Science.gov

Sample records for regulatory rna production

  1. The rise of regulatory RNA

    PubMed Central

    Morris, K.V.; Mattick, J.S.

    2015-01-01

    Discoveries over the last decade portend a paradigm shift in molecular biology. Evidence suggests that RNA is not only functional as a messenger between DNA and protein but also in the regulation of genome organization and gene expression, which is increasingly elaborated in complex organisms. Regulatory RNAs appear to operate at many levels, but in particular to play an important role in the epigenetic processes that control differentiation and development. These discoveries suggest a central role for RNA in human evolution and ontogeny. Here we survey the emergence of the previously unsuspected world of regulatory RNAs from an historical perspective. PMID:24776770

  2. Modular arrangement of regulatory RNA elements

    PubMed Central

    Roßmanith, Johanna; Narberhaus, Franz

    2017-01-01

    ABSTRACT Due to their simple architecture and control mechanism, regulatory RNA modules are attractive building blocks in synthetic biology. This is especially true for riboswitches, which are natural ligand-binding regulators of gene expression. The discovery of various tandem riboswitches inspired the design of combined RNA modules with activities not yet found in nature. Riboswitches were placed in tandem or in combination with a ribozyme or temperature-responsive RNA thermometer resulting in new functionalities. Here, we compare natural examples of tandem riboswitches with recently designed artificial RNA regulators suggesting substantial modularity of regulatory RNA elements. Challenges associated with modular RNA design are discussed. PMID:28010165

  3. Modular arrangement of regulatory RNA elements.

    PubMed

    Roßmanith, Johanna; Narberhaus, Franz

    2017-03-04

    Due to their simple architecture and control mechanism, regulatory RNA modules are attractive building blocks in synthetic biology. This is especially true for riboswitches, which are natural ligand-binding regulators of gene expression. The discovery of various tandem riboswitches inspired the design of combined RNA modules with activities not yet found in nature. Riboswitches were placed in tandem or in combination with a ribozyme or temperature-responsive RNA thermometer resulting in new functionalities. Here, we compare natural examples of tandem riboswitches with recently designed artificial RNA regulators suggesting substantial modularity of regulatory RNA elements. Challenges associated with modular RNA design are discussed.

  4. microRNA Decay: Refining microRNA Regulatory Activity.

    PubMed

    Pepin, Genevieve; Gantier, Michael P

    2016-01-01

    MicroRNAs (miRNAs) are short 19-25 nucleotide RNA molecules that impact on most biological processes by regulating the efficiency of messenger RNA (mRNA) translation. To date, most research activities have been focused on the control of miRNA expression and its functional consequences. Nonetheless, much remains unknown about the mechanisms affecting the level of specific miRNAs in the cell, a critical feature impacting their regulatory activity. This review focuses on the factors that regulate the abundance of miRNAs, including synthesis, post-transcriptional modifications, nucleases, target binding, and secretion.

  5. SRD: a Staphylococcus regulatory RNA database

    PubMed Central

    Sassi, Mohamed; Augagneur, Yoann; Mauro, Tony; Ivain, Lorraine; Chabelskaya, Svetlana; Hallier, Marc; Sallou, Olivier; Felden, Brice

    2015-01-01

    An overflow of regulatory RNAs (sRNAs) was identified in a wide range of bacteria. We designed and implemented a new resource for the hundreds of sRNAs identified in Staphylococci, with primary focus on the human pathogen Staphylococcus aureus. The “Staphylococcal Regulatory RNA Database” (SRD, http://srd.genouest.org/) compiled all published data in a single interface including genetic locations, sequences and other features. SRD proposes novel and simplified identifiers for Staphylococcal regulatory RNAs (srn) based on the sRNA's genetic location in S. aureus strain N315 which served as a reference. From a set of 894 sequences and after an in-depth cleaning, SRD provides a list of 575 srn exempt of redundant sequences. For each sRNA, their experimental support(s) is provided, allowing the user to individually assess their validity and significance. RNA-seq analysis performed on strains N315, NCTC8325, and Newman allowed us to provide further details, upgrade the initial annotation, and identified 159 RNA-seq independent transcribed sRNAs. The lists of 575 and 159 sRNAs sequences were used to predict the number and location of srns in 18 S. aureus strains and 10 other Staphylococci. A comparison of the srn contents within 32 Staphylococcal genomes revealed a poor conservation between species. In addition, sRNA structure predictions obtained with MFold are accessible. A BLAST server and the intaRNA program, which is dedicated to target prediction, were implemented. SRD is the first sRNA database centered on a genus; it is a user-friendly and scalable device with the possibility to submit new sequences that should spread in the literature. PMID:25805861

  6. Regulatory network controlling extracellular proteins in Erwinia carotovora subsp. carotovora: FlhDC, the master regulator of flagellar genes, activates rsmB regulatory RNA production by affecting gacA and hexA (lrhA) expression.

    PubMed

    Cui, Yaya; Chatterjee, Asita; Yang, Hailian; Chatterjee, Arun K

    2008-07-01

    Erwinia carotovora subsp. carotovora produces an array of extracellular proteins (i.e., exoproteins), including plant cell wall-degrading enzymes and Harpin, an effector responsible for eliciting hypersensitive reaction. Exoprotein genes are coregulated by the quorum-sensing signal, N-acyl homoserine lactone, plant signals, an assortment of transcriptional factors/regulators (GacS/A, ExpR1, ExpR2, KdgR, RpoS, HexA, and RsmC) and posttranscriptional regulators (RsmA, rsmB RNA). rsmB RNA production is positively regulated by GacS/A, a two-component system, and negatively regulated by HexA (PecT in Erwinia chrysanthemi; LrhA [LysR homolog A] in Escherichia coli) and RsmC, a putative transcriptional adaptor. While free RsmA, an RNA-binding protein, promotes decay of mRNAs of exoprotein genes, binding of RsmA with rsmB RNA neutralizes the RsmA effect. In the course of studies of GacA regulation, we discovered that a locus bearing strong homology to the flhDC operon of E. coli also controls extracellular enzyme production. A transposon insertion FlhDC(-) mutant produces very low levels of pectate lyase, polygalacturonase, cellulase, protease, and E. carotovora subsp. carotovora Harpin (Harpin(Ecc)) and is severely attenuated in its plant virulence. The production of these exoproteins is restored in the mutant carrying an FlhDC(+) plasmid. Sequence analysis and transcript assays disclosed that the flhD operon of E. carotovora subsp. carotovora, like those of other enterobacteria, consists of flhD and flhC. Complementation analysis revealed that the regulatory effect requires functions of both flhD and flhC products. The data presented here show that FlhDC positively regulates gacA, rsmC, and fliA and negatively regulates hexA (lrhA). Evidence shows that FlhDC controls extracellular protein production through cumulative effects on hexA and gacA. Reduced levels of GacA and elevated levels of HexA in the FlhDC(-) mutant are responsible for the inhibition of rsmB RNA

  7. Regulatory Circuit of Human MicroRNA Biogenesis

    PubMed Central

    Lee, Ji; Li, Zhihua; Brower-Sinning, Rachel; John, Bino

    2007-01-01

    miRNAs (microRNAs) are a class of endogenous small RNAs that are thought to negatively regulate protein production. Aberrant expression of many miRNAs is linked to cancer and other diseases. Little is known about the factors that regulate the expression of miRNAs. We have identified numerous regulatory elements upstream of miRNA genes that are likely to be essential to the transcriptional and posttranscriptional regulation of miRNAs. Newly identified regulatory motifs occur frequently and in multiple copies upstream of miRNAs. The motifs are highly enriched in G and C nucleotides, in comparison with the nucleotide composition of miRNA upstream sequences. Although the motifs were predicted using sequences that are upstream of miRNAs, we find that 99% of the top-predicted motifs preferentially occur within the first 500 nucleotides upstream of the transcription start sites of protein-coding genes; the observed preference in location underscores the validity and importance of the motifs identified in this study. Our study also raises the possibility that a considerable number of well-characterized, disease-associated transcription factors (TFs) of protein-coding genes contribute to the abnormal miRNA expression in diseases such as cancer. Further analysis of predicted miRNA–protein interactions lead us to hypothesize that TFs that include c-Myb, NF-Y, Sp-1, MTF-1, and AP-2α are master-regulators of miRNA expression. Our predictions are a solid starting point for the systematic elucidation of the causative basis for aberrant expression patterns of disease-related (e.g., cancer) miRNAs. Thus, we point out that focused studies of the TFs that regulate miRNAs will be paramount in developing cures for miRNA-related diseases. The identification of the miRNA regulatory motifs was facilitated by a new computational method, K-Factor. K-Factor predicts regulatory motifs in a set of functionally related sequences, without relying on evolutionary conservation. PMID:17447837

  8. Movement of regulatory RNA between animal cells

    PubMed Central

    Jose, Antony M.

    2015-01-01

    Summary Recent studies suggest that RNA can move from one cell to another and regulate genes through specific base-pairing. Mechanisms that modify or select RNA for secretion from a cell are unclear. Secreted RNA can be stable enough to be detected in the extracellular environment and can enter the cytosol of distant cells to regulate genes. Mechanisms that import RNA into the cytosol of an animal cell can enable uptake of RNA from many sources including other organisms. This role of RNA is akin to that of steroid hormones, which cross cell membranes to regulate genes. The potential diagnostic use of RNA in human extracellular fluids has ignited interest in understanding mechanisms that enable the movement of RNA between animal cells. Genetic model systems will be essential to gain more confidence in proposed mechanisms of RNA transport and to connect an extracellular RNA with a specific biological function. Studies in the worm C. elegans and in other animals have begun to reveal parts of this novel mechanism of cell-to-cell communication. Here, I summarize the current state of this nascent field, highlight the many unknowns, and suggest future directions. PMID:26138457

  9. Modernizing the Regulatory System for Biotechnology Products

    EPA Pesticide Factsheets

    This Web page describes the continuing effort to modernize the federal regulatory system for biotechnology products as well as clarify various roles of EPA, FDA and USDA in evaluating new biotechnology products.

  10. Recurrent rewiring and emergence of RNA regulatory networks.

    PubMed

    Wilinski, Daniel; Buter, Natascha; Klocko, Andrew D; Lapointe, Christopher P; Selker, Eric U; Gasch, Audrey P; Wickens, Marvin

    2017-04-04

    Alterations in regulatory networks contribute to evolutionary change. Transcriptional networks are reconfigured by changes in the binding specificity of transcription factors and their cognate sites. The evolution of RNA-protein regulatory networks is far less understood. The PUF (Pumilio and FBF) family of RNA regulatory proteins controls the translation, stability, and movements of hundreds of mRNAs in a single species. We probe the evolution of PUF-RNA networks by direct identification of the mRNAs bound to PUF proteins in budding and filamentous fungi and by computational analyses of orthologous RNAs from 62 fungal species. Our findings reveal that PUF proteins gain and lose mRNAs with related and emergent biological functions during evolution. We demonstrate at least two independent rewiring events for PUF3 orthologs, independent but convergent evolution of PUF4/5 binding specificity and the rewiring of the PUF4/5 regulons in different fungal lineages. These findings demonstrate plasticity in RNA regulatory networks and suggest ways in which their rewiring occurs.

  11. Regulatory RNA-assisted genome engineering in microorganisms.

    PubMed

    Si, Tong; HamediRad, Mohammad; Zhao, Huimin

    2015-12-01

    Regulatory RNAs are increasingly recognized and utilized as key modulators of gene expression in diverse organisms. Thanks to their modular and programmable nature, trans-acting regulatory RNAs are especially attractive in genome-scale applications. Here we discuss the recent examples in microbial genome engineering implementing various trans-acting RNA platforms, including sRNA, RNAi, asRNA and CRISRP-Cas. In particular, we focus on how the scalable and multiplex nature of trans-acting RNAs has been used to tackle the challenges in creating genome-wide and combinatorial diversity for functional genomics and metabolic engineering applications. Advances in computational design and context-dependent regulation are also discussed for their contribution in improving fine-tuning capabilities of trans-acting RNAs.

  12. Identification of miRNAs and miRNA-mediated regulatory pathways in Carica papaya.

    PubMed

    Liang, Gang; Li, Yang; He, Hua; Wang, Fang; Yu, Diqiu

    2013-10-01

    Plant microRNAs (miRNAs) post-transcriptionally regulate target gene expression to modulate growth and development and biotic and abiotic stress responses. By analyzing small RNA deep sequencing data in combination with the genome sequence, we identified 75 conserved miRNAs and 11 novel miRNAs. Their target genes were also predicted. For most conserved miRNAs, the miRNA-target pairs were conserved across plant species. In addition to these conserved miRNA-target pairs, we also identified some papaya-specific miRNA-target regulatory pathways. Both miR168 and miR530 target the Argonaute 1 gene, indicating a second autoregulatory mechanism for miRNA regulation. A non-conserved miRNA was mapped within an intron of Dicer-like 1 (DCL1), suggesting a conserved homeostatic autoregulatory mechanism for DCL1 expression. A 21-nt miRNA triggers secondary siRNA production from its target genes, nucleotide-binding site leucine-rich repeat protein genes. Certain phased-miRNAs were processed from their conserved miRNA precursors, indicating a putative miRNA evolution mechanism. In addition, we identified a Carica papaya-specific miRNA that targets an ethylene receptor gene, implying its function in the ethylene signaling pathway. This work will also advance our understanding of miRNA functions and evolution in plants.

  13. Identification of common microRNA-mRNA regulatory biomodules in human epithelial cancers

    PubMed Central

    Yang, Xinan; Lee, Younghee; Fan, Hong; Sun, Xiao; Lussier, Yves A

    2010-01-01

    The complex regulatory network between microRNAs and gene expression remains unclear domain of active research. We proposed to address in part this complex regulation with a novel approach for the genome-wide identification of biomodules derived from paired microRNA and mRNA profiles, which could reveal correlations associated with a complex network of de-regulation in human cancer. Two published expression datasets for 68 samples with 11 distinct types of epithelial cancers and 21 samples of normal tissues were used, containing microRNA expression (Lu et al. Nature Letters 2005) and gene expression (Ramaswarmy et al. PNAS 2001) profiles, respectively. As results, the microRNA expression used jointly with mRNA expression can provide better classifiers of epithelial cancers against normal epithelial tissue than either dataset alone (p=1×10-10, F-Test). We identified a combination of six microRNA-mRNA biomodules that optimally classified epithelial cancers from normal epithelial tissue (total accuracy = 93.3%; 95% confidence intervals: 86% - 97%), using penalized logistic regression (PLR) algorithm and three-fold cross-validation. Three of these biomodules are individually sufficient to cluster epithelial cancers from normal tissue using mutual information distance. The biomodules contain 10 distinct microRNAs and 98 distinct genes, including well known tumor markers such as miR-15a, miR-30e, IRAK1, TGFBR2, DUSP16, CDC25B and PDCD2. In addition, there is a significant enrichment (Fisher’s exact test p=3×10-10) between putative microRNA-target gene pairs reported in five microRNA target databases and the inversely correlated micro-RNA-mRNA pairs in the biomodules. Further, microRNAs and genes in the biomodules were found in abstracts mentioning epithelial cancers (Fisher Exact Test, unadjusted p<0.05). Taken together, these results strongly suggest that the discovered microRNA-mRNA biomodules correspond to regulatory mechanisms common to human epithelial cancer

  14. Regulatory RNA design through evolutionary computation and strand displacement.

    PubMed

    Rostain, William; Landrain, Thomas E; Rodrigo, Guillermo; Jaramillo, Alfonso

    2015-01-01

    The discovery and study of a vast number of regulatory RNAs in all kingdoms of life over the past decades has allowed the design of new synthetic RNAs that can regulate gene expression in vivo. Riboregulators, in particular, have been used to activate or repress gene expression. However, to accelerate and scale up the design process, synthetic biologists require computer-assisted design tools, without which riboregulator engineering will remain a case-by-case design process requiring expert attention. Recently, the design of RNA circuits by evolutionary computation and adapting strand displacement techniques from nanotechnology has proven to be suited to the automated generation of DNA sequences implementing regulatory RNA systems in bacteria. Herein, we present our method to carry out such evolutionary design and how to use it to create various types of riboregulators, allowing the systematic de novo design of genetic control systems in synthetic biology.

  15. Current status of herbal product: Regulatory overview.

    PubMed

    Sharma, Sanjay

    2015-01-01

    A review of the regulatory status of herbal drugs/products was done for few countries forming part of Asia, Africa, America, Europe, and Australia, to understand various categories under which the trade of herbal products is permitted and their premarketing requirements. A critical assessment was done, to know the hindrances in the process of harmonization of herbal products. It has been found that there is a lack of harmonization in the regulatory requirements of herbal products internationally, besides the issues of availability of herbs and their conservation. These are hindering the international trade and growth of the herbal products segment.

  16. Current status of herbal product: Regulatory overview

    PubMed Central

    Sharma, Sanjay

    2015-01-01

    A review of the regulatory status of herbal drugs/products was done for few countries forming part of Asia, Africa, America, Europe, and Australia, to understand various categories under which the trade of herbal products is permitted and their premarketing requirements. A critical assessment was done, to know the hindrances in the process of harmonization of herbal products. It has been found that there is a lack of harmonization in the regulatory requirements of herbal products internationally, besides the issues of availability of herbs and their conservation. These are hindering the international trade and growth of the herbal products segment. PMID:26681886

  17. Coordinated activities of human dicer domains in regulatory RNA processing.

    PubMed

    Ma, Enbo; Zhou, Kaihong; Kidwell, Mary Anne; Doudna, Jennifer A

    2012-09-28

    The conserved ribonuclease Dicer generates microRNAs and short-interfering RNAs that guide gene silencing in eukaryotes. The specific contributions of human Dicer's structural domains to RNA product length and substrate preference are incompletely understood, due in part to the difficulties of Dicer purification. Here, we show that active forms of human Dicer can be assembled from recombinant polypeptides expressed in bacteria. Using this system, we find that three distinct modes of RNA recognition give rise to Dicer's fidelity and product length specificity. The first involves anchoring one end of a double-stranded RNA helix within the PAZ domain, which can assemble in trans with Dicer's catalytic domains to reconstitute an accurate but non-substrate-selective dicing activity. The second entails nonspecific RNA binding by the double-stranded RNA binding domain, an interaction that is essential for substrate recruitment in the absence of the PAZ domain. The third mode of recognition involves hairpin RNA loop recognition by the helicase domain, which ensures efficient processing of specific substrates. These results reveal distinct interactions of each Dicer domain with different RNA structural features and provide a facile system for investigating the molecular mechanisms of human microRNA biogenesis.

  18. Regulatory Roles for Long ncRNA and mRNA

    PubMed Central

    Karapetyan, Armen R.; Buiting, Coen; Kuiper, Renske A.; Coolen, Marcel W.

    2013-01-01

    Recent advances in high-throughput sequencing technology have identified the transcription of a much larger portion of the genome than previously anticipated. Especially in the context of cancer it has become clear that aberrant transcription of both protein-coding and long non-coding RNAs (lncRNAs) are frequent events. The current dogma of RNA function describes mRNA to be responsible for the synthesis of proteins, whereas non-coding RNA can have regulatory or epigenetic functions. However, this distinction between protein coding and regulatory ability of transcripts may not be that strict. Here, we review the increasing body of evidence for the existence of multifunctional RNAs that have both protein-coding and trans-regulatory roles. Moreover, we demonstrate that coding transcripts bind to components of the Polycomb Repressor Complex 2 (PRC2) with similar affinities as non-coding transcripts, revealing potential epigenetic regulation by mRNAs. We hypothesize that studies on the regulatory ability of disease-associated mRNAs will form an important new field of research. PMID:24216986

  19. Cis-regulatory RNA elements that regulate specialized ribosome activity

    PubMed Central

    Xue, Shifeng; Barna, Maria

    2015-01-01

    Recent evidence has shown that the ribosome itself can play a highly regulatory role in the specialized translation of specific subpools of mRNAs, in particular at the level of ribosomal proteins (RP). However, the mechanism(s) by which this selection takes place has remained poorly understood. In our recent study, we discovered a combination of unique RNA elements in the 5′UTRs of mRNAs that allows for such control by the ribosome. These mRNAs contain a Translation Inhibitory Element (TIE) that inhibits general cap-dependent translation, and an Internal Ribosome Entry Site (IRES) that relies on a specific RP for activation. The unique combination of an inhibitor of general translation and an activator of specialized translation is key to ribosome-mediated control of gene expression. Here we discuss how these RNA regulatory elements provide a new level of control to protein expression and their implications for gene expression, organismal development and evolution. PMID:26327194

  20. Integrated analysis of miRNA and mRNA during differentiation of human CD34+ cells delineates the regulatory roles of microRNA in hematopoiesis.

    PubMed

    Raghavachari, Nalini; Liu, Poching; Barb, Jennifer J; Yang, Yanqin; Wang, Richard; Nguyen, Quang Tri; Munson, Peter J

    2014-01-01

    In the process of human hematopoiesis, precise regulation of the expression of lineage-specific gene products is critical for multiple cell-fate decisions that govern cell differentiation, proliferation, and self-renewal. Given the important role of microRNAs (miRNAs) in development and differentiation, we examined the global expression of miRNA in CD34(+) cells during lineage specific hematopoiesis and found 49 miRNAs to be differentially expressed, with functional roles in cellular growth and proliferation, and apoptosis. miR-18a was upregulated during erythropoiesis and downregulated during megakaryopoiesis. miR-145 was upregulated during granulopoiesis and down regulated during erythropoiesis. Megakaryopoitic differentiation resulted in significant alteration in the expression of many miRNAs that are believed to play critical roles in the regulation of B and T cell differentiation. Target prediction analyses on three different miRNA databases indicated that TargetScan outperformed microCosm and miRDB in identifying potential miRNA targets associated with hematopoietic differentiation process. An integrated analysis of the observed miRNAs and messenger RNAs (mRNAs) resulted in 87 highly correlated miRNA-mRNA pairs that have major functional roles in cellular growth and proliferation, hematopoietic system development, and Wnt/B-catenin and Flt 3 signaling pathways. We believe that this study will enhance our understanding on the regulatory roles of miRNA in hematopoiesis by providing a library of mRNA-miRNA networks.

  1. Deep sequencing of RNA from immune cell-derived vesicles uncovers the selective incorporation of small non-coding RNA biotypes with potential regulatory functions

    PubMed Central

    Nolte-’t Hoen, Esther N. M.; Buermans, Henk P. J.; Waasdorp, Maaike; Stoorvogel, Willem; Wauben, Marca H. M.; ’t Hoen, Peter A. C.

    2012-01-01

    Cells release RNA-carrying vesicles and membrane-free RNA/protein complexes into the extracellular milieu. Horizontal vesicle-mediated transfer of such shuttle RNA between cells allows dissemination of genetically encoded messages, which may modify the function of target cells. Other studies used array analysis to establish the presence of microRNAs and mRNA in cell-derived vesicles from many sources. Here, we used an unbiased approach by deep sequencing of small RNA released by immune cells. We found a large variety of small non-coding RNA species representing pervasive transcripts or RNA cleavage products overlapping with protein coding regions, repeat sequences or structural RNAs. Many of these RNAs were enriched relative to cellular RNA, indicating that cells destine specific RNAs for extracellular release. Among the most abundant small RNAs in shuttle RNA were sequences derived from vault RNA, Y-RNA and specific tRNAs. Many of the highly abundant small non-coding transcripts in shuttle RNA are evolutionary well-conserved and have previously been associated to gene regulatory functions. These findings allude to a wider range of biological effects that could be mediated by shuttle RNA than previously expected. Moreover, the data present leads for unraveling how cells modify the function of other cells via transfer of specific non-coding RNA species. PMID:22821563

  2. Identify signature regulatory network for glioblastoma prognosis by integrative mRNA and miRNA co-expression analysis.

    PubMed

    Bing, Zhi-Tong; Yang, Guang-Hui; Xiong, Jie; Guo, Ling; Yang, Lei

    2016-12-01

    Glioblastoma multiforme (GBM) is the most common and aggressive type of primary brain tumor in adults. Patients with this disease have a poor prognosis. The objective of this study is to identify survival-related individual genes (or miRNAs) and miRNA -mRNA pairs in GBM using a multi-step approach. First, the weighted gene co-expression network analysis and survival analysis are applied to identify survival-related modules from mRNA and miRNA expression profiles, respectively. Subsequently, the role of individual genes (or miRNAs) within these modules in GBM prognosis are highlighted using survival analysis. Finally, the integration analysis of miRNA and mRNA expression as well as miRNA target prediction is used to identify survival-related miRNA -mRNA regulatory network. In this study, five genes and two miRNA modules that significantly correlated to patient's survival. In addition, many individual genes (or miRNAs) assigned to these modules were found to be closely linked with survival. For instance, increased expression of neuropilin-1 gene (a member of module turquoise) indicated poor prognosis for patients and a group of miRNA -mRNA regulatory networks that comprised 38 survival-related miRNA -mRNA pairs. These findings provide a new insight into the underlying molecular regulatory mechanisms of GBM.

  3. Powerplant productivity improvements and regulatory incentives

    SciTech Connect

    Hardy, D; Brown, D

    1980-10-27

    The purpose of this study was to examine the benefits to be gained from increased powerplant productivity and to validate and demonstrate the use of incentives within the regulatory process to promote the improvement of powerplant productivity. The system-wide costs savings to be gained from given productivity improvement scenarios are estimated in both the short and long term. Numerous reports and studies exist which indicate that productivity improvements at the powerplant level are feasible and cost effective. The efforts of this study widen this focus and relate system-wide productivity improvements with system-wide cost savings. The initial thrust of the regulatory section of this study is to validate the existence of reasonable incentive procedures which would enable regulatory agencies to better motivate electric utilities to improve productivity on both the powerplant and system levels. The voluntary incentive format developed in this study was designed to facilitate the link between profit and efficiency which is typically not clear in most regulated market environments. It is concluded that at the present time, many electric utilities in this country could significantly increase the productivity of their base load units, and the adoption of an incentive program of the general type recommended in this study would add to rate of return regulation the needed financial incentives to enable utilities to make such improvements without losing long-run profit. In light of the upcoming oil import target levels and mandatory cutbacks of oil and gas as boiler fuels for electric utilities, the use of incentive programs to encourage more efficient utilization of coal and nuclear base load capacity will become far more inviting over the next two decades.

  4. National Strategy for Modernizing the Regulatory System for Biotechnology Products

    EPA Pesticide Factsheets

    This National Strategy for Modernizing the Regulatory System for Biotechnology Products sets forth a vision for ensuring that the federal regulatory system is prepared to efficiently assess the risks, if any, of the future products of biotechnology.

  5. Structure of an RNA dimer of a regulatory element from human thymidylate synthase mRNA

    SciTech Connect

    Dibrov, Sergey; McLean, Jaime; Hermann, Thomas

    2011-09-27

    A sequence around the start codon of the mRNA of human thymidylate synthase (TS) folds into a secondary-structure motif in which the initiation site is sequestered in a metastable hairpin. Binding of the protein to its own mRNA at the hairpin prevents the production of TS through a translation-repression feedback mechanism. Stabilization of the mRNA hairpin by other ligands has been proposed as a strategy to reduce TS levels in anticancer therapy. Rapidly proliferating cells require high TS activity to maintain the production of thymidine as a building block for DNA synthesis. The crystal structure of a model oligonucleotide (TS1) that represents the TS-binding site of the mRNA has been determined. While fluorescence studies showed that the TS1 RNA preferentially adopts a hairpin structure in solution, even at high RNA concentrations, an asymmetric dimer of two hybridized TS1 strands was obtained in the crystal. The TS1 dimer contains an unusual S-turn motif that also occurs in the 'off' state of the human ribosomal decoding site RNA.

  6. Epigenetic engineering of ribosomal RNA genes enhances protein production.

    PubMed

    Santoro, Raffaella; Lienemann, Philipp; Fussenegger, Martin

    2009-08-14

    Selection of mammalian high-producer cell lines remains a major challenge for the biopharmaceutical manufacturing industry. Ribosomal RNA (rRNA) genes encode the major component of the ribosome but many rRNA gene copies are not transcribed due to epigenetic silencing by the nucleolar remodelling complex (NoRC) [6], which may limit the cell's full production capacity. Here we show that the knockdown of TIP5, a subunit of NoRC, decreases the number of silent rRNA genes, upregulates rRNA transcription, enhances ribosome synthesis and increases production of recombinant proteins. However, general enhancement of rRNA transcription rate did not stimulate protein synthesis. Our data demonstrates that the number of transcriptionally competent rRNA genes limits efficient ribosome synthesis. Epigenetic engineering of ribosomal RNA genes offers new possibilities for improving biopharmaceutical manufacturing and provides novel insights into the complex regulatory network which governs the translation machinery in normal cellular processes as well as in pathological conditions like cancer.

  7. Changes of microRNA profile and microRNA-mRNA regulatory network in bones of ovariectomized mice.

    PubMed

    An, Jee Hyun; Ohn, Jung Hun; Song, Jung Ah; Yang, Jae-Yeon; Park, Hyojung; Choi, Hyung Jin; Kim, Sang Wan; Kim, Seong Yeon; Park, Woog-Yang; Shin, Chan Soo

    2014-03-01

    Growing evidence shows the possibility of a role of microRNAs (miRNA) in regulating bone mass. We investigated the change of miRNAs and mRNA expression profiles in bone tissue in an ovariectomized mice model and evaluated the regulatory mechanism of bone mass mediated by miRNAs in an estrogen-deficiency state. Eight-week-old female C3H/HeJ mice underwent ovariectomy (OVX) or sham operation (Sham-op), and their femur and tibia were harvested to extract total bone RNAs after 4 weeks for microarray analysis. Eight miRNAs (miR-127, -133a, -133a*, -133b, -136, -206, -378, -378*) were identified to be upregulated after OVX, whereas one miRNA (miR-204) was downregulated. Concomitant analysis of mRNA microarray revealed that 658 genes were differentially expressed between OVX and Sham-op mice. Target prediction of differentially expressed miRNAs identified potential targets, and integrative analysis using the mRNA microarray results showed that PPARγ and CREB pathways are activated in skeletal tissues after ovariectomy. Among the potential candidates of miRNA, we further studied the role of miR-127 in vitro, which exhibited the greatest changes after OVX. We also studied the effects of miR-136, which has not been studied in the context of bone mass regulation. Transfection of miR-127 inhibitor has enhanced osteoblastic differentiation in UAMS-32 cells as measured by alkaline phosphatase activities and mRNA expression of osteoblast-specific genes, whereas miR-136 precursor has inhibited osteoblastic differentiation. Furthermore, transfection of both miR-127 and miR-136 inhibitors enhanced the osteocyte-like morphological changes and survival in MLO-Y4 cells, whereas precursors of miR-127 and -136 have aggravated dexamethasone-induced cell death. Both of the precursors enhanced osteoclastic differentiation in bone marrow macrophages, indicating that both miR-127 and -136 are negatively regulating bone mass. Taken together, these results suggest a novel insight into the

  8. Deciphering RNA Regulatory Elements Involved in the Developmental and Environmental Gene Regulation of Trypanosoma brucei.

    PubMed

    Gazestani, Vahid H; Salavati, Reza

    2015-01-01

    Trypanosoma brucei is a vector-borne parasite with intricate life cycle that can cause serious diseases in humans and animals. This pathogen relies on fine regulation of gene expression to respond and adapt to variable environments, with implications in transmission and infectivity. However, the involved regulatory elements and their mechanisms of actions are largely unknown. Here, benefiting from a new graph-based approach for finding functional regulatory elements in RNA (GRAFFER), we have predicted 88 new RNA regulatory elements that are potentially involved in the gene regulatory network of T. brucei. We show that many of these newly predicted elements are responsive to both transcriptomic and proteomic changes during the life cycle of the parasite. Moreover, we found that 11 of predicted elements strikingly resemble previously identified regulatory elements for the parasite. Additionally, comparison with previously predicted motifs on T. brucei suggested the superior performance of our approach based on the current limited knowledge of regulatory elements in T. brucei.

  9. Regulatory mechanisms of exoribonuclease PNPase and regulatory small RNA on T3SS of dickeya dadantii

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The type III secretion system (T3SS) is an essential virulence factor for many bacterial pathogens. Polynucleotide phosphorylase (PNPase) is one of the major exoribonucleases in bacteria and plays important roles in mRNA degradation, tRNA processing, and small RNA (sRNA) turnover. In this study, we ...

  10. A tri-component conservation strategy reveals highly confident microRNA-mRNA interactions and evolution of microRNA regulatory networks.

    PubMed

    Lin, Chen-Ching; Mitra, Ramkrishna; Zhao, Zhongming

    2014-01-01

    MicroRNAs are small non-coding RNAs that can regulate expressions of their target genes at the post-transcriptional level. In this study, we propose a tri-component strategy that combines the conservation of microRNAs, homology of mRNA coding regions, and conserved microRNA binding sites in the 3' untranslated regions to discover conserved microRNA-mRNA interactions. To validate the performance of our conservation strategy, we collected the experimentally validated microRNA-mRNA interactions from three databases as the golden standard. We found that the proposed strategy can improve the performance of existing target prediction algorithms by approximately 2-4 fold. In addition, we demonstrated that the proposed strategy could efficiently retain highly confident interactions from the intersection results of the existing algorithms and filter out the possible false positive predictions in the union one. Furthermore, this strategy can facilitate our ability to trace the homologues in different species that are targeted by the same miRNA family because it combines these three features to identify the conserved miRNA-mRNA interactions during evolution. Through an extensive application of the proposed conservation strategy to a study of the miR-1/206 regulatory network, we demonstrate that the target mRNA recruiting process could be associated with expansion of miRNA family during its evolution. We also uncovered the functional evolution of the miR-1/206 regulatory network. In this network, the early targeted genes tend to participate in more general and development-related functions. In summary, the conservation strategy is capable of helping to highlight the highly confident miRNA-mRNA interactions and can be further applied to reveal the evolutionary features of miRNA regulatory network and functions.

  11. Regulatory factors governing adenosine-to-inosine (A-to-I) RNA editing.

    PubMed

    Hong, HuiQi; Lin, Jaymie Siqi; Chen, Leilei

    2015-03-31

    Adenosine-to-inosine (A-to-I) RNA editing, the most prevalent mode of transcript modification in higher eukaryotes, is catalysed by the adenosine deaminases acting on RNA (ADARs). A-to-I editing imposes an additional layer of gene regulation as it dictates various aspects of RNA metabolism, including RNA folding, processing, localization and degradation. Furthermore, editing events in exonic regions contribute to proteome diversity as translational machinery decodes inosine as guanosine. Although it has been demonstrated that dysregulated A-to-I editing contributes to various diseases, the precise regulatory mechanisms governing this critical cellular process have yet to be fully elucidated. However, integration of previous studies revealed that regulation of A-to-I editing is multifaceted, weaving an intricate network of auto- and transregulations, including the involvement of virus-originated factors like adenovirus-associated RNA. Taken together, it is apparent that tipping of any regulatory components will have profound effects on A-to-I editing, which in turn contributes to both normal and aberrant physiological conditions. A complete understanding of this intricate regulatory network may ultimately be translated into new therapeutic strategies against diseases driven by perturbed RNA editing events. Herein, we review the current state of knowledge on the regulatory mechanisms governing A-to-I editing and propose the role of other co-factors that may be involved in this complex regulatory process.

  12. Predicting gene regulatory networks of soybean nodulation from RNA-Seq transcriptome data

    PubMed Central

    2013-01-01

    Background High-throughput RNA sequencing (RNA-Seq) is a revolutionary technique to study the transcriptome of a cell under various conditions at a systems level. Despite the wide application of RNA-Seq techniques to generate experimental data in the last few years, few computational methods are available to analyze this huge amount of transcription data. The computational methods for constructing gene regulatory networks from RNA-Seq expression data of hundreds or even thousands of genes are particularly lacking and urgently needed. Results We developed an automated bioinformatics method to predict gene regulatory networks from the quantitative expression values of differentially expressed genes based on RNA-Seq transcriptome data of a cell in different stages and conditions, integrating transcriptional, genomic and gene function data. We applied the method to the RNA-Seq transcriptome data generated for soybean root hair cells in three different development stages of nodulation after rhizobium infection. The method predicted a soybean nodulation-related gene regulatory network consisting of 10 regulatory modules common for all three stages, and 24, 49 and 70 modules separately for the first, second and third stage, each containing both a group of co-expressed genes and several transcription factors collaboratively controlling their expression under different conditions. 8 of 10 common regulatory modules were validated by at least two kinds of validations, such as independent DNA binding motif analysis, gene function enrichment test, and previous experimental data in the literature. Conclusions We developed a computational method to reliably reconstruct gene regulatory networks from RNA-Seq transcriptome data. The method can generate valuable hypotheses for interpreting biological data and designing biological experiments such as ChIP-Seq, RNA interference, and yeast two hybrid experiments. PMID:24053776

  13. Two regulatory RNA elements affect TisB-dependent depolarization and persister formation.

    PubMed

    Berghoff, Bork A; Hoekzema, Mirthe; Aulbach, Lena; Wagner, E Gerhart H

    2017-03-01

    Bacterial survival strategies involve phenotypic diversity which is generated by regulatory factors and noisy expression of effector proteins. The question of how bacteria exploit regulatory RNAs to make decisions between phenotypes is central to a general understanding of these universal regulators. We investigated the TisB/IstR-1 toxin-antitoxin system of Escherichia coli to appreciate the role of the RNA antitoxin IstR-1 in TisB-dependent depolarization of the inner membrane and persister formation. Persisters are phenotypic variants that have become transiently drug-tolerant by arresting growth. The RNA antitoxin IstR-1 sets a threshold for TisB-dependent depolarization under DNA-damaging conditions, resulting in two sub-populations: polarized and depolarized cells. Furthermore, our data indicate that an inhibitory 5' UTR structure in the tisB mRNA serves as a regulatory RNA element that delays TisB translation to avoid inappropriate depolarization when DNA damage is low. Investigation of the persister sub-population further revealed that both regulatory RNA elements affect persister levels as well as persistence time. This work provides an intriguing example of how bacteria exploit regulatory RNAs to control phenotypic heterogeneity.

  14. Regulatory microRNA Network Identification in Bovine Blastocyst Development

    PubMed Central

    Mestdagh, Pieter; Lefever, Steve; Van Poucke, Mario; Van Zeveren, Alex; Van Soom, Ann; Vandesompele, Jo; Peelman, Luc

    2013-01-01

    Mammalian blastocyst formation is characterized by two lineage segregations resulting in the formation of the trophectoderm, the hypoblast, and the epiblast cell lineages. Cell fate determination during these early lineage segregations is associated with changes in the expression of specific transcription factors. In addition to the transcription factor-based control, it has become clear that also microRNAs (miRNAs) play an important role in the post-transcriptional regulation of pluripotency and differentiation. To elucidate the role of miRNAs in early lineage segregation, we compared the miRNA expression in early bovine blastocysts with the more advanced stage of hatched blastocysts. Reverse transcription–quantitative PCR-based miRNA expression profiling revealed eight upregulated miRNAs (miR-127, miR-130a, miR-155, miR-196a, miR-203, miR-28, miR-29c, and miR-376a) and four downregulated miRNAs (miR-135a, miR-218, miR-335, and miR-449b) in hatched blastocysts. Through an integrative analysis of matching miRNA and mRNA expression data, candidate miRNA-mRNA interaction pairs were prioritized for validation. Using an in vitro luciferase reporter assay, we confirmed a direct interaction between miR-218 and CDH2, miR-218 and NANOG, and miR-449b and NOTCH1. By interfering with the FGF signaling pathway, we found functional evidence that miR-218, mainly expressed in the inner cell mass, regulates the NANOG expression in the bovine blastocyst in response to FGF signaling. The results of this study expand our knowledge about the miRNA signature of the bovine blastocyst and of the interactions between miRNAs and cell fate regulating transcription factors. PMID:23398486

  15. Predicting miRNA Targets by Integrating Gene Regulatory Knowledge with Expression Profiles

    PubMed Central

    Zhang, Weijia; Le, Thuc Duy; Liu, Lin; Zhou, Zhi-Hua; Li, Jiuyong

    2016-01-01

    Motivation microRNAs (miRNAs) play crucial roles in post-transcriptional gene regulation of both plants and mammals, and dysfunctions of miRNAs are often associated with tumorigenesis and development through the effects on their target messenger RNAs (mRNAs). Identifying miRNA functions is critical for understanding cancer mechanisms and determining the efficacy of drugs. Computational methods analyzing high-throughput data offer great assistance in understanding the diverse and complex relationships between miRNAs and mRNAs. However, most of the existing methods do not fully utilise the available knowledge in biology to reduce the uncertainty in the modeling process. Therefore it is desirable to develop a method that can seamlessly integrate existing biological knowledge and high-throughput data into the process of discovering miRNA regulation mechanisms. Results In this article we present an integrative framework, CIDER (Causal miRNA target Discovery with Expression profile and Regulatory knowledge), to predict miRNA targets. CIDER is able to utilise a variety of gene regulation knowledge, including transcriptional and post-transcriptional knowledge, and to exploit gene expression data for the discovery of miRNA-mRNA regulatory relationships. The benefits of our framework is demonstrated by both simulation study and the analysis of the epithelial-to-mesenchymal transition (EMT) and the breast cancer (BRCA) datasets. Our results reveal that even a limited amount of either Transcription Factor (TF)-miRNA or miRNA-mRNA regulatory knowledge improves the performance of miRNA target prediction, and the combination of the two types of knowledge enhances the improvement further. Another useful property of the framework is that its performance increases monotonically with the increase of regulatory knowledge. PMID:27064982

  16. microRNA regulatory mechanism by which PLLA aligned nanofibers influence PC12 cell differentiation

    NASA Astrophysics Data System (ADS)

    Yu, Yadong; Lü, Xiaoying; Ding, Fei

    2015-08-01

    Objective. Aligned nanofibers (AFs) are regarded as promising biomaterials in nerve tissue engineering. However, a full understanding of the biocompatibility of AFs at the molecular level is still challenging. Therefore, the present study focused on identifying the microRNA (miRNA)-mediated regulatory mechanism by which poly-L-lactic acid (PLLA) AFs influence PC12 cell differentiation. Approach. Firstly, the effects of PLLA random nanofibers (RFs)/AFs and PLLA films (control) on the biological responses of PC12 cells that are associated with neuronal differentiation were examined. Then, SOLiD sequencing and cDNA microarray were employed to profile the expressions of miRNAs and mRNAs. The target genes of the misregulated miRNAs were predicted and compared with the mRNA profile data. Functions of the matched target genes (the intersection between the predicted target genes and the experimentally-determined, misregulated genes) were analyzed. Main results. The results revealed that neurites spread in various directions in control and RF groups. In the AF group, most neurites extended in parallel with each other. The glucose consumption and lactic acid production in the RF and AF groups were higher than those in the control group. Compared with the control group, 42 and 94 miRNAs were significantly dysregulated in the RF and AF groups, respectively. By comparing the predicted target genes with the mRNA profile data, five and 87 matched target genes were found in the RF and AF groups, respectively. Three of the matched target genes in the AF group were found to be associated with neuronal differentiation, whereas none had this association in the RF group. The PLLA AFs induced the dysregulation of miRNAs that regulate many biological functions, including axonal guidance, lipid metabolism and long-term potentiation. In particular, two miRNA-matched target gene-biological function modules associated with neuronal differentiation were identified as follows: (1) miR-23b, mi

  17. Modulation of neoplastic gene regulatory pathways by the RNA-binding factor AUF1

    PubMed Central

    Zucconi, Beth E.; Wilson, Gerald M.

    2013-01-01

    The mRNA-binding protein AUF1 regulates the expression of many key players in cancer including proto-oncogenes, regulators of apoptosis and the cell cycle, and pro-inflammatory cytokines, principally by directing the decay kinetics of their encoded mRNAs. Most studies support an mRNA-destabilizing role for AUF1, although other findings suggest additional functions for this factor. In this review, we explore how changes in AUF1 isoform distribution, subcellular localization, and post-translational protein modifications can influence the metabolism of targeted mRNAs. However, several lines of evidence also support a role for AUF1 in the initiation and/or development of cancer. Many AUF1-targeted transcripts encode products that control pro- and anti-oncogenic processes. Also, overexpression of AUF1 enhances tumorigenesis in murine models, and AUF1 levels are enhanced in some tumors. Finally, signaling cascades that modulate AUF1 function are deregulated in some cancerous tissues. Together, these features suggest that AUF1 may play a prominent role in regulating the expression of many genes that can contribute to tumorigenic phenotypes, and that this post-transcriptional regulatory control point may be subverted by diverse mechanisms in neoplasia. PMID:21622178

  18. Cardiac-targeted delivery of regulatory RNA molecules and genes for the treatment of heart failure

    PubMed Central

    Poller, Wolfgang; Hajjar, Roger; Schultheiss, Heinz-Peter; Fechner, Henry

    2010-01-01

    Ribonucleic acid (RNA) in its many facets of structure and function is becoming more fully understood, and, therefore, it is possible to design and use RNAs as valuable tools in molecular biology and medicine. Understanding of the role of RNAs within the cell has changed dramatically during the past few years. Therapeutic strategies based on non-coding regulatory RNAs include RNA interference (RNAi) for the silencing of specific genes, and microRNA (miRNA) modulations to alter complex gene expression patterns. Recent progress has allowed the targeting of therapeutic RNAi to the heart for the treatment of heart failure, and we discuss current strategies in this field. Owing to the peculiar biochemical properties of small RNA molecules, the actual therapeutic translation of findings in vitro or in cell cultures is more demanding than with small molecule drugs or proteins. The critical requirement for animal studies after pre-testing of RNAi tools in vitro likewise applies for miRNA modulations, which also have complex consequences for the recipient that are dependent on stability and distribution of the RNA tools. Problems in the field that are not yet fully solved are the prediction of targets and specificity of the RNA tools as well as their tissue-specific and regulatable expression. We discuss analogies and differences between regulatory RNA therapy and classical gene therapy, since recent breakthroughs in vector technology are of importance for both. Recent years have witnessed parallel progress in the fields of gene-based and regulatory RNA-based therapies that are likely to significantly expand the cardiovascular therapeutic repertoire within the next decade. PMID:20176815

  19. Identification of candidate miRNA biomarkers from miRNA regulatory network with application to prostate cancer

    PubMed Central

    2014-01-01

    Background MicroRNAs (miRNAs) are a class of non-coding regulatory RNAs approximately 22 nucleotides in length that play a role in a wide range of biological processes. Abnormal miRNA function has been implicated in various human cancers including prostate cancer (PCa). Altered miRNA expression may serve as a biomarker for cancer diagnosis and treatment. However, limited data are available on the role of cancer-specific miRNAs. Integrative computational bioinformatics approaches are effective for the detection of potential outlier miRNAs in cancer. Methods The human miRNA-mRNA target network was reconstructed by integrating multiple miRNA-mRNA interaction datasets. Paired miRNA and mRNA expression profiling data in PCa versus benign prostate tissue samples were used as another source of information. These datasets were analyzed with an integrated bioinformatics framework to identify potential PCa miRNA signatures. In vitro q-PCR experiments and further systematic analysis were used to validate these prediction results. Results Using this bioinformatics framework, we identified 39 miRNAs as potential PCa miRNA signatures. Among these miRNAs, 20 had previously been identified as PCa aberrant miRNAs by low-throughput methods, and 16 were shown to be deregulated in other cancers. In vitro q-PCR experiments verified the accuracy of these predictions. miR-648 was identified as a novel candidate PCa miRNA biomarker. Further functional and pathway enrichment analysis confirmed the association of the identified miRNAs with PCa progression. Conclusions Our analysis revealed the scale-free features of the human miRNA-mRNA interaction network and showed the distinctive topological features of existing cancer miRNA biomarkers from previously published studies. A novel cancer miRNA biomarker prediction framework was designed based on these observations and applied to prostate cancer study. This method could be applied for miRNA biomarker prediction in other cancers. PMID

  20. Biochemical Features and Functional Implications of the RNA-Based T-Box Regulatory Mechanism

    PubMed Central

    Gutiérrez-Preciado, Ana; Henkin, Tina M.; Grundy, Frank J.; Yanofsky, Charles; Merino, Enrique

    2009-01-01

    Summary: The T-box mechanism is a common regulatory strategy used for modulating the expression of genes of amino acid metabolism-related operons in gram-positive bacteria, especially members of the Firmicutes. T-box regulation is usually based on a transcription attenuation mechanism in which an interaction between a specific uncharged tRNA and the 5′ region of the transcript stabilizes an antiterminator structure in preference to a terminator structure, thereby preventing transcription termination. Although single T-box regulatory elements are common, double or triple T-box arrangements are also observed, expanding the regulatory range of these elements. In the present study, we predict the functional implications of T-box regulation in genes encoding aminoacyl-tRNA synthetases, proteins of amino acid biosynthetic pathways, transporters, and regulatory proteins. We also consider the global impact of the use of this regulatory mechanism on cell physiology. Novel biochemical relationships between regulated genes and their corresponding metabolic pathways were revealed. Some of the genes identified, such as the quorum-sensing gene luxS, in members of the Lactobacillaceae were not previously predicted to be regulated by the T-box mechanism. Our analyses also predict an imbalance in tRNA sensing during the regulation of operons containing multiple aminoacyl-tRNA synthetase genes or biosynthetic genes involved in pathways common to more than one amino acid. Based on the distribution of T-box regulatory elements, we propose that this regulatory mechanism originated in a common ancestor of members of the Firmicutes, Chloroflexi, Deinococcus-Thermus group, and Actinobacteria and was transferred into the Deltaproteobacteria by horizontal gene transfer. PMID:19258532

  1. Cycling of the Sm-like protein Hfq on the DsrA small regulatory RNA.

    PubMed

    Lease, Richard A; Woodson, Sarah A

    2004-12-10

    Small RNAs (sRNAs) regulate bacterial genes involved in environmental adaptation. This RNA regulation requires Hfq, a bacterial Sm-like protein that stabilizes sRNAs and enhances RNA-RNA interactions. To understand the mechanism of target recognition by sRNAs, we investigated the interactions between Hfq, the sRNA DsrA, and its regulatory target rpoS mRNA, which encodes the stress response sigma factor. Nuclease footprinting revealed that Hfq recognized multiple sites in rpoS mRNA without significantly perturbing secondary structure in the 5' leader that inhibits translation initiation. Base-pairing with DsrA, however, made the rpoS ribosome binding site fully accessible, as predicted by genetic data. Hfq bound DsrA four times more tightly than the DsrA.rpoS RNA complex in gel mobility-shift assays. Consequently, Hfq is displaced rapidly from its high-affinity binding site on DsrA by conformational changes in DsrA, when DsrA base-pairs with rpoS mRNA. Hfq accelerated DsrA.rpoS RNA association and stabilized the RNA complex up to twofold. Hybridization of DsrA and rpoS mRNA was optimal when Hfq occupied its primary binding site on free DsrA, but was inhibited when Hfq associated with the DsrA.rpoS RNA complex. We conclude that recognition of rpoS mRNA is stimulated by binding of Hfq to free DsrA sRNA, followed by release of Hfq from the sRNA.mRNA complex.

  2. The Regulatory Effects of Long Noncoding RNA-ANCR on Dental Tissue-Derived Stem Cells

    PubMed Central

    Jia, Qian; Chen, Xiaolin; Jiang, Wenkai; Wang, Wei

    2016-01-01

    Long noncoding RNAs (lncRNA) have been recognized as important regulators in diverse biological processes, such as transcriptional regulation, stem cell proliferation, and differentiation. Previous study has demonstrated that lncRNA-ANCR (antidifferentiation ncRNA) plays a key role in regulating the proliferation and osteogenic differentiation of periodontal ligament stem cells (PDLSCs). However, little is known about the role of ANCR in regulating other types of dental tissue-derived stem cells (DTSCs) behaviours (including proliferation and multiple-potential of differentiation). In this study, we investigated the regulatory effects of lncRNA-ANCR on the proliferation and differentiation (including osteogenic, adipogenic, and neurogenic differentiation) of DTSCs, including dental pulp stem cells (DPSCs), PDLSCs, and stem cells from the apical papilla (SCAP) by downregulation of lncRNA-ANCR. We found that downregulation of ANCR exerted little effect on proliferation of DPSCs and SCAP but promoted the osteogenic, adipogenic, and neurogenic differentiation of DTSCs. These data provide an insight into the regulatory effects of long noncoding RNA-ANCR on DTSCs and indicate that ANCR is a very important regulatory factor in stem cell differentiation. PMID:27648074

  3. Advantages of mixing bioinformatics and visualization approaches for analyzing sRNA-mediated regulatory bacterial networks

    PubMed Central

    Bourqui, Romain; Benchimol, William; Gaspin, Christine; Sirand-Pugnet, Pascal; Uricaru, Raluca; Dutour, Isabelle

    2015-01-01

    The revolution in high-throughput sequencing technologies has enabled the acquisition of gigabytes of RNA sequences in many different conditions and has highlighted an unexpected number of small RNAs (sRNAs) in bacteria. Ongoing exploitation of these data enables numerous applications for investigating bacterial transacting sRNA-mediated regulation networks. Focusing on sRNAs that regulate mRNA translation in trans, recent works have noted several sRNA-based regulatory pathways that are essential for key cellular processes. Although the number of known bacterial sRNAs is increasing, the experimental validation of their interactions with mRNA targets remains challenging and involves expensive and time-consuming experimental strategies. Hence, bioinformatics is crucial for selecting and prioritizing candidates before designing any experimental work. However, current software for target prediction produces a prohibitive number of candidates because of the lack of biological knowledge regarding the rules governing sRNA–mRNA interactions. Therefore, there is a real need to develop new approaches to help biologists focus on the most promising predicted sRNA–mRNA interactions. In this perspective, this review aims at presenting the advantages of mixing bioinformatics and visualization approaches for analyzing predicted sRNA-mediated regulatory bacterial networks. PMID:25477348

  4. Co-evolution of Bacterial Ribosomal Protein S15 with Diverse mRNA Regulatory Structures.

    PubMed

    Slinger, Betty L; Newman, Hunter; Lee, Younghan; Pei, Shermin; Meyer, Michelle M

    2015-12-01

    RNA-protein interactions are critical in many biological processes, yet how such interactions affect the evolution of both partners is still unknown. RNA and protein structures are impacted very differently by mechanisms of genomic change. While most protein families are identifiable at the nucleotide level across large phylogenetic distances, RNA families display far less nucleotide similarity and are often only shared by closely related bacterial species. Ribosomal protein S15 has two RNA binding functions. First, it is a ribosomal protein responsible for organizing the rRNA during ribosome assembly. Second, in many bacterial species S15 also interacts with a structured portion of its own transcript to negatively regulate gene expression. While the first interaction is conserved in most bacteria, the second is not. Four distinct mRNA structures interact with S15 to enable regulation, each of which appears to be independently derived in different groups of bacteria. With the goal of understanding how protein-binding specificity may influence the evolution of such RNA regulatory structures, we examine whether examples of these mRNA structures are able to interact with, and regulate in response to, S15 homologs from organisms containing distinct mRNA structures. We find that despite their shared RNA binding function in the rRNA, S15 homologs have distinct RNA recognition profiles. We present a model to explain the specificity patterns observed, and support this model by with further mutagenesis. After analyzing the patterns of conservation for the S15 protein coding sequences, we also identified amino acid changes that alter the binding specificity of an S15 homolog. In this work we demonstrate that homologous RNA-binding proteins have different specificity profiles, and minor changes to amino acid sequences, or to RNA structural motifs, can have large impacts on RNA-protein recognition.

  5. Co-evolution of Bacterial Ribosomal Protein S15 with Diverse mRNA Regulatory Structures

    PubMed Central

    Slinger, Betty L.; Newman, Hunter; Lee, Younghan; Pei, Shermin; Meyer, Michelle M.

    2015-01-01

    RNA-protein interactions are critical in many biological processes, yet how such interactions affect the evolution of both partners is still unknown. RNA and protein structures are impacted very differently by mechanisms of genomic change. While most protein families are identifiable at the nucleotide level across large phylogenetic distances, RNA families display far less nucleotide similarity and are often only shared by closely related bacterial species. Ribosomal protein S15 has two RNA binding functions. First, it is a ribosomal protein responsible for organizing the rRNA during ribosome assembly. Second, in many bacterial species S15 also interacts with a structured portion of its own transcript to negatively regulate gene expression. While the first interaction is conserved in most bacteria, the second is not. Four distinct mRNA structures interact with S15 to enable regulation, each of which appears to be independently derived in different groups of bacteria. With the goal of understanding how protein-binding specificity may influence the evolution of such RNA regulatory structures, we examine whether examples of these mRNA structures are able to interact with, and regulate in response to, S15 homologs from organisms containing distinct mRNA structures. We find that despite their shared RNA binding function in the rRNA, S15 homologs have distinct RNA recognition profiles. We present a model to explain the specificity patterns observed, and support this model by with further mutagenesis. After analyzing the patterns of conservation for the S15 protein coding sequences, we also identified amino acid changes that alter the binding specificity of an S15 homolog. In this work we demonstrate that homologous RNA-binding proteins have different specificity profiles, and minor changes to amino acid sequences, or to RNA structural motifs, can have large impacts on RNA-protein recognition. PMID:26675164

  6. Identifying miRNA synergistic regulatory networks in heterogeneous human data via network motifs.

    PubMed

    Zhang, Junpeng; Duy Le, Thuc; Liu, Lin; He, Jianfeng; Li, Jiuyong

    2016-02-01

    Understanding the synergism of multiple microRNAs (miRNAs) in gene regulation can provide important insights into the mechanisms of complex human diseases caused by miRNA regulation. Therefore, it is important to identify miRNA synergism and study miRNA characteristics in miRNA synergistic regulatory networks. A number of methods have been proposed to identify miRNA synergism. However, most of the methods only use downstream target genes of miRNAs to infer miRNA synergism when miRNAs can also be regulated by upstream transcription factors (TFs) at the transcriptional level. Additionally, most methods are based on statistical associations identified from data without considering the causal nature of gene regulation. In this paper, we present a causality based framework, called mirSRN (miRNA synergistic regulatory network), to infer miRNA synergism in human molecular systems by considering both downstream miRNA targets and upstream TF regulation. We apply the proposed framework to two real world datasets and discover that almost all the top 10 miRNAs with the largest node degree in the mirSRNs are associated with different human diseases, including cancer, and that the mirSRNs are approximately scale-free and small-world networks. We also find that most miRNAs in the networks are frequently synergistic with other miRNAs, and miRNAs related to the same disease are likely to be synergistic and in a cluster linked to a biological function. Synergistic miRNA pairs show higher co-expression level, and may have potential functional relationships indicating collaboration between the miRNAs. Functional validation of the identified synergistic miRNAs demonstrates that these miRNAs cause different kinds of diseases. These results deepen our understanding of the biological meaning of miRNA synergism.

  7. Advancing the use of noncoding RNA in regulatory toxicology: Report of an ECETOC workshop.

    PubMed

    Aigner, Achim; Buesen, Roland; Gant, Tim; Gooderham, Nigel; Greim, Helmut; Hackermüller, Jörg; Hubesch, Bruno; Laffont, Madeleine; Marczylo, Emma; Meister, Gunter; Petrick, Jay S; Rasoulpour, Reza J; Sauer, Ursula G; Schmidt, Kerstin; Seitz, Hervé; Slack, Frank; Sukata, Tokuo; van der Vies, Saskia M; Verhaert, Jan; Witwer, Kenneth W; Poole, Alan

    2016-12-01

    The European Centre for the Ecotoxicology and Toxicology of Chemicals (ECETOC) organised a workshop to discuss the state-of-the-art research on noncoding RNAs (ncRNAs) as biomarkers in regulatory toxicology and as analytical and therapeutic agents. There was agreement that ncRNA expression profiling data requires careful evaluation to determine the utility of specific ncRNAs as biomarkers. To advance the use of ncRNA in regulatory toxicology, the following research priorities were identified: (1) Conduct comprehensive literature reviews to identify possibly suitable ncRNAs and areas of toxicology where ncRNA expression profiling could address prevailing scientific deficiencies. (2) Develop consensus on how to conduct ncRNA expression profiling in a toxicological context. (3) Conduct experimental projects, including, e.g., rat (90-day) oral toxicity studies, to evaluate the toxicological relevance of the expression profiles of selected ncRNAs. Thereby, physiological ncRNA expression profiles should be established, including the biological variability of healthy individuals. To substantiate the relevance of key ncRNAs for cell homeostasis or pathogenesis, molecular events should be dose-dependently linked with substance-induced apical effects. Applying a holistic approach, knowledge on ncRNAs, 'omics and epigenetics technologies should be integrated into adverse outcome pathways to improve the understanding of the functional roles of ncRNAs within a regulatory context.

  8. MicroRNA regulatory networks in idiopathic pulmonary fibrosis.

    PubMed

    Pandit, Kusum V; Milosevic, Jadranka

    2015-04-01

    Idiopathic pulmonary fibrosis (IPF) is a chronic, progressive, and fatal scarring lung disease of unknown etiology, characterized by changes in microRNA expression. Activation of transforming growth factor (TGF-β) is a key event in the development of IPF. Recent reports have also identified epigenetic modification as an important player in the pathogenesis of IPF. In this review, we summarize the main results of studies that address the role of microRNAs in IPF and highlight the synergistic actions of these microRNAs in regulating TGF-β, the primary fibrogenic mediator. We outline epigenetic regulation of microRNAs by methylation. Functional studies identify microRNAs that alter proliferative and migratory properties of fibroblasts, and induce phenotypic changes in epithelial cells consistent with epithelial-mesenchymal transition. Though these studies were performed in isolation, we identify multiple co-operative actions after assembling the results into a network. Construction of such networks will help identify disease-propelling hubs that can be targeted for therapeutic purposes.

  9. Identifying microRNA-mRNA regulatory network in gemcitabine-resistant cells derived from human pancreatic cancer cells.

    PubMed

    Shen, Yehua; Pan, Yan; Xu, Litao; Chen, Lianyu; Liu, Luming; Chen, Hao; Chen, Zhen; Meng, Zhiqiang

    2015-06-01

    Pancreatic cancer is unresectable in over 80 % of patients owing to difficulty in early diagnosis. Chemotherapy is the most frequently adopted therapy for advanced pancreatic cancer. The development of drug resistance to gemcitabine (GEM), which is always used in standard chemotherapy, often results in therapeutic failure. However, the molecular mechanisms underlying the gemcitabine resistance remain unclear. Therefore, we sought to explore the microRNA-mRNA network that is associated with the development of gemcitabine resistance and to identify molecular targets for overcoming the gemcitabine resistance. By exposing SW1990 pancreatic cancer cells to long-term gemcitabine with increasing concentrations, we established a gemcitabine-resistant cell line (SW1990/GEM) with a high IC50 (the concentration needed for 50 % growth inhibition, 847.23 μM). The mRNA and microRNA expression profiles of SW1990 cells and SW1990/GEM cells were determined using RNA-seq analysis. By comparing the results in control SW1990 cells, 507 upregulated genes and 550 downregulated genes in SW1990/GEM cells were identified as differentially expressed genes correlated with gemcitabine sensitivity. Gene ontology (GO) analysis showed that the differentially expressed genes were related to diverse biological processes. The upregulated genes were mainly associated with drug response and apoptosis, and the downregulated genes were correlated with cell cycle progression and RNA splicing. Concurrently, the differentially expressed microRNAs, which are the important player in drug resistance development, were also examined in SW1990/GEM cells, and 56 differential microRNAs were identified. Additionally, the expression profiles of selected genes and microRNAs were confirmed by using Q-PCR assays. Furthermore, combining the differentially expressed microRNAs and mRNAs as well as the predicted targets for these microRNAs, a core microRNA-mRNA regulatory network was constructed, which included hub micro

  10. The Complexity of Posttranscriptional Small RNA Regulatory Networks Revealed by In Silico Analysis of Gossypium arboreum L. Leaf, Flower and Boll Small Regulatory RNAs

    PubMed Central

    Hu, Hongtao; Rashotte, Aaron M.; Singh, Narendra K.; Weaver, David B.; Goertzen, Leslie R.; Singh, Shree R.; Locy, Robert D.

    2015-01-01

    MicroRNAs (miRNAs) and secondary small interfering RNAs (principally phased siRNAs or trans-acting siRNAs) are two distinct subfamilies of small RNAs (sRNAs) that are emerging as key regulators of posttranscriptional gene expression in plants. Both miRNAs and secondary-siRNAs (sec-siRNAs) are processed from longer RNA precursors by DICER-LIKE proteins (DCLs). Gossypium arboreum L., also known as tree cotton or Asian cotton, is a diploid, possibly ancestral relative of tetraploid Gossypium hirsutum L., the predominant type of commercially grown cotton worldwide known as upland cotton. To understand the biological significance of these gene regulators in G. arboreum, a bioinformatics analysis was performed on G. arboreum small RNAs produced from G. arboreum leaf, flower, and boll tissues. Consequently, 263 miRNAs derived from 353 precursors, including 155 conserved miRNAs (cs-miRNAs) and 108 novel lineage-specific miRNAs (ls-miRNAs). Along with miRNAs, 2,033 miRNA variants (isomiRNAs) were identified as well. Those isomiRNAs with variation at the 3’-miRNA end were expressed at the highest levels, compared to other types of variants. In addition, 755 pha-siRNAs derived 319 pha-siRNA gene transcripts (PGTs) were identified, and the potential pha-siRNA initiators were predicted. Also, 2,251 non-phased siRNAs were found as well, of which 1,088 appeared to be produced by so-called cis- or trans-cleavage of the PGTs observed at positions differing from pha-siRNAs. Of those sRNAs, 148 miRNAs/isomiRNAs and 274 phased/non-phased siRNAs were differentially expressed in one or more pairs of tissues examined. Target analysis revealed that target genes for both miRNAs and pha-siRNAs are involved a broad range of metabolic and enzymatic activities. We demonstrate that secondary siRNA production could result from initial cleavage of precursors by both miRNAs or isomiRNAs, and that subsequently produced phased and unphased siRNAs could result that also serve as triggers of a

  11. RNA-Dependent RNA Polymerases of Picornaviruses: From the Structure to Regulatory Mechanisms

    PubMed Central

    Ferrer-Orta, Cristina; Ferrero, Diego; Verdaguer, Núria

    2015-01-01

    RNA viruses typically encode their own RNA-dependent RNA polymerase (RdRP) to ensure genome replication within the infected cells. RdRP function is critical not only for the virus life cycle but also for its adaptive potential. The combination of low fidelity of replication and the absence of proofreading and excision activities within the RdRPs result in high mutation frequencies that allow these viruses a rapid adaptation to changing environments. In this review, we summarize the current knowledge about structural and functional aspects on RdRP catalytic complexes, focused mainly in the Picornaviridae family. The structural data currently available from these viruses provided high-resolution snapshots for a range of conformational states associated to RNA template-primer binding, rNTP recognition, catalysis and chain translocation. As these enzymes are major targets for the development of antiviral compounds, such structural information is essential for the design of new therapies. PMID:26258787

  12. Understanding microRNA-mediated gene regulatory networks through mathematical modelling

    PubMed Central

    Lai, Xin; Wolkenhauer, Olaf; Vera, Julio

    2016-01-01

    The discovery of microRNAs (miRNAs) has added a new player to the regulation of gene expression. With the increasing number of molecular species involved in gene regulatory networks, it is hard to obtain an intuitive understanding of network dynamics. Mathematical modelling can help dissecting the role of miRNAs in gene regulatory networks, and we shall here review the most recent developments that utilise different mathematical modelling approaches to provide quantitative insights into the function of miRNAs in the regulation of gene expression. Key miRNA regulation features that have been elucidated via modelling include: (i) the role of miRNA-mediated feedback and feedforward loops in fine-tuning of gene expression; (ii) the miRNA–target interaction properties determining the effectiveness of miRNA-mediated gene repression; and (iii) the competition for shared miRNAs leading to the cross-regulation of genes. However, there is still lack of mechanistic understanding of many other properties of miRNA regulation like unconventional miRNA–target interactions, miRNA regulation at different sub-cellular locations and functional miRNA variant, which will need future modelling efforts to deal with. This review provides an overview of recent developments and challenges in this field. PMID:27317695

  13. Evolutionary analysis reveals regulatory and functional landscape of coding and non-coding RNA editing.

    PubMed

    Zhang, Rui; Deng, Patricia; Jacobson, Dionna; Li, Jin Billy

    2017-02-01

    Adenosine-to-inosine RNA editing diversifies the transcriptome and promotes functional diversity, particularly in the brain. A plethora of editing sites has been recently identified; however, how they are selected and regulated and which are functionally important are largely unknown. Here we show the cis-regulation and stepwise selection of RNA editing during Drosophila evolution and pinpoint a large number of functional editing sites. We found that the establishment of editing and variation in editing levels across Drosophila species are largely explained and predicted by cis-regulatory elements. Furthermore, editing events that arose early in the species tree tend to be more highly edited in clusters and enriched in slowly-evolved neuronal genes, thus suggesting that the main role of RNA editing is for fine-tuning neurological functions. While nonsynonymous editing events have been long recognized as playing a functional role, in addition to nonsynonymous editing sites, a large fraction of 3'UTR editing sites is evolutionarily constrained, highly edited, and thus likely functional. We find that these 3'UTR editing events can alter mRNA stability and affect miRNA binding and thus highlight the functional roles of noncoding RNA editing. Our work, through evolutionary analyses of RNA editing in Drosophila, uncovers novel insights of RNA editing regulation as well as its functions in both coding and non-coding regions.

  14. Evolutionary analysis reveals regulatory and functional landscape of coding and non-coding RNA editing

    PubMed Central

    Jacobson, Dionna

    2017-01-01

    Adenosine-to-inosine RNA editing diversifies the transcriptome and promotes functional diversity, particularly in the brain. A plethora of editing sites has been recently identified; however, how they are selected and regulated and which are functionally important are largely unknown. Here we show the cis-regulation and stepwise selection of RNA editing during Drosophila evolution and pinpoint a large number of functional editing sites. We found that the establishment of editing and variation in editing levels across Drosophila species are largely explained and predicted by cis-regulatory elements. Furthermore, editing events that arose early in the species tree tend to be more highly edited in clusters and enriched in slowly-evolved neuronal genes, thus suggesting that the main role of RNA editing is for fine-tuning neurological functions. While nonsynonymous editing events have been long recognized as playing a functional role, in addition to nonsynonymous editing sites, a large fraction of 3’UTR editing sites is evolutionarily constrained, highly edited, and thus likely functional. We find that these 3’UTR editing events can alter mRNA stability and affect miRNA binding and thus highlight the functional roles of noncoding RNA editing. Our work, through evolutionary analyses of RNA editing in Drosophila, uncovers novel insights of RNA editing regulation as well as its functions in both coding and non-coding regions. PMID:28166241

  15. Drug-device combination products: regulatory landscape and market growth.

    PubMed

    Bayarri, L

    2015-08-01

    Combination products are therapeutic and diagnostic products that combine drugs, devices and/or biological products, leading to safer and more effective treatments thanks to careful and precise drug targeting, local administration and individualized therapy. These technologies can especially benefit patients suffering from serious diseases and conditions such as cancer, heart disease, multiple sclerosis and diabetes, among others. On the other hand, drug-device combination products have also introduced a new dynamic in medical product development, regulatory approval and corporate interaction. Due to the increasing integration of drugs and devices observed in the latest generation of combination products, regulatory agencies have developed specific competences and regulations over the last decade. Manufacturers are required to fully understand the specific requirements in each country in order to ensure timely and accurate market access of new combination products, and the development of combination products involves a very specific pattern of interactions between manufacturers and regulatory agencies. The increased sophistication of the products brought to market over the last couple of decades has accentuated the need to develop drugs and devices collaboratively using resources from both industries, fostering the need of business partnering and technology licensing. This review will provide a global overview of the market trends, as well as (in the last section) an analysis of the drug-device combination products approved by the FDA during the latest 5 years.

  16. Targeting a Regulatory Element in Human Thymidylate Synthase mRNA

    PubMed Central

    Brunn, Nicholas D.; Sega, Emily Garcia; Kao, Melody B.

    2013-01-01

    Thymidylate synthase (TS) is a key enzyme in the biosynthesis of thymidine. TS inhibitors, which are used in cancer chemotherapy, suffer from resistance development in tumors through upregulation of TS expression. Autoregulatory translation control has been implicated with TS overexpression. TS binding at its own mRNA, which leads to sequestration of the start codon, is abolished when the enzyme forms an inhibitor complex, thereby relieving translation suppression. We have used the protein binding site from the TS mRNA in the context of a bicistronic expression system to validate targeting the regulatory motif with stabilizing ligands that prevent ribosomal initiation. Stabilization of the RNA by mutations, which were studied as surrogates of ligand binding, suppresses translation of the TS protein. Compounds that stabilize the TS binding RNA motif and thereby inhibit ribosomal initiation might be used in combination with existing TS enzyme-targeting drugs to overcome resistance development during chemotherapy. PMID:23143777

  17. Novel microRNA-like viral small regulatory RNAs arising during human hepatitis A virus infection.

    PubMed

    Shi, Jiandong; Sun, Jing; Wang, Bin; Wu, Meini; Zhang, Jing; Duan, Zhiqing; Wang, Haixuan; Hu, Ningzhu; Hu, Yunzhang

    2014-10-01

    MicroRNAs (miRNAs), including host miRNAs and viral miRNAs, play vital roles in regulating host-virus interactions. DNA viruses encode miRNAs that regulate the viral life cycle. However, it is generally believed that cytoplasmic RNA viruses do not encode miRNAs, owing to inaccessible cellular miRNA processing machinery. Here, we provide a comprehensive genome-wide analysis and identification of miRNAs that were derived from hepatitis A virus (HAV; Hu/China/H2/1982), which is a typical cytoplasmic RNA virus. Using deep-sequencing and in silico approaches, we identified 2 novel virally encoded miRNAs, named hav-miR-1-5p and hav-miR-2-5p. Both of the novel virally encoded miRNAs were clearly detected in infected cells. Analysis of Dicer enzyme silencing demonstrated that HAV-derived miRNA biogenesis is Dicer dependent. Furthermore, we confirmed that HAV mature miRNAs were generated from viral miRNA precursors (pre-miRNAs) in host cells. Notably, naturally derived HAV miRNAs were biologically and functionally active and induced post-transcriptional gene silencing (PTGS). Genomic location analysis revealed novel miRNAs located in the coding region of the viral genome. Overall, our results show that HAV naturally generates functional miRNA-like small regulatory RNAs during infection. This is the first report of miRNAs derived from the coding region of genomic RNA of a cytoplasmic RNA virus. These observations demonstrate that a cytoplasmic RNA virus can naturally generate functional miRNAs, as DNA viruses do. These findings also contribute to improved understanding of host-RNA virus interactions mediated by RNA virus-derived miRNAs.

  18. A comparative analytical assay of gene regulatory networks inferred using microarray and RNA-seq datasets

    PubMed Central

    Izadi, Fereshteh; Zarrini, Hamid Najafi; Kiani, Ghaffar; Jelodar, Nadali Babaeian

    2016-01-01

    A Gene Regulatory Network (GRN) is a collection of interactions between molecular regulators and their targets in cells governing gene expression level. Omics data explosion generated from high-throughput genomic assays such as microarray and RNA-Seq technologies and the emergence of a number of pre-processing methods demands suitable guidelines to determine the impact of transcript data platforms and normalization procedures on describing associations in GRNs. In this study exploiting publically available microarray and RNA-Seq datasets and a gold standard of transcriptional interactions in Arabidopsis, we performed a comparison between six GRNs derived by RNA-Seq and microarray data and different normalization procedures. As a result we observed that compared algorithms were highly data-specific and Networks reconstructed by RNA-Seq data revealed a considerable accuracy against corresponding networks captured by microarrays. Topological analysis showed that GRNs inferred from two platforms were similar in several of topological features although we observed more connectivity in RNA-Seq derived genes network. Taken together transcriptional regulatory networks obtained by Robust Multiarray Averaging (RMA) and Variance-Stabilizing Transformed (VST) normalized data demonstrated predicting higher rate of true edges over the rest of methods used in this comparison. PMID:28293077

  19. Dihydroartemisinin suppresses pancreatic cancer cells via a microRNA-mRNA regulatory network

    PubMed Central

    Li, Yilong; Wang, Yongwei; Kong, Rui; Xue, Dongbo; Pan, Shangha; Chen, Hua; Sun, Bei

    2016-01-01

    Despite improvements in surgical procedures and chemotherapy, pancreatic cancer remains one of the most aggressive and fatal human malignancies, with a low 5-year survival rate of only 8%. Therefore, novel strategies for prevention and treatment are urgently needed. Here, we investigated the mechanisms underlying the anti-pancreatic cancer effects dihydroartemisinin (DHA). Microarray and systematic analysis showed that DHA suppressed proliferation, inhibited angiogenesis and promoted apoptosis in two different human pancreatic cancer cell lines, and that 5 DHA-regulated microRNAs and 11 of their target mRNAs were involved in these effects via 19 microRNA-mRNA interactions. Four of these microRNAs, 9 of the mRNAs and 17 of the interactions were experimentally verified. Furthermore, we found that the anti-pancreatic caner effects of DHA in vivo involved 4 microRNAs, 9 mRNAs and 17 microRNA-mRNA interactions. These results improve the understanding of the mechanisms by which DHA suppresses proliferation and angiogenesis and promotes apoptosis in pancreatic cancer cells and indicate that DHA, an effective antimalarial drug, might improve pancreatic cancer treatments. PMID:27613829

  20. A systematic analysis of a mi-RNA inter-pathway regulatory motif

    PubMed Central

    2013-01-01

    Background The continuing discovery of new types and functions of small non-coding RNAs is suggesting the presence of regulatory mechanisms far more complex than the ones currently used to study and design Gene Regulatory Networks. Just focusing on the roles of micro RNAs (miRNAs), they have been found to be part of several intra-pathway regulatory motifs. However, inter-pathway regulatory mechanisms have been often neglected and require further investigation. Results In this paper we present the result of a systems biology study aimed at analyzing a high-level inter-pathway regulatory motif called Pathway Protection Loop, not previously described, in which miRNAs seem to play a crucial role in the successful behavior and activation of a pathway. Through the automatic analysis of a large set of public available databases, we found statistical evidence that this inter-pathway regulatory motif is very common in several classes of KEGG Homo Sapiens pathways and concurs in creating a complex regulatory network involving several pathways connected by this specific motif. The role of this motif seems also confirmed by a deeper review of other research activities on selected representative pathways. Conclusions Although previous studies suggested transcriptional regulation mechanism at the pathway level such as the Pathway Protection Loop, a high-level analysis like the one proposed in this paper is still missing. The understanding of higher-level regulatory motifs could, as instance, lead to new approaches in the identification of therapeutic targets because it could unveil new and “indirect” paths to activate or silence a target pathway. However, a lot of work still needs to be done to better uncover this high-level inter-pathway regulation including enlarging the analysis to other small non-coding RNA molecules. PMID:24152805

  1. Regulatory non-coding RNA: new instruments in the orchestration of cell death

    PubMed Central

    Su, Ye; Wu, Haijiang; Pavlosky, Alexander; Zou, Ling-Lin; Deng, Xinna; Zhang, Zhu-Xu; Jevnikar, Anthony M

    2016-01-01

    Non-coding RNA (ncRNA) comprises a substantial portion of primary transcripts that are generated by genomic transcription, but are not translated into protein. The possible functions of these once considered ‘junk' molecules have incited considerable interest and new insights have emerged. The two major members of ncRNAs, namely micro RNA (miRNA) and long non-coding RNA (lncRNA), have important regulatory roles in gene expression and many important physiological processes, which has recently been extended to programmed cell death. The previous paradigm of programmed cell death only by apoptosis has recently expanded to include modalities of regulated necrosis (RN), and particularly necroptosis. However, most research efforts in this field have been on protein regulators, leaving the role of ncRNAs largely unexplored. In this review, we discuss important findings concerning miRNAs and lncRNAs that modulate apoptosis and RN pathways, as well as the miRNA–lncRNA interactions that affect cell death regulation. PMID:27512954

  2. Small Regulatory RNA-Induced Growth Rate Heterogeneity of Bacillus subtilis

    PubMed Central

    Mars, Ruben A. T.; Nicolas, Pierre; Ciccolini, Mariano; Reilman, Ewoud; Reder, Alexander; Schaffer, Marc; Mäder, Ulrike; Völker, Uwe; van Dijl, Jan Maarten; Denham, Emma L.

    2015-01-01

    Isogenic bacterial populations can consist of cells displaying heterogeneous physiological traits. Small regulatory RNAs (sRNAs) could affect this heterogeneity since they act by fine-tuning mRNA or protein levels to coordinate the appropriate cellular behavior. Here we show that the sRNA RnaC/S1022 from the Gram-positive bacterium Bacillus subtilis can suppress exponential growth by modulation of the transcriptional regulator AbrB. Specifically, the post-transcriptional abrB-RnaC/S1022 interaction allows B. subtilis to increase the cell-to-cell variation in AbrB protein levels, despite strong negative autoregulation of the abrB promoter. This behavior is consistent with existing mathematical models of sRNA action, thus suggesting that induction of protein expression noise could be a new general aspect of sRNA regulation. Importantly, we show that the sRNA-induced diversity in AbrB levels generates heterogeneity in growth rates during the exponential growth phase. Based on these findings, we hypothesize that the resulting subpopulations of fast- and slow-growing B. subtilis cells reflect a bet-hedging strategy for enhanced survival of unfavorable conditions. PMID:25790031

  3. Small regulatory RNA-induced growth rate heterogeneity of Bacillus subtilis.

    PubMed

    Mars, Ruben A T; Nicolas, Pierre; Ciccolini, Mariano; Reilman, Ewoud; Reder, Alexander; Schaffer, Marc; Mäder, Ulrike; Völker, Uwe; van Dijl, Jan Maarten; Denham, Emma L

    2015-03-01

    Isogenic bacterial populations can consist of cells displaying heterogeneous physiological traits. Small regulatory RNAs (sRNAs) could affect this heterogeneity since they act by fine-tuning mRNA or protein levels to coordinate the appropriate cellular behavior. Here we show that the sRNA RnaC/S1022 from the Gram-positive bacterium Bacillus subtilis can suppress exponential growth by modulation of the transcriptional regulator AbrB. Specifically, the post-transcriptional abrB-RnaC/S1022 interaction allows B. subtilis to increase the cell-to-cell variation in AbrB protein levels, despite strong negative autoregulation of the abrB promoter. This behavior is consistent with existing mathematical models of sRNA action, thus suggesting that induction of protein expression noise could be a new general aspect of sRNA regulation. Importantly, we show that the sRNA-induced diversity in AbrB levels generates heterogeneity in growth rates during the exponential growth phase. Based on these findings, we hypothesize that the resulting subpopulations of fast- and slow-growing B. subtilis cells reflect a bet-hedging strategy for enhanced survival of unfavorable conditions.

  4. Target mimics: an embedded layer of microRNA-involved gene regulatory networks in plants

    PubMed Central

    2012-01-01

    Background MicroRNAs (miRNAs) play an essential role in gene regulation in plants. At the same time, the expression of miRNA genes is also tightly controlled. Recently, a novel mechanism called “target mimicry” was discovered, providing another layer for modulating miRNA activities. However, except for the artificial target mimics manipulated for functional studies on certain miRNA genes, only one example, IPS1 (Induced by Phosphate Starvation 1)—miR399 was experimentally confirmed in planta. To date, few analyses for comprehensive identification of natural target mimics have been performed in plants. Thus, limited evidences are available to provide detailed information for interrogating the questionable issue whether target mimicry was widespread in planta, and implicated in certain biological processes. Results In this study, genome-wide computational prediction of endogenous miRNA mimics was performed in Arabidopsis and rice, and dozens of target mimics were identified. In contrast to a recent report, the densities of target mimic sites were found to be much higher within the untranslated regions (UTRs) when compared to those within the coding sequences (CDSs) in both plants. Some novel sequence characteristics were observed for the miRNAs that were potentially regulated by the target mimics. GO (Gene Ontology) term enrichment analysis revealed some functional insights into the predicted mimics. After degradome sequencing data-based identification of miRNA targets, the regulatory networks constituted by target mimics, miRNAs and their downstream targets were constructed, and some intriguing subnetworks were further exploited. Conclusions These results together suggest that target mimicry may be widely implicated in regulating miRNA activities in planta, and we hope this study could expand the current understanding of miRNA-involved regulatory networks. PMID:22613869

  5. Development of novel cardiovascular therapeutics from small regulatory RNA molecules--an outline of key requirements.

    PubMed

    Poller, W; Fechner, H

    2010-01-01

    Understanding of the roles of RNAs within the cell has changed and expanded dramatically during the past few years. Based on fundamentally new insights it is now increasingly possible to employ RNAs as highly valuable tools in molecular biology and medicine. At present, the most important therapeutic strategies are based on non-coding regulatory RNAs inducing RNA interference (RNAi) to silence single genes, and on modulation of cellular microRNAs (miRNAs) to alter complex gene expression patterns in diseased organs. Only recently it became possible to target therapeutic RNAi to specific organs via organotropic viral vector systems and we discuss the most recent strategies in this field, e.g. heart failure treatment by cardiac-targeted RNAi. Due to the peculiar biochemical properties of small RNA molecules, true therapeutic translation of results in vitro is more demanding than with small molecule drugs or proteins. Specifically, there is a critical requirement for extensive studies in animal models of human disease after pre-testing of the RNAi tools in vitro. This requirement likewise applies for miRNA modulations which have complex consequences in the recipient dependent on biochemical stability and distribution of the therapeutic RNA. Problems not yet fully solved are the prediction of targets and specificity of the RNA tools. However, major progress has been made to achieve their tissue-specific and regulatable expression, and breakthroughs in vector technologies from the gene therapy field have fundamentally improved safety and efficacy of RNA-based therapeutic approaches, too. In summary, insight into the molecular mechanisms of action of regulatory RNAs in combination with new delivery tools for RNA therapeutics will significantly expand our cardiovascular therapeutic repertoire beyond classical pharmacology.

  6. MicroRNA and Transcription Factor Gene Regulatory Network Analysis Reveals Key Regulatory Elements Associated with Prostate Cancer Progression

    PubMed Central

    Sadeghi, Mehdi; Ranjbar, Bijan; Ganjalikhany, Mohamad Reza; M. Khan, Faiz; Schmitz, Ulf; Wolkenhauer, Olaf; Gupta, Shailendra K.

    2016-01-01

    Technological and methodological advances in multi-omics data generation and integration approaches help elucidate genetic features of complex biological traits and diseases such as prostate cancer. Due to its heterogeneity, the identification of key functional components involved in the regulation and progression of prostate cancer is a methodological challenge. In this study, we identified key regulatory interactions responsible for primary to metastasis transitions in prostate cancer using network inference approaches by integrating patient derived transcriptomic and miRomics data into gene/miRNA/transcription factor regulatory networks. One such network was derived for each of the clinical states of prostate cancer based on differentially expressed and significantly correlated gene, miRNA and TF pairs from the patient data. We identified key elements of each network using a network analysis approach and validated our results using patient survival analysis. We observed that HOXD10, BCL2 and PGR are the most important factors affected in primary prostate samples, whereas, in the metastatic state, STAT3, JUN and JUNB are playing a central role. Benefiting integrative networks our analysis suggests that some of these molecules were targeted by several overexpressed miRNAs which may have a major effect on the dysregulation of these molecules. For example, in the metastatic tumors five miRNAs (miR-671-5p, miR-665, miR-663, miR-512-3p and miR-371-5p) are mainly responsible for the dysregulation of STAT3 and hence can provide an opportunity for early detection of metastasis and development of alternative therapeutic approaches. Our findings deliver new details on key functional components in prostate cancer progression and provide opportunities for the development of alternative therapeutic approaches. PMID:28005952

  7. Unraveling novel TF-miRNA regulatory crosstalk in metastasis of Soft Tissue Sarcoma.

    PubMed

    Samantarrai, Devyani; Sahu, Mousumi; Roy, Jyoti; Mohanty, Bedanta Ballav; Singh, Garima; Bhushan, Chandra; Mallick, Bibekanand

    2015-05-18

    Cancer metastasis is a disease of extreme clinical relevance, as it is responsible for more than 90% of cancer-associated mortality. The molecular mechanism and critical regulators involved in this complex multi-stage process of metastasis is poorly deciphered in soft tissue sarcomas (STS), a heterogeneous group of rare tumors with high metastatic potential. Therefore, we aimed at identifying miRNA and transcription factor (TF) regulatory networks and paths in STS metastasis. We integrated mRNA and miRNA expression profiles with curated regulations (TF→gene, TF→miRNA, miRNA→gene) from different databases and constructed a potentially active regulatory sub-network in STS metastasis. From functional and topological analysis, we found nine novel regulators of Notch signaling sub-network which are conjectured to play critical role in metastasis of STS. This illustrated that the sub-network is promising for identification of critical regulators. Further analysis deploying our developed tool 'RiNAcyc' and computing coverage ratio of known STS associated genes and miRNAs identified a 15 node active path. This potential path highlights the crucial role of BMP2, hsa-miR-24, AP2 and MYC as the up-stream regulators of the path and hsa-miR-215 and TYMS as potential indicator of chemotherapeutic benefit in STS metastasis.

  8. c-Myc co-ordinates mRNA cap methylation and ribosomal RNA production

    PubMed Central

    Dunn, Sianadh; Lombardi, Olivia; Cowling, Victoria H.

    2017-01-01

    The mRNA cap is a structure added to RNA pol II transcripts in eukaryotes, which recruits factors involved in RNA processing, nuclear export and translation initiation. RNA guanine-7 methyltransferase (RNMT)–RNA-activating miniprotein (RAM), the mRNA cap methyltransferase complex, completes the basic functional mRNA cap structure, cap 0, by methylating the cap guanosine. Here, we report that RNMT–RAM co-ordinates mRNA processing with ribosome production. Suppression of RNMT–RAM reduces synthesis of the 45S ribosomal RNA (rRNA) precursor. RNMT–RAM is required for c-Myc expression, a major regulator of RNA pol I, which synthesises 45S rRNA. Constitutive expression of c-Myc restores rRNA synthesis when RNMT–RAM is suppressed, indicating that RNMT–RAM controls rRNA production predominantly by controlling c-Myc expression. We report that RNMT–RAM is recruited to the ribosomal DNA locus, which may contribute to rRNA synthesis in certain contexts. PMID:27934633

  9. c-Myc co-ordinates mRNA cap methylation and ribosomal RNA production.

    PubMed

    Dunn, Sianadh; Lombardi, Olivia; Cowling, Victoria H

    2017-02-01

    The mRNA cap is a structure added to RNA pol II transcripts in eukaryotes, which recruits factors involved in RNA processing, nuclear export and translation initiation. RNA guanine-7 methyltransferase (RNMT)-RNA-activating miniprotein (RAM), the mRNA cap methyltransferase complex, completes the basic functional mRNA cap structure, cap 0, by methylating the cap guanosine. Here, we report that RNMT-RAM co-ordinates mRNA processing with ribosome production. Suppression of RNMT-RAM reduces synthesis of the 45S ribosomal RNA (rRNA) precursor. RNMT-RAM is required for c-Myc expression, a major regulator of RNA pol I, which synthesises 45S rRNA. Constitutive expression of c-Myc restores rRNA synthesis when RNMT-RAM is suppressed, indicating that RNMT-RAM controls rRNA production predominantly by controlling c-Myc expression. We report that RNMT-RAM is recruited to the ribosomal DNA locus, which may contribute to rRNA synthesis in certain contexts.

  10. MicroRNA-Containing T-Regulatory-Cell-Derived Exosomes Suppress Pathogenic T Helper 1 Cells

    PubMed Central

    Okoye, Isobel S.; Coomes, Stephanie M.; Pelly, Victoria S.; Czieso, Stephanie; Papayannopoulos, Venizelos; Tolmachova, Tanya; Seabra, Miguel C.; Wilson, Mark S.

    2014-01-01

    Summary Foxp3+ T regulatory (Treg) cells prevent inflammatory disease but the mechanistic basis of suppression is not understood completely. Gene silencing by RNA interference can act in a cell-autonomous and non-cell-autonomous manner, providing mechanisms of intercellular regulation. Here, we demonstrate that non-cell-autonomous gene silencing, mediated by miRNA-containing exosomes, is a mechanism employed by Treg cells to suppress T-cell-mediated disease. Treg cells transferred microRNAs (miRNA) to various immune cells, including T helper 1 (Th1) cells, suppressing Th1 cell proliferation and cytokine secretion. Use of Dicer-deficient or Rab27a and Rab27b double-deficient Treg cells to disrupt miRNA biogenesis or the exosomal pathway, respectively, established a requirement for miRNAs and exosomes for Treg-cell-mediated suppression. Transcriptional analysis and miRNA inhibitor studies showed that exosome-mediated transfer of Let-7d from Treg cell to Th1 cells contributed to suppression and prevention of systemic disease. These studies reveal a mechanism of Treg-cell-mediated suppression mediated by miRNA-containing exosomes. PMID:25035954

  11. Interplay of cis- and trans-regulatory mechanisms in the spliceosomal RNA helicase Brr2.

    PubMed

    Absmeier, Eva; Becke, Christian; Wollenhaupt, Jan; Santos, Karine F; Wahl, Markus C

    2017-01-02

    RNA helicase Brr2 is implicated in multiple phases of pre-mRNA splicing and thus requires tight regulation. Brr2 can be auto-inhibited via a large N-terminal region folding back onto its helicase core and auto-activated by a catalytically inactive C-terminal helicase cassette. Furthermore, it can be regulated in trans by the Jab1 domain of the Prp8 protein, which can inhibit Brr2 by intermittently inserting a C-terminal tail in the enzyme's RNA-binding tunnel or activate the helicase after removal of this tail. Presently it is unclear, whether these regulatory mechanisms functionally interact and to which extent they are evolutionarily conserved. Here, we report crystal structures of Saccharomyces cerevisiae and Chaetomium thermophilum Brr2-Jab1 complexes, demonstrating that Jab1-based inhibition of Brr2 presumably takes effect in all eukaryotes but is implemented via organism-specific molecular contacts. Moreover, the structures show that Brr2 auto-inhibition can act in concert with Jab1-mediated inhibition, and suggest that the N-terminal region influences how the Jab1 C-terminal tail interacts at the RNA-binding tunnel. Systematic RNA binding and unwinding studies revealed that the N-terminal region and the Jab1 C-terminal tail specifically interfere with accommodation of double-stranded and single-stranded regions of an RNA substrate, respectively, mutually reinforcing each other. Additionally, such analyses show that regulation based on the N-terminal region requires the presence of the inactive C-terminal helicase cassette. Together, our results outline an intricate system of regulatory mechanisms, which control Brr2 activities during snRNP assembly and splicing.

  12. Genetically engineered crops for biofuel production: regulatory perspectives.

    PubMed

    Lee, David; Chen, Alice; Nair, Ramesh

    2008-01-01

    There are numerous challenges in realizing the potential of biofuels that many policy makers have envisioned. The technical challenges in making the production of biofuels economical and on a scale to replace a significant fraction of transportation fuel have been well described, along with the potential environmental concerns. The use of biotechnology can potentially address many of these technical challenges and environmental concerns, but brings significant regulatory hurdles that have not been discussed extensively in the scientific community. This review will give an overview of the approaches being developed to produce transgenic biofuel feedstocks, particularly cellulosic ethanol, and the regulatory process in the United States that oversees the development and commercialization of new transgenic plants. We hope to illustrate that the level of regulation for transgenic organisms is not proportional to their potential risk to human health or the environment, and that revisions to the regulatory system in the U.S. currently under consideration are necessary to streamline the process.

  13. Tristetraprolin-driven regulatory circuit controls quality and timing of mRNA decay in inflammation

    PubMed Central

    Kratochvill, Franz; Machacek, Christian; Vogl, Claus; Ebner, Florian; Sedlyarov, Vitaly; Gruber, Andreas R; Hartweger, Harald; Vielnascher, Raimund; Karaghiosoff, Marina; Rülicke, Thomas; Müller, Mathias; Hofacker, Ivo; Lang, Roland; Kovarik, Pavel

    2011-01-01

    For a successful yet controlled immune response, cells need to specifically destabilize inflammatory mRNAs but prevent premature removal of those still used. The regulatory circuits controlling quality and timing in the global inflammatory mRNA decay are not understood. Here, we show that the mRNA-destabilizing function of the AU-rich element-binding protein tristetraprolin (TTP) is inversely regulated by the p38 MAPK activity profile such that after inflammatory stimulus the TTP-dependent decay is initially limited to few mRNAs. With time, the TTP-dependent decay gradually spreads resulting in cumulative elimination of one third of inflammation-induced unstable mRNAs in macrophages in vitro. We confirmed this sequential decay model in vivo since LPS-treated mice with myeloid TTP ablation exhibited similar cytokine dysregulation profile as macrophages. The mice were hypersensitive to LPS but otherwise healthy with no signs of hyperinflammation seen in conventional TTP knockout mice demonstrating the requirement for myeloid TTP in re-installment but not maintenance of immune homeostasis. These findings reveal a TTP- and p38 MAPK-dominated regulatory mechanism that is vital for balancing acute inflammation by a temporally and qualitatively controlled mRNA decay. PMID:22186734

  14. Conservation and evolution of miRNA regulatory programs in plant development

    PubMed Central

    Willmann, Matthew R.; Poethig, R. Scott

    2007-01-01

    Summary of recent advances Over the past two years, microarray technologies, large-scale small RNA and whole genome sequencing projects, and data mining have provided a wealth of information about the spectrum of miRNAs and miRNA targets present in different plant species and the alga Chlamydomonas. Such studies have shown that a number of key miRNA regulatory modules for plant development are conserved throughout the plant kingdom, suggesting that these programs were critical to the colonization of land. New genetic and biochemical studies of miRNA pathways in Arabidopsis, the spatiotemporal expression patterns of several conserved miRNAs and their targets, and the characterization of mutations in Arabidopsis and maize have begun to reveal the functions of these ancient miRNA-regulated developmental programs. In addition to these conserved miRNAs, there are many clade and species-specific miRNAs, which have evolved more recently and whose functions are currently unknown. PMID:17709279

  15. Structural basis for specific recognition of multiple mRNA targets by a PUF regulatory protein

    SciTech Connect

    Wang, Yeming; Opperman, Laura; Wickens, Marvin; Tanaka Hall, Traci M.

    2011-11-02

    Caenorhabditis elegans fem-3 binding factor (FBF) is a founding member of the PUMILIO/FBF (PUF) family of mRNA regulatory proteins. It regulates multiple mRNAs critical for stem cell maintenance and germline development. Here, we report crystal structures of FBF in complex with 6 different 9-nt RNA sequences, including elements from 4 natural mRNAs. These structures reveal that FBF binds to conserved bases at positions 1-3 and 7-8. The key specificity determinant of FBF vs. other PUF proteins lies in positions 4-6. In FBF/RNA complexes, these bases stack directly with one another and turn away from the RNA-binding surface. A short region of FBF is sufficient to impart its unique specificity and lies directly opposite the flipped bases. We suggest that this region imposes a flattened curvature on the protein; hence, the requirement for the additional nucleotide. The principles of FBF/RNA recognition suggest a general mechanism by which PUF proteins recognize distinct families of RNAs yet exploit very nearly identical atomic contacts in doing so.

  16. Regulatory mechanisms and clinical perspectives of miRNA in tumor radiosensitivity

    PubMed Central

    Cao, Ya; Dong, Zigang

    2012-01-01

    MicroRNA (miRNA) influences carcinogenesis at multiple stages and it can effectively control tumor radiosensitivity by affecting DNA damage repair, cell cycle checkpoint, apoptosis, radio-related signal transduction pathways and tumor microenvironment. MiRNA also efficiently modulates tumor radiosensitivity at multiple levels by blocking the two essential non-homologous end-joining repair and homologous recombination repair pathways in the DNA damage response. It interferes with four radio-related pathways in ionizing radiation, including the PI3-K/Akt, NF-κB, MAPK and TGFβ signaling pathways. Moreover, the regulatory effect of miRNA in radiosensitivity can be enhanced when interacting with various key molecules, including H2AX, BRCA1, ATM, DNA-PK, RAD51, Chk1, Cdc25A, p53, PLK1, HIF-1 and VEGF, which are involved in these processes. Therefore, thoroughly understanding the mechanism of miRNA in tumor radiosensitivity could assist in finding novel targets to improve the radiotherapeutic effects and provide new clinical perspectives and insights for developing effective cancer treatments. PMID:22798379

  17. tRNA regulation of gene expression: Interactions of an mRNA 5′-UTR with a regulatory tRNA

    PubMed Central

    Nelson, Audrey R.; Henkin, Tina M.; Agris, Paul F.

    2006-01-01

    Many genes encoding aminoacyl-tRNA synthetases and other amino acid–related products in Gram-positive bacteria, including important pathogens, are regulated through interaction of unacylated tRNA with the 5′-untranslated region (5′-UTR) of the mRNA. Each gene regulated by this mechanism responds specifically to the cognate tRNA, and specificity is determined by pairing of the anticodon of the tRNA with a codon sequence in the “Specifier Loop” of the 5′-UTR. For the 5′-UTR to function in gene regulation, the mRNA folding interactions must be sufficiently stable to present the codon sequence for productive binding to the anticodon of the matching tRNA. A model bimolecular system was developed in which the interaction between two half molecules (“Common” and “Specifier”) would reconstitute the Specifier Loop region of the 5′-UTR of the Bacillus subtilis glyQS gene, encoding GlyRS mRNA. Gel mobility shift analysis and fluorescence spectroscopy yielded experimental K ds of 27.6 ± 1.0 μM and 10.5 ± 0.7 μM, respectively, for complex formation between Common and Specifier half molecules. The reconstituted 5′-UTR of the glyQS mRNA bound the anticodon stem and loop of tRNAGly (ASLGlyGCC) specifically and with a significant affinity (K d = 20.2 ± 1.4 μM). Thus, the bimolecular 5′-UTR and ASLGlyGCC models mimic the RNA–RNA interaction required for T box gene regulation in vivo. PMID:16741230

  18. Evolutionary conservation of microRNA regulatory programs in plant flower development.

    PubMed

    Luo, Yan; Guo, Zhenhua; Li, Lu

    2013-08-15

    MicroRNAs (miRNAs) are post-transcriptional regulators of growth and development in both plants and animals. Flowering is critical for the reproduction of angiosperms. Flower development entails the transition from vegetative growth to reproductive growth, floral organ initiation, and the development of floral organs. These developmental processes are genetically regulated by miRNAs, which participate in complex genetic networks of flower development. A survey of the literature shows that miRNAs, their specific targets, and the regulatory programs in which they participate are conserved throughout the plant kingdom. This review summarizes the role of miRNAs and their targets in the regulation of gene expression during the floral developmental phase, which includes the floral transition stage, followed by floral patterning, and then the development of floral organs. The conservation patterns observed in each component of the miRNA regulatory system suggest that these miRNAs play important roles in the evolution of flower development.

  19. Structure of dual function iron regulatory protein 1 complexed with ferritin IRE-RNA

    SciTech Connect

    Walden, William E.; Selezneva, Anna I.; Dupuy, Jérôme; Volbeda, Anne; Fontecilla-Camps, Juan C.; Theil, Elizabeth C.; Volz1, Karl

    2011-07-27

    Iron regulatory protein 1 (IRP1) binds iron-responsive elements (IREs) in messenger RNAs (mRNAs), to repress translation or degradation, or binds an iron-sulfur cluster, to become a cytosolic aconitase enzyme. The 2.8 angstrom resolution crystal structure of the IRP1:ferritin H IRE complex shows an open protein conformation compared with that of cytosolic aconitase. The extended, L-shaped IRP1 molecule embraces the IRE stem-loop through interactions at two sites separated by {approx}30 angstroms, each involving about a dozen protein:RNA bonds. Extensive conformational changes related to binding the IRE or an iron-sulfur cluster explain the alternate functions of IRP1 as an mRNA regulator or enzyme.

  20. MicroRNA-29b/Tet1 regulatory axis epigenetically modulates mesendoderm differentiation in mouse embryonic stem cells

    PubMed Central

    Tu, Jiajie; Ng, Shuk Han; Shui Luk, Alfred Chun; Liao, Jinyue; Jiang, Xiaohua; Feng, Bo; Lun Mak, Kingston King; Rennert, Owen M.; Chan, Wai-Yee; Lee, Tin-Lap

    2015-01-01

    Ten eleven translocation (Tet) family-mediated DNA oxidation on 5-methylcytosine (5mC) to 5-hydroxymethylcytosine (5hmC) represents a novel epigenetic modification that regulates dynamic gene expression during embryonic stem cells (ESCs) differentiation. Through the role of Tet on 5hmC regulation in stem cell development is relatively defined, how the Tet family is regulated and impacts on ESCs lineage development remains elusive. In this study, we show non-coding RNA regulation on Tet family may contribute to epigenetic regulation during ESCs differentiation, which is suggested by microRNA-29b (miR-29b) binding sites on the Tet1 3′ untranslated region (3′ UTR). We demonstrate miR-29b increases sharply after embyoid body (EB) formation, which causes Tet1 repression and reduction of cellular 5hmC level during ESCs differentiation. Importantly, we show this miR-29b/Tet1 regulatory axis promotes the mesendoderm lineage formation both in vitro and in vivo by inducing the Nodal signaling pathway and repressing the key target of the active demethylation pathway, Tdg. Taken together, our findings underscore the contribution of small non-coding RNA mediated regulation on DNA demethylation dynamics and the differential expressions of key mesendoderm regulators during ESCs lineage specification. MiR-29b could potentially be applied to enrich production of mesoderm and endoderm derivatives and be further differentiated into desired organ-specific cells. PMID:26130713

  1. A system biology approach for understanding the miRNA regulatory network in colon rectal cancer.

    PubMed

    Pradhan, Meeta; Nagulapalli, Kshithija; Ledford, Lakenvia; Pandit, Yogesh; Palakal, Mathew

    2015-01-01

    In this paper we present a systems biology approach to the understanding of the miRNA-regulatory network in colon rectal cancer. An initial set of significant genes in Colon Rectal Cancer (CRC) were obtained by mining relevant literature. An initial set of cancer-related miRNAs were obtained from three databases: miRBase, miRWalk, Targetscan and GEO microarray experiment. First principle methods were then used to generate the global miRNA-gene network. Significant miRNAs and associated transcription factors in the global miRNA-gene network were identified using topological and sub-graph analyses. Eleven novel miRNAs were identified and three of the novel miRNAs, hsa-miR-630, hsa-miR-100 and hsa-miR-99a, were further analysed to elucidate their role in CRC. The proposed methodology effectively made use of literature data and was able to show novel, significant miRNA-transcription associations in CRC.

  2. RNA regulatory networks diversified through curvature of the PUF protein scaffold

    PubMed Central

    Wilinski, Daniel; Qiu, Chen; Lapointe, Christopher P.; Nevil, Markus; Campbell, Zachary T.; Tanaka Hall, Traci M.; Wickens, Marvin

    2015-01-01

    Proteins bind and control mRNAs, directing their localization, translation and stability. Members of the PUF family of RNA-binding proteins control multiple mRNAs in a single cell, and play key roles in development, stem cell maintenance and memory formation. Here we identified the mRNA targets of a S. cerevisiae PUF protein, Puf5p, by ultraviolet-crosslinking-affinity purification and high-throughput sequencing (HITS-CLIP). The binding sites recognized by Puf5p are diverse, with variable spacer lengths between two specific sequences. Each length of site correlates with a distinct biological function. Crystal structures of Puf5p–RNA complexes reveal that the protein scaffold presents an exceptionally flat and extended interaction surface relative to other PUF proteins. In complexes with RNAs of different lengths, the protein is unchanged. A single PUF protein repeat is sufficient to induce broadening of specificity. Changes in protein architecture, such as alterations in curvature, may lead to evolution of mRNA regulatory networks. PMID:26364903

  3. RNA regulatory networks diversified through curvature of the PUF protein scaffold

    DOE PAGES

    Wilinski, Daniel; Qiu, Chen; Lapointe, Christopher P.; ...

    2015-09-14

    Proteins bind and control mRNAs, directing their localization, translation and stability. Members of the PUF family of RNA-binding proteins control multiple mRNAs in a single cell, and play key roles in development, stem cell maintenance and memory formation. Here we identified the mRNA targets of a S. cerevisiae PUF protein, Puf5p, by ultraviolet-crosslinking-affinity purification and high-throughput sequencing (HITS-CLIP). The binding sites recognized by Puf5p are diverse, with variable spacer lengths between two specific sequences. Each length of site correlates with a distinct biological function. Crystal structures of Puf5p–RNA complexes reveal that the protein scaffold presents an exceptionally flat and extendedmore » interaction surface relative to other PUF proteins. In complexes with RNAs of different lengths, the protein is unchanged. A single PUF protein repeat is sufficient to induce broadening of specificity. Changes in protein architecture, such as alterations in curvature, may lead to evolution of mRNA regulatory networks.« less

  4. RNA regulatory networks diversified through curvature of the PUF protein scaffold

    SciTech Connect

    Wilinski, Daniel; Qiu, Chen; Lapointe, Christopher P.; Nevil, Markus; Campbell, Zachary T.; Tanaka Hall, Traci M.; Wickens, Marvin

    2015-09-14

    Proteins bind and control mRNAs, directing their localization, translation and stability. Members of the PUF family of RNA-binding proteins control multiple mRNAs in a single cell, and play key roles in development, stem cell maintenance and memory formation. Here we identified the mRNA targets of a S. cerevisiae PUF protein, Puf5p, by ultraviolet-crosslinking-affinity purification and high-throughput sequencing (HITS-CLIP). The binding sites recognized by Puf5p are diverse, with variable spacer lengths between two specific sequences. Each length of site correlates with a distinct biological function. Crystal structures of Puf5p–RNA complexes reveal that the protein scaffold presents an exceptionally flat and extended interaction surface relative to other PUF proteins. In complexes with RNAs of different lengths, the protein is unchanged. A single PUF protein repeat is sufficient to induce broadening of specificity. Changes in protein architecture, such as alterations in curvature, may lead to evolution of mRNA regulatory networks.

  5. Identification of a novel miRNA-target gene regulatory network in osteosarcoma by integrating transcriptome analysis

    PubMed Central

    He, Chunlei; Gao, Hui; Fan, Xiaona; Wang, Maoyuan; Liu, Wuyang; Huang, Weiming; Yang, Yadong

    2015-01-01

    Osteosarcoma remains a leading cause of cancer death in children and young adolescents. Although the introduction of multiagent chemotherapy, survival rates have not improved in two decades. Therefore, it is urgently needed to know the details regarding molecular etiology to driving therapeutic inroads for this disease. In this study we performed an integrated analysis of miRNA and mRNA expression data to explore the dysregulation of miRNA and miRNA-target gene regulatory network underlying OS. 59 differentially expressed miRNAs were identified, with 28 up-regulated and 31 down-regulated miRNAs by integrating OS miRNA expression data sets available. Using miRWalk databases prediction, we performed an anticorrelated analysis of miRNA and genes expression identified by a integrated analysis of gene expression data to identify 109 differently expressed miRNA target genes. A novel miRNA-target gene regulatory network was constructed with the miRNA-target gene pairs. miR-19b-3p, miR-20a-5p, miR-124-3p and their common target CCND2, the nodal points of regulatory network, may play important roles in OS. Bioinformatics analysis of biological functions and pathways demonstrated that target genes of miRNAs are highly correlated with carcinogenesis. Our findings may help to understand the molecular mechanisms of OS and identify targets of effective targeted therapies for OS. PMID:26339404

  6. Noncoding RNA. piRNA-guided transposon cleavage initiates Zucchini-dependent, phased piRNA production.

    PubMed

    Han, Bo W; Wang, Wei; Li, Chengjian; Weng, Zhiping; Zamore, Phillip D

    2015-05-15

    PIWI-interacting RNAs (piRNAs) protect the animal germ line by silencing transposons. Primary piRNAs, generated from transcripts of genomic transposon "junkyards" (piRNA clusters), are amplified by the "ping-pong" pathway, yielding secondary piRNAs. We report that secondary piRNAs, bound to the PIWI protein Ago3, can initiate primary piRNA production from cleaved transposon RNAs. The first ~26 nucleotides (nt) of each cleaved RNA becomes a secondary piRNA, but the subsequent ~26 nt become the first in a series of phased primary piRNAs that bind Piwi, allowing piRNAs to spread beyond the site of RNA cleavage. The ping-pong pathway increases only the abundance of piRNAs, whereas production of phased primary piRNAs from cleaved transposon RNAs adds sequence diversity to the piRNA pool, allowing adaptation to changes in transposon sequence.

  7. Inhibition of exotoxin production by mobile genetic element SCCmec-encoded psm-mec RNA is conserved in staphylococcal species.

    PubMed

    Ikuo, Mariko; Nagano, Gentaro; Saito, Yuki; Mao, Han; Sekimizu, Kazuhisa; Kaito, Chikara

    2014-01-01

    Staphylococcal species acquire antibiotic resistance by incorporating the mobile-genetic element SCCmec. We previously found that SCCmec-encoded psm-mec RNA suppresses exotoxin production as a regulatory RNA, and the psm-mec translation product increases biofilm formation in Staphylococcus aureus. Here, we examined whether the regulatory role of psm-mec on host bacterial virulence properties is conserved among other staphylococcal species, S. epidermidis and S. haemolyticus, both of which are important causes of nosocomial infections. In S. epidermidis, introduction of psm-mec decreased the production of cytolytic toxins called phenol-soluble modulins (PSMs) and increased biofilm formation. Introduction of psm-mec with a stop-codon mutation that did not express PSM-mec protein but did express psm-mec RNA also decreased PSM production, but did not increase biofilm formation. Thus, the psm-mec RNA inhibits PSM production, whereas the PSM-mec protein increases biofilm formation in S. epidermidis. In S. haemolyticus, introduction of psm-mec decreased PSM production, but did not affect biofilm formation. The mutated psm-mec with a stop-codon also caused the same effect. Thus, the psm-mec RNA also inhibits PSM production in S. haemolyticus. These findings suggest that the inhibitory role of psm-mec RNA on exotoxin production is conserved among staphylococcal species, although the stimulating effect of the psm-mec gene on biofilm formation is not conserved.

  8. Decoy approach using RNA-DNA chimera oligonucleotides to inhibit the regulatory function of human immunodeficiency virus type 1 Rev protein.

    PubMed Central

    Nakaya, T; Iwai, S; Fujinaga, K; Sato, Y; Otsuka, E; Ikuta, K

    1997-01-01

    Human immunodeficiency virus type 1 (HIV-1) encodes two regulatory proteins, Tat and Rev, that bind to target RNA sequences. These are the trans-activation responsive (TAR) RNA and the Rev-responsive element (RRE), respectively. The Rev protein shifts RNA synthesis to viral transcripts by binding to the RRE within the env gene. In the present study we prepared a RNA-DNA chimera consisting of 29 or 31 nucleotides to inhibit the Rev regulatory function by means of the decoy approach. The chimera oligonucleotides (anti-Rev oligonucleotides [AROs]) contained an RNA "bubble" structure (13 oligonucleotides; the Rev-binding element in RRE) that bound Rev with a high affinity in an in vitro assay. The controls were RNA-DNA chimera oligonucleotides (negative control oligonucleotides [NCOs]) similar to ARO, but without the bubble structure, that bound with considerably less affinity to Rev. When the inhibitory effects of these decoys on HIV-1 replication were examined, we found that AROs, but no NCOs, reduced more than 90% of the HIV-1 production generated by productively infected human T-cell lines. The production of primary HIV-1 isolates in healthy donor-derived peripheral blood mononuclear cells was also similarly inhibited by AROs. In addition, the induction of viral mRNAs and antigens in latently HIV-1-infected ACH-2 cells by tumor necrosis factor alpha was specifically inhibited by AROs, but not by NCOs. No apparent cytotoxicity was caused by either decoy. Thus, the use of a Rev-binding element-based decoy, the RNA-DNA chimera oligonucleotide, may represent a safer approach to gene therapy for reducing the virus load in HIV-1-infected individuals. PMID:9021186

  9. Adaptation of Tri-molecular fluorescence complementation allows assaying of regulatory Csr RNA-protein interactions in bacteria.

    PubMed

    Gelderman, Grant; Sivakumar, Anusha; Lipp, Sarah; Contreras, Lydia

    2015-02-01

    sRNAs play a significant role in controlling and regulating cellular metabolism. One of the more interesting aspects of certain sRNAs is their ability to make global changes in the cell by interacting with regulatory proteins. In this work, we demonstrate the use of an in vivo Tri-molecular Fluorescence Complementation assay to detect and visualize the central regulatory sRNA-protein interaction of the Carbon Storage Regulatory system in E. coli. The Carbon Storage Regulator consists primarily of an RNA binding protein, CsrA, that alters the activity of mRNA targets and of an sRNA, CsrB, that modulates the activity of CsrA. We describe the construction of a fluorescence complementation system that detects the interactions between CsrB and CsrA. Additionally, we demonstrate that the intensity of the fluorescence of this system is able to detect changes in the affinity of the CsrB-CsrA interaction, as caused by mutations in the protein sequence of CsrA. While previous methods have adopted this technique to study mRNA or RNA localization, this is the first attempt to use this technique to study the sRNA-protein interaction directly in bacteria. This method presents a potentially powerful tool to study complex bacterial RNA protein interactions in vivo.

  10. The transcription cycle in eukaryotes: from productive initiation to RNA polymerase II recycling.

    PubMed

    Shandilya, Jayasha; Roberts, Stefan G E

    2012-05-01

    The cycle of eukaryotic transcription, from initiation to elongation and termination is regulated at multiple steps. Coordinated action of regulatory factors keeps in check the transcriptional competence of RNA polymerase II (RNAPII) at different stages. Productive transcription requires the escape of the paused RNAPII from the promoter and transition to rapid elongation of the transcript. Numerous studies have identified diverse mechanisms of initiating transcription by overriding inhibitory signals at the gene promoter. The general theme that has emerged is that the balance between positive and negative regulatory factors determines the overall rate of transcription. Recently transcription termination has emerged as an important area of transcriptional regulation that is coupled with the efficient recycling of RNAPII. The factors associated with transcription termination can also mediate gene looping and thereby determine the efficiency of re-initiation. This review highlights these regulatory steps, the key modulators involved in transcription dynamics, and the emerging tools to analyze them.

  11. Regulatory and clinical aspects of psychotropic medicinal products bioequivalence.

    PubMed

    Bałkowiec-Iskra, Ewa; Cessak, Grzegorz; Kuzawińska, Olga; Sejbuk-Rozbicka, Katarzyna; Rokita, Konrad; Mirowska-Guzel, Dagmara

    2015-07-01

    Introduction of generic medicinal products to the market has increased access to modern therapies but also enabled significant reduction in their cost, leading to containment of public expenditures on medicinal products reimbursement. The critical assessment of bioequivalence of any reference medicinal product and its counterpart is based on comparison of their rate and extent of absorption. It is assumed that two medicinal products are bioequivalent when their rate and extent of absorption do not show significant differences when administered at the same dose under similar experimental conditions. Bioequivalent medicinal products are declared to be also therapeutically equivalent and can be used interchangeably. However, despite regulatory declaration, switching from reference to generic drugs is often associated with concerns of healthcare providers about decreased treatment effectiveness or occurrence of adverse drug reactions. The aim of this article is to provide a description of rules that guide registration of generic medicinal products in the European Union and to analyze specific examples from the scientific literature concerning therapeutic equivalence of reference and generic antidepressant and antipsychotic medicinal products.

  12. Involvement of microRNA-related regulatory pathways in the glucose-mediated control of Arabidopsis early seedling development

    PubMed Central

    Vincentz, Michel

    2013-01-01

    In plants, sugars such as glucose act as signalling molecules that promote changes in gene expression programmes that impact on growth and development. Recent evidence has revealed the potential importance of controlling mRNA decay in some aspects of glucose-mediated regulatory responses suggesting a role of microRNAs (miRNAs) in these responses. In order to get a better understanding of glucose-mediated development modulation involving miRNA-related regulatory pathways, early seedling development of mutants impaired in miRNA biogenesis (hyl1-2 and dcl1-11) and miRNA activity (ago1-25) was evaluated. All mutants exhibited a glucose hyposensitive phenotype from germination up to seedling establishment, indicating that miRNA regulatory pathways are involved in the glucose-mediated delay of early seedling development. The expression profile of 200 miRNA primary transcripts (pri-miRs) was evaluated by large-scale quantitative real-time PCR profiling, which revealed that 38 pri-miRs were regulated by glucose. For several of them, the corresponding mature miRNAs are known to participate directly or indirectly in plant development, and their accumulation was shown to be co-regulated with the pri-miR by glucose. Furthermore, the expression of several miRNA target genes was found to be deregulated in response to glucose in the miRNA machinery mutants ago1-25, dcl1-11, and hyl1-2. Also, in these mutants, glucose promoted misexpression of genes for the three abscisic acid signalling elements ABI3, ABI4, and ABI5. Thus, miRNA regulatory pathways play a role in the adjustments of growth and development triggered by glucose signalling. PMID:23997203

  13. Maturation of 6S regulatory RNA to a highly elongated structure.

    PubMed

    Fadouloglou, Vasiliki E; Lin, Hong-Tin V; Tria, Giancarlo; Hernández, Helena; Robinson, Carol V; Svergun, Dmitri I; Luisi, Ben F

    2015-12-01

    As bacterial populations leave the exponential growth phase and enter the stationary phase, their patterns of gene expression undergo marked changes. A key effector of this change is 6S RNA, which is a highly conserved regulatory RNA that impedes the transcription of genes associated with exponential growth by forming an inactivating ternary complex with RNA polymerase and sigma factor σ(70) (σ(70)-RNAP). In Escherichia coli, the endoribonuclease RNase E generates 6S RNA by specific cleavage of a precursor that is nearly twice the size of the 58 kDa mature form. We have explored recognition of the precursor by RNase E, and observed that processing is inhibited under conditions of excess substrate. This finding supports a largely distributive mechanism, meaning that each round of catalysis results in enzyme dissociation and re-binding to the substrate. We show that the precursor molecule and the mature 6S share a structural core dominated by an A-type helix, indicating that processing is not accompanied by extensive refolding. Both precursor and mature forms of 6S have a highly stable secondary structure, adopt an elongated shape, and show the potential to form dimers under specific conditions; nonetheless, 6S has a high structural plasticity that probably enables it to be structurally adapted upon binding to its cognate protein partners. Analysis of the 6S-σ(70)-RNAP complex by native mass spectrometry reveals a stable association with a stoichiometry of 1:1:1. A theoretical 3D model of mature 6S is presented, which is consistent with the experimental data and supports a previously proposed structure with a small stem-loop inside the central bubble.

  14. Discovering miRNA Regulatory Networks in Holt–Oram Syndrome Using a Zebrafish Model

    PubMed Central

    D’Aurizio, Romina; Russo, Francesco; Chiavacci, Elena; Baumgart, Mario; Groth, Marco; D’Onofrio, Mara; Arisi, Ivan; Rainaldi, Giuseppe; Pitto, Letizia; Pellegrini, Marco

    2016-01-01

    MicroRNAs (miRNAs) are small non-coding RNAs that play an important role in the post-transcriptional regulation of gene expression. miRNAs are involved in the regulation of many biological processes such as differentiation, apoptosis, and cell proliferation. miRNAs are expressed in embryonic, postnatal, and adult hearts, and they have a key role in the regulation of gene expression during cardiovascular development and disease. Aberrant expression of miRNAs is associated with abnormal cardiac cell differentiation and dysfunction. Tbx5 is a member of the T-box gene family, which acts as transcription factor involved in the vertebrate heart development. Alteration of Tbx5 level affects the expression of hundreds of genes. Haploinsufficiency and gene duplication of Tbx5 are at the basis of the cardiac abnormalities associated with Holt–Oram syndrome (HOS). Recent data indicate that miRNAs might be an important part of the regulatory circuit through which Tbx5 controls heart development. Using high-throughput technologies, we characterized genome-widely the miRNA and mRNA expression profiles in WT- and Tbx5-depleted zebrafish embryos at two crucial developmental time points, 24 and 48 h post fertilization (hpf). We found that several miRNAs, which are potential effectors of Tbx5, are differentially expressed; some of them are already known to be involved in cardiac development and functions, such as miR-30, miR-34, miR-190, and miR-21. We performed an integrated analysis of miRNA expression data with gene expression profiles to refine computational target prediction approaches by means of the inversely correlation of miRNA–mRNA expressions, and we highlighted targets, which have roles in cardiac contractility, cardiomyocyte proliferation/apoptosis, and morphogenesis, crucial functions regulated by Tbx5. This approach allowed to discover complex regulatory circuits involving novel miRNAs and protein coding genes not considered before in the HOS such as miR-34a and

  15. Genome-wide survey of tissue-specific microRNA and transcription factor regulatory networks in 12 tissues

    PubMed Central

    Guo, Zhiyun; Maki, Miranda; Ding, Ruofan; Yang, Yalan; zhang, Bao; Xiong, Lili

    2014-01-01

    Tissue-specific miRNAs (TS miRNA) specifically expressed in particular tissues play an important role in tissue identity, differentiation and function. However, transcription factor (TF) and TS miRNA regulatory networks across multiple tissues have not been systematically studied. Here, we manually extracted 116 TS miRNAs and systematically investigated the regulatory network of TF-TS miRNA in 12 human tissues. We identified 2,347 TF-TS miRNA regulatory relations and revealed that most TF binding sites tend to enrich close to the transcription start site of TS miRNAs. Furthermore, we found TS miRNAs were regulated widely by non-tissue specific TFs and the tissue-specific expression level of TF have a close relationship with TF-genes regulation. Finally, we describe TSmiR (http://bioeng.swjtu.edu.cn/TSmiR), a novel and web-searchable database that houses interaction maps of TF-TS miRNA in 12 tissues. Taken together, these observations provide a new suggestion to better understand the regulatory network and mechanisms of TF-TS miRNAs underlying different tissues. PMID:24889152

  16. TRANSCRIPTION. Structures of the RNA polymerase-σ54 reveal new and conserved regulatory strategies.

    PubMed

    Yang, Yun; Darbari, Vidya C; Zhang, Nan; Lu, Duo; Glyde, Robert; Wang, Yi-Ping; Winkelman, Jared T; Gourse, Richard L; Murakami, Katsuhiko S; Buck, Martin; Zhang, Xiaodong

    2015-08-21

    Transcription by RNA polymerase (RNAP) in bacteria requires specific promoter recognition by σ factors. The major variant σ factor (σ(54)) initially forms a transcriptionally silent complex requiring specialized adenosine triphosphate-dependent activators for initiation. Our crystal structure of the 450-kilodalton RNAP-σ(54) holoenzyme at 3.8 angstroms reveals molecular details of σ(54) and its interactions with RNAP. The structure explains how σ(54) targets different regions in RNAP to exert its inhibitory function. Although σ(54) and the major σ factor, σ(70), have similar functional domains and contact similar regions of RNAP, unanticipated differences are observed in their domain arrangement and interactions with RNAP, explaining their distinct properties. Furthermore, we observe evolutionarily conserved regulatory hotspots in RNAPs that can be targeted by a diverse range of mechanisms to fine tune transcription.

  17. Role of Non-coding Regulatory RNA in the Virulence of Human Pathogenic Vibrios.

    PubMed

    Pérez-Reytor, Diliana; Plaza, Nicolás; Espejo, Romilio T; Navarrete, Paola; Bastías, Roberto; Garcia, Katherine

    2016-01-01

    In recent decades, the identification of small non-coding RNAs in bacteria has revealed an important regulatory mechanism of gene expression involved in the response to environmental signals and to the control of virulence. In the family Vibrionaceae, which includes several human and animal pathogens, small non-coding RNAs (sRNAs) are closely related to important processes including metabolism, quorum sensing, virulence, and fitness. Studies conducted in silico and experiments using microarrays and high-throughput RNA sequencing have led to the discovery of an unexpected number of sRNAs in Vibrios. The present review discusses the most relevant reports regarding the mechanisms of action of sRNAs and their implications in the virulence of the main human pathogens in the family Vibrionaceae: Vibrio parahaemolyticus, V. vulnificus and V. cholerae.

  18. Role of non-coding RNA transcription around gene regulatory elements in transcription factor recruitment

    PubMed Central

    Ohta, Kunihiro

    2017-01-01

    ABSTRACT Eukaryotic cells produce a variety of non-coding RNAs (ncRNAs), many of which have been shown to play pivotal roles in biological processes such as differentiation, maintenance of pluripotency of stem cells, and cellular response to various stresses. Genome-wide analyses have revealed that many ncRNAs are transcribed around regulatory DNA elements located proximal or distal to gene promoters, but their biological functions are largely unknown. Recently, it has been demonstrated in yeast and mouse that ncRNA transcription around gene promoters and enhancers facilitates DNA binding of transcription factors to their target sites. These results suggest universal roles of promoter/enhancer-associated ncRNAs in the recruitment of transcription factors to their binding sites. PMID:27763805

  19. Role of Non-coding Regulatory RNA in the Virulence of Human Pathogenic Vibrios

    PubMed Central

    Pérez-Reytor, Diliana; Plaza, Nicolás; Espejo, Romilio T.; Navarrete, Paola; Bastías, Roberto; Garcia, Katherine

    2017-01-01

    In recent decades, the identification of small non-coding RNAs in bacteria has revealed an important regulatory mechanism of gene expression involved in the response to environmental signals and to the control of virulence. In the family Vibrionaceae, which includes several human and animal pathogens, small non-coding RNAs (sRNAs) are closely related to important processes including metabolism, quorum sensing, virulence, and fitness. Studies conducted in silico and experiments using microarrays and high-throughput RNA sequencing have led to the discovery of an unexpected number of sRNAs in Vibrios. The present review discusses the most relevant reports regarding the mechanisms of action of sRNAs and their implications in the virulence of the main human pathogens in the family Vibrionaceae: Vibrio parahaemolyticus, V. vulnificus and V. cholerae. PMID:28123382

  20. Rapid identification of regulatory microRNAs by miTRAP (miRNA trapping by RNA in vitro affinity purification).

    PubMed

    Braun, Juliane; Misiak, Danny; Busch, Bianca; Krohn, Knut; Hüttelmaier, Stefan

    2014-04-01

    MicroRNAs (miRNAs) control gene expression at the post-transcriptional level. However, the identification of miRNAs regulating the fate of a specific messenger RNA remains limited due to the imperfect complementarity of miRNAs and targeted transcripts. Here, we describe miTRAP (miRNA trapping by RNA in vitro affinity purification), an advanced protocol of previously reported MS2-tethering approaches. MiTRAP allows the rapid identification of miRNAs targeting an in vitro transcribed RNA in cell lysates. Selective co-purification of regulatory miRNAs was confirmed for the MYC- as well as ZEB2-3'UTR, two well-established miRNA targets in vivo. Combined with miRNA-sequencing, miTRAP identified in addition to miRNAs reported to control MYC expression, 18 novel candidates including not in silico predictable miRNAs. The evaluation of 10 novel candidate miRNAs confirmed 3'UTR-dependent regulation of MYC expression as well as putative non-canonical targeting sites for the not in silico predictable candidates. In conclusion, miTRAP provides a rapid, cost-effective and easy-to-handle protocol allowing the identification of regulatory miRNAs for RNAs of choice in a cellular context of interest. Most notably, miTRAP not only identifies in silico predictable but also unpredictable miRNAs regulating the expression of a specific target RNA.

  1. Potential Inhibitory Influence of miRNA 210 on Regulatory T Cells during Epicutaneous Chemical Sensitization

    PubMed Central

    Long, Carrie Mae; Lukomska, Ewa; Marshall, Nikki B.; Nayak, Ajay; Anderson, Stacey E.

    2016-01-01

    Toluene diisocyanate (TDI) is a potent low molecular weight chemical sensitizer and a leading cause of chemical-induced occupational asthma. The regulatory potential of microRNAs (miRNAs) has been recognized in a variety of disease states, including allergic disease; however, the roles of miRNAs in chemical sensitization are largely unknown. In a previous work, increased expression of multiple miRNAs during TDI sensitization was observed and several putative mRNA targets identified for these miRNAs were directly related to regulatory T-cell (Treg) differentiation and function including Foxp3 and Runx3. In this work, we show that miR-210 expression is increased in the mouse draining lymph node (dLN) and Treg subsets following dermal TDI sensitization. Alterations in dLN mRNA and protein expression of Treg related genes/putative miR-210 targets (foxp3, runx3, ctla4, and cd25) were observed at multiple time points following TDI exposure and in ex vivo systems. A Treg suppression assay, including a miR-210 mimic, was utilized to investigate the suppressive ability of Tregs. Cells derived from TDI sensitized mice treated with miR-210 mimic had less expression of miR-210 compared to the acetone control suggesting other factors, such as additional miRNAs, might be involved in the regulation of the functional capabilities of these cells. These novel findings indicate that miR-210 may have an inhibitory role in Treg function during TDI sensitization. Because the functional roles of miRNAs have not been previously elucidated in a model of chemical sensitization, these data contribute to the understanding of the potential immunologic mechanisms of chemical induced allergic disease. PMID:28035981

  2. Rapid kinetics of iron responsive element (IRE) RNA/iron regulatory protein 1 and IRE-RNA/eIF4F complexes respond differently to metal ions

    PubMed Central

    Khan, Mateen A.; Ma, Jia; Walden, William E.; Merrick, William C.; Theil, Elizabeth C.; Goss, Dixie J.

    2014-01-01

    Metal ion binding was previously shown to destabilize IRE-RNA/IRP1 equilibria and enhanced IRE-RNA/eIF4F equilibria. In order to understand the relative importance of kinetics and stability, we now report rapid rates of protein/RNA complex assembly and dissociation for two IRE-RNAs with IRP1, and quantitatively different metal ion response kinetics that coincide with the different iron responses in vivo. kon, for FRT IRE-RNA binding to IRP1 was eight times faster than ACO2 IRE-RNA. Mn2+ decreased kon and increased koff for IRP1 binding to both FRT and ACO2 IRE-RNA, with a larger effect for FRT IRE-RNA. In order to further understand IRE-mRNA regulation in terms of kinetics and stability, eIF4F kinetics with FRT IRE-RNA were determined. kon for eIF4F binding to FRT IRE-RNA in the absence of metal ions was 5-times slower than the IRP1 binding to FRT IRE-RNA. Mn2+ increased the association rate for eIF4F binding to FRT IRE-RNA, so that at 50 µM Mn2+ eIF4F bound more than 3-times faster than IRP1. IRP1/IRE-RNA complex has a much shorter life-time than the eIF4F/IRE-RNA complex, which suggests that both rate of assembly and stability of the complexes are important, and that allows this regulatory system to respond rapidly to change in cellular iron. PMID:24728987

  3. Regulatory hurdles for genome editing: process- vs. product-based approaches in different regulatory contexts.

    PubMed

    Sprink, Thorben; Eriksson, Dennis; Schiemann, Joachim; Hartung, Frank

    2016-07-01

    Novel plant genome editing techniques call for an updated legislation regulating the use of plants produced by genetic engineering or genome editing, especially in the European Union. Established more than 25 years ago and based on a clear distinction between transgenic and conventionally bred plants, the current EU Directives fail to accommodate the new continuum between genetic engineering and conventional breeding. Despite the fact that the Directive 2001/18/EC contains both process- and product-related terms, it is commonly interpreted as a strictly process-based legislation. In view of several new emerging techniques which are closer to the conventional breeding than common genetic engineering, we argue that it should be actually interpreted more in relation to the resulting product. A legal guidance on how to define plants produced by exploring novel genome editing techniques in relation to the decade-old legislation is urgently needed, as private companies and public researchers are waiting impatiently with products and projects in the pipeline. We here outline the process in the EU to develop a legislation that properly matches the scientific progress. As the process is facing several hurdles, we also compare with existing frameworks in other countries and discuss ideas for an alternative regulatory system.

  4. Deduced products of C4-dicarboxylate transport regulatory genes of Rhizobium leguminosarum are homologous to nitrogen regulatory gene products.

    PubMed Central

    Ronson, C W; Astwood, P M; Nixon, B T; Ausubel, F M

    1987-01-01

    We have sequenced two genes dctB and dctD required for the activation of the C4-dicarboxylate transport structural gene dctA in free-living Rhizobium leguminosarum. The hydropathic profile of the dctB gene product (DctB) suggested that its N-terminal region may be located in the periplasm and its C-terminal region in the cytoplasm. The C-terminal region of DctB was strongly conserved with similar regions of the products of several regulatory genes that may act as environmental sensors, including ntrB, envZ, virA, phoR, cpxA, and phoM. The N-terminal domains of the products of several regulatory genes thought to be transcriptional activators, including ntrC, ompR, virG, phoB and sfrA. In addition, the central and C-terminal regions of DctD were strongly conserved with the products of ntrC and nifA, transcriptional activators that require the alternate sigma factor rpoN (ntrA) as co-activator. The central region of DctD also contained a potential ATP-binding domain. These results are consistent with recent results that show that rpoN product is required for dctA activation, and suggest that DctB plus DctD-mediated transcriptional activation of dctA may be mechanistically similar to NtrB plus NtrC-mediated activation of glnA in E. coli. PMID:3671068

  5. A new regulatory pathway of mRNA export by an F-box protein, Mdm30.

    PubMed

    Durairaj, Geetha; Lahudkar, Shweta; Bhaumik, Sukesh R

    2014-02-01

    Mdm30, an F-box protein in yeast, has been recently shown to promote mRNA export. However, it remains unknown how Mdm30 facilitates mRNA export. Here, we show that Mdm30 targets the Sub2 component of the TREX (Transcription/Export) complex for ubiquitylation and subsequent proteasomal degradation. Such a targeted degradation of Sub2 enhances the recruitment of the mRNA export adaptor, Yra1, to the active genes to promote mRNA export. Together, these results elucidate that Mdm30 promotes mRNA export by lowering Sub2's stability and consequently enhancing Yra1 recruitment, thus illuminating new regulatory mechanisms of mRNA export by Mdm30.

  6. Structure of a Virulence Regulatory Factor CvfB Reveals a Novel Winged-helix RNA Binding Module

    PubMed Central

    Matsumoto, Yasuhiko; Xu, Qingping; Miyazaki, Shinya; Kaito, Chikara; Farr, Carol L.; Axelrod, Herbert L.; Chiu, Hsiu-Ju; Klock, Heath E.; Knuth, Mark W.; Miller, Mitchell D.; Elsliger, Marc-André; Deacon, Ashley M.; Godzik, Adam; Lesley, Scott A.; Sekimizu, Kazuhisa; Wilson, Ian A.

    2010-01-01

    SUMMARY CvfB is a conserved regulatory protein important for the virulence of Staphylococcus aureus. We show here that CvfB binds RNA. The crystal structure of the CvfB ortholog from Streptococcus pneumoniae at 1.4 Å resolution reveals a unique RNA binding protein that is formed from a concatenation of well-known structural modules that bind nucleic acids: three consecutive S1 RNA-binding domains and a winged-helix (WH) domain. The third S1 and the WH domains are required for cooperative RNA binding and form a continuous surface that likely contributes to the RNA interaction. The WH domain is critical to CvfB function and contains a unique structural motif. Thus CvfB represents a novel assembly of modules for binding RNA. PMID:20399190

  7. GRIL-seq provides a method for identifying direct targets of bacterial small regulatory RNA by in vivo proximity ligation.

    PubMed

    Han, Kook; Tjaden, Brian; Lory, Stephen

    2016-12-22

    The first step in the post-transcriptional regulatory function of most bacterial small non-coding RNAs (sRNAs) is base pairing with partially complementary sequences of targeted transcripts. We present a simple method for identifying sRNA targets in vivo and defining processing sites of the regulated transcripts. The technique, referred to as global small non-coding RNA target identification by ligation and sequencing (GRIL-seq), is based on preferential ligation of sRNAs to the ends of base-paired targets in bacteria co-expressing T4 RNA ligase, followed by sequencing to identify the chimaeras. In addition to the RNA chaperone Hfq, the GRIL-seq method depends on the activity of the pyrophosphorylase RppH. Using PrrF1, an iron-regulated sRNA in Pseudomonas aeruginosa, we demonstrated that direct regulatory targets of this sRNA can readily be identified. Therefore, GRIL-seq represents a powerful tool not only for identifying direct targets of sRNAs in a variety of environments, but also for uncovering novel roles for sRNAs and their targets in complex regulatory networks.

  8. Diverse activities of viral cis-acting RNA regulatory elements revealed using multicolor, long-term, single-cell imaging.

    PubMed

    Pocock, Ginger M; Zimdars, Laraine L; Yuan, Ming; Eliceiri, Kevin W; Ahlquist, Paul; Sherer, Nathan M

    2017-02-01

    Cis-acting RNA structural elements govern crucial aspects of viral gene expression. How these structures and other posttranscriptional signals affect RNA trafficking and translation in the context of single cells is poorly understood. Herein we describe a multicolor, long-term (>24 h) imaging strategy for measuring integrated aspects of viral RNA regulatory control in individual cells. We apply this strategy to demonstrate differential mRNA trafficking behaviors governed by RNA elements derived from three retroviruses (HIV-1, murine leukemia virus, and Mason-Pfizer monkey virus), two hepadnaviruses (hepatitis B virus and woodchuck hepatitis virus), and an intron-retaining transcript encoded by the cellular NXF1 gene. Striking behaviors include "burst" RNA nuclear export dynamics regulated by HIV-1's Rev response element and the viral Rev protein; transient aggregations of RNAs into discrete foci at or near the nuclear membrane triggered by multiple elements; and a novel, pulsiform RNA export activity regulated by the hepadnaviral posttranscriptional regulatory element. We incorporate single-cell tracking and a data-mining algorithm into our approach to obtain RNA element-specific, high-resolution gene expression signatures. Together these imaging assays constitute a tractable, systems-based platform for studying otherwise difficult to access spatiotemporal features of viral and cellular gene regulation.

  9. Integrative identification of deregulated miRNA/TF-mediated gene regulatory loops and networks in prostate cancer.

    PubMed

    Afshar, Ali Sobhi; Xu, Joseph; Goutsias, John

    2014-01-01

    MicroRNAs (miRNAs) have attracted a great deal of attention in biology and medicine. It has been hypothesized that miRNAs interact with transcription factors (TFs) in a coordinated fashion to play key roles in regulating signaling and transcriptional pathways and in achieving robust gene regulation. Here, we propose a novel integrative computational method to infer certain types of deregulated miRNA-mediated regulatory circuits at the transcriptional, post-transcriptional and signaling levels. To reliably predict miRNA-target interactions from mRNA/miRNA expression data, our method collectively utilizes sequence-based miRNA-target predictions obtained from several algorithms, known information about mRNA and miRNA targets of TFs available in existing databases, certain molecular structures identified to be statistically over-represented in gene regulatory networks, available molecular subtyping information, and state-of-the-art statistical techniques to appropriately constrain the underlying analysis. In this way, the method exploits almost every aspect of extractable information in the expression data. We apply our procedure on mRNA/miRNA expression data from prostate tumor and normal samples and detect numerous known and novel miRNA-mediated deregulated loops and networks in prostate cancer. We also demonstrate instances of the results in a number of distinct biological settings, which are known to play crucial roles in prostate and other types of cancer. Our findings show that the proposed computational method can be used to effectively achieve notable insights into the poorly understood molecular mechanisms of miRNA-mediated interactions and dissect their functional roles in cancer in an effort to pave the way for miRNA-based therapeutics in clinical settings.

  10. Integrative Identification of Deregulated MiRNA/TF-Mediated Gene Regulatory Loops and Networks in Prostate Cancer

    PubMed Central

    Afshar, Ali Sobhi; Xu, Joseph; Goutsias, John

    2014-01-01

    MicroRNAs (miRNAs) have attracted a great deal of attention in biology and medicine. It has been hypothesized that miRNAs interact with transcription factors (TFs) in a coordinated fashion to play key roles in regulating signaling and transcriptional pathways and in achieving robust gene regulation. Here, we propose a novel integrative computational method to infer certain types of deregulated miRNA-mediated regulatory circuits at the transcriptional, post-transcriptional and signaling levels. To reliably predict miRNA-target interactions from mRNA/miRNA expression data, our method collectively utilizes sequence-based miRNA-target predictions obtained from several algorithms, known information about mRNA and miRNA targets of TFs available in existing databases, certain molecular structures identified to be statistically over-represented in gene regulatory networks, available molecular subtyping information, and state-of-the-art statistical techniques to appropriately constrain the underlying analysis. In this way, the method exploits almost every aspect of extractable information in the expression data. We apply our procedure on mRNA/miRNA expression data from prostate tumor and normal samples and detect numerous known and novel miRNA-mediated deregulated loops and networks in prostate cancer. We also demonstrate instances of the results in a number of distinct biological settings, which are known to play crucial roles in prostate and other types of cancer. Our findings show that the proposed computational method can be used to effectively achieve notable insights into the poorly understood molecular mechanisms of miRNA-mediated interactions and dissect their functional roles in cancer in an effort to pave the way for miRNA-based therapeutics in clinical settings. PMID:24968068

  11. Tobacco regulatory science: research to inform regulatory action at the Food and Drug Administration's Center for Tobacco Products.

    PubMed

    Ashley, David L; Backinger, Cathy L; van Bemmel, Dana M; Neveleff, Deborah J

    2014-08-01

    The U.S. Food and Drug Administration (FDA) promotes the development of regulatory science to ensure that a strong evidence base informs all of its regulatory activities related to the manufacture, marketing, and distribution of tobacco products as well as public education about tobacco product constituents and effects. Toward that end, the FDA's Center for Tobacco Products (CTP) provides funding for research studies with scientific aims that fall within its defined regulatory authority. However, given their traditional biomedical focus on basic and applied research, some researchers may not understand the principles of regulatory science or the types of studies CTP funds. The purpose of this paper is (1) to clarify the definition of regulatory science as a distinct scientific discipline, (2) to explore the role of tobacco regulatory science in order to help researchers understand the parameters and types of research that can be funded by CTP, and (3) to describe the types of research efforts that will inform the FDA's public health framework for tobacco product regulation.

  12. Genome-wide analysis of the regulatory function mediated by the small regulatory psm-mec RNA of methicillin-resistant Staphylococcus aureus.

    PubMed

    Cheung, Gordon Y C; Villaruz, Amer E; Joo, Hwang-Soo; Duong, Anthony C; Yeh, Anthony J; Nguyen, Thuan H; Sturdevant, Daniel E; Queck, S Y; Otto, M

    2014-07-01

    Several methicillin resistance (SCCmec) clusters characteristic of hospital-associated methicillin-resistant Staphylococcus aureus (MRSA) strains harbor the psm-mec locus. In addition to encoding the cytolysin, phenol-soluble modulin (PSM)-mec, this locus has been attributed gene regulatory functions. Here we employed genome-wide transcriptional profiling to define the regulatory function of the psm-mec locus. The immune evasion factor protein A emerged as the primary conserved and strongly regulated target of psm-mec, an effect we show is mediated by the psm-mec RNA. Furthermore, the psm-mec locus exerted regulatory effects that were more moderate in extent. For example, expression of PSM-mec limited expression of mecA, thereby decreasing methicillin resistance. Our study shows that the psm-mec locus has a rare dual regulatory RNA and encoded cytolysin function. Furthermore, our findings reveal a specific mechanism underscoring the recently emerging concept that S. aureus strains balance pronounced virulence and high expression of antibiotic resistance.

  13. A critical assessment of regulatory triggers for products of biotechnology: Product vs. process.

    PubMed

    McHughen, Alan

    2016-10-01

    Regulatory policies governing the safety of genetic engineering (rDNA) and the resulting products (GMOs) have been contentious and divisive, especially in agricultural applications of the technologies. These tensions led to vastly different approaches to safety regulation in different jurisdictions, even though the intent of regulations-to assure public and environmental safety-are common worldwide, and even though the international scientific communities agree on the basic principles of risk assessment and risk management. So great are the political divisions that jurisdictions cannot even agree on the appropriate triggers for regulatory capture, whether product or process. This paper reviews the historical policy and scientific implications of agricultural biotechnology regulatory approaches taken by the European Union, USA and Canada, using their respective statutes and regulations, and then critically assesses the scientific underpinnings of each.

  14. Transcriptome landscape of Lactococcus lactis reveals many novel RNAs including a small regulatory RNA involved in carbon uptake and metabolism

    PubMed Central

    van der Meulen, Sjoerd B.; de Jong, Anne; Kok, Jan

    2016-01-01

    ABSTRACT RNA sequencing has revolutionized genome-wide transcriptome analyses, and the identification of non-coding regulatory RNAs in bacteria has thus increased concurrently. Here we reveal the transcriptome map of the lactic acid bacterial paradigm Lactococcus lactis MG1363 by employing differential RNA sequencing (dRNA-seq) and a combination of manual and automated transcriptome mining. This resulted in a high-resolution genome annotation of L. lactis and the identification of 60 cis-encoded antisense RNAs (asRNAs), 186 trans-encoded putative regulatory RNAs (sRNAs) and 134 novel small ORFs. Based on the putative targets of asRNAs, a novel classification is proposed. Several transcription factor DNA binding motifs were identified in the promoter sequences of (a)sRNAs, providing insight in the interplay between lactococcal regulatory RNAs and transcription factors. The presence and lengths of 14 putative sRNAs were experimentally confirmed by differential Northern hybridization, including the abundant RNA 6S that is differentially expressed depending on the available carbon source. For another sRNA, LLMGnc_147, functional analysis revealed that it is involved in carbon uptake and metabolism. L. lactis contains 13% leaderless mRNAs (lmRNAs) that, from an analysis of overrepresentation in GO classes, seem predominantly involved in nucleotide metabolism and DNA/RNA binding. Moreover, an A-rich sequence motif immediately following the start codon was uncovered, which could provide novel insight in the translation of lmRNAs. Altogether, this first experimental genome-wide assessment of the transcriptome landscape of L. lactis and subsequent sRNA studies provide an extensive basis for the investigation of regulatory RNAs in L. lactis and related lactococcal species. PMID:26950529

  15. Clinical data and regulatory issues of biosimilar products.

    PubMed

    Stevenson, James G

    2015-12-01

    Biologics are a fast-growing segment of pharmaceutical development. Many are effective in the treatment of illnesses such as cancers, rheumatoid arthritis, and multiple sclerosis. Biologics encompass a range of compounds, including recombinant hormones, growth factors, monoclonal antibodies, recombinant vaccines, and blood products. Many of these drugs are facing patent expiration, and pharmaceutical research is focusing on the development of generic substitutes, or "biosimilars." Because biologics generally exhibit high molecular complexity, the process of development and approval of biosimilars is complicated. Unlike standard small molecule generics where an identical drug copy is expected, variations in biosimilars may be inherent because the sponsor does not have knowledge of the originator's processes. Because of this intricacy, regulatory requirements are needed to ensure biosimilarity, comparability, and interchangeability with respect to efficacy and safety. Clinician awareness of the similarities and differences between original biopharmaceuticals and biosimilars, as well as their impact on efficacy and safety, is imperative.

  16. Regulation of photoreceptor gene transcription via a highly conserved transcriptional regulatory element by vsx gene products

    PubMed Central

    Pan, Yi; Comiskey, Daniel F.; Kelly, Lisa E.; Chandler, Dawn S.

    2016-01-01

    Purpose The photoreceptor conserved element-1 (PCE-1) sequence is found in the transcriptional regulatory regions of many genes expressed in photoreceptors. The retinal homeobox (Rx or Rax) gene product functions by binding to PCE-1 sites. However, other transcriptional regulators have also been reported to bind to PCE-1. One of these, vsx2, is expressed in retinal progenitor and bipolar cells. The purpose of this study is to identify Xenopus laevis vsx gene products and characterize vsx gene product expression and function with respect to the PCE-1 site. Methods X. laevis vsx gene products were amplified with PCR. Expression patterns were determined with in situ hybridization using whole or sectioned X. laevis embryos and digoxigenin- or fluorescein-labeled antisense riboprobes. DNA binding characteristics of the vsx gene products were analyzed with electrophoretic mobility shift assays (EMSAs) using in vitro translated proteins and radiolabeled oligonucleotide probes. Gene transactivation assays were performed using luciferase-based reporters and in vitro transcribed effector gene products, injected into X. laevis embryos. Results We identified one vsx1 and two vsx2 gene products. The two vsx2 gene products are generated by alternate mRNA splicing. We verified that these gene products are expressed in the developing retina and that expression resolves into distinct cell types in the mature retina. Finally, we found that vsx gene products can bind the PCE-1 site in vitro and that the two vsx2 isoforms have different gene transactivation activities. Conclusions vsx gene products are expressed in the developing and mature neural retina. vsx gene products can bind the PCE-1 site in vitro and influence the expression of a rhodopsin promoter-luciferase reporter gene. The two isoforms of vsx have different gene transactivation activities in this reporter gene system. PMID:28003732

  17. UpSETing chromatin during non-coding RNA production

    PubMed Central

    2013-01-01

    The packaging of eukaryotic DNA into nucleosomal arrays permits cells to tightly regulate and fine-tune gene expression. The ordered disassembly and reassembly of these nucleosomes allows RNA polymerase II (RNAPII) conditional access to the underlying DNA sequences. Disruption of nucleosome reassembly following RNAPII passage results in spurious transcription initiation events, leading to the production of non-coding RNA (ncRNA). We review the molecular mechanisms involved in the suppression of these cryptic initiation events and discuss the role played by ncRNAs in regulating gene expression. PMID:23738864

  18. RNA-Binding Proteins in Trichomonas vaginalis: Atypical Multifunctional Proteins Involved in a Posttranscriptional Iron Regulatory Mechanism

    PubMed Central

    Figueroa-Angulo, Elisa E.; Calla-Choque, Jaeson S.; Mancilla-Olea, Maria Inocente; Arroyo, Rossana

    2015-01-01

    Iron homeostasis is highly regulated in vertebrates through a regulatory system mediated by RNA-protein interactions between the iron regulatory proteins (IRPs) that interact with an iron responsive element (IRE) located in certain mRNAs, dubbed the IRE-IRP regulatory system. Trichomonas vaginalis, the causal agent of trichomoniasis, presents high iron dependency to regulate its growth, metabolism, and virulence properties. Although T. vaginalis lacks IRPs or proteins with aconitase activity, possesses gene expression mechanisms of iron regulation at the transcriptional and posttranscriptional levels. However, only one gene with iron regulation at the transcriptional level has been described. Recently, our research group described an iron posttranscriptional regulatory mechanism in the T. vaginalis tvcp4 and tvcp12 cysteine proteinase mRNAs. The tvcp4 and tvcp12 mRNAs have a stem-loop structure in the 5'-coding region or in the 3'-UTR, respectively that interacts with T. vaginalis multifunctional proteins HSP70, α-Actinin, and Actin under iron starvation condition, causing translation inhibition or mRNA stabilization similar to the previously characterized IRE-IRP system in eukaryotes. Herein, we summarize recent progress and shed some light on atypical RNA-binding proteins that may participate in the iron posttranscriptional regulation in T. vaginalis. PMID:26703754

  19. miRNA-Target Gene Regulatory Networks: A Bayesian Integrative Approach to Biomarker Selection with Application to Kidney Cancer

    PubMed Central

    Chekouo, Thierry; Stingo, Francesco C.; Doecke, James D.; Do, Kim-Anh

    2015-01-01

    Summary The availability of cross-platform, large-scale genomic data has enabled the investigation of complex biological relationships for many cancers. Identification of reliable cancer-related biomarkers requires the characterization of multiple interactions across complex genetic networks. MicroRNAs are small non-coding RNAs that regulate gene expression; however, the direct relationship between a microRNA and its target gene is difficult to measure. We propose a novel Bayesian model to identify microRNAs and their target genes that are associated with survival time by incorporating the microRNA regulatory network through prior distributions. We assume that biomarkers involved in regulatory networks are likely associated with survival time. We employ non-local prior distributions and a stochastic search method for the selection of biomarkers associated with the survival outcome. We use KEGG pathway information to incorporate correlated gene effects within regulatory networks. Using simulation studies, we assess the performance of our method, and apply it to experimental data of kidney renal cell carcinoma (KIRC) obtained from The Cancer Genome Atlas. Our novel method validates previously identified cancer biomarkers and identifies biomarkers specific to KIRC progression that were not previously discovered. Using the KIRC data, we confirm that biomarkers involved in regulatory networks are more likely to be associated with survival time, showing connections in one regulatory network for five out of six such genes we identified. PMID:25639276

  20. Effect of ration size on fillet fatty acid composition, phospholipid allostasis and mRNA expression patterns of lipid regulatory genes in gilthead sea bream (Sparus aurata).

    PubMed

    Benedito-Palos, Laura; Calduch-Giner, Josep A; Ballester-Lozano, Gabriel F; Pérez-Sánchez, Jaume

    2013-04-14

    The effect of ration size on muscle fatty acid (FA) composition and mRNA expression levels of key regulatory enzymes of lipid and lipoprotein metabolism have been addressed in juveniles of gilthead sea bream fed a practical diet over the course of an 11-week trial. The experimental setup included three feeding levels: (i) full ration until visual satiety, (ii) 70 % of satiation and (iii) 70 % of satiation with the last 2 weeks at the maintenance ration. Feed restriction reduced lipid content of whole body by 30 % and that of fillet by 50 %. In this scenario, the FA composition of fillet TAG was not altered by ration size, whereas that of phospholipids was largely modified with a higher retention of arachidonic acid and DHA. The mRNA transcript levels of lysophosphatidylcholine acyltransferases, phosphatidylethanolamine N-methyltransferase and FA desaturase 2 were not regulated by ration size in the present experimental model. In contrast, mRNA levels of stearoyl-CoA desaturases were markedly down-regulated by feed restriction. An opposite trend was found for a muscle-specific lipoprotein lipase, which is exclusive of fish lineage. Several upstream regulatory transcriptions were also assessed, although nutritionally mediated changes in mRNA transcripts were almost reduced to PPARα and β, which might act in a counter-regulatory way on lipolysis and lipogenic pathways. This gene expression pattern contributes to the construction of a panel of biomarkers to direct marine fish production towards muscle lean phenotypes with increased retentions of long-chain PUFA.

  1. Recombinant biologic products versus nutraceuticals from plants - a regulatory choice?

    PubMed

    Drake, Pascal M W; Szeto, Tim H; Paul, Mathew J; Teh, Audrey Y-H; Ma, Julian K-C

    2017-01-01

    Biotechnology has transformed the potential for plants to be a manufacturing source of pharmaceutical compounds. Now, with transgenic and transient expression techniques, virtually any biologic, including vaccines and therapeutics, could be manufactured in plants. However, uncertainty over the regulatory path for such new pharmaceuticals has been a deterrent. Consideration has been given to using alternative regulatory paths, including those for nutraceuticals or cosmetic agents. This review will consider these possibilities, and discuss the difficulties in establishing regulatory guidelines for new pharmaceutical manufacturing technologies.

  2. Non-coding RNA in control of gene regulatory programs in cardiac development and disease.

    PubMed

    Philippen, Leonne E; Dirkx, Ellen; da Costa-Martins, Paula A; De Windt, Leon J

    2015-12-01

    Organogenesis of the vertebrate heart is a highly specialized process involving progressive specification and differentiation of distinct embryonic cardiac progenitor cell populations driven by specialized gene programming events. Likewise, the onset of pathologies in the adult heart, including cardiac hypertrophy, involves the reactivation of embryonic gene programs. In both cases, these intricate genomic events are temporally and spatially regulated by complex signaling networks and gene regulatory networks. Apart from well-established transcriptional mechanisms, increasing evidence indicates that gene programming in both the developing and the diseased myocardium are under epigenetic control by non-coding RNAs (ncRNAs). MicroRNAs regulate gene expression at the post-transcriptional level, and numerous studies have now established critical roles for this species of tiny RNAs in a broad range of aspects from cardiogenesis towards adult heart failure. Recent reports now also implicate the larger family of long non-coding RNAs (lncRNAs) in these processes as well. Here we discuss the involvement of these two ncRNA classes in proper cardiac development and hypertrophic disease processes of the adult myocardium. This article is part of a Special Issue entitled: Non-coding RNAs.

  3. MicroRNA-33 regulates sterol regulatory element-binding protein 1 expression in mice

    PubMed Central

    Horie, Takahiro; Nishino, Tomohiro; Baba, Osamu; Kuwabara, Yasuhide; Nakao, Tetsushi; Nishiga, Masataka; Usami, Shunsuke; Izuhara, Masayasu; Sowa, Naoya; Yahagi, Naoya; Shimano, Hitoshi; Matsumura, Shigenobu; Inoue, Kazuo; Marusawa, Hiroyuki; Nakamura, Tomoyuki; Hasegawa, Koji; Kume, Noriaki; Yokode, Masayuki; Kita, Toru; Kimura, Takeshi; Ono, Koh

    2013-01-01

    MicroRNAs (miRs) are small non-protein-coding RNAs that bind to specific mRNAs and inhibit translation or promote mRNA degradation. Recent reports have indicated that miR-33, which is located within the intron of sterol regulatory element-binding protein (SREBP) 2, controls cholesterol homoeostasis and may be a potential therapeutic target for the treatment of atherosclerosis. Here we show that deletion of miR-33 results in marked worsening of high-fat diet-induced obesity and liver steatosis. Using miR-33−/−Srebf1+/− mice, we demonstrate that SREBP-1 is a target of miR-33 and that the mechanisms leading to obesity and liver steatosis in miR-33−/− mice involve enhanced expression of SREBP-1. These results elucidate a novel interaction between SREBP-1 and SREBP-2 mediated by miR-33 in vivo. PMID:24300912

  4. MicroRNA-26a Promotes Regulatory T cells and Suppresses Autoimmune Diabetes in Mice.

    PubMed

    Ma, Hui; Zhang, Shoutao; Shi, Doufei; Mao, Yanhua; Cui, Jianguo

    2016-02-01

    Type-1 diabetes (TID) is an autoimmune disease in which the body's own immune cells attack islet β cells, the cells in the pancreas that produce and release the hormone insulin. Mir-26a has been reported to play functions in cellular differentiation, cell growth, cell apoptosis, and metastasis. However, the role of microRNA-26a (Mir-26a) in autoimmune TID has never been investigated. In our current study, we found that pre-Mir-26a (LV-26a)-treated mice had significantly longer normoglycemic time and lower frequency of autoreactive IFN-γ-producing CD4(+) cells compared with an empty lentiviral vector (LV-Con)-treated non-obese diabetic (NOD) mice. Mir-26a suppresses autoreactive T cells and expands Tregs in vivo and in vitro. Furthermore, in our adoptive transfer study, the groups receiving whole splenocytes and CD25-depleted splenocytes from LV-Con-treated diabetic NOD mice develop diabetes at 3 to 4 weeks of age. In comparison, mice injected with undepleted splenocytes obtained from LV-26a-treated reversal NOD mice develop diabetes after 6-8 weeks. And depletion of CD25(+) cells in the splenocytes of reversed mice abrogates the delay in diabetes onset. In conclusion, Mir-26a suppresses autoimmune diabetes in NOD mice in part through promoted regulatory T cells (Tregs) expression.

  5. Regulatory microRNA networks: complex patterns of target pathways for disease-related and housekeeping microRNAs.

    PubMed

    Zafari, Sachli; Backes, Christina; Leidinger, Petra; Meese, Eckart; Keller, Andreas

    2015-06-01

    Blood-based microRNA (miRNA) signatures as biomarkers have been reported for various pathologies, including cancer, neurological disorders, cardiovascular diseases, and also infections. The regulatory mechanism behind respective miRNA patterns is only partially understood. Moreover, "preserved" miRNAs, i.e., miRNAs that are not dysregulated in any disease, and their biological impact have been explored to a very limited extent. We set out to systematically determine their role in regulatory networks by defining groups of highly-dysregulated miRNAs that contribute to a disease signature as opposed to preserved housekeeping miRNAs. We further determined preferential targets and pathways of both dysregulated and preserved miRNAs by computing multi-layer networks, which were compared between housekeeping and dysregulated miRNAs. Of 848 miRNAs examined across 1049 blood samples, 8 potential housekeepers showed very limited expression variations, while 20 miRNAs showed highly-dysregulated expression throughout the investigated blood samples. Our approach provides important insights into miRNAs and their role in regulatory networks. The methodology can be applied to systematically investigate the differences in target genes and pathways of arbitrary miRNA sets.

  6. Adenovirus type 2 nuclear RNA accumulating during productive infection.

    PubMed Central

    Bachenheimer, S L

    1977-01-01

    The viral-specific nuclear RNA which accumulates early and late during productive infection of HeLa cells by adenovirus-type 2 (Ad2) has been characterized with respect to its size and stability after denaturation by Me2SO. Early nuclear transcripts, under nondenaturing conditions, sediment in the range 28 to 45S, but treatment with Me2SO prior to sedimentation results in a shift to about 20S. Later nuclear RNA accumulates as a composite of two populations of molecules: one with a broad size distribution centering on 45S under nondenaturing conditions and less than 32S after denaturation and a second having a narrow size distribution around 35S which is quite stable to Me2SO. Analysis of late RNA by hybridization to Sma fragments of Ad2 DNA suggests that the 35S RNA species is derived from a limited portion of the left half of the viral genome. PMID:864839

  7. A Multi-Step miRNA-mRNA Regulatory Network Construction Approach Identifies Gene Signatures Associated with Endometrioid Endometrial Carcinoma

    PubMed Central

    Xiong, Hanzhen; Li, Qiulian; Chen, Ruichao; Liu, Shaoyan; Lin, Qiongyan; Xiong, Zhongtang; Jiang, Qingping; Guo, Linlang

    2016-01-01

    We aimed to identify endometrioid endometrial carcinoma (EEC)-related gene signatures using a multi-step miRNA-mRNA regulatory network construction approach. Pathway analysis showed that 61 genes were enriched on many carcinoma-related pathways. Among the 14 highest scoring gene signatures, six genes had been previously shown to be endometrial carcinoma. By qRT-PCR and next generation sequencing, we found that a gene signature (CPEB1) was significantly down-regulated in EEC tissues, which may be caused by hsa-miR-183-5p up-regulation. In addition, our literature surveys suggested that CPEB1 may play an important role in EEC pathogenesis by regulating the EMT/p53 pathway. The miRNA-mRNA network is worthy of further investigation with respect to the regulatory mechanisms of miRNAs in EEC. CPEB1 appeared to be a tumor suppressor in EEC. Our results provided valuable guidance for the functional study at the cellular level, as well as the EEC mouse models. PMID:27271671

  8. ZNF148 modulates TOP2A expression and cell proliferation via ceRNA regulatory mechanism in colorectal cancer

    PubMed Central

    Gao, Xian Hua; Li, Juan; Liu, Yan; Liu, Qi Zhi; Hao, Li Qiang; Liu, Lian Jie; Zhang, Wei

    2017-01-01

    Abstract Background: Competing endogenous RNA (ceRNA) regulation is a novel hypothesized mechanism that states RNA molecules share common target microRNAs (miRNAs) and may competitively combine into the same miRNA pool. Methods: Zinc finger protein 148 (ZNF148) and TOP2A expression were analyzed in 742 colorectal cancer (CRC) tissues using immunohistochemistry (IHC). ZNF148 mRNA, TOP2A mRNA, miR101, miR144, miR335, and miR365 expression were estimated in 53 fresh frozen CRC tissues by reverse transcription polymerase chain reaction. Mechanisms underpinning ceRNA were examined using bioinformatics, correlation analysis, RNA interference, gene over-expression, and luciferase assays. Results: Protein levels of ZNF148 and TOP2A detected by IHC positively correlated (Spearman correlation coefficient [rs] = 0.431, P < 0.001); mRNA levels of ZNF148 and TOP2A also positively correlated (r = 0.591, P < 0.001). Bioinformatics analysis demonstrated that ZNF148 and TOP2A mRNA had 13 common target miRNAs, including miR101, miR144, miR335, and miR365. Correlation analysis demonstrated that levels of ZNF148 mRNA were negatively associated with levels of miR144, miR335, and miR365. Knockdown and overexpression tests showed that ZNF148 mRNA and TOP2A mRNA regulated each other in HCT116 cells, respectively, but not in Dicer-deficient HCT116 cells. Luciferase assays demonstrated that ZNF148 and TOP2A regulated each other through 3′UTR. Overexpression of ZNF148 mRNA and TOP2A mRNA caused significant downregulation of miR101, miR144, miR335, and miR365 in the HCT116 cells. We also found that knockdown of ZNF148 and TOP2A significantly promoted cell growth, and overexpression of ZNF148 and TOP2A inhibited cell proliferation, which was abrogated in Dicer-deficient HCT116 cells. Conclusion: ZNF148 and TOP2A regulate each other through ceRNA regulatory mechanism in CRC, which has biological effects on cell proliferation. PMID:28072746

  9. Nonsense codons in human beta-globin mRNA result in the production of mRNA degradation products.

    PubMed Central

    Lim, S K; Sigmund, C D; Gross, K W; Maquat, L E

    1992-01-01

    Human beta zero-thalassemic beta-globin genes harboring either a frameshift or a nonsense mutation that results in the premature termination of beta-globin mRNA translation have been previously introduced into the germ line of mice (S.-K. Lim, J.J. Mullins, C.-M. Chen, K. Gross, and L.E. Maquat, EMBO J. 8:2613-2619, 1989). Each transgene produces properly processed albeit abnormally unstable mRNA as well as several smaller RNAs in erythroid cells. These smaller RNAs are detected only in the cytoplasm and, relative to mRNA, are longer-lived and are missing sequences from either exon I or exons I and II. In this communication, we show by using genetics and S1 nuclease transcript mapping that the premature termination of beta-globin mRNA translation is mechanistically required for the abnormal RNA metabolism. We also provide evidence that generation of the smaller RNAs is a cytoplasmic process: the 5' ends of intron 1-containing pre-mRNAs were normal, the rates of removal of introns 1 and 2 were normal, and studies inhibiting RNA synthesis with actinomycin D demonstrated a precursor-product relationship between full-length mRNA and the smaller RNAs. In vivo, about 50% of the full-length species that undergo decay are degraded to the smaller RNAs and the rest are degraded to undetectable products. Exposure of erythroid cells that expressed a normal human beta-globin transgene to either cycloheximide or puromycin did not result in the generation of the smaller RNAs. Therefore, a drug-induced reduction in cellular protein synthesis does not reproduce this aspect of cytoplasmic mRNA metabolism. These data suggest that the premature termination of beta-globin mRNA translation in either exon I or exon II results in the cytoplasmic generation of discrete mRNA degradation products that are missing sequences from exon I or exons I and II. Since these degradation products appear to be the same for all nonsense codons tested, there is no correlation between the position of

  10. Regulatory considerations in production of a cell therapy medicinal product in Europe to clinical research.

    PubMed

    Martín, Patricia Gálvez; Martinez, Adolfina Ruiz; Lara, Visitación Gallardo; Naveros, Beatriz Clares

    2014-02-01

    The development of new drugs using stem cells has become a clinic alternative for the treatment of different diseases such as Alzheimer's, diabetes and myocardial infarction. Similar to conventional medicines, stem cells as new medicinal products for cell therapy are subjected to current legislation concerning their manufacture process. Besides, their legality is determined by the Regulatory Agencies belonging to the Member State of the European Union in which they are being registered. With the evolution of therapy that uses cells as medicines, there is a need to develop the appropriate legislative and regulatory framework capable of ensuring their safety and effectiveness. However, few works have been published regarding the regulations that these products must comply through production and commercialization processes. The present work is focused on the description of key events during clinical development and cell production of stem cells as drugs. Such as the regulations, requirements and directives involved in the production of cell therapy medicinal products, from the clinical design stage to its commercialization in Europe.

  11. Sites of amyloid SAA mRNA production

    SciTech Connect

    Meek, R.L.; Benditt, E.P.

    1986-03-01

    To investigate possible extrahepatic sites of SAA production, male BALB/c mice were given a single 0.5 ml injection of either 10% casein or lipopolysaccharide (LPS; 100 mg/ml). Twenty hours after injection, RNA was extracted from liver, kidney, adrenal, testis, brain, spleen, skeletal muscle, heart, lung and small intestine. Northern blots of total RNA were hybridized with nick-translated /sup 32/P-labeled cDNA probes (length approximately 150 base pairs) corresponding to an homologous region of the three known SAA genes. Both casein and LPS elevated the mRNA in liver to about 200-fold above control levels; mRNA was elevated in adrenals from O to approximately 2% of liver. mRNA in some other tissues responded only to LPS injection: levels in kidney reached 15% of liver; pituitary, testis and brain reached 0.02 to 0.5% of liver; no apoSAA mRNA was detected in heart, skeletal muscle, lung, spleen or small intestine. Thus, some organs other than liver appear to have operational genes for apoSAA. The expression of apoSAA genes in different tissues is shared with other apoproteins; it remains to be seen whether all three or only selected genes are transcribed and translated in different tissues.

  12. Evidence for Positive Selection on a Number of MicroRNA Regulatory Interactions during Recent Human Evolution

    PubMed Central

    Xin, Xiaofeng; Kim, Taehyung Simon; Cabeza, Eduardo Aguiar; Ren, Jie; Nielsen, Rasmus; Wrana, Jeffrey L.; Zhang, Zhaolei

    2012-01-01

    MicroRNA (miRNA)–mediated gene regulation is of critical functional importance in animals and is thought to be largely constrained during evolution. However, little is known regarding evolutionary changes of the miRNA network and their role in human evolution. Here we show that a number of miRNA binding sites display high levels of population differentiation in humans and thus are likely targets of local adaptation. In a subset we demonstrate that allelic differences modulate miRNA regulation in mammalian cells, including an interaction between miR-155 and TYRP1, an important melanosomal enzyme associated with human pigmentary differences. We identify alternate alleles of TYRP1 that induce or disrupt miR-155 regulation and demonstrate that these alleles are selected with different modes among human populations, causing a strong negative correlation between the frequency of miR-155 regulation of TYRP1 in human populations and their latitude of residence. We propose that local adaptation of microRNA regulation acts as a rheostat to optimize TYRP1 expression in response to differential UV radiation. Our findings illustrate the evolutionary plasticity of the microRNA regulatory network in recent human evolution. PMID:22457636

  13. Inducing effect of PGRs on small regulatory si/miRNA in resistance to sugar beet cyst nematode.

    PubMed

    Tsygankova, V A; Stefanovska, T R; Galkin, A P; Ponomarenko, S P; Blume, Ya B

    2012-01-01

    Sugar beet cyst nematode Heterodera schachtii Schmidt is an economically important plant parasite of sugar beet in Ukraine. The pest control options are limited. Sugar beet cyst nematode resistant varieties are not available on the market. Carbamate and organophosphate pesticides have been banned due to the high toxicity. The problem is aggravated by continuously increasing of oilseed rape (which is suitable host for H. schachtii) growing area due to biofuel demands. Several studies' results indicate that PGRs have role in management of plant parasitic nematodes but for sugar beet it is not studied well. We had an objective- studying of the role of four compositional PGRs created based of avermectin in suppression of sugar beet cyst nematode population on sugar beet and oilseed rape caused by enhancing of endogenous si/miRNA complementary to H. schachtii mRNA. Laboratory study was conducted in 2011 with using method DOT-blot hybridization si/miRNA with mRNA and by testing inhibitory activity in cell free system protein biosynthesis. That was shown that application of the PGRs enhances sugar beet and oilseeds rape plant immune-protective properties and resistance against plant-parasitic nematode Heterodera schochtii through enhancement of synthesis of small regulatory si/miRNA related (complementary) to an mRNA structure of the parasitic organisms. As a result, translation of mRNA of the nematode is blocked and causes the mortality of plant parasite juveniles.

  14. Oncogenic potential of TAR RNA binding protein TRBP and its regulatory interaction with RNA-dependent protein kinase PKR.

    PubMed Central

    Benkirane, M; Neuveut, C; Chun, R F; Smith, S M; Samuel, C E; Gatignol, A; Jeang, K T

    1997-01-01

    TAR RNA binding protein (TRBP) belongs to an RNA binding protein family that includes the double-stranded RNA-activated protein kinase (PKR), Drosophila Staufen and Xenopus xlrbpa. One member of this family, PKR, is a serine/threonine kinase which has anti-viral and anti-proliferative effects. In this study we show that TRBP is a cellular down-regulator of PKR function. Assaying expression from an infectious HIV-1 molecular clone, we found that PKR inhibited viral protein synthesis and that over-expression of TRBP effectively countered this inhibition. In intracellular and in cell-free assays we show that TRBP directly inhibits PKR autophosphorylation through an RNA binding-independent pathway. Biologically, TRBP serves a growth-promoting role; cells that overexpress TRBP exhibit transformed phenotypes. Our results demonstrate the oncogenic potential of TRBP and are consistent with the notion that intracellular PKR function contributes physiologically towards regulating cellular proliferation. PMID:9034343

  15. Global small RNA chaperone Hfq and regulatory small RNAs are important virulence regulators in Erwinia amylovora.

    PubMed

    Zeng, Quan; McNally, R Ryan; Sundin, George W

    2013-04-01

    Hfq is a global small RNA (sRNA) chaperone that interacts with Hfq-regulated sRNAs and functions in the posttranscriptional regulation of gene expression. In this work, we identified Hfq to be a virulence regulator in the Gram-negative fire blight pathogen Erwinia amylovora. Deletion of hfq in E. amylovora Ea1189 significantly reduced bacterial virulence in both immature pear fruits and apple shoots. Analysis of virulence determinants in strain Ea1189Δhfq showed that Hfq exerts pleiotropic regulation of amylovoran exopolysaccharide production, biofilm formation, motility, and the type III secretion system (T3SS). Further characterization of biofilm regulation by Hfq demonstrated that Hfq limits bacterial attachment to solid surfaces while promoting biofilm maturation. Characterization of T3SS regulation by Hfq revealed that Hfq positively regulates the translocation and secretion of the major type III effector DspE and negatively controls the secretion of the putative translocator HrpK and the type III effector Eop1. Lastly, 10 Hfq-regulated sRNAs were identified using a computational method, and two of these sRNAs, RprA and RyhA, were found to be required for the full virulence of E. amylovora.

  16. Regulatory Role of RNA Chaperone TDP-43 for RNA Misfolding and Repeat-Associated Translation in SCA31.

    PubMed

    Ishiguro, Taro; Sato, Nozomu; Ueyama, Morio; Fujikake, Nobuhiro; Sellier, Chantal; Kanegami, Akemi; Tokuda, Eiichi; Zamiri, Bita; Gall-Duncan, Terence; Mirceta, Mila; Furukawa, Yoshiaki; Yokota, Takanori; Wada, Keiji; Taylor, J Paul; Pearson, Christopher E; Charlet-Berguerand, Nicolas; Mizusawa, Hidehiro; Nagai, Yoshitaka; Ishikawa, Kinya

    2017-04-05

    Microsatellite expansion disorders are pathologically characterized by RNA foci formation and repeat-associated non-AUG (RAN) translation. However, their underlying pathomechanisms and regulation of RAN translation remain unknown. We report that expression of expanded UGGAA (UGGAAexp) repeats, responsible for spinocerebellar ataxia type 31 (SCA31) in Drosophila, causes neurodegeneration accompanied by accumulation of UGGAAexp RNA foci and translation of repeat-associated pentapeptide repeat (PPR) proteins, consistent with observations in SCA31 patient brains. We revealed that motor-neuron disease (MND)-linked RNA-binding proteins (RBPs), TDP-43, FUS, and hnRNPA2B1, bind to and induce structural alteration of UGGAAexp. These RBPs suppress UGGAAexp-mediated toxicity in Drosophila by functioning as RNA chaperones for proper UGGAAexp folding and regulation of PPR translation. Furthermore, nontoxic short UGGAA repeat RNA suppressed mutated RBP aggregation and toxicity in MND Drosophila models. Thus, functional crosstalk of the RNA/RBP network regulates their own quality and balance, suggesting convergence of pathomechanisms in microsatellite expansion disorders and RBP proteinopathies.

  17. RNA G-quadruplexes and their potential regulatory roles in translation

    PubMed Central

    Song, Jingwen; Perreault, Jean-Pierre; Topisirovic, Ivan; Richard, Stéphane

    2016-01-01

    ABSTRACT DNA guanine (G)-rich 4-stranded helical nucleic acid structures called G-quadruplexes (G4), have been extensively studied during the last decades. However, emerging evidence reveals that 5′- and 3′-untranslated regions (5′- and 3′-UTRs) as well as open reading frames (ORFs) contain putative RNA G-quadruplexes. These stable secondary structures play key roles in telomere homeostasis and RNA metabolism including pre-mRNA splicing, polyadenylation, mRNA targeting and translation. Interestingly, multiple RNA binding proteins such as nucleolin, FMRP, DHX36, and Aven were identified to bind RNA G-quadruplexes. Moreover, accumulating reports suggest that RNA G-quadruplexes regulate translation in cap-dependent and -independent manner. Herein, we discuss potential roles of RNA G-quadruplexes and associated trans-acting factors in the regulation of mRNA translation. PMID:28090421

  18. A genomic portrait of the genetic architecture and regulatory impact of microRNA expression in response to infection

    PubMed Central

    Siddle, Katherine J.; Deschamps, Matthieu; Tailleux, Ludovic; Nédélec, Yohann; Pothlichet, Julien; Lugo-Villarino, Geanncarlo; Libri, Valentina; Gicquel, Brigitte; Neyrolles, Olivier; Laval, Guillaume; Patin, Etienne; Barreiro, Luis B.; Quintana-Murci, Lluís

    2014-01-01

    MicroRNAs (miRNAs) are critical regulators of gene expression, and their role in a wide variety of biological processes, including host antimicrobial defense, is increasingly well described. Consistent with their diverse functional effects, miRNA expression is highly context dependent and shows marked changes upon cellular activation. However, the genetic control of miRNA expression in response to external stimuli and the impact of such perturbations on miRNA-mediated regulatory networks at the population level remain to be determined. Here we assessed changes in miRNA expression upon Mycobacterium tuberculosis infection and mapped expression quantitative trait loci (eQTL) in dendritic cells from a panel of healthy individuals. Genome-wide expression profiling revealed that ∼40% of miRNAs are differentially expressed upon infection. We find that the expression of 3% of miRNAs is controlled by proximate genetic factors, which are enriched in a promoter-specific histone modification associated with active transcription. Notably, we identify two infection-specific response eQTLs, for miR-326 and miR-1260, providing an initial assessment of the impact of genotype-environment interactions on miRNA molecular phenotypes. Furthermore, we show that infection coincides with a marked remodeling of the genome-wide relationships between miRNA and mRNA expression levels. This observation, supplemented by experimental data using the model of miR-29a, sheds light on the role of a set of miRNAs in cellular responses to infection. Collectively, this study increases our understanding of the genetic architecture of miRNA expression in response to infection, and highlights the wide-reaching impact of altering miRNA expression on the transcriptional landscape of a cell. PMID:24482540

  19. Genome-wide profiling of the microRNA-mRNA regulatory network in skeletal muscle with aging.

    PubMed

    Kim, Ji Young; Park, Young-Kyu; Lee, Kwang-Pyo; Lee, Seung-Min; Kang, Tae-Wook; Kim, Hee-Jin; Dho, So Hee; Kim, Seon-Young; Kwon, Ki-Sun

    2014-07-01

    Skeletal muscle degenerates progressively, losing mass (sarcopenia) over time, which leads to reduced physical ability and often results in secondary diseases such as diabetes and obesity. The regulation of gene expression by microRNAs is a key event in muscle development and disease. To understand genome‐wide changes in microRNAs and mRNAs during muscle aging, we sequenced microRNAs and mRNAs from mouse gastrocnemius muscles at two different ages (6 and 24 months). Thirty‐four microRNAs (15 up‐regulated and 19 down‐regulated) were differentially expressed with age, including the microRNAs miR‐206 and ‐434, which were differentially expressed in aged muscle in previous studies. Interestingly, eight microRNAs in a microRNA cluster at the imprinted Dlk1‐Dio3 locus on chromosome 12 were coordinately down‐regulated. In addition, sixteen novel microRNAs were identified. Integrative analysis of microRNA and mRNA expression revealed that microRNAs may contribute to muscle aging through the positive regulation of transcription, metabolic processes, and kinase activity. Many of the age‐related microRNAs have been implicated in human muscular diseases. We suggest that genome‐wide microRNA profiling will expand our knowledge of microRNA function in the muscle aging process.

  20. Molecular simulations illuminate the role of regulatory components of the RNA polymerase from the hepatitis C virus in influencing protein structure and dynamics.

    PubMed

    Davis, Brittny C; Thorpe, Ian F

    2013-07-02

    The RNA polymerase (gene product NS5B) from the hepatitis C virus is responsible for replication of the viral genome and is a validated drug target for new therapeutic agents. NS5B has a structure resembling an open right hand (containing the fingers, palm, and thumb subdomains), a hydrophobic C-terminal region, and two magnesium ions coordinated in the palm domain. Biochemical data suggest that the magnesium ions provide structural stability and are directly involved in catalysis, while the C-terminus plays a regulatory role in NS5B function. Nevertheless, the molecular mechanisms by which these two features regulate polymerase activity remain unclear. To answer this question, we performed molecular dynamics simulations of NS5B variants with different C-terminal lengths in the presence or absence of magnesium ions to determine the impact on enzyme properties. We observed that metal binding increases both the magnitude and the degree of correlated enzyme motions. In contrast, we observed that the C-terminus restricts enzyme dynamics. Under certain conditions, our simulations revealed a fully closed conformation of NS5B that may facilitate de novo initiation of RNA replication. This knowledge is important because it fosters the development of a comprehensive description of RNA replication by NS5B and is relevant to understanding the functional properties of a broad class of related RNA polymerases such as 3D-pol from poliovirus. Ultimately, this information may also be pertinent to designing novel NS5B therapeutics.

  1. Regulatory Oversight of Gene Therapy and Cell Therapy Products in Korea.

    PubMed

    Choi, Minjoung; Han, Euiri; Lee, Sunmi; Kim, Taegyun; Shin, Won

    2015-01-01

    The Ministry of Food and Drug Safety regulates gene therapy and cell therapy products as biological products under the authority of the Pharmaceutical Affairs Act. As with other medicinal products, gene therapy and cell therapy products are subject to approval for use in clinical trials and for a subsequent marketing authorization and to post-market surveillance. Research and development of gene therapy and cell therapy products have been progressing rapidly in Korea with extensive investment, offering great potential for the treatment of various serious diseases. To facilitate development of safe and effective products and provide more opportunities to patients suffering from severe diseases, several regulatory programs, such as the use of investigational products for emergency situations, fast-track approval, prereview of application packages, and intensive regulatory consultation, can be applied to these products. The regulatory approach for these innovative products is case by case and founded on science-based review that is flexible and balances the risks and benefits.

  2. Effect of acute resistance exercise and sex on human patellar tendon structural and regulatory mRNA expression.

    PubMed

    Sullivan, Bridget E; Carroll, Chad C; Jemiolo, Bozena; Trappe, Scott W; Magnusson, S Peter; Døssing, Simon; Kjaer, Michael; Trappe, Todd A

    2009-02-01

    Tendon is mainly composed of collagen and an aqueous matrix of proteoglycans that are regulated by enzymes called matrix metalloproteinases (MMPs) and tissue inhibitors of metalloproteinases (TIMPs). Although it is known that resistance exercise (RE) and sex influence tendon metabolism and mechanical properties, it is uncertain what structural and regulatory components contribute to these responses. We measured the mRNA expression of tendon's main fibrillar collagens (type I and type III) and the main proteoglycans (decorin, biglycan, fibromodulin, and versican) and the regulatory enzymes MMP-2, MMP-9, MMP-3, and TIMP-1 at rest and after RE. Patellar tendon biopsy samples were taken from six individuals (3 men and 3 women) before and 4 h after a bout of RE and from a another six individuals (3 men and 3 women) before and 24 h after RE. Resting mRNA expression was used for sex comparisons (6 men and 6 women). Collagen type I, collagen type III, and MMP-2 were downregulated (P < 0.05) 4 h after RE but were unchanged (P > 0.05) 24 h after RE. All other genes remained unchanged (P > 0.05) after RE. Women had higher resting mRNA expression (P < 0.05) of collagen type III and a trend (P = 0.08) toward lower resting expression of MMP-3 than men. All other genes were not influenced (P > 0.05) by sex. Acute RE appears to stimulate a change in collagen type I, collagen type III, and MMP-2 gene regulation in the human patellar tendon. Sex influences the structural and regulatory mRNA expression of tendon.

  3. Changes in the miRNA-mRNA Regulatory Network Precede Motor Symptoms in a Mouse Model of Multiple System Atrophy: Clinical Implications

    PubMed Central

    Refolo, Violetta; Venezia, Serena; Sturm, Edith; Piatti, Paolo; Hechenberger, Clara; Hackl, Hubert; Kessler, Roman; Willi, Michaela; Gstir, Ronald; Krogsdam, Anne; Lusser, Alexandra; Poewe, Werner; Wenning, Gregor K.; Hüttenhofer, Alexander; Stefanova, Nadia

    2016-01-01

    Multiple system atrophy (MSA) is a fatal rapidly progressive α-synucleinopathy, characterized by α-synuclein accumulation in oligodendrocytes. It is accepted that the pathological α-synuclein accumulation in the brain of MSA patients plays a leading role in the disease process, but little is known about the events in the early stages of the disease. In this study we aimed to define potential roles of the miRNA-mRNA regulatory network in the early pre-motor stages of the disease, i.e., downstream of α-synuclein accumulation in oligodendroglia, as assessed in a transgenic mouse model of MSA. We investigated the expression patterns of miRNAs and their mRNA targets in substantia nigra (SN) and striatum, two brain regions that undergo neurodegeneration at a later stage in the MSA model, by microarray and RNA-seq analysis, respectively. Analysis was performed at a time point when α-synuclein accumulation was already present in oligodendrocytes at neuropathological examination, but no neuronal loss nor deficits of motor function had yet occurred. Our data provide a first evidence for the leading role of gene dysregulation associated with deficits in immune and inflammatory responses in the very early, non-symptomatic disease stages of MSA. While dysfunctional homeostasis and oxidative stress were prominent in SN in the early stages of MSA, in striatum differential gene expression in the non-symptomatic phase was linked to oligodendroglial dysfunction, disturbed protein handling, lipid metabolism, transmembrane transport and altered cell death control, respectively. A large number of putative miRNA-mRNAs interaction partners were identified in relation to the control of these processes in the MSA model. Our results support the role of early changes in the miRNA-mRNA regulatory network in the pathogenesis of MSA preceding the clinical onset of the disease. The findings thus contribute to understanding the disease process and are likely to pave the way towards

  4. Genomic gems: SINE RNAs regulate mRNA production.

    PubMed

    Ponicsan, Steven L; Kugel, Jennifer F; Goodrich, James A

    2010-04-01

    Mammalian short interspersed elements (SINEs) are abundant retrotransposons that have long been considered junk DNA; however, RNAs transcribed from mouse B2 and human Alu SINEs have recently been found to control mRNA production at multiple levels. Upon cell stress B2 and Alu RNAs bind RNA polymerase II (Pol II) and repress transcription of some protein-encoding genes. Bi-directional transcription of a B2 SINE establishes a boundary that places the growth hormone locus in a permissive chromatin state during mouse development. Alu RNAs embedded in Pol II transcripts can promote evolution and proteome diversity through exonization via alternative splicing. Given the diverse means by which SINE encoded RNAs impact production of mRNAs, this genomic junk is proving to contain hidden gems.

  5. Expression and regulatory effects of microRNA-182 in osteosarcoma cells: A pilot study

    PubMed Central

    BIAN, DONG-LIN; WANG, XUE-MEI; HUANG, KUN; ZHAI, QI-XI; YU, GUI-BO; WU, CHENG-HUA

    2016-01-01

    The aim of the present study was to evaluate the expression level of microRNA-182 (miRNA-182) in human osteosarcoma (OS) MG-63 cells and OS tissues, and to elucidate the effect of miRNA-182 on the biological activity of tumors. In the present study, the expression of miRNA-182 in human OS MG-63 cells, OS tissues and normal osteoblast hFOB1.19 cells was determined using quantitative polymerase chain reaction. Subsequently, a miRNA-182 mimic and inhibitor were utilized to regulate the expression level of this miRNA in MG-63 cells. Cell viability and proliferation were examined using cell counting kit-8 assays, and cell apoptosis was detected by flow cytometry. Cell invasion and migration assays were performed using Transwell chambers to analyze the biological functions of miRNA-182 in vitro. The present study demonstrated that the expression level of miRNA-182 in MG-63 cells and OS tissues was significantly increased compared with the hFOB1.19 cell line (P<0.05). The present study successfully performed cell transfections of miRNA-182 inhibitor and miRNA-182 mimic into MG-63 cells and achieved the desired transfection efficiency. The present study confirmed that upregulation of miRNA-182 promotes cell apoptosis and inhibits cell viability, proliferation, invasion and migration. The present findings additionally demonstrated that miRNA-182 is a tumor suppressor gene in OS. Therefore, regulating the expression of miRNA-182 may affect the biological behavior of OS cells, which suggests a potential role for miRNA-182 in molecular therapy for malignant tumors. PMID:27123060

  6. Discovering MicroRNA-Regulatory Modules in Multi-Dimensional Cancer Genomic Data: A Survey of Computational Methods

    PubMed Central

    Walsh, Christopher J.; Hu, Pingzhao; Batt, Jane; dos Santos, Claudia C.

    2016-01-01

    MicroRNAs (miRs) are small single-stranded noncoding RNA that function in RNA silencing and post-transcriptional regulation of gene expression. An increasing number of studies have shown that miRs play an important role in tumorigenesis, and understanding the regulatory mechanism of miRs in this gene regulatory network will help elucidate the complex biological processes at play during malignancy. Despite advances, determination of miR–target interactions (MTIs) and identification of functional modules composed of miRs and their specific targets remain a challenge. A large amount of data generated by high-throughput methods from various sources are available to investigate MTIs. The development of data-driven tools to harness these multi-dimensional data has resulted in significant progress over the past decade. In parallel, large-scale cancer genomic projects are allowing new insights into the commonalities and disparities of miR–target regulation across cancers. In the first half of this review, we explore methods for identification of pairwise MTIs, and in the second half, we explore computational tools for discovery of miR-regulatory modules in a cancer-specific and pan-cancer context. We highlight strengths and limitations of each of these tools as a practical guide for the computational biologists. PMID:27721651

  7. Control of mRNA decapping by positive and negative regulatory elements in the Dcp2 C-terminal domain

    PubMed Central

    He, Feng; Jacobson, Allan

    2015-01-01

    Decapping commits an mRNA to complete degradation and promotes general 5′ to 3′ decay, nonsense-mediated decay (NMD), and transcript-specific degradation. In Saccharomyces cerevisiae, a single decapping enzyme composed of a regulatory subunit (Dcp1) and a catalytic subunit (Dcp2) targets thousands of distinct substrate mRNAs. However, the mechanisms controlling this enzyme's in vivo activity and substrate specificity remain elusive. Here, using a genetic approach, we show that the large C-terminal domain of Dcp2 includes a set of conserved negative and positive regulatory elements. A single negative element inhibits enzymatic activity and controls the downstream functions of several positive elements. The positive elements recruit the specific decapping activators Edc3, Pat1, and Upf1 to form distinct decapping complexes and control the enzyme's substrate specificity and final activation. Our results reveal unforeseen regulatory mechanisms that control decapping enzyme activity and function in vivo, and define roles for several decapping activators in the regulation of mRNA decapping. PMID:26184073

  8. A Two-Component Regulatory System Impacts Extracellular Membrane-Derived Vesicle Production in Group A Streptococcus

    PubMed Central

    Resch, Ulrike; Tsatsaronis, James Anthony; Le Rhun, Anaïs; Stübiger, Gerald; Rohde, Manfred; Kasvandik, Sergo; Holzmeister, Susanne; Tinnefeld, Philip; Wai, Sun Nyunt

    2016-01-01

    ABSTRACT Export of macromolecules via extracellular membrane-derived vesicles (MVs) plays an important role in the biology of Gram-negative bacteria. Gram-positive bacteria have also recently been reported to produce MVs; however, the composition and mechanisms governing vesiculogenesis in Gram-positive bacteria remain undefined. Here, we describe MV production in the Gram-positive human pathogen group A streptococcus (GAS), the etiological agent of necrotizing fasciitis and streptococcal toxic shock syndrome. M1 serotype GAS isolates in culture exhibit MV structures both on the cell wall surface and in the near vicinity of bacterial cells. A comprehensive analysis of MV proteins identified both virulence-associated protein substrates of the general secretory pathway in addition to “anchorless surface proteins.” Characteristic differences in the contents, distributions, and fatty acid compositions of specific lipids between MVs and GAS cell membrane were also observed. Furthermore, deep RNA sequencing of vesicular RNAs revealed that GAS MVs contained differentially abundant RNA species relative to bacterial cellular RNA. MV production by GAS strains varied in a manner dependent on an intact two-component system, CovRS, with MV production negatively regulated by the system. Modulation of MV production through CovRS was found to be independent of both GAS cysteine protease SpeB and capsule biosynthesis. Our data provide an explanation for GAS secretion of macromolecules, including RNAs, lipids, and proteins, and illustrate a regulatory mechanism coordinating this secretory response. PMID:27803183

  9. 78 FR 66940 - Regulatory Requirements for Hearing Aid Devices and Personal Sound Amplification Products; Draft...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-11-07

    ... HUMAN SERVICES Food and Drug Administration Regulatory Requirements for Hearing Aid Devices and Personal Sound Amplification Products; Draft Guidance for Industry and Food and Drug Administration Staff; Availability AGENCY: Food and Drug Administration, HHS. ACTION: Notice. SUMMARY: The Food and...

  10. Structural basis for stabilization of the tau pre-mRNA splicing regulatory element by novatrone (mitoxantrone)

    PubMed Central

    Zheng, Suxin; Chen, Yu; Donahue, Christine P.; Wolfe, Michael S.; Varani, Gabriele

    2009-01-01

    Summary Some familial neurodegenerative diseases are associated with mutations that destabilize a putative stem-loop structure within an intronic region of the tau pre-mRNA and alter the production of tau protein isoforms by alternative splicing. Since stabilization of the stem loop reverses the splicing pattern associated with neurodegeneration, small molecules that stabilize this stem loop would provide new ways to dissect the mechanism of neurodegeneration and treat tauopathies. The anti-cancer drug mitoxantrone was recently identified in a high throughput screen to stabilize the tau pre-mRNA stem loop. Here we report the solution structure of the tau mRNA-mitoxantrone complex, validated by the structure-activity relationship of existing mitoxantrone analogs. The structure describes the molecular basis for their interaction with RNA and provides a rational basis to optimize the activity of this new class of RNA-binding molecules. PMID:19477420

  11. Temporal analysis of reciprocal miRNA-mRNA expression patterns predicts regulatory networks during differentiation in human skeletal muscle cells.

    PubMed

    Sjögren, Rasmus J O; Egan, Brendan; Katayama, Mutsumi; Zierath, Juleen R; Krook, Anna

    2015-03-01

    microRNAs (miRNAs) are short noncoding RNAs that regulate gene expression through posttranscriptional repression of target genes. miRNAs exert a fundamental level of control over many developmental processes, but their role in the differentiation and development of skeletal muscle from myogenic progenitor cells in humans remains incompletely understood. Using primary cultures established from human skeletal muscle satellite cells, we performed microarray profiling of miRNA expression during differentiation of myoblasts (day 0) into myotubes at 48 h intervals (day 2, 4, 6, 8, and 10). Based on a time-course analysis, we identified 44 miRNAs with altered expression [false discovery rate (FDR) < 5%, fold change > ±1.2] during differentiation, including the marked upregulation of the canonical myogenic miRNAs miR-1, miR-133a, miR-133b, and miR-206. Microarray profiling of mRNA expression at day 0, 4, and 10 identified 842 and 949 genes differentially expressed (FDR < 10%) at day 4 and 10, respectively. At day 10, 42% of altered transcripts demonstrated reciprocal expression patterns in relation to the directional change of their in silico predicted regulatory miRNAs based on analysis using Ingenuity Pathway Analysis microRNA Target Filter. Bioinformatic analysis predicted networks of regulation during differentiation including myomiRs miR-1/206 and miR-133a/b, miRNAs previously established in differentiation including miR-26 and miR-30, and novel miRNAs regulated during differentiation of human skeletal muscle cells such as miR-138-5p and miR-20a. These reciprocal expression patterns may represent new regulatory nodes in human skeletal muscle cell differentiation. This analysis serves as a reference point for future studies of human skeletal muscle differentiation and development in healthy and disease states.

  12. The T box mechanism: tRNA as a regulatory molecule

    PubMed Central

    Green, Nicholas J.; Grundy, Frank J.; Henkin, Tina M.

    2009-01-01

    The T box mechanism is widely used in Gram-positive bacteria to regulate expression of aminoacyl-tRNA synthetase genes and genes involved in amino acid biosynthesis and uptake. Binding of a specific uncharged tRNA to a riboswitch element in the nascent transcript causes a structural change in the transcript that promotes expression of the downstream coding sequence. In most cases, this occurs by stabilization of an antiterminator element that competes with formation of a terminator helix. Specific tRNA recognition by the nascent transcript results in increased expression of genes important for tRNA aminoacylation in response to decreased pools of charged tRNA. PMID:19932103

  13. Foot-and-mouth disease virus leader proteinase inhibits dsRNA-induced type I interferon transcription by decreasing interferon regulatory factor 3/7 in protein levels

    SciTech Connect

    Wang, Dang; Fang, Liurong; Luo, Rui; Ye, Rui; Fang, Ying; Xie, Lilan; Chen, Huanchun; Xiao, Shaobo

    2010-08-13

    Research highlights: {yields} FMDV L{sup pro} inhibits poly(I:C)-induced IFN-{alpha}1/{beta} mRNA expression. {yields} L{sup pro} inhibits MDA5-mediated activation of the IFN-{alpha}1/{beta} promoter. {yields} L{sup pro} significantly reduced the transcription of multiple IRF-responsive genes. {yields} L{sup pro} inhibits IFN-{alpha}1/{beta} promoter activation by decreasing IRF-3/7 in protein levels. {yields} The ability to process eIF-4G of L{sup pro} is not necessary to inhibit IFN-{alpha}1/{beta} activation. -- Abstract: The leader proteinase (L{sup pro}) of foot-and-mouth disease virus (FMDV) has been identified as an interferon-{beta} (IFN-{beta}) antagonist that disrupts the integrity of transcription factor nuclear factor {kappa}B (NF-{kappa}B). In this study, we showed that the reduction of double stranded RNA (dsRNA)-induced IFN-{alpha}1/{beta} expression caused by L{sup pro} was also associated with a decrease of interferon regulatory factor 3/7 (IRF-3/7) in protein levels, two critical transcription factors for activation of IFN-{alpha}/{beta}. Furthermore, overexpression of L{sup pro} significantly reduced the transcription of multiple IRF-responsive genes including 2',5'-OAS, ISG54, IP-10, and RANTES. Screening L{sup pro} mutants indicated that the ability to process eIF-4G of L{sup pro} is not required for suppressing dsRNA-induced activation of the IFN-{alpha}1/{beta} promoter and decreasing IRF-3/7 expression. Taken together, our results demonstrate that, in addition to disrupting NF-{kappa}B, L{sup pro} also decreases IRF-3/7 expression to suppress dsRNA-induced type I IFN production, suggesting multiple strategies used by FMDV to counteract the immune response to viral infection.

  14. Activated platelets can deliver mRNA regulatory Ago2•microRNA complexes to endothelial cells via microparticles.

    PubMed

    Laffont, Benoit; Corduan, Aurélie; Plé, Hélène; Duchez, Anne-Claire; Cloutier, Nathalie; Boilard, Eric; Provost, Patrick

    2013-07-11

    Platelets play a crucial role in the maintenance of hemostasis, as well as in thrombosis. Upon activation, platelets release small membrane-bound microparticles (MPs) containing bioactive proteins and genetic materials from their parental cells that may be transferred to, and exert potent biological effects in, recipient cells of the circulatory system. Platelets have been shown to contain an abundant and diverse array of microRNAs, and platelet-derived MPs are the most abundant microvesicles in the circulation. Here we demonstrate that human platelets activated with thrombin preferentially release their miR-223 content in MPs. These MPs can be internalized by human umbilical vein endothelial cells (HUVEC), leading to the accumulation of platelet-derived miR-223. Platelet MPs contain functional Argonaute 2 (Ago2)•miR-223 complexes that are capable of regulating expression of a reporter gene in recipient HUVEC. Moreover, we demonstrate a role for platelet MP-derived miR-223 in the regulation of 2 endogenous endothelial genes, both at the messenger RNA and protein levels. Our results support a scenario by which platelet MPs may act as intercellular carriers of functional Ago2•microRNA complexes that may exert heterotypic regulation of gene expression in endothelial cells, and possibly other recipient cells of the circulatory system.

  15. SPIRE, a modular pipeline for eQTL analysis of RNA-Seq data, reveals a regulatory hotspot controlling miRNA expression in C. elegans.

    PubMed

    Kel, Ivan; Chang, Zisong; Galluccio, Nadia; Romeo, Margherita; Beretta, Stefano; Diomede, Luisa; Mezzelani, Alessandra; Milanesi, Luciano; Dieterich, Christoph; Merelli, Ivan

    2016-10-18

    The interpretation of genome-wide association study is difficult, as it is hard to understand how polymorphisms can affect gene regulation, in particular for trans-regulatory elements located far from their controlling gene. Using RNA or protein expression data as phenotypes, it is possible to correlate their variations with specific genotypes. This technique is usually referred to as expression Quantitative Trait Loci (eQTLs) analysis and only few packages exist for the integration of genotype patterns and expression profiles. In particular, tools are needed for the analysis of next-generation sequencing (NGS) data on a genome-wide scale, which is essential to identify eQTLs able to control a large number of genes (hotspots). Here we present SPIRE (Software for Polymorphism Identification Regulating Expression), a generic, modular and functionally highly flexible pipeline for eQTL processing. SPIRE integrates different univariate and multivariate approaches for eQTL analysis, paying particular attention to the scalability of the procedure in order to support cis- as well as trans-mapping, thus allowing the identification of hotspots in NGS data. In particular, we demonstrated how SPIRE can handle big association study datasets, reproducing published results and improving the identification of trans-eQTLs. Furthermore, we employed the pipeline to analyse novel data concerning the genotypes of two different C. elegans strains (N2 and Hawaii) and related miRNA expression data, obtained using RNA-Seq. A miRNA regulatory hotspot was identified in chromosome 1, overlapping the transcription factor grh-1, known to be involved in the early phases of embryonic development of C. elegans. In a follow-up qPCR experiment we were able to verify most of the predicted eQTLs, as well as to show, for a novel miRNA, a significant difference in the sequences of the two analysed strains of C. elegans. SPIRE is publicly available as open source software at , together with some example

  16. Comparative transcriptome analysis reveals a regulatory network of microRNA-29b during mouse early embryonic development

    PubMed Central

    Wan, Jinyuan; Yang, Ye; Chen, Xiaojiao; Wang, Jiayi; Zhou, Cheng; Liu, Mingxi; Ling, Xiufeng; Zhang, Junqiang

    2016-01-01

    MicroRNAs are endogenous ~22 nt RNAs that regulate gene expression by translational inhibition and mRNA destabilization. MicroRNA-29b (miR-29b) is essential for progression of mouse embryos past preimplantation development; however, details of the underlying regulatory network remain to be elucidated. Here, we used RNA sequencing to identify changes in the transcriptome of mouse embryos in response to miR-29b inhibition. Morula-stage embryos that had been subject to miR-29b inhibition throughout preimplantation development exhibited significant expression changes in 870 genes compared with controls. Among 405 genes that were downregulated, 30 genes encoded factors with known essential function during early embryonic development, including the pluripotent stem cell factor Nanog. We identified 19 genes encoding putative miR-29b target transcripts. These included Zbtb40, Hbp1, Ccdc117, Ypel2, Klf4, and Tmed9, which are upregulated at the 4-cell state of mouse development concomitant with miR-29b downregulation. Luciferase reporter analysis confirmed that Zbtb40, Hbp1, Ccdc117, Ypel2, and Klf4 transcripts are direct targets of miR-29b. These results suggest that miR-29b decreases the mRNA levels of several target genes during early mouse development, including the gene encoding the reprogramming factor Klf4. We hypothesize that inhibition of miR-29b causes overexpression of its target genes, triggering downstream signaling networks to decrease the expression of genes that are essential for embryonic development. In conclusion, miR-29b controls an extensive regulatory network in early mouse embryos, which comprises reprogramming factors and molecular regulators of post-transcriptional modification processes. PMID:27449102

  17. Transition into inflammatory cancer-associated adipocytes in breast cancer microenvironment requires microRNA regulatory mechanism

    PubMed Central

    Ryu, Han Suk; Lee, Han-Byoel; Lee, Minju; Park, In Ae; Kim, Jisun; Han, Wonshik; Noh, Dong-Young

    2017-01-01

    The role of adipocytes in cancer microenvironment has gained focus during the recent years. However, the characteristics of the cancer-associated adipocytes (CAA) in human breast cancer tissues and the underlying regulatory mechanism are not clearly understood. We reviewed pathology specimens of breast cancer patients to understand the morphologic characteristics of CAA, and profiled the mRNA and miRNA expression of CAA by using indirect co-culture system in vitro. The CAAs in human breast cancers showed heterogeneous topographic relationship with breast cancer cells within the breast microenvironment. The CAAs exhibited the characteristics of de-differentiation determined by their microscopic appearance and the expression levels of adipogenic markers. Additionally, the 3T3-L1 adipocytes indirectly co-cultured with breast cancer cells showed up-regulation of inflammation-related genes including Il6 and Ptx3. The up-regulation of IL6 in CAA was further observed in human breast cancer tissues. miRNA array of indirectly co-cultured 3T3-L1 cells showed increased expression of mmu-miR-5112 which may target Cpeb1. Cpeb1 is a negative regulator of Il6. The suppressive role of mmu-miR-5112 was confirmed by dual luciferase reporter assay, and mmu-miR-5112-treated adipocytes showed up-regulation of Il6. The transition of adipocytes into more inflammatory CAA resulted in proliferation-promoting effect in ER positive breast cancer cells such as MCF7 and ZR-75-1 but not in ER negative cells. In this study, we have determined the de-differentiated and inflammatory natures of CAA in breast cancer microenvironment. Additionally, we propose a miRNA-based regulatory mechanism underlying the process of acquiring inflammatory phenotypes in CAA. PMID:28333977

  18. Measuring expression levels of small regulatory RNA molecules from body fluids and formalin-fixed, paraffin-embedded samples.

    PubMed

    Gyongyosi, Adrienn; Docs, Otto; Czimmerer, Zsolt; Orosz, Laszlo; Horvath, Attila; Török, Olga; Mehes, Gabor; Nagy, Laszlo; Balint, Balint L

    2014-01-01

    MicroRNAs are involved in the regulation of various pathophysiological processes such as immune regulation and cancer. Next-generation sequencing methods enable us to monitor their presence in various types of samples but we need flexible methods for validating datasets generated by high-throughput methods. Here we describe the detailed protocols to be used with our MiRNA Primer Design Tool assay design system. The presented methods allow the flexible design of the oligonucleotides needed for the RT-qPCR detection of any variant of small regulatory RNA molecules from virtually any species. This method can be used to measure miRNA levels from formalin-fixed, paraffin-embedded (FFPE) samples and various body fluids. As an example, we show the results of the hsa-miR-515-3p, hsa-miR-325, and hsa-miR-155 quantification using a specific UPL probe (Universal Probe Library) and a stem-loop RT-qPCR assay. The small nucleolar RNA RNU43 is used as endogenous control for normalization of the results. Urine from healthy pregnant women and FFPE samples from patients diagnosed with colorectal cancer and treated with antibody-based anti-EGFR monotherapy were used as samples.

  19. Integrative analysis of miRNA and gene expression reveals regulatory networks in tamoxifen-resistant breast cancer

    PubMed Central

    Stenvang, Jan; Alves, Carla L.; Teng, Fei; Lyng, Maria B.; Lykkesfeldt, Anne E.; Brünner, Nils; Wang, Jun; Gupta, Ramneek; Workman, Christopher T.; Ditzel, Henrik J.

    2016-01-01

    Tamoxifen is an effective anti-estrogen treatment for patients with estrogen receptor-positive (ER+) breast cancer, however, tamoxifen resistance is frequently observed. To elucidate the underlying molecular mechanisms of tamoxifen resistance, we performed a systematic analysis of miRNA-mediated gene regulation in three clinically-relevant tamoxifen-resistant breast cancer cell lines (TamRs) compared to their parental tamoxifen-sensitive cell line. Alterations in the expression of 131 miRNAs in tamoxifen-resistant vs. parental cell lines were identified, 22 of which were common to all TamRs using both sequencing and LNA-based quantitative PCR technologies. Although the target genes affected by the altered miRNA in the three TamRs differed, good agreement in terms of affected molecular pathways was observed. Moreover, we found evidence of miRNA-mediated regulation of ESR1, PGR1, FOXM1 and 14-3-3 family genes. Integrating the inferred miRNA-target relationships, we investigated the functional importance of 2 central genes, SNAI2 and FYN, which showed increased expression in TamR cells, while their corresponding regulatory miRNA were downregulated. Using specific chemical inhibitors and siRNA-mediated gene knockdown, we showed that both SNAI2 and FYN significantly affect the growth of TamR cell lines. Finally, we show that a combination of 2 miRNAs (miR-190b and miR-516a-5p) exhibiting altered expression in TamR cell lines were predictive of treatment outcome in a cohort of ER+ breast cancer patients receiving adjuvant tamoxifen mono-therapy. Our results provide new insight into the molecular mechanisms of tamoxifen resistance and may form the basis for future medical intervention for the large number of women with tamoxifen-resistant ER+ breast cancer. PMID:27528030

  20. A novel microRNA-1207-3p/FNDC1/FN1/AR regulatory pathway in prostate cancer

    PubMed Central

    Das, Dibash K.; Ogunwobi, Olorunseun O.

    2017-01-01

    Prostate cancer (PCa) is the second most common cause of cancer-specific deaths in the U.S. Unfortunately, the underlying molecular mechanisms for its development and progression remain unclear. Studies have established that microRNAs (miRNAs) are dysregulated in PCa. The intron-derived microRNA-1207-3p (miR-1207-3p) is encoded at the non-protein coding gene locus PVT1 on the 8q24 human chromosomal region, an established PCa susceptibility locus. However, miR-1207-3p in PCa had not previously been investigated. Therefore, we explored if miR-1207-3p plays any regulatory role in PCa. We discovered that miR-1207-3p is significantly underexpressed in PCa cell lines in comparison to normal prostate epithelial cells, and that increased expression of microRNA-1207-3p in PCa cells significantly inhibits proliferation, migration, and induces apoptosis via direct molecular targeting of fibronectin type III domain containing 1 (FNDC1). Our studies also revealed significant overexpression of FNDC1, fibronectin (FN1) and the androgen receptor (AR) in human PCa cell lines as well as tissues, and FNDC1, FN1, and AR positively correlate with aggressive PCa. These findings, recently published in Experimental Cell Research, are the first to describe a novel miR-1207-3p/FNDC1/FN1/AR novel regulatory pathway in PCa. PMID:28251177

  1. Analysis of microRNA and Gene Expression Profiles in Multiple Sclerosis: Integrating Interaction Data to Uncover Regulatory Mechanisms

    PubMed Central

    Freiesleben, Sherry; Hecker, Michael; Zettl, Uwe Klaus; Fuellen, Georg; Taher, Leila

    2016-01-01

    MicroRNAs (miRNAs) have been reported to contribute to the pathophysiology of multiple sclerosis (MS), an inflammatory disorder of the central nervous system. Here, we propose a new consensus-based strategy to analyse and integrate miRNA and gene expression data in MS as well as other publically available data to gain a deeper understanding of the role of miRNAs in MS and to overcome the challenges posed by studies with limited patient sample sizes. We processed and analysed microarray datasets, and compared the expression of genes and miRNAs in the blood of MS patients and controls. We then used our consensus and integration approach to construct two molecular networks dysregulated in MS: a miRNA- and a gene-based network. We identified 18 differentially expressed (DE) miRNAs and 128 DE genes that may contribute to the regulatory alterations behind MS. The miRNAs were linked to immunological and neurological pathways, and we exposed let-7b-5p and miR-345-5p as promising blood-derived disease biomarkers in MS. The results suggest that DE miRNAs are more informative than DE genes in uncovering pathways potentially involved in MS. Our findings provide novel insights into the regulatory mechanisms and networks underlying MS. PMID:27694855

  2. Engineered Nanoscale Materials and Derivative Products: Regulatory Challenges

    DTIC Science & Technology

    2008-01-22

    to microbes, and some product manufacturers have made antibacterial claims for their products containing nanosilver . In addition, research has...intent to regulate nanosilver under FIFRA when it is released from certain washing machines and other products for which manufacturers claim...nanomaterials, including nanosilver , under certain conditions. To address this challenge, EPA’s Science Policy Council, an internal policy group, formed

  3. Regulatory Role of N(6) -Methyladenosine (m(6) A) Methylation in RNA Processing and Human Diseases.

    PubMed

    Wei, Wenqiang; Ji, Xinying; Guo, Xiangqian; Ji, Shaoping

    2017-03-03

    N(6) -methyladenosine (m(6) A) modification is an abundant and conservative RNA modification in bacterial and eukaryotic cells. m(6) A modification mainly occurs in the 3' untranslated regions (UTRs) and near the stop codons of mRNA. Diverse strategies have been developed for identifying m(6) A sites in single nucleotide resolution. Dynamic regulation of m(6) A is found in metabolism, embryogenesis and developmental processes, indicating a possible epigenetic regulation role along RNA processing and exerting biological functions. It has been known that m(6) A editing involves in nuclear RNA export, mRNA degradation, protein translation and RNA splicing. Deficiency of m(6) A modification will lead to kinds of diseases, such as obesity, cancer, type 2 diabetes mellitus, infertility, developmental arrest. Some specific inhibitors against methyltransferase and demethylase have been developed to selectively regulate m(6) A modification, which may be advantageous for treatment of m(6) A related diseases. This article is protected by copyright. All rights reserved.

  4. Steroidogenic acute regulatory protein in eels: cDNA cloning and effects of ACTH and seawater transfer on its mRNA expression.

    PubMed

    Li, Yuan-You; Inoue, Koji; Takei, Yoshio

    2003-02-01

    Steroidogenic acute regulatory protein (StAR) is a key molecule for steroid production by translocating cholesterol from the outer to inner mitochondrial membrane. Two cDNAs of different length encoding StAR was cloned from the head kidney of the eel (Anguilla japonica). In the 3'-untranslated region (UTR) of the longer cDNA, two putative polyadenylation signals were found. The shorter one differed from the longer one solely by the lack of middle of 3'-UTR including the first polyadenylation signal. Reverse transcription-polymerase chain reaction (RT-PCR) that differentiates the two mRNAs showed that the ratio of the two was highly variable among individuals, and no preferential expression was detected between freshwater and seawater eels. The predicted protein consists of 285 amino acid residues with 64-83% identity to other StARs thus far obtained. RT-PCR analyses revealed that eel StAR mRNA was expressed abundantly in the head kidney and gonad, and faintly in the brain; but no expression was detected in the gill, heart, liver, intestine, kidney and skeletal muscle. Plasma cortisol concentration increased, but StAR mRNA content in the head kidney did not change, 3 and 24 h after transfer of freshwater eels to seawater, indicating that the transcriptional regulation of StAR may not be involved in cortisol production after seawater transfer. However, ACTH elevated both plasma cortisol and StAR mRNA levels in the head kidney 1.5 and 4.5 h after injection. Thus, the steroidogenic effect of ACTH is mediated by increased StAR production as observed in mammals.

  5. Health claims on food products in Southeast Asia: regulatory frameworks, barriers, and opportunities.

    PubMed

    Tan, Karin Y M; van der Beek, Eline M; Chan, M Y; Zhao, Xuejun; Stevenson, Leo

    2015-09-01

    The Association of Southeast Asian Nations aims to act as a single market and allow free movement of goods, services, and manpower. The purpose of this article is to present an overview of the current regulatory framework for health claims in Southeast Asia and to highlight the current barriers and opportunities in the regulatory frameworks in the Association of Southeast Asian Nations. To date, 5 countries in Southeast Asia, i.e., Indonesia, Malaysia, the Philippines, Singapore, and Thailand, have regulations and guidelines to permit the use of health claims on food products. There are inconsistencies in the regulations and the types of evidence required for health claim applications in these countries. A clear understanding of the regulatory frameworks in these countries may help to increase trade in this fast-growing region and to provide direction for the food industry and the regulatory community to develop and market food products with better nutritional quality tailored to the needs of Southeast Asian consumers.

  6. Tat-dependent production of an HIV-1 TAR-encoded miRNA-like small RNA

    PubMed Central

    Harwig, Alex; Jongejan, Aldo; van Kampen, Antoine H. C.; Berkhout, Ben; Das, Atze T.

    2016-01-01

    Evidence is accumulating that retroviruses can produce microRNAs (miRNAs). To prevent cleavage of their RNA genome, retroviruses have to use an alternative RNA source as miRNA precursor. The transacting responsive (TAR) hairpin structure in HIV-1 RNA has been suggested as source for miRNAs, but how these small RNAs are produced without impeding virus replication remained unclear. We used deep sequencing analysis of AGO2-bound HIV-1 RNAs to demonstrate that the 3′ side of the TAR hairpin is processed into a miRNA-like small RNA. This ∼21 nt RNA product is able to repress the expression of mRNAs bearing a complementary target sequence. Analysis of the small RNAs produced by wild-type and mutant HIV-1 variants revealed that non-processive transcription from the HIV-1 LTR promoter results in the production of short TAR RNAs that serve as precursor. These TAR RNAs are cleaved by Dicer and processing is stimulated by the viral Tat protein. This biogenesis pathway differs from the canonical miRNA pathway and allows HIV-1 to produce the TAR-encoded miRNA-like molecule without cleavage of the RNA genome. PMID:26984525

  7. An Update of the Brazilian Regulatory Bioequivalence Recommendations for Approval of Generic Topical Dermatological Drug Products.

    PubMed

    Soares, Kelen Carine Costa; Santos, Gustavo Mendes Lima; Gelfuso, Guilherme M; Gratieri, Tais

    2015-11-01

    This note aims to clarify the Brazilian regulatory bioequivalence recommendations for approval of generic topical dermatological drug products, since the legal framework of the "Brazilian Health Surveillance Agency" (ANVISA) is only available in Portuguese. According to Resolutions RE n. 1170 (December 19th 2006) and RDC n. 37 (August 3rd 2011) in Brazil, only in vitro studies are required for registration of generic topical dermatological drug products. Current Regulatory Agenda of ANVISA, which contains possible future resolutions to be revised over 2015-2016, includes a discussion on biowaiver requirements and on possible in vitro and in vivo comparability tests for these products.

  8. MicroRNA Regulatory Mechanisms on Citrus sinensis leaves to Magnesium-Deficiency

    PubMed Central

    Ma, Cui-Lan; Qi, Yi-Ping; Liang, Wei-Wei; Yang, Lin-Tong; Lu, Yi-Bin; Guo, Peng; Ye, Xin; Chen, Li-Song

    2016-01-01

    Magnesium (Mg)-deficiency, which affects crop productivity and quality, widespreadly exists in many agricultural crops, including citrus. However, very limited data are available on Mg-deficiency-responsive microRNAs (miRNAs) in higher plants. Using Illumina sequencing, we isolated 75 (73 known and 2 novel) up- and 71 (64 known and 7 novel) down-regulated miRNAs from Mg-deficient Citrus sinensis leaves. In addition to the remarkable metabolic flexibility as indicated by the great alteration of miRNA expression, the adaptive responses of leaf miRNAs to Mg-deficiency might also involve the following several aspects: (a) up-regulating stress-related genes by down-regulating miR164, miR7812, miR5742, miR3946, and miR5158; (b) enhancing cell transport due to decreased expression of miR3946 and miR5158 and increased expression of miR395, miR1077, miR1160, and miR8019; (c) activating lipid metabolism-related genes by repressing miR158, miR5256, and miR3946; (d) inducing cell wall-related gene expansin 8A by repressing miR779; and (e) down-regulating the expression of genes involved in the maintenance of S, K and Cu by up-regulating miR395 and miR6426. To conclude, we isolated some new known miRNAs (i.e., miR7812, miR8019, miR6218, miR1533, miR6426, miR5256, miR5742, miR5561, miR5158, and miR5818) responsive to nutrient deficiencies and found some candidate miRNAs that might contribute to Mg-deficiency tolerance. Therefore, our results not only provide novel information about the responses of plant to Mg-deficiency, but also are useful for obtaining the key miRNAs for plant Mg-deficiency tolerance. PMID:26973661

  9. Just-in-Space: Certified Rural Products, Labor of Quality, and Regulatory Spaces

    ERIC Educational Resources Information Center

    Mutersbaugh, Tad

    2005-01-01

    Since the mid-1990s, the number and diversity of "quality-certified" products has increased dramatically. This article examines labor practices and regulatory spaces within 3rd party quality certification and suggests that this distinct configuration be termed "just-in-space" production. A privileging of space derives, on the one hand, from the…

  10. Global regulatory framework for production and marketing of crops biofortified with vitamins and minerals.

    PubMed

    Mejia, Luis A; Dary, Omar; Boukerdenna, Hala

    2017-02-01

    Biofortification of crops is being introduced in several countries as a strategy to reduce micronutrient deficiencies. Biofortified products, with increased contents of micronutrients, are currently produced by conventional plant breeding, genetic modification, or nutrient-enhanced fertilization. Corn, rice, wheat, beans, pearl millet, sweet potato, and cassava have been biofortified with increased contents of provitamin A carotenoids, iron, or zinc. However, regulatory considerations are rare or nonexistent. The objective of this paper is to review the regulatory framework for production and marketing of biofortified crops in countries that have adopted this strategy. The information was identified using Internet search engines and websites of health and nutrition organizations and nongovernmental organizations and by consulting scientists and government authorities. Thus far, biofortified products introduced in Latin America, Africa, and Asia have been produced only by conventional breeding. Cultivars using other techniques are still under testing. The production and marketing of these products have been conducted without regulatory framework and under limited government control or regulatory guidance. Nevertheless, some countries have integrated biofortified crops into their nutrition agendas. Although improvements by conventional breeding have not been subject to regulations, when biofortification becomes expanded by including other techniques, an appropriate regulatory framework will be necessary.

  11. Crystallization and preliminary X-ray diffraction analysis of iron regulatory protein 1 in complex with ferritin IRE RNA

    SciTech Connect

    Selezneva, Anna I.; Cavigiolio, Giorgio; Theil, Elizabeth C.; Walden, William E.; Volz, Karl

    2010-12-03

    Iron regulatory protein 1 (IRP1) is a bifunctional protein with activity as an RNA-binding protein or as a cytoplasmic aconitase. Interconversion of IRP1 between these mutually exclusive states is central to cellular iron regulation and is accomplished through iron-responsive assembly and disassembly of a [4Fe-4S] cluster. When in its apo form, IRP1 binds to iron responsive elements (IREs) found in mRNAs encoding proteins of iron storage and transport and either prevents translation or degradation of the bound mRNA. Excess cellular iron stimulates the assembly of a [4Fe-4S] cluster in IRP1, inhibiting its IRE-binding ability and converting it to an aconitase. The three-dimensional structure of IRP1 in its different active forms will provide details of the interconversion process and clarify the selective recognition of mRNA, Fe-S sites and catalytic activity. To this end, the apo form of IRP1 bound to a ferritin IRE was crystallized. Crystals belong to the monoclinic space group P21, with unit-cell parameters a = 109.6, b = 80.9, c = 142.9 {angstrom}, = 92.0{sup o}. Native data sets have been collected from several crystals with resolution extending to 2.8 {angstrom} and the structure has been solved by molecular replacement.

  12. Regulatory considerations for raw materials used in biological products.

    PubMed

    Khan, A S

    2010-01-01

    Raw materials are critical components of product manufacture; these include source materials such as cell substrates, tissues, and biological fluids required for product manufacture, as well as biological materials required for cell growth, propagation, differentiation, and selection. Adventitious viruses are a major safety concern in biological raw materials. This paper discusses the specific concerns related to different types of biological materials and presents the Center for Biologics Evaluation and Research's perspective on the qualification and management of raw materials for purposes of developing a safety program for the manufacture of biological products.

  13. Regulatory Interactions of Csr Components: the RNA Binding Protein CsrA Activates csrB Transcription in Escherichia coli

    PubMed Central

    Gudapaty, Seshagirirao; Suzuki, Kazushi; Wang, Xin; Babitzke, Paul; Romeo, Tony

    2001-01-01

    The global regulator CsrA (carbon storage regulator) of Escherichia coli is a small RNA binding protein that represses various metabolic pathways and processes that are induced in the stationary phase of growth, while it activates certain exponential phase functions. Both repression and activation by CsrA involve posttranscriptional mechanisms, in which CsrA binding to mRNA leads to decreased or increased transcript stability, respectively. CsrA also binds to a small untranslated RNA, CsrB, forming a ribonucleoprotein complex, which antagonizes CsrA activity. We have further examined the regulatory interactions of CsrA and CsrB RNA. The 5′ end of the CsrB transcript was mapped, and a csrB::cam null mutant was constructed. CsrA protein and CsrB RNA levels were estimated throughout the growth curves of wild-type and isogenic csrA, csrB, rpoS, or csrA rpoS mutant strains. CsrA levels exhibited modest or negligible effects of these mutations. The intracellular concentration of CsrA exceeded the total CsrA-binding capacity of intracellular CsrB RNA. In contrast, CsrB levels were drastically decreased (∼10-fold) in the csrA mutants. CsrB transcript stability was unaffected by csrA. The expression of a csrB-lacZ transcriptional fusion containing the region from −242 to +4 bp of the csrB gene was decreased ∼20-fold by a csrA::kanR mutation in vivo but was unaffected by CsrA protein in vitro. These results reveal a significant, though most likely indirect, role for CsrA in regulating csrB transcription. Furthermore, our findings suggest that CsrA mediates an intriguing form of autoregulation, whereby its activity, but not its levels, is modulated through effects on an RNA antagonist, CsrB. PMID:11567002

  14. Better understanding of the EU regulatory frameworks for cosmetic products.

    PubMed

    Rasmussen, Kirsten; Mech, Agnieszka

    2014-05-01

    This letter to the editor corrects some misunderstandings regarding the EU regulations covering cosmetic products stated in a recent publication by A. Sobek et al. "In the shadow of the cosmetics directive - Inconsistencies in EU environmental hazard classification requirements for UV-filters" published in Science of the Total Environment 461-462 (2013) 706-711.

  15. Purification of radiolabeled RNA products using denaturing gel electrophoresis

    PubMed Central

    Adachi, Hironori; Yu, Yi-Tao

    2014-01-01

    This unit discusses a basic method for purification of radiolabeled RNAs using denaturing polyacrylamide gel electrophoresis. The method consists of a number of experimental procedures, including total RNA preparation from yeast cells, isolation of a specific RNA from total yeast RNA, RNA 3' terminal labeling using nucleotide (5’[32P]pCp) addition (via ligation), denaturing (8 M urea) polyacrylamide gel electrophoresis, and RNA extraction from the gel slice. Key points for achieving good electrophoretic separation of RNA are also discussed. PMID:24510465

  16. Meta-Analysis of Multiple Sclerosis Microarray Data Reveals Dysregulation in RNA Splicing Regulatory Genes.

    PubMed

    Paraboschi, Elvezia Maria; Cardamone, Giulia; Rimoldi, Valeria; Gemmati, Donato; Spreafico, Marta; Duga, Stefano; Soldà, Giulia; Asselta, Rosanna

    2015-09-30

    Abnormalities in RNA metabolism and alternative splicing (AS) are emerging as important players in complex disease phenotypes. In particular, accumulating evidence suggests the existence of pathogenic links between multiple sclerosis (MS) and altered AS, including functional studies showing that an imbalance in alternatively-spliced isoforms may contribute to disease etiology. Here, we tested whether the altered expression of AS-related genes represents a MS-specific signature. A comprehensive comparative analysis of gene expression profiles of publicly-available microarray datasets (190 MS cases, 182 controls), followed by gene-ontology enrichment analysis, highlighted a significant enrichment for differentially-expressed genes involved in RNA metabolism/AS. In detail, a total of 17 genes were found to be differentially expressed in MS in multiple datasets, with CELF1 being dysregulated in five out of seven studies. We confirmed CELF1 downregulation in MS (p=0.0015) by real-time RT-PCRs on RNA extracted from blood cells of 30 cases and 30 controls. As a proof of concept, we experimentally verified the unbalance in alternatively-spliced isoforms in MS of the NFAT5 gene, a putative CELF1 target. In conclusion, for the first time we provide evidence of a consistent dysregulation of splicing-related genes in MS and we discuss its possible implications in modulating specific AS events in MS susceptibility genes.

  17. Effect of inulin on efficient production and regulatory biosynthesis of bacillomycin D in Bacillus subtilis fmbJ.

    PubMed

    Qian, Shiquan; Lu, Hedong; Meng, Panpan; Zhang, Chong; Lv, Fengxia; Bie, Xiaomei; Lu, Zhaoxin

    2015-03-01

    The effect of inulin on the production of bacillomycin D and the levels of mRNA of bacillomycin D synthetase genes: bmyA (BYA), bmyB (BYB), bmyC (BYC), the thioesterase gene (TE) and regulating genes: AbrB, ComA, DegU, PhrC, SigmaH and Spo0A in Bacillus subtilis fmbJ were investigated. The production of bacillomycin D was enhanced with the increase of biomass concentration. The maximum production and productivity of bacillomycin D were found to be 1227.49 mg/L and 10.23 mg/L h. Inulin significantly improved the expression of bacillomycin D synthetase genes: bmyA (BYA), bmyB (BYB), bmyC (BYC) and the thioesterase gene (TE). Also, inulin up-regulated ComA, DegU, SigmaH and Spo0A and therefore promoted the high production of bacillomycin D. Our results provided a practical approach for efficient production of bacillomycin D and a meaningful explanation for regulatory mechanism of bacillomycin D biosynthesis.

  18. RNA sequencing of laser-capture microdissected compartments of the maize kernel identifies regulatory modules associated with endosperm cell differentiation.

    PubMed

    Zhan, Junpeng; Thakare, Dhiraj; Ma, Chuang; Lloyd, Alan; Nixon, Neesha M; Arakaki, Angela M; Burnett, William J; Logan, Kyle O; Wang, Dongfang; Wang, Xiangfeng; Drews, Gary N; Yadegari, Ramin

    2015-03-01

    Endosperm is an absorptive structure that supports embryo development or seedling germination in angiosperms. The endosperm of cereals is a main source of food, feed, and industrial raw materials worldwide. However, the genetic networks that regulate endosperm cell differentiation remain largely unclear. As a first step toward characterizing these networks, we profiled the mRNAs in five major cell types of the differentiating endosperm and in the embryo and four maternal compartments of the maize (Zea mays) kernel. Comparisons of these mRNA populations revealed the diverged gene expression programs between filial and maternal compartments and an unexpected close correlation between embryo and the aleurone layer of endosperm. Gene coexpression network analysis identified coexpression modules associated with single or multiple kernel compartments including modules for the endosperm cell types, some of which showed enrichment of previously identified temporally activated and/or imprinted genes. Detailed analyses of a coexpression module highly correlated with the basal endosperm transfer layer (BETL) identified a regulatory module activated by MRP-1, a regulator of BETL differentiation and function. These results provide a high-resolution atlas of gene activity in the compartments of the maize kernel and help to uncover the regulatory modules associated with the differentiation of the major endosperm cell types.

  19. Computational Identification of Tissue-Specific Splicing Regulatory Elements in Human Genes from RNA-Seq Data

    PubMed Central

    Badr, Eman; ElHefnawi, Mahmoud; Heath, Lenwood S.

    2016-01-01

    Alternative splicing is a vital process for regulating gene expression and promoting proteomic diversity. It plays a key role in tissue-specific expressed genes. This specificity is mainly regulated by splicing factors that bind to specific sequences called splicing regulatory elements (SREs). Here, we report a genome-wide analysis to study alternative splicing on multiple tissues, including brain, heart, liver, and muscle. We propose a pipeline to identify differential exons across tissues and hence tissue-specific SREs. In our pipeline, we utilize the DEXSeq package along with our previously reported algorithms. Utilizing the publicly available RNA-Seq data set from the Human BodyMap project, we identified 28,100 differentially used exons across the four tissues. We identified tissue-specific exonic splicing enhancers that overlap with various previously published experimental and computational databases. A complicated exonic enhancer regulatory network was revealed, where multiple exonic enhancers were found across multiple tissues while some were found only in specific tissues. Putative combinatorial exonic enhancers and silencers were discovered as well, which may be responsible for exon inclusion or exclusion across tissues. Some of the exonic enhancers are found to be co-occurring with multiple exonic silencers and vice versa, which demonstrates a complicated relationship between tissue-specific exonic enhancers and silencers. PMID:27861625

  20. Gasoline toxicology: overview of regulatory and product stewardship programs.

    PubMed

    Swick, Derek; Jaques, Andrew; Walker, J C; Estreicher, Herb

    2014-11-01

    Significant efforts have been made to characterize the toxicological properties of gasoline. There have been both mandatory and voluntary toxicology testing programs to generate hazard characterization data for gasoline, the refinery process streams used to blend gasoline, and individual chemical constituents found in gasoline. The Clean Air Act (CAA) (Clean Air Act, 2012: § 7401, et seq.) is the primary tool for the U.S. Environmental Protection Agency (EPA) to regulate gasoline and this supplement presents the results of the Section 211(b) Alternative Tier 2 studies required for CAA Fuel and Fuel Additive registration. Gasoline blending streams have also been evaluated by EPA under the voluntary High Production Volume (HPV) Challenge Program through which the petroleum industry provide data on over 80 refinery streams used in gasoline. Product stewardship efforts by companies and associations such as the American Petroleum Institute (API), Conservation of Clean Air and Water Europe (CONCAWE), and the Petroleum Product Stewardship Council (PPSC) have contributed a significant amount of hazard characterization data on gasoline and related substances. The hazard of gasoline and anticipated exposure to gasoline vapor has been well characterized for risk assessment purposes.

  1. Raw materials in the manufacture of biotechnology products: regulatory considerations.

    PubMed

    Cordoba-Rodriguez, Ruth

    2010-01-01

    The Food and Drug Administration's Pharmaceutical cGMPs for the 21st Century initiative emphasizes science and risk-based approaches in the manufacture of drugs. These approaches are reflected in the International Conference on Harmonization (ICH) guidances ICH Q8, Q9, and Q10 and encourage a comprehensive assessment of the manufacture of a biologic, including all aspects of manufacture that have the potential to affect the finished drug product. Appropriate assessment and management of raw materials are an important part of this initiative. Ideally, a raw materials program should strive to assess and minimize the risk to product quality. With this in mind, risk-assessment concepts and control strategies will be discussed and illustrated by examples, with an emphasis on the impact of raw materials on cell substrates. Finally, the life cycle of the raw material will be considered, including its potential to affect the drug product life cycle. In this framework, the supply chain and the vendor-manufacturer relationship will be explored as important parts of an adequate raw materials control strategy.

  2. Interrogation of brain miRNA and mRNA expression profiles reveals a molecular regulatory network that is perturbed by mutant huntingtin

    PubMed Central

    Jin, Jing; Cheng, Yong; Zhang, Yongqing; Wood, William; Peng, Qi; Hutchison, Emmette; Mattson, Mark P.; Becker, Kevin G.; Duan, Wenzhen

    2012-01-01

    Emerging evidence indicates that microRNAs (miRNAs) may play an important role in the pathogenesis of Huntington’s disease (HD). To identify the individual miRNAs that are altered in HD and may therefore regulate a gene network underlying mutant huntingtin-induced neuronal dysfunction in HD, we performed miRNA array analysis combined with mRNA profiling in the cerebral cortex from N171-82Q HD mice. Expression profiles of miRNAs as well as mRNAs in HD mouse cerebral cortex were analyzed and confirmed at different stages of disease progression; the most significant changes of miRNAs in the cerebral cortex were also detected in the striatum of HD mice. Our results revealed a significant alteration of miR-200 family members, miR-200a and miR-200c in the cerebral cortex and the striatum, at the early stage of disease progression in N171-82Q HD mice. We used a coordinated approach to integrate miRNA and mRNA profiling, and applied bioinformatics to predict a target gene network potentially regulated by these significantly altered miRNAs that might be involved in HD disease progression. Interestingly, miR-200a and miR-200c are predicted to target genes regulating synaptic function, neurodevelopment and neuronal survival. Our results suggest that altered expression of miR-200a and miR-200c may interrupt the production of proteins involved in neuronal plasticity and survival, and further investigation of the involvement of perturbed miRNA expression in HD pathogenesis is warranted, and may lead to reveal novel approaches for HD therapy. PMID:22906125

  3. Interrogation of brain miRNA and mRNA expression profiles reveals a molecular regulatory network that is perturbed by mutant huntingtin.

    PubMed

    Jin, Jing; Cheng, Yong; Zhang, Yongqing; Wood, William; Peng, Qi; Hutchison, Emmette; Mattson, Mark P; Becker, Kevin G; Duan, Wenzhen

    2012-11-01

    Emerging evidence indicates that microRNAs (miRNAs) may play an important role in the pathogenesis of Huntington's disease (HD). To identify the individual miRNAs that are altered in HD and may therefore regulate a gene network underlying mutant huntingtin-induced neuronal dysfunction in HD, we performed miRNA array analysis combined with mRNA profiling in the cerebral cortex from N171-82Q HD mice. Expression profiles of miRNAs as well as mRNAs in HD mouse cerebral cortex were analyzed and confirmed at different stages of disease progression; the most significant changes of miRNAs in the cerebral cortex were also detected in the striatum of HD mice. Our results revealed a significant alteration of miR-200 family members, miR-200a, and miR-200c in the cerebral cortex and the striatum, at the early stage of disease progression in N171-82Q HD mice. We used a coordinated approach to integrate miRNA and mRNA profiling, and applied bioinformatics to predict a target gene network potentially regulated by these significantly altered miRNAs that might be involved in HD disease progression. Interestingly, miR-200a and miR-200c are predicted to target genes regulating synaptic function, neurodevelopment, and neuronal survival. Our results suggest that altered expression of miR-200a and miR-200c may interrupt the production of proteins involved in neuronal plasticity and survival, and further investigation of the involvement of perturbed miRNA expression in HD pathogenesis is warranted, and may lead to reveal novel approaches for HD therapy.

  4. [Regulatory requirements regarding cell-based medicinal products for human and veterinary use - a comparison].

    PubMed

    Kuhlmann-Gottke, Johanna; Duchow, Karin

    2015-11-01

    At present, there is no separate regulatory framework for cell-based medicinal products (CBMP) for veterinary use at the European or German level. Current European and national regulations exclusively apply to the corresponding medicinal products for human use. An increasing number of requests for the regulatory classification of CBMP for veterinary use, such as allogeneic stem cell preparations and dendritic cell-based autologous tumour vaccines, and a rise in scientific advice for companies developing these products, illustrate the need for adequate legislation. Currently, advice is given and decisions are made on a case-by-case basis regarding the regulatory classification and authorisation requirements.Since some of the CBMP - in particular in the area of stem-cell products - are developed in parallel for human and veterinary use, there is an urgent need to create specific legal definitions, regulations, and guidelines for these complex innovative products in the veterinary sector as well. Otherwise, there is a risk that that the current legal grey area regarding veterinary medicinal products will impede therapeutic innovations in the long run. A harmonised EU-wide approach is desirable. Currently the European legislation on veterinary medicinal products is under revision. In this context, veterinary therapeutics based on allogeneic cells and tissues will be defined and regulated. Certainly, the legal framework does not have to be as comprehensive as for human CBMP; a leaner solution is conceivable, similar to the special provisions for advanced-therapy medicinal products laid down in the German Medicines Act.

  5. MicroRNA Gene Regulatory Networks in Peripheral Nerve Sheath Tumors

    DTIC Science & Technology

    2012-09-01

    10.1093/nar/gki567 30. Lee RC, Feinbaum RL, Ambros V (1993) The C . elegans het- erochronic gene lin-4 encodes small RNAs with antisense complementarity...targeting with both miR29a/b1 and miR29b2/ c knock-out vectors, we linearized both gene targeting vectors and transfected them into C57BL/6J ES cells...as a tumor with activating mutations in the c -kit gene or PDGFRA gene . We have profiled miRNA expression of GIST samples and observed that miR-221

  6. Search for 5'-leader regulatory RNA structures based on gene annotation aided by the RiboGap database.

    PubMed

    Naghdi, Mohammad Reza; Smail, Katia; Wang, Joy X; Wade, Fallou; Breaker, Ronald R; Perreault, Jonathan

    2017-03-15

    The discovery of noncoding RNAs (ncRNAs) and their importance for gene regulation led us to develop bioinformatics tools to pursue the discovery of novel ncRNAs. Finding ncRNAs de novo is challenging, first due to the difficulty of retrieving large numbers of sequences for given gene activities, and second due to exponential demands on calculation needed for comparative genomics on a large scale. Recently, several tools for the prediction of conserved RNA secondary structure were developed, but many of them are not designed to uncover new ncRNAs, or are too slow for conducting analyses on a large scale. Here we present various approaches using the database RiboGap as a primary tool for finding known ncRNAs and for uncovering simple sequence motifs with regulatory roles. This database also can be used to easily extract intergenic sequences of eubacteria and archaea to find conserved RNA structures upstream of given genes. We also show how to extend analysis further to choose the best candidate ncRNAs for experimental validation.

  7. The function of the RNA-binding protein TEL1 in moss reveals ancient regulatory mechanisms of shoot development.

    PubMed

    Vivancos, Julien; Spinner, Lara; Mazubert, Christelle; Charlot, Florence; Paquet, Nicolas; Thareau, Vincent; Dron, Michel; Nogué, Fabien; Charon, Céline

    2012-03-01

    The shoot represents the basic body plan in land plants. It consists of a repeated structure composed of stems and leaves. Whereas vascular plants generate a shoot in their diploid phase, non-vascular plants such as mosses form a shoot (called the gametophore) in their haploid generation. The evolution of regulatory mechanisms or genetic networks used in the development of these two kinds of shoots is unclear. TERMINAL EAR1-like genes have been involved in diploid shoot development in vascular plants. Here, we show that disruption of PpTEL1 from the moss Physcomitrella patens, causes reduced protonema growth and gametophore initiation, as well as defects in gametophore development. Leafy shoots formed on ΔTEL1 mutants exhibit shorter stems with more leaves per shoot, suggesting an accelerated leaf initiation (shortened plastochron), a phenotype shared with the Poaceae vascular plants TE1 and PLA2/LHD2 mutants. Moreover, the positive correlation between plastochron length and leaf size observed in ΔTEL1 mutants suggests a conserved compensatory mechanism correlating leaf growth and leaf initiation rate that would minimize overall changes in plant biomass. The RNA-binding protein encoded by PpTEL1 contains two N-terminus RNA-recognition motifs, and a third C-terminus non-canonical RRM, specific to TEL proteins. Removal of the PpTEL1 C-terminus (including this third RRM) or only 16-18 amino acids within it seriously impairs PpTEL1 function, suggesting a critical role for this third RRM. These results show a conserved function of the RNA-binding PpTEL1 protein in the regulation of shoot development, from early ancestors to vascular plants, that depends on the third TEL-specific RRM.

  8. Enhancement of alkaloid production in opium and California poppy by transactivation using heterologous regulatory factors.

    PubMed

    Apuya, Nestor R; Park, Joon-Hyun; Zhang, Liping; Ahyow, Maurice; Davidow, Patricia; Van Fleet, Jennifer; Rarang, Joel C; Hippley, Matthew; Johnson, Thomas W; Yoo, Hye-Dong; Trieu, Anthony; Krueger, Shannon; Wu, Chuan-yin; Lu, Yu-ping; Flavell, Richard B; Bobzin, Steven C

    2008-02-01

    Genes encoding regulatory factors isolated from Arabidopsis, soybean and corn have been screened to identify those that modulate the expression of genes encoding for enzymes involved in the biosynthesis of morphinan alkaloids in opium poppy (Papaver somniferum) and benzophenanthridine alkaloids in California poppy (Eschscholzia californica). In opium poppy, the over-expression of selected regulatory factors increased the levels of PsCOR (codeinone reductase), Ps4'OMT (S-adenosyl-l-methionine:3'-hydroxy-N-methylcoclaurine 4'-O-methyltransferase) and Ps6OMT [(R,S)-norcoclaurine 6-O-methyltransferase] transcripts by 10- to more than 100-fold. These transcriptional activations translated into an enhancement of alkaloid production in opium poppy of up to at least 10-fold. In California poppy, the transactivation effect of regulatory factor WRKY1 resulted in an increase of up to 60-fold in the level of EcCYP80B1 [(S)-N-methylcoclaurine 3'-hydroxylase] and EcBBE (berberine bridge enzyme) transcripts. As a result, the accumulations of selected alkaloid intermediates were enhanced up to 30-fold. The transactivation effects of other regulatory factors led to the accumulation of the same intermediates. These regulatory factors also led to the production of new alkaloids in California poppy callus culture.

  9. Organic Coasts? Regulatory Challenges of Certifying Integrated Shrimp-Mangrove Production Systems in Vietnam

    ERIC Educational Resources Information Center

    Ha, Tran Thi Thu; Bush, Simon R.; Mol, Arthur P. J.; van Dijk, Han

    2012-01-01

    The Vietnamese government aims to expand the scale of Naturland certified organic production in integrated shrimp-mangrove farming systems across the coast of Ca Mau province by 2015. In doing so the division between public and private regulation has become blurred. We analyze the government's goal by examining the regulatory challenges of using…

  10. RNA.

    ERIC Educational Resources Information Center

    Darnell, James E., Jr.

    1985-01-01

    Ribonucleic acid (RNA) converts genetic information into protein and usually must be processed to serve its function. RNA types, chemical structure, protein synthesis, translation, manufacture, and processing are discussed. Concludes that the first genes might have been spliced RNA and that humans might be closer than bacteria to primitive…

  11. A Conserved MicroRNA Regulatory Circuit Is Differentially Controlled during Limb/Appendage Regeneration

    PubMed Central

    King, Benjamin L.; Yin, Viravuth P.

    2016-01-01

    Background Although regenerative capacity is evident throughout the animal kingdom, it is not equally distributed throughout evolution. For instance, complex limb/appendage regeneration is muted in mammals but enhanced in amphibians and teleosts. The defining characteristic of limb/appendage regenerative systems is the formation of a dedifferentiated tissue, termed blastema, which serves as the progenitor reservoir for regenerating tissues. In order to identify a genetic signature that accompanies blastema formation, we employ next-generation sequencing to identify shared, differentially regulated mRNAs and noncoding RNAs in three different, highly regenerative animal systems: zebrafish caudal fins, bichir pectoral fins and axolotl forelimbs. Results These studies identified a core group of 5 microRNAs (miRNAs) that were commonly upregulated and 5 miRNAs that were commonly downregulated, as well as 4 novel tRNAs fragments with sequences conserved with humans. To understand the potential function of these miRNAs, we built a network of 1,550 commonly differentially expressed mRNAs that had functional relationships to 11 orthologous blastema-associated genes. As miR-21 was the most highly upregulated and most highly expressed miRNA in all three models, we validated the expression of known target genes, including the tumor suppressor, pdcd4, and TGFβ receptor subunit, tgfbr2 and novel putative target genes such as the anti-apoptotic factor, bcl2l13, Choline kinase alpha, chka and the regulator of G-protein signaling, rgs5. Conclusions Our extensive analysis of RNA-seq transcriptome profiling studies in three regenerative animal models, that diverged in evolution ~420 million years ago, reveals a common miRNA-regulated genetic network of blastema genes. These comparative studies extend our current understanding of limb/appendage regeneration by identifying previously unassociated blastema genes and the extensive regulation by miRNAs, which could serve as a foundation

  12. Identification of bolting-related microRNAs and their targets reveals complex miRNA-mediated flowering-time regulatory networks in radish (Raphanus sativus L.).

    PubMed

    Nie, Shanshan; Xu, Liang; Wang, Yan; Huang, Danqiong; Muleke, Everlyne M; Sun, Xiaochuan; Wang, Ronghua; Xie, Yang; Gong, Yiqin; Liu, Liwang

    2015-09-15

    MicroRNAs (miRNAs) play vital regulatory roles in plant growth and development. The phase transition from vegetative growth to flowering is crucial in the life cycle of plants. To date, miRNA-mediated flowering regulatory networks remain largely unexplored in radish. In this study, two small RNA libraries from radish leaves at vegetative and reproductive stages were constructed and sequenced by Solexa sequencing. A total of 94 known miRNAs representing 21 conserved and 13 non-conserved miRNA families, and 44 potential novel miRNAs, were identified from the two libraries. In addition, 42 known and 17 novel miRNAs were significantly differentially expressed and identified as bolting-related miRNAs. RT-qPCR analysis revealed that some miRNAs exhibited tissue- or developmental stage-specific expression patterns. Moreover, 154 target transcripts were identified for 50 bolting-related miRNAs, which were predominately involved in plant development, signal transduction and transcriptional regulation. Based on the characterization of bolting-related miRNAs and their target genes, a putative schematic model of miRNA-mediated bolting and flowering regulatory network was proposed. These results could provide insights into bolting and flowering regulatory networks in radish, and facilitate dissecting the molecular mechanisms underlying bolting and flowering time regulation in vegetable crops.

  13. A conserved RNA structural element within the hepatitis B virus post-transcriptional regulatory element enhance nuclear export of intronless transcripts and repress the splicing mechanism.

    PubMed

    Visootsat, Akasit; Payungporn, Sunchai; T-Thienprasert, Nattanan P

    2015-12-01

    Hepatitis B virus (HBV) infection is a primary cause of hepatocellular carcinoma and liver cirrhosis worldwide. To develop novel antiviral drugs, a better understanding of HBV gene expression regulation is vital. One important aspect is to understand how HBV hijacks the cellular machinery to export unspliced RNA from the nucleus. The HBV post-transcriptional regulatory element (HBV PRE) has been proposed to be the HBV RNA nuclear export element. However, the function remains controversial, and the core element is unclear. This study, therefore, aimed to identify functional regulatory elements within the HBV PRE and investigate their functions. Using bioinformatics programs based on sequence conservation and conserved RNA secondary structures, three regulatory elements were predicted, namely PRE 1151-1410, PRE 1520-1620 and PRE 1650-1684. PRE 1151-1410 significantly increased intronless and unspliced luciferase activity in both HepG2 and COS-7 cells. Likewise, PRE 1151-1410 significantly elevated intronless and unspliced HBV surface transcripts in liver cancer cells. Moreover, motif analysis predicted that PRE 1151-1410 contains several regulatory motifs. This study reported the roles of PRE 1151-1410 in intronless transcript nuclear export and the splicing mechanism. Additionally, these results provide knowledge in the field of HBV RNA regulation. Moreover, PRE 1151-1410 may be used to enhance the expression of other mRNAs in intronless reporter plasmids.

  14. A strategy for regulatory action when new adverse effects of a licensed product emerge.

    PubMed

    Aronson, Jeffrey K; Price, Deirdre; Ferner, Robin E

    2009-01-01

    Regulatory agencies grant product licences (marketing authorizations) for medicinal products in the light of evidence that the balance between benefit and harm in the population is favourable. Here we consider a framework for allowing regulatory agencies to make rational decisions when reviewing product licences in the light of new information about harms that change that balance. The regulator can revoke the product licence, restrict the product's availability or change the 'label' in different ways. We examine the features of the adverse effect that may be relevant in making the decision: namely, individual differences in susceptibility; the possibility of monitoring; and the availability of protective strategies. The balance of benefit and harm, and the time-course and dose relation of the adverse effect play important roles in the decision-making process. We set out how these factors can help determine the logical response to new information on the balance between benefit and harm, and provide a series of relevant examples. We believe that when regulatory agencies have to decide how to amend the product licence of a drug when new serious adverse effects cause concern, they would find it useful to adopt a framework of this kind, using different strategies for different cases. Our proposed framework could also be useful in risk management planning during drug development.

  15. Plasmids in the driving seat: The regulatory RNA Rcd gives plasmid ColE1 control over division and growth of its E. coli host.

    PubMed

    Gaimster, Hannah; Summers, David

    2015-03-01

    Regulation by non-coding RNAs was found to be widespread among plasmids and other mobile elements of bacteria well before its ubiquity in the eukaryotic world was suspected. As an increasing number of examples was characterised, a common mechanism began to emerge. Non-coding RNAs, such as CopA and Sok from plasmid R1, or RNAI from ColE1, exerted regulation by refolding the secondary structures of their target RNAs or modifying their translation. One regulatory RNA that seemed to swim against the tide was Rcd, encoded within the multimer resolution site of ColE1. Required for high fidelity maintenance of the plasmid in recombination-proficient hosts, Rcd was found to have a protein target, elevating indole production by stimulating tryptophanase. Rcd production is up-regulated in dimer-containing cells and the consequent increase in indole is part of the response to the rapid accumulation of dimers by over-replication (known as the dimer catastrophe). It is proposed that indole simultaneously inhibits cell division and plasmid replication, stopping the catastrophe and allowing time for the resolution of dimers to monomers. The idea of a plasmid-mediated cell division checkpoint, proposed but then discarded in the 1980s, appears to be enjoying a revival.

  16. Strategies of bringing drug product marketing applications to meet current regulatory standards.

    PubMed

    Wu, Yan; Freed, Anita; Lavrich, David; Raghavachari, Ramesh; Huynh-Ba, Kim; Shah, Ketan; Alasandro, Mark

    2015-08-01

    In the past decade, many guidance documents have been issued through collaboration of global organizations and regulatory authorities. Most of these are applicable to new products, but there is a risk that currently marketed products will not meet the new compliance standards during audits and inspections while companies continue to make changes through the product life cycle for continuous improvement or market demands. This discussion presents different strategies to bringing drug product marketing applications to meet current and emerging standards. It also discusses stability and method designs to meet process validation and global development efforts.

  17. Transcriptional profiling and miRNA-dependent regulatory network analysis of longissimus dorsi muscle during prenatal and adult stages in two distinct pig breeds.

    PubMed

    Siengdee, P; Trakooljul, N; Murani, E; Schwerin, M; Wimmers, K; Ponsuksili, S

    2013-08-01

    MicroRNAs (miRNAs) and mRNAs establish a complex regulatory network influencing diverse biological pathways including muscle development and growth. Elucidating miRNA-dependent regulatory networks involved in muscle development could provide additional insights into muscle traits largely predefined during prenatal development. The present study aimed to determine differentially expressed transcripts and functional miRNA-mRNA relationships associated with different stages of skeletal muscle development in two pig breeds, German Landrace and Pietrain, distinct in muscle characteristics. A comparative transcriptional profiling of longissimus dorsi muscle tissues from fetuses at 35, 63 and 91 days post-conception as well as adult pigs (180 days postnatum) was performed using the Affymetrix GeneChip porcine genome microarray. Differential expression patterns were identified to be associated with muscularly developmental stages and breed types. The integration of miRNA expression data and ingenuity pathways analysis (ipa) pathway analysis revealed several miRNA-dependent regulatory networks related to muscle growth and development. The present results provide insights into muscle biology for further improvement of porcine meat quality.

  18. Application of supervised machine learning algorithms for the classification of regulatory RNA riboswitches.

    PubMed

    Singh, Swadha; Singh, Raghvendra

    2017-03-01

    Riboswitches, the small structured RNA elements, were discovered about a decade ago. It has been the subject of intense interest to identify riboswitches, understand their mechanisms of action and use them in genetic engineering. The accumulation of genome and transcriptome sequence data and comparative genomics provide unprecedented opportunities to identify riboswitches in the genome. In the present study, we have evaluated the following six machine learning algorithms for their efficiency to classify riboswitches: J48, BayesNet, Naïve Bayes, Multilayer Perceptron, sequential minimal optimization, hidden Markov model (HMM). For determining effective classifier, the algorithms were compared on the statistical measures of specificity, sensitivity, accuracy, F-measure and receiver operating characteristic (ROC) plot analysis. The classifier Multilayer Perceptron achieved the best performance, with the highest specificity, sensitivity, F-score and accuracy, and with the largest area under the ROC curve, whereas HMM was the poorest performer. At present, the available tools for the prediction and classification of riboswitches are based on covariance model, support vector machine and HMM. The present study determines Multilayer Perceptron as a better classifier for the genome-wide riboswitch searches.

  19. MicroRNA profiles and potential regulatory pattern during the early stage of spermatogenesis in mice.

    PubMed

    Luo, MengMeng; Hao, LiLi; Hu, Fen; Dong, YaNan; Gou, LiXia; Zhang, WenDian; Wang, Xin; Zhao, YuHui; Jia, MengChun; Hu, SongNian; Zhang, XiuJun

    2015-05-01

    Spermatogenesis is a complicated and poorly understood process that relies on the precise regulation of the self-renewal and differentiation of spermatogonia. In many organisms, microRNAs (miRNAs) are involved in multiple developmental processes as critical regulators of transcriptional and post-transcriptional gene silencing. This study investigated the expression pattern of miRNAs in type B spermatogonia cells (BSc) and primary spermatocytes (PSc) of mice, using a high-throughput small RNA sequencing system. The results revealed that the expression levels of Let-7 family miRNAs were remarkably high in both cell types. Furthermore, the expression levels of miR-21, miR-140-3p, miR-103, miR-30a, miR-101b and miR-99b were decreased during the transformation from BSc to PSc. These miRNAs target vital genes that participate in apoptosis, cell proliferation and differentiation, junction assembly and cell cycle regulation. These results highlight the indispensable role of miRNAs in spermatogenesis.

  20. Diverse RNA-binding proteins interact with functionally related sets of RNAs, suggesting an extensive regulatory system.

    PubMed

    Hogan, Daniel J; Riordan, Daniel P; Gerber, André P; Herschlag, Daniel; Brown, Patrick O

    2008-10-28

    RNA-binding proteins (RBPs) have roles in the regulation of many post-transcriptional steps in gene expression, but relatively few RBPs have been systematically studied. We searched for the RNA targets of 40 proteins in the yeast Saccharomyces cerevisiae: a selective sample of the approximately 600 annotated and predicted RBPs, as well as several proteins not annotated as RBPs. At least 33 of these 40 proteins, including three of the four proteins that were not previously known or predicted to be RBPs, were reproducibly associated with specific sets of a few to several hundred RNAs. Remarkably, many of the RBPs we studied bound mRNAs whose protein products share identifiable functional or cytotopic features. We identified specific sequences or predicted structures significantly enriched in target mRNAs of 16 RBPs. These potential RNA-recognition elements were diverse in sequence, structure, and location: some were found predominantly in 3'-untranslated regions, others in 5'-untranslated regions, some in coding sequences, and many in two or more of these features. Although this study only examined a small fraction of the universe of yeast RBPs, 70% of the mRNA transcriptome had significant associations with at least one of these RBPs, and on average, each distinct yeast mRNA interacted with three of the RBPs, suggesting the potential for a rich, multidimensional network of regulation. These results strongly suggest that combinatorial binding of RBPs to specific recognition elements in mRNAs is a pervasive mechanism for multi-dimensional regulation of their post-transcriptional fate.

  1. Leeway and constraints in the forced evolution of a regulatory RNA helix.

    PubMed Central

    Olsthoorn, R C; Licis, N; van Duin, J

    1994-01-01

    The start of the coat protein gene of RNA phage MS2 adopts a well-defined hairpin structure of 12 bp (including one mismatch) in which the start codon occupies the loop position. An earlier expression study using partial MS2 cDNA clones had indicated that the stability of this hairpin is important for gene expression. For every -1.4 kcal/mol increase in stability a 10-fold reduction in coat protein was obtained. Destabilizations beyond the wild-type value did not affect expression. These results suggested that the hairpin was tuned in the sense that it has the highest stability still compatible with maximal ribosome loading. Employing an infectious MS2 cDNA clone, we have now tested the prediction that the delta G 0 of the coat protein initiator helix is set at a precise value. We have introduced stabilizing and destabilizing mutations into this hairpin in the intact phage and monitored their evolution to viable species. By compensatory mutations, both types of mutants quickly revert along various pathways to wild-type stability, but not to wild-type sequence. As a rule the second-site mutations do not change the encoded amino acids or the Shine-Dalgarno sequence. The return of too strong hairpins to wild-type stability can be understood from the need to produce adequate supplies of coat protein. The return of unstable hairpins to wild-type stability is not self-evident and is presently not understood. The revertants provide an evolutionary landscape of slightly suboptimal phages, that were stable at least for the duration of the experiment (approximately 20 infection cycles).(ABSTRACT TRUNCATED AT 250 WORDS) Images PMID:8013465

  2. A novel NF-κB/YY1/microRNA-10a regulatory circuit in fibroblast-like synoviocytes regulates inflammation in rheumatoid arthritis

    PubMed Central

    Mu, Nan; Gu, Jintao; Huang, Tonglie; Zhang, Cun; Shu, Zhen; Li, Meng; Hao, Qiang; Li, Weina; Zhang, Wangqian; Zhao, Jinkang; Zhang, Yong; Huang, Luyu; Wang, Shuning; Jin, Xiaohang; Xue, Xiaochang; Zhang, Wei; Zhang, Yingqi

    2016-01-01

    The main etiopathogenesis of rheumatoid arthritis (RA) is overexpressed inflammatory cytokines and tissue injury mediated by persistent NF-κB activation. MicroRNAs widely participate in the regulation of target gene expression and play important roles in various diseases. Here, we explored the mechanisms of microRNAs in RA. We found that microRNA (miR)-10a was downregulated in the fibroblast-like synoviocytes (FLSs) of RA patients compared with osteoarthritis (OA) controls, and this downregulation could be triggered by TNF-α and IL-1β in an NF-κB-dependent manner through promoting the expression of the YingYang 1 (YY1) transcription factor. Downregulated miR-10a could accelerate IκB degradation and NF-κB activation by targeting IRAK4, TAK1 and BTRC. This miR-10a-mediated NF-κB activation then significantly promoted the production of various inflammatory cytokines, including TNF-α, IL-1β, IL-6, IL-8, and MCP-1, and matrix metalloproteinase (MMP)-1 and MMP-13. In addition, transfection of a miR-10a inhibitor accelerated the proliferation and migration of FLSs. Collectively, our data demonstrates the existence of a novel NF-κB/YY1/miR-10a/NF-κB regulatory circuit that promotes the excessive secretion of NF-κB-mediated inflammatory cytokines and the proliferation and migration of RA FLSs. Thus, miR-10a acts as a switch to control this regulatory circuit and may serve as a diagnostic and therapeutic target for RA treatment. PMID:26821827

  3. RNA sequencing and functional analysis implicate the regulatory role of long non-coding RNAs in tomato fruit ripening.

    PubMed

    Zhu, Benzhong; Yang, Yongfang; Li, Ran; Fu, Daqi; Wen, Liwei; Luo, Yunbo; Zhu, Hongliang

    2015-08-01

    Recently, long non-coding RNAs (lncRNAs) have been shown to play critical regulatory roles in model plants, such as Arabidopsis, rice, and maize. However, the presence of lncRNAs and how they function in fleshy fruit ripening are still largely unknown because fleshy fruit ripening is not present in the above model plants. Tomato is the model system for fruit ripening studies due to its dramatic ripening process. To investigate further the role of lncRNAs in fruit ripening, it is necessary and urgent to discover and identify novel lncRNAs and understand the function of lncRNAs in tomato fruit ripening. Here it is reported that 3679 lncRNAs were discovered from wild-type tomato and ripening mutant fruit. The lncRNAs are transcribed from all tomato chromosomes, 85.1% of which came from intergenic regions. Tomato lncRNAs are shorter and have fewer exons than protein-coding genes, a situation reminiscent of lncRNAs from other model plants. It was also observed that 490 lncRNAs were significantly up-regulated in ripening mutant fruits, and 187 lncRNAs were down-regulated, indicating that lncRNAs could be involved in the regulation of fruit ripening. In line with this, silencing of two novel tomato intergenic lncRNAs, lncRNA1459 and lncRNA1840, resulted in an obvious delay of ripening of wild-type fruit. Overall, the results indicated that lncRNAs might be essential regulators of tomato fruit ripening, which sheds new light on the regulation of fruit ripening.

  4. RNA sequencing and functional analysis implicate the regulatory role of long non-coding RNAs in tomato fruit ripening

    PubMed Central

    Zhu, Benzhong; Yang, Yongfang; Li, Ran; Fu, Daqi; Wen, Liwei; Luo, Yunbo; Zhu, Hongliang

    2015-01-01

    Recently, long non-coding RNAs (lncRNAs) have been shown to play critical regulatory roles in model plants, such as Arabidopsis, rice, and maize. However, the presence of lncRNAs and how they function in fleshy fruit ripening are still largely unknown because fleshy fruit ripening is not present in the above model plants. Tomato is the model system for fruit ripening studies due to its dramatic ripening process. To investigate further the role of lncRNAs in fruit ripening, it is necessary and urgent to discover and identify novel lncRNAs and understand the function of lncRNAs in tomato fruit ripening. Here it is reported that 3679 lncRNAs were discovered from wild-type tomato and ripening mutant fruit. The lncRNAs are transcribed from all tomato chromosomes, 85.1% of which came from intergenic regions. Tomato lncRNAs are shorter and have fewer exons than protein-coding genes, a situation reminiscent of lncRNAs from other model plants. It was also observed that 490 lncRNAs were significantly up-regulated in ripening mutant fruits, and 187 lncRNAs were down-regulated, indicating that lncRNAs could be involved in the regulation of fruit ripening. In line with this, silencing of two novel tomato intergenic lncRNAs, lncRNA1459 and lncRNA1840, resulted in an obvious delay of ripening of wild-type fruit. Overall, the results indicated that lncRNAs might be essential regulators of tomato fruit ripening, which sheds new light on the regulation of fruit ripening. PMID:25948705

  5. Scientific and Regulatory Considerations in Solid Oral Modified Release Drug Product Development.

    PubMed

    Li, Min; Sander, Sanna; Duan, John; Rosencrance, Susan; Miksinski, Sarah Pope; Yu, Lawrence; Seo, Paul; Rege, Bhagwant

    2016-11-01

    This review presents scientific and regulatory considerations for the development of solid oral modified release (MR) drug products. It includes a rationale for patient-focused development based on Quality-by-Design (QbD) principles. Product and process understanding of MR products includes identification and risk-based evaluation of critical material attributes (CMAs), critical process parameters (CPPs), and their impact on critical quality attributes (CQAs) that affect the clinical performance. The use of various biopharmaceutics tools that link the CQAs to a predictable and reproducible clinical performance for patient benefit is emphasized. Product and process understanding lead to a more comprehensive control strategy that can maintain product quality through the shelf life and the lifecycle of the drug product. The overall goal is to develop MR products that consistently meet the clinical objectives while mitigating the risks to patients by reducing the probability and increasing the detectability of CQA failures.

  6. α -Actinin TvACTN3 of Trichomonas vaginalis is an RNA-binding protein that could participate in its posttranscriptional iron regulatory mechanism.

    PubMed

    Calla-Choque, Jaeson Santos; Figueroa-Angulo, Elisa Elvira; Ávila-González, Leticia; Arroyo, Rossana

    2014-01-01

    Trichomonas vaginalis is a sexually transmitted flagellated protist parasite responsible for trichomoniasis. This parasite is dependent on high levels of iron, favoring its growth and multiplication. Iron also differentially regulates some trichomonad virulence properties by unknown mechanisms. However, there is evidence to support the existence of gene regulatory mechanisms at the transcriptional and posttranscriptional levels that are mediated by iron concentration in T. vaginalis. Thus, the goal of this study was to identify an RNA-binding protein in T. vaginalis that interacts with the tvcp4 RNA stem-loop structure, which may participate in a posttranscriptional iron regulatory mechanism mediated by RNA-protein interactions. We performed RNA electrophoretic mobility shift assay (REMSA) and supershift, UV cross-linking, Northwestern blot, and western blot (WB) assays using cytoplasmic protein extracts from T. vaginalis with the tvcp4 RNA hairpin structure as a probe. We identified a 135-kDa protein isolated by the UV cross-linking assays as α-actinin 3 (TvACTN3) by MALDI-TOF-MS that was confirmed by LS-MS/MS and de novo sequencing. TvACTN3 is a cytoplasmic protein that specifically binds to hairpin RNA structures from trichomonads and humans when the parasites are grown under iron-depleted conditions. Thus, TvACTN3 could participate in the regulation of gene expression by iron in T. vaginalis through a parallel posttranscriptional mechanism similar to that of the IRE/IRP system.

  7. [Collaborative study on regulatory science for facilitating clinical development of gene therapy products for genetic diseases].

    PubMed

    Uchida, Eriko; Igarashi, Yuka; Sato, Yoji

    2014-01-01

    Gene therapy products are expected as innovative medicinal products for intractable diseases such as life-threatening genetic diseases and cancer. Recently, clinical developments by pharmaceutical companies are accelerated in Europe and the United States, and the first gene therapy product in advanced countries was approved for marketing authorization by the European Commission in 2012. On the other hand, more than 40 clinical studies for gene therapy have been completed or ongoing in Japan, most of them are conducted as clinical researches by academic institutes, and few clinical trials have been conducted for approval of gene therapy products. In order to promote the development of gene therapy products, revision of the current guideline and/or preparation of concept paper to address the evaluation of the quality and safety of gene therapy products are necessary and desired to clearly show what data should be submitted before First-in-Human clinical trials of novel gene therapy products. We started collaborative study with academia and regulatory agency to promote regulatory science toward clinical development of gene therapy products for genetic diseases based on lentivirus and adeno-associated virus vectors; National Center for Child Health and Development (NCCHD), Nippon Medical School and PMDA have been joined in the task force. At first, we are preparing pre-draft of the revision of the current gene therapy guidelines in this project.

  8. MicroRNA profiling analysis throughout tomato fruit development and ripening reveals potential regulatory role of RIN on microRNAs accumulation.

    PubMed

    Gao, Chao; Ju, Zheng; Cao, Dongyan; Zhai, Baiqiang; Qin, Guozheng; Zhu, Hongliang; Fu, Daqi; Luo, Yunbo; Zhu, Benzhong

    2015-04-01

    The development and ripening of tomato fruit are complex processes involving many gene regulatory pathways at the transcriptional and post-transcriptional level. Ripening inhibitor (RIN) is a vital transcription factor, which targets numerous ripening-related genes at the transcriptional level during tomato fruit ripening. MicroRNAs (miRNAs) are a class of short noncoding RNAs that play important roles in post-transcriptional gene regulation. To elucidate the potential regulatory relationship between rin and miRNAs during fruit development and ripening, we identified known miRNAs and profiled their expression in wild-type tomato and rin mutant using a deep sequencing approach combined with quantitative RT-PCR. A total of 33 known miRNA families were identified, of which 14 miRNA families were differently accumulated. Subsequent promoter analysis showed that possible RIN-binding motifs (CArG-box) tended to occur frequently in the promoter regions of partial differently expressed miRNAs. In addition, ethylene may participate in the regulation of miRNAs accumulation during tomato fruit ripening. Chromatin immunoprecipitation (ChIP) and electrophoretic mobility shift assay confirmed the direct binding of RIN to the promoter of MIR172a. Collectively, these results showed a close correlation between miRNA expression and RIN as well as ethylene, which further elucidated the regulatory roles of miRNAs during fruit development and ripening and enriched the regulatory network of RIN in tomato fruit.

  9. Linking gene regulation to mRNA production and export.

    PubMed

    Rodríguez-Navarro, Susana; Hurt, Ed

    2011-06-01

    Regulation of gene expression can occur at many different levels. One important step in the gene expression process is the transport of mRNA from the nucleus to the cytoplasm. In recent years, studies have described how nuclear mRNA export depends on the steps preceding and following transport through nuclear pore complexes. These include gene activation, transcription, mRNA processing and mRNP assembly and disassembly. In this review, we summarise recent insights into the links between these steps in the gene expression cascade.

  10. Regulatory structures for gene therapy medicinal products in the European Union.

    PubMed

    Klug, Bettina; Celis, Patrick; Carr, Melanie; Reinhardt, Jens

    2012-01-01

    Taking into account the complexity and technical specificity of advanced therapy medicinal products: (gene and cell therapy medicinal products and tissue engineered products), a dedicated European regulatory framework was needed. Regulation (EC) No. 1394/2007, the "ATMP Regulation" provides tailored regulatory principles for the evaluation and authorization of these innovative medicines. The majority of gene or cell therapy product development is carried out by academia, hospitals, and small- and medium-sized enterprises (SMEs). Thus, acknowledging the particular needs of these types of sponsors, the legislation also provides incentives for product development tailored to them. The European Medicines Agency (EMA) and, in particular, its Committee for Advanced Therapies (CAT) provide a variety of opportunities for early interaction with developers of ATMPs to enable them to have early regulatory and scientific input. An important tool to promote innovation and the development of new medicinal products by micro-, small-, and medium-sized enterprises is the EMA's SME initiative launched in December 2005 to offer financial and administrative assistance to smaller companies. The European legislation also foresees the involvement of stakeholders, such as patient organizations, in the development of new medicines. Considering that gene therapy medicinal products are developed in many cases for treatment of rare diseases often of monogenic origin, the involvement of patient organizations, which focus on rare diseases and genetic and congenital disorders, is fruitful. Two such organizations are represented in the CAT. Research networks play another important role in the development of gene therapy medicinal products. The European Commission is funding such networks through the EU Sixth Framework Program.

  11. Abundant Intergenic TAACTGA Direct Repeats and Putative Alternate RNA Polymerase β′ Subunits in Marine Beggiatoaceae Genomes: Possible Regulatory Roles and Origins

    PubMed Central

    MacGregor, Barbara J.

    2015-01-01

    The genome sequences of several giant marine sulfur-oxidizing bacteria present evidence of a possible post-transcriptional regulatory network that may have been transmitted to or from two distantly related bacteria lineages. The draft genome of a Cand. “Maribeggiatoa” filament from the Guaymas Basin (Gulf of California, Mexico) seafloor contains 169 sets of TAACTGA direct repeats and one indirect repeat, with two to six copies per set. Related heptamers are rarely or never found as direct repeats. TAACTGA direct repeats are also found in some other Beggiatoaceae, Thiocystis violascens, a range of Cyanobacteria, and five Bacteroidetes. This phylogenetic distribution suggests they may have been transmitted horizontally, but no mechanism is evident. There is no correlation between total TAACTGA occurrences and repeats per genome. In most species the repeat units are relatively short, but longer arrays of up to 43 copies are found in several Bacteroidetes and Cyanobacteria. The majority of TAACTGA repeats in the Cand. “Maribeggiatoa” Orange Guaymas (BOGUAY) genome are within several nucleotides upstream of a putative start codon, suggesting they may be binding sites for a post-transcriptional regulator. Candidates include members of the ribosomal protein S1, Csp (cold shock protein), and Csr (carbon storage regulator) families. No pattern was evident in the predicted functions of the open reading frames (ORFs) downstream of repeats, but some encode presumably essential products such as ribosomal proteins. Among these is an ORF encoding a possible alternate or modified RNA polymerase beta prime subunit, predicted to have the expected subunit interaction domains but lacking most catalytic residues. A similar ORF was found in the Thioploca ingrica draft genome, but in no others. In both species they are immediately upstream of putative sensor kinase genes with nearly identical domain structures. In the marine Beggiatoaceae, a role for the TAACTGA repeats in

  12. Bioengineering and Coordination of Regulatory Networks and Intracellular Complexes to Maximize Hydrogen Production by Phototrophic Microorganisms

    SciTech Connect

    Tabita, F. Robert

    2013-07-30

    In this study, the Principal Investigator, F.R. Tabita has teemed up with J. C. Liao from UCLA. This project's main goal is to manipulate regulatory networks in phototrophic bacteria to affect and maximize the production of large amounts of hydrogen gas under conditions where wild-type organisms are constrained by inherent regulatory mechanisms from allowing this to occur. Unrestrained production of hydrogen has been achieved and this will allow for the potential utilization of waste materials as a feed stock to support hydrogen production. By further understanding the means by which regulatory networks interact, this study will seek to maximize the ability of currently available “unrestrained” organisms to produce hydrogen. The organisms to be utilized in this study, phototrophic microorganisms, in particular nonsulfur purple (NSP) bacteria, catalyze many significant processes including the assimilation of carbon dioxide into organic carbon, nitrogen fixation, sulfur oxidation, aromatic acid degradation, and hydrogen oxidation/evolution. Moreover, due to their great metabolic versatility, such organisms highly regulate these processes in the cell and since virtually all such capabilities are dispensable, excellent experimental systems to study aspects of molecular control and biochemistry/physiology are available.

  13. Identification of regulatory motifs in the CHO genome for stable monoclonal antibody production.

    PubMed

    Takagi, Yasuhiro; Yamazaki, Tomomi; Masuda, Kenji; Nishii, Shigeaki; Kawakami, Bunsei; Omasa, Takeshi

    2016-08-20

    Chinese hamster ovary (CHO) cell lines are widely used for therapeutic protein production. When a transgene is integrated into the genome of a CHO cell, the expression level is highly dependent on the site of integration because of positional effects such as gene silencing. To overcome negative positional effects and establish stable CHO cell lines with high productivity, several regulatory DNA elements are used in vector construction. Previously, we established the CHO DR1000L-4N cell line, a stable and high copy number Dhfr gene-amplified cell line. It was hypothesized that the chromosomal location of the exogenous gene-amplified region in the CHO DR1000L-4N genome contains regulatory motifs for stable protein production. Therefore, we isolated DNA regulatory motifs from the CHO DR1000L-4N cell line and determined whether these motifs act as an insulator. Our results suggest that stable expression of a transgene can be promoted by the CHO genome sequence, and it would be a powerful tool for therapeutic protein manufacturing.

  14. Infected erythrocyte-derived extracellular vesicles alter vascular function via regulatory Ago2-miRNA complexes in malaria

    PubMed Central

    Mantel, Pierre-Yves; Hjelmqvist, Daisy; Walch, Michael; Kharoubi-Hess, Solange; Nilsson, Sandra; Ravel, Deepali; Ribeiro, Marina; Grüring, Christof; Ma, Siyuan; Padmanabhan, Prasad; Trachtenberg, Alexander; Ankarklev, Johan; Brancucci, Nicolas M.; Huttenhower, Curtis; Duraisingh, Manoj T.; Ghiran, Ionita; Kuo, Winston P.; Filgueira, Luis; Martinelli, Roberta; Marti, Matthias

    2016-01-01

    Malaria remains one of the greatest public health challenges worldwide, particularly in sub-Saharan Africa. The clinical outcome of individuals infected with Plasmodium falciparum parasites depends on many factors including host systemic inflammatory responses, parasite sequestration in tissues and vascular dysfunction. Production of pro-inflammatory cytokines and chemokines promotes endothelial activation as well as recruitment and infiltration of inflammatory cells, which in turn triggers further endothelial cell activation and parasite sequestration. Inflammatory responses are triggered in part by bioactive parasite products such as hemozoin and infected red blood cell-derived extracellular vesicles (iRBC-derived EVs). Here we demonstrate that such EVs contain functional miRNA-Argonaute 2 complexes that are derived from the host RBC. Moreover, we show that EVs are efficiently internalized by endothelial cells, where the miRNA-Argonaute 2 complexes modulate target gene expression and barrier properties. Altogether, these findings provide a mechanistic link between EVs and vascular dysfunction during malaria infection. PMID:27721445

  15. Prevention of cross-talk in conserved regulatory systems: identification of specificity determinants in RNA-binding anti-termination proteins of the BglG family

    PubMed Central

    Hübner, Sebastian; Declerck, Nathalie; Diethmaier, Christine; Le Coq, Dominique; Aymerich, Stephane; Stülke, Jörg

    2011-01-01

    Each family of signal transduction systems requires specificity determinants that link individual signals to the correct regulatory output. In Bacillus subtilis, a family of four anti-terminator proteins controls the expression of genes for the utilisation of alternative sugars. These regulatory systems contain the anti-terminator proteins and a RNA structure, the RNA anti-terminator (RAT) that is bound by the anti-terminator proteins. We have studied three of these proteins (SacT, SacY, and LicT) to understand how they can transmit a specific signal in spite of their strong structural homology. A screen for random mutations that render SacT capable to bind a RNA structure recognized by LicT only revealed a substitution (P26S) at one of the few non-conserved residues that are in contact with the RNA. We have randomly modified this position in SacT together with another non-conserved RNA-contacting residue (Q31). Surprisingly, the mutant proteins could bind all RAT structures that are present in B. subtilis. In a complementary approach, reciprocal amino acid exchanges have been introduced in LicT and SacY at non-conserved positions of the RNA-binding site. This analysis revealed the key role of an arginine side-chain for both the high affinity and specificity of LicT for its cognate RAT. Introduction of this Arg at the equivalent position of SacY (A26) increased the RNA binding in vitro but also resulted in a relaxed specificity. Altogether our results suggest that this family of anti-termination proteins has evolved to reach a compromise between RNA binding efficacy and specific interaction with individual target sequences. PMID:21278164

  16. Linear RNA amplification for the production of microarray hybridization probes.

    PubMed

    Klebes, Ansgar; Kornberg, Thomas B

    2008-01-01

    To understand Drosophila development and other genetically controlled processes, it is often desirable to identify differences in gene expression levels. An experimental approach to investigate these processes is to catalog the transcriptome by hybridization of mRNA to DNA microbar-rays. In these experiments mRNA-derived hybridization probes are produced and hybridized to an array of DNA spots on a solid support. The labeled cDNAs of the complex hybridization probe will bind to their complementary sequences and provide quantification of the relative concentration of the corresponding transcript in the starting material. However, such approaches are often limited by the scarcity of the experimental sample because standard methods of probe preparation require microgram quantities of mRNA template. Linear RNA amplification can alleviate such limitations to support the generation of microarray hybridization probes from a few 100 pg of mRNA. These smaller quantities can be isolated from a few 100 cells. Here, we present a linear amplification protocol designed to preserve both the relative abundance of transcripts as well as their sequence complexity.

  17. Marketing Regulatory Oversight of Advanced Therapy Medicinal Products (ATMPs) in Europe: The EMA/CAT Perspective.

    PubMed

    Salmikangas, Paula; Schuessler-Lenz, Martina; Ruiz, Sol; Celis, Patrick; Reischl, Ilona; Menezes-Ferreira, Margarida; Flory, Egbert; Renner, Matthias; Ferry, Nicolas

    2015-01-01

    With the release of Regulation 1394/2007, a new framework for gene and cell therapy medicinal products and tissue-engineered products was established in the European Union. For all three product classes, called advanced therapy medicinal products, a centralised marketing authorisation became mandatory. The European Medicines Agency (EMA) together with its Committee for Advanced Therapies, Committee for Human Medicinal Products and the network of national agencies is responsible for scientific evaluation of the marketing authorisation applications. For a new application, data and information relating to manufacturing processes and quality control of the active substance and the final product have to be submitted for evaluation together with data from non-clinical and clinical safety and efficacy studies. Technical requirements for ATMPs are defined in the legislation, and guidance for different products is available through several EMA/CAT guidelines. Due to the diversity of ATMPs, a tailored approach for regulating these products is considered necessary. Thus, a risk-based approach has been introduced for ATMPs allowing flexibility for the regulatory requirements. Since the regulatory framework for ATMPs was established, five products have been licenced in the European Union. However, the pipeline of new ATMPs is much bigger, as seen from the significant numbers of different products discussed by the CAT in scientific advice and classification procedures. In 2013, a public consultation on the ATMP Regulation was conducted by the European Commission, and the results were published in 2014. The report proposes several improvements for the current framework and established procedures for the regulation of ATMPs.

  18. The Impact of 18 Ancestral and Horizontally-Acquired Regulatory Proteins upon the Transcriptome and sRNA Landscape of Salmonella enterica serovar Typhimurium.

    PubMed

    Colgan, Aoife M; Kröger, Carsten; Diard, Médéric; Hardt, Wolf-Dietrich; Puente, José L; Sivasankaran, Sathesh K; Hokamp, Karsten; Hinton, Jay C D

    2016-08-01

    We know a great deal about the genes used by the model pathogen Salmonella enterica serovar Typhimurium to cause disease, but less about global gene regulation. New tools for studying transcripts at the single nucleotide level now offer an unparalleled opportunity to understand the bacterial transcriptome, and expression of the small RNAs (sRNA) and coding genes responsible for the establishment of infection. Here, we define the transcriptomes of 18 mutants lacking virulence-related global regulatory systems that modulate the expression of the SPI1 and SPI2 Type 3 secretion systems of S. Typhimurium strain 4/74. Using infection-relevant growth conditions, we identified a total of 1257 coding genes that are controlled by one or more regulatory system, including a sub-class of genes that reflect a new level of cross-talk between SPI1 and SPI2. We directly compared the roles played by the major transcriptional regulators in the expression of sRNAs, and discovered that the RpoS (σ38) sigma factor modulates the expression of 23% of sRNAs, many more than other regulatory systems. The impact of the RNA chaperone Hfq upon the steady state levels of 280 sRNA transcripts is described, and we found 13 sRNAs that are co-regulated with SPI1 and SPI2 virulence genes. We report the first example of an sRNA, STnc1480, that is subject to silencing by H-NS and subsequent counter-silencing by PhoP and SlyA. The data for these 18 regulatory systems is now available to the bacterial research community in a user-friendly online resource, SalComRegulon.

  19. The Impact of 18 Ancestral and Horizontally-Acquired Regulatory Proteins upon the Transcriptome and sRNA Landscape of Salmonella enterica serovar Typhimurium

    PubMed Central

    Colgan, Aoife M.; Diard, Médéric; Hardt, Wolf-Dietrich; Puente, José L.; Sivasankaran, Sathesh K.; Hokamp, Karsten; Hinton, Jay C. D.

    2016-01-01

    We know a great deal about the genes used by the model pathogen Salmonella enterica serovar Typhimurium to cause disease, but less about global gene regulation. New tools for studying transcripts at the single nucleotide level now offer an unparalleled opportunity to understand the bacterial transcriptome, and expression of the small RNAs (sRNA) and coding genes responsible for the establishment of infection. Here, we define the transcriptomes of 18 mutants lacking virulence-related global regulatory systems that modulate the expression of the SPI1 and SPI2 Type 3 secretion systems of S. Typhimurium strain 4/74. Using infection-relevant growth conditions, we identified a total of 1257 coding genes that are controlled by one or more regulatory system, including a sub-class of genes that reflect a new level of cross-talk between SPI1 and SPI2. We directly compared the roles played by the major transcriptional regulators in the expression of sRNAs, and discovered that the RpoS (σ38) sigma factor modulates the expression of 23% of sRNAs, many more than other regulatory systems. The impact of the RNA chaperone Hfq upon the steady state levels of 280 sRNA transcripts is described, and we found 13 sRNAs that are co-regulated with SPI1 and SPI2 virulence genes. We report the first example of an sRNA, STnc1480, that is subject to silencing by H-NS and subsequent counter-silencing by PhoP and SlyA. The data for these 18 regulatory systems is now available to the bacterial research community in a user-friendly online resource, SalComRegulon. PMID:27564394

  20. Regulatory requirements for clinical trial and marketing authorisation application for cell-based medicinal products.

    PubMed

    Salmikangas, P; Flory, E; Reinhardt, J; Hinz, T; Maciulaitis, R

    2010-01-01

    The new era of regenerative medicine has led to rapid development of new innovative therapies especially for diseases and tissue/organ defects for which traditional therapies and medicinal products have not provided satisfactory outcome. Although the clinical use and developments of cell-based medicinal products (CBMPs) could be witnessed already for a decade, robust scientific and regulatory provisions for these products have only recently been enacted. The new Regulation for Advanced Therapies (EC) 1394/2007 together with the revised Annex I, Part IV of Directive 2001/83/EC provides the new legal framework for CBMPs. The wide variety of cell-based products and the foreseen limitations (small sample sizes, short shelf life) vs. particular risks (microbiological purity, variability, immunogenicity, tumourigenicity) associated with CBMPs have called for a flexible, case-by-case regulatory approach for these products. Consequently, a risk-based approach has been developed to allow definition of the amount of scientific data needed for a Marketing Authorisation Application (MAA) of each CBMP. The article provides further insight into the initial risk evaluation, as well as to the quality, non-clinical, and clinical requirements of CBMPs. Special somatic cell therapies designed for active immunotherapy are also addressed.

  1. The use and interpretation of in vitro data in regulatory toxicology: cosmetics, toiletries and household products.

    PubMed

    Indans, Ian

    2002-02-28

    There is currently a drive to eliminate animal testing for cosmetics, toiletries and household products; indeed, the European Union Cosmetics Directive aims to prohibit the use of experimental animals for the testing of finished cosmetic products after 2002. At present, national prohibitions are in place in the UK, Germany, Austria and the Netherlands, for the testing of finished cosmetic products and cosmetic ingredients. In the USA animal testing for certain types of finished products is mandatory. Against this background, the currently available regulatory in vitro tests comprise methods for eye irritation, skin corrosivity, genotoxicity, dermal penetration and photoirritation. The draft updates to the Organisation for Economic Co-operation and Development guidelines for eye and skin irritation advocate the use of in vitro or ex vivo methods prior to the commencement of animal studies. At present, testing for these endpoints cannot be completed in vitro, but potentially corrosive substances and products can be classified without the need for animal studies. Regulatory genotoxicity testing can be completed using only in vitro methods, provided that a clear negative outcome is obtained for each test. Data from dermal penetration studies may be used to refine risk assessments. Current developments in areas such as skin sensitisation and skin irritation promise that in the reasonably near future such information may be generated without the use of animals.

  2. Yeast deRNA viral transcriptase pause products: identification of the transcript strand.

    PubMed Central

    Brennan, V E; Bobek, L A; Bruenn, J A

    1981-01-01

    ScV-L is a double-stranded RNA virus of the yeast Saccharomyces cerevisiae. The virus possesses a capsid-associated transcriptase activity the product of which is a single-stranded RNA complementary to only one strand of the double-stranded RNA template (L). We show that the U-rich 3' terminus of L is the initiation site of transcription and that a number of pause products are made. One prominent product has the sequence pppGAAAAAUUUUUAAAUUCAUAUAACUOH. Images PMID:7031603

  3. Engineering a regulatory region of jadomycin gene cluster to improve jadomycin B production in Streptomyces venezuelae.

    PubMed

    Zheng, Jian-Ting; Wang, Sheng-Lan; Yang, Ke-Qian

    2007-09-01

    Streptomyces venezuelae ISP5230 produces a group of jadomycin congeners with cytotoxic activities. To improve jadomycin fermentation process, a genetic engineering strategy was designed to replace a 3.4-kb regulatory region of jad gene cluster that contains four regulatory genes (3' end 272 bp of jadW2, jadW3, jadR2, and jadR1) and the native promoter upstream of jadJ (P(J)) with the ermEp* promoter sequence so that ermEp* drives the expression of the jadomycin biosynthetic genes from jadJ in the engineered strain. As expected, the mutant strain produced jadomycin B without ethanol treatment, and the yield increased to about twofold that of the stressed wild-type. These results indicated that manipulation of the regulation of a biosynthetic gene cluster is an effective strategy to increase product yield.

  4. Identification of Submergence-Responsive MicroRNAs and Their Targets Reveals Complex MiRNA-Mediated Regulatory Networks in Lotus (Nelumbo nucifera Gaertn)

    PubMed Central

    Jin, Qijiang; Xu, Yingchun; Mattson, Neil; Li, Xin; Wang, Bei; Zhang, Xiao; Jiang, Hongwei; Liu, Xiaojing; Wang, Yanjie; Yao, Dongrui

    2017-01-01

    MicroRNAs (miRNAs) are endogenous non-coding RNAs with important regulatory functions in plant development and stress responses. However, their population abundance in lotus (Nelumbo nucifera Gaertn) has so far been poorly described, particularly in response to stresses. In this work, submergence-related miRNAs and their target genes were systematically identified, compared, and validated at the transcriptome-wide level using high-throughput sequencing data of small RNA, Mrna, and the degradome. A total of 128 known and 20 novel miRNAs were differentially expressed upon submergence. We identified 629 target transcripts for these submergence-responsive miRNAs. Based on the miRNA expression profiles and GO and KEGG annotation of miRNA target genes, we suggest possible molecular responses and physiological changes of lotus in response to submergence. Several metabolic, physiological and morphological adaptations-related miRNAs, i.e., NNU_far-miR159, NNU_gma-miR393h, and NNU_aly-miR319c-3p, were found to play important regulatory roles in lotus response to submergence. This work will contribute to a better understanding of miRNA-regulated adaption responses of lotus to submergence stress. PMID:28149304

  5. Inhibition of selenocysteine tRNA[Ser]Sec aminoacylation provides evidence that aminoacylation is required for regulatory methylation of this tRNA

    PubMed Central

    Kim, Jin Young; Carlson, Bradley A.; Xu, Xue-Ming; Zeng, Yu; Chen, Shawn; Gladyshev, Vadim N.; Lee, Byeong Jae; Hatfield, Dolph L.

    2011-01-01

    There are two isoforms of selenocysteine (Sec) tRNA[Ser]Sec that differ by a single methyl group, Um34. The non-Um34 isoform supports the synthesis of a subclass of selenoproteins, designated housekeeping, while the Um34 isoform supports the expression of another subclass, designated stress-related selenoproteins. Herein, we investigated the relationship between tRNA[Ser]Sec aminoacylation and Um34 synthesis which is the last step in the maturation of this tRNA. Mutation of the discriminator base at position 73 in tRNA[Ser]Sec dramatically reduced aminoacylation with serine, as did an inhibitor of seryl-tRNA synthetase, SB-217452. Although both the mutation and the inhibitor prevented Um34 synthesis, neither precluded the synthesis of any other of the known base modifications on tRNA[Ser]Sec following microinjection and incubation of the mutant tRNA[Ser]Sec transcript, or the wild type transcript along with inhibitor, in Xenopus oocytes. The data demonstrate that Sec tRNA[Ser]Sec must be aminoacylated for Um34 addition. The fact that selenium is required for Um34 methylation suggests that Sec must be attached to its tRNA for Um34 methylation. This would explain why selenium is essential for the function of Um34 methylase and provides further insights into the hierarchy of selenoprotein expression. PMID:21624347

  6. MicroRNA regulatory pathway analysis identifies miR-142-5p as a negative regulator of TGF-β pathway via targeting SMAD3

    PubMed Central

    Huang, Wei; Liu, Hui; Zhang, Hong-Mei; Li, Qiubai; Chen, Zhichao; Guo, An-Yuan

    2016-01-01

    MicroRNAs (miRNAs) are non-coding RNAs with functions of posttranscriptional regulation. The abnormally expressed miRNAs have been shown to be crucial contributors and may serve as biomarkers in many diseases. However, determining the biological function of miRNAs is an ongoing challenge. By combining miRNA targets prediction, miRNA and mRNA expression profiles in TCGA cancers, and pathway data, we performed a miRNA-pathway regulation inference by Fisher's exact test for enrichment analysis. Then we constructed a database to show the cancer related miRNA-pathway regulatory network (http://bioinfo.life.hust.edu.cn/miR_path). As one of the miRNAs targeting many cancer related pathways, miR-142-5p potentially regulates the maximum number of genes in TGF-β signaling pathway. We experimentally confirmed that miR-142-5p directly targeted and suppressed SMAD3, a key component in TGF-β signaling. Ectopic overexpression of miR-142-5p significantly promoted tumor cell proliferation and inhibited apoptosis, while silencing of miR-142-5p inhibited the tumor cell proliferation and promoted apoptosis in vitro. These findings indicate that miR-142-5p plays as a negative regulator in TGF-β pathway by targeting SMAD3 and suppresses TGF-β-induced growth inhibition in cancer cells. Our study proved the feasibility of miRNA regulatory pathway analysis and shed light on combining bioinformatics with experiments in the research of complex diseases. PMID:27683030

  7. Abnormal rapid non-linear RNA production induced by T7 RNA polymerase in the absence of an exogenous DNA template

    NASA Astrophysics Data System (ADS)

    Kakimoto, Y.; Fujinuma, A.; Fujita, S.; Kikuchi, Y.; Umekage, S.

    2015-02-01

    Although recombinant T7 RNA polymerase is commonly used for in vitro RNA synthesis, several reports have pointed out that T7 RNA polymerase can also induce RNA-directed RNA polymerization or replication. In addition, here we show a new aberrant transcription when using T7 RNA polymerase. This polymerization was observed in the presence of both ribonucleotides and a purchasable T7 RNA polymerase, Thermo T7 RNA polymerase, as well as in the absence of an exogenous DNA template. This cryptic RNA production was detectable after several hours of incubation and was inhibited by adding DNase I. These findings suggested that some contaminated DNA along with the Thermo stable T7 RNA polymerase could be used as template DNA. However, to our surprise, RNA production showed a rapid non-linear increase. This finding strongly indicated that a self-replication cycle emerged from the RNA-directed polymerization or replication by T7 RNA polymerase, triggering the abnormal explosive increase.

  8. Relation between mRNA expression and sequence information in Desulfovibrio vulgaris: Combinatorial contributions of upstream regulatory motifs and coding sequence features to variations in mRNA abundance

    SciTech Connect

    Wu, Gang; Nie, Lei; Zhang, Weiwen

    2006-05-26

    ABSTRACT-The context-dependent expression of genes is the core for biological activities, and significant attention has been given to identification of various factors contributing to gene expression at genomic scale. However, so far this type of analysis has been focused whether on relation between mRNA expression and non-coding sequence features such as upstream regulatory motifs or on correlation between mRN abundance and non-random features in coding sequences (e.g. codon usage and amino acid usage). In this study multiple regression analyses of the mRNA abundance and all sequence information in Desulfovibrio vulgaris were performed, with the goal to investigate how much coding and non-coding sequence features contribute to the variations in mRNA expression, and in what manner they act together...

  9. The Cutoff protein regulates piRNA cluster expression and piRNA production in the Drosophila germline

    PubMed Central

    Pane, Attilio; Jiang, Peng; Zhao, Dorothy Yanling; Singh, Mona; Schüpbach, Trudi

    2011-01-01

    In a broad range of organisms, Piwi-interacting RNAs (piRNAs) have emerged as core components of a surveillance system that protects the genome by silencing transposable and repetitive elements. A vast proportion of piRNAs is produced from discrete genomic loci, termed piRNA clusters, which are generally embedded in heterochromatic regions. The molecular mechanisms and the factors that govern their expression are largely unknown. Here, we show that Cutoff (Cuff), a Drosophila protein related to the yeast transcription termination factor Rai1, is essential for piRNA production in germline tissues. Cuff accumulates at centromeric/pericentromeric positions in germ-cell nuclei and strongly colocalizes with the major heterochromatic domains. Remarkably, we show that Cuff is enriched at the dual-strand piRNA cluster 1/42AB and is likely to be involved in regulation of transcript levels of similar loci dispersed in the genome. Consistent with this observation, Cuff physically interacts with the Heterochromatin Protein 1 (HP1) variant Rhino (Rhi). Our results unveil a link between Cuff activity, heterochromatin assembly and piRNA cluster expression, which is critical for stem-cell and germ-cell development in Drosophila. PMID:21952049

  10. The novel regulatory ncRNA, NfiS, optimizes nitrogen fixation via base pairing with the nitrogenase gene nifK mRNA in Pseudomonas stutzeri A1501.

    PubMed

    Zhan, Yuhua; Yan, Yongliang; Deng, Zhiping; Chen, Ming; Lu, Wei; Lu, Chao; Shang, Liguo; Yang, Zhimin; Zhang, Wei; Wang, Wei; Li, Yun; Ke, Qi; Lu, Jiasi; Xu, Yuquan; Zhang, Liwen; Xie, Zhihong; Cheng, Qi; Elmerich, Claudine; Lin, Min

    2016-07-26

    Unlike most Pseudomonas, the root-associated bacterium Pseudomonas stutzeri A1501 fixes nitrogen after the horizontal acquisition of a nitrogen-fixing (nif) island. A genome-wide search for small noncoding RNAs (ncRNAs) in P. stutzeri A1501 identified the novel P. stutzeri-specific ncRNA NfiS in the core genome, whose synthesis was significantly induced under nitrogen fixation or sorbitol stress conditions. The expression of NfiS was RNA chaperone Hfq-dependent and activated by the sigma factor RpoN/global nitrogen activator NtrC/nif-specific activator NifA regulatory cascade. The nfiS-deficient mutant displayed reduced nitrogenase activity, as well as increased sensitivity to multiple stresses, such as osmotic and oxidative stresses. Secondary structure prediction and complementation studies confirmed that a stem-loop structure was essential for NfiS to regulate the nitrogenase gene nifK mRNA synthesis and thus nitrogenase activity. Microscale thermophoresis and physiological analysis showed that NfiS directly pairs with nifK mRNA and ultimately enhances nitrogenase activity by increasing the translation efficiency and the half-life of nifK mRNA. Our data also suggest structural and functional divergence of NfiS evolution in diazotrophic and nondiazotrophic backgrounds. It is proposed that NfiS was recruited by nifK mRNA as a novel regulator to integrate the horizontally acquired nif island into host global networks.

  11. Proteomics analysis of global regulatory cascades involved in clavulanic acid production and morphological development in Streptomyces clavuligerus.

    PubMed

    Ferguson, Nicole L; Peña-Castillo, Lourdes; Moore, Marcus A; Bignell, Dawn R D; Tahlan, Kapil

    2016-04-01

    The genus Streptomyces comprises bacteria that undergo a complex developmental life cycle and produce many metabolites of importance to industry and medicine. Streptomyces clavuligerus produces the β-lactamase inhibitor clavulanic acid, which is used in combination with β-lactam antibiotics to treat certain β-lactam resistant bacterial infections. Many aspects of how clavulanic acid production is globally regulated in S. clavuligerus still remains unknown. We conducted comparative proteomics analysis using the wild type strain of S. clavuligerus and two mutants (ΔbldA and ΔbldG), which are defective in global regulators and vary in their ability to produce clavulanic acid. Approximately 33.5 % of the predicted S. clavuligerus proteome was detected and 192 known or putative regulatory proteins showed statistically differential expression levels in pairwise comparisons. Interestingly, the expression of many proteins whose corresponding genes contain TTA codons (predicted to require the bldA tRNA for translation) was unaffected in the bldA mutant.

  12. A HuD-ZBP1 ribonucleoprotein complex localizes GAP-43 mRNA into axons through its 3' untranslated region AU-rich regulatory element.

    PubMed

    Yoo, Soonmoon; Kim, Hak H; Kim, Paul; Donnelly, Christopher J; Kalinski, Ashley L; Vuppalanchi, Deepika; Park, Michael; Lee, Seung J; Merianda, Tanuja T; Perrone-Bizzozero, Nora I; Twiss, Jeffery L

    2013-09-01

    Localized translation of axonal mRNAs contributes to developmental and regenerative axon growth. Although untranslated regions (UTRs) of many different axonal mRNAs appear to drive their localization, there has been no consensus RNA structure responsible for this localization. We recently showed that limited expression of ZBP1 protein restricts axonal localization of both β-actin and GAP-43 mRNAs. β-actin 3'UTR has a defined element for interaction with ZBP1, but GAP-43 mRNA shows no homology to this RNA sequence. Here, we show that an AU-rich regulatory element (ARE) in GAP-43's 3'UTR is necessary and sufficient for its axonal localization. Axonal GAP-43 mRNA levels increase after in vivo injury, and GAP-43 mRNA shows an increased half-life in regenerating axons. GAP-43 mRNA interacts with both HuD and ZBP1, and HuD and ZBP1 co-immunoprecipitate in an RNA-dependent fashion. Reporter mRNA with the GAP-43 ARE competes with endogenous β-actin mRNA for axonal localization and decreases axon length and branching similar to the β-actin 3'UTR competing with endogenous GAP-43 mRNA. Conversely, over-expressing GAP-43 coding sequence with its 3'UTR ARE increases axonal elongation and this effect is lost when just the ARE is deleted from GAP-43's 3'UTR. We have recently found that over-expression of GAP-43 using an axonally targeted construct with the 3'UTRs of GAP-43 promoted elongating growth of axons, while restricting the mRNA to the cell body with the 3'UTR of γ-actin had minimal effect on axon length. In this study, we show that the ARE in GAP-43's 3'UTR is responsible for localization of GAP-43 mRNA into axons and is sufficient for GAP-43 protein's role in elongating axonal growth.

  13. Using RNA-Seq SNP data to reveal potential causal mutations related to pig production traits and RNA editing.

    PubMed

    Martínez-Montes, A M; Fernández, A; Pérez-Montarelo, D; Alves, E; Benítez, R M; Nuñez, Y; Óvilo, C; Ibañez-Escriche, N; Folch, J M; Fernández, A I

    2017-04-01

    RNA-Seq technology is widely used in quantitative gene expression studies and identification of non-annotated transcripts. However this technology also can be used for polymorphism detection and RNA editing in transcribed regions in an efficient and cost-effective way. This study used SNP data from an RNA-Seq assay to identify genes and mutations underlying production trait variations in an experimental pig population. The hypothalamic and hepatic transcriptomes of nine extreme animals for growth and fatness from an (Iberian × Landrace) × Landrace backcross were analyzed by RNA-Seq methodology, and SNP calling was conducted. More than 125 000 single nucleotide variants (SNVs) were identified in each tissue, and 78% were considered to be potential SNPs, those SNVs segregating in the context of this study. Potential informative SNPs were detected by considering those showing a homozygous or heterozygous genotype in one extreme group and the alternative genotype in the other group. In this way, 4396 and 1862 informative SNPs were detected in hypothalamus and liver respectively. Out of the 32 SNPs selected for validation, 25 (80%) were confirmed as actual SNPs. Association analyses for growth, fatness and premium cut yields with 19 selected SNPs were carried out, and four potential causal genes (RETSAT, COPA, RNMT and PALMD) were identified. Interestingly, new RNA editing modifications were detected and validated for the NR3C1:g.102797 (ss1985401074) and ACSM2B:g.13374 (ss1985401075) positions and for the COG3:g3.4525 (ss1985401087) modification previously identified across vertebrates, which could lead to phenotypic variation and should be further investigated.

  14. Identification of condition-specific regulatory modules through multi-level motif and mRNA expression analysis

    PubMed Central

    Chen, Li; Wang, Yue; Hoffman, Eric P.; Riggins, Rebecca B.; Clarke, Robert

    2013-01-01

    Many computational methods for identification of transcription regulatory modules often result in many false positives in practice due to noise sources of binding information and gene expression profiling data. In this paper, we propose a multi-level strategy for condition-specific gene regulatory module identification by integrating motif binding information and gene expression data through support vector regression and significant analysis. We have demonstrated the feasibility of the proposed method on a yeast cell cycle data set. The study on a breast cancer microarray data set shows that it can successfully identify the significant and reliable regulatory modules associated with breast cancer. PMID:20054984

  15. Bioequivalence study designs for generic solid oral anticancer drug products: scientific and regulatory considerations.

    PubMed

    Kaur, Paramjeet; Chaurasia, Chandra S; Davit, Barbara M; Conner, Dale P

    2013-12-01

    The demonstration of bioequivalence (BE) between the test and reference products is an integral part of generic drug approval process. A sound BE study design is pivotal to the successful demonstration of BE of generic drugs to their corresponding reference listed drug product. Generally, BE of systemically acting oral dosage forms is demonstrated in a crossover, single-dose in vivo study in healthy subjects. The determination of BE of solid oral anticancer drug products is associated with its own unique challenges due to the serious safety risks involved. Unlike typical BE study in healthy subjects, the safety issues often necessitate conducting BE studies in cancer patients. Such BE studies of an anticancer drug should be conducted without disturbing the patients' therapeutic dosing regimen. Attributes such as drug permeability and solubility, pharmacokinetics, dosing regimen, and approved therapeutic indication(s) are considered in the BE study design of solid anticancer drug products. To streamline the drug approval process, the Division of Bioequivalence posts the Bioequivalence Recommendations for Specific Products guidances on the FDA public website. The objective of this article is to illustrate the scientific and regulatory considerations in the design of BE studies for generic solid oral anticancer drug products through examples.

  16. Genome-wide modeling of transcription kinetics reveals patterns of RNA production delays.

    PubMed

    Honkela, Antti; Peltonen, Jaakko; Topa, Hande; Charapitsa, Iryna; Matarese, Filomena; Grote, Korbinian; Stunnenberg, Hendrik G; Reid, George; Lawrence, Neil D; Rattray, Magnus

    2015-10-20

    Genes with similar transcriptional activation kinetics can display very different temporal mRNA profiles because of differences in transcription time, degradation rate, and RNA-processing kinetics. Recent studies have shown that a splicing-associated RNA production delay can be significant. To investigate this issue more generally, it is useful to develop methods applicable to genome-wide datasets. We introduce a joint model of transcriptional activation and mRNA accumulation that can be used for inference of transcription rate, RNA production delay, and degradation rate given data from high-throughput sequencing time course experiments. We combine a mechanistic differential equation model with a nonparametric statistical modeling approach allowing us to capture a broad range of activation kinetics, and we use Bayesian parameter estimation to quantify the uncertainty in estimates of the kinetic parameters. We apply the model to data from estrogen receptor α activation in the MCF-7 breast cancer cell line. We use RNA polymerase II ChIP-Seq time course data to characterize transcriptional activation and mRNA-Seq time course data to quantify mature transcripts. We find that 11% of genes with a good signal in the data display a delay of more than 20 min between completing transcription and mature mRNA production. The genes displaying these long delays are significantly more likely to be short. We also find a statistical association between high delay and late intron retention in pre-mRNA data, indicating significant splicing-associated production delays in many genes.

  17. CO2 – Intrinsic Product, Essential Substrate, and Regulatory Trigger of Microbial and Mammalian Production Processes

    PubMed Central

    Blombach, Bastian; Takors, Ralf

    2015-01-01

    Carbon dioxide formation mirrors the final carbon oxidation steps of aerobic metabolism in microbial and mammalian cells. As a consequence, CO2/HCO3− dissociation equilibria arise in fermenters by the growing culture. Anaplerotic reactions make use of the abundant CO2/HCO3− levels for refueling citric acid cycle demands and for enabling oxaloacetate-derived products. At the same time, CO2 is released manifold in metabolic reactions via decarboxylation activity. The levels of extracellular CO2/HCO3− depend on cellular activities and physical constraints such as hydrostatic pressures, aeration, and the efficiency of mixing in large-scale bioreactors. Besides, local CO2/HCO3− levels might also act as metabolic inhibitors or transcriptional effectors triggering regulatory events inside the cells. This review gives an overview about fundamental physicochemical properties of CO2/HCO3− in microbial and mammalian cultures effecting cellular physiology, production processes, metabolic activity, and transcriptional regulation. PMID:26284242

  18. Phage phi 29 regulatory protein p4 stabilizes the binding of the RNA polymerase to the late promoter in a process involving direct protein-protein contacts.

    PubMed

    Nuez, B; Rojo, F; Salas, M

    1992-12-01

    Transcription from the late promoter, PA3, of Bacillus subtilis phage phi 29 is activated by the viral regulatory protein p4. A kinetic analysis of the activation process has revealed that the role of protein p4 is to stabilize the binding of RNA polymerase to the promoter as a closed complex without significantly affecting further steps of the initiation process. Electrophoretic band-shift assays performed with a DNA fragment spanning only the protein p4 binding site showed that RNA polymerase could efficiently retard the complex formed by protein p4 bound to the DNA. Similarly, when a DNA fragment containing only the RNA polymerase-binding region of PA3 was used, p4 greatly stimulated the binding of RNA polymerase to the DNA. These results strongly suggest that p4 and RNA polymerase contact each other at the PA3 promoter. In the light of current knowledge of the p4 activation mechanism, we propose that direct contacts between the two proteins participate in the activation process.

  19. A comparison of immunotoxic effects of nanomedicinal products with regulatory immunotoxicity testing requirements

    PubMed Central

    Giannakou, Christina; Park, Margriet VDZ; de Jong, Wim H; van Loveren, Henk; Vandebriel, Rob J; Geertsma, Robert E

    2016-01-01

    Nanomaterials (NMs) are attractive for biomedical and pharmaceutical applications because of their unique physicochemical and biological properties. A major application area of NMs is drug delivery. Many nanomedicinal products (NMPs) currently on the market or in clinical trials are most often based on liposomal products or polymer conjugates. NMPs can be designed to target specific tissues, eg, tumors. In virtually all cases, NMPs will eventually reach the immune system. It has been shown that most NMs end up in organs of the mononuclear phagocytic system, notably liver and spleen. Adverse immune effects, including allergy, hypersensitivity, and immunosuppression, have been reported after NMP administration. Interactions of NMPs with the immune system may therefore constitute important side effects. Currently, no regulatory documents are specifically dedicated to evaluate the immunotoxicity of NMs or NMPs. Their immunotoxicity assessment is performed based on existing guidelines for conventional substances or medicinal products. Due to the unique properties of NMPs when compared with conventional medicinal products, it is uncertain whether the currently prescribed set of tests provides sufficient information for an adequate evaluation of potential immunotoxicity of NMPs. The aim of this study was therefore, to compare the current regulatory immunotoxicity testing requirements with the accumulating knowledge on immunotoxic effects of NMPs in order to identify potential gaps in the safety assessment. This comparison showed that immunotoxic effects, such as complement activation-related pseudoallergy, myelosuppression, inflammasome activation, and hypersensitivity, are not readily detected by using current testing guidelines. Immunotoxicity of NMPs would be more accurately evaluated by an expanded testing strategy that is equipped to stratify applicable testing for the various types of NMPs. PMID:27382281

  20. A comparison of immunotoxic effects of nanomedicinal products with regulatory immunotoxicity testing requirements.

    PubMed

    Giannakou, Christina; Park, Margriet Vdz; de Jong, Wim H; van Loveren, Henk; Vandebriel, Rob J; Geertsma, Robert E

    2016-01-01

    Nanomaterials (NMs) are attractive for biomedical and pharmaceutical applications because of their unique physicochemical and biological properties. A major application area of NMs is drug delivery. Many nanomedicinal products (NMPs) currently on the market or in clinical trials are most often based on liposomal products or polymer conjugates. NMPs can be designed to target specific tissues, eg, tumors. In virtually all cases, NMPs will eventually reach the immune system. It has been shown that most NMs end up in organs of the mononuclear phagocytic system, notably liver and spleen. Adverse immune effects, including allergy, hypersensitivity, and immunosuppression, have been reported after NMP administration. Interactions of NMPs with the immune system may therefore constitute important side effects. Currently, no regulatory documents are specifically dedicated to evaluate the immunotoxicity of NMs or NMPs. Their immunotoxicity assessment is performed based on existing guidelines for conventional substances or medicinal products. Due to the unique properties of NMPs when compared with conventional medicinal products, it is uncertain whether the currently prescribed set of tests provides sufficient information for an adequate evaluation of potential immunotoxicity of NMPs. The aim of this study was therefore, to compare the current regulatory immunotoxicity testing requirements with the accumulating knowledge on immunotoxic effects of NMPs in order to identify potential gaps in the safety assessment. This comparison showed that immunotoxic effects, such as complement activation-related pseudoallergy, myelosuppression, inflammasome activation, and hypersensitivity, are not readily detected by using current testing guidelines. Immunotoxicity of NMPs would be more accurately evaluated by an expanded testing strategy that is equipped to stratify applicable testing for the various types of NMPs.

  1. The positive regulatory function of the 5'-proximal open reading frames in GCN4 mRNA can be mimicked by heterologous, short coding sequences.

    PubMed Central

    Williams, N P; Mueller, P P; Hinnebusch, A G

    1988-01-01

    Translational control of GCN4 expression in the yeast Saccharomyces cerevisiae is mediated by multiple AUG codons present in the leader of GCN4 mRNA, each of which initiates a short open reading frame of only two or three codons. Upstream AUG codons 3 and 4 are required to repress GCN4 expression in normal growth conditions; AUG codons 1 and 2 are needed to overcome this repression in amino acid starvation conditions. We show that the regulatory function of AUG codons 1 and 2 can be qualitatively mimicked by the AUG codons of two heterologous upstream open reading frames (URFs) containing the initiation regions of the yeast genes PGK and TRP1. These AUG codons inhibit GCN4 expression when present singly in the mRNA leader; however, they stimulate GCN4 expression in derepressing conditions when inserted upstream from AUG codons 3 and 4. This finding supports the idea that AUG codons 1 and 2 function in the control mechanism as translation initiation sites and further suggests that suppression of the inhibitory effects of AUG codons 3 and 4 is a general consequence of the translation of URF 1 and 2 sequences upstream. Several observations suggest that AUG codons 3 and 4 are efficient initiation sites; however, these sequences do not act as positive regulatory elements when placed upstream from URF 1. This result suggests that efficient translation is only one of the important properties of the 5' proximal URFs in GCN4 mRNA. We propose that a second property is the ability to permit reinitiation following termination of translation and that URF 1 is optimized for this regulatory function. Images PMID:3065626

  2. RNA polymerase gene, microorganism having said gene and the production of RNA polymerase by the use of said microorganism

    DOEpatents

    Kotani, Hirokazu; Hiraoka, Nobutsugu; Obayashi, Akira

    1991-01-01

    SP6 bacteriophage RNA polymerase is produced by cultivating a new microorganism (particularly new strains of Escherichia coli) harboring a plasmid that carries SP6 bacteriophage RNA polymerase gene and recovering SP6 bacteriophage RNA polymerase from the culture broth. SP6 bacteriophage RNA polymerase gene is provided as are new microorganisms harboring a plasmid that carries SP6 bacteriophage RNA polymerase gene.

  3. Production of RNA by a polymerase protein encapsulated within phospholipid vesicles

    NASA Technical Reports Server (NTRS)

    Chakrabarti, A. C.; Breaker, R. R.; Joyce, G. F.; Deamer, D. W.

    1994-01-01

    Catalyzed polymerization reactions represent a primary anabolic activity of all cells. It can be assumed that early cells carried out such reactions, in which macromolecular catalysts were encapsulated within some type of boundary membrane. In the experiments described here, we show that a template-independent RNA polymerase (polynucleotide phosphorylase) can be encapsulated in dimyristoyl phosphatidylcholine vesicles without substrate. When the substrate adenosine diphosphate (ADP) was provided externally, long-chain RNA polymers were synthesized within the vesicles. Substrate flux was maximized by maintaining the vesicles at the phase transition temperature of the component lipid. A protease was introduced externally as an additional control. Free enzyme was inactivated under identical conditions. RNA products were visualized in situ by ethidium bromide fluorescence. The products were harvested from the liposomes, radiolabeled, and analyzed by polyacrylamide gel electrophoresis. Encapsulated catalysts represent a model for primitive cellular systems in which an RNA polymerase was entrapped within a protected microenvironment.

  4. New Insights into Regulatory T Cells: Exosome- and Non-Coding RNA-Mediated Regulation of Homeostasis and Resident Treg Cells.

    PubMed

    Li, Peiyao; Liu, Changhong; Yu, Zhibin; Wu, Minghua

    2016-01-01

    Regulatory T (Treg) cells are a group of cells that are heterogeneous in origin and in functional activity. Treg cells comprise a necessary balance to adaptive immune responses. As key regulators of self-tolerance, Treg cells have been involved in a series of pathologic processes and considered as therapeutic targets. Here, we summarize recent research regarding Treg cell origins and their functional classification, highlight the role of exosomes and non-coding RNA in modulating Treg cell homeostasis, and discuss the current understanding of resident Treg cells.

  5. New Insights into Regulatory T Cells: Exosome- and Non-Coding RNA-Mediated Regulation of Homeostasis and Resident Treg Cells

    PubMed Central

    Li, Peiyao; Liu, Changhong; Yu, Zhibin; Wu, Minghua

    2016-01-01

    Regulatory T (Treg) cells are a group of cells that are heterogeneous in origin and in functional activity. Treg cells comprise a necessary balance to adaptive immune responses. As key regulators of self-tolerance, Treg cells have been involved in a series of pathologic processes and considered as therapeutic targets. Here, we summarize recent research regarding Treg cell origins and their functional classification, highlight the role of exosomes and non-coding RNA in modulating Treg cell homeostasis, and discuss the current understanding of resident Treg cells. PMID:27999575

  6. The glmS ribozyme: use of a small molecule coenzyme by a gene-regulatory RNA.

    PubMed

    Ferré-D'Amaré, Adrian R

    2010-11-01

    The glmS ribozyme is the first known example of a natural ribozyme that has evolved to require binding of an exogenous small molecule for activity. In Gram-positive bacteria, this RNA domain is part of the messenger RNA (mRNA) encoding the essential enzyme that synthesizes glucosamine-6-phosphate (GlcN6P). When present at physiologic concentration, this small molecule binds to the glmS ribozyme and uncovers a latent self-cleavage activity that ultimately leads to degradation of the mRNA. Biochemical and structural studies reveal that the RNA adopts a rigid fold stabilized by three pseudoknots and the packing of a peripheral domain against the ribozyme core. GlcN6P binding to this pre-organized RNA does not induce conformational changes; rather, the small molecule functions as a coenzyme, providing a catalytically essential amine group to the active site. The ribozyme is not a passive player, however. Active site functional groups are essential for catalysis, even in the presence of GlcN6P. In addition to being a superb experimental system with which to analyze how RNA catalysts can exploit small molecule coenzymes to broaden their chemical versatility, the presence of the glmS ribozyme in numerous pathogenic bacteria make this RNA an attractive target for the development of new antibiotics and antibacterial strategies.

  7. Transgene mobilization and regulatory uncertainty for non-GE fruit products of transgenic rootstocks.

    PubMed

    Haroldsen, Victor M; Chi-Ham, Cecilia L; Bennett, Alan B

    2012-10-31

    Genetically engineered (GE) rootstocks may offer some advantages for biotechnology applications especially in woody perennial crops such as grape or walnut. Transgrafting combines horticultural grafting practices with modern GE methods for crop improvement. Here, a non-GE conventional scion (upper stem portion) is grafted onto a transgenic GE rootstock. Thus, the scion does not contain the genetic modification present in the rootstock genome. We examined transgene presence in walnut and tomato GE rootstocks and non-GE fruit-bearing scions. Mobilization of transgene DNA, protein, and mRNA across the graft was not detected. Though transgenic siRNA mobilization was not observed in grafted tomatoes or walnut scions, transgenic siRNA signal was detected in walnut kernels. Prospective benefits from transgrafted plants include minimized risk of GE pollen flow (Lev-Yadun and Sederoff, 2001), possible use of more than one scion per approved GE rootstock which could help curb the estimated US$136 million (CropLife International, 2011) cost to bring a GE crop to international markets, as well as potential for improved consumer and market acceptance since the consumable product is not itself GE. Thus, transgrafting provides an alternative option for agricultural industries wishing to expand their biotechnology portfolio.

  8. Gender-specific Regulatory Challenges to Product Approval: a panel discussion.

    PubMed

    McGregor, Alyson J; Barr, Helen; Greenberg, Marna R; Safdar, Basmah; Wildgoose, Peter; Wright, David W; Hollander, Judd E

    2014-12-01

    On May 13, 2014, a 1-hour panel discussion session titled "Gender-specific Regulatory Challenges to Product Approval" was held during the Academic Emergency Medicine consensus conference, "Gender-specific Research in Emergency Medicine: Investigate, Understand, and Translate How Gender Affects Patient Outcomes." The session sought to bring together leaders in emergency medicine (EM) research, authors, and reviewers in EM research publications, as well as faculty, fellows, residents, and students engaged in research and clinical practice. A panel was convened involving a representative from the Office of Women's Health of the U.S. Food and Drug Administration, two pharmaceutical executives, and a clinical EM researcher. The moderated discussion also involved audience members who contributed significantly to the dialogue. Historical background leading up to the session along with the main themes of the discussion are reproduced in this article. These revolve around sex- and gender-specific research, statistical analysis of sex and gender, clinical practice, financial costs associated with pharmaceutical development, adaptive design, and specific recommendations on the regulatory process as it affects the specialty of EM.

  9. The small regulatory RNA FasX enhances group A Streptococcus virulence and inhibits pilus expression via serotype-specific targets.

    PubMed

    Danger, Jessica L; Cao, Tram N; Cao, Tran H; Sarkar, Poulomee; Treviño, Jeanette; Pflughoeft, Kathryn J; Sumby, Paul

    2015-04-01

    Bacterial pathogens commonly show intra-species variation in virulence factor expression and often this correlates with pathogenic potential. The group A Streptococcus (GAS) produces a small regulatory RNA (sRNA), FasX, which regulates the expression of pili and the thrombolytic agent streptokinase. As GAS serotypes are polymorphic regarding (a) FasX abundance, (b) the fibronectin, collagen, T-antigen (FCT) region of the genome, which contains the pilus genes (nine different FCT-types), and (c) the streptokinase-encoding gene (ska) sequence (two different alleles), we sought to test whether FasX regulates pilus and streptokinase expression in a serotype-specific manner. Parental, fasX mutant and complemented derivatives of serotype M1 (ska-2, FCT-2), M2 (ska-1, FCT-6), M6 (ska-2, FCT-1) and M28 (ska-1, FCT-4) isolates were compared. While FasX reduced pilus expression in each serotype, the molecular basis differed, as FasX bound, and inhibited the translation of, different FCT-region mRNAs. FasX enhanced streptokinase expression in each serotype, although the degree of regulation varied. Finally, we established that the regulation afforded by FasX enhances GAS virulence, assessed by a model of bacteremia using human plasminogen-expressing mice. Our data are the first to identify and characterize serotype-specific regulation by an sRNA in GAS, and to show an sRNA directly contributes to GAS virulence.

  10. The Regulatory Roles of MicroRNA in Effects of 2,2'4,4'-Tetrabromodiphenyl Ether (BDE47) on the Transcriptome of Zebrafish Larvae

    PubMed Central

    Zhao, Jing; Xu, Ting; Yin, Daqiang; Zhang, Bo; Bai, Jianfeng

    2017-01-01

    The developmental neurotoxicity caused by environmental pollutants has received great concern; however, there were still barely known about the underlying toxic mechanisms, especially the influence of varieties of regulatory factors such as microRNA (miRNA). A representative flame retardant, 2,2′,4,4′-tetrabromodiphenyl ether (BDE47), was found to disrupt zebrafish development in visual perception and bone formation in previous study, thus here we investigated its effects on miRNA expression profiling of 6 days post fertilization (dpf) zebrafish larvae by deep sequencing. To overcome the shortage of zebrafish miRNA annotation, multiple data processing approaches, especially constructed network based on the interactions between miRNAs and enrichment terms, were adopted and helped us acquire several validated zebrafish miRNAs and two novel miRNAs in BDE47-induced effects, and identify corresponding biological processes of the miRNAs. Among them, miR-735 was supposed to play essential roles in larval sensory development according to analysis results. Our study also provided an effective strategy for analyzing biological effects on non-mammalian miRNAs with limited basic information. PMID:28072866

  11. Regulatory and information support for evaluation of biological productivity of Ukrainian forests and climate change

    NASA Astrophysics Data System (ADS)

    Lakyda, Petro; Vasylyshyn, Roman; Lakyda, Ivan

    2013-04-01

    Stabilization and preservation of the planet's climate system today is regarded as one of the most important global political-economic, environmental and social problems of mankind. Rising concentration of carbon dioxide in the planet's atmosphere due to anthropogenic impact is the main reason leading to global climate change. Due to the above mentioned, social demands on forests are changing their biosphere role and function of natural sink of greenhouse gases becomes top priority. It is known that one of the most essential components of biological productivity of forests is their live biomass. Absorption, long-term sequestration of carbon and generation of oxygen are secured by its components. System research of its parametric structure and development of regulatory and reference information for assessment of aboveground live biomass components of trees and stands of the main forest-forming tree species in Ukraine began over twenty-five years ago at the department of forest mensuration and forest inventory of National University of Life and Environmental Sciences of Ukraine, involving staff from other research institutions. Today, regulatory and reference materials for evaluation of parametric structure of live biomass are developed for trees of the following major forest-forming tree species of Ukraine: Scots pine of natural and artificial origin, Crimean pine, Norway spruce, silver fir, pedunculate oak, European beech, hornbeam, ash, common birch, aspen and black alder (P.I. Lakyda et al., 2011). An ongoing process on development of similar regulatory and reference materials for forest stands of the abovementioned forest-forming tree species of Ukraine is secured by scientists of departments of forest management, and forest mensuration and forest inventory. The total experimental research base is 609 temporary sample plots, where 4880 model trees were processed, including 3195 model trees with estimates of live biomass components. Laboratory studies conducted

  12. Expressed microRNA associated with high rate of egg production in chicken ovarian follicles.

    PubMed

    Wu, N; Gaur, U; Zhu, Q; Chen, B; Xu, Z; Zhao, X; Yang, M; Li, D

    2016-10-26

    MicroRNA (miRNA) is a highly conserved class of small noncoding RNA about 19-24 nucleotides in length that function in a specific manner to post-transcriptionally regulate gene expression in organisms. Tissue miRNA expression studies have discovered a myriad of functions for miRNAs in various aspects, but a role for miRNAs in chicken ovarian tissue at 300 days of age has not hitherto been reported. In this study, we performed the first miRNA analysis of ovarian tissues in chickens with low and high rates of egg production using high-throughput sequencing. By comparing low rate of egg production chickens with high rate of egg production chickens, 17 significantly differentially expressed miRNAs were found (P < 0.05), including 11 known and six novel miRNAs. We found that all 11 known miRNAs were involved mainly in pathways of reproduction regulation, such as steroid hormone biosynthesis and dopaminergic synapse. Additionally, expression profiling of six randomly selected differentially regulated miRNAs were validated by quantitative real-time polymerase chain reaction (RT-qPCR). Some miRNAs, such as gga-miR-34b, gga-miR-34c and gga-miR-216b, were reported to regulate processes such as proliferation, cell cycle, apoptosis and metastasis and were expressed differentially in ovaries of chickens with high rates of egg production, suggesting that these miRNAs have an important role in ovary development and reproductive management of chicken. Furthermore, we uncovered that a significantly up-regulated miRNA-gga-miR-200a-3p-is ubiquitous in reproduction-regulation-related pathways. This miRNA may play a special central role in the reproductive management of chicken, and needs to be further studied for confirmation.

  13. Sustained translational repression of lactate dehydrogenase 1 in Toxoplasma gondii bradyzoites is conferred by a small regulatory RNA hairpin.

    PubMed

    Holmes, Michael; Itaas, Vaunell; Ananvoranich, Sirinart

    2014-11-01

    In response to environmental stresses, Toxoplasma gondii induces a global translational repression which allows for the remodeling of its transcriptome. While some transcripts are preferentially translated, another subset is translationally repressed and maintained in bradyzoites. Although little is known of how transcripts are targeted for sustained translational repression, the targeting probably operates through an RNA-centric mechanism relying on the recognition of cis-acting elements. In this study, we sought to determine if the targeting of transcripts through recognizable cis-acting elements could be responsible for the transcript-specific sustained translational repression displayed by Toxoplasma bradyzoites. We examined the UTRs of a translationally repressed gene, lactate dehydrogenase 1, and found a 40 nucleotide regulatory element in its 5'UTR. This element specifically induces translational repression in otherwise constitutively expressed transcripts. Mutational studies revealed that the formation of a small 16 nucleotide regulatory RNA hairpin is essential for this activity. We suggest that this hairpin may act as the nucleation site for the binding of an as yet to be identified trans-acting factor that allows for the transcript to be targeted for translational repression removal from the active translational pool. To our knowledge, this is the first report characterizing a specific cis-acting element contributing to post-transcriptional gene regulation in Toxoplasma and suggests the presence of a pathway by which the parasites can recognize, identify and specifically target transcripts for sustained translational repression under stressful conditions.

  14. The autoimmunity-associated BLK haplotype exhibits cis-regulatory effects on mRNA and protein expression that are prominently observed in B cells early in development

    PubMed Central

    Simpfendorfer, Kim R.; Olsson, Lina M.; Manjarrez Orduño, Nataly; Khalili, Houman; Simeone, Alyssa M.; Katz, Matthew S.; Lee, Annette T.; Diamond, Betty; Gregersen, Peter K.

    2012-01-01

    The gene B lymphocyte kinase (BLK) is associated with rheumatoid arthritis, systemic lupus erythematosus and several other autoimmune disorders. The disease risk haplotype is known to be associated with reduced expression of BLK mRNA transcript in human B cell lines; however, little is known about cis-regulation of BLK message or protein levels in native cell types. Here, we show that in primary human B lymphocytes, cis-regulatory effects of disease-associated single nucleotide polymorphisms in BLK are restricted to naïve and transitional B cells. Cis-regulatory effects are not observed in adult B cells in later stages of differentiation. Allelic expression bias was also identified in primary human T cells from adult peripheral and umbilical cord blood (UCB), thymus and tonsil, although mRNA levels were reduced compared with B cells. Allelic regulation of Blk expression at the protein level was confirmed in UCB B cell subsets by intracellular staining and flow cytometry. Blk protein expression in CD4+ and CD8+ T cells was documented by western blot analysis; however, differences in protein expression levels by BLK genotype were not observed in any T cell subset. Blk allele expression differences at the protein level are thus restricted to early B cells, indicating that the involvement of Blk in the risk for autoimmune disease likely acts during the very early stages of B cell development. PMID:22678060

  15. Transcriptome-wide analysis of chromium-stress responsive microRNAs to explore miRNA-mediated regulatory networks in radish (Raphanus sativus L.).

    PubMed

    Liu, Wei; Xu, Liang; Wang, Yan; Shen, Hong; Zhu, Xianwen; Zhang, Keyun; Chen, Yinglong; Yu, Rugang; Limera, Cecilia; Liu, Liwang

    2015-09-11

    MicroRNAs (miRNAs) are small noncoding RNAs that play pivotal roles in plant growth, development and stress response. Chromium (Cr) is one of common environmental contaminants possessing potential health hazards to living organisms. To date, little is known about the regulatory roles of miRNAs in response to Cr stress in radish. To systematically identify Cr-responsive miRNAs and their targets in radish, two sRNA libraries derived from Cr-free (CK) and Cr-treated (Cr200) roots were constructed. With Solexa sequencing, 81 known and 72 novel miRNAs were identified, from which 54 known and 16 novel miRNAs were significantly differentially expressed under Cr stress. Several target genes for Cr-responsive miRNAs encode different transcription factor (TF) families, including SPLs, MYBs, ERFs and bZIPs, might regulate corresponding HM-related transcriptional processes in plants. Notably, a few key responsive enzymes or proteins, including HMA, YSL1 and ABC transporter protein were involved in Cr uptake and homeostasis process. Furthermore, the expression patterns of some Cr-responsive miRNAs and their targets were validated by RT-qPCR. This study represents the first characterization of Cr-responsive miRNAs and their targets in radish. The outcomes of this study could provide novel insights into miRNA-mediated regulatory mechanisms underlying plant response to Cr stress in root vegetable crops.

  16. A cis-regulatory antisense RNA represses translation in Vibrio cholerae through extensive complementarity and proximity to the target locus.

    PubMed

    Chang, Howard; Replogle, John Michael; Vather, Naomi; Tsao-Wu, Maya; Mistry, Ronak; Liu, Jane M

    2015-01-01

    As with all facultative pathogens, Vibrio cholerae must optimize its cellular processes to adapt to different environments with varying carbon sources and to environmental stresses. More specifically, in order to metabolize mannitol, V. cholerae must regulate the synthesis of MtlA, a mannitol transporter protein produced exclusively in the presence of mannitol. We previously showed that a cis-acting small RNA (sRNA) expressed by V. cholerae, MtlS, appears to post-transcriptionally downregulate the expression of mtlA and is produced in the absence of mannitol. We hypothesized that since it is complementary to the 5' untranslated region (UTR) of mtlA mRNA, MtlS may affect synthesis of MtlA by forming an mtlA-MtlS complex that blocks translation of the mRNA through occlusion of its ribosome binding site. To test this hypothesis, we used in vitro translation assays in order to examine the role MtlS plays in mtlA regulation and found that MtlS is sufficient to suppress translation of transcripts harboring the 5' UTR of mtlA. However, in a cellular context, the 5' UTR of mtlA is not sufficient for targeted repression by endogenous MtlS; additional segments from the coding region of mtlA play a role in the ability of the sRNA to regulate translation of mtlA mRNA. Additionally, proximity of transcription sites between the sRNA and mRNA significantly affects the efficacy of MtlS.

  17. The novel regulatory ncRNA, NfiS, optimizes nitrogen fixation via base pairing with the nitrogenase gene nifK mRNA in Pseudomonas stutzeri A1501

    PubMed Central

    Zhan, Yuhua; Yan, Yongliang; Deng, Zhiping; Chen, Ming; Lu, Wei; Lu, Chao; Shang, Liguo; Yang, Zhimin; Zhang, Wei; Wang, Wei; Li, Yun; Ke, Qi; Lu, Jiasi; Xu, Yuquan; Zhang, Liwen; Xie, Zhihong; Cheng, Qi; Elmerich, Claudine; Lin, Min

    2016-01-01

    Unlike most Pseudomonas, the root-associated bacterium Pseudomonas stutzeri A1501 fixes nitrogen after the horizontal acquisition of a nitrogen-fixing (nif) island. A genome-wide search for small noncoding RNAs (ncRNAs) in P. stutzeri A1501 identified the novel P. stutzeri-specific ncRNA NfiS in the core genome, whose synthesis was significantly induced under nitrogen fixation or sorbitol stress conditions. The expression of NfiS was RNA chaperone Hfq-dependent and activated by the sigma factor RpoN/global nitrogen activator NtrC/nif-specific activator NifA regulatory cascade. The nfiS-deficient mutant displayed reduced nitrogenase activity, as well as increased sensitivity to multiple stresses, such as osmotic and oxidative stresses. Secondary structure prediction and complementation studies confirmed that a stem-loop structure was essential for NfiS to regulate the nitrogenase gene nifK mRNA synthesis and thus nitrogenase activity. Microscale thermophoresis and physiological analysis showed that NfiS directly pairs with nifK mRNA and ultimately enhances nitrogenase activity by increasing the translation efficiency and the half-life of nifK mRNA. Our data also suggest structural and functional divergence of NfiS evolution in diazotrophic and nondiazotrophic backgrounds. It is proposed that NfiS was recruited by nifK mRNA as a novel regulator to integrate the horizontally acquired nif island into host global networks. PMID:27407147

  18. Dramatic changes in 67 miRNAs during initiation of first wave of spermatogenesis in Mus musculus testis: global regulatory insights generated by miRNA-mRNA network analysis.

    PubMed

    Sree, Sreesha; Radhakrishnan, Karthika; Indu, Sivankutty; Kumar, Pradeep G

    2014-09-01

    We mapped global changes in miRNA and mRNA profiles spanning the first wave of spermatogenesis using prepubertal (Postnatal Day 8 [P8]), pubertal (P16), and adolescent (P24) Mus musculus testes and identified the differential expression of 67 miRNAs and 8226 mRNAs. These two data sets were integrated into miRNA-dependent regulatory networks based on miRWalk predictions. In a network representing the P8 to P16 transition, downregulation of four miRNAs and upregulation of 19 miRNAs were linked with 81 upregulated target mRNAs and 228 downregulated target mRNAs, respectively. Furthermore, during the P16 to P24 transition, two miRNAs were downregulated, and eight miRNAs were upregulated, which linked with 64 upregulated mRNAs and 389 downregulated mRNAs, respectively. Only three of the miRNAs present in the network (miR-34b-5p, miR-34c, and miR-449a) showed a progressive increase from P8 through P16 to P24, while the remaining miRNAs in the network showed statistically significant changes in their levels either during the P8 to P16 transition or during the P16 to P24 transition. Analysis of the chromosomal location of these differentially expressed miRNAs showed that 14 out of 25 miRNAs upregulated from P8 to P16, and 18 out of 40 miRNAs upregulated from P8 to P24 were X-linked. This is suggestive of their escape from meiotic sex chromosome inactivation and postmeiotic sex chromatin. This integrated network of miRNA-level and mRNA-level changes in mouse testis during the first wave of spermatogenesis is expected to build a base for evaluating the role of miRNA-mediated gene expression regulation in maturing mammalian testis.

  19. Dissecting the expression relationships between RNA-binding proteins and their cognate targets in eukaryotic post-transcriptional regulatory networks

    NASA Astrophysics Data System (ADS)

    Nishtala, Sneha; Neelamraju, Yaseswini; Janga, Sarath Chandra

    2016-05-01

    RNA-binding proteins (RBPs) are pivotal in orchestrating several steps in the metabolism of RNA in eukaryotes thereby controlling an extensive network of RBP-RNA interactions. Here, we employed CLIP (cross-linking immunoprecipitation)-seq datasets for 60 human RBPs and RIP-ChIP (RNP immunoprecipitation-microarray) data for 69 yeast RBPs to construct a network of genome-wide RBP- target RNA interactions for each RBP. We show in humans that majority (~78%) of the RBPs are strongly associated with their target transcripts at transcript level while ~95% of the studied RBPs were also found to be strongly associated with expression levels of target transcripts when protein expression levels of RBPs were employed. At transcript level, RBP - RNA interaction data for the yeast genome, exhibited a strong association for 63% of the RBPs, confirming the association to be conserved across large phylogenetic distances. Analysis to uncover the features contributing to these associations revealed the number of target transcripts and length of the selected protein-coding transcript of an RBP at the transcript level while intensity of the CLIP signal, number of RNA-Binding domains, location of the binding site on the transcript, to be significant at the protein level. Our analysis will contribute to improved modelling and prediction of post-transcriptional networks.

  20. Comparative RNA-Seq Analysis Reveals That Regulatory Network of Maize Root Development Controls the Expression of Genes in Response to N Stress

    PubMed Central

    Zhao, Xiongwei; Nie, Shujun; Li, Yuhua; Zhang, Zhiming; Shen, Yaou; Chen, Qi; Lu, Yanli; Lan, Hai; Zhou, Shufeng; Gao, Shibin; Pan, Guangtang; Lin, Haijian

    2016-01-01

    Nitrogen (N) is an essential nutrient for plants, and it directly affects grain yield and protein content in cereal crops. Plant root systems are not only critical for anchorage in the soil, but also for N acquisition. Therefore, genes controlling root development might also affect N uptake by plants. In this study, the responses of nitrogen on root architecture of mutant rtcs and wild-type of maize were investigated by morphological and physiological analysis. Subsequently, we performed a comparative RNA-Seq analysis to compare gene expression profiles between mutant rtcs roots and wild-type roots under different N conditions. We identified 786 co-modulated differentially expressed genes (DEGs) related to root development. These genes participated in various metabolic processes. A co-expression cluster analysis and a cis-regulatory motifs analysis revealed the importance of the AP2-EREBP transcription factor family in the rtcs-dependent regulatory network. Some genotype-specific DEGs contained at least one LBD motif in their promoter region. Further analyses of the differences in gene transcript levels between rtcs and wild-type under different N conditions revealed 403 co-modulated DEGs with distinct functions. A comparative analysis revealed that the regulatory network controlling root development also controlled gene expression in response to N-deficiency. Several AP2-EREBP family members involved in multiple hormone signaling pathways were among the DEGs. These transcription factors might play important roles in the rtcs-dependent regulatory network related to root development and the N-deficiency response. Genes encoding the nitrate transporters NRT2-1, NAR2.1, NAR2.2, and NAR2.3 showed much higher transcript levels in rtcs than in wild-type under normal-N conditions. This result indicated that the LBD gene family mainly functions as transcriptional repressors, as noted in other studies. In summary, using a comparative RNA-Seq-based approach, we identified

  1. Building parity between brand and generic peptide products: Regulatory and scientific considerations for quality of synthetic peptides.

    PubMed

    Wu, Larisa C; Chen, Fu; Lee, Sau L; Raw, Andre; Yu, Lawrence X

    2017-02-25

    Peptides are a fast growing segment in the pharmaceutical industry. Consequently, the industry and regulatory agencies are increasing their focus on the regulatory path and quality considerations for peptide development and manufacturing. Although most peptides are synthetic, manufactured by solid phase synthesis, nevertheless they are complex molecules with challenging quality and regulatory aspects. This paper provides a structured overview of relevant quality issues for chemically synthesized peptides used as active pharmaceutical ingredients (API) in drug products. It addresses the unique characteristics of peptides pertaining to structural and physicochemical characterization, manufacturing and in process controls, impurities and aggregates arising from manufacturing and storage, along with their potential impact on safety (including immunogenicity) and efficacy of the peptide drug products.

  2. RNA-Seq Analysis of Allele-Specific Expression, Hybrid Effects, and Regulatory Divergence in Hybrids Compared with Their Parents from Natural Populations

    PubMed Central

    Bell, Graeme D.M.; Kane, Nolan C.; Rieseberg, Loren H.; Adams, Keith L.

    2013-01-01

    Hybridization is a prominent process among natural plant populations that can result in phenotypic novelty, heterosis, and changes in gene expression. The effects of intraspecific hybridization on F1 hybrid gene expression were investigated using parents from divergent, natural populations of Cirsium arvense, an invasive Compositae weed. Using an RNA-seq approach, the expression of 68,746 unigenes was quantified in parents and hybrids. The expression levels of 51% of transcripts differed between parents, a majority of which had less than 1.25× fold-changes. More unigenes had higher expression in the invasive parent (P1) than the noninvasive parent (P2). Of those that were divergently expressed between parents, 10% showed additive and 81% showed nonadditive (transgressive or dominant) modes of gene action in the hybrids. A majority of the dominant cases had P2-like expression patterns in the hybrids. Comparisons of allele-specific expression also enabled a survey of cis- and trans-regulatory effects. Cis- and trans-regulatory divergence was found at 70% and 68% of 62,281 informative single-nucleotide polymorphism sites, respectively. Of the 17% of sites exhibiting both cis- and trans-effects, a majority (70%) had antagonistic regulatory interactions (cis x trans); trans-divergence tended to drive higher expression of the P1 allele, whereas cis-divergence tended to increase P2 transcript abundance. Trans-effects correlated more highly than cis with parental expression divergence and accounted for a greater proportion of the regulatory divergence at sites with additive compared with nonadditive inheritance patterns. This study explores the nature of, and types of mechanisms underlying, expression changes that occur in upon intraspecific hybridization in natural populations. PMID:23677938

  3. Genome-Wide Investigation Using sRNA-Seq, Degradome-Seq and Transcriptome-Seq Reveals Regulatory Networks of microRNAs and Their Target Genes in Soybean during Soybean mosaic virus Infection

    PubMed Central

    Yu, Kangfu; Wang, Aiming

    2016-01-01

    MicroRNAs (miRNAs) play key roles in a variety of cellular processes through regulation of their target gene expression. Accumulated experimental evidence has demonstrated that infections by viruses are associated with the altered expression profile of miRNAs and their mRNA targets in the host. However, the regulatory network of miRNA-mRNA interactions during viral infection remains largely unknown. In this study, we performed small RNA (sRNA)-seq, degradome-seq and as well as a genome-wide transcriptome analysis to profile the global gene and miRNA expression in soybean following infections by three different Soybean mosaic virus (SMV) isolates, L (G2 strain), LRB (G2 strain) and G7 (G7 strain). sRNA-seq analyses revealed a total of 253 soybean miRNAs with a two-fold or greater change in abundance compared with the mock-inoculated control. 125 transcripts were identified as the potential cleavage targets of 105 miRNAs and validated by degradome-seq analyses. Genome-wide transcriptome analysis showed that total 2679 genes are differentially expressed in response to SMV infection including 71 genes predicted as involved in defense response. Finally, complex miRNA-mRNA regulatory networks were derived using the RNAseq, small RNAseq and degradome data. This work represents a comprehensive, global approach to examining virus-host interactions. Genes responsive to SMV infection are identified as are their potential miRNA regulators. Additionally, regulatory changes of the miRNAs themselves are described and the regulatory relationships were supported with degradome data. Taken together these data provide new insights into molecular SMV-soybean interactions and offer candidate miRNAs and their targets for further elucidation of the SMV infection process. PMID:26963095

  4. Interactions between the stratum corneum and topically applied products: regulatory, instrumental and formulation issues with focus on moisturizers.

    PubMed

    Lodén, M

    2014-09-01

    Virtually everyone in Europe will use at least one cosmetic product every day. The extensive use of cosmetics and results from measurements of quality of life in patients with skin diseases demonstrate the importance of a healthy skin. The skin is not only a barrier against desiccation and intrusion of harmful materials, but also an organ of social communication, where dry, scaly, rough stratum corneum is unappealing to touch, inducing anxiety and depression. Knowledge about the skin biochemistry and the use of noninvasive instruments facilitate the development of topical products and quantification of their effects. The presentation of the products and mode of action determine the regulatory demands and the approval process, as they can fall into different regulatory entities, such as cosmetics, medicinal products, medical devices and as other chemical products. The majority of the topical products on the market are regulated as cosmetics. For example, facial skin care and daily moisturizing routines are frequently used. However, despite visible relief of dryness symptoms, some products are reported to result in deterioration of the skin barrier function. New clinical outcomes show important clinical differences between formulations and the relapse of eczema. In a worst case scenario, treatment with a moisturizing cream may increase the risks of eczema and asthma. In the present overview, product presentations and mode of actions are reflected against the regulatory demands in Europe. The regulations are continuously revisited and new guidelines are being implemented, such as the new cosmetic regulation with advice on testing and responsible marketing.

  5. Argonaute proteins regulate HIV-1 multiply spliced RNA and viral production in a Dicer independent manner.

    PubMed

    Eckenfelder, Agathe; Ségéral, Emmanuel; Pinzón, Natalia; Ulveling, Damien; Amadori, Céline; Charpentier, Marine; Nidelet, Sabine; Concordet, Jean-Paul; Zagury, Jean-François; Paillart, Jean-Christophe; Berlioz-Torrent, Clarisse; Seitz, Hervé; Emiliani, Stéphane; Gallois-Montbrun, Sarah

    2016-12-20

    Argonaute (Ago) proteins associate with microRNAs (miRNAs) to form the core of the RNA-induced silencing complex (RISC) that mediates post-transcriptional gene silencing of target mRNAs. As key players in anti-viral defense, Ago proteins are thought to have the ability to interact with human immunodeficiency virus type 1 (HIV-1) RNA. However, the role of this interaction in regulating HIV-1 replication has been debated. Here, we used high throughput sequencing of RNA isolated by cross-linking immunoprecipitation (HITS-CLIP) to explore the interaction between Ago2 and HIV-1 RNA in infected cells. By only considering reads of 50 nucleotides length in our analysis, we identified more than 30 distinct binding sites for Ago2 along the viral RNA genome. Using reporter assays, we found four binding sites, located near splice donor sites, capable of repressing Luciferase gene expression in an Ago-dependent manner. Furthermore, inhibition of Ago1 and Ago2 levels in cells expressing HIV-1 led to an increase of viral multiply spliced transcripts and to a strong reduction in the extracellular CAp24 level. Depletion of Dicer did not affect these activities. Our results highlight a new role of Ago proteins in the control of multiply spliced HIV-1 transcript levels and viral production, independently of the miRNA pathway.

  6. 37 CFR 1.791 - Termination of interim extension granted prior to regulatory approval of a product for commercial...

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 37 Patents, Trademarks, and Copyrights 1 2010-07-01 2010-07-01 false Termination of interim extension granted prior to regulatory approval of a product for commercial marketing or use. 1.791 Section 1.791 Patents, Trademarks, and Copyrights UNITED STATES PATENT AND TRADEMARK OFFICE, DEPARTMENT OF COMMERCE GENERAL RULES OF PRACTICE IN PATENT...

  7. Regulation of the small regulatory RNA MicA by ribonuclease III: a target-dependent pathway

    PubMed Central

    Viegas, Sandra C.; Silva, Inês J.; Saramago, Margarida; Domingues, Susana; Arraiano, Cecília M.

    2011-01-01

    MicA is a trans-encoded small non-coding RNA, which downregulates porin-expression in stationary-phase. In this work, we focus on the role of endoribonucleases III and E on Salmonella typhimurium sRNA MicA regulation. RNase III is shown to regulate MicA in a target-coupled way, while RNase E is responsible for the control of free MicA levels in the cell. We purified both Salmonella enzymes and demonstrated that in vitro RNase III is only active over MicA when in complex with its targets (whether ompA or lamB mRNAs). In vivo, MicA is demonstrated to be cleaved by RNase III in a coupled way with ompA mRNA. On the other hand, RNase E is able to cleave unpaired MicA and does not show a marked dependence on its 5′ phosphorylation state. The main conclusion of this work is the existence of two independent pathways for MicA turnover. Each pathway involves a distinct endoribonuclease, having a different role in the context of the fine-tuned regulation of porin levels. Cleavage of MicA by RNase III in a target-dependent fashion, with the concomitant decay of the mRNA target, strongly resembles the eukaryotic RNAi system, where RNase III-like enzymes play a pivotal role. PMID:21138960

  8. Regulation of the small regulatory RNA MicA by ribonuclease III: a target-dependent pathway.

    PubMed

    Viegas, Sandra C; Silva, Inês J; Saramago, Margarida; Domingues, Susana; Arraiano, Cecília M

    2011-04-01

    MicA is a trans-encoded small non-coding RNA, which downregulates porin-expression in stationary-phase. In this work, we focus on the role of endoribonucleases III and E on Salmonella typhimurium sRNA MicA regulation. RNase III is shown to regulate MicA in a target-coupled way, while RNase E is responsible for the control of free MicA levels in the cell. We purified both Salmonella enzymes and demonstrated that in vitro RNase III is only active over MicA when in complex with its targets (whether ompA or lamB mRNAs). In vivo, MicA is demonstrated to be cleaved by RNase III in a coupled way with ompA mRNA. On the other hand, RNase E is able to cleave unpaired MicA and does not show a marked dependence on its 5' phosphorylation state. The main conclusion of this work is the existence of two independent pathways for MicA turnover. Each pathway involves a distinct endoribonuclease, having a different role in the context of the fine-tuned regulation of porin levels. Cleavage of MicA by RNase III in a target-dependent fashion, with the concomitant decay of the mRNA target, strongly resembles the eukaryotic RNAi system, where RNase III-like enzymes play a pivotal role.

  9. Distribution, evolution, and diversity of retrotransposons at the flamenco locus reflect the regulatory properties of piRNA clusters.

    PubMed

    Zanni, Vanessa; Eymery, Angéline; Coiffet, Michael; Zytnicki, Matthias; Luyten, Isabelle; Quesneville, Hadi; Vaury, Chantal; Jensen, Silke

    2013-12-03

    Most of our understanding of Drosophila heterochromatin structure and evolution has come from the annotation of heterochromatin from the isogenic y; cn bw sp strain. However, almost nothing is known about the heterochromatin's structural dynamics and evolution. Here, we focus on a 180-kb heterochromatic locus producing Piwi-interacting RNAs (piRNA cluster), the flamenco (flam) locus, known to be responsible for the control of at least three transposable elements (TEs). We report its detailed structure in three different Drosophila lines chosen according to their capacity to repress or not to repress the expression of two retrotransposons named ZAM and Idefix, and we show that they display high structural diversity. Numerous rearrangements due to homologous and nonhomologous recombination, deletions and segmental duplications, and loss and gain of TEs are diverse sources of active genomic variation at this locus. Notably, we evidence a correlation between the presence of ZAM and Idefix in this piRNA cluster and their silencing. They are absent from flam in the strain where they are derepressed. We show that, unexpectedly, more than half of the flam locus results from recent TE insertions and that most of the elements concerned are prone to horizontal transfer between species of the melanogaster subgroup. We build a model showing how such high and constant dynamics of a piRNA master locus open the way to continual emergence of new patterns of piRNA biogenesis leading to changes in the level of transposition control.

  10. Distribution, evolution, and diversity of retrotransposons at the flamenco locus reflect the regulatory properties of piRNA clusters

    PubMed Central

    Zanni, Vanessa; Eymery, Angéline; Coiffet, Michael; Zytnicki, Matthias; Luyten, Isabelle; Quesneville, Hadi; Vaury, Chantal; Jensen, Silke

    2013-01-01

    Most of our understanding of Drosophila heterochromatin structure and evolution has come from the annotation of heterochromatin from the isogenic y; cn bw sp strain. However, almost nothing is known about the heterochromatin’s structural dynamics and evolution. Here, we focus on a 180-kb heterochromatic locus producing Piwi-interacting RNAs (piRNA cluster), the flamenco (flam) locus, known to be responsible for the control of at least three transposable elements (TEs). We report its detailed structure in three different Drosophila lines chosen according to their capacity to repress or not to repress the expression of two retrotransposons named ZAM and Idefix, and we show that they display high structural diversity. Numerous rearrangements due to homologous and nonhomologous recombination, deletions and segmental duplications, and loss and gain of TEs are diverse sources of active genomic variation at this locus. Notably, we evidence a correlation between the presence of ZAM and Idefix in this piRNA cluster and their silencing. They are absent from flam in the strain where they are derepressed. We show that, unexpectedly, more than half of the flam locus results from recent TE insertions and that most of the elements concerned are prone to horizontal transfer between species of the melanogaster subgroup. We build a model showing how such high and constant dynamics of a piRNA master locus open the way to continual emergence of new patterns of piRNA biogenesis leading to changes in the level of transposition control. PMID:24248389

  11. Production of infectious RNA transcripts from full-length cDNA clones representing two subgroups of peanut stunt virus strains: mapping satellite RNA support to RNA1.

    PubMed

    Hu, C C; Sanger, M; Ghabrial, S A

    1998-08-01

    Full-length cDNA clones from which infectious transcripts could be generated were constructed from the genomic RNAs of two distinct strains of peanut stunt cucumovirus (PSV), PSV-ER and PSV-W. PSV-ER, a subgroup I strain, is known to support efficient replication of satellite RNA (satRNA) in infected plants, whereas PSV-W, a subgroup II strain, does not support satRNA replication. Although artificial reassortants (pseudorecombinants) of all possible combinations of infectious transcripts representing RNA1, RNA2 and RNA3 were infectious, only those having RNA1 from PSV-ER supported the replication of satRNA. These results demonstrate conclusively that support of PSV satRNA replication maps to RNA1. Comparisons of secondary structure predictions of the C-terminal helicase-like domain of the 1a proteins of four PSV strains belonging to two subgroups did not reveal any obvious differences between strains that differ in satRNA support. The complete nucleotide sequence of RNA1 from strains PSV-ER and PSV-W were determined and found to be 79% identical. Sequence comparison analysis of RNA1 sequences of cucumoviruses confirmed the placement of the PSV strains into two distinct subgroups.

  12. Regulatory roles of microRNA-708 and microRNA-31 in proliferation, apoptosis and invasion of colorectal cancer cells

    PubMed Central

    LEI, SAN-LIN; ZHAO, HUA; YAO, HONG-LIANG; CHEN, YONG; LEI, ZHEN-DONG; LIU, KUI-JIE; YANG, QUN

    2014-01-01

    MicroRNAs (miRs) function as key regulators of gene expression and their deregulation is associated with the carcinogenesis of various cancers. In the present study, the aim was to validate the potential roles and regulatory mechanisms of miR-708 and miR-31 in colorectal cancer (CRC) cells. miR-708 and miR-31 were found to be highly expressed in five CRC tissue samples. Functional studies showed that the inhibition of miR-708 and miR-31 inhibited cell proliferation and invasion, however, promoted apoptosis in vitro. Subsequently, it was identified that miR-708 and miR-31 directly target cyclin-dependent kinase inhibitor 2B (CDKN2B) by binding to the 3′ untranslated region, which suppresses the CDKN2B protein levels. In addition, the CDKN2B protein levels were significantly reduced when there was high miR-708 and miR-31 expression in the CRC tissue samples. The results indicate that miR-31 and miR-708 function in an oncogenic manner in CRC development, and inhibition of the two miRs may be used as a therapeutic strategy for patients with CRC. PMID:25202407

  13. Regulatory roles of microRNA-708 and microRNA-31 in proliferation, apoptosis and invasion of colorectal cancer cells.

    PubMed

    Lei, San-Lin; Zhao, Hua; Yao, Hong-Liang; Chen, Yong; Lei, Zhen-Dong; Liu, Kui-Jie; Yang, Qun

    2014-10-01

    MicroRNAs (miRs) function as key regulators of gene expression and their deregulation is associated with the carcinogenesis of various cancers. In the present study, the aim was to validate the potential roles and regulatory mechanisms of miR-708 and miR-31 in colorectal cancer (CRC) cells. miR-708 and miR-31 were found to be highly expressed in five CRC tissue samples. Functional studies showed that the inhibition of miR-708 and miR-31 inhibited cell proliferation and invasion, however, promoted apoptosis in vitro. Subsequently, it was identified that miR-708 and miR-31 directly target cyclin-dependent kinase inhibitor 2B (CDKN2B) by binding to the 3' untranslated region, which suppresses the CDKN2B protein levels. In addition, the CDKN2B protein levels were significantly reduced when there was high miR-708 and miR-31 expression in the CRC tissue samples. The results indicate that miR-31 and miR-708 function in an oncogenic manner in CRC development, and inhibition of the two miRs may be used as a therapeutic strategy for patients with CRC.

  14. Identification of co-expression gene networks, regulatory genes and pathways for obesity based on adipose tissue RNA Sequencing in a porcine model

    PubMed Central

    2014-01-01

    Background Obesity is a complex metabolic condition in strong association with various diseases, like type 2 diabetes, resulting in major public health and economic implications. Obesity is the result of environmental and genetic factors and their interactions, including genome-wide genetic interactions. Identification of co-expressed and regulatory genes in RNA extracted from relevant tissues representing lean and obese individuals provides an entry point for the identification of genes and pathways of importance to the development of obesity. The pig, an omnivorous animal, is an excellent model for human obesity, offering the possibility to study in-depth organ-level transcriptomic regulations of obesity, unfeasible in humans. Our aim was to reveal adipose tissue co-expression networks, pathways and transcriptional regulations of obesity using RNA Sequencing based systems biology approaches in a porcine model. Methods We selected 36 animals for RNA Sequencing from a previously created F2 pig population representing three extreme groups based on their predicted genetic risks for obesity. We applied Weighted Gene Co-expression Network Analysis (WGCNA) to detect clusters of highly co-expressed genes (modules). Additionally, regulator genes were detected using Lemon-Tree algorithms. Results WGCNA revealed five modules which were strongly correlated with at least one obesity-related phenotype (correlations ranging from -0.54 to 0.72, P < 0.001). Functional annotation identified pathways enlightening the association between obesity and other diseases, like osteoporosis (osteoclast differentiation, P = 1.4E-7), and immune-related complications (e.g. Natural killer cell mediated cytotoxity, P = 3.8E-5; B cell receptor signaling pathway, P = 7.2E-5). Lemon-Tree identified three potential regulator genes, using confident scores, for the WGCNA module which was associated with osteoclast differentiation: CCR1, MSR1 and SI1 (probability scores respectively 95.30, 62.28, and

  15. Cytoplasmic inositol hexakisphosphate production is sufficient for mediating the Gle1-mRNA export pathway.

    PubMed

    Miller, Aimee L; Suntharalingam, Mythili; Johnson, Sylvia L; Audhya, Anjon; Emr, Scott D; Wente, Susan R

    2004-12-03

    Production of inositol hexakisphosphate (IP6) by Ipk1, the inositol-1,3,4,5,6-pentakisphosphate 2-kinase, is required for Gle1-mediated mRNA export in Saccharomyces cerevisiae cells. To examine the network of interactions that require IP6 production, an analysis of fitness defects was conducted in mutants harboring both an ipk1 null allele and a mutant allele in genes encoding nucleoporins or transport factors. Enhanced lethality was observed with a specific subset of mutants, including nup42, nup116, nup159, dbp5, and gle2, all of which had been previously connected to Gle1 function. Complementation of the nup116Deltaipk1Delta and nup42Deltaipk1Delta double mutants did not require the Phe-Gly repeat domains in the respective nucleoporins, suggesting that IP6 was acting subsequent to heterogeneous nuclear ribonucleoprotein targeting to the nuclear pore complex. With Nup42 and Nup159 localized exclusively to the nuclear pore complex cytoplasmic side, we speculated that IP6 may regulate a cytoplasmic step in mRNA export. To test this prediction, the spatial requirements for the production of IP6 were investigated. Restriction of Ipk1 to the cytoplasm did not block IP6 production. Moreover, coincident sequestering of both Ipk1 and Mss4 (an enzyme required for phosphatidylinositol 4,5-bisphosphate production) to the cytoplasm also did not block IP6 production. Given that the kinase required for inositol 1,3,4,5,6-pentakisphosphate production (Ipk2) is localized in the nucleus, these results indicated that soluble inositides were diffusing between the nucleus and the cytoplasm. Additionally, the cytoplasmic production of IP6 by plasma membrane-anchored Ipk1 rescued a gle1-2 ipk1-4 synthetic lethal mutant. Thus, cytoplasmic IP6 production is sufficient for mediating the Gle1-mRNA export pathway.

  16. The RNA Chaperone Hfq Impacts Growth, Metabolism and Production of Virulence Factors in Yersinia enterocolitica

    PubMed Central

    Kakoschke, Tamara; Kakoschke, Sara; Magistro, Giuseppe; Schubert, Sören; Borath, Marc; Heesemann, Jürgen; Rossier, Ombeline

    2014-01-01

    To adapt to changes in environmental conditions, bacteria regulate their gene expression at the transcriptional but also at the post-transcriptional level, e.g. by small RNAs (sRNAs) which modulate mRNA stability and translation. The conserved RNA chaperone Hfq mediates the interaction of many sRNAs with their target mRNAs, thereby playing a global role in fine-tuning protein production. In this study, we investigated the significance of Hfq for the enteropathogen Yersina enterocolitica serotype O:8. Hfq facilitated optimal growth in complex and minimal media. Our comparative protein analysis of parental and hfq-negative strains suggested that Hfq promotes lipid metabolism and transport, cell redox homeostasis, mRNA translation and ATP synthesis, and negatively affects carbon and nitrogen metabolism, transport of siderophore and peptides and tRNA synthesis. Accordingly, biochemical tests indicated that Hfq represses ornithine decarboxylase activity, indole production and utilization of glucose, mannitol, inositol and 1,2-propanediol. Moreover, Hfq repressed production of the siderophore yersiniabactin and its outer membrane receptor FyuA. In contrast, hfq mutants exhibited reduced urease production. Finally, strains lacking hfq were more susceptible to acidic pH and oxidative stress. Unlike previous reports in other Gram-negative bacteria, Hfq was dispensable for type III secretion encoded by the virulence plasmid. Using a chromosomally encoded FLAG-tagged Hfq, we observed increased production of Hfq-FLAG in late exponential and stationary phases. Overall, Hfq has a profound effect on metabolism, resistance to stress and modulates the production of two virulence factors in Y. enterocolitica, namely urease and yersiniabactin. PMID:24454955

  17. [Future Regulatory Science through a Global Product Development Strategy to Overcome the Device Lag].

    PubMed

    Tsuchii, Isao

    2016-01-01

    Environment that created "medical device lag (MDL)" has changed dramatically, and currently that term is not heard often. This was mainly achieved through the leadership of three groups: government, which determined to overcome MDL and took steps to do so; medical societies, which exhibited accountability in trial participation; and MD companies, which underwent a change in mindset that allowed comprehensive tripartite cooperation to reach the current stage. In particular, the global product development strategy (GPDS) of companies in a changing social environment has taken a new-turn with international harmonization trends, like Global Harmonization Task Force and International Council for Harmonisation of Technical Requirements for Registration of Pharmaceuticals for Human Use. As a result, this evolution has created opportunities for treatment with cutting-edge MDs in Japanese society. Simultaneously, it has had a major impact on the planning process of GPDS of companies. At the same time, the interest of global companies has shifted to emerging economies for future potential profit since Japan no longer faces MDL issue. This economic trend makes MDLs a greater problem for manufacturers. From the regulatory science viewpoint, this new environment has not made it easy to plan a global strategy that will be adaptable to local societies. Without taking hasty action, flexible thinking from the global point of view is necessary to enable the adjustment of local strategies to fit the situation on the ground so that the innovative Japanese medical technology can be exported to a broad range of societies.

  18. Dissecting and engineering metabolic and regulatory networks of thermophilic bacteria for biofuel production.

    PubMed

    Lin, Lu; Xu, Jian

    2013-11-01

    Interest in thermophilic bacteria as live-cell catalysts in biofuel and biochemical industry has surged in recent years, due to their tolerance of high temperature and wide spectrum of carbon-sources that include cellulose. However their direct employment as microbial cellular factories in the highly demanding industrial conditions has been hindered by uncompetitive biofuel productivity, relatively low tolerance to solvent and osmic stresses, and limitation in genome engineering tools. In this work we review recent advances in dissecting and engineering the metabolic and regulatory networks of thermophilic bacteria for improving the traits of key interest in biofuel industry: cellulose degradation, pentose-hexose co-utilization, and tolerance of thermal, osmotic, and solvent stresses. Moreover, new technologies enabling more efficient genetic engineering of thermophiles were discussed, such as improved electroporation, ultrasound-mediated DNA delivery, as well as thermo-stable plasmids and functional selection systems. Expanded applications of such technological advancements in thermophilic microbes promise to substantiate a synthetic biology perspective, where functional parts, module, chassis, cells and consortia were modularly designed and rationally assembled for the many missions at industry and nature that demand the extraordinary talents of these extremophiles.

  19. Effect of various stress-regulatory factors on biomass and lipid production in microalga Haematococcus pluvialis.

    PubMed

    Saha, Sushanta Kumar; McHugh, Edward; Hayes, Jeremiah; Moane, Siobhan; Walsh, Daniel; Murray, Patrick

    2013-01-01

    To maximize the biomass and lipid production for applications in food or biofuel feedstock, nine stress conditions were tested considering N and/or P limitations, light intensity & quality, for Haematococcus pluvialis SCCAP K-0084 cultivation. Photosynthetically active radiation (PAR), warm white light emitting diode (WWLED), and white light emitting diode (WLED) at illumination of 240 μmol photons m(-2) sec(-1) were the best stress-regulatory factors. PAR without P & low N conditions yielded high biomass with 33% lipids containing increased C16:0 and C18:0 saturated fatty acids, and reduced unsaturated fatty acids (UFAs) (oleic, linoleic, and α/γ-linolenic). WWLED and WLED without P conditions also yielded high biomass, but 25% lipids with increased amounts of UFAs. Red light emitting diode (RLED) without P & low N conditions yielded 46% lipids with lowest biomass. PAR and WWLED & WLED illuminated conditions were found suitable respectively for biodiesel feedstock lipids and UFA-rich lipids for multiple applications.

  20. A Nascent Peptide Signal Responsive to Endogenous Levels of Polyamines Acts to Stimulate Regulatory Frameshifting on Antizyme mRNA.

    PubMed

    Yordanova, Martina M; Wu, Cheng; Andreev, Dmitry E; Sachs, Matthew S; Atkins, John F

    2015-07-17

    The protein antizyme is a negative regulator of cellular polyamine concentrations from yeast to mammals. Synthesis of functional antizyme requires programmed +1 ribosomal frameshifting at the 3' end of the first of two partially overlapping ORFs. The frameshift is the sensor and effector in an autoregulatory circuit. Except for Saccharomyces cerevisiae antizyme mRNA, the frameshift site alone only supports low levels of frameshifting. The high levels usually observed depend on the presence of cis-acting stimulatory elements located 5' and 3' of the frameshift site. Antizyme genes from different evolutionary branches have evolved different stimulatory elements. Prior and new multiple alignments of fungal antizyme mRNA sequences from the Agaricomycetes class of Basidiomycota show a distinct pattern of conservation 5' of the frameshift site consistent with a function at the amino acid level. As shown here when tested in Schizosaccharomyces pombe and mammalian HEK293T cells, the 5' part of this conserved sequence acts at the nascent peptide level to stimulate the frameshifting, without involving stalling detectable by toe-printing. However, the peptide is only part of the signal. The 3' part of the stimulator functions largely independently and acts at least mostly at the nucleotide level. When polyamine levels were varied, the stimulatory effect was seen to be especially responsive in the endogenous polyamine concentration range, and this effect may be more general. A conserved RNA secondary structure 3' of the frameshift site has weaker stimulatory and polyamine sensitizing effects on frameshifting.

  1. Novel regulatory principles of the spliceosomal Brr2 RNA helicase and links to retinal disease in humans.

    PubMed

    Mozaffari-Jovin, Sina; Wandersleben, Traudy; Santos, Karine F; Will, Cindy L; Lührmann, Reinhard; Wahl, Markus C

    2014-01-01

    For each round of pre-mRNA splicing, a spliceosome is assembled anew on its substrate. RNA-protein remodeling events required for spliceosome assembly, splicing catalysis, and spliceosome disassembly are driven and controlled by a conserved group of ATPases/RNA helicases. The activities of most of these enzymes are timed by their recruitment to the spliceosome. The Brr2 enzyme, however, which mediates spliceosome catalytic activation, is a stable subunit of the spliceosome, and thus, requires special regulation. Recent structural and functional studies have revealed diverse mechanisms whereby an RNaseH-like and a Jab1/MPN-like domain of the Prp8 protein regulate Brr2 activity during splicing both positively and negatively. Reversible Brr2 inhibition might in part be achieved via an intrinsically unstructured element of the Prp8 Jab1/MPN domain, a concept widespread in biological systems. Mutations leading to changes in the Prp8 Jab1/MPN domain, which are linked to a severe form of retinitis pigmentosa, disrupt Jab1/MPN-mediated regulation of Brr2.

  2. Regulatory insights into the production of UDP-N-acetylglucosamine by Lactobacillus casei.

    PubMed

    Rodríguez-Díaz, Jesús; Rubio-Del-Campo, Antonio; Yebra, María J

    2012-01-01

    UDP-N-acetylglucosamine (UDP-GlcNAc) is an important sugar nucleotide used as a precursor of cell wall components in bacteria, and as a substrate in the synthesis of oligosaccharides in eukaryotes. In bacteria UDP-GlcNAc is synthesized from the glycolytic intermediate D-fructose-6-phosphate (fructose-6P) by four successive reactions catalyzed by three enzymes: glucosamine-6-phosphate synthase (GlmS), phosphoglucosamine mutase (GlmM) and the bi-functional enzyme glucosamine-1-phosphate acetyltransferase/ N-acetylglucosamine-1-phosphate uridyltransferase (GlmU). We have previously reported a metabolic engineering strategy in Lactobacillus casei directed to increase the intracellular levels of UDP-GlcNAc by homologous overexpression of the genes glmS, glmM and glmU. One of the most remarkable features regarding the production of UDP-GlcNAc in L. casei was to find multiple regulation points on its biosynthetic pathway: (1) regulation by the NagB enzyme, (2) glmS RNA specific degradation through the possible participation of a glmS riboswitch mechanism, (3) regulation of the GlmU activity probably by end product inhibition and (4) transcription of glmU.

  3. Regulatory insights into the production of UDP-N-acetylglucosamine by Lactobacillus casei

    PubMed Central

    Rodríguez-Díaz, Jesús; Rubio-del-Campo, Antonio; Yebra, María J.

    2012-01-01

    UDP-N-acetylglucosamine (UDP-GlcNAc) is an important sugar nucleotide used as a precursor of cell wall components in bacteria, and as a substrate in the synthesis of oligosaccharides in eukaryotes. In bacteria UDP-GlcNAc is synthesized from the glycolytic intermediate D-fructose-6-phosphate (fructose-6P) by four successive reactions catalyzed by three enzymes: glucosamine-6-phosphate synthase (GlmS), phosphoglucosamine mutase (GlmM) and the bi-functional enzyme glucosamine-1-phosphate acetyltransferase/ N-acetylglucosamine-1-phosphate uridyltransferase (GlmU). We have previously reported a metabolic engineering strategy in Lactobacillus casei directed to increase the intracellular levels of UDP-GlcNAc by homologous overexpression of the genes glmS, glmM and glmU. One of the most remarkable features regarding the production of UDP-GlcNAc in L. casei was to find multiple regulation points on its biosynthetic pathway: (1) regulation by the NagB enzyme, (2) glmS RNA specific degradation through the possible participation of a glmS riboswitch mechanism, (3) regulation of the GlmU activity probably by end product inhibition and (4) transcription of glmU. PMID:22825354

  4. RNA Sequencing of Laser-Capture Microdissected Compartments of the Maize Kernel Identifies Regulatory Modules Associated with Endosperm Cell Differentiation[OPEN

    PubMed Central

    Zhan, Junpeng; Thakare, Dhiraj; Ma, Chuang; Lloyd, Alan; Nixon, Neesha M.; Arakaki, Angela M.; Burnett, William J.; Logan, Kyle O.; Wang, Dongfang; Wang, Xiangfeng; Drews, Gary N.; Yadegari, Ramin

    2015-01-01

    Endosperm is an absorptive structure that supports embryo development or seedling germination in angiosperms. The endosperm of cereals is a main source of food, feed, and industrial raw materials worldwide. However, the genetic networks that regulate endosperm cell differentiation remain largely unclear. As a first step toward characterizing these networks, we profiled the mRNAs in five major cell types of the differentiating endosperm and in the embryo and four maternal compartments of the maize (Zea mays) kernel. Comparisons of these mRNA populations revealed the diverged gene expression programs between filial and maternal compartments and an unexpected close correlation between embryo and the aleurone layer of endosperm. Gene coexpression network analysis identified coexpression modules associated with single or multiple kernel compartments including modules for the endosperm cell types, some of which showed enrichment of previously identified temporally activated and/or imprinted genes. Detailed analyses of a coexpression module highly correlated with the basal endosperm transfer layer (BETL) identified a regulatory module activated by MRP-1, a regulator of BETL differentiation and function. These results provide a high-resolution atlas of gene activity in the compartments of the maize kernel and help to uncover the regulatory modules associated with the differentiation of the major endosperm cell types. PMID:25783031

  5. A direct link between the global regulator PhoP and the Csr regulon in Y. pseudotuberculosis through the small regulatory RNA CsrC.

    PubMed

    Nuss, Aaron M; Schuster, Franziska; Kathrin Heroven, Ann; Heine, Wiebke; Pisano, Fabio; Dersch, Petra

    2014-01-01

    In this study we investigated the influence of the global response regulator PhoP on the complex regulatory cascade controlling expression of early stage virulence genes of Yersinia pseudotuberculosis via the virulence regulator RovA. Our analysis revealed the following novel features: (1) PhoP activates expression of the CsrC RNA in Y. pseudotuberculosis, leading to activation of RovA synthesis through the CsrABC-RovM cascade, (2) activation of csrC transcription is direct and PhoP is shown to bind to two separate PhoP box-like sites, (3) PhoP-mediated activation results in transcription from two different promoters closely downstream of the PhoP binding sites, leading to two distinct CsrC RNAs, and (4) the stability of the CsrC RNAs differs significantly between the Y. pseudotuberculosis strains YPIII and IP32953 due to a 20 nucleotides insertion in CsrC(IP32953), which renders the transcript more susceptible to degradation. In summary, our study showed that PhoP-mediated influence on the regulatory cascade controlling the Csr system and RovA in Y. pseudotuberculosis varies within the species, suggesting that the Csr system is a focal point to readjust and adapt the genus to different hosts and reservoirs.

  6. [Improvement of natamycin production in an industrial strain by heterologous expression of the afsRS(cla) global regulatory genes].

    PubMed

    Tao, Zhengsheng; Wang, Yemin; Zheng, Hualiang; Tao, Meifeng

    2015-05-01

    The afsRS(cla) global regulatory genes from Streptomyces clavuligerus activate the production of two antibiotics in Streptomyces lividans. In this study, we gained an increase of 38% in the production of natamycin (3.56 g/L) in an industrial strain Streptomyces gilvosporeus TZ1401 through the integration of pHL851 that bears the afsRS(cla) global regulatory genes into its genome. We discovered by quantitive real-time reverse transcription PCR (qRT-PCR) that the expression of 6 genes of the natamycin biosynthetic gene cluster were improved from 1.9 to 2.7 times. This suggests that afsRS(cla) improve the production of natamycin through increased transcription. This study provides a good example for applying afsRS(cla) in high yield breeding of industrial antibiotic producers.

  7. Inhibition of pathologic immunoglobulin free light chain production by small interfering RNA molecules

    PubMed Central

    Phipps, Jonathan E.; Kestler, Daniel P.; Foster, James S.; Kennel, Stephen J.; Donnell, Robert; Weiss, Deborah T.; Solomon, Alan; Wall, Jonathan S.

    2010-01-01

    Objectives Morbidity and mortality occurring in patients with multiple myeloma, AL amyloidosis, and light chain deposition disease can result from the pathologic deposition of monoclonal Ig light chains (LCs) in kidneys and other organs. To reduce synthesis of such components, therapy for these disorders typically has involved anti-plasma cell agents; however, this approach is not always effective and can have adverse consequences. We have investigated another means to achieve this objective; namely, RNA interference (RNAi). Materials and Methods SP2/O mouse myeloma cells were stably transfected with a construct encoding a λ6 LC (Wil) under control of the CMV promoter, while λ2-producing myeloma cell line RPMI 8226 was purchased from the ATCC. Both were treated with small interfering RNA (siRNA) directed specifically to the V, J, or C portions of the molecules and then analyzed by ELISA, flow cytometry and real time PCR. Results Transfected cells were found to constitutively express detectable quantities of mRNA and protein Wil and, after exposure to siRNAs, an ~40% reduction in mRNA and LC production was evidenced at 48 hours. An even greater effect was seen with the 8226 cells. Conclusion Our results have shown that RNAi can markedly reduce LC synthesis and provide the basis for testing the therapeutic potential of this strategy using in vivo experimental models of multiple myeloma. PMID:20637260

  8. Cell therapy medicinal product regulatory framework in Europe and its application for MSC-based therapy development.

    PubMed

    Ancans, Janis

    2012-01-01

    Advanced therapy medicinal products (ATMPs), including cell therapy products, form a new class of medicines in the European Union. Since the ATMPs are at the forefront of scientific innovation in medicine, specific regulatory framework has been developed for these medicines and implemented from 2009. The Committee for Advanced Therapies (CAT) has been established at the European Medicines Agency (EMA) for centralized classification, certification and evaluation procedures, and other ATMP-related tasks. Guidance documents, initiatives, and interaction platforms are available to make the new framework more accessible for small- and medium-sized enterprises, academia, hospitals, and foundations. Good understanding of the centralized and national components of the regulatory system is required to plan product development. It is in the best interests of the cell therapy developers to utilize the resources provided starting with the pre-clinical stage. Whilst there have been no mesenchymal stem cell (MSC)-based medicine authorizations in the EU, three MSC products have received marketing approval in other regions since 2011. The information provided on the regulatory requirements, procedures, and initiatives is aimed at facilitating MSC-based medicinal product development and authorization in the EU.

  9. Cell therapy medicinal product regulatory framework in Europe and its application for MSC-based therapy development

    PubMed Central

    Ancans, Janis

    2012-01-01

    Advanced therapy medicinal products (ATMPs), including cell therapy products, form a new class of medicines in the European Union. Since the ATMPs are at the forefront of scientific innovation in medicine, specific regulatory framework has been developed for these medicines and implemented from 2009. The Committee for Advanced Therapies (CAT) has been established at the European Medicines Agency (EMA) for centralized classification, certification and evaluation procedures, and other ATMP-related tasks. Guidance documents, initiatives, and interaction platforms are available to make the new framework more accessible for small- and medium-sized enterprises, academia, hospitals, and foundations. Good understanding of the centralized and national components of the regulatory system is required to plan product development. It is in the best interests of the cell therapy developers to utilize the resources provided starting with the pre-clinical stage. Whilst there have been no mesenchymal stem cell (MSC)-based medicine authorizations in the EU, three MSC products have received marketing approval in other regions since 2011. The information provided on the regulatory requirements, procedures, and initiatives is aimed at facilitating MSC-based medicinal product development and authorization in the EU. PMID:22912639

  10. Main Reasons for Registration Application Refusal of Generic and Similar Pharmaceutical Drug Products by the Brazilian Health Regulatory Agency (ANVISA)

    PubMed Central

    do Carmo, Ana Cerúlia Moraes; Piras, Stefânia Schimaneski; Rocha, Nayrton Flávio Moura

    2017-01-01

    Objective. The marketing authorization of generic and similar pharmaceutical drug products involves the analysis of proposing company's administrative aspects as well as drug product technical description and scientific evaluations. This study evaluated the main reasons for registration refusal of generic and similar pharmaceutical drug products in Brazil. The aim is to help future applicants to better organize the proposal. Methods. A retrospective search of drug products registration processes was performed on the Brazilian Government Official Gazette from January 1, 2015, and December 31, 2015. Results. Drug product quality control, drug product stability study, deadline accomplishment, API quality control made by drug manufacturer, active pharmaceutical ingredient (API), and production report were the main reasons for marketing authorization application refusal of generic and similar pharmaceutical drug products in 2015. Conclusion. Disclosure of the reasons behind failed applications is a step forward on regulatory transparency. Sharing of experiences is essential to international regulatory authorities and organizations to improve legislation requirements for the marketing authorization of generic and similar pharmaceutical drug products. PMID:28280742

  11. bldA dependence of undecylprodigiosin production in Streptomyces coelicolor A3(2) involves a pathway-specific regulatory cascade.

    PubMed Central

    White, J; Bibb, M

    1997-01-01

    The production of the red-pigmented tripyrrole antibiotic undecylprodigiosin (Red) by Streptomyces coelicolor A3(2) depends on two pathway-specific regulatory genes, redD and redZ. RedD is homologous to several other proteins that regulate antibiotic production in streptomycetes; RedZ is a member of the response regulator family. redZ transcripts were detected during exponential growth and increased in amount during transition and stationary phases; transcription of redD was confined to the two latter stages of growth. Whereas mutation of redD had no effect on redZ transcription, transcription of redD was highly dependent on redZ, suggesting that RedZ is a transcriptional activator of redD. bldA, which encodes the only tRNA of S. coelicolor that can efficiently translate the rare leucine codon UUA, is required for Red production at higher phosphate concentrations. While the redD transcript contains no UUA codons, the redZ mRNA contains one. Transcription of redZ appeared to be unaffected in a bldA mutant; in contrast, redD transcription was undetectable, consistent with the translational dependence of redZ on bldA and the transcriptional dependence of redD on redZ. Red production in a bldA mutant was restored by multiple copies of redZ, presumably reflecting a low level of mistranslation of the redZ UUA codon, while multiple copies of redD had no effect, presumably a consequence of the severe dependence of redD transcription on RedZ. Transcription of redZ appears to be negatively autoregulated. PMID:9006013

  12. The RNase III enzyme DROSHA is essential for microRNA production and spermatogenesis.

    PubMed

    Wu, Qiuxia; Song, Rui; Ortogero, Nicole; Zheng, Huili; Evanoff, Ryan; Small, Chris L; Griswold, Michael D; Namekawa, Satoshi H; Royo, Helene; Turner, James M; Yan, Wei

    2012-07-20

    DROSHA is a nuclear RNase III enzyme responsible for cleaving primary microRNAs (miRNAs) into precursor miRNAs and thus is essential for the biogenesis of canonical miRNAs. DICER is a cytoplasmic RNase III enzyme that not only cleaves precursor miRNAs to produce mature miRNAs but also dissects naturally formed/synthetic double-stranded RNAs to generate small interfering RNAs (siRNAs). To investigate the role of canonical miRNA and/or endogenous siRNA production in spermatogenesis, we generated Drosha or Dicer conditional knock-out (cKO) mouse lines by inactivating Drosha or Dicer exclusively in spermatogenic cells in postnatal testes using the Cre-loxp strategy. Both Drosha and Dicer cKO males were infertile due to disrupted spermatogenesis characterized by depletion of spermatocytes and spermatids leading to oligoteratozoospermia or azoospermia. The developmental course of spermatogenic disruptions was similar at morphological levels between Drosha and Dicer cKO males, but Drosha cKO testes appeared to be more severe in spermatogenic disruptions than Dicer cKO testes. Microarray analyses revealed transcriptomic differences between Drosha- and Dicer-null pachytene spermatocytes or round spermatids. Although levels of sex-linked mRNAs were mildly elevated, meiotic sex chromosome inactivation appeared to have occurred normally. Our data demonstrate that unlike DICER, which is required for the biogenesis of several small RNA species, DROSHA is essential mainly for the canonical miRNA production, and DROSHA-mediated miRNA production is essential for normal spermatogenesis and male fertility.

  13. The product of the imprinted H19 gene is an oncofetal RNA.

    PubMed Central

    Ariel, I.; Ayesh, S.; Perlman, E. J.; Pizov, G.; Tanos, V.; Schneider, T.; Erdmann, V. A.; Podeh, D.; Komitowski, D.; Quasem, A. S.; de Groot, N.; Hochberg, A.

    1997-01-01

    AIMS/BACKGROUND: The H19 gene is an imprinted, maternally expressed gene in humans. It is tightly linked and coregulated with the imprinted, paternally expressed gene of insulin-like growth factor 2. The H19 gene product is not translated into protein and functions as an RNA molecule. Although its role has been investigated for more than a decade, its biological function is still not understood fully. H19 is abundantly expressed in many tissues from early stages of embryogenesis through fetal life, and is down regulated postnatally. It is also expressed in certain childhood and adult tumours. This study was designed to screen the expression of H19 in human cancer and its relation to the expression of H19 in the fetus. METHODS: Using in situ hybridisation with a [35S] labelled probe, H19 mRNA was detected in paraffin wax sections of fetal tissues from the first and second trimesters of pregnancy and of a large array of human adult and childhood tumours arising from these tissues. RESULTS: The H19 gene is expressed in tumours arising from tissues which express this gene in fetal life. Its expression in the fetus and in cancer is closely linked with tissue differentiation. CONCLUSIONS: Based on these and previous data, H19 is neither a tumour suppressor gene nor an oncogene. Its product is an oncofetal RNA. The potential use of this RNA as a tumour marker should be evaluated. Images PMID:9208812

  14. Engineering Structurally Interacting RNA (sxRNA).

    PubMed

    Doyle, Francis; Lapsia, Sameer; Spadaro, Salvatore; Wurz, Zachary E; Bhaduri-McIntosh, Sumita; Tenenbaum, Scott A

    2017-03-28

    RNA-based three-way junctions (3WJs) are naturally occurring structures found in many functional RNA molecules including rRNA, tRNA, snRNA and ribozymes. 3WJs are typically characterized as resulting from an RNA molecule folding back on itself in cis but could also form in trans when one RNA, for instance a microRNA binds to a second structured RNA, such as a mRNA. Trans-3WJs can influence the final shape of one or both of the RNA molecules and can thus provide a means for modulating the availability of regulatory motifs including potential protein or microRNA binding sites. Regulatory 3WJs generated in trans represent a newly identified regulatory category that we call structurally interacting RNA or sxRNA for convenience. Here we show that they can be rationally designed using familiar cis-3WJ examples as a guide. We demonstrate that an sxRNA "bait" sequence can be designed to interact with a specific microRNA "trigger" sequence, creating a regulatable RNA-binding protein motif that retains its functional activity. Further, we show that when placed downstream of a coding sequence, sxRNA can be used to switch "ON" translation of that sequence in the presence of the trigger microRNA and the amount of translation corresponded with the amount of microRNA present.

  15. Engineering Structurally Interacting RNA (sxRNA)

    PubMed Central

    Doyle, Francis; Lapsia, Sameer; Spadaro, Salvatore; Wurz, Zachary E.; Bhaduri-McIntosh, Sumita; Tenenbaum, Scott A.

    2017-01-01

    RNA-based three-way junctions (3WJs) are naturally occurring structures found in many functional RNA molecules including rRNA, tRNA, snRNA and ribozymes. 3WJs are typically characterized as resulting from an RNA molecule folding back on itself in cis but could also form in trans when one RNA, for instance a microRNA binds to a second structured RNA, such as a mRNA. Trans-3WJs can influence the final shape of one or both of the RNA molecules and can thus provide a means for modulating the availability of regulatory motifs including potential protein or microRNA binding sites. Regulatory 3WJs generated in trans represent a newly identified regulatory category that we call structurally interacting RNA or sxRNA for convenience. Here we show that they can be rationally designed using familiar cis-3WJ examples as a guide. We demonstrate that an sxRNA “bait” sequence can be designed to interact with a specific microRNA “trigger” sequence, creating a regulatable RNA-binding protein motif that retains its functional activity. Further, we show that when placed downstream of a coding sequence, sxRNA can be used to switch “ON” translation of that sequence in the presence of the trigger microRNA and the amount of translation corresponded with the amount of microRNA present. PMID:28350000

  16. Evaluation of CTX-M steady-state mRNA, mRNA half-life and protein production in various STs of Escherichia coli

    PubMed Central

    Geyer, Chelsie N.; Fowler, Randal C.; Johnson, James R.; Johnston, Brian; Weissman, Scott J.; Hawkey, Peter; Hanson, Nancy D.

    2016-01-01

    Objectives High levels of β-lactamase production can impact treatment with a β-lactam/β-lactamase inhibitor combination. Goals of this study were to: (i) compare the mRNA and protein levels of CTX-M-15- and CTX-M-14-producing Escherichia coli from 18 different STs and 10 different phylotypes; (ii) evaluate the mRNA half-lives and establish a role for chromosomal- and/or plasmid-encoded factors; and (iii) evaluate the zones of inhibition for piperacillin/tazobactam and ceftolozane/tazobactam. Methods Disc diffusion was used to establish zone size. RNA analysis was accomplished using real-time RT–PCR and CTX-M protein levels were evaluated by immunoblotting. Clinical isolates, transformants and transconjugants were used to evaluate mRNA half-lives. Results mRNA levels of CTX-M-15 were up to 165-fold higher compared with CTX-M-14. CTX-M-15 protein levels were 2–48-fold less than their respective transcript levels, while CTX-M-14 protein production was comparable to the observed transcript levels. Nineteen of 25 E. coli (76%) had extended CTX-M-15 mRNA half-lives of 5–15 min and 16 (100%) CTX-M-14 isolates had mRNA half-lives of <2–3 min. Transformants had mRNA half-lives of <2 min for both CTX-M-type transcripts, while transconjugant mRNA half-lives corresponded to the half-life of the donor. Ceftolozane/tazobactam zone sizes were ≥19 mm, while piperacillin/tazobactam zone sizes were ≥17 mm. Conclusions CTX-M-15 mRNA and protein production did not correlate. Neither E. coli ST nor phylotype influenced the variability observed for CTX-M-15 mRNA or protein produced. mRNA half-life is controlled by a plasmid-encoded factor and may influence mRNA transcript levels, but not protein levels. PMID:26612874

  17. A Nascent Peptide Signal Responsive to Endogenous Levels of Polyamines Acts to Stimulate Regulatory Frameshifting on Antizyme mRNA*

    PubMed Central

    Yordanova, Martina M.; Wu, Cheng; Andreev, Dmitry E.; Sachs, Matthew S.; Atkins, John F.

    2015-01-01

    The protein antizyme is a negative regulator of cellular polyamine concentrations from yeast to mammals. Synthesis of functional antizyme requires programmed +1 ribosomal frameshifting at the 3′ end of the first of two partially overlapping ORFs. The frameshift is the sensor and effector in an autoregulatory circuit. Except for Saccharomyces cerevisiae antizyme mRNA, the frameshift site alone only supports low levels of frameshifting. The high levels usually observed depend on the presence of cis-acting stimulatory elements located 5′ and 3′ of the frameshift site. Antizyme genes from different evolutionary branches have evolved different stimulatory elements. Prior and new multiple alignments of fungal antizyme mRNA sequences from the Agaricomycetes class of Basidiomycota show a distinct pattern of conservation 5′ of the frameshift site consistent with a function at the amino acid level. As shown here when tested in Schizosaccharomyces pombe and mammalian HEK293T cells, the 5′ part of this conserved sequence acts at the nascent peptide level to stimulate the frameshifting, without involving stalling detectable by toe-printing. However, the peptide is only part of the signal. The 3′ part of the stimulator functions largely independently and acts at least mostly at the nucleotide level. When polyamine levels were varied, the stimulatory effect was seen to be especially responsive in the endogenous polyamine concentration range, and this effect may be more general. A conserved RNA secondary structure 3′ of the frameshift site has weaker stimulatory and polyamine sensitizing effects on frameshifting. PMID:25998126

  18. Linking Hematopoietic Differentiation to Co-Expressed Sets of Pluripotency-Associated and Imprinted Genes and to Regulatory microRNA-Transcription Factor Motifs

    PubMed Central

    Hamed, Mohamed; Trumm, Johannes; Spaniol, Christian; Sethi, Riccha; Irhimeh, Mohammad R.; Fuellen, Georg; Paulsen, Martina

    2017-01-01

    Maintenance of cell pluripotency, differentiation, and reprogramming are regulated by complex gene regulatory networks (GRNs) including monoallelically-expressed imprinted genes. Besides transcriptional control, epigenetic modifications and microRNAs contribute to cellular differentiation. As a model system for studying the capacity of cells to preserve their pluripotency state and the onset of differentiation and subsequent specialization, murine hematopoiesis was used and compared to embryonic stem cells (ESCs) as a control. Using published microarray data, the expression profiles of two sets of genes, pluripotent and imprinted, were compared to a third set of known hematopoietic genes. We found that more than half of the pluripotent and imprinted genes are clearly upregulated in ESCs but subsequently repressed during hematopoiesis. The remaining genes were either upregulated in hematopoietic progenitors or in differentiated blood cells. The three gene sets each consist of three similarly behaving gene groups with similar expression profiles in various lineages of the hematopoietic system as well as in ESCs. To explain this co-regulation behavior, we explored the transcriptional and post-transcriptional mechanisms of pluripotent and imprinted genes and their regulator/target miRNAs in six different hematopoietic lineages. Therewith, lineage-specific transcription factor (TF)-miRNA regulatory networks were generated and their topologies and functional impacts during hematopoiesis were analyzed. This led to the identification of TF-miRNA co-regulatory motifs, for which we validated the contribution to the cellular development of the corresponding lineage in terms of statistical significance and relevance to biological evidence. This analysis also identified key miRNAs and TFs/genes that might play important roles in the derived lineage networks. These molecular associations suggest new aspects of the cellular regulation of the onset of cellular differentiation and

  19. Pleiotropic regulatory genes bldA, adpA and absB are implicated in production of phosphoglycolipid antibiotic moenomycin

    PubMed Central

    Makitrynskyy, Roman; Ostash, Bohdan; Tsypik, Olga; Rebets, Yuriy; Doud, Emma; Meredith, Timothy; Luzhetskyy, Andriy; Bechthold, Andreas; Walker, Suzanne; Fedorenko, Victor

    2013-01-01

    Unlike the majority of actinomycete secondary metabolic pathways, the biosynthesis of peptidoglycan glycosyltransferase inhibitor moenomycin in Streptomyces ghanaensis does not involve any cluster-situated regulators (CSRs). This raises questions about the regulatory signals that initiate and sustain moenomycin production. We now show that three pleiotropic regulatory genes for Streptomyces morphogenesis and antibiotic production—bldA, adpA and absB—exert multi-layered control over moenomycin biosynthesis in native and heterologous producers. The bldA gene for tRNALeuUAA is required for the translation of rare UUA codons within two key moenomycin biosynthetic genes (moe), moeO5 and moeE5. It also indirectly influences moenomycin production by controlling the translation of the UUA-containing adpA and, probably, other as-yet-unknown repressor gene(s). AdpA binds key moe promoters and activates them. Furthermore, AdpA interacts with the bldA promoter, thus impacting translation of bldA-dependent mRNAs—that of adpA and several moe genes. Both adpA expression and moenomycin production are increased in an absB-deficient background, most probably because AbsB normally limits adpA mRNA abundance through ribonucleolytic cleavage. Our work highlights an underappreciated strategy for secondary metabolism regulation, in which the interaction between structural genes and pleiotropic regulators is not mediated by CSRs. This strategy might be relevant for a growing number of CSR-free gene clusters unearthed during actinomycete genome mining. PMID:24153004

  20. Protein-RNA networks revealed through covalent RNA marks

    PubMed Central

    Lapointe, Christopher P.; Wilinski, Daniel; Saunders, Harriet A. J.; Wickens, Marvin

    2015-01-01

    Protein-RNA networks are ubiquitous and central in biological control. We present an approach, termed “RNA Tagging,” that identifies protein-RNA interactions in vivo by analyzing purified cellular RNA, without protein purification or crosslinking. An RNA-binding protein of interest is fused to an enzyme that adds uridines to the end of RNA. RNA targets bound by the chimeric protein in vivo are covalently marked with uridines and subsequently identified from extracted RNA using high-throughput sequencing. We used this approach to identify hundreds of RNAs bound by a Saccharomyces cerevisiae PUF protein, Puf3p. The method revealed that while RNA-binding proteins productively bind specific RNAs to control their function, they also “sample” RNAs without exerting a regulatory effect. We exploited the method to uncover hundreds of new and likely regulated targets for a protein without canonical RNA-binding domains, Bfr1p. The RNA Tagging approach is well-suited to detect and analyze protein-RNA networks in vivo. PMID:26524240

  1. Effect of antibiotic down-regulatory gene wblA ortholog on antifungal polyene production in rare actinomycetes Pseudonocardia autotrophica.

    PubMed

    Kim, Hye-Jin; Kim, Min-Kyung; Jin, Ying-Yu; Kim, Young-Woo; Kim, Eung-Soo

    2014-09-01

    The rare actinomycete Pseudonocardia autotrophica was previously shown to produce a solubilityimproved toxicity-reduced novel polyene compound named Nystatin-like Pseudonocardia Polyene (NPP). The low productivity of NPP in P. autotrophica implies that its biosynthetic pathway is tightly regulated. In this study, wblApau was isolated and identified as a novel negative regulatory gene for NPP production in P. autotrophica, which showed approximately 49% amino acid identity with a global antibiotic down-regulatory gene, wblA, identified from various Streptomycetes species. Although no significant difference in NPP production was observed between P. autotrophica harboring empty vector and the S. coelicolor wblA under its native promoter, approximately 12% less NPP was produced in P. autotrophica expressing the wblA gene under the strong constitutive ermE(*) promoter. Furthermore, disruption of the wblApau gene from P. autotrophica resulted in an approximately 80% increase in NPP productivity. These results strongly suggest that identification and inactivation of the global antibiotic down-regulatory gene wblA ortholog are a critical strategy for improving secondary metabolite overproduction in not only Streptomyces but also non-Streptomyces rare actinomycete species.

  2. microRNA-132/212 deficiency enhances Aβ production and senile plaque deposition in Alzheimer's disease triple transgenic mice.

    PubMed

    Hernandez-Rapp, Julia; Rainone, Sara; Goupil, Claudia; Dorval, Véronique; Smith, Pascal Y; Saint-Pierre, Martine; Vallée, Maxime; Planel, Emmanuel; Droit, Arnaud; Calon, Frédéric; Cicchetti, Francesca; Hébert, Sébastien S

    2016-08-03

    The abnormal regulation of amyloid-β (Aβ) metabolism (e.g., production, cleavage, clearance) plays a central role in Alzheimer's disease (AD). Among endogenous factors believed to participate in AD progression are the small regulatory non-coding microRNAs (miRs). In particular, the miR-132/212 cluster is severely reduced in the AD brain. In previous studies we have shown that miR-132/212 deficiency in mice leads to impaired memory and enhanced Tau pathology as seen in AD patients. Here we demonstrate that the genetic deletion of miR-132/212 promotes Aβ production and amyloid (senile) plaque formation in triple transgenic AD (3xTg-AD) mice. Using RNA-Seq and bioinformatics, we identified genes of the miR-132/212 network with documented roles in the regulation of Aβ metabolism, including Tau, Mapk, and Sirt1. Consistent with these findings, we show that the modulation of miR-132, or its target Sirt1, can directly regulate Aβ production in cells. Finally, both miR-132 and Sirt1 levels correlated with Aβ load in humans. Overall, our results support the hypothesis that the miR-132/212 network, including Sirt1 and likely other target genes, contributes to abnormal Aβ metabolism and senile plaque deposition in AD. This study strengthens the importance of miR-dependent networks in neurodegenerative disorders, and opens the door to multifactorial drug targets of AD by targeting Aβ and Tau.

  3. Expression of IMP1 enhances production of murine leukemia virus vector by facilitating viral genomic RNA packaging.

    PubMed

    Mai, Yun; Gao, Guangxia

    2010-12-29

    Murine leukemia virus (MLV)-based retroviral vector is widely used for gene transfer. Efficient packaging of the genomic RNA is critical for production of high-titer virus. Here, we report that expression of the insulin-like growth factor II mRNA binding protein 1 (IMP1) enhanced the production of infectious MLV vector. Overexpression of IMP1 increased the stability of viral genomic RNA in virus producer cells and packaging of the RNA into progeny virus in a dose-dependent manner. Downregulation of IMP1 in virus producer cells resulted in reduced production of the retroviral vector. These results indicate that IMP1 plays a role in regulating the packaging of MLV genomic RNA and can be used for improving production of retroviral vectors.

  4. Engineering and Coordination of Regulatory Networks and Intracellular Complexes to Maximize Hydrogen Production by Phototrophic Microorganisms

    SciTech Connect

    James C. Liao

    2012-05-22

    This project is a collaboration with F. R. Tabita of Ohio State. Our major goal is to understand the factors and regulatory mechanisms that influence hydrogen production. The organisms to be utilized in this study, phototrophic microorganisms, in particular nonsulfur purple (NSP) bacteria, catalyze many significant processes including the assimilation of carbon dioxide into organic carbon, nitrogen fixation, sulfur oxidation, aromatic acid degradation, and hydrogen oxidation/evolution. Our part of the project was to develop a modeling technique to investigate the metabolic network in connection to hydrogen production and regulation. Organisms must balance the pathways that generate and consume reducing power in order to maintain redox homeostasis to achieve growth. Maintaining this homeostasis in the nonsulfur purple photosynthetic bacteria is a complex feat with many avenues that can lead to balance, as these organisms possess versatile metabolic capabilities including anoxygenic photosynthesis, aerobic or anaerobic respiration, and fermentation. Growth is achieved by using H{sub 2} as an electron donor and CO{sub 2} as a carbon source during photoautotrophic and chemoautotrophic growth, where CO{sub 2} is fixed via the Calvin-Benson-Bassham (CBB) cycle. Photoheterotrophic growth can also occur when alternative organic carbon compounds are utilized as both the carbon source and electron donor. Regardless of the growth mode, excess reducing equivalents generated as a result of oxidative processes, must be transferred to terminal electron acceptors, thus insuring that redox homeostasis is maintained in the cell. Possible terminal acceptors include O{sub 2}, CO{sub 2}, organic carbon, or various oxyanions. Cells possess regulatory mechanisms to balance the activity of the pathways which supply energy, such as photosynthesis, and those that consume energy, such as CO{sub 2} assimilation or N{sub 2} fixation. The major route for CO{sub 2} assimilation is the CBB

  5. Regulatory role of microRNA-30b and plasminogen activator inhibitor-1 in the pathogenesis of cognitive impairment

    PubMed Central

    LI, XIUQIN; GAO, YONG; MENG, ZHAOYUN; ZHANG, CUI; QI, QINDE

    2016-01-01

    The present study aimed to investigate the role of plasminogen activator inhibitor-1 (PAI-1) in drug-induced early cognitive impairment and the underlying mechanism concerning microRNA (miR)-30b. A mouse model of cognitive impairment was established by intraperitoneal injection of scopolamine (2 mg/kg body weight) for 13 days. Behavioral performance was assessed using the Morris water maze (MWM) test. The mRNA expression levels of PAI-1 and miR-30b were detected using quantitative polymerase chain reaction (qPCR). The protein expression levels of PAI-1 in the hippocampus and blood were determined using western blot analysis and enzyme-linked immunosorbent assays. The MWM test demonstrated that, on days 3 and 4, the escape latency was significantly elevated in the model mice in comparison with control group (P<0.05). In addition, the length of swimming path was significantly increased (P<0.05), while the number of times of crossing the platform location was significantly reduced in the model mouse group (P<0.05) in comparison with the control group. qPCR demonstrated that the mRNA expression levels of PAI-1 in the model mice was significantly elevated in the hippocampus and blood in comparison with the control group (P<0.01). Furthermore, western blot analysis and enzyme-linked immunosorbent assay demonstrated that the protein expression levels of PAI-1 were significantly elevated in the hippocampus and blood in the model group, in comparison with the control group (P<0.05). Notably, the levels of miR-30b in the hippocampus and blood were significantly decreased in the model mice in comparison with the control group (P<0.01). To conclude, the expression levels of PAI-1 were significantly elevated in mice with scopolamine-induced cognitive impairment, which may be associated with the downregulation of miR-30b. The findings from the present study suggest that miR-30b may be involved in the regulation of PAI-1, which would contribute to the pathogenesis of cognitive

  6. Launching a new food product or dietary supplement in the United States: industrial, regulatory, and nutritional considerations.

    PubMed

    Finley, John Weldon; Finley, John Wescott; Ellwood, Kathleen; Hoadley, James

    2014-01-01

    Launching a new food/dietary supplement into the US market can be a confusing process to those unfamiliar with the food industry. Industry capability and product specifications are initial determinants of whether a candidate product can be manufactured in a reproducible manner and whether pilot production can be brought up to the market scale. Regulatory issues determine how a product can be produced and marketed; the primary federal institutions involved in regulations are the US Department of Agriculture, the Food and Drug Administration, and the Federal Trade Commission. A primary distinction is made between food and drugs, and no product may enter the food market if it is in part or whole a drug. Product safety is a major concern, and myriad regulations govern the determination of safety. New foods/dietary supplements are often marketed by health claims or structure/function claims, and there are specific regulations pertaining to claims. Not understanding the regulatory issues involved in developing a new product or failing to comply with associated regulations can have legal and financial repercussions.

  7. The Regulatory Roles of ncRNA Rli60 in Adaptability of Listeria monocytogenes to Environmental Stress and Biofilm Formation.

    PubMed

    Peng, Ye-Long; Meng, Qing-Ling; Qiao, Jun; Xie, Kun; Chen, Cheng; Liu, Tian-Li; Hu, Zheng-Xiang; Ma, Yu; Cai, Xue-Peng; Chen, Chuang-Fu

    2016-07-01

    Listeria monocytogenes is a facultative anaerobic Gram-positive bacterium. It is well adapted to external environments and able to infect both humans and animals. To understand the impacts of ncRNA Rli60 on the adaptability of L. monocytogenes to environmental stresses and biofilm formation, a rli60 deletion strain of L. monocytogenes (LM-Δrli60) was constructed using splicing by overlap extension PCR (SOE-PCR) and homologous recombination and then compared it with wild-type strain L. monocytogenes EGD-e in the aspects of adaptability to environmental stresses by measuring their growth under stresses of different temperatures, and acidic, alkaline, hypertonic and alcoholic conditions, and capability of biofilm formation by using crystal violet staining, as well as the transcriptional levels of genes (gltB and gltC) related to the biofilm formation by real-time quantitative PCR (qRT-PCR). The results showed that (1) the growth of LM-Δrli60 strain was significantly slower under environmental stresses of low temperature (30 °C), high temperature (42 °C), as well as alkaline and alcoholic conditions, (2) the amount of biofilm formed by LM-Δrli60 was attenuated, and (3) the transcriptional levels of gltB and gltC genes at 24 h and 48 h in LM-Δrli60 revealed a significant reduction. Overall, the results confirmed that ncRNA Rli60 plays important roles in regulating the adaptability of L. monocytogenes to environmental stresses and biofilm formation possibly through impacting the expression of gltB and gltC genes.

  8. Enhancing Tissue Engineering and Regenerative Medicine Product Commercialization: The Role of Science in Regulatory Decision-Making for the TE/RM Product Development.

    PubMed

    Bertram, Timothy A; Johnson, Peter C; Tawil, Bill J; Van Dyke, Mark; Hellman, Kiki B

    2015-10-01

    TERMIS-AM Industry Committee (TERMIS-AM/IC), in collaboration with the TERMIS-Europe (EU)/IC, conducted a symposium involving the European Medicines Agency and the U.S. Food and Drug Administration (FDA) toward building an understanding of the rational basis for regulatory decision-making and providing a framework for decisions made during the evaluation of safety and efficacy of TE/RM technologies. This symposium was held in August 2012 during the TERMIS-WC in Vienna, Austria. Emerging from this international initiative by the European Union and the United States, representatives from the respective agencies demonstrated that there are ongoing interagency efforts for developing common national practices toward harmonization of regulatory requirements for the TE/RM products. To extend a broad-based understanding of the role of science in regulatory decision-making, TERMIS-AM/IC, in cooperation with the FDA, organized a symposium at the 2014 TERMIS-AM Annual Meeting, which was held in Washington, DC. This event provided insights from leaders in the FDA and TERMIS on the current status of regulatory approaches for the approved TE/RM products, the use of science in making regulatory decisions, and TE/RM technologies that are in the development pipeline to address unmet medical needs. A far-ranging discussion with FDA representatives, industrialists, physicians, regenerative medicine biologists, and tissue engineers considered the gaps in today's scientific and regulatory understanding of TE/RM technologies. The identified gaps represent significant opportunities to advance TE/RM technologies toward commercialization.

  9. Paramutation in Drosophila Requires Both Nuclear and Cytoplasmic Actors of the piRNA Pathway and Induces Cis-spreading of piRNA Production

    PubMed Central

    Hermant, Catherine; Boivin, Antoine; Teysset, Laure; Delmarre, Valérie; Asif-Laidin, Amna; van den Beek, Marius; Antoniewski, Christophe; Ronsseray, Stéphane

    2015-01-01

    Transposable element activity is repressed in the germline in animals by PIWI-interacting RNAs (piRNAs), a class of small RNAs produced by genomic loci mostly composed of TE sequences. The mechanism of induction of piRNA production by these loci is still enigmatic. We have shown that, in Drosophila melanogaster, a cluster of tandemly repeated P-lacZ-white transgenes can be activated for piRNA production by maternal inheritance of a cytoplasm containing homologous piRNAs. This activated state is stably transmitted over generations and allows trans-silencing of a homologous transgenic target in the female germline. Such an epigenetic conversion displays the functional characteristics of a paramutation, i.e., a heritable epigenetic modification of one allele by the other. We report here that piRNA production and trans-silencing capacities of the paramutated cluster depend on the function of the rhino, cutoff, and zucchini genes involved in primary piRNA biogenesis in the germline, as well as on that of the aubergine gene implicated in the ping-pong piRNA amplification step. The 21-nt RNAs, which are produced by the paramutated cluster, in addition to 23- to 28-nt piRNAs are not necessary for paramutation to occur. Production of these 21-nt RNAs requires Dicer-2 but also all the piRNA genes tested. Moreover, cytoplasmic transmission of piRNAs homologous to only a subregion of the transgenic locus can generate a strong paramutated locus that produces piRNAs along the whole length of the transgenes. Finally, we observed that maternally inherited transgenic small RNAs can also impact transgene expression in the soma. In conclusion, paramutation involves both nuclear (Rhino, Cutoff) and cytoplasmic (Aubergine, Zucchini) actors of the piRNA pathway. In addition, since it is observed between nonfully homologous loci located on different chromosomes, paramutation may play a crucial role in epigenome shaping in Drosophila natural populations. PMID:26482790

  10. The potential function of steroid sulphatase activity in steroid production and steroidogenic acute regulatory protein expression.

    PubMed Central

    Sugawara, Teruo; Fujimoto, Seiichiro

    2004-01-01

    The first step in the biosynthesis of steroid hormones is conversion of cholesterol into pregnenolone. StAR (steroidogenic acute regulatory) protein plays a crucial role in the intra-mitochondrial movement of cholesterol. STS (steroid sulphatase), which is present ubiquitously in mammalian tissues, including the placenta, adrenal gland, testis and ovary, desulphates a number of 3beta-hydroxysteroid sulphates, including cholesterol sulphate. The present study was designed to examine the effect of STS on StAR protein synthesis and steroidogenesis in cells. Steroidogenic activities of COS-1 cells that had been co-transfected with a vector for the cholesterol P450scc (cytochrome P450 side-chain-cleavage enzyme) system, named F2, a StAR expression vector (pStAR), and an STS expression vector (pSTS) were assayed. Whole-cell extracts were subjected to SDS/PAGE and then to Western blot analysis. pSTS co-expressed in COS-1 cells with F2 and pStAR increased pregnenolone synthesis 2-fold compared with that of co-expression with F2 and pStAR. Western blot analysis using COS-1 cells that had been co-transfected with pSTS, F2 and pStAR revealed that StAR protein levels increased, whereas STS and P450scc protein levels did not change. The amount of StAR protein translation products increased when pSTS was added to an in vitro transcription-translation reaction mixture. Pulse-chase experiments demonstrated that the 37 kDa StAR pre-protein disappeared significantly ( P <0.01) more slowly in COS-1 cells that had been transfected with pSTS than in COS-1 cells that had not been transfected with pSTS. The increase in StAR protein level is not a result of an increase in StAR gene expression, but is a result of both an increase in translation and a longer half-life of the 37 kDa pre-StAR protein. In conclusion, STS increases StAR protein expression level and stimulates steroid production. PMID:14969586

  11. Induction of bacteriocin production by coculture is widespread among plantaricin-producing Lactobacillus plantarum strains with different regulatory operons.

    PubMed

    Maldonado-Barragán, Antonio; Caballero-Guerrero, Belén; Lucena-Padrós, Helena; Ruiz-Barba, José Luis

    2013-02-01

    We describe the bacteriocin-production phenotype in a group of eight singular bacteriocinogenic Lactobacillus plantarum strains with three distinct genotypes regarding the plantaricin locus. Genotyping of these strains revealed the existence of two different plantaricin-production regulatory operons, plNC8-plNC8HK-plnD or plnABCD, involving three-component systems controlled each of them by a specific autoinducer peptide (AIP), i.e. PLNC8IF or PlnA. While all of the strains produced antimicrobial activity when growing on solid medium, most of them halted this production when cultured in broth, thus reflecting the functionality of regulatory mechanisms. Antimicrobial activity in broth cultures was re-established or enhanced when the specific AIP was added to the culture or by coculturing with specific bacterial strains. The latter trait appeared to be widespread in bacteriocinogenic L. plantarum strains independently of the regulatory system used to regulate bacteriocin production or the specific bacteriocins produced. The induction spectrum through coculture, i.e. the pattern of bacterial strains able to induce bacteriocin production, was characteristic of each individual L. plantarum strain. Also, the ability of some bacteria to induce bacteriocin production in L. plantarum by coculture appeared to be strain specific. The fact that induction of bacteriocin production by coculturing appeared to be a common feature in L. plantarum can be exploited accordingly to enhance the viability of this species in food and feed fermentations, as well as to contribute to probiotic functionality when colonising the gastrointestinal tract.

  12. Pol IV-Dependent siRNA Production is Reduced in Brassica rapa

    PubMed Central

    Huang, Yi; Kendall, Timmy; Mosher, Rebecca A.

    2013-01-01

    Plants produce a diverse array of small RNA molecules capable of gene regulation, including Pol IV-dependent short interfering (p4-si)RNAs that trigger transcriptional gene silencing. Small RNA transcriptomes are available for many plant species, but mutations affecting the synthesis of Pol IV-dependent siRNAs are characterized only in Arabidopsis and maize, leading to assumptions regarding nature of p4-siRNAs in all other species. We have identified a mutation in the largest subunit of Pol IV, NRPD1, that impacts Pol IV activity in Brassica rapa, an agriculturally important relative of the reference plant Arabidopsis. Using this mutation we characterized the Pol IV-dependent and Pol IV-independent small RNA populations in B. rapa. In addition, our analysis demonstrates reduced production of p4-siRNAs in B. rapa relative to Arabidopsis. B. rapa genomic regions are less likely to generate p4-siRNAs than Arabidopsis but more likely to generate Pol IV-independent siRNAs, including 24 nt RNAs mapping to transposable elements. These observations underscore the diversity of small RNAs produced by plants and highlight the importance of genetic studies during small RNA analysis. PMID:24833221

  13. Conserved stem-loop structures in the HIV-1 RNA region containing the A3 3' splice site and its cis-regulatory element: possible involvement in RNA splicing.

    PubMed

    Jacquenet, S; Ropers, D; Bilodeau, P S; Damier, L; Mougin, A; Stoltzfus, C M; Branlant, C

    2001-01-15

    The HIV-1 transcript is alternatively spliced to over 30 different mRNAs. Whether RNA secondary structure can influence HIV-1 RNA alternative splicing has not previously been examined. Here we have determined the secondary structure of the HIV-1/BRU RNA segment, containing the alternative A3, A4a, A4b, A4c and A5 3' splice sites. Site A3, required for tat mRNA production, is contained in the terminal loop of a stem-loop structure (SLS2), which is highly conserved in HIV-1 and related SIVcpz strains. The exon splicing silencer (ESS2) acting on site A3 is located in a long irregular stem-loop structure (SLS3). Two SLS3 domains were protected by nuclear components under splicing condition assays. One contains the A4c branch points and a putative SR protein binding site. The other one is adjacent to ESS2. Unexpectedly, only the 3' A residue of ESS2 was protected. The suboptimal A3 polypyrimidine tract (PPT) is base paired. Using site-directed mutagenesis and transfection of a mini-HIV-1 cDNA into HeLa cells, we found that, in a wild-type PPT context, a mutation of the A3 downstream sequence that reinforced SLS2 stability decreased site A3 utilization. This was not the case with an optimized PPT. Hence, sequence and secondary structure of the PPT may cooperate in limiting site A3 utilization.

  14. Site-specific DICER and DROSHA RNA products control the DNA-damage response.

    PubMed

    Francia, Sofia; Michelini, Flavia; Saxena, Alka; Tang, Dave; de Hoon, Michiel; Anelli, Viviana; Mione, Marina; Carninci, Piero; d'Adda di Fagagna, Fabrizio

    2012-08-09

    Non-coding RNAs (ncRNAs) are involved in an increasingly recognized number of cellular events. Some ncRNAs are processed by DICER and DROSHA RNases to give rise to small double-stranded RNAs involved in RNA interference (RNAi). The DNA-damage response (DDR) is a signalling pathway that originates from a DNA lesion and arrests cell proliferation3. So far, DICER and DROSHA RNA products have not been reported to control DDR activation. Here we show, in human, mouse and zebrafish, that DICER and DROSHA, but not downstream elements of the RNAi pathway, are necessary to activate the DDR upon exogenous DNA damage and oncogene-induced genotoxic stress, as studied by DDR foci formation and by checkpoint assays. DDR foci are sensitive to RNase A treatment, and DICER- and DROSHA-dependent RNA products are required to restore DDR foci in RNase-A-treated cells. Through RNA deep sequencing and the study of DDR activation at a single inducible DNA double-strand break, we demonstrate that DDR foci formation requires site-specific DICER- and DROSHA-dependent small RNAs, named DDRNAs, which act in a MRE11–RAD50–NBS1-complex-dependent manner (MRE11 also known as MRE11A; NBS1 also known as NBN). DDRNAs, either chemically synthesized or in vitro generated by DICER cleavage, are sufficient to restore the DDR in RNase-A-treated cells, also in the absence of other cellular RNAs. Our results describe an unanticipated direct role of a novel class of ncRNAs in the control of DDR activation at sites of DNA damage.

  15. Regulatory issues related to functional foods and natural health products in Canada: possible implications for manufacturers of conjugated linoleic acid.

    PubMed

    Fitzpatrick, Kelley C

    2004-06-01

    The Canadian Food and Drugs Act and Regulations, through its definitions of food and drug, currently restricts health-related claims for foods, food ingredients, and natural health products (NHPs). Over the past few decades, scientific research has led to a large body of information that demonstrates the benefits for health of many food and NHP ingredients. Health Canada recognized the constraints of the current regulatory environment and started to develop regulations related to the allowance of health claims for functional foods and NHPs, including those foods and NHPs that would contain conjugated linoleic acid isomers. Health Canada has 3 initiatives under way in the area of health claims for foods: 1) to adopt the generic health claims of the United States within a Canadian context, 2) to develop scientific standards of evidence and a guidance document for supporting the validity of product-specific claims, and 3) to develop an overall regulatory framework for functional foods. In 2000, Health Canada announced approval for the use of 5 generic diet-related health claims: sodium and hypertension, calcium and osteoporosis, saturated and trans fat and cholesterol and coronary artery disease, fruits and vegetables and cancer, and sugar alcohols and dental caries. Under a separate initiative, Natural Health Products Regulations were published in the Canada Gazette Part II on June 18, 2003. The NHP Regulations came into force on January 1, 2004, with a transition period ranging from 2 y (for site licensing) to 6 y (for product licensing, for products already issued a drug identification number).

  16. SARM regulates CCL5 production in macrophages by promoting the recruitment of transcription factors and RNA polymerase II to the Ccl5 promoter.

    PubMed

    Gürtler, Claudia; Carty, Michael; Kearney, Jay; Schattgen, Stefan A; Ding, Aihao; Fitzgerald, Katherine A; Bowie, Andrew G

    2014-05-15

    The four Toll/IL-1R domain-containing adaptor proteins MyD88, MAL, TRIF, and TRAM are well established as essential mediators of TLR signaling and gene induction following microbial detection. In contrast, the function of the fifth, most evolutionarily conserved Toll/IL-1R adaptor, sterile α and HEAT/Armadillo motif-containing protein (SARM), has remained more elusive. Recent studies of Sarm(-/-) mice have highlighted a role for SARM in stress-induced neuronal cell death and immune responses in the CNS. However, whether SARM has a role in immune responses in peripheral myeloid immune cells is less clear. Thus, we characterized TLR-induced cytokine responses in SARM-deficient murine macrophages and discovered a requirement for SARM in CCL5 production, whereas gene induction of TNF, IL-1β, CCL2, and CXCL10 were SARM-independent. SARM was not required for TLR-induced activation of MAPKs or of transcription factors implicated in CCL5 induction, namely NF-κB and IFN regulatory factors, nor for Ccl5 mRNA stability or splicing. However, SARM was critical for the recruitment of transcription factors and of RNA polymerase II to the Ccl5 promoter. Strikingly, the requirement of SARM for CCL5 induction was not restricted to TLR pathways, as it was also apparent in cytosolic RNA and DNA responses. Thus, this study identifies a new role for SARM in CCL5 expression in macrophages.

  17. An efficient approach for conversion of 5-substituted 2-thiouridines built in RNA oligomers into corresponding desulfured 4-pyrimidinone products.

    PubMed

    Chwialkowska, Anna; Wielgus, Ewelina; Leszczynska, Grazyna; Sobczak, Milena; Mikolajczyk, Barbara; Sochacka, Elzbieta; Nawrot, Barbara

    2015-08-15

    An efficient approach for the desulfuration of C5-substituted 2-thiouridines (R5S2U) bound in the RNA chain exclusively to 4-pyrimidinone nucleoside (R5H2U)-containing RNA products is proposed. This post-synthetic transformation avoids the preparation of a suitably protected H2U phosphoramidite, which otherwise would be necessary for solid-phase synthesis of the modified RNA. Optimization of the desulfuration, which included reaction stoichiometry, time and temperature, allowed to transform a set of ten R5S2U-RNAs into their R5H2U-RNA congeners in ca. 90% yield.

  18. The large N-terminal region of the Brr2 RNA helicase guides productive spliceosome activation

    PubMed Central

    Absmeier, Eva; Wollenhaupt, Jan; Mozaffari-Jovin, Sina; Becke, Christian; Lee, Chung-Tien; Preussner, Marco; Heyd, Florian; Urlaub, Henning; Lührmann, Reinhard; Santos, Karine F.; Wahl, Markus C.

    2015-01-01

    The Brr2 helicase provides the key remodeling activity for spliceosome catalytic activation, during which it disrupts the U4/U6 di-snRNP (small nuclear RNA protein), and its activity has to be tightly regulated. Brr2 exhibits an unusual architecture, including an ∼500-residue N-terminal region, whose functions and molecular mechanisms are presently unknown, followed by a tandem array of structurally similar helicase units (cassettes), only the first of which is catalytically active. Here, we show by crystal structure analysis of full-length Brr2 in complex with a regulatory Jab1/MPN domain of the Prp8 protein and by cross-linking/mass spectrometry of isolated Brr2 that the Brr2 N-terminal region encompasses two folded domains and adjacent linear elements that clamp and interconnect the helicase cassettes. Stepwise N-terminal truncations led to yeast growth and splicing defects, reduced Brr2 association with U4/U6•U5 tri-snRNPs, and increased ATP-dependent disruption of the tri-snRNP, yielding U4/U6 di-snRNP and U5 snRNP. Trends in the RNA-binding, ATPase, and helicase activities of the Brr2 truncation variants are fully rationalized by the crystal structure, demonstrating that the N-terminal region autoinhibits Brr2 via substrate competition and conformational clamping. Our results reveal molecular mechanisms that prevent premature and unproductive tri-snRNP disruption and suggest novel principles of Brr2-dependent splicing regulation. PMID:26637280

  19. RNA of Enterococcus faecalis Strain EC-12 Is a Major Component Inducing Interleukin-12 Production from Human Monocytic Cells

    PubMed Central

    Nishibayashi, Ryoichiro; Inoue, Ryo; Harada, Yuri; Watanabe, Takumi; Makioka, Yuko; Ushida, Kazunari

    2015-01-01

    Interleukin-12 (IL-12) is an important cytokine for the immunomodulatory effects of lactic acid bacteria (LAB). Using murine immune cells, we previously reported that the RNA of Enterococcus faecalis EC-12, a LAB strain exerting probiotic-like beneficial effects, is the major IL-12-inducing immunogenic component. However, it was recently revealed that bacterial RNA can be a ligand for Toll-like receptor (TLR) 13, which is only expressed in mice. Because TLR13 is not expressed in humans, the immuno-stimulatory and -modulatory effects of LAB RNA in human cells should be augmented excluding TLR13 contribution. In experiment 1 of this study, the role of LAB RNA in IL-12 induction in human immune cells was studied using three LAB strains, E.faecalis EC-12, Lactobacillus gasseri JCM5344, and Bifidobacterium breve JCM1192. RNase A treatment of heat-killed LAB significantly decreased the IL-12 production of human peripheral blood mononuclear cells on stimulation, while RNase III treatment revealed virtually no effects. Further, IL-12 production against heat-killed E. faecalis EC-12 was abolished by depleting monocytes. These results demonstrated that single stranded RNA (ssRNA) of LAB is a strong inducer of IL-12 production from human monocytes. In experiment 2, major receptor for ssRNA of E. faecalis EC-12 was identified using THP-1 cells, a human monocytic cell line. The type of RNA molecules of E. faecalis EC-12 responsible for IL-12 induction was also identified. IL-12 production induced by the total RNA of E. faecalis EC-12 was significantly reduced by the treatment of siRNA for TLR8 but not for TLR7. Furthermore, both 23S and 16S rRNA, but not mRNA, of E. faecalis EC-12 markedly induced IL-12 production from THP-1 cells. These results suggested that the recognition of ssRNA of E. faecalis EC-12 was mediated by TLR8 and that rRNA was the RNA molecule that exhibited IL-12-inducing ability in human cells. PMID:26083838

  20. Host MicroRNA miR-197 Plays a Negative Regulatory Role in the Enterovirus 71 Infectious Cycle by Targeting the RAN Protein

    PubMed Central

    Tang, Wen-Fang; Huang, Ru-Ting; Chien, Kun-Yi; Huang, Jo-Yun; Lau, Kean-Seng; Jheng, Jia-Rong; Chiu, Cheng-Hsun; Wu, Tzong-Yuan; Chen, Chung-Yung

    2015-01-01

    ABSTRACT Enterovirus 71 (EV71), a member of Picornaviridae, is associated with severe central nervous system complications. In this study, we identified a cellular microRNA (miRNA), miR-197, whose expression was downregulated by viral infection in a time-dependent manner. In miR-197 mimic-transfected cells, EV71 replication was inhibited, whereas the internal ribosome entry site (IRES) activity was decreased in EV71 strains with or without predicted miR-197 target sites, indicating that miR-197 targets host proteins to modulate viral replication. We thus used a quantitative proteomics approach, aided by the TargetScan algorithm, to identify putative target genes of miR-197. Among them, RAN was selected and validated as a genuine target in a 3′ untranslated region (UTR) reporter assay. Reduced production of RAN by RNA interference markedly reduced the synthesis of EV71-encoded viral proteins and virus titers. Furthermore, reintroduction of nondegradable RAN into these knockdown cells rescued viral protein synthesis. miR-197 levels were modulated by EV71 to maintain RAN mRNA translatability at late times postinfection since we demonstrated that cap-independent translation exerted by its intrinsic IRES activity was occurring at times when translation attenuation was induced by EV71. EV71-induced downregulation of miR-197 expression increased the expression of RAN, which supported the nuclear transport of the essential viral proteins 3D/3CD and host protein hnRNP K for viral replication. Our data suggest that downregulation of cellular miRNAs may constitute a newly identified mechanism that sustains the expression of host proteins to facilitate viral replication. IMPORTANCE Enterovirus 71 (EV71) is a picornavirus with a positive-sense single-stranded RNA that globally inhibits the cellular translational system, mainly by cleaving cellular eukaryotic translation initiation factor 4G (eIF4G) and poly(A)-binding protein (PABP), which inhibits the association of the

  1. RNA-binding protein HuD reduces triglyceride production in pancreatic β cells by enhancing the expression of insulin-induced gene 1.

    PubMed

    Kim, Chongtae; Lee, Heejin; Kang, Hoin; Shin, Jung Jae; Tak, Hyosun; Kim, Wook; Gorospe, Myriam; Lee, Eun Kyung

    2016-04-01

    Although triglyceride (TG) accumulation in the pancreas leads to β-cell dysfunction and raises the chance to develop metabolic disorders such as type 2 diabetes (T2DM), the molecular mechanisms whereby intracellular TG levels are regulated in pancreatic β cells have not been fully elucidated. Here, we present evidence that the RNA-binding protein HuD regulates TG production in pancreatic β cells. Mouse insulinoma βTC6 cells stably expressing a small hairpin RNA targeting HuD (shHuD) (βTC6-shHuD) contained higher TG levels compared to control cells. Moreover, downregulation of HuD resulted in a decrease in insulin-induced gene 1 (INSIG1) levels but not in the levels of sterol regulatory element-binding protein 1c (SREBP1c), a key transcription factor for lipid production. We identified Insig1 mRNA as a direct target of HuD by using ribonucleoprotein immunoprecipitation (RIP) and biotin pulldown analyses. By associating with the 3'-untranslated region (3'UTR) of Insig1 mRNA, HuD promoted INSIG1 translation; accordingly, HuD downregulation reduced while ectopic HuD expression increased INSIG1 levels. We further observed that HuD downregulation facilitated the nuclear localization of SREBP1c, thereby increasing the transcriptional activity of SREBP1c and the expression of target genes involved in lipogenesis; likewise, we observed lower INSIG1 levels in the pancreatic islets of HuD-null mice. Taken together, our results indicate that HuD functions as a novel repressor of lipid synthesis in pancreatic β cells.

  2. Product feedback regulation implicated in translational control of the Trypanosoma brucei S-adenosylmethionine decarboxylase regulatory subunit prozyme

    PubMed Central

    Xiao, Yanjing; Nguyen, Suong; Kim, Sok Ho; Volkov, Oleg A.; Tu, Benjamin P.; Phillips, Margaret A.

    2013-01-01

    Summary Human African sleeping sickness (HAT) is caused by the parasitic protozoan Trypanosoma brucei. Polyamine biosynthesis is an important drug target in the treatment of HAT. Previously we showed that trypanosomatid S-adenosylmethionine decarboxylase (AdoMetDC), a key enzyme for biosynthesis of the polyamine spermidine, is activated by heterodimer formation with an inactive paralog termed prozyme. Furthermore, prozyme protein levels were regulated in response reduced AdoMetDC activity. Herein we show that T. brucei encodes three prozyme transcripts. The 3’UTRs of these transcripts were mapped and chloramphenicol acetyltransferase (CAT) reporter constructs were used to identify a 1.2 kb region that contained a 3’UTR prozyme regulatory element sufficient to up regulate CAT protein levels (but not RNA) upon AdoMetDC inhibition, supporting the hypothesis that prozyme expression is regulated translationally. To gain insight into trans-acting factors, genetic rescue of AdoMetDC RNAi knockdown lines with human AdoMetDC was performed leading to rescue of the cell growth block, and restoration of prozyme protein to wild-type levels. Polyamine and AdoMet metabolite analysis showed that prozyme protein levels were inversely proportional to intracellular levels of decarboxylated AdoMet (dcAdoMet). These data suggest that prozyme translation may be regulated by dcAdoMet, a metabolite not previously identified to play a regulatory role. PMID:23634831

  3. Several Cis-regulatory Elements Control mRNA Stability, Translation Efficiency, and Expression Pattern of Prrxl1 (Paired Related Homeobox Protein-like 1)*

    PubMed Central

    Regadas, Isabel; Matos, Mariana Raimundo; Monteiro, Filipe Almeida; Gómez-Skarmeta, José Luis; Lima, Deolinda; Bessa, José; Casares, Fernando; Reguenga, Carlos

    2013-01-01

    The homeodomain transcription factor Prrxl1/DRG11 has emerged as a crucial molecule in the establishment of the pain circuitry, in particular spinal cord targeting of dorsal root ganglia (DRG) axons and differentiation of nociceptive glutamatergic spinal cord neurons. Despite Prrxl1 importance in the establishment of the DRG-spinal nociceptive circuit, the molecular mechanisms that regulate its expression along development remain largely unknown. Here, we show that Prrxl1 transcription is regulated by three alternative promoters (named P1, P2, and P3), which control the expression of three distinct Prrxl1 5′-UTR variants, named 5′-UTR-A, 5′-UTR-B, and 5′-UTR-C. These 5′-UTR sequences confer distinct mRNA stability and translation efficiency to the Prrxl1 transcript. The most conserved promoter (P3) contains a TATA-box and displays in vivo enhancer activity in a pattern that overlaps with the zebrafish Prrxl1 homologue, drgx. Regulatory modules present in this sequence were identified and characterized, including a binding site for Phox2b. Concomitantly, we demonstrate that zebrafish Phox2b is required for the expression of drgx in the facial, glossopharyngeal, and vagal cranial ganglia. PMID:24214975

  4. An Integrative Approach to Computational Modelling of the Gene Regulatory Network Controlling Clostridium botulinum Type A1 Toxin Production

    PubMed Central

    Walshaw, John; Peck, Michael W.; Barker, Gary C.

    2016-01-01

    Clostridium botulinum produces botulinum neurotoxins (BoNTs), highly potent substances responsible for botulism. Currently, mathematical models of C. botulinum growth and toxigenesis are largely aimed at risk assessment and do not include explicit genetic information beyond group level but integrate many component processes, such as signalling, membrane permeability and metabolic activity. In this paper we present a scheme for modelling neurotoxin production in C. botulinum Group I type A1, based on the integration of diverse information coming from experimental results available in the literature. Experiments show that production of BoNTs depends on the growth-phase and is under the control of positive and negative regulatory elements at the intracellular level. Toxins are released as large protein complexes and are associated with non-toxic components. Here, we systematically review and integrate those regulatory elements previously described in the literature for C. botulinum Group I type A1 into a population dynamics model, to build the very first computational model of toxin production at the molecular level. We conduct a validation of our model against several items of published experimental data for different wild type and mutant strains of C. botulinum Group I type A1. The result of this process underscores the potential of mathematical modelling at the cellular level, as a means of creating opportunities in developing new strategies that could be used to prevent botulism; and potentially contribute to improved methods for the production of toxin that is used for therapeutics. PMID:27855161

  5. An Integrative Approach to Computational Modelling of the Gene Regulatory Network Controlling Clostridium botulinum Type A1 Toxin Production.

    PubMed

    Ihekwaba, Adaoha E C; Mura, Ivan; Walshaw, John; Peck, Michael W; Barker, Gary C

    2016-11-01

    Clostridium botulinum produces botulinum neurotoxins (BoNTs), highly potent substances responsible for botulism. Currently, mathematical models of C. botulinum growth and toxigenesis are largely aimed at risk assessment and do not include explicit genetic information beyond group level but integrate many component processes, such as signalling, membrane permeability and metabolic activity. In this paper we present a scheme for modelling neurotoxin production in C. botulinum Group I type A1, based on the integration of diverse information coming from experimental results available in the literature. Experiments show that production of BoNTs depends on the growth-phase and is under the control of positive and negative regulatory elements at the intracellular level. Toxins are released as large protein complexes and are associated with non-toxic components. Here, we systematically review and integrate those regulatory elements previously described in the literature for C. botulinum Group I type A1 into a population dynamics model, to build the very first computational model of toxin production at the molecular level. We conduct a validation of our model against several items of published experimental data for different wild type and mutant strains of C. botulinum Group I type A1. The result of this process underscores the potential of mathematical modelling at the cellular level, as a means of creating opportunities in developing new strategies that could be used to prevent botulism; and potentially contribute to improved methods for the production of toxin that is used for therapeutics.

  6. Regulatory RNAs in Planarians.

    PubMed

    Pawlicka, Kamila; Perrigue, Patrick M; Barciszewski, Jan

    2016-01-01

    The full scope of regulatory RNA evolution and function in epigenetic processes is still not well understood. The development of planarian flatworms to be used as a simple model organism for research has shown a great potential to address gaps in the knowledge in this field of study. The genomes of planarians encode a wide array of regulatory RNAs that function in gene regulation. Here, we review planarians as a suitable model organism for the identification and function of regulatory RNAs.

  7. MicroRNA-155 regulates interferon-γ production in natural killer cells via Tim-3 signalling in chronic hepatitis C virus infection.

    PubMed

    Cheng, Yong Q; Ren, Jun P; Zhao, Juan; Wang, Jia M; Zhou, Yun; Li, Guang Y; Moorman, Jonathan P; Yao, Zhi Q

    2015-08-01

    Host immune responses must be tightly regulated by an intricate balance between positive and negative signals while fighting pathogens; persistent pathogens may usurp these regulatory mechanisms to dampen host immunity to facilitate survival in vivo. Here we report that Tim-3, a negative signalling molecule expressed on monocytes and T cells, is up-regulated on natural killer (NK) cells in individuals chronically infected with hepatitis C virus (HCV). Additionally, the transcription factor T-bet was also found to be up-regulated and associated with Tim-3 expression in NK cells during chronic HCV infection. MicroRNA-155 (miR-155), an miRNA that inhibits signalling proteins involved in immune responses, was down-regulated in NK cells by HCV infection. This Tim-3/T-bet over-expression and miR-155 inhibition were recapitulated in vitro by incubating primary NK cells or NK92 cell line with Huh-7 hepatocytes expressing HCV. Reconstitution of miR-155 in NK cells from HCV-infected patients led to a decrease in T-bet/Tim-3 expression and an increase in interferon-γ production. Blocking Tim-3 signalling also enhanced interferon-γ production in NK cells by improving signal transducer and activator of transcription-5 phosphorylation. These data indicate that HCV-induced, miR-155-regulated Tim-3 expression regulates NK cell function, suggesting a novel mechanism for balancing immune clearance and immune injury during chronic viral infection.

  8. Basic fibroblast growth factor promotes stem Leydig cell development and inhibits LH-stimulated androgen production by regulating microRNA expression.

    PubMed

    Liu, Hui; Yang, Yan; Zhang, Lei; Liang, Rui; Ge, Ren-Shan; Zhang, Yufei; Zhang, Qihao; Xiang, Qi; Huang, Yadong; Su, Zhijian

    2014-10-01

    Leydig cells are the primary source of testosterone in the testes, and their steroidogenic function is strictly controlled by the hypothalamus-pituitary-gonad axis. Emerging evidence has indicated that fibroblast growth factors play a role in regulating stem Leydig cell development and steroidogenesis, but little is known about the regulatory mechanism. Using a seminiferous tubule culture system, we demonstrated that basic fibroblast growth factor (bFGF) can promote stem Leydig cell proliferation and commitment toward differentiation in testosterone-producing Leydig cells. However, these promoting effects decreased with an increase in the bFGF dose. Previous studies have reported that bFGF inhibits luteinizing hormone (LH)-stimulated androgen production by downregulating the mRNA expression of steroidogenic genes in immature Leydig cells. However, the expression levels of 677 microRNAs did not change significantly during the LH-mediated process of testosterone synthesis. Five microRNAs (miR-29a, -29c, -142-3p, -451 and -335) were identified, and their expression in immature Leydig cells was regulated simultaneously by bFGF and LH. These results suggested that the inhibition of LH-stimulated androgen production may be modulated by a change in bFGF-mediated microRNA expression, which further impacts the signaling pathway of testosterone biosynthesis and steroidogenic gene expression.

  9. Methods and compositions for the production of orthogonal tRNA-aminoacyl tRNA synthetase pairs

    DOEpatents

    Schultz, Peter G.; Wang, Lei; Anderson, John Christopher; Chin, Jason W.; Liu, David R.; Magliery, Thomas J.; Meggers, Eric L.; Mehl, Ryan Aaron; Pastrnak, Miro; Santoro, Stephen William; Zhang, Zhiwen

    2015-10-20

    This invention provides compositions and methods for generating components of protein biosynthetic machinery including orthogonal tRNAs, orthogonal aminoacyl-tRNA synthetases, and orthogonal pairs of tRNAs/synthetases. Methods for identifying orthogonal pairs are also provided. These components can be used to incorporate unnatural amino acids into proteins in vivo.

  10. Methods and compositions for the production of orthogonal tRNA-aminoacyl tRNA synthetase pairs

    SciTech Connect

    Schultz, Peter; Wang, Lei; Anderson, John Christopher; Chin, Jason; Liu, David R.; Magliery, Thomas J.; Meggers, Eric L.; Mehl, Ryan Aaron; Pastrnak, Miro; Santoro, Stephen William; Zhang, Zhiwen

    2006-08-01

    This invention provides compositions and methods for generating components of protein biosynthetic machinery including orthogonal tRNAs, orthogonal aminoacyl-tRNA synthetases, and orthogonal pairs of tRNAs/synthetases. Methods for identifying orthogonal pairs are also provided. These components can be used to incorporate unnatural amino acids into proteins in vivo.

  11. A clone screening method using mRNA levels to determine specific productivity and product quality for monoclonal antibodies.

    PubMed

    Lee, Christina J; Seth, Gargi; Tsukuda, Joni; Hamilton, Robert W

    2009-03-01

    To meet increasing demands for efficient and streamlined production processes of therapeutic antibodies, improved methods of screening clones are required. In this article, we examined the potential of using antibody transcript levels as criteria for clone screening. We evaluated the QuantiGene Plex, a commercially available, high-throughput assay for simultaneously measuring multiple transcripts from cell lysate. Using the development of stable Chinese hamster ovary cell lines as examples, we investigated the relationship between transcript and antibody levels through several rounds of screening. First, we observed that measured heavy chain transcript levels are generally correlated with specific productivity, enabling the identification of high-producing clones from mRNA. Second, we observed that low ratios (< 1.5) of light to heavy chain transcript levels may be indicative of high antibody aggregation levels, allowing for the rapid identification and elimination of clones of questionable product quality. Therefore, an efficient process of identifying high-producing clones of desirable product quality is possible by using QuantiGene Plex assay to measure antibody transcript levels.

  12. Molecular mechanisms of RNA interference.

    PubMed

    Wilson, Ross C; Doudna, Jennifer A

    2013-01-01

    Small RNA molecules regulate eukaryotic gene expression during development and in response to stresses including viral infection. Specialized ribonucleases and RNA-binding proteins govern the production and action of small regulatory RNAs. After initial processing in the nucleus by Drosha, precursor microRNAs (pre-miRNAs) are transported to the cytoplasm, where Dicer cleavage generates mature microRNAs (miRNAs) and short interfering RNAs (siRNAs). These double-stranded products assemble with Argonaute proteins such that one strand is preferentially selected and used to guide sequence-specific silencing of complementary target mRNAs by endonucleolytic cleavage or translational repression. Molecular structures of Dicer and Argonaute proteins, and of RNA-bound complexes, have offered exciting insights into the mechanisms operating at the heart of RNA-silencing pathways.

  13. Identification of microRNAs and Their Target Genes Explores miRNA-Mediated Regulatory Network of Cytoplasmic Male Sterility Occurrence during Anther Development in Radish (Raphanus sativus L.)

    PubMed Central

    Zhang, Wei; Xie, Yang; Xu, Liang; Wang, Yan; Zhu, Xianwen; Wang, Ronghua; Zhang, Yang; Muleke, Everlyne M.; Liu, Liwang

    2016-01-01

    MicroRNAs (miRNAs) are a type of endogenous non-coding small RNAs that play critical roles in plant growth and developmental processes. Cytoplasmic male sterility (CMS) is typically a maternally inherited trait and widely used in plant heterosis utilization. However, the miRNA-mediated regulatory network of CMS occurrence during anther development remains largely unknown in radish. In this study, a comparative small RNAome sequencing was conducted in floral buds of CMS line ‘WA’ and its maintainer line ‘WB’ by high-throughput sequencing. A total of 162 known miRNAs belonging to 25 conserved and 24 non-conserved miRNA families were isolated and 27 potential novel miRNA families were identified for the first time in floral buds of radish. Of these miRNAs, 28 known and 14 potential novel miRNAs were differentially expressed during anther development. Several target genes for CMS occurrence-related miRNAs encode important transcription factors and functional proteins, which might be involved in multiple biological processes including auxin signaling pathways, signal transduction, miRNA target silencing, floral organ development, and organellar gene expression. Moreover, the expression patterns of several CMS occurrence-related miRNAs and their targets during three stages of anther development were validated by qRT-PCR. In addition, a potential miRNA-mediated regulatory network of CMS occurrence during anther development was firstly proposed in radish. These findings could contribute new insights into complex miRNA-mediated genetic regulatory network of CMS occurrence and advance our understanding of the roles of miRNAs during CMS occurrence and microspore formation in radish and other crops. PMID:27499756

  14. Identification of microRNAs and Their Target Genes Explores miRNA-Mediated Regulatory Network of Cytoplasmic Male Sterility Occurrence during Anther Development in Radish (Raphanus sativus L.).

    PubMed

    Zhang, Wei; Xie, Yang; Xu, Liang; Wang, Yan; Zhu, Xianwen; Wang, Ronghua; Zhang, Yang; Muleke, Everlyne M; Liu, Liwang

    2016-01-01

    MicroRNAs (miRNAs) are a type of endogenous non-coding small RNAs that play critical roles in plant growth and developmental processes. Cytoplasmic male sterility (CMS) is typically a maternally inherited trait and widely used in plant heterosis utilization. However, the miRNA-mediated regulatory network of CMS occurrence during anther development remains largely unknown in radish. In this study, a comparative small RNAome sequencing was conducted in floral buds of CMS line 'WA' and its maintainer line 'WB' by high-throughput sequencing. A total of 162 known miRNAs belonging to 25 conserved and 24 non-conserved miRNA families were isolated and 27 potential novel miRNA families were identified for the first time in floral buds of radish. Of these miRNAs, 28 known and 14 potential novel miRNAs were differentially expressed during anther development. Several target genes for CMS occurrence-related miRNAs encode important transcription factors and functional proteins, which might be involved in multiple biological processes including auxin signaling pathways, signal transduction, miRNA target silencing, floral organ development, and organellar gene expression. Moreover, the expression patterns of several CMS occurrence-related miRNAs and their targets during three stages of anther development were validated by qRT-PCR. In addition, a potential miRNA-mediated regulatory network of CMS occurrence during anther development was firstly proposed in radish. These findings could contribute new insights into complex miRNA-mediated genetic regulatory network of CMS occurrence and advance our understanding of the roles of miRNAs during CMS occurrence and microspore formation in radish and other crops.

  15. Micro-RNA378 (miR-378) regulates ovarian estradiol production by targeting aromatase.

    PubMed

    Xu, Shengyu; Linher-Melville, Katja; Yang, Burton B; Wu, De; Li, Julang

    2011-10-01

    Estradiol is a steroid hormone that not only plays an important role in ovarian follicular development but also is associated with many reproductive disorders. Owing to the importance of aromatase in the production of estradiol, the regulation of aromatase gene expression at the transcriptional level has been an extensive area of study for over two decades. However, its regulation at the posttranscriptional level has remained unclear. Here, we show that micro-RNA378 (miR-378) is spatiotemporally expressed in porcine granulosa cells, the cells that generate estradiol in the ovary during follicular development, in an inverse manner compared with the expression of aromatase. In vitro overexpression and inhibition experiments revealed that aromatase expression, and therefore estradiol production, by granulosa cells, is posttranscriptionally down-regulated by miR-378. Furthermore, site-directed mutation studies identified two binding sites in the 3'-untranslated region (3'-UTR) of the aromatase coding sequence that are critical for the action of miR-378. Interestingly, overexpression of the aromatase 3'-UTR enhanced aromatase expression at the protein level in granulosa cells, possibly mediated by the binding of miR-378 within this region, thereby reducing the binding of this micro-RNA to the endogenous aromatase 3'-UTR.

  16. Clinical Translation of Cell Therapy, Tissue Engineering, and Regenerative Medicine Product in Malaysia and Its Regulatory Policy

    PubMed Central

    Abas, Arpah; Ab Rahim, Fazillahnor; Saim, Aminuddin Bin

    2015-01-01

    With the worldwide growth of cell and tissue therapy (CTT) in treating diseases, the need of a standardized regulatory policy is of paramount concern. Research in CTT in Malaysia has reached stages of clinical trials and commercialization. In Malaysia, the regulation of CTT is under the purview of the National Pharmaceutical Control Bureau (NPCB), Ministry of Health (MOH). NPCB is given the task of regulating CTT, under a new Cell and Gene Therapy Products framework, and the guidelines are currently being formulated. Apart from the laboratory accreditation, researchers are advised to follow Guidelines for Stem Cell Research and Therapy from the Medical Development Division, MOH, published in 2009. PMID:26192075

  17. Violacein Treatment Modulates Acute and Chronic Inflammation through the Suppression of Cytokine Production and Induction of Regulatory T Cells.

    PubMed

    Verinaud, Liana; Lopes, Stefanie Costa Pinto; Prado, Isabel Cristina Naranjo; Zanucoli, Fábio; Alves da Costa, Thiago; Di Gangi, Rosária; Issayama, Luidy Kazuo; Carvalho, Ana Carolina; Bonfanti, Amanda Pires; Niederauer, Guilherme Francio; Duran, Nelson; Costa, Fábio Trindade Maranhão; Oliveira, Alexandre Leite Rodrigues; Höfling, Maria Alice da Cruz; Machado, Dagmar Ruth Stach; Thomé, Rodolfo

    2015-01-01

    Inflammation is a necessary process to control infection. However, exacerbated inflammation, acute or chronic, promotes deleterious effects in the organism. Violacein (viola), a quorum sensing metabolite from the Gram-negative bacterium Chromobacterium violaceum, has been shown to protect mice from malaria and to have beneficial effects on tumors. However, it is not known whether this drug possesses anti-inflammatory activity. In this study, we investigated whether viola administration is able to reduce acute and chronic autoimmune inflammation. For that purpose, C57BL/6 mice were intraperitoneally injected with 1 μg of LPS and were treated with viola (3.5mg/kg) via i.p. at the same time-point. Three hours later, the levels of inflammatory cytokines in the sera and phenotypical characterization of leukocytes were determined. Mice treated with viola presented a significant reduction in the production of inflammatory cytokines compared with untreated mice. Interestingly, although viola is a compound derived from bacteria, it did not induce inflammation upon administration to naïve mice. To test whether viola would protect mice from an autoimmune inflammation, Experimental Autoimmune Encephalomyelitis (EAE)-inflicted mice were given viola i.p. at disease onset, at the 10th day from immunization. Viola-treated mice developed mild EAE disease in contrast with placebo-treated mice. The frequencies of dendritic cells and macrophages were unaltered in EAE mice treated with viola. However, the sole administration of viola augmented the levels of splenic regulatory T cells (CD4+Foxp3+). We also found that adoptive transfer of viola-elicited regulatory T cells significantly reduced EAE. Our study shows, for the first time, that violacein is able to modulate acute and chronic inflammation. Amelioration relied in suppression of cytokine production (in acute inflammation) and stimulation of regulatory T cells (in chronic inflammation). New studies must be conducted in order to

  18. Violacein Treatment Modulates Acute and Chronic Inflammation through the Suppression of Cytokine Production and Induction of Regulatory T Cells

    PubMed Central

    Verinaud, Liana; Lopes, Stefanie Costa Pinto; Prado, Isabel Cristina Naranjo; Zanucoli, Fábio; Alves da Costa, Thiago; Di Gangi, Rosária; Issayama, Luidy Kazuo; Carvalho, Ana Carolina; Bonfanti, Amanda Pires; Niederauer, Guilherme Francio; Duran, Nelson; Costa, Fábio Trindade Maranhão; Oliveira, Alexandre Leite Rodrigues; Höfling, Maria Alice da Cruz; Machado, Dagmar Ruth Stach; Thomé, Rodolfo

    2015-01-01

    Inflammation is a necessary process to control infection. However, exacerbated inflammation, acute or chronic, promotes deleterious effects in the organism. Violacein (viola), a quorum sensing metabolite from the Gram-negative bacterium Chromobacterium violaceum, has been shown to protect mice from malaria and to have beneficial effects on tumors. However, it is not known whether this drug possesses anti-inflammatory activity. In this study, we investigated whether viola administration is able to reduce acute and chronic autoimmune inflammation. For that purpose, C57BL/6 mice were intraperitoneally injected with 1 μg of LPS and were treated with viola (3.5mg/kg) via i.p. at the same time-point. Three hours later, the levels of inflammatory cytokines in the sera and phenotypical characterization of leukocytes were determined. Mice treated with viola presented a significant reduction in the production of inflammatory cytokines compared with untreated mice. Interestingly, although viola is a compound derived from bacteria, it did not induce inflammation upon administration to naïve mice. To test whether viola would protect mice from an autoimmune inflammation, Experimental Autoimmune Encephalomyelitis (EAE)-inflicted mice were given viola i.p. at disease onset, at the 10th day from immunization. Viola-treated mice developed mild EAE disease in contrast with placebo-treated mice. The frequencies of dendritic cells and macrophages were unaltered in EAE mice treated with viola. However, the sole administration of viola augmented the levels of splenic regulatory T cells (CD4+Foxp3+). We also found that adoptive transfer of viola-elicited regulatory T cells significantly reduced EAE. Our study shows, for the first time, that violacein is able to modulate acute and chronic inflammation. Amelioration relied in suppression of cytokine production (in acute inflammation) and stimulation of regulatory T cells (in chronic inflammation). New studies must be conducted in order to

  19. Base pairing between hepatitis C virus RNA and microRNA 122 3' of its seed sequence is essential for genome stabilization and production of infectious virus.

    PubMed

    Shimakami, Tetsuro; Yamane, Daisuke; Welsch, Christoph; Hensley, Lucinda; Jangra, Rohit K; Lemon, Stanley M

    2012-07-01

    MicroRNA 122 (miR-122) facilitates hepatitis C virus (HCV) replication by recruiting an RNA-induced silencing complex (RISC)-like complex containing argonaute 2 (Ago2) to the 5' end of the HCV genome, thereby stabilizing the viral RNA. This requires base pairing between the miR-122 "seed sequence" (nucleotides [nt] 2 to 8) and two sequences near the 5' end of the HCV RNA: S1 (nt 22 to 28) and S2 (nt 38 to 43). However, recent reports suggest that additional base pair interactions occur between HCV RNA and miR-122. We searched 606 sequences from a public database (genotypes 1 to 6) and identified two conserved, putatively single-stranded RNA segments, upstream of S1 (nt 2 and 3) and S2 (nt 30 to 34), with potential for base pairing to miR-122 (nt 15 and 16 and nt 13 to 16, respectively). Mutagenesis and genetic complementation experiments confirmed that HCV nt 2 and 3 pair with nt 15 and 16 of miR-122 bound to S1, while HCV nt 30 to 33 pair with nt 13 to 16 of miR-122 at S2. In genotype 1 and 6 HCV, nt 4 also base pairs with nt 14 of miR-122. These 3' supplementary base pair interactions of miR-122 are functionally important and are required for Ago2 recruitment to HCV RNA by miR-122, miR-122-mediated stabilization of HCV RNA, and production of infectious virus. However, while complementary mutations at HCV nt 30 and 31 efficiently rescued the activity of a 15C,16C miR-122 mutant targeting S2, similar mutations at nt 2 and 3 failed to rescue Ago2 recruitment at S1. These data add to the current understanding of miR-122 interactions with HCV RNA but indicate that base pairing between miR-122 and the 5' 43 nt of the HCV genome is more complex than suggested by existing models.

  20. Cluster analysis of Plasmodium RNA-seq time-course data identifies stage-specific co-regulated biological processes and regulatory elements

    PubMed Central

    Oyelade, Jelili; Adebiyi, Ezekiel

    2016-01-01

    In this study, we interpreted RNA-seq time-course data of three developmental stages of Plasmodium species by clustering genes based on similarities in their expression profile without prior knowledge of the gene function. Functional enrichment of clusters of upregulated genes at specific time-points reveals potential targetable biological processes with information on their timings. We identified common consensus sequences that these clusters shared as potential points of coordinated transcriptional control. Five cluster groups showed upregulated profile patterns of biological interest. This included two clusters from the Intraerythrocytic Developmental Cycle (cluster 4 = 16 genes, and cluster 9 = 32 genes), one from the sexual development stage (cluster 2 = 851 genes), and two from the gamete-fertilization stage in the mosquito host (cluster 4 = 153 genes, and cluster 9 = 258 genes). The IDC expressed the least numbers of genes with only 1448 genes showing any significant activity of the 5020 genes (~29%) in the experiment. Gene ontology (GO) enrichment analysis of these clusters revealed a total of 671 uncharacterized genes implicated in 14 biological processes and components associated with these stages, some of which are currently being investigated as drug targets in on-going research. Five putative transcription regulatory binding motifs shared by members of each cluster were also identified, one of which was also identified in a previous study by separate researchers. Our study shows stage-specific genes and biological processes that may be important in antimalarial drug research efforts. In addition, timed-coordinated control of separate processes may explain the paucity of factors in parasites. PMID:27990252

  1. A Small Regulatory RNA Contributes to the Preferential Colonization of Escherichia coli O157:H7 in the Large Intestine in Response to a Low DNA Concentration

    PubMed Central

    Han, Runhua; Xu, Letian; Wang, Ting; Liu, Bin; Wang, Lei

    2017-01-01

    Enterohemorrhagic Escherichia coli (EHEC) serotype O157:H7 (O157) is one of the most notorious human pathogens, causing severe disease in humans worldwide. O157 specifically colonizes the large intestine of mammals after passing through the small intestine, and this process is influenced by differential signals between the two regions. Small regulatory RNAs (sRNAs) are able to sense and respond to environmental changes and regulate diverse physiological processes in pathogenic bacteria. Although some sRNAs of O157 have been extensively investigated, whether these molecules can sense differences between the small and large intestine and influence the preferential colonization in the large intestine by O157 remains unknown. In this study, we identified a new sRNA, Esr055, in O157 which senses the low DNA concentration in the large intestine and contributes to the preferential colonization of the bacteria in this region. The number of O157 wild-type that adhered to the colon is 30.18 times higher than the number that adhered to the ileum of mice, while the number of the ΔEsr055 mutant that adhered to the colon decreased to 13.27 times higher than the number adhered to the ileum. Furthermore, we found that the expression of Esr055 is directly activated by the regulator, DeoR, and its expression is positively affected by DNA, which is significantly more abundant in the ileum than in the colon of mice. Additionally, combining the results of informatics predictions and transcriptomic analysis, we found that several virulence genes are up-regulated in the ΔEsr055 mutant and five candidate genes (z0568, z0974, z1356, z1926, and z5187) may be its direct targets. PMID:28289405

  2. Universal bacterial identification by mass spectrometry of 16S ribosomal RNA cleavage products

    NASA Astrophysics Data System (ADS)

    Jackson, George W.; McNichols, Roger J.; Fox, George E.; Willson, Richard C.

    2007-03-01

    The public availability of over 180,000 bacterial 16S ribosomal RNA (rRNA) sequences has facilitated microbial identification and classification using nucleic acid hybridization and other molecular approaches. Species-specific PCR, microarrays, and in situ hybridization are based on the presence of unique subsequences in the target sequence and therefore require prior knowledge of what organisms are likely to be present in a sample. Mass spectrometry is not limited by a pre-synthesized inventory of probe/primer sequences. It has already been demonstrated that organism identification can be recovered from mass spectra using various methods including base-specific cleavage of nucleic acids. The feasibility of broad bacterial identification by comparing such mass spectral patterns to predictive databases derived from virtually all previously sequenced strains has yet to be demonstrated, however. Herein, we present universal bacterial identification by base-specific cleavage, mass spectrometry, and an efficient coincidence function for rapid spectral scoring against a large database of predicted "mass catalogs". Using this approach in conjunction with universal PCR of the 16S rDNA gene, four bacterial isolates and an uncultured clone were successfully identified against a database of predicted cleavage products derived 6rom over 47,000 16S rRNA sequences representing all major bacterial taxaE At present, the conventional DNA isolation and PCR steps require approximately 2 h, while subsequent transcription, enzymatic cleavage, mass spectrometric analysis, and database comparison require less than 45 min. All steps are amenable to high-throughput implementation.

  3. Lactose inhibits regulatory T-cell-mediated suppression of effector T-cell interferon-γ and IL-17 production.

    PubMed

    Paasela, Monika; Kolho, Kaija-Leena; Vaarala, Outi; Honkanen, Jarno

    2014-12-14

    Our interest in lactose as an immunomodulatory molecule results from studies showing that lactose binds to galectin-9, which has been shown to have various regulatory functions in the immune system including regulation of T-cell responses. Impaired regulation of T helper (Th)1 and Th17 type immune responses and dysfunction of regulatory T cells (Treg) have been implicated in many human immune-mediated diseases. In the present study, we investigated the effects of lactose on immune regulation using co-cultures of human peripheral blood mononuclear cell (PBMC)-derived Treg and effector T cells (Teff) obtained from twenty healthy adults. Treg, i.e. CD4+CD25+CD127-, were isolated from PBMC by immunomagnetic separation. The fraction of CD4+CD127- cells that was depleted of CD25+ cells was used as Teff. Treg and Teff at a ratio 1:5 were activated and the effects of lactose on the secretion of interferon-γ (IFN-γ) and IL-17 were analysed using ELISA for protein and quantitative RT-PCR for mRNA. Treg down-regulated the secretion of both IFN-γ (8.8-3.9 ng/ml, n 20, P= 0.003) and IL-17 (0.83-0.64 ng/ml, n 15, P= 0.04) in co-cultures, while in the presence of lactose the levels of secreted IFN-γ and IL-17 remained high and no down-regulation was observed (16.4 v. 3.99 ng/ml, n 20, P< 0.0001, and 0.74 v. 0.64 ng/ml, n 15, P= 0.005, respectively). We showed that lactose inhibits human Treg-mediated suppression of Th1 and Th17 immune responses in vitro.

  4. IRE1beta inhibits chylomicron production by selectively degrading MTP mRNA.

    PubMed

    Iqbal, Jahangir; Dai, Kezhi; Seimon, Tracie; Jungreis, Rivka; Oyadomari, Miho; Kuriakose, George; Ron, David; Tabas, Ira; Hussain, M Mahmood

    2008-05-01

    Microsomal triglyceride transfer protein (MTP) is needed to assemble chylomicrons in the endoplasmic reticulum (ER) of enterocytes. We explored the role of an ER stress protein, inositol-requiring enzyme 1beta (IRE1beta), in regulating this process. High-cholesterol and high-fat diets decreased intestinal IRE1beta mRNA in wild-type mice. Ire1b(-/-) mice fed high-cholesterol and high-fat diets developed more pronounced hyperlipidemia because these mice secreted more chylomicrons and expressed more intestinal MTP, though not hepatic MTP, than wild-type mice did. Chylomicron secretion and MTP expression also were increased in primary enterocytes isolated from cholesterol-fed Ire1b(-/-) mice. There was no correlation between ER stress and MTP expression. Instead, cell culture studies revealed that IRE1beta, but not its ubiquitous homolog IRE1alpha, decreased MTP mRNA through increased posttranscriptional degradation. Conversely, knockdown of IRE1beta enhanced MTP expression. These studies show that IRE1beta plays a role in regulating MTP and in chylomicron production.

  5. Products of lipid, protein and RNA oxidation as signals and regulators of gene expression in plants

    PubMed Central

    Chmielowska-Bąk, Jagna; Izbiańska, Karolina; Deckert, Joanna

    2015-01-01

    Reactive oxygen species (ROS) are engaged in several processes essential for normal cell functioning, such as differentiation, anti-microbial defense, stimulus sensing and signaling. Interestingly, recent studies imply that cellular signal transduction and gene regulation are mediated not only directly by ROS but also by the molecules derived from ROS-mediated oxidation. Lipid peroxidation leads to non-enzymatic formation of oxylipins. These molecules were shown to modulate expression of signaling associated genes including genes encoding phosphatases, kinases and transcription factors. Oxidized peptides derived from protein oxidation might be engaged in organelle-specific ROS signaling. In turn, oxidation of particular mRNAs leads to decrease in the level of encoded proteins and thus, contributes to the post-transcriptional regulation of gene expression. Present mini review summarizes latest findings concerning involvement of products of lipid, protein and RNA oxidation in signal transduction and gene regulation. PMID:26082792

  6. Exposure to 3,3',5-triiodothyronine affects histone and RNA polymerase II modifications, but not DNA methylation status, in the regulatory region of the Xenopus laevis thyroid hormone receptor βΑ gene.

    PubMed

    Kasai, Kentaro; Nishiyama, Norihito; Izumi, Yushi; Otsuka, Shunsuke; Ishihara, Akinori; Yamauchi, Kiyoshi

    2015-11-06

    Thyroid hormones (THs) play a critical role in amphibian metamorphosis, during which the TH receptor (TR) gene, thrb, is upregulated in a tissue-specific manner. The Xenopus laevis thrb gene has 3 TH response elements (TREs) in the 5' flanking regulatory region and 1 TRE in the exon b region, around which CpG sites are highly distributed. To clarify whether exposure to 3,3',5-triiodothyronine (T3) affects histone and RNA polymerase II (RNAPII) modifications and the level of DNA methylation in the 5' regulatory region, we conducted reverse transcription-quantitative polymerase chain reaction, bisulfite sequencing and chromatin immunoprecipitation assay using X. laevis cultured cells and premetamorphic tadpoles treated with or without 2 nM T3. Exposure to T3 increased the amount of the thrb transcript, in parallel with enhanced histone H4 acetylation and RNAPII recruitment, and probably phosphorylation of RNAPII at serine 5, in the 5' regulatory and exon b regions. However, the 5' regulatory region remained hypermethylated even with exposure to T3, and there was no significant difference in the methylation status between DNAs from T3-untreated and -treated cultured cells or tadpole tissues. Our results demonstrate that exposure to T3 induced euchromatin-associated epigenetic marks by enhancing histone acetylation and RNAPII recruitment, but not by decreasing the level of DNA methylation, in the 5' regulatory region of the X. laevis thrb gene.

  7. The regulatory framework for preventing cross-contamination of pharmaceutical products: History and considerations for the future.

    PubMed

    Sargent, Edward V; Flueckiger, Andreas; Barle, Ester Lovsin; Luo, Wendy; Molnar, Lance R; Sandhu, Reena; Weideman, Patricia A

    2016-08-01

    Cross-contamination in multi-product pharmaceutical manufacturing facilities can impact both product safety and quality. This issue has been recognized by regulators and industry for some time, leading to publication of a number of continually evolving guidelines. This manuscript provides a historical overview of the regulatory framework for managing cross-contamination in multi-product facilities to provide context for current approaches. Early guidelines focused on the types of pharmaceuticals for which dedicated facilities and control systems were needed, and stated the requirements for cleaning validation. More recent guidelines have promoted the idea of using Acceptable Daily Exposures (ADEs) to establish cleaning limits for actives and other potentially hazardous substances. The ADE approach is considered superior to previous methods for setting cleaning limits such as using a predetermined general limit (e.g., 10 ppm or a fraction of the median lethal dose (LD50) or therapeutic dose). The ADEs can be used to drive the cleaning process and as part of the overall assessment of whether dedicated production facilities are required. While great strides have been made in using the ADE approach, work remains to update good manufacturing practices (GMPs) to ensure that the approaches are clear, consistent with the state-of-the-science, and broadly applicable yet flexible enough for adaptation to unique products and situations.

  8. Summary workshop report: Facilitating oral product development and reducing regulatory burden through novel approaches to assess bioavailability/bioequivalence.

    PubMed

    Polli, James E; Cook, Jack A; Davit, Barbara M; Dickinson, Paul A; Argenti, Domenick; Barbour, Nancy; García-Arieta, Alfredo; Geoffroy, Jean-Marie; Hartauer, Kerry; Li, Shoufeng; Mitra, Amitava; Muller, Francis X; Purohit, Vivek; Sanchez-Felix, Manuel; Skoug, John W; Tang, Kin

    2012-09-01

    This summary workshop report highlights presentations and over-arching themes from an October 2011 workshop. Discussions focused on best practices in the application of biopharmaceutics in oral drug product development and evolving bioequivalence approaches. Best practices leverage biopharmaceutic data and other drug, formulation, and patient/disease data to identify drug development challenges in yielding a successfully performing product. Quality by design and product developability paradigms were discussed. Development tools include early development strategies to identify critical absorption factors and oral absorption modeling. An ongoing theme was the desire to comprehensively and systematically assess risk of product failure via the quality target product profile and root cause and risk analysis. However, a parallel need is reduced timelines and fewer resources. Several presentations discussed applying Biopharmaceutics Classification System (BCS) and in vitro-in vivo correlations in development and in post-development and discussed both resource savings and best scientific practices. The workshop also focused on evolving bioequivalence approaches, with emphasis on highly variable products (HVDP), as well as specialized modified-release products. In USA, two bioequivalence approaches for HVDP are the reference-scaled average bioequivalence approach and the two-stage group-sequential design. An adaptive sequential design approach is also acceptable in Canada. In European Union, two approaches for HVDP are a two-stage design and an approach to widen C (max) acceptance limits. For some specialized modified-release products, FDA now requests partial area under the curve. Rationale and limitations of such metrics were discussed (e.g., zolpidem and methylphenidate). A common theme was the benefit of the scientific and regulatory community developing, validating, and harmonizing newer bioequivalence methodologies (e.g., BCS-based waivers and HVDP trial designs).

  9. A Rhizobium meliloti symbiotic regulatory gene.

    PubMed

    Szeto, W W; Zimmerman, J L; Sundaresan, V; Ausubel, F M

    1984-04-01

    We have characterized a Rhizobium meliloti regulatory gene required for the expression of two closely linked symbiotic operons, the nitrogenase operon (nifHDK genes) and the "P2" operon. This regulatory gene maps to a 1.8 kb region located 5.5 kb upstream of the nifHDK operon. The regulatory gene is required for the accumulation of nifHDK and P2 mRNA and for the derepression of an R. meliloti nifH-lacZ fusion plasmid during symbiotic growth. The nifH and P2 promoters can be activated in free-living cultures of R. meliloti containing plasmids that produce the Escherichia coli ntrC(glnG) or the Klebsiella pneumoniae nifA regulatory gene products constitutively. The R. meliloti regulatory gene hybridizes to E. coli ntrC(glnG) and, to a lesser extent, to K. pneumoniae nifA DNA. Our results suggest that the R. meliloti regulatory gene acts as a positive transcriptional activator and that it is related to the K. pneumoniae nif regulatory genes.

  10. Cloning and expression analyses of interferon regulatory factor (IRF) 3 and 7 genes in European eel, Anguilla anguilla with the identification of genes involved in IFN production.

    PubMed

    Huang, Bei; Huang, Wen Shu; Nie, P

    2014-04-01

    Interferon regulatory factor (IRF) 3 and IRF7 have been identified as regulators of type I interferon (IFN) gene expression in mammals. In the present study, the two genes were cloned and characterized in the European eel, Anguilla anguilla. The full-length cDNA sequence of IRF3 and IRF7 in the European eel, named as AaIRF3 and AaIRF7 consists of 2879 and 2419 bp respectively. Multiple alignments showed that the two IRFs have a highly conserved DNA binding domain (DBD) in the N terminus, with the characteristic motif containing five tryptophan residues, which is a feature present in their mammalian homologues. But, IRF7 has only four of the five residues in other species of fish. The expression of AaIRF3 and AaIRF7 both displayed an obvious dose-dependent manner following polyinosinic:polycytidylic acid (PolyI:C) challenge. In vivo expression analysis showed that the mRNA level of AaIRF3 and AaIRF7 was significantly up-regulated in response to PolyI:C stimulation in all examined tissues/organs except in muscle, with a lower level of increase observed in response to lipopolysaccharide (LPS) challenge and Edwardsiella tarda infection, indicating that AaIRF3 and AaIRF7 may be more likely involved in antiviral immune response. In addition, some pattern recognition receptors genes related with the production of type I IFNs and those genes in response to type I IFNs were identified in the European eel genome database, indicating a relatively conserved system in the production of type I IFN and its signalling in the European eel.

  11. Over-expression of GTP-cyclohydrolase 1 feedback regulatory protein attenuates LPS and cytokine-stimulated nitric oxide production.

    PubMed

    Nandi, Manasi; Kelly, Peter; Vallance, Patrick; Leiper, James

    2008-02-01

    GTP-cyclohydrolase 1 (GTP-CH1) catalyses the first and rate-limiting step for the de novo production of tetrahydrobiopterin (BH(4)), an essential cofactor for nitric oxide synthase (NOS). The GTP-CH1-BH(4) pathway is emerging as an important regulator in a number of pathologies associated with over-production of nitric oxide (NO) and hence a more detailed understanding of this pathway may lead to novel therapeutic targets for the treatment of certain vascular diseases. GTP-CH1 activity can be inhibited by BH(4) through its protein-protein interactions with GTP-CH1 regulatory protein (GFRP), and transcriptional and post-translational modification of both GTP-CH1 and GFRP have been reported in response to proinflammatory stimuli. However, the functional significance of GFRP/GTP-CH1 interactions on NO pathways has not yet been demonstrated. We aimed to investigate whether over-expression of GFRP could affect NO production in living cells. Over-expression of N-terminally Myc-tagged recombinant human GFRP in the murine endothelial cell line sEnd 1 resulted in no significant effect on basal BH(4) nor NO levels but significantly attenuated the rise in BH(4) and NO observed following lipopolysaccharide and cytokine stimulation of cells. This study demonstrates that GFRP can play a direct regulatory role in iNOS-mediated NO synthesis and suggests that the allosteric regulation of GTP-CH1 activity by GFRP may be an important mechanism regulating BH(4) and NO levels in vivo.

  12. Biochemical characterization of G4 quadruplex telomerase RNA unwinding by the RNA helicase RHAU.

    PubMed

    Booy, Evan P; McRae, Ewan K S; McKenna, Sean A

    2015-01-01

    G4 quadruplexes are stable secondary structures prevalent in DNA and RNA that exhibit diverse regulatory functions. Herein, we describe an in vitro technique using the purified RNA helicase RHAU to unwind a G4 quadruplex identified near the 5' end of the human telomerase RNA (hTR). A synthetic RNA corresponding to the quadruplex forming region of hTR (hTR10-43), as well as a predicted complementary strand (25P1), are combined in a reaction containing the purified helicase and ATP. Reaction products and appropriate controls are resolved by native gel electrophoresis. Gels can be stained using a combination of total RNA and quadruplex-specific dyes to observe the expected quadruplex to duplex conversion. This straightforward method can be extended to study structural changes in other inter- or intramolecular quadruplex containing DNA/RNA molecules with the RHAU helicase or other RNA/DNA remodeling enzymes.

  13. WHO informal consultation on regulatory evaluation of therapeutic biological medicinal products held at WHO Headquarters, Geneva, 19-20 April 2007.

    PubMed

    Joung, Jeewon; Robertson, James S; Griffiths, Elwyn; Knezevic, Ivana

    2008-07-01

    This report reflects the discussion and conclusions of an informal consultation held on 19-20 April 2007 at the World Health Organization concerning the regulatory evaluation of therapeutic biological medicinal products. The objectives of this meeting were to discuss the current status of so-called "similar" biological medicinal products (biosimilars) and to review regulatory pathways and challenges in evaluating the quality, safety and efficacy of these products. Biosimilars are products that are subject to licensing with a reduced data package due to a proven 'similarity' to the licensed reference product. The meeting was attended by experts in biotherapeutics from regulatory agencies, industry and academia representing 16 countries worldwide. Dr. Elwyn Griffiths (Canada) acted as Chairman and Dr. James Robertson (UK) was the Rapporteur. The meeting strongly focused on the usage of biosimilars and the current regulatory situation in many different countries. The application of International Nonproprietary Names (INN) to biosimilars, their potential immunogenicity, and WHO international standards and reference materials were also discussed, alongside presentations from the innovator and generic manufacturing industries. The consultation recognized the importance of the terminology as well as a definition of biosimilars for future considerations of these products. However, achieving a global consensus on the terminology for these new challenging products was not attempted at the Consultation, and it was decided that a future WHO working group should act on this issue as a next step. For purposes of this meeting report only, the term 'biosimilars' is temporarily used to refer to this category of products. It became clear that biotherapeutics authorized on the basis of a reduced data package are available and being used in some countries, with more appearing on the market. The existence of divergent approaches to the regulatory oversight of biosimilars in different

  14. Discrepancies in listed adverse drug reactions in pharmaceutical product information supplied by the regulatory authorities in Denmark and the USA.

    PubMed

    Eriksson, Robert; Aagaard, Lise; Jensen, Lars Juhl; Borisova, Liza; Hørlück, Dorte; Brunak, Søren; Hansen, Ebba Holme

    2014-06-01

    Pharmaceutical product information (PI) supplied by the regulatory authorities serves as a source of information on safe and effective use of drugs. The objectives of this study were to qualitatively and quantitatively compare PIs for selected drugs marketed in both Denmark and the USA with respect to consistency and discrepancy of listed adverse drug reaction (ADR) information. We compared individual ADRs listed in PIs from Denmark and the USA with respect to type and frequency. Consistency was defined as match of ADRs and of ADR frequency or match could not be ruled out. Discrepancies were defined as ADRs listed only in one country or listed with different frequencies. We analyzed PIs for 40 separate drugs from ten therapeutic groups and assigned the 4003 identified ADRs to System Organ Classes (Medical Dictionary for Regulatory Activities [MedDRA] terminology). Less than half of listed ADRs (n = 1874; 47%) showed consistency. Discrepancies (n = 2129; 53%) were split into ADRs listed only in the USA (n = 1558; 39%), ADRs listed only in Denmark (n = 325; 8%) and ADRs listed with different frequencies (n = 246; 6%). The majority of listed ADRs were of the type "gastrointestinal disorders" and "nervous system disorders". Our results show great differences in PIs for drugs approved in both Denmark and the USA illuminating concerns about the credibility of the publicly available PIs. The results also represent an argument for further harmonization across borders to improve consistency between authority-supplied information.

  15. MicroRNA-155 potentiates the inflammatory response in hypothermia by suppressing IL-10 production.

    PubMed

    Billeter, Adrian T; Hellmann, Jason; Roberts, Henry; Druen, Devin; Gardner, Sarah A; Sarojini, Harshini; Galandiuk, Susan; Chien, Sufan; Bhatnagar, Aruni; Spite, Matthew; Polk, Hiram C

    2014-12-01

    Therapeutic hypothermia is commonly used to improve neurological outcomes in patients after cardiac arrest. However, therapeutic hypothermia increases sepsis risk and unintentional hypothermia in surgical patients increases infectious complications. Nonetheless, the molecular mechanisms by which hypothermia dysregulates innate immunity are incompletely understood. We found that exposure of human monocytes to cold (32°C) potentiated LPS-induced production of TNF and IL-6, while blunting IL-10 production. This dysregulation was associated with increased expression of microRNA-155 (miR-155), which potentiates Toll-like receptor (TLR) signaling by negatively regulating Ship1 and Socs1. Indeed, Ship1 and Socs1 were suppressed at 32°C and miR-155 antagomirs increased Ship1 and Socs1 and reversed the alterations in cytokine production in cold-exposed monocytes. In contrast, miR-155 mimics phenocopied the effects of cold exposure, reducing Ship1 and Socs1 and altering TNF and IL-10 production. In a murine model of LPS-induced peritonitis, cold exposure potentiated hypothermia and decreased survival (10 vs. 50%; P < 0.05), effects that were associated with increased miR-155, suppression of Ship1 and Socs1, and alterations in TNF and IL-10. Importantly, miR-155-deficiency reduced hypothermia and improved survival (78 vs. 32%, P < 0.05), which was associated with increased Ship1, Socs1, and IL-10. These results establish a causal role of miR-155 in the dysregulation of the inflammatory response to hypothermia.

  16. Efficient production of superior dumbbell-shaped DNA minimal vectors for small hairpin RNA expression.

    PubMed

    Yu, Han; Jiang, Xiaoou; Tan, Kar Tong; Hang, Liting; Patzel, Volker

    2015-10-15

    Genetic therapy holds great promise for the treatment of inherited or acquired genetic diseases; however, its breakthrough is hampered by the lack of suitable gene delivery systems. Dumbbell-shaped DNA minimal vectors represent an attractive, safe alternative to the commonly used viral vectors which are fraught with risk, but dumbbell generation appears to be costly and time-consuming. We developed a new PCR-based method for dumbbell production which comprises only two steps. First, PCR amplification of the therapeutic expression cassette using chemically modified primers to form a ready-to-ligate DNA structure; and second, a highly efficient intramolecular ligation reaction. Compared with conventional strategies, the new method produces dumbbell vectors more rapidly, with higher yields and purity, and at lower costs. In addition, such produced small hairpin RNA expressing dumbbells triggered superior target gene knockdown compared with conventionally produced dumbbells or plasmids. Our novel method is suitable for large-scale dumbbell production and can facilitate clinical applications of this vector system.

  17. Hepatic Stellate Cells Preferentially Induce Foxp3+ Regulatory T Cells by Production of Retinoic Acid

    PubMed Central

    Dunham, Richard M.; Thapa, Manoj; Velazquez, Victoria M.; Elrod, Elizabeth J.; Denning, Timothy L.; Pulendran, Bali

    2013-01-01

    The liver has long been described as immunosuppressive, although the mechanisms underlying this phenomenon are incompletely understood. Hepatic stellate cells (HSCs), a population of liver nonparenchymal cells, are potent producers of the regulatory T cell (Treg)–polarizing molecules TGF-β1 and all-trans retinoic acid, particularly during states of inflammation. HSCs are activated during hepatitis C virus infection and may therefore play a role in the enrichment of Tregs during infection. We hypothesized that Ag presentation in the context of HSC activation will induce naive T cells to differentiate into Foxp3+ Tregs. To test this hypothesis, we investigated the molecular interactions between murine HSCs, dendritic cells, and naive CD4+ T cells. We found that HSCs alone do not present Ag to naive CD4+ T cells, but in the presence of dendritic cells and TGF-β1, preferentially induce functional Tregs. This Treg induction was associated with retinoid metabolism by HSCs and was dependent on all-trans retinoic acid. Thus, we conclude that HSCs preferentially generate Foxp3+ Tregs and, therefore, may play a role in the tolerogenic nature of the liver. PMID:23359509

  18. Elimination of polyamine N-acetylation and regulatory engineering improved putrescine production by Corynebacterium glutamicum.

    PubMed

    Nguyen, Anh Q D; Schneider, Jens; Wendisch, Volker F

    2015-05-10

    Corynebacterium glutamicum has been engineered for production of the polyamide monomer putrescine or 1,4-diaminobutane. Here, N-acetylputrescine was shown to be a significant by-product of putrescine production by recombinant putrescine producing C. glutamicum strains. A systematic gene deletion approach of 18 (putative) N-acetyltransferase genes revealed that the cg1722 gene product was responsible for putrescine acetylation. The encoded enzyme was purified and characterized as polyamine N-acetyltransferase. The enzyme accepted acetyl-CoA and propionyl-CoA as donors for acetylation of putrescine and other diamines as acceptors, but showed highest catalytic efficiency with the triamine spermidine and the tetraamine spermine and, hence, was named SnaA. Upon deletion of snaA in the putrescine producing strain PUT21, no acteylputrescine accumulated, but about 41% more putrescine as compared to the parent strain. Moreover, a transcriptome approach identified increased expression of the cgmAR operon encoding a putative permease and a transcriptional TetR-family repressor upon induction of putrescine production in C. glutamicum PUT21. CgmR is known to bind to cgmO upstream of cgmAR and gel mobility shift experiments with purified CgmR revealed that putrescine and other diamines perturbed CgmR-cgmO complex formation, but not migration of free cgmO DNA. Deletion of the repressor gene cgmR resulted in expression changes of a number of genes and increased putrescine production of C. glutamicum PUT21 by 19% as compared to the parent strain. Overexpression of the putative transport gene cgmA increased putrescine production by 24% as compared to the control strain. However, cgmA overexpression in PUT21ΔsnaA did not further improve putrescine production, hence, the beneficial effects of both targets were not synergistic at the highest described yield of 0.21 g g(-1).

  19. Identification and characterization of promoters and cis-regulatory elements of genes involved in secondary metabolites production in hop (Humulus lupulus. L).

    PubMed

    Duraisamy, Ganesh Selvaraj; Mishra, Ajay Kumar; Kocabek, Tomas; Matoušek, Jaroslav

    2016-10-01

    Molecular and biochemical studies have shown that gene contains single or combination of different cis-acting regulatory elements are actively controlling the transcriptional regulation of associated genes, downstream effects of these result in the modulation of various biological pathways such as biotic/abiotic stress responses, hormonal responses to growth and development processes and secondary metabolite production. Therefore, the identification of promoters and their cis-regulatory elements is one of intriguing area to study the dynamic complex regulatory network of genes activities by integrating computational, comparative, structural and functional genomics. Several bioinformatics servers or database have been established to predict the cis-acting elements present in the promoter region of target gene and their association with the expression profiles in the TFs. The aim of this study is to predict possible cis-acting regulatory elements that have putative role in the transcriptional regulation of a dynamic network of metabolite gene activities controlling prenylflavonoid and bitter acids biosynthesis in hop (Humulus lupulus). Recent release of hop draft genome enabled us to predict the possible cis-acting regulatory elements by extracting 2kbp of 5' regulatory regions of genes important for lupulin metabolome biosynthesis, using Plant CARE, PLACE and Genomatix Matinspector professional databases. The result reveals the plausible role of cis-acting regulatory elements in the regulation of gene expression primarily involved in lupulin metabolome biosynthesis including under various stress conditions.

  20. In vivo co-localization of enzymes on RNA scaffolds increases metabolic production in a geometrically dependent manner.

    PubMed

    Sachdeva, Gairik; Garg, Abhishek; Godding, David; Way, Jeffrey C; Silver, Pamela A

    2014-08-01

    Co-localization of biochemical processes plays a key role in the directional control of metabolic fluxes toward specific products in cells. Here, we employ in vivo scaffolds made of RNA that can bind engineered proteins fused to specific RNA binding domains. This allows proteins to be co-localized on RNA scaffolds inside living Escherichia coli. We assembled a library of eight aptamers and corresponding RNA binding domains fused to partial fragments of fluorescent proteins. New scaffold designs could co-localize split green fluorescent protein fragments to produce activity as measured by cell-based fluorescence. The scaffolds consisted of either single bivalent RNAs or RNAs designed to polymerize in one or two dimensions. The new scaffolds were used to increase metabolic output from a two-enzyme pentadecane production pathway that contains a fatty aldehyde intermediate, as well as three and four enzymes in the succinate production pathway. Pentadecane synthesis depended on the geometry of enzymes on the scaffold, as determined through systematic reorientation of the acyl-ACP reductase fusion by rotation via addition of base pairs to its cognate RNA aptamer. Together, these data suggest that intra-cellular scaffolding of enzymatic reactions may enhance the direct channeling of a variety of substrates.

  1. Phosphate-binding pocket in Dicer-2 PAZ domain for high-fidelity siRNA production.

    PubMed

    Kandasamy, Suresh K; Fukunaga, Ryuya

    2016-12-06

    The enzyme Dicer produces small silencing RNAs such as micro-RNAs (miRNAs) and small interfering RNAs (siRNAs). In Drosophila, Dicer-1 produces ∼22-24-nt miRNAs from pre-miRNAs, whereas Dicer-2 makes 21-nt siRNAs from long double-stranded RNAs (dsRNAs). How Dicer-2 precisely makes 21-nt siRNAs with a remarkably high fidelity is unknown. Here we report that recognition of the 5'-monophosphate of a long dsRNA substrate by a phosphate-binding pocket in the Dicer-2 PAZ (Piwi, Argonaute, and Zwille/Pinhead) domain is crucial for the length fidelity, but not the efficiency, in 21-nt siRNA production. Loss of the length fidelity, meaning increased length heterogeneity of siRNAs, caused by point mutations in the phosphate-binding pocket of the Dicer-2 PAZ domain decreased RNA silencing activity in vivo, showing the importance of the high fidelity to make 21-nt siRNAs. We propose that the 5'-monophosphate of a long dsRNA substrate is anchored by the phosphate-binding pocket in the Dicer-2 PAZ domain and the distance between the pocket and the RNA cleavage active site in the RNaseIII domain corresponds to the 21-nt pitch in the A-form duplex of a long dsRNA substrate, resulting in high-fidelity 21-nt siRNA production. This study sheds light on the molecular mechanism by which Dicer-2 produces 21-nt siRNAs with a remarkably high fidelity for efficient RNA silencing.

  2. Restrictions on antimicrobial use in food animal production: an international regulatory and economic survey

    PubMed Central

    2013-01-01

    Background The administration of antimicrobial drugs to food animals at low doses for extended durations for growth promotion and disease prevention has been linked to the global health crisis of antimicrobial resistance. Internationally, multiple jurisdictions have responded by restricting antimicrobial use for these purposes, and by requiring a veterinary prescription to use these drugs in food animals. Opponents of these policies have argued that restrictions have been detrimental to food animal production where they have been adopted. Methods We surveyed the antimicrobial use policies of 17 political jurisdictions outside of the United States with respect to growth promotion, disease prevention, and veterinary oversight, and reviewed the available evidence regarding their production impacts, including measures of animal health. Jurisdictions were included if they were a top-five importer of a major U.S. food animal product in 2011, as differences between the policies of the U.S. and other jurisdictions may lead to trade barriers to U.S. food animal product exports. Jurisdictions were also included if information on their policies was publicly available in English. We searched the peer-reviewed and grey literatures and corresponded with jurisdictions’ U.S. embassies, regulators, and local experts. Results Jurisdictions were categorized by whether they prohibit use of antimicrobials for growth promotion and/or use of antimicrobials without a veterinary prescription. Of the 17 jurisdictions surveyed, six jurisdictions have prohibited both types of use, five jurisdictions have prohibited one use but not the other use, and five jurisdictions have not prohibited either use, while information was not available for one jurisdiction. Data on the production impacts of these prohibitions were limited, although available data, especially from Denmark and Sweden, suggest that restrictions on growth promotion use can be implemented with minimal production consequences

  3. Complementary transcriptomic and proteomic analyses reveal regulatory mechanisms of milk protein production in dairy cows consuming different forages

    PubMed Central

    Dai, Wenting; Chen, Qiong; Wang, Quanjuan; White, Robin R.; Liu, Jianxin; Liu, Hongyun

    2017-01-01

    Forage plays a critical role in the milk production of dairy cows; however, the mechanisms regulating bovine milk synthesis in dairy cows fed high forage rations with different basal forage types are not well-understood. In the study, rice straw (RS, low-quality) and alfalfa hay (AH, high-quality) diets were fed to lactating cows to explore how forage quality affected the molecular mechanisms regulating milk production using RNA-seq transcriptomic method with iTRAQ proteomic technique. A total of 554 transcripts (423 increased and 131 decreased) and 517 proteins (231 up-regulated and 286 down-regulated) were differentially expressed in the mammary glands of the two groups. The correlation analysis demonstrated seven proteins (six up-regulated and one down-regulated) had consistent mRNA expression. Functional analysis of the differentially expressed transcripts/proteins suggested that enhanced capacity for energy and fatty acid metabolism, increased protein degradation, reduced protein synthesis, decreased amino acid metabolism and depressed cell growth were related to RS consumption. The results indicated cows consuming RS diets may have had depressed milk protein synthesis because these animals had decreased capacity for protein synthesis, enhanced proteolysis, inefficient energy generation and reduced cell growth. Additional work evaluating RS- and AH-based rations may help better isolate molecular adaptations to low nutrient availability during lactation. PMID:28290485

  4. High-level extracellular production of alkaline polygalacturonate lyase in Bacillus subtilis with optimized regulatory elements.

    PubMed

    Zhang, Junjiao; Kang, Zhen; Ling, Zhenmin; Cao, Wenlong; Liu, Long; Wang, Miao; Du, Guocheng; Chen, Jian

    2013-10-01

    The present work aims to construct a robust recombinant Bacillus subtilis to achieve secretory production of alkaline polygalacturonate lyase (PGL). First, 6 signal peptides (amyX, bpr, vpr, yvgO, wapA and nprE) were screened with a semi-rational approach and comparatively investigated their effects on the production of PGL. The signal peptide bpr directed efficient PGL secretory expression and increased PGL titer to 313.7 U mL(-1). By optimizing and applying strong promoter P43 and Shine-Dalgarno sequence, higher titer of 446.3 U mL(-1) PGL was achieved. Finally, the capacity of the recombinant B. subtilis WB43CB was evaluated with a fed-batch strategy in 3 L fermentor. The PGL titer reached 632.6 U mL(-1) with a productivity of 17.6 U mL(-1) h(-1), which was the highest secretory production of PGL by the B. subtilis system. The recombinant B. subtilis strain WB43CB constructed in the present work has great potential in production of alkaline PGL.

  5. Important Regulatory Aspects in the Receipt of Animal Products by Food Services.

    PubMed

    de Mesquita, Marizete Oliveira; de Freitas Saccol, Ana Lúcia; Mesquita, Marilise Oliveira; Fries, Leadir Lucy Martins; Cesar Tondo, Eduardo

    2016-12-09

    The aim of this study was to review the current legislation and rules in Brazil that involve quality assurance of animal products during food service reception. Published federal legislation and technical regulations were verified to present a broad general approach to raw material reception. Food service determinations included specifications of the criteria for evaluating and selecting suppliers, verifying the transport system, reception area requirements, and inspecting raw material. For product approval, the packaging, labeling, and temperature should be evaluated. However, periodic microbiological, physicochemical, and sensory support assessment analyses are not required for receiving animal products. For the safety of the raw material, it was concluded that the largest impacts came from the regulation and supervision of the food sector provider because of the challenges of food service and a lack of requirements to use more complex evaluation methods during the reception of raw materials.

  6. Postmarket surveillance of natural health products in Canada: clinical and federal regulatory perspectives.

    PubMed

    Murty, Mano

    2007-09-01

    Postmarket surveillance, particularly adverse reactions (ARs), forms an integral part of the ongoing safety evaluation for natural health products (NHPs). ARs can be related to many factors, including inherent toxicity, misuse, hypersensitivity, NHP-drug interactions, or product quality. High consumer use and limited safety and efficacy data from human clinical trials for many NHPs present a challenge to consumers, healthcare practitioners, and federal regulators. Canada's Natural Health Products Regulations mandate NHPs to be licensed. As the currently available unauthorized NHPs are being brought into compliance in Canada, the transition has produced some challenges, requiring ongoing public communication and education to promote the safe use of NHPs. This article will highlight Health Canada's key postmarket initiatives in strengthening the regulation of NHPs.

  7. RNA helicase signaling is critical for type i interferon production and protection against Rift Valley fever virus during mucosal challenge.

    PubMed

    Ermler, Megan E; Yerukhim, Ekaterina; Schriewer, Jill; Schattgen, Stefan; Traylor, Zachary; Wespiser, Adam R; Caffrey, Daniel R; Chen, Zhijian J; King, Charles H; Gale, Michael; Colonna, Marco; Fitzgerald, Katherine A; Buller, R Mark L; Hise, Amy G

    2013-05-01

    Rift Valley fever virus (RVFV) is an emerging RNA virus with devastating economic and social consequences. Clinically, RVFV induces a gamut of symptoms ranging from febrile illness to retinitis, hepatic necrosis, hemorrhagic fever, and death. It is known that type I interferon (IFN) responses can be protective against severe pathology; however, it is unknown which innate immune receptor pathways are crucial for mounting this response. Using both in vitro assays and in vivo mucosal mouse challenge, we demonstrate here that RNA helicases are critical for IFN production by immune cells and that signaling through the helicase adaptor molecule MAVS (mitochondrial antiviral signaling) is protective against mortality and more subtle pathology during RVFV infection. In addition, we demonstrate that Toll-like-receptor-mediated signaling is not involved in IFN production, further emphasizing the importance of the RNA cellular helicases in type I IFN responses to RVFV.

  8. Rates of chemical cleavage of DNA and RNA oligomers containing guanine oxidation products.

    PubMed

    Fleming, Aaron M; Alshykhly, Omar; Zhu, Judy; Muller, James G; Burrows, Cynthia J

    2015-06-15

    The nucleobase guanine in DNA (dG) and RNA (rG) has the lowest standard reduction potential of the bases, rendering it a major site of oxidative damage in these polymers. Mapping the sites at which oxidation occurs in an oligomer via chemical reagents utilizes hot piperidine for cleaving oxidized DNA and aniline (pH 4.5) for cleaving oxidized RNA. In the present studies, a series of time-dependent cleavages of DNA and RNA strands containing various guanine lesions were examined to determine the strand scission rate constants. The guanine base lesions 8-oxo-7,8-dihydroguanine (OG), spiroiminodihydantoin (Sp), 5-guanidinohydantoin (Gh), 2,2,4-triamino-2H-oxazol-5-one (Z), and 5-carboxamido-5-formamido-2-iminohydantoin (2Ih) were evaluated in piperidine-treated DNA and aniline-treated RNA. These data identified wide variability in the chemical lability of the lesions studied in both DNA and RNA. Further, the rate constants for cleaving lesions in RNA were generally found to be significantly smaller than for lesions in DNA. The OG nucleotides were poorly cleaved in DNA and RNA; Sp nucleotides were slowly cleaved in DNA and did not cleave significantly in RNA; Gh and Z nucleotides cleaved in both DNA and RNA at intermediate rates; and 2Ih oligonucleotides cleaved relatively quickly in both DNA and RNA. The data are compared and contrasted with respect to future experimental design.

  9. Snf1-Dependent Transcription Confers Glucose-Induced Decay upon the mRNA Product

    PubMed Central

    Braun, Katherine A.; Dombek, Kenneth M.

    2015-01-01

    In the yeast Saccharomyces cerevisiae, the switch from respiratory metabolism to fermentation causes rapid decay of transcripts encoding proteins uniquely required for aerobic metabolism. Snf1, the yeast ortholog of AMP-activated protein kinase, has been implicated in this process because inhibiting Snf1 mimics the addition of glucose. In this study, we show that the SNF1-dependent ADH2 promoter, or just the major transcription factor binding site, is sufficient to confer glucose-induced mRNA decay upon heterologous transcripts. SNF1-independent expression from the ADH2 promoter prevented glucose-induced mRNA decay without altering the start site of transcription. SNF1-dependent transcripts are enriched for the binding motif of the RNA binding protein Vts1, an important mediator of mRNA decay and mRNA repression whose expression is correlated with decreased abundance of SNF1-dependent transcripts during the yeast metabolic cycle. However, deletion of VTS1 did not slow the rate of glucose-induced mRNA decay. ADH2 mRNA rapidly dissociated from polysomes after glucose repletion, and sequences bound by RNA binding proteins were enriched in the transcripts from repressed cells. Inhibiting the protein kinase A pathway did not affect glucose-induced decay of ADH2 mRNA. Our results suggest that Snf1 may influence mRNA stability by altering the recruitment activity of the transcription factor Adr1. PMID:26667037

  10. Differential roles of human Dicer-binding proteins TRBP and PACT in small RNA processing.

    PubMed

    Lee, Ho Young; Zhou, Kaihong; Smith, Alison Marie; Noland, Cameron L; Doudna, Jennifer A

    2013-07-01

    During RNA interference and related gene regulatory pathways, the endonuclease Dicer cleaves precursor RNA molecules to produce microRNAs (miRNAs) and short interfering RNAs (siRNAs). Human cells encode a single Dicer enzyme that can associate with two different double-stranded RNA (dsRNA)-binding proteins, protein activator of PKR (PACT) and trans-activation response RNA-binding protein (TRBP). However, the functional redundancy or differentiation of PACT and TRBP in miRNA and siRNA biogenesis is not well understood. Using a reconstituted system, we show here that PACT and TRBP have distinct effects on Dicer-mediated dsRNA processing. In particular, we found that PACT in complex with Dicer inhibits the processing of pre-siRNA substrates when compared with Dicer and a Dicer-TRBP complex. In addition, PACT and TRBP show non-redundant effects on the production of different-sized miRNAs (isomiRs), which in turn alter target-binding specificities. Experiments using chimeric versions of PACT and TRBP suggest that the two N-terminal RNA-binding domains of each protein confer the observed differences in dsRNA substrate recognition and processing behavior of Dicer-dsRNA-binding protein complexes. These results support the conclusion that in humans, Dicer-associated dsRNA-binding proteins are important regulatory factors that contribute both substrate and cleavage specificity during miRNA and siRNA production.

  11. Control of Drosophila Sex-lethal pre-mRNA splicing by its own female-specific product.

    PubMed Central

    Sakamoto, H; Inoue, K; Higuchi, I; Ono, Y; Shimura, Y

    1992-01-01

    Drosophila melanogaster somatic sexual differentiation is accomplished by serial function of the products of sex-determination genes. Sex-lethal (Sxl), is one such gene. It is functionally expressed only in female flies. The sex-specific expression of this gene is regulated by alternative mRNA splicing which results in either the inclusion or exclusion of the translation stop codon containing third exon. Although previous genetic and molecular analyses suggest that functional Sxl expression is maintained by a positive feedback loop, where the female-specific Sxl product promotes the synthesis of its own female-specific mRNA, the mechanistic details of such regulation have remained unclear. We have developed a cotransfection system using Drosophila cultured (Kc) cells in which Sxl primary transcripts are expressed with or without the female specific Sxl product. Here we show that the female-specific Sxl product induces the synthesis of its own female-specific mRNA by negative control of male-specific splicing. Deletion, substitution, and binding experiments have demonstrated that multiple uridine-rich sequences in the introns around the male-specific third exon are involved in the splicing regulation of Sxl pre-mRNA. Images PMID:1454517

  12. Viral precursor protein P3 and its processed products perform discrete and essential functions in the poliovirus RNA replication complex

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The differential use of protein precursors and their products is a key strategy used during poliovirus replication. To characterize the role of protein precursors during replication, we examined the complementation profiles of mutants that inhibited 3D polymerase or 3C-RNA binding activity. We showe...

  13. Regulatory T cell levels and cytokine production in active non-infectious uveitis: in-vitro effects of pharmacological treatment

    PubMed Central

    Molins, B; Mesquida, M; Lee, R W J; Llorenç, V; Pelegrín, L; Adán, A

    2015-01-01

    The aim of this study was to quantify the proportion of regulatory T cells (Treg) and cytokine expression by peripheral blood mononuclear cells (PBMCs) in patients with active non-infectious uveitis, and to evaluate the effect of in-vitro treatment with infliximab, dexamethasone and cyclosporin A on Treg levels and cytokine production in PBMCs from uveitis patients and healthy subjects. We included a group of 21 patients with active non-infectious uveitis and 18 age-matched healthy subjects. The proportion of forkhead box protein 3 (FoxP3)+ Treg cells and intracellular tumour necrosis factor (TNF)-α expression in CD4+ T cells was determined by flow cytometry. PBMCs were also either rested or activated with anti-CD3/anti-CD28 and cultured in the presence or absence of dexamethasone, cyclosporin A and infliximab. Supernatants of cultured PBMCs were collected and TNF-α, interleukin (IL)-10, IL-17 and interferon (IFN)-γ levels were measured by enzyme-linked immunosorbent assay (ELISA). No significant differences were observed in nTreg levels between uveitis patients and healthy subjects. However, PBMCs from uveitis patients produced significantly higher amounts of TNF-α and lower amounts of IL-10. Dexamethasone treatment in vitro significantly reduced FoxP3+ Treg levels in PBMCs from both healthy subjects and uveitis patients, and all tested drugs significantly reduced TNF-α production in PBMCs. Dexamethasone and cyclosporin A significantly reduced IL-17 and IFN-γ production in PBMCs and dexamethasone up-regulated IL-10 production in activated PBMCs from healthy subjects. Our results suggest that PBMCs from patients with uveitis express more TNF-α and less IL-10 than healthy subjects, and this is independent of FoxP3+ Treg levels. Treatment with infliximab, dexamethasone and cyclosporin A in vitro modulates cytokine production, but does not increase the proportion of FoxP3+ Treg cells. PMID:25354724

  14. Regulatory T cell levels and cytokine production in active non-infectious uveitis: in-vitro effects of pharmacological treatment.

    PubMed

    Molins, B; Mesquida, M; Lee, R W J; Llorenç, V; Pelegrín, L; Adán, A

    2015-03-01

    The aim of this study was to quantify the proportion of regulatory T cells (Treg ) and cytokine expression by peripheral blood mononuclear cells (PBMCs) in patients with active non-infectious uveitis, and to evaluate the effect of in-vitro treatment with infliximab, dexamethasone and cyclosporin A on Treg levels and cytokine production in PBMCs from uveitis patients and healthy subjects. We included a group of 21 patients with active non-infectious uveitis and 18 age-matched healthy subjects. The proportion of forkhead box protein 3 (FoxP3)(+) Treg cells and intracellular tumour necrosis factor (TNF)-α expression in CD4(+) T cells was determined by flow cytometry. PBMCs were also either rested or activated with anti-CD3/anti-CD28 and cultured in the presence or absence of dexamethasone, cyclosporin A and infliximab. Supernatants of cultured PBMCs were collected and TNF-α, interleukin (IL)-10, IL-17 and interferon (IFN)-γ levels were measured by enzyme-linked immunosorbent assay (ELISA). No significant differences were observed in nTreg levels between uveitis patients and healthy subjects. However, PBMCs from uveitis patients produced significantly higher amounts of TNF-α and lower amounts of IL-10. Dexamethasone treatment in vitro significantly reduced FoxP3(+) Treg levels in PBMCs from both healthy subjects and uveitis patients, and all tested drugs significantly reduced TNF-α production in PBMCs. Dexamethasone and cyclosporin A significantly reduced IL-17 and IFN-γ production in PBMCs and dexamethasone up-regulated IL-10 production in activated PBMCs from healthy subjects. Our results suggest that PBMCs from patients with uveitis express more TNF-α and less IL-10 than healthy subjects, and this is independent of FoxP3(+) Treg levels. Treatment with infliximab, dexamethasone and cyclosporin A in vitro modulates cytokine production, but does not increase the proportion of FoxP3(+) Treg cells.

  15. MicroRNA-22 negatively regulates poly(I:C)-triggered type I interferon and inflammatory cytokine production via targeting mitochondrial antiviral signaling protein (MAVS)

    PubMed Central

    Ye, Jing; Duan, Xiaodong; Zohaib, Ali; Wang, Wentao; Chen, Zheng; Zhu, Bibo; Li, Yunchuan; Chen, Huanchun; Cao, Shengbo

    2016-01-01

    MicroRNAs (miRNAs) are small non-coding RNAs that play important roles in regulating the host immune response. Here we found that miR-22 is induced in glial cells upon stimulation with poly(I:C). Overexpression of miR-22 in the cultured cells resulted in decreased activity of interferon regulatory factor-3 and nuclear factor-kappa B, which in turn led to reduced expression of interferon-β and inflammatory cytokines, including tumor necrosis factor-α, interleukin-1β, interleukin-6, and chemokine (C-C motif) ligand 5, upon stimulation with poly(I:C), whereas knockdown of miR-22 had the opposite effect. We used a combination of bioinformatics and experimental techniques to demonstrate that mitochondrial antiviral signaling protein (MAVS), which positively regulates type I interferon production, is a novel target of miR-22. Overexpression of miR-22 decreased the activity of a luciferase reporter containing the MAVS 3′-untranslated region and led to decreased MAVS mRNA and protein levels. In contrast, ectopic expression of miR-22 inhibitor led to elevated MAVS expression. Collectively, our results demonstrate that miR-22 negatively regulates poly(I:C)-induced production of type I interferon and inflammatory cytokines via targeting MAVS. PMID:27705941

  16. Associations between gastrointestinal toxicity, micro RNA and cytokine production in patients undergoing myeloablative allogeneic stem cell transplantation.

    PubMed

    Pontoppidan, Peter L; Jordan, Karina; Carlsen, Anting Liu; Uhlving, Hilde Hylland; Kielsen, Katrine; Christensen, Mette; Ifversen, Marianne; Nielsen, Claus Henrik; Sangild, Per; Heegaard, Niels Henrik Helweg; Heilmann, Carsten; Sengeløv, Henrik; Müller, Klaus

    2015-03-01

    Allogeneic hematopoietic stem cell transplantation (HSCT) is a procedure with a high risk of treatment related mortality. The primary aim of the present study was to examine associations between markers of gastrointestinal toxicity, markers of systemic inflammation, and plasma levels of microRNA (miRNA) -155 and -146a during the first month after HSCT. The secondary aim was to characterize the impact of the toxic-inflammatory response on the function of circulating leukocytes during immune recovery. Thirty HSCT patients were included. Gastrointestinal injury was monitored by toxicity scores, lactulose-mannitol test and plasma citrulline, as a measure of the enterocyte population. Nadir of citrulline and maximum of oral toxicity scores, intestinal permeability, CRP and plasma levels of IL-6 and IL-10 was seen at day +7 post-HSCT. miRNA-155 and mi-RNA-146a showed an inverse relation with significantly elevated miRNA-155 and decreased miRNA-146a levels, from day 0 to day +28 compared with pre-conditioning levels. Citrulline levels below the median at day +7 were associated with higher spontaneous production of IL-6 and TNF-α as well as higher in vitro stimulated production of IL-17A at day +21. This study is the first to demonstrate that toxic responses to chemotherapy are accompanied by differential regulation of miRNAs with opposing effects on immune regulation. We find that a proinflammatory miRNA profile is sustained during the first three weeks after the transplantation, indicating that these miRNAs may play a role in the regulation of the inflammatory environment during immune reconstitution after HSCT.

  17. A comparative evaluation of the regulation of GM crops or products containing dsRNA and suggested improvements to risk assessments.

    PubMed

    Heinemann, Jack A; Agapito-Tenfen, Sarah Zanon; Carman, Judy A

    2013-05-01

    Changing the nature, kind and quantity of particular regulatory-RNA molecules through genetic engineering can create biosafety risks. While some genetically modified organisms (GMOs) are intended to produce new regulatory-RNA molecules, these may also arise in other GMOs not intended to express them. To characterise, assess and then mitigate the potential adverse effects arising from changes to RNA requires changing current approaches to food or environmental risk assessments of GMOs. We document risk assessment advice offered to government regulators in Australia, New Zealand and Brazil during official risk evaluations of GM plants for use as human food or for release into the environment (whether for field trials or commercial release), how the regulator considered those risks, and what that experience teaches us about the GMO risk assessment framework. We also suggest improvements to the process.

  18. The revised microRNA complement of Fasciola hepatica reveals a plethora of overlooked microRNAs and evidence for enrichment of immuno-regulatory microRNAs in extracellular vesicles.

    PubMed

    Fromm, B; Trelis, M; Hackenberg, M; Cantalapiedra, F; Bernal, D; Marcilla, A

    2015-09-01

    MicroRNAs (miRNAs) are gene regulators that have recently been shown to down-regulate the immune response via extracellular vesicles in the mammalian host of helminthic parasites. Using the miRNA prediction pipeline miRCandRef, we expanded the current miRNA set of the liver fluke Fasciola hepatica (Platyhelminthes, Trematoda) from 16 to 54 miRNAs (42 conserved and 13 novel). Comparing the cellular expression levels with extracellular vesicles, we found all miRNAs expressed and enriched for miRNAs with immuno-regulatory function, tissue growth and cancer. Our findings support the hypothesis that miRNAs are the molecular mediators of the previously demonstrated immune modulatory function of extracellular vesicles.

  19. Dietary glycerol for quail: association between productive performance and COX III mRNA expression.

    PubMed

    Silva, S C C; Gasparino, E; Batista, E; Tanamati, F; Vesco, A P D; Lala, B; de Oliveira, D P

    2016-05-25

    This study was carry out to evaluate mRNA expression of mitochondrial cytochrome c oxidase III in the Pectoralis superficialis muscle of 28-day-old quails fed diets containing 0, 8, and 12% glycerol. Total RNA was extracted (N = 10) and cDNA was amplified using specifics primers for qRT-PCR. Feed efficiency and feed intake were evaluated. COX III mRNA expression in breast muscle was higher in the group fed with 12% glycerol (0.863 AU); no differences were observed in the expression of this gene between the muscle of animals fed diets without glycerol (0.357 AU) and 8% glycerol (0.415 AU). Quails that showed greater COX III mRNA expression also showed the lowest feed efficiency. These results show that there is a difference in COX III mRNA expression in breast muscle of 28-day-old quail fed diets different concentrations of glycerol.

  20. Regulatory mechanism of gallic acid against advanced glycation end products induced cardiac remodeling in experimental rats.

    PubMed

    Umadevi, Subramanian; Gopi, Venkatachalam; Elangovan, Vellaichamy

    2014-02-05

    Advanced glycation end products (AGEs) play a major role in the development of cardiovascular disorders in diabetic patients. Recent studies evidenced the beneficial role of phytochemicals in reducing the risk of cardiovascular diseases. Hence the present study was framed to investigate the protective role of Gallic acid (GA) on AGEs induced cardiac fibrosis. Rats were infused with in vitro prepared AGEs (50mg/kg BW-intravenous injection) for 30 days. Further, GA (25mg/kgBW) was administered to rats along with AGEs. On infusion of AGEs, induction of fibrotic markers, collagen deposition, oxidative marker NADPH oxidase (NOX-p47 phox subunit), AGE receptor (RAGE) and cytokines expression was evaluated in the heart tissues using RT-PCR, Western blot and immunostaining methods. AGEs infusion significantly (P<0.01) increased the HW/BW ratio and fibrosis (4-fold) with increased expression of matrix genes MMP-2 and -9 (P<0.01, respectively) in the heart tissues. Whereas, administration of GA along with AGEs infusion prevented the fibrosis induced by AGEs. Further, GA treatment effectively prevented the AGEs mediated up-regulation of pro-fibrotic genes and ECM proteins such as TNF-α, TGF-β, MMP-2 and -9 expression. In addition, the increased expression of NOX (P<0.01), RAGE (P<0.01), NF-κB (P<0.01) and ERK 1/2 on AGEs infusion were normalized by GA treatment. Thus the present study shows the protective effect of GA on the fibrotic response and cardiac remodeling process induced by advanced glycation end products from external sources.

  1. Intracellular coordination of potyviral RNA functions in infection

    PubMed Central

    Mäkinen, Kristiina; Hafrén, Anders

    2014-01-01

    Establishment of an infection cycle requires mechanisms to allocate the genomes of (+)-stranded RNA viruses in a balanced ratio to translation, replication, encapsidation, and movement, as well as mechanisms to prevent translocation of viral RNA (vRNA) to cellular RNA degradation pathways. The ratio of vRNA allocated to various functions is likely balanced by the availability of regulatory proteins or competition of the interaction sites within regulatory ribonucleoprotein complexes. Due to the transient nature of viral processes and the interdependency between vRNA pathways, it is technically demanding to work out the exact molecular mechanisms underlying vRNA regulation. A substantial number of viral and host proteins have been identified that facilitate the steps that lead to the assembly of a functional potyviral RNA replication complex and their fusion with chloroplasts. Simultaneously with on-going viral replication, part of the replicated potyviral RNA enters movement pathways. Although not much is known about the processes of potyviral RNA release from viral replication complexes, the molecular interactions involved in these processes determine the fate of the replicated vRNA. Some viral and host cell proteins have been described that direct replicated potyviral RNA to translation to enable potyviral gene expression and productive infection. The antiviral defense of the cell causes vRNA degradation by RNA silencing. We hypothesize that also plant pathways involved in mRNA decay may have a role in the coordination of potyviral RNA expression. In this review, we discuss the roles of different potyviral and host proteins in the coordination of various potyviral RNA functions. PMID:24723931

  2. Identification of TIAR as a protein binding to the translational regulatory AU-rich element of tumor necrosis factor alpha mRNA.

    PubMed

    Gueydan, C; Droogmans, L; Chalon, P; Huez, G; Caput, D; Kruys, V

    1999-01-22

    In monocyte/macrophages, the translation of tumor necrosis factor alpha (TNF-alpha) mRNA is tightly regulated. In unstimulated cells, translation of TNF-alpha mRNA is blocked. Upon stimulation with lipopolysaccharides, this repression is overcome, and the mRNA becomes efficiently translated. The key element in this regulation is the AU-rich element (ARE). We have previously reported the binding of two cytosolic protein complexes to the TNF-alpha mRNA ARE. One of these complexes (complex 1) forms with extracts of both unstimulated and lipopolysaccharide-stimulated macrophages and requires a large fragment of the ARE containing clustered AUUUA pentamers. The other complex (complex 2) is only detected after cell activation, binds to a minimal UUAUUUAUU nonamer, and is composed of a 55-kDa protein. Here, we report the identification of the RNA-binding protein TIAR as a protein involved in complex 1. The RNA sequence bound by TIAR and the cytoplasmic localization of this protein in macrophages argue for an involvement of TIAR in TNF mRNA posttranscriptional regulation.

  3. Environmental Signals and Regulatory Pathways That Influence Exopolysaccharide Production in Rhizobia

    PubMed Central

    Janczarek, Monika

    2011-01-01

    Rhizobia are Gram-negative bacteria that can exist either as free-living bacteria or as nitrogen-fixing symbionts inside root nodules of leguminous plants. The composition of the rhizobial outer surface, containing a variety of polysaccharides, plays a significant role in the adaptation of these bacteria in both habitats. Among rhizobial polymers, exopolysaccharide (EPS) is indispensable for the invasion of a great majority of host plants which form indeterminate-type nodules. Various functions are ascribed to this heteropolymer, including protection against environmental stress and host defense, attachment to abiotic and biotic surfaces, and in signaling. The synthesis of EPS in rhizobia is a multi-step process regulated by several proteins at both transcriptional and post-transcriptional levels. Also, some environmental factors (carbon source, nitrogen and phosphate starvation, flavonoids) and stress conditions (osmolarity, ionic strength) affect EPS production. This paper discusses the recent data concerning the function of the genes required for EPS synthesis and the regulation of this process by several environmental signals. Up till now, the synthesis of rhizobial EPS has been best studied in two species, Sinorhizobium meliloti and Rhizobium leguminosarum. The latest data indicate that EPS synthesis in rhizobia undergoes very complex hierarchical regulation, in which proteins engaged in quorum sensing and the regulation of motility genes also participate. This finding enables a better understanding of the complex processes occurring in the rhizosphere which are crucial for successful colonization and infection of host plant roots. PMID:22174640

  4. Natural product (–)-gossypol inhibits colon cancer cell growth by targeting RNA-binding protein Musashi-1

    PubMed Central

    Lan, Lan; Appelman, Carl; Smith, Amber R.; Yu, Jia; Larsen, Sarah; Marquez, Rebecca T.; Liu, Hao; Wu, Xiaoqing; Gao, Philip; Roy, Anuradha; Anbanandam, Asokan; Gowthaman, Ragul; Karanicolas, John; De Guzman, Roberto N.; Rogers, Steven; Aubé, Jeffrey; Ji, Min; Cohen, Robert S.; Neufeld, Kristi L.; Xu, Liang

    2015-01-01

    Musashi-1 (MSI1) is an RNA-binding protein that acts as a translation activator or repressor of target mRNAs. The best-characterized MSI1 target is Numb mRNA, whose encoded protein negatively regulates Notch signaling. Additional MSI1 targets include the mRNAs for the tumor suppressor protein APC that regulates Wnt signaling and the cyclin-dependent kinase inhibitor P21WAF-1. We hypothesized that increased expression of NUMB, P21 and APC, through inhibition of MSI1 RNA-binding activity might be an effective way to simultaneously downregulate Wnt and Notch signaling, thus blocking the growth of a broad range of cancer cells. We used a fluorescence polarization assay to screen for small molecules that disrupt the binding of MSI1 to its consensus RNA binding site. One of the top hits was (–)-gossypol (Ki = 476 ± 273 nM), a natural product from cottonseed, known to have potent anti-tumor activity and which has recently completed Phase IIb clinical trials for prostate cancer. Surface plasmon resonance and nuclear magnetic resonance studies demonstrate a direct interaction of (–)-gossypol with the RNA binding pocket of MSI1. We further showed that (–)-gossypol reduces Notch/Wnt signaling in several colon cancer cell lines having high levels of MSI1, with reduced SURVIVIN expression and increased apoptosis/autophagy. Finally, we showed that orally administered (–)-gossypol inhibits colon cancer growth in a mouse xenograft model. Our study identifies (–)-gossypol as a potential small molecule inhibitor of MSI1-RNA interaction, and suggests that inhibition of MSI1's RNA binding activity may be an effective anti-cancer strategy. PMID:25933687

  5. Decoding the RNA structurome

    PubMed Central

    Lu, Zhipeng; Chang, Howard Y

    2016-01-01

    Structures of RNA molecules are essential for their architectural, regulatory, and catalytic functions. Recent advances in high throughput sequencing enabled the development of methods for probing RNA structures on a transcriptome-wide scale – termed the RNA structurome. Here we review the state-of-the-art technologies for probing the RNA structurome, and highlight insights gained from these studies. We also point out the limits of current methods and discuss potential directions for future improvements. PMID:26923056

  6. Lysyl-tRNA synthetase from Escherichia coli K12. Chromatographic heterogeneity and the lysU-gene product.

    PubMed Central

    Charlier, J; Sanchez, R

    1987-01-01

    In contrast with most aminoacyl-tRNA synthetases, the lysyl-tRNA synthetase of Escherichia coli is coded for by two genes, the normal lysS gene and the inducible lysU gene. During its purification from E. coli K12, lysyl-tRNA synthetase was monitored by its aminoacylation and adenosine(5')tetraphospho(5')adenosine (Ap4A) synthesis activities. Ap4A synthesis was measured by a new assay using DEAE-cellulose filters. The heterogeneity of lysyl-tRNA synthetase (LysRS) was revealed on hydroxyapatite; we focused on the first peak, LysRS1, because of its higher Ap4A/lysyl-tRNA activity ratio at that stage. Additional differences between LysRS1 and LysRS2 (major peak on hydroxyapatite) were collected. LysRS1 was eluted from phosphocellulose in the presence of the substrates, whereas LysRS2 was not. Phosphocellulose chromatography was used to show the increase of LysRS1 in cells submitted to heat shock. Also, the Mg2+ optimum in the Ap4A-synthesis reaction is much higher for LysRS1. LysRS1 showed a higher thermostability, which was specifically enhanced by Zn2+. These results in vivo and in vitro strongly suggest that LysRS1 is the heat-inducible lysU-gene product. PMID:3325036

  7. Hyperosmotic stimulus study discloses benefits in ATP supply and reveals miRNA/mRNA targets to improve recombinant protein production of CHO cells.

    PubMed

    Pfizenmaier, Jennifer; Junghans, Lisa; Teleki, Attila; Takors, Ralf

    2016-08-01

    Biopharmaceuticals are predominantly produced by Chinese hamster ovary (CHO) cells cultivated in fed-batch mode. Hyperosmotic culture conditions (≥ 350 mOsmol kg(∑1) ) resulting from feeding of nutrients may enhance specific product formation rates (qp ). As an improved ATP supply was anticipated to enhance qp this study focused on the identification of suitable miRNA/mRNA targets to increase ATP levels. Therefor next generation sequencing and a compartment specific metabolomics approach were applied to analyze the response of an antibody (mAB) producing CHO cell line upon osmotic shift (280 → 430 mOsmol kg(-1) ). Hyperosmotic culture conditions caused a ∼2.6-fold increase of specific ATP formation rates together with a ∼1.7-fold rise in cytosolic and mitochondrial ATP-pools, thus showing increased ATP supply. mRNA expression analysis identified several genes encoding glycosylated proteins with strictly tissue related function. In addition, hyperosmotic culture conditions induced an upregulation of miR-132-3p, miR-132-5p, miR-182, miR-183, miR-194, miR-215-3p, miR-215-5p which have all been related to cell cycle arrest/proliferation in cancer studies. In relation to a previous independent CHO study miR-183 may be the most promising target to enhance qp by stable overexpression. Furthermore, deletion of genes with presumably dispensable function in suspension growing CHO cells may enhance mAB formation by increased ATP levels.

  8. Rational Manipulation of mRNA Folding Free Energy Allows Rheostat Control of Pneumolysin Production by Streptococcus pneumoniae

    PubMed Central

    Amaral, Fábio E.; Parker, Dane; Randis, Tara M.; Kulkarni, Ritwij; Prince, Alice S.; Shirasu-Hiza, Mimi M.; Ratner, Adam J.

    2015-01-01

    The contribution of specific factors to bacterial virulence is generally investigated through creation of genetic “knockouts” that are then compared to wild-type strains or complemented mutants. This paradigm is useful to understand the effect of presence vs. absence of a specific gene product but cannot account for concentration-dependent effects, such as may occur with some bacterial toxins. In order to assess threshold and dose-response effects of virulence factors, robust systems for tunable expression are required. Recent evidence suggests that the folding free energy (ΔG) of the 5’ end of mRNA transcripts can have a significant effect on translation efficiency and overall protein abundance. Here we demonstrate that rational alteration of 5’ mRNA folding free energy by introduction of synonymous mutations allows for predictable changes in pneumolysin (PLY) expression by Streptococcus pneumoniae without the need for chemical inducers or heterologous promoters. We created a panel of isogenic S. pneumoniae strains, differing only in synonymous (silent) mutations at the 5’ end of the PLY mRNA that are predicted to alter ΔG. Such manipulation allows rheostat-like control of PLY production and alters the cytotoxicity of whole S. pneumoniae on primary and immortalized human cells. These studies provide proof-of-principle for further investigation of mRNA ΔG manipulation as a tool in studies of bacterial pathogenesis. PMID:25798590

  9. Investigation of post-transcriptional gene regulatory networks associated with autism spectrum disorders by microRNA expression profiling of lymphoblastoid cell lines

    PubMed Central

    2010-01-01

    Background Autism spectrum disorders (ASD) are neurodevelopmental disorders characterized by abnormalities in reciprocal social interactions and language development and/or usage, and by restricted interests and repetitive behaviors. Differential gene expression of neurologically relevant genes in lymphoblastoid cell lines from monozygotic twins discordant in diagnosis or severity of autism suggested that epigenetic factors such as DNA methylation or microRNAs (miRNAs) may be involved in ASD. Methods Global miRNA expression profiling using lymphoblasts derived from these autistic twins and unaffected sibling controls was therefore performed using high-throughput miRNA microarray analysis. Selected differentially expressed miRNAs were confirmed by quantitative reverse transcription-polymerase chain reaction (qRT-PCR) analysis, and the putative target genes of two of the confirmed miRNA were validated by knockdown and overexpression of the respective miRNAs. Results Differentially expressed miRNAs were found to target genes highly involved in neurological functions and disorders in addition to genes involved in gastrointestinal diseases, circadian rhythm signaling, as well as steroid hormone metabolism and receptor signaling. Novel network analyses of the putative target genes that were inversely expressed relative to the relevant miRNA in these same samples further revealed an association with ASD and other co-morbid disorders, including muscle and gastrointestinal diseases, as well as with biological functions implicated in ASD, such as memory and synaptic plasticity. Putative gene targets (ID3 and PLK2) of two RT-PCR-confirmed brain-specific miRNAs (hsa-miR-29b and hsa-miR-219-5p) were validated by miRNA overexpression or knockdown assays, respectively. Comparisons of these mRNA and miRNA expression levels between discordant twins and between case-control sib pairs show an inverse relationship, further suggesting that ID3 and PLK2 are in vivo targets of the

  10. Factors associated with regulatory action involving investigation of illnesses associated with Shiga toxin-producing Escherichia coli in products regulated by the Food Safety and Inspection Service.

    PubMed

    Green, Alice L; Seys, Scott; Douris, Aphrodite; Levine, Jeoff; Robertson, Kis

    2014-07-01

    We described characteristics of the Escherichia coli O157 and Escherichia coli non-O157 illness investigations conducted by the United States Department of Agriculture's Food Safety and Inspection Service (FSIS) during the 5-year period from 2006 through 2010. We created a multivariable logistic regression model to determine characteristics of these investigations that were associated with FSIS regulatory action, which was defined as having occurred if a product recall occurred or if FSIS personnel performed an environmental health assessment (Food Safety Assessment) at the implicated establishment. During this period, FSIS took regulatory action in 38 of 88 (43%) investigations. Illness investigations in which FoodNet states were involved were more likely to result in regulatory action. Illness investigations in which state and local traceback, or FSIS traceback occurred were more likely to result in regulatory action. Reasons for lack of action included evidence of cross-contamination after the product left a regulated establishment, delayed notification, lack of epidemiological information, and insufficient product information.

  11. A Regulatory miRNA–mRNA Network Is Associated with Tissue Repair Induced by Mesenchymal Stromal Cells in Acute Kidney Injury

    PubMed Central

    de Almeida, Danilo Candido; Bassi, Ênio Jose; Azevedo, Hatylas; Anderson, Letícia; Origassa, Clarice Silvia Taemi; Cenedeze, Marcos Antônio; de Andrade-Oliveira, Vinicius; Felizardo, Raphael José Ferreira; da Silva, Reinaldo Correia; Hiyane, Meire Ioshie; Semedo, Patricia; dos Reis, Marlene Antônia; Moreira-Filho, Carlos Alberto; Verjovski-Almeida, Sergio; Pacheco-Silva, Álvaro; Câmara, Niels Olsen Saraiva

    2017-01-01

    Mesenchymal stromal cells (MSCs) orchestrate tissue repair by releasing cell-derived microvesicles (MVs), which, presumably by small RNA species, modulate global gene expression. The knowledge of miRNA/mRNA signatures linked to a reparative status may elucidate some of the molecular events associated with MSC protection. Here, we used a model of cisplatin-induced kidney injury (acute kidney injury) to assess how MSCs or MVs could restore tissue function. MSCs and MVs presented similar protective effects, which were evidenced in vivo and in vitro by modulating apoptosis, inflammation, oxidative stress, and a set of prosurvival molecules. In addition, we observed that miRNAs (i.e., miR-880, miR-141, miR-377, and miR-21) were modulated, thereby showing active participation on regenerative process. Subsequently, we identified that MSC regulates a particular miRNA subset which mRNA targets are associated with Wnt/TGF-β, fibrosis, and epithelial–mesenchymal transition signaling pathways. Our results suggest that MSCs release MVs that transcriptionally reprogram injured cells, thereby modulating a specific miRNA–mRNA network. PMID:28096802

  12. Assessing regulatory violations of disinfection by-products in water distribution networks using a non-compliance potential index.

    PubMed

    Islam, Nilufar; Sadiq, Rehan; Rodriguez, Manuel J; Legay, Christelle

    2016-05-01

    Inactivating pathogens is essential to eradicate waterborne diseases. However, disinfection forms undesirable disinfection by-products (DBPs) in the presence of natural organic matter. Many regulations and guidelines exist to limit DBP exposure for eliminating possible health impacts such as bladder cancer, reproductive effects, and child development effects. In this paper, an index named non-compliance potential (NCP) index is proposed to evaluate regulatory violations by DBPs. The index can serve to evaluate water quality in distribution networks using the Bayesian Belief Network (BBN). BBN is a graphical model to represent contributing variables and their probabilistic relationships. Total trihalomethanes (TTHM), haloacetic acids (HAA5), and free residual chlorine (FRC) are selected as the variables to predict the NCP index. A methodology has been proposed to implement the index using either monitored data, empirical model results (e.g., multiple linear regression), and disinfectant kinetics through EPANET simulations. The index's usefulness is demonstrated through two case studies on municipal distribution systems using both full-scale monitoring and modeled data. The proposed approach can be implemented for data-sparse conditions, making it especially useful for smaller municipal drinking water systems.

  13. Production of pure and functional RNA for in vitro reconstitution experiments.

    PubMed

    Edelmann, Franziska Theresia; Niedner, Annika; Niessing, Dierk

    2014-02-01

    Reconstitution of protein complexes has been a valuable tool to test molecular functions and to interpret in vivo observations. In recent years, a large number of RNA-protein complexes has been identified to regulate gene expression and to be important for a range of cellular functions. In contrast to protein complexes, in vitro analyses of RNA-protein complexes are hampered by the fact that recombinant expression and purification of RNA molecules is more difficult and less well established than for proteins. Here we review the current state of technology available for in vitro experiments with RNAs. We outline the possibilities to produce and purify large amounts of homogenous RNA and to perform the required quality controls. RNA-specific problems such as degradation, 5' and 3' end heterogeneity, co-existence of different folding states, and prerequisites for reconstituting RNAs with recombinantly expressed proteins are discussed. Additionally a number of techniques for the characterization of direct and indirect RNA-protein interactions are explained.

  14. The Arabidopsis MicroRNA396-GRF1/GRF3 Regulatory Module Acts as a Developmental Regulator in the Reprogramming of Root Cells during Cyst Nematode Infection1[W][OA

    PubMed Central

    Hewezi, Tarek; Maier, Tom R.; Nettleton, Dan; Baum, Thomas J.

    2012-01-01

    The syncytium is a unique plant root organ whose differentiation is induced by plant-parasitic cyst nematodes to create a source of nourishment. Syncytium formation involves the redifferentiation and fusion of hundreds of root cells. The underlying regulatory networks that control this unique change of plant cell fate are not understood. Here, we report that a strong down-regulation of Arabidopsis (Arabidopsis thaliana) microRNA396 (miR396) in cells giving rise to the syncytium coincides with the initiation of the syncytial induction/formation phase and that specific miR396 up-regulation in the developed syncytium marks the beginning of the maintenance phase, when no new cells are incorporated into the syncytium. In addition, our results show that miR396 in fact has a role in the transition from one phase to the other. Expression modulations of miR396 and its Growth-Regulating Factor (GRF) target genes resulted in reduced syncytium size and arrested nematode development. Furthermore, genome-wide expression profiling revealed that the miR396-GRF regulatory system can alter the expression of 44% of the more than 7,000 genes reported to change expression in the Arabidopsis syncytium. Thus, miR396 represents a key regulator for the reprogramming of root cells. As such, this regulatory unit represents a powerful molecular target for the parasitic animal to modulate plant cells and force them into novel developmental pathways. PMID:22419826

  15. Production of Viral mRNA in Adenovirus-Transformed Cells by the Post-Transcriptional Processing of Heterogeneous Nuclear RNA Containing Viral and Cell Sequences

    PubMed Central

    Wall, R.; Weber, J.; Gage, Z.; Darnell, J. E.

    1973-01-01

    Adenovirus 2-transformed cells contain virus-specific sequences which are covalently linked to cell-specific RNA sequences in heterogeneous nuclear RNA (HnRNA) molecules larger than 45S. Virus sequences are identified by hybridization to viral DNA, and the cell sequences are detected by hybridization to cellular DNA under conditions where hybridization only occurs to reiterated sites in cell DNA. Such large composite viral-cell HnRNA molecules presumably arise through the uninterrupted transcription of host sequences and integrated viral DNA. Adenovirus-specific polysomal RNA from these cells sediments as three discrete species at 16, 20, and 26S. These specific classes of viral mRNA do not contain rapidly hybridizing host-specific RNA sequences. Both virus-specific HnRNA and mRNA contain polyadenylic acid sequences since they bind to polyU columns at levels characteristics of other polyA-terminated HnRNA and mRNA. Thus, the discrete species of virus-specific mRNA in adenovirus 2 transformed cells appear to be derived from high-molecular-weight virus-specific HnRNA through a series of post-transcriptional modifications involving polyA addition. Subsequently the HnRNA is cleaved so that the cell-specific RNA sequences that originate from the reiterated sites in cell DNA do not accompany the adenovirus mRNA to the cytoplasm. These events for the adenovirus-specific mRNA appear, therefore, to be similar to the stages in the biogenesis of the majority of mRNA in eukaryotic cells. PMID:4736534

  16. LGP2 downregulates interferon production during infection with seasonal human influenza A viruses that activate interferon regulatory factor 3.

    PubMed

    Malur, Meghana; Gale, Michael; Krug, Robert M

    2012-10-01

    LGP2, a member of the RIG-I-like receptor family, lacks the amino-terminal caspase activation recruitment domains (CARDs) required for initiating the activation of interferon regulatory factor 3 (IRF3) and interferon (IFN) transcription. The role of LGP2 in virus infection is controversial, and the only LGP2 experiments previously carried out with mammalian influenza A viruses employed an attenuated, mouse-adapted H1N1 A/PR/8/34 (PR8) virus that does not encode the NS1 protein. Here we determine whether LGP2 has a role during infection with wild-type, nonattenuated influenza A viruses that have circulated in the human population, specifically two types of seasonal influenza A viruses: (i) H3N2 and H1N1 viruses that activate IRF3 and IFN transcription and (ii) recent H1N1 viruses that block these two activations. In human cells infected with an H3N2 virus that activates IRF3, overexpression of LGP2 or its repressor domain decreased STAT1 activation and IFN-β transcription approximately 10-fold. Overexpression of LGP2 also caused a 10-fold decrease of STAT1 activation during infection with other seasonal influenza A viruses that activate IRF3. Using LGP2(+/+) and LGP2(-/-) mouse cells, we show that endogenous LGP2 decreased IFN production during H3N2 virus infection 3- to 4-fold. In contrast, in both mouse and human cells infected with H1N1 viruses that do not activate IRF3, LGP2 had no detectable role. These results demonstrate that LGP2 downregulates IFN production during infection by seasonal influenza A viruses that activate IRF3 and IFN transcription. It is intriguing that LGP2, a host protein induced during influenza A virus infection, downregulates the host antiviral IFN response.

  17. Sequences of the 5' portion of the human c-sis gene: characterization of the transcriptional promoter and regulation of expression of the protein product by 5' untranslated mRNA sequences.

    PubMed Central

    Ratner, L; Thielan, B; Collins, T

    1987-01-01

    The c-sis gene encodes the B polypeptide chain of platelet-derived growth factor (PDGF), and is expressed in a number of normal and pathological conditions. In order to study the control of synthesis of the human c-sis product, we have initiated a study of two regions of this genetic locus which regulate transcription and translation. A clone of the 5' portion of the gene was obtained which included 1361 nucleotides upstream of the RNA initiation site. Transcriptional promoter activity of this region was demonstrated in normal and transformed cells using a plasmid with the sequences upstream of the c-sis RNA initiation site fused to an indicator gene, chloramphenicol acetyl transferase. Experiments were also performed to identify other possible regulatory regions of the c-sis gene. These data demonstrated that a portion of the c-sis first exon encoding the 5' untranslated region of the c-sis mRNA inhibited synthesis of the PDGF B product in vitro. These results define regions of the c-sis gene whose activity may be important in the regulation of transcription and translation under normal conditions and in the pathogenesis several human diseases. Images PMID:3627977

  18. MicroRNA390-Directed TAS3 Cleavage Leads to the Production of tasiRNA-ARF3/4 During Somatic Embryogenesis in Dimocarpus longan Lour

    PubMed Central

    Lin, Yuling; Lin, Lixia; Lai, Ruilian; Liu, Weihua; Chen, Yukun; Zhang, Zihao; XuHan, Xu; Lai, Zhongxiong

    2015-01-01

    Trans-acting short-interfering RNAs (tasiRNAs) originate from TAS3 families through microRNA (miRNA) 390-guided cleavage of primary transcripts and target auxin response factors (ARF3/-4), which are involved in the normal development of lateral roots and flowers in plants. However, their roles in embryo development are still unclear. Here, the pathway miR390-TAS3-ARF3/-4 was identified systematically for the first time during somatic embryo development in Dimocarpus longan. We identified the miR390 primary transcript and promoter. The promoter contained cis-acting elements responsive to stimuli such as light, salicylic acid, anaerobic induction, fungal elicitor, circadian control, and heat stress. The longan TAS3 transcript, containing two miR390-binding sites, was isolated; the miR390- guided cleavage site located near the 3′ end of the TAS3 transcript was verified. Eight TAS3-tasiRNAs with the 21-nucleotides phase were found among longan small RNA data, further confirming that miR390-directed TAS3 cleavage leads to the production of tasiRNA in longan. Among them, TAS3_5′D5+ and 5′D6+ tasiRNAs were highly abundant, and verified to target ARF3 and -4, implying that miR390-guided TAS3 cleavage with 21-nucleotides phase leading to the production of tasiRNA-ARF is conserved in plants. Pri-miR390 was highly expressed in friable-embryogenic callus (EC), and less expressed in incomplete compact pro-embryogenic cultures, while miR390 showed its lowest expression in EC and highest expression in torpedo-shaped embryos (TEs). DlTAS3 and DlARF4 both exhibited their lowest expressions in EC, and reached their peaks in the globular embryos stage, which were mainly inversely proportional to the expression of miR390, especially at the globular embryos to cotyledonary embryos (CEs) stages. While DlARF3 showed little variation from the EC to TEs stages, and exhibited its lowest expression in the CEs stage. There was a general lack of correlation between the expressions of Dl

  19. microRNA-132/212 deficiency enhances Aβ production and senile plaque deposition in Alzheimer’s disease triple transgenic mice

    PubMed Central

    Hernandez-Rapp, Julia; Rainone, Sara; Goupil, Claudia; Dorval, Véronique; Smith, Pascal Y.; Saint-Pierre, Martine; Vallée, Maxime; Planel, Emmanuel; Droit, Arnaud; Calon, Frédéric; Cicchetti, Francesca; Hébert, Sébastien S.

    2016-01-01

    The abnormal regulation of amyloid-β (Aβ) metabolism (e.g., production, cleavage, clearance) plays a central role in Alzheimer’s disease (AD). Among endogenous factors believed to participate in AD progression are the small regulatory non-coding microRNAs (miRs). In particular, the miR-132/212 cluster is severely reduced in the AD brain. In previous studies we have shown that miR-132/212 deficiency in mice leads to impaired memory and enhanced Tau pathology as seen in AD patients. Here we demonstrate that the genetic deletion of miR-132/212 promotes Aβ production and amyloid (senile) plaque formation in triple transgenic AD (3xTg-AD) mice. Using RNA-Seq and bioinformatics, we identified genes of the miR-132/212 network with documented roles in the regulation of Aβ metabolism, including Tau, Mapk, and Sirt1. Consistent with these findings, we show that the modulation of miR-132, or its target Sirt1, can directly regulate Aβ production in cells. Finally, both miR-132 and Sirt1 levels correlated with Aβ load in humans. Overall, our results support the hypothesis that the miR-132/212 network, including Sirt1 and likely other target genes, contributes to abnormal Aβ metabolism and senile plaque deposition in AD. This study strengthens the importance of miR-dependent networks in neurodegenerative disorders, and opens the door to multifactorial drug targets of AD by targeting Aβ and Tau. PMID:27484949

  20. Safety of plant-made pharmaceuticals: product development and regulatory considerations based on case studies of two autologous human cancer vaccines.

    PubMed

    Tusé, Daniel

    2011-03-01

    Guidelines issued by regulatory agencies for the development of plant-made pharmaceutical (PMP) products provide criteria for product manufacturing and characterization, safety determination, containment and mitigation of environmental risks. Features of plant-made products do not always enable an easy fit within the criteria subscribed to by regulators. The unconventional nature of plant-based manufacturing processes and peculiarities of plant biology relative to that of traditional biological production systems have led to special considerations in the regulatory scrutiny of PMP. Presented in this review are case studies of two plant-made autologous (patient-specific) cancer vaccines, the nature of which introduced challenges to conventional and standardized development and preclinical evaluation routes. The rationale presented to FDA by the sponsors of each vaccine to build consensus and obtain variances to existing guidelines is discussed. While development of many plant-made biologics can be accomplished within the existing regulatory framework, the development of specialized products can be defended with rational arguments based on strong science.

  1. In-Plant Protection against Helicoverpa armigera by Production of Long hpRNA in Chloroplasts

    PubMed Central

    Bally, Julia; McIntyre, Glen J.; Doran, Rachel L.; Lee, Karen; Perez, Alicia; Jung, Hyungtaek; Naim, Fatima; Larrinua, Ignacio M.; Narva, Kenneth E.; Waterhouse, Peter M.

    2016-01-01

    Expressing double-stranded RNA (dsRNA) in transgenic plants to silence essential genes within herbivorous pests is referred to as trans-kingdom RNA interference (TK-RNAi) and has emerged as a promising strategy for crop protection. However, the dicing of dsRNA into siRNAs by the plant’s intrinsic RNAi machinery may reduce this pesticidal activity. Therefore, genetic constructs, encoding ∼200 nt duplex-stemmed-hairpin (hp) RNAs, targeting the acetylcholinesterase gene of the cotton bollworm, Helicoverpa armigera, were integrated into either the nuclear or the chloroplast genome of Nicotiana benthamiana. Undiced, full-length hpRNAs accumulated in transplastomic lines of N. benthamiana and conferred strong protection against H. armigera herbivory while the hpRNAs of nuclear-transformed plants were processed into siRNAs and gave more modest anti-feeding activity. This suggests that there is little or no RNAi machinery or activity in the chloroplast, that hpRNAs produced within this organelle do not enter the cytoplasm, and that oral delivery of chloroplast-packaged intact hpRNA is a more effective means of delivering TK-RNAi than using nuclear encoded hpRNAs. This contrasts with a recently reported correlation between siRNA expression and effectiveness of TK-RNAi targeting the chitinase gene of H. armigera, but is consistent with reports of efficient TK-RNAi by dsRNA generated in chloroplasts by converging promoters flanking a pest gene sequence and from very small (21 nt-stem) hpRNAs resembling artificial miRNAs. Here we demonstrate that hpRNAs, constructed along the conventional design principles of plant RNAi constructs but integrated into the chloroplast genome, are stable and effective over multiple generations, and hold the promise of providing durable pest resistance in crops. PMID:27746796

  2. In-Plant Protection against Helicoverpa armigera by Production of Long hpRNA in Chloroplasts.

    PubMed

    Bally, Julia; McIntyre, Glen J; Doran, Rachel L; Lee, Karen; Perez, Alicia; Jung, Hyungtaek; Naim, Fatima; Larrinua, Ignacio M; Narva, Kenneth E; Waterhouse, Peter M

    2016-01-01

    Expressing double-stranded RNA (dsRNA) in transgenic plants to silence essential genes within herbivorous pests is referred to as trans-kingdom RNA interference (TK-RNAi) and has emerged as a promising strategy for crop protection. However, the dicing of dsRNA into siRNAs by the plant's intrinsic RNAi machinery may reduce this pesticidal activity. Therefore, genetic constructs, encoding ∼200 nt duplex-stemmed-hairpin (hp) RNAs, targeting the acetylcholinesterase gene of the cotton bollworm, Helicoverpa armigera, were integrated into either the nuclear or the chloroplast genome of Nicotiana benthamiana. Undiced, full-length hpRNAs accumulated in transplastomic lines of N. benthamiana and conferred strong protection against H. armigera herbivory while the hpRNAs of nuclear-transformed plants were processed into siRNAs and gave more modest anti-feeding activity. This suggests that there is little or no RNAi machinery or activity in the chloroplast, that hpRNAs produced within this organelle do not enter the cytoplasm, and that oral delivery of chloroplast-packaged intact hpRNA is a more effective means of delivering TK-RNAi than using nuclear encoded hpRNAs. This contrasts with a recently reported correlation between siRNA expression and effectiveness of TK-RNAi targeting the chitinase gene of H. armigera, but is consistent with reports of efficient TK-RNAi by dsRNA generated in chloroplasts by converging promoters flanking a pest gene sequence and from very small (21 nt-stem) hpRNAs resembling artificial miRNAs. Here we demonstrate that hpRNAs, constructed along the conventional design principles of plant RNAi constructs but integrated into the chloroplast genome, are stable and effective over multiple generations, and hold the promise of providing durable pest resistance in crops.

  3. Super-Enhancer-Mediated RNA Processing Revealed by Integrative MicroRNA Network Analysis.

    PubMed

    Suzuki, Hiroshi I; Young, Richard A; Sharp, Phillip A

    2017-03-09

    Super-enhancers are an emerging subclass of regulatory regions controlling cell identity and disease genes. However, their biological function and impact on miRNA networks are unclear. Here, we report that super-enhancers drive the biogenesis of master miRNAs crucial for cell identity by enhancing both transcription and Drosha/DGCR8-mediated primary miRNA (pri-miRNA) processing. Super-enhancers, together with broad H3K4me3 domains, shape a tissue-specific and evolutionarily conserved atlas of miRNA expression and function. CRISPR/Cas9 genomics revealed that super-enhancer constituents act cooperatively and facilitate Drosha/DGCR8 recruitment and pri-miRNA processing to boost cell-specific miRNA production. The BET-bromodomain inhibitor JQ1 preferentially inhibits super-enhancer-directed cotranscriptional pri-miRNA processing. Furthermore, super-enhancers are characterized by pervasive interaction with DGCR8/Drosha and DGCR8/Drosha-regulated mRNA stability control, suggesting unique RNA regulation at super-enhancers. Finally, super-enhancers mark multiple miRNAs associated with cancer hallmarks. This study presents principles underlying miRNA biology in health and disease and an unrecognized higher-order property of super-enhancers in RNA processing beyond transcription.

  4. Expression of Ets-1 and FOXP3 mRNA in CD4(+)CD25 (+) T regulatory cells from patients with systemic lupus erythematosus.

    PubMed

    Xiang, Nan; Li, Xiang-Pei; Li, Xiao-Mei; Wang, Guo-Sheng; Tao, Jin-Hui; Pan, Hai-Feng; Fang, Xuan; Ma, Qian; Yu, Ning

    2014-11-01

    Systemic lupus erythematosus (SLE) is a multisystem autoimmune disease with complex genetic predisposing factors involved. Ets-1 transcription factor plays an important role in the suppressive activity of CD4(+)CD25(+) Treg cells and stable expression of FOXP3. To find its potential role in the pathogenesis of SLE, we investigate the mRNA expression of Ets-1 and FOXP3 mRNA in CD4(+)CD25(+) Treg cells from patients with SLE. Real-time transcription-polymerase chain reaction analysis was used to determine the expression of Ets-1 and FOXP3 mRNA in CD4(+)CD25(+) Treg cells from 36 patients with SLE and 18 sex-and-age-matched healthy controls. The Ets-1 mRNA expression level was decreased in patients with SLE [0.225 (0.135, 0.337)] than healthy controls [0.528 (0.303, 0.681)] (P < 0.001). The expression levels of FOXP3 mRNA were lower in SLE patients [0.608 (0.272, 1.164)] than healthy controls [0.919 (0.690, 1.223)], but the difference was not significant (P = 0.106). Significant reduction in Ets-1 and FOXP3 expression was also found in new-onset SLE subgroup when compared with healthy controls (P < 0.001). The level of Ets-1 and FOXP3 mRNA was not significantly different in hyperactive and lower active SLE group when compared with inactive SLE group, respectively (P > 0.05). There were no significant differences between SLE with lupus nephritis (LN) and SLE without LN either (P > 0.05). Associations of Ets-1 and FOXP3 mRNA expression levels with major clinical and laboratory parameters of SLE patients were also analyzed. However, no significant association was found. Significant positive correlation was found between Ets-1 and FOXP3 mRNA expression in CD4(+)CD25(+) Treg cells from SLE patients (r = 0.698, P < 0.001). Our results found that the expression levels of Ets-1 mRNA were decreased in SLE patients and Ets-1 expression was positively correlated with the expression of FOXP3. It indicated that Ets-1 may play an important role in the stable expression of FOXP3 in

  5. Two separate modules of the conserved regulatory RNA AbcR1 address multiple target mRNAs in and outside of the translation initiation region

    PubMed Central

    Overlöper, Aaron; Kraus, Alexander; Gurski, Rosemarie; Wright, Patrick R; Georg, Jens; Hess, Wolfgang R; Narberhaus, Franz

    2014-01-01

    The small RNA AbcR1 regulates the expression of ABC transporters in the plant pathogen Agrobacterium tumefaciens, the plant symbiont Sinorhizobium meliloti, and the human pathogen Brucella abortus. A combination of proteomic and bioinformatic approaches suggested dozens of AbcR1 targets in A. tumefaciens. Several of these newly discovered targets are involved in the uptake of amino acids, their derivatives, and sugars. Among the latter is the periplasmic sugar-binding protein ChvE, a component of the virulence signal transduction system. We examined 16 targets and their interaction with AbcR1 in close detail. In addition to the previously described mRNA interaction site of AbcR1 (M1), the CopraRNA program predicted a second functional module (M2) as target-binding site. Both M1 and M2 contain single-stranded anti-SD motifs. Using mutated AbcR1 variants, we systematically tested by band shift experiments, which sRNA region is responsible for mRNA binding and gene regulation. On the target site, we find that AbcR1 interacts with some mRNAs in the translation initiation region and with others far into their coding sequence. Our data show that AbcR1 is a versatile master regulator of nutrient uptake systems in A. tumefaciens and related bacteria. PMID:24921646

  6. Roles of nonstructural polyproteins and cleavage products in regulating Sindbis virus RNA replication and transcription.

    PubMed Central

    Lemm, J A; Rice, C M

    1993-01-01

    Using vaccinia virus to express Sindbis virus (SIN) nonstructural proteins (nsPs) and template RNAs, we showed previously that synthesis of all three viral RNAs occurred only during expression of either the entire nonstructural coding region or the polyprotein precursors P123 and P34. In this report, the vaccinia virus system was used to express cleavage-defective polyproteins and nsP4 proteins containing various N-terminal extensions to directly examine the roles of the P123 and P34 polyproteins in RNA replication. Replication and subgenomic mRNA transcription occurred during coexpression of P34 and P123 polyproteins in which cleavage was blocked at either or both of the 1/2 and 2/3 sites. For all cleavage-defective P123 polyproteins, however, the ratio of subgenomic to genomic RNA was decreased, suggesting that both the 1/2 and 2/3 cleavages are required for efficient subgenomic RNA transcription. These studies indicate that the uncleaved P123 polyprotein can function as a component of the viral replicase capable of synthesizing both plus- and minus-strand RNAs. In contrast, cleavage-defective P34 was unable to function in RNA replication, even in complementation experiments in which minus-strand RNAs were provided by nsP4. A P34 polyprotein whose cleavage site was not altered could only function in RNA replication in the presence of an active nsP2 protease. Although nsP4, the putative RNA polymerase, was capable of synthesizing only minus-strand RNAs during coexpression with P123, the addition of only 22 upstream residues to nsP4 allowed both replication and transcription of subgenomic RNA to occur. These data show that the conserved domains of both nsP3 and the nsP4 polymerase do not need to be present in a P34 polyprotein to form a functional plus-strand replicase-transcriptase and suggest that the presence of an active nsP2 protease and a cleavable 3/4 site correlates with synthesis of all virus-specific RNA species. Images PMID:8445717

  7. Assistance to Oil and Gas State Agencies and Industry through Continuation of Environmental and Production Data Management and a Water Regulatory Initiative

    SciTech Connect

    Grunewald, Ben; Arthur, Dan; Langhus, Bruce; Gillespie, Tom; Binder, Ben; Warner, Don; Roberts, Jim; Cox, D.O.

    2002-05-31

    This grant project was a major step toward completion of the Risk Based Data Management System (RBDMS) project. Additionally the project addresses the needs identified during the projects initial phases. By implementing this project, the following outcomes were sought: (1) State regulatory agencies implemented more formalized environmental risk management practices as they pertain to the production of oil and gas, and injection via Class II wells. (2) Enhancement of oil and gas production by implementing a management system supporting the saving of abandoned or idle wells located in areas with a relatively low environmental risk of endangering underground sources of drinking water (USDWs) in a particular state. (3) Verification that protection of USDWs is adequate and additional restrictions of requirements are not necessary in areas with a relatively low environmental risk. (4) Standardization of data and information maintained by state regulatory agencies and decrease the regulatory cost burden on producers operating in multiple states, and (5) Development of a system for electronic data transfer among operators and state regulatory agencies and reduction of overall operator reporting burdens.

  8. Rapid production of novel pre-microRNA agent hsa-mir-27b in Escherichia coli using recombinant RNA technology for functional studies in mammalian cells.

    PubMed

    Li, Mei-Mei; Wang, Wei-Peng; Wu, Wen-Juan; Huang, Min; Yu, Ai-Ming

    2014-11-01

    Noncoding microRNAs (miRNAs or miRs) have been revealed as critical epigenetic factors in the regulation of various cellular processes, including drug metabolism and disposition. However, research on miRNA functions is limited to the use of synthetic RNA and recombinant DNA agents. Herein, we show that novel pre-miRNA-27b (miR-27b) agents can be biosynthesized in Escherichia coli using recombinant RNA technology, and recombinant transfer RNA (tRNA)/mir-27b chimera was readily purified to a high degree of homogeneity (>95%) using anion-exchange fast protein liquid chromatography. The tRNA-fusion miR-27b was revealed to be processed to mature miRNA miR-27b in human carcinoma LS-180 cells in a dose- and time-dependent manner. Moreover, recombinant tRNA/miR-27b agents were biologically active in reducing the mRNA and protein expression levels of cytochrome P450 3A4 (CYP3A4), which consequently led to lower midazolam 1'-hydroxylase activity. These findings demonstrate that pre-miRNA agents can be produced by recombinant RNA technology for functional studies.

  9. Structure of Leishmania major methionyl-tRNA synthetase in complex with intermediate products methionyladenylate and pyrophosphate.

    PubMed

    Larson, Eric T; Kim, Jessica E; Zucker, Frank H; Kelley, Angela; Mueller, Natascha; Napuli, Alberto J; Verlinde, Christophe L M J; Fan, Erkang; Buckner, Frederick S; Van Voorhis, Wesley C; Merritt, Ethan A; Hol, Wim G J

    2011-03-01

    Leishmania parasites cause two million new cases of leishmaniasis each year with several hundreds of millions of people at risk. Due to the paucity and shortcomings of available drugs, we have undertaken the crystal structure determination of a key enzyme from Leishmania major in hopes of creating a platform for the rational design of new therapeutics. Crystals of the catalytic core of methionyl-tRNA synthetase from L. major (LmMetRS) were obtained with the substrates MgATP and methionine present in the crystallization medium. These crystals yielded the 2.0 Å resolution structure of LmMetRS in complex with two products, methionyladenylate and pyrophosphate, along with a Mg(2+) ion that bridges them. This is the first class I aminoacyl-tRNA synthetase (aaRS) structure with pyrophosphate bound. The residues of the class I aaRS signature sequence motifs, KISKS and HIGH, make numerous contacts with the pyrophosphate. Substantial differences between the LmMetRS structure and previously reported complexes of Escherichia coli MetRS (EcMetRS) with analogs of the methionyladenylate intermediate product are observed, even though one of these analogs only differs by one atom from the intermediate. The source of these structural differences is attributed to the presence of the product pyrophosphate in LmMetRS. Analysis of the LmMetRS structure in light of the Aquifex aeolicus MetRS-tRNA(Met) complex shows that major rearrangements of multiple structural elements of enzyme and/or tRNA are required to allow the CCA acceptor triplet to reach the methionyladenylate intermediate in the active site. Comparison with sequences of human cytosolic and mitochondrial MetRS reveals interesting differences near the ATP- and methionine-binding regions of LmMetRS, suggesting that it should be possible to obtain compounds that selectively inhibit the parasite enzyme.

  10. Excessive production and extreme editing of human metapneumovirus defective interfering RNA is associated with type I IFN induction.

    PubMed

    van den Hoogen, Bernadette G; van Boheemen, Sander; de Rijck, Jonneke; van Nieuwkoop, Stefan; Smith, Derek J; Laksono, Brigitta; Gultyaev, Alexander; Osterhaus, Albert D M E; Fouchier, Ron A M

    2014-08-01

    Type I IFN production is one of the hallmarks of host innate immune responses upon virus infection. Whilst most respiratory viruses carry IFN antagonists, reports on human metapneumovirus (HMPV) have been conflicting. Using deep sequencing, we have demonstrated that HMPV particles accumulate excessive amounts of defective interfering RNA (DIs) rapidly upon in vitro passage, and that these are associated with IFN induction. Importantly, the DIs were edited extensively; up to 70% of the original A and T residues had mutated to G or C, respectively. Such high editing rates of viral RNA have not, to our knowledge, been reported before. Bioinformatics and PCR assays indicated that adenosine deaminase acting on RNA (ADAR) was the most likely editing enzyme. HMPV thus has an unusually high propensity to generate DIs, which are edited at an unprecedented high frequency. The conflicting published data on HMPV IFN induction and antagonism are probably explained by DIs in virus stocks. The interaction of HMPV DIs with the RNA-editing machinery and IFN responses warrants further investigation.

  11. The HRPT2 tumor suppressor gene product parafibromin associates with human PAF1 and RNA polymerase II.

    PubMed

    Yart, Armelle; Gstaiger, Matthias; Wirbelauer, Christiane; Pecnik, Maria; Anastasiou, Dimitrios; Hess, Daniel; Krek, Wilhelm

    2005-06-01

    Inactivation of the HRPT2 tumor suppressor gene is associated with the pathogenesis of the hereditary hyperparathyroidism-jaw tumor syndrome and malignancy in sporadic parathyroid tumors. The cellular function of the HPRT2 gene product, parafibromin, has not been defined yet. Here we show that parafibromin physically interacts with human orthologs of yeast Paf1 complex components, including PAF1, LEO1, and CTR9, that are involved in transcription elongation and 3' end processing. It also associates with modified forms of the large subunit of RNA polymerase II, in particular those phosphorylated on serine 5 or 2 within the carboxy-terminal domain, that are important for the coordinate recruitment of transcription elongation and RNA processing machineries during the transcription cycle. These interactions depend on a C-terminal domain of parafibromin, which is deleted in ca. 80% of clinically relevant mutations. Finally, RNAi-induced downregulation of parafibromin promotes entry into S phase, implying a role for parafibromin as an inhibitor of cell cycle progression. Taken together, these findings link the tumor suppressor parafibromin to the transcription elongation and RNA processing pathway as a PAF1 complex- and RNA polymerase II-bound protein. Dysfunction of this pathway may be a general phenomenon in the majority of cases of hereditary parathyroid cancer.

  12. The HRPT2 Tumor Suppressor Gene Product Parafibromin Associates with Human PAF1 and RNA Polymerase II

    PubMed Central

    Yart, Armelle; Gstaiger, Matthias; Wirbelauer, Christiane; Pecnik, Maria; Anastasiou, Dimitrios; Hess, Daniel; Krek, Wilhelm

    2005-01-01

    Inactivation of the HRPT2 tumor suppressor gene is associated with the pathogenesis of the hereditary hyperparathyroidism-jaw tumor syndrome and malignancy in sporadic parathyroid tumors. The cellular function of the HPRT2 gene product, parafibromin, has not been defined yet. Here we show that parafibromin physically interacts with human orthologs of yeast Paf1 complex components, including PAF1, LEO1, and CTR9, that are involved in transcription elongation and 3′ end processing. It also associates with modified forms of the large subunit of RNA polymerase II, in particular those phosphorylated on serine 5 or 2 within the carboxy-terminal domain, that are important for the coordinate recruitment of transcription elongation and RNA processing machineries during the transcription cycle. These interactions depend on a C-terminal domain of parafibromin, which is deleted in ca. 80% of clinically relevant mutations. Finally, RNAi-induced downregulation of parafibromin promotes entry into S phase, implying a role for parafibromin as an inhibitor of cell cycle progression. Taken together, these findings link the tumor suppressor parafibromin to the transcription elongation and RNA processing pathway as a PAF1 complex- and RNA polymerase II-bound protein. Dysfunction of this pathway may be a general phenomenon in the majority of cases of hereditary parathyroid cancer. PMID:15923622

  13. Regulation of Gene Expression in Plants through miRNA Inactivation

    PubMed Central

    Zhang, Yuanji; Ziegler, Todd E.; Roberts, James K.; Heck, Gregory R.

    2011-01-01

    Eukaryotic organisms possess a complex RNA-directed gene expression regulatory network allowing the production of unique gene expression patterns. A recent addition to the repertoire of RNA-based gene regulation is miRNA target decoys, endogenous RNA that can negatively regulate miRNA activity. miRNA decoys have been shown to be a valuable tool for understanding the function of several miRNA families in plants and invertebrates. Engineering and precise manipulation of an endogenous RNA regulatory network through modification of miRNA activity also affords a significant opportunity to achieve a desired outcome of enhanced plant development or response to environmental stresses. Here we report that expression of miRNA decoys as single or heteromeric non-cleavable microRNA (miRNA) sites embedded in either non-protein-coding or within the 3′ untranslated region of protein-coding transcripts can regulate the expression of one or more miRNA targets. By altering the sequence of the miRNA decoy sites, we were able to attenuate miRNA inactivation, which allowed for fine regulation of native miRNA targets and the production of a desirable range of plant phenotypes. Thus, our results demonstrate miRNA decoys are a flexible and robust tool, not only for studying miRNA function, but also for targeted engineering of gene expression in plants. Computational analysis of the Arabidopsis transcriptome revealed a number of potential miRNA decoys, suggesting that endogenous decoys may have an important role in natural modulation of expression in plants. PMID:21731706

  14. Evidence of tRNA cleavage in apicomplexan parasites: half-tRNAs as new potential regulatory molecules of Toxoplasma gondii and Plasmodium berghei

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Several lines of evidence demonstrated that organisms ranging from bacteria to higher animals possess a regulated endonucleolytic cleavage pathway producing half-tRNA fragments. In the present study, we investigated the occurrence of this phenomenon in two distantly related apicomplexan parasites, T...

  15. The chromatin remodeling and mRNA splicing functions of the Brahma (SWI/SNF) complex are mediated by the SNR1/SNF5 regulatory subunit.

    PubMed

    Zraly, Claudia B; Dingwall, Andrew K

    2012-07-01

    Nucleosome remodeling catalyzed by the ATP-dependent SWI/SNF complex is essential for regulated gene expression. Transcriptome profiling studies in flies and mammals identified cell cycle and hormone responsive genes as important targets of remodeling complex activities. Loss of chromatin remodeling function has been linked to developmental abnormalities and aggressive cancers. The Drosophila Brahma (Brm) SWI/SNF complex assists in reprogramming and coordinating gene expression in response to ecdysone hormone signaling at critical points during development. We used RNAi knockdown in cultured cells and transgenic flies, and conditional mutant alleles to identify unique and important functions of two conserved Brm complex core subunits, SNR1/SNF5 and BRM/SNF2-SWI2, on target gene regulation. Unexpectedly, we found that incorporation of a loss of function SNR1 subunit led to alterations in RNA polymerase elongation, pre-mRNA splicing regulation and chromatin accessibility of ecdysone hormone regulated genes, revealing that SNR1 functions to restrict BRM-dependent nucleosome remodeling activities downstream of the promoter region. Our results reveal critically important roles of the SNR1/SNF5 subunit and the Brm chromatin remodeling complex in transcription regulation during elongation by RNA Polymerase II and completion of pre-mRNA transcripts that are dependent on hormone signaling in late development.

  16. The first two nucleotides of the respiratory syncytial virus antigenome RNA replication product can be selected independently of the promoter terminus.

    PubMed

    Noton, Sarah L; Fearns, Rachel

    2011-10-01

    There is limited knowledge regarding how the RNA-dependent RNA polymerases of the nonsegmented negative-strand RNA viruses initiate genome replication. In a previous study of respiratory syncytial virus (RSV) RNA replication, we found evidence that the polymerase could select the 5'-ATP residue of the genome RNA independently of the 3' nucleotide of the template. To investigate if a similar mechanism is used during antigenome synthesis, a study of initiation from the RSV leader (Le) promoter was performed using an intracellular minigenome assay in which RNA replication was restricted to a single step, so that the products examined were derived only from input mutant templates. Templates in which Le nucleotides 1U, or 1U and 2G, were deleted directed efficient replication, and in both cases, the replication products were initiated at the wild-type position, at position -1 or -2 relative to the template, respectively. Sequence analysis of the RNA products showed that they contained ATP and CTP at the -1 and -2 positions, respectively, thus restoring the mini-antigenome RNA to wild-type sequence. These data indicate that the RSV polymerase is able to select the first two nucleotides of the antigenome and initiate at the correct position, even if the 3'-terminal two nucleotides of the template are missing. Substitution of positions +1 and +2 of the template reduced RNA replication and resulted in increased initiation at positions +3 and +5. Together these data suggest a model for how the RSV polymerase initiates antigenome synthesis.

  17. Oxygen-glucose deprivation inducing B1 RNA inhibits neuronal cells metabolic activity by NLRP3 and associated proinflammatory cytokines production.

    PubMed

    Wang, Li; Wang, Weihua; Zhang, Lei; Dai, Peng; Wang, Kai; Hui, Hao; Rao, Wei; Peng, Cheng; Yang, Jinghua; Yan, Zhen; Fei, Zhou

    2015-02-19

    Cerebral ischemia occurs when blood flow to part of the brain is obstructed, which can result in oxygen and glucose deprivation (OGD) and neuronal damage. However, the mechanisms remain poorly understood. The present study investigated the production and effects of double-stranded RNA (dsRNA) induced by OGD in neuronal cells. By confocal microscopy, dsRNA containing B1 and B2 RNA, was found accumulating in HT22 cells under OGD treatment. The sequence of B1 RNA was identified and transfected into HT22 cells. Interestingly, B1 RNA induced transcription and expression of NLRP3, interleukin (IL)-1β, and tumor necrosis factor (TNF)-α, which was similar to the effects of OGD treatment. Moreover, HT22 cell growth inhibition and proinflammatory cytokines production induced by OGD and B1 RNA treatment were down-regulated by NLRP3 knock-down. These findings suggest that B1 RNA induced by OGD forms as dsRNA and inhibits neuronal cell metabolic activity by regulating the NLRP3 and associated proinflammatory cytokines production.

  18. RNA binding protein Pub1p regulates glycerol production and stress tolerance by controlling Gpd1p activity during winemaking.

    PubMed

    Orozco, Helena; Sepúlveda, Ana; Picazo, Cecilia; Matallana, Emilia; Aranda, Agustín

    2016-06-01

    Glycerol is a key yeast metabolite in winemaking because it contributes to improve the organoleptic properties of wine. It is also a cellular protective molecule that enhances the tolerance of yeasts to osmotic stress and promotes longevity. Thus, its production increases by genetic manipulation, which is of biotechnological and basic interest. Glycerol is produced by diverting glycolytic glyceraldehyde-3-phosphate through the action of glycerol-3-phosphate dehydrogenase (coded by genes GPD1 and GPD2). Here, we demonstrate that RNA-binding protein Pub1p regulates glycerol production by controlling Gpd1p activity. Its deletion does not alter GPD1 mRNA levels, but protein levels and enzymatic activity increase, which explains the higher intracellular glycerol concentration and greater tolerance to osmotic stress of the pub1∆ mutant. PUB1 deletion also enhances the activity of nicotinamidase, a longevity-promoting enzyme. Both enzymatic activities are partially located in peroxisomes, and we detected peroxisome formation during wine fermentation. The role of Pub1p in life span control depends on nutrient conditions and is related with the TOR pathway, and a major connection between RNA metabolism and the nutrient signaling response is established.

  19. Enhancement of protein production via the strong DIT1 terminator and two RNA-binding proteins in Saccharomyces cerevisiae

    PubMed Central

    Ito, Yoichiro; Kitagawa, Takao; Yamanishi, Mamoru; Katahira, Satoshi; Izawa, Shingo; Irie, Kenji; Furutani-Seiki, Makoto; Matsuyama, Takashi

    2016-01-01

    Post-transcriptional upregulation is an effective way to increase the expression of transgenes and thus maximize the yields of target chemicals from metabolically engineered organisms. Refractory elements in the 3′ untranslated region (UTR) that increase mRNA half-life might be available. In Saccharomyces cerevisiae, several terminator regions have shown activity in increasing the production of proteins by upstream coding genes; among these terminators the DIT1 terminator has the highest activity. Here, we found in Saccharomyces cerevisiae that two resident trans-acting RNA-binding proteins (Nab6p and Pap1p) enhance the activity of the DIT1 terminator through the cis element GUUCG/U within the 3′-UTR. These two RNA-binding proteins could upregulate a battery of cell-wall–related genes. Mutagenesis of the DIT1 terminator improved its activity by a maximum of 500% of that of the standard PGK1 terminator. Further understanding and improvement of this system will facilitate inexpensive and stable production of complicated organism-derived drugs worldwide. PMID:27845367

  20. Enhancement of protein production via the strong DIT1 terminator and two RNA-binding proteins in Saccharomyces cerevisiae.

    PubMed

    Ito, Yoichiro; Kitagawa, Takao; Yamanishi, Mamoru; Katahira, Satoshi; Izawa, Shingo; Irie, Kenji; Furutani-Seiki, Makoto; Matsuyama, Takashi

    2016-11-15

    Post-transcriptional upregulation is an effective way to increase the expression of transgenes and thus maximize the yields of target chemicals from metabolically engineered organisms. Refractory elements in the 3' untranslated region (UTR) that increase mRNA half-life might be available. In Saccharomyces cerevisiae, several terminator regions have shown activity in increasing the production of proteins by upstream coding genes; among these terminators the DIT1 terminator has the highest activity. Here, we found in Saccharomyces cerevisiae that two resident trans-acting RNA-binding proteins (Nab6p and Pap1p) enhance the activity of the DIT1 terminator through the cis element GUUCG/U within the 3'-UTR. These two RNA-binding proteins could upregulate a battery of cell-wall-related genes. Mutagenesis of the DIT1 terminator improved its activity by a maximum of 500% of that of the standard PGK1 terminator. Further understanding and improvement of this system will facilitate inexpensive and stable production of complicated organism-derived drugs worldwide.

  1. Downregulating galectin-3 inhibits proinflammatory cytokine production by human monocyte-derived dendritic cells via RNA interference.

    PubMed

    Chen, Swey-Shen; Sun, Liang-Wu; Brickner, Howard; Sun, Pei-Qing

    2015-03-01

    Galectin-3 (Gal-3), a β-galactoside-binding lectin, serves as a pattern-recognition receptor (PRR) of dendritic cells (DCs) in regulating proinflammatory cytokine production. Galectin-3 (Gal-3) siRNA downregulates expression of IL-6, IL-1β and IL-23 p19, while upregulates IL-10 and IL-12 p35 in TLR/NLR stimulated human MoDCs. Furthermore, Gal-3 siRNA-treated MoDCs enhanced IFN-γ production in SEB-stimulated CD45RO CD4 T-cells, but attenuated IL-17A and IL-5 production by CD4 T-cells. Addition of neutralizing antibodies against Gal-3, or recombinant Gal-3 did not differentially modulate IL-23 p19 versus IL-12 p35. The data indicate that intracellular Gal-3 acts as cytokine hub of human DCs in responding to innate immunity signals. Gal-3 downregulation reprograms proinflammatory cytokine production by MoDCs that inhibit Th2/Th17 development.

  2. Nickel Ions Selectively Inhibit Lipopolysaccharide-Induced Interleukin-6 Production by Decreasing Its mRNA Stability

    PubMed Central

    Asakawa, Sanki; Kishimoto, Yu; Takano, Takayuki; Okita, Kiyuki; Takakuwa, Shiho; Sato, Taiki; Hiratsuka, Masahiro; Takeuchi, Osamu; Hirasawa, Noriyasu

    2015-01-01

    Nickel (Ni) ions easily elute from many alloys and elicit inflammation and allergies. Previous studies have shown that infections due to the implantation of medical devices cause inflammation and enhance the elution of Ni ions (Ni2+). However, cross-talk between infection- and Ni2+-induced signaling pathways has not yet been elucidated in detail. In the present study, we investigated the effects of Ni2+ on the lipopolysaccharide (LPS)-induced production of cytokines in a LPS-induced air pouch-type inflammation model in BALB/c mice and the murine macrophage cell line RAW264. We demonstrated that Ni2+ inhibited the LPS-induced production of interleukin (IL)-6, but not that of tumor necrosis factor (TNF)-α both in vivo and in vitro. This inhibitory effect was also observed with cobalt ion (Co2+), but not with chloride ion (Cl-), zinc ion (Zn2+), or palladium ion (Pd2+), and was highly selective to the production of IL-6. Ni2+ did not inhibit the activation of ERK1/2, p38 MAPK, or JNK. Although Ni2+ decreased IL-6 mRNA levels, it failed to inhibit the LPS-induced activation of the IL-6 promoter. An experiment using actinomycin D, a transcription inhibitor, revealed that Ni2+ decreased the stability of IL-6 mRNA. Moreover, Ni2+ inhibited the LPS-induced expression of Arid5a, but not regnase-1. These results demonstrated that Ni2+ may have selectively inhibited the LPS-induced production of IL-6 by decreasing the Arid5a-dependent stabilization of IL-6 mRNA. PMID:25742007

  3. Effects of ACTH and cAMP on steroidogenic acute regulatory protein and P450 11beta-hydroxylase messenger RNAs in rainbow trout interrenal cells: relationship with in vitro cortisol production.

    PubMed

    Hagen, I Julie; Kusakabe, Makoto; Young, Graham

    2006-02-01

    Steroidogenic acute regulatory protein (StAR) transfers cholesterol over the inner mitochondrial membrane, thereby making the molecule available for cholesterol side-chain cleavage enzyme, which carries out the first conversion in the steroidogenic pathway. In mammals, StAR controls this rate limiting step in steroidogenesis, and both StAR protein and StAR mRNA levels become rapidly elevated in response to tropic hormone stimulation. The relationship between StAR gene expression and steroid production in fish has not yet been well explored. We investigated the relationship between adrenocorticotropic hormone (ACTH)- and cAMP-stimulated cortisol production in vitro and levels of StAR transcripts in interrenal cells of rainbow trout. To assess the effect of ACTH on mRNA levels of a downstream steroidogenic enzyme, we also investigated the effects of ACTH on transcripts encoding 11beta hydroxylase (P450 11beta). In a series of experiments, juvenile rainbow trout head kidney tissue containing interrenal cells was incubated with either ACTH or dibutyryl cyclic AMP (dbcAMP). Cortisol in incubation media were measured by radioimmunoassay and total RNA was isolated from the tissue for Northern analysis or for quantitative real-time PCR. Incubation of tissue with 150 ng/mL ACTH for 1-18 h induced a progressive increase in cortisol accumulation in media, but StAR mRNA levels increased modestly and mostly insignificantly over 18 h, irrespective of treatment. Exposure of tissue for 18 h to 5, 150, 500 or 1,500 ng ACTH/mL resulted in a strong increase in cortisol production, with a peak response (15-fold increase over controls) achieved with 150 ng/mL ACTH. Although there was a trend towards a dose-response effect, mean StAR mRNA levels were only significantly affected by the highest concentration of ACTH used (1,500 ng/mL), which induced a less than 2-fold increase in StAR transcripts. However, there was a significant linear relationship between StAR mRNA levels and ACTH

  4. Analysis of mRNA expression for genes associated with regulatory T lymphocytes (CD25, FoxP3, CTLA4, and IDO) after experimental infection with bovine viral diarrhea virus of low or high virulence in beef calves.

    PubMed

    Palomares, Roberto A; Hurley, David J; Woolums, Amelia R; Parrish, Jacqueline E; Brock, Kenny V

    2014-12-01

    Immunosuppression caused by bovine viral diarrhea virus (BVDV) has been associated with lymphocyte depletion, leukopenia and impairment of leukocyte function; however, no work has been done on the relationship between BVDV and regulatory T lymphocytes (Tregs). The objective of this study was to compare the mRNA expression of genes associated with Tregs (CD25, FoxP3, CTLA4, and IDO), after experimental infection of beef calves with low (LV) or high (HV) virulence BVDV. Thirty BVDV-naïve calves were randomly assigned to three groups. Calves were intra-nasally inoculated with LV (n=10, strain SD-1) or HV (n=10, strain 1373) BVDV or BVDV-free cell culture medium (control, n=10). Quantitative RT-PCR was used to determine the expression of target genes in tracheo-bronchial lymph nodes and spleen on day 5 post-infection. The mRNA expression of CD25 was up-regulated in tracheo-bronchial lymph nodes of LV (P<0.05), but not in HV compared to the control group. The expression of FoxP3 and CTLA4 was not increased in tracheo-bronchial lymph nodes of either of the BVDV-inoculated groups. A dramatic up-regulation of IDO mRNA was observed in tracheo-bronchial lymph nodes of LV (P<0.05), but not HV compared to the control calves. In conclusion, experimental infection with BVDV did not provide evidence of Treg activation based on expression of FoxP3 and CTL4. Differential expression of CD25 and IDO mRNA on day 5 post-infection with HV or LV BVDV might reflect temporal differences in transcription occurring during the immune response elicited by these viral strains, or differences in viral infectivity of the host cells.

  5. Antagonistic control of the turnover pathway for the global regulatory sRNA CsrB by the CsrA and CsrD proteins

    PubMed Central

    Vakulskas, Christopher A.; Leng, Yuanyuan; Abe, Hazuki; Amaki, Takumi; Okayama, Akihiro; Babitzke, Paul; Suzuki, Kazushi; Romeo, Tony

    2016-01-01

    The widely conserved protein CsrA (carbon storage regulator A) globally regulates bacterial gene expression at the post-transcriptional level. In many species, CsrA activity is governed by untranslated sRNAs, CsrB and CsrC in Escherichia coli, which bind to multiple CsrA dimers, sequestering them from lower affinity mRNA targets. Both the synthesis and turnover of CsrB/C are regulated. Their turnover requires the housekeeping endonuclease RNase E and is activated by the presence of a preferred carbon source via the binding of EIIAGlc of the glucose transport system to the GGDEF-EAL domain protein CsrD. We demonstrate that the CsrB 3′ segment contains the features necessary for CsrD-mediated decay. RNase E cleavage in an unstructured segment located immediately upstream from the intrinsic terminator is necessary for subsequent degradation to occur. CsrA stabilizes CsrB against RNase E cleavage by binding to two canonical sites adjacent to the necessary cleavage site, while CsrD acts by overcoming CsrA-mediated protection. Our genetic, biochemical and structural studies establish a molecular framework for sRNA turnover by the CsrD-RNase E pathway. We propose that CsrD evolution was driven by the selective advantage of decoupling Csr sRNA decay from CsrA binding, connecting it instead to the availability of a preferred carbon source. PMID:27235416

  6. MNKs act as a regulatory switch for eIF4E1 and eIF4E3 driven mRNA translation in DLBCL

    PubMed Central

    Landon, Ari L.; Muniandy, Parameswary A.; Shetty, Amol C.; Lehrmann, Elin; Volpon, Laurent; Houng, Simone; Zhang, Yongqing; Dai, Bojie; Peroutka, Raymond; Mazan-Mamczarz, Krystyna; Steinhardt, James; Mahurkar, Anup; Becker, Kevin G.; Borden, Katherine L.; Gartenhaus, Ronald B.

    2014-01-01

    The phosphorylation of eIF4E1 at serine 209 by MNK1 or MNK2 has been shown to initiate oncogenic mRNA translation, a process that favours cancer development and maintenance. Here, we interrogate the MNK-eIF4E axis in diffuse large B-cell lymphoma (DLBCL) and show a distinct distribution of MNK1 and MNK2 in germinal centre B-cell (GCB) and activated B-cell (ABC) DLBCL. Despite displaying a differential distribution in GCB and ABC, both MNKs functionally complement each other to sustain cell survival. MNK inhibition ablates eIF4E1 phosphorylation and concurrently enhances eIF4E3 expression. Loss of MNK protein itself downregulates total eIF4E1 protein level by reducing eIF4E1 mRNA polysomal loading without affecting total mRNA level or stability. Enhanced eIF4E3 expression marginally suppresses eIF4E1-driven translation but exhibits a unique translatome that unveils a novel role for eIF4E3 in translation initiation. We propose that MNKs can modulate oncogenic translation by regulating eIF4E1-eIF4E3 levels and activity in DLBCL. PMID:25403230

  7. [Production of type I interferons in the body exposed to yeast RNA-tiloron molecular complexes].

    PubMed

    Karpov, A V; Zholobak, N M

    1996-01-01

    Molecular complexes forming as a result of interaction between yeast RNA preparations with 2,7-bis[-(diethylaminoethoxy)-fluorene]-9-on dihydrochloride (tilorone) administered parenterally to mice cause the appearance of interferon in high titers compatible to those induced by standard inductors of polyribonucleotide origin, poly(I)-poly(C) and larifan. Some physiologic conditions of interferonogenesis have been studied. The above molecular complexes in the dose range used experimentally were completely nontoxic. Hence, these complexes are promising agents for interferon induction.

  8. RNA Mediated Evolution of Catalysts for the Production of Alternative Fuels

    SciTech Connect

    Feldheim, Daniel

    2014-11-13

    Sequences that emerge from a RNA in vitro selection represent a genomic archive of functional biomolecules. The archive is much more than a simple list of sequences, however, as it also contains vital and detailed information concerning sequence-function relationships. That is, a “phylogeny” of active sequences can be constructed that can point the way toward a sequence or group of sequences with new functions.

  9. Production of Transgenic Calves Expressing an shRNA Targeting Myostatin

    PubMed Central

    Tessanne, K; Golding, MC; Long, CR; Peoples, MD; Hannon, G; Westhusin, ME

    2012-01-01

    Myostatin (MSTN) is a well-known negative regulator of muscle growth. Animals that possess mutations within this gene display an enhanced muscling phenotype, a desirable agricultural trait. Increased neonatal morbidity is common, however, resulting from complications arising from the birth of offspring with increased fetal muscle mass. The objective of the current research was to generate an attenuated MSTN-null phenotype in a large-animal model using RNA interference to enhance muscle development without the detrimental consequences of an inactivating mutation. To this end, we identified a series of short interfering RNAs that demonstrated effective suppression of MSTN mRNA and protein levels. To produce transgenic offspring capable of stable MSTN suppression in vivo, a recombinant lentiviral vector expressing a short hairpin RNA (shRNA) targeting MSTN for silencing was introduced into bovine fetal fibroblasts. These cells were used as nucleus donors for somatic cell nuclear transfer (SCNT). Twenty blastocysts were transferred into seven recipient cows resulting in five pregnancies. One transgenic calf developed to term, but died following delivery by Caesarean-section. As an alternative strategy, microinjection of recombinant lentiviral particles into the perivitelline space of in vitro-produced bovine zygotes was utilized to produce 40 transgenic blastocysts that were transferred into 14 recipient cows, resulting in 7 pregnancies. Five transgenic calves were produced, of which three expressed the transgene. This is the first report of transgenic livestock produced by direct injection of a recombinant lentivirus, and expressing transgenes encoding shRNAs targeting an endogenous gene (myostatin) for silencing. PMID:22139943

  10. An RNA-Dependent RNA Polymerase Prevents Meristem Invasion by Potato Virus X and Is Required for the Activity But Not the Production of a Systemic Silencing Signal1[w

    PubMed Central

    Schwach, Frank; Vaistij, Fabian E.; Jones, Louise; Baulcombe, David C.

    2005-01-01

    One of the functions of RNA silencing in plants is antiviral defense. A hallmark of RNA silencing is spreading of the silenced state through the plant. Little is known about the nature of the systemic silencing signal and the proteins required for its production, transport, and reception in plant tissues. Here, we show that the RNA-dependent RNA polymerase RDR6 in Nicotiana benthamiana is involved in defense against potato virus X at the level of systemic spreading and in exclusion of the virus from the apical growing point. It has no effect on primary replication and cell-to-cell movement of the virus and does not contribute significantly to the formation of virus-derived small interfering (si) RNA in a fully established potato virus X infection. In grafting experiments, the RDR6 homolog was required for the ability of a cell to respond to, but not to produce or translocate, the systemic silencing signal. Taking these findings together, we suggest a model of virus defense in which RDR6 uses incoming silencing signal to generate double-stranded RNA precursors of secondary siRNA. According to this idea, the secondary siRNAs mediate RNA silencing as an immediate response that slows down the systemic spreading of the virus into the growing point and newly emerging leaves. PMID:16040651

  11. Purification of RNA from milk whey.

    PubMed

    Izumi, Hirohisa; Kosaka, Nobuyoshi; Shimizu, Takashi; Sekine, Kazunori; Ochiya, Takahiro; Takase, Mitsunori

    2013-01-01

    MicroRNAs (miRNAs) are small regulatory RNA molecules that modulate specific target mRNAs and play very important roles in physiological processes. They were recently detected in body fluids such as blood, urine, saliva, and milk. These body fluid miRNAs have been studied thoroughly as potential diagnostic biomarkers. However, there have been few studies of milk miRNAs, and their roles are not clearly understood. Milk is the only nutritional source for newborn infants, and bovine milk is used widely as a dairy product. Thus, it is important to study milk miRNAs. In general, body fluid RNA concentrations are extremely low and of diverse existence types. In this chapter, we compare two silica membrane column-based RNA purification kits, and also compare RNA obtained directly from whey with that isolated from whey-derived exosomes.

  12. CD44 co-stimulation promotes FoxP3+ regulatory T-cell persistence and function via production of IL-2, IL-10 and TGF-beta

    PubMed Central

    Bollyky, Paul L.; Falk, Ben A.; Long, Alice; Preisinger, Anton; Braun, Kathy R.; Wu, Rebecca P.; Evanko, Stephen P.; Buckner, Jane H.; Wight, Thomas N.; Nepom, Gerald T.

    2011-01-01

    Work by our group and others has demonstrated a role for the extracellular matrix receptor CD44 and it's ligand hyaluronan in CD4+CD25+ regulatory T-cell (Treg) function. Herein we explore the mechanistic basis for this observation. Using mouse FoxP3/GFP+ Treg we find that CD44 co-stimulation promotes expression of FoxP3, in part through production of IL-2. This promotion of IL-2 production was also resistant to Cyclosporine A treatment, suggesting that CD44 costimulation may promote IL-2 production through bypassing FoxP3-mediated suppression of NFAT. CD44 co-stimulation increased production of IL-10 in a partially Il-2 dependant manner and also promoted cell-surface TGF-β expression. Consistent with these findings, Treg from CD44 knock-out mice demonstrated impaired regulatory function ex vivo and depressed production of IL-10 and cell-surface TGF-β. These data reveal a novel role for CD44 cross-linking in the production of regulatory cytokines. Similar salutary effects on FoxP3 expression were observed upon co-stimulation with hyaluronan, the primary natural ligand for CD44. This effect is dependent upon CD44 cross-linking; while both high molecular weight hyaluronan (HMW-HA) and plate-bound anti-CD44 Ab promoted FoxP3 expression, neither low-molecular weight HA (LMW-HA) nor soluble anti-CD44 Ab did so. The implication is that intact HMW-HA can cross-link CD44 only in those settings where it predominates over fragmentary LMW-HA, namely in un-inflamed tissue. We propose that intact but not fragmented ECM is capable of cross-linking CD44 and thereby maintains immunologic tolerance in uninjured or healing tissue. PMID:19635906

  13. Selection of rat hepatoma cells defective in hormone-regulated production of mouse mammary tumor virus RNA.

    PubMed Central

    Grove, J R; Ringold, G M

    1981-01-01

    We have been studying the mechanism of glucocorticoid hormone action by using mouse mammary tumor virus (MMTV)-infected rat hepatoma cells as a model system. J2.17, a clonal cell line that contains one MMTV provirus, induces tyrosine aminotransferase (TyrATase; L-tyrosine:2-oxoglutarate aminotransferase, EC 2.6.1.5), viral RNA, and the cell surface viral glycoprotein gp52 in response to dexamethasone. Using a fluorescence-activated cell sorter and a rabbit antiserum directed against gp52, we selected a cell population that displays a reduced hormone-mediated increase in cell surface gp52. Fourteen clones of this population were assayed for induction of viral gp52 and RNA and of cellular TyrATase. The results of these assays revealed that the clones display a variety of responses to hormone. One clone has retained wild-type responses of both TyrATase and gp52. Six clones exhibit coordinately reduced or abolished responses of both markers. Seven clones show normal induction of TyrATase but reduced or undetectable induction of gp52. These latter clones exhibit reduced production of MMTV RNA and thus may represent a unique class of variants defective in the regulation of MMTV gene expression. Images PMID:6117075

  14. Viability, longevity, and egg production of Drosophila melanogaster are regulated by the miR-282 microRNA.

    PubMed

    Vilmos, Péter; Bujna, Agnes; Szuperák, Milán; Havelda, Zoltán; Várallyay, Éva; Szabad, János; Kucerova, Lucie; Somogyi, Kálmán; Kristó, Ildikó; Lukácsovich, Tamás; Jankovics, Ferenc; Henn, László; Erdélyi, Miklós

    2013-10-01

    The first microRNAs were discovered some 20 years ago, but only a small fraction of the microRNA-encoding genes have been described in detail yet. Here we report the molecular analysis of a computationally predicted Drosophila melanogaster microRNA gene, mir-282. We show that the mir-282 gene is the source of a 4.9-kb-long primary transcript with a 5' cap and a 3'-poly(A) sequence and a mature microRNA of ∼25 bp. Our data strongly suggest the existence of an independent mir-282 gene conserved in holometabolic insects. We give evidence that the mir-282 locus encodes a functional transcript that influences viability, longevity, and egg production in Drosophila. We identify the nervous system-specific adenylate cyclase (rutabaga) as a target of miR-282 and assume that one of the main functions of mir-282 is the regulation of adenylate cyclase activity in the nervous system during metamorphosis.

  15. TFmiR: a web server for constructing and analyzing disease-specific transcription factor and miRNA co-regulatory networks.

    PubMed

    Hamed, Mohamed; Spaniol, Christian; Nazarieh, Maryam; Helms, Volkhard

    2015-07-01

    TFmiR is a freely available web server for deep and integrative analysis of combinatorial regulatory interactions between transcription factors, microRNAs and target genes that are involved in disease pathogenesis. Since the inner workings of cells rely on the correct functioning of an enormously complex system of activating and repressing interactions that can be perturbed in many ways, TFmiR helps to better elucidate cellular mechanisms at the molecular level from a network perspective. The provided topological and functional analyses promote TFmiR as a reliable systems biology tool for researchers across the life science communities. TFmiR web server is accessible through the following URL: http://service.bioinformatik.uni-saarland.de/tfmir.

  16. Effect of insulin on human skeletal muscle mitochondrial ATP production, protein synthesis, and mRNA transcripts

    PubMed Central

    Stump, Craig S.; Short, Kevin R.; Bigelow, Maureen L.; Schimke, Jill M.; Nair, K. Sreekumaran

    2003-01-01

    Mitochondria are the primary site of skeletal muscle fuel metabolism and ATP production. Although insulin is a major regulator of fuel metabolism, its effect on mitochondrial ATP production is not known. Here we report increases in vastus lateralis muscle mitochondrial ATP production capacity (32–42%) in healthy humans (P < 0.01) i.v. infused with insulin (1.5 milliunits/kg of fat-free mass per min) while clamping glucose, amino acids, glucagon, and growth hormone. Increased ATP production occurred in association with increased mRNA levels from both mitochondrial (NADH dehydrogenase subunit IV) and nuclear [cytochrome c oxidase (COX) subunit IV] genes (164–180%) encoding mitochondrial proteins (P < 0.05). In addition, muscle mitochondrial protein synthesis, and COX and citrate synthase enzyme activities were increased by insulin (P < 0.05). Further studies demonstrated no effect of low to high insulin levels on muscle mitochondrial ATP production for people with type 2 diabetes mellitus, whereas matched nondiabetic controls increased 16–26% (P < 0.02) when four different substrate combinations were used. In conclusion, insulin stimulates mitochondrial oxidative phosphorylation in skeletal muscle along with synthesis of gene transcripts and mitochondrial protein in human subjects. Skeletal muscle of type 2 diabetic patients has a reduced capacity to increase ATP production with high insulin levels. PMID:12808136

  17. Effect of insulin on human skeletal muscle mitochondrial ATP production, protein synthesis, and mRNA transcripts

    NASA Astrophysics Data System (ADS)

    Stump, Craig S.; Short, Kevin R.; Bigelow, Maureen L.; Schimke, Jill M.; Sreekumaran Nair, K.

    2003-06-01

    Mitochondria are the primary site of skeletal muscle fuel metabolism and ATP production. Although insulin is a major regulator of fuel metabolism, its effect on mitochondrial ATP production is not known. Here we report increases in vastus lateralis muscle mitochondrial ATP production capacity (32-42%) in healthy humans (P < 0.01) i.v. infused with insulin (1.5 milliunits/kg of fat-free mass per min) while clamping glucose, amino acids, glucagon, and growth hormone. Increased ATP production occurred in association with increased mRNA levels from both mitochondrial (NADH dehydrogenase subunit IV) and nuclear [cytochrome c oxidase (COX) subunit IV] genes (164-180%) encoding mitochondrial proteins (P < 0.05). In addition, muscle mitochondrial protein synthesis, and COX and citrate synthase enzyme activities were increased by insulin (P < 0.05). Further studies demonstrated no effect of low to high insulin levels on muscle mitochondrial ATP production for people with type 2 diabetes mellitus, whereas matched nondiabetic controls increased 16-26% (P < 0.02) when four different substrate combinations were used. In conclusion, insulin stimulates mitochondrial oxidative phosphorylation in skeletal muscle along with synthesis of gene transcripts and mitochondrial protein in human subjects. Skeletal muscle of type 2 diabetic patients has a reduced capacity to increase ATP production with high insulin levels. cytochrome c oxidase | NADH dehydrogenase subunit IV | amino acids | citrate synthase

  18. A protease-activated receptor 2 agonist (AC-264613) suppresses interferon regulatory factor 5 and decreases interleukin-12p40 production by lipopolysaccharide-stimulated macrophages: Role of p53.

    PubMed

    Yamaguchi, Rui; Yamamoto, Takatoshi; Sakamoto, Arisa; Ishimaru, Yasuji; Narahara, Shinji; Sugiuchi, Hiroyuki; Yamaguchi, Yasuo

    2016-06-01

    The transcription factor interferon regulatory factor 5 (IRF5) has a key role in the production of interleukin (IL)-12 by macrophages. IRF5 is also a central mediator of toll-like receptor signaling and is a direct target of p53. Activation of protease-activated receptor 2 (PAR-2) upregulates p53 and suppresses apoptosis. This study investigated the influence of human neutrophil elastase (HNE) and PAR-2 agonists on expression of IRF5 and IL-12p40 by macrophages stimulated with lipopolysaccharide. Granulocyte-macrophage colony-stimulating factor (GM-CSF)-dependent macrophages showed upregulation of IRF5 expression, while HNE reduced expression of p53 and IRF5 in a concentration-dependent manner. HNE also caused a concentration-dependent decrease of IRF5 in macrophages transfected with small interfering RNA to silence p53, while silencing of β-arrestin 2 blunted the reduction of p53 or IRF5 by HNE. Incubation of macrophages with a PAR-2 agonist, AC-264613, caused a decrease of IRF5 expression and also significantly reduced p53 protein expression. HNE upregulated the expression of tumor necrosis factor receptor-associated factor 6 (TRAF6) and caused transactivation of TLR4, while AC-264613 did not promote TLR4 transactivation. In conclusion, the PAR-2 agonist AC-264613 attenuated IRF5-associated IL-12p40 production by macrophages.

  19. A regulatory gene (ccaR) required for cephamycin and clavulanic acid production in Streptomyces clavuligerus: amplification results in overproduction of both beta-lactam compounds.

    PubMed Central

    Pérez-Llarena, F J; Liras, P; Rodríguez-García, A; Martín, J F

    1997-01-01

    A regulatory gene (ccaR), located within the cephamycin gene cluster of Streptomyces clavuligerus, is linked to a gene (blp) encoding a protein similar to a beta-lactamase-inhibitory protein. Expression of ccaR is required for cephamycin and clavulanic acid biosynthesis in S. clavuligerus. The ccaR-encoded protein resembles the ActII-ORF4, RedD, AfsR, and DnrI regulatory proteins of other Streptomyces species, all of which share several motifs. Disruption of ccaR by targeted double recombination resulted in the loss of the ability to synthesize cephamycin and clavulanic acid. Complementation of the disrupted mutant with ccaR restored production of both secondary metabolites. ccaR was expressed as a monocistronic transcript at 24 and 48 h in S. clavuligerus cultures (preceding the phase of antibiotic accumulation), but no transcript hybridization signals were observed at 72 or 96 h. This expression pattern is consistent with those of regulatory proteins required for antibiotic biosynthesis. Amplification of ccaR in S. clavuligerus resulted in a two- to threefold increase in the production of cephamycin and clavulanic acid. PMID:9068654

  20. Down-Regulatory Effects of miR-211 on Long Non-Coding RNA SOX2OT and SOX2 Genes in Esophageal Squamous Cell Carcinoma

    PubMed Central

    Shafiee, Mohammad; Aleyasin, Seyed Ahmad; Vasei, Mohammad; Semnani, Shahriar Semnani; Mowla, Seyed Javad

    2016-01-01

    Objective MicroRNAs (miRNAs) are a class of non-coding RNAs (ncRNAs) that tran- scriptionally or post-transcriptionally regulate gene expression through degradation of their mRNA targets and/or translational suppression. However, there are a few reports on miRNA-mediated expression regulation of long ncRNAs (lncRNAs). We have previ- ously reported a significant upregulation of the lncRNA SOX2OT and its intronic cod- ing gene, SOX2, in esophageal squamous cell carcinoma (ESCC) tissue samples. In this study, we aimed to evaluate the effect of induced overexpression of miR-211 on SOX2OT and SOX2 expression in vitro. Materials and Methods In this experimental study, we performed both bioinformatic and experimental analyses to examine whether these transcripts are regulated by miRNAs. From the list of potential candidate miRNAs, miR-211 was found to have complementary sequences to SOX2OT and SOX2 transcripts. To validate our finding experimentally, we transfected the NT-2 pluripotent cell line (an embryonal carcinoma stem cell) with an expression vector overexpressing miR-211. The expression chang- es of miR-211, SOX2OT, and SOX2 were then quantified by a real-time polymerase chain reaction (RT-PCR) approach. Results Compared with mock-transfected cells, overexpression of miR-211 caused a significant down-regulation of both genes (P<0.05). Furthermore, flow-cytometry analysis revealed a significant elevation in sub-G1 cell population following ectopic expression of miR-211 in NT-2 cells. Conclusion We report here, for the first time, the down-regulation of SOX2OT and SOX2 genes by an miRNA. Considering the vital role of SOX2OT and SOX2 genes in pluripotency and tumorigenesis, our data suggest an important and inhibitory role for miR-211 in the aforementioned processes. PMID:26862518

  1. A microRNA network dysregulated in asthma controls IL-6 production in bronchial epithelial cells.

    PubMed

    Martinez-Nunez, Rocio T; Bondanese, Victor P; Louafi, Fethi; Francisco-Garcia, Ana S; Rupani, Hitasha; Bedke, Nicole; Holgate, Stephen; Howarth, Peter H; Davies, Donna E; Sanchez-Elsner, Tilman

    2014-01-01

    MicroRNAs are short non-coding single stranded RNAs that regulate gene expression. While much is known about the effects of individual microRNAs, there is now growing evidence that they can work in co-operative networks. MicroRNAs are known to be dysregulated in many diseases and affect pathways involved in the pathology. We investigated dysregulation of microRNA networks using asthma as the disease model. Asthma is a chronic inflammatory disease of the airways characterized by bronchial hyperresponsiveness and airway remodelling. The airway epithelium is a major contributor to asthma pathology and has been shown to produce an excess of inflammatory and pro-remodelling cytokines such as TGF-β, IL-6 and IL-8 as well as deficient amounts of anti-viral interferons. After performing microRNA arrays, we found that microRNAs -18a, -27a, -128 and -155 are down-regulated in asthmatic bronchial epithelial cells, compared to cells from healthy donors. Interestingly, these microRNAs are predicted in silico to target several components of the TGF-β, IL-6, IL