonary fibrosis.

    PubMed

    Pandit, Kusum V; Milosevic, Jadranka

    2015-04-01

    Idiopathic pulmonary fibrosis (IPF) is a chronic, progressive, and fatal scarring lung disease of unknown etiology, characterized by changes in microRNA expression. Activation of transforming growth factor (TGF-β) is a key event in the development of IPF. Recent reports have also identified epigenetic modification as an important player in the pathogenesis of IPF. In this review, we summarize the main results of studies that address the role of microRNAs in IPF and highlight the synergistic actions of these microRNAs in regulating TGF-β, the primary fibrogenic mediator. We outline epigenetic regulation of microRNAs by methylation. Functional studies identify microRNAs that alter proliferative and migratory properties of fibroblasts, and induce phenotypic changes in epithelial cells consistent with epithelial-mesenchymal transition. Though these studies were performed in isolation, we identify multiple co-operative actions after assembling the results into a network. Construction of such networks will help identify disease-propelling hubs that can be targeted for therapeutic purposes.

  14. Identification of active miRNA and transcription factor regulatory pathways in human obesity-related inflammation.

    PubMed

    Zhang, Xi-Mei; Guo, Lin; Chi, Mei-Hua; Sun, Hong-Mei; Chen, Xiao-Wen

    2015-03-07

    Obesity-induced chronic inflammation plays a fundamental role in the pathogenesis of metabolic syndrome (MS). Recently, a growing body of evidence supports that miRNAs are largely dysregulated in obesity and that specific miRNAs regulate obesity-associated inflammation. We applied an approach aiming to identify active miRNA-TF-gene regulatory pathways in obesity. Firstly, we detected differentially expressed genes (DEGs) and differentially expressed miRNAs (DEmiRs) from mRNA and miRNA expression profiles, respectively. Secondly, by mapping the DEGs and DEmiRs to the curated miRNA-TF-gene regulatory network as active seed nodes and connect them with their immediate neighbors, we obtained the potential active miRNA-TF-gene regulatory subnetwork in obesity. Thirdly, using a Breadth-First-Search (BFS) algorithm, we identified potential active miRNA-TF-gene regulatory pathways in obesity. Finally, through the hypergeometric test, we identified the active miRNA-TF-gene regulatory pathways that were significantly related to obesity. The potential active pathways with FDR < 0.0005 were considered to be the active miRNA-TF regulatory pathways in obesity. The union of the active pathways is visualized and identical nodes of the active pathways were merged. We identified 23 active miRNA-TF-gene regulatory pathways that were significantly related to obesity-related inflammation.

  15. Multi-disciplinary methods to define RNA-protein interactions and regulatory networks.

    PubMed

    Ascano, Manuel; Gerstberger, Stefanie; Tuschl, Thomas

    2013-02-01

    The advent of high-throughput technologies including deep-sequencing and protein mass spectrometry is facilitating the acquisition of large and precise data sets toward the definition of post-transcriptional regulatory networks. While early studies that investigated specific RNA-protein interactions in isolation laid the foundation for our understanding of the existence of molecular machines to assemble and process RNAs, there is a more recent appreciation of the importance of individual RNA-protein interactions that contribute to post-transcriptional gene regulation. The multitude of RNA-binding proteins (RBPs) and their many RNA targets has only been captured experimentally in recent times. In this review, we will examine current multidisciplinary approaches toward elucidating RNA-protein networks and their regulation. Copyright © 2013 Elsevier Ltd. All rights reserved.

  16. Drug-device combination products: regulatory landscape and market growth.

    PubMed

    Bayarri, L

    2015-08-01

    Combination products are therapeutic and diagnostic products that combine drugs, devices and/or biological products, leading to safer and more effective treatments thanks to careful and precise drug targeting, local administration and individualized therapy. These technologies can especially benefit patients suffering from serious diseases and conditions such as cancer, heart disease, multiple sclerosis and diabetes, among others. On the other hand, drug-device combination products have also introduced a new dynamic in medical product development, regulatory approval and corporate interaction. Due to the increasing integration of drugs and devices observed in the latest generation of combination products, regulatory agencies have developed specific competences and regulations over the last decade. Manufacturers are required to fully understand the specific requirements in each country in order to ensure timely and accurate market access of new combination products, and the development of combination products involves a very specific pattern of interactions between manufacturers and regulatory agencies. The increased sophistication of the products brought to market over the last couple of decades has accentuated the need to develop drugs and devices collaboratively using resources from both industries, fostering the need of business partnering and technology licensing. This review will provide a global overview of the market trends, as well as (in the last section) an analysis of the drug-device combination products approved by the FDA during the latest 5 years. Copyright 2015 Prous Science, S.A.U. or its licensors. All rights reserved.

  17. Identifying microRNA-mRNA regulatory network in gemcitabine-resistant cells derived from human pancreatic cancer cells.

    PubMed

    Shen, Yehua; Pan, Yan; Xu, Litao; Chen, Lianyu; Liu, Luming; Chen, Hao; Chen, Zhen; Meng, Zhiqiang

    2015-06-01

    Pancreatic cancer is unresectable in over 80 % of patients owing to difficulty in early diagnosis. Chemotherapy is the most frequently adopted therapy for advanced pancreatic cancer. The development of drug resistance to gemcitabine (GEM), which is always used in standard chemotherapy, often results in therapeutic failure. However, the molecular mechanisms underlying the gemcitabine resistance remain unclear. Therefore, we sought to explore the microRNA-mRNA network that is associated with the development of gemcitabine resistance and to identify molecular targets for overcoming the gemcitabine resistance. By exposing SW1990 pancreatic cancer cells to long-term gemcitabine with increasing concentrations, we established a gemcitabine-resistant cell line (SW1990/GEM) with a high IC50 (the concentration needed for 50 % growth inhibition, 847.23 μM). The mRNA and microRNA expression profiles of SW1990 cells and SW1990/GEM cells were determined using RNA-seq analysis. By comparing the results in control SW1990 cells, 507 upregulated genes and 550 downregulated genes in SW1990/GEM cells were identified as differentially expressed genes correlated with gemcitabine sensitivity. Gene ontology (GO) analysis showed that the differentially expressed genes were related to diverse biological processes. The upregulated genes were mainly associated with drug response and apoptosis, and the downregulated genes were correlated with cell cycle progression and RNA splicing. Concurrently, the differentially expressed microRNAs, which are the important player in drug resistance development, were also examined in SW1990/GEM cells, and 56 differential microRNAs were identified. Additionally, the expression profiles of selected genes and microRNAs were confirmed by using Q-PCR assays. Furthermore, combining the differentially expressed microRNAs and mRNAs as well as the predicted targets for these microRNAs, a core microRNA-mRNA regulatory network was constructed, which included hub micro

  18. The Complexity of Posttranscriptional Small RNA Regulatory Networks Revealed by In Silico Analysis of Gossypium arboreum L. Leaf, Flower and Boll Small Regulatory RNAs

    PubMed Central

    Hu, Hongtao; Rashotte, Aaron M.; Singh, Narendra K.; Weaver, David B.; Goertzen, Leslie R.; Singh, Shree R.; Locy, Robert D.

    2015-01-01

    MicroRNAs (miRNAs) and secondary small interfering RNAs (principally phased siRNAs or trans-acting siRNAs) are two distinct subfamilies of small RNAs (sRNAs) that are emerging as key regulators of posttranscriptional gene expression in plants. Both miRNAs and secondary-siRNAs (sec-siRNAs) are processed from longer RNA precursors by DICER-LIKE proteins (DCLs). Gossypium arboreum L., also known as tree cotton or Asian cotton, is a diploid, possibly ancestral relative of tetraploid Gossypium hirsutum L., the predominant type of commercially grown cotton worldwide known as upland cotton. To understand the biological significance of these gene regulators in G. arboreum, a bioinformatics analysis was performed on G. arboreum small RNAs produced from G. arboreum leaf, flower, and boll tissues. Consequently, 263 miRNAs derived from 353 precursors, including 155 conserved miRNAs (cs-miRNAs) and 108 novel lineage-specific miRNAs (ls-miRNAs). Along with miRNAs, 2,033 miRNA variants (isomiRNAs) were identified as well. Those isomiRNAs with variation at the 3’-miRNA end were expressed at the highest levels, compared to other types of variants. In addition, 755 pha-siRNAs derived 319 pha-siRNA gene transcripts (PGTs) were identified, and the potential pha-siRNA initiators were predicted. Also, 2,251 non-phased siRNAs were found as well, of which 1,088 appeared to be produced by so-called cis- or trans-cleavage of the PGTs observed at positions differing from pha-siRNAs. Of those sRNAs, 148 miRNAs/isomiRNAs and 274 phased/non-phased siRNAs were differentially expressed in one or more pairs of tissues examined. Target analysis revealed that target genes for both miRNAs and pha-siRNAs are involved a broad range of metabolic and enzymatic activities. We demonstrate that secondary siRNA production could result from initial cleavage of precursors by both miRNAs or isomiRNAs, and that subsequently produced phased and unphased siRNAs could result that also serve as triggers of a

  19. Understanding microRNA-mediated gene regulatory networks through mathematical modelling

    PubMed Central

    Lai, Xin; Wolkenhauer, Olaf; Vera, Julio

    2016-01-01

    The discovery of microRNAs (miRNAs) has added a new player to the regulation of gene expression. With the increasing number of molecular species involved in gene regulatory networks, it is hard to obtain an intuitive understanding of network dynamics. Mathematical modelling can help dissecting the role of miRNAs in gene regulatory networks, and we shall here review the most recent developments that utilise different mathematical modelling approaches to provide quantitative insights into the function of miRNAs in the regulation of gene expression. Key miRNA regulation features that have been elucidated via modelling include: (i) the role of miRNA-mediated feedback and feedforward loops in fine-tuning of gene expression; (ii) the miRNA–target interaction properties determining the effectiveness of miRNA-mediated gene repression; and (iii) the competition for shared miRNAs leading to the cross-regulation of genes. However, there is still lack of mechanistic understanding of many other properties of miRNA regulation like unconventional miRNA–target interactions, miRNA regulation at different sub-cellular locations and functional miRNA variant, which will need future modelling efforts to deal with. This review provides an overview of recent developments and challenges in this field. PMID:27317695

  20. RNA-Dependent RNA Polymerases of Picornaviruses: From the Structure to Regulatory Mechanisms

    PubMed Central

    Ferrer-Orta, Cristina; Ferrero, Diego; Verdaguer, Núria

    2015-01-01

    RNA viruses typically encode their own RNA-dependent RNA polymerase (RdRP) to ensure genome replication within the infected cells. RdRP function is critical not only for the virus life cycle but also for its adaptive potential. The combination of low fidelity of replication and the absence of proofreading and excision activities within the RdRPs result in high mutation frequencies that allow these viruses a rapid adaptation to changing environments. In this review, we summarize the current knowledge about structural and functional aspects on RdRP catalytic complexes, focused mainly in the Picornaviridae family. The structural data currently available from these viruses provided high-resolution snapshots for a range of conformational states associated to RNA template-primer binding, rNTP recognition, catalysis and chain translocation. As these enzymes are major targets for the development of antiviral compounds, such structural information is essential for the design of new therapies. PMID:26258787

  1. Regulatory Oversight of Cell and Gene Therapy Products in Canada.

    PubMed

    Ridgway, Anthony; Agbanyo, Francisca; Wang, Jian; Rosu-Myles, Michael

    2015-01-01

    Health Canada regulates gene therapy products and many cell therapy products as biological drugs under the Canadian Food and Drugs Act and its attendant regulations. Cellular products that meet certain criteria, including minimal manipulation and homologous use, may be subjected to a standards-based approach under the Safety of Human Cells, Tissues and Organs for Transplantation Regulations. The manufacture and clinical testing of cell and gene therapy products (CGTPs) presents many challenges beyond those for protein biologics. Cells cannot be subjected to pathogen removal or inactivation procedures and must frequently be administered shortly after final formulation. Viral vector design and manufacturing control are critically important to overall product quality and linked to safety and efficacy in patients through concerns such as replication competence, vector integration, and vector shedding. In addition, for many CGTPs, the value of nonclinical studies is largely limited to providing proof of concept, and the first meaningful data relating to appropriate dosing, safety parameters, and validity of surrogate or true determinants of efficacy must come from carefully designed clinical trials in patients. Addressing these numerous challenges requires application of various risk mitigation strategies and meeting regulatory expectations specifically adapted to the product types. Regulatory cooperation and harmonisation at an international level are essential for progress in the development and commercialisation of these products. However, particularly in the area of cell therapy, new regulatory paradigms may be needed to harness the benefits of clinical progress in situations where the resources and motivation to pursue a typical drug product approval pathway may be lacking.

  2. Identification of microRNA expression patterns and definition of a microRNA/mRNA regulatory network in distinct molecular groups of multiple myeloma.

    PubMed

    Lionetti, Marta; Biasiolo, Marta; Agnelli, Luca; Todoerti, Katia; Mosca, Laura; Fabris, Sonia; Sales, Gabriele; Deliliers, Giorgio Lambertenghi; Bicciato, Silvio; Lombardi, Luigia; Bortoluzzi, Stefania; Neri, Antonino

    2009-12-10

    To date, little evidence of miRNA expression/deregulation in multiple myeloma has been reported. To characterize miRNA in the context of the major multiple myeloma molecular types, we generated miRNA expression profiles of highly purified malignant plasma cells from 40 primary tumors. Furthermore, transcriptional profiles, available for all patients, were used to investigate the occurrence of miRNA/predicted target mRNA pair anticorrelations, and the miRNA and genome-wide DNA data were integrated in a subset of patients to evaluate the influence of allelic imbalances on miRNA expression. Differential miRNA expression patterns were identified, which were mainly associated with the major IGH translocations; particularly, t(4;14) patients showed specific overexpression of let-7e, miR-125a-5p, and miR-99b belonging to a cluster at 19q13.33. The occurrence of other lesions (ie, 1q gain, 13q and 17p deletions, and hyperdiploidy) was slightly characterized by specific miRNA signatures. Furthermore, the occurrence of several allelic imbalances or loss of heterozygosity was found significantly associated with the altered expression of miRNAs located in the involved regions, such as let-7b at 22q13.31 or miR-140-3p at 16q22. Finally, the integrative analysis based on computational target prediction and miRNA/mRNA profiling defined a network of putative functional miRNA-target regulatory relations supported by expression data.

  3. Auto-Regulatory RNA Editing Fine-Tunes mRNA Re-Coding and Complex Behaviour in Drosophila

    PubMed Central

    Savva, Yiannis A.; Jepson, James E.C; Sahin, Asli; Sugden, Arthur U.; Dorsky, Jacquelyn S.; Alpert, Lauren; Lawrence, Charles; Reenan, Robert A.

    2014-01-01

    Auto-regulatory feedback loops are a common molecular strategy used to optimize protein function. In Drosophila many mRNAs involved in neuro-transmission are re-coded at the RNA level by the RNA editing enzyme dADAR, leading to the incorporation of amino acids that are not directly encoded by the genome. dADAR also re-codes its own transcript, but the consequences of this auto-regulation in vivo are unclear. Here we show that hard-wiring or abolishing endogenous dADAR auto-regulation dramatically remodels the landscape of re-coding events in a site-specific manner. These molecular phenotypes correlate with altered localization of dADAR within the nuclear compartment. Furthermore, auto-editing exhibits sexually dimorphic patterns of spatial regulation and can be modified by abiotic environmental factors. Finally, we demonstrate that modifying dAdar auto-editing affects adaptive complex behaviors. Our results reveal the in vivo relevance of auto-regulatory control over post-transcriptional mRNA re-coding events in fine-tuning brain function and organismal behavior. PMID:22531175

  4. The regulatory sciences for stem cell-based medicinal products.

    PubMed

    Yuan, Bao-Zhu; Wang, Junzhi

    2014-06-01

    Over the past few years, several new achievements have been made from stem cell studies, many of which have moved up from preclinical stages to early, or from early to middle or late, stages thanks to relatively safe profile and preliminary evidence of effectiveness. Moreover, some stem cell-based products have been approved for marketing by different national regulatory authorities. However, many critical issues associated mainly with incomplete understanding of stem cell biology and the relevant risk factors, and lack of effective regulations still exist and need to be urgently addressed, especially in countries where establishment of appropriate regulatory system just commenced. More relevantly, the stem cell regulatory sciences need to be established or improved to more effectively evaluate quality, safety and efficacy of stem cell products, and for building up the appropriate regulatory framework. In this review, we summarize some new achievements in stem cell studies, especially the preclinical and clinical studies, the existing regulations, and the associated challenges, and we then propose some considerations for improving stem cell regulatory sciences with a goal of promoting the steadfast growth of the well-regulated stem cell therapies abreast of evolvement of stem cell sciences and technologies.

  5. Evolutionary analysis reveals regulatory and functional landscape of coding and non-coding RNA editing

    PubMed Central

    Jacobson, Dionna

    2017-01-01

    Adenosine-to-inosine RNA editing diversifies the transcriptome and promotes functional diversity, particularly in the brain. A plethora of editing sites has been recently identified; however, how they are selected and regulated and which are functionally important are largely unknown. Here we show the cis-regulation and stepwise selection of RNA editing during Drosophila evolution and pinpoint a large number of functional editing sites. We found that the establishment of editing and variation in editing levels across Drosophila species are largely explained and predicted by cis-regulatory elements. Furthermore, editing events that arose early in the species tree tend to be more highly edited in clusters and enriched in slowly-evolved neuronal genes, thus suggesting that the main role of RNA editing is for fine-tuning neurological functions. While nonsynonymous editing events have been long recognized as playing a functional role, in addition to nonsynonymous editing sites, a large fraction of 3’UTR editing sites is evolutionarily constrained, highly edited, and thus likely functional. We find that these 3’UTR editing events can alter mRNA stability and affect miRNA binding and thus highlight the functional roles of noncoding RNA editing. Our work, through evolutionary analyses of RNA editing in Drosophila, uncovers novel insights of RNA editing regulation as well as its functions in both coding and non-coding regions. PMID:28166241

  6. Evolutionary analysis reveals regulatory and functional landscape of coding and non-coding RNA editing.

    PubMed

    Zhang, Rui; Deng, Patricia; Jacobson, Dionna; Li, Jin Billy

    2017-02-01

    Adenosine-to-inosine RNA editing diversifies the transcriptome and promotes functional diversity, particularly in the brain. A plethora of editing sites has been recently identified; however, how they are selected and regulated and which are functionally important are largely unknown. Here we show the cis-regulation and stepwise selection of RNA editing during Drosophila evolution and pinpoint a large number of functional editing sites. We found that the establishment of editing and variation in editing levels across Drosophila species are largely explained and predicted by cis-regulatory elements. Furthermore, editing events that arose early in the species tree tend to be more highly edited in clusters and enriched in slowly-evolved neuronal genes, thus suggesting that the main role of RNA editing is for fine-tuning neurological functions. While nonsynonymous editing events have been long recognized as playing a functional role, in addition to nonsynonymous editing sites, a large fraction of 3'UTR editing sites is evolutionarily constrained, highly edited, and thus likely functional. We find that these 3'UTR editing events can alter mRNA stability and affect miRNA binding and thus highlight the functional roles of noncoding RNA editing. Our work, through evolutionary analyses of RNA editing in Drosophila, uncovers novel insights of RNA editing regulation as well as its functions in both coding and non-coding regions.

  7. Targeting a Regulatory Element in Human Thymidylate Synthase mRNA

    PubMed Central

    Brunn, Nicholas D.; Sega, Emily Garcia; Kao, Melody B.

    2013-01-01

    Thymidylate synthase (TS) is a key enzyme in the biosynthesis of thymidine. TS inhibitors, which are used in cancer chemotherapy, suffer from resistance development in tumors through upregulation of TS expression. Autoregulatory translation control has been implicated with TS overexpression. TS binding at its own mRNA, which leads to sequestration of the start codon, is abolished when the enzyme forms an inhibitor complex, thereby relieving translation suppression. We have used the protein binding site from the TS mRNA in the context of a bicistronic expression system to validate targeting the regulatory motif with stabilizing ligands that prevent ribosomal initiation. Stabilization of the RNA by mutations, which were studied as surrogates of ligand binding, suppresses translation of the TS protein. Compounds that stabilize the TS binding RNA motif and thereby inhibit ribosomal initiation might be used in combination with existing TS enzyme-targeting drugs to overcome resistance development during chemotherapy. PMID:23143777

  8. Metastamir - the field of metastasis-regulatory microRNA is spreading

    PubMed Central

    Hurst, Douglas R.; Edmonds, Mick D.; Welch, Danny R.

    2009-01-01

    Despite advancements in knowledge from over a century of metastasis research, the genetic programs and molecular mechanisms required for cancer metastasis are still incompletely understood. Genes that specifically regulate the process of metastasis are useful tools to elucidate molecular mechanisms and may become markers and/or targets for anti-metastatic therapy. Recently, several non-coding regulatory RNA genes, microRNA (miRNA), were identified that play roles in various steps of metastasis, some without obvious roles in tumorigenesis. Understanding how these metastasis-associated miRNA, which we term metastamir, are involved in metastasis will help identify possible biomarkers or targets for the most lethal attribute of cancer - metastasis. PMID:19773429

  9. A comparative analytical assay of gene regulatory networks inferred using microarray and RNA-seq datasets

    PubMed Central

    Izadi, Fereshteh; Zarrini, Hamid Najafi; Kiani, Ghaffar; Jelodar, Nadali Babaeian

    2016-01-01

    A Gene Regulatory Network (GRN) is a collection of interactions between molecular regulators and their targets in cells governing gene expression level. Omics data explosion generated from high-throughput genomic assays such as microarray and RNA-Seq technologies and the emergence of a number of pre-processing methods demands suitable guidelines to determine the impact of transcript data platforms and normalization procedures on describing associations in GRNs. In this study exploiting publically available microarray and RNA-Seq datasets and a gold standard of transcriptional interactions in Arabidopsis, we performed a comparison between six GRNs derived by RNA-Seq and microarray data and different normalization procedures. As a result we observed that compared algorithms were highly data-specific and Networks reconstructed by RNA-Seq data revealed a considerable accuracy against corresponding networks captured by microarrays. Topological analysis showed that GRNs inferred from two platforms were similar in several of topological features although we observed more connectivity in RNA-Seq derived genes network. Taken together transcriptional regulatory networks obtained by Robust Multiarray Averaging (RMA) and Variance-Stabilizing Transformed (VST) normalized data demonstrated predicting higher rate of true edges over the rest of methods used in this comparison. PMID:28293077

  10. Novel microRNA-like viral small regulatory RNAs arising during human hepatitis A virus infection.

    PubMed

    Shi, Jiandong; Sun, Jing; Wang, Bin; Wu, Meini; Zhang, Jing; Duan, Zhiqing; Wang, Haixuan; Hu, Ningzhu; Hu, Yunzhang

    2014-10-01

    MicroRNAs (miRNAs), including host miRNAs and viral miRNAs, play vital roles in regulating host-virus interactions. DNA viruses encode miRNAs that regulate the viral life cycle. However, it is generally believed that cytoplasmic RNA viruses do not encode miRNAs, owing to inaccessible cellular miRNA processing machinery. Here, we provide a comprehensive genome-wide analysis and identification of miRNAs that were derived from hepatitis A virus (HAV; Hu/China/H2/1982), which is a typical cytoplasmic RNA virus. Using deep-sequencing and in silico approaches, we identified 2 novel virally encoded miRNAs, named hav-miR-1-5p and hav-miR-2-5p. Both of the novel virally encoded miRNAs were clearly detected in infected cells. Analysis of Dicer enzyme silencing demonstrated that HAV-derived miRNA biogenesis is Dicer dependent. Furthermore, we confirmed that HAV mature miRNAs were generated from viral miRNA precursors (pre-miRNAs) in host cells. Notably, naturally derived HAV miRNAs were biologically and functionally active and induced post-transcriptional gene silencing (PTGS). Genomic location analysis revealed novel miRNAs located in the coding region of the viral genome. Overall, our results show that HAV naturally generates functional miRNA-like small regulatory RNAs during infection. This is the first report of miRNAs derived from the coding region of genomic RNA of a cytoplasmic RNA virus. These observations demonstrate that a cytoplasmic RNA virus can naturally generate functional miRNAs, as DNA viruses do. These findings also contribute to improved understanding of host-RNA virus interactions mediated by RNA virus-derived miRNAs.

  11. A systematic analysis of a mi-RNA inter-pathway regulatory motif

    PubMed Central

    2013-01-01

    Background The continuing discovery of new types and functions of small non-coding RNAs is suggesting the presence of regulatory mechanisms far more complex than the ones currently used to study and design Gene Regulatory Networks. Just focusing on the roles of micro RNAs (miRNAs), they have been found to be part of several intra-pathway regulatory motifs. However, inter-pathway regulatory mechanisms have been often neglected and require further investigation. Results In this paper we present the result of a systems biology study aimed at analyzing a high-level inter-pathway regulatory motif called Pathway Protection Loop, not previously described, in which miRNAs seem to play a crucial role in the successful behavior and activation of a pathway. Through the automatic analysis of a large set of public available databases, we found statistical evidence that this inter-pathway regulatory motif is very common in several classes of KEGG Homo Sapiens pathways and concurs in creating a complex regulatory network involving several pathways connected by this specific motif. The role of this motif seems also confirmed by a deeper review of other research activities on selected representative pathways. Conclusions Although previous studies suggested transcriptional regulation mechanism at the pathway level such as the Pathway Protection Loop, a high-level analysis like the one proposed in this paper is still missing. The understanding of higher-level regulatory motifs could, as instance, lead to new approaches in the identification of therapeutic targets because it could unveil new and “indirect” paths to activate or silence a target pathway. However, a lot of work still needs to be done to better uncover this high-level inter-pathway regulation including enlarging the analysis to other small non-coding RNA molecules. PMID:24152805

  12. Dihydroartemisinin suppresses pancreatic cancer cells via a microRNA-mRNA regulatory network

    PubMed Central

    Li, Yilong; Wang, Yongwei; Kong, Rui; Xue, Dongbo; Pan, Shangha; Chen, Hua; Sun, Bei

    2016-01-01

    Despite improvements in surgical procedures and chemotherapy, pancreatic cancer remains one of the most aggressive and fatal human malignancies, with a low 5-year survival rate of only 8%. Therefore, novel strategies for prevention and treatment are urgently needed. Here, we investigated the mechanisms underlying the anti-pancreatic cancer effects dihydroartemisinin (DHA). Microarray and systematic analysis showed that DHA suppressed proliferation, inhibited angiogenesis and promoted apoptosis in two different human pancreatic cancer cell lines, and that 5 DHA-regulated microRNAs and 11 of their target mRNAs were involved in these effects via 19 microRNA-mRNA interactions. Four of these microRNAs, 9 of the mRNAs and 17 of the interactions were experimentally verified. Furthermore, we found that the anti-pancreatic caner effects of DHA in vivo involved 4 microRNAs, 9 mRNAs and 17 microRNA-mRNA interactions. These results improve the understanding of the mechanisms by which DHA suppresses proliferation and angiogenesis and promotes apoptosis in pancreatic cancer cells and indicate that DHA, an effective antimalarial drug, might improve pancreatic cancer treatments. PMID:27613829

  13. Integrated analysis of microRNA regulatory network in nasopharyngeal carcinoma with deep sequencing.

    PubMed

    Wang, Fan; Lu, Juan; Peng, Xiaohong; Wang, Jie; Liu, Xiong; Chen, Xiaomei; Jiang, Yiqi; Li, Xiangping; Zhang, Bao

    2016-01-22

    MicroRNAs (miRNAs) have been shown to play a critical role in the development and progression of nasopharyngeal carcinoma (NPC). Although accumulating studies have been performed on the molecular mechanisms of NPC, the miRNA regulatory networks in cancer progression remain largely unknown. Laser capture microdissection (LCM) and deep sequencing are powerful tools that can help us to detect the integrated view of miRNA-target network. Illumina Hiseq2000 deep sequencing was used to screen differentially expressed miRNAs in laser-microdessected biopsies between 12 NPC and 8 chronic nasopharyngitis patients. The result was validated by real-time PCR on 201 NPC and 25 chronic nasopharyngitis patients. The potential candidate target genes of the miRNAs were predicted using published target prediction softwares (RNAhybrid, TargetScan, Miranda, PITA), and the overlay part was analyzed in Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) biological process. The miRNA regulatory network analysis was performed using the Ingenuity Pathway Analysis (IPA) software. Eight differentially expressed miRNAs were identified between NPC and chronic nasopharyngitis patients by deep sequencing. Further qRT-PCR assays confirmed 3 down-regulated miRNAs (miR-34c-5p, miR-375 and miR-449c-5p), 4 up-regulated miRNAs (miR-205-5p, miR-92a-3p, miR-193b-3p and miR-27a-5p). Additionally, the low level of miR-34c-5p (miR-34c) was significantly correlated with advanced TNM stage. GO and KEGG enrichment analyses showed that 914 target genes were involved in cell cycle, cytokine secretion and tumor immunology, and so on. IPA revealed that cancer was the top disease associated with those dysregulated miRNAs, and the genes regulated by miR-34c were in the center of miRNA-mRNA regulatory network, including TP53, CCND1, CDK6, MET and BCL2, and the PI3K/AKT/ mTOR signaling was regarded as a significant function pathway in this network. Our study presents the current knowledge of miRNA

  14. Integration of Regulatory Guidelines into Protein Drug Product Development.

    PubMed

    Wang, Wei

    2016-01-01

    The drug product development process for proteins went through its infancy in the early eighties of last century and is in its maturity today. This has been driven largely by the rapid growth of the biotechnology industry, which led to the development and issuance of many regulatory guidelines/directories, especially those through the International Conference of Harmonization (ICH). These guidelines have certainly guided different aspects of a drug product development process. On the other hand, they were issued separately on different topics and in different time periods. An integration of all relevant guidelines into the corresponding areas in drug product development would greatly facilitate the development process. The purpose of this short review is to integrate the relevant (mainly ICH) regulatory guidelines into protein drug product development and to discuss remaining issues, which may lead to further revision of existing guidelines or development of new ones. Drug product development scientists need to collect adequate and relevant development data for a successful product registration. The key is the ability to justify the final drug product in terms of choice of the drug product formulation, container closure system, and manufacturing process. The drug product development process for proteins has matured today, largely due to the rapid growth of the biotechnology industry. In this process, many regulatory guidelines/directories were developed and issued, especially through the International Conference of Harmonization (ICH). However, they were issued separately on different topics and in different time periods. An integration of all relevant guidelines into the corresponding areas in drug product development would greatly facilitate the development process. The purpose of this short review is to integrate the relevant (mainly ICH) regulatory guidelines into protein drug product development and to discuss remaining issues, which may lead to further

  15. Genetically engineered crops for biofuel production: regulatory perspectives.

    PubMed

    Lee, David; Chen, Alice; Nair, Ramesh

    2008-01-01

    There are numerous challenges in realizing the potential of biofuels that many policy makers have envisioned. The technical challenges in making the production of biofuels economical and on a scale to replace a significant fraction of transportation fuel have been well described, along with the potential environmental concerns. The use of biotechnology can potentially address many of these technical challenges and environmental concerns, but brings significant regulatory hurdles that have not been discussed extensively in the scientific community. This review will give an overview of the approaches being developed to produce transgenic biofuel feedstocks, particularly cellulosic ethanol, and the regulatory process in the United States that oversees the development and commercialization of new transgenic plants. We hope to illustrate that the level of regulation for transgenic organisms is not proportional to their potential risk to human health or the environment, and that revisions to the regulatory system in the U.S. currently under consideration are necessary to streamline the process.

  16. Regulatory non-coding RNA: new instruments in the orchestration of cell death

    PubMed Central

    Su, Ye; Wu, Haijiang; Pavlosky, Alexander; Zou, Ling-Lin; Deng, Xinna; Zhang, Zhu-Xu; Jevnikar, Anthony M

    2016-01-01

    Non-coding RNA (ncRNA) comprises a substantial portion of primary transcripts that are generated by genomic transcription, but are not translated into protein. The possible functions of these once considered ‘junk' molecules have incited considerable interest and new insights have emerged. The two major members of ncRNAs, namely micro RNA (miRNA) and long non-coding RNA (lncRNA), have important regulatory roles in gene expression and many important physiological processes, which has recently been extended to programmed cell death. The previous paradigm of programmed cell death only by apoptosis has recently expanded to include modalities of regulated necrosis (RN), and particularly necroptosis. However, most research efforts in this field have been on protein regulators, leaving the role of ncRNAs largely unexplored. In this review, we discuss important findings concerning miRNAs and lncRNAs that modulate apoptosis and RN pathways, as well as the miRNA–lncRNA interactions that affect cell death regulation. PMID:27512954

  17. Small Regulatory RNA-Induced Growth Rate Heterogeneity of Bacillus subtilis

    PubMed Central

    Mars, Ruben A. T.; Nicolas, Pierre; Ciccolini, Mariano; Reilman, Ewoud; Reder, Alexander; Schaffer, Marc; Mäder, Ulrike; Völker, Uwe; van Dijl, Jan Maarten; Denham, Emma L.

    2015-01-01

    Isogenic bacterial populations can consist of cells displaying heterogeneous physiological traits. Small regulatory RNAs (sRNAs) could affect this heterogeneity since they act by fine-tuning mRNA or protein levels to coordinate the appropriate cellular behavior. Here we show that the sRNA RnaC/S1022 from the Gram-positive bacterium Bacillus subtilis can suppress exponential growth by modulation of the transcriptional regulator AbrB. Specifically, the post-transcriptional abrB-RnaC/S1022 interaction allows B. subtilis to increase the cell-to-cell variation in AbrB protein levels, despite strong negative autoregulation of the abrB promoter. This behavior is consistent with existing mathematical models of sRNA action, thus suggesting that induction of protein expression noise could be a new general aspect of sRNA regulation. Importantly, we show that the sRNA-induced diversity in AbrB levels generates heterogeneity in growth rates during the exponential growth phase. Based on these findings, we hypothesize that the resulting subpopulations of fast- and slow-growing B. subtilis cells reflect a bet-hedging strategy for enhanced survival of unfavorable conditions. PMID:25790031

  18. Small regulatory RNA-induced growth rate heterogeneity of Bacillus subtilis.

    PubMed

    Mars, Ruben A T; Nicolas, Pierre; Ciccolini, Mariano; Reilman, Ewoud; Reder, Alexander; Schaffer, Marc; Mäder, Ulrike; Völker, Uwe; van Dijl, Jan Maarten; Denham, Emma L

    2015-03-01

    Isogenic bacterial populations can consist of cells displaying heterogeneous physiological traits. Small regulatory RNAs (sRNAs) could affect this heterogeneity since they act by fine-tuning mRNA or protein levels to coordinate the appropriate cellular behavior. Here we show that the sRNA RnaC/S1022 from the Gram-positive bacterium Bacillus subtilis can suppress exponential growth by modulation of the transcriptional regulator AbrB. Specifically, the post-transcriptional abrB-RnaC/S1022 interaction allows B. subtilis to increase the cell-to-cell variation in AbrB protein levels, despite strong negative autoregulation of the abrB promoter. This behavior is consistent with existing mathematical models of sRNA action, thus suggesting that induction of protein expression noise could be a new general aspect of sRNA regulation. Importantly, we show that the sRNA-induced diversity in AbrB levels generates heterogeneity in growth rates during the exponential growth phase. Based on these findings, we hypothesize that the resulting subpopulations of fast- and slow-growing B. subtilis cells reflect a bet-hedging strategy for enhanced survival of unfavorable conditions.

  19. MicroRNA and Transcription Factor Gene Regulatory Network Analysis Reveals Key Regulatory Elements Associated with Prostate Cancer Progression

    PubMed Central

    Sadeghi, Mehdi; Ranjbar, Bijan; Ganjalikhany, Mohamad Reza; M. Khan, Faiz; Schmitz, Ulf; Wolkenhauer, Olaf; Gupta, Shailendra K.

    2016-01-01

    Technological and methodological advances in multi-omics data generation and integration approaches help elucidate genetic features of complex biological traits and diseases such as prostate cancer. Due to its heterogeneity, the identification of key functional components involved in the regulation and progression of prostate cancer is a methodological challenge. In this study, we identified key regulatory interactions responsible for primary to metastasis transitions in prostate cancer using network inference approaches by integrating patient derived transcriptomic and miRomics data into gene/miRNA/transcription factor regulatory networks. One such network was derived for each of the clinical states of prostate cancer based on differentially expressed and significantly correlated gene, miRNA and TF pairs from the patient data. We identified key elements of each network using a network analysis approach and validated our results using patient survival analysis. We observed that HOXD10, BCL2 and PGR are the most important factors affected in primary prostate samples, whereas, in the metastatic state, STAT3, JUN and JUNB are playing a central role. Benefiting integrative networks our analysis suggests that some of these molecules were targeted by several overexpressed miRNAs which may have a major effect on the dysregulation of these molecules. For example, in the metastatic tumors five miRNAs (miR-671-5p, miR-665, miR-663, miR-512-3p and miR-371-5p) are mainly responsible for the dysregulation of STAT3 and hence can provide an opportunity for early detection of metastasis and development of alternative therapeutic approaches. Our findings deliver new details on key functional components in prostate cancer progression and provide opportunities for the development of alternative therapeutic approaches. PMID:28005952

  20. MicroRNA and Transcription Factor Gene Regulatory Network Analysis Reveals Key Regulatory Elements Associated with Prostate Cancer Progression.

    PubMed

    Sadeghi, Mehdi; Ranjbar, Bijan; Ganjalikhany, Mohamad Reza; M Khan, Faiz; Schmitz, Ulf; Wolkenhauer, Olaf; Gupta, Shailendra K

    2016-01-01

    Technological and methodological advances in multi-omics data generation and integration approaches help elucidate genetic features of complex biological traits and diseases such as prostate cancer. Due to its heterogeneity, the identification of key functional components involved in the regulation and progression of prostate cancer is a methodological challenge. In this study, we identified key regulatory interactions responsible for primary to metastasis transitions in prostate cancer using network inference approaches by integrating patient derived transcriptomic and miRomics data into gene/miRNA/transcription factor regulatory networks. One such network was derived for each of the clinical states of prostate cancer based on differentially expressed and significantly correlated gene, miRNA and TF pairs from the patient data. We identified key elements of each network using a network analysis approach and validated our results using patient survival analysis. We observed that HOXD10, BCL2 and PGR are the most important factors affected in primary prostate samples, whereas, in the metastatic state, STAT3, JUN and JUNB are playing a central role. Benefiting integrative networks our analysis suggests that some of these molecules were targeted by several overexpressed miRNAs which may have a major effect on the dysregulation of these molecules. For example, in the metastatic tumors five miRNAs (miR-671-5p, miR-665, miR-663, miR-512-3p and miR-371-5p) are mainly responsible for the dysregulation of STAT3 and hence can provide an opportunity for early detection of metastasis and development of alternative therapeutic approaches. Our findings deliver new details on key functional components in prostate cancer progression and provide opportunities for the development of alternative therapeutic approaches.

  1. Target mimics: an embedded layer of microRNA-involved gene regulatory networks in plants

    PubMed Central

    2012-01-01

    Background MicroRNAs (miRNAs) play an essential role in gene regulation in plants. At the same time, the expression of miRNA genes is also tightly controlled. Recently, a novel mechanism called “target mimicry” was discovered, providing another layer for modulating miRNA activities. However, except for the artificial target mimics manipulated for functional studies on certain miRNA genes, only one example, IPS1 (Induced by Phosphate Starvation 1)—miR399 was experimentally confirmed in planta. To date, few analyses for comprehensive identification of natural target mimics have been performed in plants. Thus, limited evidences are available to provide detailed information for interrogating the questionable issue whether target mimicry was widespread in planta, and implicated in certain biological processes. Results In this study, genome-wide computational prediction of endogenous miRNA mimics was performed in Arabidopsis and rice, and dozens of target mimics were identified. In contrast to a recent report, the densities of target mimic sites were found to be much higher within the untranslated regions (UTRs) when compared to those within the coding sequences (CDSs) in both plants. Some novel sequence characteristics were observed for the miRNAs that were potentially regulated by the target mimics. GO (Gene Ontology) term enrichment analysis revealed some functional insights into the predicted mimics. After degradome sequencing data-based identification of miRNA targets, the regulatory networks constituted by target mimics, miRNAs and their downstream targets were constructed, and some intriguing subnetworks were further exploited. Conclusions These results together suggest that target mimicry may be widely implicated in regulating miRNA activities in planta, and we hope this study could expand the current understanding of miRNA-involved regulatory networks. PMID:22613869

  2. Development of novel cardiovascular therapeutics from small regulatory RNA molecules--an outline of key requirements.

    PubMed

    Poller, W; Fechner, H

    2010-01-01

    Understanding of the roles of RNAs within the cell has changed and expanded dramatically during the past few years. Based on fundamentally new insights it is now increasingly possible to employ RNAs as highly valuable tools in molecular biology and medicine. At present, the most important therapeutic strategies are based on non-coding regulatory RNAs inducing RNA interference (RNAi) to silence single genes, and on modulation of cellular microRNAs (miRNAs) to alter complex gene expression patterns in diseased organs. Only recently it became possible to target therapeutic RNAi to specific organs via organotropic viral vector systems and we discuss the most recent strategies in this field, e.g. heart failure treatment by cardiac-targeted RNAi. Due to the peculiar biochemical properties of small RNA molecules, true therapeutic translation of results in vitro is more demanding than with small molecule drugs or proteins. Specifically, there is a critical requirement for extensive studies in animal models of human disease after pre-testing of the RNAi tools in vitro. This requirement likewise applies for miRNA modulations which have complex consequences in the recipient dependent on biochemical stability and distribution of the therapeutic RNA. Problems not yet fully solved are the prediction of targets and specificity of the RNA tools. However, major progress has been made to achieve their tissue-specific and regulatable expression, and breakthroughs in vector technologies from the gene therapy field have fundamentally improved safety and efficacy of RNA-based therapeutic approaches, too. In summary, insight into the molecular mechanisms of action of regulatory RNAs in combination with new delivery tools for RNA therapeutics will significantly expand our cardiovascular therapeutic repertoire beyond classical pharmacology.

  3. Identification of MicroRNA as Sepsis Biomarker Based on miRNAs Regulatory Network Analysis

    PubMed Central

    Huang, Jie; Sun, Zhandong; Yan, Wenying; Zhu, Yujie; Lin, Yuxin; Chen, Jiajai; Shen, Bairong

    2014-01-01

    Sepsis is regarded as arising from an unusual systemic response to infection but the physiopathology of sepsis remains elusive. At present, sepsis is still a fatal condition with delayed diagnosis and a poor outcome. Many biomarkers have been reported in clinical application for patients with sepsis, and claimed to improve the diagnosis and treatment. Because of the difficulty in the interpreting of clinical features of sepsis, some biomarkers do not show high sensitivity and specificity. MicroRNAs (miRNAs) are small noncoding RNAs which pair the sites in mRNAs to regulate gene expression in eukaryotes. They play a key role in inflammatory response, and have been validated to be potential sepsis biomarker recently. In the present work, we apply a miRNA regulatory network based method to identify novel microRNA biomarkers associated with the early diagnosis of sepsis. By analyzing the miRNA expression profiles and the miRNA regulatory network, we obtained novel miRNAs associated with sepsis. Pathways analysis, disease ontology analysis, and protein-protein interaction network (PIN) analysis, as well as ROC curve, were exploited to testify the reliability of the predicted miRNAs. We finally identified 8 novel miRNAs which have the potential to be sepsis biomarkers. PMID:24809055

  4. Unraveling novel TF-miRNA regulatory crosstalk in metastasis of Soft Tissue Sarcoma.

    PubMed

    Samantarrai, Devyani; Sahu, Mousumi; Roy, Jyoti; Mohanty, Bedanta Ballav; Singh, Garima; Bhushan, Chandra; Mallick, Bibekanand

    2015-05-18

    Cancer metastasis is a disease of extreme clinical relevance, as it is responsible for more than 90% of cancer-associated mortality. The molecular mechanism and critical regulators involved in this complex multi-stage process of metastasis is poorly deciphered in soft tissue sarcomas (STS), a heterogeneous group of rare tumors with high metastatic potential. Therefore, we aimed at identifying miRNA and transcription factor (TF) regulatory networks and paths in STS metastasis. We integrated mRNA and miRNA expression profiles with curated regulations (TF→gene, TF→miRNA, miRNA→gene) from different databases and constructed a potentially active regulatory sub-network in STS metastasis. From functional and topological analysis, we found nine novel regulators of Notch signaling sub-network which are conjectured to play critical role in metastasis of STS. This illustrated that the sub-network is promising for identification of critical regulators. Further analysis deploying our developed tool 'RiNAcyc' and computing coverage ratio of known STS associated genes and miRNAs identified a 15 node active path. This potential path highlights the crucial role of BMP2, hsa-miR-24, AP2 and MYC as the up-stream regulators of the path and hsa-miR-215 and TYMS as potential indicator of chemotherapeutic benefit in STS metastasis.

  5. Evolution of MIR159/319 microRNA genes and their post-transcriptional regulatory link to siRNA pathways

    PubMed Central

    2011-01-01

    -transcriptional level to express multiple mature products with variable proportions under different circumstances. Moreover, our analyses reveal conserved regulatory link of MIR159/319 genes to siRNA pathway through post-transcriptional regulation. PMID:21569383

  6. Evolution of MIR159/319 microRNA genes and their post-transcriptional regulatory link to siRNA pathways.

    PubMed

    Li, Yang; Li, Chaoqun; Ding, Guohui; Jin, Youxin

    2011-05-12

    multiple mature products with variable proportions under different circumstances. Moreover, our analyses reveal conserved regulatory link of MIR159/319 genes to siRNA pathway through post-transcriptional regulation.

  7. MicroRNA-Containing T-Regulatory-Cell-Derived Exosomes Suppress Pathogenic T Helper 1 Cells

    PubMed Central

    Okoye, Isobel S.; Coomes, Stephanie M.; Pelly, Victoria S.; Czieso, Stephanie; Papayannopoulos, Venizelos; Tolmachova, Tanya; Seabra, Miguel C.; Wilson, Mark S.

    2014-01-01

    Summary Foxp3+ T regulatory (Treg) cells prevent inflammatory disease but the mechanistic basis of suppression is not understood completely. Gene silencing by RNA interference can act in a cell-autonomous and non-cell-autonomous manner, providing mechanisms of intercellular regulation. Here, we demonstrate that non-cell-autonomous gene silencing, mediated by miRNA-containing exosomes, is a mechanism employed by Treg cells to suppress T-cell-mediated disease. Treg cells transferred microRNAs (miRNA) to various immune cells, including T helper 1 (Th1) cells, suppressing Th1 cell proliferation and cytokine secretion. Use of Dicer-deficient or Rab27a and Rab27b double-deficient Treg cells to disrupt miRNA biogenesis or the exosomal pathway, respectively, established a requirement for miRNAs and exosomes for Treg-cell-mediated suppression. Transcriptional analysis and miRNA inhibitor studies showed that exosome-mediated transfer of Let-7d from Treg cell to Th1 cells contributed to suppression and prevention of systemic disease. These studies reveal a mechanism of Treg-cell-mediated suppression mediated by miRNA-containing exosomes. PMID:25035954

  8. MicroRNA and Transcription Factor: Key Players in Plant Regulatory Network

    PubMed Central

    Samad, Abdul F. A.; Sajad, Muhammad; Nazaruddin, Nazaruddin; Fauzi, Izzat A.; Murad, Abdul M. A.; Zainal, Zamri; Ismail, Ismanizan

    2017-01-01

    Recent achievements in plant microRNA (miRNA), a large class of small and non-coding RNAs, are very exciting. A wide array of techniques involving forward genetic, molecular cloning, bioinformatic analysis, and the latest technology, deep sequencing have greatly advanced miRNA discovery. A tiny miRNA sequence has the ability to target single/multiple mRNA targets. Most of the miRNA targets are transcription factors (TFs) which have paramount importance in regulating the plant growth and development. Various families of TFs, which have regulated a range of regulatory networks, may assist plants to grow under normal and stress environmental conditions. This present review focuses on the regulatory relationships between miRNAs and different families of TFs like; NF-Y, MYB, AP2, TCP, WRKY, NAC, GRF, and SPL. For instance NF-Y play important role during drought tolerance and flower development, MYB are involved in signal transduction and biosynthesis of secondary metabolites, AP2 regulate the floral development and nodule formation, TCP direct leaf development and growth hormones signaling. WRKY have known roles in multiple stress tolerances, NAC regulate lateral root formation, GRF are involved in root growth, flower, and seed development, and SPL regulate plant transition from juvenile to adult. We also studied the relation between miRNAs and TFs by consolidating the research findings from different plant species which will help plant scientists in understanding the mechanism of action and interaction between these regulators in the plant growth and development under normal and stress environmental conditions. PMID:28446918

  9. Interplay of cis- and trans-regulatory mechanisms in the spliceosomal RNA helicase Brr2.

    PubMed

    Absmeier, Eva; Becke, Christian; Wollenhaupt, Jan; Santos, Karine F; Wahl, Markus C

    2017-01-02

    RNA helicase Brr2 is implicated in multiple phases of pre-mRNA splicing and thus requires tight regulation. Brr2 can be auto-inhibited via a large N-terminal region folding back onto its helicase core and auto-activated by a catalytically inactive C-terminal helicase cassette. Furthermore, it can be regulated in trans by the Jab1 domain of the Prp8 protein, which can inhibit Brr2 by intermittently inserting a C-terminal tail in the enzyme's RNA-binding tunnel or activate the helicase after removal of this tail. Presently it is unclear, whether these regulatory mechanisms functionally interact and to which extent they are evolutionarily conserved. Here, we report crystal structures of Saccharomyces cerevisiae and Chaetomium thermophilum Brr2-Jab1 complexes, demonstrating that Jab1-based inhibition of Brr2 presumably takes effect in all eukaryotes but is implemented via organism-specific molecular contacts. Moreover, the structures show that Brr2 auto-inhibition can act in concert with Jab1-mediated inhibition, and suggest that the N-terminal region influences how the Jab1 C-terminal tail interacts at the RNA-binding tunnel. Systematic RNA binding and unwinding studies revealed that the N-terminal region and the Jab1 C-terminal tail specifically interfere with accommodation of double-stranded and single-stranded regions of an RNA substrate, respectively, mutually reinforcing each other. Additionally, such analyses show that regulation based on the N-terminal region requires the presence of the inactive C-terminal helicase cassette. Together, our results outline an intricate system of regulatory mechanisms, which control Brr2 activities during snRNP assembly and splicing.

  10. c-Myc co-ordinates mRNA cap methylation and ribosomal RNA production.

    PubMed

    Dunn, Sianadh; Lombardi, Olivia; Cowling, Victoria H

    2017-02-01

    The mRNA cap is a structure added to RNA pol II transcripts in eukaryotes, which recruits factors involved in RNA processing, nuclear export and translation initiation. RNA guanine-7 methyltransferase (RNMT)-RNA-activating miniprotein (RAM), the mRNA cap methyltransferase complex, completes the basic functional mRNA cap structure, cap 0, by methylating the cap guanosine. Here, we report that RNMT-RAM co-ordinates mRNA processing with ribosome production. Suppression of RNMT-RAM reduces synthesis of the 45S ribosomal RNA (rRNA) precursor. RNMT-RAM is required for c-Myc expression, a major regulator of RNA pol I, which synthesises 45S rRNA. Constitutive expression of c-Myc restores rRNA synthesis when RNMT-RAM is suppressed, indicating that RNMT-RAM controls rRNA production predominantly by controlling c-Myc expression. We report that RNMT-RAM is recruited to the ribosomal DNA locus, which may contribute to rRNA synthesis in certain contexts.

  11. c-Myc co-ordinates mRNA cap methylation and ribosomal RNA production

    PubMed Central

    Dunn, Sianadh; Lombardi, Olivia; Cowling, Victoria H.

    2017-01-01

    The mRNA cap is a structure added to RNA pol II transcripts in eukaryotes, which recruits factors involved in RNA processing, nuclear export and translation initiation. RNA guanine-7 methyltransferase (RNMT)–RNA-activating miniprotein (RAM), the mRNA cap methyltransferase complex, completes the basic functional mRNA cap structure, cap 0, by methylating the cap guanosine. Here, we report that RNMT–RAM co-ordinates mRNA processing with ribosome production. Suppression of RNMT–RAM reduces synthesis of the 45S ribosomal RNA (rRNA) precursor. RNMT–RAM is required for c-Myc expression, a major regulator of RNA pol I, which synthesises 45S rRNA. Constitutive expression of c-Myc restores rRNA synthesis when RNMT–RAM is suppressed, indicating that RNMT–RAM controls rRNA production predominantly by controlling c-Myc expression. We report that RNMT–RAM is recruited to the ribosomal DNA locus, which may contribute to rRNA synthesis in certain contexts. PMID:27934633

  12. The Regulatory Small RNA MarS Supports Virulence of Streptococcus pyogenes.

    PubMed

    Pappesch, Roberto; Warnke, Philipp; Mikkat, Stefan; Normann, Jana; Wisniewska-Kucper, Aleksandra; Huschka, Franziska; Wittmann, Maja; Khani, Afsaneh; Schwengers, Oliver; Oehmcke-Hecht, Sonja; Hain, Torsten; Kreikemeyer, Bernd; Patenge, Nadja

    2017-09-25

    Small regulatory RNAs (sRNAs) play a role in the control of bacterial virulence gene expression. In this study, we investigated an sRNA that was identified in Streptococcus pyogenes (group A Streptococcus, GAS) but is conserved throughout various streptococci. In a deletion strain, expression of mga, the gene encoding the multiple virulence gene regulator, was reduced. Accordingly, transcript and proteome analyses revealed decreased expression of several Mga-activated genes. Therefore, and because the sRNA was shown to interact with the 5' UTR of the mga transcript in a gel-shift assay, we designated it MarS for m ga-activating regulatory sRNA. Down-regulation of important virulence factors, including the antiphagocytic M-protein, led to increased susceptibility of the deletion strain to phagocytosis and reduced adherence to human keratinocytes. In a mouse infection model, the marS deletion mutant showed reduced dissemination to the liver, kidney, and spleen. Additionally, deletion of marS led to increased tolerance towards oxidative stress. Our in vitro and in vivo results indicate a modulating effect of MarS on virulence gene expression and on the pathogenic potential of GAS.

  13. Tristetraprolin-driven regulatory circuit controls quality and timing of mRNA decay in inflammation

    PubMed Central

    Kratochvill, Franz; Machacek, Christian; Vogl, Claus; Ebner, Florian; Sedlyarov, Vitaly; Gruber, Andreas R; Hartweger, Harald; Vielnascher, Raimund; Karaghiosoff, Marina; Rülicke, Thomas; Müller, Mathias; Hofacker, Ivo; Lang, Roland; Kovarik, Pavel

    2011-01-01

    For a successful yet controlled immune response, cells need to specifically destabilize inflammatory mRNAs but prevent premature removal of those still used. The regulatory circuits controlling quality and timing in the global inflammatory mRNA decay are not understood. Here, we show that the mRNA-destabilizing function of the AU-rich element-binding protein tristetraprolin (TTP) is inversely regulated by the p38 MAPK activity profile such that after inflammatory stimulus the TTP-dependent decay is initially limited to few mRNAs. With time, the TTP-dependent decay gradually spreads resulting in cumulative elimination of one third of inflammation-induced unstable mRNAs in macrophages in vitro. We confirmed this sequential decay model in vivo since LPS-treated mice with myeloid TTP ablation exhibited similar cytokine dysregulation profile as macrophages. The mice were hypersensitive to LPS but otherwise healthy with no signs of hyperinflammation seen in conventional TTP knockout mice demonstrating the requirement for myeloid TTP in re-installment but not maintenance of immune homeostasis. These findings reveal a TTP- and p38 MAPK-dominated regulatory mechanism that is vital for balancing acute inflammation by a temporally and qualitatively controlled mRNA decay. PMID:22186734

  14. Structural basis for specific recognition of multiple mRNA targets by a PUF regulatory protein

    SciTech Connect

    Wang, Yeming; Opperman, Laura; Wickens, Marvin; Tanaka Hall, Traci M.

    2011-11-02

    Caenorhabditis elegans fem-3 binding factor (FBF) is a founding member of the PUMILIO/FBF (PUF) family of mRNA regulatory proteins. It regulates multiple mRNAs critical for stem cell maintenance and germline development. Here, we report crystal structures of FBF in complex with 6 different 9-nt RNA sequences, including elements from 4 natural mRNAs. These structures reveal that FBF binds to conserved bases at positions 1-3 and 7-8. The key specificity determinant of FBF vs. other PUF proteins lies in positions 4-6. In FBF/RNA complexes, these bases stack directly with one another and turn away from the RNA-binding surface. A short region of FBF is sufficient to impart its unique specificity and lies directly opposite the flipped bases. We suggest that this region imposes a flattened curvature on the protein; hence, the requirement for the additional nucleotide. The principles of FBF/RNA recognition suggest a general mechanism by which PUF proteins recognize distinct families of RNAs yet exploit very nearly identical atomic contacts in doing so.

  15. Conservation and evolution of miRNA regulatory programs in plant development

    PubMed Central

    Willmann, Matthew R.; Poethig, R. Scott

    2007-01-01

    Summary of recent advances Over the past two years, microarray technologies, large-scale small RNA and whole genome sequencing projects, and data mining have provided a wealth of information about the spectrum of miRNAs and miRNA targets present in different plant species and the alga Chlamydomonas. Such studies have shown that a number of key miRNA regulatory modules for plant development are conserved throughout the plant kingdom, suggesting that these programs were critical to the colonization of land. New genetic and biochemical studies of miRNA pathways in Arabidopsis, the spatiotemporal expression patterns of several conserved miRNAs and their targets, and the characterization of mutations in Arabidopsis and maize have begun to reveal the functions of these ancient miRNA-regulated developmental programs. In addition to these conserved miRNAs, there are many clade and species-specific miRNAs, which have evolved more recently and whose functions are currently unknown. PMID:17709279

  16. Regulatory mechanisms and clinical perspectives of miRNA in tumor radiosensitivity

    PubMed Central

    Cao, Ya; Dong, Zigang

    2012-01-01

    MicroRNA (miRNA) influences carcinogenesis at multiple stages and it can effectively control tumor radiosensitivity by affecting DNA damage repair, cell cycle checkpoint, apoptosis, radio-related signal transduction pathways and tumor microenvironment. MiRNA also efficiently modulates tumor radiosensitivity at multiple levels by blocking the two essential non-homologous end-joining repair and homologous recombination repair pathways in the DNA damage response. It interferes with four radio-related pathways in ionizing radiation, including the PI3-K/Akt, NF-κB, MAPK and TGFβ signaling pathways. Moreover, the regulatory effect of miRNA in radiosensitivity can be enhanced when interacting with various key molecules, including H2AX, BRCA1, ATM, DNA-PK, RAD51, Chk1, Cdc25A, p53, PLK1, HIF-1 and VEGF, which are involved in these processes. Therefore, thoroughly understanding the mechanism of miRNA in tumor radiosensitivity could assist in finding novel targets to improve the radiotherapeutic effects and provide new clinical perspectives and insights for developing effective cancer treatments. PMID:22798379

  17. Evolutionary conservation of microRNA regulatory programs in plant flower development.

    PubMed

    Luo, Yan; Guo, Zhenhua; Li, Lu

    2013-08-15

    MicroRNAs (miRNAs) are post-transcriptional regulators of growth and development in both plants and animals. Flowering is critical for the reproduction of angiosperms. Flower development entails the transition from vegetative growth to reproductive growth, floral organ initiation, and the development of floral organs. These developmental processes are genetically regulated by miRNAs, which participate in complex genetic networks of flower development. A survey of the literature shows that miRNAs, their specific targets, and the regulatory programs in which they participate are conserved throughout the plant kingdom. This review summarizes the role of miRNAs and their targets in the regulation of gene expression during the floral developmental phase, which includes the floral transition stage, followed by floral patterning, and then the development of floral organs. The conservation patterns observed in each component of the miRNA regulatory system suggest that these miRNAs play important roles in the evolution of flower development.

  18. [Micro RNA-451 promoting osteogenesis of mesenchymal stem cells by targeting regulatory calcium binding protein 39].

    PubMed

    Kang, Xia; Kang, Fei; Yang, Bo; Guo, Hongfeng; Quan, Yi; Dong, Shiwu

    2013-09-01

    To investigate the role of micro RNA-451 (miRNA-451) in promoting the osteogenesis of mesenchymal stem cells (MSCs) by targeting regulatory calcium binding protein 39 (CAB39). pMIR-report and pRL-TK vectors were selected to identify the relationship between miRNA-451 and CAB39 by using dual-luciferase reporter assay. pre-miRNA-451 (group A), anti-miRNA-451 (group C), pre-miRNA negative control (group B), and anti-miRNA negative control (group D) were transfected into the C3H10T1/2 cells, respectively. Then, the cells were collected after osteogenic induction for 7 and 14 days. At 7 and 14 days, the real-time fluorescent quantitative PCR and Western blot assays were performed to detect the related osteogenetic biomarkers [Runx2 and alkaline phosphatase (ALP) mRNA] and expressions of CAB39 protein. At 14 days, the extracellular calcium deposition during the osteogenesis of MSCs was tested by Alizarin red staining method. CAB39 was the target gene of miRNA-451. At 7 and 14 days after osteogenic induction, the mRNA expressions of Runx2 and ALP in group A were significantly higher than those in group B (P < 0.05), and the expressions in group C was significantly lower than those in group D (P < 0.05). Furthermore, at 14 days after osteogenic induction, the protein expression of CAB39 in group A (0.55 +/- 0.05) was significantly lower than that in group B (1.00 +/- 0.07), and the protein expression in group C (1.21 +/- 0.05) was significantly higher than that in group D (1.00 +/- 0.04), all showing significant difference (P < 0.05). Finally, at 14 days after osteogenic induction, the extracellular calcium deposition in group A was obviously more than that in group B, and group C was downregulated when compared with group D. miRNA-451 can promote the osteogenesis process of MSCs by downregulating the CAB39.

  19. tRNA regulation of gene expression: Interactions of an mRNA 5′-UTR with a regulatory tRNA

    PubMed Central

    Nelson, Audrey R.; Henkin, Tina M.; Agris, Paul F.

    2006-01-01

    Many genes encoding aminoacyl-tRNA synthetases and other amino acid–related products in Gram-positive bacteria, including important pathogens, are regulated through interaction of unacylated tRNA with the 5′-untranslated region (5′-UTR) of the mRNA. Each gene regulated by this mechanism responds specifically to the cognate tRNA, and specificity is determined by pairing of the anticodon of the tRNA with a codon sequence in the “Specifier Loop” of the 5′-UTR. For the 5′-UTR to function in gene regulation, the mRNA folding interactions must be sufficiently stable to present the codon sequence for productive binding to the anticodon of the matching tRNA. A model bimolecular system was developed in which the interaction between two half molecules (“Common” and “Specifier”) would reconstitute the Specifier Loop region of the 5′-UTR of the Bacillus subtilis glyQS gene, encoding GlyRS mRNA. Gel mobility shift analysis and fluorescence spectroscopy yielded experimental K ds of 27.6 ± 1.0 μM and 10.5 ± 0.7 μM, respectively, for complex formation between Common and Specifier half molecules. The reconstituted 5′-UTR of the glyQS mRNA bound the anticodon stem and loop of tRNAGly (ASLGlyGCC) specifically and with a significant affinity (K d = 20.2 ± 1.4 μM). Thus, the bimolecular 5′-UTR and ASLGlyGCC models mimic the RNA–RNA interaction required for T box gene regulation in vivo. PMID:16741230

  20. Signal Transduction and Regulatory Mechanisms Involved in Control of the σS (RpoS) Subunit of RNA Polymerase

    PubMed Central

    Hengge-Aronis, Regine

    2002-01-01

    The σS (RpoS) subunit of RNA polymerase is the master regulator of the general stress response in Escherichia coli and related bacteria. While rapidly growing cells contain very little σS, exposure to many different stress conditions results in rapid and strong σS induction. Consequently, transcription of numerous σS-dependent genes is activated, many of which encode gene products with stress-protective functions. Multiple signal integration in the control of the cellular σS level is achieved by rpoS transcriptional and translational control as well as by regulated σS proteolysis, with various stress conditions differentially affecting these levels of σS control. Thus, a reduced growth rate results in increased rpoS transcription whereas high osmolarity, low temperature, acidic pH, and some late-log-phase signals stimulate the translation of already present rpoS mRNA. In addition, carbon starvation, high osmolarity, acidic pH, and high temperature result in stabilization of σS, which, under nonstress conditions, is degraded with a half-life of one to several minutes. Important cis-regulatory determinants as well as trans-acting regulatory factors involved at all levels of σS regulation have been identified. rpoS translation is controlled by several proteins (Hfq and HU) and small regulatory RNAs that probably affect the secondary structure of rpoS mRNA. For σS proteolysis, the response regulator RssB is essential. RssB is a specific direct σS recognition factor, whose affinity for σS is modulated by phosphorylation of its receiver domain. RssB delivers σS to the ClpXP protease, where σS is unfolded and completely degraded. This review summarizes our current knowledge about the molecular functions and interactions of these components and tries to establish a framework for further research on the mode of multiple signal input into this complex regulatory system. PMID:12208995

  1. Structure of dual function iron regulatory protein 1 complexed with ferritin IRE-RNA

    SciTech Connect

    Walden, William E.; Selezneva, Anna I.; Dupuy, Jérôme; Volbeda, Anne; Fontecilla-Camps, Juan C.; Theil, Elizabeth C.; Volz1, Karl

    2011-07-27

    Iron regulatory protein 1 (IRP1) binds iron-responsive elements (IREs) in messenger RNAs (mRNAs), to repress translation or degradation, or binds an iron-sulfur cluster, to become a cytosolic aconitase enzyme. The 2.8 angstrom resolution crystal structure of the IRP1:ferritin H IRE complex shows an open protein conformation compared with that of cytosolic aconitase. The extended, L-shaped IRP1 molecule embraces the IRE stem-loop through interactions at two sites separated by {approx}30 angstroms, each involving about a dozen protein:RNA bonds. Extensive conformational changes related to binding the IRE or an iron-sulfur cluster explain the alternate functions of IRP1 as an mRNA regulator or enzyme.

  2. SCODE: an efficient regulatory network inference algorithm from single-cell RNA-Seq during differentiation.

    PubMed

    Matsumoto, Hirotaka; Kiryu, Hisanori; Furusawa, Chikara; Ko, Minoru S H; Ko, Shigeru B H; Gouda, Norio; Hayashi, Tetsutaro; Nikaido, Itoshi

    2017-08-01

    The analysis of RNA-Seq data from individual differentiating cells enables us to reconstruct the differentiation process and the degree of differentiation (in pseudo-time) of each cell. Such analyses can reveal detailed expression dynamics and functional relationships for differentiation. To further elucidate differentiation processes, more insight into gene regulatory networks is required. The pseudo-time can be regarded as time information and, therefore, single-cell RNA-Seq data are time-course data with high time resolution. Although time-course data are useful for inferring networks, conventional inference algorithms for such data suffer from high time complexity when the number of samples and genes is large. Therefore, a novel algorithm is necessary to infer networks from single-cell RNA-Seq during differentiation. In this study, we developed the novel and efficient algorithm SCODE to infer regulatory networks, based on ordinary differential equations. We applied SCODE to three single-cell RNA-Seq datasets and confirmed that SCODE can reconstruct observed expression dynamics. We evaluated SCODE by comparing its inferred networks with use of a DNaseI-footprint based network. The performance of SCODE was best for two of the datasets and nearly best for the remaining dataset. We also compared the runtimes and showed that the runtimes for SCODE are significantly shorter than for alternatives. Thus, our algorithm provides a promising approach for further single-cell differentiation analyses. The R source code of SCODE is available at https://github.com/hmatsu1226/SCODE. hirotaka.matsumoto@riken.jp. Supplementary data are available at Bioinformatics online.

  3. MicroRNA-29b/Tet1 regulatory axis epigenetically modulates mesendoderm differentiation in mouse embryonic stem cells

    PubMed Central

    Tu, Jiajie; Ng, Shuk Han; Shui Luk, Alfred Chun; Liao, Jinyue; Jiang, Xiaohua; Feng, Bo; Lun Mak, Kingston King; Rennert, Owen M.; Chan, Wai-Yee; Lee, Tin-Lap

    2015-01-01

    Ten eleven translocation (Tet) family-mediated DNA oxidation on 5-methylcytosine (5mC) to 5-hydroxymethylcytosine (5hmC) represents a novel epigenetic modification that regulates dynamic gene expression during embryonic stem cells (ESCs) differentiation. Through the role of Tet on 5hmC regulation in stem cell development is relatively defined, how the Tet family is regulated and impacts on ESCs lineage development remains elusive. In this study, we show non-coding RNA regulation on Tet family may contribute to epigenetic regulation during ESCs differentiation, which is suggested by microRNA-29b (miR-29b) binding sites on the Tet1 3′ untranslated region (3′ UTR). We demonstrate miR-29b increases sharply after embyoid body (EB) formation, which causes Tet1 repression and reduction of cellular 5hmC level during ESCs differentiation. Importantly, we show this miR-29b/Tet1 regulatory axis promotes the mesendoderm lineage formation both in vitro and in vivo by inducing the Nodal signaling pathway and repressing the key target of the active demethylation pathway, Tdg. Taken together, our findings underscore the contribution of small non-coding RNA mediated regulation on DNA demethylation dynamics and the differential expressions of key mesendoderm regulators during ESCs lineage specification. MiR-29b could potentially be applied to enrich production of mesoderm and endoderm derivatives and be further differentiated into desired organ-specific cells. PMID:26130713

  4. RNA regulatory networks diversified through curvature of the PUF protein scaffold

    DOE PAGES

    Wilinski, Daniel; Qiu, Chen; Lapointe, Christopher P.; ...

    2015-09-14

    Proteins bind and control mRNAs, directing their localization, translation and stability. Members of the PUF family of RNA-binding proteins control multiple mRNAs in a single cell, and play key roles in development, stem cell maintenance and memory formation. Here we identified the mRNA targets of a S. cerevisiae PUF protein, Puf5p, by ultraviolet-crosslinking-affinity purification and high-throughput sequencing (HITS-CLIP). The binding sites recognized by Puf5p are diverse, with variable spacer lengths between two specific sequences. Each length of site correlates with a distinct biological function. Crystal structures of Puf5p–RNA complexes reveal that the protein scaffold presents an exceptionally flat and extendedmore » interaction surface relative to other PUF proteins. In complexes with RNAs of different lengths, the protein is unchanged. A single PUF protein repeat is sufficient to induce broadening of specificity. Changes in protein architecture, such as alterations in curvature, may lead to evolution of mRNA regulatory networks.« less

  5. A system biology approach for understanding the miRNA regulatory network in colon rectal cancer.

    PubMed

    Pradhan, Meeta; Nagulapalli, Kshithija; Ledford, Lakenvia; Pandit, Yogesh; Palakal, Mathew

    2015-01-01

    In this paper we present a systems biology approach to the understanding of the miRNA-regulatory network in colon rectal cancer. An initial set of significant genes in Colon Rectal Cancer (CRC) were obtained by mining relevant literature. An initial set of cancer-related miRNAs were obtained from three databases: miRBase, miRWalk, Targetscan and GEO microarray experiment. First principle methods were then used to generate the global miRNA-gene network. Significant miRNAs and associated transcription factors in the global miRNA-gene network were identified using topological and sub-graph analyses. Eleven novel miRNAs were identified and three of the novel miRNAs, hsa-miR-630, hsa-miR-100 and hsa-miR-99a, were further analysed to elucidate their role in CRC. The proposed methodology effectively made use of literature data and was able to show novel, significant miRNA-transcription associations in CRC.

  6. RNA regulatory networks diversified through curvature of the PUF protein scaffold

    PubMed Central

    Wilinski, Daniel; Qiu, Chen; Lapointe, Christopher P.; Nevil, Markus; Campbell, Zachary T.; Tanaka Hall, Traci M.; Wickens, Marvin

    2015-01-01

    Proteins bind and control mRNAs, directing their localization, translation and stability. Members of the PUF family of RNA-binding proteins control multiple mRNAs in a single cell, and play key roles in development, stem cell maintenance and memory formation. Here we identified the mRNA targets of a S. cerevisiae PUF protein, Puf5p, by ultraviolet-crosslinking-affinity purification and high-throughput sequencing (HITS-CLIP). The binding sites recognized by Puf5p are diverse, with variable spacer lengths between two specific sequences. Each length of site correlates with a distinct biological function. Crystal structures of Puf5p–RNA complexes reveal that the protein scaffold presents an exceptionally flat and extended interaction surface relative to other PUF proteins. In complexes with RNAs of different lengths, the protein is unchanged. A single PUF protein repeat is sufficient to induce broadening of specificity. Changes in protein architecture, such as alterations in curvature, may lead to evolution of mRNA regulatory networks. PMID:26364903

  7. RNA regulatory networks diversified through curvature of the PUF protein scaffold

    SciTech Connect

    Wilinski, Daniel; Qiu, Chen; Lapointe, Christopher P.; Nevil, Markus; Campbell, Zachary T.; Tanaka Hall, Traci M.; Wickens, Marvin

    2015-09-14

    Proteins bind and control mRNAs, directing their localization, translation and stability. Members of the PUF family of RNA-binding proteins control multiple mRNAs in a single cell, and play key roles in development, stem cell maintenance and memory formation. Here we identified the mRNA targets of a S. cerevisiae PUF protein, Puf5p, by ultraviolet-crosslinking-affinity purification and high-throughput sequencing (HITS-CLIP). The binding sites recognized by Puf5p are diverse, with variable spacer lengths between two specific sequences. Each length of site correlates with a distinct biological function. Crystal structures of Puf5p–RNA complexes reveal that the protein scaffold presents an exceptionally flat and extended interaction surface relative to other PUF proteins. In complexes with RNAs of different lengths, the protein is unchanged. A single PUF protein repeat is sufficient to induce broadening of specificity. Changes in protein architecture, such as alterations in curvature, may lead to evolution of mRNA regulatory networks.

  8. Identification of a novel miRNA-target gene regulatory network in osteosarcoma by integrating transcriptome analysis

    PubMed Central

    He, Chunlei; Gao, Hui; Fan, Xiaona; Wang, Maoyuan; Liu, Wuyang; Huang, Weiming; Yang, Yadong

    2015-01-01

    Osteosarcoma remains a leading cause of cancer death in children and young adolescents. Although the introduction of multiagent chemotherapy, survival rates have not improved in two decades. Therefore, it is urgently needed to know the details regarding molecular etiology to driving therapeutic inroads for this disease. In this study we performed an integrated analysis of miRNA and mRNA expression data to explore the dysregulation of miRNA and miRNA-target gene regulatory network underlying OS. 59 differentially expressed miRNAs were identified, with 28 up-regulated and 31 down-regulated miRNAs by integrating OS miRNA expression data sets available. Using miRWalk databases prediction, we performed an anticorrelated analysis of miRNA and genes expression identified by a integrated analysis of gene expression data to identify 109 differently expressed miRNA target genes. A novel miRNA-target gene regulatory network was constructed with the miRNA-target gene pairs. miR-19b-3p, miR-20a-5p, miR-124-3p and their common target CCND2, the nodal points of regulatory network, may play important roles in OS. Bioinformatics analysis of biological functions and pathways demonstrated that target genes of miRNAs are highly correlated with carcinogenesis. Our findings may help to understand the molecular mechanisms of OS and identify targets of effective targeted therapies for OS. PMID:26339404

  9. Regulatory Consequences of "Brexit" for the Development of Medicinal Products.

    PubMed

    Jackson, E L; Feldschreiber, P; Breckenridge, A

    2017-08-01

    The United Kingdom voted in a referendum in June 2016 to leave the European Union (EU) after 45 years of membership. Among the many political, social, and scientific consequences are those for the regulation of health care products. No longer will the efficacy, safety, and quality of medicines in the United Kingdom be subject to an EU regulatory framework. The European Medicines Agency (EMA), which is currently located in London, will move elsewhere in Europe. The pharmaceutical industry will reassess its commitment to the UK health scene. © 2017, ASCPT.

  10. Regulatory and clinical aspects of psychotropic medicinal products bioequivalence.

    PubMed

    Bałkowiec-Iskra, Ewa; Cessak, Grzegorz; Kuzawińska, Olga; Sejbuk-Rozbicka, Katarzyna; Rokita, Konrad; Mirowska-Guzel, Dagmara

    2015-07-01

    Introduction of generic medicinal products to the market has increased access to modern therapies but also enabled significant reduction in their cost, leading to containment of public expenditures on medicinal products reimbursement. The critical assessment of bioequivalence of any reference medicinal product and its counterpart is based on comparison of their rate and extent of absorption. It is assumed that two medicinal products are bioequivalent when their rate and extent of absorption do not show significant differences when administered at the same dose under similar experimental conditions. Bioequivalent medicinal products are declared to be also therapeutically equivalent and can be used interchangeably. However, despite regulatory declaration, switching from reference to generic drugs is often associated with concerns of healthcare providers about decreased treatment effectiveness or occurrence of adverse drug reactions. The aim of this article is to provide a description of rules that guide registration of generic medicinal products in the European Union and to analyze specific examples from the scientific literature concerning therapeutic equivalence of reference and generic antidepressant and antipsychotic medicinal products.

  11. Decoy approach using RNA-DNA chimera oligonucleotides to inhibit the regulatory function of human immunodeficiency virus type 1 Rev protein.

    PubMed Central

    Nakaya, T; Iwai, S; Fujinaga, K; Sato, Y; Otsuka, E; Ikuta, K

    1997-01-01

    Human immunodeficiency virus type 1 (HIV-1) encodes two regulatory proteins, Tat and Rev, that bind to target RNA sequences. These are the trans-activation responsive (TAR) RNA and the Rev-responsive element (RRE), respectively. The Rev protein shifts RNA synthesis to viral transcripts by binding to the RRE within the env gene. In the present study we prepared a RNA-DNA chimera consisting of 29 or 31 nucleotides to inhibit the Rev regulatory function by means of the decoy approach. The chimera oligonucleotides (anti-Rev oligonucleotides [AROs]) contained an RNA "bubble" structure (13 oligonucleotides; the Rev-binding element in RRE) that bound Rev with a high affinity in an in vitro assay. The controls were RNA-DNA chimera oligonucleotides (negative control oligonucleotides [NCOs]) similar to ARO, but without the bubble structure, that bound with considerably less affinity to Rev. When the inhibitory effects of these decoys on HIV-1 replication were examined, we found that AROs, but no NCOs, reduced more than 90% of the HIV-1 production generated by productively infected human T-cell lines. The production of primary HIV-1 isolates in healthy donor-derived peripheral blood mononuclear cells was also similarly inhibited by AROs. In addition, the induction of viral mRNAs and antigens in latently HIV-1-infected ACH-2 cells by tumor necrosis factor alpha was specifically inhibited by AROs, but not by NCOs. No apparent cytotoxicity was caused by either decoy. Thus, the use of a Rev-binding element-based decoy, the RNA-DNA chimera oligonucleotide, may represent a safer approach to gene therapy for reducing the virus load in HIV-1-infected individuals. PMID:9021186

  12. CLIP-seq analysis of multi-mapped reads discovers novel functional RNA regulatory sites in the human transcriptome.

    PubMed

    Zhang, Zijun; Xing, Yi

    2017-09-19

    Crosslinking or RNA immunoprecipitation followed by sequencing (CLIP-seq or RIP-seq) allows transcriptome-wide discovery of RNA regulatory sites. As CLIP-seq/RIP-seq reads are short, existing computational tools focus on uniquely mapped reads, while reads mapped to multiple loci are discarded. We present CLAM (CLIP-seq Analysis of Multi-mapped reads). CLAM uses an expectation-maximization algorithm to assign multi-mapped reads and calls peaks combining uniquely and multi-mapped reads. To demonstrate the utility of CLAM, we applied it to a wide range of public CLIP-seq/RIP-seq datasets involving numerous splicing factors, microRNAs and m6A RNA methylation. CLAM recovered a large number of novel RNA regulatory sites inaccessible by uniquely mapped reads. The functional significance of these sites was demonstrated by consensus motif patterns and association with alternative splicing (splicing factors), transcript abundance (AGO2) and mRNA half-life (m6A). CLAM provides a useful tool to discover novel protein-RNA interactions and RNA modification sites from CLIP-seq and RIP-seq data, and reveals the significant contribution of repetitive elements to the RNA regulatory landscape of the human transcriptome. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  13. Adaptation of Tri-molecular fluorescence complementation allows assaying of regulatory Csr RNA-protein interactions in bacteria.

    PubMed

    Gelderman, Grant; Sivakumar, Anusha; Lipp, Sarah; Contreras, Lydia

    2015-02-01

    sRNAs play a significant role in controlling and regulating cellular metabolism. One of the more interesting aspects of certain sRNAs is their ability to make global changes in the cell by interacting with regulatory proteins. In this work, we demonstrate the use of an in vivo Tri-molecular Fluorescence Complementation assay to detect and visualize the central regulatory sRNA-protein interaction of the Carbon Storage Regulatory system in E. coli. The Carbon Storage Regulator consists primarily of an RNA binding protein, CsrA, that alters the activity of mRNA targets and of an sRNA, CsrB, that modulates the activity of CsrA. We describe the construction of a fluorescence complementation system that detects the interactions between CsrB and CsrA. Additionally, we demonstrate that the intensity of the fluorescence of this system is able to detect changes in the affinity of the CsrB-CsrA interaction, as caused by mutations in the protein sequence of CsrA. While previous methods have adopted this technique to study mRNA or RNA localization, this is the first attempt to use this technique to study the sRNA-protein interaction directly in bacteria. This method presents a potentially powerful tool to study complex bacterial RNA protein interactions in vivo.

  14. Inhibition of exotoxin production by mobile genetic element SCCmec-encoded psm-mec RNA is conserved in staphylococcal species.

    PubMed

    Ikuo, Mariko; Nagano, Gentaro; Saito, Yuki; Mao, Han; Sekimizu, Kazuhisa; Kaito, Chikara

    2014-01-01

    Staphylococcal species acquire antibiotic resistance by incorporating the mobile-genetic element SCCmec. We previously found that SCCmec-encoded psm-mec RNA suppresses exotoxin production as a regulatory RNA, and the psm-mec translation product increases biofilm formation in Staphylococcus aureus. Here, we examined whether the regulatory role of psm-mec on host bacterial virulence properties is conserved among other staphylococcal species, S. epidermidis and S. haemolyticus, both of which are important causes of nosocomial infections. In S. epidermidis, introduction of psm-mec decreased the production of cytolytic toxins called phenol-soluble modulins (PSMs) and increased biofilm formation. Introduction of psm-mec with a stop-codon mutation that did not express PSM-mec protein but did express psm-mec RNA also decreased PSM production, but did not increase biofilm formation. Thus, the psm-mec RNA inhibits PSM production, whereas the PSM-mec protein increases biofilm formation in S. epidermidis. In S. haemolyticus, introduction of psm-mec decreased PSM production, but did not affect biofilm formation. The mutated psm-mec with a stop-codon also caused the same effect. Thus, the psm-mec RNA also inhibits PSM production in S. haemolyticus. These findings suggest that the inhibitory role of psm-mec RNA on exotoxin production is conserved among staphylococcal species, although the stimulating effect of the psm-mec gene on biofilm formation is not conserved.

  15. Regulatory hurdles for genome editing: process- vs. product-based approaches in different regulatory contexts.

    PubMed

    Sprink, Thorben; Eriksson, Dennis; Schiemann, Joachim; Hartung, Frank

    2016-07-01

    Novel plant genome editing techniques call for an updated legislation regulating the use of plants produced by genetic engineering or genome editing, especially in the European Union. Established more than 25 years ago and based on a clear distinction between transgenic and conventionally bred plants, the current EU Directives fail to accommodate the new continuum between genetic engineering and conventional breeding. Despite the fact that the Directive 2001/18/EC contains both process- and product-related terms, it is commonly interpreted as a strictly process-based legislation. In view of several new emerging techniques which are closer to the conventional breeding than common genetic engineering, we argue that it should be actually interpreted more in relation to the resulting product. A legal guidance on how to define plants produced by exploring novel genome editing techniques in relation to the decade-old legislation is urgently needed, as private companies and public researchers are waiting impatiently with products and projects in the pipeline. We here outline the process in the EU to develop a legislation that properly matches the scientific progress. As the process is facing several hurdles, we also compare with existing frameworks in other countries and discuss ideas for an alternative regulatory system.

  16. Deduced products of C4-dicarboxylate transport regulatory genes of Rhizobium leguminosarum are homologous to nitrogen regulatory gene products.

    PubMed Central

    Ronson, C W; Astwood, P M; Nixon, B T; Ausubel, F M

    1987-01-01

    We have sequenced two genes dctB and dctD required for the activation of the C4-dicarboxylate transport structural gene dctA in free-living Rhizobium leguminosarum. The hydropathic profile of the dctB gene product (DctB) suggested that its N-terminal region may be located in the periplasm and its C-terminal region in the cytoplasm. The C-terminal region of DctB was strongly conserved with similar regions of the products of several regulatory genes that may act as environmental sensors, including ntrB, envZ, virA, phoR, cpxA, and phoM. The N-terminal domains of the products of several regulatory genes thought to be transcriptional activators, including ntrC, ompR, virG, phoB and sfrA. In addition, the central and C-terminal regions of DctD were strongly conserved with the products of ntrC and nifA, transcriptional activators that require the alternate sigma factor rpoN (ntrA) as co-activator. The central region of DctD also contained a potential ATP-binding domain. These results are consistent with recent results that show that rpoN product is required for dctA activation, and suggest that DctB plus DctD-mediated transcriptional activation of dctA may be mechanistically similar to NtrB plus NtrC-mediated activation of glnA in E. coli. PMID:3671068

  17. The transcription cycle in eukaryotes: from productive initiation to RNA polymerase II recycling.

    PubMed

    Shandilya, Jayasha; Roberts, Stefan G E

    2012-05-01

    The cycle of eukaryotic transcription, from initiation to elongation and termination is regulated at multiple steps. Coordinated action of regulatory factors keeps in check the transcriptional competence of RNA polymerase II (RNAPII) at different stages. Productive transcription requires the escape of the paused RNAPII from the promoter and transition to rapid elongation of the transcript. Numerous studies have identified diverse mechanisms of initiating transcription by overriding inhibitory signals at the gene promoter. The general theme that has emerged is that the balance between positive and negative regulatory factors determines the overall rate of transcription. Recently transcription termination has emerged as an important area of transcriptional regulation that is coupled with the efficient recycling of RNAPII. The factors associated with transcription termination can also mediate gene looping and thereby determine the efficiency of re-initiation. This review highlights these regulatory steps, the key modulators involved in transcription dynamics, and the emerging tools to analyze them.

  18. Thermodynamic and Kinetic Analyses of Iron Response Element (IRE)-mRNA Binding to Iron Regulatory Protein, IRP1.

    PubMed

    Khan, Mateen A; Walden, William E; Theil, Elizabeth C; Goss, Dixie J

    2017-08-17

    Comparison of kinetic and thermodynamic properties of IRP1 (iron regulatory protein1) binding to FRT (ferritin) and ACO2 (aconitase2) IRE-RNAs, with or without Mn(2+), revealed differences specific to each IRE-RNA. Conserved among animal mRNAs, IRE-RNA structures are noncoding and bind Fe(2+) to regulate biosynthesis rates of the encoded, iron homeostatic proteins. IRP1 protein binds IRE-RNA, inhibiting mRNA activity; Fe(2+) decreases IRE-mRNA/IRP1 binding, increasing encoded protein synthesis. Here, we observed heat, 5 °C to 30 °C, increased IRP1 binding to IRE-RNA 4-fold (FRT IRE-RNA) or 3-fold (ACO2 IRE-RNA), which was enthalpy driven and entropy favorable. Mn(2+) (50 µM, 25 °C) increased IRE-RNA/IRP1 binding (K d) 12-fold (FRT IRE-RNA) or 6-fold (ACO2 IRE-RNA); enthalpic contributions decreased ~61% (FRT) or ~32% (ACO2), and entropic contributions increased ~39% (FRT) or ~68% (ACO2). IRE-RNA/IRP1 binding changed activation energies: FRT IRE-RNA 47.0 ± 2.5 kJ/mol, ACO2 IRE-RNA 35.0 ± 2.0 kJ/mol. Mn(2+) (50 µM) decreased the activation energy of RNA-IRP1 binding for both IRE-RNAs. The observations suggest decreased RNA hydrogen bonding and changed RNA conformation upon IRP1 binding and illustrate how small, conserved, sequence differences among IRE-mRNAs selectively influence thermodynamic and kinetic selectivity of the protein/RNA interactions.

  19. Involvement of microRNA-related regulatory pathways in the glucose-mediated control of Arabidopsis early seedling development

    PubMed Central

    Vincentz, Michel

    2013-01-01

    In plants, sugars such as glucose act as signalling molecules that promote changes in gene expression programmes that impact on growth and development. Recent evidence has revealed the potential importance of controlling mRNA decay in some aspects of glucose-mediated regulatory responses suggesting a role of microRNAs (miRNAs) in these responses. In order to get a better understanding of glucose-mediated development modulation involving miRNA-related regulatory pathways, early seedling development of mutants impaired in miRNA biogenesis (hyl1-2 and dcl1-11) and miRNA activity (ago1-25) was evaluated. All mutants exhibited a glucose hyposensitive phenotype from germination up to seedling establishment, indicating that miRNA regulatory pathways are involved in the glucose-mediated delay of early seedling development. The expression profile of 200 miRNA primary transcripts (pri-miRs) was evaluated by large-scale quantitative real-time PCR profiling, which revealed that 38 pri-miRs were regulated by glucose. For several of them, the corresponding mature miRNAs are known to participate directly or indirectly in plant development, and their accumulation was shown to be co-regulated with the pri-miR by glucose. Furthermore, the expression of several miRNA target genes was found to be deregulated in response to glucose in the miRNA machinery mutants ago1-25, dcl1-11, and hyl1-2. Also, in these mutants, glucose promoted misexpression of genes for the three abscisic acid signalling elements ABI3, ABI4, and ABI5. Thus, miRNA regulatory pathways play a role in the adjustments of growth and development triggered by glucose signalling. PMID:23997203

  20. Tobacco regulatory science: research to inform regulatory action at the Food and Drug Administration's Center for Tobacco Products.

    PubMed

    Ashley, David L; Backinger, Cathy L; van Bemmel, Dana M; Neveleff, Deborah J

    2014-08-01

    The U.S. Food and Drug Administration (FDA) promotes the development of regulatory science to ensure that a strong evidence base informs all of its regulatory activities related to the manufacture, marketing, and distribution of tobacco products as well as public education about tobacco product constituents and effects. Toward that end, the FDA's Center for Tobacco Products (CTP) provides funding for research studies with scientific aims that fall within its defined regulatory authority. However, given their traditional biomedical focus on basic and applied research, some researchers may not understand the principles of regulatory science or the types of studies CTP funds. The purpose of this paper is (1) to clarify the definition of regulatory science as a distinct scientific discipline, (2) to explore the role of tobacco regulatory science in order to help researchers understand the parameters and types of research that can be funded by CTP, and (3) to describe the types of research efforts that will inform the FDA's public health framework for tobacco product regulation. Published by Oxford University Press on behalf of the Society for Research on Nicotine and Tobacco 2014. This work is written by (a) US Government employee(s) and is in the public domain in the US.

  1. Maturation of 6S regulatory RNA to a highly elongated structure.

    PubMed

    Fadouloglou, Vasiliki E; Lin, Hong-Tin V; Tria, Giancarlo; Hernández, Helena; Robinson, Carol V; Svergun, Dmitri I; Luisi, Ben F

    2015-12-01

    As bacterial populations leave the exponential growth phase and enter the stationary phase, their patterns of gene expression undergo marked changes. A key effector of this change is 6S RNA, which is a highly conserved regulatory RNA that impedes the transcription of genes associated with exponential growth by forming an inactivating ternary complex with RNA polymerase and sigma factor σ(70) (σ(70)-RNAP). In Escherichia coli, the endoribonuclease RNase E generates 6S RNA by specific cleavage of a precursor that is nearly twice the size of the 58 kDa mature form. We have explored recognition of the precursor by RNase E, and observed that processing is inhibited under conditions of excess substrate. This finding supports a largely distributive mechanism, meaning that each round of catalysis results in enzyme dissociation and re-binding to the substrate. We show that the precursor molecule and the mature 6S share a structural core dominated by an A-type helix, indicating that processing is not accompanied by extensive refolding. Both precursor and mature forms of 6S have a highly stable secondary structure, adopt an elongated shape, and show the potential to form dimers under specific conditions; nonetheless, 6S has a high structural plasticity that probably enables it to be structurally adapted upon binding to its cognate protein partners. Analysis of the 6S-σ(70)-RNAP complex by native mass spectrometry reveals a stable association with a stoichiometry of 1:1:1. A theoretical 3D model of mature 6S is presented, which is consistent with the experimental data and supports a previously proposed structure with a small stem-loop inside the central bubble.

  2. Discovering miRNA Regulatory Networks in Holt–Oram Syndrome Using a Zebrafish Model

    PubMed Central

    D’Aurizio, Romina; Russo, Francesco; Chiavacci, Elena; Baumgart, Mario; Groth, Marco; D’Onofrio, Mara; Arisi, Ivan; Rainaldi, Giuseppe; Pitto, Letizia; Pellegrini, Marco

    2016-01-01

    MicroRNAs (miRNAs) are small non-coding RNAs that play an important role in the post-transcriptional regulation of gene expression. miRNAs are involved in the regulation of many biological processes such as differentiation, apoptosis, and cell proliferation. miRNAs are expressed in embryonic, postnatal, and adult hearts, and they have a key role in the regulation of gene expression during cardiovascular development and disease. Aberrant expression of miRNAs is associated with abnormal cardiac cell differentiation and dysfunction. Tbx5 is a member of the T-box gene family, which acts as transcription factor involved in the vertebrate heart development. Alteration of Tbx5 level affects the expression of hundreds of genes. Haploinsufficiency and gene duplication of Tbx5 are at the basis of the cardiac abnormalities associated with Holt–Oram syndrome (HOS). Recent data indicate that miRNAs might be an important part of the regulatory circuit through which Tbx5 controls heart development. Using high-throughput technologies, we characterized genome-widely the miRNA and mRNA expression profiles in WT- and Tbx5-depleted zebrafish embryos at two crucial developmental time points, 24 and 48 h post fertilization (hpf). We found that several miRNAs, which are potential effectors of Tbx5, are differentially expressed; some of them are already known to be involved in cardiac development and functions, such as miR-30, miR-34, miR-190, and miR-21. We performed an integrated analysis of miRNA expression data with gene expression profiles to refine computational target prediction approaches by means of the inversely correlation of miRNA–mRNA expressions, and we highlighted targets, which have roles in cardiac contractility, cardiomyocyte proliferation/apoptosis, and morphogenesis, crucial functions regulated by Tbx5. This approach allowed to discover complex regulatory circuits involving novel miRNAs and protein coding genes not considered before in the HOS such as miR-34a and

  3. Role of Non-coding Regulatory RNA in the Virulence of Human Pathogenic Vibrios

    PubMed Central

    Pérez-Reytor, Diliana; Plaza, Nicolás; Espejo, Romilio T.; Navarrete, Paola; Bastías, Roberto; Garcia, Katherine

    2017-01-01

    In recent decades, the identification of small non-coding RNAs in bacteria has revealed an important regulatory mechanism of gene expression involved in the response to environmental signals and to the control of virulence. In the family Vibrionaceae, which includes several human and animal pathogens, small non-coding RNAs (sRNAs) are closely related to important processes including metabolism, quorum sensing, virulence, and fitness. Studies conducted in silico and experiments using microarrays and high-throughput RNA sequencing have led to the discovery of an unexpected number of sRNAs in Vibrios. The present review discusses the most relevant reports regarding the mechanisms of action of sRNAs and their implications in the virulence of the main human pathogens in the family Vibrionaceae: Vibrio parahaemolyticus, V. vulnificus and V. cholerae. PMID:28123382

  4. Role of non-coding RNA transcription around gene regulatory elements in transcription factor recruitment

    PubMed Central

    Ohta, Kunihiro

    2017-01-01

    ABSTRACT Eukaryotic cells produce a variety of non-coding RNAs (ncRNAs), many of which have been shown to play pivotal roles in biological processes such as differentiation, maintenance of pluripotency of stem cells, and cellular response to various stresses. Genome-wide analyses have revealed that many ncRNAs are transcribed around regulatory DNA elements located proximal or distal to gene promoters, but their biological functions are largely unknown. Recently, it has been demonstrated in yeast and mouse that ncRNA transcription around gene promoters and enhancers facilitates DNA binding of transcription factors to their target sites. These results suggest universal roles of promoter/enhancer-associated ncRNAs in the recruitment of transcription factors to their binding sites. PMID:27763805

  5. Role of Non-coding Regulatory RNA in the Virulence of Human Pathogenic Vibrios.

    PubMed

    Pérez-Reytor, Diliana; Plaza, Nicolás; Espejo, Romilio T; Navarrete, Paola; Bastías, Roberto; Garcia, Katherine

    2016-01-01

    In recent decades, the identification of small non-coding RNAs in bacteria has revealed an important regulatory mechanism of gene expression involved in the response to environmental signals and to the control of virulence. In the family Vibrionaceae, which includes several human and animal pathogens, small non-coding RNAs (sRNAs) are closely related to important processes including metabolism, quorum sensing, virulence, and fitness. Studies conducted in silico and experiments using microarrays and high-throughput RNA sequencing have led to the discovery of an unexpected number of sRNAs in Vibrios. The present review discusses the most relevant reports regarding the mechanisms of action of sRNAs and their implications in the virulence of the main human pathogens in the family Vibrionaceae: Vibrio parahaemolyticus, V. vulnificus and V. cholerae.

  6. TRANSCRIPTION. Structures of the RNA polymerase-σ54 reveal new and conserved regulatory strategies.

    PubMed

    Yang, Yun; Darbari, Vidya C; Zhang, Nan; Lu, Duo; Glyde, Robert; Wang, Yi-Ping; Winkelman, Jared T; Gourse, Richard L; Murakami, Katsuhiko S; Buck, Martin; Zhang, Xiaodong

    2015-08-21

    Transcription by RNA polymerase (RNAP) in bacteria requires specific promoter recognition by σ factors. The major variant σ factor (σ(54)) initially forms a transcriptionally silent complex requiring specialized adenosine triphosphate-dependent activators for initiation. Our crystal structure of the 450-kilodalton RNAP-σ(54) holoenzyme at 3.8 angstroms reveals molecular details of σ(54) and its interactions with RNAP. The structure explains how σ(54) targets different regions in RNAP to exert its inhibitory function. Although σ(54) and the major σ factor, σ(70), have similar functional domains and contact similar regions of RNAP, unanticipated differences are observed in their domain arrangement and interactions with RNAP, explaining their distinct properties. Furthermore, we observe evolutionarily conserved regulatory hotspots in RNAPs that can be targeted by a diverse range of mechanisms to fine tune transcription.

  7. A critical assessment of regulatory triggers for products of biotechnology: Product vs. process.

    PubMed

    McHughen, Alan

    2016-10-01

    Regulatory policies governing the safety of genetic engineering (rDNA) and the resulting products (GMOs) have been contentious and divisive, especially in agricultural applications of the technologies. These tensions led to vastly different approaches to safety regulation in different jurisdictions, even though the intent of regulations-to assure public and environmental safety-are common worldwide, and even though the international scientific communities agree on the basic principles of risk assessment and risk management. So great are the political divisions that jurisdictions cannot even agree on the appropriate triggers for regulatory capture, whether product or process. This paper reviews the historical policy and scientific implications of agricultural biotechnology regulatory approaches taken by the European Union, USA and Canada, using their respective statutes and regulations, and then critically assesses the scientific underpinnings of each.

  8. Genome-wide survey of tissue-specific microRNA and transcription factor regulatory networks in 12 tissues

    PubMed Central

    Guo, Zhiyun; Maki, Miranda; Ding, Ruofan; Yang, Yalan; zhang, Bao; Xiong, Lili

    2014-01-01

    Tissue-specific miRNAs (TS miRNA) specifically expressed in particular tissues play an important role in tissue identity, differentiation and function. However, transcription factor (TF) and TS miRNA regulatory networks across multiple tissues have not been systematically studied. Here, we manually extracted 116 TS miRNAs and systematically investigated the regulatory network of TF-TS miRNA in 12 human tissues. We identified 2,347 TF-TS miRNA regulatory relations and revealed that most TF binding sites tend to enrich close to the transcription start site of TS miRNAs. Furthermore, we found TS miRNAs were regulated widely by non-tissue specific TFs and the tissue-specific expression level of TF have a close relationship with TF-genes regulation. Finally, we describe TSmiR (http://bioeng.swjtu.edu.cn/TSmiR), a novel and web-searchable database that houses interaction maps of TF-TS miRNA in 12 tissues. Taken together, these observations provide a new suggestion to better understand the regulatory network and mechanisms of TF-TS miRNAs underlying different tissues. PMID:24889152

  9. Potential Inhibitory Influence of miRNA 210 on Regulatory T Cells during Epicutaneous Chemical Sensitization

    PubMed Central

    Long, Carrie Mae; Lukomska, Ewa; Marshall, Nikki B.; Nayak, Ajay; Anderson, Stacey E.

    2016-01-01

    Toluene diisocyanate (TDI) is a potent low molecular weight chemical sensitizer and a leading cause of chemical-induced occupational asthma. The regulatory potential of microRNAs (miRNAs) has been recognized in a variety of disease states, including allergic disease; however, the roles of miRNAs in chemical sensitization are largely unknown. In a previous work, increased expression of multiple miRNAs during TDI sensitization was observed and several putative mRNA targets identified for these miRNAs were directly related to regulatory T-cell (Treg) differentiation and function including Foxp3 and Runx3. In this work, we show that miR-210 expression is increased in the mouse draining lymph node (dLN) and Treg subsets following dermal TDI sensitization. Alterations in dLN mRNA and protein expression of Treg related genes/putative miR-210 targets (foxp3, runx3, ctla4, and cd25) were observed at multiple time points following TDI exposure and in ex vivo systems. A Treg suppression assay, including a miR-210 mimic, was utilized to investigate the suppressive ability of Tregs. Cells derived from TDI sensitized mice treated with miR-210 mimic had less expression of miR-210 compared to the acetone control suggesting other factors, such as additional miRNAs, might be involved in the regulation of the functional capabilities of these cells. These novel findings indicate that miR-210 may have an inhibitory role in Treg function during TDI sensitization. Because the functional roles of miRNAs have not been previously elucidated in a model of chemical sensitization, these data contribute to the understanding of the potential immunologic mechanisms of chemical induced allergic disease. PMID:28035981

  10. Clinical data and regulatory issues of biosimilar products.

    PubMed

    Stevenson, James G

    2015-12-01

    Biologics are a fast-growing segment of pharmaceutical development. Many are effective in the treatment of illnesses such as cancers, rheumatoid arthritis, and multiple sclerosis. Biologics encompass a range of compounds, including recombinant hormones, growth factors, monoclonal antibodies, recombinant vaccines, and blood products. Many of these drugs are facing patent expiration, and pharmaceutical research is focusing on the development of generic substitutes, or "biosimilars." Because biologics generally exhibit high molecular complexity, the process of development and approval of biosimilars is complicated. Unlike standard small molecule generics where an identical drug copy is expected, variations in biosimilars may be inherent because the sponsor does not have knowledge of the originator's processes. Because of this intricacy, regulatory requirements are needed to ensure biosimilarity, comparability, and interchangeability with respect to efficacy and safety. Clinician awareness of the similarities and differences between original biopharmaceuticals and biosimilars, as well as their impact on efficacy and safety, is imperative.

  11. An SREBP Responsive micro-RNA Operon Contributes to a Regulatory Loop for Intracellular Lipid Homeostasis

    PubMed Central

    Jeon, Tae-Il; Esquejo, Ryan M.; Roqueta-Rivera, Manuel; Phelan, Peter E.; Moon, Young-Ah; Govindarajan, Subramaniam S.; Esau, Christine C.; Osborne, Timothy F.

    2013-01-01

    Sterol regulatory element binding proteins (SREBPs) have evolved as a focal point for linking lipid synthesis with other pathways that regulate cell growth and survival. Here, we have uncovered a polycistrionic micro-RNA locus that is activated directly by SREBP-2. Two of the encoded miRs, miR-182 and miR-96, negatively regulate expression of Fbxw7 and Insig-2 respectively, and both are known to negatively affect nuclear SREBP accumulation. Direct manipulation of this miR pathway alters nuclear SREBP levels and endogenous lipid synthesis. Thus, we have uncovered a new mechanism for regulation of intracellular lipid metabolism mediated by the concerted action of a pair of miRs that are expressed from the same SREBP-2 regulated miR locus and each targets a different protein of the multi-step pathway that regulates SREBP function. These studies reveal a miR “operon” analogous to the classic model for genetic control in bacterial regulatory systems. PMID:23823476

  12. Rapid identification of regulatory microRNAs by miTRAP (miRNA trapping by RNA in vitro affinity purification).

    PubMed

    Braun, Juliane; Misiak, Danny; Busch, Bianca; Krohn, Knut; Hüttelmaier, Stefan

    2014-04-01

    MicroRNAs (miRNAs) control gene expression at the post-transcriptional level. However, the identification of miRNAs regulating the fate of a specific messenger RNA remains limited due to the imperfect complementarity of miRNAs and targeted transcripts. Here, we describe miTRAP (miRNA trapping by RNA in vitro affinity purification), an advanced protocol of previously reported MS2-tethering approaches. MiTRAP allows the rapid identification of miRNAs targeting an in vitro transcribed RNA in cell lysates. Selective co-purification of regulatory miRNAs was confirmed for the MYC- as well as ZEB2-3'UTR, two well-established miRNA targets in vivo. Combined with miRNA-sequencing, miTRAP identified in addition to miRNAs reported to control MYC expression, 18 novel candidates including not in silico predictable miRNAs. The evaluation of 10 novel candidate miRNAs confirmed 3'UTR-dependent regulation of MYC expression as well as putative non-canonical targeting sites for the not in silico predictable candidates. In conclusion, miTRAP provides a rapid, cost-effective and easy-to-handle protocol allowing the identification of regulatory miRNAs for RNAs of choice in a cellular context of interest. Most notably, miTRAP not only identifies in silico predictable but also unpredictable miRNAs regulating the expression of a specific target RNA.

  13. ProteoMirExpress: inferring microRNA and protein-centered regulatory networks from high-throughput proteomic and mRNA expression data.

    PubMed

    Qin, Jing; Li, Mulin Jun; Wang, Panwen; Wong, Nai Sum; Wong, Maria P; Xia, Zhengyuan; Tsao, George S W; Zhang, Michael Q; Wang, Junwen

    2013-11-01

    MicroRNAs (miRNAs) regulate gene expression through translational repression and RNA degradation. Recently developed high-throughput proteomic methods measure gene expression changes at protein level and therefore can reveal the direct effects of miRNAs' translational repression. Here, we present a web server, ProteoMirExpress, that integrates proteomic and mRNA expression data together to infer miRNA-centered regulatory networks. With both types of high-throughput data from the users, ProteoMirExpress is able to discover not only miRNA targets that have decreased mRNA, but also subgroups of targets with suppressed proteins whose mRNAs are not significantly changed or with decreased mRNA whose proteins are not significantly changed, which are usually ignored by most current methods. Furthermore, both direct and indirect targets of miRNAs can be detected. Therefore, ProteoMirExpress provides more comprehensive miRNA-centered regulatory networks. We used several published data to assess the quality of our inferred networks and prove the value of our server. ProteoMirExpress is available online, with free access to academic users.

  14. Rapid kinetics of iron responsive element (IRE) RNA/iron regulatory protein 1 and IRE-RNA/eIF4F complexes respond differently to metal ions

    PubMed Central

    Khan, Mateen A.; Ma, Jia; Walden, William E.; Merrick, William C.; Theil, Elizabeth C.; Goss, Dixie J.

    2014-01-01

    Metal ion binding was previously shown to destabilize IRE-RNA/IRP1 equilibria and enhanced IRE-RNA/eIF4F equilibria. In order to understand the relative importance of kinetics and stability, we now report rapid rates of protein/RNA complex assembly and dissociation for two IRE-RNAs with IRP1, and quantitatively different metal ion response kinetics that coincide with the different iron responses in vivo. kon, for FRT IRE-RNA binding to IRP1 was eight times faster than ACO2 IRE-RNA. Mn2+ decreased kon and increased koff for IRP1 binding to both FRT and ACO2 IRE-RNA, with a larger effect for FRT IRE-RNA. In order to further understand IRE-mRNA regulation in terms of kinetics and stability, eIF4F kinetics with FRT IRE-RNA were determined. kon for eIF4F binding to FRT IRE-RNA in the absence of metal ions was 5-times slower than the IRP1 binding to FRT IRE-RNA. Mn2+ increased the association rate for eIF4F binding to FRT IRE-RNA, so that at 50 µM Mn2+ eIF4F bound more than 3-times faster than IRP1. IRP1/IRE-RNA complex has a much shorter life-time than the eIF4F/IRE-RNA complex, which suggests that both rate of assembly and stability of the complexes are important, and that allows this regulatory system to respond rapidly to change in cellular iron. PMID:24728987

  15. A new regulatory pathway of mRNA export by an F-box protein, Mdm30.

    PubMed

    Durairaj, Geetha; Lahudkar, Shweta; Bhaumik, Sukesh R

    2014-02-01

    Mdm30, an F-box protein in yeast, has been recently shown to promote mRNA export. However, it remains unknown how Mdm30 facilitates mRNA export. Here, we show that Mdm30 targets the Sub2 component of the TREX (Transcription/Export) complex for ubiquitylation and subsequent proteasomal degradation. Such a targeted degradation of Sub2 enhances the recruitment of the mRNA export adaptor, Yra1, to the active genes to promote mRNA export. Together, these results elucidate that Mdm30 promotes mRNA export by lowering Sub2's stability and consequently enhancing Yra1 recruitment, thus illuminating new regulatory mechanisms of mRNA export by Mdm30.

  16. Structure of a Virulence Regulatory Factor CvfB Reveals a Novel Winged-helix RNA Binding Module

    PubMed Central

    Matsumoto, Yasuhiko; Xu, Qingping; Miyazaki, Shinya; Kaito, Chikara; Farr, Carol L.; Axelrod, Herbert L.; Chiu, Hsiu-Ju; Klock, Heath E.; Knuth, Mark W.; Miller, Mitchell D.; Elsliger, Marc-André; Deacon, Ashley M.; Godzik, Adam; Lesley, Scott A.; Sekimizu, Kazuhisa; Wilson, Ian A.

    2010-01-01

    SUMMARY CvfB is a conserved regulatory protein important for the virulence of Staphylococcus aureus. We show here that CvfB binds RNA. The crystal structure of the CvfB ortholog from Streptococcus pneumoniae at 1.4 Å resolution reveals a unique RNA binding protein that is formed from a concatenation of well-known structural modules that bind nucleic acids: three consecutive S1 RNA-binding domains and a winged-helix (WH) domain. The third S1 and the WH domains are required for cooperative RNA binding and form a continuous surface that likely contributes to the RNA interaction. The WH domain is critical to CvfB function and contains a unique structural motif. Thus CvfB represents a novel assembly of modules for binding RNA. PMID:20399190

  17. GRIL-seq provides a method for identifying direct targets of bacterial small regulatory RNA by in vivo proximity ligation.

    PubMed

    Han, Kook; Tjaden, Brian; Lory, Stephen

    2016-12-22

    The first step in the post-transcriptional regulatory function of most bacterial small non-coding RNAs (sRNAs) is base pairing with partially complementary sequences of targeted transcripts. We present a simple method for identifying sRNA targets in vivo and defining processing sites of the regulated transcripts. The technique, referred to as global small non-coding RNA target identification by ligation and sequencing (GRIL-seq), is based on preferential ligation of sRNAs to the ends of base-paired targets in bacteria co-expressing T4 RNA ligase, followed by sequencing to identify the chimaeras. In addition to the RNA chaperone Hfq, the GRIL-seq method depends on the activity of the pyrophosphorylase RppH. Using PrrF1, an iron-regulated sRNA in Pseudomonas aeruginosa, we demonstrated that direct regulatory targets of this sRNA can readily be identified. Therefore, GRIL-seq represents a powerful tool not only for identifying direct targets of sRNAs in a variety of environments, but also for uncovering novel roles for sRNAs and their targets in complex regulatory networks.

  18. Diverse activities of viral cis-acting RNA regulatory elements revealed using multicolor, long-term, single-cell imaging.

    PubMed

    Pocock, Ginger M; Zimdars, Laraine L; Yuan, Ming; Eliceiri, Kevin W; Ahlquist, Paul; Sherer, Nathan M

    2017-02-01

    Cis-acting RNA structural elements govern crucial aspects of viral gene expression. How these structures and other posttranscriptional signals affect RNA trafficking and translation in the context of single cells is poorly understood. Herein we describe a multicolor, long-term (>24 h) imaging strategy for measuring integrated aspects of viral RNA regulatory control in individual cells. We apply this strategy to demonstrate differential mRNA trafficking behaviors governed by RNA elements derived from three retroviruses (HIV-1, murine leukemia virus, and Mason-Pfizer monkey virus), two hepadnaviruses (hepatitis B virus and woodchuck hepatitis virus), and an intron-retaining transcript encoded by the cellular NXF1 gene. Striking behaviors include "burst" RNA nuclear export dynamics regulated by HIV-1's Rev response element and the viral Rev protein; transient aggregations of RNAs into discrete foci at or near the nuclear membrane triggered by multiple elements; and a novel, pulsiform RNA export activity regulated by the hepadnaviral posttranscriptional regulatory element. We incorporate single-cell tracking and a data-mining algorithm into our approach to obtain RNA element-specific, high-resolution gene expression signatures. Together these imaging assays constitute a tractable, systems-based platform for studying otherwise difficult to access spatiotemporal features of viral and cellular gene regulation.

  19. Genome-wide analysis of the regulatory function mediated by the small regulatory psm-mec RNA of methicillin-resistant Staphylococcus aureus.

    PubMed

    Cheung, Gordon Y C; Villaruz, Amer E; Joo, Hwang-Soo; Duong, Anthony C; Yeh, Anthony J; Nguyen, Thuan H; Sturdevant, Daniel E; Queck, S Y; Otto, M

    2014-07-01

    Several methicillin resistance (SCCmec) clusters characteristic of hospital-associated methicillin-resistant Staphylococcus aureus (MRSA) strains harbor the psm-mec locus. In addition to encoding the cytolysin, phenol-soluble modulin (PSM)-mec, this locus has been attributed gene regulatory functions. Here we employed genome-wide transcriptional profiling to define the regulatory function of the psm-mec locus. The immune evasion factor protein A emerged as the primary conserved and strongly regulated target of psm-mec, an effect we show is mediated by the psm-mec RNA. Furthermore, the psm-mec locus exerted regulatory effects that were more moderate in extent. For example, expression of PSM-mec limited expression of mecA, thereby decreasing methicillin resistance. Our study shows that the psm-mec locus has a rare dual regulatory RNA and encoded cytolysin function. Furthermore, our findings reveal a specific mechanism underscoring the recently emerging concept that S. aureus strains balance pronounced virulence and high expression of antibiotic resistance.

  20. Integrative Identification of Deregulated MiRNA/TF-Mediated Gene Regulatory Loops and Networks in Prostate Cancer

    PubMed Central

    Afshar, Ali Sobhi; Xu, Joseph; Goutsias, John

    2014-01-01

    MicroRNAs (miRNAs) have attracted a great deal of attention in biology and medicine. It has been hypothesized that miRNAs interact with transcription factors (TFs) in a coordinated fashion to play key roles in regulating signaling and transcriptional pathways and in achieving robust gene regulation. Here, we propose a novel integrative computational method to infer certain types of deregulated miRNA-mediated regulatory circuits at the transcriptional, post-transcriptional and signaling levels. To reliably predict miRNA-target interactions from mRNA/miRNA expression data, our method collectively utilizes sequence-based miRNA-target predictions obtained from several algorithms, known information about mRNA and miRNA targets of TFs available in existing databases, certain molecular structures identified to be statistically over-represented in gene regulatory networks, available molecular subtyping information, and state-of-the-art statistical techniques to appropriately constrain the underlying analysis. In this way, the method exploits almost every aspect of extractable information in the expression data. We apply our procedure on mRNA/miRNA expression data from prostate tumor and normal samples and detect numerous known and novel miRNA-mediated deregulated loops and networks in prostate cancer. We also demonstrate instances of the results in a number of distinct biological settings, which are known to play crucial roles in prostate and other types of cancer. Our findings show that the proposed computational method can be used to effectively achieve notable insights into the poorly understood molecular mechanisms of miRNA-mediated interactions and dissect their functional roles in cancer in an effort to pave the way for miRNA-based therapeutics in clinical settings. PMID:24968068

  1. Integrative identification of deregulated miRNA/TF-mediated gene regulatory loops and networks in prostate cancer.

    PubMed

    Afshar, Ali Sobhi; Xu, Joseph; Goutsias, John

    2014-01-01

    MicroRNAs (miRNAs) have attracted a great deal of attention in biology and medicine. It has been hypothesized that miRNAs interact with transcription factors (TFs) in a coordinated fashion to play key roles in regulating signaling and transcriptional pathways and in achieving robust gene regulation. Here, we propose a novel integrative computational method to infer certain types of deregulated miRNA-mediated regulatory circuits at the transcriptional, post-transcriptional and signaling levels. To reliably predict miRNA-target interactions from mRNA/miRNA expression data, our method collectively utilizes sequence-based miRNA-target predictions obtained from several algorithms, known information about mRNA and miRNA targets of TFs available in existing databases, certain molecular structures identified to be statistically over-represented in gene regulatory networks, available molecular subtyping information, and state-of-the-art statistical techniques to appropriately constrain the underlying analysis. In this way, the method exploits almost every aspect of extractable information in the expression data. We apply our procedure on mRNA/miRNA expression data from prostate tumor and normal samples and detect numerous known and novel miRNA-mediated deregulated loops and networks in prostate cancer. We also demonstrate instances of the results in a number of distinct biological settings, which are known to play crucial roles in prostate and other types of cancer. Our findings show that the proposed computational method can be used to effectively achieve notable insights into the poorly understood molecular mechanisms of miRNA-mediated interactions and dissect their functional roles in cancer in an effort to pave the way for miRNA-based therapeutics in clinical settings.

  2. Low regulatory T cell and high IL-17 mRNA expression in a mouse Graves' disease model.

    PubMed

    Yuan, Q; Zhao, Y; Zhu, X; Liu, X

    2017-04-01

    Graves' disease (GD) is an autoimmune thyroid disease, and the most important characteristic of it is the presence of the thyroid-stimulating antibody (TSAb). The mechanisms of the TSAb elevation are still uncertain. Recent studies have suggested that the dysregulation of regulatory T cell (Treg) and T helper 17 (Th17) might stimulate the production of TSAb and be a pathogenesis of GD. However, the role of Treg and Th17 cells in the pathogenesis of GD is still debated. Our aim is to assess changes of Treg and Th17 cells in the spleen of a mouse in an in vivo GD model and try to explain the pathogenesis of GD. We used an adenovirus expressing the autoantigen thyroid-stimulating hormone receptor (Ad-TSHR289) to immunise mice in order to induce GD in the model. Flow cytometry was used to measure the frequencies of splenic Treg and Th17 cells and real-time PCR to analyse the mRNA expression of forkhead box P3(Foxp3) and interleukin-17(IL-17). Compared with the Ad-Control group, the frequencies of CD4(+)CD25(+)Foxp3(+) Treg cells were significantly decreased (p = 0.007) and gene expression of Foxp3 was down-regulated (p = 0.001) in the Ad-TSHR289 group. Though there was no significant difference in CD4(+)IL-17(+) T cell subpopulation between the two groups (p = 0.336), the IL-17 mRNA expression was significantly up-regulated in the Ad-TSHR289 group (p = 0.001). The pathogenesis of GD may be associated with reduced Treg cells and increased IL-17 gene expression. The increased IL-17 mRNA needs to be explained by other mechanisms but not Th17 cells.

  3. Sequence search and analysis of gene products containing RNA recognition motifs in the human genome.

    PubMed

    Malhotra, Sony; Sowdhamini, Ramanathan

    2014-12-22

    Gene expression is tightly regulated at both transcriptional and post-transcriptional levels. RNA-binding proteins are involved in post-transcriptional gene regulation events. They are involved in a variety of functions such as splicing, alternative splicing, nuclear import and export of mRNA, RNA stability and translation. There are several well-characterized RNA-binding motifs present in a whole genome, such as RNA recognition motif (RRM), KH domain, zinc-fingers etc. In the present study, we have investigated human genome for the presence of RRM-containing gene products starting from RRM domains in the Pfam (Protein family database) repository. In Pfam, seven families are recorded to contain RRM-containing proteins. We studied these families for their taxonomic representation, sequence features (identity, length, phylogeny) and structural properties (mapping conservation on the structures). We then examined the presence of RRM-containing gene products in Homo sapiens genome and identified 928 RRM-containing gene products. These were studied for their predicted domain architectures, biological processes, involvement in pathways, disease relevance and disorder content. RRM domains were observed to occur multiple times in a single polypeptide. However, there are 56 other co-existing domains involved in different regulatory functions. Further, functional enrichment analysis revealed that RRM-containing gene products are mainly involved in biological functions such as mRNA splicing and its regulation. Our sequence analysis identified RRM-containing gene products in the human genome and provides insights into their domain architectures and biological functions. Since mRNA splicing and gene regulation are important in the cellular machinery, this analysis provides an early overview of genes that carry out these functions.

  4. Regulation of photoreceptor gene transcription via a highly conserved transcriptional regulatory element by vsx gene products

    PubMed Central

    Pan, Yi; Comiskey, Daniel F.; Kelly, Lisa E.; Chandler, Dawn S.

    2016-01-01

    Purpose The photoreceptor conserved element-1 (PCE-1) sequence is found in the transcriptional regulatory regions of many genes expressed in photoreceptors. The retinal homeobox (Rx or Rax) gene product functions by binding to PCE-1 sites. However, other transcriptional regulators have also been reported to bind to PCE-1. One of these, vsx2, is expressed in retinal progenitor and bipolar cells. The purpose of this study is to identify Xenopus laevis vsx gene products and characterize vsx gene product expression and function with respect to the PCE-1 site. Methods X. laevis vsx gene products were amplified with PCR. Expression patterns were determined with in situ hybridization using whole or sectioned X. laevis embryos and digoxigenin- or fluorescein-labeled antisense riboprobes. DNA binding characteristics of the vsx gene products were analyzed with electrophoretic mobility shift assays (EMSAs) using in vitro translated proteins and radiolabeled oligonucleotide probes. Gene transactivation assays were performed using luciferase-based reporters and in vitro transcribed effector gene products, injected into X. laevis embryos. Results We identified one vsx1 and two vsx2 gene products. The two vsx2 gene products are generated by alternate mRNA splicing. We verified that these gene products are expressed in the developing retina and that expression resolves into distinct cell types in the mature retina. Finally, we found that vsx gene products can bind the PCE-1 site in vitro and that the two vsx2 isoforms have different gene transactivation activities. Conclusions vsx gene products are expressed in the developing and mature neural retina. vsx gene products can bind the PCE-1 site in vitro and influence the expression of a rhodopsin promoter-luciferase reporter gene. The two isoforms of vsx have different gene transactivation activities in this reporter gene system. PMID:28003732

  5. Interactive cooperation and hierarchical operation of microRNA and transcription factor crosstalk in human transcriptional regulatory network.

    PubMed

    Gov, Esra; Arga, Kazim Yalcin

    2016-12-01

    Transcriptional regulation of gene expression is an essential cellular process that is arranged by transcription factors (TFs), microRNAs (miRNA) and their target genes through a variety of mechanisms. Here, we set out to reconstruct a comprehensive transcriptional regulatory network of Homo sapiens consisting of experimentally verified regulatory information on miRNAs, TFs and their target genes. We have performed topological analyses to elucidate the transcriptional regulatory roles of miRNAs and TFs. When we thoroughly investigated the network motifs, different gene regulatory scenarios were observed; whereas, mutual TF-miRNA regulation (interactive cooperation) and hierarchical operation where miRNAs were the upstream regulators of TFs came into prominence. Otherwise, biological process specific subnetworks were also constructed and integration of gene and miRNA expression data on ovarian cancer was achieved as a case study to observe dynamic patterns of the gene expression. Meanwhile, both co-operation and hierarchical operation types were determined in active ovarian cancer and process-specific subnetworks. In addition, the analysis showed that multiple signals from miRNAs were integrated by TFs. Our results demonstrate new insights on the architecture of the human transcriptional regulatory network, and here we present some lessons we gained from deciphering the reciprocal interplay between miRNAs, TFs and their target genes.

  6. Transcriptome landscape of Lactococcus lactis reveals many novel RNAs including a small regulatory RNA involved in carbon uptake and metabolism

    PubMed Central

    van der Meulen, Sjoerd B.; de Jong, Anne; Kok, Jan

    2016-01-01

    ABSTRACT RNA sequencing has revolutionized genome-wide transcriptome analyses, and the identification of non-coding regulatory RNAs in bacteria has thus increased concurrently. Here we reveal the transcriptome map of the lactic acid bacterial paradigm Lactococcus lactis MG1363 by employing differential RNA sequencing (dRNA-seq) and a combination of manual and automated transcriptome mining. This resulted in a high-resolution genome annotation of L. lactis and the identification of 60 cis-encoded antisense RNAs (asRNAs), 186 trans-encoded putative regulatory RNAs (sRNAs) and 134 novel small ORFs. Based on the putative targets of asRNAs, a novel classification is proposed. Several transcription factor DNA binding motifs were identified in the promoter sequences of (a)sRNAs, providing insight in the interplay between lactococcal regulatory RNAs and transcription factors. The presence and lengths of 14 putative sRNAs were experimentally confirmed by differential Northern hybridization, including the abundant RNA 6S that is differentially expressed depending on the available carbon source. For another sRNA, LLMGnc_147, functional analysis revealed that it is involved in carbon uptake and metabolism. L. lactis contains 13% leaderless mRNAs (lmRNAs) that, from an analysis of overrepresentation in GO classes, seem predominantly involved in nucleotide metabolism and DNA/RNA binding. Moreover, an A-rich sequence motif immediately following the start codon was uncovered, which could provide novel insight in the translation of lmRNAs. Altogether, this first experimental genome-wide assessment of the transcriptome landscape of L. lactis and subsequent sRNA studies provide an extensive basis for the investigation of regulatory RNAs in L. lactis and related lactococcal species. PMID:26950529

  7. HIV-1 splicing is controlled by local RNA structure and binding of splicing regulatory proteins at the major 5' splice site.

    PubMed

    Mueller, Nancy; Berkhout, Ben; Das, Atze T

    2015-07-01

    The 5' leader region of the human immunodeficiency virus 1 (HIV-1) RNA genome contains the major 5' splice site (ss) that is used in the production of the many spliced viral RNAs. This splice-donor (SD) region can fold into a stable stem-loop structure and the thermodynamic stability of this RNA hairpin influences splicing efficiency. In addition, splicing may be modulated by binding of splicing regulatory (SR) proteins, in particular SF2/ASF (SRSF1), SC35 (SRSF2), SRp40 (SRSF5) and SRp55 (SRSF6), to sequence elements in the SD region. The role of RNA structure and SR protein binding in splicing control was previously studied by functional analysis of mutant SD sequences. The interpretation of these studies was complicated by the fact that most mutations simultaneously affect both structure and sequence elements. We therefore tried to disentangle the contribution of these two variables by designing more precise SD region mutants with a single effect on either the sequence or the structure. The current analysis indicates that HIV-1 splicing at the major 5'ss is modulated by both the stability of the local RNA structure and the binding of splicing regulatory proteins.

  8. A competitive regulatory mechanism discriminates between juxtaposed splice sites and pri-miRNA structures

    PubMed Central

    Mattioli, Chiara; Pianigiani, Giulia; Pagani, Franco

    2013-01-01

    We have explored the functional relationships between spliceosome and Microprocessor complex activities in a novel class of microRNAs (miRNAs), named Splice site Overlapping (SO) miRNAs, whose pri-miRNA hairpins overlap splice sites. We focused on the evolutionarily conserved SO miR-34b, and we identified two indispensable elements for recognition of its 3′ splice site: a branch point located in the hairpin and a downstream purine-rich exonic splicing enhancer. In minigene systems, splicing inhibition owing to exonic splicing enhancer deletion or AG 3′ss mutation increases miR-34b levels. Moreover, small interfering-mediated silencing of Drosha and/or DGCR8 improves splicing efficiency and abolishes miR-34b production. Thus, the processing of this 3′ SO miRNA is regulated in an antagonistic manner by the Microprocessor and the spliceosome owing to competition between these two machineries for the nascent transcript. We propose that this novel mechanism is commonly used to regulate the relative amount of SO miRNA and messenger RNA produced from primary transcripts. PMID:23863840

  9. Recombinant biologic products versus nutraceuticals from plants - a regulatory choice?

    PubMed

    Drake, Pascal M W; Szeto, Tim H; Paul, Mathew J; Teh, Audrey Y-H; Ma, Julian K-C

    2017-01-01

    Biotechnology has transformed the potential for plants to be a manufacturing source of pharmaceutical compounds. Now, with transgenic and transient expression techniques, virtually any biologic, including vaccines and therapeutics, could be manufactured in plants. However, uncertainty over the regulatory path for such new pharmaceuticals has been a deterrent. Consideration has been given to using alternative regulatory paths, including those for nutraceuticals or cosmetic agents. This review will consider these possibilities, and discuss the difficulties in establishing regulatory guidelines for new pharmaceutical manufacturing technologies.

  10. Interconnections between mRNA degradation and RDR-dependent siRNA production in mRNA turnover in plants.

    PubMed

    Tsuzuki, Masayuki; Motomura, Kazuki; Kumakura, Naoyoshi; Takeda, Atsushi

    2017-03-01

    Accumulation of an mRNA species is determined by the balance between the synthesis and the degradation of the mRNA. Individual mRNA molecules are selectively and actively degraded through RNA degradation pathways, which include 5'-3' mRNA degradation pathway, 3'-5' mRNA degradation pathway, and RNA-dependent RNA polymerase-mediated mRNA degradation pathway. Recent studies have revealed that these RNA degradation pathways compete with each other in mRNA turnover in plants and that plants have a hidden layer of non-coding small-interfering RNA production from a set of mRNAs. In this review, we summarize the current information about plant mRNA degradation pathways in mRNA turnover and discuss the potential roles of a novel class of the endogenous siRNAs derived from plant mRNAs.

  11. Noncoding RNA. piRNA-guided transposon cleavage initiates Zucchini-dependent, phased piRNA production.

    PubMed

    Han, Bo W; Wang, Wei; Li, Chengjian; Weng, Zhiping; Zamore, Phillip D

    2015-05-15

    PIWI-interacting RNAs (piRNAs) protect the animal germ line by silencing transposons. Primary piRNAs, generated from transcripts of genomic transposon "junkyards" (piRNA clusters), are amplified by the "ping-pong" pathway, yielding secondary piRNAs. We report that secondary piRNAs, bound to the PIWI protein Ago3, can initiate primary piRNA production from cleaved transposon RNAs. The first ~26 nucleotides (nt) of each cleaved RNA becomes a secondary piRNA, but the subsequent ~26 nt become the first in a series of phased primary piRNAs that bind Piwi, allowing piRNAs to spread beyond the site of RNA cleavage. The ping-pong pathway increases only the abundance of piRNAs, whereas production of phased primary piRNAs from cleaved transposon RNAs adds sequence diversity to the piRNA pool, allowing adaptation to changes in transposon sequence. Copyright © 2015, American Association for the Advancement of Science.

  12. RNA-Binding Proteins in Trichomonas vaginalis: Atypical Multifunctional Proteins Involved in a Posttranscriptional Iron Regulatory Mechanism

    PubMed Central

    Figueroa-Angulo, Elisa E.; Calla-Choque, Jaeson S.; Mancilla-Olea, Maria Inocente; Arroyo, Rossana

    2015-01-01

    Iron homeostasis is highly regulated in vertebrates through a regulatory system mediated by RNA-protein interactions between the iron regulatory proteins (IRPs) that interact with an iron responsive element (IRE) located in certain mRNAs, dubbed the IRE-IRP regulatory system. Trichomonas vaginalis, the causal agent of trichomoniasis, presents high iron dependency to regulate its growth, metabolism, and virulence properties. Although T. vaginalis lacks IRPs or proteins with aconitase activity, possesses gene expression mechanisms of iron regulation at the transcriptional and posttranscriptional levels. However, only one gene with iron regulation at the transcriptional level has been described. Recently, our research group described an iron posttranscriptional regulatory mechanism in the T. vaginalis tvcp4 and tvcp12 cysteine proteinase mRNAs. The tvcp4 and tvcp12 mRNAs have a stem-loop structure in the 5'-coding region or in the 3'-UTR, respectively that interacts with T. vaginalis multifunctional proteins HSP70, α-Actinin, and Actin under iron starvation condition, causing translation inhibition or mRNA stabilization similar to the previously characterized IRE-IRP system in eukaryotes. Herein, we summarize recent progress and shed some light on atypical RNA-binding proteins that may participate in the iron posttranscriptional regulation in T. vaginalis. PMID:26703754

  13. UpSETing chromatin during non-coding RNA production

    PubMed Central

    2013-01-01

    The packaging of eukaryotic DNA into nucleosomal arrays permits cells to tightly regulate and fine-tune gene expression. The ordered disassembly and reassembly of these nucleosomes allows RNA polymerase II (RNAPII) conditional access to the underlying DNA sequences. Disruption of nucleosome reassembly following RNAPII passage results in spurious transcription initiation events, leading to the production of non-coding RNA (ncRNA). We review the molecular mechanisms involved in the suppression of these cryptic initiation events and discuss the role played by ncRNAs in regulating gene expression. PMID:23738864

  14. miRNA-Target Gene Regulatory Networks: A Bayesian Integrative Approach to Biomarker Selection with Application to Kidney Cancer

    PubMed Central

    Chekouo, Thierry; Stingo, Francesco C.; Doecke, James D.; Do, Kim-Anh

    2015-01-01

    Summary The availability of cross-platform, large-scale genomic data has enabled the investigation of complex biological relationships for many cancers. Identification of reliable cancer-related biomarkers requires the characterization of multiple interactions across complex genetic networks. MicroRNAs are small non-coding RNAs that regulate gene expression; however, the direct relationship between a microRNA and its target gene is difficult to measure. We propose a novel Bayesian model to identify microRNAs and their target genes that are associated with survival time by incorporating the microRNA regulatory network through prior distributions. We assume that biomarkers involved in regulatory networks are likely associated with survival time. We employ non-local prior distributions and a stochastic search method for the selection of biomarkers associated with the survival outcome. We use KEGG pathway information to incorporate correlated gene effects within regulatory networks. Using simulation studies, we assess the performance of our method, and apply it to experimental data of kidney renal cell carcinoma (KIRC) obtained from The Cancer Genome Atlas. Our novel method validates previously identified cancer biomarkers and identifies biomarkers specific to KIRC progression that were not previously discovered. Using the KIRC data, we confirm that biomarkers involved in regulatory networks are more likely to be associated with survival time, showing connections in one regulatory network for five out of six such genes we identified. PMID:25639276

  15. Expression Profiling of Human Immune Cell Subsets Identifies miRNA-mRNA Regulatory Relationships Correlated with Cell Type Specific Expression

    PubMed Central

    Bergauer, Tobias; Ravindran, Palanikumar; Rossier, Michel F.; Ebeling, Martin; Badi, Laura; Reis, Bernhard; Bitter, Hans; D'Asaro, Matilde; Chiappe, Alberto; Sridhar, Sriram; Pacheco, Gonzalo Duran; Burczynski, Michael E.; Hochstrasser, Denis; Vonderscher, Jacky; Matthes, Thomas

    2012-01-01

    Blood consists of different cell populations with distinct functions and correspondingly, distinct gene expression profiles. In this study, global miRNA expression profiling was performed across a panel of nine human immune cell subsets (neutrophils, eosinophils, monocytes, B cells, NK cells, CD4 T cells, CD8 T cells, mDCs and pDCs) to identify cell-type specific miRNAs. mRNA expression profiling was performed on the same samples to determine if miRNAs specific to certain cell types down-regulated expression levels of their target genes. Six cell-type specific miRNAs (miR-143; neutrophil specific, miR-125; T cells and neutrophil specific, miR-500; monocyte and pDC specific, miR-150; lymphoid cell specific, miR-652 and miR-223; both myeloid cell specific) were negatively correlated with expression of their predicted target genes. These results were further validated using an independent cohort where similar immune cell subsets were isolated and profiled for both miRNA and mRNA expression. miRNAs which negatively correlated with target gene expression in both cohorts were identified as candidates for miRNA/mRNA regulatory pairs and were used to construct a cell-type specific regulatory network. miRNA/mRNA pairs formed two distinct clusters in the network corresponding to myeloid (nine miRNAs) and lymphoid lineages (two miRNAs). Several myeloid specific miRNAs targeted common genes including ABL2, EIF4A2, EPC1 and INO80D; these common targets were enriched for genes involved in the regulation of gene expression (p<9.0E-7). Those miRNA might therefore have significant further effect on gene expression by repressing the expression of genes involved in transcriptional regulation. The miRNA and mRNA expression profiles reported in this study form a comprehensive transcriptome database of various human blood cells and serve as a valuable resource for elucidating the role of miRNA mediated regulation in the establishment of immune cell identity. PMID:22276136

  16. Non-coding RNA in control of gene regulatory programs in cardiac development and disease.

    PubMed

    Philippen, Leonne E; Dirkx, Ellen; da Costa-Martins, Paula A; De Windt, Leon J

    2015-12-01

    Organogenesis of the vertebrate heart is a highly specialized process involving progressive specification and differentiation of distinct embryonic cardiac progenitor cell populations driven by specialized gene programming events. Likewise, the onset of pathologies in the adult heart, including cardiac hypertrophy, involves the reactivation of embryonic gene programs. In both cases, these intricate genomic events are temporally and spatially regulated by complex signaling networks and gene regulatory networks. Apart from well-established transcriptional mechanisms, increasing evidence indicates that gene programming in both the developing and the diseased myocardium are under epigenetic control by non-coding RNAs (ncRNAs). MicroRNAs regulate gene expression at the post-transcriptional level, and numerous studies have now established critical roles for this species of tiny RNAs in a broad range of aspects from cardiogenesis towards adult heart failure. Recent reports now also implicate the larger family of long non-coding RNAs (lncRNAs) in these processes as well. Here we discuss the involvement of these two ncRNA classes in proper cardiac development and hypertrophic disease processes of the adult myocardium. This article is part of a Special Issue entitled: Non-coding RNAs.

  17. MicroRNA-33 regulates sterol regulatory element-binding protein 1 expression in mice

    PubMed Central

    Horie, Takahiro; Nishino, Tomohiro; Baba, Osamu; Kuwabara, Yasuhide; Nakao, Tetsushi; Nishiga, Masataka; Usami, Shunsuke; Izuhara, Masayasu; Sowa, Naoya; Yahagi, Naoya; Shimano, Hitoshi; Matsumura, Shigenobu; Inoue, Kazuo; Marusawa, Hiroyuki; Nakamura, Tomoyuki; Hasegawa, Koji; Kume, Noriaki; Yokode, Masayuki; Kita, Toru; Kimura, Takeshi; Ono, Koh

    2013-01-01

    MicroRNAs (miRs) are small non-protein-coding RNAs that bind to specific mRNAs and inhibit translation or promote mRNA degradation. Recent reports have indicated that miR-33, which is located within the intron of sterol regulatory element-binding protein (SREBP) 2, controls cholesterol homoeostasis and may be a potential therapeutic target for the treatment of atherosclerosis. Here we show that deletion of miR-33 results in marked worsening of high-fat diet-induced obesity and liver steatosis. Using miR-33−/−Srebf1+/− mice, we demonstrate that SREBP-1 is a target of miR-33 and that the mechanisms leading to obesity and liver steatosis in miR-33−/− mice involve enhanced expression of SREBP-1. These results elucidate a novel interaction between SREBP-1 and SREBP-2 mediated by miR-33 in vivo. PMID:24300912

  18. MicroRNA-26a Promotes Regulatory T cells and Suppresses Autoimmune Diabetes in Mice.

    PubMed

    Ma, Hui; Zhang, Shoutao; Shi, Doufei; Mao, Yanhua; Cui, Jianguo

    2016-02-01

    Type-1 diabetes (TID) is an autoimmune disease in which the body's own immune cells attack islet β cells, the cells in the pancreas that produce and release the hormone insulin. Mir-26a has been reported to play functions in cellular differentiation, cell growth, cell apoptosis, and metastasis. However, the role of microRNA-26a (Mir-26a) in autoimmune TID has never been investigated. In our current study, we found that pre-Mir-26a (LV-26a)-treated mice had significantly longer normoglycemic time and lower frequency of autoreactive IFN-γ-producing CD4(+) cells compared with an empty lentiviral vector (LV-Con)-treated non-obese diabetic (NOD) mice. Mir-26a suppresses autoreactive T cells and expands Tregs in vivo and in vitro. Furthermore, in our adoptive transfer study, the groups receiving whole splenocytes and CD25-depleted splenocytes from LV-Con-treated diabetic NOD mice develop diabetes at 3 to 4 weeks of age. In comparison, mice injected with undepleted splenocytes obtained from LV-26a-treated reversal NOD mice develop diabetes after 6-8 weeks. And depletion of CD25(+) cells in the splenocytes of reversed mice abrogates the delay in diabetes onset. In conclusion, Mir-26a suppresses autoimmune diabetes in NOD mice in part through promoted regulatory T cells (Tregs) expression.

  19. Effect of ration size on fillet fatty acid composition, phospholipid allostasis and mRNA expression patterns of lipid regulatory genes in gilthead sea bream (Sparus aurata).

    PubMed

    Benedito-Palos, Laura; Calduch-Giner, Josep A; Ballester-Lozano, Gabriel F; Pérez-Sánchez, Jaume

    2013-04-14

    The effect of ration size on muscle fatty acid (FA) composition and mRNA expression levels of key regulatory enzymes of lipid and lipoprotein metabolism have been addressed in juveniles of gilthead sea bream fed a practical diet over the course of an 11-week trial. The experimental setup included three feeding levels: (i) full ration until visual satiety, (ii) 70 % of satiation and (iii) 70 % of satiation with the last 2 weeks at the maintenance ration. Feed restriction reduced lipid content of whole body by 30 % and that of fillet by 50 %. In this scenario, the FA composition of fillet TAG was not altered by ration size, whereas that of phospholipids was largely modified with a higher retention of arachidonic acid and DHA. The mRNA transcript levels of lysophosphatidylcholine acyltransferases, phosphatidylethanolamine N-methyltransferase and FA desaturase 2 were not regulated by ration size in the present experimental model. In contrast, mRNA levels of stearoyl-CoA desaturases were markedly down-regulated by feed restriction. An opposite trend was found for a muscle-specific lipoprotein lipase, which is exclusive of fish lineage. Several upstream regulatory transcriptions were also assessed, although nutritionally mediated changes in mRNA transcripts were almost reduced to PPARα and β, which might act in a counter-regulatory way on lipolysis and lipogenic pathways. This gene expression pattern contributes to the construction of a panel of biomarkers to direct marine fish production towards muscle lean phenotypes with increased retentions of long-chain PUFA.

  20. Regulatory microRNA networks: complex patterns of target pathways for disease-related and housekeeping microRNAs.

    PubMed

    Zafari, Sachli; Backes, Christina; Leidinger, Petra; Meese, Eckart; Keller, Andreas

    2015-06-01

    Blood-based microRNA (miRNA) signatures as biomarkers have been reported for various pathologies, including cancer, neurological disorders, cardiovascular diseases, and also infections. The regulatory mechanism behind respective miRNA patterns is only partially understood. Moreover, "preserved" miRNAs, i.e., miRNAs that are not dysregulated in any disease, and their biological impact have been explored to a very limited extent. We set out to systematically determine their role in regulatory networks by defining groups of highly-dysregulated miRNAs that contribute to a disease signature as opposed to preserved housekeeping miRNAs. We further determined preferential targets and pathways of both dysregulated and preserved miRNAs by computing multi-layer networks, which were compared between housekeeping and dysregulated miRNAs. Of 848 miRNAs examined across 1049 blood samples, 8 potential housekeepers showed very limited expression variations, while 20 miRNAs showed highly-dysregulated expression throughout the investigated blood samples. Our approach provides important insights into miRNAs and their role in regulatory networks. The methodology can be applied to systematically investigate the differences in target genes and pathways of arbitrary miRNA sets.

  1. Regulatory considerations in production of a cell therapy medicinal product in Europe to clinical research.

    PubMed

    Martín, Patricia Gálvez; Martinez, Adolfina Ruiz; Lara, Visitación Gallardo; Naveros, Beatriz Clares

    2014-02-01

    The development of new drugs using stem cells has become a clinic alternative for the treatment of different diseases such as Alzheimer's, diabetes and myocardial infarction. Similar to conventional medicines, stem cells as new medicinal products for cell therapy are subjected to current legislation concerning their manufacture process. Besides, their legality is determined by the Regulatory Agencies belonging to the Member State of the European Union in which they are being registered. With the evolution of therapy that uses cells as medicines, there is a need to develop the appropriate legislative and regulatory framework capable of ensuring their safety and effectiveness. However, few works have been published regarding the regulations that these products must comply through production and commercialization processes. The present work is focused on the description of key events during clinical development and cell production of stem cells as drugs. Such as the regulations, requirements and directives involved in the production of cell therapy medicinal products, from the clinical design stage to its commercialization in Europe.

  2. A Multi-Step miRNA-mRNA Regulatory Network Construction Approach Identifies Gene Signatures Associated with Endometrioid Endometrial Carcinoma

    PubMed Central

    Xiong, Hanzhen; Li, Qiulian; Chen, Ruichao; Liu, Shaoyan; Lin, Qiongyan; Xiong, Zhongtang; Jiang, Qingping; Guo, Linlang

    2016-01-01

    We aimed to identify endometrioid endometrial carcinoma (EEC)-related gene signatures using a multi-step miRNA-mRNA regulatory network construction approach. Pathway analysis showed that 61 genes were enriched on many carcinoma-related pathways. Among the 14 highest scoring gene signatures, six genes had been previously shown to be endometrial carcinoma. By qRT-PCR and next generation sequencing, we found that a gene signature (CPEB1) was significantly down-regulated in EEC tissues, which may be caused by hsa-miR-183-5p up-regulation. In addition, our literature surveys suggested that CPEB1 may play an important role in EEC pathogenesis by regulating the EMT/p53 pathway. The miRNA-mRNA network is worthy of further investigation with respect to the regulatory mechanisms of miRNAs in EEC. CPEB1 appeared to be a tumor suppressor in EEC. Our results provided valuable guidance for the functional study at the cellular level, as well as the EEC mouse models. PMID:27271671

  3. An SREBP-responsive microRNA operon contributes to a regulatory loop for intracellular lipid homeostasis.

    PubMed

    Jeon, Tae-Il; Esquejo, Ryan M; Roqueta-Rivera, Manuel; Phelan, Peter E; Moon, Young-Ah; Govindarajan, Subramaniam S; Esau, Christine C; Osborne, Timothy F

    2013-07-02

    Sterol regulatory element-binding proteins (SREBPs) have evolved as a focal point for linking lipid synthesis with other pathways that regulate cell growth and survival. Here, we have uncovered a polycistrionic microRNA (miRNA) locus that is activated directly by SREBP-2. Two of the encoded miRNAs, miR-182 and miR-96, negatively regulate the expression of Fbxw7 and Insig-2, respectively, and both are known to negatively affect nuclear SREBP accumulation. Direct manipulation of this miRNA pathway alters nuclear SREBP levels and endogenous lipid synthesis. Thus, we have uncovered a mechanism for the regulation of intracellular lipid metabolism mediated by the concerted action of a pair of miRNAs that are expressed from the same SREBP-2-regulated miRNA locus, and each targets a different protein of the multistep pathway that regulates SREBP function. These studies reveal an miRNA "operon" analogous to the classic model for genetic control in bacterial regulatory systems. Copyright © 2013 Elsevier Inc. All rights reserved.

  4. Adenovirus type 2 nuclear RNA accumulating during productive infection.

    PubMed Central

    Bachenheimer, S L

    1977-01-01

    The viral-specific nuclear RNA which accumulates early and late during productive infection of HeLa cells by adenovirus-type 2 (Ad2) has been characterized with respect to its size and stability after denaturation by Me2SO. Early nuclear transcripts, under nondenaturing conditions, sediment in the range 28 to 45S, but treatment with Me2SO prior to sedimentation results in a shift to about 20S. Later nuclear RNA accumulates as a composite of two populations of molecules: one with a broad size distribution centering on 45S under nondenaturing conditions and less than 32S after denaturation and a second having a narrow size distribution around 35S which is quite stable to Me2SO. Analysis of late RNA by hybridization to Sma fragments of Ad2 DNA suggests that the 35S RNA species is derived from a limited portion of the left half of the viral genome. PMID:864839

  5. ZNF148 modulates TOP2A expression and cell proliferation via ceRNA regulatory mechanism in colorectal cancer

    PubMed Central

    Gao, Xian Hua; Li, Juan; Liu, Yan; Liu, Qi Zhi; Hao, Li Qiang; Liu, Lian Jie; Zhang, Wei

    2017-01-01

    Abstract Background: Competing endogenous RNA (ceRNA) regulation is a novel hypothesized mechanism that states RNA molecules share common target microRNAs (miRNAs) and may competitively combine into the same miRNA pool. Methods: Zinc finger protein 148 (ZNF148) and TOP2A expression were analyzed in 742 colorectal cancer (CRC) tissues using immunohistochemistry (IHC). ZNF148 mRNA, TOP2A mRNA, miR101, miR144, miR335, and miR365 expression were estimated in 53 fresh frozen CRC tissues by reverse transcription polymerase chain reaction. Mechanisms underpinning ceRNA were examined using bioinformatics, correlation analysis, RNA interference, gene over-expression, and luciferase assays. Results: Protein levels of ZNF148 and TOP2A detected by IHC positively correlated (Spearman correlation coefficient [rs] = 0.431, P < 0.001); mRNA levels of ZNF148 and TOP2A also positively correlated (r = 0.591, P < 0.001). Bioinformatics analysis demonstrated that ZNF148 and TOP2A mRNA had 13 common target miRNAs, including miR101, miR144, miR335, and miR365. Correlation analysis demonstrated that levels of ZNF148 mRNA were negatively associated with levels of miR144, miR335, and miR365. Knockdown and overexpression tests showed that ZNF148 mRNA and TOP2A mRNA regulated each other in HCT116 cells, respectively, but not in Dicer-deficient HCT116 cells. Luciferase assays demonstrated that ZNF148 and TOP2A regulated each other through 3′UTR. Overexpression of ZNF148 mRNA and TOP2A mRNA caused significant downregulation of miR101, miR144, miR335, and miR365 in the HCT116 cells. We also found that knockdown of ZNF148 and TOP2A significantly promoted cell growth, and overexpression of ZNF148 and TOP2A inhibited cell proliferation, which was abrogated in Dicer-deficient HCT116 cells. Conclusion: ZNF148 and TOP2A regulate each other through ceRNA regulatory mechanism in CRC, which has biological effects on cell proliferation. PMID:28072746

  6. Evidence for Positive Selection on a Number of MicroRNA Regulatory Interactions during Recent Human Evolution

    PubMed Central

    Xin, Xiaofeng; Kim, Taehyung Simon; Cabeza, Eduardo Aguiar; Ren, Jie; Nielsen, Rasmus; Wrana, Jeffrey L.; Zhang, Zhaolei

    2012-01-01

    MicroRNA (miRNA)–mediated gene regulation is of critical functional importance in animals and is thought to be largely constrained during evolution. However, little is known regarding evolutionary changes of the miRNA network and their role in human evolution. Here we show that a number of miRNA binding sites display high levels of population differentiation in humans and thus are likely targets of local adaptation. In a subset we demonstrate that allelic differences modulate miRNA regulation in mammalian cells, including an interaction between miR-155 and TYRP1, an important melanosomal enzyme associated with human pigmentary differences. We identify alternate alleles of TYRP1 that induce or disrupt miR-155 regulation and demonstrate that these alleles are selected with different modes among human populations, causing a strong negative correlation between the frequency of miR-155 regulation of TYRP1 in human populations and their latitude of residence. We propose that local adaptation of microRNA regulation acts as a rheostat to optimize TYRP1 expression in response to differential UV radiation. Our findings illustrate the evolutionary plasticity of the microRNA regulatory network in recent human evolution. PMID:22457636

  7. Inducing effect of PGRs on small regulatory si/miRNA in resistance to sugar beet cyst nematode.

    PubMed

    Tsygankova, V A; Stefanovska, T R; Galkin, A P; Ponomarenko, S P; Blume, Ya B

    2012-01-01

    Sugar beet cyst nematode Heterodera schachtii Schmidt is an economically important plant parasite of sugar beet in Ukraine. The pest control options are limited. Sugar beet cyst nematode resistant varieties are not available on the market. Carbamate and organophosphate pesticides have been banned due to the high toxicity. The problem is aggravated by continuously increasing of oilseed rape (which is suitable host for H. schachtii) growing area due to biofuel demands. Several studies' results indicate that PGRs have role in management of plant parasitic nematodes but for sugar beet it is not studied well. We had an objective- studying of the role of four compositional PGRs created based of avermectin in suppression of sugar beet cyst nematode population on sugar beet and oilseed rape caused by enhancing of endogenous si/miRNA complementary to H. schachtii mRNA. Laboratory study was conducted in 2011 with using method DOT-blot hybridization si/miRNA with mRNA and by testing inhibitory activity in cell free system protein biosynthesis. That was shown that application of the PGRs enhances sugar beet and oilseeds rape plant immune-protective properties and resistance against plant-parasitic nematode Heterodera schochtii through enhancement of synthesis of small regulatory si/miRNA related (complementary) to an mRNA structure of the parasitic organisms. As a result, translation of mRNA of the nematode is blocked and causes the mortality of plant parasite juveniles.

  8. Regulatory Oversight of Gene Therapy and Cell Therapy Products in Korea.

    PubMed

    Choi, Minjoung; Han, Euiri; Lee, Sunmi; Kim, Taegyun; Shin, Won

    2015-01-01

    The Ministry of Food and Drug Safety regulates gene therapy and cell therapy products as biological products under the authority of the Pharmaceutical Affairs Act. As with other medicinal products, gene therapy and cell therapy products are subject to approval for use in clinical trials and for a subsequent marketing authorization and to post-market surveillance. Research and development of gene therapy and cell therapy products have been progressing rapidly in Korea with extensive investment, offering great potential for the treatment of various serious diseases. To facilitate development of safe and effective products and provide more opportunities to patients suffering from severe diseases, several regulatory programs, such as the use of investigational products for emergency situations, fast-track approval, prereview of application packages, and intensive regulatory consultation, can be applied to these products. The regulatory approach for these innovative products is case by case and founded on science-based review that is flexible and balances the risks and benefits.

  9. SKI2 mediates degradation of RISC 5′-cleavage fragments and prevents secondary siRNA production from miRNA targets in Arabidopsis

    PubMed Central

    Branscheid, Anja; Marchais, Antonin; Schott, Gregory; Lange, Heike; Gagliardi, Dominique; Andersen, Stig Uggerhøj; Voinnet, Olivier; Brodersen, Peter

    2015-01-01

    Small regulatory RNAs are fundamental in eukaryotic and prokaryotic gene regulation. In plants, an important element of post-transcriptional control is effected by 20–24 nt microRNAs (miRNAs) and short interfering RNAs (siRNAs) bound to the ARGONAUTE1 (AGO1) protein in an RNA induced silencing complex (RISC). AGO1 may cleave target mRNAs with small RNA complementarity, but the fate of the resulting cleavage fragments remains incompletely understood. Here, we show that SKI2, SKI3 and SKI8, subunits of a cytoplasmic cofactor of the RNA exosome, are required for degradation of RISC 5′, but not 3′-cleavage fragments in Arabidopsis. In the absence of SKI2 activity, many miRNA targets produce siRNAs via the RNA-dependent RNA polymerase 6 (RDR6) pathway. These siRNAs are low-abundant, and map close to the cleavage site. In most cases, siRNAs were produced 5′ to the cleavage site, but several examples of 3′-spreading were also identified. These observations suggest that siRNAs do not simply derive from RDR6 action on stable 5′-cleavage fragments and hence that SKI2 has a direct role in limiting secondary siRNA production in addition to its function in mediating degradation of 5′-cleavage fragments. PMID:26464441

  10. A Novel Regulatory Gene, Tri10, Controls Trichothecene Toxin Production and Gene Expression

    PubMed Central

    Tag, Andrew G.; Garifullina, Gulnara F.; Peplow, Andrew W.; Ake, Charles; Phillips, T. D.; Hohn, Thomas M.; Beremand, Marian N.

    2001-01-01

    We report here the characterization of Tri10, a novel regulatory gene within the trichothecene gene cluster. Comparison of Tri10 genomic and mRNA sequences revealed that removal of a single 77-bp intron provided a 1,260-bp open reading frame, encoding a 420-amino-acid protein. Disruption of Tri10 in Fusarium sporotrichioides abolished T-2 toxin production and dramatically decreased the transcript accumulation for four trichothecene genes (Tri4, Tri5, Tri6, and Tri101) and an apparent farnesyl pyrophosphate synthetase (Fpps) gene. Conversely, homologous integration of a disruption vector by a single upstream crossover event significantly increased T-2 toxin production and elevated the transcript accumulation of the trichothecene genes and Fpps. Further analysis revealed that disruption of Tri10, and to a greater extent the disruption of Tri6, increased sensitivity to T-2 toxin under certain growth conditions. Although Tri10 is conserved in Fusarium graminearum and Fusarium sambucinum and clearly plays a central role in regulating trichothecene gene expression, it does not show any significant matches to proteins of known or predicted function or to motifs except a single transmembrane domain. We suggest a model in which Tri10 acts upstream of the cluster-encoded transcription factor TRI6 and is necessary for full expression of both the other trichothecene genes and the genes for the primary metabolic pathway that precedes the trichothecene biosynthetic pathway, as well as for wild-type levels of trichothecene self-protection. We further suggest the presence of a regulatory loop where Tri6 is not required for the transcription of Tri10 but is required to limit the expression of Tri10. PMID:11679358

  11. Global small RNA chaperone Hfq and regulatory small RNAs are important virulence regulators in Erwinia amylovora.

    PubMed

    Zeng, Quan; McNally, R Ryan; Sundin, George W

    2013-04-01

    Hfq is a global small RNA (sRNA) chaperone that interacts with Hfq-regulated sRNAs and functions in the posttranscriptional regulation of gene expression. In this work, we identified Hfq to be a virulence regulator in the Gram-negative fire blight pathogen Erwinia amylovora. Deletion of hfq in E. amylovora Ea1189 significantly reduced bacterial virulence in both immature pear fruits and apple shoots. Analysis of virulence determinants in strain Ea1189Δhfq showed that Hfq exerts pleiotropic regulation of amylovoran exopolysaccharide production, biofilm formation, motility, and the type III secretion system (T3SS). Further characterization of biofilm regulation by Hfq demonstrated that Hfq limits bacterial attachment to solid surfaces while promoting biofilm maturation. Characterization of T3SS regulation by Hfq revealed that Hfq positively regulates the translocation and secretion of the major type III effector DspE and negatively controls the secretion of the putative translocator HrpK and the type III effector Eop1. Lastly, 10 Hfq-regulated sRNAs were identified using a computational method, and two of these sRNAs, RprA and RyhA, were found to be required for the full virulence of E. amylovora.

  12. Nonsense codons in human beta-globin mRNA result in the production of mRNA degradation products.

    PubMed Central

    Lim, S K; Sigmund, C D; Gross, K W; Maquat, L E

    1992-01-01

    Human beta zero-thalassemic beta-globin genes harboring either a frameshift or a nonsense mutation that results in the premature termination of beta-globin mRNA translation have been previously introduced into the germ line of mice (S.-K. Lim, J.J. Mullins, C.-M. Chen, K. Gross, and L.E. Maquat, EMBO J. 8:2613-2619, 1989). Each transgene produces properly processed albeit abnormally unstable mRNA as well as several smaller RNAs in erythroid cells. These smaller RNAs are detected only in the cytoplasm and, relative to mRNA, are longer-lived and are missing sequences from either exon I or exons I and II. In this communication, we show by using genetics and S1 nuclease transcript mapping that the premature termination of beta-globin mRNA translation is mechanistically required for the abnormal RNA metabolism. We also provide evidence that generation of the smaller RNAs is a cytoplasmic process: the 5' ends of intron 1-containing pre-mRNAs were normal, the rates of removal of introns 1 and 2 were normal, and studies inhibiting RNA synthesis with actinomycin D demonstrated a precursor-product relationship between full-length mRNA and the smaller RNAs. In vivo, about 50% of the full-length species that undergo decay are degraded to the smaller RNAs and the rest are degraded to undetectable products. Exposure of erythroid cells that expressed a normal human beta-globin transgene to either cycloheximide or puromycin did not result in the generation of the smaller RNAs. Therefore, a drug-induced reduction in cellular protein synthesis does not reproduce this aspect of cytoplasmic mRNA metabolism. These data suggest that the premature termination of beta-globin mRNA translation in either exon I or exon II results in the cytoplasmic generation of discrete mRNA degradation products that are missing sequences from exon I or exons I and II. Since these degradation products appear to be the same for all nonsense codons tested, there is no correlation between the position of

  13. Simulation of compliance choices for the disinfection by-products regulatory impact analysis

    SciTech Connect

    Gelderloos, A.B.; Harrington, G.W.; Owen, D.M.; Regli, S.; Schaefer, J.K.

    1992-01-01

    The U.S. EPA is in the process of developing regulations designed to limit the concentrations of disinfectants and their by-products in drinking water systems. The objective of regulatory analysis is to determine the potential impacts of implementing different regulatory options. This paper describes one aspect of this analysis.

  14. Oncogenic potential of TAR RNA binding protein TRBP and its regulatory interaction with RNA-dependent protein kinase PKR.

    PubMed Central

    Benkirane, M; Neuveut, C; Chun, R F; Smith, S M; Samuel, C E; Gatignol, A; Jeang, K T

    1997-01-01

    TAR RNA binding protein (TRBP) belongs to an RNA binding protein family that includes the double-stranded RNA-activated protein kinase (PKR), Drosophila Staufen and Xenopus xlrbpa. One member of this family, PKR, is a serine/threonine kinase which has anti-viral and anti-proliferative effects. In this study we show that TRBP is a cellular down-regulator of PKR function. Assaying expression from an infectious HIV-1 molecular clone, we found that PKR inhibited viral protein synthesis and that over-expression of TRBP effectively countered this inhibition. In intracellular and in cell-free assays we show that TRBP directly inhibits PKR autophosphorylation through an RNA binding-independent pathway. Biologically, TRBP serves a growth-promoting role; cells that overexpress TRBP exhibit transformed phenotypes. Our results demonstrate the oncogenic potential of TRBP and are consistent with the notion that intracellular PKR function contributes physiologically towards regulating cellular proliferation. PMID:9034343

  15. RNA G-quadruplexes and their potential regulatory roles in translation

    PubMed Central

    Song, Jingwen; Perreault, Jean-Pierre; Topisirovic, Ivan; Richard, Stéphane

    2016-01-01

    ABSTRACT DNA guanine (G)-rich 4-stranded helical nucleic acid structures called G-quadruplexes (G4), have been extensively studied during the last decades. However, emerging evidence reveals that 5′- and 3′-untranslated regions (5′- and 3′-UTRs) as well as open reading frames (ORFs) contain putative RNA G-quadruplexes. These stable secondary structures play key roles in telomere homeostasis and RNA metabolism including pre-mRNA splicing, polyadenylation, mRNA targeting and translation. Interestingly, multiple RNA binding proteins such as nucleolin, FMRP, DHX36, and Aven were identified to bind RNA G-quadruplexes. Moreover, accumulating reports suggest that RNA G-quadruplexes regulate translation in cap-dependent and -independent manner. Herein, we discuss potential roles of RNA G-quadruplexes and associated trans-acting factors in the regulation of mRNA translation. PMID:28090421

  16. Sites of amyloid SAA mRNA production

    SciTech Connect

    Meek, R.L.; Benditt, E.P.

    1986-03-01

    To investigate possible extrahepatic sites of SAA production, male BALB/c mice were given a single 0.5 ml injection of either 10% casein or lipopolysaccharide (LPS; 100 mg/ml). Twenty hours after injection, RNA was extracted from liver, kidney, adrenal, testis, brain, spleen, skeletal muscle, heart, lung and small intestine. Northern blots of total RNA were hybridized with nick-translated /sup 32/P-labeled cDNA probes (length approximately 150 base pairs) corresponding to an homologous region of the three known SAA genes. Both casein and LPS elevated the mRNA in liver to about 200-fold above control levels; mRNA was elevated in adrenals from O to approximately 2% of liver. mRNA in some other tissues responded only to LPS injection: levels in kidney reached 15% of liver; pituitary, testis and brain reached 0.02 to 0.5% of liver; no apoSAA mRNA was detected in heart, skeletal muscle, lung, spleen or small intestine. Thus, some organs other than liver appear to have operational genes for apoSAA. The expression of apoSAA genes in different tissues is shared with other apoproteins; it remains to be seen whether all three or only selected genes are transcribed and translated in different tissues.

  17. Regulatory Role of RNA Chaperone TDP-43 for RNA Misfolding and Repeat-Associated Translation in SCA31.

    PubMed

    Ishiguro, Taro; Sato, Nozomu; Ueyama, Morio; Fujikake, Nobuhiro; Sellier, Chantal; Kanegami, Akemi; Tokuda, Eiichi; Zamiri, Bita; Gall-Duncan, Terence; Mirceta, Mila; Furukawa, Yoshiaki; Yokota, Takanori; Wada, Keiji; Taylor, J Paul; Pearson, Christopher E; Charlet-Berguerand, Nicolas; Mizusawa, Hidehiro; Nagai, Yoshitaka; Ishikawa, Kinya

    2017-04-05

    Microsatellite expansion disorders are pathologically characterized by RNA foci formation and repeat-associated non-AUG (RAN) translation. However, their underlying pathomechanisms and regulation of RAN translation remain unknown. We report that expression of expanded UGGAA (UGGAAexp) repeats, responsible for spinocerebellar ataxia type 31 (SCA31) in Drosophila, causes neurodegeneration accompanied by accumulation of UGGAAexp RNA foci and translation of repeat-associated pentapeptide repeat (PPR) proteins, consistent with observations in SCA31 patient brains. We revealed that motor-neuron disease (MND)-linked RNA-binding proteins (RBPs), TDP-43, FUS, and hnRNPA2B1, bind to and induce structural alteration of UGGAAexp. These RBPs suppress UGGAAexp-mediated toxicity in Drosophila by functioning as RNA chaperones for proper UGGAAexp folding and regulation of PPR translation. Furthermore, nontoxic short UGGAA repeat RNA suppressed mutated RBP aggregation and toxicity in MND Drosophila models. Thus, functional crosstalk of the RNA/RBP network regulates their own quality and balance, suggesting convergence of pathomechanisms in microsatellite expansion disorders and RBP proteinopathies.

  18. A genomic portrait of the genetic architecture and regulatory impact of microRNA expression in response to infection

    PubMed Central

    Siddle, Katherine J.; Deschamps, Matthieu; Tailleux, Ludovic; Nédélec, Yohann; Pothlichet, Julien; Lugo-Villarino, Geanncarlo; Libri, Valentina; Gicquel, Brigitte; Neyrolles, Olivier; Laval, Guillaume; Patin, Etienne; Barreiro, Luis B.; Quintana-Murci, Lluís

    2014-01-01

    MicroRNAs (miRNAs) are critical regulators of gene expression, and their role in a wide variety of biological processes, including host antimicrobial defense, is increasingly well described. Consistent with their diverse functional effects, miRNA expression is highly context dependent and shows marked changes upon cellular activation. However, the genetic control of miRNA expression in response to external stimuli and the impact of such perturbations on miRNA-mediated regulatory networks at the population level remain to be determined. Here we assessed changes in miRNA expression upon Mycobacterium tuberculosis infection and mapped expression quantitative trait loci (eQTL) in dendritic cells from a panel of healthy individuals. Genome-wide expression profiling revealed that ∼40% of miRNAs are differentially expressed upon infection. We find that the expression of 3% of miRNAs is controlled by proximate genetic factors, which are enriched in a promoter-specific histone modification associated with active transcription. Notably, we identify two infection-specific response eQTLs, for miR-326 and miR-1260, providing an initial assessment of the impact of genotype-environment interactions on miRNA molecular phenotypes. Furthermore, we show that infection coincides with a marked remodeling of the genome-wide relationships between miRNA and mRNA expression levels. This observation, supplemented by experimental data using the model of miR-29a, sheds light on the role of a set of miRNAs in cellular responses to infection. Collectively, this study increases our understanding of the genetic architecture of miRNA expression in response to infection, and highlights the wide-reaching impact of altering miRNA expression on the transcriptional landscape of a cell. PMID:24482540

  19. An Ancient Transcription Factor Initiates the Burst of piRNA Production During Early Meiosis in Mouse Testes

    PubMed Central

    Li, Xin Zhiguo; Roy, Christian K.; Dong, Xianjun; Bolcun-Filas, Ewelina; Wang, Jie; Han, Bo W.; Xu, Jia; Moore, Melissa J.; Schimenti, John C.; Weng, Zhiping; Zamore, Phillip D.

    2013-01-01

    SUMMARY Animal germ cells produce PIWI-interacting RNAs (piRNAs), small silencing RNAs that suppress transposons and enable gamete maturation. Mammalian transposon-silencing piRNAs accumulate early in spermatogenesis, whereas pachytene piRNAs are produced later during post-natal spermatogenesis and account for >95% of all piRNAs in the adult mouse testis. Mutants defective for pachytene piRNA pathway proteins fail to produce mature sperm, but neither the piRNA precursor transcripts nor the trigger for pachytene piRNA production is known. Here, we show that the transcription factor A-MYB initiates pachytene piRNA production. A-MYB drives transcription of both pachytene piRNA precursor RNAs and the mRNAs for core piRNA biogenesis factors, including MIWI, the protein through which pachytene piRNAs function. A-MYB regulation of piRNA pathway proteins and piRNA genes creates a coherent feed-forward loop that ensures the robust accumulation of pachytene piRNAs. This regulatory circuit, which can be detected in rooster testes, likely predates the divergence of birds and mammals. PMID:23523368

  20. Molecular simulations illuminate the role of regulatory components of the RNA polymerase from the hepatitis C virus in influencing protein structure and dynamics.

    PubMed

    Davis, Brittny C; Thorpe, Ian F

    2013-07-02

    The RNA polymerase (gene product NS5B) from the hepatitis C virus is responsible for replication of the viral genome and is a validated drug target for new therapeutic agents. NS5B has a structure resembling an open right hand (containing the fingers, palm, and thumb subdomains), a hydrophobic C-terminal region, and two magnesium ions coordinated in the palm domain. Biochemical data suggest that the magnesium ions provide structural stability and are directly involved in catalysis, while the C-terminus plays a regulatory role in NS5B function. Nevertheless, the molecular mechanisms by which these two features regulate polymerase activity remain unclear. To answer this question, we performed molecular dynamics simulations of NS5B variants with different C-terminal lengths in the presence or absence of magnesium ions to determine the impact on enzyme properties. We observed that metal binding increases both the magnitude and the degree of correlated enzyme motions. In contrast, we observed that the C-terminus restricts enzyme dynamics. Under certain conditions, our simulations revealed a fully closed conformation of NS5B that may facilitate de novo initiation of RNA replication. This knowledge is important because it fosters the development of a comprehensive description of RNA replication by NS5B and is relevant to understanding the functional properties of a broad class of related RNA polymerases such as 3D-pol from poliovirus. Ultimately, this information may also be pertinent to designing novel NS5B therapeutics.

  1. Genome-wide profiling of the microRNA-mRNA regulatory network in skeletal muscle with aging

    PubMed Central

    Kim, Ji Young; Park, Young-Kyu; Lee, Kwang-Pyo; Lee, Seung-Min; Kang, Tae-Wook; Kim, Hee-Jin; Dho, So Hee; Kim, Seon-Young; Kwon, Ki-Sun

    2014-01-01

    Skeletal muscle degenerates progressively, losing mass (sarcopenia) over time, which leads to reduced physical ability and often results in secondary diseases such as diabetes and obesity. The regulation of gene expression by microRNAs is a key event in muscle development and disease. To understand genome-wide changes in microRNAs and mRNAs during muscle aging, we sequenced microRNAs and mRNAs from mouse gastrocnemius muscles at two different ages (6 and 24 months). Thirty-four microRNAs (15 up-regulated and 19 down-regulated) were differentially expressed with age, including the microRNAs miR-206 and -434, which were differentially expressed in aged muscle in previous studies. Interestingly, eight microRNAs in a microRNA cluster at the imprinted Dlk1-Dio3 locus on chromosome 12 were coordinately down-regulated. In addition, sixteen novel microRNAs were identified. Integrative analysis of microRNA and mRNA expression revealed that microRNAs may contribute to muscle aging through the positive regulation of transcription, metabolic processes, and kinase activity. Many of the age-related microRNAs have been implicated in human muscular diseases. We suggest that genome-wide microRNA profiling will expand our knowledge of microRNA function in the muscle aging process. PMID:25063768

  2. Genome-wide profiling of the microRNA-mRNA regulatory network in skeletal muscle with aging.

    PubMed

    Kim, Ji Young; Park, Young-Kyu; Lee, Kwang-Pyo; Lee, Seung-Min; Kang, Tae-Wook; Kim, Hee-Jin; Dho, So Hee; Kim, Seon-Young; Kwon, Ki-Sun

    2014-07-01

    Skeletal muscle degenerates progressively, losing mass (sarcopenia) over time, which leads to reduced physical ability and often results in secondary diseases such as diabetes and obesity. The regulation of gene expression by microRNAs is a key event in muscle development and disease. To understand genome‐wide changes in microRNAs and mRNAs during muscle aging, we sequenced microRNAs and mRNAs from mouse gastrocnemius muscles at two different ages (6 and 24 months). Thirty‐four microRNAs (15 up‐regulated and 19 down‐regulated) were differentially expressed with age, including the microRNAs miR‐206 and ‐434, which were differentially expressed in aged muscle in previous studies. Interestingly, eight microRNAs in a microRNA cluster at the imprinted Dlk1‐Dio3 locus on chromosome 12 were coordinately down‐regulated. In addition, sixteen novel microRNAs were identified. Integrative analysis of microRNA and mRNA expression revealed that microRNAs may contribute to muscle aging through the positive regulation of transcription, metabolic processes, and kinase activity. Many of the age‐related microRNAs have been implicated in human muscular diseases. We suggest that genome‐wide microRNA profiling will expand our knowledge of microRNA function in the muscle aging process.

  3. A transcriptome-wide study on the microRNA- and the Argonaute 1-enriched small RNA-mediated regulatory networks involved in plant leaf senescence.

    PubMed

    Qin, J; Ma, X; Yi, Z; Tang, Z; Meng, Y

    2016-03-01

    Leaf senescence is an important physiological process during the plant life cycle. However, systemic studies on the impact of microRNAs (miRNAs) on the expression of senescence-associated genes (SAGs) are lacking. Besides, whether other Argonaute 1 (AGO1)-enriched small RNAs (sRNAs) play regulatory roles in leaf senescence remains unclear. In this study, a total of 5,123 and 1,399 AGO1-enriched sRNAs, excluding miRNAs, were identified in Arabidopsis thaliana and rice (Oryza sativa), respectively. After retrieving SAGs from the Leaf Senescence Database, all of the AGO1-enriched sRNAs and the miRBase-registered miRNAs of these two plants were included for target identification. Supported by degradome signatures, 200 regulatory pairs involving 120 AGO1-enriched sRNAs and 40 SAGs, and 266 regulatory pairs involving 64 miRNAs and 42 SAGs were discovered in Arabidopsis. Moreover, 13 genes predicted to interact with some of the above-identified target genes at protein level were validated as regulated by 17 AGO1-enriched sRNAs and ten miRNAs in Arabidopsis. In rice, only one SAG was targeted by three AGO1-enriched sRNAs, and one SAG was targeted by miR395. However, five AGO1-enriched sRNAs were conserved between Arabidopsis and rice. Target genes conserved between the two plants were identified for three of the above five sRNAs, pointing to the conserved roles of these regulatory pairs in leaf senescence or other developmental procedures. Novel targets were discovered for three of the five AGO1-enriched sRNAs in rice, indicating species-specific functions of these sRNA-target pairs. These results could advance our understanding of the sRNA-involved molecular processes modulating leaf senescence. © 2015 German Botanical Society and The Royal Botanical Society of the Netherlands.

  4. A Two-Component Regulatory System Impacts Extracellular Membrane-Derived Vesicle Production in Group A Streptococcus

    PubMed Central

    Resch, Ulrike; Tsatsaronis, James Anthony; Le Rhun, Anaïs; Stübiger, Gerald; Rohde, Manfred; Kasvandik, Sergo; Holzmeister, Susanne; Tinnefeld, Philip; Wai, Sun Nyunt

    2016-01-01

    ABSTRACT Export of macromolecules via extracellular membrane-derived vesicles (MVs) plays an important role in the biology of Gram-negative bacteria. Gram-positive bacteria have also recently been reported to produce MVs; however, the composition and mechanisms governing vesiculogenesis in Gram-positive bacteria remain undefined. Here, we describe MV production in the Gram-positive human pathogen group A streptococcus (GAS), the etiological agent of necrotizing fasciitis and streptococcal toxic shock syndrome. M1 serotype GAS isolates in culture exhibit MV structures both on the cell wall surface and in the near vicinity of bacterial cells. A comprehensive analysis of MV proteins identified both virulence-associated protein substrates of the general secretory pathway in addition to “anchorless surface proteins.” Characteristic differences in the contents, distributions, and fatty acid compositions of specific lipids between MVs and GAS cell membrane were also observed. Furthermore, deep RNA sequencing of vesicular RNAs revealed that GAS MVs contained differentially abundant RNA species relative to bacterial cellular RNA. MV production by GAS strains varied in a manner dependent on an intact two-component system, CovRS, with MV production negatively regulated by the system. Modulation of MV production through CovRS was found to be independent of both GAS cysteine protease SpeB and capsule biosynthesis. Our data provide an explanation for GAS secretion of macromolecules, including RNAs, lipids, and proteins, and illustrate a regulatory mechanism coordinating this secretory response. PMID:27803183

  5. 78 FR 66940 - Regulatory Requirements for Hearing Aid Devices and Personal Sound Amplification Products; Draft...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-11-07

    ... HUMAN SERVICES Food and Drug Administration Regulatory Requirements for Hearing Aid Devices and Personal Sound Amplification Products; Draft Guidance for Industry and Food and Drug Administration Staff; Availability AGENCY: Food and Drug Administration, HHS. ACTION: Notice. SUMMARY: The Food and...

  6. Effect of acute resistance exercise and sex on human patellar tendon structural and regulatory mRNA expression.

    PubMed

    Sullivan, Bridget E; Carroll, Chad C; Jemiolo, Bozena; Trappe, Scott W; Magnusson, S Peter; Døssing, Simon; Kjaer, Michael; Trappe, Todd A

    2009-02-01

    Tendon is mainly composed of collagen and an aqueous matrix of proteoglycans that are regulated by enzymes called matrix metalloproteinases (MMPs) and tissue inhibitors of metalloproteinases (TIMPs). Although it is known that resistance exercise (RE) and sex influence tendon metabolism and mechanical properties, it is uncertain what structural and regulatory components contribute to these responses. We measured the mRNA expression of tendon's main fibrillar collagens (type I and type III) and the main proteoglycans (decorin, biglycan, fibromodulin, and versican) and the regulatory enzymes MMP-2, MMP-9, MMP-3, and TIMP-1 at rest and after RE. Patellar tendon biopsy samples were taken from six individuals (3 men and 3 women) before and 4 h after a bout of RE and from a another six individuals (3 men and 3 women) before and 24 h after RE. Resting mRNA expression was used for sex comparisons (6 men and 6 women). Collagen type I, collagen type III, and MMP-2 were downregulated (P < 0.05) 4 h after RE but were unchanged (P > 0.05) 24 h after RE. All other genes remained unchanged (P > 0.05) after RE. Women had higher resting mRNA expression (P < 0.05) of collagen type III and a trend (P = 0.08) toward lower resting expression of MMP-3 than men. All other genes were not influenced (P > 0.05) by sex. Acute RE appears to stimulate a change in collagen type I, collagen type III, and MMP-2 gene regulation in the human patellar tendon. Sex influences the structural and regulatory mRNA expression of tendon.

  7. A genome-wide analysis of the RNA-guided silencing pathway in coffee reveals insights into its regulatory mechanisms.

    PubMed

    Noronha Fernandes-Brum, Christiane; Marinho Rezende, Pâmela; Cherubino Ribeiro, Thales Henrique; Ricon de Oliveira, Raphael; Cunha de Sousa Cardoso, Thaís; Rodrigues do Amaral, Laurence; de Souza Gomes, Matheus; Chalfun-Junior, Antonio

    2017-01-01

    microRNAs (miRNAs) are derived from self-complementary hairpin structures, while small-interfering RNAs (siRNAs) are derived from double-stranded RNA (dsRNA) or hairpin precursors. The core mechanism of sRNA production involves DICER-like (DCL) in processing the smallRNAs (sRNAs) and ARGONAUTE (AGO) as effectors of silencing, and siRNA biogenesis also involves action of RNA-Dependent RNA Polymerase (RDR), Pol IV and Pol V in biogenesis. Several other proteins interact with the core proteins to guide sRNA biogenesis, action, and turnover. We aimed to unravel the components and functions of the RNA-guided silencing pathway in a non-model plant species of worldwide economic relevance. The sRNA-guided silencing complex members have been identified in the Coffea canephora genome, and they have been characterized at the structural, functional, and evolutionary levels by computational analyses. Eleven AGO proteins, nine DCL proteins (which include a DCL1-like protein that was not previously annotated), and eight RDR proteins were identified. Another 48 proteins implicated in smallRNA (sRNA) pathways were also identified. Furthermore, we identified 235 miRNA precursors and 317 mature miRNAs from 113 MIR families, and we characterized ccp-MIR156, ccp-MIR172, and ccp-MIR390. Target prediction and gene ontology analyses of 2239 putative targets showed that significant pathways in coffee are targeted by miRNAs. We provide evidence of the expansion of the loci related to sRNA pathways, insights into the activities of these proteins by domain and catalytic site analyses, and gene expression analysis. The number of MIR loci and their targeted pathways highlight the importance of miRNAs in coffee. We identified several roles of sRNAs in C. canephora, which offers substantial insight into better understanding the transcriptional and post-transcriptional regulation of this major crop.

  8. Expression and regulatory effects of microRNA-182 in osteosarcoma cells: A pilot study

    PubMed Central

    BIAN, DONG-LIN; WANG, XUE-MEI; HUANG, KUN; ZHAI, QI-XI; YU, GUI-BO; WU, CHENG-HUA

    2016-01-01

    The aim of the present study was to evaluate the expression level of microRNA-182 (miRNA-182) in human osteosarcoma (OS) MG-63 cells and OS tissues, and to elucidate the effect of miRNA-182 on the biological activity of tumors. In the present study, the expression of miRNA-182 in human OS MG-63 cells, OS tissues and normal osteoblast hFOB1.19 cells was determined using quantitative polymerase chain reaction. Subsequently, a miRNA-182 mimic and inhibitor were utilized to regulate the expression level of this miRNA in MG-63 cells. Cell viability and proliferation were examined using cell counting kit-8 assays, and cell apoptosis was detected by flow cytometry. Cell invasion and migration assays were performed using Transwell chambers to analyze the biological functions of miRNA-182 in vitro. The present study demonstrated that the expression level of miRNA-182 in MG-63 cells and OS tissues was significantly increased compared with the hFOB1.19 cell line (P<0.05). The present study successfully performed cell transfections of miRNA-182 inhibitor and miRNA-182 mimic into MG-63 cells and achieved the desired transfection efficiency. The present study confirmed that upregulation of miRNA-182 promotes cell apoptosis and inhibits cell viability, proliferation, invasion and migration. The present findings additionally demonstrated that miRNA-182 is a tumor suppressor gene in OS. Therefore, regulating the expression of miRNA-182 may affect the biological behavior of OS cells, which suggests a potential role for miRNA-182 in molecular therapy for malignant tumors. PMID:27123060

  9. Control of mRNA decapping by positive and negative regulatory elements in the Dcp2 C-terminal domain

    PubMed Central

    He, Feng; Jacobson, Allan

    2015-01-01

    Decapping commits an mRNA to complete degradation and promotes general 5′ to 3′ decay, nonsense-mediated decay (NMD), and transcript-specific degradation. In Saccharomyces cerevisiae, a single decapping enzyme composed of a regulatory subunit (Dcp1) and a catalytic subunit (Dcp2) targets thousands of distinct substrate mRNAs. However, the mechanisms controlling this enzyme's in vivo activity and substrate specificity remain elusive. Here, using a genetic approach, we show that the large C-terminal domain of Dcp2 includes a set of conserved negative and positive regulatory elements. A single negative element inhibits enzymatic activity and controls the downstream functions of several positive elements. The positive elements recruit the specific decapping activators Edc3, Pat1, and Upf1 to form distinct decapping complexes and control the enzyme's substrate specificity and final activation. Our results reveal unforeseen regulatory mechanisms that control decapping enzyme activity and function in vivo, and define roles for several decapping activators in the regulation of mRNA decapping. PMID:26184073

  10. Discovering MicroRNA-Regulatory Modules in Multi-Dimensional Cancer Genomic Data: A Survey of Computational Methods

    PubMed Central

    Walsh, Christopher J.; Hu, Pingzhao; Batt, Jane; dos Santos, Claudia C.

    2016-01-01

    MicroRNAs (miRs) are small single-stranded noncoding RNA that function in RNA silencing and post-transcriptional regulation of gene expression. An increasing number of studies have shown that miRs play an important role in tumorigenesis, and understanding the regulatory mechanism of miRs in this gene regulatory network will help elucidate the complex biological processes at play during malignancy. Despite advances, determination of miR–target interactions (MTIs) and identification of functional modules composed of miRs and their specific targets remain a challenge. A large amount of data generated by high-throughput methods from various sources are available to investigate MTIs. The development of data-driven tools to harness these multi-dimensional data has resulted in significant progress over the past decade. In parallel, large-scale cancer genomic projects are allowing new insights into the commonalities and disparities of miR–target regulation across cancers. In the first half of this review, we explore methods for identification of pairwise MTIs, and in the second half, we explore computational tools for discovery of miR-regulatory modules in a cancer-specific and pan-cancer context. We highlight strengths and limitations of each of these tools as a practical guide for the computational biologists. PMID:27721651

  11. Changes in the miRNA-mRNA Regulatory Network Precede Motor Symptoms in a Mouse Model of Multiple System Atrophy: Clinical Implications

    PubMed Central

    Refolo, Violetta; Venezia, Serena; Sturm, Edith; Piatti, Paolo; Hechenberger, Clara; Hackl, Hubert; Kessler, Roman; Willi, Michaela; Gstir, Ronald; Krogsdam, Anne; Lusser, Alexandra; Poewe, Werner; Wenning, Gregor K.; Hüttenhofer, Alexander; Stefanova, Nadia

    2016-01-01

    Multiple system atrophy (MSA) is a fatal rapidly progressive α-synucleinopathy, characterized by α-synuclein accumulation in oligodendrocytes. It is accepted that the pathological α-synuclein accumulation in the brain of MSA patients plays a leading role in the disease process, but little is known about the events in the early stages of the disease. In this study we aimed to define potential roles of the miRNA-mRNA regulatory network in the early pre-motor stages of the disease, i.e., downstream of α-synuclein accumulation in oligodendroglia, as assessed in a transgenic mouse model of MSA. We investigated the expression patterns of miRNAs and their mRNA targets in substantia nigra (SN) and striatum, two brain regions that undergo neurodegeneration at a later stage in the MSA model, by microarray and RNA-seq analysis, respectively. Analysis was performed at a time point when α-synuclein accumulation was already present in oligodendrocytes at neuropathological examination, but no neuronal loss nor deficits of motor function had yet occurred. Our data provide a first evidence for the leading role of gene dysregulation associated with deficits in immune and inflammatory responses in the very early, non-symptomatic disease stages of MSA. While dysfunctional homeostasis and oxidative stress were prominent in SN in the early stages of MSA, in striatum differential gene expression in the non-symptomatic phase was linked to oligodendroglial dysfunction, disturbed protein handling, lipid metabolism, transmembrane transport and altered cell death control, respectively. A large number of putative miRNA-mRNAs interaction partners were identified in relation to the control of these processes in the MSA model. Our results support the role of early changes in the miRNA-mRNA regulatory network in the pathogenesis of MSA preceding the clinical onset of the disease. The findings thus contribute to understanding the disease process and are likely to pave the way towards

  12. Genomic gems: SINE RNAs regulate mRNA production

    PubMed Central

    Ponicsan, Steven L.; Kugel, Jennifer F.; Goodrich, James A.

    2010-01-01

    Summary Mammalian short interspersed elements (SINEs) are abundant retrotransposons that have long been considered junk DNA; however, RNAs transcribed from mouse B2 and human Alu SINEs have recently been found to control mRNA production at multiple levels. Upon cell stress B2 and Alu RNAs bind RNA polymerase II (Pol II) and repress transcription of some protein-encoding genes. Bidirectional transcription of a B2 SINE establishes a boundary that places the growth hormone locus in a permissive chromatin state during mouse development. Alu RNAs embedded in Pol II transcripts can promote evolution and proteome diversity through exonization via alternative splicing. Given the diverse means by which SINE encoded RNAs impact production of mRNAs, this genomic junk is proving to contain hidden gems. PMID:20176473

  13. Genomic gems: SINE RNAs regulate mRNA production.

    PubMed

    Ponicsan, Steven L; Kugel, Jennifer F; Goodrich, James A

    2010-04-01

    Mammalian short interspersed elements (SINEs) are abundant retrotransposons that have long been considered junk DNA; however, RNAs transcribed from mouse B2 and human Alu SINEs have recently been found to control mRNA production at multiple levels. Upon cell stress B2 and Alu RNAs bind RNA polymerase II (Pol II) and repress transcription of some protein-encoding genes. Bi-directional transcription of a B2 SINE establishes a boundary that places the growth hormone locus in a permissive chromatin state during mouse development. Alu RNAs embedded in Pol II transcripts can promote evolution and proteome diversity through exonization via alternative splicing. Given the diverse means by which SINE encoded RNAs impact production of mRNAs, this genomic junk is proving to contain hidden gems.

  14. Integrative analysis of mRNA and miRNA array data reveals the suppression of retinoic acid pathway in regulatory T cells of Graves' disease.

    PubMed

    Wang, Zhe; Fan, Xiaohua; Zhang, Rongrong; Lin, Zongwei; Lu, Ting; Bai, Xue; Li, Wenchao; Zhao, Jiajun; Zhang, Qunye

    2014-12-01

    It is well known that regulatory T cells (Tregs) are abnormal in Graves' disease (GD) and play crucial roles in the breakdown of immune tolerance and GD development. However, there are controversies about whether the quantity and/or function of Tregs is aberrant in GD. The molecular mechanism of Tregs abnormality and its effects on GD development was still unclear, until now. MiRNAs play important roles in the function and development of the immune system including Tregs. To reveal the Tregs abnormality and its molecular mechanism in GD, we systematically studied the quantity and immunosuppressive function as well as the differential expression profiles of miRNA and mRNA of Tregs in newly diagnosed patients with GD using TaqMan miRNA array and mRNA microarray. Our results showed that the quantity and immunosuppressive function of Tregs in initial patients with GD was significantly decreased. More importantly, the retinoic acid (RA) pathway was markedly suppressed and its agonist, all-trans retinoic acid, could notably improve the quantity and immunosuppressive function of Tregs from patients with GD in vitro. In addition, many other pathways including protein ubiquitination and circadian rhythm were also significantly regulated in Tregs of GD. This integrative study first revealed the expression profiles of mRNA/miRNA in Tregs of initial GD and RA pathway might play important roles in GD development. Our results implied that all-trans RA, which had been used for a long time in the clinical setting, had potential value in the treatment of GD and was worthy of additional study.

  15. Small interfering RNA mediated knockdown of irisin suppresses food intake and modulates appetite regulatory peptides in zebrafish.

    PubMed

    Sundarrajan, Lakshminarasimhan; Unniappan, Suraj

    2017-10-01

    Irisin is a myokine encoded in fibronectin type III domain containing 5 (FNDC5). FNDC5 forms an integral part of the muscle post-exercise, and causes an increase in energy expenditure in mammals. Irisin is abundantly expressed in cardiac and skeletal muscles and is secreted upon activation of peroxisome proliferator-activated receptor gamma coactivator-1 (PGC-1 alpha). Irisin regulates feeding behaviour and cardiovascular function in mammals. More recently, irisin has gained importance as a potential biomarker for myocardial infarction due to its abundance in cardiac muscle. The goal of this research was to determine whether irisin influences feeding, and regulates appetite regulatory peptides in zebrafish. Intraperitoneal injection of irisin [0.1, 1, 10 and 100ng/g body weight (BW)] did not affect feeding, but its knockdown using siRNA (10ng/g BW) caused a significant reduction in food intake. Knockdown of irisin reduced ghrelin and orexin-A mRNA expression, and increased cocaine and amphetamine regulated transcript mRNA expression in zebrafish brain and gut. siRNA mediated knockdown of irisin also downregulated brain derived neurotrophic factor mRNA in zebrafish. The role of endogenous irisin on food intake is likely mediated by its actions on other metabolic peptides. Collectively, these results indicate that unaltered endogenous irisin is required to maintain food intake in zebrafish. Copyright © 2017 Elsevier Inc. All rights reserved.

  16. Translational Activation of Oskar mRNA: Reevaluation of the Role and Importance of a 5' Regulatory Element

    PubMed Central

    Kanke, Matt; Macdonald, Paul M.

    2015-01-01

    Local translation of oskar (osk) mRNA at the posterior pole of the Drosophila oocyte is essential for axial patterning of the embryo, and is achieved by a program of translational repression, mRNA localization, and translational activation. Multiple forms of repression are used to prevent Oskar protein from accumulating at sites other than the oocyte posterior. Activation is mediated by several types of cis-acting elements, which presumably control different forms of activation. We characterize a 5' element, positioned in the coding region for the Long Osk isoform and in the extended 5' UTR for translation of the Short Osk isoform. This element was previously thought to be essential for osk mRNA translation, with a role in posterior-specific release from repression. From our work, which includes assays which separate the effects of mutations on RNA regulatory elements and protein coding capacity, we find that the element is not essential, and conclude that there is no evidence supporting a role for the element only at the posterior of the oocyte. The 5' element has a redundant role, and is only required when Long Osk is not translated from the same mRNA. Mutations in the element do disrupt the anchoring function of Long Osk protein through their effects on the amino acid sequence, a confounding influence on interpretation of previous experiments. PMID:25938537

  17. A Two-Component Regulatory System Impacts Extracellular Membrane-Derived Vesicle Production in Group A Streptococcus.

    PubMed

    Resch, Ulrike; Tsatsaronis, James Anthony; Le Rhun, Anaïs; Stübiger, Gerald; Rohde, Manfred; Kasvandik, Sergo; Holzmeister, Susanne; Tinnefeld, Philip; Wai, Sun Nyunt; Charpentier, Emmanuelle

    2016-11-01

    Export of macromolecules via extracellular membrane-derived vesicles (MVs) plays an important role in the biology of Gram-negative bacteria. Gram-positive bacteria have also recently been reported to produce MVs; however, the composition and mechanisms governing vesiculogenesis in Gram-positive bacteria remain undefined. Here, we describe MV production in the Gram-positive human pathogen group A streptococcus (GAS), the etiological agent of necrotizing fasciitis and streptococcal toxic shock syndrome. M1 serotype GAS isolates in culture exhibit MV structures both on the cell wall surface and in the near vicinity of bacterial cells. A comprehensive analysis of MV proteins identified both virulence-associated protein substrates of the general secretory pathway in addition to "anchorless surface proteins." Characteristic differences in the contents, distributions, and fatty acid compositions of specific lipids between MVs and GAS cell membrane were also observed. Furthermore, deep RNA sequencing of vesicular RNAs revealed that GAS MVs contained differentially abundant RNA species relative to bacterial cellular RNA. MV production by GAS strains varied in a manner dependent on an intact two-component system, CovRS, with MV production negatively regulated by the system. Modulation of MV production through CovRS was found to be independent of both GAS cysteine protease SpeB and capsule biosynthesis. Our data provide an explanation for GAS secretion of macromolecules, including RNAs, lipids, and proteins, and illustrate a regulatory mechanism coordinating this secretory response. Group A streptococcus (GAS) is a Gram-positive bacterial pathogen responsible for more than 500,000 deaths annually. Establishment of GAS infection is dependent on a suite of proteins exported via the general secretory pathway. Here, we show that GAS naturally produces extracellular vesicles with a unique lipid composition that are laden with proteins and RNAs. Interestingly, both virulence

  18. Structural basis for stabilization of the tau pre-mRNA splicing regulatory element by novatrone (mitoxantrone)

    PubMed Central

    Zheng, Suxin; Chen, Yu; Donahue, Christine P.; Wolfe, Michael S.; Varani, Gabriele

    2009-01-01

    Summary Some familial neurodegenerative diseases are associated with mutations that destabilize a putative stem-loop structure within an intronic region of the tau pre-mRNA and alter the production of tau protein isoforms by alternative splicing. Since stabilization of the stem loop reverses the splicing pattern associated with neurodegeneration, small molecules that stabilize this stem loop would provide new ways to dissect the mechanism of neurodegeneration and treat tauopathies. The anti-cancer drug mitoxantrone was recently identified in a high throughput screen to stabilize the tau pre-mRNA stem loop. Here we report the solution structure of the tau mRNA-mitoxantrone complex, validated by the structure-activity relationship of existing mitoxantrone analogs. The structure describes the molecular basis for their interaction with RNA and provides a rational basis to optimize the activity of this new class of RNA-binding molecules. PMID:19477420

  19. Regulatory interactions of Csr components: the RNA binding protein CsrA activates csrB transcription in Escherichia coli.

    PubMed

    Gudapaty, S; Suzuki, K; Wang, X; Babitzke, P; Romeo, T

    2001-10-01

    The global regulator CsrA (carbon storage regulator) of Escherichia coli is a small RNA binding protein that represses various metabolic pathways and processes that are induced in the stationary phase of growth, while it activates certain exponential phase functions. Both repression and activation by CsrA involve posttranscriptional mechanisms, in which CsrA binding to mRNA leads to decreased or increased transcript stability, respectively. CsrA also binds to a small untranslated RNA, CsrB, forming a ribonucleoprotein complex, which antagonizes CsrA activity. We have further examined the regulatory interactions of CsrA and CsrB RNA. The 5' end of the CsrB transcript was mapped, and a csrB::cam null mutant was constructed. CsrA protein and CsrB RNA levels were estimated throughout the growth curves of wild-type and isogenic csrA, csrB, rpoS, or csrA rpoS mutant strains. CsrA levels exhibited modest or negligible effects of these mutations. The intracellular concentration of CsrA exceeded the total CsrA-binding capacity of intracellular CsrB RNA. In contrast, CsrB levels were drastically decreased (~10-fold) in the csrA mutants. CsrB transcript stability was unaffected by csrA. The expression of a csrB-lacZ transcriptional fusion containing the region from -242 to +4 bp of the csrB gene was decreased ~20-fold by a csrA::kanR mutation in vivo but was unaffected by CsrA protein in vitro. These results reveal a significant, though most likely indirect, role for CsrA in regulating csrB transcription. Furthermore, our findings suggest that CsrA mediates an intriguing form of autoregulation, whereby its activity, but not its levels, is modulated through effects on an RNA antagonist, CsrB.

  20. Engineered Nanoscale Materials and Derivative Products: Regulatory Challenges

    DTIC Science & Technology

    2008-01-22

    to microbes, and some product manufacturers have made antibacterial claims for their products containing nanosilver . In addition, research has...intent to regulate nanosilver under FIFRA when it is released from certain washing machines and other products for which manufacturers claim...nanomaterials, including nanosilver , under certain conditions. To address this challenge, EPA’s Science Policy Council, an internal policy group, formed

  1. The T box mechanism: tRNA as a regulatory molecule

    PubMed Central

    Green, Nicholas J.; Grundy, Frank J.; Henkin, Tina M.

    2009-01-01

    The T box mechanism is widely used in Gram-positive bacteria to regulate expression of aminoacyl-tRNA synthetase genes and genes involved in amino acid biosynthesis and uptake. Binding of a specific uncharged tRNA to a riboswitch element in the nascent transcript causes a structural change in the transcript that promotes expression of the downstream coding sequence. In most cases, this occurs by stabilization of an antiterminator element that competes with formation of a terminator helix. Specific tRNA recognition by the nascent transcript results in increased expression of genes important for tRNA aminoacylation in response to decreased pools of charged tRNA. PMID:19932103

  2. RNA Sequencing and Bioinformatics Analysis Implicate the Regulatory Role of a Long Noncoding RNA-mRNA Network in Hepatic Stellate Cell Activation.

    PubMed

    Guo, Can-Jie; Xiao, Xiao; Sheng, Li; Chen, Lili; Zhong, Wei; Li, Hai; Hua, Jing; Ma, Xiong

    2017-08-11

    To analyze the long noncoding (lncRNA)-mRNA expression network and potential roles in rat hepatic stellate cells (HSCs) during activation. LncRNA expression was analyzed in quiescent and culture-activated HSCs by RNA sequencing, and differentially expressed lncRNAs verified by quantitative reverse transcription polymerase chain reaction (qRT-PCR) were subjected to bioinformatics analysis. In vivo analyses of differential lncRNA-mRNA expression were performed on a rat model of liver fibrosis. We identified upregulation of 12 lncRNAs and 155 mRNAs and downregulation of 12 lncRNAs and 374 mRNAs in activated HSCs. Additionally, we identified the differential expression of upregulated lncRNAs (NONRATT012636.2, NONRATT016788.2, and NONRATT021402.2) and downregulated lncRNAs (NONRATT007863.2, NONRATT019720.2, and NONRATT024061.2) in activated HSCs relative to levels observed in quiescent HSCs, and Gene Ontology and Kyoto Encyclopedia of Genes and Genomes pathway analyses showed that changes in lncRNAs associated with HSC activation revealed 11 significantly enriched pathways according to their predicted targets. Moreover, based on the predicted co-expression network, the relative dynamic levels of NONRATT013819.2 and lysyl oxidase (Lox) were compared during HSC activation both in vitro and in vivo. Our results confirmed the upregulation of lncRNA NONRATT013819.2 and Lox mRNA associated with the extracellular matrix (ECM)-related signaling pathway in HSCs and fibrotic livers. Our results detailing a dysregulated lncRNA-mRNA network might provide new treatment strategies for hepatic fibrosis based on findings indicating potentially critical roles for NONRATT013819.2 and Lox in ECM remodeling during HSC activation. © 2017 The Author(s). Published by S. Karger AG, Basel.

  3. Temporal analysis of reciprocal miRNA-mRNA expression patterns predicts regulatory networks during differentiation in human skeletal muscle cells.

    PubMed

    Sjögren, Rasmus J O; Egan, Brendan; Katayama, Mutsumi; Zierath, Juleen R; Krook, Anna

    2015-03-01

    microRNAs (miRNAs) are short noncoding RNAs that regulate gene expression through posttranscriptional repression of target genes. miRNAs exert a fundamental level of control over many developmental processes, but their role in the differentiation and development of skeletal muscle from myogenic progenitor cells in humans remains incompletely understood. Using primary cultures established from human skeletal muscle satellite cells, we performed microarray profiling of miRNA expression during differentiation of myoblasts (day 0) into myotubes at 48 h intervals (day 2, 4, 6, 8, and 10). Based on a time-course analysis, we identified 44 miRNAs with altered expression [false discovery rate (FDR) < 5%, fold change > ±1.2] during differentiation, including the marked upregulation of the canonical myogenic miRNAs miR-1, miR-133a, miR-133b, and miR-206. Microarray profiling of mRNA expression at day 0, 4, and 10 identified 842 and 949 genes differentially expressed (FDR < 10%) at day 4 and 10, respectively. At day 10, 42% of altered transcripts demonstrated reciprocal expression patterns in relation to the directional change of their in silico predicted regulatory miRNAs based on analysis using Ingenuity Pathway Analysis microRNA Target Filter. Bioinformatic analysis predicted networks of regulation during differentiation including myomiRs miR-1/206 and miR-133a/b, miRNAs previously established in differentiation including miR-26 and miR-30, and novel miRNAs regulated during differentiation of human skeletal muscle cells such as miR-138-5p and miR-20a. These reciprocal expression patterns may represent new regulatory nodes in human skeletal muscle cell differentiation. This analysis serves as a reference point for future studies of human skeletal muscle differentiation and development in healthy and disease states.

  4. Reconstruction of gene regulatory modules from RNA silencing of IFN-α modulators: experimental set-up and inference method.

    PubMed

    Grassi, Angela; Di Camillo, Barbara; Ciccarese, Francesco; Agnusdei, Valentina; Zanovello, Paola; Amadori, Alberto; Finesso, Lorenzo; Indraccolo, Stefano; Toffolo, Gianna Maria

    2016-03-12

    Inference of gene regulation from expression data may help to unravel regulatory mechanisms involved in complex diseases or in the action of specific drugs. A challenging task for many researchers working in the field of systems biology is to build up an experiment with a limited budget and produce a dataset suitable to reconstruct putative regulatory modules worth of biological validation. Here, we focus on small-scale gene expression screens and we introduce a novel experimental set-up and a customized method of analysis to make inference on regulatory modules starting from genetic perturbation data, e.g. knockdown and overexpression data. To illustrate the utility of our strategy, it was applied to produce and analyze a dataset of quantitative real-time RT-PCR data, in which interferon-α (IFN-α) transcriptional response in endothelial cells is investigated by RNA silencing of two candidate IFN-α modulators, STAT1 and IFIH1. A putative regulatory module was reconstructed by our method, revealing an intriguing feed-forward loop, in which STAT1 regulates IFIH1 and they both negatively regulate IFNAR1. STAT1 regulation on IFNAR1 was object of experimental validation at the protein level. Detailed description of the experimental set-up and of the analysis procedure is reported, with the intent to be of inspiration for other scientists who want to realize similar experiments to reconstruct gene regulatory modules starting from perturbations of possible regulators. Application of our approach to the study of IFN-α transcriptional response modulators in endothelial cells has led to many interesting novel findings and new biological hypotheses worth of validation.

  5. Health claims on food products in Southeast Asia: regulatory frameworks, barriers, and opportunities.

    PubMed

    Tan, Karin Y M; van der Beek, Eline M; Chan, M Y; Zhao, Xuejun; Stevenson, Leo

    2015-09-01

    The Association of Southeast Asian Nations aims to act as a single market and allow free movement of goods, services, and manpower. The purpose of this article is to present an overview of the current regulatory framework for health claims in Southeast Asia and to highlight the current barriers and opportunities in the regulatory frameworks in the Association of Southeast Asian Nations. To date, 5 countries in Southeast Asia, i.e., Indonesia, Malaysia, the Philippines, Singapore, and Thailand, have regulations and guidelines to permit the use of health claims on food products. There are inconsistencies in the regulations and the types of evidence required for health claim applications in these countries. A clear understanding of the regulatory frameworks in these countries may help to increase trade in this fast-growing region and to provide direction for the food industry and the regulatory community to develop and market food products with better nutritional quality tailored to the needs of Southeast Asian consumers.

  6. Foot-and-mouth disease virus leader proteinase inhibits dsRNA-induced type I interferon transcription by decreasing interferon regulatory factor 3/7 in protein levels

    SciTech Connect

    Wang, Dang; Fang, Liurong; Luo, Rui; Ye, Rui; Fang, Ying; Xie, Lilan; Chen, Huanchun; Xiao, Shaobo

    2010-08-13

    Research highlights: {yields} FMDV L{sup pro} inhibits poly(I:C)-induced IFN-{alpha}1/{beta} mRNA expression. {yields} L{sup pro} inhibits MDA5-mediated activation of the IFN-{alpha}1/{beta} promoter. {yields} L{sup pro} significantly reduced the transcription of multiple IRF-responsive genes. {yields} L{sup pro} inhibits IFN-{alpha}1/{beta} promoter activation by decreasing IRF-3/7 in protein levels. {yields} The ability to process eIF-4G of L{sup pro} is not necessary to inhibit IFN-{alpha}1/{beta} activation. -- Abstract: The leader proteinase (L{sup pro}) of foot-and-mouth disease virus (FMDV) has been identified as an interferon-{beta} (IFN-{beta}) antagonist that disrupts the integrity of transcription factor nuclear factor {kappa}B (NF-{kappa}B). In this study, we showed that the reduction of double stranded RNA (dsRNA)-induced IFN-{alpha}1/{beta} expression caused by L{sup pro} was also associated with a decrease of interferon regulatory factor 3/7 (IRF-3/7) in protein levels, two critical transcription factors for activation of IFN-{alpha}/{beta}. Furthermore, overexpression of L{sup pro} significantly reduced the transcription of multiple IRF-responsive genes including 2',5'-OAS, ISG54, IP-10, and RANTES. Screening L{sup pro} mutants indicated that the ability to process eIF-4G of L{sup pro} is not required for suppressing dsRNA-induced activation of the IFN-{alpha}1/{beta} promoter and decreasing IRF-3/7 expression. Taken together, our results demonstrate that, in addition to disrupting NF-{kappa}B, L{sup pro} also decreases IRF-3/7 expression to suppress dsRNA-induced type I IFN production, suggesting multiple strategies used by FMDV to counteract the immune response to viral infection.

  7. Comparative transcriptome analysis reveals a regulatory network of microRNA-29b during mouse early embryonic development

    PubMed Central

    Wan, Jinyuan; Yang, Ye; Chen, Xiaojiao; Wang, Jiayi; Zhou, Cheng; Liu, Mingxi; Ling, Xiufeng; Zhang, Junqiang

    2016-01-01

    MicroRNAs are endogenous ~22 nt RNAs that regulate gene expression by translational inhibition and mRNA destabilization. MicroRNA-29b (miR-29b) is essential for progression of mouse embryos past preimplantation development; however, details of the underlying regulatory network remain to be elucidated. Here, we used RNA sequencing to identify changes in the transcriptome of mouse embryos in response to miR-29b inhibition. Morula-stage embryos that had been subject to miR-29b inhibition throughout preimplantation development exhibited significant expression changes in 870 genes compared with controls. Among 405 genes that were downregulated, 30 genes encoded factors with known essential function during early embryonic development, including the pluripotent stem cell factor Nanog. We identified 19 genes encoding putative miR-29b target transcripts. These included Zbtb40, Hbp1, Ccdc117, Ypel2, Klf4, and Tmed9, which are upregulated at the 4-cell state of mouse development concomitant with miR-29b downregulation. Luciferase reporter analysis confirmed that Zbtb40, Hbp1, Ccdc117, Ypel2, and Klf4 transcripts are direct targets of miR-29b. These results suggest that miR-29b decreases the mRNA levels of several target genes during early mouse development, including the gene encoding the reprogramming factor Klf4. We hypothesize that inhibition of miR-29b causes overexpression of its target genes, triggering downstream signaling networks to decrease the expression of genes that are essential for embryonic development. In conclusion, miR-29b controls an extensive regulatory network in early mouse embryos, which comprises reprogramming factors and molecular regulators of post-transcriptional modification processes. PMID:27449102

  8. Transition into inflammatory cancer-associated adipocytes in breast cancer microenvironment requires microRNA regulatory mechanism

    PubMed Central

    Ryu, Han Suk; Lee, Han-Byoel; Lee, Minju; Park, In Ae; Kim, Jisun; Han, Wonshik; Noh, Dong-Young

    2017-01-01

    The role of adipocytes in cancer microenvironment has gained focus during the recent years. However, the characteristics of the cancer-associated adipocytes (CAA) in human breast cancer tissues and the underlying regulatory mechanism are not clearly understood. We reviewed pathology specimens of breast cancer patients to understand the morphologic characteristics of CAA, and profiled the mRNA and miRNA expression of CAA by using indirect co-culture system in vitro. The CAAs in human breast cancers showed heterogeneous topographic relationship with breast cancer cells within the breast microenvironment. The CAAs exhibited the characteristics of de-differentiation determined by their microscopic appearance and the expression levels of adipogenic markers. Additionally, the 3T3-L1 adipocytes indirectly co-cultured with breast cancer cells showed up-regulation of inflammation-related genes including Il6 and Ptx3. The up-regulation of IL6 in CAA was further observed in human breast cancer tissues. miRNA array of indirectly co-cultured 3T3-L1 cells showed increased expression of mmu-miR-5112 which may target Cpeb1. Cpeb1 is a negative regulator of Il6. The suppressive role of mmu-miR-5112 was confirmed by dual luciferase reporter assay, and mmu-miR-5112-treated adipocytes showed up-regulation of Il6. The transition of adipocytes into more inflammatory CAA resulted in proliferation-promoting effect in ER positive breast cancer cells such as MCF7 and ZR-75-1 but not in ER negative cells. In this study, we have determined the de-differentiated and inflammatory natures of CAA in breast cancer microenvironment. Additionally, we propose a miRNA-based regulatory mechanism underlying the process of acquiring inflammatory phenotypes in CAA. PMID:28333977

  9. Activated platelets can deliver mRNA regulatory Ago2•microRNA complexes to endothelial cells via microparticles.

    PubMed

    Laffont, Benoit; Corduan, Aurélie; Plé, Hélène; Duchez, Anne-Claire; Cloutier, Nathalie; Boilard, Eric; Provost, Patrick

    2013-07-11

    Platelets play a crucial role in the maintenance of hemostasis, as well as in thrombosis. Upon activation, platelets release small membrane-bound microparticles (MPs) containing bioactive proteins and genetic materials from their parental cells that may be transferred to, and exert potent biological effects in, recipient cells of the circulatory system. Platelets have been shown to contain an abundant and diverse array of microRNAs, and platelet-derived MPs are the most abundant microvesicles in the circulation. Here we demonstrate that human platelets activated with thrombin preferentially release their miR-223 content in MPs. These MPs can be internalized by human umbilical vein endothelial cells (HUVEC), leading to the accumulation of platelet-derived miR-223. Platelet MPs contain functional Argonaute 2 (Ago2)•miR-223 complexes that are capable of regulating expression of a reporter gene in recipient HUVEC. Moreover, we demonstrate a role for platelet MP-derived miR-223 in the regulation of 2 endogenous endothelial genes, both at the messenger RNA and protein levels. Our results support a scenario by which platelet MPs may act as intercellular carriers of functional Ago2•microRNA complexes that may exert heterotypic regulation of gene expression in endothelial cells, and possibly other recipient cells of the circulatory system.

  10. SPIRE, a modular pipeline for eQTL analysis of RNA-Seq data, reveals a regulatory hotspot controlling miRNA expression in C. elegans.

    PubMed

    Kel, Ivan; Chang, Zisong; Galluccio, Nadia; Romeo, Margherita; Beretta, Stefano; Diomede, Luisa; Mezzelani, Alessandra; Milanesi, Luciano; Dieterich, Christoph; Merelli, Ivan

    2016-10-18

    The interpretation of genome-wide association study is difficult, as it is hard to understand how polymorphisms can affect gene regulation, in particular for trans-regulatory elements located far from their controlling gene. Using RNA or protein expression data as phenotypes, it is possible to correlate their variations with specific genotypes. This technique is usually referred to as expression Quantitative Trait Loci (eQTLs) analysis and only few packages exist for the integration of genotype patterns and expression profiles. In particular, tools are needed for the analysis of next-generation sequencing (NGS) data on a genome-wide scale, which is essential to identify eQTLs able to control a large number of genes (hotspots). Here we present SPIRE (Software for Polymorphism Identification Regulating Expression), a generic, modular and functionally highly flexible pipeline for eQTL processing. SPIRE integrates different univariate and multivariate approaches for eQTL analysis, paying particular attention to the scalability of the procedure in order to support cis- as well as trans-mapping, thus allowing the identification of hotspots in NGS data. In particular, we demonstrated how SPIRE can handle big association study datasets, reproducing published results and improving the identification of trans-eQTLs. Furthermore, we employed the pipeline to analyse novel data concerning the genotypes of two different C. elegans strains (N2 and Hawaii) and related miRNA expression data, obtained using RNA-Seq. A miRNA regulatory hotspot was identified in chromosome 1, overlapping the transcription factor grh-1, known to be involved in the early phases of embryonic development of C. elegans. In a follow-up qPCR experiment we were able to verify most of the predicted eQTLs, as well as to show, for a novel miRNA, a significant difference in the sequences of the two analysed strains of C. elegans. SPIRE is publicly available as open source software at , together with some example

  11. RNA cleavage products generated by antisense oligonucleotides and siRNAs are processed by the RNA surveillance machinery

    PubMed Central

    Lima, Walt F.; De Hoyos, Cheryl L.; Liang, Xue-hai; Crooke, Stanley T.

    2016-01-01

    DNA-based antisense oligonucleotides (ASOs) elicit cleavage of the targeted RNA by the endoribonuclease RNase H1, whereas siRNAs mediate cleavage through the RNAi pathway. To determine the fates of the cleaved RNA in cells, we lowered the levels of the factors involved in RNA surveillance prior to treating cells with ASOs or siRNA and analyzed cleavage products by RACE. The cytoplasmic 5′ to 3′ exoribonuclease XRN1 was responsible for the degradation of the downstream cleavage products generated by ASOs or siRNA targeting mRNAs. In contrast, downstream cleavage products generated by ASOs targeting nuclear long non-coding RNA Malat 1 and pre-mRNA were degraded by nuclear XRN2. The downstream cleavage products did not appear to be degraded in the 3′ to 5′ direction as the majority of these products contained intact poly(A) tails and were bound by the poly(A) binding protein. The upstream cleavage products of Malat1 were degraded in the 3′ to 5′ direction by the exosome complex containing the nuclear exoribonuclease Dis3. The exosome complex containing Dis3 or cytoplasmic Dis3L1 degraded mRNA upstream cleavage products, which were not bound by the 5′-cap binding complex and, consequently, were susceptible to degradation in the 5′ to 3′ direction by the XRN exoribonucleases. PMID:26843429

  12. An Update of the Brazilian Regulatory Bioequivalence Recommendations for Approval of Generic Topical Dermatological Drug Products.

    PubMed

    Soares, Kelen Carine Costa; Santos, Gustavo Mendes Lima; Gelfuso, Guilherme M; Gratieri, Tais

    2015-11-01

    This note aims to clarify the Brazilian regulatory bioequivalence recommendations for approval of generic topical dermatological drug products, since the legal framework of the "Brazilian Health Surveillance Agency" (ANVISA) is only available in Portuguese. According to Resolutions RE n. 1170 (December 19th 2006) and RDC n. 37 (August 3rd 2011) in Brazil, only in vitro studies are required for registration of generic topical dermatological drug products. Current Regulatory Agenda of ANVISA, which contains possible future resolutions to be revised over 2015-2016, includes a discussion on biowaiver requirements and on possible in vitro and in vivo comparability tests for these products.

  13. Measuring expression levels of small regulatory RNA molecules from body fluids and formalin-fixed, paraffin-embedded samples.

    PubMed

    Gyongyosi, Adrienn; Docs, Otto; Czimmerer, Zsolt; Orosz, Laszlo; Horvath, Attila; Török, Olga; Mehes, Gabor; Nagy, Laszlo; Balint, Balint L

    2014-01-01

    MicroRNAs are involved in the regulation of various pathophysiological processes such as immune regulation and cancer. Next-generation sequencing methods enable us to monitor their presence in various types of samples but we need flexible methods for validating datasets generated by high-throughput methods. Here we describe the detailed protocols to be used with our MiRNA Primer Design Tool assay design system. The presented methods allow the flexible design of the oligonucleotides needed for the RT-qPCR detection of any variant of small regulatory RNA molecules from virtually any species. This method can be used to measure miRNA levels from formalin-fixed, paraffin-embedded (FFPE) samples and various body fluids. As an example, we show the results of the hsa-miR-515-3p, hsa-miR-325, and hsa-miR-155 quantification using a specific UPL probe (Universal Probe Library) and a stem-loop RT-qPCR assay. The small nucleolar RNA RNU43 is used as endogenous control for normalization of the results. Urine from healthy pregnant women and FFPE samples from patients diagnosed with colorectal cancer and treated with antibody-based anti-EGFR monotherapy were used as samples.

  14. Integrative analysis of miRNA and gene expression reveals regulatory networks in tamoxifen-resistant breast cancer

    PubMed Central

    Stenvang, Jan; Alves, Carla L.; Teng, Fei; Lyng, Maria B.; Lykkesfeldt, Anne E.; Brünner, Nils; Wang, Jun; Gupta, Ramneek; Workman, Christopher T.; Ditzel, Henrik J.

    2016-01-01

    Tamoxifen is an effective anti-estrogen treatment for patients with estrogen receptor-positive (ER+) breast cancer, however, tamoxifen resistance is frequently observed. To elucidate the underlying molecular mechanisms of tamoxifen resistance, we performed a systematic analysis of miRNA-mediated gene regulation in three clinically-relevant tamoxifen-resistant breast cancer cell lines (TamRs) compared to their parental tamoxifen-sensitive cell line. Alterations in the expression of 131 miRNAs in tamoxifen-resistant vs. parental cell lines were identified, 22 of which were common to all TamRs using both sequencing and LNA-based quantitative PCR technologies. Although the target genes affected by the altered miRNA in the three TamRs differed, good agreement in terms of affected molecular pathways was observed. Moreover, we found evidence of miRNA-mediated regulation of ESR1, PGR1, FOXM1 and 14-3-3 family genes. Integrating the inferred miRNA-target relationships, we investigated the functional importance of 2 central genes, SNAI2 and FYN, which showed increased expression in TamR cells, while their corresponding regulatory miRNA were downregulated. Using specific chemical inhibitors and siRNA-mediated gene knockdown, we showed that both SNAI2 and FYN significantly affect the growth of TamR cell lines. Finally, we show that a combination of 2 miRNAs (miR-190b and miR-516a-5p) exhibiting altered expression in TamR cell lines were predictive of treatment outcome in a cohort of ER+ breast cancer patients receiving adjuvant tamoxifen mono-therapy. Our results provide new insight into the molecular mechanisms of tamoxifen resistance and may form the basis for future medical intervention for the large number of women with tamoxifen-resistant ER+ breast cancer. PMID:27528030

  15. Just-in-Space: Certified Rural Products, Labor of Quality, and Regulatory Spaces

    ERIC Educational Resources Information Center

    Mutersbaugh, Tad

    2005-01-01

    Since the mid-1990s, the number and diversity of "quality-certified" products has increased dramatically. This article examines labor practices and regulatory spaces within 3rd party quality certification and suggests that this distinct configuration be termed "just-in-space" production. A privileging of space derives, on the one hand, from the…

  16. Just-in-Space: Certified Rural Products, Labor of Quality, and Regulatory Spaces

    ERIC Educational Resources Information Center

    Mutersbaugh, Tad

    2005-01-01

    Since the mid-1990s, the number and diversity of "quality-certified" products has increased dramatically. This article examines labor practices and regulatory spaces within 3rd party quality certification and suggests that this distinct configuration be termed "just-in-space" production. A privileging of space derives, on the one hand, from the…

  17. Global regulatory framework for production and marketing of crops biofortified with vitamins and minerals.

    PubMed

    Mejia, Luis A; Dary, Omar; Boukerdenna, Hala

    2017-02-01

    Biofortification of crops is being introduced in several countries as a strategy to reduce micronutrient deficiencies. Biofortified products, with increased contents of micronutrients, are currently produced by conventional plant breeding, genetic modification, or nutrient-enhanced fertilization. Corn, rice, wheat, beans, pearl millet, sweet potato, and cassava have been biofortified with increased contents of provitamin A carotenoids, iron, or zinc. However, regulatory considerations are rare or nonexistent. The objective of this paper is to review the regulatory framework for production and marketing of biofortified crops in countries that have adopted this strategy. The information was identified using Internet search engines and websites of health and nutrition organizations and nongovernmental organizations and by consulting scientists and government authorities. Thus far, biofortified products introduced in Latin America, Africa, and Asia have been produced only by conventional breeding. Cultivars using other techniques are still under testing. The production and marketing of these products have been conducted without regulatory framework and under limited government control or regulatory guidance. Nevertheless, some countries have integrated biofortified crops into their nutrition agendas. Although improvements by conventional breeding have not been subject to regulations, when biofortification becomes expanded by including other techniques, an appropriate regulatory framework will be necessary. © 2016 New York Academy of Sciences.

  18. Integrative analysis of RNA, translation, and protein levels reveals distinct regulatory variation across humans

    PubMed Central

    Cenik, Can; Cenik, Elif Sarinay; Byeon, Gun W.; Grubert, Fabian; Candille, Sophie I.; Spacek, Damek; Alsallakh, Bilal; Tilgner, Hagen; Araya, Carlos L.; Tang, Hua; Ricci, Emiliano; Snyder, Michael P.

    2015-01-01

    Elucidating the consequences of genetic differences between humans is essential for understanding phenotypic diversity and personalized medicine. Although variation in RNA levels, transcription factor binding, and chromatin have been explored, little is known about global variation in translation and its genetic determinants. We used ribosome profiling, RNA sequencing, and mass spectrometry to perform an integrated analysis in lymphoblastoid cell lines from a diverse group of individuals. We find significant differences in RNA, translation, and protein levels suggesting diverse mechanisms of personalized gene expression control. Combined analysis of RNA expression and ribosome occupancy improves the identification of individual protein level differences. Finally, we identify genetic differences that specifically modulate ribosome occupancy—many of these differences lie close to start codons and upstream ORFs. Our results reveal a new level of gene expression variation among humans and indicate that genetic variants can cause changes in protein levels through effects on translation. PMID:26297486

  19. Dominance hierarchy arising from the evolution of a complex small RNA regulatory network.

    PubMed

    Durand, Eléonore; Méheust, Raphaël; Soucaze, Marion; Goubet, Pauline M; Gallina, Sophie; Poux, Céline; Fobis-Loisy, Isabelle; Guillon, Eline; Gaude, Thierry; Sarazin, Alexis; Figeac, Martin; Prat, Elisa; Marande, William; Bergès, Hélène; Vekemans, Xavier; Billiard, Sylvain; Castric, Vincent

    2014-12-05

    The prevention of fertilization through self-pollination (or pollination by a close relative) in the Brassicaceae plant family is determined by the genotype of the plant at the self-incompatibility locus (S locus). The many alleles at this locus exhibit a dominance hierarchy that determines which of the two allelic specificities of a heterozygous genotype is expressed at the phenotypic level. Here, we uncover the evolution of how at least 17 small RNA (sRNA)-producing loci and their multiple target sites collectively control the dominance hierarchy among alleles within the gene controlling the pollen S-locus phenotype in a self-incompatible Arabidopsis species. Selection has created a dynamic repertoire of sRNA-target interactions by jointly acting on sRNA genes and their target sites, which has resulted in a complex system of regulation among alleles. Copyright © 2014, American Association for the Advancement of Science.

  20. Regulatory considerations for raw materials used in biological products.

    PubMed

    Khan, A S

    2010-01-01

    Raw materials are critical components of product manufacture; these include source materials such as cell substrates, tissues, and biological fluids required for product manufacture, as well as biological materials required for cell growth, propagation, differentiation, and selection. Adventitious viruses are a major safety concern in biological raw materials. This paper discusses the specific concerns related to different types of biological materials and presents the Center for Biologics Evaluation and Research's perspective on the qualification and management of raw materials for purposes of developing a safety program for the manufacture of biological products.

  1. Analysis of microRNA and Gene Expression Profiles in Multiple Sclerosis: Integrating Interaction Data to Uncover Regulatory Mechanisms

    PubMed Central

    Freiesleben, Sherry; Hecker, Michael; Zettl, Uwe Klaus; Fuellen, Georg; Taher, Leila

    2016-01-01

    MicroRNAs (miRNAs) have been reported to contribute to the pathophysiology of multiple sclerosis (MS), an inflammatory disorder of the central nervous system. Here, we propose a new consensus-based strategy to analyse and integrate miRNA and gene expression data in MS as well as other publically available data to gain a deeper understanding of the role of miRNAs in MS and to overcome the challenges posed by studies with limited patient sample sizes. We processed and analysed microarray datasets, and compared the expression of genes and miRNAs in the blood of MS patients and controls. We then used our consensus and integration approach to construct two molecular networks dysregulated in MS: a miRNA- and a gene-based network. We identified 18 differentially expressed (DE) miRNAs and 128 DE genes that may contribute to the regulatory alterations behind MS. The miRNAs were linked to immunological and neurological pathways, and we exposed let-7b-5p and miR-345-5p as promising blood-derived disease biomarkers in MS. The results suggest that DE miRNAs are more informative than DE genes in uncovering pathways potentially involved in MS. Our findings provide novel insights into the regulatory mechanisms and networks underlying MS. PMID:27694855

  2. A novel microRNA-1207-3p/FNDC1/FN1/AR regulatory pathway in prostate cancer

    PubMed Central

    Das, Dibash K.; Ogunwobi, Olorunseun O.

    2017-01-01

    Prostate cancer (PCa) is the second most common cause of cancer-specific deaths in the U.S. Unfortunately, the underlying molecular mechanisms for its development and progression remain unclear. Studies have established that microRNAs (miRNAs) are dysregulated in PCa. The intron-derived microRNA-1207-3p (miR-1207-3p) is encoded at the non-protein coding gene locus PVT1 on the 8q24 human chromosomal region, an established PCa susceptibility locus. However, miR-1207-3p in PCa had not previously been investigated. Therefore, we explored if miR-1207-3p plays any regulatory role in PCa. We discovered that miR-1207-3p is significantly underexpressed in PCa cell lines in comparison to normal prostate epithelial cells, and that increased expression of microRNA-1207-3p in PCa cells significantly inhibits proliferation, migration, and induces apoptosis via direct molecular targeting of fibronectin type III domain containing 1 (FNDC1). Our studies also revealed significant overexpression of FNDC1, fibronectin (FN1) and the androgen receptor (AR) in human PCa cell lines as well as tissues, and FNDC1, FN1, and AR positively correlate with aggressive PCa. These findings, recently published in Experimental Cell Research, are the first to describe a novel miR-1207-3p/FNDC1/FN1/AR novel regulatory pathway in PCa. PMID:28251177

  3. Regulatory Role of N(6) -Methyladenosine (m(6) A) Methylation in RNA Processing and Human Diseases.

    PubMed

    Wei, Wenqiang; Ji, Xinying; Guo, Xiangqian; Ji, Shaoping

    2017-03-03

    N(6) -methyladenosine (m(6) A) modification is an abundant and conservative RNA modification in bacterial and eukaryotic cells. m(6) A modification mainly occurs in the 3' untranslated regions (UTRs) and near the stop codons of mRNA. Diverse strategies have been developed for identifying m(6) A sites in single nucleotide resolution. Dynamic regulation of m(6) A is found in metabolism, embryogenesis and developmental processes, indicating a possible epigenetic regulation role along RNA processing and exerting biological functions. It has been known that m(6) A editing involves in nuclear RNA export, mRNA degradation, protein translation and RNA splicing. Deficiency of m(6) A modification will lead to kinds of diseases, such as obesity, cancer, type 2 diabetes mellitus, infertility, developmental arrest. Some specific inhibitors against methyltransferase and demethylase have been developed to selectively regulate m(6) A modification, which may be advantageous for treatment of m(6) A related diseases. This article is protected by copyright. All rights reserved.

  4. Report of the International Regulatory Forum on Human Cell Therapy and Gene Therapy Products.

    PubMed

    Hayakawa, Takao; Harris, Ian; Joung, Jeewon; Kanai, Nobuo; Kawamata, Shin; Kellathur, Srinivasan; Koga, Junichi; Lin, Yi-Chu; Maruyama, Yoshiaki; McBlane, James; Nishimura, Takuya; Renner, Matthias; Ridgway, Anthony; Salmikangas, Paula; Sakamoto, Norihisa; Sato, Daisaku; Sato, Yoji; Toda, Yuzo; Umezawa, Akihiro; Werner, Michael; Wicks, Stephen

    2016-09-01

    The development of human cell therapy and gene therapy products has progressed internationally. Efforts have been made to address regulatory challenges in the evaluation of quality, efficacy, and safety of the products. In this forum, updates on the specific challenges in quality, efficacy, and safety of products in the view of international development were shared through the exchange of information and opinions among experts from regulatory authorities, academic institutions, and industry practitioners. Sessions identified specific/critical points to consider for the evaluation of human cell therapy and gene therapy products that are different from conventional biological products; common approaches and practices among regulatory regions were also shared. Certain elements of current international guidelines might not be appropriate to be applied to these products. Further, international discussion on the concept of potency and in vivo tumorigenicity studies, among others, is needed. This forum concluded that the continued collective actions are expected to promote international convergence of regulatory approaches of the products. The Pharmaceuticals and Medical Devices Agency and Japanese Society for Regenerative Medicine jointly convened the forum with support from the National Institutes of Biomedical Innovation, Health and Nutrition. Participants at the forum include 300 experts in and outside of Japan. Copyright © 2016.

  5. A MicroRNA-Mediated Positive Feedback Regulatory Loop of the NF-κB Pathway in Litopenaeus vannamei.

    PubMed

    Zuo, Hongliang; Yuan, Jia; Chen, Yonggui; Li, Sedong; Su, Ziqi; Wei, Erman; Li, Chaozheng; Weng, Shaoping; Xu, Xiaopeng; He, Jianguo

    2016-05-01

    In the evolutionarily conserved canonical NF-κB pathway, degradation of the NF-κB inhibitor IκB in the cytoplasmic NF-κB/IκB complex allows the liberated NF-κB to translocate into the nucleus to activate various target genes. The regulatory mechanism governing this process needs further investigation. In this study, a novel microRNA, temporarily named miR-1959, was first identified from an invertebrate Litopenaeus vannamei miR-1959 targets the 3'-untranslated region of the IκB homolog Cactus gene and reduces the protein level of Cactus in vivo, whereas the NF-κB homolog Dorsal directly binds the miR-1959 promoter to activate its transcription. Therefore, miR-1959 mediates a positive feedback regulatory loop, in that Dorsal activates miR-1959 expression, and in turn, miR-1959 inhibits the expression of Cactus, further leading to enhanced activation of Dorsal. Moreover, miR-1959 regulates the expression of many antimicrobial peptides in vivo and is involved in antibacterial immunity. To our knowledge, it is the first discovery of a microRNA-mediated feedback loop that directly regulates the NF-κB/IκB complex. This positive feedback loop could collaborate with the known NF-κB/IκB negative loop to generate a dynamic balance to regulate the activity of NF-κB, thus constituting an effective regulatory mechanism at the critical node of the NF-κB pathway. Copyright © 2016 by The American Association of Immunologists, Inc.

  6. Steroidogenic acute regulatory protein in eels: cDNA cloning and effects of ACTH and seawater transfer on its mRNA expression.

    PubMed

    Li, Yuan-You; Inoue, Koji; Takei, Yoshio

    2003-02-01

    Steroidogenic acute regulatory protein (StAR) is a key molecule for steroid production by translocating cholesterol from the outer to inner mitochondrial membrane. Two cDNAs of different length encoding StAR was cloned from the head kidney of the eel (Anguilla japonica). In the 3'-untranslated region (UTR) of the longer cDNA, two putative polyadenylation signals were found. The shorter one differed from the longer one solely by the lack of middle of 3'-UTR including the first polyadenylation signal. Reverse transcription-polymerase chain reaction (RT-PCR) that differentiates the two mRNAs showed that the ratio of the two was highly variable among individuals, and no preferential expression was detected between freshwater and seawater eels. The predicted protein consists of 285 amino acid residues with 64-83% identity to other StARs thus far obtained. RT-PCR analyses revealed that eel StAR mRNA was expressed abundantly in the head kidney and gonad, and faintly in the brain; but no expression was detected in the gill, heart, liver, intestine, kidney and skeletal muscle. Plasma cortisol concentration increased, but StAR mRNA content in the head kidney did not change, 3 and 24 h after transfer of freshwater eels to seawater, indicating that the transcriptional regulation of StAR may not be involved in cortisol production after seawater transfer. However, ACTH elevated both plasma cortisol and StAR mRNA levels in the head kidney 1.5 and 4.5 h after injection. Thus, the steroidogenic effect of ACTH is mediated by increased StAR production as observed in mammals.

  7. MicroRNA Regulatory Mechanisms on Citrus sinensis leaves to Magnesium-Deficiency

    PubMed Central

    Ma, Cui-Lan; Qi, Yi-Ping; Liang, Wei-Wei; Yang, Lin-Tong; Lu, Yi-Bin; Guo, Peng; Ye, Xin; Chen, Li-Song

    2016-01-01

    Magnesium (Mg)-deficiency, which affects crop productivity and quality, widespreadly exists in many agricultural crops, including citrus. However, very limited data are available on Mg-deficiency-responsive microRNAs (miRNAs) in higher plants. Using Illumina sequencing, we isolated 75 (73 known and 2 novel) up- and 71 (64 known and 7 novel) down-regulated miRNAs from Mg-deficient Citrus sinensis leaves. In addition to the remarkable metabolic flexibility as indicated by the great alteration of miRNA expression, the adaptive responses of leaf miRNAs to Mg-deficiency might also involve the following several aspects: (a) up-regulating stress-related genes by down-regulating miR164, miR7812, miR5742, miR3946, and miR5158; (b) enhancing cell transport due to decreased expression of miR3946 and miR5158 and increased expression of miR395, miR1077, miR1160, and miR8019; (c) activating lipid metabolism-related genes by repressing miR158, miR5256, and miR3946; (d) inducing cell wall-related gene expansin 8A by repressing miR779; and (e) down-regulating the expression of genes involved in the maintenance of S, K and Cu by up-regulating miR395 and miR6426. To conclude, we isolated some new known miRNAs (i.e., miR7812, miR8019, miR6218, miR1533, miR6426, miR5256, miR5742, miR5561, miR5158, and miR5818) responsive to nutrient deficiencies and found some candidate miRNAs that might contribute to Mg-deficiency tolerance. Therefore, our results not only provide novel information about the responses of plant to Mg-deficiency, but also are useful for obtaining the key miRNAs for plant Mg-deficiency tolerance. PMID:26973661

  8. Cis-Regulatory Variants Affect CHRNA5 mRNA Expression in Populations of African and European Ancestry

    PubMed Central

    Wang, Jen-Chyong; Spiegel, Noah; Bertelsen, Sarah; Le, Nhung; McKenna, Nicholas; Budde, John P.; Harari, Oscar; Kapoor, Manav; Brooks, Andrew; Hancock, Dana; Tischfield, Jay; Foroud, Tatiana; Bierut, Laura J.; Steinbach, Joe Henry; Edenberg, Howard J.; Traynor, Bryan J.; Goate, Alison M.

    2013-01-01

    Variants within the gene cluster encoding α3, α5, and β4 nicotinic receptor subunits are major risk factors for substance dependence. The strongest impact on risk is associated with variation in the CHRNA5 gene, where at least two mechanisms are at work: amino acid variation and altered mRNA expression levels. The risk allele of the non-synonymous variant (rs16969968; D398N) primarily occurs on the haplotype containing the low mRNA expression allele. In populations of European ancestry, there are approximately 50 highly correlated variants in the CHRNA5-CHRNA3-CHRNB4 gene cluster and the adjacent PSMA4 gene region that are associated with CHRNA5 mRNA levels. It is not clear which of these variants contribute to the changes in CHRNA5 transcript level. Because populations of African ancestry have reduced linkage disequilibrium among variants spanning this gene cluster, eQTL mapping in subjects of African ancestry could potentially aid in defining the functional variants that affect CHRNA5 mRNA levels. We performed quantitative allele specific gene expression using frontal cortices derived from 49 subjects of African ancestry and 111 subjects of European ancestry. This method measures allele-specific transcript levels in the same individual, which eliminates other biological variation that occurs when comparing expression levels between different samples. This analysis confirmed that substance dependence associated variants have a direct cis-regulatory effect on CHRNA5 transcript levels in human frontal cortices of African and European ancestry and identified 10 highly correlated variants, located in a 9 kb region, that are potential functional variants modifying CHRNA5 mRNA expression levels. PMID:24303001

  9. The small regulatory RNA SyR1/PsrR1 controls photosynthetic functions in cyanobacteria.

    PubMed

    Georg, Jens; Dienst, Dennis; Schürgers, Nils; Wallner, Thomas; Kopp, Dominik; Stazic, Damir; Kuchmina, Ekaterina; Klähn, Stephan; Lokstein, Heiko; Hess, Wolfgang R; Wilde, Annegret

    2014-09-01

    Little is known so far about RNA regulators of photosynthesis in plants, algae, or cyanobacteria. The small RNA PsrR1 (formerly SyR1) has been discovered in Synechocystis sp PCC 6803 and appears to be widely conserved within the cyanobacterial phylum. Expression of PsrR1 is induced shortly after a shift from moderate to high-light conditions. Artificial overexpression of PsrR1 led to a bleaching phenotype under moderate light growth conditions. Advanced computational target prediction suggested that several photosynthesis-related mRNAs could be controlled by PsrR1, a finding supported by the results of transcriptome profiling experiments upon pulsed overexpression of this small RNA in Synechocystis sp PCC 6803. We confirmed the interaction between PsrR1 and the ribosome binding regions of the psaL, psaJ, chlN, and cpcA mRNAs by mutational analysis in a heterologous reporter system. Focusing on psaL as a specific target, we show that the psaL mRNA is processed by RNase E only in the presence of PsrR1. Furthermore, we provide evidence for a posttranscriptional regulation of psaL by PsrR1 in the wild type at various environmental conditions and analyzed the consequences of PsrR1-based regulation on photosystem I. In summary, computational and experimental data consistently establish the small RNA PsrR1 as a regulatory factor controlling photosynthetic functions. © 2014 American Society of Plant Biologists. All rights reserved.

  10. Cis-regulatory variants affect CHRNA5 mRNA expression in populations of African and European ancestry.

    PubMed

    Wang, Jen-Chyong; Spiegel, Noah; Bertelsen, Sarah; Le, Nhung; McKenna, Nicholas; Budde, John P; Harari, Oscar; Kapoor, Manav; Brooks, Andrew; Hancock, Dana; Tischfield, Jay; Foroud, Tatiana; Bierut, Laura J; Steinbach, Joe Henry; Edenberg, Howard J; Traynor, Bryan J; Goate, Alison M

    2013-01-01

    Variants within the gene cluster encoding α3, α5, and β4 nicotinic receptor subunits are major risk factors for substance dependence. The strongest impact on risk is associated with variation in the CHRNA5 gene, where at least two mechanisms are at work: amino acid variation and altered mRNA expression levels. The risk allele of the non-synonymous variant (rs16969968; D398N) primarily occurs on the haplotype containing the low mRNA expression allele. In populations of European ancestry, there are approximately 50 highly correlated variants in the CHRNA5-CHRNA3-CHRNB4 gene cluster and the adjacent PSMA4 gene region that are associated with CHRNA5 mRNA levels. It is not clear which of these variants contribute to the changes in CHRNA5 transcript level. Because populations of African ancestry have reduced linkage disequilibrium among variants spanning this gene cluster, eQTL mapping in subjects of African ancestry could potentially aid in defining the functional variants that affect CHRNA5 mRNA levels. We performed quantitative allele specific gene expression using frontal cortices derived from 49 subjects of African ancestry and 111 subjects of European ancestry. This method measures allele-specific transcript levels in the same individual, which eliminates other biological variation that occurs when comparing expression levels between different samples. This analysis confirmed that substance dependence associated variants have a direct cis-regulatory effect on CHRNA5 transcript levels in human frontal cortices of African and European ancestry and identified 10 highly correlated variants, located in a 9 kb region, that are potential functional variants modifying CHRNA5 mRNA expression levels.

  11. Better understanding of the EU regulatory frameworks for cosmetic products.

    PubMed

    Rasmussen, Kirsten; Mech, Agnieszka

    2014-05-01

    This letter to the editor corrects some misunderstandings regarding the EU regulations covering cosmetic products stated in a recent publication by A. Sobek et al. "In the shadow of the cosmetics directive - Inconsistencies in EU environmental hazard classification requirements for UV-filters" published in Science of the Total Environment 461-462 (2013) 706-711.

  12. Regulatory roles and therapeutic potential of microRNA in sarcoma.

    PubMed

    Lim, Hui Jun; Yang, Jia-Lin

    2016-01-01

    MicroRNAs (miRNAs) are single-stranded noncoding RNAs involved in various biological processes, including cell differentiation and development. They play multiple key roles as tumour suppressors, oncogenes or both in particular cases. This review aims to summarise current findings of the expression of miRNAs and their role in clinical oncology. Current knowledge regarding the involvement of miRNAs in different sarcoma subtypes will be assessed, in conjunction with their potential application as therapeutic targets. Relevant articles in scientific databases were identified using a combination of search terms, including "microRNA," "deregulation," "sarcoma," and "targeted therapy". These databases included Medline, Embase, Cochrane Review, Pubmed and Scopus. Aberrant miRNA expression patterns have been identified in a range of sarcoma subtypes, and differences in miRNA expression profiles between malignant cells and their normal counterparts suggests that miRNAs play key roles in sarcoma development. The identification of unique miRNA patterns in individual tumour types could possibly be used as a diagnostic tool in sarcoma. Moreover, identification of these miRNAs provides novel targets for the development of therapeutic strategies in distinct sarcoma subtypes. miRNAs hold significant potential as diagnostic biomarkers, as well as therapeutic targets in sarcoma. Possible future clinical applications include the use of miRNA pathways as therapeutic targets or miRNA expression profiling as a means of patient selection. The involvement miRNAs will undoubtedly contribute to the advancement of future targeted therapeutic interventions in sarcoma, and further establishment of appropriate delivery systems is vital for their use in clinical settings. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  13. Crystallization and preliminary X-ray diffraction analysis of iron regulatory protein 1 in complex with ferritin IRE RNA

    SciTech Connect

    Selezneva, Anna I.; Cavigiolio, Giorgio; Theil, Elizabeth C.; Walden, William E.; Volz, Karl

    2010-12-03

    Iron regulatory protein 1 (IRP1) is a bifunctional protein with activity as an RNA-binding protein or as a cytoplasmic aconitase. Interconversion of IRP1 between these mutually exclusive states is central to cellular iron regulation and is accomplished through iron-responsive assembly and disassembly of a [4Fe-4S] cluster. When in its apo form, IRP1 binds to iron responsive elements (IREs) found in mRNAs encoding proteins of iron storage and transport and either prevents translation or degradation of the bound mRNA. Excess cellular iron stimulates the assembly of a [4Fe-4S] cluster in IRP1, inhibiting its IRE-binding ability and converting it to an aconitase. The three-dimensional structure of IRP1 in its different active forms will provide details of the interconversion process and clarify the selective recognition of mRNA, Fe-S sites and catalytic activity. To this end, the apo form of IRP1 bound to a ferritin IRE was crystallized. Crystals belong to the monoclinic space group P21, with unit-cell parameters a = 109.6, b = 80.9, c = 142.9 {angstrom}, = 92.0{sup o}. Native data sets have been collected from several crystals with resolution extending to 2.8 {angstrom} and the structure has been solved by molecular replacement.

  14. The antiphasic regulatory module comprising CDF5 and its antisense RNA FLORE links the circadian clock to photoperiodic flowering.

    PubMed

    Henriques, Rossana; Wang, Huan; Liu, Jun; Boix, Marc; Huang, Li-Fang; Chua, Nam-Hai

    2017-07-31

    Circadian rhythms of gene expression are generated by the combinatorial action of transcriptional and translational feedback loops as well as chromatin remodelling events. Recently, long noncoding RNAs (lncRNAs) that are natural antisense transcripts (NATs) to transcripts encoding central oscillator components were proposed as modulators of core clock function in mammals (Per) and fungi (frq/qrf). Although oscillating lncRNAs exist in plants, their functional characterization is at an initial stage. By screening an Arabidopsis thaliana lncRNA custom-made array we identified CDF5 LONG NONCODING RNA (FLORE), a circadian-regulated lncRNA that is a NAT of CDF5. Quantitative real-time RT-PCR confirmed the circadian regulation of FLORE, whereas GUS-staining and flowering time evaluation were used to determine its biological function. FLORE and CDF5 antiphasic expression reflects mutual inhibition in a similar way to frq/qrf. Moreover, whereas the CDF5 protein delays flowering by directly repressing FT transcription, FLORE promotes it by repressing several CDFs (CDF1, CDF3, CDF5) and increasing FT transcript levels, indicating both cis and trans function. We propose that the CDF5/FLORE NAT pair constitutes an additional circadian regulatory module with conserved (mutual inhibition) and unique (function in trans) features, able to fine-tune its own circadian oscillation, and consequently, adjust the onset of flowering to favourable environmental conditions. © 2017 The Authors. New Phytologist © 2017 New Phytologist Trust.

  15. Tat-dependent production of an HIV-1 TAR-encoded miRNA-like small RNA

    PubMed Central

    Harwig, Alex; Jongejan, Aldo; van Kampen, Antoine H. C.; Berkhout, Ben; Das, Atze T.

    2016-01-01

    Evidence is accumulating that retroviruses can produce microRNAs (miRNAs). To prevent cleavage of their RNA genome, retroviruses have to use an alternative RNA source as miRNA precursor. The transacting responsive (TAR) hairpin structure in HIV-1 RNA has been suggested as source for miRNAs, but how these small RNAs are produced without impeding virus replication remained unclear. We used deep sequencing analysis of AGO2-bound HIV-1 RNAs to demonstrate that the 3′ side of the TAR hairpin is processed into a miRNA-like small RNA. This ∼21 nt RNA product is able to repress the expression of mRNAs bearing a complementary target sequence. Analysis of the small RNAs produced by wild-type and mutant HIV-1 variants revealed that non-processive transcription from the HIV-1 LTR promoter results in the production of short TAR RNAs that serve as precursor. These TAR RNAs are cleaved by Dicer and processing is stimulated by the viral Tat protein. This biogenesis pathway differs from the canonical miRNA pathway and allows HIV-1 to produce the TAR-encoded miRNA-like molecule without cleavage of the RNA genome. PMID:26984525

  16. Raw materials in the manufacture of biotechnology products: regulatory considerations.

    PubMed

    Cordoba-Rodriguez, Ruth

    2010-01-01

    The Food and Drug Administration's Pharmaceutical cGMPs for the 21st Century initiative emphasizes science and risk-based approaches in the manufacture of drugs. These approaches are reflected in the International Conference on Harmonization (ICH) guidances ICH Q8, Q9, and Q10 and encourage a comprehensive assessment of the manufacture of a biologic, including all aspects of manufacture that have the potential to affect the finished drug product. Appropriate assessment and management of raw materials are an important part of this initiative. Ideally, a raw materials program should strive to assess and minimize the risk to product quality. With this in mind, risk-assessment concepts and control strategies will be discussed and illustrated by examples, with an emphasis on the impact of raw materials on cell substrates. Finally, the life cycle of the raw material will be considered, including its potential to affect the drug product life cycle. In this framework, the supply chain and the vendor-manufacturer relationship will be explored as important parts of an adequate raw materials control strategy.

  17. Gasoline toxicology: overview of regulatory and product stewardship programs.

    PubMed

    Swick, Derek; Jaques, Andrew; Walker, J C; Estreicher, Herb

    2014-11-01

    Significant efforts have been made to characterize the toxicological properties of gasoline. There have been both mandatory and voluntary toxicology testing programs to generate hazard characterization data for gasoline, the refinery process streams used to blend gasoline, and individual chemical constituents found in gasoline. The Clean Air Act (CAA) (Clean Air Act, 2012: § 7401, et seq.) is the primary tool for the U.S. Environmental Protection Agency (EPA) to regulate gasoline and this supplement presents the results of the Section 211(b) Alternative Tier 2 studies required for CAA Fuel and Fuel Additive registration. Gasoline blending streams have also been evaluated by EPA under the voluntary High Production Volume (HPV) Challenge Program through which the petroleum industry provide data on over 80 refinery streams used in gasoline. Product stewardship efforts by companies and associations such as the American Petroleum Institute (API), Conservation of Clean Air and Water Europe (CONCAWE), and the Petroleum Product Stewardship Council (PPSC) have contributed a significant amount of hazard characterization data on gasoline and related substances. The hazard of gasoline and anticipated exposure to gasoline vapor has been well characterized for risk assessment purposes.

  18. Characterizing dynamic regulatory programs in mouse lung development and their potential association with tumourigenesis via miRNA-TF-mRNA circuits.

    PubMed

    Liu, Juan; Ye, Xinghuo; Wu, Fang-Xiang

    2013-01-01

    developmental systems may be involved in tumourigenesis, we also check the cancer genes involved circuits, trying to find out their regulatory program, which would be useful for the research of lung cancer. The relevant transcriptional or post-transcriptional factors and their roles involved in the mouse lung development are both changed greatly in different stages. By investigating the cancer genes involved circuits, we can find miRNAs/TFs playing important roles in tumour progression. Therefore, the miRNA-TF-mRNA circuits can be used in wide translational biomedicine studies, and can provide potential drug targets towards the treatment of lung cancer.

  19. Assembly of Regulatory Factors on rRNA and Ribosomal Protein Genes in Saccharomyces cerevisiae▿ †

    PubMed Central

    Kasahara, Koji; Ohtsuki, Kazushige; Ki, Sewon; Aoyama, Kayo; Takahashi, Hiroyuki; Kobayashi, Takehiko; Shirahige, Katsuhiko; Kokubo, Tetsuro

    2007-01-01

    HMO1 is a high-mobility group B protein that plays a role in transcription of genes encoding rRNA and ribosomal proteins (RPGs) in Saccharomyces cerevisiae. This study uses genome-wide chromatin immunoprecipitation to study the roles of HMO1, FHL1, and RAP1 in transcription of these genes as well as other RNA polymerase II-transcribed genes in yeast. The results show that HMO1 associates with the 35S rRNA gene in an RNA polymerase I-dependent manner and that RPG promoters (138 in total) can be classified into several distinct groups based on HMO1 abundance at the promoter and the HMO1 dependence of FHL1 and/or RAP1 binding to the promoter. FHL1, a key regulator of RPGs, binds to most of the HMO1-enriched and transcriptionally HMO1-dependent RPG promoters in an HMO1-dependent manner, whereas it binds to HMO1-limited RPG promoters in an HMO1-independent manner, irrespective of whether they are transcribed in an HMO1-dependent manner. Reporter gene assays indicate that these functional properties are determined by the promoter sequence. PMID:17646381

  20. Short hairpin RNA targeting NP mRNA inhibiting Newcastle disease virus production and other viral structural mRNA transcription.

    PubMed

    Yue, Hua; Deng, Shu; Yang, Fa-Long; Li, Ding-Fei; Fu, An-Jing; Yang, Fan; Tang, Cheng

    2009-02-01

    Newcastle disease virus (NDV), formally recognized as avian paramyxovirus 1 (APMV-1), is the etiological agent of Newcastle disease (ND), an affliction which can cause severe losses in the poultry industry. Better understanding of the molecular basis of viral structural genes involved with production should contribute significantly toward the development of improved prophylactic and therapeutic reagents to control the infection. Here we show that a short hairpin RNA (shRNA) eukaryotic expression vector targeting nucleocapsid (NP) gene of NDV can potently inhibit NDV production in both primary cells and embryonated chicken eggs. Moreover, shRNA specific for NP abolished the accumulation of not only the corresponding mRNA but also P, HN, F, M gene mRNA. The findings reveal that newly synthesized NP mRNA is essential for NDV transcription and replication, and provide a basis for the development of shRNAs as a prophylaxis and therapy for NDV infection in poultry.

  1. Regulatory Interactions of Csr Components: the RNA Binding Protein CsrA Activates csrB Transcription in Escherichia coli

    PubMed Central

    Gudapaty, Seshagirirao; Suzuki, Kazushi; Wang, Xin; Babitzke, Paul; Romeo, Tony

    2001-01-01

    The global regulator CsrA (carbon storage regulator) of Escherichia coli is a small RNA binding protein that represses various metabolic pathways and processes that are induced in the stationary phase of growth, while it activates certain exponential phase functions. Both repression and activation by CsrA involve posttranscriptional mechanisms, in which CsrA binding to mRNA leads to decreased or increased transcript stability, respectively. CsrA also binds to a small untranslated RNA, CsrB, forming a ribonucleoprotein complex, which antagonizes CsrA activity. We have further examined the regulatory interactions of CsrA and CsrB RNA. The 5′ end of the CsrB transcript was mapped, and a csrB::cam null mutant was constructed. CsrA protein and CsrB RNA levels were estimated throughout the growth curves of wild-type and isogenic csrA, csrB, rpoS, or csrA rpoS mutant strains. CsrA levels exhibited modest or negligible effects of these mutations. The intracellular concentration of CsrA exceeded the total CsrA-binding capacity of intracellular CsrB RNA. In contrast, CsrB levels were drastically decreased (∼10-fold) in the csrA mutants. CsrB transcript stability was unaffected by csrA. The expression of a csrB-lacZ transcriptional fusion containing the region from −242 to +4 bp of the csrB gene was decreased ∼20-fold by a csrA::kanR mutation in vivo but was unaffected by CsrA protein in vitro. These results reveal a significant, though most likely indirect, role for CsrA in regulating csrB transcription. Furthermore, our findings suggest that CsrA mediates an intriguing form of autoregulation, whereby its activity, but not its levels, is modulated through effects on an RNA antagonist, CsrB. PMID:11567002

  2. Quantitative Proteomics Reveals the Regulatory Networks of Circular RNA CDR1as in Hepatocellular Carcinoma Cells.

    PubMed

    Yang, Xue; Xiong, Qian; Wu, Ying; Li, Siting; Ge, Feng

    2017-09-20

    Circular RNAs (circRNAs), a class of widespread endogenous RNAs, play crucial roles in diverse biological processes and are potential biomarkers in diverse human diseases and cancers. Cerebellar-degeneration-related protein 1 antisense RNA (CDR1as), an oncogenic circRNA, is involved in human tumorigenesis and is dysregulated in hepatocellular carcinoma (HCC). However, the molecular mechanisms underlying CDR1as functions in HCC remain unclear. Here we explored the functions of CDR1as and searched for CDR1as-regulated proteins in HCC cells. A quantitative proteomics strategy was employed to globally identify CDR1as-regulated proteins in HCC cells. In total, we identified 330 differentially expressed proteins (DEPs) upon enhanced CDR1as expression in HepG2 cells, indicating that they could be proteins regulated by CDR1as. Bioinformatic analysis revealed that many DEPs were involved in cell proliferation and the cell cycle. Further functional studies of epidermal growth factor receptor (EGFR) found that CDR1as exerts its effects on cell proliferation at least in part through the regulation of EGFR expression. We further confirmed that CDR1as could inhibit the expression of microRNA-7 (miR-7). EGFR is a validated target of miR-7; therefore, CDR1as may exert its function by regulating EGFR expression via targeting miR-7 in HCC cells. Taken together, we revealed novel functions and underlying mechanisms of CDR1as in HCC cells. This study serves as the first proteome-wide analysis of a circRNA-regulated protein in cells and provides a reliable and highly efficient method for globally identifying circRNA-regulated proteins.

  3. Effect of inulin on efficient production and regulatory biosynthesis of bacillomycin D in Bacillus subtilis fmbJ.

    PubMed

    Qian, Shiquan; Lu, Hedong; Meng, Panpan; Zhang, Chong; Lv, Fengxia; Bie, Xiaomei; Lu, Zhaoxin

    2015-03-01

    The effect of inulin on the production of bacillomycin D and the levels of mRNA of bacillomycin D synthetase genes: bmyA (BYA), bmyB (BYB), bmyC (BYC), the thioesterase gene (TE) and regulating genes: AbrB, ComA, DegU, PhrC, SigmaH and Spo0A in Bacillus subtilis fmbJ were investigated. The production of bacillomycin D was enhanced with the increase of biomass concentration. The maximum production and productivity of bacillomycin D were found to be 1227.49 mg/L and 10.23 mg/L h. Inulin significantly improved the expression of bacillomycin D synthetase genes: bmyA (BYA), bmyB (BYB), bmyC (BYC) and the thioesterase gene (TE). Also, inulin up-regulated ComA, DegU, SigmaH and Spo0A and therefore promoted the high production of bacillomycin D. Our results provided a practical approach for efficient production of bacillomycin D and a meaningful explanation for regulatory mechanism of bacillomycin D biosynthesis.

  4. [Regulatory requirements regarding cell-based medicinal products for human and veterinary use - a comparison].

    PubMed

    Kuhlmann-Gottke, Johanna; Duchow, Karin

    2015-11-01

    At present, there is no separate regulatory framework for cell-based medicinal products (CBMP) for veterinary use at the European or German level. Current European and national regulations exclusively apply to the corresponding medicinal products for human use. An increasing number of requests for the regulatory classification of CBMP for veterinary use, such as allogeneic stem cell preparations and dendritic cell-based autologous tumour vaccines, and a rise in scientific advice for companies developing these products, illustrate the need for adequate legislation. Currently, advice is given and decisions are made on a case-by-case basis regarding the regulatory classification and authorisation requirements.Since some of the CBMP - in particular in the area of stem-cell products - are developed in parallel for human and veterinary use, there is an urgent need to create specific legal definitions, regulations, and guidelines for these complex innovative products in the veterinary sector as well. Otherwise, there is a risk that that the current legal grey area regarding veterinary medicinal products will impede therapeutic innovations in the long run. A harmonised EU-wide approach is desirable. Currently the European legislation on veterinary medicinal products is under revision. In this context, veterinary therapeutics based on allogeneic cells and tissues will be defined and regulated. Certainly, the legal framework does not have to be as comprehensive as for human CBMP; a leaner solution is conceivable, similar to the special provisions for advanced-therapy medicinal products laid down in the German Medicines Act.

  5. microRNA regulatory circuits in a mouse model of inherited retinal degeneration

    PubMed Central

    Palfi, Arpad; Hokamp, Karsten; Hauck, Stefanie M.; Vencken, Sebastian; Millington-Ward, Sophia; Chadderton, Naomi; Carrigan, Mathew; Kortvely, Elod; Greene, Catherine M.; Kenna, Paul F.; Farrar, G. Jane

    2016-01-01

    miRNA dysregulation is a hallmark of many neurodegenerative disorders, including those involving the retina. Up-regulation of miR-1/133 and miR-142, and down-regulation of miR-183/96/182 has been described in the RHO-P347S mouse retina, a model for a common form of inherited blindness. High-throughput LC-MS/MS was employed to analyse the protein expression of predicted targets for these miRNAs in RHO-P347S mouse retinas; 133 potential target genes were identified. Pathway over-representation analysis suggests G-protein signaling/visual transduction, and synaptic transmission for miR-1, and transmembrane transport, cell-adhesion, signal transduction and apoptosis for miR-183/96/182 as regulated functions in retina. Validation of miRNA-target mRNA interactions for miR-1, miR-96/182 and miR-96 targeting Ctbp2, Rac1 and Slc6a9, respectively, was demonstrated in vitro. In vivo interaction of miR-183/96/182 and Rac1 mRNA in retina was confirmed using miR-CATCH. Additional miRNAs (including miR-103-3p, miR-9-5p) were both predicted to target Rac1 mRNA and enriched by Rac1-miR-CATCH. Other Rac1-miR-CATCH-enriched miRNAs (including miR-125a/b-5p, miR-378a-3p) were not predicted to target Rac1. Furthermore, levels of ~25% of the retinal Rac1 interactors were determined by LC-MS/MS; expression of Rap1gds1 and Cav1 was elevated. Our data suggest significant utilisation of miRNA-based regulation in retina. Possibly more than 30 miRNAs interact with Rac1 in retina, targeting both UTRs and coding regions. PMID:27527066

  6. Genome-wide Annotation, Identification, and Global Transcriptomic Analysis of Regulatory or Small RNA Gene Expression in Staphylococcus aureus

    PubMed Central

    Weiss, Andy; Broach, William H.; Wiemels, Richard E.; Mogen, Austin B.; Rice, Kelly C.

    2016-01-01

    ABSTRACT In Staphylococcus aureus, hundreds of small regulatory or small RNAs (sRNAs) have been identified, yet this class of molecule remains poorly understood and severely understudied. sRNA genes are typically absent from genome annotation files, and as a consequence, their existence is often overlooked, particularly in global transcriptomic studies. To facilitate improved detection and analysis of sRNAs in S. aureus, we generated updated GenBank files for three commonly used S. aureus strains (MRSA252, NCTC 8325, and USA300), in which we added annotations for >260 previously identified sRNAs. These files, the first to include genome-wide annotation of sRNAs in S. aureus, were then used as a foundation to identify novel sRNAs in the community-associated methicillin-resistant strain USA300. This analysis led to the discovery of 39 previously unidentified sRNAs. Investigating the genomic loci of the newly identified sRNAs revealed a surprising degree of inconsistency in genome annotation in S. aureus, which may be hindering the analysis and functional exploration of these elements. Finally, using our newly created annotation files as a reference, we perform a global analysis of sRNA gene expression in S. aureus and demonstrate that the newly identified tsr25 is the most highly upregulated sRNA in human serum. This study provides an invaluable resource to the S. aureus research community in the form of our newly generated annotation files, while at the same time presenting the first examination of differential sRNA expression in pathophysiologically relevant conditions. PMID:26861020

  7. MicroRNA Gene Regulatory Networks in Peripheral Nerve Sheath Tumors

    DTIC Science & Technology

    2012-09-01

    Physiol 223(2):289–298. doi:10.1002/jcp. 22066 37. Gabriely G, Wurdinger T, Kesari S, Esau CC, Burchard J, Linsley PS, Krichevsky AM (2008) MicroRNA...Mol Pharmacol 79(4):735–741. doi:10.1124/mol.110.069633 103. Esau C, Kang X, Peralta E, Hanson E, Marcusson EG, Ravi- chandran LV, Sun Y, Koo S

  8. Meta-Analysis of Multiple Sclerosis Microarray Data Reveals Dysregulation in RNA Splicing Regulatory Genes.

    PubMed

    Paraboschi, Elvezia Maria; Cardamone, Giulia; Rimoldi, Valeria; Gemmati, Donato; Spreafico, Marta; Duga, Stefano; Soldà, Giulia; Asselta, Rosanna

    2015-09-30

    Abnormalities in RNA metabolism and alternative splicing (AS) are emerging as important players in complex disease phenotypes. In particular, accumulating evidence suggests the existence of pathogenic links between multiple sclerosis (MS) and altered AS, including functional studies showing that an imbalance in alternatively-spliced isoforms may contribute to disease etiology. Here, we tested whether the altered expression of AS-related genes represents a MS-specific signature. A comprehensive comparative analysis of gene expression profiles of publicly-available microarray datasets (190 MS cases, 182 controls), followed by gene-ontology enrichment analysis, highlighted a significant enrichment for differentially-expressed genes involved in RNA metabolism/AS. In detail, a total of 17 genes were found to be differentially expressed in MS in multiple datasets, with CELF1 being dysregulated in five out of seven studies. We confirmed CELF1 downregulation in MS (p=0.0015) by real-time RT-PCRs on RNA extracted from blood cells of 30 cases and 30 controls. As a proof of concept, we experimentally verified the unbalance in alternatively-spliced isoforms in MS of the NFAT5 gene, a putative CELF1 target. In conclusion, for the first time we provide evidence of a consistent dysregulation of splicing-related genes in MS and we discuss its possible implications in modulating specific AS events in MS susceptibility genes.

  9. Organic Coasts? Regulatory Challenges of Certifying Integrated Shrimp-Mangrove Production Systems in Vietnam

    ERIC Educational Resources Information Center

    Ha, Tran Thi Thu; Bush, Simon R.; Mol, Arthur P. J.; van Dijk, Han

    2012-01-01

    The Vietnamese government aims to expand the scale of Naturland certified organic production in integrated shrimp-mangrove farming systems across the coast of Ca Mau province by 2015. In doing so the division between public and private regulation has become blurred. We analyze the government's goal by examining the regulatory challenges of using…

  10. Organic Coasts? Regulatory Challenges of Certifying Integrated Shrimp-Mangrove Production Systems in Vietnam

    ERIC Educational Resources Information Center

    Ha, Tran Thi Thu; Bush, Simon R.; Mol, Arthur P. J.; van Dijk, Han

    2012-01-01

    The Vietnamese government aims to expand the scale of Naturland certified organic production in integrated shrimp-mangrove farming systems across the coast of Ca Mau province by 2015. In doing so the division between public and private regulation has become blurred. We analyze the government's goal by examining the regulatory challenges of using…

  11. Enhancement of alkaloid production in opium and California poppy by transactivation using heterologous regulatory factors.

    PubMed

    Apuya, Nestor R; Park, Joon-Hyun; Zhang, Liping; Ahyow, Maurice; Davidow, Patricia; Van Fleet, Jennifer; Rarang, Joel C; Hippley, Matthew; Johnson, Thomas W; Yoo, Hye-Dong; Trieu, Anthony; Krueger, Shannon; Wu, Chuan-yin; Lu, Yu-ping; Flavell, Richard B; Bobzin, Steven C

    2008-02-01

    Genes encoding regulatory factors isolated from Arabidopsis, soybean and corn have been screened to identify those that modulate the expression of genes encoding for enzymes involved in the biosynthesis of morphinan alkaloids in opium poppy (Papaver somniferum) and benzophenanthridine alkaloids in California poppy (Eschscholzia californica). In opium poppy, the over-expression of selected regulatory factors increased the levels of PsCOR (codeinone reductase), Ps4'OMT (S-adenosyl-l-methionine:3'-hydroxy-N-methylcoclaurine 4'-O-methyltransferase) and Ps6OMT [(R,S)-norcoclaurine 6-O-methyltransferase] transcripts by 10- to more than 100-fold. These transcriptional activations translated into an enhancement of alkaloid production in opium poppy of up to at least 10-fold. In California poppy, the transactivation effect of regulatory factor WRKY1 resulted in an increase of up to 60-fold in the level of EcCYP80B1 [(S)-N-methylcoclaurine 3'-hydroxylase] and EcBBE (berberine bridge enzyme) transcripts. As a result, the accumulations of selected alkaloid intermediates were enhanced up to 30-fold. The transactivation effects of other regulatory factors led to the accumulation of the same intermediates. These regulatory factors also led to the production of new alkaloids in California poppy callus culture.

  12. Regulatory conservation of protein coding and microRNA genes in vertebrates: lessons from the opossum genome.

    PubMed

    Mahony, Shaun; Corcoran, David L; Feingold, Eleanor; Benos, Panayiotis V

    2007-01-01

    Being the first noneutherian mammal sequenced, Monodelphis domestica (opossum) offers great potential for enhancing our understanding of the evolutionary processes that take place in mammals. This study focuses on the evolutionary relationships between conservation of noncoding sequences, cis-regulatory elements, and biologic functions of regulated genes in opossum and eight vertebrate species. Analysis of 145 intergenic microRNA and all protein coding genes revealed that the upstream sequences of the former are up to twice as conserved as the latter among mammals, except in the first 500 base pairs, where the conservation is similar. Comparison of promoter conservation in 513 protein coding genes and related transcription factor binding sites (TFBSs) showed that 41% of the known human TFBSs are located in the 6.7% of promoter regions that are conserved between human and opossum. Some core biologic processes exhibited significantly fewer conserved TFBSs in human-opossum comparisons, suggesting greater functional divergence. A new measure of efficiency in multigenome phylogenetic footprinting (base regulatory potential rate [BRPR]) shows that including human-opossum conservation increases specificity in finding human TFBSs. Opossum facilitates better estimation of promoter conservation and TFBS turnover among mammals. The fact that substantial TFBS numbers are located in a small proportion of the human-opossum conserved sequences emphasizes the importance of marsupial genomes for phylogenetic footprinting-based motif discovery strategies. The BRPR measure is expected to help select genome combinations for optimal performance of these algorithms. Finally, although the etiology of the microRNA upstream increased conservation remains unknown, it is expected to have strong implications for our understanding of regulation of their expression.

  13. RNA-Sequencing Analysis Reveals a Regulatory Role for Transcription Factor Fezf2 in the Mature Motor Cortex.

    PubMed

    Clare, Alison J; Wicky, Hollie E; Empson, Ruth M; Hughes, Stephanie M

    2017-01-01

    Forebrain embryonic zinc finger (Fezf2) encodes a transcription factor essential for the specification of layer 5 projection neurons (PNs) in the developing cerebral cortex. As with many developmental transcription factors, Fezf2 continues to be expressed into adulthood, suggesting it remains crucial to the maintenance of neuronal phenotypes. Despite the continued expression, a function has yet to be explored for Fezf2 in the PNs of the developed cortex. Here, we investigated the role of Fezf2 in mature neurons, using lentiviral-mediated delivery of a shRNA to conditionally knockdown the expression of Fezf2 in the mouse primary motor cortex (M1). RNA-sequencing analysis of Fezf2-reduced M1 revealed significant changes to the transcriptome, identifying a regulatory role for Fezf2 in the mature M1. Kyoto Encyclopedia Genes and Genomes (KEGG) pathway analyses of Fezf2-regulated genes indicated a role in neuronal signaling and plasticity, with significant enrichment of neuroactive ligand-receptor interaction, cell adhesion molecules and calcium signaling pathways. Gene Ontology analysis supported a functional role for Fezf2-regulated genes in neuronal transmission and additionally indicated an importance in the regulation of behavior. Using the mammalian phenotype ontology database, we identified a significant overrepresentation of Fezf2-regulated genes associated with specific behavior phenotypes, including associative learning, social interaction, locomotor activation and hyperactivity. These roles were distinct from that of Fezf2-regulated genes identified in development, indicating a dynamic transition in Fezf2 function. Together our findings demonstrate a regulatory role for Fezf2 in the mature brain, with Fezf2-regulated genes having functional roles in sustaining normal neuronal and behavioral phenotypes. These results support the hypothesis that developmental transcription factors are important for maintaining neuron transcriptomes and that disruption of their

  14. Computational Identification of Tissue-Specific Splicing Regulatory Elements in Human Genes from RNA-Seq Data

    PubMed Central

    Badr, Eman; ElHefnawi, Mahmoud; Heath, Lenwood S.

    2016-01-01

    Alternative splicing is a vital process for regulating gene expression and promoting proteomic diversity. It plays a key role in tissue-specific expressed genes. This specificity is mainly regulated by splicing factors that bind to specific sequences called splicing regulatory elements (SREs). Here, we report a genome-wide analysis to study alternative splicing on multiple tissues, including brain, heart, liver, and muscle. We propose a pipeline to identify differential exons across tissues and hence tissue-specific SREs. In our pipeline, we utilize the DEXSeq package along with our previously reported algorithms. Utilizing the publicly available RNA-Seq data set from the Human BodyMap project, we identified 28,100 differentially used exons across the four tissues. We identified tissue-specific exonic splicing enhancers that overlap with various previously published experimental and computational databases. A complicated exonic enhancer regulatory network was revealed, where multiple exonic enhancers were found across multiple tissues while some were found only in specific tissues. Putative combinatorial exonic enhancers and silencers were discovered as well, which may be responsible for exon inclusion or exclusion across tissues. Some of the exonic enhancers are found to be co-occurring with multiple exonic silencers and vice versa, which demonstrates a complicated relationship between tissue-specific exonic enhancers and silencers. PMID:27861625

  15. RNA sequencing of laser-capture microdissected compartments of the maize kernel identifies regulatory modules associated with endosperm cell differentiation.

    PubMed

    Zhan, Junpeng; Thakare, Dhiraj; Ma, Chuang; Lloyd, Alan; Nixon, Neesha M; Arakaki, Angela M; Burnett, William J; Logan, Kyle O; Wang, Dongfang; Wang, Xiangfeng; Drews, Gary N; Yadegari, Ramin

    2015-03-01

    Endosperm is an absorptive structure that supports embryo development or seedling germination in angiosperms. The endosperm of cereals is a main source of food, feed, and industrial raw materials worldwide. However, the genetic networks that regulate endosperm cell differentiation remain largely unclear. As a first step toward characterizing these networks, we profiled the mRNAs in five major cell types of the differentiating endosperm and in the embryo and four maternal compartments of the maize (Zea mays) kernel. Comparisons of these mRNA populations revealed the diverged gene expression programs between filial and maternal compartments and an unexpected close correlation between embryo and the aleurone layer of endosperm. Gene coexpression network analysis identified coexpression modules associated with single or multiple kernel compartments including modules for the endosperm cell types, some of which showed enrichment of previously identified temporally activated and/or imprinted genes. Detailed analyses of a coexpression module highly correlated with the basal endosperm transfer layer (BETL) identified a regulatory module activated by MRP-1, a regulator of BETL differentiation and function. These results provide a high-resolution atlas of gene activity in the compartments of the maize kernel and help to uncover the regulatory modules associated with the differentiation of the major endosperm cell types. © 2015 American Society of Plant Biologists. All rights reserved.

  16. Computational Identification of Tissue-Specific Splicing Regulatory Elements in Human Genes from RNA-Seq Data.

    PubMed

    Badr, Eman; ElHefnawi, Mahmoud; Heath, Lenwood S

    2016-01-01

    Alternative splicing is a vital process for regulating gene expression and promoting proteomic diversity. It plays a key role in tissue-specific expressed genes. This specificity is mainly regulated by splicing factors that bind to specific sequences called splicing regulatory elements (SREs). Here, we report a genome-wide analysis to study alternative splicing on multiple tissues, including brain, heart, liver, and muscle. We propose a pipeline to identify differential exons across tissues and hence tissue-specific SREs. In our pipeline, we utilize the DEXSeq package along with our previously reported algorithms. Utilizing the publicly available RNA-Seq data set from the Human BodyMap project, we identified 28,100 differentially used exons across the four tissues. We identified tissue-specific exonic splicing enhancers that overlap with various previously published experimental and computational databases. A complicated exonic enhancer regulatory network was revealed, where multiple exonic enhancers were found across multiple tissues while some were found only in specific tissues. Putative combinatorial exonic enhancers and silencers were discovered as well, which may be responsible for exon inclusion or exclusion across tissues. Some of the exonic enhancers are found to be co-occurring with multiple exonic silencers and vice versa, which demonstrates a complicated relationship between tissue-specific exonic enhancers and silencers.

  17. The regulatory role of B cells in autoimmunity, infections and cancer: Perspectives beyond IL10 production.

    PubMed

    Gorosito Serrán, Melisa; Fiocca Vernengo, Facundo; Beccaria, Cristian G; Acosta Rodriguez, Eva V; Montes, Carolina L; Gruppi, Adriana

    2015-11-14

    The term regulatory B cells (B regs) is ascribed to a heterogeneous population of B cells with the function of suppressing inflammatory responses. They have been described mainly during the last decade in the context of different immune-mediated diseases. Most of the work on B regs has been focused on IL-10-producing B cells. However, B cells can exert regulatory functions independently of IL-10 production. Here we discuss the phenotypes, development and effector mechanisms of B regs and advances in their role in autoimmunity, infections and cancer. Copyright © 2015 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

  18. A strategy for regulatory action when new adverse effects of a licensed product emerge.

    PubMed

    Aronson, Jeffrey K; Price, Deirdre; Ferner, Robin E

    2009-01-01

    Regulatory agencies grant product licences (marketing authorizations) for medicinal products in the light of evidence that the balance between benefit and harm in the population is favourable. Here we consider a framework for allowing regulatory agencies to make rational decisions when reviewing product licences in the light of new information about harms that change that balance. The regulator can revoke the product licence, restrict the product's availability or change the 'label' in different ways. We examine the features of the adverse effect that may be relevant in making the decision: namely, individual differences in susceptibility; the possibility of monitoring; and the availability of protective strategies. The balance of benefit and harm, and the time-course and dose relation of the adverse effect play important roles in the decision-making process. We set out how these factors can help determine the logical response to new information on the balance between benefit and harm, and provide a series of relevant examples. We believe that when regulatory agencies have to decide how to amend the product licence of a drug when new serious adverse effects cause concern, they would find it useful to adopt a framework of this kind, using different strategies for different cases. Our proposed framework could also be useful in risk management planning during drug development.

  19. Equivalence of complex drug products: advances in and challenges for current regulatory frameworks.

    PubMed

    Hussaarts, Leonie; Mühlebach, Stefan; Shah, Vinod P; McNeil, Scott; Borchard, Gerrit; Flühmann, Beat; Weinstein, Vera; Neervannan, Sesha; Griffiths, Elwyn; Jiang, Wenlei; Wolff-Holz, Elena; Crommelin, Daan J A; de Vlieger, Jon S B

    2017-04-26

    Biotechnology and nanotechnology provide a growing number of innovator-driven complex drug products and their copy versions. Biologics exemplify one category of complex drugs, but there are also nonbiological complex drug products, including many nanomedicines, such as iron-carbohydrate complexes, drug-carrying liposomes or emulsions, and glatiramoids. In this white paper, which stems from a 1-day conference at the New York Academy of Sciences, we discuss regulatory frameworks in use worldwide (e.g., the U.S. Food and Drug Administration, the European Medicines Agency, the World Health Organization) to approve these complex drug products and their follow-on versions. One of the key questions remains how to assess equivalence of these complex products. We identify a number of points for which consensus was found among the stakeholders who were present: scientists from innovator and generic/follow-on companies, academia, and regulatory bodies from different parts of the world. A number of topics requiring follow-up were identified: (1) assessment of critical attributes to establish equivalence for follow-on versions, (2) the need to publish scientific findings in the public domain to further progress in the field, (3) the necessity to develop worldwide consensus regarding nomenclature and labeling of these complex products, and (4) regulatory actions when substandard complex drug products are identified. © 2017 The Authors. Annals of the New York Academy of Sciences published by Wiley Periodicals, Inc. on behalf of New York Academy of Sciences.

  20. Purification of radiolabeled RNA products using denaturing gel electrophoresis

    PubMed Central

    Adachi, Hironori; Yu, Yi-Tao

    2014-01-01

    This unit discusses a basic method for purification of radiolabeled RNAs using denaturing polyacrylamide gel electrophoresis. The method consists of a number of experimental procedures, including total RNA preparation from yeast cells, isolation of a specific RNA from total yeast RNA, RNA 3' terminal labeling using nucleotide (5’[32P]pCp) addition (via ligation), denaturing (8 M urea) polyacrylamide gel electrophoresis, and RNA extraction from the gel slice. Key points for achieving good electrophoretic separation of RNA are also discussed. PMID:24510465

  1. Noncoding RNA and its associated proteins as regulatory elements of the immune system.

    PubMed

    Turner, Martin; Galloway, Alison; Vigorito, Elena

    2014-06-01

    The rapid changes in gene expression that accompany developmental transitions, stress responses and proliferation are controlled by signal-mediated coordination of transcriptional and post-transcriptional mechanisms. In recent years, understanding of the mechanics of these processes and the contexts in which they are employed during hematopoiesis and immune challenge has increased. An important aspect of this progress is recognition of the importance of RNA-binding proteins and noncoding RNAs. These have roles in the development and function of the immune system and in pathogen life cycles, and they represent an important aspect of intracellular immunity.

  2. Strategies of bringing drug product marketing applications to meet current regulatory standards.

    PubMed

    Wu, Yan; Freed, Anita; Lavrich, David; Raghavachari, Ramesh; Huynh-Ba, Kim; Shah, Ketan; Alasandro, Mark

    2015-08-01

    In the past decade, many guidance documents have been issued through collaboration of global organizations and regulatory authorities. Most of these are applicable to new products, but there is a risk that currently marketed products will not meet the new compliance standards during audits and inspections while companies continue to make changes through the product life cycle for continuous improvement or market demands. This discussion presents different strategies to bringing drug product marketing applications to meet current and emerging standards. It also discusses stability and method designs to meet process validation and global development efforts.

  3. Interrogation of brain miRNA and mRNA expression profiles reveals a molecular regulatory network that is perturbed by mutant huntingtin.

    PubMed

    Jin, Jing; Cheng, Yong; Zhang, Yongqing; Wood, William; Peng, Qi; Hutchison, Emmette; Mattson, Mark P; Becker, Kevin G; Duan, Wenzhen

    2012-11-01

    Emerging evidence indicates that microRNAs (miRNAs) may play an important role in the pathogenesis of Huntington's disease (HD). To identify the individual miRNAs that are altered in HD and may therefore regulate a gene network underlying mutant huntingtin-induced neuronal dysfunction in HD, we performed miRNA array analysis combined with mRNA profiling in the cerebral cortex from N171-82Q HD mice. Expression profiles of miRNAs as well as mRNAs in HD mouse cerebral cortex were analyzed and confirmed at different stages of disease progression; the most significant changes of miRNAs in the cerebral cortex were also detected in the striatum of HD mice. Our results revealed a significant alteration of miR-200 family members, miR-200a, and miR-200c in the cerebral cortex and the striatum, at the early stage of disease progression in N171-82Q HD mice. We used a coordinated approach to integrate miRNA and mRNA profiling, and applied bioinformatics to predict a target gene network potentially regulated by these significantly altered miRNAs that might be involved in HD disease progression. Interestingly, miR-200a and miR-200c are predicted to target genes regulating synaptic function, neurodevelopment, and neuronal survival. Our results suggest that altered expression of miR-200a and miR-200c may interrupt the production of proteins involved in neuronal plasticity and survival, and further investigation of the involvement of perturbed miRNA expression in HD pathogenesis is warranted, and may lead to reveal novel approaches for HD therapy.

  4. Interrogation of brain miRNA and mRNA expression profiles reveals a molecular regulatory network that is perturbed by mutant huntingtin

    PubMed Central

    Jin, Jing; Cheng, Yong; Zhang, Yongqing; Wood, William; Peng, Qi; Hutchison, Emmette; Mattson, Mark P.; Becker, Kevin G.; Duan, Wenzhen

    2012-01-01

    Emerging evidence indicates that microRNAs (miRNAs) may play an important role in the pathogenesis of Huntington’s disease (HD). To identify the individual miRNAs that are altered in HD and may therefore regulate a gene network underlying mutant huntingtin-induced neuronal dysfunction in HD, we performed miRNA array analysis combined with mRNA profiling in the cerebral cortex from N171-82Q HD mice. Expression profiles of miRNAs as well as mRNAs in HD mouse cerebral cortex were analyzed and confirmed at different stages of disease progression; the most significant changes of miRNAs in the cerebral cortex were also detected in the striatum of HD mice. Our results revealed a significant alteration of miR-200 family members, miR-200a and miR-200c in the cerebral cortex and the striatum, at the early stage of disease progression in N171-82Q HD mice. We used a coordinated approach to integrate miRNA and mRNA profiling, and applied bioinformatics to predict a target gene network potentially regulated by these significantly altered miRNAs that might be involved in HD disease progression. Interestingly, miR-200a and miR-200c are predicted to target genes regulating synaptic function, neurodevelopment and neuronal survival. Our results suggest that altered expression of miR-200a and miR-200c may interrupt the production of proteins involved in neuronal plasticity and survival, and further investigation of the involvement of perturbed miRNA expression in HD pathogenesis is warranted, and may lead to reveal novel approaches for HD therapy. PMID:22906125

  5. Search for 5'-leader regulatory RNA structures based on gene annotation aided by the RiboGap database.

    PubMed

    Naghdi, Mohammad Reza; Smail, Katia; Wang, Joy X; Wade, Fallou; Breaker, Ronald R; Perreault, Jonathan

    2017-03-15

    The discovery of noncoding RNAs (ncRNAs) and their importance for gene regulation led us to develop bioinformatics tools to pursue the discovery of novel ncRNAs. Finding ncRNAs de novo is challenging, first due to the difficulty of retrieving large numbers of sequences for given gene activities, and second due to exponential demands on calculation needed for comparative genomics on a large scale. Recently, several tools for the prediction of conserved RNA secondary structure were developed, but many of them are not designed to uncover new ncRNAs, or are too slow for conducting analyses on a large scale. Here we present various approaches using the database RiboGap as a primary tool for finding known ncRNAs and for uncovering simple sequence motifs with regulatory roles. This database also can be used to easily extract intergenic sequences of eubacteria and archaea to find conserved RNA structures upstream of given genes. We also show how to extend analysis further to choose the best candidate ncRNAs for experimental validation.

  6. The function of the RNA-binding protein TEL1 in moss reveals ancient regulatory mechanisms of shoot development.

    PubMed

    Vivancos, Julien; Spinner, Lara; Mazubert, Christelle; Charlot, Florence; Paquet, Nicolas; Thareau, Vincent; Dron, Michel; Nogué, Fabien; Charon, Céline

    2012-03-01

    The shoot represents the basic body plan in land plants. It consists of a repeated structure composed of stems and leaves. Whereas vascular plants generate a shoot in their diploid phase, non-vascular plants such as mosses form a shoot (called the gametophore) in their haploid generation. The evolution of regulatory mechanisms or genetic networks used in the development of these two kinds of shoots is unclear. TERMINAL EAR1-like genes have been involved in diploid shoot development in vascular plants. Here, we show that disruption of PpTEL1 from the moss Physcomitrella patens, causes reduced protonema growth and gametophore initiation, as well as defects in gametophore development. Leafy shoots formed on ΔTEL1 mutants exhibit shorter stems with more leaves per shoot, suggesting an accelerated leaf initiation (shortened plastochron), a phenotype shared with the Poaceae vascular plants TE1 and PLA2/LHD2 mutants. Moreover, the positive correlation between plastochron length and leaf size observed in ΔTEL1 mutants suggests a conserved compensatory mechanism correlating leaf growth and leaf initiation rate that would minimize overall changes in plant biomass. The RNA-binding protein encoded by PpTEL1 contains two N-terminus RNA-recognition motifs, and a third C-terminus non-canonical RRM, specific to TEL proteins. Removal of the PpTEL1 C-terminus (including this third RRM) or only 16-18 amino acids within it seriously impairs PpTEL1 function, suggesting a critical role for this third RRM. These results show a conserved function of the RNA-binding PpTEL1 protein in the regulation of shoot development, from early ancestors to vascular plants, that depends on the third TEL-specific RRM.

  7. Deletion of Cytoplasmic Double-Stranded RNA Sensors Does Not Uncover Viral Small Interfering RNA Production in Human Cells.

    PubMed

    Schuster, Susan; Tholen, Lotte E; Overheul, Gijs J; van Kuppeveld, Frank J M; van Rij, Ronald P

    2017-01-01

    Antiviral immunity in insects and plants is mediated by the RNA interference (RNAi) pathway in which viral long double-stranded RNA (dsRNA) is processed into small interfering RNAs (siRNAs) by Dicer enzymes. Although this pathway is evolutionarily conserved, its involvement in antiviral defense in mammals is the subject of debate. In vertebrates, recognition of viral RNA induces a sophisticated type I interferon (IFN)-based immune response, and it has been proposed that this response masks or inhibits antiviral RNAi. To test this hypothesis, we analyzed viral small RNA production in differentiated cells deficient in the cytoplasmic RNA sensors RIG-I and MDA5. We did not detect 22-nucleotide (nt) viral siRNAs upon infection with three different positive-sense RNA viruses. Our data suggest that the depletion of cytoplasmic RIG-I-like sensors is not sufficient to uncover viral siRNAs in differentiated cells. IMPORTANCE The contribution of the RNA interference (RNAi) pathway in antiviral immunity in vertebrates has been widely debated. It has been proposed that RNAi possesses antiviral activity in mammalian systems but that its antiviral effect is masked by the potent antiviral interferon response in differentiated mammalian cells. In this study, we show that inactivation of the interferon response is not sufficient to uncover antiviral activity of RNAi in human epithelial cells infected with three wild-type positive-sense RNA viruses.

  8. A Conserved MicroRNA Regulatory Circuit Is Differentially Controlled during Limb/Appendage Regeneration

    PubMed Central

    King, Benjamin L.; Yin, Viravuth P.

    2016-01-01

    Background Although regenerative capacity is evident throughout the animal kingdom, it is not equally distributed throughout evolution. For instance, complex limb/appendage regeneration is muted in mammals but enhanced in amphibians and teleosts. The defining characteristic of limb/appendage regenerative systems is the formation of a dedifferentiated tissue, termed blastema, which serves as the progenitor reservoir for regenerating tissues. In order to identify a genetic signature that accompanies blastema formation, we employ next-generation sequencing to identify shared, differentially regulated mRNAs and noncoding RNAs in three different, highly regenerative animal systems: zebrafish caudal fins, bichir pectoral fins and axolotl forelimbs. Results These studies identified a core group of 5 microRNAs (miRNAs) that were commonly upregulated and 5 miRNAs that were commonly downregulated, as well as 4 novel tRNAs fragments with sequences conserved with humans. To understand the potential function of these miRNAs, we built a network of 1,550 commonly differentially expressed mRNAs that had functional relationships to 11 orthologous blastema-associated genes. As miR-21 was the most highly upregulated and most highly expressed miRNA in all three models, we validated the expression of known target genes, including the tumor suppressor, pdcd4, and TGFβ receptor subunit, tgfbr2 and novel putative target genes such as the anti-apoptotic factor, bcl2l13, Choline kinase alpha, chka and the regulator of G-protein signaling, rgs5. Conclusions Our extensive analysis of RNA-seq transcriptome profiling studies in three regenerative animal models, that diverged in evolution ~420 million years ago, reveals a common miRNA-regulated genetic network of blastema genes. These comparative studies extend our current understanding of limb/appendage regeneration by identifying previously unassociated blastema genes and the extensive regulation by miRNAs, which could serve as a foundation

  9. Computational Prediction of Intronic microRNA Targets using Host Gene Expression Reveals Novel Regulatory Mechanisms

    PubMed Central

    Radfar, M. Hossein; Wong, Willy; Morris, Quaid

    2011-01-01

    Approximately half of known human miRNAs are located in the introns of protein coding genes. Some of these intronic miRNAs are only expressed when their host gene is and, as such, their steady state expression levels are highly correlated with those of the host gene's mRNA. Recently host gene expression levels have been used to predict the targets of intronic miRNAs by identifying other mRNAs that they have consistent negative correlation with. This is a potentially powerful approach because it allows a large number of expression profiling studies to be used but needs refinement because mRNAs can be targeted by multiple miRNAs and not all intronic miRNAs are co-expressed with their host genes. Here we introduce InMiR, a new computational method that uses a linear-Gaussian model to predict the targets of intronic miRNAs based on the expression profiles of their host genes across a large number of datasets. Our method recovers nearly twice as many true positives at the same fixed false positive rate as a comparable method that only considers correlations. Through an analysis of 140 Affymetrix datasets from Gene Expression Omnibus, we build a network of 19,926 interactions among 57 intronic miRNAs and 3,864 targets. InMiR can also predict which host genes have expression profiles that are good surrogates for those of their intronic miRNAs. Host genes that InMiR predicts are bad surrogates contain significantly more miRNA target sites in their 3′ UTRs and are significantly more likely to have predicted Pol II and Pol III promoters in their introns. We provide a dataset of 1,935 predicted mRNA targets for 22 intronic miRNAs. These prediction are supported both by sequence features and expression. By combining our results with previous reports, we distinguish three classes of intronic miRNAs: Those that are tightly regulated with their host gene; those that are likely to be expressed from the same promoter but whose host gene is highly regulated by miRNAs; and those

  10. A conserved RNA structural element within the hepatitis B virus post-transcriptional regulatory element enhance nuclear export of intronless transcripts and repress the splicing mechanism.

    PubMed

    Visootsat, Akasit; Payungporn, Sunchai; T-Thienprasert, Nattanan P

    2015-12-01

    Hepatitis B virus (HBV) infection is a primary cause of hepatocellular carcinoma and liver cirrhosis worldwide. To develop novel antiviral drugs, a better understanding of HBV gene expression regulation is vital. One important aspect is to understand how HBV hijacks the cellular machinery to export unspliced RNA from the nucleus. The HBV post-transcriptional regulatory element (HBV PRE) has been proposed to be the HBV RNA nuclear export element. However, the function remains controversial, and the core element is unclear. This study, therefore, aimed to identify functional regulatory elements within the HBV PRE and investigate their functions. Using bioinformatics programs based on sequence conservation and conserved RNA secondary structures, three regulatory elements were predicted, namely PRE 1151-1410, PRE 1520-1620 and PRE 1650-1684. PRE 1151-1410 significantly increased intronless and unspliced luciferase activity in both HepG2 and COS-7 cells. Likewise, PRE 1151-1410 significantly elevated intronless and unspliced HBV surface transcripts in liver cancer cells. Moreover, motif analysis predicted that PRE 1151-1410 contains several regulatory motifs. This study reported the roles of PRE 1151-1410 in intronless transcript nuclear export and the splicing mechanism. Additionally, these results provide knowledge in the field of HBV RNA regulation. Moreover, PRE 1151-1410 may be used to enhance the expression of other mRNAs in intronless reporter plasmids.

  11. Identification of bolting-related microRNAs and their targets reveals complex miRNA-mediated flowering-time regulatory networks in radish (Raphanus sativus L.).

    PubMed

    Nie, Shanshan; Xu, Liang; Wang, Yan; Huang, Danqiong; Muleke, Everlyne M; Sun, Xiaochuan; Wang, Ronghua; Xie, Yang; Gong, Yiqin; Liu, Liwang

    2015-09-15

    MicroRNAs (miRNAs) play vital regulatory roles in plant growth and development. The phase transition from vegetative growth to flowering is crucial in the life cycle of plants. To date, miRNA-mediated flowering regulatory networks remain largely unexplored in radish. In this study, two small RNA libraries from radish leaves at vegetative and reproductive stages were constructed and sequenced by Solexa sequencing. A total of 94 known miRNAs representing 21 conserved and 13 non-conserved miRNA families, and 44 potential novel miRNAs, were identified from the two libraries. In addition, 42 known and 17 novel miRNAs were significantly differentially expressed and identified as bolting-related miRNAs. RT-qPCR analysis revealed that some miRNAs exhibited tissue- or developmental stage-specific expression patterns. Moreover, 154 target transcripts were identified for 50 bolting-related miRNAs, which were predominately involved in plant development, signal transduction and transcriptional regulation. Based on the characterization of bolting-related miRNAs and their target genes, a putative schematic model of miRNA-mediated bolting and flowering regulatory network was proposed. These results could provide insights into bolting and flowering regulatory networks in radish, and facilitate dissecting the molecular mechanisms underlying bolting and flowering time regulation in vegetable crops.

  12. Identification of bolting-related microRNAs and their targets reveals complex miRNA-mediated flowering-time regulatory networks in radish (Raphanus sativus L.)

    PubMed Central

    Nie, Shanshan; Xu, Liang; Wang, Yan; Huang, Danqiong; Muleke, Everlyne M.; Sun, Xiaochuan; Wang, Ronghua; Xie, Yang; Gong, Yiqin; Liu, Liwang

    2015-01-01

    MicroRNAs (miRNAs) play vital regulatory roles in plant growth and development. The phase transition from vegetative growth to flowering is crucial in the life cycle of plants. To date, miRNA-mediated flowering regulatory networks remain largely unexplored in radish. In this study, two small RNA libraries from radish leaves at vegetative and reproductive stages were constructed and sequenced by Solexa sequencing. A total of 94 known miRNAs representing 21 conserved and 13 non-conserved miRNA families, and 44 potential novel miRNAs, were identified from the two libraries. In addition, 42 known and 17 novel miRNAs were significantly differentially expressed and identified as bolting-related miRNAs. RT-qPCR analysis revealed that some miRNAs exhibited tissue- or developmental stage-specific expression patterns. Moreover, 154 target transcripts were identified for 50 bolting-related miRNAs, which were predominately involved in plant development, signal transduction and transcriptional regulation. Based on the characterization of bolting-related miRNAs and their target genes, a putative schematic model of miRNA-mediated bolting and flowering regulatory network was proposed. These results could provide insights into bolting and flowering regulatory networks in radish, and facilitate dissecting the molecular mechanisms underlying bolting and flowering time regulation in vegetable crops. PMID:26369897

  13. Scientific and Regulatory Considerations in Solid Oral Modified Release Drug Product Development.

    PubMed

    Li, Min; Sander, Sanna; Duan, John; Rosencrance, Susan; Miksinski, Sarah Pope; Yu, Lawrence; Seo, Paul; Rege, Bhagwant

    2016-11-01

    This review presents scientific and regulatory considerations for the development of solid oral modified release (MR) drug products. It includes a rationale for patient-focused development based on Quality-by-Design (QbD) principles. Product and process understanding of MR products includes identification and risk-based evaluation of critical material attributes (CMAs), critical process parameters (CPPs), and their impact on critical quality attributes (CQAs) that affect the clinical performance. The use of various biopharmaceutics tools that link the CQAs to a predictable and reproducible clinical performance for patient benefit is emphasized. Product and process understanding lead to a more comprehensive control strategy that can maintain product quality through the shelf life and the lifecycle of the drug product. The overall goal is to develop MR products that consistently meet the clinical objectives while mitigating the risks to patients by reducing the probability and increasing the detectability of CQA failures.

  14. Plasmids in the driving seat: The regulatory RNA Rcd gives plasmid ColE1 control over division and growth of its E. coli host

    PubMed Central

    Gaimster, Hannah; Summers, David

    2015-01-01

    Regulation by non-coding RNAs was found to be widespread among plasmids and other mobile elements of bacteria well before its ubiquity in the eukaryotic world was suspected. As an increasing number of examples was characterised, a common mechanism began to emerge. Non-coding RNAs, such as CopA and Sok from plasmid R1, or RNAI from ColE1, exerted regulation by refolding the secondary structures of their target RNAs or modifying their translation. One regulatory RNA that seemed to swim against the tide was Rcd, encoded within the multimer resolution site of ColE1. Required for high fidelity maintenance of the plasmid in recombination-proficient hosts, Rcd was found to have a protein target, elevating indole production by stimulating tryptophanase. Rcd production is up-regulated in dimer-containing cells and the consequent increase in indole is part of the response to the rapid accumulation of dimers by over-replication (known as the dimer catastrophe). It is proposed that indole simultaneously inhibits cell division and plasmid replication, stopping the catastrophe and allowing time for the resolution of dimers to monomers. The idea of a plasmid-mediated cell division checkpoint, proposed but then discarded in the 1980s, appears to be enjoying a revival. PMID:25446541

  15. Plasmids in the driving seat: The regulatory RNA Rcd gives plasmid ColE1 control over division and growth of its E. coli host.

    PubMed

    Gaimster, Hannah; Summers, David

    2015-03-01

    Regulation by non-coding RNAs was found to be widespread among plasmids and other mobile elements of bacteria well before its ubiquity in the eukaryotic world was suspected. As an increasing number of examples was characterised, a common mechanism began to emerge. Non-coding RNAs, such as CopA and Sok from plasmid R1, or RNAI from ColE1, exerted regulation by refolding the secondary structures of their target RNAs or modifying their translation. One regulatory RNA that seemed to swim against the tide was Rcd, encoded within the multimer resolution site of ColE1. Required for high fidelity maintenance of the plasmid in recombination-proficient hosts, Rcd was found to have a protein target, elevating indole production by stimulating tryptophanase. Rcd production is up-regulated in dimer-containing cells and the consequent increase in indole is part of the response to the rapid accumulation of dimers by over-replication (known as the dimer catastrophe). It is proposed that indole simultaneously inhibits cell division and plasmid replication, stopping the catastrophe and allowing time for the resolution of dimers to monomers. The idea of a plasmid-mediated cell division checkpoint, proposed but then discarded in the 1980s, appears to be enjoying a revival.

  16. [Collaborative study on regulatory science for facilitating clinical development of gene therapy products for genetic diseases].

    PubMed

    Uchida, Eriko; Igarashi, Yuka; Sato, Yoji

    2014-01-01

    Gene therapy products are expected as innovative medicinal products for intractable diseases such as life-threatening genetic diseases and cancer. Recently, clinical developments by pharmaceutical companies are accelerated in Europe and the United States, and the first gene therapy product in advanced countries was approved for marketing authorization by the European Commission in 2012. On the other hand, more than 40 clinical studies for gene therapy have been completed or ongoing in Japan, most of them are conducted as clinical researches by academic institutes, and few clinical trials have been conducted for approval of gene therapy products. In order to promote the development of gene therapy products, revision of the current guideline and/or preparation of concept paper to address the evaluation of the quality and safety of gene therapy products are necessary and desired to clearly show what data should be submitted before First-in-Human clinical trials of novel gene therapy products. We started collaborative study with academia and regulatory agency to promote regulatory science toward clinical development of gene therapy products for genetic diseases based on lentivirus and adeno-associated virus vectors; National Center for Child Health and Development (NCCHD), Nippon Medical School and PMDA have been joined in the task force. At first, we are preparing pre-draft of the revision of the current gene therapy guidelines in this project.

  17. Transcriptional profiling and miRNA-dependent regulatory network analysis of longissimus dorsi muscle during prenatal and adult stages in two distinct pig breeds.

    PubMed

    Siengdee, P; Trakooljul, N; Murani, E; Schwerin, M; Wimmers, K; Ponsuksili, S

    2013-08-01

    MicroRNAs (miRNAs) and mRNAs establish a complex regulatory network influencing diverse biological pathways including muscle development and growth. Elucidating miRNA-dependent regulatory networks involved in muscle development could provide additional insights into muscle traits largely predefined during prenatal development. The present study aimed to determine differentially expressed transcripts and functional miRNA-mRNA relationships associated with different stages of skeletal muscle development in two pig breeds, German Landrace and Pietrain, distinct in muscle characteristics. A comparative transcriptional profiling of longissimus dorsi muscle tissues from fetuses at 35, 63 and 91 days post-conception as well as adult pigs (180 days postnatum) was performed using the Affymetrix GeneChip porcine genome microarray. Differential expression patterns were identified to be associated with muscularly developmental stages and breed types. The integration of miRNA expression data and ingenuity pathways analysis (ipa) pathway analysis revealed several miRNA-dependent regulatory networks related to muscle growth and development. The present results provide insights into muscle biology for further improvement of porcine meat quality.

  18. Regulatory structures for gene therapy medicinal products in the European Union.

    PubMed

    Klug, Bettina; Celis, Patrick; Carr, Melanie; Reinhardt, Jens

    2012-01-01

    Taking into account the complexity and technical specificity of advanced therapy medicinal products: (gene and cell therapy medicinal products and tissue engineered products), a dedicated European regulatory framework was needed. Regulation (EC) No. 1394/2007, the "ATMP Regulation" provides tailored regulatory principles for the evaluation and authorization of these innovative medicines. The majority of gene or cell therapy product development is carried out by academia, hospitals, and small- and medium-sized enterprises (SMEs). Thus, acknowledging the particular needs of these types of sponsors, the legislation also provides incentives for product development tailored to them. The European Medicines Agency (EMA) and, in particular, its Committee for Advanced Therapies (CAT) provide a variety of opportunities for early interaction with developers of ATMPs to enable them to have early regulatory and scientific input. An important tool to promote innovation and the development of new medicinal products by micro-, small-, and medium-sized enterprises is the EMA's SME initiative launched in December 2005 to offer financial and administrative assistance to smaller companies. The European legislation also foresees the involvement of stakeholders, such as patient organizations, in the development of new medicines. Considering that gene therapy medicinal products are developed in many cases for treatment of rare diseases often of monogenic origin, the involvement of patient organizations, which focus on rare diseases and genetic and congenital disorders, is fruitful. Two such organizations are represented in the CAT. Research networks play another important role in the development of gene therapy medicinal products. The European Commission is funding such networks through the EU Sixth Framework Program.

  19. Application of supervised machine learning algorithms for the classification of regulatory RNA riboswitches.

    PubMed

    Singh, Swadha; Singh, Raghvendra

    2017-03-01

    Riboswitches, the small structured RNA elements, were discovered about a decade ago. It has been the subject of intense interest to identify riboswitches, understand their mechanisms of action and use them in genetic engineering. The accumulation of genome and transcriptome sequence data and comparative genomics provide unprecedented opportunities to identify riboswitches in the genome. In the present study, we have evaluated the following six machine learning algorithms for their efficiency to classify riboswitches: J48, BayesNet, Naïve Bayes, Multilayer Perceptron, sequential minimal optimization, hidden Markov model (HMM). For determining effective classifier, the algorithms were compared on the statistical measures of specificity, sensitivity, accuracy, F-measure and receiver operating characteristic (ROC) plot analysis. The classifier Multilayer Perceptron achieved the best performance, with the highest specificity, sensitivity, F-score and accuracy, and with the largest area under the ROC curve, whereas HMM was the poorest performer. At present, the available tools for the prediction and classification of riboswitches are based on covariance model, support vector machine and HMM. The present study determines Multilayer Perceptron as a better classifier for the genome-wide riboswitch searches.

  20. MicroRNA profiles and potential regulatory pattern during the early stage of spermatogenesis in mice.

    PubMed

    Luo, MengMeng; Hao, LiLi; Hu, Fen; Dong, YaNan; Gou, LiXia; Zhang, WenDian; Wang, Xin; Zhao, YuHui; Jia, MengChun; Hu, SongNian; Zhang, XiuJun

    2015-05-01

    Spermatogenesis is a complicated and poorly understood process that relies on the precise regulation of the self-renewal and differentiation of spermatogonia. In many organisms, microRNAs (miRNAs) are involved in multiple developmental processes as critical regulators of transcriptional and post-transcriptional gene silencing. This study investigated the expression pattern of miRNAs in type B spermatogonia cells (BSc) and primary spermatocytes (PSc) of mice, using a high-throughput small RNA sequencing system. The results revealed that the expression levels of Let-7 family miRNAs were remarkably high in both cell types. Furthermore, the expression levels of miR-21, miR-140-3p, miR-103, miR-30a, miR-101b and miR-99b were decreased during the transformation from BSc to PSc. These miRNAs target vital genes that participate in apoptosis, cell proliferation and differentiation, junction assembly and cell cycle regulation. These results highlight the indispensable role of miRNAs in spermatogenesis.

  1. The regulatory system in europe with special emphasis on allergen products.

    PubMed

    Lorenz, A R; Luttkopf, D; Seitz, R; Vieths, S

    2008-01-01

    For each medicinal product quality, safety and efficacy have to be proven to obtain a marketing authorisation. The national competent health authorities and the European Medicines Agency (EMEA) with support of the Heads of Medicines Agencies (HMA) work together to grant marketing authorisations for medicinal products. Several regulatory procedures to apply for a marketing authorisation in the European Community (EC) and associated countries exist. After approval by a national procedure a medicinal product can be marketed in only one country. If a medicinal product should enter the markets of two or more European countries of choice the application has to undergo the Mutual Recognition Procedure (MRP) or the Decentralised Procedure (DCP). A marketing authorisation granted by the Centralised Procedure (CP) is valid in the whole EC. The CP is mandatory for certain medicinal products, for example all products derived from recombinant DNA technology including recombinant allergens. The guidance documents applicable to allergen products comprise general as well as product-specific guidelines such as the Note for Guidance on Allergen Products and the Monograph on Allergen Products of the European Pharmacopoeia. So-called 'named patient products' have a special status and are applied to patients without having a marketing authorisation. Recombinant allergens as medicinal products are insufficiently covered by the existing allergen product-specific guidelines, but product-specific guidelines are in the development stage. 2008 S. Karger AG, Basel.

  2. Comparative analysis of mRNA isoform expression in cardiac hypertrophy and development reveals multiple post-transcriptional regulatory modules.

    PubMed

    Park, Ji Yeon; Li, Wencheng; Zheng, Dinghai; Zhai, Peiyong; Zhao, Yun; Matsuda, Takahisa; Vatner, Stephen F; Sadoshima, Junichi; Tian, Bin

    2011-01-01

    Cardiac hypertrophy is enlargement of the heart in response to physiological or pathological stimuli, chiefly involving growth of myocytes in size rather than in number. Previous studies have shown that the expression pattern of a group of genes in hypertrophied heart induced by pressure overload resembles that at the embryonic stage of heart development, a phenomenon known as activation of the "fetal gene program". Here, using a genome-wide approach we systematically defined genes and pathways regulated in short- and long-term cardiac hypertrophy conditions using mice with transverse aortic constriction (TAC), and compared them with those regulated at different stages of embryonic and postnatal development. In addition, exon-level analysis revealed widespread mRNA isoform changes during cardiac hypertrophy resulting from alternative usage of terminal or internal exons, some of which are also developmentally regulated and may be attributable to decreased expression of Fox-1 protein in cardiac hypertrophy. Genes with functions in certain pathways, such as cell adhesion and cell morphology, are more likely to be regulated by alternative splicing. Moreover, we found 3'UTRs of mRNAs were generally shortened through alternative cleavage and polyadenylation in hypertrophy, and microRNA target genes were generally de-repressed, suggesting coordinated mechanisms to increase mRNA stability and protein production during hypertrophy. Taken together, our results comprehensively delineated gene and mRNA isoform regulation events in cardiac hypertrophy and revealed their relations to those in development, and suggested that modulation of mRNA isoform expression plays an importance role in heart remodeling under pressure overload.

  3. Comparative Analysis of mRNA Isoform Expression in Cardiac Hypertrophy and Development Reveals Multiple Post-Transcriptional Regulatory Modules

    PubMed Central

    Park, Ji Yeon; Li, Wencheng; Zheng, Dinghai; Zhai, Peiyong; Zhao, Yun; Matsuda, Takahisa; Vatner, Stephen F.; Sadoshima, Junichi; Tian, Bin

    2011-01-01

    Cardiac hypertrophy is enlargement of the heart in response to physiological or pathological stimuli, chiefly involving growth of myocytes in size rather than in number. Previous studies have shown that the expression pattern of a group of genes in hypertrophied heart induced by pressure overload resembles that at the embryonic stage of heart development, a phenomenon known as activation of the “fetal gene program”. Here, using a genome-wide approach we systematically defined genes and pathways regulated in short- and long-term cardiac hypertrophy conditions using mice with transverse aortic constriction (TAC), and compared them with those regulated at different stages of embryonic and postnatal development. In addition, exon-level analysis revealed widespread mRNA isoform changes during cardiac hypertrophy resulting from alternative usage of terminal or internal exons, some of which are also developmentally regulated and may be attributable to decreased expression of Fox-1 protein in cardiac hypertrophy. Genes with functions in certain pathways, such as cell adhesion and cell morphology, are more likely to be regulated by alternative splicing. Moreover, we found 3′UTRs of mRNAs were generally shortened through alternative cleavage and polyadenylation in hypertrophy, and microRNA target genes were generally de-repressed, suggesting coordinated mechanisms to increase mRNA stability and protein production during hypertrophy. Taken together, our results comprehensively delineated gene and mRNA isoform regulation events in cardiac hypertrophy and revealed their relations to those in development, and suggested that modulation of mRNA isoform expression plays an importance role in heart remodeling under pressure overload. PMID:21799842

  4. Diverse RNA-binding proteins interact with functionally related sets of RNAs, suggesting an extensive regulatory system.

    PubMed

    Hogan, Daniel J; Riordan, Daniel P; Gerber, André P; Herschlag, Daniel; Brown, Patrick O

    2008-10-28

    RNA-binding proteins (RBPs) have roles in the regulation of many post-transcriptional steps in gene expression, but relatively few RBPs have been systematically studied. We searched for the RNA targets of 40 proteins in the yeast Saccharomyces cerevisiae: a selective sample of the approximately 600 annotated and predicted RBPs, as well as several proteins not annotated as RBPs. At least 33 of these 40 proteins, including three of the four proteins that were not previously known or predicted to be RBPs, were reproducibly associated with specific sets of a few to several hundred RNAs. Remarkably, many of the RBPs we studied bound mRNAs whose protein products share identifiable functional or cytotopic features. We identified specific sequences or predicted structures significantly enriched in target mRNAs of 16 RBPs. These potential RNA-recognition elements were diverse in sequence, structure, and location: some were found predominantly in 3'-untranslated regions, others in 5'-untranslated regions, some in coding sequences, and many in two or more of these features. Although this study only examined a small fraction of the universe of yeast RBPs, 70% of the mRNA transcriptome had significant associations with at least one of these RBPs, and on average, each distinct yeast mRNA interacted with three of the RBPs, suggesting the potential for a rich, multidimensional network of regulation. These results strongly suggest that combinatorial binding of RBPs to specific recognition elements in mRNAs is a pervasive mechanism for multi-dimensional regulation of their post-transcriptional fate.

  5. Leeway and constraints in the forced evolution of a regulatory RNA helix.

    PubMed Central

    Olsthoorn, R C; Licis, N; van Duin, J

    1994-01-01

    The start of the coat protein gene of RNA phage MS2 adopts a well-defined hairpin structure of 12 bp (including one mismatch) in which the start codon occupies the loop position. An earlier expression study using partial MS2 cDNA clones had indicated that the stability of this hairpin is important for gene expression. For every -1.4 kcal/mol increase in stability a 10-fold reduction in coat protein was obtained. Destabilizations beyond the wild-type value did not affect expression. These results suggested that the hairpin was tuned in the sense that it has the highest stability still compatible with maximal ribosome loading. Employing an infectious MS2 cDNA clone, we have now tested the prediction that the delta G 0 of the coat protein initiator helix is set at a precise value. We have introduced stabilizing and destabilizing mutations into this hairpin in the intact phage and monitored their evolution to viable species. By compensatory mutations, both types of mutants quickly revert along various pathways to wild-type stability, but not to wild-type sequence. As a rule the second-site mutations do not change the encoded amino acids or the Shine-Dalgarno sequence. The return of too strong hairpins to wild-type stability can be understood from the need to produce adequate supplies of coat protein. The return of unstable hairpins to wild-type stability is not self-evident and is presently not understood. The revertants provide an evolutionary landscape of slightly suboptimal phages, that were stable at least for the duration of the experiment (approximately 20 infection cycles).(ABSTRACT TRUNCATED AT 250 WORDS) Images PMID:8013465

  6. RNA-seq analysis identifies an intricate regulatory network controlling cluster root development in white lupin

    PubMed Central

    2014-01-01

    Background Highly adapted plant species are able to alter their root architecture to improve nutrient uptake and thrive in environments with limited nutrient supply. Cluster roots (CRs) are specialised structures of dense lateral roots formed by several plant species for the effective mining of nutrient rich soil patches through a combination of increased surface area and exudation of carboxylates. White lupin is becoming a model-species allowing for the discovery of gene networks involved in CR development. A greater understanding of the underlying molecular mechanisms driving these developmental processes is important for the generation of smarter plants for a world with diminishing resources to improve food security. Results RNA-seq analyses for three developmental stages of the CR formed under phosphorus-limited conditions and two of non-cluster roots have been performed for white lupin. In total 133,045,174 high-quality paired-end reads were used for a de novo assembly of the root transcriptome and merged with LAGI01 (Lupinus albus gene index) to generate an improved LAGI02 with 65,097 functionally annotated contigs. This was followed by comparative gene expression analysis. We show marked differences in the transcriptional response across the various cluster root stages to adjust to phosphate limitation by increasing uptake capacity and adjusting metabolic pathways. Several transcription factors such as PLT, SCR, PHB, PHV or AUX/IAA with a known role in the control of meristem activity and developmental processes show an increased expression in the tip of the CR. Genes involved in hormonal responses (PIN, LAX, YUC) and cell cycle control (CYCA/B, CDK) are also differentially expressed. In addition, we identify primary transcripts of miRNAs with established function in the root meristem. Conclusions Our gene expression analysis shows an intricate network of transcription factors and plant hormones controlling CR initiation and formation. In addition

  7. A novel NF-κB/YY1/microRNA-10a regulatory circuit in fibroblast-like synoviocytes regulates inflammation in rheumatoid arthritis

    PubMed Central

    Mu, Nan; Gu, Jintao; Huang, Tonglie; Zhang, Cun; Shu, Zhen; Li, Meng; Hao, Qiang; Li, Weina; Zhang, Wangqian; Zhao, Jinkang; Zhang, Yong; Huang, Luyu; Wang, Shuning; Jin, Xiaohang; Xue, Xiaochang; Zhang, Wei; Zhang, Yingqi

    2016-01-01

    The main etiopathogenesis of rheumatoid arthritis (RA) is overexpressed inflammatory cytokines and tissue injury mediated by persistent NF-κB activation. MicroRNAs widely participate in the regulation of target gene expression and play important roles in various diseases. Here, we explored the mechanisms of microRNAs in RA. We found that microRNA (miR)-10a was downregulated in the fibroblast-like synoviocytes (FLSs) of RA patients compared with osteoarthritis (OA) controls, and this downregulation could be triggered by TNF-α and IL-1β in an NF-κB-dependent manner through promoting the expression of the YingYang 1 (YY1) transcription factor. Downregulated miR-10a could accelerate IκB degradation and NF-κB activation by targeting IRAK4, TAK1 and BTRC. This miR-10a-mediated NF-κB activation then significantly promoted the production of various inflammatory cytokines, including TNF-α, IL-1β, IL-6, IL-8, and MCP-1, and matrix metalloproteinase (MMP)-1 and MMP-13. In addition, transfection of a miR-10a inhibitor accelerated the proliferation and migration of FLSs. Collectively, our data demonstrates the existence of a novel NF-κB/YY1/miR-10a/NF-κB regulatory circuit that promotes the excessive secretion of NF-κB-mediated inflammatory cytokines and the proliferation and migration of RA FLSs. Thus, miR-10a acts as a switch to control this regulatory circuit and may serve as a diagnostic and therapeutic target for RA treatment. PMID:26821827

  8. Bioengineering and Coordination of Regulatory Networks and Intracellular Complexes to Maximize Hydrogen Production by Phototrophic Microorganisms

    SciTech Connect

    Tabita, F. Robert

    2013-07-30

    In this study, the Principal Investigator, F.R. Tabita has teemed up with J. C. Liao from UCLA. This project's main goal is to manipulate regulatory networks in phototrophic bacteria to affect and maximize the production of large amounts of hydrogen gas under conditions where wild-type organisms are constrained by inherent regulatory mechanisms from allowing this to occur. Unrestrained production of hydrogen has been achieved and this will allow for the potential utilization of waste materials as a feed stock to support hydrogen production. By further understanding the means by which regulatory networks interact, this study will seek to maximize the ability of currently available “unrestrained” organisms to produce hydrogen. The organisms to be utilized in this study, phototrophic microorganisms, in particular nonsulfur purple (NSP) bacteria, catalyze many significant processes including the assimilation of carbon dioxide into organic carbon, nitrogen fixation, sulfur oxidation, aromatic acid degradation, and hydrogen oxidation/evolution. Moreover, due to their great metabolic versatility, such organisms highly regulate these processes in the cell and since virtually all such capabilities are dispensable, excellent experimental systems to study aspects of molecular control and biochemistry/physiology are available.

  9. Identification of regulatory motifs in the CHO genome for stable monoclonal antibody production.

    PubMed

    Takagi, Yasuhiro; Yamazaki, Tomomi; Masuda, Kenji; Nishii, Shigeaki; Kawakami, Bunsei; Omasa, Takeshi

    2016-08-20

    Chinese hamster ovary (CHO) cell lines are widely used for therapeutic protein production. When a transgene is integrated into the genome of a CHO cell, the expression level is highly dependent on the site of integration because of positional effects such as gene silencing. To overcome negative positional effects and establish stable CHO cell lines with high productivity, several regulatory DNA elements are used in vector construction. Previously, we established the CHO DR1000L-4N cell line, a stable and high copy number Dhfr gene-amplified cell line. It was hypothesized that the chromosomal location of the exogenous gene-amplified region in the CHO DR1000L-4N genome contains regulatory motifs for stable protein production. Therefore, we isolated DNA regulatory motifs from the CHO DR1000L-4N cell line and determined whether these motifs act as an insulator. Our results suggest that stable expression of a transgene can be promoted by the CHO genome sequence, and it would be a powerful tool for therapeutic protein manufacturing.

  10. RNA.

    ERIC Educational Resources Information Center

    Darnell, James E., Jr.

    1985-01-01

    Ribonucleic acid (RNA) converts genetic information into protein and usually must be processed to serve its function. RNA types, chemical structure, protein synthesis, translation, manufacture, and processing are discussed. Concludes that the first genes might have been spliced RNA and that humans might be closer than bacteria to primitive…

  11. RNA.

    ERIC Educational Resources Information Center

    Darnell, James E., Jr.

    1985-01-01

    Ribonucleic acid (RNA) converts genetic information into protein and usually must be processed to serve its function. RNA types, chemical structure, protein synthesis, translation, manufacture, and processing are discussed. Concludes that the first genes might have been spliced RNA and that humans might be closer than bacteria to primitive…

  12. RNA sequencing and functional analysis implicate the regulatory role of long non-coding RNAs in tomato fruit ripening.

    PubMed

    Zhu, Benzhong; Yang, Yongfang; Li, Ran; Fu, Daqi; Wen, Liwei; Luo, Yunbo; Zhu, Hongliang

    2015-08-01

    Recently, long non-coding RNAs (lncRNAs) have been shown to play critical regulatory roles in model plants, such as Arabidopsis, rice, and maize. However, the presence of lncRNAs and how they function in fleshy fruit ripening are still largely unknown because fleshy fruit ripening is not present in the above model plants. Tomato is the model system for fruit ripening studies due to its dramatic ripening process. To investigate further the role of lncRNAs in fruit ripening, it is necessary and urgent to discover and identify novel lncRNAs and understand the function of lncRNAs in tomato fruit ripening. Here it is reported that 3679 lncRNAs were discovered from wild-type tomato and ripening mutant fruit. The lncRNAs are transcribed from all tomato chromosomes, 85.1% of which came from intergenic regions. Tomato lncRNAs are shorter and have fewer exons than protein-coding genes, a situation reminiscent of lncRNAs from other model plants. It was also observed that 490 lncRNAs were significantly up-regulated in ripening mutant fruits, and 187 lncRNAs were down-regulated, indicating that lncRNAs could be involved in the regulation of fruit ripening. In line with this, silencing of two novel tomato intergenic lncRNAs, lncRNA1459 and lncRNA1840, resulted in an obvious delay of ripening of wild-type fruit. Overall, the results indicated that lncRNAs might be essential regulators of tomato fruit ripening, which sheds new light on the regulation of fruit ripening. © The Author 2015. Published by Oxford University Press on behalf of the Society for Experimental Biology.

  13. RNA sequencing and functional analysis implicate the regulatory role of long non-coding RNAs in tomato fruit ripening

    PubMed Central

    Zhu, Benzhong; Yang, Yongfang; Li, Ran; Fu, Daqi; Wen, Liwei; Luo, Yunbo; Zhu, Hongliang

    2015-01-01

    Recently, long non-coding RNAs (lncRNAs) have been shown to play critical regulatory roles in model plants, such as Arabidopsis, rice, and maize. However, the presence of lncRNAs and how they function in fleshy fruit ripening are still largely unknown because fleshy fruit ripening is not present in the above model plants. Tomato is the model system for fruit ripening studies due to its dramatic ripening process. To investigate further the role of lncRNAs in fruit ripening, it is necessary and urgent to discover and identify novel lncRNAs and understand the function of lncRNAs in tomato fruit ripening. Here it is reported that 3679 lncRNAs were discovered from wild-type tomato and ripening mutant fruit. The lncRNAs are transcribed from all tomato chromosomes, 85.1% of which came from intergenic regions. Tomato lncRNAs are shorter and have fewer exons than protein-coding genes, a situation reminiscent of lncRNAs from other model plants. It was also observed that 490 lncRNAs were significantly up-regulated in ripening mutant fruits, and 187 lncRNAs were down-regulated, indicating that lncRNAs could be involved in the regulation of fruit ripening. In line with this, silencing of two novel tomato intergenic lncRNAs, lncRNA1459 and lncRNA1840, resulted in an obvious delay of ripening of wild-type fruit. Overall, the results indicated that lncRNAs might be essential regulators of tomato fruit ripening, which sheds new light on the regulation of fruit ripening. PMID:25948705

  14. MicroRNA profiling analysis throughout tomato fruit development and ripening reveals potential regulatory role of RIN on microRNAs accumulation.

    PubMed

    Gao, Chao; Ju, Zheng; Cao, Dongyan; Zhai, Baiqiang; Qin, Guozheng; Zhu, Hongliang; Fu, Daqi; Luo, Yunbo; Zhu, Benzhong

    2015-04-01

    The development and ripening of tomato fruit are complex processes involving many gene regulatory pathways at the transcriptional and post-transcriptional level. Ripening inhibitor (RIN) is a vital transcription factor, which targets numerous ripening-related genes at the transcriptional level during tomato fruit ripening. MicroRNAs (miRNAs) are a class of short noncoding RNAs that play important roles in post-transcriptional gene regulation. To elucidate the potential regulatory relationship between rin and miRNAs during fruit development and ripening, we identified known miRNAs and profiled their expression in wild-type tomato and rin mutant using a deep sequencing approach combined with quantitative RT-PCR. A total of 33 known miRNA families were identified, of which 14 miRNA families were differently accumulated. Subsequent promoter analysis showed that possible RIN-binding motifs (CArG-box) tended to occur frequently in the promoter regions of partial differently expressed miRNAs. In addition, ethylene may participate in the regulation of miRNAs accumulation during tomato fruit ripening. Chromatin immunoprecipitation (ChIP) and electrophoretic mobility shift assay confirmed the direct binding of RIN to the promoter of MIR172a. Collectively, these results showed a close correlation between miRNA expression and RIN as well as ethylene, which further elucidated the regulatory roles of miRNAs during fruit development and ripening and enriched the regulatory network of RIN in tomato fruit.

  15. α -Actinin TvACTN3 of Trichomonas vaginalis is an RNA-binding protein that could participate in its posttranscriptional iron regulatory mechanism.

    PubMed

    Calla-Choque, Jaeson Santos; Figueroa-Angulo, Elisa Elvira; Ávila-González, Leticia; Arroyo, Rossana

    2014-01-01

    Trichomonas vaginalis is a sexually transmitted flagellated protist parasite responsible for trichomoniasis. This parasite is dependent on high levels of iron, favoring its growth and multiplication. Iron also differentially regulates some trichomonad virulence properties by unknown mechanisms. However, there is evidence to support the existence of gene regulatory mechanisms at the transcriptional and posttranscriptional levels that are mediated by iron concentration in T. vaginalis. Thus, the goal of this study was to identify an RNA-binding protein in T. vaginalis that interacts with the tvcp4 RNA stem-loop structure, which may participate in a posttranscriptional iron regulatory mechanism mediated by RNA-protein interactions. We performed RNA electrophoretic mobility shift assay (REMSA) and supershift, UV cross-linking, Northwestern blot, and western blot (WB) assays using cytoplasmic protein extracts from T. vaginalis with the tvcp4 RNA hairpin structure as a probe. We identified a 135-kDa protein isolated by the UV cross-linking assays as α-actinin 3 (TvACTN3) by MALDI-TOF-MS that was confirmed by LS-MS/MS and de novo sequencing. TvACTN3 is a cytoplasmic protein that specifically binds to hairpin RNA structures from trichomonads and humans when the parasites are grown under iron-depleted conditions. Thus, TvACTN3 could participate in the regulation of gene expression by iron in T. vaginalis through a parallel posttranscriptional mechanism similar to that of the IRE/IRP system.

  16. piRNA production requires heterochromatin formation in Drosophila

    PubMed Central

    Rangan, Prashanth; Malone, Colin D.; Navarro, Caryn; Newbold, Sam P.; Hayes, Patrick S.; Sachidanandam, Ravi; Hannon, Gregory J.; Lehmann, Ruth

    2011-01-01

    Summary Protecting the genome from transposable element (TE) mobilization is critical for germline development. In Drosophila, Piwi proteins and their bound small RNAs (piRNAs) provide a potent defense against TE activity. TE targeting piRNAs are processed from TE-dense heterochromatic loci termed ‘piRNA clusters’. While piRNA biogenesis from cluster precursors is beginning to be understood, little is known about piRNA cluster transcriptional regulation. Here we show that deposition of histone 3 lysine 9 by the methyltransferase dSETDB1 (egg) is required for piRNA cluster transcription. In the absence of dSETDB1, cluster precursor transcription collapses in germline and somatic gonadal cells and TEs are activated, resulting in germline loss and a block in germline stem cell differentiation. We propose that heterochromatin protects the germline by activating the piRNA pathway. PMID:21820311

  17. Marketing Regulatory Oversight of Advanced Therapy Medicinal Products (ATMPs) in Europe: The EMA/CAT Perspective.

    PubMed

    Salmikangas, Paula; Schuessler-Lenz, Martina; Ruiz, Sol; Celis, Patrick; Reischl, Ilona; Menezes-Ferreira, Margarida; Flory, Egbert; Renner, Matthias; Ferry, Nicolas

    2015-01-01

    With the release of Regulation 1394/2007, a new framework for gene and cell therapy medicinal products and tissue-engineered products was established in the European Union. For all three product classes, called advanced therapy medicinal products, a centralised marketing authorisation became mandatory. The European Medicines Agency (EMA) together with its Committee for Advanced Therapies, Committee for Human Medicinal Products and the network of national agencies is responsible for scientific evaluation of the marketing authorisation applications. For a new application, data and information relating to manufacturing processes and quality control of the active substance and the final product have to be submitted for evaluation together with data from non-clinical and clinical safety and efficacy studies. Technical requirements for ATMPs are defined in the legislation, and guidance for different products is available through several EMA/CAT guidelines. Due to the diversity of ATMPs, a tailored approach for regulating these products is considered necessary. Thus, a risk-based approach has been introduced for ATMPs allowing flexibility for the regulatory requirements. Since the regulatory framework for ATMPs was established, five products have been licenced in the European Union. However, the pipeline of new ATMPs is much bigger, as seen from the significant numbers of different products discussed by the CAT in scientific advice and classification procedures. In 2013, a public consultation on the ATMP Regulation was conducted by the European Commission, and the results were published in 2014. The report proposes several improvements for the current framework and established procedures for the regulation of ATMPs.

  18. Abundant Intergenic TAACTGA Direct Repeats and Putative Alternate RNA Polymerase β′ Subunits in Marine Beggiatoaceae Genomes: Possible Regulatory Roles and Origins

    PubMed Central

    MacGregor, Barbara J.

    2015-01-01

    The genome sequences of several giant marine sulfur-oxidizing bacteria present evidence of a possible post-transcriptional regulatory network that may have been transmitted to or from two distantly related bacteria lineages. The draft genome of a Cand. “Maribeggiatoa” filament from the Guaymas Basin (Gulf of California, Mexico) seafloor contains 169 sets of TAACTGA direct repeats and one indirect repeat, with two to six copies per set. Related heptamers are rarely or never found as direct repeats. TAACTGA direct repeats are also found in some other Beggiatoaceae, Thiocystis violascens, a range of Cyanobacteria, and five Bacteroidetes. This phylogenetic distribution suggests they may have been transmitted horizontally, but no mechanism is evident. There is no correlation between total TAACTGA occurrences and repeats per genome. In most species the repeat units are relatively short, but longer arrays of up to 43 copies are found in several Bacteroidetes and Cyanobacteria. The majority of TAACTGA repeats in the Cand. “Maribeggiatoa” Orange Guaymas (BOGUAY) genome are within several nucleotides upstream of a putative start codon, suggesting they may be binding sites for a post-transcriptional regulator. Candidates include members of the ribosomal protein S1, Csp (cold shock protein), and Csr (carbon storage regulator) families. No pattern was evident in the predicted functions of the open reading frames (ORFs) downstream of repeats, but some encode presumably essential products such as ribosomal proteins. Among these is an ORF encoding a possible alternate or modified RNA polymerase beta prime subunit, predicted to have the expected subunit interaction domains but lacking most catalytic residues. A similar ORF was found in the Thioploca ingrica draft genome, but in no others. In both species they are immediately upstream of putative sensor kinase genes with nearly identical domain structures. In the marine Beggiatoaceae, a role for the TAACTGA repeats in

  19. The use and interpretation of in vitro data in regulatory toxicology: cosmetics, toiletries and household products.

    PubMed

    Indans, Ian

    2002-02-28

    There is currently a drive to eliminate animal testing for cosmetics, toiletries and household products; indeed, the European Union Cosmetics Directive aims to prohibit the use of experimental animals for the testing of finished cosmetic products after 2002. At present, national prohibitions are in place in the UK, Germany, Austria and the Netherlands, for the testing of finished cosmetic products and cosmetic ingredients. In the USA animal testing for certain types of finished products is mandatory. Against this background, the currently available regulatory in vitro tests comprise methods for eye irritation, skin corrosivity, genotoxicity, dermal penetration and photoirritation. The draft updates to the Organisation for Economic Co-operation and Development guidelines for eye and skin irritation advocate the use of in vitro or ex vivo methods prior to the commencement of animal studies. At present, testing for these endpoints cannot be completed in vitro, but potentially corrosive substances and products can be classified without the need for animal studies. Regulatory genotoxicity testing can be completed using only in vitro methods, provided that a clear negative outcome is obtained for each test. Data from dermal penetration studies may be used to refine risk assessments. Current developments in areas such as skin sensitisation and skin irritation promise that in the reasonably near future such information may be generated without the use of animals.

  20. Regulatory requirements for clinical trial and marketing authorisation application for cell-based medicinal products.

    PubMed

    Salmikangas, P; Flory, E; Reinhardt, J; Hinz, T; Maciulaitis, R

    2010-01-01

    The new era of regenerative medicine has led to rapid development of new innovative therapies especially for diseases and tissue/organ defects for which traditional therapies and medicinal products have not provided satisfactory outcome. Although the clinical use and developments of cell-based medicinal products (CBMPs) could be witnessed already for a decade, robust scientific and regulatory provisions for these products have only recently been enacted. The new Regulation for Advanced Therapies (EC) 1394/2007 together with the revised Annex I, Part IV of Directive 2001/83/EC provides the new legal framework for CBMPs. The wide variety of cell-based products and the foreseen limitations (small sample sizes, short shelf life) vs. particular risks (microbiological purity, variability, immunogenicity, tumourigenicity) associated with CBMPs have called for a flexible, case-by-case regulatory approach for these products. Consequently, a risk-based approach has been developed to allow definition of the amount of scientific data needed for a Marketing Authorisation Application (MAA) of each CBMP. The article provides further insight into the initial risk evaluation, as well as to the quality, non-clinical, and clinical requirements of CBMPs. Special somatic cell therapies designed for active immunotherapy are also addressed.

  1. RNA-seq analysis of apical meristem reveals integrative regulatory network of ROS and chilling potentially related to flowering in Litchi chinensis.

    PubMed

    Lu, Xingyu; Li, Jingjing; Chen, Houbin; Hu, Jiaqi; Liu, Pengxu; Zhou, Biyan

    2017-08-31

    Litchi is an important woody fruit tree. Floral initiation in litchi is triggered by low temperatures. However, defective flowering is a major challenge for litchi production in times of climate change and global warming. Previous studies have shown that the reactive oxygen species (ROS) generated by methyl viologen dichloride hydrate (MV) promotes flowering. In this study, potted trees were transferred to growth chambers for low-temperature (LT), medium-temperature (MT), and high-temperature (HT) treatments. Trees at MT were subjected to ROS treatment to promote flowering, and those at LT were induced to flower. RNA-sequencing was applied to obtain a global transcriptome of the apical meristem and reveal potential gene networks controlling the transformation from vegetative meristems (VM) into inflorescence meristems (IM). We assembled 73,117 unigenes with a mean size of 790 bp and 11741 unigenes were identified as both chilling and ROS responsive genes (CRRGs), of which 48 were identified as flowering-related CRRGs, 59 were plant hormone signal transduction CRRGs, and 146 were plant hormone biosynthesis-related CRRGs. Genes co-expression network analysis indicated inner relationships, suggesting that ROS and chilling promotes the VM to IM transition through a regulatory gene network of transcription factors, hormones, and flowering regulators.

  2. Linking gene regulation to mRNA production and export.

    PubMed

    Rodríguez-Navarro, Susana; Hurt, Ed

    2011-06-01

    Regulation of gene expression can occur at many different levels. One important step in the gene expression process is the transport of mRNA from the nucleus to the cytoplasm. In recent years, studies have described how nuclear mRNA export depends on the steps preceding and following transport through nuclear pore complexes. These include gene activation, transcription, mRNA processing and mRNP assembly and disassembly. In this review, we summarise recent insights into the links between these steps in the gene expression cascade.

  3. Engineering a regulatory region of jadomycin gene cluster to improve jadomycin B production in Streptomyces venezuelae.

    PubMed

    Zheng, Jian-Ting; Wang, Sheng-Lan; Yang, Ke-Qian

    2007-09-01

    Streptomyces venezuelae ISP5230 produces a group of jadomycin congeners with cytotoxic activities. To improve jadomycin fermentation process, a genetic engineering strategy was designed to replace a 3.4-kb regulatory region of jad gene cluster that contains four regulatory genes (3' end 272 bp of jadW2, jadW3, jadR2, and jadR1) and the native promoter upstream of jadJ (P(J)) with the ermEp* promoter sequence so that ermEp* drives the expression of the jadomycin biosynthetic genes from jadJ in the engineered strain. As expected, the mutant strain produced jadomycin B without ethanol treatment, and the yield increased to about twofold that of the stressed wild-type. These results indicated that manipulation of the regulation of a biosynthetic gene cluster is an effective strategy to increase product yield.

  4. Infected erythrocyte-derived extracellular vesicles alter vascular function via regulatory Ago2-miRNA complexes in malaria

    PubMed Central

    Mantel, Pierre-Yves; Hjelmqvist, Daisy; Walch, Michael; Kharoubi-Hess, Solange; Nilsson, Sandra; Ravel, Deepali; Ribeiro, Marina; Grüring, Christof; Ma, Siyuan; Padmanabhan, Prasad; Trachtenberg, Alexander; Ankarklev, Johan; Brancucci, Nicolas M.; Huttenhower, Curtis; Duraisingh, Manoj T.; Ghiran, Ionita; Kuo, Winston P.; Filgueira, Luis; Martinelli, Roberta; Marti, Matthias

    2016-01-01

    Malaria remains one of the greatest public health challenges worldwide, particularly in sub-Saharan Africa. The clinical outcome of individuals infected with Plasmodium falciparum parasites depends on many factors including host systemic inflammatory responses, parasite sequestration in tissues and vascular dysfunction. Production of pro-inflammatory cytokines and chemokines promotes endothelial activation as well as recruitment and infiltration of inflammatory cells, which in turn triggers further endothelial cell activation and parasite sequestration. Inflammatory responses are triggered in part by bioactive parasite products such as hemozoin and infected red blood cell-derived extracellular vesicles (iRBC-derived EVs). Here we demonstrate that such EVs contain functional miRNA-Argonaute 2 complexes that are derived from the host RBC. Moreover, we show that EVs are efficiently internalized by endothelial cells, where the miRNA-Argonaute 2 complexes modulate target gene expression and barrier properties. Altogether, these findings provide a mechanistic link between EVs and vascular dysfunction during malaria infection. PMID:27721445

  5. Prevention of cross-talk in conserved regulatory systems: identification of specificity determinants in RNA-binding anti-termination proteins of the BglG family

    PubMed Central

    Hübner, Sebastian; Declerck, Nathalie; Diethmaier, Christine; Le Coq, Dominique; Aymerich, Stephane; Stülke, Jörg

    2011-01-01

    Each family of signal transduction systems requires specificity determinants that link individual signals to the correct regulatory output. In Bacillus subtilis, a family of four anti-terminator proteins controls the expression of genes for the utilisation of alternative sugars. These regulatory systems contain the anti-terminator proteins and a RNA structure, the RNA anti-terminator (RAT) that is bound by the anti-terminator proteins. We have studied three of these proteins (SacT, SacY, and LicT) to understand how they can transmit a specific signal in spite of their strong structural homology. A screen for random mutations that render SacT capable to bind a RNA structure recognized by LicT only revealed a substitution (P26S) at one of the few non-conserved residues that are in contact with the RNA. We have randomly modified this position in SacT together with another non-conserved RNA-contacting residue (Q31). Surprisingly, the mutant proteins could bind all RAT structures that are present in B. subtilis. In a complementary approach, reciprocal amino acid exchanges have been introduced in LicT and SacY at non-conserved positions of the RNA-binding site. This analysis revealed the key role of an arginine side-chain for both the high affinity and specificity of LicT for its cognate RAT. Introduction of this Arg at the equivalent position of SacY (A26) increased the RNA binding in vitro but also resulted in a relaxed specificity. Altogether our results suggest that this family of anti-termination proteins has evolved to reach a compromise between RNA binding efficacy and specific interaction with individual target sequences. PMID:21278164

  6. Regulatory assessment of brand changes in the commercial tobacco product market.

    PubMed

    Wayne, G Ferris; Connolly, G N

    2009-08-01

    Regulatory oversight of tobacco product design has gained momentum in the US and internationally. Appropriate standards for assessing commercial brands and characterising product features must be considered a priority. An area of potential concern is in-market design changes adopted within a single commercial brand over time. Internal tobacco industry documents were identified and used to assess internal discussion of product guidelines and practices regarding in-market brand changes. Commercial tobacco products undergo a constant process of revision in-market, beginning at the most basic level of physical product characteristics and components, and including every aspect of design. These revisions commonly exceed guidelines for acceptable product variance adopted within the industry. While consumer and market testing is conducted to ensure that products remain acceptable to users, explicit marketing often may not accompany brand changes. In the absence of such marketing, it should not be assumed that a brand remains unchanged. For manufacturers, assessment of competitor brands includes identification and analysis of non-routine changes; that is, those changes likely to significantly alter the character of a given brand. Regulators must adopt a similar practice in determining standards for product evaluation in the face of ongoing commercial product revision.

  7. Precursor-product discrimination by La protein during tRNA metabolism.

    PubMed

    Bayfield, Mark A; Maraia, Richard J

    2009-04-01

    La proteins bind pre-tRNAs at their UUU-3'OH ends, facilitating their maturation. Although the mechanism by which La binds pre-tRNA 3' trailers is known, the function of the RNA binding beta-sheet surface of the RNA-recognition motif (RRM1) is unknown. How La dissociates from UUU-3'OH-containing trailers after 3' processing is also unknown. Here we show that La preferentially binds pre-tRNAs over processed tRNAs or 3' trailer products through coupled use of two sites: one on the La motif and another on the RRM1 beta-surface that binds elsewhere on tRNA. Two sites provide stable pre-tRNA binding, whereas the processed tRNA and 3' trailer are released from their single sites relatively fast. RRM1 loop-3 mutations decrease affinity for pre-tRNA and tRNA, but not for the UUU-3'OH trailer, and impair tRNA maturation in vivo. We propose that RRM1 functions in activities that are more complex than UUU-3'OH binding. Accordingly, the RRM1 mutations also impair an RNA chaperone activity of La. The results suggest how La distinguishes precursor from product RNAs, allowing it to recycle onto a new pre-tRNA.

  8. The Impact of 18 Ancestral and Horizontally-Acquired Regulatory Proteins upon the Transcriptome and sRNA Landscape of Salmonella enterica serovar Typhimurium.

    PubMed

    Colgan, Aoife M; Kröger, Carsten; Diard, Médéric; Hardt, Wolf-Dietrich; Puente, José L; Sivasankaran, Sathesh K; Hokamp, Karsten; Hinton, Jay C D

    2016-08-01

    We know a great deal about the genes used by the model pathogen Salmonella enterica serovar Typhimurium to cause disease, but less about global gene regulation. New tools for studying transcripts at the single nucleotide level now offer an unparalleled opportunity to understand the bacterial transcriptome, and expression of the small RNAs (sRNA) and coding genes responsible for the establishment of infection. Here, we define the transcriptomes of 18 mutants lacking virulence-related global regulatory systems that modulate the expression of the SPI1 and SPI2 Type 3 secretion systems of S. Typhimurium strain 4/74. Using infection-relevant growth conditions, we identified a total of 1257 coding genes that are controlled by one or more regulatory system, including a sub-class of genes that reflect a new level of cross-talk between SPI1 and SPI2. We directly compared the roles played by the major transcriptional regulators in the expression of sRNAs, and discovered that the RpoS (σ38) sigma factor modulates the expression of 23% of sRNAs, many more than other regulatory systems. The impact of the RNA chaperone Hfq upon the steady state levels of 280 sRNA transcripts is described, and we found 13 sRNAs that are co-regulated with SPI1 and SPI2 virulence genes. We report the first example of an sRNA, STnc1480, that is subject to silencing by H-NS and subsequent counter-silencing by PhoP and SlyA. The data for these 18 regulatory systems is now available to the bacterial research community in a user-friendly online resource, SalComRegulon.

  9. The Impact of 18 Ancestral and Horizontally-Acquired Regulatory Proteins upon the Transcriptome and sRNA Landscape of Salmonella enterica serovar Typhimurium

    PubMed Central

    Colgan, Aoife M.; Diard, Médéric; Hardt, Wolf-Dietrich; Puente, José L.; Sivasankaran, Sathesh K.; Hokamp, Karsten; Hinton, Jay C. D.

    2016-01-01

    We know a great deal about the genes used by the model pathogen Salmonella enterica serovar Typhimurium to cause disease, but less about global gene regulation. New tools for studying transcripts at the single nucleotide level now offer an unparalleled opportunity to understand the bacterial transcriptome, and expression of the small RNAs (sRNA) and coding genes responsible for the establishment of infection. Here, we define the transcriptomes of 18 mutants lacking virulence-related global regulatory systems that modulate the expression of the SPI1 and SPI2 Type 3 secretion systems of S. Typhimurium strain 4/74. Using infection-relevant growth conditions, we identified a total of 1257 coding genes that are controlled by one or more regulatory system, including a sub-class of genes that reflect a new level of cross-talk between SPI1 and SPI2. We directly compared the roles played by the major transcriptional regulators in the expression of sRNAs, and discovered that the RpoS (σ38) sigma factor modulates the expression of 23% of sRNAs, many more than other regulatory systems. The impact of the RNA chaperone Hfq upon the steady state levels of 280 sRNA transcripts is described, and we found 13 sRNAs that are co-regulated with SPI1 and SPI2 virulence genes. We report the first example of an sRNA, STnc1480, that is subject to silencing by H-NS and subsequent counter-silencing by PhoP and SlyA. The data for these 18 regulatory systems is now available to the bacterial research community in a user-friendly online resource, SalComRegulon. PMID:27564394

  10. Statistical and regulatory considerations in assessments of interchangeability of biological drug products.

    PubMed

    Tóthfalusi, Lászlo; Endrényi, László; Chow, Shein-Chung

    2014-05-01

    When the patent of a brand-name, marketed drug expires, new, generic products are usually offered. Small-molecule generic and originator drug products are expected to be chemically identical. Their pharmaceutical similarity can be typically assessed by simple regulatory criteria such as the expectation that the 90% confidence interval for the ratio of geometric means of some pharmacokinetic parameters be between 0.80 and 1.25. When such criteria are satisfied, the drug products are generally considered to exhibit therapeutic equivalence. They are then usually interchanged freely within individual patients. Biological drugs are complex proteins, for instance, because of their large size, intricate structure, sensitivity to environmental conditions, difficult manufacturing procedures, and the possibility of immunogenicity. Generic and brand-name biologic products can be expected to show only similarity but not identity in their various features and clinical effects. Consequently, the determination of biosimilarity is also a complicated process which involves assessment of the totality of the evidence for the close similarity of the two products. Moreover, even when biosimilarity has been established, it may not be assumed that the two biosimilar products can be automatically substituted by pharmacists. This generally requires additional, careful considerations. Without declaring interchangeability, a new product could be prescribed, i.e. it is prescribable. However, two products can be automatically substituted only if they are interchangeable. Interchangeability is a statistical term and it means that products can be used in any order in the same patient without considering the treatment history. The concepts of interchangeability and prescribability have been widely discussed in the past but only in relation to small molecule generics. In this paper we apply these concepts to biosimilars and we discuss: definitions of prescribability and interchangeability and

  11. Linear RNA amplification for the production of microarray hybridization probes.

    PubMed

    Klebes, Ansgar; Kornberg, Thomas B

    2008-01-01

    To understand Drosophila development and other genetically controlled processes, it is often desirable to identify differences in gene expression levels. An experimental approach to investigate these processes is to catalog the transcriptome by hybridization of mRNA to DNA microbar-rays. In these experiments mRNA-derived hybridization probes are produced and hybridized to an array of DNA spots on a solid support. The labeled cDNAs of the complex hybridization probe will bind to their complementary sequences and provide quantification of the relative concentration of the corresponding transcript in the starting material. However, such approaches are often limited by the scarcity of the experimental sample because standard methods of probe preparation require microgram quantities of mRNA template. Linear RNA amplification can alleviate such limitations to support the generation of microarray hybridization probes from a few 100 pg of mRNA. These smaller quantities can be isolated from a few 100 cells. Here, we present a linear amplification protocol designed to preserve both the relative abundance of transcripts as well as their sequence complexity.

  12. A novel strategy to identify the location of necessary and sufficient cis-acting regulatory mRNA elements in trypanosomes.

    PubMed

    Webb, Helena; Burns, Roisin; Kimblin, Nicola; Ellis, Louise; Carrington, Mark

    2005-07-01

    Expression of nearly all protein coding genes in trypanosomes is regulated post-transcriptionally, predominantly at the level of mRNA half-life. The identification of cis-acting elements involved in mRNA stability has been hindered by a lack of ability to screen for loss-of-regulation mutants. The method described in this article allows the region containing the necessary and sufficient elements within a mRNA to be identified and uses antibiotic resistance genes as both selectable markers and reporters. In the case of unstable mRNAs, the strategy can be extended by performing a screen for spontaneous loss-of-function mutants in regulatory parts of a mRNA. The method was validated by using the GPI-PLC mRNA, which is unstable in procyclic form trypanosomes and showed that the 3'UTR of the GPI-PLC mRNA contains all elements required for developmentally regulated instability. Loss-of-instability mutants all contained deletions within the 2300-nucleotide-long 3'UTR, and their analysis showed that a deletion including the last 800 nt of the gene stabilized the mRNA. The method is nonpresumptive, allows far more rapid screening for cis-elements than existing procedures, and has the advantage of identifying functional mutants. It is applicable to all eukaryotes using polycistronic transcription.

  13. [Official experimental testing of biomedical products. Regulatory frame and importance of for quality, safety and efficacy].

    PubMed

    Vieths, S; Seitz, R

    2014-10-01

    The official experimental testing of biomedicinal products provides a very significant contribution to ensuring quality, safety and efficacy of these indispensable medicines. Already in the prelicensing phase or to elucidate clusters of increased adverse effects, official medicinal control laboratories are committed to perform experimental testing. The official batch release can be seen as external quality control of the manufacturer's release testing. For proficient performance in these tasks, scientific research is required, in particular on the development and refinement of test methods, and considering the continuous development of innovative biomedicinal products. This article is aimed at introducing the present thematic issue and in particular the regulatory basis of experimental product testing, and illustrates by means of several examples its great importance for the sake of the patients.

  14. Methods and composition for the production of orthogonal tRNA-aminoacyltRNA synthetase pairs

    DOEpatents

    Schultz, Peter G [La Jolla, CA; Wang, Lei [San Diego, CA; Anderson, John Christopher [San Diego, CA; Chin, Jason [Cambridge, GB; Liu, David R [Lexington, MA; Magliery, Thomas J [North Haven, CT; Meggers, Eric L [Philadelphia, PA; Mehl, Ryan Aaron [Lancaster, PA; Pastrnak, Miro [San Diego, CA; Santoro, Steven William [Cambridge, MA; Zhang, Zhiwen [San Diego, CA

    2008-04-08

    This invention provides compositions and methods for generating components of protein biosynthetic machinery including orthogonal tRNAs, orthogonal aminoacyl-tRNA synthetases, and orthogonal pairs of tRNAs/synthetases. Methods for identifying orthogonal pairs are also provided. These components can be used to incorporate unnatural amino acids into proteins in vivo.

  15. Methods and composition for the production of orthogonal tRNA-aminoacyltRNA synthetase pairs

    DOEpatents

    Schultz, Peter G [La Jolla, CA; Wang, Lei [San Diego, CA; Anderson, John Christopher [San Diego, CA; Chin, Jason [Cambridge, GB; Liu, David R [Lexington, MA; Magliery, Thomas J [North Haven, CT; Meggers, Eric L [Philadelphia, PA; Mehl, Ryan Aaron [Lancaster, PA; Pastrnak, Miro [San Diego, CA; Santoro, Steven William [Cambridge, MA; Zhang, Zhiwen [San Diego, CA

    2012-05-22

    This invention provides compositions and methods for generating components of protein biosynthetic machinery including orthogonal tRNAs, orthogonal aminoacyl-tRNA synthetases, and orthogonal pairs of tRNAs/synthetases. Methods for identifying orthogonal pairs are also provided. These components can be used to incorporate unnatural amino acids into proteins in vivo.

  16. Methods and compositions for the production of orthogonal tRNA-aminoacyl-tRNA synthetase pairs

    DOEpatents

    Schultz, Peter G [La Jolla, CA; Wang, Lei [San Diego, CA; Anderson, John Christopher [San Diego, CA; Chin, Jason W [San Diego, CA; Liu, David R [Lexington, MA; Magliery, Thomas J [North Haven, CT; Meggers, Eric L [Philadelphia, PA; Mehl, Ryan Aaron [San Diego, CA; Pastrnak, Miro [San Diego, CA; Santoro, Stephen William [San Diego, CA; Zhang, Zhiwen [San Diego, CA

    2011-09-06

    This invention provides compositions and methods for generating components of protein biosynthetic machinery including orthogonal tRNAs, orthogonal aminoacyl-tRNA synthetases, and orthogonal pairs of tRNAs/synthetases. Methods for identifying orthogonal pairs are also provided. These components can be used to incorporate unnatural amino acids into proteins in vivo.

  17. Yeast deRNA viral transcriptase pause products: identification of the transcript strand.

    PubMed Central

    Brennan, V E; Bobek, L A; Bruenn, J A

    1981-01-01

    ScV-L is a double-stranded RNA virus of the yeast Saccharomyces cerevisiae. The virus possesses a capsid-associated transcriptase activity the product of which is a single-stranded RNA complementary to only one strand of the double-stranded RNA template (L). We show that the U-rich 3' terminus of L is the initiation site of transcription and that a number of pause products are made. One prominent product has the sequence pppGAAAAAUUUUUAAAUUCAUAUAACUOH. Images PMID:7031603

  18. Altering SARS coronavirus frameshift efficiency affects genomic and subgenomic RNA production.

    PubMed

    Plant, Ewan P; Sims, Amy C; Baric, Ralph S; Dinman, Jonathan D; Taylor, Deborah R

    2013-01-18

    In previous studies, differences in the amount of genomic and subgenomic RNA produced by coronaviruses with mutations in the programmed ribosomal frameshift signal of ORF1a/b were observed. It was not clear if these differences were due to changes in genomic sequence, the protein sequence or the frequency of frameshifting. Here, viruses with synonymous codon changes are shown to produce different ratios of genomic and subgenomic RNA. These findings demonstrate that the protein sequence is not the primary cause of altered genomic and subgenomic RNA production. The synonymous codon changes affect both the structure of the frameshift signal and frameshifting efficiency. Small differences in frameshifting efficiency result in dramatic differences in genomic RNA production and TCID50 suggesting that the frameshifting frequency must stay above a certain threshold for optimal virus production. The data suggest that either the RNA sequence or the ratio of viral proteins resulting from different levels of frameshifting affects viral replication.

  19. Precursor-product discrimination by La protein during tRNA metabolism

    PubMed Central

    Bayfield, Mark A.; Maraia, Richard J.

    2009-01-01

    SUMMARY La proteins bind pre-tRNAs at their UUU-3'OH ends, facilitating their maturation. While the mechanism by which La binds pre-tRNA 3' trailers is known, the function of the RNA-binding β-sheet surface of RRM1 is unknown. How La dissociates from UUU-3'OH-containing trailers after 3' processing is also unknown. La preferentially binds pre-tRNAs over processed tRNAs or 3' trailer products through coupled use of two sites: one on the La motif and another on the RRM1 β surface that binds elsewhere on tRNA. Two sites provide stable pre-tRNA binding while processed tRNA and 3' trailer are released from their single sites relatively fast. RRM1 loop-3 mutations decrease affinity for pre-tRNA and tRNA but not UUU-3'OH trailer, and impair tRNA maturation in vivo. We propose that RRM1 functions in activities that are more complex than UUU-3'OH binding. Accordingly, the RRM1 mutations also impair a RNA chaperone activity of La. The results suggest how La distinguishes precursor from product RNAs, allowing it to recycle onto a new pre-tRNA. PMID:19287396

  20. Identification of Submergence-Responsive MicroRNAs and Their Targets Reveals Complex MiRNA-Mediated Regulatory Networks in Lotus (Nelumbo nucifera Gaertn)

    PubMed Central

    Jin, Qijiang; Xu, Yingchun; Mattson, Neil; Li, Xin; Wang, Bei; Zhang, Xiao; Jiang, Hongwei; Liu, Xiaojing; Wang, Yanjie; Yao, Dongrui

    2017-01-01

    MicroRNAs (miRNAs) are endogenous non-coding RNAs with important regulatory functions in plant development and stress responses. However, their population abundance in lotus (Nelumbo nucifera Gaertn) has so far been poorly described, particularly in response to stresses. In this work, submergence-related miRNAs and their target genes were systematically identified, compared, and validated at the transcriptome-wide level using high-throughput sequencing data of small RNA, Mrna, and the degradome. A total of 128 known and 20 novel miRNAs were differentially expressed upon submergence. We identified 629 target transcripts for these submergence-responsive miRNAs. Based on the miRNA expression profiles and GO and KEGG annotation of miRNA target genes, we suggest possible molecular responses and physiological changes of lotus in response to submergence. Several metabolic, physiological and morphological adaptations-related miRNAs, i.e., NNU_far-miR159, NNU_gma-miR393h, and NNU_aly-miR319c-3p, were found to play important regulatory roles in lotus response to submergence. This work will contribute to a better understanding of miRNA-regulated adaption responses of lotus to submergence stress. PMID:28149304

  1. Group 1 Innate Lymphoid Cell Lineage Identity Is Determined by a cis-Regulatory Element Marked by a Long Non-coding RNA.

    PubMed

    Mowel, Walter K; McCright, Sam J; Kotzin, Jonathan J; Collet, Magalie A; Uyar, Asli; Chen, Xin; DeLaney, Alexandra; Spencer, Sean P; Virtue, Anthony T; Yang, EnJun; Villarino, Alejandro; Kurachi, Makoto; Dunagin, Margaret C; Pritchard, Gretchen Harms; Stein, Judith; Hughes, Cynthia; Fonseca-Pereira, Diogo; Veiga-Fernandes, Henrique; Raj, Arjun; Kambayashi, Taku; Brodsky, Igor E; O'Shea, John J; Wherry, E John; Goff, Loyal A; Rinn, John L; Williams, Adam; Flavell, Richard A; Henao-Mejia, Jorge

    2017-09-19

    Commitment to the innate lymphoid cell (ILC) lineage is determined by Id2, a transcriptional regulator that antagonizes T and B cell-specific gene expression programs. Yet how Id2 expression is regulated in each ILC subset remains poorly understood. We identified a cis-regulatory element demarcated by a long non-coding RNA (lncRNA) that controls the function and lineage identity of group 1 ILCs, while being dispensable for early ILC development and homeostasis of ILC2s and ILC3s. The locus encoding this lncRNA, which we termed Rroid, directly interacted with the promoter of its neighboring gene, Id2, in group 1 ILCs. Moreover, the Rroid locus, but not the lncRNA itself, controlled the identity and function of ILC1s by promoting chromatin accessibility and deposition of STAT5 at the promoter of Id2 in response to interleukin (IL)-15. Thus, non-coding elements responsive to extracellular cues unique to each ILC subset represent a key regulatory layer for controlling the identity and function of ILCs. Copyright © 2017 Elsevier Inc. All rights reserved.

  2. Trypanosome MKT1 and the RNA-binding protein ZC3H11: interactions and potential roles in post-transcriptional regulatory networks

    PubMed Central

    Singh, Aditi; Minia, Igor; Droll, Dorothea; Fadda, Abeer; Clayton, Christine; Erben, Esteban

    2014-01-01

    The trypanosome zinc finger protein ZC3H11 binds to AU-rich elements in mRNAs. It is essential for survival of the mammalian-infective bloodstream form, where it stabilizes several mRNAs including some encoding chaperones, and is also required for stabilization of chaperone mRNAs during the heat-shock response in the vector-infective procyclic form. When ZC3H11 was artificially ‘tethered’ to a reporter mRNA in bloodstream forms it increased reporter expression. We here show that ZC3H11 interacts with trypanosome MKT1 and PBP1, and that domains required for both interactions are necessary for function in the bloodstream-form tethering assay. PBP1 interacts with MKT1, LSM12 and poly(A) binding protein, and localizes to granules during parasite starvation. All of these proteins are essential for bloodstream-form trypanosome survival and increase gene expression in the tethering assay. MKT1 is cytosolic and polysome associated. Using a yeast two-hybrid screen and tandem affinity purification we found that trypanosome MKT1 interacts with multiple RNA-binding proteins and other potential RNA regulators, placing it at the centre of a post-transcriptional regulatory network. A consensus interaction sequence, H(E/D/N/Q)PY, was identified. Recruitment of MKT1-containing regulatory complexes to mRNAs via sequence-specific mRNA-binding proteins could thus control several different post-transcriptional regulons. PMID:24470144

  3. Proteomics analysis of global regulatory cascades involved in clavulanic acid production and morphological development in Streptomyces clavuligerus.

    PubMed

    Ferguson, Nicole L; Peña-Castillo, Lourdes; Moore, Marcus A; Bignell, Dawn R D; Tahlan, Kapil

    2016-04-01

    The genus Streptomyces comprises bacteria that undergo a complex developmental life cycle and produce many metabolites of importance to industry and medicine. Streptomyces clavuligerus produces the β-lactamase inhibitor clavulanic acid, which is used in combination with β-lactam antibiotics to treat certain β-lactam resistant bacterial infections. Many aspects of how clavulanic acid production is globally regulated in S. clavuligerus still remains unknown. We conducted comparative proteomics analysis using the wild type strain of S. clavuligerus and two mutants (ΔbldA and ΔbldG), which are defective in global regulators and vary in their ability to produce clavulanic acid. Approximately 33.5 % of the predicted S. clavuligerus proteome was detected and 192 known or putative regulatory proteins showed statistically differential expression levels in pairwise comparisons. Interestingly, the expression of many proteins whose corresponding genes contain TTA codons (predicted to require the bldA tRNA for translation) was unaffected in the bldA mutant.

  4. Bioequivalence study designs for generic solid oral anticancer drug products: scientific and regulatory considerations.

    PubMed

    Kaur, Paramjeet; Chaurasia, Chandra S; Davit, Barbara M; Conner, Dale P

    2013-12-01

    The demonstration of bioequivalence (BE) between the test and reference products is an integral part of generic drug approval process. A sound BE study design is pivotal to the successful demonstration of BE of generic drugs to their corresponding reference listed drug product. Generally, BE of systemically acting oral dosage forms is demonstrated in a crossover, single-dose in vivo study in healthy subjects. The determination of BE of solid oral anticancer drug products is associated with its own unique challenges due to the serious safety risks involved. Unlike typical BE study in healthy subjects, the safety issues often necessitate conducting BE studies in cancer patients. Such BE studies of an anticancer drug should be conducted without disturbing the patients' therapeutic dosing regimen. Attributes such as drug permeability and solubility, pharmacokinetics, dosing regimen, and approved therapeutic indication(s) are considered in the BE study design of solid anticancer drug products. To streamline the drug approval process, the Division of Bioequivalence posts the Bioequivalence Recommendations for Specific Products guidances on the FDA public website. The objective of this article is to illustrate the scientific and regulatory considerations in the design of BE studies for generic solid oral anticancer drug products through examples.

  5. Yeast Edc3 Targets RPS28B mRNA for Decapping by Binding to a 3′ Untranslated Region Decay-Inducing Regulatory Element

    PubMed Central

    Li, Chunfang; Roy, Bijoyita

    2014-01-01

    mRNA decapping commits a transcript to complete turnover in eukaryotic cells. In yeast, general mRNA decapping requires the Dcp1/Dcp2 decapping enzyme and a set of decapping activators, including Pat1, Dhh1, Edc3, and the Lsm1-7 complex. The exact function and mode of action of each of these decapping activators in mRNA decapping largely remain elusive. Here, we analyzed the role of Edc3 in the decay of yeast RPS28B mRNA, a pathway triggered by a negative-feedback autoregulatory mechanism. We show that Edc3-mediated RPS28B mRNA decay requires either of two orthologous proteins, Rps28a and Rps28b, expressed from the RPS28A and RPS28B genes, respectively. Contrary to a generally accepted model, we found that Rps28b does not bind to the 3′-untranslated region (UTR) regulatory element in RPS28B mRNA. Instead, Edc3 is directly involved in binding the element, and Rps28b binds Edc3 and regulates its activity. Decay of RPS28B mRNA requires the Lsm and YjeF-N domains of Edc3, but surprisingly, decay of YRA1 pre-mRNA, the only other known substrate of Edc3, requires only the Lsm domain. Collectively, our experiments reveal a new role for Edc3 in mRNA substrate recognition and suggest that this activity is subject to intricate regulation by additional factors, including the Rps28 ribosomal protein. PMID:24492965

  6. Inhibition of selenocysteine tRNA[Ser]Sec aminoacylation provides evidence that aminoacylation is required for regulatory methylation of this tRNA

    PubMed Central

    Kim, Jin Young; Carlson, Bradley A.; Xu, Xue-Ming; Zeng, Yu; Chen, Shawn; Gladyshev, Vadim N.; Lee, Byeong Jae; Hatfield, Dolph L.

    2011-01-01

    There are two isoforms of selenocysteine (Sec) tRNA[Ser]Sec that differ by a single methyl group, Um34. The non-Um34 isoform supports the synthesis of a subclass of selenoproteins, designated housekeeping, while the Um34 isoform supports the expression of another subclass, designated stress-related selenoproteins. Herein, we investigated the relationship between tRNA[Ser]Sec aminoacylation and Um34 synthesis which is the last step in the maturation of this tRNA. Mutation of the discriminator base at position 73 in tRNA[Ser]Sec dramatically reduced aminoacylation with serine, as did an inhibitor of seryl-tRNA synthetase, SB-217452. Although both the mutation and the inhibitor prevented Um34 synthesis, neither precluded the synthesis of any other of the known base modifications on tRNA[Ser]Sec following microinjection and incubation of the mutant tRNA[Ser]Sec transcript, or the wild type transcript along with inhibitor, in Xenopus oocytes. The data demonstrate that Sec tRNA[Ser]Sec must be aminoacylated for Um34 addition. The fact that selenium is required for Um34 methylation suggests that Sec must be attached to its tRNA for Um34 methylation. This would explain why selenium is essential for the function of Um34 methylase and provides further insights into the hierarchy of selenoprotein expression. PMID:21624347

  7. CO2 – Intrinsic Product, Essential Substrate, and Regulatory Trigger of Microbial and Mammalian Production Processes

    PubMed Central

    Blombach, Bastian; Takors, Ralf

    2015-01-01

    Carbon dioxide formation mirrors the final carbon oxidation steps of aerobic metabolism in microbial and mammalian cells. As a consequence, CO2/HCO3− dissociation equilibria arise in fermenters by the growing culture. Anaplerotic reactions make use of the abundant CO2/HCO3− levels for refueling citric acid cycle demands and for enabling oxaloacetate-derived products. At the same time, CO2 is released manifold in metabolic reactions via decarboxylation activity. The levels of extracellular CO2/HCO3− depend on cellular activities and physical constraints such as hydrostatic pressures, aeration, and the efficiency of mixing in large-scale bioreactors. Besides, local CO2/HCO3− levels might also act as metabolic inhibitors or transcriptional effectors triggering regulatory events inside the cells. This review gives an overview about fundamental physicochemical properties of CO2/HCO3− in microbial and mammalian cultures effecting cellular physiology, production processes, metabolic activity, and transcriptional regulation. PMID:26284242

  8. Overview of the Regulatory Oversight Implemented by the French Regulatory Authorities for the Clinical Investigation of Gene Therapy and Cell Therapy Products.

    PubMed

    Lucas-Samuel, Sophie; Ferry, Nicolas; Trouvin, Jean-Hugues

    2015-01-01

    Advanced therapy medicinal products, a new class of products with promising therapeutic effects, have been classified as medicinal products and as such should be developed according to a well-structured development plan, to establish their quality, safety and efficacy profile and conclude, at the time of the marketing authorisation evaluation, on a positive risk/benefit balance for patients. An important part of this development plan is achieved through clinical trials, which have also to be approved according to a well-established regulatory process, prior any initiation. This chapter is dedicated to describe the regulatory pathway to be followed in France, before initiating any clinical trial with those investigational advanced therapy medicinal products. In France, to get the final authorisation to initiate a clinical trial, the legislation imposes to run in parallel two independent but complementary authorisation procedures. The first procedure is aimed at assessing the ethical aspect of the biomedical research, while the second has to review the safety and regulatory aspects. A third procedure has to be envisaged where in case the investigational product consists or contains a genetically modified organism. The French system herein described is in line with the EU regulation on clinical trial and follows the respective deadlines for granting the final approval. The complexity of the procedure is in fact more due to the complexity of the products and protocols to be assessed than to the procedure itself which is now very close to the well-known procedure applied routinely for more conventional chemical or biological candidate medicinal products.

  9. MicroRNA regulatory pathway analysis identifies miR-142-5p as a negative regulator of TGF-β pathway via targeting SMAD3

    PubMed Central

    Huang, Wei; Liu, Hui; Zhang, Hong-Mei; Li, Qiubai; Chen, Zhichao; Guo, An-Yuan

    2016-01-01

    MicroRNAs (miRNAs) are non-coding RNAs with functions of posttranscriptional regulation. The abnormally expressed miRNAs have been shown to be crucial contributors and may serve as biomarkers in many diseases. However, determining the biological function of miRNAs is an ongoing challenge. By combining miRNA targets prediction, miRNA and mRNA expression profiles in TCGA cancers, and pathway data, we performed a miRNA-pathway regulation inference by Fisher's exact test for enrichment analysis. Then we constructed a database to show the cancer related miRNA-pathway regulatory network (http://bioinfo.life.hust.edu.cn/miR_path). As one of the miRNAs targeting many cancer related pathways, miR-142-5p potentially regulates the maximum number of genes in TGF-β signaling pathway. We experimentally confirmed that miR-142-5p directly targeted and suppressed SMAD3, a key component in TGF-β signaling. Ectopic overexpression of miR-142-5p significantly promoted tumor cell proliferation and inhibited apoptosis, while silencing of miR-142-5p inhibited the tumor cell proliferation and promoted apoptosis in vitro. These findings indicate that miR-142-5p plays as a negative regulator in TGF-β pathway by targeting SMAD3 and suppresses TGF-β-induced growth inhibition in cancer cells. Our study proved the feasibility of miRNA regulatory pathway analysis and shed light on combining bioinformatics with experiments in the research of complex diseases. PMID:27683030

  10. A comparison of immunotoxic effects of nanomedicinal products with regulatory immunotoxicity testing requirements

    PubMed Central

    Giannakou, Christina; Park, Margriet VDZ; de Jong, Wim H; van Loveren, Henk; Vandebriel, Rob J; Geertsma, Robert E

    2016-01-01

    Nanomaterials (NMs) are attractive for biomedical and pharmaceutical applications because of their unique physicochemical and biological properties. A major application area of NMs is drug delivery. Many nanomedicinal products (NMPs) currently on the market or in clinical trials are most often based on liposomal products or polymer conjugates. NMPs can be designed to target specific tissues, eg, tumors. In virtually all cases, NMPs will eventually reach the immune system. It has been shown that most NMs end up in organs of the mononuclear phagocytic system, notably liver and spleen. Adverse immune effects, including allergy, hypersensitivity, and immunosuppression, have been reported after NMP administration. Interactions of NMPs with the immune system may therefore constitute important side effects. Currently, no regulatory documents are specifically dedicated to evaluate the immunotoxicity of NMs or NMPs. Their immunotoxicity assessment is performed based on existing guidelines for conventional substances or medicinal products. Due to the unique properties of NMPs when compared with conventional medicinal products, it is uncertain whether the currently prescribed set of tests provides sufficient information for an adequate evaluation of potential immunotoxicity of NMPs. The aim of this study was therefore, to compare the current regulatory immunotoxicity testing requirements with the accumulating knowledge on immunotoxic effects of NMPs in order to identify potential gaps in the safety assessment. This comparison showed that immunotoxic effects, such as complement activation-related pseudoallergy, myelosuppression, inflammasome activation, and hypersensitivity, are not readily detected by using current testing guidelines. Immunotoxicity of NMPs would be more accurately evaluated by an expanded testing strategy that is equipped to stratify applicable testing for the various types of NMPs. PMID:27382281

  11. A comparison of immunotoxic effects of nanomedicinal products with regulatory immunotoxicity testing requirements.

    PubMed

    Giannakou, Christina; Park, Margriet Vdz; de Jong, Wim H; van Loveren, Henk; Vandebriel, Rob J; Geertsma, Robert E

    2016-01-01

    Nanomaterials (NMs) are attractive for biomedical and pharmaceutical applications because of their unique physicochemical and biological properties. A major application area of NMs is drug delivery. Many nanomedicinal products (NMPs) currently on the market or in clinical trials are most often based on liposomal products or polymer conjugates. NMPs can be designed to target specific tissues, eg, tumors. In virtually all cases, NMPs will eventually reach the immune system. It has been shown that most NMs end up in organs of the mononuclear phagocytic system, notably liver and spleen. Adverse immune effects, including allergy, hypersensitivity, and immunosuppression, have been reported after NMP administration. Interactions of NMPs with the immune system may therefore constitute important side effects. Currently, no regulatory documents are specifically dedicated to evaluate the immunotoxicity of NMs or NMPs. Their immunotoxicity assessment is performed based on existing guidelines for conventional substances or medicinal products. Due to the unique properties of NMPs when compared with conventional medicinal products, it is uncertain whether the currently prescribed set of tests provides sufficient information for an adequate evaluation of potential immunotoxicity of NMPs. The aim of this study was therefore, to compare the current regulatory immunotoxicity testing requirements with the accumulating knowledge on immunotoxic effects of NMPs in order to identify potential gaps in the safety assessment. This comparison showed that immunotoxic effects, such as complement activation-related pseudoallergy, myelosuppression, inflammasome activation, and hypersensitivity, are not readily detected by using current testing guidelines. Immunotoxicity of NMPs would be more accurately evaluated by an expanded testing strategy that is equipped to stratify applicable testing for the various types of NMPs.

  12. Relation between mRNA expression and sequence information in Desulfovibrio vulgaris: Combinatorial contributions of upstream regulatory motifs and coding sequence features to variations in mRNA abundance

    SciTech Connect

    Wu, Gang; Nie, Lei; Zhang, Weiwen

    2006-05-26

    ABSTRACT-The context-dependent expression of genes is the core for biological activities, and significant attention has been given to identification of various factors contributing to gene expression at genomic scale. However, so far this type of analysis has been focused whether on relation between mRNA expression and non-coding sequence features such as upstream regulatory motifs or on correlation between mRN abundance and non-random features in coding sequences (e.g. codon usage and amino acid usage). In this study multiple regression analyses of the mRNA abundance and all sequence information in Desulfovibrio vulgaris were performed, with the goal to investigate how much coding and non-coding sequence features contribute to the variations in mRNA expression, and in what manner they act together...

  13. Regulatory Notes on Impact of Excipients on Drug Products and the Maillard Reaction.

    PubMed

    Chowdhury, Dipak K; Sarker, Haripada; Schwartz, Paul

    2017-09-25

    In general, it is an important criterion that excipients remain inert throughout the shelf life of the formulated pharmaceutical product. However, depending on the functionality in chemical structure of active drug and excipients, they may undergo interaction. The well-known Maillard reaction occurs between a primary amine with lactose at high temperature to produce brown pigments. The reactivity of Maillard reaction may vary depending on the concentration as well as other conditions. Commercially, there are products where the active pharmaceutical ingredient is a primary amine and contains less than 75% lactose along with inactive excipients. This product does not show Maillard reaction during its shelf life of around 2 years at ambient conditions. However, when the same type of product contains more than 95 % lactose as an excipient, then there is a possibility of interactions though it is not visible in the initial year. Therefore, this regulatory note discusses involvement of different factors of a known drug-excipient interactions with case studies and provides an overview on how the concentration of lactose in the pharmaceutical product is important in addition to temperature and moisture in Maillard reaction.

  14. The novel regulatory ncRNA, NfiS, optimizes nitrogen fixation via base pairing with the nitrogenase gene nifK mRNA in Pseudomonas stutzeri A1501.

    PubMed

    Zhan, Yuhua; Yan, Yongliang; Deng, Zhiping; Chen, Ming; Lu, Wei; Lu, Chao; Shang, Liguo; Yang, Zhimin; Zhang, Wei; Wang, Wei; Li, Yun; Ke, Qi; Lu, Jiasi; Xu, Yuquan; Zhang, Liwen; Xie, Zhihong; Cheng, Qi; Elmerich, Claudine; Lin, Min

    2016-07-26

    Unlike most Pseudomonas, the root-associated bacterium Pseudomonas stutzeri A1501 fixes nitrogen after the horizontal acquisition of a nitrogen-fixing (nif) island. A genome-wide search for small noncoding RNAs (ncRNAs) in P. stutzeri A1501 identified the novel P. stutzeri-specific ncRNA NfiS in the core genome, whose synthesis was significantly induced under nitrogen fixation or sorbitol stress conditions. The expression of NfiS was RNA chaperone Hfq-dependent and activated by the sigma factor RpoN/global nitrogen activator NtrC/nif-specific activator NifA regulatory cascade. The nfiS-deficient mutant displayed reduced nitrogenase activity, as well as increased sensitivity to multiple stresses, such as osmotic and oxidative stresses. Secondary structure prediction and complementation studies confirmed that a stem-loop structure was essential for NfiS to regulate the nitrogenase gene nifK mRNA synthesis and thus nitrogenase activity. Microscale thermophoresis and physiological analysis showed that NfiS directly pairs with nifK mRNA and ultimately enhances nitrogenase activity by increasing the translation efficiency and the half-life of nifK mRNA. Our data also suggest structural and functional divergence of NfiS evolution in diazotrophic and nondiazotrophic backgrounds. It is proposed that NfiS was recruited by nifK mRNA as a novel regulator to integrate the horizontally acquired nif island into host global networks.

  15. [Regulatory science research to facilitate the development of cell/tissue-processed products].

    PubMed

    Sato, Yoji; Tsutsumi, Hideki; Sawada, Rumi; Suzuki, Takayoshi; Yasuda, Satoshi

    2013-01-01

    Regenerative medicine is regarded as innovative therapy for severe diseases and damages caused by tissue loss and functional impairment. In Japan, regenerative medicine is one of the most important subjects issued by Council for Science and Technology Policy and also referred to in Medical Innovation of New Growth Strategy. Cell/tissue-processed products are living cells, which have been manipulated or processed for the purpose of regenerative medicine, and are extensively developing. Human somatic cells, somatic stem cells, embryonic stem cells, and induced pluripotent stem cells are cell sources used for regenerative medicine. Since we lack in experiences with cell/tissue-processed products, technical development of safety and quality assessment is urgently needed. National Institute of Health Sciences has carried out a mission of Regulatory Science and worked on safety assessment of pharmaceuticals and medical devices and their guideline development. The objective of our study is to develop safety and quality assessment methods for cell/tissue-processed products derived from stem cells, based on recent progresses in life science. We are currently developing methods to evaluate products as follows; a) useful and quantitative tumorigenicity tests to detect contamination of undifferentiated and/or abnormal cells in products, b) quality assessment by gene expression analysis and detection of genetic stability in a manufacturing process, and c) analysis of quality attributes associated with propensity of undifferentiated cells to set acceptable criteria of cell banks. We will be able to provide indicators to control the quality, efficacy and safety of stem cell-processed products and support efficient and economical promotion of the products. Especially, this study would help translate stem cell science into therapeutic products to patients with severe and life-threatening diseases, consequently contributing to administrative policy of Ministry of Health, Labor and

  16. Identification of condition-specific regulatory modules through multi-level motif and mRNA expression analysis

    PubMed Central

    Chen, Li; Wang, Yue; Hoffman, Eric P.; Riggins, Rebecca B.; Clarke, Robert

    2013-01-01

    Many computational methods for identification of transcription regulatory modules often result in many false positives in practice due to noise sources of binding information and gene expression profiling data. In this paper, we propose a multi-level strategy for condition-specific gene regulatory module identification by integrating motif binding information and gene expression data through support vector regression and significant analysis. We have demonstrated the feasibility of the proposed method on a yeast cell cycle data set. The study on a breast cancer microarray data set shows that it can successfully identify the significant and reliable regulatory modules associated with breast cancer. PMID:20054984

  17. Abnormal rapid non-linear RNA production induced by T7 RNA polymerase in the absence of an exogenous DNA template

    NASA Astrophysics Data System (ADS)

    Kakimoto, Y.; Fujinuma, A.; Fujita, S.; Kikuchi, Y.; Umekage, S.

    2015-02-01

    Although recombinant T7 RNA polymerase is commonly used for in vitro RNA synthesis, several reports have pointed out that T7 RNA polymerase can also induce RNA-directed RNA polymerization or replication. In addition, here we show a new aberrant transcription when using T7 RNA polymerase. This polymerization was observed in the presence of both ribonucleotides and a purchasable T7 RNA polymerase, Thermo T7 RNA polymerase, as well as in the absence of an exogenous DNA template. This cryptic RNA production was detectable after several hours of incubation and was inhibited by adding DNase I. These findings suggested that some contaminated DNA along with the Thermo stable T7 RNA polymerase could be used as template DNA. However, to our surprise, RNA production showed a rapid non-linear increase. This finding strongly indicated that a self-replication cycle emerged from the RNA-directed polymerization or replication by T7 RNA polymerase, triggering the abnormal explosive increase.

  18. miRTrail--a comprehensive webserver for analyzing gene and miRNA patterns to enhance the understanding of regulatory mechanisms in diseases.

    PubMed

    Laczny, Cedric; Leidinger, Petra; Haas, Jan; Ludwig, Nicole; Backes, Christina; Gerasch, Andreas; Kaufmann, Michael; Vogel, Britta; Katus, Hugo A; Meder, Benjamin; Stähler, Cord; Meese, Eckart; Lenhof, Hans-Peter; Keller, Andreas

    2012-02-22

    Expression profiling provides new insights into regulatory and metabolic processes and in particular into pathogenic mechanisms associated with diseases. Besides genes, non-coding transcripts as microRNAs (miRNAs) gained increasing relevance in the last decade. To understand the regulatory processes of miRNAs on genes, integrative computer-aided approaches are essential, especially in the light of complex human diseases as cancer. Here, we present miRTrail, an integrative tool that allows for performing comprehensive analyses of interactions of genes and miRNAs based on expression profiles. The integrated analysis of mRNA and miRNA data should generate more robust and reliable results on deregulated pathogenic processes and may also offer novel insights into the regulatory interactions between miRNAs and genes. Our web-server excels in carrying out gene sets analysis, analysis of miRNA sets as well as the combination of both in a systems biology approach. To this end, miRTrail integrates information on 20.000 genes, almost 1.000 miRNAs, and roughly 280.000 putative interactions, for Homo sapiens and accordingly for Mus musculus and Danio rerio. The well-established, classical Chi-squared test is one of the central techniques of our tool for the joint consideration of miRNAs and their targets. For interactively visualizing obtained results, it relies on the network analyzers and viewers BiNA or Cytoscape-web, also enabling direct access to relevant literature. We demonstrated the potential of miRTrail by applying our tool to mRNA and miRNA data of malignant melanoma. MiRTrail identified several deregulated miRNAs that target deregulated mRNAs including miRNAs hsa-miR-23b and hsa-miR-223, which target the highest numbers of deregulated mRNAs and regulate the pathway "basal cell carcinoma". In addition, both miRNAs target genes like PTCH1 and RASA1 that are involved in many oncogenic processes. The application on melanoma samples demonstrates that the mi

  19. The Cutoff protein regulates piRNA cluster expression and piRNA production in the Drosophila germline

    PubMed Central

    Pane, Attilio; Jiang, Peng; Zhao, Dorothy Yanling; Singh, Mona; Schüpbach, Trudi

    2011-01-01

    In a broad range of organisms, Piwi-interacting RNAs (piRNAs) have emerged as core components of a surveillance system that protects the genome by silencing transposable and repetitive elements. A vast proportion of piRNAs is produced from discrete genomic loci, termed piRNA clusters, which are generally embedded in heterochromatic regions. The molecular mechanisms and the factors that govern their expression are largely unknown. Here, we show that Cutoff (Cuff), a Drosophila protein related to the yeast transcription termination factor Rai1, is essential for piRNA production in germline tissues. Cuff accumulates at centromeric/pericentromeric positions in germ-cell nuclei and strongly colocalizes with the major heterochromatic domains. Remarkably, we show that Cuff is enriched at the dual-strand piRNA cluster 1/42AB and is likely to be involved in regulation of transcript levels of similar loci dispersed in the genome. Consistent with this observation, Cuff physically interacts with the Heterochromatin Protein 1 (HP1) variant Rhino (Rhi). Our results unveil a link between Cuff activity, heterochromatin assembly and piRNA cluster expression, which is critical for stem-cell and germ-cell development in Drosophila. PMID:21952049

  20. A HuD-ZBP1 ribonucleoprotein complex localizes GAP-43 mRNA into axons through its 3' untranslated region AU-rich regulatory element.

    PubMed

    Yoo, Soonmoon; Kim, Hak H; Kim, Paul; Donnelly, Christopher J; Kalinski, Ashley L; Vuppalanchi, Deepika; Park, Michael; Lee, Seung J; Merianda, Tanuja T; Perrone-Bizzozero, Nora I; Twiss, Jeffery L

    2013-09-01

    Localized translation of axonal mRNAs contributes to developmental and regenerative axon growth. Although untranslated regions (UTRs) of many different axonal mRNAs appear to drive their localization, there has been no consensus RNA structure responsible for this localization. We recently showed that limited expression of ZBP1 protein restricts axonal localization of both β-actin and GAP-43 mRNAs. β-actin 3'UTR has a defined element for interaction with ZBP1, but GAP-43 mRNA shows no homology to this RNA sequence. Here, we show that an AU-rich regulatory element (ARE) in GAP-43's 3'UTR is necessary and sufficient for its axonal localization. Axonal GAP-43 mRNA levels increase after in vivo injury, and GAP-43 mRNA shows an increased half-life in regenerating axons. GAP-43 mRNA interacts with both HuD and ZBP1, and HuD and ZBP1 co-immunoprecipitate in an RNA-dependent fashion. Reporter mRNA with the GAP-43 ARE competes with endogenous β-actin mRNA for axonal localization and decreases axon length and branching similar to the β-actin 3'UTR competing with endogenous GAP-43 mRNA. Conversely, over-expressing GAP-43 coding sequence with its 3'UTR ARE increases axonal elongation and this effect is lost when just the ARE is deleted from GAP-43's 3'UTR. We have recently found that over-expression of GAP-43 using an axonally targeted construct with the 3'UTRs of GAP-43 promoted elongating growth of axons, while restricting the mRNA to the cell body with the 3'UTR of γ-actin had minimal effect on axon length. In this study, we show that the ARE in GAP-43's 3'UTR is responsible for localization of GAP-43 mRNA into axons and is sufficient for GAP-43 protein's role in elongating axonal growth.

  1. Inheritable stimulatory effects of caffeine on steroidogenic acute regulatory protein expression and cortisol production in human adrenocortical cells.

    PubMed

    Ping, Jie; Lei, You-Ying; Liu, Lian; Wang, Ting-ting; Feng, Ying-hong; Wang, Hui

    2012-01-05

    Caffeine is the most widely consumed psychoactive substance in the world. It can elevate the level of glucocorticoid which is involved in metabolism regulation, stress response, and immune function. However, the specific mechanism has yet to be elucidated. Glucocorticoid is steroid hormone synthesized in adrenal cortex and the key rate-limiting step in its biosynthesis is mediated by steroidogenic acute regulatory protein (StAR). This study was designed to investigate the direct effects and inheritable epigenetic mechanisms of caffeine on cortisol production and StAR expression in human adrenocortical cells. The human adrenocortical cell line NCI-H295A was cultured with 0.4-40μM caffeine. There was a significant increase of the cortisol production in cells. In both acutely and chronically caffeine-treated cell groups, mRNA and protein expressions of StAR were stimulated in a dose-dependent manner. DNA methylation detection via bisulfite-sequencing PCR (BSP) uncovered a single site CpG demethylation at nt -682 within the StAR promoter region. Then we investigated how long the increased StAR expression and the single CpG demethylation could last. The caffeine was withdrawn after 48h of treatment and then the cells were continually subcultured for up to 5 and 10 passages, respectively. The results showed that the StAR expression at post-caffeine passage 10 still increased, as compared with that in the control. The caffeine-induced demethylation at nt -682 in StAR promoter underwent a similar time course as StAR expression does. The present study reveals the direct effect and possible inheritable epigenetic mechanism of caffeine on steroidogenesis in human adrenocortical cells and has implications for our understanding of the consumption of caffeine. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.

  2. Gender-specific Regulatory Challenges to Product Approval: a panel discussion.

    PubMed

    McGregor, Alyson J; Barr, Helen; Greenberg, Marna R; Safdar, Basmah; Wildgoose, Peter; Wright, David W; Hollander, Judd E

    2014-12-01

    On May 13, 2014, a 1-hour panel discussion session titled "Gender-specific Regulatory Challenges to Product Approval" was held during the Academic Emergency Medicine consensus conference, "Gender-specific Research in Emergency Medicine: Investigate, Understand, and Translate How Gender Affects Patient Outcomes." The session sought to bring together leaders in emergency medicine (EM) research, authors, and reviewers in EM research publications, as well as faculty, fellows, residents, and students engaged in research and clinical practice. A panel was convened involving a representative from the Office of Women's Health of the U.S. Food and Drug Administration, two pharmaceutical executives, and a clinical EM researcher. The moderated discussion also involved audience members who contributed significantly to the dialogue. Historical background leading up to the session along with the main themes of the discussion are reproduced in this article. These revolve around sex- and gender-specific research, statistical analysis of sex and gender, clinical practice, financial costs associated with pharmaceutical development, adaptive design, and specific recommendations on the regulatory process as it affects the specialty of EM.

  3. Gender-specific Regulatory Challenges to Product Approval: A Panel Discussion

    PubMed Central

    McGregor, Alyson J.; Barr, Helen; Greenberg, Marna Rayl; Safdar, Basmah; Wildgoose, Peter; Wright, David W.; Hollander, Judd E.

    2015-01-01

    On May 13, 2014, a 1-hour panel discussion session titled “Gender-Specific Regulatory Challenges to Product Approval” was held during the Academic Emergency Medicine consensus conference, “Gender-Specific Research in Emergency Medicine: Investigate, Understand, and Translate How Gender Affects Patient Outcomes.” The session sought to bring together leaders in emergency medicine (EM) research, authors, and reviewers in EM research publications, as well as faculty, fellows, residents, and students engaged in research and clinical practice. A panel was convened involving a representative from the Office of Women’s Health of the U.S. Food and Drug Administration, two pharmaceutical executives, and a clinical EM researcher. The moderated discussion also involved audience members who contributed significantly to the dialogue. Historical background leading up to the session along with the main themes of the discussion are reproduced in this article. These revolve around sex- and gender-specific research, statistical analysis of sex and gender, clinical practice, financial costs associated with pharmaceutical development, adaptive design, and specific recommendations on the regulatory process as it affects the specialty of EM. PMID:25443664

  4. Removal of the cardiac myosin regulatory light chain increases isometric force production

    PubMed Central

    Pant, Kiran; Watt, James; Greenberg, Michael; Jones, Michelle; Szczesna-Cordary, Danuta; Moore, Jeffrey R.

    2009-01-01

    The myosin neck, which is supported by the interactions between light chains and the underlying α-helical heavy chain, is thought to act as a lever arm to amplify movements originating in the globular motor domain. Here, we studied the role of the cardiac myosin regulatory light chains (RLCs) in the capacity of myosin to produce force using a novel optical-trap-based isometric force in vitro motility assay. We measured the isometric force and actin filament velocity for native porcine cardiac (PC) myosin, RLC-depleted PC (PCdepl) myosin, and PC myosin reconstituted with recombinant bacterially expressed human cardiac RLC (PCrecon). RLC depletion reduced unloaded actin filament velocity by 58% and enhanced the myosin-based isometric force ∼2-fold. No significant change between PC and PCdepl preparations was observed in the maximal rate of actin-activated myosin ATPase activity. Reconstitution of PCdepl myosin with human RLC partially restored the velocity and force levels to near untreated values. The reduction in unloaded velocity after RLC extraction is consistent with the myosin neck acting as a lever, while the enhancement in isometric force can be directly related to enhancement of unitary force. The force data are consistent with a model in which the neck region behaves as a cantilevered beam.—Pant, K., Watt, J., Greenberg, M., Jones, M., Szczesna-Cordary, D., Moore, J. R. Removal of the cardiac myosin regulatory light chain increases isometric force production. PMID:19470801

  5. Molecular cloning, DNA structure, and RNA analysis of the arginase gene in Saccharomyces cerevisiae. A study of cis-dominant regulatory mutations.

    PubMed Central

    Jauniaux, J C; Dubois, E; Vissers, S; Crabeel, M; Wiame, J M

    1982-01-01

    The Saccharomyces cerevisiae gene cargA + or CAR1 , encoding arginase has been cloned by recovering function in transformed yeast cells. It was used to analyse RNA and chromosomal DNA from six strains bearing cis-dominant regulatory mutations leading to constitutive arginase synthesis. The DNA from the four cargA + O- strains in which constitutive arginase synthesis was independent of the mating-type functions showed no detectable differences with the wild- typye . The cargA + O- mutations were, therefore, small alterations, possibly single base substitutions. On the other hand, the cargA + Oh-1 and cargA + Oh-2 mutations, leading to a constitutive and mating-type dependent arginase synthesis, were identified as insertions. Their size and restriction pattern strongly suggested that they were induced by the Ty1 yeast transposable element. This was confirmed by cloning and analysis of the cargA + Oh-1 mutant gene. The concentration of arginase RNA was significantly increased in the mutants, indicating that the regulation of arginase synthesis was exerted, at least in part, at the level of RNA synthesis or stability. In the cargA + Oh-2 strain the Ty1 element was located at a distance of approximately 600 base pairs from the insertion present in the cargA + Oh-1 strain. This result suggests either a surprisingly large arginase regulatory region or an indirect influence of the Ty1 element on gene expression over long distances. Images Fig. 2. Fig. 3. Fig. 4. PMID:6329729

  6. Molecular cloning, DNA structure, and RNA analysis of the arginase gene in Saccharomyces cerevisiae. A study of cis-dominant regulatory mutations.

    PubMed

    Jauniaux, J C; Dubois, E; Vissers, S; Crabeel, M; Wiame, J M

    1982-01-01

    The Saccharomyces cerevisiae gene cargA + or CAR1 , encoding arginase has been cloned by recovering function in transformed yeast cells. It was used to analyse RNA and chromosomal DNA from six strains bearing cis-dominant regulatory mutations leading to constitutive arginase synthesis. The DNA from the four cargA + O- strains in which constitutive arginase synthesis was independent of the mating-type functions showed no detectable differences with the wild- typye . The cargA + O- mutations were, therefore, small alterations, possibly single base substitutions. On the other hand, the cargA + Oh-1 and cargA + Oh-2 mutations, leading to a constitutive and mating-type dependent arginase synthesis, were identified as insertions. Their size and restriction pattern strongly suggested that they were induced by the Ty1 yeast transposable element. This was confirmed by cloning and analysis of the cargA + Oh-1 mutant gene. The concentration of arginase RNA was significantly increased in the mutants, indicating that the regulation of arginase synthesis was exerted, at least in part, at the level of RNA synthesis or stability. In the cargA + Oh-2 strain the Ty1 element was located at a distance of approximately 600 base pairs from the insertion present in the cargA + Oh-1 strain. This result suggests either a surprisingly large arginase regulatory region or an indirect influence of the Ty1 element on gene expression over long distances.

  7. Transgene mobilization and regulatory uncertainty for non-GE fruit products of transgenic rootstocks.

    PubMed

    Haroldsen, Victor M; Chi-Ham, Cecilia L; Bennett, Alan B

    2012-10-31

    Genetically engineered (GE) rootstocks may offer some advantages for biotechnology applications especially in woody perennial crops such as grape or walnut. Transgrafting combines horticultural grafting practices with modern GE methods for crop improvement. Here, a non-GE conventional scion (upper stem portion) is grafted onto a transgenic GE rootstock. Thus, the scion does not contain the genetic modification present in the rootstock genome. We examined transgene presence in walnut and tomato GE rootstocks and non-GE fruit-bearing scions. Mobilization of transgene DNA, protein, and mRNA across the graft was not detected. Though transgenic siRNA mobilization was not observed in grafted tomatoes or walnut scions, transgenic siRNA signal was detected in walnut kernels. Prospective benefits from transgrafted plants include minimized risk of GE pollen flow (Lev-Yadun and Sederoff, 2001), possible use of more than one scion per approved GE rootstock which could help curb the estimated US$136 million (CropLife International, 2011) cost to bring a GE crop to international markets, as well as potential for improved consumer and market acceptance since the consumable product is not itself GE. Thus, transgrafting provides an alternative option for agricultural industries wishing to expand their biotechnology portfolio.

  8. Region-specific RNA m(6)A methylation represents a new layer of control in the gene regulatory network in the mouse brain.

    PubMed

    Chang, Mengqi; Lv, Hongyi; Zhang, Weilong; Ma, Chunhui; He, Xue; Zhao, Shunli; Zhang, Zhi-Wei; Zeng, Yi-Xin; Song, Shuhui; Niu, Yamei; Tong, Wei-Min

    2017-09-01

    N(6)-methyladenosine (m(6)A) is the most abundant epitranscriptomic mark found on mRNA and has important roles in various physiological processes. Despite the relatively high m(6)A levels in the brain, its potential functions in the brain remain largely unexplored. We performed a transcriptome-wide methylation analysis using the mouse brain to depict its region-specific methylation profile. RNA methylation levels in mouse cerebellum are generally higher than those in the cerebral cortex. Heterogeneity of RNA methylation exists across different brain regions and different types of neural cells including the mRNAs to be methylated, their methylation levels and methylation site selection. Common and region-specific methylation have different preferences for methylation site selection and thereby different impacts on their biological functions. In addition, high methylation levels of fragile X mental retardation protein (FMRP) target mRNAs suggest that m(6)A methylation is likely to be used for selective recognition of target mRNAs by FMRP in the synapse. Overall, we provide a region-specific map of RNA m(6)A methylation and characterize the distinct features of specific and common methylation in mouse cerebellum and cerebral cortex. Our results imply that RNA m(6)A methylation is a newly identified element in the region-specific gene regulatory network in the mouse brain. © 2017 The Authors.

  9. Phage φ29 Regulatory Protein p4 Stabilizes the Binding of the RNA Polymerase to the Late Promoter in a Process Involving Direct Protein-Protein Contacts

    NASA Astrophysics Data System (ADS)

    Nuez, Beatriz; Rojo, Fernando; Salas, Margarita

    1992-12-01

    Transcription from the late promoter, PA3, of Bacillus subtilis phage φ29 is activated by the viral regulatory protein p4. A kinetic analysis of the activation process has revealed that the role of protein p4 is to stabilize the binding of RNA polymerase to the promoter as a closed complex without significantly affecting further steps of the initiation process. Electrophoretic band-shift assays performed with a DNA fragment spanning only the protein p4 binding site showed that RNA polymerase could efficiently retard the complex formed by protein p4 bound to the DNA. Similarly, when a DNA fragment containing only the RNA polymerase-binding region of PA3 was used, p4 greatly stimulated the binding of RNA polymerase to the DNA. These results strongly suggest that p4 and RNA polymerase contact each other at the PA3 promoter. In the light of current knowledge of the p4 activation mechanism, we propose that direct contacts between the two proteins participate in the activation process.

  10. Phage phi 29 regulatory protein p4 stabilizes the binding of the RNA polymerase to the late promoter in a process involving direct protein-protein contacts.

    PubMed

    Nuez, B; Rojo, F; Salas, M

    1992-12-01

    Transcription from the late promoter, PA3, of Bacillus subtilis phage phi 29 is activated by the viral regulatory protein p4. A kinetic analysis of the activation process has revealed that the role of protein p4 is to stabilize the binding of RNA polymerase to the promoter as a closed complex without significantly affecting further steps of the initiation process. Electrophoretic band-shift assays performed with a DNA fragment spanning only the protein p4 binding site showed that RNA polymerase could efficiently retard the complex formed by protein p4 bound to the DNA. Similarly, when a DNA fragment containing only the RNA polymerase-binding region of PA3 was used, p4 greatly stimulated the binding of RNA polymerase to the DNA. These results strongly suggest that p4 and RNA polymerase contact each other at the PA3 promoter. In the light of current knowledge of the p4 activation mechanism, we propose that direct contacts between the two proteins participate in the activation process.

  11. Natural antisense RNAs as mRNA regulatory elements in bacteria: a review on function and applications.

    PubMed

    Saberi, Fatemeh; Kamali, Mehdi; Najafi, Ali; Yazdanparast, Alavieh; Moghaddam, Mehrdad Moosazadeh

    2016-01-01

    Naturally occurring antisense RNAs are small, diffusible, untranslated transcripts that pair to target RNAs at specific regions of complementarity to control their biological function by regulating gene expression at the post-transcriptional level. This review focuses on known cases of antisense RNA control in prokaryotes and provides an overview of some natural RNA-based mechanisms that bacteria use to modulate gene expression, such as mRNA sensors, riboswitches and antisense RNAs. We also highlight recent advances in RNA-based technology. The review shows that studies on both natural and synthetic systems are reciprocally beneficial.

  12. Using RNA-Seq SNP data to reveal potential causal mutations related to pig production traits and RNA editing.

    PubMed

    Martínez-Montes, A M; Fernández, A; Pérez-Montarelo, D; Alves, E; Benítez, R M; Nuñez, Y; Óvilo, C; Ibañez-Escriche, N; Folch, J M; Fernández, A I

    2017-04-01

    RNA-Seq technology is widely used in quantitative gene expression studies and identification of non-annotated transcripts. However this technology also can be used for polymorphism detection and RNA editing in transcribed regions in an efficient and cost-effective way. This study used SNP data from an RNA-Seq assay to identify genes and mutations underlying production trait variations in an experimental pig population. The hypothalamic and hepatic transcriptomes of nine extreme animals for growth and fatness from an (Iberian × Landrace) × Landrace backcross were analyzed by RNA-Seq methodology, and SNP calling was conducted. More than 125 000 single nucleotide variants (SNVs) were identified in each tissue, and 78% were considered to be potential SNPs, those SNVs segregating in the context of this study. Potential informative SNPs were detected by considering those showing a homozygous or heterozygous genotype in one extreme group and the alternative genotype in the other group. In this way, 4396 and 1862 informative SNPs were detected in hypothalamus and liver respectively. Out of the 32 SNPs selected for validation, 25 (80%) were confirmed as actual SNPs. Association analyses for growth, fatness and premium cut yields with 19 selected SNPs were carried out, and four potential causal genes (RETSAT, COPA, RNMT and PALMD) were identified. Interestingly, new RNA editing modifications were detected and validated for the NR3C1:g.102797 (ss1985401074) and ACSM2B:g.13374 (ss1985401075) positions and for the COG3:g3.4525 (ss1985401087) modification previously identified across vertebrates, which could lead to phenotypic variation and should be further investigated.

  13. Genome-wide modeling of transcription kinetics reveals patterns of RNA production delays.

    PubMed

    Honkela, Antti; Peltonen, Jaakko; Topa, Hande; Charapitsa, Iryna; Matarese, Filomena; Grote, Korbinian; Stunnenberg, Hendrik G; Reid, George; Lawrence, Neil D; Rattray, Magnus

    2015-10-20

    Genes with similar transcriptional activation kinetics can display very different temporal mRNA profiles because of differences in transcription time, degradation rate, and RNA-processing kinetics. Recent studies have shown that a splicing-associated RNA production delay can be significant. To investigate this issue more generally, it is useful to develop methods applicable to genome-wide datasets. We introduce a joint model of transcriptional activation and mRNA accumulation that can be used for inference of transcription rate, RNA production delay, and degradation rate given data from high-throughput sequencing time course experiments. We combine a mechanistic differential equation model with a nonparametric statistical modeling approach allowing us to capture a broad range of activation kinetics, and we use Bayesian parameter estimation to quantify the uncertainty in estimates of the kinetic parameters. We apply the model to data from estrogen receptor α activation in the MCF-7 breast cancer cell line. We use RNA polymerase II ChIP-Seq time course data to characterize transcriptional activation and mRNA-Seq time course data to quantify mature transcripts. We find that 11% of genes with a good signal in the data display a delay of more than 20 min between completing transcription and mature mRNA production. The genes displaying these long delays are significantly more likely to be short. We also find a statistical association between high delay and late intron retention in pre-mRNA data, indicating significant splicing-associated production delays in many genes.

  14. The positive regulatory function of the 5'-proximal open reading frames in GCN4 mRNA can be mimicked by heterologous, short coding sequences.

    PubMed Central

    Williams, N P; Mueller, P P; Hinnebusch, A G

    1988-01-01

    Translational control of GCN4 expression in the yeast Saccharomyces cerevisiae is mediated by multiple AUG codons present in the leader of GCN4 mRNA, each of which initiates a short open reading frame of only two or three codons. Upstream AUG codons 3 and 4 are required to repress GCN4 expression in normal growth conditions; AUG codons 1 and 2 are needed to overcome this repression in amino acid starvation conditions. We show that the regulatory function of AUG codons 1 and 2 can be qualitatively mimicked by the AUG codons of two heterologous upstream open reading frames (URFs) containing the initiation regions of the yeast genes PGK and TRP1. These AUG codons inhibit GCN4 expression when present singly in the mRNA leader; however, they stimulate GCN4 expression in derepressing conditions when inserted upstream from AUG codons 3 and 4. This finding supports the idea that AUG codons 1 and 2 function in the control mechanism as translation initiation sites and further suggests that suppression of the inhibitory effects of AUG codons 3 and 4 is a general consequence of the translation of URF 1 and 2 sequences upstream. Several observations suggest that AUG codons 3 and 4 are efficient initiation sites; however, these sequences do not act as positive regulatory elements when placed upstream from URF 1. This result suggests that efficient translation is only one of the important properties of the 5' proximal URFs in GCN4 mRNA. We propose that a second property is the ability to permit reinitiation following termination of translation and that URF 1 is optimized for this regulatory function. Images PMID:3065626

  15. Regulatory and information support for evaluation of biological productivity of Ukrainian forests and climate change

    NASA Astrophysics Data System (ADS)

    Lakyda, Petro; Vasylyshyn, Roman; Lakyda, Ivan

    2013-04-01

    Stabilization and preservation of the planet's climate system today is regarded as one of the most important global political-economic, environmental and social problems of mankind. Rising concentration of carbon dioxide in the planet's atmosphere due to anthropogenic impact is the main reason leading to global climate change. Due to the above mentioned, social demands on forests are changing their biosphere role and function of natural sink of greenhouse gases becomes top priority. It is known that one of the most essential components of biological productivity of forests is their live biomass. Absorption, long-term sequestration of carbon and generation of oxygen are secured by its components. System research of its parametric structure and development of regulatory and reference information for assessment of aboveground live biomass components of trees and stands of the main forest-forming tree species in Ukraine began over twenty-five years ago at the department of forest mensuration and forest inventory of National University of Life and Environmental Sciences of Ukraine, involving staff from other research institutions. Today, regulatory and reference materials for evaluation of parametric structure of live biomass are developed for trees of the following major forest-forming tree species of Ukraine: Scots pine of natural and artificial origin, Crimean pine, Norway spruce, silver fir, pedunculate oak, European beech, hornbeam, ash, common birch, aspen and black alder (P.I. Lakyda et al., 2011). An ongoing process on development of similar regulatory and reference materials for forest stands of the abovementioned forest-forming tree species of Ukraine is secured by scientists of departments of forest management, and forest mensuration and forest inventory. The total experimental research base is 609 temporary sample plots, where 4880 model trees were processed, including 3195 model trees with estimates of live biomass components. Laboratory studies conducted

  16. New Insights into Regulatory T Cells: Exosome- and Non-Coding RNA-Mediated Regulation of Homeostasis and Resident Treg Cells

    PubMed Central

    Li, Peiyao; Liu, Changhong; Yu, Zhibin; Wu, Minghua

    2016-01-01

    Regulatory T (Treg) cells are a group of cells that are heterogeneous in origin and in functional activity. Treg cells comprise a necessary balance to adaptive immune responses. As key regulators of self-tolerance, Treg cells have been involved in a series of pathologic processes and considered as therapeutic targets. Here, we summarize recent research regarding Treg cell origins and their functional classification, highlight the role of exosomes and non-coding RNA in modulating Treg cell homeostasis, and discuss the current understanding of resident Treg cells. PMID:27999575

  17. New Insights into Regulatory T Cells: Exosome- and Non-Coding RNA-Mediated Regulation of Homeostasis and Resident Treg Cells.

    PubMed

    Li, Peiyao; Liu, Changhong; Yu, Zhibin; Wu, Minghua

    2016-01-01

    Regulatory T (Treg) cells are a group of cells that are heterogeneous in origin and in functional activity. Treg cells comprise a necessary balance to adaptive immune responses. As key regulators of self-tolerance, Treg cells have been involved in a series of pathologic processes and considered as therapeutic targets. Here, we summarize recent research regarding Treg cell origins and their functional classification, highlight the role of exosomes and non-coding RNA in modulating Treg cell homeostasis, and discuss the current understanding of resident Treg cells.

  18. The glmS ribozyme: use of a small molecule coenzyme by a gene-regulatory RNA.

    PubMed

    Ferré-D'Amaré, Adrian R

    2010-11-01

    The glmS ribozyme is the first known example of a natural ribozyme that has evolved to require binding of an exogenous small molecule for activity. In Gram-positive bacteria, this RNA domain is part of the messenger RNA (mRNA) encoding the essential enzyme that synthesizes glucosamine-6-phosphate (GlcN6P). When present at physiologic concentration, this small molecule binds to the glmS ribozyme and uncovers a latent self-cleavage activity that ultimately leads to degradation of the mRNA. Biochemical and structural studies reveal that the RNA adopts a rigid fold stabilized by three pseudoknots and the packing of a peripheral domain against the ribozyme core. GlcN6P binding to this pre-organized RNA does not induce conformational changes; rather, the small molecule functions as a coenzyme, providing a catalytically essential amine group to the active site. The ribozyme is not a passive player, however. Active site functional groups are essential for catalysis, even in the presence of GlcN6P. In addition to being a superb experimental system with which to analyze how RNA catalysts can exploit small molecule coenzymes to broaden their chemical versatility, the presence of the glmS ribozyme in numerous pathogenic bacteria make this RNA an attractive target for the development of new antibiotics and antibacterial strategies.

  19. Genetic Tools for Self-Organizing Culture of Mouse Embryonic Stem Cells via Small Regulatory RNA-Mediated Technologies, CRISPR/Cas9, and Inducible RNAi.

    PubMed

    Takata, Nozomu; Sakakura, Eriko; Sakuma, Tetsushi; Yamamoto, Takashi

    2017-01-01

    Approaches to investigate gene functions in experimental biology are becoming more diverse and reliable. Furthermore, several kinds of tissues and organs that possess their original identities can be generated in petri dishes from stem cells including embryonic, adult and induced pluripotent stem cells. Researchers now have several choices of experimental methods and their combinations to analyze gene functions in various biological systems. Here, as an example we describe one of the better protocols, which combines three-dimensional embryonic stem cell culture with small regulatory RNA-mediated technologies, clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated protein 9 (Cas9), and inducible RNA interference (RNAi). This protocol allows investigation of genes of interest to better understand gene functions in target tissues (or organs) during in vitro development.

  20. Structure of tau exon 10 splicing regulatory element RNA and destabilization by mutations of frontotemporal dementia and parkinsonism linked to chromosome 17

    PubMed Central

    Varani, Luca; Hasegawa, Masato; Spillantini, Maria Grazia; Smith, Michael J.; Murrell, Jill R.; Ghetti, Bernardino; Klug, Aaron; Goedert, Michel; Varani, Gabriele

    1999-01-01

    Coding region and intronic mutations in the tau gene cause frontotemporal dementia and parkinsonism linked to chromosome 17. Intronic mutations and some missense mutations increase splicing in of exon 10, leading to an increased ratio of four-repeat to three-repeat tau isoforms. Secondary structure predictions have led to the proposal that intronic mutations and one missense mutation destabilize a putative RNA stem-loop structure located close to the splice-donor site of the intron after exon 10. We have determined the three-dimensional structure of this tau exon 10 splicing regulatory element RNA by NMR spectroscopy. We show that it forms a stable, folded stem-loop structure whose thermodynamic stability is reduced by frontotemporal dementia and parkinsonism linked to chromosome 17 mutations and increased by compensatory mutations. By exon trapping, the reduction in thermodynamic stability is correlated with increased splicing in of exon 10. PMID:10393977

  1. Production of RNA by a polymerase protein encapsulated within phospholipid vesicles

    NASA Technical Reports Server (NTRS)

    Chakrabarti, A. C.; Breaker, R. R.; Joyce, G. F.; Deamer, D. W.

    1994-01-01

    Catalyzed polymerization reactions represent a primary anabolic activity of all cells. It can be assumed that early cells carried out such reactions, in which macromolecular catalysts were encapsulated within some type of boundary membrane. In the experiments described here, we show that a template-independent RNA polymerase (polynucleotide phosphorylase) can be encapsulated in dimyristoyl phosphatidylcholine vesicles without substrate. When the substrate adenosine diphosphate (ADP) was provided externally, long-chain RNA polymers were synthesized within the vesicles. Substrate flux was maximized by maintaining the vesicles at the phase transition temperature of the component lipid. A protease was introduced externally as an additional control. Free enzyme was inactivated under identical conditions. RNA products were visualized in situ by ethidium bromide fluorescence. The products were harvested from the liposomes, radiolabeled, and analyzed by polyacrylamide gel electrophoresis. Encapsulated catalysts represent a model for primitive cellular systems in which an RNA polymerase was entrapped within a protected microenvironment.

  2. Enzymatic production of single-molecule FISH and RNA capture probes.

    PubMed

    Gaspar, Imre; Wippich, Frank; Ephrussi, Anne

    2017-10-01

    Arrays of singly labeled short oligonucleotides that hybridize to a specific target revolutionized RNA biology, enabling quantitative, single-molecule microscopy analysis and high-efficiency RNA/RNP capture. Here, we describe a simple and efficient method that allows flexible functionalization of inexpensive DNA oligonucleotides by different fluorescent dyes or biotin using terminal deoxynucleotidyl transferase and custom-made functional group conjugated dideoxy-UTP. We show that (i) all steps of the oligonucleotide labeling-including conjugation, enzymatic synthesis, and product purification-can be performed in a standard biology laboratory, (ii) the process yields >90%, often >95% labeled product with minimal carryover of impurities, and (iii) the oligonucleotides can be labeled with different dyes or biotin, allowing single-molecule FISH, RNA affinity purification, and Northern blot analysis to be performed. © 2017 Gaspar et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  3. Production of RNA by a polymerase protein encapsulated within phospholipid vesicles

    NASA Technical Reports Server (NTRS)

    Chakrabarti, A. C.; Breaker, R. R.; Joyce, G. F.; Deamer, D. W.

    1994-01-01

    Catalyzed polymerization reactions represent a primary anabolic activity of all cells. It can be assumed that early cells carried out such reactions, in which macromolecular catalysts were encapsulated within some type of boundary membrane. In the experiments described here, we show that a template-independent RNA polymerase (polynucleotide phosphorylase) can be encapsulated in dimyristoyl phosphatidylcholine vesicles without substrate. When the substrate adenosine diphosphate (ADP) was provided externally, long-chain RNA polymers were synthesized within the vesicles. Substrate flux was maximized by maintaining the vesicles at the phase transition temperature of the component lipid. A protease was introduced externally as an additional control. Free enzyme was inactivated under identical conditions. RNA products were visualized in situ by ethidium bromide fluorescence. The products were harvested from the liposomes, radiolabeled, and analyzed by polyacrylamide gel electrophoresis. Encapsulated catalysts represent a model for primitive cellular systems in which an RNA polymerase was entrapped within a protected microenvironment.

  4. RNA polymerase gene, microorganism having said gene and the production of RNA polymerase by the use of said microorganism

    DOEpatents

    Kotani, Hirokazu; Hiraoka, Nobutsugu; Obayashi, Akira

    1991-01-01

    SP6 bacteriophage RNA polymerase is produced by cultivating a new microorganism (particularly new strains of Escherichia coli) harboring a plasmid that carries SP6 bacteriophage RNA polymerase gene and recovering SP6 bacteriophage RNA polymerase from the culture broth. SP6 bacteriophage RNA polymerase gene is provided as are new microorganisms harboring a plasmid that carries SP6 bacteriophage RNA polymerase gene.

  5. The glmS ribozyme: use of a small molecule coenzyme by a gene-regulatory RNA

    PubMed Central

    Ferré-D’Amaré, Adrian R.

    2012-01-01

    The glmS ribozyme is the first known example of a natural ribozyme that has evolved to require binding of an exogenous small molecule for activity. In Gram-positive bacteria, this RNA domain is part of the mRNA encoding the essential enzyme that synthesizes glucosamine-6-phosphate (GlcN6P). When present at physiologic concentration, this small molecule binds to the glmS ribozyme and uncovers a latent self-cleavage activity that ultimately leads to degradation of the mRNA. Biochemical and structural studies reveal that the RNA adopts a rigid fold stabilized by three pseudoknots and the packing of a peripheral domain against the ribozyme core. GlcN6P binding to this pre-organized RNA does not induce conformational changes; rather, the small molecule functions as a co-enzyme, providing a catalytically essential amine group to the active site. The ribozyme is not a passive player, however. Active site functional groups are essential for activity, even in the presence of GlcN6P. In addition to being a superb experimental system with which to analyze how RNA catalysts can exploit small molecule coenzymes to broaden their chemical versatility, the presence of the glmS ribozyme in numerous pathogenic bacteria make this RNA an attractive target for the development of new antibiotics and antibacterial strategies. PMID:20822574

  6. The small regulatory RNA FasX enhances group A Streptococcus virulence and inhibits pilus expression via serotype-specific targets.

    PubMed

    Danger, Jessica L; Cao, Tram N; Cao, Tran H; Sarkar, Poulomee; Treviño, Jeanette; Pflughoeft, Kathryn J; Sumby, Paul

    2015-04-01

    Bacterial pathogens commonly show intra-species variation in virulence factor expression and often this correlates with pathogenic potential. The group A Streptococcus (GAS) produces a small regulatory RNA (sRNA), FasX, which regulates the expression of pili and the thrombolytic agent streptokinase. As GAS serotypes are polymorphic regarding (a) FasX abundance, (b) the fibronectin, collagen, T-antigen (FCT) region of the genome, which contains the pilus genes (nine different FCT-types), and (c) the streptokinase-encoding gene (ska) sequence (two different alleles), we sought to test whether FasX regulates pilus and streptokinase expression in a serotype-specific manner. Parental, fasX mutant and complemented derivatives of serotype M1 (ska-2, FCT-2), M2 (ska-1, FCT-6), M6 (ska-2, FCT-1) and M28 (ska-1, FCT-4) isolates were compared. While FasX reduced pilus expression in each serotype, the molecular basis differed, as FasX bound, and inhibited the translation of, different FCT-region mRNAs. FasX enhanced streptokinase expression in each serotype, although the degree of regulation varied. Finally, we established that the regulation afforded by FasX enhances GAS virulence, assessed by a model of bacteremia using human plasminogen-expressing mice. Our data are the first to identify and characterize serotype-specific regulation by an sRNA in GAS, and to show an sRNA directly contributes to GAS virulence.

  7. The Regulatory Roles of MicroRNA in Effects of 2,2'4,4'-Tetrabromodiphenyl Ether (BDE47) on the Transcriptome of Zebrafish Larvae

    PubMed Central

    Zhao, Jing; Xu, Ting; Yin, Daqiang; Zhang, Bo; Bai, Jianfeng

    2017-01-01

    The developmental neurotoxicity caused by environmental pollutants has received great concern; however, there were still barely known about the underlying toxic mechanisms, especially the influence of varieties of regulatory factors such as microRNA (miRNA). A representative flame retardant, 2,2′,4,4′-tetrabromodiphenyl ether (BDE47), was found to disrupt zebrafish development in visual perception and bone formation in previous study, thus here we investigated its effects on miRNA expression profiling of 6 days post fertilization (dpf) zebrafish larvae by deep sequencing. To overcome the shortage of zebrafish miRNA annotation, multiple data processing approaches, especially constructed network based on the interactions between miRNAs and enrichment terms, were adopted and helped us acquire several validated zebrafish miRNAs and two novel miRNAs in BDE47-induced effects, and identify corresponding biological processes of the miRNAs. Among them, miR-735 was supposed to play essential roles in larval sensory development according to analysis results. Our study also provided an effective strategy for analyzing biological effects on non-mammalian miRNAs with limited basic information. PMID:28072866

  8. Unusual RNA plant virus integration in the soybean genome leads to the production of small RNAs.

    PubMed

    da Fonseca, Guilherme Cordenonsi; de Oliveira, Luiz Felipe Valter; de Morais, Guilherme Loss; Abdelnor, Ricardo Vilela; Nepomuceno, Alexandre Lima; Waterhouse, Peter M; Farinelli, Laurent; Margis, Rogerio

    2016-05-01

    Horizontal gene transfer (HGT) is known to be a major force in genome evolution. The acquisition of genes from viruses by eukaryotic genomes is a well-studied example of HGT, including rare cases of non-retroviral RNA virus integration. The present study describes the integration of cucumber mosaic virus RNA-1 into soybean genome. After an initial metatranscriptomic analysis of small RNAs derived from soybean, the de novo assembly resulted a 3029-nt contig homologous to RNA-1. The integration of this sequence in the soybean genome was confirmed by DNA deep sequencing. The locus where the integration occurred harbors the full RNA-1 sequence followed by the partial sequence of an endogenous mRNA and another sequence of RNA-1 as an inverted repeat and allowing the formation of a hairpin structure. This region recombined into a retrotransposon located inside an exon of a soybean gene. The nucleotide similarity of the integrated sequence compared to other Cucumber mosaic virus sequences indicates that the integration event occurred recently. We described a rare event of non-retroviral RNA virus integration in soybean that leads to the production of a double-stranded RNA in a similar fashion to virus resistance RNAi plants. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  9. Regulatory acceptability of the minipig in the development of pharmaceuticals, chemicals and other products.

    PubMed

    van der Laan, Jan Willem; Brightwell, John; McAnulty, Peter; Ratky, Joszef; Stark, Claudia

    2010-01-01

    As part of the RETHINK European FP6 Project an overview of the acceptability and usefulness of minipigs has been carried out in the regulatory arenas of human and veterinary pharmaceuticals, food additives, cosmetics, biocides and agrochemicals, chemicals and medical devices. The safety of new pharmaceuticals for human use should be tested in non-rodents, but the regulatory world is not too prescriptive regarding the choice of species. The choice is most often dogs through long tradition. When dogs are not appropriate, in many cases non-human primates are chosen as an alternative. From information in the public domain as well as literature from the EMA and FDA, it is clear that minipigs have already been identified as suitable to take the role of non-rodent species in toxicity testing of pharmaceutical products. In the field of foodstuffs, the pig is used more extensively because of the apparent similarity in the omnivorous food pattern and digestive tract between humans and pigs. The extensive use of pigs in this field provides historical data. In the field of medical devices the ISO Guidelines indicate that the pig is regarded as a suitable animal model because of its haematological and cardiovascular similarities to man. The pig is also mentioned as suitable for testing local effects after implantation. Political and societal support for using nonhuman primates is decreasing, and it is an appropriate time to consider the role of the minipig. We have reviewed the costs of testing in minipigs, and these are not significantly higher than the costs for a study in dogs. Economical reasons should therefore not be used to argue against the use of minipigs instead of dogs or monkeys. For most purposes, minipigs may be considered an acceptable choice as non-rodent species, provided adequate justification for this choice is made. Copyright © 2010 Elsevier Inc. All rights reserved.

  10. Building parity between brand and generic peptide products: Regulatory and scientific considerations for quality of synthetic peptides.

    PubMed

    Wu, Larisa C; Chen, Fu; Lee, Sau L; Raw, Andre; Yu, Lawrence X

    2017-02-25

    Peptides are a fast growing segment in the pharmaceutical industry. Consequently, the industry and regulatory agencies are increasing their focus on the regulatory path and quality considerations for peptide development and manufacturing. Although most peptides are synthetic, manufactured by solid phase synthesis, nevertheless they are complex molecules with challenging quality and regulatory aspects. This paper provides a structured overview of relevant quality issues for chemically synthesized peptides used as active pharmaceutical ingredients (API) in drug products. It addresses the unique characteristics of peptides pertaining to structural and physicochemical characterization, manufacturing and in process controls, impurities and aggregates arising from manufacturing and storage, along with their potential impact on safety (including immunogenicity) and efficacy of the peptide drug products.

  11. Interactions between the stratum corneum and topically applied products: regulatory, instrumental and formulation issues with focus on moisturizers.

    PubMed

    Lodén, M

    2014-09-01

    Virtually everyone in Europe will use at least one cosmetic product every day. The extensive use of cosmetics and results from measurements of quality of life in patients with skin diseases demonstrate the importance of a healthy skin. The skin is not only a barrier against desiccation and intrusion of harmful materials, but also an organ of social communication, where dry, scaly, rough stratum corneum is unappealing to touch, inducing anxiety and depression. Knowledge about the skin biochemistry and the use of noninvasive instruments facilitate the development of topical products and quantification of their effects. The presentation of the products and mode of action determine the regulatory demands and the approval process, as they can fall into different regulatory entities, such as cosmetics, medicinal products, medical devices and as other chemical products. The majority of the topical products on the market are regulated as cosmetics. For example, facial skin care and daily moisturizing routines are frequently used. However, despite visible relief of dryness symptoms, some products are reported to result in deterioration of the skin barrier function. New clinical outcomes show important clinical differences between formulations and the relapse of eczema. In a worst case scenario, treatment with a moisturizing cream may increase the risks of eczema and asthma. In the present overview, product presentations and mode of actions are reflected against the regulatory demands in Europe. The regulations are continuously revisited and new guidelines are being implemented, such as the new cosmetic regulation with advice on testing and responsible marketing.

  12. A cis-regulatory antisense RNA represses translation in Vibrio cholerae through extensive complementarity and proximity to the target locus.

    PubMed

    Chang, Howard; Replogle, John Michael; Vather, Naomi; Tsao-Wu, Maya; Mistry, Ronak; Liu, Jane M

    2015-01-01

    As with all facultative pathogens, Vibrio cholerae must optimize its cellular processes to adapt to different environments with varying carbon sources and to environmental stresses. More specifically, in order to metabolize mannitol, V. cholerae must regulate the synthesis of MtlA, a mannitol transporter protein produced exclusively in the presence of mannitol. We previously showed that a cis-acting small RNA (sRNA) expressed by V. cholerae, MtlS, appears to post-transcriptionally downregulate the expression of mtlA and is produced in the absence of mannitol. We hypothesized that since it is complementary to the 5' untranslated region (UTR) of mtlA mRNA, MtlS may affect synthesis of MtlA by forming an mtlA-MtlS complex that blocks translation of the mRNA through occlusion of its ribosome binding site. To test this hypothesis, we used in vitro translation assays in order to examine the role MtlS plays in mtlA regulation and found that MtlS is sufficient to suppress translation of transcripts harboring the 5' UTR of mtlA. However, in a cellular context, the 5' UTR of mtlA is not sufficient for targeted repression by endogenous MtlS; additional segments from the coding region of mtlA play a role in the ability of the sRNA to regulate translation of mtlA mRNA. Additionally, proximity of transcription sites between the sRNA and mRNA significantly affects the efficacy of MtlS.

  13. The autoimmunity-associated BLK haplotype exhibits cis-regulatory effects on mRNA and protein expression that are prominently observed in B cells early in development

    PubMed Central

    Simpfendorfer, Kim R.; Olsson, Lina M.; Manjarrez Orduño, Nataly; Khalili, Houman; Simeone, Alyssa M.; Katz, Matthew S.; Lee, Annette T.; Diamond, Betty; Gregersen, Peter K.

    2012-01-01

    The gene B lymphocyte kinase (BLK) is associated with rheumatoid arthritis, systemic lupus erythematosus and several other autoimmune disorders. The disease risk haplotype is known to be associated with reduced expression of BLK mRNA transcript in human B cell lines; however, little is known about cis-regulation of BLK message or protein levels in native cell types. Here, we show that in primary human B lymphocytes, cis-regulatory effects of disease-associated single nucleotide polymorphisms in BLK are restricted to naïve and transitional B cells. Cis-regulatory effects are not observed in adult B cells in later stages of differentiation. Allelic expression bias was also identified in primary human T cells from adult peripheral and umbilical cord blood (UCB), thymus and tonsil, although mRNA levels were reduced compared with B cells. Allelic regulation of Blk expression at the protein level was confirmed in UCB B cell subsets by intracellular staining and flow cytometry. Blk protein expression in CD4+ and CD8+ T cells was documented by western blot analysis; however, differences in protein expression levels by BLK genotype were not observed in any T cell subset. Blk allele expression differences at the protein level are thus restricted to early B cells, indicating that the involvement of Blk in the risk for autoimmune disease likely acts during the very early stages of B cell development. PMID:22678060

  14. Sustained translational repression of lactate dehydrogenase 1 in Toxoplasma gondii bradyzoites is conferred by a small regulatory RNA hairpin.

    PubMed

    Holmes, Michael; Itaas, Vaunell; Ananvoranich, Sirinart

    2014-11-01

    In response to environmental stresses, Toxoplasma gondii induces a global translational repression which allows for the remodeling of its transcriptome. While some transcripts are preferentially translated, another subset is translationally repressed and maintained in bradyzoites. Although little is known of how transcripts are targeted for sustained translational repression, the targeting probably operates through an RNA-centric mechanism relying on the recognition of cis-acting elements. In this study, we sought to determine if the targeting of transcripts through recognizable cis-acting elements could be responsible for the transcript-specific sustained translational repression displayed by Toxoplasma bradyzoites. We examined the UTRs of a translationally repressed gene, lactate dehydrogenase 1, and found a 40 nucleotide regulatory element in its 5'UTR. This element specifically induces translational repression in otherwise constitutively expressed transcripts. Mutational studies revealed that the formation of a small 16 nucleotide regulatory RNA hairpin is essential for this activity. We suggest that this hairpin may act as the nucleation site for the binding of an as yet to be identified trans-acting factor that allows for the transcript to be targeted for translational repression removal from the active translational pool. To our knowledge, this is the first report characterizing a specific cis-acting element contributing to post-transcriptional gene regulation in Toxoplasma and suggests the presence of a pathway by which the parasites can recognize, identify and specifically target transcripts for sustained translational repression under stressful conditions.

  15. Transcriptome-wide analysis of chromium-stress responsive microRNAs to explore miRNA-mediated regulatory networks in radish (Raphanus sativus L.)

    PubMed Central

    Liu, Wei; Xu, Liang; Wang, Yan; Shen, Hong; Zhu, Xianwen; Zhang, Keyun; Chen, Yinglong; Yu, Rugang; Limera, Cecilia; Liu, Liwang

    2015-01-01

    MicroRNAs (miRNAs) are small noncoding RNAs that play pivotal roles in plant growth, development and stress response. Chromium (Cr) is one of common environmental contaminants possessing potential health hazards to living organisms. To date, little is known about the regulatory roles of miRNAs in response to Cr stress in radish. To systematically identify Cr-responsive miRNAs and their targets in radish, two sRNA libraries derived from Cr-free (CK) and Cr-treated (Cr200) roots were constructed. With Solexa sequencing, 81 known and 72 novel miRNAs were identified, from which 54 known and 16 novel miRNAs were significantly differentially expressed under Cr stress. Several target genes for Cr-responsive miRNAs encode different transcription factor (TF) families, including SPLs, MYBs, ERFs and bZIPs, might regulate corresponding HM-related transcriptional processes in plants. Notably, a few key responsive enzymes or proteins, including HMA, YSL1 and ABC transporter protein were involved in Cr uptake and homeostasis process. Furthermore, the expression patterns of some Cr-responsive miRNAs and their targets were validated by RT-qPCR. This study represents the first characterization of Cr-responsive miRNAs and their targets in radish. The outcomes of this study could provide novel insights into miRNA-mediated regulatory mechanisms underlying plant response to Cr stress in root vegetable crops. PMID:26357995

  16. Transcriptome-wide analysis of chromium-stress responsive microRNAs to explore miRNA-mediated regulatory networks in radish (Raphanus sativus L.).

    PubMed

    Liu, Wei; Xu, Liang; Wang, Yan; Shen, Hong; Zhu, Xianwen; Zhang, Keyun; Chen, Yinglong; Yu, Rugang; Limera, Cecilia; Liu, Liwang

    2015-09-11

    MicroRNAs (miRNAs) are small noncoding RNAs that play pivotal roles in plant growth, development and stress response. Chromium (Cr) is one of common environmental contaminants possessing potential health hazards to living organisms. To date, little is known about the regulatory roles of miRNAs in response to Cr stress in radish. To systematically identify Cr-responsive miRNAs and their targets in radish, two sRNA libraries derived from Cr-free (CK) and Cr-treated (Cr200) roots were constructed. With Solexa sequencing, 81 known and 72 novel miRNAs were identified, from which 54 known and 16 novel miRNAs were significantly differentially expressed under Cr stress. Several target genes for Cr-responsive miRNAs encode different transcription factor (TF) families, including SPLs, MYBs, ERFs and bZIPs, might regulate corresponding HM-related transcriptional processes in plants. Notably, a few key responsive enzymes or proteins, including HMA, YSL1 and ABC transporter protein were involved in Cr uptake and homeostasis process. Furthermore, the expression patterns of some Cr-responsive miRNAs and their targets were validated by RT-qPCR. This study represents the first characterization of Cr-responsive miRNAs and their targets in radish. The outcomes of this study could provide novel insights into miRNA-mediated regulatory mechanisms underlying plant response to Cr stress in root vegetable crops.

  17. Dissecting the expression relationships between RNA-binding proteins and their cognate targets in eukaryotic post-transcriptional regulatory networks

    NASA Astrophysics Data System (ADS)

    Nishtala, Sneha; Neelamraju, Yaseswini; Janga, Sarath Chandra

    2016-05-01

    RNA-binding proteins (RBPs) are pivotal in orchestrating several steps in the metabolism of RNA in eukaryotes thereby controlling an extensive network of RBP-RNA interactions. Here, we employed CLIP (cross-linking immunoprecipitation)-seq datasets for 60 human RBPs and RIP-ChIP (RNP immunoprecipitation-microarray) data for 69 yeast RBPs to construct a network of genome-wide RBP- target RNA interactions for each RBP. We show in humans that majority (~78%) of the RBPs are strongly associated with their target transcripts at transcript level while ~95% of the studied RBPs were also found to be strongly associated with expression levels of target transcripts when protein expression levels of RBPs were employed. At transcript level, RBP - RNA interaction data for the yeast genome, exhibited a strong association for 63% of the RBPs, confirming the association to be conserved across large phylogenetic distances. Analysis to uncover the features contributing to these associations revealed the number of target transcripts and length of the selected protein-coding transcript of an RBP at the transcript level while intensity of the CLIP signal, number of RNA-Binding domains, location of the binding site on the transcript, to be significant at the protein level. Our analysis will contribute to improved modelling and prediction of post-transcriptional networks.

  18. Comparative RNA-Seq Analysis Reveals That Regulatory Network of Maize Root Development Controls the Expression of Genes in Response to N Stress

    PubMed Central

    Zhao, Xiongwei; Nie, Shujun; Li, Yuhua; Zhang, Zhiming; Shen, Yaou; Chen, Qi; Lu, Yanli; Lan, Hai; Zhou, Shufeng; Gao, Shibin; Pan, Guangtang; Lin, Haijian

    2016-01-01

    Nitrogen (N) is an essential nutrient for plants, and it directly affects grain yield and protein content in cereal crops. Plant root systems are not only critical for anchorage in the soil, but also for N acquisition. Therefore, genes controlling root development might also affect N uptake by plants. In this study, the responses of nitrogen on root architecture of mutant rtcs and wild-type of maize were investigated by morphological and physiological analysis. Subsequently, we performed a comparative RNA-Seq analysis to compare gene expression profiles between mutant rtcs roots and wild-type roots under different N conditions. We identified 786 co-modulated differentially expressed genes (DEGs) related to root development. These genes participated in various metabolic processes. A co-expression cluster analysis and a cis-regulatory motifs analysis revealed the importance of the AP2-EREBP transcription factor family in the rtcs-dependent regulatory network. Some genotype-specific DEGs contained at least one LBD motif in their promoter region. Further analyses of the differences in gene transcript levels between rtcs and wild-type under different N conditions revealed 403 co-modulated DEGs with distinct functions. A comparative analysis revealed that the regulatory network controlling root development also controlled gene expression in response to N-deficiency. Several AP2-EREBP family members involved in multiple hormone signaling pathways were among the DEGs. These transcription factors might play important roles in the rtcs-dependent regulatory network related to root development and the N-deficiency response. Genes encoding the nitrate transporters NRT2-1, NAR2.1, NAR2.2, and NAR2.3 showed much higher transcript levels in rtcs than in wild-type under normal-N conditions. This result indicated that the LBD gene family mainly functions as transcriptional repressors, as noted in other studies. In summary, using a comparative RNA-Seq-based approach, we identified

  19. 37 CFR 1.791 - Termination of interim extension granted prior to regulatory approval of a product for commercial...

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 37 Patents, Trademarks, and Copyrights 1 2010-07-01 2010-07-01 false Termination of interim extension granted prior to regulatory approval of a product for commercial marketing or use. 1.791 Section 1.791 Patents, Trademarks, and Copyrights UNITED STATES PATENT AND TRADEMARK OFFICE, DEPARTMENT OF COMMERCE GENERAL RULES OF PRACTICE IN PATENT...

  20. The novel regulatory ncRNA, NfiS, optimizes nitrogen fixation via base pairing with the nitrogenase gene nifK mRNA in Pseudomonas stutzeri A1501

    PubMed Central

    Zhan, Yuhua; Yan, Yongliang; Deng, Zhiping; Chen, Ming; Lu, Wei; Lu, Chao; Shang, Liguo; Yang, Zhimin; Zhang, Wei; Wang, Wei; Li, Yun; Ke, Qi; Lu, Jiasi; Xu, Yuquan; Zhang, Liwen; Xie, Zhihong; Cheng, Qi; Elmerich, Claudine; Lin, Min

    2016-01-01

    Unlike most Pseudomonas, the root-associated bacterium Pseudomonas stutzeri A1501 fixes nitrogen after the horizontal acquisition of a nitrogen-fixing (nif) island. A genome-wide search for small noncoding RNAs (ncRNAs) in P. stutzeri A1501 identified the novel P. stutzeri-specific ncRNA NfiS in the core genome, whose synthesis was significantly induced under nitrogen fixation or sorbitol stress conditions. The expression of NfiS was RNA chaperone Hfq-dependent and activated by the sigma factor RpoN/global nitrogen activator NtrC/nif-specific activator NifA regulatory cascade. The nfiS-deficient mutant displayed reduced nitrogenase activity, as well as increased sensitivity to multiple stresses, such as osmotic and oxidative stresses. Secondary structure prediction and complementation studies confirmed that a stem-loop structure was essential for NfiS to regulate the nitrogenase gene nifK mRNA synthesis and thus nitrogenase activity. Microscale thermophoresis and physiological analysis showed that NfiS directly pairs with nifK mRNA and ultimately enhances nitrogenase activity by increasing the translation efficiency and the half-life of nifK mRNA. Our data also suggest structural and functional divergence of NfiS evolution in diazotrophic and nondiazotrophic backgrounds. It is proposed that NfiS was recruited by nifK mRNA as a novel regulator to integrate the horizontally acquired nif island into host global networks. PMID:27407147

  1. Dramatic changes in 67 miRNAs during initiation of first wave of spermatogenesis in Mus musculus testis: global regulatory insights generated by miRNA-mRNA network analysis.

    PubMed

    Sree, Sreesha; Radhakrishnan, Karthika; Indu, Sivankutty; Kumar, Pradeep G

    2014-09-01

    We mapped global changes in miRNA and mRNA profiles spanning the first wave of spermatogenesis using prepubertal (Postnatal Day 8 [P8]), pubertal (P16), and adolescent (P24) Mus musculus testes and identified the differential expression of 67 miRNAs and 8226 mRNAs. These two data sets were integrated into miRNA-dependent regulatory networks based on miRWalk predictions. In a network representing the P8 to P16 transition, downregulation of four miRNAs and upregulation of 19 miRNAs were linked with 81 upregulated target mRNAs and 228 downregulated target mRNAs, respectively. Furthermore, during the P16 to P24 transition, two miRNAs were downregulated, and eight miRNAs were upregulated, which linked with 64 upregulated mRNAs and 389 downregulated mRNAs, respectively. Only three of the miRNAs present in the network (miR-34b-5p, miR-34c, and miR-449a) showed a progressive increase from P8 through P16 to P24, while the remaining miRNAs in the network showed statistically significant changes in their levels either during the P8 to P16 transition or during the P16 to P24 transition. Analysis of the chromosomal location of these differentially expressed miRNAs showed that 14 out of 25 miRNAs upregulated from P8 to P16, and 18 out of 40 miRNAs upregulated from P8 to P24 were X-linked. This is suggestive of their escape from meiotic sex chromosome inactivation and postmeiotic sex chromatin. This integrated network of miRNA-level and mRNA-level changes in mouse testis during the first wave of spermatogenesis is expected to build a base for evaluating the role of miRNA-mediated gene expression regulation in maturing mammalian testis.

  2. The regulatory mechanism underlying light-inducible production of carotenoids in nonphototrophic bacteria.

    PubMed

    Takano, Hideaki

    2016-07-01

    Light is a ubiquitous environmental factor serving as an energy source and external stimulus. Here, I review the conserved molecular mechanism of light-inducible production of carotenoids in three nonphototrophic bacteria: Streptomyces coelicolor A3(2), Thermus thermophilus HB27, and Bacillus megaterium QM B1551. A MerR family transcriptional regulator, LitR, commonly plays a central role in their light-inducible carotenoid production. Genetic and biochemical studies on LitR proteins revealed a conserved function: LitR in complex with adenosyl B12 (AdoB12) has a light-sensitive DNA-binding activity and thus suppresses the expression of the Crt biosynthesis gene cluster. The in vitro DNA-binding and transcription assays showed that the LitR-AdoB12 complex serves as a repressor allowing transcription initiation by RNA polymerase in response to illumination. The existence of novel light-inducible genes and the unique role of the megaplasmid were revealed by the transcriptomic analysis of T. thermophilus. The findings suggest that LitR is a general regulator responsible for the light-inducible carotenoid production in the phylogenetically divergent nonphototrophic bacteria, and that LitR performs diverse physiological functions in bacteria.

  3. Expressed microRNA associated with high rate of egg production in chicken ovarian follicles.

    PubMed

    Wu, N; Gaur, U; Zhu, Q; Chen, B; Xu, Z; Zhao, X; Yang, M; Li, D

    2016-10-26

    MicroRNA (miRNA) is a highly conserved class of small noncoding RNA about 19-24 nucleotides in length that function in a specific manner to post-transcriptionally regulate gene expression in organisms. Tissue miRNA expression studies have discovered a myriad of functions for miRNAs in various aspects, but a role for miRNAs in chicken ovarian tissue at 300 days of age has not hitherto been reported. In this study, we performed the first miRNA analysis of ovarian tissues in chickens with low and high rates of egg production using high-throughput sequencing. By comparing low rate of egg production chickens with high rate of egg production chickens, 17 significantly differentially expressed miRNAs were found (P < 0.05), including 11 known and six novel miRNAs. We found that all 11 known miRNAs were involved mainly in pathways of reproduction regulation, such as steroid hormone biosynthesis and dopaminergic synapse. Additionally, expression profiling of six randomly selected differentially regulated miRNAs were validated by quantitative real-time polymerase chain reaction (RT-qPCR). Some miRNAs, such as gga-miR-34b, gga-miR-34c and gga-miR-216b, were reported to regulate processes such as proliferation, cell cycle, apoptosis and metastasis and were expressed differentially in ovaries of chickens with high rates of egg production, suggesting that these miRNAs have an important role in ovary development and reproductive management of chicken. Furthermore, we uncovered that a significantly up-regulated miRNA-gga-miR-200a-3p-is ubiquitous in reproduction-regulation-related pathways. This miRNA may play a special central role in the reproductive management of chicken, and needs to be further studied for confirmation.

  4. Identification of new TSGA10 transcript variants in human testis with conserved regulatory RNA elements in 5'untranslated region and distinct expression in breast cancer.

    PubMed

    Salehipour, Pouya; Nematzadeh, Mahsa; Mobasheri, Maryam Beigom; Afsharpad, Mandana; Mansouri, Kamran; Modarressi, Mohammad Hossein

    2017-09-01

    Testis specific gene antigen 10 (TSGA10) is a cancer testis antigen involved in the process of spermatogenesis. TSGA10 could also play an important role in the inhibition of angiogenesis by preventing nuclear localization of HIF-1α. Although it has been shown that TSGA10 messenger RNA (mRNA) is mainly expressed in testis and some tumors, the transcription pattern and regulatory mechanisms of this gene remain largely unknown. Here, we report that human TSGA10 comprises at least 22 exons and generates four different transcript variants. It was identified that using two distinct promoters and splicing of exons 4 and 7 produced these transcript variants, which have the same coding sequence, but the sequence of 5'untanslated region (5'UTR) is different between them. This is significant because conserved regulatory RNA elements like upstream open reading frame (uORF) and putative internal ribosome entry site (IRES) were found in this region which have different combinations in each transcript variant and it may influence translational efficiency of them in normal or unusual environmental conditions like hypoxia. To indicate the transcription pattern of TSGA10 in breast cancer, expression of identified transcript variants was analyzed in 62 breast cancer samples. We found that TSGA10 tends to express variants with shorter 5'UTR and fewer uORF elements in breast cancer tissues. Our study demonstrates for the first time the expression of different TSGA10 transcript variants in testis and breast cancer tissues and provides a first clue to a role of TSGA10 5'UTR in regulation of translation in unusual environmental conditions like hypoxia. Copyright © 2017. Published by Elsevier B.V.

  5. RNA-Seq Analysis of Allele-Specific Expression, Hybrid Effects, and Regulatory Divergence in Hybrids Compared with Their Parents from Natural Populations

    PubMed Central

    Bell, Graeme D.M.; Kane, Nolan C.; Rieseberg, Loren H.; Adams, Keith L.

    2013-01-01

    Hybridization is a prominent process among natural plant populations that can result in phenotypic novelty, heterosis, and changes in gene expression. The effects of intraspecific hybridization on F1 hybrid gene expression were investigated using parents from divergent, natural populations of Cirsium arvense, an invasive Compositae weed. Using an RNA-seq approach, the expression of 68,746 unigenes was quantified in parents and hybrids. The expression levels of 51% of transcripts differed between parents, a majority of which had less than 1.25× fold-changes. More unigenes had higher expression in the invasive parent (P1) than the noninvasive parent (P2). Of those that were divergently expressed between parents, 10% showed additive and 81% showed nonadditive (transgressive or dominant) modes of gene action in the hybrids. A majority of the dominant cases had P2-like expression patterns in the hybrids. Comparisons of allele-specific expression also enabled a survey of cis- and trans-regulatory effects. Cis- and trans-regulatory divergence was found at 70% and 68% of 62,281 informative single-nucleotide polymorphism sites, respectively. Of the 17% of sites exhibiting both cis- and trans-effects, a majority (70%) had antagonistic regulatory interactions (cis x trans); trans-divergence tended to drive higher expression of the P1 allele, whereas cis-divergence tended to increase P2 transcript abundance. Trans-effects correlated more highly than cis with parental expression divergence and accounted for a greater proportion of the regulatory divergence at sites with additive compared with nonadditive inheritance patterns. This study explores the nature of, and types of mechanisms underlying, expression changes that occur in upon intraspecific hybridization in natural populations. PMID:23677938

  6. A Feed-Forward Regulatory Loop between HuR and the Long Noncoding RNA HOTAIR Promotes Head and Neck Squamous Cell Carcinoma Progression and Metastasis.

    PubMed

    Xu, Cheng-Zhi; Jiang, Chenyan; Wu, Qingwei; Liu, Liu; Yan, Xiaojun; Shi, Runjie

    2016-01-01

    The lncRNA Homeobox (HOX) transcript antisense RNA (HOTAIR) is overexpressed in numerous cancers. HuR is also overexpressed during tumourigenesis and is abnormally present within the cytoplasm, where it binds to AU-rich elements in the 3'UTRs of target mRNA and post-transcriptionally regulates the expression of its target genes. However, whether HOTAIR is regulated and the mechanisms by which it affects head and neck squamous cell carcinoma (HNSCC) are not well understood. MTT, cell cycle arrest and apoptotic assays were used to examine the effects of HOTAIR and HuR on cell viability in SCC25 and FaDu cells. Wound healing and transwell invasion analysis were performed to detect the effects of HOTAIR and HuR on cell migration and invasion. The interaction between HuR and HOTAIR was confirmed via qRT-PCR, western blots, luciferase reporter and RIP assays. Finally, qRT-PCR analysis was used to detect the levels of HuR and HOTAIR in HNSCC tumours and adjacent normal tissues. Knockdown of HOTAIR and HuR decreased cell viability, cellular migration and invasion. Moreover, HuR interacted and stabilized HOTAIR stability and thus promoted HOTAIR expression. Notably, HOTAIR acted as a miRNA sponge for HuR. HuR also reinforced HOTAIR sponge activity through miRNA recruitment, thus enhancing HuR expression in turn. Finally, HuR and HOTAIR levels were positively correlated and significantly up-regulated in tumours samples. We demonstrated the existence of a regulatory loop in which the expression of HOTAIR and HuR is reciprocally and temporally regulated during the metastasis and progression of HNSCC. © 2016 The Author(s) Published by S. Karger AG, Basel.

  7. 6S RNA-dependent inhibition of RNA polymerase is released by RNA-dependent synthesis of small de novo products.

    PubMed

    Wurm, Reinhild; Neusser, Thomas; Wagner, Rolf

    2010-01-01

    6S RNA from Escherichia coli is known to bind to RNA polymerase, preventing interaction with many promoters during stationary growth. The resulting repression is released under conditions of nutritional upshift, when the growth situation improves. 6S RNA, which binds to the active site of RNA polymerase, has the particularly interesting feature to act as a template, causing the transcription of defined de novo RNAs (dnRNA) that are complementary to a specific sequence region of the 6S RNA. We analyzed the conditions of dnRNA synthesis and determined their effect on the 6S RNA-mediated inhibition of RNA polymerase in vitro and in vivo. Upon nutritional upshift the RNA polymerase/6S RNA complex induces the rapid synthesis of dnRNAs, which form stable hybrids with the 6S RNA template. The resulting structural change destabilizes the inactivated RNA polymerase complex, causing sigma subunit release. Both dnRNA and 6S RNA are rapidly degraded after complex disintegration. Experiments using the transcriptional inhibitor rifampicin demonstrate that active transcription is required for the disintegration of the RNA polymerase/6S RNA complex. Our results support the conclusion that 6S RNA not only inhibits transcription during stationary growth but also enables cells to resume rapid growth after starvation and help to escape from stationary phase.

  8. Genome-Wide Investigation Using sRNA-Seq, Degradome-Seq and Transcriptome-Seq Reveals Regulatory Networks of microRNAs and Their Target Genes in Soybean during Soybean mosaic virus Infection

    PubMed Central

    Yu, Kangfu; Wang, Aiming

    2016-01-01

    MicroRNAs (miRNAs) play key roles in a variety of cellular processes through regulation of their target gene expression. Accumulated experimental evidence has demonstrated that infections by viruses are associated with the altered expression profile of miRNAs and their mRNA targets in the host. However, the regulatory network of miRNA-mRNA interactions during viral infection remains largely unknown. In this study, we performed small RNA (sRNA)-seq, degradome-seq and as well as a genome-wide transcriptome analysis to profile the global gene and miRNA expression in soybean following infections by three different Soybean mosaic virus (SMV) isolates, L (G2 strain), LRB (G2 strain) and G7 (G7 strain). sRNA-seq analyses revealed a total of 253 soybean miRNAs with a two-fold or greater change in abundance compared with the mock-inoculated control. 125 transcripts were identified as the potential cleavage targets of 105 miRNAs and validated by degradome-seq analyses. Genome-wide transcriptome analysis showed that total 2679 genes are differentially expressed in response to SMV infection including 71 genes predicted as involved in defense response. Finally, complex miRNA-mRNA regulatory networks were derived using the RNAseq, small RNAseq and degradome data. This work represents a comprehensive, global approach to examining virus-host interactions. Genes responsive to SMV infection are identified as are their potential miRNA regulators. Additionally, regulatory changes of the miRNAs themselves are described and the regulatory relationships were supported with degradome data. Taken together these data provide new insights into molecular SMV-soybean interactions and offer candidate miRNAs and their targets for further elucidation of the SMV infection process. PMID:26963095

  9. Identification of novel and salt-responsive miRNAs to explore miRNA-mediated regulatory network of salt stress response in radish (Raphanus sativus L.).

    PubMed

    Sun, Xiaochuan; Xu, Liang; Wang, Yan; Yu, Rugang; Zhu, Xianwen; Luo, Xiaobo; Gong, Yiqin; Wang, Ronghua; Limera, Cecilia; Zhang, Keyun; Liu, Liwang

    2015-03-17

    Salt stress is one of the most representative abiotic stresses that severely affect plant growth and development. MicroRNAs (miRNAs) are well known for their significant involvement in plant responses to abiotic stresses. Although miRNAs implicated in salt stress response have been widely reported in numerous plant species, their regulatory roles in the adaptive response to salt stress in radish (Raphanus sativus L.), an important root vegetable crop worldwide, remain largely unknown. Solexa sequencing of two sRNA libraries from NaCl-free (CK) and NaCl-treated (Na200) radish roots were performed for systematical identification of salt-responsive miRNAs and their expression profiling in radish. Totally, 136 known miRNAs (representing 43 miRNA families) and 68 potential novel miRNAs (belonging to 51 miRNA families) were identified. Of these miRNAs, 49 known and 22 novel miRNAs were differentially expressed under salt stress. Target prediction and annotation indicated that these miRNAs exerted a role by regulating specific stress-responsive genes, such as squamosa promoter binding-like proteins (SPLs), auxin response factors (ARFs), nuclear transcription factor Y (NF-Y) and superoxide dismutase [Cu-Zn] (CSD1). Further functional analysis suggested that these target genes were mainly implicated in signal perception and transduction, regulation of ion homeostasis, basic metabolic processes, secondary stress responses, as well as modulation of attenuated plant growth and development under salt stress. Additionally, the expression patterns of ten miRNAs and five corresponding target genes were validated by reverse-transcription quantitative PCR (RT-qPCR). With the sRNA sequencing, salt-responsive miRNAs and their target genes in radish were comprehensively identified. The results provide novel insight into complex miRNA-mediated regulatory network of salt stress response in radish, and facilitate further dissection of molecular mechanism underlying plant adaptive response

  10. Using polyclonal and monoclonal antibodies in regulatory testing of biological products.

    PubMed

    Coe Clough, Nancy E; Hauer, Paul J

    2005-01-01

    Polyclonal and monoclonal antibodies are often used in regulatory testing of biologicals (vaccines and related products). One of the most common applications for antibody-based immunoassays is as a batch release test. Batch release tests, whether they measure serological responses to vaccination or they quantify individual antigens by in vitro methods, must provide an acceptable estimate of potency of an individual batch of vaccine. Thus, due consideration must be given to the type of antibody used or quantified in such assays. Differences in specificity and avidity may affect the utility of an assay as an indicator of potency; case examples are given to illustrate these concepts. Concerns associated with antigen quantification assays (e.g., reagent denaturation upon binding to solid substrates, and interference from nontarget antigens or additives in a complex vaccine) are also discussed. International efforts to harmonize test methods in recent years have increased the importance of establishing standardized antibodies. Sources of such antibodies and issues associated with the ongoing availability of antibody supplies are described.

  11. Dissecting and engineering metabolic and regulatory networks of thermophilic bacteria for biofuel production.

    PubMed

    Lin, Lu; Xu, Jian

    2013-11-01

    Interest in thermophilic bacteria as live-cell catalysts in biofuel and biochemical industry has surged in recent years, due to their tolerance of high temperature and wide spectrum of carbon-sources that include cellulose. However their direct employment as microbial cellular factories in the highly demanding industrial conditions has been hindered by uncompetitive biofuel productivity, relatively low tolerance to solvent and osmic stresses, and limitation in genome engineering tools. In this work we review recent advances in dissecting and engineering the metabolic and regulatory networks of thermophilic bacteria for improving the traits of key interest in biofuel industry: cellulose degradation, pentose-hexose co-utilization, and tolerance of thermal, osmotic, and solvent stresses. Moreover, new technologies enabling more efficient genetic engineering of thermophiles were discussed, such as improved electroporation, ultrasound-mediated DNA delivery, as well as thermo-stable plasmids and functional selection systems. Expanded applications of such technological advancements in thermophilic microbes promise to substantiate a synthetic biology perspective, where functional parts, module, chassis, cells and consortia were modularly designed and rationally assembled for the many missions at industry and nature that demand the extraordinary talents of these extremophiles. Copyright © 2013 Elsevier Inc. All rights reserved.

  12. [Future Regulatory Science through a Global Product Development Strategy to Overcome the Device Lag].

    PubMed

    Tsuchii, Isao

    2016-01-01

    Environment that created "medical device lag (MDL)" has changed dramatically, and currently that term is not heard often. This was mainly achieved through the leadership of three groups: government, which determined to overcome MDL and took steps to do so; medical societies, which exhibited accountability in trial participation; and MD companies, which underwent a change in mindset that allowed comprehensive tripartite cooperation to reach the current stage. In particular, the global product development strategy (GPDS) of companies in a changing social environment has taken a new-turn with international harmonization trends, like Global Harmonization Task Force and International Council for Harmonisation of Technical Requirements for Registration of Pharmaceuticals for Human Use. As a result, this evolution has created opportunities for treatment with cutting-edge MDs in Japanese society. Simultaneously, it has had a major impact on the planning process of GPDS of companies. At the same time, the interest of global companies has shifted to emerging economies for future potential profit since Japan no longer faces MDL issue. This economic trend makes MDLs a greater problem for manufacturers. From the regulatory science viewpoint, this new environment has not made it easy to plan a global strategy that will be adaptable to local societies. Without taking hasty action, flexible thinking from the global point of view is necessary to enable the adjustment of local strategies to fit the situation on the ground so that the innovative Japanese medical technology can be exported to a broad range of societies.

  13. Analytical Challenges and Regulatory Requirements for Nasal Drug Products in Europe and the U.S.

    PubMed Central

    Trows, Sabrina; Wuchner, Klaus; Spycher, Rene; Steckel, Hartwig

    2014-01-01

    Nasal drug delivery can be assessed by a variety of means and regulatory agencies, e.g., the Food and Drug Administration (FDA) and the European Medicines Agency (EMA) have published a set of guidelines and regulations proposing in vitro test methods for the characterization of nasal drug products. This article gives a summary of the FDA and EMA requirements regarding the determination of droplet size distribution (DSD), plume geometry, spray pattern and shot weights of solution nasal sprays and discusses the analytical challenges that can occur when performing these measurements. In order to support findings from the literature, studies were performed using a standard nasal spray pump and aqueous model formulations. The aim was to identify possible method-, device- and formulation-dependent influencing factors. The literature review, as well as the results from the studies show that DSD, plume geometry and spray pattern are influenced by, e.g., the viscosity of the solution, the design of the device and the actuation parameters, particularly the stroke length, actuation velocity and actuation force. The dominant factor influencing shot weights, however, is the adjustment of the actuation parameters, especially stroke length and actuation velocity. Consequently, for routine measurements assuring, e.g., the quality of a solution nasal spray or, for in vitro bioequivalence studies, the critical parameters, have to be identified and considered in method development in order to obtain reproducible and reliable results. PMID:24732068

  14. Effect of various stress-regulatory factors on biomass and lipid production in microalga Haematococcus pluvialis.

    PubMed

    Saha, Sushanta Kumar; McHugh, Edward; Hayes, Jeremiah; Moane, Siobhan; Walsh, Daniel; Murray, Patrick

    2013-01-01

    To maximize the biomass and lipid production for applications in food or biofuel feedstock, nine stress conditions were tested considering N and/or P limitations, light intensity & quality, for Haematococcus pluvialis SCCAP K-0084 cultivation. Photosynthetically active radiation (PAR), warm white light emitting diode (WWLED), and white light emitting diode (WLED) at illumination of 240 μmol photons m(-2) sec(-1) were the best stress-regulatory factors. PAR without P & low N conditions yielded high biomass with 33% lipids containing increased C16:0 and C18:0 saturated fatty acids, and reduced unsaturated fatty acids (UFAs) (oleic, linoleic, and α/γ-linolenic). WWLED and WLED without P conditions also yielded high biomass, but 25% lipids with increased amounts of UFAs. Red light emitting diode (RLED) without P & low N conditions yielded 46% lipids with lowest biomass. PAR and WWLED & WLED illuminated conditions were found suitable respectively for biodiesel feedstock lipids and UFA-rich lipids for multiple applications.

  15. Regulatory factor X1 depresses ApoE-dependent Aβ uptake by miRNA-124 in microglial response to oxidative stress.

    PubMed

    Feng, Chen-Zhuo; Yin, Jin-Bo; Yang, Jian-Jun; Cao, Lin

    2017-03-06

    Decreased proteolytic clearance of soluble amyloid β (Aβ) in microglia affects Aβ accumulation on Alzheimer's disease progression. However, the potential molecular mechanism by which microglial Aβ uptake is regulated remains unclear. In this study, we identified a microRNA, miR-124, that was down-regulated in aging with a function in regulating apolipoprotein E (ApoE)-dependent Aβ uptake by targeting regulatory factor X1 (RFX1) transcripts on BV2 microglia cell. Decreased expression of miRNA-124 in BV2 cells exposed to mild hydrogen peroxide increased RFX1 protein level and decreased the expression of ApoE, a gene which has been suggested to enhance cellular Aβ uptake in microglia. We also identified a miR-124 binding site in the 3'-UTR of RFX1 mRNA and a RFX1 binding site in the first intron of ApoE gene. Furthermore, interfering this signaling pathway by knocking down RFX1 significantly improved Aβ uptake in BV2 cells. These data demonstrate the mechanism through which decreased miR-124 expression under oxidative stress slowed Aβ uptake and suggest that RFX1 might be a target for improving Aβ clearance during aging. Copyright © 2017 IBRO. Published by Elsevier Ltd. All rights reserved.

  16. Regulatory insights into the production of UDP-N-acetylglucosamine by Lactobacillus casei.

    PubMed

    Rodríguez-Díaz, Jesús; Rubio-Del-Campo, Antonio; Yebra, María J

    2012-01-01

    UDP-N-acetylglucosamine (UDP-GlcNAc) is an important sugar nucleotide used as a precursor of cell wall components in bacteria, and as a substrate in the synthesis of oligosaccharides in eukaryotes. In bacteria UDP-GlcNAc is synthesized from the glycolytic intermediate D-fructose-6-phosphate (fructose-6P) by four successive reactions catalyzed by three enzymes: glucosamine-6-phosphate synthase (GlmS), phosphoglucosamine mutase (GlmM) and the bi-functional enzyme glucosamine-1-phosphate acetyltransferase/ N-acetylglucosamine-1-phosphate uridyltransferase (GlmU). We have previously reported a metabolic engineering strategy in Lactobacillus casei directed to increase the intracellular levels of UDP-GlcNAc by homologous overexpression of the genes glmS, glmM and glmU. One of the most remarkable features regarding the production of UDP-GlcNAc in L. casei was to find multiple regulation points on its biosynthetic pathway: (1) regulation by the NagB enzyme, (2) glmS RNA specific degradation through the possible participation of a glmS riboswitch mechanism, (3) regulation of the GlmU activity probably by end product inhibition and (4) transcription of glmU.

  17. Regulatory insights into the production of UDP-N-acetylglucosamine by Lactobacillus casei

    PubMed Central

    Rodríguez-Díaz, Jesús; Rubio-del-Campo, Antonio; Yebra, María J.

    2012-01-01

    UDP-N-acetylglucosamine (UDP-GlcNAc) is an important sugar nucleotide used as a precursor of cell wall components in bacteria, and as a substrate in the synthesis of oligosaccharides in eukaryotes. In bacteria UDP-GlcNAc is synthesized from the glycolytic intermediate D-fructose-6-phosphate (fructose-6P) by four successive reactions catalyzed by three enzymes: glucosamine-6-phosphate synthase (GlmS), phosphoglucosamine mutase (GlmM) and the bi-functional enzyme glucosamine-1-phosphate acetyltransferase/ N-acetylglucosamine-1-phosphate uridyltransferase (GlmU). We have previously reported a metabolic engineering strategy in Lactobacillus casei directed to increase the intracellular levels of UDP-GlcNAc by homologous overexpression of the genes glmS, glmM and glmU. One of the most remarkable features regarding the production of UDP-GlcNAc in L. casei was to find multiple regulation points on its biosynthetic pathway: (1) regulation by the NagB enzyme, (2) glmS RNA specific degradation through the possible participation of a glmS riboswitch mechanism, (3) regulation of the GlmU activity probably by end product inhibition and (4) transcription of glmU. PMID:22825354

  18. Regulation of the small regulatory RNA MicA by ribonuclease III: a target-dependent pathway

    PubMed Central

    Viegas, Sandra C.; Silva, Inês J.; Saramago, Margarida; Domingues, Susana; Arraiano, Cecília M.

    2011-01-01

    MicA is a trans-encoded small non-coding RNA, which downregulates porin-expression in stationary-phase. In this work, we focus on the role of endoribonucleases III and E on Salmonella typhimurium sRNA MicA regulation. RNase III is shown to regulate MicA in a target-coupled way, while RNase E is responsible for the control of free MicA levels in the cell. We purified both Salmonella enzymes and demonstrated that in vitro RNase III is only active over MicA when in complex with its targets (whether ompA or lamB mRNAs). In vivo, MicA is demonstrated to be cleaved by RNase III in a coupled way with ompA mRNA. On the other hand, RNase E is able to cleave unpaired MicA and does not show a marked dependence on its 5′ phosphorylation state. The main conclusion of this work is the existence of two independent pathways for MicA turnover. Each pathway involves a distinct endoribonuclease, having a different role in the context of the fine-tuned regulation of porin levels. Cleavage of MicA by RNase III in a target-dependent fashion, with the concomitant decay of the mRNA target, strongly resembles the eukaryotic RNAi system, where RNase III-like enzymes play a pivotal role. PMID:21138960

  19. Regulation of the small regulatory RNA MicA by ribonuclease III: a target-dependent pathway.

    PubMed

    Viegas, Sandra C; Silva, Inês J; Saramago, Margarida; Domingues, Susana; Arraiano, Cecília M

    2011-04-01

    MicA is a trans-encoded small non-coding RNA, which downregulates porin-expression in stationary-phase. In this work, we focus on the role of endoribonucleases III and E on Salmonella typhimurium sRNA MicA regulation. RNase III is shown to regulate MicA in a target-coupled way, while RNase E is responsible for the control of free MicA levels in the cell. We purified both Salmonella enzymes and demonstrated that in vitro RNase III is only active over MicA when in complex with its targets (whether ompA or lamB mRNAs). In vivo, MicA is demonstrated to be cleaved by RNase III in a coupled way with ompA mRNA. On the other hand, RNase E is able to cleave unpaired MicA and does not show a marked dependence on its 5' phosphorylation state. The main conclusion of this work is the existence of two independent pathways for MicA turnover. Each pathway involves a distinct endoribonuclease, having a different role in the context of the fine-tuned regulation of porin levels. Cleavage of MicA by RNase III in a target-dependent fashion, with the concomitant decay of the mRNA target, strongly resembles the eukaryotic RNAi system, where RNase III-like enzymes play a pivotal role.

  20. Distribution, evolution, and diversity of retrotransposons at the flamenco locus reflect the regulatory properties of piRNA clusters

    PubMed Central

    Zanni, Vanessa; Eymery, Angéline; Coiffet, Michael; Zytnicki, Matthias; Luyten, Isabelle; Quesneville, Hadi; Vaury, Chantal; Jensen, Silke

    2013-01-01

    Most of our understanding of Drosophila heterochromatin structure and evolution has come from the annotation of heterochromatin from the isogenic y; cn bw sp strain. However, almost nothing is known about the heterochromatin’s structural dynamics and evolution. Here, we focus on a 180-kb heterochromatic locus producing Piwi-interacting RNAs (piRNA cluster), the flamenco (flam) locus, known to be responsible for the control of at least three transposable elements (TEs). We report its detailed structure in three different Drosophila lines chosen according to their capacity to repress or not to repress the expression of two retrotransposons named ZAM and Idefix, and we show that they display high structural diversity. Numerous rearrangements due to homologous and nonhomologous recombination, deletions and segmental duplications, and loss and gain of TEs are diverse sources of active genomic variation at this locus. Notably, we evidence a correlation between the presence of ZAM and Idefix in this piRNA cluster and their silencing. They are absent from flam in the strain where they are derepressed. We show that, unexpectedly, more than half of the flam locus results from recent TE insertions and that most of the elements concerned are prone to horizontal transfer between species of the melanogaster subgroup. We build a model showing how such high and constant dynamics of a piRNA master locus open the way to continual emergence of new patterns of piRNA biogenesis leading to changes in the level of transposition control. PMID:24248389

  1. Distribution, evolution, and diversity of retrotransposons at the flamenco locus reflect the regulatory properties of piRNA clusters.

    PubMed

    Zanni, Vanessa; Eymery, Angéline; Coiffet, Michael; Zytnicki, Matthias; Luyten, Isabelle; Quesneville, Hadi; Vaury, Chantal; Jensen, Silke

    2013-12-03

    Most of our understanding of Drosophila heterochromatin structure and evolution has come from the annotation of heterochromatin from the isogenic y; cn bw sp strain. However, almost nothing is known about the heterochromatin's structural dynamics and evolution. Here, we focus on a 180-kb heterochromatic locus producing Piwi-interacting RNAs (piRNA cluster), the flamenco (flam) locus, known to be responsible for the control of at least three transposable elements (TEs). We report its detailed structure in three different Drosophila lines chosen according to their capacity to repress or not to repress the expression of two retrotransposons named ZAM and Idefix, and we show that they display high structural diversity. Numerous rearrangements due to homologous and nonhomologous recombination, deletions and segmental duplications, and loss and gain of TEs are diverse sources of active genomic variation at this locus. Notably, we evidence a correlation between the presence of ZAM and Idefix in this piRNA cluster and their silencing. They are absent from flam in the strain where they are derepressed. We show that, unexpectedly, more than half of the flam locus results from recent TE insertions and that most of the elements concerned are prone to horizontal transfer between species of the melanogaster subgroup. We build a model showing how such high and constant dynamics of a piRNA master locus open the way to continual emergence of new patterns of piRNA biogenesis leading to changes in the level of transposition control.

  2. Emergency authorization of medical products: regulatory challenges from the 2009 H1N1 influenza pandemic in Japan.

    PubMed

    Urushihara, Hisashi; Matsui, Sayako; Kawakami, Koji

    2012-12-01

    In response to the 2009 H1N1 influenza pandemic, the governments of Japan and the United States for the first time authorized the emergency use of unapproved drugs. In this article, we comprehensively review the different regulatory approaches of Japan and the United States, countries with advanced regulatory and healthcare systems, to emergency authorization of the use of medical products as a countermeasure to public health emergencies. We outline the legal system, range of targeted products, requirements for the application dossier, legal stance for authorization, product availability, and termination of the Japanese Emergency Approval (EA), and we compare characteristics with those of the US Emergency Use Authorization (EUA). We also review the actual cases of these 2009 emergency authorizations. The Japanese EA importation of novel H1N1 influenza vaccines with adjuvant is presented, with lessons learned, and contrasted with the US EUA of peramivir.

  3. [European Union regulatory and quality requirements for botanical drugs and their implications for Chinese herbal medicinal products development].

    PubMed

    Zhu, You-Ping

    2017-06-01

    This paper introduces regulatory pathways and characteristic quality requirements for marketing authorization of herbal medicinal products in the European Union(EU), and the legal status and applications of "European Union list of herbal substances, preparations and combinations" and "European Union herbal monographs". Also introduced are Chinese herbs that have been granted the EU list entry, those with EU herbal monographs, and registered EU traditional herbal medicinal products with Chinese herbs as active ingredients. Special attention is paid to the technical details of three authorized EU herbal medicinal products (Veregen, Sativex and Episalvan) in comparison with Andrographis paniculata extract HMPL-004 that failed the phase Ⅲ clinical trial for ulcerative colitis. The paper further emphasizes the importance of enriching active fractions of herbal extracts and taking regulatory and quality considerations into account in early stage of botanical drug development. Copyright© by the Chinese Pharmaceutical Association.

  4. [Improvement of natamycin production in an industrial strain by heterologous expression of the afsRS(cla) global regulatory genes].

    PubMed

    Tao, Zhengsheng; Wang, Yemin; Zheng, Hualiang; Tao, Meifeng

    2015-05-01

    The afsRS(cla) global regulatory genes from Streptomyces clavuligerus activate the production of two antibiotics in Streptomyces lividans. In this study, we gained an increase of 38% in the production of natamycin (3.56 g/L) in an industrial strain Streptomyces gilvosporeus TZ1401 through the integration of pHL851 that bears the afsRS(cla) global regulatory genes into its genome. We discovered by quantitive real-time reverse transcription PCR (qRT-PCR) that the expression of 6 genes of the natamycin biosynthetic gene cluster were improved from 1.9 to 2.7 times. This suggests that afsRS(cla) improve the production of natamycin through increased transcription. This study provides a good example for applying afsRS(cla) in high yield breeding of industrial antibiotic producers.

  5. De novo transcriptomic analysis of hydrogen production in the green alga Chlamydomonas moewusii through RNA-Seq

    PubMed Central

    2013-01-01

    Background Microalgae can make a significant contribution towards meeting global renewable energy needs in both carbon-based and hydrogen (H2) biofuel. The development of energy-related products from algae could be accelerated with improvements in systems biology tools, and recent advances in sequencing technology provide a platform for enhanced transcriptomic analyses. However, these techniques are still heavily reliant upon available genomic sequence data. Chlamydomonas moewusii is a unicellular green alga capable of evolving molecular H2 under both dark and light anaerobic conditions, and has high hydrogenase activity that can be rapidly induced. However, to date, there is no systematic investigation of transcriptomic profiling during induction of H2 photoproduction in this organism. Results In this work, RNA-Seq was applied to investigate transcriptomic profiles during the dark anaerobic induction of H2 photoproduction. 156 million reads generated from 7 samples were then used for de novo assembly after data trimming. BlastX results against NCBI database and Blast2GO results were used to interpret the functions of the assembled 34,136 contigs, which were then used as the reference contigs for RNA-Seq analysis. Our results indicated that more contigs were differentially expressed during the period of early and higher H2 photoproduction, and fewer contigs were differentially expressed when H2-photoproduction rates decreased. In addition, C. moewusii and C. reinhardtii share core functional pathways, and transcripts for H2 photoproduction and anaerobic metabolite production were identified in both organisms. C. moewusii also possesses similar metabolic flexibility as C. reinhardtii, and the difference between C. moewusii and C. reinhardtii on hydrogenase expression and anaerobic fermentative pathways involved in redox balancing may explain their different profiles of hydrogenase activity and secreted anaerobic metabolites. Conclusions Herein, we have described a

  6. De novo transcriptomic analysis of hydrogen production in the green alga Chlamydomonas moewusii through RNA-Seq.

    PubMed

    Yang, Shihui; Guarnieri, Michael T; Smolinski, Sharon; Ghirardi, Maria; Pienkos, Philip T

    2013-08-23

    Microalgae can make a significant contribution towards meeting global renewable energy needs in both carbon-based and hydrogen (H2) biofuel. The development of energy-related products from algae could be accelerated with improvements in systems biology tools, and recent advances in sequencing technology provide a platform for enhanced transcriptomic analyses. However, these techniques are still heavily reliant upon available genomic sequence data. Chlamydomonas moewusii is a unicellular green alga capable of evolving molecular H2 under both dark and light anaerobic conditions, and has high hydrogenase activity that can be rapidly induced. However, to date, there is no systematic investigation of transcriptomic profiling during induction of H2 photoproduction in this organism. In this work, RNA-Seq was applied to investigate transcriptomic profiles during the dark anaerobic induction of H2 photoproduction. 156 million reads generated from 7 samples were then used for de novo assembly after data trimming. BlastX results against NCBI database and Blast2GO results were used to interpret the functions of the assembled 34,136 contigs, which were then used as the reference contigs for RNA-Seq analysis. Our results indicated that more contigs were differentially expressed during the period of early and higher H2 photoproduction, and fewer contigs were differentially expressed when H2-photoproduction rates decreased. In addition, C. moewusii and C. reinhardtii share core functional pathways, and transcripts for H2 photoproduction and anaerobic metabolite production were identified in both organisms. C. moewusii also possesses similar metabolic flexibility as C. reinhardtii, and the difference between C. moewusii and C. reinhardtii on hydrogenase expression and anaerobic fermentative pathways involved in redox balancing may explain their different profiles of hydrogenase activity and secreted anaerobic metabolites. Herein, we have described a workflow using commercial

  7. Cell therapy medicinal product regulatory framework in Europe and its application for MSC-based therapy development.

    PubMed

    Ancans, Janis

    2012-01-01

    Advanced therapy medicinal products (ATMPs), including cell therapy products, form a new class of medicines in the European Union. Since the ATMPs are at the forefront of scientific innovation in medicine, specific regulatory framework has been developed for these medicines and implemented from 2009. The Committee for Advanced Therapies (CAT) has been established at the European Medicines Agency (EMA) for centralized classification, certification and evaluation procedures, and other ATMP-related tasks. Guidance documents, initiatives, and interaction platforms are available to make the new framework more accessible for small- and medium-sized enterprises, academia, hospitals, and foundations. Good understanding of the centralized and national components of the regulatory system is required to plan product development. It is in the best interests of the cell therapy developers to utilize the resources provided starting with the pre-clinical stage. Whilst there have been no mesenchymal stem cell (MSC)-based medicine authorizations in the EU, three MSC products have received marketing approval in other regions since 2011. The information provided on the regulatory requirements, procedures, and initiatives is aimed at facilitating MSC-based medicinal product development and authorization in the EU.

  8. Cell therapy medicinal product regulatory framework in Europe and its application for MSC-based therapy development

    PubMed Central

    Ancans, Janis

    2012-01-01

    Advanced therapy medicinal products (ATMPs), including cell therapy products, form a new class of medicines in the European Union. Since the ATMPs are at the forefront of scientific innovation in medicine, specific regulatory framework has been developed for these medicines and implemented from 2009. The Committee for Advanced Therapies (CAT) has been established at the European Medicines Agency (EMA) for centralized classification, certification and evaluation procedures, and other ATMP-related tasks. Guidance documents, initiatives, and interaction platforms are available to make the new framework more accessible for small- and medium-sized enterprises, academia, hospitals, and foundations. Good understanding of the centralized and national components of the regulatory system is required to plan product development. It is in the best interests of the cell therapy developers to utilize the resources provided starting with the pre-clinical stage. Whilst there have been no mesenchymal stem cell (MSC)-based medicine authorizations in the EU, three MSC products have received marketing approval in other regions since 2011. The information provided on the regulatory requirements, procedures, and initiatives is aimed at facilitating MSC-based medicinal product development and authorization in the EU. PMID:22912639

  9. Main Reasons for Registration Application Refusal of Generic and Similar Pharmaceutical Drug Products by the Brazilian Health Regulatory Agency (ANVISA).

    PubMed

    do Carmo, Ana Cerúlia Moraes; Piras, Stefânia Schimaneski; Rocha, Nayrton Flávio Moura; Gratieri, Tais

    2017-01-01

    Objective. The marketing authorization of generic and similar pharmaceutical drug products involves the analysis of proposing company's administrative aspects as well as drug product technical description and scientific evaluations. This study evaluated the main reasons for registration refusal of generic and similar pharmaceutical drug products in Brazil. The aim is to help future applicants to better organize the proposal. Methods. A retrospective search of drug products registration processes was performed on the Brazilian Government Official Gazette from January 1, 2015, and December 31, 2015. Results. Drug product quality control, drug product stability study, deadline accomplishment, API quality control made by drug manufacturer, active pharmaceutical ingredient (API), and production report were the main reasons for marketing authorization application refusal of generic and similar pharmaceutical drug products in 2015. Conclusion. Disclosure of the reasons behind failed applications is a step forward on regulatory transparency. Sharing of experiences is essential to international regulatory authorities and organizations to improve legislation requirements for the marketing authorization of generic and similar pharmaceutical drug products.

  10. The impact of implementation of the Canadian regulatory requirements on the quality of natural health products: the glucosamine case.

    PubMed

    Aghazadeh-Habashi, Ali; Duke, John; Jamali, Fakhreddin

    2014-01-01

    We investigated whether the recent implementation of the regulatory requirements for the entry to the Canadian market of natural products has resulted in improved quality of the available glucosamine products. Eleven available products, of which 8 had been tested in 2002 (7 had contained substantially lower than the label claim of the active ingredient), and a European pharmaceutical grade tablet were assayed for their glucosamine content. The potassium and sodium contents of the products were also tested. Nine of the 11 Canadian products and the European tablet had more than 91% of the label claim of the active ingredient, hence, met the criterion. Two products contained 71 and 78% label claim. The electrolyte contents were very variable but constituted only a small fraction of the daily requirements. Most tested glucosamine products passed the Health Canada requirements. This improvement is likely due to the publicity regarding the low quality of the products in the past and also a result, at least in part, of the introduction of the new regulatory requirements. The sub-standard quality of a few tested products is still of concern.

  11. Main Reasons for Registration Application Refusal of Generic and Similar Pharmaceutical Drug Products by the Brazilian Health Regulatory Agency (ANVISA)

    PubMed Central

    do Carmo, Ana Cerúlia Moraes; Piras, Stefânia Schimaneski; Rocha, Nayrton Flávio Moura

    2017-01-01

    Objective. The marketing authorization of generic and similar pharmaceutical drug products involves the analysis of proposing company's administrative aspects as well as drug product technical description and scientific evaluations. This study evaluated the main reasons for registration refusal of generic and similar pharmaceutical drug products in Brazil. The aim is to help future applicants to better organize the proposal. Methods. A retrospective search of drug products registration processes was performed on the Brazilian Government Official Gazette from January 1, 2015, and December 31, 2015. Results. Drug product quality control, drug product stability study, deadline accomplishment, API quality control made by drug manufacturer, active pharmaceutical ingredient (API), and production report were the main reasons for marketing authorization application refusal of generic and similar pharmaceutical drug products in 2015. Conclusion. Disclosure of the reasons behind failed applications is a step forward on regulatory transparency. Sharing of experiences is essential to international regulatory authorities and organizations to improve legislation requirements for the marketing authorization of generic and similar pharmaceutical drug products. PMID:28280742

  12. Regulatory roles of bone morphogenetic proteins and glucocorticoids in catecholamine production by rat pheochromocytoma cells.

    PubMed

    Kano, Yoshihiro; Otsuka, Fumio; Takeda, Masaya; Suzuki, Jiro; Inagaki, Kenichi; Miyoshi, Tomoko; Miyamoto, Manabu; Otani, Hiroyuki; Ogura, Toshio; Makino, Hirofumi

    2005-12-01

    We here report a new physiological system that governs catecholamine synthesis involving bone morphogenetic proteins (BMPs) and activin in the rat pheochromocytoma cell line, PC12. BMP type I receptors, including activin receptor-like kinase-2 (ALK-2) (also referred to as ActRIA) and ALK-3 (BMPRIA), both type II receptors, ActRII and BMPRII, as well as the ligands BMP-2, -4, and -7 and inhibin/activin subunits were expressed in PC12 cells. PC12 cells predominantly secrete dopamine, whereas noradrenaline and adrenaline production is negligible. BMP-2, -4, -6, and -7 and activin A each suppressed dopamine and cAMP synthesis in a dose-dependent fashion. The BMP ligands also decreased 3,4-dihydroxyphenylalanine decarboxylase mRNA expression, whereas activin suppressed tyrosine hydroxylase expression. BMPs induced both Smad1/5/8 phosphorylation and Tlx2-Luc activation, whereas activin stimulated 3TP-Luc activity and p38 MAPK phosphorylation. ERK signaling was not affected by BMPs or activin. Dexamethasone enhanced catecholamine synthesis, accompanying increases in tyrosine hydroxylase and 3,4-dihydroxyphenylalanine decarboxylase transcription without cAMP accumulation. In the presence of dexamethasone, BMPs and activin failed to reduce dopamine as well as cAMP production. In addition, dexamethasone modulated mitotic suppression of PC12 induced by BMPs in a ligand-dependent manner. Furthermore, intracellular BMP signaling was markedly suppressed by dexamethasone treatment and the expression of ALK-2, ALK-3, and BMPRII was significantly inhibited by dexamethasone. Collectively, the endogenous BMP/activin system plays a key role in the regulation of catecholamine production. Controlling activity of the BMP system may be critical for glucocorticoid-induced catecholamine synthesis by adrenomedullar cells.

  13. Argonaute proteins regulate HIV-1 multiply spliced RNA and viral production in a Dicer independent manner.

    PubMed

    Eckenfelder, Agathe; Ségéral, Emmanuel; Pinzón, Natalia; Ulveling, Damien; Amadori, Céline; Charpentier, Marine; Nidelet, Sabine; Concordet, Jean-Paul; Zagury, Jean-François; Paillart, Jean-Christophe; Berlioz-Torrent, Clarisse; Seitz, Hervé; Emiliani, Stéphane; Gallois-Montbrun, Sarah

    2016-12-20

    Argonaute (Ago) proteins associate with microRNAs (miRNAs) to form the core of the RNA-induced silencing complex (RISC) that mediates post-transcriptional gene silencing of target mRNAs. As key players in anti-viral defense, Ago proteins are thought to have the ability to interact with human immunodeficiency virus type 1 (HIV-1) RNA. However, the role of this interaction in regulating HIV-1 replication has been debated. Here, we used high throughput sequencing of RNA isolated by cross-linking immunoprecipitation (HITS-CLIP) to explore the interaction between Ago2 and HIV-1 RNA in infected cells. By only considering reads of 50 nucleotides length in our analysis, we identified more than 30 distinct binding sites for Ago2 along the viral RNA genome. Using reporter assays, we found four binding sites, located near splice donor sites, capable of repressing Luciferase gene expression in an Ago-dependent manner. Furthermore, inhibition of Ago1 and Ago2 levels in cells expressing HIV-1 led to an increase of viral multiply spliced transcripts and to a strong reduction in the extracellular CAp24 level. Depletion of Dicer did not affect these activities. Our results highlight a new role of Ago proteins in the control of multiply spliced HIV-1 transcript levels and viral production, independently of the miRNA pathway.

  14. Argonaute proteins regulate HIV-1 multiply spliced RNA and viral production in a Dicer independent manner

    PubMed Central

    Eckenfelder, Agathe; Ségéral, Emmanuel; Pinzón, Natalia; Ulveling, Damien; Amadori, Céline; Charpentier, Marine; Nidelet, Sabine; Concordet, Jean-Paul; Zagury, Jean-François; Paillart, Jean-Christophe; Berlioz-Torrent, Clarisse; Seitz, Hervé

    2017-01-01

    Abstract Argonaute (Ago) proteins associate with microRNAs (miRNAs) to form the core of the RNA-induced silencing complex (RISC) that mediates post-transcriptional gene silencing of target mRNAs. As key players in anti-viral defense, Ago proteins are thought to have the ability to interact with human immunodeficiency virus type 1 (HIV-1) RNA. However, the role of this interaction in regulating HIV-1 replication has been debated. Here, we used high throughput sequencing of RNA isolated by cross-linking immunoprecipitation (HITS-CLIP) to explore the interaction between Ago2 and HIV-1 RNA in infected cells. By only considering reads of 50 nucleotides length in our analysis, we identified more than 30 distinct binding sites for Ago2 along the viral RNA genome. Using reporter assays, we found four binding sites, located near splice donor sites, capable of repressing Luciferase gene expression in an Ago-dependent manner. Furthermore, inhibition of Ago1 and Ago2 levels in cells expressing HIV-1 led to an increase of viral multiply spliced transcripts and to a strong reduction in the extracellular CAp24 level. Depletion of Dicer did not affect these activities. Our results highlight a new role of Ago proteins in the control of multiply spliced HIV-1 transcript levels and viral production, independently of the miRNA pathway. PMID:28003477

  15. Hepatitis B virus nuclear export elements: RNA stem-loop α and β, key parts of the HBV post-transcriptional regulatory element.

    PubMed

    Lim, Chun Shen; Brown, Chris M

    2016-09-01

    Many viruses contain RNA elements that modulate splicing and/or promote nuclear export of their RNAs. The RNAs of the major human pathogen, hepatitis B virus (HBV) contain a large (~600 bases) composite cis-acting 'post-transcriptional regulatory element' (PRE). This element promotes expression from these naturally intronless transcripts. Indeed, the related woodchuck hepadnavirus PRE (WPRE) is used to enhance expression in gene therapy and other expression vectors. These PRE are likely to act through a combination of mechanisms, including promotion of RNA nuclear export. Functional components of both the HBV PRE and WPRE are 2 conserved RNA cis-acting stem-loop (SL) structures, SLα and SLβ. They are within the coding regions of polymerase (P) gene, and both P and X genes, respectively. Based on previous studies using mutagenesis and/or nuclear magnetic resonance (NMR), here we propose 2 covariance models for SLα and SLβ. The model for the 30-nucleotide SLα contains a G-bulge and a CNGG(U) apical loop of which the first and the fourth loop residues form a CG pair and the fifth loop residue is bulged out, as observed in the NMR structure. The model for the 23-nucleotide SLβ contains a 7-base-pair stem and a 9-nucleotide loop. Comparison of the models with other RNA structural elements, as well as similarity searches of human transcriptome and viral genomes demonstrate that SLα and SLβ are specific to HBV transcripts. However, they are well conserved among the hepadnaviruses of non-human primates, the woodchuck and ground squirrel.

  16. bldA dependence of undecylprodigiosin production in Streptomyces coelicolor A3(2) involves a pathway-specific regulatory cascade.

    PubMed Central

    White, J; Bibb, M

    1997-01-01

    The production of the red-pigmented tripyrrole antibiotic undecylprodigiosin (Red) by Streptomyces coelicolor A3(2) depends on two pathway-specific regulatory genes, redD and redZ. RedD is homologous to several other proteins that regulate antibiotic production in streptomycetes; RedZ is a member of the response regulator family. redZ transcripts were detected during exponential growth and increased in amount during transition and stationary phases; transcription of redD was confined to the two latter stages of growth. Whereas mutation of redD had no effect on redZ transcription, transcription of redD was highly dependent on redZ, suggesting that RedZ is a transcriptional activator of redD. bldA, which encodes the only tRNA of S. coelicolor that can efficiently translate the rare leucine codon UUA, is required for Red production at higher phosphate concentrations. While the redD transcript contains no UUA codons, the redZ mRNA contains one. Transcription of redZ appeared to be unaffected in a bldA mutant; in contrast, redD transcription was undetectable, consistent with the translational dependence of redZ on bldA and the transcriptional dependence of redD on redZ. Red production in a bldA mutant was restored by multiple copies of redZ, presumably reflecting a low level of mistranslation of the redZ UUA codon, while multiple copies of redD had no effect, presumably a consequence of the severe dependence of redD transcription on RedZ. Transcription of redZ appears to be negatively autoregulated. PMID:9006013

  17. Identification of co-expression gene networks, regulatory genes and pathways for obesity based on adipose tissue RNA Sequencing in a porcine model.

    PubMed

    Kogelman, Lisette J A; Cirera, Susanna; Zhernakova, Daria V; Fredholm, Merete; Franke, Lude; Kadarmideen, Haja N

    2014-09-30

    Obesity is a complex metabolic condition in strong association with various diseases, like type 2 diabetes, resulting in major public health and economic implications. Obesity is the result of environmental and genetic factors and their interactions, including genome-wide genetic interactions. Identification of co-expressed and regulatory genes in RNA extracted from relevant tissues representing lean and obese individuals provides an entry point for the identification of genes and pathways of importance to the development of obesity. The pig, an omnivorous animal, is an excellent model for human obesity, offering the possibility to study in-depth organ-level transcriptomic regulations of obesity, unfeasible in humans. Our aim was to reveal adipose tissue co-expression networks, pathways and transcriptional regulations of obesity using RNA Sequencing based systems biology approaches in a porcine model. We selected 36 animals for RNA Sequencing from a previously created F2 pig population representing three extreme groups based on their predicted genetic risks for obesity. We applied Weighted Gene Co-expression Network Analysis (WGCNA) to detect clusters of highly co-expressed genes (modules). Additionally, regulator genes were detected using Lemon-Tree algorithms. WGCNA revealed five modules which were strongly correlated with at least one obesity-related phenotype (correlations ranging from -0.54 to 0.72, P < 0.001). Functional annotation identified pathways enlightening the association between obesity and other diseases, like osteoporosis (osteoclast differentiation, P = 1.4E-7), and immune-related complications (e.g. Natural killer cell mediated cytotoxity, P = 3.8E-5; B cell receptor signaling pathway, P = 7.2E-5). Lemon-Tree identified three potential regulator genes, using confident scores, for the WGCNA module which was associated with osteoclast differentiation: CCR1, MSR1 and SI1 (probability scores respectively 95.30, 62.28, and 34.58). Moreover, detection

  18. Identification of co-expression gene networks, regulatory genes and pathways for obesity based on adipose tissue RNA Sequencing in a porcine model

    PubMed Central

    2014-01-01

    Background Obesity is a complex metabolic condition in strong association with various diseases, like type 2 diabetes, resulting in major public health and economic implications. Obesity is the result of environmental and genetic factors and their interactions, including genome-wide genetic interactions. Identification of co-expressed and regulatory genes in RNA extracted from relevant tissues representing lean and obese individuals provides an entry point for the identification of genes and pathways of importance to the development of obesity. The pig, an omnivorous animal, is an excellent model for human obesity, offering the possibility to study in-depth organ-level transcriptomic regulations of obesity, unfeasible in humans. Our aim was to reveal adipose tissue co-expression networks, pathways and transcriptional regulations of obesity using RNA Sequencing based systems biology approaches in a porcine model. Methods We selected 36 animals for RNA Sequencing from a previously created F2 pig population representing three extreme groups based on their predicted genetic risks for obesity. We applied Weighted Gene Co-expression Network Analysis (WGCNA) to detect clusters of highly co-expressed genes (modules). Additionally, regulator genes were detected using Lemon-Tree algorithms. Results WGCNA revealed five modules which were strongly correlated with at least one obesity-related phenotype (correlations ranging from -0.54 to 0.72, P < 0.001). Functional annotation identified pathways enlightening the association between obesity and other diseases, like osteoporosis (osteoclast differentiation, P = 1.4E-7), and immune-related complications (e.g. Natural killer cell mediated cytotoxity, P = 3.8E-5; B cell receptor signaling pathway, P = 7.2E-5). Lemon-Tree identified three potential regulator genes, using confident scores, for the WGCNA module which was associated with osteoclast differentiation: CCR1, MSR1 and SI1 (probability scores respectively 95.30, 62.28, and

  19. Regulatory roles of microRNA-708 and microRNA-31 in proliferation, apoptosis and invasion of colorectal cancer cells

    PubMed Central

    LEI, SAN-LIN; ZHAO, HUA; YAO, HONG-LIANG; CHEN, YONG; LEI, ZHEN-DONG; LIU, KUI-JIE; YANG, QUN

    2014-01-01

    MicroRNAs (miRs) function as key regulators of gene expression and their deregulation is associated with the carcinogenesis of various cancers. In the present study, the aim was to validate the potential roles and regulatory mechanisms of miR-708 and miR-31 in colorectal cancer (CRC) cells. miR-708 and miR-31 were found to be highly expressed in five CRC tissue samples. Functional studies showed that the inhibition of miR-708 and miR-31 inhibited cell proliferation and invasion, however, promoted apoptosis in vitro. Subsequently, it was identified that miR-708 and miR-31 directly target cyclin-dependent kinase inhibitor 2B (CDKN2B) by binding to the 3′ untranslated region, which suppresses the CDKN2B protein levels. In addition, the CDKN2B protein levels were significantly reduced when there was high miR-708 and miR-31 expression in the CRC tissue samples. The results indicate that miR-31 and miR-708 function in an oncogenic manner in CRC development, and inhibition of the two miRs may be used as a therapeutic strategy for patients with CRC. PMID:25202407

  20. Regulatory roles of microRNA-708 and microRNA-31 in proliferation, apoptosis and invasion of colorectal cancer cells.

    PubMed

    Lei, San-Lin; Zhao, Hua; Yao, Hong-Liang; Chen, Yong; Lei, Zhen-Dong; Liu, Kui-Jie; Yang, Qun

    2014-10-01

    MicroRNAs (miRs) function as key regulators of gene expression and their deregulation is associated with the carcinogenesis of various cancers. In the present study, the aim was to validate the potential roles and regulatory mechanisms of miR-708 and miR-31 in colorectal cancer (CRC) cells. miR-708 and miR-31 were found to be highly expressed in five CRC tissue samples. Functional studies showed that the inhibition of miR-708 and miR-31 inhibited cell proliferation and invasion, however, promoted apoptosis in vitro. Subsequently, it was identified that miR-708 and miR-31 directly target cyclin-dependent kinase inhibitor 2B (CDKN2B) by binding to the 3' untranslated region, which suppresses the CDKN2B protein levels. In addition, the CDKN2B protein levels were significantly reduced when there was high miR-708 and miR-31 expression in the CRC tissue samples. The results indicate that miR-31 and miR-708 function in an oncogenic manner in CRC development, and inhibition of the two miRs may be used as a therapeutic strategy for patients with CRC.

  1. Fine-scale chromatin interaction maps reveal the cis-regulatory landscape of human lincRNA genes

    PubMed Central

    Ma, Wenxiu; Ay, Ferhat; Lee, Choli; Gulsoy, Gunhan; Deng, Xinxian; Cook, Savannah; Hesson, Jennifer; Cavanaugh, Christopher; Ware, Carol B.; Krumm, Anton; Shendure, Jay; Blau, C. Anthony; Disteche, Christine M.; Noble, William S.; Duan, ZhiJun

    2014-01-01

    High-throughput methods based on chromosome conformation capture (3C) have greatly advanced our understanding of the three-dimensional (3D) organization of genomes but are limited in resolution by their reliance on restriction enzymes (REs). Here we describe a method called DNase Hi-C for comprehensively mapping global chromatin contacts that uses DNase I for chromatin fragmentation, leading to greatly improved efficiency and resolution compared to Hi-C. Coupling this method with DNA capture technology provides a high-throughput approach for targeted mapping of fine-scale chromatin architecture. We applied targeted DNase Hi-C to characterize the 3D organization of 998 lincRNA (long intergenic noncoding RNA) promoters in two human cell lines, thereby revealing that expression of lincRNAs is tightly controlled by complex mechanisms involving both super-enhancers and the polycomb repressive complex. Our results provide the first glimpse of a cell type-specific 3D organization of lincRNA genes. PMID:25437436

  2. A Nascent Peptide Signal Responsive to Endogenous Levels of Polyamines Acts to Stimulate Regulatory Frameshifting on Antizyme mRNA.

    PubMed

    Yordanova, Martina M; Wu, Cheng; Andreev, Dmitry E; Sachs, Matthew S; Atkins, John F

    2015-07-17

    The protein antizyme is a negative regulator of cellular polyamine concentrations from yeast to mammals. Synthesis of functional antizyme requires programmed +1 ribosomal frameshifting at the 3' end of the first of two partially overlapping ORFs. The frameshift is the sensor and effector in an autoregulatory circuit. Except for Saccharomyces cerevisiae antizyme mRNA, the frameshift site alone only supports low levels of frameshifting. The high levels usually observed depend on the presence of cis-acting stimulatory elements located 5' and 3' of the frameshift site. Antizyme genes from different evolutionary branches have evolved different stimulatory elements. Prior and new multiple alignments of fungal antizyme mRNA sequences from the Agaricomycetes class of Basidiomycota show a distinct pattern of conservation 5' of the frameshift site consistent with a function at the amino acid level. As shown here when tested in Schizosaccharomyces pombe and mammalian HEK293T cells, the 5' part of this conserved sequence acts at the nascent peptide level to stimulate the frameshifting, without involving stalling detectable by toe-printing. However, the peptide is only part of the signal. The 3' part of the stimulator functions largely independently and acts at least mostly at the nucleotide level. When polyamine levels were varied, the stimulatory effect was seen to be especially responsive in the endogenous polyamine concentration range, and this effect may be more general. A conserved RNA secondary structure 3' of the frameshift site has weaker stimulatory and polyamine sensitizing effects on frameshifting.

  3. Novel regulatory principles of the spliceosomal Brr2 RNA helicase and links to retinal disease in humans.

    PubMed

    Mozaffari-Jovin, Sina; Wandersleben, Traudy; Santos, Karine F; Will, Cindy L; Lührmann, Reinhard; Wahl, Markus C

    2014-01-01

    For each round of pre-mRNA splicing, a spliceosome is assembled anew on its substrate. RNA-protein remodeling events required for spliceosome assembly, splicing catalysis, and spliceosome disassembly are driven and controlled by a conserved group of ATPases/RNA helicases. The activities of most of these enzymes are timed by their recruitment to the spliceosome. The Brr2 enzyme, however, which mediates spliceosome catalytic activation, is a stable subunit of the spliceosome, and thus, requires special regulation. Recent structural and functional studies have revealed diverse mechanisms whereby an RNaseH-like and a Jab1/MPN-like domain of the Prp8 protein regulate Brr2 activity during splicing both positively and negatively. Reversible Brr2 inhibition might in part be achieved via an intrinsically unstructured element of the Prp8 Jab1/MPN domain, a concept widespread in biological systems. Mutations leading to changes in the Prp8 Jab1/MPN domain, which are linked to a severe form of retinitis pigmentosa, disrupt Jab1/MPN-mediated regulation of Brr2.

  4. The RNA processing enzyme polynucleotide phosphorylase negatively controls biofilm formation by repressing poly-N-acetylglucosamine (PNAG) production in Escherichia coli C

    PubMed Central

    2012-01-01

    Background Transition from planktonic cells to biofilm is mediated by production of adhesion factors, such as extracellular polysaccharides (EPS), and modulated by complex regulatory networks that, in addition to controlling production of adhesion factors, redirect bacterial cell metabolism to the biofilm mode. Results Deletion of the pnp gene, encoding polynucleotide phosphorylase, an RNA processing enzyme and a component of the RNA degradosome, results in increased biofilm formation in Escherichia coli. This effect is particularly pronounced in the E. coli strain C-1a, in which deletion of the pnp gene leads to strong cell aggregation in liquid medium. Cell aggregation is dependent on the EPS poly-N-acetylglucosamine (PNAG), thus suggesting negative regulation of the PNAG biosynthetic operon pgaABCD by PNPase. Indeed, pgaABCD transcript levels are higher in the pnp mutant. Negative control of pgaABCD expression by PNPase takes place at mRNA stability level and involves the 5’-untranslated region of the pgaABCD transcript, which serves as a cis-element regulating pgaABCD transcript stability and translatability. Conclusions Our results demonstrate that PNPase is necessary to maintain bacterial cells in the planktonic mode through down-regulation of pgaABCD expression and PNAG production. PMID:23171129

  5. The RNA processing enzyme polynucleotide phosphorylase negatively controls biofilm formation by repressing poly-N-acetylglucosamine (PNAG) production in Escherichia coli C.

    PubMed

    Carzaniga, Thomas; Antoniani, Davide; Dehò, Gianni; Briani, Federica; Landini, Paolo

    2012-11-21

    Transition from planktonic cells to biofilm is mediated by production of adhesion factors, such as extracellular polysaccharides (EPS), and modulated by complex regulatory networks that, in addition to controlling production of adhesion factors, redirect bacterial cell metabolism to the biofilm mode. Deletion of the pnp gene, encoding polynucleotide phosphorylase, an RNA processing enzyme and a component of the RNA degradosome, results in increased biofilm formation in Escherichia coli. This effect is particularly pronounced in the E. coli strain C-1a, in which deletion of the pnp gene leads to strong cell aggregation in liquid medium. Cell aggregation is dependent on the EPS poly-N-acetylglucosamine (PNAG), thus suggesting negative regulation of the PNAG biosynthetic operon pgaABCD by PNPase. Indeed, pgaABCD transcript levels are higher in the pnp mutant. Negative control of pgaABCD expression by PNPase takes place at mRNA stability level and involves the 5'-untranslated region of the pgaABCD transcript, which serves as a cis-element regulating pgaABCD transcript stability and translatability. Our results demonstrate that PNPase is necessary to maintain bacterial cells in the planktonic mode through down-regulation of pgaABCD expression and PNAG production.

  6. Effect of antibiotic down-regulatory gene wblA ortholog on antifungal polyene production in rare actinomycetes Pseudonocardia autotrophica.

    PubMed

    Kim, Hye-Jin; Kim, Min-Kyung; Jin, Ying-Yu; Kim, Young-Woo; Kim, Eung-Soo

    2014-09-01

    The rare actinomycete Pseudonocardia autotrophica was previously shown to produce a solubilityimproved toxicity-reduced novel polyene compound named Nystatin-like Pseudonocardia Polyene (NPP). The low productivity of NPP in P. autotrophica implies that its biosynthetic pathway is tightly regulated. In this study, wblApau was isolated and identified as a novel negative regulatory gene for NPP production in P. autotrophica, which showed approximately 49% amino acid identity with a global antibiotic down-regulatory gene, wblA, identified from various Streptomycetes species. Although no significant difference in NPP production was observed between P. autotrophica harboring empty vector and the S. coelicolor wblA under its native promoter, approximately 12% less NPP was produced in P. autotrophica expressing the wblA gene under the strong constitutive ermE(*) promoter. Furthermore, disruption of the wblApau gene from P. autotrophica resulted in an approximately 80% increase in NPP productivity. These results strongly suggest that identification and inactivation of the global antibiotic down-regulatory gene wblA ortholog are a critical strategy for improving secondary metabolite overproduction in not only Streptomyces but also non-Streptomyces rare actinomycete species.

  7. Pleiotropic regulatory genes bldA, adpA and absB are implicated in production of phosphoglycolipid antibiotic moenomycin

    PubMed Central

    Makitrynskyy, Roman; Ostash, Bohdan; Tsypik, Olga; Rebets, Yuriy; Doud, Emma; Meredith, Timothy; Luzhetskyy, Andriy; Bechthold, Andreas; Walker, Suzanne; Fedorenko, Victor

    2013-01-01

    Unlike the majority of actinomycete secondary metabolic pathways, the biosynthesis of peptidoglycan glycosyltransferase inhibitor moenomycin in Streptomyces ghanaensis does not involve any cluster-situated regulators (CSRs). This raises questions about the regulatory signals that initiate and sustain moenomycin production. We now show that three pleiotropic regulatory genes for Streptomyces morphogenesis and antibiotic production—bldA, adpA and absB—exert multi-layered control over moenomycin biosynthesis in native and heterologous producers. The bldA gen