Sample records for regulatory sequence common

  1. Population sequencing of two endocannabinoid metabolic genes identifies rare and common regulatory variants associated with extreme obesity and metabolite level

    PubMed Central


    Background Targeted re-sequencing of candidate genes in individuals at the extremes of a quantitative phenotype distribution is a method of choice to gain information on the contribution of rare variants to disease susceptibility. The endocannabinoid system mediates signaling in the brain and peripheral tissues involved in the regulation of energy balance, is highly active in obese patients, and represents a strong candidate pathway to examine for genetic association with body mass index (BMI). Results We sequenced two intervals (covering 188 kb) encoding the endocannabinoid metabolic enzymes fatty-acid amide hydrolase (FAAH) and monoglyceride lipase (MGLL) in 147 normal controls and 142 extremely obese cases. After applying quality filters, we called 1,393 high quality single nucleotide variants, 55% of which are rare, and 143 indels. Using single marker tests and collapsed marker tests, we identified four intervals associated with BMI: the FAAH promoter, the MGLL promoter, MGLL intron 2, and MGLL intron 3. Two of these intervals are composed of rare variants and the majority of the associated variants are located in promoter sequences or in predicted transcriptional enhancers, suggesting a regulatory role. The set of rare variants in the FAAH promoter associated with BMI is also associated with increased level of FAAH substrate anandamide, further implicating a functional role in obesity. Conclusions Our study, which is one of the first reports of a sequence-based association study using next-generation sequencing of candidate genes, provides insights into study design and analysis approaches and demonstrates the importance of examining regulatory elements rather than exclusively focusing on exon sequences. PMID:21118518

  2. Coordinate cytokine regulatory sequences


    Frazer, Kelly A.; Rubin, Edward M.; Loots, Gabriela G.


    The present invention provides CNS sequences that regulate the cytokine gene expression, expression cassettes and vectors comprising or lacking the CNS sequences, host cells and non-human transgenic animals comprising the CNS sequences or lacking the CNS sequences. The present invention also provides methods for identifying compounds that modulate the functions of CNS sequences as well as methods for diagnosing defects in the CNS sequences of patients.

  3. Formation of Regulatory Modules by Local Sequence Duplication

    PubMed Central

    Nourmohammad, Armita; Lässig, Michael


    Turnover of regulatory sequence and function is an important part of molecular evolution. But what are the modes of sequence evolution leading to rapid formation and loss of regulatory sites? Here we show that a large fraction of neighboring transcription factor binding sites in the fly genome have formed from a common sequence origin by local duplications. This mode of evolution is found to produce regulatory information: duplications can seed new sites in the neighborhood of existing sites. Duplicate seeds evolve subsequently by point mutations, often towards binding a different factor than their ancestral neighbor sites. These results are based on a statistical analysis of 346 cis-regulatory modules in the Drosophila melanogaster genome, and a comparison set of intergenic regulatory sequence in Saccharomyces cerevisiae. In fly regulatory modules, pairs of binding sites show significantly enhanced sequence similarity up to distances of about 50 bp. We analyze these data in terms of an evolutionary model with two distinct modes of site formation: (i) evolution from independent sequence origin and (ii) divergent evolution following duplication of a common ancestor sequence. Our results suggest that pervasive formation of binding sites by local sequence duplications distinguishes the complex regulatory architecture of higher eukaryotes from the simpler architecture of unicellular organisms. PMID:21998564

  4. RSAT 2015: Regulatory Sequence Analysis Tools

    PubMed Central

    Medina-Rivera, Alejandra; Defrance, Matthieu; Sand, Olivier; Herrmann, Carl; Castro-Mondragon, Jaime A.; Delerce, Jeremy; Jaeger, Sébastien; Blanchet, Christophe; Vincens, Pierre; Caron, Christophe; Staines, Daniel M.; Contreras-Moreira, Bruno; Artufel, Marie; Charbonnier-Khamvongsa, Lucie; Hernandez, Céline; Thieffry, Denis; Thomas-Chollier, Morgane; van Helden, Jacques


    RSAT (Regulatory Sequence Analysis Tools) is a modular software suite for the analysis of cis-regulatory elements in genome sequences. Its main applications are (i) motif discovery, appropriate to genome-wide data sets like ChIP-seq, (ii) transcription factor binding motif analysis (quality assessment, comparisons and clustering), (iii) comparative genomics and (iv) analysis of regulatory variations. Nine new programs have been added to the 43 described in the 2011 NAR Web Software Issue, including a tool to extract sequences from a list of coordinates (fetch-sequences from UCSC), novel programs dedicated to the analysis of regulatory variants from GWAS or population genomics (retrieve-variation-seq and variation-scan), a program to cluster motifs and visualize the similarities as trees (matrix-clustering). To deal with the drastic increase of sequenced genomes, RSAT public sites have been reorganized into taxon-specific servers. The suite is well-documented with tutorials and published protocols. The software suite is available through Web sites, SOAP/WSDL Web services, virtual machines and stand-alone programs at PMID:25904632

  5. RSAT 2015: Regulatory Sequence Analysis Tools.


    Medina-Rivera, Alejandra; Defrance, Matthieu; Sand, Olivier; Herrmann, Carl; Castro-Mondragon, Jaime A; Delerce, Jeremy; Jaeger, Sébastien; Blanchet, Christophe; Vincens, Pierre; Caron, Christophe; Staines, Daniel M; Contreras-Moreira, Bruno; Artufel, Marie; Charbonnier-Khamvongsa, Lucie; Hernandez, Céline; Thieffry, Denis; Thomas-Chollier, Morgane; van Helden, Jacques


    RSAT (Regulatory Sequence Analysis Tools) is a modular software suite for the analysis of cis-regulatory elements in genome sequences. Its main applications are (i) motif discovery, appropriate to genome-wide data sets like ChIP-seq, (ii) transcription factor binding motif analysis (quality assessment, comparisons and clustering), (iii) comparative genomics and (iv) analysis of regulatory variations. Nine new programs have been added to the 43 described in the 2011 NAR Web Software Issue, including a tool to extract sequences from a list of coordinates (fetch-sequences from UCSC), novel programs dedicated to the analysis of regulatory variants from GWAS or population genomics (retrieve-variation-seq and variation-scan), a program to cluster motifs and visualize the similarities as trees (matrix-clustering). To deal with the drastic increase of sequenced genomes, RSAT public sites have been reorganized into taxon-specific servers. The suite is well-documented with tutorials and published protocols. The software suite is available through Web sites, SOAP/WSDL Web services, virtual machines and stand-alone programs at

  6. Proving universal common ancestry with similar sequences

    PubMed Central

    Martins, Leonardo de Oliveira; Posada, David


    Douglas Theobald recently developed an interesting test putatively capable of quantifying the evidence for a Universal Common Ancestry uniting the three domains of life (Eukarya, Archaea and Bacteria) against hypotheses of Independent Origins for some of these domains. We review here his model, in particular in relation to the treatment of Horizontal Gene Transfer (HGT) and to the quality of sequence alignment. PMID:23814665

  7. Integrating sequence, evolution and functional genomics in regulatory genomics

    PubMed Central

    Vingron, Martin; Brazma, Alvis; Coulson, Richard; van Helden, Jacques; Manke, Thomas; Palin, Kimmo; Sand, Olivier; Ukkonen, Esko


    With genome analysis expanding from the study of genes to the study of gene regulation, 'regulatory genomics' utilizes sequence information, evolution and functional genomics measurements to unravel how regulatory information is encoded in the genome. PMID:19226437

  8. Poisson approach to clustering analysis of regulatory sequences.


    Wang, Haiying; Zheng, Huiru; Hu, Jinglu


    The presence of similar patterns in regulatory sequences may aid users in identifying co-regulated genes or inferring regulatory modules. By modelling pattern occurrences in regulatory regions with Poisson statistics, this paper presents a log likelihood ratio statistics-based distance measure to calculate pair-wise similarities between regulatory sequences. We employed it within three clustering algorithms: hierarchical clustering, Self-Organising Map, and a self-adaptive neural network. The results indicate that, in comparison to traditional clustering algorithms, the incorporation of the log likelihood ratio statistics-based distance into the learning process may offer considerable improvements in the process of regulatory sequence-based classification of genes.

  9. Conventional and Regulatory CD4+ T Cells That Share Identical TCRs Are Derived from Common Clones.


    Wolf, Kyle J; Emerson, Ryan O; Pingel, Jeanette; Buller, R Mark; DiPaolo, Richard J


    Results from studies comparing the diversity and specificity of the TCR repertoires expressed by conventional (Tconv) and regulatory (Treg) CD4+ T cell have varied depending on the experimental system employed. We developed a new model in which T cells express a single fixed TCRα chain, randomly rearranged endogenous TCRβ chains, and a Foxp3-GFP reporter. We purified CD4+Foxp3- and CD4+Foxp3+ cells, then performed biased controlled multiplex PCR and high throughput sequencing of endogenous TCRβ chains. We identified >7,000 different TCRβ sequences in the periphery of 5 individual mice. On average, ~12% of TCR sequences were expressed by both conventional and regulatory populations within individual mice. The CD4+ T cells that expressed shared TCR sequences were present at higher frequencies compared to T cells expressing non-shared TCRs. Furthermore, nearly all (>90%) of the TCR sequences that were shared within mice were identical at the DNA sequence level, indicating that conventional and regulatory T cells that express shared TCRs are derived from common clones. Analysis of TCR repertoire overlap in the thymus reveals that a large proportion of Tconv and Treg sharing observed in the periphery is due to clonal expansion in the thymus. Together these data show that there are a limited number of TCR sequences shared between Tconv and Tregs. Also, Tconv and Tregs sharing identical TCRs are found at relatively high frequencies and are derived from common progenitors, of which a large portion are generated in the thymus.

  10. Systematic localization of common disease-associated variation in regulatory DNA.


    Maurano, Matthew T; Humbert, Richard; Rynes, Eric; Thurman, Robert E; Haugen, Eric; Wang, Hao; Reynolds, Alex P; Sandstrom, Richard; Qu, Hongzhu; Brody, Jennifer; Shafer, Anthony; Neri, Fidencio; Lee, Kristen; Kutyavin, Tanya; Stehling-Sun, Sandra; Johnson, Audra K; Canfield, Theresa K; Giste, Erika; Diegel, Morgan; Bates, Daniel; Hansen, R Scott; Neph, Shane; Sabo, Peter J; Heimfeld, Shelly; Raubitschek, Antony; Ziegler, Steven; Cotsapas, Chris; Sotoodehnia, Nona; Glass, Ian; Sunyaev, Shamil R; Kaul, Rajinder; Stamatoyannopoulos, John A


    Genome-wide association studies have identified many noncoding variants associated with common diseases and traits. We show that these variants are concentrated in regulatory DNA marked by deoxyribonuclease I (DNase I) hypersensitive sites (DHSs). Eighty-eight percent of such DHSs are active during fetal development and are enriched in variants associated with gestational exposure-related phenotypes. We identified distant gene targets for hundreds of variant-containing DHSs that may explain phenotype associations. Disease-associated variants systematically perturb transcription factor recognition sequences, frequently alter allelic chromatin states, and form regulatory networks. We also demonstrated tissue-selective enrichment of more weakly disease-associated variants within DHSs and the de novo identification of pathogenic cell types for Crohn's disease, multiple sclerosis, and an electrocardiogram trait, without prior knowledge of physiological mechanisms. Our results suggest pervasive involvement of regulatory DNA variation in common human disease and provide pathogenic insights into diverse disorders.

  11. Computational identification of transcriptional regulatory elements in DNA sequence

    PubMed Central

    GuhaThakurta, Debraj


    Identification and annotation of all the functional elements in the genome, including genes and the regulatory sequences, is a fundamental challenge in genomics and computational biology. Since regulatory elements are frequently short and variable, their identification and discovery using computational algorithms is difficult. However, significant advances have been made in the computational methods for modeling and detection of DNA regulatory elements. The availability of complete genome sequence from multiple organisms, as well as mRNA profiling and high-throughput experimental methods for mapping protein-binding sites in DNA, have contributed to the development of methods that utilize these auxiliary data to inform the detection of transcriptional regulatory elements. Progress is also being made in the identification of cis-regulatory modules and higher order structures of the regulatory sequences, which is essential to the understanding of transcription regulation in the metazoan genomes. This article reviews the computational approaches for modeling and identification of genomic regulatory elements, with an emphasis on the recent developments, and current challenges. PMID:16855295

  12. Multigenome DNA sequence conservation identifies Hox cis-regulatory elements

    PubMed Central

    Kuntz, Steven G.; Schwarz, Erich M.; DeModena, John A.; De Buysscher, Tristan; Trout, Diane; Shizuya, Hiroaki; Sternberg, Paul W.; Wold, Barbara J.


    To learn how well ungapped sequence comparisons of multiple species can predict cis-regulatory elements in Caenorhabditis elegans, we made such predictions across the large, complex ceh-13/lin-39 locus and tested them transgenically. We also examined how prediction quality varied with different genomes and parameters in our comparisons. Specifically, we sequenced ∼0.5% of the C. brenneri and C. sp. 3 PS1010 genomes, and compared five Caenorhabditis genomes (C. elegans, C. briggsae, C. brenneri, C. remanei, and C. sp. 3 PS1010) to find regulatory elements in 22.8 kb of noncoding sequence from the ceh-13/lin-39 Hox subcluster. We developed the MUSSA program to find ungapped DNA sequences with N-way transitive conservation, applied it to the ceh-13/lin-39 locus, and transgenically assayed 21 regions with both high and low degrees of conservation. This identified 10 functional regulatory elements whose activities matched known ceh-13/lin-39 expression, with 100% specificity and a 77% recovery rate. One element was so well conserved that a similar mouse Hox cluster sequence recapitulated the native nematode expression pattern when tested in worms. Our findings suggest that ungapped sequence comparisons can predict regulatory elements genome-wide. PMID:18981268

  13. Detection of Weakly Conserved Ancestral Mammalian RegulatorySequences by Primate Comparisons

    SciTech Connect

    Wang, Qian-fei; Prabhakar, Shyam; Chanan, Sumita; Cheng,Jan-Fang; Rubin, Edward M.; Boffelli, Dario


    Genomic comparisons between human and distant, non-primatemammals are commonly used to identify cis-regulatory elements based onconstrained sequence evolution. However, these methods fail to detectcryptic functional elements, which are too weakly conserved among mammalsto distinguish from nonfunctional DNA. To address this problem, weexplored the potential of deep intra-primate sequence comparisons. Wesequenced the orthologs of 558 kb of human genomic sequence, coveringmultiple loci involved in cholesterol homeostasis, in 6 nonhumanprimates. Our analysis identified 6 noncoding DNA elements displayingsignificant conservation among primates, but undetectable in more distantcomparisons. In vitro and in vivo tests revealed that at least three ofthese 6 elements have regulatory function. Notably, the mouse orthologsof these three functional human sequences had regulatory activity despitetheir lack of significant sequence conservation, indicating that they arecryptic ancestral cis-regulatory elements. These regulatory elementscould still be detected in a smaller set of three primate speciesincluding human, rhesus and marmoset. Since the human and rhesus genomesequences are already available, and the marmoset genome is activelybeing sequenced, the primate-specific conservation analysis describedhere can be applied in the near future on a whole-genome scale, tocomplement the annotation provided by more distant speciescomparisons.

  14. Learning gene regulatory networks from next generation sequencing data.


    Jia, Bochao; Xu, Suwa; Xiao, Guanghua; Lamba, Vishal; Liang, Faming


    In recent years, next generation sequencing (NGS) has gradually replaced microarray as the major platform in measuring gene expressions. Compared to microarray, NGS has many advantages, such as less noise and higher throughput. However, the discreteness of NGS data also challenges the existing statistical methodology. In particular, there still lacks an appropriate statistical method for reconstructing gene regulatory networks using NGS data in the literature. The existing local Poisson graphical model method is not consistent and can only infer certain local structures of the network. In this article, we propose a random effect model-based transformation to continuize NGS data and then we transform the continuized data to Gaussian via a semiparametric transformation and apply an equivalent partial correlation selection method to reconstruct gene regulatory networks. The proposed method is consistent. The numerical results indicate that the proposed method can lead to much more accurate inference of gene regulatory networks than the local Poisson graphical model and other existing methods. The proposed data-continuized transformation fills the theoretical gap for how to transform discrete data to continuous data and facilitates NGS data analysis. The proposed data-continuized transformation also makes it feasible to integrate different types of data, such as microarray and RNA-seq data, in reconstruction of gene regulatory networks.

  15. Pleiotropy constrains the evolution of protein but not regulatory sequences in a transcription regulatory network influencing complex social behaviors

    PubMed Central

    Molodtsova, Daria; Harpur, Brock A.; Kent, Clement F.; Seevananthan, Kajendra; Zayed, Amro


    It is increasingly apparent that genes and networks that influence complex behavior are evolutionary conserved, which is paradoxical considering that behavior is labile over evolutionary timescales. How does adaptive change in behavior arise if behavior is controlled by conserved, pleiotropic, and likely evolutionary constrained genes? Pleiotropy and connectedness are known to constrain the general rate of protein evolution, prompting some to suggest that the evolution of complex traits, including behavior, is fuelled by regulatory sequence evolution. However, we seldom have data on the strength of selection on mutations in coding and regulatory sequences, and this hinders our ability to study how pleiotropy influences coding and regulatory sequence evolution. Here we use population genomics to estimate the strength of selection on coding and regulatory mutations for a transcriptional regulatory network that influences complex behavior of honey bees. We found that replacement mutations in highly connected transcription factors and target genes experience significantly stronger negative selection relative to weakly connected transcription factors and targets. Adaptively evolving proteins were significantly more likely to reside at the periphery of the regulatory network, while proteins with signs of negative selection were near the core of the network. Interestingly, connectedness and network structure had minimal influence on the strength of selection on putative regulatory sequences for both transcription factors and their targets. Our study indicates that adaptive evolution of complex behavior can arise because of positive selection on protein-coding mutations in peripheral genes, and on regulatory sequence mutations in both transcription factors and their targets throughout the network. PMID:25566318

  16. Population genetics of cis-regulatory sequences that operate during embryonic development in the sea urchin Strongylocentrotus purpuratus.


    Garfield, David; Haygood, Ralph; Nielsen, William J; Wray, Gregory A


    Despite the fact that noncoding sequences comprise a substantial fraction of functional sites within all genomes, the evolutionary mechanisms that operate on genetic variation within regulatory elements remain poorly understood. In this study, we examine the population genetics of the core, upstream cis-regulatory regions of eight genes (AN, CyIIa, CyIIIa, Endo16, FoxB, HE, SM30 a, and SM50) that function during the early development of the purple sea urchin, Strongylocentrotus purpuratus. Quantitative and qualitative measures of segregating variation are not conspicuously different between cis-regulatory and closely linked "proxy neutral" noncoding regions containing no known functional sites. Length and compound mutations are common in noncoding sequences; conventional descriptive statistics ignore such mutations, under-representing true genetic variation by approximately 28% for these loci in this population. Patterns of variation in the cis-regulatory regions of six of the genes examined (CyIIa, CyIIIa, Endo16, FoxB, AN, and HE) are consistent with directional selection. Genetic variation within annotated transcription factor binding sites is comparable to, and frequently greater than, that of surrounding sequences. Comparisons of two paralog pairs (CyIIa/CyIIIa and AN/HE) suggest that distinct evolutionary processes have operated on their cis-regulatory regions following gene duplication. Together, these analyses provide a detailed view of the evolutionary mechanisms operating on noncoding sequences within a natural population, and underscore how little is known about how these processes operate on cis-regulatory sequences.

  17. WeederH: an algorithm for finding conserved regulatory motifs and regions in homologous sequences

    PubMed Central

    Pavesi, Giulio; Zambelli, Federico; Pesole, Graziano


    Background This work addresses the problem of detecting conserved transcription factor binding sites and in general regulatory regions through the analysis of sequences from homologous genes, an approach that is becoming more and more widely used given the ever increasing amount of genomic data available. Results We present an algorithm that identifies conserved transcription factor binding sites in a given sequence by comparing it to one or more homologs, adapting a framework we previously introduced for the discovery of sites in sequences from co-regulated genes. Differently from the most commonly used methods, the approach we present does not need or compute an alignment of the sequences investigated, nor resorts to descriptors of the binding specificity of known transcription factors. The main novel idea we introduce is a relative measure of conservation, assuming that true functional elements should present a higher level of conservation with respect to the rest of the sequence surrounding them. We present tests where we applied the algorithm to the identification of conserved annotated sites in homologous promoters, as well as in distal regions like enhancers. Conclusion Results of the tests show how the algorithm can provide fast and reliable predictions of conserved transcription factor binding sites regulating the transcription of a gene, with better performances than other available methods for the same task. We also show examples on how the algorithm can be successfully employed when promoter annotations of the genes investigated are missing, or when regulatory sites and regions are located far away from the genes. PMID:17286865

  18. Properties of Sequence Conservation in Upstream Regulatory and Protein Coding Sequences among Paralogs in Arabidopsis thaliana

    NASA Astrophysics Data System (ADS)

    Richardson, Dale N.; Wiehe, Thomas

    Whole genome duplication (WGD) has catalyzed the formation of new species, genes with novel functions, altered expression patterns, complexified signaling pathways and has provided organisms a level of genetic robustness. We studied the long-term evolution and interrelationships of 5’ upstream regulatory sequences (URSs), protein coding sequences (CDSs) and expression correlations (EC) of duplicated gene pairs in Arabidopsis. Three distinct methods revealed significant evolutionary conservation between paralogous URSs and were highly correlated with microarray-based expression correlation of the respective gene pairs. Positional information on exact matches between sequences unveiled the contribution of micro-chromosomal rearrangements on expression divergence. A three-way rank analysis of URS similarity, CDS divergence and EC uncovered specific gene functional biases. Transcription factor activity was associated with gene pairs exhibiting conserved URSs and divergent CDSs, whereas a broad array of metabolic enzymes was found to be associated with gene pairs showing diverged URSs but conserved CDSs.

  19. Sex determination strategies in 2012: towards a common regulatory model?


    Angelopoulou, Roxani; Lavranos, Giagkos; Manolakou, Panagiota


    Sex determination is a complicated process involving large-scale modifications in gene expression affecting virtually every tissue in the body. Although the evolutionary origin of sex remains controversial, there is little doubt that it has developed as a process of optimizing metabolic control, as well as developmental and reproductive functions within a given setting of limited resources and environmental pressure. Evidence from various model organisms supports the view that sex determination may occur as a result of direct environmental induction or genetic regulation. The first process has been well documented in reptiles and fish, while the second is the classic case for avian species and mammals. Both of the latter have developed a variety of sex-specific/sex-related genes, which ultimately form a complete chromosome pair (sex chromosomes/gonosomes). Interestingly, combinations of environmental and genetic mechanisms have been described among different classes of animals, thus rendering the possibility of a unidirectional continuous evolutionary process from the one type of mechanism to the other unlikely. On the other hand, common elements appear throughout the animal kingdom, with regard to a) conserved key genes and b) a central role of sex steroid control as a prerequisite for ultimately normal sex differentiation. Studies in invertebrates also indicate a role of epigenetic chromatin modification, particularly with regard to alternative splicing options. This review summarizes current evidence from research in this hot field and signifies the need for further study of both normal hormonal regulators of sexual phenotype and patterns of environmental disruption.

  20. Noninvasive prenatal diagnosis of common aneuploidies by semiconductor sequencing

    PubMed Central

    Liao, Can; Yin, Ai-hua; Peng, Chun-fang; Fu, Fang; Yang, Jie-xia; Li, Ru; Chen, Yang-yi; Luo, Dong-hong; Zhang, Yong-ling; Ou, Yan-mei; Li, Jian; Wu, Jing; Mai, Ming-qin; Hou, Rui; Wu, Frances; Luo, Hongrong; Li, Dong-zhi; Liu, Hai-liang; Zhang, Xiao-zhuang; Zhang, Kang


    Massively parallel sequencing (MPS) of cell-free fetal DNA from maternal plasma has revolutionized our ability to perform noninvasive prenatal diagnosis. This approach avoids the risk of fetal loss associated with more invasive diagnostic procedures. The present study developed an effective method for noninvasive prenatal diagnosis of common chromosomal aneuploidies using a benchtop semiconductor sequencing platform (SSP), which relies on the MPS platform but offers advantages over existing noninvasive screening techniques. A total of 2,275 pregnant subjects was included in the study; of these, 515 subjects who had full karyotyping results were used in a retrospective analysis, and 1,760 subjects without karyotyping were analyzed in a prospective study. In the retrospective study, all 55 fetal trisomy 21 cases were identified using the SSP with a sensitivity and specificity of 99.94% and 99.46%, respectively. The SSP also detected 16 trisomy 18 cases with 100% sensitivity and 99.24% specificity and 3 trisomy 13 cases with 100% sensitivity and 100% specificity. Furthermore, 15 fetuses with sex chromosome aneuploidies (10 45,X, 2 47,XYY, 2 47,XXX, and 1 47,XXY) were detected. In the prospective study, nine fetuses with trisomy 21, three with trisomy 18, three with trisomy 13, and one with 45,X were detected. To our knowledge, this is the first large-scale clinical study to systematically identify chromosomal aneuploidies based on cell-free fetal DNA using the SSP and provides an effective strategy for large-scale noninvasive screening for chromosomal aneuploidies in a clinical setting. PMID:24799683

  1. On the Concept of Cis-regulatory Information: From Sequence Motifs to Logic Functions

    NASA Astrophysics Data System (ADS)

    Tarpine, Ryan; Istrail, Sorin

    The regulatory genome is about the “system level organization of the core genomic regulatory apparatus, and how this is the locus of causality underlying the twin phenomena of animal development and animal evolution” (E.H. Davidson. The Regulatory Genome: Gene Regulatory Networks in Development and Evolution, Academic Press, 2006). Information processing in the regulatory genome is done through regulatory states, defined as sets of transcription factors (sequence-specific DNA binding proteins which determine gene expression) that are expressed and active at the same time. The core information processing machinery consists of modular DNA sequence elements, called cis-modules, that interact with transcription factors. The cis-modules “read” the information contained in the regulatory state of the cell through transcription factor binding, “process” it, and directly or indirectly communicate with the basal transcription apparatus to determine gene expression. This endowment of each gene with the information-receiving capacity through their cis-regulatory modules is essential for the response to every possible regulatory state to which it might be exposed during all phases of the life cycle and in all cell types. We present here a set of challenges addressed by our CYRENE research project aimed at studying the cis-regulatory code of the regulatory genome. The CYRENE Project is devoted to (1) the construction of a database, the cis-Lexicon, containing comprehensive information across species about experimentally validated cis-regulatory modules; and (2) the software development of a next-generation genome browser, the cis-Browser, specialized for the regulatory genome. The presentation is anchored on three main computational challenges: the Gene Naming Problem, the Consensus Sequence Bottleneck Problem, and the Logic Function Inference Problem.

  2. Signal sequence detection given noisy, common background image sets.

    NASA Technical Reports Server (NTRS)

    Harger, R. O.


    The optimum processing (likelihood functional) is found for a set of M images, each the sum of a member of a signal sequence due to an object to be detected and its parameters estimated, a sample function of a noise field, and a sample function of a common background field. The noise fields are independent, zero mean, white Gaussian fields, all independent of the background field. The latter is assumed to be either (1) completely unknown or of known mean and covariance functions with (2) a certain fluctuation property or (3) Gaussian. Three equivalent forms of the optimum processing are found: (1) a summation of generalized matched filterings of the images, (2) a summation of matched filtering of certain generalized differences of the images, and (3) a summation of 'estimator-correlator' type filterings. The detection performance and optimum signal/image selection under the Neyman-Pearson criterion is given, and is shown that optimum processor and signal design can completely eliminate any effect of the background on detectability.

  3. Genetic Diagnosis Using Whole Exome Sequencing in Common Variable Immunodeficiency

    PubMed Central

    Maffucci, Patrick; Filion, Charles A.; Boisson, Bertrand; Itan, Yuval; Shang, Lei; Casanova, Jean-Laurent; Cunningham-Rundles, Charlotte


    Whole exome sequencing (WES) has proven an effective tool for the discovery of genetic defects in patients with primary immunodeficiencies (PIDs). However, success in dissecting the genetic etiology of common variable immunodeficiency (CVID) has been limited. We outline a practical framework for using WES to identify causative genetic defects in these subjects. WES was performed on 50 subjects diagnosed with CVID who had at least one of the following criteria: early onset, autoimmune/inflammatory manifestations, low B lymphocytes, and/or familial history of hypogammaglobulinemia. Following alignment and variant calling, exomes were screened for mutations in 269 PID-causing genes. Variants were filtered based on the mode of inheritance and reported frequency in the general population. Each variant was assessed by study of familial segregation and computational predictions of deleteriousness. Out of 433 variations in PID-associated genes, we identified 17 probable disease-causing mutations in 15 patients (30%). These variations were rare or private and included monoallelic mutations in NFKB1, STAT3, CTLA4, PIK3CD, and IKZF1, and biallelic mutations in LRBA and STXBP2. Forty-two other damaging variants were found but were not considered likely disease-causing based on the mode of inheritance and/or patient phenotype. WES combined with analysis of PID-associated genes is a cost-effective approach to identify disease-causing mutations in CVID patients with severe phenotypes and was successful in 30% of our cohort. As targeted therapeutics are becoming the mainstay of treatment for non-infectious manifestations in CVID, this approach will improve management of patients with more severe phenotypes. PMID:27379089

  4. Annotation of cis-regulatory elements by identification, subclassification, and functional assessment of multispecies conserved sequences

    PubMed Central

    Hughes, Jim R.; Cheng, Jan-Fang; Ventress, Nicki; Prabhakar, Shyam; Clark, Kevin; Anguita, Eduardo; De Gobbi, Marco; de Jong, Pieter; Rubin, Eddy; Higgs, Douglas R.


    An important step toward improving the annotation of the human genome is to identify cis-acting regulatory elements from primary DNA sequence. One approach is to compare sequences from multiple, divergent species. This approach distinguishes multispecies conserved sequences (MCS) in noncoding regions from more rapidly evolving neutral DNA. Here, we have analyzed a region of ≈238kb containing the human α globin cluster that was sequenced and/or annotated across the syntenic region in 22 species spanning 500 million years of evolution. Using a variety of bioinformatic approaches and correlating the results with many aspects of chromosome structure and function in this region, we were able to identify and evaluate the importance of 24 individual MCSs. This approach sensitively and accurately identified previously characterized regulatory elements but also discovered unidentified promoters, exons, splicing, and transcriptional regulatory elements. Together, these studies demonstrate an integrated approach by which to identify, subclassify, and predict the potential importance of MCSs. PMID:15998734

  5. Regulatory convergence and harmonization: barriers to effective use and adoption of common standards.


    Pombo, María Luz; Porrás, Analía; Saidon, Patricia Claudia; Cascio, Stephanie M


    Objective To evaluate 1) the level of use and adoption of eight Technical Documents (TDs) published by the Pan American Network for Drug Regulatory Harmonization (PANDRH) member states and 2) identify the hurdles that can prevent countries from successfully adopting a common standard. Methods An in-depth analysis of the incorporation of PANDRH Technical Document No. 1 ("TDNo1") recommendations in member states' national requirements was carried out. Results The results illustrate the role of PANDRH in promoting convergence/harmonization among its members. Conclusions The study results show that the rate of use of TDs varied greatly by product/area and country. Timing, TD content, and product/area, and, more importantly, national capacities, are critical determinants of the level of TD guideline adoption. While PANDRH TDs have proven instrumental for the harmonization/convergence of member states' national requirements, as shown by the level of convergence across a majority of the national requirements issued for vaccine licensing, several countries had yet to incorporate common standards due, in large part, to weak national regulatory capacities. Therefore, harmonization/convergence initiatives should include the strengthening of national regulatory capacities as part of their core strategy, which will, in turn, allow for the incorporation and deployment of common standards in all participating countries.

  6. Synthetic muscle promoters: activities exceeding naturally occurring regulatory sequences

    NASA Technical Reports Server (NTRS)

    Li, X.; Eastman, E. M.; Schwartz, R. J.; Draghia-Akli, R.


    Relatively low levels of expression from naturally occurring promoters have limited the use of muscle as a gene therapy target. Myogenic restricted gene promoters display complex organization usually involving combinations of several myogenic regulatory elements. By random assembly of E-box, MEF-2, TEF-1, and SRE sites into synthetic promoter recombinant libraries, and screening of hundreds of individual clones for transcriptional activity in vitro and in vivo, several artificial promoters were isolated whose transcriptional potencies greatly exceed those of natural myogenic and viral gene promoters.

  7. Molecular sled sequences are common in mammalian proteins

    PubMed Central

    Xiong, Kan; Blainey, Paul C.


    Recent work revealed a new class of molecular machines called molecular sleds, which are small basic molecules that bind and slide along DNA with the ability to carry cargo along DNA. Here, we performed biochemical and single-molecule flow stretching assays to investigate the basis of sliding activity in molecular sleds. In particular, we identified the functional core of pVIc, the first molecular sled characterized; peptide functional groups that control sliding activity; and propose a model for the sliding activity of molecular sleds. We also observed widespread DNA binding and sliding activity among basic polypeptide sequences that implicate mammalian nuclear localization sequences and many cell penetrating peptides as molecular sleds. These basic protein motifs exhibit weak but physiologically relevant sequence-nonspecific DNA affinity. Our findings indicate that many mammalian proteins contain molecular sled sequences and suggest the possibility that substantial undiscovered sliding activity exists among nuclear mammalian proteins. PMID:26857546

  8. Phylum-Level Conservation of Regulatory Information in Nematodes despite Extensive Non-coding Sequence Divergence.


    Gordon, Kacy L; Arthur, Robert K; Ruvinsky, Ilya


    Gene regulatory information guides development and shapes the course of evolution. To test conservation of gene regulation within the phylum Nematoda, we compared the functions of putative cis-regulatory sequences of four sets of orthologs (unc-47, unc-25, mec-3 and elt-2) from distantly-related nematode species. These species, Caenorhabditis elegans, its congeneric C. briggsae, and three parasitic species Meloidogyne hapla, Brugia malayi, and Trichinella spiralis, represent four of the five major clades in the phylum Nematoda. Despite the great phylogenetic distances sampled and the extensive sequence divergence of nematode genomes, all but one of the regulatory elements we tested are able to drive at least a subset of the expected gene expression patterns. We show that functionally conserved cis-regulatory elements have no more extended sequence similarity to their C. elegans orthologs than would be expected by chance, but they do harbor motifs that are important for proper expression of the C. elegans genes. These motifs are too short to be distinguished from the background level of sequence similarity, and while identical in sequence they are not conserved in orientation or position. Functional tests reveal that some of these motifs contribute to proper expression. Our results suggest that conserved regulatory circuitry can persist despite considerable turnover within cis elements.

  9. Phylum-Level Conservation of Regulatory Information in Nematodes despite Extensive Non-coding Sequence Divergence

    PubMed Central

    Gordon, Kacy L.; Arthur, Robert K.; Ruvinsky, Ilya


    Gene regulatory information guides development and shapes the course of evolution. To test conservation of gene regulation within the phylum Nematoda, we compared the functions of putative cis-regulatory sequences of four sets of orthologs (unc-47, unc-25, mec-3 and elt-2) from distantly-related nematode species. These species, Caenorhabditis elegans, its congeneric C. briggsae, and three parasitic species Meloidogyne hapla, Brugia malayi, and Trichinella spiralis, represent four of the five major clades in the phylum Nematoda. Despite the great phylogenetic distances sampled and the extensive sequence divergence of nematode genomes, all but one of the regulatory elements we tested are able to drive at least a subset of the expected gene expression patterns. We show that functionally conserved cis-regulatory elements have no more extended sequence similarity to their C. elegans orthologs than would be expected by chance, but they do harbor motifs that are important for proper expression of the C. elegans genes. These motifs are too short to be distinguished from the background level of sequence similarity, and while identical in sequence they are not conserved in orientation or position. Functional tests reveal that some of these motifs contribute to proper expression. Our results suggest that conserved regulatory circuitry can persist despite considerable turnover within cis elements. PMID:26020930

  10. Comprehensive population-based genome sequencing provides insight into hematopoietic regulatory mechanisms

    PubMed Central

    Guo, Michael H.; Nandakumar, Satish K.; Ulirsch, Jacob C.; Zekavat, Seyedeh M.; Buenrostro, Jason D.; Natarajan, Pradeep; Salem, Rany M.; Chiarle, Roberto; Mitt, Mario; Kals, Mart; Pärn, Kalle; Fischer, Krista; Milani, Lili; Mägi, Reedik; Palta, Priit; Gabriel, Stacey B.; Metspalu, Andres; Lander, Eric S.; Kathiresan, Sekar; Hirschhorn, Joel N.; Esko, Tõnu; Sankaran, Vijay G.


    Genetic variants affecting hematopoiesis can influence commonly measured blood cell traits. To identify factors that affect hematopoiesis, we performed association studies for blood cell traits in the population-based Estonian Biobank using high-coverage whole-genome sequencing (WGS) in 2,284 samples and SNP genotyping in an additional 14,904 samples. Using up to 7,134 samples with available phenotype data, our analyses identified 17 associations across 14 blood cell traits. Integration of WGS-based fine-mapping and complementary epigenomic datasets provided evidence for causal mechanisms at several loci, including at a previously undiscovered basophil count-associated locus near the master hematopoietic transcription factor CEBPA. The fine-mapped variant at this basophil count association near CEBPA overlapped an enhancer active in common myeloid progenitors and influenced its activity. In situ perturbation of this enhancer by CRISPR/Cas9 mutagenesis in hematopoietic stem and progenitor cells demonstrated that it is necessary for and specifically regulates CEBPA expression during basophil differentiation. We additionally identified basophil count-associated variation at another more pleiotropic myeloid enhancer near GATA2, highlighting regulatory mechanisms for ordered expression of master hematopoietic regulators during lineage specification. Our study illustrates how population-based genetic studies can provide key insights into poorly understood cell differentiation processes of considerable physiologic relevance. PMID:28031487

  11. Poster — Thur Eve — 50: Common Regulatory Non-Compliances and How to Avoid Them

    SciTech Connect

    Heimann, M.


    The Accelerators and Class II Facilities Division (ACFD) of the Canadian Nuclear Safety Commission (CNSC), is responsible for the oversight of radiotherapy facilities containing Class II prescribed equipment in Canada. Over the past several years, ACFD has been performing compliance inspections of Class II nuclear facilities across the country (medical and otherwise), and in that time, has issued several hundred corrective actions to licensees due to non-compliance with regulatory requirements. Recently, a study was done to determine the most common regulatory non-compliances. The purpose of this poster presentation is to disseminate information to the licensee community about the nature of these non-compliances, and how they can be avoided by licensees in the future.

  12. Long-range cooperativity between gene regulatory sequences in a prokaryote.


    Dandanell, G; Valentin-Hansen, P; Larsen, J E; Hammer, K

    Regulation of transcription initiation by proteins binding at DNA sequences some distance from the promoter region itself seems to be a general phenomenon in both eukaryotes and prokaryotes. Proteins bound to an enhancer site in eukaryotes can turn on a distant gene, whereas efficient repression of some prokaryotic genes such as the gal, ara and deo operons of Escherichia coli, requires the presence of two operator sites, separated by 110, 200 and 600 base pairs (bp) respectively. In the deo operon, which encodes nucleoside catabolizing enzymes, we have shown that efficient and cooperative repression can be obtained when the distance between the two sites ranges from 224 to 997 bp. Here, we report that transcription initiation can be regulated from an operator site placed 1 to 5 kilobases (kb) downstream of the deoP2 promoter (and downstream of the transcribed gene), and present the first experimental data for prokaryotic regulation at distances greater than 1 kb. Our results support the model of DNA loop formation as a common regulatory mechanism explaining both some prokaryotic regulation and the action of eukaryotic enhancers.

  13. Use of H19 Gene Regulatory Sequences in DNA-Based Therapy for Pancreatic Cancer

    PubMed Central

    Scaiewicz, V.; Sorin, V.; Fellig, Y.; Birman, T.; Mizrahi, A.; Galula, J.; Abu-lail, R.; Shneider, T.; Ohana, P.; Buscail, L.; Hochberg, A.; Czerniak, A.


    Pancreatic cancer is the eighth most common cause of death from cancer in the world, for which palliative treatments are not effective and frequently accompanied by severe side effects. We propose a DNA-based therapy for pancreatic cancer using a nonviral vector, expressing the diphtheria toxin A chain under the control of the H19 gene regulatory sequences. The H19 gene is an oncofetal RNA expressed during embryo development and in several types of cancer. We tested the expression of H19 gene in patients, and found that 65% of human pancreatic tumors analyzed showed moderated to strong expression of the gene. In vitro experiments showed that the vector was effective in reducing Luciferase protein activity on pancreatic carcinoma cell lines. In vivo experiment results revealed tumor growth arrest in different animal models for pancreatic cancer. Differences in tumor size between control and treated groups reached a 75% in the heterotopic model (P = .037) and 50% in the orthotopic model (P = .007). In addition, no visible metastases were found in the treated group of the orthotopic model. These results indicate that the treatment with the vector DTA-H19 might be a viable new therapeutic option for patients with unresectable pancreatic cancer. PMID:21052499

  14. Common Warm Dust Temperatures Around Main Sequence Stars

    NASA Technical Reports Server (NTRS)

    Morales, Farisa; Rieke, George; Werner, Michael; Stapelfeldt, Karl; Bryden, Geoffrey; Su, Kate


    We compare the properties of warm dust emission from a sample of main-sequence A-type stars (B8-A7) to those of dust around solar-type stars (F5-KO) with similar Spitzer Space Telescope Infrared Spectrograph/MIPS data and similar ages. Both samples include stars with sources with infrared spectral energy distributions that show evidence of multiple components. Over the range of stellar types considered, we obtain nearly the same characteristic dust temperatures (∼ 190 K and ∼60 K for the inner and outer dust components, respectively)-slightly above the ice evaporation temperature for the inner belts. The warm inner dust temperature is readily explained if populations of small grains are being released by sublimation of ice from icy planetesimals. Evaporation of low-eccentricity icy bodies at ∼ 150 K can deposit particles into an inner/warm belt, where the small grains are heated to dust Temperatures of -190 K. Alternatively, enhanced collisional processing of an asteroid belt-like system of parent planetesimals just interior to the snow line may account for the observed uniformity in dust temperature. The similarity in temperature of the warmer dust across our B8-KO stellar sample strongly suggests that dust-producing planetesimals are not found at similar radial locations around all stars, but that dust production is favored at a characteristic temperature horizon.


    SciTech Connect

    Morales, Farisa Y.; Werner, M. W.; Bryden, G.; Stapelfeldt, K. R.; Rieke, G. H.; Su, K. Y. L.


    We compare the properties of warm dust emission from a sample of main-sequence A-type stars (B8-A7) to those of dust around solar-type stars (F5-K0) with similar Spitzer Space Telescope Infrared Spectrograph/MIPS data and similar ages. Both samples include stars with sources with infrared spectral energy distributions that show evidence of multiple components. Over the range of stellar types considered, we obtain nearly the same characteristic dust temperatures ({approx}190 K and {approx}60 K for the inner and outer dust components, respectively)-slightly above the ice evaporation temperature for the inner belts. The warm inner dust temperature is readily explained if populations of small grains are being released by sublimation of ice from icy planetesimals. Evaporation of low-eccentricity icy bodies at {approx}150 K can deposit particles into an inner/warm belt, where the small grains are heated to T{sub dust} {approx} 190 K. Alternatively, enhanced collisional processing of an asteroid belt-like system of parent planetesimals just interior to the snow line may account for the observed uniformity in dust temperature. The similarity in temperature of the warmer dust across our B8-K0 stellar sample strongly suggests that dust-producing planetesimals are not found at similar radial locations around all stars, but that dust production is favored at a characteristic temperature horizon.

  16. Identification of common microRNA-mRNA regulatory biomodules in human epithelial cancers

    PubMed Central

    Yang, Xinan; Lee, Younghee; Fan, Hong; Sun, Xiao; Lussier, Yves A


    The complex regulatory network between microRNAs and gene expression remains unclear domain of active research. We proposed to address in part this complex regulation with a novel approach for the genome-wide identification of biomodules derived from paired microRNA and mRNA profiles, which could reveal correlations associated with a complex network of de-regulation in human cancer. Two published expression datasets for 68 samples with 11 distinct types of epithelial cancers and 21 samples of normal tissues were used, containing microRNA expression (Lu et al. Nature Letters 2005) and gene expression (Ramaswarmy et al. PNAS 2001) profiles, respectively. As results, the microRNA expression used jointly with mRNA expression can provide better classifiers of epithelial cancers against normal epithelial tissue than either dataset alone (p=1×10-10, F-Test). We identified a combination of six microRNA-mRNA biomodules that optimally classified epithelial cancers from normal epithelial tissue (total accuracy = 93.3%; 95% confidence intervals: 86% - 97%), using penalized logistic regression (PLR) algorithm and three-fold cross-validation. Three of these biomodules are individually sufficient to cluster epithelial cancers from normal tissue using mutual information distance. The biomodules contain 10 distinct microRNAs and 98 distinct genes, including well known tumor markers such as miR-15a, miR-30e, IRAK1, TGFBR2, DUSP16, CDC25B and PDCD2. In addition, there is a significant enrichment (Fisher’s exact test p=3×10-10) between putative microRNA-target gene pairs reported in five microRNA target databases and the inversely correlated micro-RNA-mRNA pairs in the biomodules. Further, microRNAs and genes in the biomodules were found in abstracts mentioning epithelial cancers (Fisher Exact Test, unadjusted p<0.05). Taken together, these results strongly suggest that the discovered microRNA-mRNA biomodules correspond to regulatory mechanisms common to human epithelial cancer

  17. Close Sequence Comparisons are Sufficient to Identify Humancis-Regulatory Elements

    SciTech Connect

    Prabhakar, Shyam; Poulin, Francis; Shoukry, Malak; Afzal, Veena; Rubin, Edward M.; Couronne, Olivier; Pennacchio, Len A.


    Cross-species DNA sequence comparison is the primary method used to identify functional noncoding elements in human and other large genomes. However, little is known about the relative merits of evolutionarily close and distant sequence comparisons, due to the lack of a universal metric for sequence conservation, and also the paucity of empirically defined benchmark sets of cis-regulatory elements. To address this problem, we developed a general-purpose algorithm (Gumby) that detects slowly-evolving regions in primate, mammalian and more distant comparisons without requiring adjustment of parameters, and ranks conserved elements by P-value using Karlin-Altschul statistics. We benchmarked Gumby predictions against previously identified cis-regulatory elements at diverse genomic loci, and also tested numerous extremely conserved human-rodent sequences for transcriptional enhancer activity using reporter-gene assays in transgenic mice. Human regulatory elements were identified with acceptable sensitivity and specificity by comparison with 1-5 other eutherian mammals or 6 other simian primates. More distant comparisons (marsupial, avian, amphibian and fish) failed to identify many of the empirically defined functional noncoding elements. We derived an intuitive relationship between ancient and recent noncoding sequence conservation from whole genome comparative analysis, which explains some of these findings. Lastly, we determined that, in addition to strength of conservation, genomic location and/or density of surrounding conserved elements must also be considered in selecting candidate enhancers for testing at embryonic time points.

  18. Evolution in biosynthetic pathways: two enzymes catalyzing consecutive steps in methionine biosynthesis originate from a common ancestor and possess a similar regulatory region.


    Belfaiza, J; Parsot, C; Martel, A; de la Tour, C B; Margarita, D; Cohen, G N; Saint-Girons, I


    The metC gene of Escherichia coli K-12 was cloned and the nucleotide sequence of the metC gene and its flanking regions was determined. The translation initiation codon was identified by sequencing the NH2-terminal part of beta-cystathionase, the MetC gene product. The metC gene (1185 nucleotides) encodes a protein having 395 amino acid residues. The 5' noncoding region was found to contain a "Met box" homologous to sequences suggestive of operator structures upstream from other methionine genes that are controlled by the product of the pleiotropic regulatory metJ gene. The deduced amino acid sequence of beta-cystathionase showed extensive homology with that of the MetB protein (cystathionine gamma-synthase) that catalyzes the preceding step in methionine biosynthesis. The homology strongly suggests that the structural genes for the MetB and MetC proteins evolved from a common ancestral gene.

  19. Anti-Sigma Factors in E. coli: Common Regulatory Mechanisms Controlling Sigma Factors Availability

    PubMed Central

    Treviño-Quintanilla, Luis Gerardo; Freyre-González, Julio Augusto; Martínez-Flores, Irma


    In bacteria, transcriptional regulation is a key step in cellular gene expression. All bacteria contain a core RNA polymerase that is catalytically competent but requires an additional σ factor for specific promoter recognition and correct transcriptional initiation. The RNAP core is not able to selectively bind to a given σ factor. In contrast, different σ factors have different affinities for the RNAP core. As a consequence, the concentration of alternate σ factors requires strict regulation in order to properly control the delicate interplay among them, which favors the competence for the RNAP core. This control is archived by different σ/anti-σ controlling mechanisms that shape complex regulatory networks and cascades, and enable the response to sudden environmental cues, whose global understanding is a current challenge for systems biology. Although there have been a number of excellent studies on each of these σ/anti-σ post-transcriptional regulatory systems, no comprehensive comparison of these mechanisms in a single model organism has been conducted. Here, we survey all these systems in E. coli dissecting and analyzing their inner workings and highlightin their differences. Then, following an integral approach, we identify their commonalities and outline some of the principles exploited by the cell to effectively and globally reprogram the transcriptional machinery. These principles provide guidelines for developing biological synthetic circuits enabling an efficient and robust response to sudden stimuli. PMID:24396271

  20. Anti-Sigma Factors in E. coli: Common Regulatory Mechanisms Controlling Sigma Factors Availability.


    Treviño-Quintanilla, Luis Gerardo; Freyre-González, Julio Augusto; Martínez-Flores, Irma


    In bacteria, transcriptional regulation is a key step in cellular gene expression. All bacteria contain a core RNA polymerase that is catalytically competent but requires an additional σ factor for specific promoter recognition and correct transcriptional initiation. The RNAP core is not able to selectively bind to a given σ factor. In contrast, different σ factors have different affinities for the RNAP core. As a consequence, the concentration of alternate σ factors requires strict regulation in order to properly control the delicate interplay among them, which favors the competence for the RNAP core. This control is archived by different σ/anti-σ controlling mechanisms that shape complex regulatory networks and cascades, and enable the response to sudden environmental cues, whose global understanding is a current challenge for systems biology. Although there have been a number of excellent studies on each of these σ/anti-σ post-transcriptional regulatory systems, no comprehensive comparison of these mechanisms in a single model organism has been conducted. Here, we survey all these systems in E. coli dissecting and analyzing their inner workings and highlightin their differences. Then, following an integral approach, we identify their commonalities and outline some of the principles exploited by the cell to effectively and globally reprogram the transcriptional machinery. These principles provide guidelines for developing biological synthetic circuits enabling an efficient and robust response to sudden stimuli.

  1. Comparative analysis identifies exonic splicing regulatory sequences--The complex definition of enhancers and silencers.


    Goren, Amir; Ram, Oren; Amit, Maayan; Keren, Hadas; Lev-Maor, Galit; Vig, Ida; Pupko, Tal; Ast, Gil


    Exonic splicing regulatory sequences (ESRs) are cis-acting factor binding sites that regulate constitutive and alternative splicing. A computational method based on the conservation level of wobble positions and the overabundance of sequence motifs between 46,103 human and mouse orthologous exons was developed, identifying 285 putative ESRs. Alternatively spliced exons that are either short in length or contain weak splice sites show the highest conservation level of those ESRs, especially toward the edges of exons. ESRs that are abundant in those subgroups show a different distribution between constitutively and alternatively spliced exons. Representatives of these ESRs and two SR protein binding sites were shown, experimentally, to display variable regulatory effects on alternative splicing, depending on their relative locations in the exon. This finding signifies the delicate positional effect of ESRs on alternative splicing regulation.

  2. Partitioning heritability of regulatory and cell-type-specific variants across 11 common diseases.


    Gusev, Alexander; Lee, S Hong; Trynka, Gosia; Finucane, Hilary; Vilhjálmsson, Bjarni J; Xu, Han; Zang, Chongzhi; Ripke, Stephan; Bulik-Sullivan, Brendan; Stahl, Eli; Kähler, Anna K; Hultman, Christina M; Purcell, Shaun M; McCarroll, Steven A; Daly, Mark; Pasaniuc, Bogdan; Sullivan, Patrick F; Neale, Benjamin M; Wray, Naomi R; Raychaudhuri, Soumya; Price, Alkes L


    Regulatory and coding variants are known to be enriched with associations identified by genome-wide association studies (GWASs) of complex disease, but their contributions to trait heritability are currently unknown. We applied variance-component methods to imputed genotype data for 11 common diseases to partition the heritability explained by genotyped SNPs (hg(2)) across functional categories (while accounting for shared variance due to linkage disequilibrium). Extensive simulations showed that in contrast to current estimates from GWAS summary statistics, the variance-component approach partitions heritability accurately under a wide range of complex-disease architectures. Across the 11 diseases DNaseI hypersensitivity sites (DHSs) from 217 cell types spanned 16% of imputed SNPs (and 24% of genotyped SNPs) but explained an average of 79% (SE = 8%) of hg(2) from imputed SNPs (5.1× enrichment; p = 3.7 × 10(-17)) and 38% (SE = 4%) of hg(2) from genotyped SNPs (1.6× enrichment, p = 1.0 × 10(-4)). Further enrichment was observed at enhancer DHSs and cell-type-specific DHSs. In contrast, coding variants, which span 1% of the genome, explained <10% of hg(2) despite having the highest enrichment. We replicated these findings but found no significant contribution from rare coding variants in independent schizophrenia cohorts genotyped on GWAS and exome chips. Our results highlight the value of analyzing components of heritability to unravel the functional architecture of common disease.

  3. Partitioning Heritability of Regulatory and Cell-Type-Specific Variants across 11 Common Diseases

    PubMed Central

    Gusev, Alexander; Lee, S. Hong; Trynka, Gosia; Finucane, Hilary; Vilhjálmsson, Bjarni J.; Xu, Han; Zang, Chongzhi; Ripke, Stephan; Bulik-Sullivan, Brendan; Stahl, Eli; Ripke, Stephan; Neale, Benjamin M.; Corvin, Aiden; Walters, James T.R.; Farh, Kai-How; Holmans, Peter A.; Lee, Phil; Bulik-Sullivan, Brendan; Collier, David A.; Huang, Hailiang; Pers, Tune H.; Agartz, Ingrid; Agerbo, Esben; Albus, Margot; Alexander, Madeline; Amin, Farooq; Bacanu, Silviu A.; Begemann, Martin; Belliveau, Richard A.; Bene, Judit; Bergen, Sarah E.; Bevilacqua, Elizabeth; Bigdeli, Tim B.; Black, Donald W.; Børglum, Anders D.; Bruggeman, Richard; Buccola, Nancy G.; Buckner, Randy L.; Byerley, William; Cahn, Wiepke; Cai, Guiqing; Campion, Dominique; Cantor, Rita M.; Carr, Vaughan J.; Carrera, Noa; Catts, Stanley V.; Chambert, Kimberly D.; Chan, Raymond C.K.; Chen, Ronald Y.L.; Chen, Eric Y.H.; Cheng, Wei; Cheung, Eric F.C.; Chong, Siow Ann; Cloninger, C. Robert; Cohen, David; Cohen, Nadine; Cormican, Paul; Craddock, Nick; Crowley, James J.; Curtis, David; Davidson, Michael; Davis, Kenneth L.; Degenhardt, Franziska; Del Favero, Jurgen; DeLisi, Lynn E.; Demontis, Ditte; Dikeos, Dimitris; Dinan, Timothy; Djurovic, Srdjan; Donohoe, Gary; Drapeau, Elodie; Duan, Jubao; Dudbridge, Frank; Durmishi, Naser; Eichhammer, Peter; Eriksson, Johan; Escott-Price, Valentina; Essioux, Laurent; Fanous, Ayman H.; Farrell, Martilias S.; Frank, Josef; Franke, Lude; Freedman, Robert; Freimer, Nelson B.; Friedl, Marion; Friedman, Joseph I.; Fromer, Menachem; Genovese, Giulio; Georgieva, Lyudmila; Gershon, Elliot S.; Giegling, Ina; Giusti-Rodrguez, Paola; Godard, Stephanie; Goldstein, Jacqueline I.; Golimbet, Vera; Gopal, Srihari; Gratten, Jacob; Grove, Jakob; de Haan, Lieuwe; Hammer, Christian; Hamshere, Marian L.; Hansen, Mark; Hansen, Thomas; Haroutunian, Vahram; Hartmann, Annette M.; Henskens, Frans A.; Herms, Stefan; Hirschhorn, Joel N.; Hoffmann, Per; Hofman, Andrea; Hollegaard, Mads V.; Hougaard, David M.; Ikeda, Masashi; Joa, Inge; Julià, Antonio; Kahn, René S.; Kalaydjieva, Luba; Karachanak-Yankova, Sena; Karjalainen, Juha; Kavanagh, David; Keller, Matthew C.; Kelly, Brian J.; Kennedy, James L.; Khrunin, Andrey; Kim, Yunjung; Klovins, Janis; Knowles, James A.; Konte, Bettina; Kucinskas, Vaidutis; Kucinskiene, Zita Ausrele; Kuzelova-Ptackova, Hana; Kähler, Anna K.; Laurent, Claudine; Keong, Jimmy Lee Chee; Lee, S. Hong; Legge, Sophie E.; Lerer, Bernard; Li, Miaoxin; Li, Tao; Liang, Kung-Yee; Lieberman, Jeffrey; Limborska, Svetlana; Loughland, Carmel M.; Lubinski, Jan; Lnnqvist, Jouko; Macek, Milan; Magnusson, Patrik K.E.; Maher, Brion S.; Maier, Wolfgang; Mallet, Jacques; Marsal, Sara; Mattheisen, Manuel; Mattingsdal, Morten; McCarley, Robert W.; McDonald, Colm; McIntosh, Andrew M.; Meier, Sandra; Meijer, Carin J.; Melegh, Bela; Melle, Ingrid; Mesholam-Gately, Raquelle I.; Metspalu, Andres; Michie, Patricia T.; Milani, Lili; Milanova, Vihra; Mokrab, Younes; Morris, Derek W.; Mors, Ole; Mortensen, Preben B.; Murphy, Kieran C.; Murray, Robin M.; Myin-Germeys, Inez; Mller-Myhsok, Bertram; Nelis, Mari; Nenadic, Igor; Nertney, Deborah A.; Nestadt, Gerald; Nicodemus, Kristin K.; Nikitina-Zake, Liene; Nisenbaum, Laura; Nordin, Annelie; O’Callaghan, Eadbhard; O’Dushlaine, Colm; O’Neill, F. Anthony; Oh, Sang-Yun; Olincy, Ann; Olsen, Line; Van Os, Jim; Pantelis, Christos; Papadimitriou, George N.; Papiol, Sergi; Parkhomenko, Elena; Pato, Michele T.; Paunio, Tiina; Pejovic-Milovancevic, Milica; Perkins, Diana O.; Pietilinen, Olli; Pimm, Jonathan; Pocklington, Andrew J.; Powell, John; Price, Alkes; Pulver, Ann E.; Purcell, Shaun M.; Quested, Digby; Rasmussen, Henrik B.; Reichenberg, Abraham; Reimers, Mark A.; Richards, Alexander L.; Roffman, Joshua L.; Roussos, Panos; Ruderfer, Douglas M.; Salomaa, Veikko; Sanders, Alan R.; Schall, Ulrich; Schubert, Christian R.; Schulze, Thomas G.; Schwab, Sibylle G.; Scolnick, Edward M.; Scott, Rodney J.; Seidman, Larry J.; Shi, Jianxin; Sigurdsson, Engilbert; Silagadze, Teimuraz; Silverman, Jeremy M.; Sim, Kang; Slominsky, Petr; Smoller, Jordan W.; So, Hon-Cheong; Spencer, Chris C.A.; Stahl, Eli A.; Stefansson, Hreinn; Steinberg, Stacy; Stogmann, Elisabeth; Straub, Richard E.; Strengman, Eric; Strohmaier, Jana; Stroup, T. Scott; Subramaniam, Mythily; Suvisaari, Jaana; Svrakic, Dragan M.; Szatkiewicz, Jin P.; Sderman, Erik; Thirumalai, Srinivas; Toncheva, Draga; Tooney, Paul A.; Tosato, Sarah; Veijola, Juha; Waddington, John; Walsh, Dermot; Wang, Dai; Wang, Qiang; Webb, Bradley T.; Weiser, Mark; Wildenauer, Dieter B.; Williams, Nigel M.; Williams, Stephanie; Witt, Stephanie H.; Wolen, Aaron R.; Wong, Emily H.M.; Wormley, Brandon K.; Wu, Jing Qin; Xi, Hualin Simon; Zai, Clement C.; Zheng, Xuebin; Zimprich, Fritz; Wray, Naomi R.; Stefansson, Kari; Visscher, Peter M.; Adolfsson, Rolf; Andreassen, Ole A.; Blackwood, Douglas H.R.; Bramon, Elvira; Buxbaum, Joseph D.; Brglum, Anders D.; Cichon, Sven; Darvasi, Ariel; Domenici, Enrico; Ehrenreich, Hannelore; Esko, Tõnu; Gejman, Pablo V.; Gill, Michael; Gurling, Hugh; Hultman, Christina M.; Iwata, Nakao; Jablensky, Assen V.; Jönsson, Erik G.; Kendler, Kenneth S.; Kirov, George; Knight, Jo; Lencz, Todd; Levinson, Douglas F.; Li, Qingqin S.; Liu, Jianjun; Malhotra, Anil K.; McCarroll, Steven A.; McQuillin, Andrew; Moran, Jennifer L.; Mortensen, Preben B.; Mowry, Bryan J.; Nthen, Markus M.; Ophoff, Roel A.; Owen, Michael J.; Palotie, Aarno; Pato, Carlos N.; Petryshen, Tracey L.; Posthuma, Danielle; Rietschel, Marcella; Riley, Brien P.; Rujescu, Dan; Sham, Pak C.; Sklar, Pamela; St. Clair, David; Weinberger, Daniel R.; Wendland, Jens R.; Werge, Thomas; Daly, Mark J.; Sullivan, Patrick F.; O’Donovan, Michael C.; Ripke, Stephan; O’Dushlaine, Colm; Chambert, Kimberly; Moran, Jennifer L.; Kähler, Anna K.; Akterin, Susanne; Bergen, Sarah; Magnusson, Patrik K.E.; Neale, Benjamin M.; Ruderfer, Douglas; Scolnick, Edward; Purcell, Shaun; McCarroll, Steve; Sklar, Pamela; Hultman, Christina M.; Sullivan, Patrick F.; Kähler, Anna K.; Hultman, Christina M.; Purcell, Shaun M.; McCarroll, Steven A.; Daly, Mark; Pasaniuc, Bogdan; Sullivan, Patrick F.; Neale, Benjamin M.; Wray, Naomi R.; Raychaudhuri, Soumya; Price, Alkes L.


    Regulatory and coding variants are known to be enriched with associations identified by genome-wide association studies (GWASs) of complex disease, but their contributions to trait heritability are currently unknown. We applied variance-component methods to imputed genotype data for 11 common diseases to partition the heritability explained by genotyped SNPs (hg2) across functional categories (while accounting for shared variance due to linkage disequilibrium). Extensive simulations showed that in contrast to current estimates from GWAS summary statistics, the variance-component approach partitions heritability accurately under a wide range of complex-disease architectures. Across the 11 diseases DNaseI hypersensitivity sites (DHSs) from 217 cell types spanned 16% of imputed SNPs (and 24% of genotyped SNPs) but explained an average of 79% (SE = 8%) of hg2 from imputed SNPs (5.1× enrichment; p = 3.7 × 10−17) and 38% (SE = 4%) of hg2 from genotyped SNPs (1.6× enrichment, p = 1.0 × 10−4). Further enrichment was observed at enhancer DHSs and cell-type-specific DHSs. In contrast, coding variants, which span 1% of the genome, explained <10% of hg2 despite having the highest enrichment. We replicated these findings but found no significant contribution from rare coding variants in independent schizophrenia cohorts genotyped on GWAS and exome chips. Our results highlight the value of analyzing components of heritability to unravel the functional architecture of common disease. PMID:25439723

  4. Variation in sequence and organization of splicing regulatory elements in vertebrate genes

    PubMed Central

    Yeo, Gene; Hoon, Shawn; Venkatesh, Byrappa; Burge, Christopher B.


    Although core mechanisms and machinery of premRNA splicing are conserved from yeast to human, the details of intron recognition often differ, even between closely related organisms. For example, genes from the pufferfish Fugu rubripes generally contain one or more introns that are not properly spliced in mouse cells. Exploiting available genome sequence data, a battery of sequence analysis techniques was used to reach several conclusions about the organization and evolution of splicing regulatory elements in vertebrate genes. The classical splice site and putative branch site signals are completely conserved across the vertebrates studied (human, mouse, pufferfish, and zebrafish), and exonic splicing enhancers also appear broadly conserved in vertebrates. However, another class of splicing regulatory elements, the intronic splicing enhancers, appears to differ substantially between mammals and fish, with G triples (GGG) very abundant in mammalian introns but comparatively rare in fish. Conversely, short repeats of AC and GT are predicted to function as intronic splicing enhancers in fish but are not enriched in mammalian introns. Consistent with this pattern, exonic splicing enhancer-binding SR proteins are highly conserved across all vertebrates, whereas heterogeneous nuclear ribonucleoproteins, which bind many intronic sequences, vary in domain structure and even presence/absence between mammals and fish. Exploiting differences in intronic sequence composition, a statistical model was developed to predict the splicing phenotype of Fugu introns in mammalian systems and was used to engineer the spliceability of a Fugu intron in human cells by insertion of specific sequences, thereby rescuing splicing in human cells. PMID:15505203

  5. High sequence turnover in the regulatory regions of the developmental gene hunchback in insects.


    Hancock, J M; Shaw, P J; Bonneton, F; Dover, G A


    Extensive sequence analysis of the developmental gene hunchback and its 5' and 3' regulatory regions in Drosophila melanogaster, Drosophila virilis, Musca domestica, and Tribolium castaneum, using a variety of computer algorithms, reveals regions of high sequence simplicity probably generated by slippage-like mechanisms of turnover. No regions are entirely refractory to the action of slippage, although the density and composition of simple sequence motifs varies from region to region. Interestingly, the 5' and 3' flanking regions share short repetitive motifs despite their separation by the gene itself, and the motifs are different in composition from those in the exons and introns. Furthermore, there are high levels of conservation of motifs in equivalent orthologous regions. Detailed sequence analysis of the P2 promoter and DNA footprinting assays reveal that the number, orientation, sequence, spacing, and protein-binding affinities of the BICOID-binding sites varies between species and that the 'P2' promoter, the nanos response element in the 3' untranslated region, and several conserved boxes of sequence in the gene (e.g., the two zinc-finger regions) are surrounded by cryptically-simple-sequence DNA. We argue that high sequence turnover and genetic redundancy permit both the general maintenance of promoter functions through the establishment of coevolutionary (compensatory) changes in cis- and trans-acting genetic elements and, at the same time, the possibility of subtle changes in the regulation of hunchback in the different species.

  6. Time Delayed Causal Gene Regulatory Network Inference with Hidden Common Causes.


    Lo, Leung-Yau; Wong, Man-Leung; Lee, Kin-Hong; Leung, Kwong-Sak


    Inferring the gene regulatory network (GRN) is crucial to understanding the working of the cell. Many computational methods attempt to infer the GRN from time series expression data, instead of through expensive and time-consuming experiments. However, existing methods make the convenient but unrealistic assumption of causal sufficiency, i.e. all the relevant factors in the causal network have been observed and there are no unobserved common cause. In principle, in the real world, it is impossible to be certain that all relevant factors or common causes have been observed, because some factors may not have been conceived of, and therefore are impossible to measure. In view of this, we have developed a novel algorithm named HCC-CLINDE to infer an GRN from time series data allowing the presence of hidden common cause(s). We assume there is a sparse causal graph (possibly with cycles) of interest, where the variables are continuous and each causal link has a delay (possibly more than one time step). A small but unknown number of variables are not observed. Each unobserved variable has only observed variables as children and parents, with at least two children, and the children are not linked to each other. Since it is difficult to obtain very long time series, our algorithm is also capable of utilizing multiple short time series, which is more realistic. To our knowledge, our algorithm is far less restrictive than previous works. We have performed extensive experiments using synthetic data on GRNs of size up to 100, with up to 10 hidden nodes. The results show that our algorithm can adequately recover the true causal GRN and is robust to slight deviation from Gaussian distribution in the error terms. We have also demonstrated the potential of our algorithm on small YEASTRACT subnetworks using limited real data.

  7. Time Delayed Causal Gene Regulatory Network Inference with Hidden Common Causes

    PubMed Central

    Lo, Leung-Yau; Wong, Man-Leung; Lee, Kin-Hong; Leung, Kwong-Sak


    Inferring the gene regulatory network (GRN) is crucial to understanding the working of the cell. Many computational methods attempt to infer the GRN from time series expression data, instead of through expensive and time-consuming experiments. However, existing methods make the convenient but unrealistic assumption of causal sufficiency, i.e. all the relevant factors in the causal network have been observed and there are no unobserved common cause. In principle, in the real world, it is impossible to be certain that all relevant factors or common causes have been observed, because some factors may not have been conceived of, and therefore are impossible to measure. In view of this, we have developed a novel algorithm named HCC-CLINDE to infer an GRN from time series data allowing the presence of hidden common cause(s). We assume there is a sparse causal graph (possibly with cycles) of interest, where the variables are continuous and each causal link has a delay (possibly more than one time step). A small but unknown number of variables are not observed. Each unobserved variable has only observed variables as children and parents, with at least two children, and the children are not linked to each other. Since it is difficult to obtain very long time series, our algorithm is also capable of utilizing multiple short time series, which is more realistic. To our knowledge, our algorithm is far less restrictive than previous works. We have performed extensive experiments using synthetic data on GRNs of size up to 100, with up to 10 hidden nodes. The results show that our algorithm can adequately recover the true causal GRN and is robust to slight deviation from Gaussian distribution in the error terms. We have also demonstrated the potential of our algorithm on small YEASTRACT subnetworks using limited real data. PMID:26394325

  8. Organization of the lexA gene of Escherichia coli and nucleotide sequence of the regulatory region.

    PubMed Central

    Miki, T; Ebina, Y; Kishi, F; Nakazawa, A


    The product of the lexA gene of Escherichia coli has been shown to regulate expression of the several cellular functions (SOS functions) induced by treatments which abruptly inhibit DNA synthesis. We have cloned and mapped the lexA gene on a small segment of approximately 600 base pairs. The lexA promotor was located by transcription R-loop analysis, and the lexA product of 22,000 daltons was identified by protein synthesis in vitro. An unknown gene was found which directed the synthesis of a protein of 35,000 daltons in a region downstream from the lexA gene. Nucleotide sequence of the regulatory region of the lexA gene was determined. The sequence contained inverted repeats homologous to that of the recA regulatory region. These inverted repeats may be recognized by the lexA protein, because the protein is considered to repress both the genes as a common repressor. Images PMID:6261224

  9. Identification of the regulatory sequence of anaerobically expressed locus aeg-46.5.

    PubMed Central

    Choe, M; Reznikoff, W S


    A newly identified anaerobically expressed locus, aeg-46.5, which is located at min 46.5 on Escherichia coli linkage map, was cloned and analyzed. The phenotype of this gene was studied by using a lacZ operon fusion. aeg-46.5 is induced anaerobically in the presence of nitrate in wild-type and narL cells. It is repressed by the narL gene product, as it showed derepressed anaerobic expression in narL mutant cells. We postulate that aeg-46.5 is subject to multiple regulatory systems, activation as a result of anaerobiosis, narL-independent nitrate-dependent activation, and narL-mediated repression. The regulatory region of aeg-46.5 was identified. A 304-bp DNA sequence which includes the regulatory elements was obtained, and the 5' end of aeg-46.5 mRNA was identified. It was verified that the anaerobic regulation of aeg-46.5 expression is controlled on the transcriptional level. Computer analysis predicted possible control sites for the NarL and FNR proteins. The proposed NarL site was found in a perfect-symmetry element. The aeg-46.5 regulatory elements are adjacent to, but divergent from, those of the eco gene. Images PMID:8432709

  10. Analysis of common k-mers for whole genome sequences using SSB-tree.


    Choi, Jeong-Hyeon; Cho, Hwan-Gue


    As sequenced genomes become larger and sequencing process becomes faster, there is a need to develop a tool to analyze sequences in the whole genomic scale. However, on-memory algorithms such as suffix tree and suffix array are not applicable to the analysis of whole genome sequence set, since the size of individual whole genome ranges from several million base pairs to hundreds billion base pairs. In order to effectively manipulate the huge sequence data, it is necessary to use the indexed data structure for external memory. In this paper, we introduce a workbench called SequeX for the analysis and visualization of whole genome sequences using SSB-tree (Static SB-tree). It consists of two parts: the analysis query subsystem and the visualization subsystem. The query subsystem supports various transactions such as pattern matching, k-occurrence, and k-mer analysis. The visualization subsystem helps biologists to easily understand whole genome structure and feature by sequence viewer, annotation viewer, CGR (Chaos Game Representation) viewer, and k-mer viewer. The system also supports a user-friendly programming interface based on Java script for batch processing and the extension for a specific purpose of a user. SequeX can be used to identify conserved genes or sequences by the analysis of the common k-mers and annotation. We analyze the common k-mer for 72 microbial genomes announced by Entrez, and find an interesting biological fact that the longest common k-mer for 72 sequences is 11-mer, and only 11 such sequences exist. Finally we note that many common k-mers occur in conserved region such as CDS, rRNA, and tRNA.

  11. Two lamprey Hedgehog genes share non-coding regulatory sequences and expression patterns with gnathostome Hedgehogs.


    Kano, Shungo; Xiao, Jin-Hua; Osório, Joana; Ekker, Marc; Hadzhiev, Yavor; Müller, Ferenc; Casane, Didier; Magdelenat, Ghislaine; Rétaux, Sylvie


    Hedgehog (Hh) genes play major roles in animal development and studies of their evolution, expression and function point to major differences among chordates. Here we focused on Hh genes in lampreys in order to characterize the evolution of Hh signalling at the emergence of vertebrates. Screening of a cosmid library of the river lamprey Lampetra fluviatilis and searching the preliminary genome assembly of the sea lamprey Petromyzon marinus indicate that lampreys have two Hh genes, named Hha and Hhb. Phylogenetic analyses suggest that Hha and Hhb are lamprey-specific paralogs closely related to Sonic/Indian Hh genes. Expression analysis indicates that Hha and Hhb are expressed in a Sonic Hh-like pattern. The two transcripts are expressed in largely overlapping but not identical domains in the lamprey embryonic brain, including a newly-described expression domain in the nasohypophyseal placode. Global alignments of genomic sequences and local alignment with known gnathostome regulatory motifs show that lamprey Hhs share conserved non-coding elements (CNE) with gnathostome Hhs albeit with sequences that have significantly diverged and dispersed. Functional assays using zebrafish embryos demonstrate gnathostome-like midline enhancer activity for CNEs contained in intron2. We conclude that lamprey Hh genes are gnathostome Shh-like in terms of expression and regulation. In addition, they show some lamprey-specific features, including duplication and structural (but not functional) changes in the intronic/regulatory sequences.

  12. Genome Sequencing of Autism-Affected Families Reveals Disruption of Putative Noncoding Regulatory DNA

    PubMed Central

    Turner, Tychele N.; Hormozdiari, Fereydoun; Duyzend, Michael H.; McClymont, Sarah A.; Hook, Paul W.; Iossifov, Ivan; Raja, Archana; Baker, Carl; Hoekzema, Kendra; Stessman, Holly A.; Zody, Michael C.; Nelson, Bradley J.; Huddleston, John; Sandstrom, Richard; Smith, Joshua D.; Hanna, David; Swanson, James M.; Faustman, Elaine M.; Bamshad, Michael J.; Stamatoyannopoulos, John; Nickerson, Deborah A.; McCallion, Andrew S.; Darnell, Robert; Eichler, Evan E.


    We performed whole-genome sequencing (WGS) of 208 genomes from 53 families affected by simplex autism. For the majority of these families, no copy-number variant (CNV) or candidate de novo gene-disruptive single-nucleotide variant (SNV) had been detected by microarray or whole-exome sequencing (WES). We integrated multiple CNV and SNV analyses and extensive experimental validation to identify additional candidate mutations in eight families. We report that compared to control individuals, probands showed a significant (p = 0.03) enrichment of de novo and private disruptive mutations within fetal CNS DNase I hypersensitive sites (i.e., putative regulatory regions). This effect was only observed within 50 kb of genes that have been previously associated with autism risk, including genes where dosage sensitivity has already been established by recurrent disruptive de novo protein-coding mutations (ARID1B, SCN2A, NR3C2, PRKCA, and DSCAM). In addition, we provide evidence of gene-disruptive CNVs (in DISC1, WNT7A, RBFOX1, and MBD5), as well as smaller de novo CNVs and exon-specific SNVs missed by exome sequencing in neurodevelopmental genes (e.g., CANX, SAE1, and PIK3CA). Our results suggest that the detection of smaller, often multiple CNVs affecting putative regulatory elements might help explain additional risk of simplex autism. PMID:26749308

  13. Phylogenetic Relationships and the Evolution of Regulatory Gene Sequences in the Parrotfishes

    PubMed Central

    Smith, Lydia L.; Fessler, Jennifer L.; Alfaro, Michael E.; Streelman, J. Todd; Westneat, Mark W.


    Regulatory genes control the expression of other genes and are key components of developmental processes such as segmentation and embryonic construction of the skull in vertebrates. Here we examine the variability and evolution of three vertebrate regulatory genes, addressing issues of their utility for phylogenetics and comparing the rates of genetic change seen in regulatory loci to the rates seen in other genes in the parrotfishes. The parrotfishes are a diverse group of colorful fishes from coral reefs and seagrasses worldwide and have been placed phylogenetically within the family Labridae. We tested phylogenetic hypotheses among the parrotfishes, with a focus on the genera Chlorurus and Scarus, by analyzing eight gene fragments for 42 parrotfishes and eight outgroup species. We sequenced mitochondrial 12s rRNA (967 bp), 16s rRNA (577 bp), and cytochrome b (477 bp). From the nuclear genome, we sequenced part of the protein-coding genes rag2 (715 bp), tmo4c4 (485 bp), and the developmental regulatory genes otx1 (672 bp), bmp4 (488 bp), and dlx2 (522 bp). Bayesian, likelihood, and parsimony analyses on the resulting 4903 bp of DNA sequence produced similar topologies that confirm the monophyly of the scarines and provide a phylogeny at the species level for portions of the genera Scarus and Chlorurus. Four major clades of Scarus were recovered, with three distributed in the Indo-Pacific and one containing Caribbean/Atlantic taxa. Molecular rates suggest a Miocene origin of the parrotfishes (22 mya) and a recent divergence of species within Scarus and Chlorurus, within the past 5 million years. Developmentally important genes made a significant contribution to phylogenetic structure, and rates of genetic evolution were high in bmp4, similar to other coding nuclear genes, but low in otx1 and the dlx2 exons. Synonymous and nonsynonymous substitution patterns in developmental regulatory genes support the hypothesis of stabilizing selection during the history of

  14. Exploring the reasons for the large density of triplex-forming oligonucleotide target sequences in the human regulatory regions

    PubMed Central

    Goñi, Josep Ramon; Vaquerizas, Juan Manuel; Dopazo, Joaquin; Orozco, Modesto


    Background DNA duplex sequences that can be targets for triplex formation are highly over-represented in the human genome, especially in regulatory regions. Results Here we studied using bioinformatics tools several properties of triplex target sequences in an attempt to determine those that make these sequences so special in the genome. Conclusion Our results strongly suggest that the unique physical properties of these sequences make them particularly suitable as "separators" between protein-recognition sites in the promoter region. PMID:16566817

  15. Improved K-means clustering algorithm for exploring local protein sequence motifs representing common structural property.


    Zhong, Wei; Altun, Gulsah; Harrison, Robert; Tai, Phang C; Pan, Yi


    Information about local protein sequence motifs is very important to the analysis of biologically significant conserved regions of protein sequences. These conserved regions can potentially determine the diverse conformation and activities of proteins. In this work, recurring sequence motifs of proteins are explored with an improved K-means clustering algorithm on a new dataset. The structural similarity of these recurring sequence clusters to produce sequence motifs is studied in order to evaluate the relationship between sequence motifs and their structures. To the best of our knowledge, the dataset used by our research is the most updated dataset among similar studies for sequence motifs. A new greedy initialization method for the K-means algorithm is proposed to improve traditional K-means clustering techniques. The new initialization method tries to choose suitable initial points, which are well separated and have the potential to form high-quality clusters. Our experiments indicate that the improved K-means algorithm satisfactorily increases the percentage of sequence segments belonging to clusters with high structural similarity. Careful comparison of sequence motifs obtained by the improved and traditional algorithms also suggests that the improved K-means clustering algorithm may discover some relatively weak and subtle sequence motifs, which are undetectable by the traditional K-means algorithms. Many biochemical tests reported in the literature show that these sequence motifs are biologically meaningful. Experimental results also indicate that the improved K-means algorithm generates more detailed sequence motifs representing common structures than previous research. Furthermore, these motifs are universally conserved sequence patterns across protein families, overcoming some weak points of other popular sequence motifs. The satisfactory result of the experiment suggests that this new K-means algorithm may be applied to other areas of bioinformatics

  16. Rapid evolution of cis-regulatory sequences via local point mutations

    NASA Technical Reports Server (NTRS)

    Stone, J. R.; Wray, G. A.


    Although the evolution of protein-coding sequences within genomes is well understood, the same cannot be said of the cis-regulatory regions that control transcription. Yet, changes in gene expression are likely to constitute an important component of phenotypic evolution. We simulated the evolution of new transcription factor binding sites via local point mutations. The results indicate that new binding sites appear and become fixed within populations on microevolutionary timescales under an assumption of neutral evolution. Even combinations of two new binding sites evolve very quickly. We predict that local point mutations continually generate considerable genetic variation that is capable of altering gene expression.

  17. IL-10-Producing Regulatory B Cells Are Decreased in Patients with Common Variable Immunodeficiency

    PubMed Central

    Costa, Priscilla Ramos; Barros, Myrthes Toledo; Kalil, Jorge; Kokron, Cristina Maria


    Common variable immunodeficiency (CVID) is the most prevalent symptomatic primary immunodeficiency in adults. CVID patients often present changes in the frequency and function of B lymphocytes, reduced number of Treg cells, chronic immune activation, recurrent infections, high incidence of autoimmunity and increased risk for malignancies. We hypothesized that the frequency of B10 cells would be diminished in CVID patients because these cells play an important role in the development of Treg cells and in the control of T cell activation and autoimmunity. Therefore, we evaluated the frequency of B10 cells in CVID patients and correlated it with different clinical and immunological characteristics of this disease. Forty-two CVID patients and 17 healthy controls were recruited for this study. Cryopreserved PBMCs were used for analysis of T cell activation, frequency of Treg cells and characterization of B10 cells by flow cytometry. IL-10 production by sorted B cells culture and plasma sCD14 were determined by ELISA. We found that CVID patients presented decreased frequency of IL-10-producing CD24hiCD38hi B cells in different cell culture conditions and decreased frequency of IL-10-producing CD24hiCD27+ B cells stimulated with CpG+PIB. Moreover, we found that CVID patients presented lower secretion of IL-10 by sorting-purified B cells when compared to healthy controls. The frequency of B10 cells had no correlation with autoimmunity, immune activation and Treg cells in CVID patients. This work suggests that CVID patients have a compromised regulatory B cell compartment which is not correlated with clinical and immunological characteristics presented by these individuals. PMID:26991898

  18. Resequencing of the common marmoset genome improves genome assemblies and gene-coding sequence analysis.


    Sato, Kengo; Kuroki, Yoko; Kumita, Wakako; Fujiyama, Asao; Toyoda, Atsushi; Kawai, Jun; Iriki, Atsushi; Sasaki, Erika; Okano, Hideyuki; Sakakibara, Yasubumi


    The first draft of the common marmoset (Callithrix jacchus) genome was published by the Marmoset Genome Sequencing and Analysis Consortium. The draft was based on whole-genome shotgun sequencing, and the current assembly version is Callithrix_jacches-3.2.1, but there still exist 187,214 undetermined gap regions and supercontigs and relatively short contigs that are unmapped to chromosomes in the draft genome. We performed resequencing and assembly of the genome of common marmoset by deep sequencing with high-throughput sequencing technology. Several different sequence runs using Illumina sequencing platforms were executed, and 181 Gbp of high-quality bases including mate-pairs with long insert lengths of 3, 8, 20, and 40 Kbp were obtained, that is, approximately 60× coverage. The resequencing significantly improved the MGSAC draft genome sequence. The N50 of the contigs, which is a statistical measure used to evaluate assembly quality, doubled. As a result, 51% of the contigs (total length: 299 Mbp) that were unmapped to chromosomes in the MGSAC draft were merged with chromosomal contigs, and the improved genome sequence helped to detect 5,288 new genes that are homologous to human cDNAs and the gaps in 5,187 transcripts of the Ensembl gene annotations were completely filled.

  19. Whole-genome sequencing to understand the genetic architecture of common gene expression and biomarker phenotypes.


    Wood, Andrew R; Tuke, Marcus A; Nalls, Mike; Hernandez, Dena; Gibbs, J Raphael; Lin, Haoxiang; Xu, Christopher S; Li, Qibin; Shen, Juan; Jun, Goo; Almeida, Marcio; Tanaka, Toshiko; Perry, John R B; Gaulton, Kyle; Rivas, Manny; Pearson, Richard; Curran, Joanne E; Johnson, Matthew P; Göring, Harald H H; Duggirala, Ravindranath; Blangero, John; Mccarthy, Mark I; Bandinelli, Stefania; Murray, Anna; Weedon, Michael N; Singleton, Andrew; Melzer, David; Ferrucci, Luigi; Frayling, Timothy M


    Initial results from sequencing studies suggest that there are relatively few low-frequency (<5%) variants associated with large effects on common phenotypes. We performed low-pass whole-genome sequencing in 680 individuals from the InCHIANTI study to test two primary hypotheses: (i) that sequencing would detect single low-frequency-large effect variants that explained similar amounts of phenotypic variance as single common variants, and (ii) that some common variant associations could be explained by low-frequency variants. We tested two sets of disease-related common phenotypes for which we had statistical power to detect large numbers of common variant-common phenotype associations-11 132 cis-gene expression traits in 450 individuals and 93 circulating biomarkers in all 680 individuals. From a total of 11 657 229 high-quality variants of which 6 129 221 and 5 528 008 were common and low frequency (<5%), respectively, low frequency-large effect associations comprised 7% of detectable cis-gene expression traits [89 of 1314 cis-eQTLs at P < 1 × 10(-06) (false discovery rate ∼5%)] and one of eight biomarker associations at P < 8 × 10(-10). Very few (30 of 1232; 2%) common variant associations were fully explained by low-frequency variants. Our data show that whole-genome sequencing can identify low-frequency variants undetected by genotyping based approaches when sample sizes are sufficiently large to detect substantial numbers of common variant associations, and that common variant associations are rarely explained by single low-frequency variants of large effect.

  20. Detecting Functional Divergence after Gene Duplication through Evolutionary Changes in Posttranslational Regulatory Sequences

    PubMed Central

    Nguyen Ba, Alex N.; Strome, Bob; Hua, Jun Jie; Desmond, Jonathan; Gagnon-Arsenault, Isabelle; Weiss, Eric L.; Landry, Christian R.; Moses, Alan M.


    Gene duplication is an important evolutionary mechanism that can result in functional divergence in paralogs due to neo-functionalization or sub-functionalization. Consistent with functional divergence after gene duplication, recent studies have shown accelerated evolution in retained paralogs. However, little is known in general about the impact of this accelerated evolution on the molecular functions of retained paralogs. For example, do new functions typically involve changes in enzymatic activities, or changes in protein regulation? Here we study the evolution of posttranslational regulation by examining the evolution of important regulatory sequences (short linear motifs) in retained duplicates created by the whole-genome duplication in budding yeast. To do so, we identified short linear motifs whose evolutionary constraint has relaxed after gene duplication with a likelihood-ratio test that can account for heterogeneity in the evolutionary process by using a non-central chi-squared null distribution. We find that short linear motifs are more likely to show changes in evolutionary constraints in retained duplicates compared to single-copy genes. We examine changes in constraints on known regulatory sequences and show that for the Rck1/Rck2, Fkh1/Fkh2, Ace2/Swi5 paralogs, they are associated with previously characterized differences in posttranslational regulation. Finally, we experimentally confirm our prediction that for the Ace2/Swi5 paralogs, Cbk1 regulated localization was lost along the lineage leading to SWI5 after gene duplication. Our analysis suggests that changes in posttranslational regulation mediated by short regulatory motifs systematically contribute to functional divergence after gene duplication. PMID:25474245

  1. Detecting functional divergence after gene duplication through evolutionary changes in posttranslational regulatory sequences.


    Nguyen Ba, Alex N; Strome, Bob; Hua, Jun Jie; Desmond, Jonathan; Gagnon-Arsenault, Isabelle; Weiss, Eric L; Landry, Christian R; Moses, Alan M


    Gene duplication is an important evolutionary mechanism that can result in functional divergence in paralogs due to neo-functionalization or sub-functionalization. Consistent with functional divergence after gene duplication, recent studies have shown accelerated evolution in retained paralogs. However, little is known in general about the impact of this accelerated evolution on the molecular functions of retained paralogs. For example, do new functions typically involve changes in enzymatic activities, or changes in protein regulation? Here we study the evolution of posttranslational regulation by examining the evolution of important regulatory sequences (short linear motifs) in retained duplicates created by the whole-genome duplication in budding yeast. To do so, we identified short linear motifs whose evolutionary constraint has relaxed after gene duplication with a likelihood-ratio test that can account for heterogeneity in the evolutionary process by using a non-central chi-squared null distribution. We find that short linear motifs are more likely to show changes in evolutionary constraints in retained duplicates compared to single-copy genes. We examine changes in constraints on known regulatory sequences and show that for the Rck1/Rck2, Fkh1/Fkh2, Ace2/Swi5 paralogs, they are associated with previously characterized differences in posttranslational regulation. Finally, we experimentally confirm our prediction that for the Ace2/Swi5 paralogs, Cbk1 regulated localization was lost along the lineage leading to SWI5 after gene duplication. Our analysis suggests that changes in posttranslational regulation mediated by short regulatory motifs systematically contribute to functional divergence after gene duplication.

  2. Complete genome sequences of two novel begomoviruses infecting common bean in Venezuela.


    Fiallo-Olivé, Elvira; Márquez-Martín, Belén; Hassan, Ishtiaq; Chirinos, Dorys T; Geraud-Pouey, Francis; Navas-Castillo, Jesús; Moriones, Enrique


    The complete genome sequences of isolates of two new bipartite begomoviruses (genus Begomovirus, family Geminiviridae) found infecting common bean in Venezuela are provided. The names proposed for each of these viruses are "bean yellow chlorosis virus" (BYCV) and "bean white chlorosis mosaic virus" (BWCMV). Phylogenetic analysis showed that they segregated in two distinct clades of New World begomoviruses. This is the first report of begomoviruses infecting common bean in Venezuela.

  3. Complete genome sequence of bean leaf crumple virus, a novel begomovirus infecting common bean in Colombia.


    Carvajal-Yepes, Monica; Zambrano, Leidy; Bueno, Juan M; Raatz, Bodo; Cuellar, Wilmer J


    A copy of the complete genome of a novel bipartite begomovirus infecting common bean (Phaseolus vulgaris L.) in Colombia was obtained by rolling-circle amplification (RCA), cloned, and sequenced. The virus is associated with leaf crumple symptoms and significant yield losses in Andean and Mesoamerican beans. Such symptoms have been reported increasingly in Colombia since at least 2002, and we detected the virus in leaf material collected since 2008. Sequence analysis showed that the virus is a member of a distinct species, sharing 81% and 76% nucleotide (nt) sequence identity (in DNA-A and DNA-B, respectively) to other begomoviruses infecting common bean in the Americas. The data obtained support the taxonomic status of this virus (putatively named 'bean leaf crumple virus', BLCrV) as a member of a novel species in the genus Begomovirus.

  4. SNPs in putative regulatory regions identified by human mouse comparative sequencing and transcription factor binding site data

    SciTech Connect

    Banerjee, Poulabi; Bahlo, Melanie; Schwartz, Jody R.; Loots, Gabriela G.; Houston, Kathryn A.; Dubchak, Inna; Speed, Terence P.; Rubin, Edward M.


    Genome wide disease association analysis using SNPs is being explored as a method for dissecting complex genetic traits and a vast number of SNPs have been generated for this purpose. As there are cost and throughput limitations of genotyping large numbers of SNPs and statistical issues regarding the large number of dependent tests on the same data set, to make association analysis practical it has been proposed that SNPs should be prioritized based on likely functional importance. The most easily identifiable functional SNPs are coding SNPs (cSNPs) and accordingly cSNPs have been screened in a number of studies. SNPs in gene regulatory sequences embedded in noncoding DNA are another class of SNPs suggested for prioritization due to their predicted quantitative impact on gene expression. The main challenge in evaluating these SNPs, in contrast to cSNPs is a lack of robust algorithms and databases for recognizing regulatory sequences in noncoding DNA. Approaches that have been previously used to delineate noncoding sequences with gene regulatory activity include cross-species sequence comparisons and the search for sequences recognized by transcription factors. We combined these two methods to sift through mouse human genomic sequences to identify putative gene regulatory elements and subsequently localized SNPs within these sequences in a 1 Megabase (Mb) region of human chromosome 5q31, orthologous to mouse chromosome 11 containing the Interleukin cluster.

  5. Insights from exome sequencing in common and rare human endocrine disorders

    PubMed Central

    Dauber, Andrew; de Bruin, Christiaan


    Exome sequencing has emerged in recent years as a rapid and effective tool for the elucidation of genetic defects underlying both rare and common human disease. Increased availability and decreased costs of next generation sequencing has enabled researchers worldwide to use this approach not only in individual patients with rare diseases, but also to screen larger cohorts or populations for genetic determinants of disease. Within the field of endocrinology, exome sequencing has led to significant advancements in our understanding of numerous disorders including adrenal disease, growth and pubertal disorders, type 2 diabetes, as well as a multitude of rare genetic syndromes with prominent endocrine involvement. In this review, we aim to provide an overview of these recent new insights and discuss the role that exome sequencing is expected to play in endocrine research and clinical practice in the coming years. PMID:25963271

  6. Exceptionally high heterologous protein levels in transgenic dicotyledonous seeds using Phaseolus vulgaris regulatory sequences.


    De Jaeger, Geert; Angenon, Geert; Depicker, Ann


    Seeds are concentrated sources of protein and thus may be ideal 'bioreactors' for the production of heterologous proteins. For this application, strong seed-specific expression signals are required. A set of expression cassettes were designed using 5' and 3' regulatory sequences of the seed storage protein gene arcelin 5-I (arc5-I) from Phaseolus vulgaris, and evaluated for the production of heterologous proteins in dicotyledonous plant species. A murine single-chain variable fragment (scFv) was chosen as model protein because of the current industrial interest to produce antibodies and derived fragments in crops. Because the highest scFv accumulation in seed had previously been achieved in the endoplasmic reticulum (ER), the scFv-encoding sequence was provided with signal sequences for accumulation in the ER. Transgenic Arabidopsis seed stocks, expressing the scFv under control of the 35S promoter, contained scFv accumulation levels in the range of 1% of total soluble protein (TSP). However, the seed storage promoter constructs boosted the scFv to exceptionally high levels. Maximum scFv levels were obtained in homozygous seed stocks, being 12.5% of TSP under control of the arc5-I regulatory sequences and even up to 36.5% of TSP upon replacing the arc5-I promoter by the beta-phaseolin promoter of Phaseolus vulgaris. Even at such very high levels, the scFv proteins retain their full antigen-binding activity. Moreover, the presence of very high scFv levels has only minory effects on seed germination and no effect on seed production. These results demonstrate that the expression levels of arcelin 5-I and beta-phaseolin seed storage protein genes can be transferred to heterologous proteins, giving exceptionally high levels of heterologous proteins, which can be of great value for the molecular farming industry by raising production yield and lowering bio-mass production and purification costs. Finally, the feasibility of heterologous protein production using the

  7. The immunogenicity of viral haemorragic septicaemia rhabdovirus (VHSV) DNA vaccines can depend on plasmid regulatory sequences.


    Chico, V; Ortega-Villaizan, M; Falco, A; Tafalla, C; Perez, L; Coll, J M; Estepa, A


    A plasmid DNA encoding the viral hemorrhagic septicaemia virus (VHSV)-G glycoprotein under the control of 5' sequences (enhancer/promoter sequence plus both non-coding 1st exon and 1st intron sequences) from carp beta-actin gene (pAE6-G(VHSV)) was compared to the vaccine plasmid usually described the gene expression is regulated by the human cytomegalovirus (CMV) immediate-early promoter (pMCV1.4-G(VHSV)). We observed that these two plasmids produced a markedly different profile in the level and time of expression of the encoded-antigen, and this may have a direct effect upon the intensity and suitability of the in vivo immune response. Thus, fish genetic immunisation assays were carried out to study the immune response of both plasmids. A significantly enhanced specific-antibody response against the viral glycoprotein was found in the fish immunised with pAE6-G(VHSV). However, the protective efficacy against VHSV challenge conferred by both plasmids was similar. Later analysis of the transcription profile of a set of representative immune-related genes in the DNA immunized fish suggested that depending on the plasmid-related regulatory sequences controlling its expression, the plasmid might activate distinct patterns of the immune system. All together, the results from this study mainly point out that the selection of a determinate encoded-antigen/vector combination for genetic immunisation is of extraordinary importance in designing optimised DNA vaccines that, when required for inducing protective immune response, could elicit responses biased to antigen-specific antibodies or cytotoxic T cells generation.

  8. Development of taxon-specific sequences of common wheat for the detection of genetically modified wheat.


    Iida, Mayu; Yamashiro, Satomi; Yamakawa, Hirohito; Hayakawa, Katsuyuki; Kuribara, Hideo; Kodama, Takashi; Furui, Satoshi; Akiyama, Hiroshi; Maitani, Tamio; Hino, Akihiro


    Qualitative and quantitative Polymerase Chain Reaction (PCR) systems aimed at the specific detection and quantification of common wheat DNA are described. Many countries have issued regulations to label foods that include genetically modified organisms (GMOs). PCR technology is widely recognized as a reliable and useful technique for the qualitative and quantitative detection of GMOs. Detection methods are needed to amplify a target GM gene, and the amplified results should be compared with those of the corresponding taxon-specific reference gene to obtain reliable results. This paper describes the development of a specific DNA sequence in the waxy-D1 gene for common wheat (Triticum aestivum L.) and the design of a specific primer pair and TaqMan probe on the waxy-D1 gene for PCR analysis. The primers amplified a product (Wx012) of 102 bp. It is indicated that the Wx012 DNA sequence is specific to common wheat, showing homogeneity in qualitative PCR results and very similar quantification accuracy along 19 distantly related common wheat varieties. In Southern blot and real-time PCR analyses, this sequence showed either a single or a low number of copy genes. In addition, by qualitative and quantitative PCR using wx012 primers and a wx012-T probe, the limits of detection of the common wheat genome were found to be about 15 copies, and the reproducibility was reliable. In consequence, the PCR system using wx012 primers and wx012-T probe is considered to be suitable for use as a common wheat-specific taxon-specific reference gene in DNA analyses, including GMO tests.

  9. Using mitochondrial nucleotide sequences to investigate diversity and genealogical relationships within common carp (Cyprinus carpio L.).


    Thai, B T; Burridge, C P; Pham, T A; Austin, C M


    Direct sequencing of mitochondrial DNA (mtDNA) D-loop (745 bp) and MTATPase6/MTATPase8 (857 bp) regions was used to investigate genetic variation within common carp and develop a global genealogy of common carp strains. The D-loop region was more variable than the MTATPase6/MTATPase8 region, but given the wide distribution of carp the overall levels of sequence divergence were low. Levels of haplotype diversity varied widely among countries with Chinese, Indonesian and Vietnamese carp showing the greatest diversity whereas Japanese Koi and European carp had undetectable nucleotide variation. A genealogical analysis supports a close relationship between Vietnamese, Koi and Chinese Color carp strains and to a lesser extent, European carp. Chinese and Indonesian carp strains were the most divergent, and their relationships do not support the evolution of independent Asian and European lineages and current taxonomic treatments.

  10. Candidate regulatory sequence elements for cell cycle-dependent transcription in Saccharomyces cerevisiae.


    Wolfsberg, T G; Gabrielian, A E; Campbell, M J; Cho, R J; Spouge, J L; Landsman, D


    Recent developments in genome-wide transcript monitoring have led to a rapid accumulation of data from gene expression studies. Such projects highlight the need for methods to predict the molecular basis of transcriptional coregulation. A microarray project identified the 420 yeast transcripts whose synthesis displays cell cycle-dependent periodicity. We present here a statistical technique we developed to identify the sequence elements that may be responsible for this cell cycle regulation. Because most gene regulatory sites contain a short string of highly conserved nucleotides, any such strings that are involved in gene regulation will occur frequently in the upstream regions of the genes that they regulate, and rarely in the upstream regions of other genes. Our strategy therefore utilizes statistical procedures to identify short oligomers, five or six nucleotides in length, that are over-represented in upstream regions of genes whose expression peaks at the same phase of the cell cycle. We report, with a high level of confidence, that 9 hexamers and 12 pentamers are over-represented in the upstream regions of genes whose expression peaks at the early G(1), late G(1), S, G(2), or M phase of the cell cycle. Some of these sequence elements show a preference for a particular orientation, and others, through a separate statistical test, for a particular position upstream of the ATG start codon. The finding that the majority of the statistically significant sequence elements are located in late G(1) upstream regions correlates with other experiments that identified the late G(1)/early S boundary as a vital cell cycle control point. Our results highlight the importance of MCB, an element implicated previously in late G(1)/early S gene regulation, as most of the late G(1) oligomers contain the MCB sequence or variations thereof. It is striking that most MCB-like sequences localize to a specific region upstream of the ATG start codon. Additional sequences that we have

  11. Optimum designs for next-generation sequencing to discover rare variants for common complex disease.


    Shi, Gang; Rao, D C


    Recent advances in next-generation sequencing technologies make it affordable to search for rare and functional variants for common complex diseases systematically. We investigated strategies for enriching rare variants in the samples selected for sequencing so as to optimize the power for their discovery. In particular, we investigated the roles of alternative sources of enrichment in families through computer simulations. We showed that linkage information, extreme phenotype, and nonrandom ascertainment, such as multiply affected families, constitute different sources for enriching rare and functional variants in a sequencing study design. Linkage is well known to have limited power for detecting small genetic effects, and hence not considered to be a powerful tool for discovering variants for common complex diseases. However, those families with some degree of family-specific linkage evidence provide an effective sampling strategy to sub-select the most linkage-informative families for sequencing. Compared with selecting subjects with extreme phenotypes, linkage evidence performs better with larger families, while extreme-phenotype method is more efficient with smaller families. Families with multiple affected siblings were found to provide the largest enrichment of rare variants. Finally, we showed that combined strategies, such as selecting linkage-informative families from multiply affected families, provide much higher enrichment of rare functional variants than either strategy alone.

  12. Development of polymorphic expressed sequence tag-single sequence repeat markers in the common Chinese cuttlefish, Sepiella maindroni.


    Li, R H; Lu, S K; Zhang, C L; Song, W W; Mu, C K; Wang, C L


    The common Chinese cuttlefish (Sepiella maindroni) is one of the popular edible cephalopod consumed across Asia. To facilitate the population genetic investigation of this species, we developed fourteen polymorphic microsatellite makers from expressed sequence tags of S. maindroni. The number of alleles at each locus ranged from 6 to 10 with an average of 7.9 alleles per locus. The ranges of observed and expected heterozygosity were from 0.615 to 0.962 and 0.685 to 0.888, respectively. Four loci were found deviated significantly from Hardy-Weinberg equilibrium. The polymorphism information content ranged from 0.638 to 0.833. These polymorphic microsatellite loci will be helpful for the population genetic, genetic linkage map, and other genetic studies of S. maindroni.

  13. Integrated genome analysis suggests that most conserved non-coding sequences are regulatory factor binding sites

    PubMed Central

    Hemberg, Martin; Gray, Jesse M.; Cloonan, Nicole; Kuersten, Scott; Grimmond, Sean; Greenberg, Michael E.; Kreiman, Gabriel


    More than 98% of a typical vertebrate genome does not code for proteins. Although non-coding regions are sprinkled with short (<200 bp) islands of evolutionarily conserved sequences, the function of most of these unannotated conserved islands remains unknown. One possibility is that unannotated conserved islands could encode non-coding RNAs (ncRNAs); alternatively, unannotated conserved islands could serve as promoter-distal regulatory factor binding sites (RFBSs) like enhancers. Here we assess these possibilities by comparing unannotated conserved islands in the human and mouse genomes to transcribed regions and to RFBSs, relying on a detailed case study of one human and one mouse cell type. We define transcribed regions by applying a novel transcript-calling algorithm to RNA-Seq data obtained from total cellular RNA, and we define RFBSs using ChIP-Seq and DNAse-hypersensitivity assays. We find that unannotated conserved islands are four times more likely to coincide with RFBSs than with unannotated ncRNAs. Thousands of conserved RFBSs can be categorized as insulators based on the presence of CTCF or as enhancers based on the presence of p300/CBP and H3K4me1. While many unannotated conserved RFBSs are transcriptionally active to some extent, the transcripts produced tend to be unspliced, non-polyadenylated and expressed at levels 10 to 100-fold lower than annotated coding or ncRNAs. Extending these findings across multiple cell types and tissues, we propose that most conserved non-coding genomic DNA in vertebrate genomes corresponds to promoter-distal regulatory elements. PMID:22684627

  14. Understanding the Effects of Users' Behaviors on Effectiveness of Different Exogenous Regulatory Common Pool Resource Management Institutions

    NASA Astrophysics Data System (ADS)

    Madani, K.; Dinar, A.


    Tragedy of the commons is generally recognized as one of the possible destinies for common pool resources (CPRs). To avoid the tragedy of the commons and prolonging the life of CPRs, users may show different behavioral characteristics and use different rationales for CPR planning and management. Furthermore, regulators may adopt different strategies for sustainable management of CPRs. The effectiveness of different regulatory exogenous management institutions cannot be evaluated through conventional CPR models since they assume that either users base their behavior on individual rationality and adopt a selfish behavior (Nash behavior), or that the users seek the system's optimal solution without giving priority to their own interests. Therefore, conventional models fail to reliably predict the outcome of CPR problems in which parties may have a range of behavioral characteristics, putting them somewhere in between the two types of behaviors traditionally considered. This work examines the effectiveness of different regulatory exogenous CPR management institutions through a user-based model (as opposed to a system-based model). The new modeling framework allows for consideration of sensitivity of the results to different behavioral characteristics of interacting CPR users. The suggested modeling approach is applied to a benchmark groundwater management problem. Results indicate that some well-known exogenous management institutions (e.g. taxing) are ineffective in sustainable management of CPRs in most cases. Bankruptcy-based management can be helpful, but determination of the fair level of cutbacks remains challenging under this type of institution. Furthermore, some bankruptcy rules such as the Constrained Equal Award (CEA) method are more beneficial to wealthier users, failing to establish social justice. Quota-based and CPR status-based management perform as the most promising and robust regulatory exogenous institutions in prolonging the CPR's life and

  15. Regulatory codes of conduct and the common law. Part 2: confidentiality.


    Fullbrook, Suzanne

    In Part One, three aspects of the principles that underpin the law of confidentiality were identified from a review of case law. Public interest(s), public safety and the protection of vulnerable people were identified as producing a matrix whereby health providers could see that the rules relating to confidentiality were viewed by all in society as being of the utmost importance. This article concentrates on the codes of conduct that two regulatory bodies have produced to guide the practice of health professionals. The General Medical Council (GMC) and the Nursing and Midwifery Council (NMC) have codes of conduct that are very similar in their guidance. This is not surprising given that the central importance of confidentiality is reflected at the highest possible levels of judicial and political thinking.

  16. Common DNA sequences with potential for detection of genetically manipulated organisms in food.


    MacCormick, C A; Griffin, H G; Underwood, H M; Gasson, M J


    Foods produced by genetic engineering technology are now appearing on the market and many more are likely to emerge in the future. The safety aspects, regulation, and labelling of these foods are still contentious issues in most countries and recent surveys highlight consumer concerns about the safety and labelling of genetically modified food. In most countries it is necessary to have approval for the use of genetically manipulated organisms (GMOs) in the production of food. In order to police regulations, a technology to detect such foods is desirable. In addition, a requirement to label approved genetically modified food would necessitate a monitoring system. One solution is to 'tag' approved GMOs with some form of biological or genetic marker, permitting the surveillance of foods for the presence of approved products of genetic engineering. While non-approved GMOs would not be detected by such a surveillance, they might be detected by a screen for DNA sequences common to all or most GMOs. This review focuses on the potential of using common DNA sequences as detection probes for GMOs. The identification of vector sequences, plant transcription terminators, and marker genes by PCR and hybridization techniques is discussed.

  17. Identification of parasite DNA in common bile duct stones by PCR and DNA sequencing

    PubMed Central

    Jang, Ji Sun; Kim, Kyung Ho; Yu, Jae-Ran


    We attempted to identify parasite DNA in the biliary stones of humans via PCR and DNA sequencing. Genomic DNA was isolated from each of 15 common bile duct (CBD) stones and 5 gallbladder (GB) stones. The patients who had the CBD stones suffered from cholangitis, and the patients with GB stones showed acute cholecystitis, respectively. The 28S and 18S rDNA genes were amplified successfully from 3 and/or 1 common bile duct stone samples, and then cloned and sequenced. The 28S and 18S rDNA sequences were highly conserved among isolates. Identity of the obtained 28S D1 rDNA with that of Clonorchis sinensis was higher than 97.6%, and identity of the 18S rDNA with that of other Ascarididae was 97.9%. Almost no intra-specific variations were detected in the 28S and 18S rDNA with the exception of a few nucleotide variations, i.e., substitution and deletion. These findings suggest that C. sinensis and Ascaris lumbricoides may be related with the biliary stone formation and development. PMID:18165713

  18. Sequencing of SCN5A identifies rare and common variants associated with cardiac conduction

    PubMed Central

    Magnani, Jared W.; Brody, Jennifer A.; Prins, Bram P.; Arking, Dan E.; Lin, Honghuang; Yin, Xiaoyan; Liu, Ching-Ti; Morrison, Alanna C.; Zhang, Feng; Spector, Tim D.; Alonso, Alvaro; Bis, Joshua C.; Heckbert, Susan R.; Lumley, Thomas; Sitlani, Colleen M.; Cupples, L. Adrienne; Lubitz, Steven A.; Soliman, Elsayed Z.; Pulit, Sara L.; Newton-Cheh, Christopher; O'Donnell, Christopher J.; Ellinor, Patrick T.; Benjamin, Emelia J.; Muzny, Donna M.; Gibbs, Richard A.; Santibanez, Jireh; Taylor, Herman A.; Rotter, Jerome I.; Lange, Leslie A.; Psaty, Bruce M.; Jackson, Rebecca; Rich, Stephen S.; Boerwinkle, Eric; Jamshidi, Yalda; Sotoodehnia, Nona


    Background The cardiac sodium channel SCN5A regulates atrioventricular and ventricular conduction. Genetic variants in this gene are associated with PR and QRS intervals. We sought to further characterize the contribution of rare and common coding variation in SCN5A to cardiac conduction. Methods and Results In the Cohorts for Heart and Aging Research in Genomic Epidemiology Targeted Sequencing Study (CHARGE), we performed targeted exonic sequencing of SCN5A (n=3699, European-ancestry individuals) and identified 4 common (minor allele frequency >1%) and 157 rare variants. Common and rare SCN5A coding variants were examined for association with PR and QRS intervals through meta-analysis of European ancestry participants from CHARGE, NHLBI’s Exome Sequencing Project (ESP, n=607) and the UK10K (n=1275) and by examining ESP African-ancestry participants (N=972). Rare coding SCN5A variants in aggregate were associated with PR interval in European and African-ancestry participants (P=1.3×10−3). Three common variants were associated with PR and/or QRS interval duration among European-ancestry participants and one among African-ancestry participants. These included two well-known missense variants; rs1805124 (H558R) was associated with PR and QRS shortening in European-ancestry participants (P=6.25×10−4 and P=5.2×10−3 respectively) and rs7626962 (S1102Y) was associated with PR shortening in those of African ancestry (P=2.82×10−3). Among European-ancestry participants, two novel synonymous variants, rs1805126 and rs6599230, were associated with cardiac conduction. Our top signal, rs1805126 was associated with PR and QRS lengthening (P=3.35×10−7 and P=2.69×10−4 respectively), and rs6599230 was associated with PR shortening (P=2.67×10−5). Conclusions By sequencing SCN5A, we identified novel common and rare coding variants associated with cardiac conduction. PMID:24951663

  19. Sequence variation in the androgen receptor gene is not a common determinant of male sexual orientation

    SciTech Connect

    Macke, J.P.; Nathans, J.; King, V.L. ); Hu, N.; Hu, S.; Hamer, D.; Bailey, M. ); Brown, T. )


    To test the hypothesis that DNA sequence variation in the androgen receptor gene plays a causal role in the development of male sexual orientation, the authors have (1) measured the degree of concordance of androgen receptor alleles in 36 pairs of homosexual brothers, (2) compared the lengths of polyglutamine and polyglycine tracts in the amino-terminal domain of the androgen receptor in a sample of 197 homosexual males and 213 unselected subjects, and (3) screened the entire androgen receptor coding region for sequence variation by PCR and denaturing gradient-gel electrophoresis (DGGE) and/or single-strand conformation polymorphism analysis in 20 homosexual males with homosexual or bisexual brothers and one homosexual male with no homosexual brothers, and screened the amino-terminal domain of the receptor for sequence variation in an additional 44 homosexual males, 37 of whom had one or more first- or second-degree male relatives who were either homosexual or bisexual. These analyses show that (1) homosexual brothers are as likely to be discordant as concordant for androgen receptor alleles; (2) there are no large-scale differences between the distributions of polyglycine or polyglutamine tract lengths in the homosexual and control groups; and (3) coding region sequence variation is not commonly found within the androgen receptor gene of homosexual men. The DGGE screen identified two rare amino acid substitutions, ser[sup 205] -to-arg and glu[sup 793]-to-asp, the biological significance of which is unknown. 32 refs., 2 figs., 2 tabs.

  20. Common 5' beta-globin RFLP haplotypes harbour a surprising level of ancestral sequence mosaicism.


    Webster, Matthew T; Clegg, John B; Harding, Rosalind M


    Blocks of linkage disequilibrium (LD) in the human genome represent segments of ancestral chromosomes. To investigate the relationship between LD and genealogy, we analysed diversity associated with restriction fragment length polymorphism (RFLP) haplotypes of the 5' beta-globin gene complex. Genealogical analyses were based on sequence alleles that spanned a 12.2-kb interval, covering 3.1 kb around the psibeta gene and 6.2 kb of the delta-globin gene and its 5' flanking sequence known as the R/T region. Diversity was sampled from a Kenyan Luo population where recent malarial selection has contributed to substantial LD. A single common sequence allele spanning the 12.2-kb interval exclusively identified the ancestral chromosome bearing the "Bantu" beta(s) (sickle-cell) RFLP haplotype. Other common 5' RFLP haplotypes comprised interspersed segments from multiple ancestral chromosomes. Nucleotide diversity was similar between psibeta and R/T-delta-globin but was non-uniformly distributed within the R/T-delta-globin region. High diversity associated with the 5' R/T identified two ancestral lineages that probably date back more than 2 million years. Within this genealogy, variation has been introduced into the 3' R/T by gene conversion from other ancestral chromosomes. Diversity in delta-globin was found to lead through parts of the main genealogy but to coalesce in a more recent ancestor. The well-known recombination hotspot is clearly restricted to the region 3' of delta-globin. Our analyses show that, whereas one common haplotype in a block of high LD represents a long segment from a single ancestral chromosome, others are mosaics of short segments from multiple ancestors related in genealogies of unsuspected complexity.

  1. Direct interaction of the Polycomb protein with Antennapedia regulatory sequences in polytene chromosomes of Drosophila melanogaster.

    PubMed Central

    Zink, B; Engström, Y; Gehring, W J; Paro, R


    The Polycomb (Pc) gene is responsible for the elaboration and maintenance of the expression pattern of the homeotic genes during development of Drosophila. In mutant Pc- embryos, homeotic transcripts are ectopically expressed, leading to abdominal transformations in all segments. From this it was suggested that PC+ acts as a repressor of homeotic gene transcription. We have mapped the cis-acting control sequences of the homeotic Antennapedia (Antp) gene regulated by Pc. Using Antp P1 and P2 promoter fragments linked to the E. coli lacZ reporter gene we show different expression patterns of beta-galactosidase (beta-gal) in transformed Pc+ and Pc- embryos. In addition we are able to visualize by immunocytochemical techniques on polytene chromosomes the direct binding of the Pc protein to the transposed cis-regulatory promoter fragments. However, short Antp P1 promoter constructs which are--due to position effects--ectopically activated in salivary glands, do not reveal a Pc binding signal. Images PMID:1671215

  2. Unstable microsatellite repeats facilitate rapid evolution of coding and regulatory sequences.


    Jansen, A; Gemayel, R; Verstrepen, K J


    Tandem repeats are intrinsically highly variable sequences since repeat units are often lost or gained during replication or following unequal recombination events. Because of their low complexity and their instability, these repeats, which are also called satellite repeats, are often considered to be useless 'junk' DNA. However, recent findings show that tandem repeats are frequently found within promoters of stress-induced genes and within the coding regions of genes encoding cell-surface and regulatory proteins. Interestingly, frequent changes in these repeats often confer phenotypic variability. Examples include variation in the microbial cell surface, rapid tuning of internal molecular clocks in flies, and enhanced morphological plasticity in mammals. This suggests that instead of being useless junk DNA, some variable tandem repeats are useful functional elements that confer 'evolvability', facilitating swift evolution and rapid adaptation to changing environments. Since changes in repeats are frequent and reversible, repeats provide a unique type of mutation that bridges the gap between rare genetic mutations, such as single nucleotide polymorphisms, and highly unstable but reversible epigenetic inheritance.

  3. Building a model: developing genomic resources for common milkweed (Asclepias syriaca) with low coverage genome sequencing

    PubMed Central


    Background Milkweeds (Asclepias L.) have been extensively investigated in diverse areas of evolutionary biology and ecology; however, there are few genetic resources available to facilitate and compliment these studies. This study explored how low coverage genome sequencing of the common milkweed (Asclepias syriaca L.) could be useful in characterizing the genome of a plant without prior genomic information and for development of genomic resources as a step toward further developing A. syriaca as a model in ecology and evolution. Results A 0.5× genome of A. syriaca was produced using Illumina sequencing. A virtually complete chloroplast genome of 158,598 bp was assembled, revealing few repeats and loss of three genes: accD, clpP, and ycf1. A nearly complete rDNA cistron (18S-5.8S-26S; 7,541 bp) and 5S rDNA (120 bp) sequence were obtained. Assessment of polymorphism revealed that the rDNA cistron and 5S rDNA had 0.3% and 26.7% polymorphic sites, respectively. A partial mitochondrial genome sequence (130,764 bp), with identical gene content to tobacco, was also assembled. An initial characterization of repeat content indicated that Ty1/copia-like retroelements are the most common repeat type in the milkweed genome. At least one A. syriaca microread hit 88% of Catharanthus roseus (Apocynaceae) unigenes (median coverage of 0.29×) and 66% of single copy orthologs (COSII) in asterids (median coverage of 0.14×). From this partial characterization of the A. syriaca genome, markers for population genetics (microsatellites) and phylogenetics (low-copy nuclear genes) studies were developed. Conclusions The results highlight the promise of next generation sequencing for development of genomic resources for any organism. Low coverage genome sequencing allows characterization of the high copy fraction of the genome and exploration of the low copy fraction of the genome, which facilitate the development of molecular tools for further study of a target species and its relatives

  4. Sequencing Y Chromosomes Resolves Discrepancy in Time to Common Ancestor of Males versus Females

    PubMed Central

    Poznik, G. David; Henn, Brenna M.; Yee, Muh-Ching; Sliwerska, Elzbieta; Euskirchen, Ghia M.; Lin, Alice A.; Snyder, Michael; Quintana-Murci, Lluis; Kidd, Jeffrey M.; Underhill, Peter A.; Bustamante, Carlos D.


    The Y chromosome and the mitochondrial genome (mtDNA) have been used to estimate when the common patrilineal and matrilineal ancestors of humans lived. We sequenced the genomes of 69 males from nine populations, including two in which we find basal branches of the Y chromosome tree. We identify ancient phylogenetic structure within African haplogroups and resolve a long-standing ambiguity deep within the tree. Applying equivalent methodologies to the Y and mtDNA, we estimate the time to the most recent common ancestor (TMRCA) of the Y chromosome to be 120–156 thousand years and the mtDNA TMRCA to be 99–148 ky. Our findings suggest that, contrary to prior claims, male lineages do not coalesce significantly more recently than female lineages. PMID:23908239

  5. Commonality.

    ERIC Educational Resources Information Center

    Beaton, Albert E., Jr.

    Commonality analysis is an attempt to understand the relative predictive power of the regressor variables, both individually and in combination. The squared multiple correlation is broken up into elements assigned to each individual regressor and to each possible combination of regressors. The elements have the property that the appropriate sums…

  6. Omeprazole transactivates human CYP1A1 and CYP1A2 expression through the common regulatory region containing multiple xenobiotic-responsive elements.


    Yoshinari, Kouichi; Ueda, Rika; Kusano, Kazutomi; Yoshimura, Tsutomu; Nagata, Kiyoshi; Yamazoe, Yasushi


    Omeprazole induces human CYP1A1 and CYP1A2 in human hepatoma cells and human liver. Aryl hydrocarbon receptor (AHR) is shown to be involved in this induction. However, its precise molecular mechanism remains unknown because the chemical activates AHR without its direct binding in contrast to typical AHR ligands such as 3-methylcholanthrene (3MC) and beta-naphthoflavone (BNF). Human CYP1A1 and CYP1A2 genes are located in a head-to-head orientation sharing about 23 kb 5'-flanking region. Recently, we succeeded to measure CYP1A1 and CYP1A2 transcriptional activities simultaneously using dual reporter gene constructs containing the 23 kb sequence. In this study, transient transfection assays have been performed using numbers of single and dual reporter constructs to identify omeprazole-responsive region for CYP1A1 and CYP1A2 induction. Reporter assays with deletion constructs have demonstrated that the omeprazole-induced expression of both CYP1A1 and CYP1A2 is mediated via the common regulatory region containing multiple AHR-binding motifs (the nucleotides from -464 to -1829 of human CYP1A1), which is identical with the region for BNF and 3MC induction. Interestingly, omeprazole activated the transcription of CYP1A1 and CYP1A2 to similar extents while BNF and 3MC preferred CYP1A1 expression. We have also found that primaquine is an omeprazole-like CYP1A inducer, while lansoprazole and albendazole are 3MC/BNF-like in terms of the CYP1A1/CYP1A2 preference. The present results suggest that omeprazole as well as BNF and 3MC activates both human CYP1A1 and CYP1A2 expression through the common regulatory region despite that omeprazole may involve a different cellular signal(s) from BNF and 3MC.

  7. MISCORE: a new scoring function for characterizing DNA regulatory motifs in promoter sequences

    PubMed Central


    Background Computational approaches for finding DNA regulatory motifs in promoter sequences are useful to biologists in terms of reducing the experimental costs and speeding up the discovery process of de novo binding sites. It is important for rule-based or clustering-based motif searching schemes to effectively and efficiently evaluate the similarity between a k-mer (a k-length subsequence) and a motif model, without assuming the independence of nucleotides in motif models or without employing computationally expensive Markov chain models to estimate the background probabilities of k-mers. Also, it is interesting and beneficial to use a priori knowledge in developing advanced searching tools. Results This paper presents a new scoring function, termed as MISCORE, for functional motif characterization and evaluation. Our MISCORE is free from: (i) any assumption on model dependency; and (ii) the use of Markov chain model for background modeling. It integrates the compositional complexity of motif instances into the function. Performance evaluations with comparison to the well-known Maximum a Posteriori (MAP) score and Information Content (IC) have shown that MISCORE has promising capabilities to separate and recognize functional DNA motifs and its instances from non-functional ones. Conclusions MISCORE is a fast computational tool for candidate motif characterization, evaluation and selection. It enables to embed priori known motif models for computing motif-to-motif similarity, which is more advantageous than IC and MAP score. In addition to these merits mentioned above, MISCORE can automatically filter out some repetitive k-mers from a motif model due to the introduction of the compositional complexity in the function. Consequently, the merits of our proposed MISCORE in terms of both motif signal modeling power and computational efficiency will make it more applicable in the development of computational motif discovery tools. PMID:23282090

  8. IgH sequences in common variable immune deficiency reveal altered B cell development and selection**

    PubMed Central

    Roskin, Krishna M.; Simchoni, Noa; Liu, Yi; Lee, Ji-Yeun; Seo, Katie; Hoh, Ramona A.; Pham, Tho; Park, Joon H.; Furman, David; Dekker, Cornelia L.; Davis, Mark M.; James, Judith A.; Nadeau, Kari C.; Cunningham-Rundles, Charlotte; Boyd, Scott D.


    Common variable immune deficiency (CVID) is the most common symptomatic primary immune deficiency, affecting ∼1 in 25,000 persons. These patients suffer from impaired antibody responses, autoimmunity, and susceptibility to lymphoid cancers. To explore the cellular basis for these clinical phenotypes, we conducted high-throughput DNA sequencing of immunoglobulin heavy chain gene rearrangements from 93 CVID patients and 105 control subjects and sorted naïve and memory B cells from 13 of the CVID patients and 10 of the control subjects. CVID patients showed abnormal VDJ rearrangement and abnormal formation of complementarity determining region 3 (CDR3). We observed decreased selection against antibodies with long CDR3 regions in memory repertoires and decreased V gene replacement, offering possible mechanisms for increased patient autoreactivity. Our data indicate that patient immunodeficiency might derive both from decreased diversity of the naïve B cell pool and decreased somatic hypermutation in memory repertoires. CVID patients also exhibited abnormal clonal expansion of unmutated B cells relative to controls. Although impaired B cell germinal center activation is commonly viewed as causative in CVID, these data indicate that CVID B cells diverge from controls as early as the pro-B cell stage and suggest possible explanations for the increased incidence of autoimmunity, immunodeficiency, and lymphoma CVID patients. PMID:26311730

  9. Nucleotide sequence and functional analysis of regulatory region of the lumP and the lux operon from Photobacterium leiognathi.


    Lin, J W; Chao, Y F; Weng, S F


    The lumP gene is linked to the lux operon, but runs in the opposite direction in Photobacterium leiognathi PL741. The gene order of the lumP and the lux operon is < -lumP-R & R-luxC-luxD-luxA-luxB-luxN-luxE- > (R & R: regulatory region). The nucleotide sequence of the regulatory region (827-bp) between the lumP and the lux operon was determined. Sequence analysis illustrates that the regulatory region includes two divergent promoter systems, PR-promoter system for the lux operon (R-operon) and PL-promoter system for the lumP or lum operon (L-operon). Functional analysis of the regulatory region shows that the PR- and PL-promoter systems both are able to lead the gene expression. The deletion experiment result elicits that the PR- and PL-promoter are coordinatively and negatively regulated; the PR- and PL-promoter might be competing for recognition by RNA polymerase to initiate transcription. The fact of the LumP responsible for the spectral blue shift in P. leiognathi implied that the lumP gene closedly linked to the lux operon is for coordinative regulation with the lux operon. In addition, the glucose repression on the PR-promoter system shows that the expression of the lux operon is regulated by cAMP-CRP induction in E. coli.

  10. Reprint of: The effectiveness of common thermo-regulatory behaviours in a cool temperate grasshopper.


    Harris, Rebecca M B; McQuillan, Peter; Hughes, Lesley


    Behavioural thermoregulation has the potential to alleviate the short-term impacts of climate change on some small ectotherms, without the need for changes to species distributions or genetic adaptation. We illustrate this by measuring the effect of behaviour in a cool temperate species of grasshopper (Phaulacridium vittatum) over a range of spatial and temporal scales in laboratory and natural field experiments. Microhabitat selection at the site scale was tested in free-ranging grasshoppers and related to changing thermal quality over a daily period. Artificial warming experiments were then used to measure the temperature at which common thermoregulatory behaviours are initiated and the subsequent reductions in body temperature. Behavioural means such as timing of activity, choice of substrates with optimum surface temperatures, shade seeking and postural adjustments (e.g. stilting, vertical orientation) were found to be highly effective at maintaining preferred body temperature. The maximum voluntarily tolerated temperature (MVT) was determined to be 44 °C ± 0.4 °C, indicating the upper bounds of thermal flexibility in this species. Behavioural thermoregulation effectively enables small ectotherms to regulate exposure to changing environmental temperatures and utilize the spatially and temporally heterogeneous environments they occupy. Species such as the wingless grasshopper, although adapted to cool temperate conditions, are likely to be well equipped to respond successfully to coarse scale climate change.

  11. The effectiveness of common thermo-regulatory behaviours in a cool temperate grasshopper.


    Harris, Rebecca M B; McQuillan, Peter; Hughes, Lesley


    Behavioural thermoregulation has the potential to alleviate the short-term impacts of climate change on some small ectotherms, without the need for changes to species distributions or genetic adaptation. We illustrate this by measuring the effect of behaviour in a cool temperate species of grasshopper (Phaulacridium vittatum) over a range of spatial and temporal scales in laboratory and natural field experiments. Microhabitat selection at the site scale was tested in free-ranging grasshoppers and related to changing thermal quality over a daily period. Artificial warming experiments were then used to measure the temperature at which common thermoregulatory behaviours are initiated and the subsequent reductions in body temperature. Behavioural means such as timing of activity, choice of substrates with optimum surface temperatures, shade seeking and postural adjustments (e.g. stilting, vertical orientation) were found to be highly effective at maintaining preferred body temperature. The maximum voluntarily tolerated temperature (MVT) was determined to be 44°C±0.4°C, indicating the upper bounds of thermal flexibility in this species. Behavioural thermoregulation effectively enables small ectotherms to regulate exposure to changing environmental temperatures and utilize the spatially and temporally heterogeneous environments they occupy. Species such as the wingless grasshopper, although adapted to cool temperate conditions, are likely to be well equipped to respond successfully to coarse scale climate change.

  12. Cis-regulatory sequence variation and association with Mycoplasma load in natural populations of the house finch (Carpodacus mexicanus)

    PubMed Central

    Backström, Niclas; Shipilina, Daria; Blom, Mozes P K; Edwards, Scott V


    Characterization of the genetic basis of fitness traits in natural populations is important for understanding how organisms adapt to the changing environment and to novel events, such as epizootics. However, candidate fitness-influencing loci, such as regulatory regions, are usually unavailable in nonmodel species. Here, we analyze sequence data from targeted resequencing of the cis-regulatory regions of three candidate genes for disease resistance (CD74, HSP90α, and LCP1) in populations of the house finch (Carpodacus mexicanus) historically exposed (Alabama) and naïve (Arizona) to Mycoplasma gallisepticum. Our study, the first to quantify variation in regulatory regions in wild birds, reveals that the upstream regions of CD74 and HSP90α are GC-rich, with the former exhibiting unusually low sequence variation for this species. We identified two SNPs, located in a GC-rich region immediately upstream of an inferred promoter site in the gene HSP90α, that were significantly associated with Mycoplasma pathogen load in the two populations. The SNPs are closely linked and situated in potential regulatory sequences: one in a binding site for the transcription factor nuclear NFYα and the other in a dinucleotide microsatellite ((GC)6). The genotype associated with pathogen load in the putative NFYα binding site was significantly overrepresented in the Alabama birds. However, we did not see strong effects of selection at this SNP, perhaps because selection has acted on standing genetic variation over an extremely short time in a highly recombining region. Our study is a useful starting point to explore functional relationships between sequence polymorphisms, gene expression, and phenotypic traits, such as pathogen resistance that affect fitness in the wild. PMID:23532859

  13. Polymorphism in the bovine BOLA-DRB3 upstream regulatory regions detected through PCR-SSCP and DNA sequencing.


    Ripoli, M V; Peral-García, P; Dulout, F N; Giovambattista, G


    In the present work, we describe through polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) and DNA sequencing the polymorphism within the URR-BoLA-DRB3 in 15 cattle breeds. In total, seven PCR-SSCP defined alleles were detected. The alignment of studied sequences showed six polymorphic sites (four transitions, one transversion and one deletion) in the interconsensus regions of the BoLA-DRB3 upstream regulatory region (URR), while the consensus boxes were invariant. Five out of six detected polymorphic sites were of one nucleotide substitution in the interconsensus regions. It is expected that these mutations do not affect significantly the level of expression. In contrast, the deletion observed in the sequence between CCAAT and TATA boxes could have some effect on affinity interactions between the promoter region and the transcription factors. The URR-BoLA-DRB3 DNA analyzed sequences showed moderate level of nucleotide diversity, high level of identity among them and were grouped in the same clade in the phylogenetic tree. In addition, the phylogenetic tree, the similarity analysis and the sequence structure confirmed that the fragment analyzed in this study corresponds to the URR-BoLA-DRB3. The functional role of the observed polymorphic sites among the regulatory motifs in bovine needs to be analyzed and confirmed by means of gene expression assays.

  14. The Effects of Sequence Variation on Genome-wide NRF2 Binding—New Target Genes and Regulatory SNPs

    PubMed Central

    Kuosmanen, Suvi M.; Viitala, Sari; Laitinen, Tuomo; Peräkylä, Mikael; Pölönen, Petri; Kansanen, Emilia; Leinonen, Hanna; Raju, Suresh; Wienecke-Baldacchino, Anke; Närvänen, Ale; Poso, Antti; Heinäniemi, Merja; Heikkinen, Sami; Levonen, Anna-Liisa


    Transcription factor binding specificity is crucial for proper target gene regulation. Motif discovery algorithms identify the main features of the binding patterns, but the accuracy on the lower affinity sites is often poor. Nuclear factor E2-related factor 2 (NRF2) is a ubiquitous redox-activated transcription factor having a key protective role against endogenous and exogenous oxidant and electrophile stress. Herein, we decipher the effects of sequence variation on the DNA binding sequence of NRF2, in order to identify both genome-wide binding sites for NRF2 and disease-associated regulatory SNPs (rSNPs) with drastic effects on NRF2 binding. Interactions between NRF2 and DNA were studied using molecular modelling, and NRF2 chromatin immunoprecipitation-sequence datasets together with protein binding microarray measurements were utilized to study binding sequence variation in detail. The binding model thus generated was used to identify genome-wide binding sites for NRF2, and genomic binding sites with rSNPs that have strong effects on NRF2 binding and reside on active regulatory elements in human cells. As a proof of concept, miR-126–3p and -5p were identified as NRF2 target microRNAs, and a rSNP (rs113067944) residing on NRF2 target gene (Ferritin, light polypeptide, FTL) promoter was experimentally verified to decrease NRF2 binding and result in decreased transcriptional activity. PMID:26826707

  15. SNP marker development for linkage map construction, anchoring of the common bean whole genome sequence and genetic research

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Our objectives were to identify SNP DNA markers based on a diverse set of common bean cultivars via next generation sequencing technologies; to develop Illumina Infinium BeadChip assays containing SNPs with high polymorphism within and between common bean market classes, to create high density genet...

  16. Identification of novel craniofacial regulatory domains located far upstream of SOX9 and disrupted in Pierre Robin sequence

    PubMed Central

    Gordon, Christopher T.; Attanasio, Catia; Bhatia, Shipra; Benko, Sabina; Ansari, Morad; Tan, Tiong Y.; Munnich, Arnold; Pennacchio, Len A.; Abadie, Véronique; Temple, I. Karen; Goldenberg, Alice; van Heyningen, Veronica; Amiel, Jeanne; FitzPatrick, David; Kleinjan, Dirk A.; Visel, Axel; Lyonnet, Stanislas


    Mutations in the coding sequence of SOX9 cause campomelic dysplasia (CD), a disorder of skeletal development associated with 46,XY disorders of sex development (DSDs). Translocations, deletions and duplications within a ~2 Mb region upstream of SOX9 can recapitulate the CD-DSD phenotype fully or partially, suggesting the existence of an unusually large cis-regulatory control region. Pierre Robin sequence (PRS) is a craniofacial disorder that is frequently an endophenotype of CD and a locus for isolated PRS at ~1.2-1.5 Mb upstream of SOX9 has been previously reported. The craniofacial regulatory potential within this locus, and within the greater genomic domain surrounding SOX9, remains poorly defined. We report two novel deletions upstream of SOX9 in families with PRS, allowing refinement of the regions harbouring candidate craniofacial regulatory elements. In parallel, ChIP-Seq for p300 binding sites in mouse craniofacial tissue led to the identification of several novel craniofacial enhancers at the SOX9 locus, which were validated in transgenic reporter mice and zebrafish. Notably, some of the functionally validated elements fall within the PRS deletions. These studies suggest that multiple non-coding elements contribute to the craniofacial regulation of SOX9 expression, and that their disruption results in PRS. PMID:24934569

  17. Weak Palindromic Consensus Sequences Are a Common Feature Found at the Integration Target Sites of Many Retroviruses

    PubMed Central

    Wu, Xiaolin; Li, Yuan; Crise, Bruce; Burgess, Shawn M.; Munroe, David J.


    Integration into the host genome is one of the hallmarks of the retroviral life cycle and is catalyzed by virus-encoded integrases. While integrase has strict sequence requirements for the viral DNA ends, target site sequences have been shown to be very diverse. We carefully examined a large number of integration target site sequences from several retroviruses, including human immunodeficiency virus type 1, simian immunodeficiency virus, murine leukemia virus, and avian sarcoma-leukosis virus, and found that a statistical palindromic consensus, centered on the virus-specific duplicated target site sequence, was a common feature at integration target sites for these retroviruses. PMID:15795304

  18. Enhancer Sequence Variants and Transcription Factor Deregulation Synergize to Construct Pathogenic Regulatory Circuits in B Cell Lymphoma

    PubMed Central

    Koues, Olivia I.; Kowalewski, Rodney A.; Chang, Li-Wei; Pyfrom, Sarah C.; Schmidt, Jennifer A.; Luo, Hong; Sandoval, Luis E.; Hughes, Tyler B.; Bednarski, Jeffrey J.; Cashen, Amanda F.; Payton, Jacqueline E.; Oltz, Eugene M.


    Summary Most B cell lymphomas arise in the germinal center (GC), where humoral immune responses evolve from potentially oncogenic cycles of mutation, proliferation, and clonal selection. Although lymphoma gene expression diverges significantly from GC-B cells, underlying mechanisms that alter the activities of corresponding regulatory elements (REs) remain elusive. Here we define the complete pathogenic circuitry of human follicular lymphoma (FL), which activates or decommissions REs from normal GC-B cells and commandeers enhancers from other lineages. Moreover, independent sets of transcription factors, whose expression was deregulated in FL, targeted commandeered versus decommissioned REs. Our approach revealed two distinct subtypes of low-grade FL, whose pathogenic circuitries resembled GC-B or activated B cells. FL-altered enhancers also were enriched for sequence variants, including somatic mutations, which disrupt transcription factor binding and expression of circuit-linked genes. Thus, the pathogenic regulatory circuitry of FL reveals distinct genetic and epigenetic etiologies for GC-B transformation. PMID:25607463

  19. Whole genome sequence of Desulfovibrio magneticus strain RS-1 revealed common gene clusters in magnetotactic bacteria

    PubMed Central

    Nakazawa, Hidekazu; Arakaki, Atsushi; Narita-Yamada, Sachiko; Yashiro, Isao; Jinno, Koji; Aoki, Natsuko; Tsuruyama, Ai; Okamura, Yoshiko; Tanikawa, Satoshi; Fujita, Nobuyuki; Takeyama, Haruko; Matsunaga, Tadashi


    Magnetotactic bacteria are ubiquitous microorganisms that synthesize intracellular magnetite particles (magnetosomes) by accumulating Fe ions from aquatic environments. Recent molecular studies, including comprehensive proteomic, transcriptomic, and genomic analyses, have considerably improved our hypotheses of the magnetosome-formation mechanism. However, most of these studies have been conducted using pure-cultured bacterial strains of α-proteobacteria. Here, we report the whole-genome sequence of Desulfovibrio magneticus strain RS-1, the only isolate of magnetotactic microorganisms classified under δ-proteobacteria. Comparative genomics of the RS-1 and four α-proteobacterial strains revealed the presence of three separate gene regions (nuo and mamAB-like gene clusters, and gene region of a cryptic plasmid) conserved in all magnetotactic bacteria. The nuo gene cluster, encoding NADH dehydrogenase (complex I), was also common to the genomes of three iron-reducing bacteria exhibiting uncontrolled extracellular and/or intracellular magnetite synthesis. A cryptic plasmid, pDMC1, encodes three homologous genes that exhibit high similarities with those of other magnetotactic bacterial strains. In addition, the mamAB-like gene cluster, encoding the key components for magnetosome formation such as iron transport and magnetosome alignment, was conserved only in the genomes of magnetotactic bacteria as a similar genomic island-like structure. Our findings suggest the presence of core genetic components for magnetosome biosynthesis; these genes may have been acquired into the magnetotactic bacterial genomes by multiple gene-transfer events during proteobacterial evolution. PMID:19675025

  20. 'Size leap' algorithm: an efficient extraction of the longest common motifs from a molecular sequence set. Application to the DNA sequence reconstruction.


    Danckaert, A; Chappey, C; Hazout, S


    We propose a new method, called 'size leap' algorithm, of search for motifs of maximum size and common to two fragments at least. It allows the creation of a reduced database of motifs from a set of sequences whose size obeys the series of Fibonacci numbers. The convenience lies in the efficiency of the motif extraction. It can be applied in the establishment of overlap regions for DNA sequence reconstruction and multiple alignment of biological sequences. The method of complete DNA sequence reconstruction by extraction of the longest motifs ('anchor motifs') is presented as an application of the size leap algorithm. The details of a reconstruction from three sequenced fragments are given as an example.

  1. Maps of open chromatin highlight cell type-restricted patterns of regulatory sequence variation at hematological trait loci.


    Paul, Dirk S; Albers, Cornelis A; Rendon, Augusto; Voss, Katrin; Stephens, Jonathan; van der Harst, Pim; Chambers, John C; Soranzo, Nicole; Ouwehand, Willem H; Deloukas, Panos


    Nearly three-quarters of the 143 genetic signals associated with platelet and erythrocyte phenotypes identified by meta-analyses of genome-wide association (GWA) studies are located at non-protein-coding regions. Here, we assessed the role of candidate regulatory variants associated with cell type-restricted, closely related hematological quantitative traits in biologically relevant hematopoietic cell types. We used formaldehyde-assisted isolation of regulatory elements followed by next-generation sequencing (FAIRE-seq) to map regions of open chromatin in three primary human blood cells of the myeloid lineage. In the precursors of platelets and erythrocytes, as well as in monocytes, we found that open chromatin signatures reflect the corresponding hematopoietic lineages of the studied cell types and associate with the cell type-specific gene expression patterns. Dependent on their signal strength, open chromatin regions showed correlation with promoter and enhancer histone marks, distance to the transcription start site, and ontology classes of nearby genes. Cell type-restricted regions of open chromatin were enriched in sequence variants associated with hematological indices. The majority (63.6%) of such candidate functional variants at platelet quantitative trait loci (QTLs) coincided with binding sites of five transcription factors key in regulating megakaryopoiesis. We experimentally tested 13 candidate regulatory variants at 10 platelet QTLs and found that 10 (76.9%) affected protein binding, suggesting that this is a frequent mechanism by which regulatory variants influence quantitative trait levels. Our findings demonstrate that combining large-scale GWA data with open chromatin profiles of relevant cell types can be a powerful means of dissecting the genetic architecture of closely related quantitative traits.

  2. Nucleotide sequence conservation of novel and established cis-regulatory sites within the tyrosine hydroxylase gene promoter

    PubMed Central

    Wang, Meng; Banerjee, Kasturi; Baker, Harriet; Cave, John W.


    Tyrosine hydroxylase (TH) is the rate-limiting enzyme in catecholamine biosynthesis and its gene proximal promoter ( < 1 kb upstream from the transcription start site) is essential for regulating transcription in both the developing and adult nervous systems. Several putative regulatory elements within the TH proximal promoter have been reported, but evolutionary conservation of these elements has not been thoroughly investigated. Since many vertebrate species are used to model development, function and disorders of human catecholaminergic neurons, identifying evolutionarily conserved transcription regulatory mechanisms is a high priority. In this study, we align TH proximal promoter nucleotide sequences from several vertebrate species to identify evolutionarily conserved motifs. This analysis identified three elements (a TATA box, cyclic AMP response element (CRE) and a 5′-GGTGG-3′ site) that constitute the core of an ancient vertebrate TH promoter. Focusing on only eutherian mammals, two regions of high conservation within the proximal promoter were identified: a ∼250 bp region adjacent to the transcription start site and a ∼85 bp region located approximately 350 bp further upstream. Within both regions, conservation of previously reported cis-regulatory motifs and human single nucleotide variants was evaluated. Transcription reporter assays in a TH -expressing cell line demonstrated the functionality of highly conserved motifs in the proximal promoter regions and electromobility shift assays showed that brain-region specific complexes assemble on these motifs. These studies also identified a non-canonical CRE binding (CREB) protein recognition element in the proximal promoter. Together, these studies provide a detailed analysis of evolutionary conservation within the TH promoter and identify potential cis-regulatory motifs that underlie a core set of regulatory mechanisms in mammals. PMID:25774193

  3. Levels of dendritic cell populations and regulatory T cells vary significantly between two commonly used mouse strains.


    Vogelsang, Petra; Hovden, Arnt-Ove; Jonsson, Roland; Appel, Silke


    Dendritic cells (DC) are a heterogeneous group of professional antigen-presenting cells (APC) involved in both initiating immune responses and maintaining tolerance. Roughly, DC can be divided into plasmacytoid DC (pDC) and conventional DC (cDC). By controlling regulatory T cells (Treg), DC can influence the outcome of both immunity and autoimmunity. Since the use of mice as in vivo models became a practical tool for researchers studying pathological events in all kind of human diseases, we decided to compare levels of cDC, pDC and Treg in both spleen and blood between two inbred mouse strains. Here we show that two commonly used mouse strains, BALB/c and C57BL/10J mice, have significantly different levels of distinct CD11c(+)/CD4(-)/CD8a(+), CD11c(+)/CD4(+)/CD8a(-) and CD11c(+)/CD4(-)/CD8a(-) cDC populations, pDC and Treg. Therefore, we emphasize the importance of considering the proper model when comparing data sets from different mouse strains.

  4. Use of a Drosophila Genome-Wide Conserved Sequence Database to Identify Functionally Related cis-Regulatory Enhancers

    PubMed Central

    Brody, Thomas; Yavatkar, Amarendra S; Kuzin, Alexander; Kundu, Mukta; Tyson, Leonard J; Ross, Jermaine; Lin, Tzu-Yang; Lee, Chi-Hon; Awasaki, Takeshi; Lee, Tzumin; Odenwald, Ward F


    Background: Phylogenetic footprinting has revealed that cis-regulatory enhancers consist of conserved DNA sequence clusters (CSCs). Currently, there is no systematic approach for enhancer discovery and analysis that takes full-advantage of the sequence information within enhancer CSCs. Results: We have generated a Drosophila genome-wide database of conserved DNA consisting of >100,000 CSCs derived from EvoPrints spanning over 90% of the genome. cis-Decoder database search and alignment algorithms enable the discovery of functionally related enhancers. The program first identifies conserved repeat elements within an input enhancer and then searches the database for CSCs that score highly against the input CSC. Scoring is based on shared repeats as well as uniquely shared matches, and includes measures of the balance of shared elements, a diagnostic that has proven to be useful in predicting cis-regulatory function. To demonstrate the utility of these tools, a temporally-restricted CNS neuroblast enhancer was used to identify other functionally related enhancers and analyze their structural organization. Conclusions: cis-Decoder reveals that co-regulating enhancers consist of combinations of overlapping shared sequence elements, providing insights into the mode of integration of multiple regulating transcription factors. The database and accompanying algorithms should prove useful in the discovery and analysis of enhancers involved in any developmental process. Developmental Dynamics 241:169–189, 2012. © 2011 Wiley Periodicals, Inc. Key findings A genome-wide catalog of Drosophila conserved DNA sequence clusters. cis-Decoder discovers functionally related enhancers. Functionally related enhancers share balanced sequence element copy numbers. Many enhancers function during multiple phases of development. PMID:22174086

  5. The nucleosome landscape of Plasmodium falciparum reveals chromatin architecture and dynamics of regulatory sequences.


    Kensche, Philip Reiner; Hoeijmakers, Wieteke Anna Maria; Toenhake, Christa Geeke; Bras, Maaike; Chappell, Lia; Berriman, Matthew; Bártfai, Richárd


    In eukaryotes, the chromatin architecture has a pivotal role in regulating all DNA-associated processes and it is central to the control of gene expression. For Plasmodium falciparum, a causative agent of human malaria, the nucleosome positioning profile of regulatory regions deserves particular attention because of their extreme AT-content. With the aid of a highly controlled MNase-seq procedure we reveal how positioning of nucleosomes provides a structural and regulatory framework to the transcriptional unit by demarcating landmark sites (transcription/translation start and end sites). In addition, our analysis provides strong indications for the function of positioned nucleosomes in splice site recognition. Transcription start sites (TSSs) are bordered by a small nucleosome-depleted region, but lack the stereotypic downstream nucleosome arrays, highlighting a key difference in chromatin organization compared to model organisms. Furthermore, we observe transcription-coupled eviction of nucleosomes on strong TSSs during intraerythrocytic development and demonstrate that nucleosome positioning and dynamics can be predictive for the functionality of regulatory DNA elements. Collectively, the strong nucleosome positioning over splice sites and surrounding putative transcription factor binding sites highlights the regulatory capacity of the nucleosome landscape in this deadly human pathogen.

  6. The downstream regulatory sequence of the adenovirus type 2 major late promoter is functionally redundant.

    PubMed Central

    Li, X C; Huang, W L; Flint, S J


    Mutagenesis of promoter sequences and oligonucleotide competition assays have been used to demonstrate the late-phase-specific stimulation of the adenovirus type 2 major late promoter is mediated by functionally redundant elements located between positions +75 and +125. These octamer motif-related sequences are recognized by multiple factors. Images PMID:1501301

  7. Development of molecular markers linked to disease resistance genes in common bean based on whole genome sequence.


    Meziadi, Chouaïb; Richard, Manon M S; Derquennes, Amandine; Thareau, Vincent; Blanchet, Sophie; Gratias, Ariane; Pflieger, Stéphanie; Geffroy, Valérie


    Common bean (Phaseolus vulgaris) is the most important grain legume for direct human consumption in the world, particularly in developing countries where it constitutes the main source of protein. Unfortunately, common bean yield stability is constrained by a number of pests and diseases. As use of resistant genotypes is the most economic and ecologically safe means for controlling plant diseases, efforts have been made to genetically characterize resistance genes (R genes) in common bean. Despite its agronomic importance, genomic resources available in common bean were limited until the recent sequencing of common bean genome (Andean genotype G19833). Besides allowing the annotation of Nucleotide Binding-Leucine Rich Repeat (NB-LRR) encoding gene family, which is the prevalent class of disease R genes in plants, access to the whole genome sequence of common bean can be of great help for intense selection to increase the overall efficiency of crop improvement programs using marker-assisted selection (MAS). This review presents the state of the art of common bean NB-LRR gene clusters, their peculiar location in subtelomeres and correlation with genetically characterized monogenic R genes, as well as how the availability of the whole genome sequence can boost the development of molecular markers for MAS.

  8. Construction and EST sequencing of full-length, drought stress cDNA libraries for common beans (Phaseolus vulgaris L.)

    PubMed Central


    Background Common bean is an important legume crop with only a moderate number of short expressed sequence tags (ESTs) made with traditional methods. The goal of this research was to use full-length cDNA technology to develop ESTs that would overlap with the beginning of open reading frames and therefore be useful for gene annotation of genomic sequences. The library was also constructed to represent genes expressed under drought, low soil phosphorus and high soil aluminum toxicity. We also undertook comparisons of the full-length cDNA library to two previous non-full clone EST sets for common bean. Results Two full-length cDNA libraries were constructed: one for the drought tolerant Mesoamerican genotype BAT477 and the other one for the acid-soil tolerant Andean genotype G19833 which has been selected for genome sequencing. Plants were grown in three soil types using deep rooting cylinders subjected to drought and non-drought stress and tissues were collected from both roots and above ground parts. A total of 20,000 clones were selected robotically, half from each library. Then, nearly 10,000 clones from the G19833 library were sequenced with an average read length of 850 nucleotides. A total of 4,219 unigenes were identified consisting of 2,981 contigs and 1,238 singletons. These were functionally annotated with gene ontology terms and placed into KEGG pathways. Compared to other EST sequencing efforts in common bean, about half of the sequences were novel or represented the 5' ends of known genes. Conclusions The present full-length cDNA libraries add to the technological toolbox available for common bean and our sequencing of these clones substantially increases the number of unique EST sequences available for the common bean genome. All of this should be useful for both functional gene annotation, analysis of splice site variants and intron/exon boundary determination by comparison to soybean genes or with common bean whole-genome sequences. In addition the

  9. Monte Carlo Simulations of the Post-Common-Envelope White-Dwarf Main-Sequence Binary Population

    SciTech Connect

    Camacho, Judit; Torres, Santiago; Garcia-Berro, Enrique; Schreiber, Matthias R.


    We present a detailed Monte Carlo simulator of the population of binary systems within the solar neighborhood. We have used the most up-to-date stellar evolutionary models, a complete treatment of the Roche lobe overflow episode, as well as a full implementation of the orbital evolution of the binary system. Preliminary results are presented for the population of white-dwarf main-sequence binaries, resulting from a common envelope episode. We also study the role played by the binding energy parameter, {lambda}, and by the common envelope efficiency, {alpha}{sub CE}. Finally, results are compared with the population of identified white-dwarf main-sequence binaries.

  10. A Catalog of Regulatory Sequences for Trait Gene for the Genome Editing of Wheat

    PubMed Central

    Makai, Szabolcs; Tamás, László; Juhász, Angéla


    Wheat has been cultivated for 10000 years and ever since the origin of hexaploid wheat it has been exempt from natural selection. Instead, it was under the constant selective pressure of human agriculture from harvest to sowing during every year, producing a vast array of varieties. Wheat has been adopted globally, accumulating variation for genes involved in yield traits, environmental adaptation and resistance. However, one small but important part of the wheat genome has hardly changed: the regulatory regions of both the x- and y-type high molecular weight glutenin subunit (HMW-GS) genes, which are alone responsible for approximately 12% of the grain protein content. The phylogeny of the HMW-GS regulatory regions of the Triticeae demonstrates that a genetic bottleneck may have led to its decreased diversity during domestication and the subsequent cultivation. It has also highlighted the fact that the wild relatives of wheat may offer an unexploited genetic resource for the regulatory region of these genes. Significant research efforts have been made in the public sector and by international agencies, using wild crosses to exploit the available genetic variation, and as a result synthetic hexaploids are now being utilized by a number of breeding companies. However, a newly emerging tool of genome editing provides significantly improved efficiency in exploiting the natural variation in HMW-GS genes and incorporating this into elite cultivars and breeding lines. Recent advancement in the understanding of the regulation of these genes underlines the needs for an overview of the regulatory elements for genome editing purposes. PMID:27766102

  11. A Catalog of Regulatory Sequences for Trait Gene for the Genome Editing of Wheat.


    Makai, Szabolcs; Tamás, László; Juhász, Angéla


    Wheat has been cultivated for 10000 years and ever since the origin of hexaploid wheat it has been exempt from natural selection. Instead, it was under the constant selective pressure of human agriculture from harvest to sowing during every year, producing a vast array of varieties. Wheat has been adopted globally, accumulating variation for genes involved in yield traits, environmental adaptation and resistance. However, one small but important part of the wheat genome has hardly changed: the regulatory regions of both the x- and y-type high molecular weight glutenin subunit (HMW-GS) genes, which are alone responsible for approximately 12% of the grain protein content. The phylogeny of the HMW-GS regulatory regions of the Triticeae demonstrates that a genetic bottleneck may have led to its decreased diversity during domestication and the subsequent cultivation. It has also highlighted the fact that the wild relatives of wheat may offer an unexploited genetic resource for the regulatory region of these genes. Significant research efforts have been made in the public sector and by international agencies, using wild crosses to exploit the available genetic variation, and as a result synthetic hexaploids are now being utilized by a number of breeding companies. However, a newly emerging tool of genome editing provides significantly improved efficiency in exploiting the natural variation in HMW-GS genes and incorporating this into elite cultivars and breeding lines. Recent advancement in the understanding of the regulation of these genes underlines the needs for an overview of the regulatory elements for genome editing purposes.

  12. Conservation of position and sequence of a novel, widely expressed gene containing the major human {alpha}-globin regulatory element

    SciTech Connect

    Vyas, P.; Vickers, M.A.; Picketts, D.J.; Higgs, D.R.


    We have determined the cDNA and genomic structure of a gene (-14 gene) that lies adjacent to the human {alpha}-globin cluster. Although it is expressed in a wide range of cell lines and tissues, a previously described erythroid-specific regulatory element that controls expression of the {alpha}-globin genes lies within intron 5 of this gene. Analysis of the -14 gene promoter shows that it is GC rich and associated with a constitutively expressed DNase 1 hypersensitive site; unlike the {alpha}-globin promoter, it does not contain a TATA or CCAAT box. These and other differences in promoter structure may explain why the erythroid regulatory element interacts specifically with the {alpha}-globin promoters and not the -14 gene promoter, which lies between the {alpha} promoters and their regulatory element. Interspecies comparisons demonstrate that the sequence and location of the -14 gene adjacent to the a cluster have been maintained since the bird/mammal divergence, 270 million years ago. 38 refs., 6 figs.

  13. In situ detection of a heat-shock regulatory element binding protein using a soluble synthetic enhancer sequence.

    PubMed Central

    Harel-Bellan, A; Brini, A T; Ferris, D K; Robin, P; Farrar, W L


    In various studies, enhancer binding proteins have been successfully absorbed out by competing sequences inserted into plasmids, resulting in the inhibition of the plasmid expression. Theoretically, such a result could be achieved using synthetic enhancer sequences not inserted into plasmids. In this study, a double stranded DNA sequence corresponding to the human heat shock regulatory element was chemically synthesized. By in vitro retardation assays, the synthetic sequence was shown to bind specifically a protein in extracts from the human T cell line Jurkat. When the synthetic enhancer was electroporated into Jurkat cells, not only the enhancer was shown to remain undegraded into the cells for up to 2 days, but also it was shown to bind intracellularly a protein. The binding was specific and was modulated upon heat shock. Furthermore, the binding protein was shown to be of the expected molecular weight by UV crosslinking. However, when the synthetic enhancer element was co-electroporated with an HSP 70-CAT reporter construct, the expression of the reporter plasmid was consistently enhanced in the presence of the exogenous synthetic enhancer. Images PMID:2740211

  14. Sox2 regulatory region 2 sequence works as a DNA nuclear targeting sequence enhancing the efficiency of an exogenous gene expression in ES cells.


    Funabashi, Hisakage; Takatsu, Makoto; Saito, Mikako; Matsuoka, Hideaki


    In this report, the effects of two DNA nuclear targeting sequence (DTS) candidates on the gene expression efficiency in ES cells were investigated. Reporter plasmids containing the simian virus 40 (SV40) promoter/enhancer sequence (SV40-DTS), a DTS for various types of cells but not being reported yet for ES cells, and the 81 base pairs of Sox2 regulatory region 2 (SRR2) where two transcriptional factors in ES cells, Oct3/4 and Sox2, are bound (SRR2-DTS), were introduced into cytoplasm in living cells by femtoinjection. The gene expression efficiencies of each plasmid in mouse insulinoma cell line MIN6 cells and mouse ES cells were then evaluated. Plasmids including SV40-DTS and SRR2-DTS exhibited higher gene expression efficiency comparing to plasmids without these DTSs, and thus it was concluded that both sequences work as a DTS in ES cells. In addition, it was suggested that SRR2-DTS works as an ES cell-specific DTS. To the best of our knowledge, this is the first report to confirm the function of DTSs in ES cells.

  15. Spatio-temporal sequence of cross-regulatory events in root meristem growth

    PubMed Central

    Scacchi, Emanuele; Salinas, Paula; Gujas, Bojan; Santuari, Luca; Krogan, Naden; Ragni, Laura; Berleth, Thomas; Hardtke, Christian S.


    A central question in developmental biology is how multicellular organisms coordinate cell division and differentiation to determine organ size. In Arabidopsis roots, this balance is controlled by cytokinin-induced expression of SHORT HYPOCOTYL 2 (SHY2) in the so-called transition zone of the meristem, where SHY2 negatively regulates auxin response factors (ARFs) by protein–protein interaction. The resulting down-regulation of PIN-FORMED (PIN) auxin efflux carriers is considered the key event in promoting differentiation of meristematic cells. Here we show that this regulation involves additional, intermediary factors and is spatio-temporally constrained. We found that the described cytokinin–auxin crosstalk antagonizes BREVIS RADIX (BRX) activity in the developing protophloem. BRX is an auxin-responsive target of the prototypical ARF MONOPTEROS (MP), a key promoter of vascular development, and transiently enhances PIN3 expression to promote meristem growth in young roots. At later stages, cytokinin induction of SHY2 in the vascular transition zone restricts BRX expression to down-regulate PIN3 and thus limit meristem growth. Interestingly, proper SHY2 expression requires BRX, which could reflect feedback on the auxin responsiveness of SHY2 because BRX protein can directly interact with MP, likely acting as a cofactor. Thus, cross-regulatory antagonism between BRX and SHY2 could determine ARF activity in the protophloem. Our data suggest a model in which the regulatory interactions favor BRX expression in the early proximal meristem and SHY2 prevails because of supplementary cytokinin induction in the later distal meristem. The complex equilibrium of this regulatory module might represent a universal switch in the transition toward differentiation in various developmental contexts. PMID:21149702

  16. Complete Chloroplast Genome Sequence of Tartary Buckwheat (Fagopyrum tataricum) and Comparative Analysis with Common Buckwheat (F. esculentum).


    Cho, Kwang-Soo; Yun, Bong-Kyoung; Yoon, Young-Ho; Hong, Su-Young; Mekapogu, Manjulatha; Kim, Kyung-Hee; Yang, Tae-Jin


    We report the chloroplast (cp) genome sequence of tartary buckwheat (Fagopyrum tataricum) obtained by next-generation sequencing technology and compared this with the previously reported common buckwheat (F. esculentum ssp. ancestrale) cp genome. The cp genome of F. tataricum has a total sequence length of 159,272 bp, which is 327 bp shorter than the common buckwheat cp genome. The cp gene content, order, and orientation are similar to those of common buckwheat, but with some structural variation at tandem and palindromic repeat frequencies and junction areas. A total of seven InDels (around 100 bp) were found within the intergenic sequences and the ycf1 gene. Copy number variation of the 21-bp tandem repeat varied in F. tataricum (four repeats) and F. esculentum (one repeat), and the InDel of the ycf1 gene was 63 bp long. Nucleotide and amino acid have highly conserved coding sequence with about 98% homology and four genes--rpoC2, ycf3, accD, and clpP--have high synonymous (Ks) value. PCR based InDel markers were applied to diverse genetic resources of F. tataricum and F. esculentum, and the amplicon size was identical to that expected in silico. Therefore, these InDel markers are informative biomarkers to practically distinguish raw or processed buckwheat products derived from F. tataricum and F. esculentum.

  17. Complete Chloroplast Genome Sequence of Tartary Buckwheat (Fagopyrum tataricum) and Comparative Analysis with Common Buckwheat (F. esculentum)

    PubMed Central

    Cho, Kwang-Soo; Yun, Bong-Kyoung; Yoon, Young-Ho; Hong, Su-Young; Mekapogu, Manjulatha; Kim, Kyung-Hee; Yang, Tae-Jin


    We report the chloroplast (cp) genome sequence of tartary buckwheat (Fagopyrum tataricum) obtained by next-generation sequencing technology and compared this with the previously reported common buckwheat (F. esculentum ssp. ancestrale) cp genome. The cp genome of F. tataricum has a total sequence length of 159,272 bp, which is 327 bp shorter than the common buckwheat cp genome. The cp gene content, order, and orientation are similar to those of common buckwheat, but with some structural variation at tandem and palindromic repeat frequencies and junction areas. A total of seven InDels (around 100 bp) were found within the intergenic sequences and the ycf1 gene. Copy number variation of the 21-bp tandem repeat varied in F. tataricum (four repeats) and F. esculentum (one repeat), and the InDel of the ycf1 gene was 63 bp long. Nucleotide and amino acid have highly conserved coding sequence with about 98% homology and four genes—rpoC2, ycf3, accD, and clpP—have high synonymous (Ks) value. PCR based InDel markers were applied to diverse genetic resources of F. tataricum and F. esculentum, and the amplicon size was identical to that expected in silico. Therefore, these InDel markers are informative biomarkers to practically distinguish raw or processed buckwheat products derived from F. tataricum and F. esculentum. PMID:25966355

  18. Common 5S rRNA variants are likely to be accepted in many sequence contexts

    NASA Technical Reports Server (NTRS)

    Zhang, Zhengdong; D'Souza, Lisa M.; Lee, Youn-Hyung; Fox, George E.


    Over evolutionary time RNA sequences which are successfully fixed in a population are selected from among those that satisfy the structural and chemical requirements imposed by the function of the RNA. These sequences together comprise the structure space of the RNA. In principle, a comprehensive understanding of RNA structure and function would make it possible to enumerate which specific RNA sequences belong to a particular structure space and which do not. We are using bacterial 5S rRNA as a model system to attempt to identify principles that can be used to predict which sequences do or do not belong to the 5S rRNA structure space. One promising idea is the very intuitive notion that frequently seen sequence changes in an aligned data set of naturally occurring 5S rRNAs would be widely accepted in many other 5S rRNA sequence contexts. To test this hypothesis, we first developed well-defined operational definitions for a Vibrio region of the 5S rRNA structure space and what is meant by a highly variable position. Fourteen sequence variants (10 point changes and 4 base-pair changes) were identified in this way, which, by the hypothesis, would be expected to incorporate successfully in any of the known sequences in the Vibrio region. All 14 of these changes were constructed and separately introduced into the Vibrio proteolyticus 5S rRNA sequence where they are not normally found. Each variant was evaluated for its ability to function as a valid 5S rRNA in an E. coli cellular context. It was found that 93% (13/14) of the variants tested are likely valid 5S rRNAs in this context. In addition, seven variants were constructed that, although present in the Vibrio region, did not meet the stringent criteria for a highly variable position. In this case, 86% (6/7) are likely valid. As a control we also examined seven variants that are seldom or never seen in the Vibrio region of 5S rRNA sequence space. In this case only two of seven were found to be potentially valid. The

  19. The Effects of Common Knowledge Construction Model Sequence of Lessons on Science Achievement and Relational Conceptual Change

    ERIC Educational Resources Information Center

    Ebenezer, Jazlin; Chacko, Sheela; Kaya, Osman Nafiz; Koya, Satya Kiran; Ebenezer, Devairakkam Luke


    The purpose of this study was to investigate the effects of the Common Knowledge Construction Model (CKCM) lesson sequence, an intervention based both in conceptual change theory and in Phenomenography, a subset of conceptual change theory. A mixed approach was used to investigate whether this model had a significant effect on 7th grade students'…

  20. Oxytocin receptor gene sequences in owl monkeys and other primates show remarkable interspecific regulatory and protein coding variation.


    Babb, Paul L; Fernandez-Duque, Eduardo; Schurr, Theodore G


    The oxytocin (OT) hormone pathway is involved in numerous physiological processes, and one of its receptor genes (OXTR) has been implicated in pair bonding behavior in mammalian lineages. This observation is important for understanding social monogamy in primates, which occurs in only a small subset of taxa, including Azara's owl monkey (Aotus azarae). To examine the potential relationship between social monogamy and OXTR variation, we sequenced its 5' regulatory (4936bp) and coding (1167bp) regions in 25 owl monkeys from the Argentinean Gran Chaco, and examined OXTR sequences from 1092 humans from the 1000 Genomes Project. We also assessed interspecific variation of OXTR in 25 primate and rodent species that represent a set of phylogenetically and behaviorally disparate taxa. Our analysis revealed substantial variation in the putative 5' regulatory region of OXTR, with marked structural differences across primate taxa, particularly for humans and chimpanzees, which exhibited unique patterns of large motifs of dinucleotide A+T repeats upstream of the OXTR 5' UTR. In addition, we observed a large number of amino acid substitutions in the OXTR CDS region among New World primate taxa that distinguish them from Old World primates. Furthermore, primate taxa traditionally defined as socially monogamous (e.g., gibbons, owl monkeys, titi monkeys, and saki monkeys) all exhibited different amino acid motifs for their respective OXTR protein coding sequences. These findings support the notion that monogamy has evolved independently in Old World and New World primates, and that it has done so through different molecular mechanisms, not exclusively through the oxytocin pathway.

  1. Patterns and Sequences: Interactive Exploration of Clickstreams to Understand Common Visitor Paths.


    Liu, Zhicheng; Wang, Yang; Dontcheva, Mira; Hoffman, Matthew; Walker, Seth; Wilson, Alan


    Modern web clickstream data consists of long, high-dimensional sequences of multivariate events, making it difficult to analyze. Following the overarching principle that the visual interface should provide information about the dataset at multiple levels of granularity and allow users to easily navigate across these levels, we identify four levels of granularity in clickstream analysis: patterns, segments, sequences and events. We present an analytic pipeline consisting of three stages: pattern mining, pattern pruning and coordinated exploration between patterns and sequences. Based on this approach, we discuss properties of maximal sequential patterns, propose methods to reduce the number of patterns and describe design considerations for visualizing the extracted sequential patterns and the corresponding raw sequences. We demonstrate the viability of our approach through an analysis scenario and discuss the strengths and limitations of the methods based on user feedback.

  2. Complete Genome Sequences of Three Rhizobium gallicum Symbionts Associated with Common Bean (Phaseolus vulgaris)

    PubMed Central

    Bustos, Patricia; Santamaría, Rosa Isela; Pérez-Carrascal, Olga María; Acosta, José Luis; Lozano, Luis; Juárez, Soledad; Martínez-Romero, Esperanza; Cevallos, Miguel Ángel; Romero, David; Dávila, Guillermo; Vinuesa, Pablo; Miranda, Fabiola; Ormeño, Ernesto


    ABSTRACT The whole-genome sequences of three strains of Rhizobium gallicum reported here support the concept that the distinct nodulation host ranges displayed by the symbiovars gallicum and phaseoli can be largely explained by different symbiotic plasmids. PMID:28302777

  3. Draft Genome Sequence of Catellicoccus marimammalium, a Novel Species Commonly Found in Gull Feces

    EPA Science Inventory

    Catellicoccus marimammalium is a relatively uncharacterized Gram-positive, facultative anaerobe with potential utility as an indicator of waterfowl fecal contamination. Here we report an annotated draft genome sequence that suggests this organism may be a symbiotic gut microbe.

  4. Identification of a novel regulatory sequence of actin nucleation promoting factor encoded by Autographa californica multiple nucleopolyhedrovirus.


    Wang, Yun; Zhang, Yongli; Han, Shili; Hu, Xue; Zhou, Yuan; Mu, Jingfang; Pei, Rongjuan; Wu, Chunchen; Chen, Xinwen


    Actin polymerization induced by nucleation promoting factors (NPFs) is one of the most fundamental biological processes in eukaryotic cells. NPFs contain a conserved output domain (VCA domain) near the C terminus, which interacts with and activates the cellular actin-related protein 2/3 complex (Arp2/3) to induce actin polymerization and a diverse regulatory domain near the N terminus. Autographa californica multiple nucleopolyhedrovirus (AcMNPV) nucleocapsid protein P78/83 is a virus-encoded NPF that contains a C-terminal VCA domain and induces actin polymerization in virus-infected cells. However, there is no similarity between the N terminus of P78/83 and that of other identified NPFs, suggesting that P78/83 may possess a unique regulatory mechanism. In this study, we identified a multifunctional regulatory sequence (MRS) located near the N terminus of P78/83 and determined that one of its functions is to serve as a degron to mediate P78/83 degradation in a proteasome-dependent manner. In AcMNPV-infected cells, the MRS also binds to another nucleocapsid protein, BV/ODV-C42, which stabilizes P78/83 and modulates the P78/83-Arp2/3 interaction to orchestrate actin polymerization. In addition, the MRS is also essential for the incorporation of P78/83 into the nucleocapsid, ensuring virion mobility powered by P78/83-induced actin polymerization. The triple functions of the MRS enable P78/83 to serve as an essential viral protein in the AcMNPV replication cycle, and the possible roles of the MRS in orchestrating the virus-induced actin polymerization and viral genome decapsidation are discussed.

  5. Mutation analysis of TRPS1 gene including core promoter, 5'UTR, and 3'UTR regulatory sequences with insight into their organization.


    Solc, Roman; Klugerova, Michaela; Vcelak, Josef; Baxova, Alice; Kuklik, Miloslav; Vseticka, Jan; Beharka, Rastislav; Hirschfeldova, Katerina


    The TRPS1 protein is a potent regulator of proliferation, differentiation, and apoptosis. The TRPS1 gene aberrations are strongly associated with rare trichorhinophalangeal syndrome (TRPS) development. We have conducted MLPA analysis to capture deletion within the crucial 8q24.1 chromosomal region in combination with mutation analysis of TRPS1 gene including core promoter, 5'UTR, and 3'UTR sequences in nine TRPS patients. Low complexity or extent of untranslated regulatory sequences avoided them from analysis in previous studies. Amplicon based next generation sequencing used in our study bridge over these technical limitations. Finally, we have made extended in silico analysis of TRPS1 gene regulatory sequences organization. Single contiguous deletion and an intragenic deletion intervening several exons were detected. Mutation analysis revealed five TRPS1 gene aberrations (two structural rearrangements, two nonsense mutations, and one missense substitution) reaching the overall detection rate of 78%. Several polymorphic variants were detected within the analysed regulatory sequences but without proposed pathogenic effect. In silico analysis suggested alternative promoter usage and diverse expression effectivity for different TRPS1 transcripts. Haploinsufficiency of TRPS1 gene was responsible for most of the TRPS phenotype. Structure of TRPS1 gene regulatory sequences is indicative of generally low single allele expression and its tight control.

  6. A variant in the sonic hedgehog regulatory sequence (ZRS) is associated with triphalangeal thumb and deregulates expression in the developing limb

    PubMed Central

    Furniss, Dominic; Lettice, Laura A.; Taylor, Indira B.; Critchley, Paul S.; Giele, Henk; Hill, Robert E.; Wilkie, Andrew O.M.


    A locus for triphalangeal thumb, variably associated with pre-axial polydactyly, was previously identified in the zone of polarizing activity regulatory sequence (ZRS), a long range limb-specific enhancer of the Sonic Hedgehog (SHH) gene at human chromosome 7q36.3. Here, we demonstrate that a 295T>C variant in the human ZRS, previously thought to represent a neutral polymorphism, acts as a dominant allele with reduced penetrance. We found this variant in three independently ascertained probands from southern England with triphalangeal thumb, demonstrated significant linkage of the phenotype to the variant (LOD = 4.1), and identified a shared microsatellite haplotype around the ZRS, suggesting that the probands share a common ancestor. An individual homozygous for the 295C allele presented with isolated bilateral triphalangeal thumb resembling the heterozygous phenotype, suggesting that the variant is largely dominant to the wild-type allele. As a functional test of the pathogenicity of the 295C allele, we utilized a mutated ZRS construct to demonstrate that it can drive ectopic anterior expression of a reporter gene in the developing mouse forelimb. We conclude that the 295T>C variant is in fact pathogenic and, in southern England, appears to be the most common cause of triphalangeal thumb. Depending on the dispersal of the founding mutation, it may play a wider role in the aetiology of this disorder. PMID:18463159

  7. Full length nucleotide sequences of 30 common SLC44A2 alleles encoding human neutrophil antigen-3 (HNA-3)

    PubMed Central

    Chen, Qing; Srivastava, Kshitij; Ardinski, Stefanie C.; Lam, Kevin; Huvard, Michael J.; Schmid, Pirmin; Flegel, Willy A.


    Background HNA-3a alloantibodies can cause severe transfusion-related acute lung injury (TRALI). The frequency of the single nucleotide polymorphisms (SNPs) indicative of the two clinically relevant HNA-3a/b antigens are known in many populations. In the present study, we determined the full length nucleotide sequence of common SLC44A2 alleles encoding the choline transporter-like protein-2 (CTL2) that harbors HNA-3a/b antigens. Study design and methods A method was devised to determine the full length coding sequence and adjacent intron sequences from genomic DNA by 8 polymerase chain reaction (PCR) amplifications covering all 22 SLC44A2 exons. Samples from 200 African American, 96 Caucasian, 2 Hispanic and 4 Asian blood donors were analyzed. We developed a decision tree to determine alleles (confirmed haplotypes) from the genotype data. Results A total of 10 SNPs were detected in the SLC44A2 coding sequence. The non-coding sequences harbored an additional 28 SNPs (1 in the 5’-untranslated region (UTR); 23 in the introns; and 4 in the 3’-UTR). No SNP indicative of a non-functional allele was detected. The nucleotide sequences for 30 SLC44A2 alleles (haplotypes) were confirmed. There may be 66 haplotypes among the 604 chromosomes screened. Conclusions We found 38 SNPs, including 1 novel SNP, in 8192 nucleotides covering the coding sequence of the SLC44A2 gene among 302 blood donors. Population frequencies of these SNPs were established for African Americans and Caucasians. Because alleles encoding HNA-3b are more common than non-functional SLC44A2 alleles, we confirmed our previous postulate that African American donors are less likely to form HNA-3a antibodies compared to Caucasians. PMID:26437811

  8. Draft Genome Sequence of Acholeplasma laidlawii, a Common Contaminant of Cell Cultures.


    Siqueira, Franciele Maboni; Cibulski, Samuel Paulo; Teixeira, Thais Fumaco; Mayer, Fabiana Quoos; Roehe, Paulo Michel


    Mollicutes are important cell culture contaminants which may eventually affect the results of biological assays or affect their interpretation. Acholeplasma laidlawii is one of the most frequent contaminants of cell cultures. Here, we report the complete genome sequence of A. laidlawii strain MDBK/IPV, recovered from Madin-Darby bovine kidney (MDBK) cells.

  9. Draft Genome Sequence of Acholeplasma laidlawii, a Common Contaminant of Cell Cultures

    PubMed Central

    Siqueira, Franciele Maboni; Cibulski, Samuel Paulo; Teixeira, Thais Fumaco; Mayer, Fabiana Quoos


    ABSTRACT Mollicutes are important cell culture contaminants which may eventually affect the results of biological assays or affect their interpretation. Acholeplasma laidlawii is one of the most frequent contaminants of cell cultures. Here, we report the complete genome sequence of A. laidlawii strain MDBK/IPV, recovered from Madin-Darby bovine kidney (MDBK) cells. PMID:28153907

  10. Maternal stress, preterm birth, and DNA methylation at imprint regulatory sequences in humans.


    Vidal, Adriana C; Benjamin Neelon, Sara E; Liu, Ying; Tuli, Abbas M; Fuemmeler, Bernard F; Hoyo, Cathrine; Murtha, Amy P; Huang, Zhiqing; Schildkraut, Joellen; Overcash, Francine; Kurtzberg, Joanne; Jirtle, Randy L; Iversen, Edwin S; Murphy, Susan K


    In infants exposed to maternal stress in utero, phenotypic plasticity through epigenetic events may mechanistically explain increased risk of preterm birth (PTB), which confers increased risk for neurodevelopmental disorders, cardiovascular disease, and cancers in adulthood. We examined associations between prenatal maternal stress and PTB, evaluating the role of DNA methylation at imprint regulatory regions. We enrolled women from prenatal clinics in Durham, NC. Stress was measured in 537 women at 12 weeks of gestation using the Perceived Stress Scale. DNA methylation at differentially methylated regions (DMRs) associated with H19, IGF2, MEG3, MEST, SGCE/PEG10, PEG3, NNAT, and PLAGL1 was measured from peripheral and cord blood using bisulfite pyrosequencing in a sub-sample of 79 mother-infant pairs. We examined associations between PTB and stress and evaluated differences in DNA methylation at each DMR by stress. Maternal stress was not associated with PTB (OR = 0.98; 95% CI, 0.40-2.40; P = 0.96), after adjustment for maternal body mass index (BMI), income, and raised blood pressure. However, elevated stress was associated with higher infant DNA methylation at the MEST DMR (2.8% difference, P < 0.01) after adjusting for PTB. Maternal stress may be associated with epigenetic changes at MEST, a gene relevant to maternal care and obesity. Reduced prenatal stress may support the epigenomic profile of a healthy infant.

  11. Inverted duplication of histone genes in chicken and disposition of regulatory sequences.

    PubMed Central

    Wang, S W; Robins, A J; d'Andrea, R; Wells, J R


    Sequence analysis of an 8.4 kb fragment containing five chicken histone genes shows that an H4-H2A gene pair is duplicated and inverted around a central H3 gene. A left and right region, each of 2.1 kb are 97% homologous and the boundaries of homology coincide with ten base pair repeats. These boundary regions also contain highly conserved gene promoter elements, suggesting that interaction of transcriptional machinery with histone genes may be connected with recombination in promoter regions, resulting in the inverted duplication structure seen in this cluster. PMID:4000938

  12. De novo assembly and characterization of the spleen transcriptome of common carp (Cyprinus carpio) using Illumina paired-end sequencing.


    Li, Guoxi; Zhao, Yinli; Liu, Zhonghu; Gao, Chunsheng; Yan, Fengbin; Liu, Bianzhi; Feng, Jianxin


    Common carp (Cyprinus carpio) is one of the most important aquacultured species of the family Cyprinidae, and breeding this species for disease resistance is becoming more and more important. However, at the genome or transcriptome levels, study of the immunogenetics of disease resistance in the common carp is lacking. In this study, 60,316,906 and 75,200,328 paired-end clean reads were obtained from two cDNA libraries of the common carp spleen by Illumina paired-end sequencing technology. Totally, 130,293 unique transcript fragments (unigenes) were assembled, with an average length of 1400.57 bp. Approximately 105,612 (81.06%) unigenes could be annotated according to their homology with matches in the Nr, Nt, Swiss-Prot, COG, GO, or KEGG databases, and they were found to represent 46,747 non-redundant genes. Comparative analysis showed that 59.82% of the unigenes have significant similarity to zebrafish Refseq proteins. Gene expression comparison revealed that 10,432 and 6889 annotated unigenes were, respectively, up- and down-regulated with at least twofold changes between two developmental stages of the common carp spleen. Gene ontology and KEGG analysis were performed to classify all unigenes into functional categories for understanding gene functions and regulation pathways. In addition, 46,847 simple sequence repeats (SSRs) were detected from 35,618 unigenes, and a large number of single nucleotide polymorphism (SNP) and insertion/deletion (INDEL) sites were identified in the spleen transcriptome of common carp. This study has characterized the spleen transcriptome of the common carp for the first time, providing a valuable resource for a better understanding of the common carp immune system and defense mechanisms. This knowledge will also facilitate future functional studies on common carp immunogenetics that may eventually be applied in breeding programs.

  13. [Examination of processed vegetable foods for the presence of common DNA sequences of genetically modified tomatoes].


    Kitagawa, Mamiko; Nakamura, Kosuke; Kondo, Kazunari; Ubukata, Shoji; Akiyama, Hiroshi


    The contamination of processed vegetable foods with genetically modified tomatoes was investigated by the use of qualitative PCR methods to detect the cauliflower mosaic virus 35S promoter (P35S) and the kanamycin resistance gene (NPTII). DNA fragments of P35S and NPTII were detected in vegetable juice samples, possibly due to contamination with the genomes of cauliflower mosaic virus infecting juice ingredients of Brassica species and soil bacteria, respectively. Therefore, to detect the transformation construct sequences of GM tomatoes, primer pairs were designed for qualitative PCR to specifically detect the border region between P35S and NPTII, and the border region between nopaline synthase gene promoter and NPTII. No amplification of the targeted sequences was observed using genomic DNA purified from the juice ingredients. The developed qualitative PCR method is considered to be a reliable tool to check contamination of products with GM tomatoes.

  14. Identification of regulatory sequences in the gene for 5-aminolevulinate synthase from rat.


    Braidotti, G; Borthwick, I A; May, B K


    The housekeeping enzyme 5-aminolevulinate synthase (ALAS) regulates the supply of heme for respiratory cytochromes. Here we report on the isolation of a genomic clone for the rat ALAS gene. The 5'-flanking region was fused to the chloramphenicol acetyltransferase gene and transient expression analysis revealed the presence of both positive and negative cis-acting sequences. Expression was substantially increased by the inclusion of the first intron located in the 5'-untranslated region. Sequence analysis of the promoter identified two elements at positions -59 and -88 bp with strong similarity to the binding site for nuclear respiratory factor 1 (NRF-1). Gel shift analysis revealed that both NRF-1 elements formed nucleoprotein complexes which could be abolished by an authentic NRF-1 oligomer. Mutagenesis of each NRF-1 motif in the ALAS promoter gave substantially lowered levels of chloramphenicol acetyltransferase expression, whereas mutagenesis of both NRF-1 motifs resulted in the almost complete loss of expression. These results establish that the NRF-1 motifs in the ALAS promoter are critical for promoter activity. NRF-1 binding sites have been identified in the promoters of several nuclear genes encoding mitochondrial proteins concerned with oxidative phosphorylation. The present studies suggest that NRF-1 may co-ordinate the supply of mitochondrial heme with the synthesis of respiratory cytochromes by regulating expression of ALAS. In erythroid cells, NRF-1 may be less important for controlling heme levels since an erythroid ALAS gene is strongly expressed and the promoter for this gene apparently lacks NRF-1 binding sites.

  15. The genome sequence of Geobacter metallireducens: features of metabolism, physiology and regulation common and dissimilar to Geobacter sulfurreducens

    SciTech Connect

    Aklujkar, Muktak; Krushkal, Julia; DiBartolo, Genevieve; Lapidus, Alla L.; Land, Miriam L; Lovley, Derek


    Background. The genome sequence of Geobacter metallireducens is the second to be completed from the metal-respiring genus Geobacter, and is compared in this report to that of Geobacter sulfurreducens in order to understand their metabolic, physiological and regulatory similarities and differences. Results. The experimentally observed greater metabolic versatility of G. metallireducens versus G. sulfurreducens is borne out by the presence of more numerous genes for metabolism of organic acids including acetate, propionate, and pyruvate. Although G. metallireducens lacks a dicarboxylic acid transporter, it has acquired a second succinate dehydrogenase/fumarate reductase complex, suggesting that respiration of fumarate was important until recently in its evolutionary history. Vestiges of the molybdate (ModE) regulon of G. sulfurreducens can be detected in G. metallireducens, which has lost the global regulatory protein ModE but retained some putative ModE-binding sites and multiplied certain genes of molybdenum cofactor biosynthesis. Several enzymes of amino acid metabolism are of different origin in the two species, but significant patterns of gene organization are conserved. Whereas most Geobacteraceae are predicted to obtain biosynthetic reducing equivalents from electron transfer pathways via a ferredoxin oxidoreductase, G. metallireducens can derive them from the oxidative pentose phosphate pathway. In addition to the evidence of greater metabolic versatility, the G. metallireducens genome is also remarkable for the abundance of multicopy nucleotide sequences found in intergenic regions and even within genes. Conclusion. The genomic evidence suggests that metabolism, physiology Background. The genome sequence of Geobacter metallireducens is the second to be completed from the metal-respiring genus Geobacter, and is compared in this report to that of Geobacter sulfurreducens in order to understand their metabolic, physiological and regulatory similarities and

  16. A 454 sequencing approach for large scale phylogenomic analysis of the common emperor scorpion (Pandinus imperator).


    Roeding, Falko; Borner, Janus; Kube, Michael; Klages, Sven; Reinhardt, Richard; Burmester, Thorsten


    In recent years, phylogenetic tree reconstructions that rely on multiple gene alignments that had been deduced from expressed sequence tags (ESTs) have become a popular method in molecular systematics. Here, we present a 454 pyrosequencing approach to infer the transcriptome of the Emperor scorpion Pandinus imperator. We obtained 428,844 high-quality reads (mean length=223+/-50 b) from total cDNA, which were assembled into 8334 contigs (mean length 422+/-313 bp) and 26,147 singletons. About 1200 contigs were successfully annotated by BLAST and orthology search. Specific analyses of eight distinct hemocyanin sequences provided further proof for the quality of the 454 reads and the assembly process. The P. imperator sequences were included in a concatenated alignment of 149 orthologous genes of 67 metazoan taxa that covers 39,842 amino acids. After removal of low-quality regions, 11,168 positions were employed for phylogenetic reconstructions. Using Bayesian and maximum likelihood methods, we obtained strongly supported monophyletic Ecdysozoa, Arthropoda (excluding Tardigrada), Euarthropoda, Pancrustacea and Hexapoda. We also recovered the Myriochelata (Chelicerata+Myriapoda). Within the chelicerates, Pycnogonida form the sister group of Euchelicerata. However, Arachnida were found paraphyletic because the Acari (mites and ticks) were recovered as sister group of a clade comprising Xiphosura, Scorpiones and Araneae. In summary, we have shown that 454 pyrosequencing is a cost-effective method that provides sufficient data and coverage depth for gene detection and multigene-based phylogenetic analyses.

  17. One common structural feature of "words" in protein sequences and human texts.


    Zemková, M; Trifonov, E N; Zahradník, D


    Frequently discussed analogy between genetic and human texts is explored by comparison of alternation of polar and non-polar amino-acid residues in proteins and alternation of consonants and vowels in human texts. In human languages, the usage of possible combinations of consonants and vowels is influenced by pronounceability of the combinations. Similarly, oligopeptide composition of proteins is influenced by requirements of protein folding and stability. One special type of structure often present in proteins is amphipathic α-helices in which polar and non-polar amino acids alternate with the period 3.5 residues, not unlike alternation of consonants and vowels. In this study, we evaluated the contribution made by amphipathic alternations to the protein sequence texts (20-24%). Their proportion is lower than respective values for alternating words in human texts (57-89%). The proteomes (full sets of proteins for selected organisms) were transformed into ranked sequences of n-grams (words of length n), including periodical amphipathic structures. Similarly, human texts were transformed into sequences of alternating consonants and vowels. Analysis of the vocabularies shows that in both types of texts (human languages and proteins) the alternating words are dominant or highly preferred, thus, strengthening the analogy between these two types of texts. The contribution of amphipathic words in the upper parts of the ranked lists for 10 analyzed proteomes varies between 58 and 74%. In human texts respective values range between 90 and 100%.

  18. 'In silico expression analysis', a novel PathoPlant web tool to identify abiotic and biotic stress conditions associated with specific cis-regulatory sequences.


    Bolívar, Julio C; Machens, Fabian; Brill, Yuri; Romanov, Artyom; Bülow, Lorenz; Hehl, Reinhard


    Using bioinformatics, putative cis-regulatory sequences can be easily identified using pattern recognition programs on promoters of specific gene sets. The abundance of predicted cis-sequences is a major challenge to associate these sequences with a possible function in gene expression regulation. To identify a possible function of the predicted cis-sequences, a novel web tool designated 'in silico expression analysis' was developed that correlates submitted cis-sequences with gene expression data from Arabidopsis thaliana. The web tool identifies the A. thaliana genes harbouring the sequence in a defined promoter region and compares the expression of these genes with microarray data. The result is a hierarchy of abiotic and biotic stress conditions to which these genes are most likely responsive. When testing the performance of the web tool, known cis-regulatory sequences were submitted to the 'in silico expression analysis' resulting in the correct identification of the associated stress conditions. When using a recently identified novel elicitor-responsive sequence, a WT-box (CGACTTTT), the 'in silico expression analysis' predicts that genes harbouring this sequence in their promoter are most likely Botrytis cinerea induced. Consistent with this prediction, the strongest induction of a reporter gene harbouring this sequence in the promoter is observed with B. cinerea in transgenic A. thaliana. DATABASE URL:

  19. Application of whole genome and RNA sequencing to investigate the genomic landscape of common variable immunodeficiency disorders.


    van Schouwenburg, Pauline A; Davenport, Emma E; Kienzler, Anne-Kathrin; Marwah, Ishita; Wright, Benjamin; Lucas, Mary; Malinauskas, Tomas; Martin, Hilary C; Lockstone, Helen E; Cazier, Jean-Baptiste; Chapel, Helen M; Knight, Julian C; Patel, Smita Y


    Common Variable Immunodeficiency Disorders (CVIDs) are the most prevalent cause of primary antibody failure. CVIDs are highly variable and a genetic causes have been identified in <5% of patients. Here, we performed whole genome sequencing (WGS) of 34 CVID patients (94% sporadic) and combined them with transcriptomic profiling (RNA-sequencing of B cells) from three patients and three healthy controls. We identified variants in CVID disease genes TNFRSF13B, TNFRSF13C, LRBA and NLRP12 and enrichment of variants in known and novel disease pathways. The pathways identified include B-cell receptor signalling, non-homologous end-joining, regulation of apoptosis, T cell regulation and ICOS signalling. Our data confirm the polygenic nature of CVID and suggest individual-specific aetiologies in many cases. Together our data show that WGS in combination with RNA-sequencing allows for a better understanding of CVIDs and the identification of novel disease associated pathways.

  20. The genome sequence of Geobacter metallireducens: features of metabolism, physiology and regulation common and dissimilar to Geobacter sulfurreducens

    SciTech Connect

    Aklujkar, Muktak; Krushkal, Julia; DiBartolo, Genevieve; Lapidus, Alla; Land, Miriam L.; Lovley, Derek R.


    Background: The genome sequence of Geobacter metallireducens is the second to be completed from the metal-respiring genus Geobacter, and is compared in this report to that of Geobacter sulfurreducens in order to understand their metabolic, physiological and regulatory similarities and differences. Results: The experimentally observed greater metabolic versatility of G. metallireducens versus G. sulfurreducens is borne out by the presence of more numerous genes for metabolism of organic acids including acetate, propionate, and pyruvate. Although G. metallireducens lacks a dicarboxylic acid transporter, it has acquired a second succinate dehydrogenase/fumarate reductase complex, suggesting that respiration of fumarate was important until recently in its evolutionary history. Vestiges of the molybdate (ModE) regulon of G. sulfurreducens can be detected in G. metallireducens, which has lost the global regulatory protein ModE but retained some putative ModE-binding sites and multiplied certain genes of molybdenum cofactor biosynthesis. Several enzymes of amino acid metabolism are of different origin in the two species, but significant patterns of gene organization are conserved. Whereas most Geobacteraceae are predicted to obtain biosynthetic reducing equivalents from electron transfer pathways via a ferredoxin oxidoreductase, G. metallireducens can derive them from the oxidative pentose phosphate pathway. In addition to the evidence of greater metabolic versatility, the G. metallireducens genome is also remarkable for the abundance of multicopy nucleotide sequences found in intergenic regions and even within genes. Conclusion: The genomic evidence suggests that metabolism, physiology and regulation of gene expression in G. metallireducens may be dramatically different from other Geobacteraceae.

  1. The genome sequence of Geobacter metallireducens: features of metabolism, physiology and regulation common and dissimilar to Geobacter sulfurreducens

    PubMed Central


    Background The genome sequence of Geobacter metallireducens is the second to be completed from the metal-respiring genus Geobacter, and is compared in this report to that of Geobacter sulfurreducens in order to understand their metabolic, physiological and regulatory similarities and differences. Results The experimentally observed greater metabolic versatility of G. metallireducens versus G. sulfurreducens is borne out by the presence of more numerous genes for metabolism of organic acids including acetate, propionate, and pyruvate. Although G. metallireducens lacks a dicarboxylic acid transporter, it has acquired a second putative succinate dehydrogenase/fumarate reductase complex, suggesting that respiration of fumarate was important until recently in its evolutionary history. Vestiges of the molybdate (ModE) regulon of G. sulfurreducens can be detected in G. metallireducens, which has lost the global regulatory protein ModE but retained some putative ModE-binding sites and multiplied certain genes of molybdenum cofactor biosynthesis. Several enzymes of amino acid metabolism are of different origin in the two species, but significant patterns of gene organization are conserved. Whereas most Geobacteraceae are predicted to obtain biosynthetic reducing equivalents from electron transfer pathways via a ferredoxin oxidoreductase, G. metallireducens can derive them from the oxidative pentose phosphate pathway. In addition to the evidence of greater metabolic versatility, the G. metallireducens genome is also remarkable for the abundance of multicopy nucleotide sequences found in intergenic regions and even within genes. Conclusion The genomic evidence suggests that metabolism, physiology and regulation of gene expression in G. metallireducens may be dramatically different from other Geobacteraceae. PMID:19473543

  2. Multilocus sequence analysis of Bacillus thuringiensis serovars navarrensis, bolivia and vazensis and Bacillus weihenstephanensis reveals a common phylogeny.


    Soufiane, Brahim; Baizet, Mathilde; Côté, Jean-Charles


    The Bacillus cereus group sensu lato includes six closely-related bacterial species: Bacillus cereus, Bacillus anthracis, Bacillus thuringiensis, Bacillus mycoides, Bacillus pseudomycoides and Bacillus weihenstephanensis. B. thuringiensis is distinguished from the other species mainly by the appearance of an inclusion body upon sporulation. B. weihenstephanensis is distinguished based on its psychrotolerance and the presence of specific signature sequences in the 16S rRNA gene and cspA genes. A total of seven housekeeping genes (glpF, gmK, ilvD, pta, purH, pycA and tpi) from different B. thuringiensis serovars and B. weihenstephanensis strains were amplified and their nucleotide sequences determined. A maximum likelihood phylogenetic tree was inferred from comparisons of the concatenated sequences. B. thuringiensis serovars navarrensis, bolivia and vazensis clustered not with the other B. thuringiensis serovars but rather with the B. weihenstephanensis strains, indicative of a common phylogeny. In addition, specific signature sequences and single nucleotide polymorphisms common to B. thuringiensis serovars navarrensis, bolivia and vazensis and the B. weihenstephanensis strains, and absent in the other B. thuringiensis serovars, were identified.

  3. Sequence-based introgression mapping identifies candidate white mold tolerance genes in common bean

    Technology Transfer Automated Retrieval System (TEKTRAN)

    White mold disease, caused by the necrotrophic fungus Sclerotinia sclerotiorum (Lib.) de Bary, is a major pathogen of common bean (Phaseolus vulgaris L.). More than 20 QTL were reported using multiple bi-parental populations. To study the disease in more detail, advanced back-cross populations seg...

  4. Complete Genome Sequence of a Genomovirus Associated with Common Bean Plant Leaves in Brazil

    PubMed Central

    Lamas, Natalia Silva; Fontenele, Rafaela Salgado; Melo, Fernando Lucas; Costa, Antonio Felix; Varsani, Arvind


    A new genomovirus has been identified in three common bean plants in Brazil. This virus has a circular genome of 2,220 nucleotides and 3 major open reading frames. It shares 80.7% genome-wide pairwise identity with a genomovirus recovered from Tongan fruit bat guano. PMID:27834705

  5. Massively parallel sequencing of 17 commonly used forensic autosomal STRs and amelogenin with small amplicons.


    Kim, Eun Hye; Lee, Hwan Young; Yang, In Seok; Jung, Sang-Eun; Yang, Woo Ick; Shin, Kyoung-Jin


    The next-generation sequencing (NGS) method has been utilized to analyze short tandem repeat (STR) markers, which are routinely used for human identification purposes in the forensic field. Some researchers have demonstrated the successful application of the NGS system to STR typing, suggesting that NGS technology may be an alternative or additional method to overcome limitations of capillary electrophoresis (CE)-based STR profiling. However, there has been no available multiplex PCR system that is optimized for NGS analysis of forensic STR markers. Thus, we constructed a multiplex PCR system for the NGS analysis of 18 markers (13CODIS STRs, D2S1338, D19S433, Penta D, Penta E and amelogenin) by designing amplicons in the size range of 77-210 base pairs. Then, PCR products were generated from two single-sources, mixed samples and artificially degraded DNA samples using a multiplex PCR system, and were prepared for sequencing on the MiSeq system through construction of a subsequent barcoded library. By performing NGS and analyzing the data, we confirmed that the resultant STR genotypes were consistent with those of CE-based typing. Moreover, sequence variations were detected in targeted STR regions. Through the use of small-sized amplicons, the developed multiplex PCR system enables researchers to obtain successful STR profiles even from artificially degraded DNA as well as STR loci which are analyzed with large-sized amplicons in the CE-based commercial kits. In addition, successful profiles can be obtained from mixtures up to a 1:19 ratio. Consequently, the developed multiplex PCR system, which produces small size amplicons, can be successfully applied to STR NGS analysis of forensic casework samples such as mixtures and degraded DNA samples.

  6. Substitution of Feline Leukemia Virus Long Terminal Repeat Sequences into Murine Leukemia Virus Alters the Pattern of Insertional Activation and Identifies New Common Insertion Sites

    PubMed Central

    Johnson, Chassidy; Lobelle-Rich, Patricia A.; Puetter, Adriane; Levy, Laura S.


    The recombinant retrovirus, MoFe2-MuLV (MoFe2), was constructed by replacing the U3 region of Moloney murine leukemia virus (M-MuLV) with homologous sequences from the FeLV-945 LTR. NIH/Swiss mice neonatally inoculated with MoFe2 developed T-cell lymphomas of immature thymocyte surface phenotype. MoFe2 integrated infrequently (0 to 9%) near common insertion sites (CISs) previously identified for either parent virus. Using three different strategies, CISs in MoFe2-induced tumors were identified at six loci, none of which had been previously reported as CISs in tumors induced by either parent virus in wild-type animals. Two of the newly identified CISs had not previously been implicated in lymphoma in any retrovirus model. One of these, designated 3-19, encodes the p101 regulatory subunit of phosphoinositide-3-kinase-gamma. The other, designated Rw1, is predicted to encode a protein that functions in the immune response to virus infection. Thus, substitution of FeLV-945 U3 sequences into the M-MuLV long terminal repeat (LTR) did not alter the target tissue for M-MuLV transformation but significantly altered the pattern of CIS utilization in the induction of T-cell lymphoma. These observations support a growing body of evidence that the distinctive sequence and/or structure of the retroviral LTR determines its pattern of insertional activation. The findings also demonstrate the oligoclonal nature of retrovirus-induced lymphomas by demonstrating proviral insertions at CISs in subdominant populations in the tumor mass. Finally, the findings demonstrate the utility of novel recombinant retroviruses such as MoFe2 to contribute new genes potentially relevant to the induction of lymphoid malignancy. PMID:15596801

  7. Common and distinct DNA-binding and regulatory activities of the BEN-solo transcription factor family

    PubMed Central

    Dai, Qi; Ren, Aiming; Westholm, Jakub O.; Duan, Hong; Patel, Dinshaw J.


    Recently, the BEN (BANP, E5R, and NAC1) domain was recognized as a new class of conserved DNA-binding domain. The fly genome encodes three proteins that bear only a single BEN domain (“BEN-solo” factors); namely, Insensitive (Insv), Bsg25A (Elba1), and CG9883 (Elba2). Insv homodimers preferentially bind CCAATTGG palindromes throughout the genome to mediate transcriptional repression, whereas Bsg25A and Elba2 heterotrimerize with their obligate adaptor, Elba3 (i.e., the ELBA complex), to recognize a CCAATAAG motif in the Fab-7 insulator. While these data suggest distinct DNA-binding properties of BEN-solo proteins, we performed reporter assays that indicate that both Bsg25A and Elba2 can individually recognize Insv consensus sites efficiently. We confirmed this by solving the structure of Bsg25A complexed to the Insv site, which showed that key aspects of the BEN:DNA recognition strategy are similar between these proteins. We next show that both Insv and ELBA proteins are competent to mediate transcriptional repression via Insv consensus sequences but that the ELBA complex appears to be selective for the ELBA site. Reciprocally, genome-wide analysis reveals that Insv exhibits significant cobinding to class I insulator elements, indicating that it may also contribute to insulator function. Indeed, we observed abundant Insv binding within the Hox complexes with substantial overlaps with class I insulators, many of which bear Insv consensus sites. Moreover, Insv coimmunoprecipitates with the class I insulator factor CP190. Finally, we observed that Insv harbors exclusive activity among fly BEN-solo factors with respect to regulation of Notch-mediated cell fate choices in the peripheral nervous system. This in vivo activity is recapitulated by BEND6, a mammalian BEN-solo factor that conserves the Notch corepressor function of Insv but not its capacity to bind Insv consensus sites. Altogether, our data define an array of common and distinct biochemical and functional

  8. A Next-Generation Sequencing Strategy for Evaluating the Most Common Genetic Abnormalities in Multiple Myeloma.


    Jiménez, Cristina; Jara-Acevedo, María; Corchete, Luis A; Castillo, David; Ordóñez, Gonzalo R; Sarasquete, María E; Puig, Noemí; Martínez-López, Joaquín; Prieto-Conde, María I; García-Álvarez, María; Chillón, María C; Balanzategui, Ana; Alcoceba, Miguel; Oriol, Albert; Rosiñol, Laura; Palomera, Luis; Teruel, Ana I; Lahuerta, Juan J; Bladé, Joan; Mateos, María V; Orfão, Alberto; San Miguel, Jesús F; González, Marcos; Gutiérrez, Norma C; García-Sanz, Ramón


    Identification and characterization of genetic alterations are essential for diagnosis of multiple myeloma and may guide therapeutic decisions. Currently, genomic analysis of myeloma to cover the diverse range of alterations with prognostic impact requires fluorescence in situ hybridization (FISH), single nucleotide polymorphism arrays, and sequencing techniques, which are costly and labor intensive and require large numbers of plasma cells. To overcome these limitations, we designed a targeted-capture next-generation sequencing approach for one-step identification of IGH translocations, V(D)J clonal rearrangements, the IgH isotype, and somatic mutations to rapidly identify risk groups and specific targetable molecular lesions. Forty-eight newly diagnosed myeloma patients were tested with the panel, which included IGH and six genes that are recurrently mutated in myeloma: NRAS, KRAS, HRAS, TP53, MYC, and BRAF. We identified 14 of 17 IGH translocations previously detected by FISH and three confirmed translocations not detected by FISH, with the additional advantage of breakpoint identification, which can be used as a target for evaluating minimal residual disease. IgH subclass and V(D)J rearrangements were identified in 77% and 65% of patients, respectively. Mutation analysis revealed the presence of missense protein-coding alterations in at least one of the evaluating genes in 16 of 48 patients (33%). This method may represent a time- and cost-effective diagnostic method for the molecular characterization of multiple myeloma.

  9. Next-generation sequencing of common osteogenesis imperfecta-related genes in clinical practice

    PubMed Central

    Árvai, Kristóf; Horváth, Péter; Balla, Bernadett; Tobiás, Bálint; Kató, Karina; Kirschner, Gyöngyi; Klujber, Valéria; Lakatos, Péter; Kósa, János P.


    Next generation sequencing (NGS) is a rapidly developing area in genetics. Utilizing this technology in the management of disorders with complex genetic background and not recurrent mutation hot spots can be extremely useful. In this study, we applied NGS, namely semiconductor sequencing to determine the most significant osteogenesis imperfecta-related genetic variants in the clinical practice. We selected genes coding collagen type I alpha-1 and-2 (COL1A1, COL1A2) which are responsible for more than 90% of all cases. CRTAP and LEPRE1/P3H1 genes involved in the background of the recessive forms with relatively high frequency (type VII and VIII) represent less than 10% of the disease. In our six patients (1–41 years), we identified 23 different variants. We found a total of 14 single nucleotide variants (SNV) in COL1A1 and COL1A2, 5 in CRTAP and 4 in LEPRE1. Two novel and two already well-established pathogenic SNVs have been identified. Among the newly recognized mutations, one results in an amino acid change and one of them is a stop codon. We have shown that a new full-scale cost-effective NGS method can be developed and utilized to supplement diagnostic process of osteogenesis imperfecta with molecular genetic data in clinical practice. PMID:27335225

  10. SNP discovery in common bean by restriction-associated DNA (RAD) sequencing for genetic diversity and population structure analysis.


    Valdisser, Paula Arielle M R; Pappas, Georgios J; de Menezes, Ivandilson P P; Müller, Bárbara S F; Pereira, Wendell J; Narciso, Marcelo G; Brondani, Claudio; Souza, Thiago L P O; Borba, Tereza C O; Vianello, Rosana P


    Researchers have made great advances into the development and application of genomic approaches for common beans, creating opportunities to driving more real and applicable strategies for sustainable management of the genetic resource towards plant breeding. This work provides useful polymorphic single-nucleotide polymorphisms (SNPs) for high-throughput common bean genotyping developed by RAD (restriction site-associated DNA) sequencing. The RAD tags were generated from DNA pooled from 12 common bean genotypes, including breeding lines of different gene pools and market classes. The aligned sequences identified 23,748 putative RAD-SNPs, of which 3357 were adequate for genotyping; 1032 RAD-SNPs with the highest ADT (assay design tool) score are presented in this article. The RAD-SNPs were structurally annotated in different coding (47.00 %) and non-coding (53.00 %) sequence components of genes. A subset of 384 RAD-SNPs with broad genome distribution was used to genotype a diverse panel of 95 common bean germplasms and revealed a successful amplification rate of 96.6 %, showing 73 % of polymorphic SNPs within the Andean group and 83 % in the Mesoamerican group. A slightly increased He (0.161, n = 21) value was estimated for the Andean gene pool, compared to the Mesoamerican group (0.156, n = 74). For the linkage disequilibrium (LD) analysis, from a group of 580 SNPs (289 RAD-SNPs and 291 BARC-SNPs) genotyped for the same set of genotypes, 70.2 % were in LD, decreasing to 0.10 %in the Andean group and 0.77 % in the Mesoamerican group. Haplotype patterns spanning 310 Mb of the genome (60 %) were characterized in samples from different origins. However, the haplotype frameworks were under-represented for the Andean (7.85 %) and Mesoamerican (5.55 %) gene pools separately. In conclusion, RAD sequencing allowed the discovery of hundreds of useful SNPs for broad genetic analysis of common bean germplasm. From now, this approach provides an excellent panel

  11. Exome Sequencing Links Corticospinal Motor Neuron Disease to Common Neurodegenerative Disorders

    PubMed Central

    Hofree, Matan; Silhavy, Jennifer L.; Heiberg, Andrew D.; Abdellateef, Mostafa; Rosti, Basak; Scott, Eric; Mansour, Lobna; Masri, Amira; Kayserili, Hulya; Al-Aama, Jumana Y.; Abdel-Salam, Ghada M. H.; Karminejad, Ariana; Kara, Majdi; Kara, Bulent; Bozorgmehri, Bita; Ben-Omran, Tawfeg; Mojahedi, Faezeh; El Din Mahmoud, Iman Gamal; Bouslam, Naima; Bouhouche, Ahmed; Benomar, Ali; Hanein, Sylvain; Raymond, Laure; Forlani, Sylvie; Mascaro, Massimo; Selim, Laila; Shehata, Nabil; Al-Allawi, Nasir; Bindu, P.S.; Azam, Matloob; Gunel, Murat; Caglayan, Ahmet; Bilguvar, Kaya; Tolun, Aslihan; Issa, Mahmoud Y.; Schroth, Jana; Spencer, Emily G.; Rosti, Rasim O.; Akizu, Naiara; Vaux, Keith K.; Johansen, Anide; Koh, Alice A.; Megahed, Hisham; Durr, Alexandra; Brice, Alexis; Stevanin, Giovanni; Gabriel, Stacy B.; Ideker, Trey; Gleeson, Joseph G.


    Hereditary spastic paraplegias (HSPs) are neurodegenerative motor neuron diseases characterized by progressive age-dependent loss of corticospinal motor tract function. Although the genetic basis is partly understood, only a fraction of cases can receive a genetic diagnosis, and a global view of HSP is lacking. By using whole-exome sequencing in combination with network analysis, we identified 18 previously unknown putative HSP genes and validated nearly all of these genes functionally or genetically. The pathways highlighted by these mutations link HSP to cellular transport, nucleotide metabolism, and synapse and axon development. Network analysis revealed a host of further candidate genes, of which three were mutated in our cohort. Our analysis links HSP to other neurodegenerative disorders and can facilitate gene discovery and mechanistic understanding of disease. PMID:24482476

  12. Role of common and rare APP DNA sequence variants in Alzheimer disease

    PubMed Central

    Hooli, B.V.; Mohapatra, G.; Mattheisen, M.; Parrado, A.R.; Roehr, J.T.; Shen, Y.; Gusella, J.F.; Moir, R.; Saunders, A.J.; Lange, C.; Tanzi, R.E.


    Objectives: More than 30 different rare mutations, including copy number variants (CNVs), in the amyloid precursor protein gene (APP) cause early-onset familial Alzheimer disease (EOFAD), whereas the contribution of common APP variants to disease risk remains controversial. In this study we systematically assessed the role of both rare and common APP DNA variants in Alzheimer disease (AD) families. Methods: Families with EOFAD genetically linked to the APP region were screened for missense mutations and locus duplications of APP. Further, using genome-wide DNA microarray data, we examined the APP locus for CNVs in a total of 797 additional early- and late-onset AD pedigrees. Finally, 423 single nucleotide polymorphisms (SNPs) in the APP locus, including 2 promoter polymorphisms previously associated with AD risk, were tested in up to 4,200 individuals from multiplex AD families. Results: Analyses of 8 21q21-linked families revealed one family carrying a nonsynonymous mutation in exon 17 (Val717Leu) and another family with a partially penetrant 3.5-Mb locus duplication encompassing APP. CNV analysis in the APP locus revealed an additional family carrying a fully penetrant 380-kb duplication, merely spanning APP. Last, contrary to previous reports, association analyses of more than 400 different SNPs in or near APP failed to show significant effects on AD risk. Conclusion: Our study shows that APP mutations and locus duplications are a very rare cause of EOFAD and that the contribution of common APP variants to AD susceptibility is insignificant. Furthermore, duplications of APP may not be fully penetrant, possibly indicating the existence of hitherto unknown protective genetic factors. PMID:22491860

  13. Whole Genome Shotgun Sequencing Shows Selection on Leptospira Regulatory Proteins during in vitro Culture Attenuation

    PubMed Central

    Lehmann, Jason S.; Corey, Victoria C.; Ricaldi, Jessica N.; Vinetz, Joseph M.; Winzeler, Elizabeth A.; Matthias, Michael A.


    Leptospirosis is the most common zoonotic disease worldwide with an estimated 500,000 severe cases reported annually, and case fatality rates of 12–25%, due primarily to acute kidney and lung injuries. Despite its prevalence, the molecular mechanisms underlying leptospirosis pathogenesis remain poorly understood. To identify virulence-related genes in Leptospira interrogans, we delineated cumulative genome changes that occurred during serial in vitro passage of a highly virulent strain of L. interrogans serovar Lai into a nearly avirulent isogenic derivative. Comparison of protein coding and computationally predicted noncoding RNA (ncRNA) genes between these two polyclonal strains identified 15 nonsynonymous single nucleotide variant (nsSNV) alleles that increased in frequency and 19 that decreased, whereas no changes in allelic frequency were observed among the ncRNA genes. Some of the nsSNV alleles were in six genes shown previously to be transcriptionally upregulated during exposure to in vivo-like conditions. Five of these nsSNVs were in evolutionarily conserved positions in genes related to signal transduction and metabolism. Frequency changes of minor nsSNV alleles identified in this study likely contributed to the loss of virulence during serial in vitro culture. The identification of new virulence-associated genes should spur additional experimental inquiry into their potential role in Leptospira pathogenesis. PMID:26711524

  14. Genome sequence and genetic diversity of the common carp, Cyprinus carpio.


    Xu, Peng; Zhang, Xiaofeng; Wang, Xumin; Li, Jiongtang; Liu, Guiming; Kuang, Youyi; Xu, Jian; Zheng, Xianhu; Ren, Lufeng; Wang, Guoliang; Zhang, Yan; Huo, Linhe; Zhao, Zixia; Cao, Dingchen; Lu, Cuiyun; Li, Chao; Zhou, Yi; Liu, Zhanjiang; Fan, Zhonghua; Shan, Guangle; Li, Xingang; Wu, Shuangxiu; Song, Lipu; Hou, Guangyuan; Jiang, Yanliang; Jeney, Zsigmond; Yu, Dan; Wang, Li; Shao, Changjun; Song, Lai; Sun, Jing; Ji, Peifeng; Wang, Jian; Li, Qiang; Xu, Liming; Sun, Fanyue; Feng, Jianxin; Wang, Chenghui; Wang, Shaolin; Wang, Baosen; Li, Yan; Zhu, Yaping; Xue, Wei; Zhao, Lan; Wang, Jintu; Gu, Ying; Lv, Weihua; Wu, Kejing; Xiao, Jingfa; Wu, Jiayan; Zhang, Zhang; Yu, Jun; Sun, Xiaowen


    The common carp, Cyprinus carpio, is one of the most important cyprinid species and globally accounts for 10% of freshwater aquaculture production. Here we present a draft genome of domesticated C. carpio (strain Songpu), whose current assembly contains 52,610 protein-coding genes and approximately 92.3% coverage of its paleotetraploidized genome (2n = 100). The latest round of whole-genome duplication has been estimated to have occurred approximately 8.2 million years ago. Genome resequencing of 33 representative individuals from worldwide populations demonstrates a single origin for C. carpio in 2 subspecies (C. carpio Haematopterus and C. carpio carpio). Integrative genomic and transcriptomic analyses were used to identify loci potentially associated with traits including scaling patterns and skin color. In combination with the high-resolution genetic map, the draft genome paves the way for better molecular studies and improved genome-assisted breeding of C. carpio and other closely related species.

  15. Exploring a Nonmodel Teleost Genome Through RAD Sequencing-Linkage Mapping in Common Pandora, Pagellus erythrinus and Comparative Genomic Analysis.


    Manousaki, Tereza; Tsakogiannis, Alexandros; Taggart, John B; Palaiokostas, Christos; Tsaparis, Dimitris; Lagnel, Jacques; Chatziplis, Dimitrios; Magoulas, Antonios; Papandroulakis, Nikos; Mylonas, Constantinos C; Tsigenopoulos, Costas S


    Common pandora (Pagellus erythrinus) is a benthopelagic marine fish belonging to the teleost family Sparidae, and a newly recruited species in Mediterranean aquaculture. The paucity of genetic information relating to sparids, despite their growing economic value for aquaculture, provides the impetus for exploring the genomics of this fish group. Genomic tool development, such as genetic linkage maps provision, lays the groundwork for linking genotype to phenotype, allowing fine-mapping of loci responsible for beneficial traits. In this study, we applied ddRAD methodology to identify polymorphic markers in a full-sib family of common pandora. Employing the Illumina MiSeq platform, we sampled and sequenced a size-selected genomic fraction of 99 individuals, which led to the identification of 920 polymorphic loci. Downstream mapping analysis resulted in the construction of 24 robust linkage groups, corresponding to the karyotype of the species. The common pandora linkage map showed varying degrees of conserved synteny with four other teleost genomes, namely the European seabass (Dicentrarchus labrax), Nile tilapia (Oreochromis niloticus), stickleback (Gasterosteus aculeatus), and medaka (Oryzias latipes), suggesting a conserved genomic evolution in Sparidae. Our work exploits the possibilities of genotyping by sequencing to gain novel insights into genome structure and evolution. Such information will boost the study of cultured species and will set the foundation for a deeper understanding of the complex evolutionary history of teleosts.

  16. Complete Coding Sequence of Usutu Virus Strain Gracula religiosa/U1609393/Belgium/2016 Obtained from the Brain Tissue of an Infected Captive Common Hill Myna (Gracula religiosa)

    PubMed Central

    Lambrecht, Bénédicte; Vandenbussche, Frank; Steensels, Mieke


    ABSTRACT The complete and annotated coding sequence and partial noncoding sequence of an Usutu virus genome were sequenced from RNA extracted from a clinical brain tissue sample obtained from a common hill myna (Gracula religiosa), demonstrating close homology with Usutu viruses circulating in Europe. PMID:28336592

  17. A common cis-acting sequence in the DiGeorge critical region regulates bi-directional transcription of UFD1L and CDC45L.


    Kunte, A; Ivey, K; Yamagishi, C; Garg, V; Yamagishi, H; Srivastava, D


    Two to three megabase deletions on chromosome 22q11 are the cytogenetic findings most commonly associated with cardiac and craniofacial defects in humans. The constellation of clinical findings associated with these deletions is termed the 22q11 deletion syndrome. We had earlier described a patient with the 22q11 deletion phenotype who was hemizygous for an atypical 20 kb microdeletion in this region. The deletion included coding regions of two genes organized head-to-head, UFD1L and CDC45L, along with an 884 bp CpG-rich intervening region. Based on this genomic organization, we hypothesized that both genes may be co-expressed and co-regulated by sequences within this region. We demonstrate that expression of both genes is enhanced in a similar pattern in precursors of structures affected by the deletion. The intergenic region is sufficient to direct transcription most strongly in the developing pharyngeal arches and limb buds of transgenic mice and can also direct bi-directional transcriptional activation in a neural crest-derived cell line. Deletion analyses revealed that a 404 bp fragment closest to UFD1L is necessary and sufficient to direct this bi-directional transcriptional activity. These results reveal the presence of a conserved regulatory region in the 22q11 deletion locus that can direct simultaneous transcription of genes involved in ubiquitin mediated protein processing (UFD1L) and cell cycle control (CDC45L).

  18. A regulatory sequence from the retinoid X receptor γ gene directs expression to horizontal cells and photoreceptors in the embryonic chicken retina

    PubMed Central

    Blixt, Maria K. E.


    Purpose Combining techniques of episomal vector gene-specific Cre expression and genomic integration using the piggyBac transposon system enables studies of gene expression–specific cell lineage tracing in the chicken retina. In this work, we aimed to target the retinal horizontal cell progenitors. Methods A 208 bp gene regulatory sequence from the chicken retinoid X receptor γ gene (RXRγ208) was used to drive Cre expression. RXRγ is expressed in progenitors and photoreceptors during development. The vector was combined with a piggyBac “donor” vector containing a floxed STOP sequence followed by enhanced green fluorescent protein (EGFP), as well as a piggyBac helper vector for efficient integration into the host cell genome. The vectors were introduced into the embryonic chicken retina with in ovo electroporation. Tissue electroporation targets specific developmental time points and in specific structures. Results Cells that drove Cre expression from the regulatory RXRγ208 sequence excised the floxed STOP-sequence and expressed GFP. The approach generated a stable lineage with robust expression of GFP in retinal cells that have activated transcription from the RXRγ208 sequence. Furthermore, GFP was expressed in cells that express horizontal or photoreceptor markers when electroporation was performed between developmental stages 22 and 28. Electroporation of a stage 12 optic cup gave multiple cell types in accordance with RXRγ gene expression in the early retina. Conclusions In this study, we describe an easy, cost-effective, and time-efficient method for testing regulatory sequences in general. More specifically, our results open up the possibility for further studies of the RXRγ-gene regulatory network governing the formation of photoreceptor and horizontal cells. In addition, the method presents approaches to target the expression of effector genes, such as regulators of cell fate or cell cycle progression, to these cells and their progenitor. PMID

  19. A regulatory governance perspective on health technology assessment (HTA) in France: the contextual mediation of common functional pressures.


    Barron, Anthony J G; Klinger, Corinna; Shah, Sara Mehmood Birchall; Wright, John S F


    The new regulatory governance perspective has introduced several insights to the study of health technology assessment (HTA): it has broadened the scope for the analysis of HTA; it has provided a more sophisticated account of national diversity and the potential for cross-border policy learning; and, it has dissolved the distinction between HTA assessment and appraisal processes. In this paper, we undertake a qualitative study of the French process for HTA with a view to introducing a fourth insight: that the emergence and continuing function of national agencies for HTA follows a broadly evolutionary pattern in which contextual factors play an important mediating role. We demonstrate that the French process for HTA is characterised by distinctive institutions, processes and evidential requirements. Consistent with the mediating role of this divergent policy context, we argue that even initiatives for the harmonisation of national approaches to HTA are likely to meet with divergent national policy responses.

  20. Targeted re-sequencing analysis of 25 genes commonly mutated in myeloid disorders in del(5q) myelodysplastic syndromes

    PubMed Central

    Fernandez-Mercado, Marta; Burns, Adam; Pellagatti, Andrea; Giagounidis, Aristoteles; Germing, Ulrich; Agirre, Xabier; Prosper, Felipe; Aul, Carlo; Killick, Sally; Wainscoat, James S.; Schuh, Anna; Boultwood, Jacqueline


    Interstitial deletion of chromosome 5q is the most common chromosomal abnormality in myelodysplastic syndromes. The catalogue of genes involved in the molecular pathogenesis of myelodysplastic syndromes is rapidly expanding and next-generation sequencing technology allows detection of these mutations at great depth. Here we describe the design, validation and application of a targeted next-generation sequencing approach to simultaneously screen 25 genes mutated in myeloid malignancies. We used this method alongside single nucleotide polymorphism-array technology to characterize the mutational and cytogenetic profile of 43 cases of early or advanced del(5q) myelodysplastic syndromes. A total of 29 mutations were detected in our cohort. Overall, 45% of early and 66.7% of advanced cases had at least one mutation. Genes with the highest mutation frequency among advanced cases were TP53 and ASXL1 (25% of patients each). These showed a lower mutation frequency in cases of 5q- syndrome (4.5% and 13.6%, respectively), suggesting a role in disease progression in del(5q) myelodysplastic syndromes. Fifty-two percent of mutations identified were in genes involved in epigenetic regulation (ASXL1, TET2, DNMT3A and JAK2). Six mutations had allele frequencies <20%, likely below the detection limit of traditional sequencing methods. Genomic array data showed that cases of advanced del(5q) myelodysplastic syndrome had a complex background of cytogenetic aberrations, often encompassing genes involved in myeloid disorders. Our study is the first to investigate the molecular pathogenesis of early and advanced del(5q) myelodysplastic syndromes using next-generation sequencing technology on a large panel of genes frequently mutated in myeloid malignancies, further illuminating the molecular landscape of del(5q) myelodysplastic syndromes. PMID:23831921

  1. Common interruptions in the repeating tripeptide sequence of non-fibrillar collagens: sequence analysis and structural studies on triple-helix peptide models.


    Thiagarajan, Geetha; Li, Yingjie; Mohs, Angela; Strafaci, Christopher; Popiel, Magdalena; Baum, Jean; Brodsky, Barbara


    Interruptions in the repeating (Gly-X1-X2)(n) amino acid sequence pattern are found in the triple-helix domains of all non-fibrillar collagens, and perturbations to the triple-helix at such sites are likely to play a role in collagen higher-order structure and function. This study defines the sequence features and structural consequences of the most common interruption, where one residue is missing from the tripeptide pattern, Gly-X1-X2-Gly-AA(1)-Gly-X1-X2, designated G1G interruptions. Residues found within G1G interruptions are predominantly hydrophobic (70%), followed by a significant amount of charged residues (16%), and the Gly-X1-X2 triplets flanking the interruption are atypical. Studies on peptide models indicate the degree of destabilization is much greater when Pro is in the interruption, GP, than when hydrophobic residues (GF, GY) are present, and a rigid Gly-Pro-Hyp tripeptide adjacent to the interruption leads to greater destabilization than a flexible Gly-Ala-Ala sequence. Modeling based on NMR data indicates the Phe residue within a GF interruption is located on the outside of the triple helix. The G1G interruptions resemble a previously studied collagen interruption GPOGAAVMGPO, designated G4G-type, in that both are destabilizing, but allow continuation of rod-like triple helices and maintenance of the single residue stagger throughout the imperfection, with a loss of axial register of the superhelix on both sides. Both kinds of interruptions result in a highly localized perturbation in hydrogen bonding and dihedral angles, but the hydrophobic residue of a G4G interruption packs near the central axis of the superhelix, while the hydrophobic residue of a G1G interruption is located on the triple-helix surface. The different structural consequences of G1G and G4G interruptions in the repeating tripeptide sequence pattern suggest a physical basis for their differential susceptibility to matrix metalloproteinases in type X collagen.

  2. p38 MAPK down-regulates fibulin 3 expression through methylation of gene regulatory sequences: role in migration and invasion.


    Arechederra, María; Priego, Neibla; Vázquez-Carballo, Ana; Sequera, Celia; Gutiérrez-Uzquiza, Álvaro; Cerezo-Guisado, María Isabel; Ortiz-Rivero, Sara; Roncero, Cesáreo; Cuenda, Ana; Guerrero, Carmen; Porras, Almudena


    p38 MAPKs regulate migration and invasion. However, the mechanisms involved are only partially known. We had previously identified fibulin 3, which plays a role in migration, invasion, and tumorigenesis, as a gene regulated by p38α. We have characterized in detail how p38 MAPK regulates fibulin 3 expression and its role. We describe here for the first time that p38α, p38γ, and p38δ down-regulate fibulin 3 expression. p38α has a stronger effect, and it does so through hypermethylation of CpG sites in the regulatory sequences of the gene. This would be mediated by the DNA methylase, DNMT3A, which is down-regulated in cells lacking p38α, but once re-introduced represses Fibulin 3 expression. p38α through HuR stabilizes dnmt3a mRNA leading to an increase in DNMT3A protein levels. Moreover, by knocking-down fibulin 3, we have found that Fibulin 3 inhibits migration and invasion in MEFs by mechanisms involving p38α/β inhibition. Hence, p38α pro-migratory/invasive effect might be, at least in part, mediated by fibulin 3 down-regulation in MEFs. In contrast, in HCT116 cells, Fibulin 3 promotes migration and invasion through a mechanism dependent on p38α and/or p38β activation. Furthermore, Fibulin 3 promotes in vitro and in vivo tumor growth of HCT116 cells through a mechanism dependent on p38α, which surprisingly acts as a potent inducer of tumor growth. At the same time, p38α limits fibulin 3 expression, which might represent a negative feed-back loop.

  3. Large-Scale Evaluation of Common Variation in Regulatory T Cell-Related Genes and Ovarian Cancer Outcome

    PubMed Central

    Charbonneau, Bridget; Moysich, Kirsten B.; Kalli, Kimberly R.; Oberg, Ann L.; Vierkant, Robert A.; Fogarty, Zachary C.; Block, Matthew S.; Maurer, Matthew J.; Goergen, Krista M.; Fridley, Brooke L.; Cunningham, Julie M.; Rider, David N.; Preston, Claudia; Hartmann, Lynn C.; Lawrenson, Kate; Wang, Chen; Tyrer, Jonathan; Song, Honglin; deFazio, Anna; Johnatty, Sharon E.; Doherty, Jennifer A.; Phelan, Catherine M.; Sellers, Thomas A.; Ramirez, Starr M.; Vitonis, Allison F.; Terry, Kathryn L.; Van Den Berg, David; Pike, Malcolm C.; Wu, Anna H.; Berchuck, Andrew; Gentry-Maharaj, Aleksandra; Ramus, Susan J.; Diergaarde, Brenda; Shen, Howard; Jensen, Allan; Menkiszak, Janusz; Cybulski, Cezary; Lubiński, Jan; Ziogas, Argyrios; Rothstein, Joseph H.; McGuire, Valerie; Sieh, Weiva; Lester, Jenny; Walsh, Christine; Vergote, Ignace; Lambrechts, Sandrina; Despierre, Evelyn; Garcia-Closas, Montserrat; Yang, Hannah; Brinton, Louise A.; Spiewankiewicz, Beata; Rzepecka, Iwona K.; Dansonka-Mieszkowska, Agnieszka; Seibold, Petra; Rudolph, Anja; Paddock, Lisa E.; Orlow, Irene; Lundvall, Lene; Olson, Sara H.; Hogdall, Claus K.; Schwaab, Ira; du Bois, Andreas; Harter, Philipp; Flanagan, James M.; Brown, Robert; Paul, James; Ekici, Arif B.; Beckmann, Matthias W.; Hein, Alexander; Eccles, Diana; Lurie, Galina; Hays, Laura E.; Bean, Yukie T.; Pejovic, Tanja; Goodman, Marc T.; Campbell, Ian; Fasching, Peter A.; Konecny, Gottfried; Kaye, Stanley B.; Heitz, Florian; Hogdall, Estrid; Bandera, Elisa V.; Chang-Claude, Jenny; Kupryjanczyk, Jolanta; Wentzensen, Nicolas; Lambrechts, Diether; Karlan, Beth Y.; Whittemore, Alice S.; Culver, Hoda Anton; Gronwald, Jacek; Levine, Douglas A.; Kjaer, Susanne K.; Menon, Usha; Schildkraut, Joellen M.; Pearce, Celeste Leigh; Cramer, Daniel W.; Rossing, Mary Anne; Chenevix-Trench, Georgia; Pharoah, Paul D.P.; Gayther, Simon A.; Ness, Roberta B.; Odunsi, Kunle; Sucheston, Lara E.; Knutson, Keith L.; Goode, Ellen L.


    The presence of regulatory T cells (Tregs) in solid tumors is known to play a role in patient survival in ovarian cancer and other malignancies. We assessed inherited genetic variations via 749 tag SNPs in 25 Treg-associated genes (CD28, CTLA4, FOXP3, IDO1, IL10, IL10RA, IL15, 1L17RA, IL23A, IL23R, IL2RA, IL6, IL6R, IL8, LGALS1, LGALS9, MAP3K8, STAT5A, STAT5B, TGFB1, TGFB2, TGFB3, TGFBR1, TGRBR2, and TGFBR3) in relation to ovarian cancer survival. We analyzed genotype and overall survival in 10,084 women with invasive epithelial ovarian cancer, including 5,248 high-grade serous, 1,452 endometrioid, 795 clear cell, and 661 mucinous carcinoma cases of European descent across 28 studies from the Ovarian Cancer Association Consortium (OCAC). The strongest associations were found for endometrioid carcinoma and IL2RA SNPs rs11256497 [HR=1.42, 95% CI: 1.22–1.64; p=5.7 × 10−6], rs791587 [HR=1.36, 95% CI:1.17–1.57; p=6.2 × 10−5], rs2476491 [HR=1.40, 95% CI: 1.191.64; p=5.6 × 10−5], and rs10795763 [HR=1.35, 95% CI: 1.17–1.57; p=7.9 × 10−5], and for clear cell carcinoma and CTLA4 SNP rs231775 [HR=0.67, 95% CI: 0.54–0.82; p=9.3 × 10−5] after adjustment for age, study site, population stratification, stage, grade, and oral contraceptive use. The rs231775 allele associated with improved survival in our study also results in an amino acid change in CTLA4 and previously has been reported to be associated with autoimmune conditions. Thus, we found evidence that SNPs in genes related to Tregs appear to play a role in ovarian cancer survival, particularly in patients with clear cell and endometrioid EOC. PMID:24764580

  4. Amino acid sequence of a neurotoxic phospholipase A2 enzyme from common death adder (Acanthophis antracticus) venom.


    van der Weyden, L; Hains, P; Broady, K; Shaw, D; Milburn, P


    The amino acid sequence of the first neurotoxic phospholipase A2, acanthoxin A1, purified from the venom of the Common death adder (Acanthophis antarcticus) was determined. Acanthoxin A1 shows high homology with other Australian elapid PLA2 neurotoxins, in particular Acanthin-I and -II, also from Death adder, Pseudexin A from the Red-bellied black snake (Pseudechis porphyriacus), and Pa-12a and Pa-9c from the King brown snake (Pseudechis australis). Acanthoxin A1 is a single-chain 118 amino acid residue PLA2, including 14 half cystine residues and the essential residues forming the ubiquitous calcium binding pocket and catalytic site. Critical analysis of the residues hypothesized to be important for neurotoxicity is presented.

  5. Immunity related genes in dipterans share common enrichment of AT-rich motifs in their 5' regulatory regions that are potentially involved in nucleosome formation

    PubMed Central

    Hernandez-Romano, Jesus; Carlos-Rivera, Francisco J; Salgado, Heladia; Lamadrid-Figueroa, Hector; Valverde-Garduño, Veronica; Rodriguez, Mario H; Martinez-Barnetche, Jesus


    Background Understanding the transcriptional regulation mechanisms in response to environmental challenges is of fundamental importance in biology. Transcription factors associated to response elements and the chromatin structure had proven to play important roles in gene expression regulation. We have analyzed promoter regions of dipteran genes induced in response to immune challenge, in search for particular sequence patterns involved in their transcriptional regulation. Results 5' upstream regions of D. melanogaster and A. gambiae immunity-induced genes and their corresponding orthologous genes in 11 non-melanogaster drosophilid species and Ae. aegypti share enrichment in AT-rich short motifs. AT-rich motifs are associated with nucleosome formation as predicted by two different algorithms. In A. gambiae and D. melanogaster, many immunity genes 5' upstream sequences also showed NFκB response elements, located within 500 bp from the transcription start site. In A. gambiae, the frequency of ATAA motif near the NFκB response elements was increased, suggesting a functional link between nucleosome formation/remodelling and NFκB regulation of transcription. Conclusion AT-rich motif enrichment in 5' upstream sequences in A. gambiae, Ae. aegypti and the Drosophila genus immunity genes suggests a particular pattern of nucleosome formation/chromatin organization. The co-occurrence of such motifs with the NFκB response elements suggests that these sequence signatures may be functionally involved in transcriptional activation during dipteran immune response. AT-rich motif enrichment in regulatory regions in this group of co-regulated genes could represent an evolutionary constrained signature in dipterans and perhaps other distantly species. PMID:18613977

  6. Genomic sequence analysis of the MHC class I G/F segment in common marmoset (Callithrix jacchus).


    Kono, Azumi; Brameier, Markus; Roos, Christian; Suzuki, Shingo; Shigenari, Atsuko; Kametani, Yoshie; Kitaura, Kazutaka; Matsutani, Takaji; Suzuki, Ryuji; Inoko, Hidetoshi; Walter, Lutz; Shiina, Takashi


    The common marmoset (Callithrix jacchus) is a New World monkey that is used frequently as a model for various human diseases. However, detailed knowledge about the MHC is still lacking. In this study, we sequenced and annotated a total of 854 kb of the common marmoset MHC region that corresponds to the HLA-A/G/F segment (Caja-G/F) between the Caja-G1 and RNF39 genes. The sequenced region contains 19 MHC class I genes, of which 14 are of the MHC-G (Caja-G) type, and 5 are of the MHC-F (Caja-F) type. Six putatively functional Caja-G and Caja-F genes (Caja-G1, Caja-G3, Caja-G7, Caja-G12, Caja-G13, and Caja-F4), 13 pseudogenes related either to Caja-G or Caja-F, three non-MHC genes (ZNRD1, PPPIR11, and RNF39), two miscRNA genes (ZNRD1-AS1 and HCG8), and one non-MHC pseudogene (ETF1P1) were identified. Phylogenetic analysis suggests segmental duplications of units consisting of basically five (four Caja-G and one Caja-F) MHC class I genes, with subsequent expansion/deletion of genes. A similar genomic organization of the Caja-G/F segment has not been observed in catarrhine primates, indicating that this genomic segment was formed in New World monkeys after the split of New World and Old World monkeys.

  7. Variations in a hotspot region of chloroplast DNAs among common wheat and Aegilops revealed by nucleotide sequence analysis.


    Guo, Chang-Hong; Terachi, Toru


    The second largest BamHI fragment (B2) of the chloroplast DNA in Triticum (wheat) and Aegilops contains a highly variable region (a hotspot), resulting in four types of B2 of different size, i.e. B2l (10.5kb), B2m (10.2kb), B2 (9.6kb) and B2s (9.4kb). In order to gain a better understanding of the molecular nature of the variations in length and explain unexpected identity among B2 of Ae. ovata, Ae. speltoides and common wheat (T. aestivum), the nucleotide sequence between a stop codon of rbcL and a HindIII site in cemA in the hotspot was determined for Ae. ovata, Ae. speltoides, Ae. caudata and Ae. mutica. The total number of nucleotides in the region was 2808, 2810, 3302, and 3594 bp, for Ae. speltoides, Ae. ovata, Ae. caudata and Ae. mutica, respectively, and the sequences were compared with the corresponding ones of Ae. crassa 4x, T. aestivum and Ae. squarrosa. Compared with the largest B2l fragment of Ae. mutica, a 791bp and a 793 bp deletion were found in Ae. speltoides and Ae. ovata, respectively, and the possible site of deletion in the two species is the same as that of T. aestivum. However, a deleted segment in Ae. ovata is 2 bp longer than that of Ae. speltoides (and T. aestivum), demonstrating that recurrent deletions had occurred in the chloroplast genomes of both species. Comparison of the sequences from Ae. caudata and Ae. crassa 4x with that of Ae. mutica revealed a 289 bp and a 61 bp deletion at the same site in Ae. caudata and Ae. crassa 4x, respectively. Sequence comparison using wild Aegilops plants showed that the large length variations in a hotspot are fixed to each species. A considerable number of polymorphisms are observed in a loop in the 3' of rbcL. The study reveals the relative importance of the large and small indels and minute inversions to account for variations in the chloroplast genomes among closely related species.

  8. Fully automated segmentation and tracking of the intima media thickness in ultrasound video sequences of the common carotid artery.


    Ilea, Dana E; Duffy, Caoimhe; Kavanagh, Liam; Stanton, Alice; Whelan, Paul F


    The robust identification and measurement of the intima media thickness (IMT) has a high clinical relevance because it represents one of the most precise predictors used in the assessment of potential future cardiovascular events. To facilitate the analysis of arterial wall thickening in serial clinical investigations, in this paper we have developed a novel fully automatic algorithm for the segmentation, measurement, and tracking of the intima media complex (IMC) in B-mode ultrasound video sequences. The proposed algorithm entails a two-stage image analysis process that initially addresses the segmentation of the IMC in the first frame of the ultrasound video sequence using a model-based approach; in the second step, a novel customized tracking procedure is applied to robustly detect the IMC in the subsequent frames. For the video tracking procedure, we introduce a spatially coherent algorithm called adaptive normalized correlation that prevents the tracking process from converging to wrong arterial interfaces. This represents the main contribution of this paper and was developed to deal with inconsistencies in the appearance of the IMC over the cardiac cycle. The quantitative evaluation has been carried out on 40 ultrasound video sequences of the common carotid artery (CCA) by comparing the results returned by the developed algorithm with respect to ground truth data that has been manually annotated by clinical experts. The measured IMT(mean) ± standard deviation recorded by the proposed algorithm is 0.60 mm ± 0.10, with a mean coefficient of variation (CV) of 2.05%, whereas the corresponding result obtained for the manually annotated ground truth data is 0.60 mm ± 0.11 with a mean CV equal to 5.60%. The numerical results reported in this paper indicate that the proposed algorithm is able to correctly segment and track the IMC in ultrasound CCA video sequences, and we were encouraged by the stability of our technique when applied to data captured under

  9. Relation between mRNA expression and sequence information in Desulfovibrio vulgaris: Combinatorial contributions of upstream regulatory motifs and coding sequence features to variations in mRNA abundance

    SciTech Connect

    Wu, Gang; Nie, Lei; Zhang, Weiwen


    ABSTRACT-The context-dependent expression of genes is the core for biological activities, and significant attention has been given to identification of various factors contributing to gene expression at genomic scale. However, so far this type of analysis has been focused whether on relation between mRNA expression and non-coding sequence features such as upstream regulatory motifs or on correlation between mRN abundance and non-random features in coding sequences (e.g. codon usage and amino acid usage). In this study multiple regression analyses of the mRNA abundance and all sequence information in Desulfovibrio vulgaris were performed, with the goal to investigate how much coding and non-coding sequence features contribute to the variations in mRNA expression, and in what manner they act together...

  10. Evaluation of global sequence comparison and one-to-one FASTA local alignment in regulatory allergenicity assessment of transgenic proteins in food crops.


    Song, Ping; Herman, Rod A; Kumpatla, Siva


    To address the high false positive rate using >35% identity over 80 amino acids in the regulatory assessment of transgenic proteins for potential allergenicity and the change of E-value with database size, the Needleman-Wunsch global sequence alignment and a one-to-one (1:1) local FASTA search (one protein in the target database at a time) using FASTA were evaluated by comparing proteins randomly selected from Arabidopsis, rice, corn, and soybean with known allergens in a peer-reviewed allergen database ( Compared with the approach of searching >35%/80aa+, the false positive rate measured by specificity rate for identification of true allergens was reduced by a 1:1 global sequence alignment with a cut-off threshold of ≧30% identity and a 1:1 FASTA local alignment with a cut-off E-value of ≦1.0E-09 while maintaining the same sensitivity. Hence, a 1:1 sequence comparison, especially using the FASTA local alignment tool with a biological relevant E-value of 1.0E-09 as a threshold, is recommended for the regulatory assessment of sequence identities between transgenic proteins in food crops and known allergens.

  11. Functional equivalence of common and unique sequences in the 3' untranslated regions of alfalfa mosaic virus RNAs 1, 2, and 3.

    PubMed Central

    van Rossum, C M; Brederode, F T; Neeleman, L; Bol, J F


    The 3' untranslated regions (UTRs) of alfalfa mosaic virus (AMV) RNAs 1, 2, and 3 consist of a common 3'-terminal sequence of 145 nucleotides (nt) and upstream sequences of 18 to 34 nt that are unique for each RNA. The common sequence can be folded into five stem-loop structures, A to E, despite the occurrence of 22 nt differences between the three RNAs in this region. Exchange of the common sequences or full-length UTRs between the three genomic RNAs did not affect the replication of these RNAs in vivo, indicating that the UTRs are functionally equivalent. Mutations that disturbed base pairing in the stem of hairpin E reduced or abolished RNA replication, whereas compensating mutations restored RNA replication. In vitro, the 3' UTRs of the three RNAs were recognized with similar efficiencies by the AMV RNA-dependent RNA polymerase (RdRp). A deletion analysis of template RNAs indicated that a 3'-terminal sequence of 127 nt in each of the three AMV RNAs was not sufficient for recognition by the RdRp. Previously, it has been shown that this 127-nt sequence is sufficient for coat protein binding. Apparently, sequences required for recognition of AMV RNAs by the RdRp are longer than sequences required for CP binding. PMID:9094656

  12. Sequencing the GRHL3 Coding Region Reveals Rare Truncating Mutations and a Common Susceptibility Variant for Nonsyndromic Cleft Palate

    PubMed Central

    Mangold, Elisabeth; Böhmer, Anne C.; Ishorst, Nina; Hoebel, Ann-Kathrin; Gültepe, Pinar; Schuenke, Hannah; Klamt, Johanna; Hofmann, Andrea; Gölz, Lina; Raff, Ruth; Tessmann, Peter; Nowak, Stefanie; Reutter, Heiko; Hemprich, Alexander; Kreusch, Thomas; Kramer, Franz-Josef; Braumann, Bert; Reich, Rudolf; Schmidt, Gül; Jäger, Andreas; Reiter, Rudolf; Brosch, Sibylle; Stavusis, Janis; Ishida, Miho; Seselgyte, Rimante; Moore, Gudrun E.; Nöthen, Markus M.; Borck, Guntram; Aldhorae, Khalid A.; Lace, Baiba; Stanier, Philip; Knapp, Michael; Ludwig, Kerstin U.


    Nonsyndromic cleft lip with/without cleft palate (nsCL/P) and nonsyndromic cleft palate only (nsCPO) are the most frequent subphenotypes of orofacial clefts. A common syndromic form of orofacial clefting is Van der Woude syndrome (VWS) where individuals have CL/P or CPO, often but not always associated with lower lip pits. Recently, ∼5% of VWS-affected individuals were identified with mutations in the grainy head-like 3 gene (GRHL3). To investigate GRHL3 in nonsyndromic clefting, we sequenced its coding region in 576 Europeans with nsCL/P and 96 with nsCPO. Most strikingly, nsCPO-affected individuals had a higher minor allele frequency for rs41268753 (0.099) than control subjects (0.049; p = 1.24 × 10−2). This association was replicated in nsCPO/control cohorts from Latvia, Yemen, and the UK (pcombined = 2.63 × 10−5; ORallelic = 2.46 [95% CI 1.6–3.7]) and reached genome-wide significance in combination with imputed data from a GWAS in nsCPO triads (p = 2.73 × 10−9). Notably, rs41268753 is not associated with nsCL/P (p = 0.45). rs41268753 encodes the highly conserved p.Thr454Met (c.1361C>T) (GERP = 5.3), which prediction programs denote as deleterious, has a CADD score of 29.6, and increases protein binding capacity in silico. Sequencing also revealed four novel truncating GRHL3 mutations including two that were de novo in four families, where all nine individuals harboring mutations had nsCPO. This is important for genetic counseling: given that VWS is rare compared to nsCPO, our data suggest that dominant GRHL3 mutations are more likely to cause nonsyndromic than syndromic CPO. Thus, with rare dominant mutations and a common risk variant in the coding region, we have identified an important contribution for GRHL3 in nsCPO. PMID:27018475

  13. [Cloning and function identification of gene 'admA' and up-stream regulatory sequence related to antagonistic activity of Enterobacter cloacae B8].


    Zhu, Jun-Li; Li, De-Bao; Yu, Xu-Ping


    To reveal the antagonistic mechanism of B8 strain to Xanthomonas oryzae pv. oryzae, transposon tagging method and chromosome walking were deployed to clone antagonistic related fragments around Tn5 insertion site in the mutant strain B8B. The function of up-stream regulatory sequence of gene 'admA' involved in the antagonistic activity was further identified by gene knocking out technique. An antagonistic related left fragment of Tn5 insertion site, 2 608 bp in length, was obtained by tagging with Kan resistance gene of Tn5. A 2 354 bp right fragment of Tn5 insertion site was amplified with 2 rounds of chromosome walking. The length of the B contig around the Tn5 insertion site was 4 611 bp, containing 7 open reading frames (ORFs). Bioinformatic analysis revealed that these ORFs corresponded to the partial coding regions of glyceraldehyde-3-phosphate dehydrogenase, two LysR family transcriptional regulators, hypothetical protein VSWAT3-20465 of Vibrionales and admA, admB, and partial sequence of admC gene of Pantoea agglomerans biosynthetic gene cluster, respectively. Tn5 was inserted in the up-stream of 200 bp or 894 bp of the sequence corresponding to anrP ORF or admA gene on B8B, respectively. The B-1 and B-2 mutants that lost antagonistic activity were selected by homeologuous recombination technology in association with knocking out plasmid pMB-BG. These results suggested that the transcription and expression of anrP gene might be disrupted as a result of the knocking out of up-stream regulatory sequence by Tn5 in B8B strain, further causing biosythesis regulation of the antagonistic related gene cluster. Thus, the antagonistic related genes in B8 strain is a gene family similar as andrimid biosynthetic gene cluster, and the upstream regulatory region appears to be critical for the antibiotics biosynthesis.

  14. The upstream regulatory sequence of the light harvesting complex Lhcf2 gene of the marine diatom Phaeodactylum tricornutum enhances transcription in an orientation- and distance-independent fashion.


    Russo, Monia Teresa; Annunziata, Rossella; Sanges, Remo; Ferrante, Maria Immacolata; Falciatore, Angela


    Diatoms are a key phytoplankton group in the contemporary ocean, showing extraordinary adaptation capacities to rapidly changing environments. The recent availability of whole genome sequences from representative species has revealed distinct features in their genomes, like novel combinations of genes encoding distinct metabolisms and a significant number of diatom-specific genes. However, the regulatory mechanisms driving diatom gene expression are still largely uncharacterized. Considering the wide variety of fields of study orbiting diatoms, ranging from ecology, evolutionary biology to biotechnology, it is thus essential to increase our understanding of fundamental gene regulatory processes such as transcriptional regulation. To this aim, we explored the functional properties of the 5'-flanking region of the Phaeodatylum tricornutum Lhcf2 gene, encoding a member of the Light Harvesting Complex superfamily and we showed that this region enhances transcription of a GUS reporter gene in an orientation- and distance-independent fashion. This represents the first example of a cis-regulatory sequence with enhancer-like features discovered in diatoms and it is instrumental for the generation of novel genetic tools and diatom exploitation in different areas of study.

  15. Post-common envelope binaries from SDSS - VII. A catalogue of white dwarf-main sequence binaries

    NASA Astrophysics Data System (ADS)

    Rebassa-Mansergas, A.; Gänsicke, B. T.; Schreiber, M. R.; Koester, D.; Rodríguez-Gil, P.


    We present a catalogue of 1602 white-dwarf-main-sequence (WDMS) binaries from the spectroscopic Sloan Digital Sky Survey Data Release 6 (SDSS DR6). Among these, we identify 440 as new WDMS binaries. We select WDMS binary candidates by template fitting all 1.27 million DR6 spectra, using combined constraints in both χ2 and signal-to-noise ratio. In addition, we use Galaxy Evolution Explorer (GALEX) and UKIRT Infrared Sky Survey (UKIDSS) magnitudes to search for objects in which one of the two components dominates the SDSS spectrum. We use a decomposition/fitting technique to measure the effective temperatures, surface gravities, masses and distances to the white dwarfs, as well as the spectral types and distances to the companions in our catalogue. Distributions and density maps obtained from these stellar parameters are then used to study both the general properties and the selection effects of WDMS binaries in the SDSS. A comparison between the distances measured to the white dwarfs and the main-sequence companions shows dsec > dwd for approximately one-fifth of the systems, a tendency already found in our previous work. The hypothesis that magnetic activity raises the temperature of the inter-spot regions in active stars that are heavily covered by cool spots, leading to a bluer optical colour compared to inactive stars, remains the best explanation for this behaviour. We also make use of SDSS-GALEX-UKIDSS magnitudes to investigate the distribution of WDMS binaries, as well as their white-dwarf effective temperatures and companion star spectral types, in ultraviolet to infrared colour space. We show that WDMS binaries can be very efficiently separated from single main-sequence stars and white dwarfs when using a combined ultraviolet, optical and infrared colour selection. Finally, we also provide radial velocities for 1068 systems measured from the NaI λλ8183.27, 8194.81 absorption doublet and/or the Hα emission line. Among the systems with multiple SDSS

  16. Characterization of mutations of the phosphoinositide-3-kinase regulatory subunit, PIK3R2, in perisylvian polymicrogyria: a next generation sequencing study

    PubMed Central

    Mirzaa, Ghayda; Conti, Valerio; Timms, Andrew E.; Smyser, Christopher D.; Ahmed, Sarah; Carter, Melissa; Barnett, Sarah; Hufnagel, Robert B.; Goldstein, Amy; Narumi-Kishimoto, Yoko; Olds, Carissa; Collins, Sarah; Johnston, Kathreen; Deleuze, Jean-François; Nitschké, Patrick; Friend, Kathryn; Harris, Catharine; Goetsch, Allison; Martin, Beth; Boyle, Evan August; Parrini, Elena; Mei, Davide; Tattini, Lorenzo; Slavotinek, Anne; Blair, Ed; Barnett, Christopher; Shendure, Jay; Chelly, Jamel; Dobyns, William B.; Guerrini, Renzo


    SUMMARY Background Bilateral perisylvian polymicrogyria (BPP), the most common form of regional polymicrogyria, causes the congenital bilateral perisylvian syndrome, featuring oromotor dysfunction, cognitive impairment and epilepsy. BPP is etiologically heterogeneous, but only a few genetic causes have been reported. The aim of this study was to identify additional genetic etiologies of BPP and delineate their frequency in this patient population. Methods We performed child-parent (trio)-based whole exome sequencing (WES) on eight children with BPP. Following the identification of mosaic PIK3R2 mutations in two of these eight children, we performed targeted screening of PIK3R2 in a cohort of 118 children with BPP who were ascertained from 1980 until 2015 using two methods. First, we performed targeted sequencing of the entire PIK3R2 gene by single molecule molecular inversion probes (smMIPs) on 38 patients with BPP with normal-large head size. Second, we performed amplicon sequencing of the recurrent PIK3R2 mutation (p.Gly373Arg) on 80 children with various types of polymicrogyria including BPP. One additional patient underwent clinical WES independently, and was included in this study given the phenotypic similarity to our cohort. All patients included in this study were children (< 18 years of age) with polymicrogyria enrolled in our research program. Findings Using WES, we identified a mosaic mutation (p.Gly373Arg) in the regulatory subunit of the PI3K-AKT-MTOR pathway, PIK3R2, in two children with BPP. Of the 38 patients with BPP and normal-large head size who underwent targeted next generation sequencing by smMIPs, we identified constitutional and mosaic PIK3R2 mutations in 17 additional children. In parallel, one patient was found to have the recurrent PIK3R2 mutation by clinical WES. Seven patients had BPP alone, and 13 had BPP in association with features of the megalencephaly-polymicrogyria-polydactyly-hydrocephalus syndrome (MPPH). Nineteen patients had

  17. Single-cell sequencing analysis characterizes common and cell-lineage-specific mutations in a muscle-invasive bladder cancer

    PubMed Central


    Background Cancers arise through an evolutionary process in which cell populations are subjected to selection; however, to date, the process of bladder cancer, which is one of the most common cancers in the world, remains unknown at a single-cell level. Results We carried out single-cell exome sequencing of 66 individual tumor cells from a muscle-invasive bladder transitional cell carcinoma (TCC). Analyses of the somatic mutant allele frequency spectrum and clonal structure revealed that the tumor cells were derived from a single ancestral cell, but that subsequent evolution occurred, leading to two distinct tumor cell subpopulations. By analyzing recurrently mutant genes in an additional cohort of 99 TCC tumors, we identified genes that might play roles in the maintenance of the ancestral clone and in the muscle-invasive capability of subclones of this bladder cancer, respectively. Conclusions This work provides a new approach of investigating the genetic details of bladder tumoral changes at the single-cell level and a new method for assessing bladder cancer evolution at a cell-population level. PMID:23587365

  18. RegTransBase - A Database Of Regulatory Sequences and Interactionsin a Wide Range of Prokaryotic Genomes

    SciTech Connect

    Kazakov, Alexei E.; Cipriano, Michael J.; Novichkov, Pavel S.; Minovitsky, Simon; Vinogradov, Dmitry V.; Arkin, Adam; Mironov, AndreyA.; Gelfand, Mikhail S.; Dubchak, Inna


    RegTransBase, a manually curated database of regulatoryinteractions in prokaryotes, captures the knowledge in publishedscientific literature using a controlled vocabulary. Although a number ofdatabases describing interactions between regulatory proteins and theirbinding sites are currently being maintained, they focus mostly on themodel organisms Escherichia coli and Bacillus subtilis, or are entirelycomputationally derived. RegTransBase describes a large number ofregulatory interactions reported in many organisms and contains varioustypes of experimental data, in particular: the activation or repressionof transcription by an identified direct regulator; determining thetranscriptional regulatory function of a protein (or RNA) directlybinding to DNA (RNA); mapping or prediction of binding site for aregulatory protein; characterization of regulatory mutations. Currently,the RegTransBase content is derived from about 3000 relevant articlesdescribing over 7000 experiments in relation to 128 microbes. It containsdata on the regulation of about 7500 genes and evidence for 6500interactions with 650 regulators. RegTransBase also contains manuallycreated position weight matrices (PWM) that can be used to identifycandidate regulatory sites in over 60 species. RegTransBase is availableat

  19. Sequence variants in SLC16A11 are a common risk factor for type 2 diabetes in Mexico.


    Williams, Amy L; Jacobs, Suzanne B R; Moreno-Macías, Hortensia; Huerta-Chagoya, Alicia; Churchhouse, Claire; Márquez-Luna, Carla; García-Ortíz, Humberto; Gómez-Vázquez, María José; Burtt, Noël P; Aguilar-Salinas, Carlos A; González-Villalpando, Clicerio; Florez, Jose C; Orozco, Lorena; Haiman, Christopher A; Tusié-Luna, Teresa; Altshuler, David


    Performing genetic studies in multiple human populations can identify disease risk alleles that are common in one population but rare in others, with the potential to illuminate pathophysiology, health disparities, and the population genetic origins of disease alleles. Here we analysed 9.2 million single nucleotide polymorphisms (SNPs) in each of 8,214 Mexicans and other Latin Americans: 3,848 with type 2 diabetes and 4,366 non-diabetic controls. In addition to replicating previous findings, we identified a novel locus associated with type 2 diabetes at genome-wide significance spanning the solute carriers SLC16A11 and SLC16A13 (P = 3.9 × 10(-13); odds ratio (OR) = 1.29). The association was stronger in younger, leaner people with type 2 diabetes, and replicated in independent samples (P = 1.1 × 10(-4); OR = 1.20). The risk haplotype carries four amino acid substitutions, all in SLC16A11; it is present at ~50% frequency in Native American samples and ~10% in east Asian, but is rare in European and African samples. Analysis of an archaic genome sequence indicated that the risk haplotype introgressed into modern humans via admixture with Neanderthals. The SLC16A11 messenger RNA is expressed in liver, and V5-tagged SLC16A11 protein localizes to the endoplasmic reticulum. Expression of SLC16A11 in heterologous cells alters lipid metabolism, most notably causing an increase in intracellular triacylglycerol levels. Despite type 2 diabetes having been well studied by genome-wide association studies in other populations, analysis in Mexican and Latin American individuals identified SLC16A11 as a novel candidate gene for type 2 diabetes with a possible role in triacylglycerol metabolism.

  20. Sequence variants in SLC16A11 are a common risk factor for type 2 diabetes in Mexico

    PubMed Central


    Performing genetic studies in multiple human populations can identify disease risk alleles that are common in one population but rare in others1, with the potential to illuminate pathophysiology, health disparities, and the population genetic origins of disease alleles. We analyzed 9.2 million single nucleotide polymorphisms (SNPs) in each of 8,214 Mexicans and Latin Americans: 3,848 with type 2 diabetes (T2D) and 4,366 non-diabetic controls. In addition to replicating previous findings2–4, we identified a novel locus associated with T2D at genome-wide significance spanning the solute carriers SLC16A11 and SLC16A13 (P=3.9×10−13; odds ratio (OR)=1.29). The association was stronger in younger, leaner people with T2D, and replicated in independent samples (P=1.1×10−4; OR=1.20). The risk haplotype carries four amino acid substitutions, all in SLC16A11; it is present at ≈50% frequency in Native American samples and ≈10% in East Asian, but rare in European and African samples. Analysis of an archaic genome sequence indicated the risk haplotype introgressed into modern humans via admixture with Neandertals. The SLC16A11 mRNA is expressed in liver, and V5-tagged SLC16A11 protein localizes to the endoplasmic reticulum. Expression of SLC16A11 in heterologous cells alters lipid metabolism, most notably causing an increase in intracellular triacylglycerol levels. Despite T2D having been well studied by genome-wide association studies (GWAS) in other populations, analysis in Mexican and Latin American individuals identified SLC16A11 as a novel candidate gene for T2D with a possible role in triacylglycerol metabolism. PMID:24390345

  1. Analyses of Methylomes Derived from Meso-American Common Bean (Phaseolus vulgaris L.) Using MeDIP-Seq and Whole Genome Sodium Bisulfite-Sequencing

    PubMed Central

    Crampton, Mollee; Sripathi, Venkateswara R.; Hossain, Khwaja; Kalavacharla, Venu


    Common bean (Phaseolus vulgaris L.) is economically important for its high protein, fiber, and micronutrient contents, with a relatively small genome size of ∼587 Mb. Common bean is genetically diverse with two major gene pools, Meso-American and Andean. The phenotypic variability within common bean is partly attributed to the genetic diversity and epigenetic changes that are largely influenced by environmental factors. It is well established that an important epigenetic regulator of gene expression is DNA methylation. Here, we present results generated from two high-throughput sequencing technologies, methylated DNA immunoprecipitation-sequencing (MeDIP-seq) and whole genome bisulfite-sequencing (BS-Seq). Our analyses revealed that this Meso-American common bean displays similar methylation patterns as other previously published plant methylomes, with CG ∼50%, CHG ∼30%, and CHH ∼2.7% methylation, however, these differ from the common bean reference methylome of Andean origin. We identified higher CG methylation levels in both promoter and genic regions than CHG and CHH contexts. Moreover, we found relatively higher CG methylation levels in genes than in promoters. Conversely, the CHG and CHH methylation levels were highest in promoters than in genes. This is the first genome-wide DNA methylation profiling study in a Meso-American common bean cultivar (“Sierra”) using NGS approaches. Our long-term goal is to generate genome-wide epigenomic maps in common bean focusing on chromatin accessibility, histone modifications, and DNA methylation. PMID:27199997

  2. Analyses of Methylomes Derived from Meso-American Common Bean (Phaseolus vulgaris L.) Using MeDIP-Seq and Whole Genome Sodium Bisulfite-Sequencing.


    Crampton, Mollee; Sripathi, Venkateswara R; Hossain, Khwaja; Kalavacharla, Venu


    Common bean (Phaseolus vulgaris L.) is economically important for its high protein, fiber, and micronutrient contents, with a relatively small genome size of ∼587 Mb. Common bean is genetically diverse with two major gene pools, Meso-American and Andean. The phenotypic variability within common bean is partly attributed to the genetic diversity and epigenetic changes that are largely influenced by environmental factors. It is well established that an important epigenetic regulator of gene expression is DNA methylation. Here, we present results generated from two high-throughput sequencing technologies, methylated DNA immunoprecipitation-sequencing (MeDIP-seq) and whole genome bisulfite-sequencing (BS-Seq). Our analyses revealed that this Meso-American common bean displays similar methylation patterns as other previously published plant methylomes, with CG ∼50%, CHG ∼30%, and CHH ∼2.7% methylation, however, these differ from the common bean reference methylome of Andean origin. We identified higher CG methylation levels in both promoter and genic regions than CHG and CHH contexts. Moreover, we found relatively higher CG methylation levels in genes than in promoters. Conversely, the CHG and CHH methylation levels were highest in promoters than in genes. This is the first genome-wide DNA methylation profiling study in a Meso-American common bean cultivar ("Sierra") using NGS approaches. Our long-term goal is to generate genome-wide epigenomic maps in common bean focusing on chromatin accessibility, histone modifications, and DNA methylation.

  3. Common and distinguishing regulatory and expression characteristics of the highly related KorB proteins of streptomycete plasmids pIJ101 and pSB24.2.


    Ducote, Matthew J; Pettis, Gregg S


    The conjugative plasmid pIJ101 of the spore-forming bacterium Streptomyces lividans contains a regulatory gene, korB, whose product is required to repress potentially lethal expression of the pIJ101 kilB gene. The KorB protein also autoregulates korB gene expression and may be involved in control of pIJ101 copy number. KorB (pIJ101) is expressed as a 10-kDa protein in S. lividans that is immediately processed to a mature 6-kDa repressor molecule. The conjugative Streptomyces cyanogenus plasmid pSB24.1 is deleted upon entry into S. lividans to form pSB24.2, a nonconjugative derivative that contains a korB gene nearly identical to that of pIJ101. Previous evidence that korB of pSB24.2 is capable of overriding pIJ101 kilB-associated lethality supported the notion that pIJ101 and pSB24.2 encode highly related, perhaps even identical conjugation systems. Here we show that KorB (pIJ101) and KorB (pSB24.2) repress transcription from the pIJ101 kilB promoter equally well, although differences exist with respect to their interactions with kilB promoter sequences. Despite high sequence and functional similarities, KorB (pSB24.2) was found to exist as multiple stable forms ranging in size from 10 to 6 kDa both in S. lividans and S. cyanogenus. Immediate processing of KorB (pIJ101) exclusively to the 6-kDa repressor form meanwhile was conserved between the two species. A feature common to both proteins was a marked increase in expression or accumulation upon sporulation, an occurrence that may indicate a particular need for increased quantities of this regulatory protein upon spore germination and resumption of active growth of plasmid-containing cells.

  4. Common and Distinguishing Regulatory and Expression Characteristics of the Highly Related KorB Proteins of Streptomycete Plasmids pIJ101 and pSB24.2

    PubMed Central

    Ducote, Matthew J.; Pettis, Gregg S.


    The conjugative plasmid pIJ101 of the spore-forming bacterium Streptomyces lividans contains a regulatory gene, korB, whose product is required to repress potentially lethal expression of the pIJ101 kilB gene. The KorB protein also autoregulates korB gene expression and may be involved in control of pIJ101 copy number. KorB (pIJ101) is expressed as a 10-kDa protein in S. lividans that is immediately processed to a mature 6-kDa repressor molecule. The conjugative Streptomyces cyanogenus plasmid pSB24.1 is deleted upon entry into S. lividans to form pSB24.2, a nonconjugative derivative that contains a korB gene nearly identical to that of pIJ101. Previous evidence that korB of pSB24.2 is capable of overriding pIJ101 kilB-associated lethality supported the notion that pIJ101 and pSB24.2 encode highly related, perhaps even identical conjugation systems. Here we show that KorB (pIJ101) and KorB (pSB24.2) repress transcription from the pIJ101 kilB promoter equally well, although differences exist with respect to their interactions with kilB promoter sequences. Despite high sequence and functional similarities, KorB (pSB24.2) was found to exist as multiple stable forms ranging in size from 10 to 6 kDa both in S. lividans and S. cyanogenus. Immediate processing of KorB (pIJ101) exclusively to the 6-kDa repressor form meanwhile was conserved between the two species. A feature common to both proteins was a marked increase in expression or accumulation upon sporulation, an occurrence that may indicate a particular need for increased quantities of this regulatory protein upon spore germination and resumption of active growth of plasmid-containing cells. PMID:12813071

  5. Two distinct nuclear factors bind the conserved regulatory sequences of a rabbit major histocompatibility complex class II gene.

    PubMed Central

    Sittisombut, N


    The constitutive coexpression of the major histocompatibility complex (MHC) class II genes in B lymphocytes requires positive, trans-acting transcriptional factors. The need for these trans-acting factors has been suggested by the reversion of the MHC class II-negative phenotype of rare B-lymphocyte mutants through somatic cell fusion with B cells or T-cell lines. The mechanism by which the trans-acting factors exert their effect on gene transcription is unknown. The possibility that two highly conserved DNA sequences, located 90 to 100 base pairs (bp) (the A sequence) and 60 to 70 bp (the B sequence) upstream of the transcription start site of the class II genes, are recognized by the trans-acting factors was investigated in this study. By using the gel electrophoresis retardation assay, a minimum of two proteins which specifically bound the conserved A or B sequence of a rabbit DP beta gene were identified in murine nuclear extracts of a B-lymphoma cell line, A20-2J. Fractionation of nuclear extract through a heparin-agarose column allowed the identification of one protein, designated NF-MHCIIB, which bound an oligonucleotide containing the B sequence and protected the entire B sequence in the DNase I protection analysis. Another protein, designated NF-MHCIIA, which bound an oligonucleotide containing the A sequence and partially protected the 3' half of this sequence, was also identified. NF-MHCIIB did not protect a CCAAT sequence located 17 bp downstream of the B sequence. The possible relationship between these DNA-binding factors and the trans-acting factors identified in the cell fusion experiments is discussed. Images PMID:3133552

  6. De novo sequencing of root transcriptome reveals complex cadmium-responsive regulatory networks in radish (Raphanus sativus L.).


    Xu, Liang; Wang, Yan; Liu, Wei; Wang, Jin; Zhu, Xianwen; Zhang, Keyun; Yu, Rugang; Wang, Ronghua; Xie, Yang; Zhang, Wei; Gong, Yiqin; Liu, Liwang


    Cadmium (Cd) is a nonessential metallic trace element that poses potential chronic toxicity to living organisms. To date, little is known about the Cd-responsive regulatory network in root vegetable crops including radish. In this study, 31,015 unigenes representing 66,552 assembled unique transcripts were isolated from radish root under Cd stress based on de novo transcriptome assembly. In all, 1496 differentially expressed genes (DEGs) consisted of 3579 transcripts were identified from Cd-free (CK) and Cd-treated (Cd200) libraries. Gene Ontology and pathway enrichment analysis indicated that the up- and down-regulated DEGs were predominately involved in glucosinolate biosynthesis as well as cysteine and methionine-related pathways, respectively. RT-qPCR showed that the expression profiles of DEGs were in consistent with results from RNA-Seq analysis. Several candidate genes encoding phytochelatin synthase (PCS), metallothioneins (MTs), glutathione (GSH), zinc iron permease (ZIPs) and ABC transporter were responsible for Cd uptake, accumulation, translocation and detoxification in radish. The schematic model of DEGs and microRNAs-involved in Cd-responsive regulatory network was proposed. This study represents a first comprehensive transcriptome-based characterization of Cd-responsive DEGs in radish. These results could provide fundamental insight into complex Cd-responsive regulatory networks and facilitate further genetic manipulation of Cd accumulation in root vegetable crops.

  7. Deciphering the molecular mechanisms underlying the binding of the TWIST1/E12 complex to regulatory E-box sequences.


    Bouard, Charlotte; Terreux, Raphael; Honorat, Mylène; Manship, Brigitte; Ansieau, Stéphane; Vigneron, Arnaud M; Puisieux, Alain; Payen, Léa


    The TWIST1 bHLH transcription factor controls embryonic development and cancer processes. Although molecular and genetic analyses have provided a wealth of data on the role of bHLH transcription factors, very little is known on the molecular mechanisms underlying their binding affinity to the E-box sequence of the promoter. Here, we used an in silico model of the TWIST1/E12 (TE) heterocomplex and performed molecular dynamics (MD) simulations of its binding to specific (TE-box) and modified E-box sequences. We focused on (i) active E-box and inactive E-box sequences, on (ii) modified active E-box sequences, as well as on (iii) two box sequences with modified adjacent bases the AT- and TA-boxes. Our in silico models were supported by functional in vitro binding assays. This exploration highlighted the predominant role of protein side-chain residues, close to the heart of the complex, at anchoring the dimer to DNA sequences, and unveiled a shift towards adjacent ((-1) and (-1*)) bases and conserved bases of modified E-box sequences. In conclusion, our study provides proof of the predictive value of these MD simulations, which may contribute to the characterization of specific inhibitors by docking approaches, and their use in pharmacological therapies by blocking the tumoral TWIST1/E12 function in cancers.

  8. Identification of an upstream regulatory sequence that mediates the transcription of mox genes in Methylobacterium extorquens AM1.


    Zhang, Meng; FitzGerald, Kelly A; Lidstrom, Mary E


    A multiple A-tract sequence has been identified in the promoter regions for the mxaF, pqqA, mxaW, mxbD and mxcQ genes involved in methanol oxidation in Methylobacterium extorquens AM1, a facultative methylotroph. Site-directed mutagenesis was exploited to delete or change this conserved sequence. Promoter-xylE transcriptional fusions were used to assess promoter activity in these mutants. A fiftyfold drop in the XylE activity was observed for the mxaF and pqqA promoters without this sequence, and a five- to sixfold drop in the XylE activity was observed for the mxbD and mxcQ promoters without this sequence. Mutants were generated in the chromosomal copies in which this sequence was either deleted or altered, and these mutants were unable to grow on methanol. When one of these sequences was added to Plac of Escherichia coli, which is a weak constitutive promoter in M. extorquens AM1, the activity increased two- to threefold. These results suggest that this sequence is essential for normal expression of these genes in M. extorquens AM1, and may serve as a general enhancer element for genetic constructs in this bacterium.

  9. A re-sequencing based assessment of genomic heterogeneity and fast neutron-induced deletions in a common bean cultivar

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A small fast neutron mutant population has been established from Phaseolus vulgaris cv. Red Hawk. We leveraged the available P. vulgaris genome sequence and high throughput next generation DNA sequencing to examine the genomic structure of five Phaseolus vulgaris cv. Red Hawk fast neutron mutants wi...

  10. The positive regulatory function of the 5'-proximal open reading frames in GCN4 mRNA can be mimicked by heterologous, short coding sequences.

    PubMed Central

    Williams, N P; Mueller, P P; Hinnebusch, A G


    Translational control of GCN4 expression in the yeast Saccharomyces cerevisiae is mediated by multiple AUG codons present in the leader of GCN4 mRNA, each of which initiates a short open reading frame of only two or three codons. Upstream AUG codons 3 and 4 are required to repress GCN4 expression in normal growth conditions; AUG codons 1 and 2 are needed to overcome this repression in amino acid starvation conditions. We show that the regulatory function of AUG codons 1 and 2 can be qualitatively mimicked by the AUG codons of two heterologous upstream open reading frames (URFs) containing the initiation regions of the yeast genes PGK and TRP1. These AUG codons inhibit GCN4 expression when present singly in the mRNA leader; however, they stimulate GCN4 expression in derepressing conditions when inserted upstream from AUG codons 3 and 4. This finding supports the idea that AUG codons 1 and 2 function in the control mechanism as translation initiation sites and further suggests that suppression of the inhibitory effects of AUG codons 3 and 4 is a general consequence of the translation of URF 1 and 2 sequences upstream. Several observations suggest that AUG codons 3 and 4 are efficient initiation sites; however, these sequences do not act as positive regulatory elements when placed upstream from URF 1. This result suggests that efficient translation is only one of the important properties of the 5' proximal URFs in GCN4 mRNA. We propose that a second property is the ability to permit reinitiation following termination of translation and that URF 1 is optimized for this regulatory function. Images PMID:3065626

  11. On universal common ancestry, sequence similarity, and phylogenetic structure: the sins of P-values and the virtues of Bayesian evidence

    PubMed Central


    Background The universal common ancestry (UCA) of all known life is a fundamental component of modern evolutionary theory, supported by a wide range of qualitative molecular evidence. Nevertheless, recently both the status and nature of UCA has been questioned. In earlier work I presented a formal, quantitative test of UCA in which model selection criteria overwhelmingly choose common ancestry over independent ancestry, based on a dataset of universally conserved proteins. These model-based tests are founded in likelihoodist and Bayesian probability theory, in opposition to classical frequentist null hypothesis tests such as Karlin-Altschul E-values for sequence similarity. In a recent comment, Koonin and Wolf (K&W) claim that the model preference for UCA is "a trivial consequence of significant sequence similarity". They support this claim with a computational simulation, derived from universally conserved proteins, which produces similar sequences lacking phylogenetic structure. The model selection tests prefer common ancestry for this artificial data set. Results For the real universal protein sequences, hierarchical phylogenetic structure (induced by genealogical history) is the overriding reason for why the tests choose UCA; sequence similarity is a relatively minor factor. First, for cases of conflicting phylogenetic structure, the tests choose independent ancestry even with highly similar sequences. Second, certain models, like star trees and K&W's profile model (corresponding to their simulation), readily explain sequence similarity yet lack phylogenetic structure. However, these are extremely poor models for the real proteins, even worse than independent ancestry models, though they explain K&W's artificial data well. Finally, K&W's simulation is an implementation of a well-known phylogenetic model, and it produces sequences that mimic homologous proteins. Therefore the model selection tests work appropriately with the artificial data. Conclusions For K

  12. Differentiated evolutionary relationships among chordates from comparative alignments of multiple sequences of MyoD and MyoG myogenic regulatory factors.


    Oliani, L C; Lidani, K C F; Gabriel, J E


    MyoD and MyoG are transcription factors that have essential roles in myogenic lineage determination and muscle differentiation. The purpose of this study was to compare multiple amino acid sequences of myogenic regulatory proteins to infer evolutionary relationships among chordates. Protein sequences from Mus musculus (P10085 and P12979), human Homo sapiens (P15172 and P15173), bovine Bos taurus (Q7YS82 and Q7YS81), wild pig Sus scrofa (P49811 and P49812), quail Coturnix coturnix (P21572 and P34060), chicken Gallus gallus (P16075 and P17920), rat Rattus norvegicus (Q02346 and P20428), domestic water buffalo Bubalus bubalis (D2SP11 and A7L034), and sheep Ovis aries (Q90477 and D3YKV7) were searched from a non-redundant protein sequence database UniProtKB/Swiss-Prot, and subsequently analyzed using the Mega6.0 software. MyoD evolutionary analyses revealed the presence of three main clusters with all mammals branched in one cluster, members of the order Rodentia (mouse and rat) in a second branch linked to the first, and birds of the order Galliformes (chicken and quail) remaining isolated in a third. MyoG evolutionary analyses aligned sequences in two main clusters, all mammalian specimens grouped in different sub-branches, and birds clustered in a second branch. These analyses suggest that the evolution of MyoD and MyoG was driven by different pathways.

  13. DNA sequence of Rhizobium trifolii nodulation genes reveals a reiterated and potentially regulatory sequence preceding nodABC and nodFE.

    PubMed Central

    Schofield, P R; Watson, J M


    The Rhizobium trifolii nod genes required for host-specific nodulation of clovers are located on 14 kb of Sym (symbiotic) plasmid DNA. Analysis of the nucleotide sequence of a 3.7 kb portion of this region has revealed open reading frames corresponding to the nodABCDEF genes. A DNA sequencing technique, using primer extension from within Tn5, has been used to determine the precise locations of Tn5 mutations within the nod genes and the phenotypes of the corresponding mutants correlate with their mapped locations. The predicted nodA and nodB genes overlap by four nucleotides and the nod F and nodE genes overlap by a single nucleotide, suggesting that translational coupling may ensure the synthesis of equimolar amounts of these gene products. The nodABC and nodFE genes constitute separate transcriptional units and each is preceded by a conserved 76-bp sequence which may be involved in the regulation of expression of these genes. Images PMID:3008100

  14. High-Throughput Sequencing Reveals H2O2 Stress-Associated MicroRNAs and a Potential Regulatory Network in Brachypodium distachyon Seedlings

    PubMed Central

    Lv, Dong-Wen; Zhen, Shoumin; Zhu, Geng-Rui; Bian, Yan-Wei; Chen, Guan-Xing; Han, Cai-Xia; Yu, Zi-Tong; Yan, Yue-Ming


    Oxidative stress in plants can be triggered by many environmental stress factors, such as drought and salinity. Brachypodium distachyon is a model organism for the study of biofuel plants and crops, such as wheat. Although recent studies have found many oxidative stress response-related proteins, the mechanism of microRNA (miRNA)-mediated oxidative stress response is still unclear. Using next generation high-throughput sequencing technology, the small RNAs were sequenced from the model plant B. distachyon 21 (Bd21) under H2O2 stress and normal growth conditions. In total, 144 known B. distachyon miRNAs and 221 potential new miRNAs were identified. Further analysis of potential new miRNAs suggested that 36 could be clustered into known miRNA families, while the remaining 185 were identified as B. distachyon-specific new miRNAs. Differential analysis of miRNAs from the normal and H2O2 stress libraries identified 31 known and 30 new H2O2 stress responsive miRNAs. The expression patterns of seven representative miRNAs were verified by reverse transcription quantitative polymerase chain reaction (RT-qPCR) analysis, which produced results consistent with those of the deep sequencing method. Moreover, we also performed RT-qPCR analysis to verify the expression levels of 13 target genes and the cleavage site of 5 target genes by known or novel miRNAs were validated experimentally by 5′ RACE. Additionally, a miRNA-mediated gene regulatory network for H2O2 stress response was constructed. Our study identifies a set of H2O2-responsive miRNAs and their target genes and reveals the mechanism of oxidative stress response and defense at the post-transcriptional regulatory level. PMID:27812362

  15. Structure analysis of two Toxoplasma gondii and Neospora caninum satellite DNA families and evolution of their common monomeric sequence.


    Clemente, Marina; de Miguel, Natalia; Lia, Veronica V; Matrajt, Mariana; Angel, Sergio O


    A family of repetitive DNA elements of approximately 350 bp-Sat350-that are members of Toxoplasma gondii satellite DNA was further analyzed. Sequence analysis identified at least three distinct repeat types within this family, called types A, B, and C. B repeats were divided into the subtypes B1 and B2. A search for internal repetitions within this family permitted the identification of conserved regions and the design of PCR primers that amplify almost all these repetitive elements. These primers amplified the expected 350-bp repeats and a novel 680-bp repetitive element (Sat680) related to this family. Two additional tandemly repeated high-order structures corresponding to this satellite DNA family were found by searching the Toxoplasma genome database with these sequences. These studies were confirmed by sequence analysis and identified: (1). an arrangement of AB1CB2 350-bp repeats and (2). an arrangement of two 350-bp-like repeats, resulting in a 680-bp monomer. Sequence comparison and phylogenetic analysis indicated that both high-order structures may have originated from the same ancestral 350-bp repeat. PCR amplification, sequence analysis and Southern blot showed that similar high-order structures were also found in the Toxoplasma-sister taxon Neospora caninum. The Toxoplasma genome database ( ) permitted the assembly of a contig harboring Sat350 elements at one end and a long nonrepetitive DNA sequence flanking this satellite DNA. The region bordering the Sat350 repeats contained two differentially expressed sequence-related regions and interstitial telomeric sequences.

  16. RNA sequencing of laser-capture microdissected compartments of the maize kernel identifies regulatory modules associated with endosperm cell differentiation.


    Zhan, Junpeng; Thakare, Dhiraj; Ma, Chuang; Lloyd, Alan; Nixon, Neesha M; Arakaki, Angela M; Burnett, William J; Logan, Kyle O; Wang, Dongfang; Wang, Xiangfeng; Drews, Gary N; Yadegari, Ramin


    Endosperm is an absorptive structure that supports embryo development or seedling germination in angiosperms. The endosperm of cereals is a main source of food, feed, and industrial raw materials worldwide. However, the genetic networks that regulate endosperm cell differentiation remain largely unclear. As a first step toward characterizing these networks, we profiled the mRNAs in five major cell types of the differentiating endosperm and in the embryo and four maternal compartments of the maize (Zea mays) kernel. Comparisons of these mRNA populations revealed the diverged gene expression programs between filial and maternal compartments and an unexpected close correlation between embryo and the aleurone layer of endosperm. Gene coexpression network analysis identified coexpression modules associated with single or multiple kernel compartments including modules for the endosperm cell types, some of which showed enrichment of previously identified temporally activated and/or imprinted genes. Detailed analyses of a coexpression module highly correlated with the basal endosperm transfer layer (BETL) identified a regulatory module activated by MRP-1, a regulator of BETL differentiation and function. These results provide a high-resolution atlas of gene activity in the compartments of the maize kernel and help to uncover the regulatory modules associated with the differentiation of the major endosperm cell types.

  17. Preliminary whole-exome sequencing reveals mutations that imply common tumorigenicity pathways in multiple endocrine neoplasia type 1 patients

    PubMed Central

    Arenas, Minerva Angélica Romero; Fowler, Richard G.; Lucas, F. Anthony San; Shen, Jie; Rich, Thereasa A.; Grubbs, Elizabeth G.; Lee, Jeffrey E.; Scheet, Paul; Perrier, Nancy D.; Zhao, Hua


    Background Whole-exome sequencing studies have not established definitive somatic mutation patterns among patients with sporadic hyperparathyroidism (HPT). No sequencing has evaluated multiple endocrine neoplasia type 1 (MEN1)-related HPT. We sought to perform whole-exome sequencing in HPT patients to identify somatic mutations and associated biological pathways and tumorigenic networks. Methods Whole-exome sequencing was performed on blood and tissue from HPT patients (MEN1 and sporadic) and somatic single nucleotide variants (SNVs) were identified. Stop-gain and stop-loss SNVs were analyzed with Ingenuity Pathways Analysis (IPA). Loss of heterozygosity (LOH) was also assessed. Results Sequencing was performed on 4 MEN1 and 10 sporadic cases. Eighteen stop-gain/stop-loss SNV mutations were identified in 3 MEN1 patients. One complex network was identified on IPA: Cellular function and maintenance, tumor morphology, and cardiovascular disease (IPA score = 49). A nonsynonymous SNV of TP53 (lysine-to-glutamic acid change at codon 81) identified in a MEN1 patient was suggested to be a driver mutation (Cancer-specific High-throughput Annotation of Somatic Mutations; P = .002). All MEN1 and 3/10 sporadic specimens demonstrated LOH of chromosome 11. Conclusion Whole-exome sequencing revealed somatic mutations in MEN1 associated with a single tumorigenic network, whereas sporadic pathogenesis seemed to be more diverse. A somatic TP53 mutation was also identified. LOH of chromosome 11 was seen in all MEN1 and 3 of 10 sporadic patients. PMID:25456907

  18. Developmental appearance of factors that bind specifically to cis-regulatory sequences of a gene expressed in the sea urchin embryo.


    Calzone, F J; Thézé, N; Thiebaud, P; Hill, R L; Britten, R J; Davidson, E H


    Previous gene-transfer experiments have identified a 2500-nucleotide 5' domain of the CyIIIa cytoskeletal actin gene, which contains cis-regulatory sequences that are necessary and sufficient for spatial and temporal control of CyIIIa gene expression during embryogenesis. This gene is activated in late cleavage, exclusively in aboral ectoderm cell lineages. In this study, we focus on interactions demonstrated in vitro between sequences of the regulatory domain and proteins present in crude extracts derived from sea urchin embryo nuclei and from unfertilized eggs. Quantitative gel-shift measurements are utilized to estimate minimum numbers of factor molecules per embryo at 24 hr postfertilization, when the CyIIIa gene is active, at 7 hr, when it is still silent, and in the unfertilized egg. We also estimate the binding affinity preferences (Kr) of the various factors for their respective sites, relative to their affinity for synthetic DNA competitors. At least 14 different specific interactions occur within the regulatory regions, some of which produce multiple DNA-protein complexes. Values of Kr range from approximately 2 x 10(4) to approximately 2 x 10(6) for these factors under the conditions applied. With one exception, the minimum factor prevalences that we measured in the 400-cell 24-hr embryo nuclear extracts fell within the range of 2 x 10(5) to 2 x 10(6) molecules per embryo, i.e., a few hundred to a few thousand molecules per nucleus. Three developmental patterns were observed with respect to factor prevalence: Factors reacting at one site were found in unfertilized egg cytoplasm at about the same level per egg or embryo as in 24-hr embryo nuclei; factors reacting with five other regions of the regulatory domain are not detectable in egg cytoplasm but in 7-hr mid-cleavage-stage embryo, nuclei are already at or close to their concentrations in the 24-hr embryo nuclei; and factors reacting with five additional regions are not detectable in egg cytoplasm and

  19. Characterization of the cis elements in the proximal promoter regions of the anthocyanin pathway genes reveals a common regulatory logic that governs pathway regulation

    PubMed Central

    Zhu, Zhixin; Wang, Hailong; Wang, Yiting; Guan, Shan; Wang, Fang; Tang, Jingyu; Zhang, Ruijuan; Xie, Lulu; Lu, Yingqing


    Cellular activities such as compound synthesis often require the transcriptional activation of an entire pathway; however, the molecular mechanisms underlying pathway activation have rarely been explained. Here, the cis regulatory architecture of the anthocyanin pathway genes targeted by the transcription factor (TF) complex including MYB, bHLH, and WDR was systematically analysed in one species and the findings extended to others. In Ipomoea purpurea, the IpMYB1-IpbHLH2-IpWDR1 (IpMBW) complex was found to be orthologous to the PAP1-GL3-TTG1 (AtPGT) complex of Arabidopsis thaliana, and interacted with a 7-bp MYB-recognizing element (MRE) and a 6-bp bHLH-recognizing element (BRE) at the proximal promoter region of the pathway genes. There was little transcription of the gene in the absence of the MRE or BRE. The cis elements identified experimentally converged on two syntaxes, ANCNNCC for MREs and CACN(A/C/T)(G/T) for BREs, and our bioinformatic analysis showed that these were present within anthocyanin gene promoters in at least 35 species, including both gymnosperms and angiosperms. For the anthocyanin pathway, IpMBW and AtPGT recognized the interspecific promoters of both early and later genes. In A. thaliana, the seed-specific TF complex (TT2, TT8, and TTG1) may regulate all the anthocyanin pathway genes, in addition to the proanthocyanidin-specific BAN. When multiple TF complexes in the anthocyanin pathway were compared, the cis architecture played a role larger than the TF complex in determining the variation in promoter activity. Collectively, a cis logic common to the pathway gene promoters was found, and this logic is essential for the trans factors to regulate the pathway. PMID:25911741

  20. Propionibacterium acnes: Disease-Causing Agent or Common Contaminant? Detection in Diverse Patient Samples by Next-Generation Sequencing

    PubMed Central

    Friis-Nielsen, Jens; Vinner, Lasse; Hansen, Thomas Arn; Richter, Stine Raith; Fridholm, Helena; Herrera, Jose Alejandro Romero; Lund, Ole; Brunak, Søren; Izarzugaza, Jose M. G.; Mourier, Tobias; Nielsen, Lars Peter


    Propionibacterium acnes is the most abundant bacterium on human skin, particularly in sebaceous areas. P. acnes is suggested to be an opportunistic pathogen involved in the development of diverse medical conditions but is also a proven contaminant of human clinical samples and surgical wounds. Its significance as a pathogen is consequently a matter of debate. In the present study, we investigated the presence of P. acnes DNA in 250 next-generation sequencing data sets generated from 180 samples of 20 different sample types, mostly of cancerous origin. The samples were subjected to either microbial enrichment, involving nuclease treatment to reduce the amount of host nucleic acids, or shotgun sequencing. We detected high proportions of P. acnes DNA in enriched samples, particularly skin tissue-derived and other tissue samples, with the levels being higher in enriched samples than in shotgun-sequenced samples. P. acnes reads were detected in most samples analyzed, though the proportions in most shotgun-sequenced samples were low. Our results show that P. acnes can be detected in practically all sample types when molecular methods, such as next-generation sequencing, are employed. The possibility of contamination from the patient or other sources, including laboratory reagents or environment, should therefore always be considered carefully when P. acnes is detected in clinical samples. We advocate that detection of P. acnes always be accompanied by experiments validating the association between this bacterium and any clinical condition. PMID:26818667

  1. T Cell Receptor CDR3 Sequence but Not Recognition Characteristics Distinguish Autoreactive Effector and Foxp3+ Regulatory T Cells

    PubMed Central

    Liu, Xin; Nguyen, Phuong; Liu, Wei; Cheng, Cheng; Steeves, Meredith; Obenauer, John C.; Ma, Jing; Geiger, Terrence L.


    SUMMARY The source, specificity, and plasticity of the forkhead box transcription factor 3 (Foxp3)+ regulatory T (Treg) and conventional T (Tconv) cell populations active at sites of autoimmune pathology are not well characterized. To evaluate this, we combined global repertoire analyses and functional assessments of isolated T cell receptors (TCR) from TCRα retrogenic mice with autoimmune encephalomyelitis. Treg and Tconv cell TCR repertoires were distinct, and autoantigen-specific Treg and Tconv cells were enriched in diseased tissue. Autoantigen sensitivity and fine specificity of these cells intersected, implying that differences in responsiveness were not responsible for lineage specification. Notably, autoreactive Treg and Tconv cells could be fully distinguished by an acidic versus aliphatic variation at a single TCR CDR3 residue. Our results imply that ontogenically distinct Treg and Tconv cell repertoires with convergent specificities for autoantigen respond during autoimmunity and argue against more than limited plasticity between Treg and Tconv cells during autoimmune inflammation. PMID:20005134

  2. A site-specific, single-copy transgenesis strategy to identify 5' regulatory sequences of the mouse testis-determining gene Sry.


    Quinn, Alexander; Kashimada, Kenichi; Davidson, Tara-Lynne; Ng, Ee Ting; Chawengsaksophak, Kallayanee; Bowles, Josephine; Koopman, Peter


    The Y-chromosomal gene SRY acts as the primary trigger for male sex determination in mammalian embryos. Correct regulation of SRY is critical: aberrant timing or level of Sry expression is known to disrupt testis development in mice and we hypothesize that mutations that affect regulation of human SRY may account for some of the many cases of XY gonadal dysgenesis that currently remain unexplained. However, the cis-sequences involved in regulation of Sry have not been identified, precluding a test of this hypothesis. Here, we used a transgenic mouse approach aimed at identifying mouse Sry 5' flanking regulatory sequences within 8 kb of the Sry transcription start site (TSS). To avoid problems associated with conventional pronuclear injection of transgenes, we used a published strategy designed to yield single-copy transgene integration at a defined, transcriptionally open, autosomal locus, Col1a1. None of the Sry transgenes tested was expressed at levels compatible with activation of Sox9 or XX sex reversal. Our findings indicate either that the Col1a1 locus does not provide an appropriate context for the correct expression of Sry transgenes, or that the cis-sequences required for Sry expression in the developing gonads lie beyond 8 kb 5' of the TSS.

  3. Structural analysis of the regulatory elements of the type-II procollagen gene. Conservation of promoter and first intron sequences between human and mouse.

    PubMed Central

    Vikkula, M; Metsäranta, M; Syvänen, A C; Ala-Kokko, L; Vuorio, E; Peltonen, L


    Transcription of the type-II procollagen gene (COL2A1) is very specifically restricted to a limited number of tissues, particularly cartilages. In order to identify transcription-control motifs we have sequenced the promoter region and the first intron of the human and mouse COL2A1 genes. With the assumption that these motifs should be well conserved during evolution, we have searched for potential elements important for the tissue-specific transcription of the COL2A1 gene by aligning the two sequences with each other and with the available rat type-II procollagen sequence for the promoter. With this approach we could identify specific evolutionarily well-conserved motifs in the promoter area. On the other hand, several suggested regulatory elements in the promoter region did not show evolutionary conservation. In the middle of the first intron we found a cluster of well-conserved transcription-control elements and we conclude that these conserved motifs most probably possess a significant function in the control of the tissue-specific transcription of the COL2A1 gene. We also describe locations of additional, highly conserved nucleotide stretches, which are good candidate regions in the search for binding sites of yet-uncharacterized cartilage-specific transcription regulators of the COL2A1 gene. PMID:1637314

  4. Deep sequencing of RNA from immune cell-derived vesicles uncovers the selective incorporation of small non-coding RNA biotypes with potential regulatory functions

    PubMed Central

    Nolte-’t Hoen, Esther N. M.; Buermans, Henk P. J.; Waasdorp, Maaike; Stoorvogel, Willem; Wauben, Marca H. M.; ’t Hoen, Peter A. C.


    Cells release RNA-carrying vesicles and membrane-free RNA/protein complexes into the extracellular milieu. Horizontal vesicle-mediated transfer of such shuttle RNA between cells allows dissemination of genetically encoded messages, which may modify the function of target cells. Other studies used array analysis to establish the presence of microRNAs and mRNA in cell-derived vesicles from many sources. Here, we used an unbiased approach by deep sequencing of small RNA released by immune cells. We found a large variety of small non-coding RNA species representing pervasive transcripts or RNA cleavage products overlapping with protein coding regions, repeat sequences or structural RNAs. Many of these RNAs were enriched relative to cellular RNA, indicating that cells destine specific RNAs for extracellular release. Among the most abundant small RNAs in shuttle RNA were sequences derived from vault RNA, Y-RNA and specific tRNAs. Many of the highly abundant small non-coding transcripts in shuttle RNA are evolutionary well-conserved and have previously been associated to gene regulatory functions. These findings allude to a wider range of biological effects that could be mediated by shuttle RNA than previously expected. Moreover, the data present leads for unraveling how cells modify the function of other cells via transfer of specific non-coding RNA species. PMID:22821563

  5. Identifying Distal cis-acting Gene-Regulatory Sequences by Expressing BACs Functionalized with loxP-Tn10 Transposons in Zebrafish.


    Chatterjee, Pradeep K; Shakes, Leighcraft A; Wolf, Hope M; Mujalled, Mohammad A; Zhou, Constance; Hatcher, Charles; Norford, Derek C


    Bacterial Artificial Chromosomes (BACs) are large pieces of DNA from the chromosomes of organisms propagated faithfully in bacteria as large extra-chromosomal plasmids. Expression of genes contained in BACs can be monitored after functionalizing the BAC DNA with reporter genes and other sequences that allow stable maintenance and propagation of the DNA in the new host organism. The DNA in BACs can be altered within its bacterial host in several ways. Here we discuss one such approach, using Tn10 mini-transposons, to introduce exogenous sequences into BACs for a variety of purposes. The largely random insertions of Tn10 transposons carrying lox sites have been used to position mammalian cell-selectable antibiotic resistance genes, enhancer-traps and inverted repeat ends of the vertebrate transposon Tol2 precisely at the ends of the genomic DNA insert in BACs. These modified BACs are suitable for expression in zebrafish or mouse, and have been used to functionally identify important long-range gene regulatory sequences in both species. Enhancer-trapping using BACs should prove uniquely useful in analyzing multiple discontinuous DNA domains that act in concert to regulate expression of a gene, and is not limited by genome accessibility issues of traditional enhancer-trapping methods.

  6. Analysis of the coding-complete genomic sequence of groundnut ringspot virus suggests a common ancestor with tomato chlorotic spot virus.


    de Breuil, Soledad; Cañizares, Joaquín; Blanca, José Miguel; Bejerman, Nicolás; Trucco, Verónica; Giolitti, Fabián; Ziarsolo, Peio; Lenardon, Sergio


    Groundnut ringspot virus (GRSV) and tomato chlorotic spot virus (TCSV) share biological and serological properties, so their identification is carried out by molecular methods. Their genomes consist of three segmented RNAs: L, M and S. The finding of a reassortant between these two viruses may complicate correct virus identification and requires the characterization of the complete genome. Therefore, we present for the first time the complete sequences of all the genes encoded by a GRSV isolate. The high level of sequence similarity between GRSV and TCSV (over 90 % identity) observed in the genes and proteins encoded in the M RNA support previous results indicating that these viruses probably have a common ancestor.

  7. Constitutive androstane receptor transcriptionally activates human CYP1A1 and CYP1A2 genes through a common regulatory element in the 5'-flanking region.


    Yoshinari, Kouichi; Yoda, Noriaki; Toriyabe, Takayoshi; Yamazoe, Yasushi


    Phenobarbital has long been known to increase cellular levels of CYP1A1 and CYP1A2 possibly through a pathway(s) independent of aryl hydrocarbon receptor. We have investigated the role of constitutive androstane receptor (CAR), a xenobiotic-responsive nuclear receptor, in the transactivation of human CYP1A1 and CYP1A2. These genes are located in a head-to-head orientation, sharing a 5'-flanking region. Reporter assays were thus performed with dual-reporter constructs, containing the whole or partially deleted human CYP1A promoter between two different reporter genes. In this system, human CAR (hCAR) enhanced the transcription of both genes through common promoter regions from -461 to -554 and from -18089 to -21975 of CYP1A1. With reporter assays using additional deleted and mutated constructs, electrophoresis mobility shift assays and chromatin immunoprecipitation assays, an ER8 motif (everted repeat separated by eight nucleotides), located at around -520 of CYP1A1, was identified as an hCAR-responsive element and a binding motif of hCAR/human retinoid X receptor alpha heterodimer. hCAR enhanced the transcription of both genes also in the presence of an aryl hydrocarbon receptor ligand. Finally, hCAR activation increased CYP1A1 and CYP1A2 mRNA levels in cultured human hepatocytes. Our results indicate that CAR transactivates human CYP1A1 and CYP1A2 in human hepatocytes through the common cis-element ER8. Interestingly, the ER8 motif is highly conserved in the CYP1A1 proximal promoter sequences of various species, suggesting a fundamental role of CAR in the xenobiotic-induced expression of CYP1A1 and CYP1A2 independent of aryl hydrocarbon receptor.

  8. Full Mitochondrial Genome Sequence of the Sugar Beet Wireworm Limonius californicus (Coleoptera: Elateridae), a Common Agricultural Pest

    PubMed Central

    New, Daniel D.; Robison, Barrie D.; Rashed, Arash; Hohenlohe, Paul; Forney, Larry; Rashidi, Mahnaz; Wilson, Cathy M.; Settles, Matthew L.


    We report here the full mitochondrial genome sequence of Limonius californicus, a species of click beetle that is an agricultural pest in its larval form. The circular genome is 16.5 kb and contains 13 protein-coding genes, 2 rRNA genes, and 22 tRNA genes. PMID:26798113

  9. Retinoic acid-induced down-regulation of the interleukin-2 promoter via cis-regulatory sequences containing an octamer motif.

    PubMed Central

    Felli, M P; Vacca, A; Meco, D; Screpanti, I; Farina, A R; Maroder, M; Martinotti, S; Petrangeli, E; Frati, L; Gulino, A


    Retinoic acid (RA) is known to influence the proliferation and differentiation of a wide variety of transformed and developing cells. We found that RA and the specific RA receptor (RAR) ligand Ch55 inhibited the phorbol ester and calcium ionophore-induced expression of the T-cell growth factor interleukin-2 (IL-2) gene. Expression of transiently transfected chloramphenicol acetyltransferase vectors containing the 5'-flanking region of the IL-2 gene was also inhibited by RA. RA-induced down-regulation of the IL-2 enhancer is mediated by RAR, since overexpression of transfected RARs increased RA sensitivity of the IL-2 promoter. Functional analysis of chloramphenicol acetyltransferase vectors containing either internal deletion mutants of the region from -317 to +47 bp of the IL-2 enhancer or multimerized cis-regulatory elements showed that the RA-responsive element in the IL-2 promoter mapped to sequences containing an octamer motif. RAR also inhibited the transcriptional activity of the octamer motif of the immunoglobulin heavy chain enhancer. In spite of the transcriptional inhibition of the IL-2 octamer motif, RA did not decrease the in vitro DNA-binding capability of octamer-1 protein. These results identify a regulatory pathway within the IL-2 promoter which involves the octamer motif and RAR. Images PMID:1652063

  10. Plasmid pKM101 encodes two nonhomologous antirestriction proteins (ArdA and ArdB) whose expression is controlled by homologous regulatory sequences.

    PubMed Central

    Belogurov, A A; Delver, E P; Rodzevich, O V


    The IncN plasmid pKM101 (a derivative of R46) encodes the antirestriction protein ArdB (alleviation of restriction of DNA) in addition to another antirestriction protein, ArdA, described previously. The relevant gene, ardB, was located in the leading region of pKM101, about 7 kb from oriT. The nucleotide sequence of ardB was determined, and an appropriate polypeptide was identified in maxicells of Escherichia coli. Like ArdA, ArdB efficiently inhibits restriction by members of the three known families of type I systems of E. coli and only slightly affects the type II enzyme, EcoRI. However, in contrast to ArdA, ArdB is ineffective against the modification activity of the type I (EcoK) system. Comparison of deduced amino acid sequences of ArdA and ArdB revealed only one small region of similarity (nine residues), suggesting that this region may be somehow involved in the interaction with the type I restriction systems. We also found that the expression of both ardA and ardB genes is controlled jointly by two pKM101-encoded proteins, ArdK and ArdR, with molecular weights of about 15,000 and 20,000, respectively. The finding that the sequences immediately upstream of ardA and ardB share about 94% identity over 218 bp suggests that their expression may be controlled by ArdK and ArdR at the transcriptional level. Deletion studies and promoter probe analysis of these sequences revealed the regions responsible for the action of ArdK and ArdR as regulatory proteins. We propose that both types of antirestriction proteins may play a pivotal role in overcoming the host restriction barrier by self-transmissible broad-host-range plasmids. It seems likely that the ardKR-dependent regulatory system serves in this case as a genetic switch that controls the expression of plasmid-encoded antirestriction functions during mating. Images PMID:8393008

  11. Existence of microsatellites in expressed sequence tags of common carp ( Cyprinus carpio L.) available in GenBank dbEST database

    NASA Astrophysics Data System (ADS)

    Jingjie, Hu; Xiaolong, Wang; Xiaoli, Hu; Zhenmin, Bao


    Common carp expressed sequence tags (ESTs) were analyzed for the existence of microsatellites, or simple sequence repeats (SSRs). In the NCBI dbEST database, a total of 10612 sequences were registered before December 31, 2004. A complete search of 2-6 nucleotide microsatellites resulted in the identification of 513 SSR-containing ESTs, accounting for 4.8% of the total. Cluster analysis indicated that 73 sequences of SSR-containing ESTs fell into 27 groups and the remaining 440 ESTs were indenpendent. A total of 467 unique SSR-containing ESTs were identified. These EST-SSRs contained a variety of simple sequence types, and di- and tri-nucleotide repeats were the most abundant, accounting for 42.1% and 27.9% of the whole, respectively. Of the dinucleotide repeats, CA/TG was the most abundant, followed by GA/TC. BLASTx search showed that 38.1% of the SSR loci could be associated with genes or proteins of known or unknown function. BLASTx searches of SSR-containing ESTs also showed high frequencies (98/179) of hits on zebrafish sequences.

  12. Existence of microsatellites in expressed sequence tags of common carp ( Cyprinus carpio L.) available in GenBank dbEST database

    NASA Astrophysics Data System (ADS)

    Hu, Jingjie; Wang, Xiaolong; Hu, Xiaoli; Bao, Zhenmin


    Common carp expressed sequence tags (ESTs) were analyzed for the existence of microsatellites, or simple sequence repeats (SSRs). In the NCBI dbEST database, a total of 10612 sequences were registered before December 31, 2004. A complete search of 2 6 nucleotide microsatellites resulted in the identification of 513 SSR-containing ESTs, accounting for 4.8% of the total. Cluster analysis indicated that 73 sequences of SSR-containing ESTs fell into 27 groups and the remaining 440 ESTs were indenpendent. A total of 467 unique SSR-containing ESTs were identified. These EST-SSRs contained a variety of simple sequence types, and di- and tri-nucleotide repeats were the most abundant, accounting for 42.1% and 27.9% of the whole, respectively. Of the dinucleotide repeats, CA/TG was the most abundant, followed by GA/TC. BLASTx search showed that 38.1% of the SSR loci could be associated with genes or proteins of known or unknown function. BLASTx searches of SSR-containing ESTs also showed high frequencies (98/179) of hits on zebrafish sequences.

  13. Activation of the major immediate early gene of human cytomegalovirus by cis-acting elements in the promoter-regulatory sequence and by virus-specific trans-acting components.

    PubMed Central

    Stinski, M F; Roehr, T J


    Upstream of the major immediate early gene of human cytomegalovirus (Towne) is a strong promoter-regulatory region that promotes the synthesis of 1.95-kilobase mRNA (D. R. Thomsen, R. M. Stenberg, W. F. Goins, and M. F. Stinski, Proc. Natl. Acad. Sci. U.S.A. 81:659-663, 1984; M. F. Stinski, D. R. Thomsen, R. M. Stenberg, and L. C. Goldstein, J. Virol. 46:1-14, 1983). The wild-type promoter-regulatory region as well as deletions within this region were ligated upstream of the thymidine kinase, chloramphenicol acetyltransferase, or ovalbumin genes. These gene chimeras were constructed to investigate the role of the regulatory sequences in enhancing downstream expression. The regulatory region extends to approximately 465 nucleotides upstream of the cap site for the initiation of transcription. The extent and type of regulatory sequences upstream of the promoter influences the level of in vitro transcription as well as the amount of in vivo expression of the downstream gene. The regulatory elements for cis-activation appear to be repeated several times within the regulatory region. A direct correlation was established between the distribution of the 19 (5' CCCCAGTTGACGTCAATGGG 3')- and 18 (5' CACTAACGGGACTTTCCAA 3')-nucleotide repeats and the level of downstream expression. In contrast, the 16 (5' CTTGGCAGTACATCAA 3')-nucleotide repeat is not necessary for the enhancement of downstream expression. In a domain associated with the 19- or 18-nucleotide repeats are elements that can be activated in trans by a human cytomegalovirus-specified component but not a herpes simplex virus-specified component. Therefore, the regulatory sequences of the major immediate early gene of human cytomegalovirus have an important role in interacting with cellular and virus-specific factors of the transcription complex to enhance downstream expression of this critical viral gene. Images PMID:2991567

  14. RNA sequencing and functional analysis implicate the regulatory role of long non-coding RNAs in tomato fruit ripening.


    Zhu, Benzhong; Yang, Yongfang; Li, Ran; Fu, Daqi; Wen, Liwei; Luo, Yunbo; Zhu, Hongliang


    Recently, long non-coding RNAs (lncRNAs) have been shown to play critical regulatory roles in model plants, such as Arabidopsis, rice, and maize. However, the presence of lncRNAs and how they function in fleshy fruit ripening are still largely unknown because fleshy fruit ripening is not present in the above model plants. Tomato is the model system for fruit ripening studies due to its dramatic ripening process. To investigate further the role of lncRNAs in fruit ripening, it is necessary and urgent to discover and identify novel lncRNAs and understand the function of lncRNAs in tomato fruit ripening. Here it is reported that 3679 lncRNAs were discovered from wild-type tomato and ripening mutant fruit. The lncRNAs are transcribed from all tomato chromosomes, 85.1% of which came from intergenic regions. Tomato lncRNAs are shorter and have fewer exons than protein-coding genes, a situation reminiscent of lncRNAs from other model plants. It was also observed that 490 lncRNAs were significantly up-regulated in ripening mutant fruits, and 187 lncRNAs were down-regulated, indicating that lncRNAs could be involved in the regulation of fruit ripening. In line with this, silencing of two novel tomato intergenic lncRNAs, lncRNA1459 and lncRNA1840, resulted in an obvious delay of ripening of wild-type fruit. Overall, the results indicated that lncRNAs might be essential regulators of tomato fruit ripening, which sheds new light on the regulation of fruit ripening.

  15. RNA sequencing and functional analysis implicate the regulatory role of long non-coding RNAs in tomato fruit ripening

    PubMed Central

    Zhu, Benzhong; Yang, Yongfang; Li, Ran; Fu, Daqi; Wen, Liwei; Luo, Yunbo; Zhu, Hongliang


    Recently, long non-coding RNAs (lncRNAs) have been shown to play critical regulatory roles in model plants, such as Arabidopsis, rice, and maize. However, the presence of lncRNAs and how they function in fleshy fruit ripening are still largely unknown because fleshy fruit ripening is not present in the above model plants. Tomato is the model system for fruit ripening studies due to its dramatic ripening process. To investigate further the role of lncRNAs in fruit ripening, it is necessary and urgent to discover and identify novel lncRNAs and understand the function of lncRNAs in tomato fruit ripening. Here it is reported that 3679 lncRNAs were discovered from wild-type tomato and ripening mutant fruit. The lncRNAs are transcribed from all tomato chromosomes, 85.1% of which came from intergenic regions. Tomato lncRNAs are shorter and have fewer exons than protein-coding genes, a situation reminiscent of lncRNAs from other model plants. It was also observed that 490 lncRNAs were significantly up-regulated in ripening mutant fruits, and 187 lncRNAs were down-regulated, indicating that lncRNAs could be involved in the regulation of fruit ripening. In line with this, silencing of two novel tomato intergenic lncRNAs, lncRNA1459 and lncRNA1840, resulted in an obvious delay of ripening of wild-type fruit. Overall, the results indicated that lncRNAs might be essential regulators of tomato fruit ripening, which sheds new light on the regulation of fruit ripening. PMID:25948705

  16. Uncommon HLA alleles identified by hemizygous ultra-high Sanger sequencing: haplotype associations and reconsideration of their assignment in the Common and Well-Documented catalogue.


    Voorter, Christina E M; Groeneweg, Mathijs; Groeneveld, Lisette; Tilanus, Marcel G J


    Although the number of HLA alleles still increases, many of them have been reported being uncommon. This is partly due to lack of full length gene sequencing, especially for those alleles belonging to an allele ambiguity in which the first discovered allele has been assigned as the most frequent one. As members of the working group on Common and Well Documented (CWD) alleles and since we implemented full length group-specific sequencing as standard method routinely, we have investigated the presence of presumably rare alleles in our collection of HLA typing data. We identified 50 alleles, that were not previously encountered as Common or Well Documented. Sixteen of them should be added to the CWD catalogue, since we encountered them in 5 or more unrelated individuals. Another 11 could be added, based upon our results and the data present in the IMGT database and the rare allele section of the allele frequencies database. Furthermore, tight associations were observed between several different alleles even at the level of synonymous and non-coding sequences. In addition, in several cases the uncommon allele was found to be more frequent than its common counterpart.

  17. Analysis of sequences involved in IE2 transactivation of a baculovirus immediate-early gene promoter and identification of a new regulatory motif.


    Shippam-Brett, C E; Willis, L G; Theilmann, D A


    Opep-2 is a unique baculovirus early gene that has only been identified in the Orgyia pseudotsugata multiple capsid nucleopolyhedrovirus (OpMNPV). Previous analyses have shown this gene is expressed at very early times post-infection (p.i.) but is shut down by 36-48 h p.i. The promoter of opep-2 therefore, represents a class of early genes that is temporally regulated. In this study, a detailed analysis of the opep-2 promoter is performed to analyze the role individual motifs play in early gene expression. A new 13 base pair regulatory element was identified and shown to be essential in controlling high-level expression of this gene. In addition, mutational analysis revealed that GATA and CACGTG motifs, which have been shown to bind cellular factors in Sf9 and Ld652Y cells, played minor roles in influencing opep-2 expression in the absence of other viral factors. The OpMNPV transactivator IE2 causes a significant activation of the opep-2 promoter. Cotransfection of an extensive number of promoter deletions and mutations did not show any sequence specificity for IE2 transactivation. This is the first detailed analysis of the sequence requirements for IE2 transactivation, and these results suggest that IE2 does not bind directly to specific elements in the opep-2 promoter.

  18. The mouse p97 (CDC48) gene. Genomic structure, definition of transcriptional regulatory sequences, gene expression, and characterization of a pseudogene.


    Müller, J M; Meyer, H H; Ruhrberg, C; Stamp, G W; Warren, G; Shima, D T


    Here we present the first description of the genomic organization, transcriptional regulatory sequences, and adult and embryonic gene expression for the mouse p97(CDC48) AAA ATPase. Clones representing two distinct p97 genes were isolated in a genomic library screen, one of them likely representing a non-functional processed pseudogene. The coding region of the gene encoding the functional mRNA is interrupted by 16 introns and encompasses 20.4 kilobase pairs. Definition of the transcriptional initiation site and sequence analysis showed that the gene contains a TATA-less, GC-rich promoter region with an initiator element spanning the transcription start site. Cis-acting elements necessary for basal transcription activity reside within 410 base pairs of the flanking region as determined by transient transfection assays. In immunohistological analyses, p97 was widely expressed in embryos and adults, but protein levels were tightly controlled in a cell type- and cell differentiation-dependent manner. A remarkable heterogeneity in p97 immunostaining was found on a cellular level within a given tissue, and protein amounts in the cytoplasm and nucleus varied widely, suggesting a highly regulated and intermittent function for p97. This study provides the basis for a detailed analysis of the complex regulation of p97 and the reagents required for assessing its functional significance using targeted gene manipulation in the mouse.

  19. Paleoecology of the Devonian-Mississippian black-shale sequence in eastern Kentucky with an atlas of some common fossils

    SciTech Connect

    Barron, L.S.; Ettensohn, F.R.


    The Devonian-Mississippian black-shale sequence of eastern North America is a distinctive stratigraphic interval generally characterized by low clastic influx, high organic production in the water column, anaerobic bottom conditions, and the relative absence of fossil evidence for biologic activity. The laminated black shales which constitute most of the black-shale sequence are broken by two major sequences of interbedded greenish-gray, clayey shales which contain bioturbation and pyritized micromorph invertebrates. The black shales contain abundant evidence of life from upper parts of the water column such as fish fossils, conodonts, algae and other phytoplankton; however, there is a lack of evidence of benthic life. The rare brachiopods, crinoids, and molluscs that occur in the black shales were probably epiplanktic. A significant physical distinction between the environment in which the black sediments were deposited and that in which the greenish-gray sediments were deposited was the level of dissolved oxygen. The laminated black shales point to anaerobic conditions and the bioturbated greenish-gray shales suggest dysaerobic to marginally aerobic-dysaerobic conditions. A paleoenvironmental model in which quasi-estuarine circulation compliments and enhances the effect of a stratified water column can account for both depletion of dissolved oxygen in the bottom environments and the absence of oxygen replenishment during black-shale deposition. Periods of abundant clastic influx from fluvial environments to the east probably account for the abundance of clays in the greenish-gray shale as well as the small amounts of oxygen necessary to support the depauparate, opportunistic, benthic faunas found there. These pulses of greenish-gray clastics were short-lived and eventually were replaced by anaerobic conditions and low rates of clastic sedimentation which characterized most of black-shale deposition.

  20. Identification of co-expression gene networks, regulatory genes and pathways for obesity based on adipose tissue RNA Sequencing in a porcine model

    PubMed Central


    Background Obesity is a complex metabolic condition in strong association with various diseases, like type 2 diabetes, resulting in major public health and economic implications. Obesity is the result of environmental and genetic factors and their interactions, including genome-wide genetic interactions. Identification of co-expressed and regulatory genes in RNA extracted from relevant tissues representing lean and obese individuals provides an entry point for the identification of genes and pathways of importance to the development of obesity. The pig, an omnivorous animal, is an excellent model for human obesity, offering the possibility to study in-depth organ-level transcriptomic regulations of obesity, unfeasible in humans. Our aim was to reveal adipose tissue co-expression networks, pathways and transcriptional regulations of obesity using RNA Sequencing based systems biology approaches in a porcine model. Methods We selected 36 animals for RNA Sequencing from a previously created F2 pig population representing three extreme groups based on their predicted genetic risks for obesity. We applied Weighted Gene Co-expression Network Analysis (WGCNA) to detect clusters of highly co-expressed genes (modules). Additionally, regulator genes were detected using Lemon-Tree algorithms. Results WGCNA revealed five modules which were strongly correlated with at least one obesity-related phenotype (correlations ranging from -0.54 to 0.72, P < 0.001). Functional annotation identified pathways enlightening the association between obesity and other diseases, like osteoporosis (osteoclast differentiation, P = 1.4E-7), and immune-related complications (e.g. Natural killer cell mediated cytotoxity, P = 3.8E-5; B cell receptor signaling pathway, P = 7.2E-5). Lemon-Tree identified three potential regulator genes, using confident scores, for the WGCNA module which was associated with osteoclast differentiation: CCR1, MSR1 and SI1 (probability scores respectively 95.30, 62.28, and

  1. Nucleotide sequence analysis reveals linked N-acetyl hydrolase, thioesterase, transport, and regulatory genes encoded by the bialaphos biosynthetic gene cluster of Streptomyces hygroscopicus.

    PubMed Central

    Raibaud, A; Zalacain, M; Holt, T G; Tizard, R; Thompson, C J


    Nucleotide sequence analysis of a 5,000-bp region of the bialaphos antibiotic production (bap) gene cluster defined five open reading frames (ORFs) which predicted structural genes in the order bah, ORF1, ORF2, and ORF3 followed by the regulatory gene, brpA (H. Anzai, T. Murakami, S. Imai, A. Satoh, K. Nagaoka, and C.J. Thompson, J. Bacteriol. 169:3482-3488, 1987). The four structural genes were translationally coupled and apparently cotranscribed from an undefined promoter(s) under the positive control of the brpA gene product. S1 mapping experiments indicated that brpA was transcribed by two promoters (brpAp1 and brpAp2) which initiate transcription 150 and 157 bp upstream of brp A within an intergenic region and at least one promoter further upstream within the bap gene cluster (brpAp3). All three transcripts were present at low levels during exponential growth and increased just before the stationary phase. The levels of the brpAp3 band continued to increase at the onset of stationary phase, whereas brpAp1-and brpAp2-protected fragments showed no further change. BrpA contained a possible helix-turn-helix motif at its C terminus which was similar to the C-terminal regulatory motif found in the receiver component of a family of two-component transcriptional activator proteins. This motif was not associated with the N-terminal domain conserved in other members of the family. The structural gene cluster sequenced began with bah, encoding a bialaphos acetylhydrolase which removes the N-acetyl group from bialaphos as one of the final steps in the biosynthetic pathway. The observation that Bah was similar to a rat and to a bacterial (Acinetobacter calcoaceticus) lipase probably reflects the fact that the ester bonds of triglycerides and the amide bond linking acetate to phosphinothricin are similar and hydrolysis is catalyzed by structurally related enzymes. This was followed by two regions encoding ORF1 and ORF2 which were similar to each other (48% nucleotide

  2. Comparison of Muscle Onset Activation Sequences between a Golf or Tennis Swing and Common Training Exercises Using Surface Electromyography: A Pilot Study

    PubMed Central

    Shultz, Rebecca; Fredericson, Michael


    Aim. The purpose of this pilot study is to use surface electromyography to determine an individual athlete's typical muscle onset activation sequence when performing a golf or tennis forward swing and to use the method to assess to what degree the sequence is reproduced with common conditioning exercises and a machine designed for this purpose. Methods. Data for 18 healthy male subjects were collected for 15 muscles of the trunk and lower extremities. Data were filtered and processed to determine the average onset of muscle activation for each motion. A Spearman correlation estimated congruence of activation order between the swing and each exercise. Correlations of each group were pooled with 95% confidence intervals using a random effects meta-analytic strategy. Results. The averaged sequences differed among each athlete tested, but pooled correlations demonstrated a positive association between each exercise and the participants' natural muscle onset activation sequence. Conclusion. The selected training exercises and Turning Point™ device all partially reproduced our athletes' averaged muscle onset activation sequences for both sports. The results support consideration of a larger, adequately powered study using this method to quantify to what degree each of the selected exercises is appropriate for use in both golf and tennis. PMID:27403454

  3. Rearrangements of the transcriptional regulatory networks of metabolic pathways in fungi.


    Lavoie, Hugo; Hogues, Hervé; Whiteway, Malcolm


    Growing evidence suggests that transcriptional regulatory networks in many organisms are highly flexible. Here, we discuss the evolution of transcriptional regulatory networks governing the metabolic machinery of sequenced ascomycetes. In particular, recent work has shown that transcriptional rewiring is common in regulons controlling processes such as production of ribosome components and metabolism of carbohydrates and lipids. We note that dramatic rearrangements of the transcriptional regulatory components of metabolic functions have occurred among ascomycetes species.

  4. Functional homology between the yeast regulatory proteins GAL4 and LAC9: LAC9-mediated transcriptional activation in Kluyveromyces lactis involves protein binding to a regulatory sequence homologous to the GAL4 protein-binding site.

    PubMed Central

    Breunig, K D; Kuger, P


    As shown previously, the beta-galactosidase gene of Kluyveromyces lactis is transcriptionally regulated via an upstream activation site (UASL) which contains a sequence homologous to the GAL4 protein-binding site in Saccharomyces cerevisiae (M. Ruzzi, K.D. Breunig, A.G. Ficca, and C.P. Hollenberg, Mol. Cell. Biol. 7:991-997, 1987). Here we demonstrate that the region of homology specifically binds a K. lactis regulatory protein. The binding activity was detectable in protein extracts from wild-type cells enriched for DNA-binding proteins by heparin affinity chromatography. These extracts could be used directly for DNase I and exonuclease III protection experiments. A lac9 deletion strain, which fails to induce the beta-galactosidase gene, did not contain the binding factor. The homology of LAC9 protein with GAL4 (J.M. Salmeron and S. A. Johnston, Nucleic Acids Res. 14:7767-7781, 1986) strongly suggests that LAC9 protein binds directly to UASL and plays a role similar to that of GAL4 in regulating transcription. Images PMID:2830492

  5. Targeted sequence capture and resequencing implies a predominant role of regulatory regions in the divergence of a sympatric lake whitefish species pair (Coregonus clupeaformis).


    Hebert, Francois Olivier; Renaut, Sébastien; Bernatchez, Louis


    Latest technological developments in evolutionary biology bring new challenges in documenting the intricate genetic architecture of species in the process of divergence. Sympatric populations of lake whitefish represent one of the key systems to investigate this issue. Despite the value of random genotype-by-sequencing methods and decreasing cost of sequencing technologies, it remains challenging to investigate variation in coding regions, especially in the case of recently duplicated genomes as in salmonids, as this greatly complicates whole genome resequencing. We thus designed a sequence capture array targeting 2773 annotated genes to document the nature and the extent of genomic divergence between sympatric dwarf and normal whitefish. Among the 2728 genes successfully captured, a total of 2182 coding and 10,415 noncoding putative single-nucleotide polymorphisms (SNPs) were identified after applying a first set of basic filters. A genome scan with a quality-refined selection of 2203 SNPs identified 267 outlier SNPs in 210 candidate genes located in genomic regions potentially involved in whitefish divergence and reproductive isolation. We found highly heterogeneous FST estimates among SNP loci. There was an overall low level of coding polymorphism, with a predominance of noncoding mutations among outliers. The heterogeneous patterns of divergence among loci confirm the porous nature of genomes during speciation with gene flow. Considering that few protein-coding mutations were identified as highly divergent, our results, along with previous transcriptomic studies, imply that changes in regulatory regions most likely had a greater role in the process of whitefish population divergence than protein-coding mutations. This study is the first to demonstrate the efficiency of large-scale targeted resequencing for a nonmodel species with such a large and unsequenced genome.

  6. A Common Missense Variant in the Glucokinase Regulatory Protein Gene (GCKR) Is Associated with Increased Plasma Triglyceride and C-Reactive Protein but Lower Fasting Glucose Concentrations

    Technology Transfer Automated Retrieval System (TEKTRAN)

    OBJECTIVE-Using the genome-wide-association approach, we recently identified the glucokinase regulatory protein gene (GCKR, rs780094) region as a novel quantitative trait locus for plasma triglyceride concentration in Europeans. Here, we sought to study the association of GCKR variants with metaboli...

  7. Complete genome sequence and transcriptomics analyses reveal pigment biosynthesis and regulatory mechanisms in an industrial strain, Monascus purpureus YY-1.


    Yang, Yue; Liu, Bin; Du, Xinjun; Li, Ping; Liang, Bin; Cheng, Xiaozhen; Du, Liangcheng; Huang, Di; Wang, Lei; Wang, Shuo


    Monascus has been used to produce natural colorants and food supplements for more than one thousand years, and approximately more than one billion people eat Monascus-fermented products during their daily life. In this study, using next-generation sequencing and optical mapping approaches, a 24.1-Mb complete genome of an industrial strain, Monascus purpureus YY-1, was obtained. This genome consists of eight chromosomes and 7,491 genes. Phylogenetic analysis at the genome level provides convincing evidence for the evolutionary position of M. purpureus. We provide the first comprehensive prediction of the biosynthetic pathway for Monascus pigment. Comparative genomic analyses show that the genome of M. purpureus is 13.6-40% smaller than those of closely related filamentous fungi and has undergone significant gene losses, most of which likely occurred during its specialized adaptation to starch-based foods. Comparative transcriptome analysis reveals that carbon starvation stress, resulting from the use of relatively low-quality carbon sources, contributes to the high yield of pigments by repressing central carbon metabolism and augmenting the acetyl-CoA pool. Our work provides important insights into the evolution of this economically important fungus and lays a foundation for future genetic manipulation and engineering of this strain.

  8. Comparisons of Ribosomal Protein Gene Promoters Indicate Superiority of Heterologous Regulatory Sequences for Expressing Transgenes in Phytophthora infestans.


    Poidevin, Laetitia; Andreeva, Kalina; Khachatoorian, Careen; Judelson, Howard S


    Molecular genetics approaches in Phytophthora research can be hampered by the limited number of known constitutive promoters for expressing transgenes and the instability of transgene activity. We have therefore characterized genes encoding the cytoplasmic ribosomal proteins of Phytophthora and studied their suitability for expressing transgenes in P. infestans. Phytophthora spp. encode a standard complement of 79 cytoplasmic ribosomal proteins. Several genes are duplicated, and two appear to be pseudogenes. Half of the genes are expressed at similar levels during all stages of asexual development, and we discovered that the majority share a novel promoter motif named the PhRiboBox. This sequence is enriched in genes associated with transcription, translation, and DNA replication, including tRNA and rRNA biogenesis. Promoters from the three P. infestans genes encoding ribosomal proteins S9, L10, and L23 and their orthologs from P. capsici were tested for their ability to drive transgenes in stable transformants of P. infestans. Five of the six promoters yielded strong expression of a GUS reporter, but the stability of expression was higher using the P. capsici promoters. With the RPS9 and RPL10 promoters of P. infestans, about half of transformants stopped making GUS over two years of culture, while their P. capsici orthologs conferred stable expression. Since cross-talk between native and transgene loci may trigger gene silencing, we encourage the use of heterologous promoters in transformation studies.

  9. HLA-F coding and regulatory segments variability determined by massively parallel sequencing procedures in a Brazilian population sample.


    Lima, Thálitta Hetamaro Ayala; Buttura, Renato Vidal; Donadi, Eduardo Antônio; Veiga-Castelli, Luciana Caricati; Mendes-Junior, Celso Teixeira; Castelli, Erick C


    Human Leucocyte Antigen F (HLA-F) is a non-classical HLA class I gene distinguished from its classical counterparts by low allelic polymorphism and distinctive expression patterns. Its exact function remains unknown. It is believed that HLA-F has tolerogenic and immune modulatory properties. Currently, there is little information regarding the HLA-F allelic variation among human populations and the available studies have evaluated only a fraction of the HLA-F gene segment and/or have searched for known alleles only. Here we present a strategy to evaluate the complete HLA-F variability including its 5' upstream, coding and 3' downstream segments by using massively parallel sequencing procedures. HLA-F variability was surveyed on 196 individuals from the Brazilian Southeast. The results indicate that the HLA-F gene is indeed conserved at the protein level, where thirty coding haplotypes or coding alleles were detected, encoding only four different HLA-F full-length protein molecules. Moreover, a same protein molecule is encoded by 82.45% of all coding alleles detected in this Brazilian population sample. However, the HLA-F nucleotide and haplotype variability is much higher than our current knowledge both in Brazilians and considering the 1000 Genomes Project data. This protein conservation is probably a consequence of the key role of HLA-F in the immune system physiology.

  10. Establishment of quantitative sequencing and filter contact vial bioassay for monitoring pyrethroid resistance in the common bed bug, Cimex lectularius.


    Seong, Keon Mook; Lee, Da-Young; Yoon, Kyong Sup; Kwon, Deok Ho; Kim, Heung Chul; Klein, Terry A; Clark, J Marshall; Lee, Si Hyeock


    Two point mutations (V419L and L925I) in the voltage-sensitive sodium channel alpha-subunit gene have been identified in deltamethrin-resistant bed bugs. A quantitative sequencing (QS) protocol was developed to establish a population-based genotyping method as a molecular resistance-monitoring tool based on the frequency of the two mutations. The nucleotide signal ratio at each mutation site was generated from sequencing chromatograms and plotted against the corresponding resistance allele frequency. Frequency prediction equations were generated from the plots by linear regression, and the signal ratios were shown to highly correlate with resistance allele frequencies (r2 > 0.9928). As determined by QS, neither mutation was found in a bed bug population collected in 1993. Populations collected in recent years (2007-2009), however, exhibited completely or nearly saturating L925I mutation frequencies and highly variable frequencies of the V419L mutation. In addition to QS, the filter contact vial bioassay (FCVB) method was established and used to determine the baseline susceptibility and resistance of bed bugs to deltamethrin and lambda-cyhalothrin. A pyrethroid-resistant strain showed >9,375- and 6,990-fold resistance to deltamethrin and lambda-cyhalothrin, respectively. Resistance allele frequencies in different bed bug populations predicted by QS correlated well with the FCVB results, confirming the roles of the two mutations in pyrethroid resistance. Taken together, employment of QS in conjunction with FCVB should greatly facilitate the detection and monitoring of pyrethroid-resistant bed bugs in the field. The advantages of FCVB as an on-site resistance-monitoring tool are discussed.

  11. A distinct regulatory sequence is essential for the expression of a subset of nle genes in attaching and effacing Escherichia coli.


    García-Angulo, Víctor A; Martínez-Santos, Verónica I; Villaseñor, Tomás; Santana, Francisco J; Huerta-Saquero, Alejandro; Martínez, Luary C; Jiménez, Rafael; Lara-Ochoa, Cristina; Téllez-Sosa, Juan; Bustamante, Víctor H; Puente, José L


    Enteropathogenic Escherichia coli uses a type III secretion system (T3SS), encoded in the locus of enterocyte effacement (LEE) pathogenicity island, to translocate a wide repertoire of effector proteins into the host cell in order to subvert cell signaling cascades and promote bacterial colonization and survival. Genes encoding type III-secreted effectors are located in the LEE and scattered throughout the chromosome. While LEE gene regulation is better understood, the conditions and factors involved in the expression of effectors encoded outside the LEE are just starting to be elucidated. Here, we identified a highly conserved sequence containing a 13-bp inverted repeat (IR), located upstream of a subset of genes coding for different non-LEE-encoded effectors in A/E pathogens. Site-directed mutagenesis and deletion analysis of the nleH1 and nleB2 regulatory regions revealed that this IR is essential for the transcriptional activation of both genes. Growth conditions that favor the expression of LEE genes also facilitate the activation of nleH1 and nleB2; however, their expression is independent of the LEE-encoded positive regulators Ler and GrlA but is repressed by GrlR and the global regulator H-NS. In contrast, GrlA and Ler are required for nleA expression, while H-NS silences it. Consistent with their role in the regulation of nleA, purified Ler and H-NS bound to the regulatory region of nleA upstream of its promoter. This work shows that at least two modes of regulation control the expression of effector genes in attaching and effacing (A/E) pathogens, suggesting that a subset of effector functions may be coordinately expressed in a particular niche or time during infection.

  12. A Distinct Regulatory Sequence Is Essential for the Expression of a Subset of nle Genes in Attaching and Effacing Escherichia coli

    PubMed Central

    García-Angulo, Víctor A.; Martínez-Santos, Verónica I.; Villaseñor, Tomás; Santana, Francisco J.; Huerta-Saquero, Alejandro; Martínez, Luary C.; Jiménez, Rafael; Lara-Ochoa, Cristina; Téllez-Sosa, Juan; Bustamante, Víctor H.


    Enteropathogenic Escherichia coli uses a type III secretion system (T3SS), encoded in the locus of enterocyte effacement (LEE) pathogenicity island, to translocate a wide repertoire of effector proteins into the host cell in order to subvert cell signaling cascades and promote bacterial colonization and survival. Genes encoding type III-secreted effectors are located in the LEE and scattered throughout the chromosome. While LEE gene regulation is better understood, the conditions and factors involved in the expression of effectors encoded outside the LEE are just starting to be elucidated. Here, we identified a highly conserved sequence containing a 13-bp inverted repeat (IR), located upstream of a subset of genes coding for different non-LEE-encoded effectors in A/E pathogens. Site-directed mutagenesis and deletion analysis of the nleH1 and nleB2 regulatory regions revealed that this IR is essential for the transcriptional activation of both genes. Growth conditions that favor the expression of LEE genes also facilitate the activation of nleH1 and nleB2; however, their expression is independent of the LEE-encoded positive regulators Ler and GrlA but is repressed by GrlR and the global regulator H-NS. In contrast, GrlA and Ler are required for nleA expression, while H-NS silences it. Consistent with their role in the regulation of nleA, purified Ler and H-NS bound to the regulatory region of nleA upstream of its promoter. This work shows that at least two modes of regulation control the expression of effector genes in attaching and effacing (A/E) pathogens, suggesting that a subset of effector functions may be coordinately expressed in a particular niche or time during infection. PMID:22904277

  13. SNP Assay Development for Linkage Map Construction, Anchoring Whole-Genome Sequence, and Other Genetic and Genomic Applications in Common Bean


    Song, Qijian; Jia, Gaofeng; Hyten, David L.; ...


    A total of 992,682 single-nucleotide polymorphisms (SNPs) was identified as ideal for Illumina Infinium II BeadChip design after sequencing a diverse set of 17 common bean (Phaseolus vulgaris L) varieties with the aid of next-generation sequencing technology. From these, two BeadChips each with >5000 SNPs were designed. The BARCBean6K_1 BeadChip was selected for the purpose of optimizing polymorphism among market classes and, when possible, SNPs were targeted to sequence scaffolds in the Phaseolus vulgaris 14× genome assembly with sequence lengths >10 kb. The BARCBean6K_2 BeadChip was designed with the objective of anchoring additional scaffolds and to facilitate orientation of largemore » scaffolds. Analysis of 267 F2 plants from a cross of varieties Stampede × Red Hawk with the two BeadChips resulted in linkage maps with a total of 7040 markers including 7015 SNPs. With the linkage map, a total of 432.3 Mb of sequence from 2766 scaffolds was anchored to create the Phaseolus vulgaris v1.0 assembly, which accounted for approximately 89% of the 487 Mb of available sequence scaffolds of the Phaseolus vulgaris v0.9 assembly. A core set of 6000 SNPs (BARCBean6K_3 BeadChip) with high genotyping quality and polymorphism was selected based on the genotyping of 365 dry bean and 134 snap bean accessions with the BARCBean6K_1 and BARCBean6K_2 BeadChips. The BARCBean6K_3 BeadChip is a useful tool for genetics and genomics research and it is widely used by breeders and geneticists in the United States and abroad.« less

  14. SNP Assay Development for Linkage Map Construction, Anchoring Whole-Genome Sequence, and Other Genetic and Genomic Applications in Common Bean

    PubMed Central

    Song, Qijian; Jia, Gaofeng; Hyten, David L.; Jenkins, Jerry; Hwang, Eun-Young; Schroeder, Steven G.; Osorno, Juan M.; Schmutz, Jeremy; Jackson, Scott A.; McClean, Phillip E.; Cregan, Perry B.


    A total of 992,682 single-nucleotide polymorphisms (SNPs) was identified as ideal for Illumina Infinium II BeadChip design after sequencing a diverse set of 17 common bean (Phaseolus vulgaris L) varieties with the aid of next-generation sequencing technology. From these, two BeadChips each with >5000 SNPs were designed. The BARCBean6K_1 BeadChip was selected for the purpose of optimizing polymorphism among market classes and, when possible, SNPs were targeted to sequence scaffolds in the Phaseolus vulgaris 14× genome assembly with sequence lengths >10 kb. The BARCBean6K_2 BeadChip was designed with the objective of anchoring additional scaffolds and to facilitate orientation of large scaffolds. Analysis of 267 F2 plants from a cross of varieties Stampede × Red Hawk with the two BeadChips resulted in linkage maps with a total of 7040 markers including 7015 SNPs. With the linkage map, a total of 432.3 Mb of sequence from 2766 scaffolds was anchored to create the Phaseolus vulgaris v1.0 assembly, which accounted for approximately 89% of the 487 Mb of available sequence scaffolds of the Phaseolus vulgaris v0.9 assembly. A core set of 6000 SNPs (BARCBean6K_3 BeadChip) with high genotyping quality and polymorphism was selected based on the genotyping of 365 dry bean and 134 snap bean accessions with the BARCBean6K_1 and BARCBean6K_2 BeadChips. The BARCBean6K_3 BeadChip is a useful tool for genetics and genomics research and it is widely used by breeders and geneticists in the United States and abroad. PMID:26318155

  15. SNP Assay Development for Linkage Map Construction, Anchoring Whole-Genome Sequence, and Other Genetic and Genomic Applications in Common Bean

    SciTech Connect

    Song, Qijian; Jia, Gaofeng; Hyten, David L.; Jenkins, Jerry; Hwang, Eun-Young; Schroeder, Steven G.; Osorno, Juan M.; Schmutz, Jeremy; Jackson, Scott A.; McClean, Phillip E.; Cregan, Perry B.


    A total of 992,682 single-nucleotide polymorphisms (SNPs) was identified as ideal for Illumina Infinium II BeadChip design after sequencing a diverse set of 17 common bean (Phaseolus vulgaris L) varieties with the aid of next-generation sequencing technology. From these, two BeadChips each with >5000 SNPs were designed. The BARCBean6K_1 BeadChip was selected for the purpose of optimizing polymorphism among market classes and, when possible, SNPs were targeted to sequence scaffolds in the Phaseolus vulgaris 14× genome assembly with sequence lengths >10 kb. The BARCBean6K_2 BeadChip was designed with the objective of anchoring additional scaffolds and to facilitate orientation of large scaffolds. Analysis of 267 F2 plants from a cross of varieties Stampede × Red Hawk with the two BeadChips resulted in linkage maps with a total of 7040 markers including 7015 SNPs. With the linkage map, a total of 432.3 Mb of sequence from 2766 scaffolds was anchored to create the Phaseolus vulgaris v1.0 assembly, which accounted for approximately 89% of the 487 Mb of available sequence scaffolds of the Phaseolus vulgaris v0.9 assembly. A core set of 6000 SNPs (BARCBean6K_3 BeadChip) with high genotyping quality and polymorphism was selected based on the genotyping of 365 dry bean and 134 snap bean accessions with the BARCBean6K_1 and BARCBean6K_2 BeadChips. The BARCBean6K_3 BeadChip is a useful tool for genetics and genomics research and it is widely used by breeders and geneticists in the United States and abroad.

  16. Cis-regulatory mutations in human disease

    PubMed Central


    Cis-acting regulatory sequences are required for the proper temporal and spatial control of gene expression. Variation in gene expression is highly heritable and a significant determinant of human disease susceptibility. The diversity of human genetic diseases attributed, in whole or in part, to mutations in non-coding regulatory sequences is on the rise. Improvements in genome-wide methods of associating genetic variation with human disease and predicting DNA with cis-regulatory potential are two of the major reasons for these recent advances. This review will highlight select examples from the literature that have successfully integrated genetic and genomic approaches to uncover the molecular basis by which cis-regulatory mutations alter gene expression and contribute to human disease. The fine mapping of disease-causing variants has led to the discovery of novel cis-acting regulatory elements that, in some instances, are located as far away as 1.5 Mb from the target gene. In other cases, the prior knowledge of the regulatory landscape surrounding the gene of interest aided in the selection of enhancers for mutation screening. The success of these studies should provide a framework for following up on the large number of genome-wide association studies that have identified common variants in non-coding regions of the genome that associate with increased risk of human diseases including, diabetes, autism, Crohn's, colorectal cancer, and asthma, to name a few. PMID:19641089

  17. Cis-regulatory mutations in human disease.


    Epstein, Douglas J


    Cis-acting regulatory sequences are required for the proper temporal and spatial control of gene expression. Variation in gene expression is highly heritable and a significant determinant of human disease susceptibility. The diversity of human genetic diseases attributed, in whole or in part, to mutations in non-coding regulatory sequences is on the rise. Improvements in genome-wide methods of associating genetic variation with human disease and predicting DNA with cis-regulatory potential are two of the major reasons for these recent advances. This review will highlight select examples from the literature that have successfully integrated genetic and genomic approaches to uncover the molecular basis by which cis-regulatory mutations alter gene expression and contribute to human disease. The fine mapping of disease-causing variants has led to the discovery of novel cis-acting regulatory elements that, in some instances, are located as far away as 1.5 Mb from the target gene. In other cases, the prior knowledge of the regulatory landscape surrounding the gene of interest aided in the selection of enhancers for mutation screening. The success of these studies should provide a framework for following up on the large number of genome-wide association studies that have identified common variants in non-coding regions of the genome that associate with increased risk of human diseases including, diabetes, autism, Crohn's, colorectal cancer, and asthma, to name a few.

  18. ICO amplicon NGS data analysis: a Web tool for variant detection in common high-risk hereditary cancer genes analyzed by amplicon GS Junior next-generation sequencing.


    Lopez-Doriga, Adriana; Feliubadaló, Lídia; Menéndez, Mireia; Lopez-Doriga, Sergio; Morón-Duran, Francisco D; del Valle, Jesús; Tornero, Eva; Montes, Eva; Cuesta, Raquel; Campos, Olga; Gómez, Carolina; Pineda, Marta; González, Sara; Moreno, Victor; Capellá, Gabriel; Lázaro, Conxi


    Next-generation sequencing (NGS) has revolutionized genomic research and is set to have a major impact on genetic diagnostics thanks to the advent of benchtop sequencers and flexible kits for targeted libraries. Among the main hurdles in NGS are the difficulty of performing bioinformatic analysis of the huge volume of data generated and the high number of false positive calls that could be obtained, depending on the NGS technology and the analysis pipeline. Here, we present the development of a free and user-friendly Web data analysis tool that detects and filters sequence variants, provides coverage information, and allows the user to customize some basic parameters. The tool has been developed to provide accurate genetic analysis of targeted sequencing of common high-risk hereditary cancer genes using amplicon libraries run in a GS Junior System. The Web resource is linked to our own mutation database, to assist in the clinical classification of identified variants. We believe that this tool will greatly facilitate the use of the NGS approach in routine laboratories.

  19. Genetic divergence analysis of the Common Barn Owl Tyto alba (Scopoli, 1769) and the Short-eared Owl Asio flammeus (Pontoppidan, 1763) from southern Chile using COI sequence

    PubMed Central

    Colihueque, Nelson; Gantz, Alberto; Rau, Jaime Ricardo; Parraguez, Margarita


    Abstract In this paper new mitochondrial COI sequences of Common Barn Owl Tyto alba (Scopoli, 1769) and Short-eared Owl Asio flammeus (Pontoppidan, 1763) from southern Chile are reported and compared with sequences from other parts of the World. The intraspecific genetic divergence (mean p-distance) was 4.6 to 5.5% for the Common Barn Owl in comparison with specimens from northern Europe and Australasia and 3.1% for the Short-eared Owl with respect to samples from north America, northern Europe and northern Asia. Phylogenetic analyses revealed three distinctive groups for the Common Barn Owl: (i) South America (Chile and Argentina) plus Central and North America, (ii) northern Europe and (iii) Australasia, and two distinctive groups for the Short-eared Owl: (i) South America (Chile and Argentina) and (ii) north America plus northern Europe and northern Asia. The level of genetic divergence observed in both species exceeds the upper limit of intraspecific comparisons reported previously for Strigiformes. Therefore, this suggests that further research is needed to assess the taxonomic status, particularly for the Chilean populations that, to date, have been identified as belonging to these species through traditional taxonomy. PMID:26668551

  20. Genetic divergence analysis of the Common Barn Owl Tyto alba (Scopoli, 1769) and the Short-eared Owl Asio flammeus (Pontoppidan, 1763) from southern Chile using COI sequence.


    Colihueque, Nelson; Gantz, Alberto; Rau, Jaime Ricardo; Parraguez, Margarita


    In this paper new mitochondrial COI sequences of Common Barn Owl Tyto alba (Scopoli, 1769) and Short-eared Owl Asio flammeus (Pontoppidan, 1763) from southern Chile are reported and compared with sequences from other parts of the World. The intraspecific genetic divergence (mean p-distance) was 4.6 to 5.5% for the Common Barn Owl in comparison with specimens from northern Europe and Australasia and 3.1% for the Short-eared Owl with respect to samples from north America, northern Europe and northern Asia. Phylogenetic analyses revealed three distinctive groups for the Common Barn Owl: (i) South America (Chile and Argentina) plus Central and North America, (ii) northern Europe and (iii) Australasia, and two distinctive groups for the Short-eared Owl: (i) South America (Chile and Argentina) and (ii) north America plus northern Europe and northern Asia. The level of genetic divergence observed in both species exceeds the upper limit of intraspecific comparisons reported previously for Strigiformes. Therefore, this suggests that further research is needed to assess the taxonomic status, particularly for the Chilean populations that, to date, have been identified as belonging to these species through traditional taxonomy.

  1. Identification of the transcriptional regulatory sequences of human calponin promoter and their use in targeting a conditionally replicating herpes vector to malignant human soft tissue and bone tumors.


    Yamamura, H; Hashio, M; Noguchi, M; Sugenoya, Y; Osakada, M; Hirano, N; Sasaki, Y; Yoden, T; Awata, N; Araki, N; Tatsuta, M; Miyatake, S I; Takahashi, K


    The calponin (basic or h1) gene, normally expressed in maturated smooth muscle cells, is aberrantly expressed in a variety of human soft tissue and bone tumors. In this study, we show that expression of the calponin gene in human soft tissue and bone tumor cells is regulated at the transcriptional level by the sequence between positions -260 and -219 upstream of the translation initiation site. A novel conditionally replicating herpes simplex virus-1 vector (d12.CALP) in which the calponin promoter drives expression of ICP4, a major trans-activating factor for viral genes was constructed and tested as an experimental treatment for malignant human soft tissue and bone tumors. In cell culture, d12.CALP at low multiplicity of infection (0.001 plaque-forming unit/cell) selectively killed calponin-positive human synovial sarcoma, leiomyosarcoma, and osteosarcoma cells. For in vivo studies, 10 animals harboring SK-LMS-1 human leiomyosarcoma cells were randomly divided and treated twice on days 0 and 9 intraneoplastically with either 1 x 10(7) plaque-forming units of d12.CALP/100 mm(3) of tumor volume or with medium alone. The viral treatment group showed stable and significant inhibition of tumorigenicity with apparent cure in four of five mice by day 35. Replication of viral DNA demonstrated by PCR amplification and expression of the inserted LacZ gene visualized by 5-bromo-4-chloro-3-indolyl-beta-D-galactopyranoside histochemistry was associated with oncolysis of d12.CALP-treated tumors, while sparing normal vascular smooth muscle cells. In mice harboring two SK-LMS-1 tumors, replication of d12.CALP was detected in a nontreated tumor distant from the site of virus inoculation. These results indicate that replication-competent virus vectors controlled by the calponin transcriptional regulatory sequence may be a new therapeutic strategy for treatment of malignant human soft tissue and bone tumors.

  2. A common sequence motif determines the Cajal body-specific localization of box H/ACA scaRNAs.


    Richard, Patricia; Darzacq, Xavier; Bertrand, Edouard; Jády, Beáta E; Verheggen, Céline; Kiss, Tamás


    Post-transcriptional synthesis of 2'-O-methylated nucleotides and pseudouridines in Sm spliceosomal small nuclear RNAs takes place in the nucleoplasmic Cajal bodies and it is directed by guide RNAs (scaRNAs) that are structurally and functionally indistinguishable from small nucleolar RNAs (snoRNAs) directing rRNA modification in the nucleolus. The scaRNAs are synthesized in the nucleoplasm and specifically targeted to Cajal bodies. Here, mutational analysis of the human U85 box C/D-H/ACA scaRNA, followed by in situ localization, demonstrates that box H/ACA scaRNAs share a common Cajal body-specific localization signal, the CAB box. Two copies of the evolutionarily conserved CAB consensus (UGAG) are located in the terminal loops of the 5' and 3' hairpins of the box H/ACA domains of mammalian, Drosophila and plant scaRNAs. Upon alteration of the CAB boxes, mutant scaRNAs accumulate in the nucleolus. In turn, authentic snoRNAs can be targeted into Cajal bodies by addition of exogenous CAB box motifs. Our results indicate that scaRNAs represent an ancient group of small nuclear RNAs which are localized to Cajal bodies by an evolutionarily conserved mechanism.

  3. Common methods for fecal sample storage in field studies yield consistent signatures of individual identity in microbiome sequencing data.


    Blekhman, Ran; Tang, Karen; Archie, Elizabeth A; Barreiro, Luis B; Johnson, Zachary P; Wilson, Mark E; Kohn, Jordan; Yuan, Michael L; Gesquiere, Laurence; Grieneisen, Laura E; Tung, Jenny


    Field studies of wild vertebrates are frequently associated with extensive collections of banked fecal samples-unique resources for understanding ecological, behavioral, and phylogenetic effects on the gut microbiome. However, we do not understand whether sample storage methods confound the ability to investigate interindividual variation in gut microbiome profiles. Here, we extend previous work on storage methods for gut microbiome samples by comparing immediate freezing, the gold standard of preservation, to three methods commonly used in vertebrate field studies: lyophilization, storage in ethanol, and storage in RNAlater. We found that the signature of individual identity consistently outweighed storage effects: alpha diversity and beta diversity measures were significantly correlated across methods, and while samples often clustered by donor, they never clustered by storage method. Provided that all analyzed samples are stored the same way, banked fecal samples therefore appear highly suitable for investigating variation in gut microbiota. Our results open the door to a much-expanded perspective on variation in the gut microbiome across species and ecological contexts.

  4. Common methods for fecal sample storage in field studies yield consistent signatures of individual identity in microbiome sequencing data

    PubMed Central

    Blekhman, Ran; Tang, Karen; Archie, Elizabeth A.; Barreiro, Luis B.; Johnson, Zachary P.; Wilson, Mark E.; Kohn, Jordan; Yuan, Michael L.; Gesquiere, Laurence; Grieneisen, Laura E.; Tung, Jenny


    Field studies of wild vertebrates are frequently associated with extensive collections of banked fecal samples—unique resources for understanding ecological, behavioral, and phylogenetic effects on the gut microbiome. However, we do not understand whether sample storage methods confound the ability to investigate interindividual variation in gut microbiome profiles. Here, we extend previous work on storage methods for gut microbiome samples by comparing immediate freezing, the gold standard of preservation, to three methods commonly used in vertebrate field studies: lyophilization, storage in ethanol, and storage in RNAlater. We found that the signature of individual identity consistently outweighed storage effects: alpha diversity and beta diversity measures were significantly correlated across methods, and while samples often clustered by donor, they never clustered by storage method. Provided that all analyzed samples are stored the same way, banked fecal samples therefore appear highly suitable for investigating variation in gut microbiota. Our results open the door to a much-expanded perspective on variation in the gut microbiome across species and ecological contexts. PMID:27528013

  5. Evolutionary inferences based on ITS rDNA and actin sequences reveal extensive diversity of the common lichen alga Asterochloris (Trebouxiophyceae, Chlorophyta).


    Skaloud, Pavel; Peksa, Ondrej


    The genus Asterochloris is one of the most common lichen photobionts. We present a molecular investigation of 41 cultured strains, for which nuclear-encoded ITS rDNA and partial actin I sequences were determined. The loci studied revealed considerable differences in their evolutionary dynamics as well as sequence variation. As compared to ITS data, the actin sequences show much greater variation, and the phylogenies yield strong resolution and support of many internal branches. The partitioning of ITS dataset into several regions yielded better node resolution. We recognized 16 well-supported monophyletic lineages, of which one represents the type species of the genus (Asterochloris phycobiontica), and six correspond to species previously classified to the genus Trebouxia (T. erici, T. excentrica, T. glomerata, T. irregularis, T. italiana and T. magna). Only 15% of isolated photobionts considered in our study could be assigned with certainty to previously described species, emphasizing amazing cryptic variability in Asterochloris. Concurrently with the formal delimitation of the genus Asterochloris, we propose new combinations for the former Trebouxia species; furthermore, T. pyriformis is reduced to a synonym of A. glomerata. The present knowledge of global diversity of Asterochloris algae is discussed.

  6. Helena, the hidden beauty: Resolving the most common West Eurasian mtDNA control region haplotype by massively parallel sequencing an Italian population sample.


    Bodner, Martin; Iuvaro, Alessandra; Strobl, Christina; Nagl, Simone; Huber, Gabriela; Pelotti, Susi; Pettener, Davide; Luiselli, Donata; Parson, Walther


    The analysis of mitochondrial (mt)DNA is a powerful tool in forensic genetics when nuclear markers fail to give results or maternal relatedness is investigated. The mtDNA control region (CR) contains highly condensed variation and is therefore routinely typed. Some samples exhibit an identical haplotype in this restricted range. Thus, they convey only weak evidence in forensic queries and limited phylogenetic information. However, a CR match does not imply that also the mtDNA coding regions are identical or samples belong to the same phylogenetic lineage. This is especially the case for the most frequent West Eurasian CR haplotype 263G 315.1C 16519C, which is observed in various clades within haplogroup H and occurs at a frequency of 3-4% in many European populations. In this study, we investigated the power of massively parallel complete mtGenome sequencing in 29 Italian samples displaying the most common West Eurasian CR haplotype - and found an unexpected high diversity. Twenty-eight different haplotypes falling into 19 described sub-clades of haplogroup H were revealed in the samples with identical CR sequences. This study demonstrates the benefit of complete mtGenome sequencing for forensic applications to enforce maximum discrimination, more comprehensive heteroplasmy detection, as well as highest phylogenetic resolution.

  7. Lung Parenchymal Signal Intensity in MRI: A Technical Review with Educational Aspirations Regarding Reversible Versus Irreversible Transverse Relaxation Effects in Common Pulse Sequences

    PubMed Central



    Lung parenchyma is challenging to image with proton MRI. The large air space results in ~l/5th as many signal-generating protons compared to other organs. Air/tissue magnetic susceptibility differences lead to strong magnetic field gradients throughout the lungs and to broad frequency distributions, much broader than within other organs. Such distributions have been the subject of experimental and theoretical analyses which may reveal aspects of lung microarchitecture useful for diagnosis. Their most immediate relevance to current imaging practice is to cause rapid signal decays, commonly discussed in terms of short T2* values of 1 ms or lower at typical imaging field strengths. Herein we provide a brief review of previous studies describing and interpreting proton lung spectra. We then link these broad frequency distributions to rapid signal decays, though not necessarily the exponential decays generally used to define T2* values. We examine how these decays influence observed signal intensities and spatial mapping features associated with the most prominent torso imaging sequences, including spoiled gradient and spin echo sequences. Effects of imperfect refocusing pulses on the multiple echo signal decays in single shot fast spin echo (SSFSE) sequences and effects of broad frequency distributions on balanced steady state free precession (bSSFP) sequence signal intensities are also provided. The theoretical analyses are based on the concept of explicitly separating the effects of reversible and irreversible transverse relaxation processes, thus providing a somewhat novel and more general framework from which to estimate lung signal intensity behavior in modern imaging practice. PMID:25228852

  8. Common CYP2D6 polymorphisms affecting alternative splicing and transcription: long-range haplotypes with two regulatory variants modulate CYP2D6 activity.


    Wang, Danxin; Poi, Ming J; Sun, Xiaochun; Gaedigk, Andrea; Leeder, J Steven; Sadee, Wolfgang


    Cytochrome P450 2D6 (CYP2D6) is involved in the metabolism of 25% of clinically used drugs. Genetic polymorphisms cause substantial variation in CYP2D6 activity and serve as biomarkers guiding drug therapy. However, genotype-phenotype relationships remain ambiguous except for poor metabolizers carrying null alleles, suggesting the presence of yet unknown genetic variants. Searching for regulatory CYP2D6 polymorphisms, we find that a SNP defining the CYP2D6*2 allele, rs16947 [R296C, 17-60% minor allele frequency (MAF)], previously thought to convey normal activity, alters exon 6 splicing, thereby reducing CYP2D6 expression at least 2-fold. In addition, two completely linked SNPs (rs5758550/rs133333, MAF 13-42%) increase CYP2D6 transcription more than 2-fold, located in a distant downstream enhancer region (>100 kb) that interacts with the CYP2D6 promoter. In high linkage disequilibrium (LD) with each other, rs16947 and the enhancer SNPs form haplotypes that affect CYP2D6 enzyme activity in vivo. In a pediatric cohort of 164 individuals, rs16947 alone (minor haplotype frequency 28%) was associated with reduced CYP2D6 metabolic activity (measured as dextromethorphan/metabolite ratios), whereas rs5758550/rs133333 alone (frequency 3%) resulted in increased CYP2D6 activity, while haplotypes containing both rs16947 and rs5758550/rs133333 were similar to the wild-type. Other alleles used in biomarker panels carrying these variants such as CYP2D6*41 require re-evaluation of independent effects on CYP2D6 activity. The occurrence of two regulatory variants of high frequency and in high LD, residing on a long haplotype, highlights the importance of gene architecture, likely shaped by evolutionary selection pressures, in determining activity of encoded proteins.

  9. Risk-based assessment applied to QA GLP audits. How to fulfill regulatory requirements while making the best use of our common sense, knowledge, talents, and resources?


    Piton, Alain


    For ages the standard plan of internal good laboratory practice (GLP) audits has been designed according to the study critical phases concept. A decade ago the concept of facility-based and processbased audits was adopted, mostly under the influence of short-term and in vitro study design. For unclear reasons, the quarterly inspection scheme has been the prevailing rule. Nowadays, the emerging concept of risk management reaches the field of GLP. In this context, the following items are discussed: i) nature of risks associated with the GLP principles and GLP studies; ii) risk in a GLP environment and criteria used to characterize a risk in laboratory and in an environment of research and development; iii) quality and integrity of data, study results and scientific conclusions; iv) risks associated to the processes and those associated to the products; v) workers safety; vi) consumers safety; vii) variety of tools available for the assessment of the above specific risks; viii) principles of risk assessment (the five-step approach); ix) standard and specific risk assessment tools; x) required level of accuracy; xi) use of risk assessment results for the elaboration of audit plans; xi) nature of information obtained; xii) prioritization; xiii) intrinsic risk versus available resources; xiv) potential caveats from a regulatory standpoint; xv) compatibility of risk approach with the GLP regulatory requirements; xvi) how to demonstrate the GLP goals are fulfilled although some of the GLP specific requirements may not be; xvii) benefits of this approach for the audits efficiency and the quality systems improvement; xviii) what the risk approach provides to the organization; xix) how does risk approach efficiency compare to standard efficacy; xx) use of metrics for continuous improvement.

  10. Deep sequencing of RYR3 gene identifies rare and common variants associated with increased carotid intima-media thickness (cIMT) in HIV-infected individuals.


    Zhi, Degui; Shendre, Aditi; Scherzer, Rebecca; Irvin, Marguerite R; Perry, Rodney T; Levy, Shawn; Arnett, Donna K; Grunfeld, Carl; Shrestha, Sadeep


    Carotid intima-media thickness (cIMT) is a subclinical measure of atherosclerosis with mounting evidence that higher cIMT confers an increased risk of cardiovascular disease. The ryanodine receptor 3 gene (RYR3) has previously been linked to increased cIMT; however, the causal variants have not yet been localized. Therefore, we sequenced 339,480 bp encompassing 104 exons and 2 kb flanking region of the RYR3 gene in 96 HIV-positive white men from the extremes of the distribution of common cIMT from the Fat Redistribution and Metabolic Changes in HIV infection study (FRAM). We identified 2710 confirmed variants (2414 single-nucleotide polymorphisms (SNPs) and 296 insertion/deletions (indels)), with a mean count of 736 SNPs (ranging from 528 to 1032) and 170 indels (ranging from 128 to 214) distributed in each individual. There were 39 variants in the exons and 15 of these were non-synonymous, of which with only 4 were common variants and the remaining 11 were rare variants, one was a novel SNP. We confirmed that the common variant rs2229116 was significantly associated with cIMT in this design (P<7.9 × 10(-9)), and observed seven other significantly associated SNPs (P<10(-8)). These variants including the private non-synonymous SNPs need to be followed up in a larger sample size and also tested with clinical atherosclerotic outcomes.

  11. Exploiting Illumina sequencing for the development of 95 novel polymorphic EST-SSR markers in common vetch (Vicia sativa subsp. sativa).


    Liu, Zhipeng; Liu, Peng; Luo, Dong; Liu, Wenxian; Wang, Yanrong


    The common vetch (Vicia sativa subsp. sativa), a self-pollinating and diploid species, is one of the most important annual legumes in the world due to its short growth period, high nutritional value, and multiple usages as hay, grain, silage, and green manure. The available simple sequence repeat (SSR) markers for common vetch, however, are insufficient to meet the developing demand for genetic and molecular research on this important species. Here, we aimed to develop and characterise several polymorphic EST-SSR markers from the vetch Illumina transcriptome. A total number of 1,071 potential EST-SSR markers were identified from 1025 unigenes whose lengths were greater than 1,000 bp, and 450 primer pairs were then designed and synthesized. Finally, 95 polymorphic primer pairs were developed for the 10 common vetch accessions, which included 50 individuals. Among the 95 EST-SSR markers, the number of alleles ranged from three to 13, and the polymorphism information content values ranged from 0.09 to 0.98. The observed heterozygosity values ranged from 0.00 to 1.00, and the expected heterozygosity values ranged from 0.11 to 0.98. These 95 EST-SSR markers developed from the vetch Illumina transcriptome could greatly promote the development of genetic and molecular breeding studies pertaining to in this species.

  12. Common and rare von Willebrand factor (VWF) coding variants, VWF levels, and factor VIII levels in African Americans: the NHLBI Exome Sequencing Project.


    Johnsen, Jill M; Auer, Paul L; Morrison, Alanna C; Jiao, Shuo; Wei, Peng; Haessler, Jeffrey; Fox, Keolu; McGee, Sean R; Smith, Joshua D; Carlson, Christopher S; Smith, Nicholas; Boerwinkle, Eric; Kooperberg, Charles; Nickerson, Deborah A; Rich, Stephen S; Green, David; Peters, Ulrike; Cushman, Mary; Reiner, Alex P


    Several rare European von Willebrand disease missense variants of VWF (including p.Arg2185Gln and p.His817Gln) were recently reported to be common in apparently healthy African Americans (AAs). Using data from the NHLBI Exome Sequencing Project, we assessed the association of these and other VWF coding variants with von Willebrand factor (VWF) and factor VIII (FVIII) levels in 4468 AAs. Of 30 nonsynonymous VWF variants, 6 were significantly and independently associated (P < .001) with levels of VWF and/or FVIII. Each additional copy of the common VWF variants encoding p.Thr789Ala or p.Asp1472His was associated with 6 to 8 IU/dL higher VWF levels. The VWF variant encoding p.Arg2185Gln was associated with 7 to 13 IU/dL lower VWF and FVIII levels. The type 2N-related VWF variant encoding p.His817Gln was associated with 17 IU/dL lower FVIII level but normal VWF level. A novel, rare missense VWF variant that predicts disruption of an O-glycosylation site (p.Ser1486Leu) and a rare variant encoding p.Arg2287Trp were each associated with 30 to 40 IU/dL lower VWF level (P < .001). In summary, several common and rare VWF missense variants contribute to phenotypic differences in VWF and FVIII among AAs.

  13. ‘Default’ generated neonatal regulatory T cells are hypomethylated at conserved non-coding sequence 2 and promote long-term cardiac allograft survival

    PubMed Central

    Cheng, Chao; Wang, Sihua; Ye, Ping; Huang, Xiaofan; Liu, Zheng; Wu, Jie; Sun, Yuan; Xie, Aini; Wang, Guohua; Xia, Jiahong


    Regulatory T (Treg) cells play an important role in the maintenance of immune self-tolerance and homeostasis. We previously reported that neonatal CD4+ T cells have an intrinsic ‘default’ mechanism to become Treg (neoTreg) cells in response to T-cell receptor (TCR) stimulation. However, the underlying mechanisms are unclear and the effects of neoTreg cells on regulating immune responses remain unknown. Due to their involvement in Foxp3 regulation, we examined the role of DNA methyltransferase 1 (DNMT1) and DNMT3b during the induction of neoTreg cells in the Foxp3gfp mice. The function of neoTreg cells was assessed in an acute allograft rejection model established in RAG2−/− mice with allograft cardiac transplantation and transferred with syngeneic CD4+ effector T cells. Following ex vivo TCR stimulation, the DNMT activity was increased threefold in adult CD4+ T cells, but not significantly increased in neonatal cells. However, adoptively transferred neoTreg cells significantly prolonged cardiac allograft survival (mean survival time 47 days, P < 0·001) and maintained Foxp3 expression similar to natural Treg cells. The neoTreg cells were hypomethylated at the conserved non-coding DNA sequence 2 locus of Foxp3 compared with adult Treg cells. The DNMT antagonist 5-aza-2′-deoxycytidine (5-Aza) induced increased Foxp3 expression in mature CD4+ T cells. 5-Aza-inducible Treg cells combined with continuous 5-Aza treatment prolonged graft survival. These results indicate that the ‘default’ pathway of neoTreg cell differentiation is associated with reduced DNMT1 and DNMT3b response to TCR stimulus. The neoTreg cells may be a strategy to alleviate acute allograft rejection. PMID:24944101

  14. Analysis of transcriptional and upstream regulatory sequence activity of two environmental stress-inducible genes, NBS-Str1 and BLEC-Str8, of rice.


    Ray, Swatismita; Kapoor, Sanjay; Tyagi, Akhilesh K


    Two abiotic stress-inducible upstream regulatory sequences (URSs) from rice have been identified and functionally characterized in rice. NBS-Str1 and BLEC-Str8 genes have been identified, by analysing the transcriptome data of cold, salt and desiccation stress-treated 7-day-old rice (Oryza sativa L. var. IR64) seedling, to be preferentially responsive to desiccation and salt stress, respectively. NBS-Str1 and BLEC-Str8 genes code for putative NBS (nucleotide binding site)-LRR (leucine rich repeat) and β-lectin domain protein, respectively. NBS-Str1 URS is induced in root tissue, preferentially in vascular bundle, during 3 and 24 h of desiccation stress condition in transgenic 7-day-old rice seedling. In mature transgenic plants, this URS shows induction in root and shoot tissue under desiccation stress as well as under prolonged (1 and 2 day) salt stress. BLEC-Str8 URS shows basal activity under un-stressed condition, however, it is inducible under salt stress condition in both root and leaf tissues in young seedling and mature plants. Activity of BLEC-Str8 URS has been found to be vascular tissue preferential, however, under salt stress condition its activity is also found in the mesophyll tissue. NBS-Str1 and BLEC-Str8 URSs are inducible by heavy metal, copper and manganese. Interestingly, both the URSs have been found to be non responsive to ABA treatment, implying them to be part of ABA-independent abiotic stress response pathway. These URSs could prove useful for expressing a transgene in a stress responsive manner for development of stress tolerant transgenic systems.

  15. DNA Sequence Variants in the Five Prime Untranslated Region of the Cyclooxygenase-2 Gene Are Commonly Found in Healthy Dogs and Gray Wolves

    PubMed Central

    Safra, Noa; Hayward, Louisa J.; Aguilar, Miriam; Sacks, Benjamin N.; Westropp, Jodi L.; Mohr, F. Charles; Mellersh, Cathryn S.; Bannasch, Danika L.


    The aim of this study was to investigate the frequency of regional DNA variants upstream to the translation initiation site of the canine Cyclooxygenase-2 (Cox-2) gene in healthy dogs. Cox-2 plays a role in various disease conditions such as acute and chronic inflammation, osteoarthritis and malignancy. A role for Cox-2 DNA variants in genetic predisposition to canine renal dysplasia has been proposed and dog breeders have been encouraged to select against these DNA variants. We sequenced 272–422 bases in 152 dogs unaffected by renal dysplasia and found 19 different haplotypes including 11 genetic variants which had not been described previously. We genotyped 7 gray wolves to ascertain the wildtype variant and found that the wolves we analyzed had predominantly the second most common DNA variant found in dogs. Our results demonstrate an elevated level of regional polymorphism that appears to be a feature of healthy domesticated dogs. PMID:26244515

  16. Genome Sequences of Three Koi Herpesvirus Isolates Representing the Expanding Distribution of an Emerging Disease Threatening Koi and Common Carp Worldwide▿

    PubMed Central

    Aoki, Takashi; Hirono, Ikuo; Kurokawa, Ken; Fukuda, Hideo; Nahary, Ronen; Eldar, Avi; Davison, Andrew J.; Waltzek, Thomas B.; Bercovier, Herve; Hedrick, Ronald P.


    Since the mid-1990s, lethal infections of koi herpesvirus (KHV) have been spreading, threatening the worldwide production of common carp and koi (both Cyprinus carpio). The complete genome sequences of three KHV strains from Japan, the United States, and Israel revealed a 295-kbp genome containing a 22-kbp terminal direct repeat. The finding that 15 KHV genes have clear homologs in the distantly related channel catfish virus (ictalurid herpesvirus 1) confirms the proposed place of KHV in the family Herpesviridae, specifically in the branch with fish and amphibian hosts. KHV thus has the largest genome reported to date for this family. The three strains were interpreted as having arisen from a wild-type parent encoding 156 unique protein-coding genes, 8 of which are duplicated in the terminal repeat. In each strain, four to seven genes from among a set of nine are fragmented by frameshifts likely to render the encoded proteins nonfunctional. Six of the affected genes encode predicted membrane glycoproteins. Frameshifts or other mutations close to the 3′ ends of coding sequences were identified in a further six genes. The conclusion that at least some of these mutations occurred in vivo prompts the hypothesis that loss of gene functions might be associated with emergence of the disease and provides a basis for further investigations into the molecular epidemiology of the virus. PMID:17329333

  17. Push it to the limit: Characterizing the convergence of common sequences of basis sets for intermolecular interactions as described by density functional theory.


    Witte, Jonathon; Neaton, Jeffrey B; Head-Gordon, Martin


    With the aim of systematically characterizing the convergence of common families of basis sets such that general recommendations for basis sets can be made, we have tested a wide variety of basis sets against complete-basis binding energies across the S22 set of intermolecular interactions-noncovalent interactions of small and medium-sized molecules consisting of first- and second-row atoms-with three distinct density functional approximations: SPW92, a form of local-density approximation; B3LYP, a global hybrid generalized gradient approximation; and B97M-V, a meta-generalized gradient approximation with nonlocal correlation. We have found that it is remarkably difficult to reach the basis set limit; for the methods and systems examined, the most complete basis is Jensen's pc-4. The Dunning correlation-consistent sequence of basis sets converges slowly relative to the Jensen sequence. The Karlsruhe basis sets are quite cost effective, particularly when a correction for basis set superposition error is applied: counterpoise-corrected def2-SVPD binding energies are better than corresponding energies computed in comparably sized Dunning and Jensen bases, and on par with uncorrected results in basis sets 3-4 times larger. These trends are exhibited regardless of the level of density functional approximation employed. A sense of the magnitude of the intrinsic incompleteness error of each basis set not only provides a foundation for guiding basis set choice in future studies but also facilitates quantitative comparison of existing studies on similar types of systems.

  18. Post-glacial recolonization of the Great Lakes region by the common gartersnake (Thamnophis sirtalis) inferred from mtDNA sequences.


    Placyk, John S; Burghardt, Gordon M; Small, Randall L; King, Richard B; Casper, Gary S; Robinson, Jace W


    Pleistocene events played an important role in the differentiation of North American vertebrate populations. Michigan, in particular, and the Great Lakes region, in general, were greatly influenced by the last glaciation. While several hypotheses regarding the recolonization of this region have been advanced, none have been strongly supported. We generated 148 complete ND2 mitochondrial DNA (mtDNA) sequences from common gartersnake (Thamnophis sirtalis) populations throughout the Great Lakes region to evaluate phylogeographic patterns and population structure and to determine whether the distribution of haplotypic variants is related to the post-Pleistocene retreat of the Wisconsinan glacier. The common gartersnake was utilized, as it is believed to have been one of the primary vertebrate invaders of the Great Lakes region following the most recent period of glacial retreat and because it has been a model species for a variety of evolutionary, ecological, behavioral, and physiological studies. Several genetically distinct evolutionary lineages were supported by both genealogical and molecular population genetic analyses, although to different degrees. The geographic distribution of the majority of these lineages is interpreted as reflecting post-glacial recolonization dynamics during the late Pleistocene. These findings generally support previous hypotheses of range expansion in this region.

  19. Draft Genome Sequence of Textile Azo Dye-Decolorizing and -Degrading Pseudomonas aeruginosa Strain PFK10, Isolated from the Common Effluent Treatment Plant of the Ankleshwar Industrial Area of Gujarat, India.


    Faldu, P R; Kothari, V V; Kothari, C R; Rawal, C M; Domadia, K K; Patel, P A; Bhimani, H D; Raval, V H; Parmar, N R; Nathani, N M; Koringa, P G; Joshi, C G; Kothari, R K


    Here, we report the draft genome sequence of Pseudomonas aeruginosa strain PFK10, isolated from the common effluent treatment plant (CETP) of the Ankleshwar industrial area of Gujarat, India. The 6.04-Mb draft genome sequence of strain PFK10 provides information about the genes encoding enzymes that enable the strain to decolorize and degrade textile azo dye.

  20. Draft Genome Sequence of Textile Azo Dye-Decolorizing and -Degrading Pseudomonas aeruginosa Strain PFK10, Isolated from the Common Effluent Treatment Plant of the Ankleshwar Industrial Area of Gujarat, India

    PubMed Central

    Faldu, P. R.; Kothari, V. V.; Kothari, C. R.; Rawal, C. M.; Domadia, K. K.; Patel, P. A.; Bhimani, H. D.; Raval, V. H.; Parmar, N. R.; Nathani, N. M.; Koringa, P. G.; Joshi, C. G.


    Here, we report the draft genome sequence of Pseudomonas aeruginosa strain PFK10, isolated from the common effluent treatment plant (CETP) of the Ankleshwar industrial area of Gujarat, India. The 6.04-Mb draft genome sequence of strain PFK10 provides information about the genes encoding enzymes that enable the strain to decolorize and degrade textile azo dye. PMID:24503984

  1. QTL analysis of photoperiod sensitivity in common buckwheat by using markers for expressed sequence tags and photoperiod-sensitivity candidate genes

    PubMed Central

    Hara, Takashi; Iwata, Hiroyoshi; Okuno, Kazutoshi; Matsui, Katsuhiro; Ohsawa, Ryo


    Photoperiod sensitivity is an important trait related to crop adaptation and ecological breeding in common buckwheat (Fagopyrum esculentum Moench). Although photoperiod sensitivity in this species is thought to be controlled by quantitative trait loci (QTLs), no genes or regions related to photoperiod sensitivity had been identified until now. Here, we identified QTLs controlling photoperiod sensitivity by QTL analysis in a segregating F4 population (n = 100) derived from a cross of two autogamous lines, 02AL113(Kyukei SC2)LH.self and C0408-0 RP. The F4 progenies were genotyped with three markers for photoperiod-sensitivity candidate genes, which were identified based on homology to photoperiod-sensitivity genes in Arabidopsis and 76 expressed sequence tag markers. Among the three photoperiod-sensitivity candidate genes (FeCCA1, FeELF3 and FeCOL3) identified in common buckwheat, FeELF3 was associated with photoperiod sensitivity. Two EST regions, Fest_L0606_4 and Fest_L0337_6, were associated with photoperiod sensitivity and explained 20.0% and 14.2% of the phenotypic variation, respectively. For both EST regions, the allele from 02AL113(Kyukei SC2)LH.self led to early flowering. An epistatic interaction was also confirmed between Fest_L0606_4 and Fest_L0337_6. These results demonstrate that photoperiod sensitivity in common buckwheat is controlled by a pathway consisting of photoperiod-sensitivity candidate genes as well as multiple gene action. PMID:23136477

  2. PCR detection and DNA sequence analysis of the regulatory region of lymphotropic papovavirus in peripheral blood mononuclear cells of an immunocompromised rhesus macaque

    NASA Technical Reports Server (NTRS)

    Lednicky, John A.; Halvorson, Steven J.; Butel, Janet S.


    A lymphotropic papovavirus (LPV) archetypal regulatory region was amplified from DNA from the blood of an immunocompromised rhesus monkey. We believe this is the first nonserological evidence of LPV infection in rhesus monkeys.

  3. Comparative genome analysis of the major histocompatibility complex (MHC) class I B/C segments in primates elucidated by genomic sequencing in common marmoset (Callithrix jacchus).


    Shiina, Takashi; Kono, Azumi; Westphal, Nico; Suzuki, Shingo; Hosomichi, Kazuyoshi; Kita, Yuki F; Roos, Christian; Inoko, Hidetoshi; Walter, Lutz


    Common marmoset monkeys (Callithrix jacchus) have emerged as important animal models for biomedical research, necessitating a more extensive characterization of their major histocompatibility complex (MHC) region. However, the genomic information of the marmoset MHC (Caja) is still lacking. The MHC-B/C segment represents the most diverse MHC region among primates. Therefore, in this paper, to elucidate the detailed gene organization and evolutionary processes of the Caja class I B (Caja-B) segment, we determined two parts of the Caja-B sequences with 1,079 kb in total, ranging from H6orf15 to BAT1 and compared the structure and phylogeny with that of other primates. This segment contains 54 genes in total, nine Caja-B genes (Caja-B1 to Caja-B9), two MIC genes (MIC1 and MIC2), eight non-MHC genes, two non-coding genes, and 33 non-MHC pseudogenes that have not been observed in other primate MHC-B/C segments. Caja-B3, Caja-B4, and Caja-B7 encode proper MHC class I proteins according to amino acid structural characteristics. Phylogenetic relationships based on 48 MHC-I nucleotide sequences in primates suggested (1) species-specific divergence for Caja, Mamu, and HLA/Patr/Gogo lineages, (2) independent generation of the "seven coding exon" type MHC-B genes in Mamu and HLA/Patr/Gogo lineages from an ancestral "eight coding exon" type MHC-I gene, (3) parallel correlation with the long and short segmental duplication unit length in Caja and Mamu lineages. These findings indicate that the MHC-B/C segment has been under permanent selective pressure in the evolution of primates.

  4. Tissue expression map of a large number of expressed sequence tags and its application to in silico screening of stress response genes in common wheat.


    Mochida, Keiichi; Kawaura, Kanako; Shimosaka, Etsuo; Kawakami, Naoto; Shin-I, Tadasu; Kohara, Yuji; Yamazaki, Yukiko; Ogihara, Yasunari


    In order to assess global changes in gene expression patterns in stress-induced tissues, we conducted large-scale analysis of expressed sequence tags (ESTs) in common wheat. Twenty-one cDNA libraries derived from stress-induced tissues, such as callus, as well as liquid cultures and abiotic stress conditions (temperature treatment, desiccation, photoperiod, moisture and ABA) were constructed. Several thousand colonies were randomly selected from each of these 21 cDNA libraries and sequenced from both the 5' and 3' ends. By computing abundantly expressed ESTs, correlated expression patterns of genes across the tissues were monitored. Furthermore, the relationships between gene expression profiles among the stress-induced tissues were inferred from the gene expression patterns. Multi-dimensional analysis of EST data is analogous to microarray experiments. As an example, genes specifically induced and/or suppressed by cold acclimation and heat-shock treatments were selected in silico. Four hundred and ninety genes showing fivefold induction or 218 genes for suppression in comparison to the control expression level were selected. These selected genes were annotated with the BLAST search. Furthermore, gene ontology was conducted for these genes with the InterPro search. Because genes regulated in response to temperature treatment were successfully selected, this method can be applied to other stress-treated tissues. Then, the method was applied to screen genes in response to abiotic stresses such as drought and ABA treatments. In silico selection of screened genes from virtual display should provide a powerful tool for functional plant genomics.

  5. A cis-regulatory module activating transcription in the suspensor contains five cis-regulatory elements.


    Henry, Kelli F; Kawashima, Tomokazu; Goldberg, Robert B


    Little is known about the molecular mechanisms by which the embryo proper and suspensor of plant embryos activate specific gene sets shortly after fertilization. We analyzed the upstream region of the Scarlet Runner Bean (Phaseolus coccineus) G564 gene in order to understand how genes are activated specifically in the suspensor during early embryo development. Previously, we showed that a 54-bp fragment of the G564 upstream region is sufficient for suspensor transcription and contains at least three required cis-regulatory sequences, including the 10-bp motif (5'-GAAAAGCGAA-3'), the 10 bp-like motif (5'-GAAAAACGAA-3'), and Region 2 motif (partial sequence 5'-TTGGT-3'). Here, we use site-directed mutagenesis experiments in transgenic tobacco globular-stage embryos to identify two additional cis-regulatory elements within the 54-bp cis-regulatory module that are required for G564 suspensor transcription: the Fifth motif (5'-GAGTTA-3') and a third 10-bp-related sequence (5'-GAAAACCACA-3'). Further deletion of the 54-bp fragment revealed that a 47-bp fragment containing the five motifs (the 10-bp, 10-bp-like, 10-bp-related, Region 2 and Fifth motifs) is sufficient for suspensor transcription, and represents a cis-regulatory module. A consensus sequence for each type of motif was determined by comparing motif sequences shown to activate suspensor transcription. Phylogenetic analyses suggest that the regulation of G564 is evolutionarily conserved. A homologous cis-regulatory module was found upstream of the G564 ortholog in the Common Bean (Phaseolus vulgaris), indicating that the regulation of G564 is evolutionarily conserved in closely related bean species.

  6. Subcuticular bacteria associated with two common New Zealand echinoderms: Characterization using 16S rRNA sequence analysis and fluorescence in situ hybridization.


    Lawrence, Scott A; O'Toole, Ronan; Taylor, Michael W; Davy, Simon K


    Many echinoderms contain subcuticular bacteria (SCB), symbionts which reside in the lumen between the host's epidermal cells and outer cuticle. This relationship is common, existing in about 60% of echinoderms studied so far, yet the function of SCB remains largely unknown. In this study, phylogenetic analysis was carried out on 16S rRNA sequences obtained from echinoderm-associated bacteria, resulting in the identification of four species of putative SCB. All four bacteria were identified from the holothurian Stichopus mollis, and two of the four were also found in the asteroid Patiriella sp. Two of these bacteria belong to the Alphaproteobacteria, and two to the Gammaproteobacteria. In addition to phylogenetic analysis, fluorescence in situ hybridization (FISH) assays were carried out on Patiriella sp., S. mollis, and the asteroid Astrostole scabra. Results showed that Patiriella sp. and S. mollis contain SCB, in agreement with the phylogenetic analysis, while SCB were not detected in A. scabra. Of the bacteria detected using FISH, more than 80% were recognized as belonging to the Alphaproteobacteria in both host species. However, in S. mollis about 20% of the detected SCB successfully hybridized with the Gammaproteobacteria-specific probe, whereas bacteria belonging to this class were never observed in Patiriella sp. This is only the second study to characterize SCB by molecular means, and is the first to identify SCB in situ using FISH.

  7. Sequence homologies between eukaryotic 5.8S rRNA and the 5' end of prokaryotic 23S rRNa: evidences for a common evolutionary origin.

    PubMed Central

    Jacq, B


    The question of the evolutionary origin of eukaryotic 5.8S rRNA was re-examined after the recent publication of the E. coli 23S rRNA sequence (26,40). A region of the 23S RNA located at its 5' end was found to be approximately 50% homologous to four different eukaryotic 5.8S rRNAs. A computer comparison analysis indicates that no other region of the E. coli ribosomal transcription unit (greater than 5 000 nucleotides in length) shares a comparable homology with 5.8S rRNA. Homology between the 5' end of e. coli 23S and four different eukaryotic 5.8S rRNAs falls within the same range as that between E. coli 5S RNA from the same four eukaryotic species. All these data strongly suggest that the 5' end of prokaryotic 23S rRNA and eukaryotic 5.8S RNA have a common evolutionary origin. Secondary structure models are proposed for the 5' region of E. coli 23S RNA. Images PMID:7024907

  8. Cytochrome P450 CYP2 genes in the common cormorant: Evolutionary relationships with 130 diapsid CYP2 clan sequences and chemical effects on their expression.


    Kubota, Akira; Stegeman, John J; Goldstone, Jared V; Nelson, David R; Kim, Eun-Young; Tanabe, Shinsuke; Iwata, Hisato


    Cytochrome P450 CYP2 family enzymes are important in a variety of physiological and toxicological processes. CYP2 genes are highly diverse and orthologous relationships remain clouded among CYP2s in different taxa. Sequence and expression analyses of CYP2 genes in diapsids including birds and reptiles may improve understanding of this CYP family. We sought CYP2 genes in a liver cDNA library of the common cormorant (Phalacrocorax carbo), and in the genomes of other diapsids, chicken (Gallus gallus), zebra finch (Taeniopygia guttata), and anole lizard (Anolis carolinensis), for phylogenetic and/or syntenic analyses. Screening of the cDNA library yielded four CYP2 cDNA clones that were phylogenetically classified as CYP2C45, CYP2J25, CYP2AC1, and CYP2AF1. There are numerous newly identified diapsid CYP2 genes that include genes related to the human CYP2Cs, CYP2D6, CYP2G2P, CYP2J2, CYP2R1, CYP2U1, CYP2W1, CYP2AB1P, and CYP2AC1P. Syntenic relationships show that avian CYP2Hs are orthologous to CYP2C62P in humans, CYP2C23 in rats, and Cyp2c44 in mice, and suggest that avian CYP2Hs, along with human CYP2C62P and mouse Cyp2c44, could be renamed as CYP2C23, based upon the nomenclature rules. Analysis of sequence and synteny identifies cormorant and finch CYPs that are apparent orthologs of phenobarbital-inducible chicken CYP2C45. Transcripts of all four cormorant CYP2 genes were detected in the liver of birds from Lake Biwa, Japan. The transcript levels bore no significant relationship to levels of chlorinated organic pollutants in the liver, including polychlorinated biphenyls and dichlorodiphenyltrichloroethane and its metabolites. In contrast, concentrations of perfluorooctane sulfonate and perfluorononanoic acid were negatively correlated with levels of CYP2C45 and/or CYP2J25, suggesting down-regulation of expression by these environmental pollutants. This study expands our view of the phylogeny and evolution of CYP2s, and provides evolutionary insight into the chemical

  9. Sequencing of Candidate Genes in Dominican Families Implicates Both Rare Exonic and Common Non-Exonic Variants for Carotid Intima-Media Thickness at Bifurcation

    PubMed Central

    Wang, Liyong; Beecham, Ashley; Dueker, Nicole; Blanton, Susan H.; Rundek, Tatjana; Sacco, Ralph L.


    Background Through linkage and tagSNP-based association studies in 100 Dominican Republic (DR) families, we previously identified ANLN and AOAH (7p14.3) as candidate genes for carotid intima-media thickness at bifurcation (bIMT). Methods and Results Introns, exons and flanking regions of ANLN and AOAH were re-sequenced in 151 individuals from 9 families with evidence for linkage at 7p14.3. For common variants [CV, minor allele frequency (MAF) ≥ 5%], single variant-based analysis was performed. For rare variants (RV, MAF<5%), gene-based analysis aggregating all RVs within a gene was performed. CV analysis revealed the strongest signal at rs3815483 (P=0.0003) in ANLN and rs60023210 (P=0.00005) in AOAH. In ANLN, RV analysis found suggestive evidence for association with exonic RVs (P=0.08), and in particular non-synonymous RVs (P=0.04) but not with all RVs (P=0.15). The variant alleles of all non-synonymous RVs segregated with the major allele of rs3815483 and were associated with lower bIMT while a novel synonymous RV segregated with the minor allele of rs3815483 and was associated with greater bIMT. Additional analysis in 561 DR individuals found suggestive evidence for association with all ANLN non-synonymous RVs (P=0.08). In AOAH, no evidence for association with RVs was detected. Instead, conditional analysis revealed that multiple independent intronic CVs are associated with bIMT in addition to rs60023210. Conclusions We demonstrate the utility of using family-based studies to evaluate the contribution of RVs. Our data suggest two modes of genetic architecture underlying the linkage and association at ANLN (multiple exonic RVs) and AOAH (multiple intronic CVs with uncharacterized functions). PMID:26319989

  10. Genomic analysis reveals major determinants of cis-regulatory variation in Capsella grandiflora

    PubMed Central

    Steige, Kim A.; Laenen, Benjamin; Reimegård, Johan; Slotte, Tanja


    Understanding the causes of cis-regulatory variation is a long-standing aim in evolutionary biology. Although cis-regulatory variation has long been considered important for adaptation, we still have a limited understanding of the selective importance and genomic determinants of standing cis-regulatory variation. To address these questions, we studied the prevalence, genomic determinants, and selective forces shaping cis-regulatory variation in the outcrossing plant Capsella grandiflora. We first identified a set of 1,010 genes with common cis-regulatory variation using analyses of allele-specific expression (ASE). Population genomic analyses of whole-genome sequences from 32 individuals showed that genes with common cis-regulatory variation (i) are under weaker purifying selection and (ii) undergo less frequent positive selection than other genes. We further identified genomic determinants of cis-regulatory variation. Gene body methylation (gbM) was a major factor constraining cis-regulatory variation, whereas presence of nearby transposable elements (TEs) and tissue specificity of expression increased the odds of ASE. Our results suggest that most common cis-regulatory variation in C. grandiflora is under weak purifying selection, and that gene-specific functional constraints are more important for the maintenance of cis-regulatory variation than genome-scale variation in the intensity of selection. Our results agree with previous findings that suggest TE silencing affects nearby gene expression, and provide evidence for a link between gbM and cis-regulatory constraint, possibly reflecting greater dosage sensitivity of body-methylated genes. Given the extensive conservation of gbM in flowering plants, this suggests that gbM could be an important predictor of cis-regulatory variation in a wide range of plant species. PMID:28096395

  11. Genomic analysis reveals major determinants of cis-regulatory variation in Capsella grandiflora.


    Steige, Kim A; Laenen, Benjamin; Reimegård, Johan; Scofield, Douglas G; Slotte, Tanja


    Understanding the causes of cis-regulatory variation is a long-standing aim in evolutionary biology. Although cis-regulatory variation has long been considered important for adaptation, we still have a limited understanding of the selective importance and genomic determinants of standing cis-regulatory variation. To address these questions, we studied the prevalence, genomic determinants, and selective forces shaping cis-regulatory variation in the outcrossing plant Capsella grandiflora We first identified a set of 1,010 genes with common cis-regulatory variation using analyses of allele-specific expression (ASE). Population genomic analyses of whole-genome sequences from 32 individuals showed that genes with common cis-regulatory variation (i) are under weaker purifying selection and (ii) undergo less frequent positive selection than other genes. We further identified genomic determinants of cis-regulatory variation. Gene body methylation (gbM) was a major factor constraining cis-regulatory variation, whereas presence of nearby transposable elements (TEs) and tissue specificity of expression increased the odds of ASE. Our results suggest that most common cis-regulatory variation in C. grandiflora is under weak purifying selection, and that gene-specific functional constraints are more important for the maintenance of cis-regulatory variation than genome-scale variation in the intensity of selection. Our results agree with previous findings that suggest TE silencing affects nearby gene expression, and provide evidence for a link between gbM and cis-regulatory constraint, possibly reflecting greater dosage sensitivity of body-methylated genes. Given the extensive conservation of gbM in flowering plants, this suggests that gbM could be an important predictor of cis-regulatory variation in a wide range of plant species.

  12. PrimerSNP: a web tool for whole-genome selection of allele-specific and common primers of phylogenetically-related bacterial genomic sequences

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The increasing number of genomic sequences of bacteria makes it possible to select unique SNPs of a particular strain/species at the whole genome level and thus design specific primers based on the SNPs. The high similarity of genomic sequences among phylogenetically-related bacteria requires the id...

  13. Exploration of Noncoding Sequences in Metagenomes

    PubMed Central

    Tobar-Tosse, Fabián; Rodríguez, Adrián C.; Vélez, Patricia E.; Zambrano, María M.; Moreno, Pedro A.


    Environment-dependent genomic features have been defined for different metagenomes, whose genes and their associated processes are related to specific environments. Identification of ORFs and their functional categories are the most common methods for association between functional and environmental features. However, this analysis based on finding ORFs misses noncoding sequences and, therefore, some metagenome regulatory or structural information could be discarded. In this work we analyzed 23 whole metagenomes, including coding and noncoding sequences using the following sequence patterns: (G+C) content, Codon Usage (Cd), Trinucleotide Usage (Tn), and functional assignments for ORF prediction. Herein, we present evidence of a high proportion of noncoding sequences discarded in common similarity-based methods in metagenomics, and the kind of relevant information present in those. We found a high density of trinucleotide repeat sequences (TRS) in noncoding sequences, with a regulatory and adaptive function for metagenome communities. We present associations between trinucleotide values and gene function, where metagenome clustering correlate with microorganism adaptations and kinds of metagenomes. We propose here that noncoding sequences have relevant information to describe metagenomes that could be considered in a whole metagenome analysis in order to improve their organization, classification protocols, and their relation with the environment. PMID:23536879

  14. CRISPRs of Enterococcus faecalis and E. hirae isolates from pig feces have species-specific repeats but share some common spacer sequences.


    Katyal, Isha; Chaban, Bonnie; Ng, Beata; Hill, Janet E


    Clustered regularly interspaced short palindromic repeats (CRISPR) are currently a topic of interest in microbiology due to their role as a prokaryotic immune system. Investigations of CRISPR distribution and characterization to date have focused on pathogenic bacteria, while less is known about CRISPR in commensal bacteria, where they may have a significant role in the ecology of the microbiota of humans and other animals, and act as a recorder of interactions between bacteria and viruses. A combination of PCR and sequencing was used to determine prevalence and distribution of CRISPR arrays in Enterococcus faecalis and Enterococcus hirae isolates from the feces of healthy pigs. Both type II CRISPR-Cas and Orphan CRISPR (without Cas genes) were detected in the 195 isolates examined. CRISPR-Cas was detected in 52 (46/88) and 42 % (45/107) E. faecalis and E. hirae isolates, respectively. The prevalence of Orphan CRISPR arrays was higher in E. faecalis isolates (95 %, 84/88) compared with E. hirae isolates (49 %, 53/107). Species-specific repeat sequences were identified in Orphan CRISPR arrays, and 42 unique spacer sequences were identified. Only two spacers matched previously characterized pig virome sequences, and many were apparently derived from chromosomal sequences of enterococci. Surprisingly, 17 (40 %) of the spacers were detected in both species. Shared spacer sequences are evidence of a lack of species specificity in the agents and mechanisms responsible for integration of spacers, and the abundance of spacer sequences corresponding to bacterial chromosomal sequences reflects interspecific interactions within the intestinal microbiota.

  15. RNA Sequencing of Laser-Capture Microdissected Compartments of the Maize Kernel Identifies Regulatory Modules Associated with Endosperm Cell Differentiation[OPEN

    PubMed Central

    Zhan, Junpeng; Thakare, Dhiraj; Ma, Chuang; Lloyd, Alan; Nixon, Neesha M.; Arakaki, Angela M.; Burnett, William J.; Logan, Kyle O.; Wang, Dongfang; Wang, Xiangfeng; Drews, Gary N.; Yadegari, Ramin


    Endosperm is an absorptive structure that supports embryo development or seedling germination in angiosperms. The endosperm of cereals is a main source of food, feed, and industrial raw materials worldwide. However, the genetic networks that regulate endosperm cell differentiation remain largely unclear. As a first step toward characterizing these networks, we profiled the mRNAs in five major cell types of the differentiating endosperm and in the embryo and four maternal compartments of the maize (Zea mays) kernel. Comparisons of these mRNA populations revealed the diverged gene expression programs between filial and maternal compartments and an unexpected close correlation between embryo and the aleurone layer of endosperm. Gene coexpression network analysis identified coexpression modules associated with single or multiple kernel compartments including modules for the endosperm cell types, some of which showed enrichment of previously identified temporally activated and/or imprinted genes. Detailed analyses of a coexpression module highly correlated with the basal endosperm transfer layer (BETL) identified a regulatory module activated by MRP-1, a regulator of BETL differentiation and function. These results provide a high-resolution atlas of gene activity in the compartments of the maize kernel and help to uncover the regulatory modules associated with the differentiation of the major endosperm cell types. PMID:25783031

  16. Commonly-occurring polymorphisms in the COMT, DRD1 and DRD2 genes influence different aspects of motor sequence learning in humans.


    Baetu, Irina; Burns, Nicholas R; Urry, Kristi; Barbante, Girolamo Giovanni; Pitcher, Julia B


    Performing sequences of movements is a ubiquitous skill that involves dopamine transmission. However, it is unclear which components of the dopamine system contribute to which aspects of motor sequence learning. Here we used a genetic approach to investigate the relationship between different components of the dopamine system and specific aspects of sequence learning in humans. In particular, we investigated variations in genes that code for the catechol-O-methyltransferase (COMT) enzyme, the dopamine transporter (DAT) and dopamine D1 and D2 receptors (DRD1 and DRD2). COMT and the DAT regulate dopamine availability in the prefrontal cortex and the striatum, respectively, two key regions recruited during learning, whereas dopamine D1 and D2 receptors are thought to be involved in long-term potentiation and depression, respectively. We show that polymorphisms in the COMT, DRD1 and DRD2 genes differentially affect behavioral performance on a sequence learning task in 161 Caucasian participants. The DRD1 polymorphism predicted the ability to learn new sequences, the DRD2 polymorphism predicted the ability to perform a previously learnt sequence after performing interfering random movements, whereas the COMT polymorphism predicted the ability to switch flexibly between two sequences. We used computer simulations to explore potential mechanisms underlying these effects, which revealed that the DRD1 and DRD2 effects are possibly related to neuroplasticity. Our prediction-error algorithm estimated faster rates of connection strengthening in genotype groups with presumably higher D1 receptor densities, and faster rates of connection weakening in genotype groups with presumably higher D2 receptor densities. Consistent with current dopamine theories, these simulations suggest that D1-mediated neuroplasticity contributes to learning to select appropriate actions, whereas D2-mediated neuroplasticity is involved in learning to inhibit incorrect action plans. However, the

  17. Localization of proteins to the 1,2-propanediol utilization microcompartment by non-native signal sequences is mediated by a common hydrophobic motif.


    Jakobson, Christopher M; Kim, Edward Y; Slininger, Marilyn F; Chien, Alex; Tullman-Ercek, Danielle


    Various bacteria localize metabolic pathways to proteinaceous organelles known as bacterial microcompartments (MCPs), enabling the metabolism of carbon sources to enhance survival and pathogenicity in the gut. There is considerable interest in exploiting bacterial MCPs for metabolic engineering applications, but little is known about the interactions between MCP signal sequences and the protein shells of different MCP systems. We found that the N-terminal sequences from the ethanolamine utilization (Eut) and glycyl radical-generating protein MCPs are able to target reporter proteins to the 1,2-propanediol utilization (Pdu) MCP, and that this localization is mediated by a conserved hydrophobic residue motif. Recapitulation of this motif by the addition of a single amino acid conferred targeting function on an N-terminal sequence from the ethanol utilization MCP system that previously did not act as a Pdu signal sequence. Moreover, the Pdu-localized signal sequences competed with native Pdu targeting sequences for encapsulation in the Pdu MCP. Salmonella enterica natively possesses both the Pdu and Eut operons, and our results suggest that Eut proteins might be localized to the Pdu MCP in vivo. We further demonstrate that S. enterica LT2 retained the ability to grow on 1,2-propanediol as the sole carbon source when a Pdu enzyme was replaced with its Eut homolog. Although the relevance of this finding to the native system remains to be explored, we show that the Pdu-localized signal sequences described herein allow control over the ratio of heterologous proteins encapsulated within Pdu MCPs.

  18. Cofunctional Subpathways Were Regulated by Transcription Factor with Common Motif, Common Family, or Common Tissue.


    Su, Fei; Shang, Desi; Xu, Yanjun; Feng, Li; Yang, Haixiu; Liu, Baoquan; Su, Shengyang; Chen, Lina; Li, Xia


    Dissecting the characteristics of the transcription factor (TF) regulatory subpathway is helpful for understanding the TF underlying regulatory function in complex biological systems. To gain insight into the influence of TFs on their regulatory subpathways, we constructed a global TF-subpathways network (TSN) to analyze systematically the regulatory effect of common-motif, common-family, or common-tissue TFs on subpathways. We performed cluster analysis to show that the common-motif, common-family, or common-tissue TFs that regulated the same pathway classes tended to cluster together and contribute to the same biological function that led to disease initiation and progression. We analyzed the Jaccard coefficient to show that the functional consistency of subpathways regulated by the TF pairs with common motif, common family, or common tissue was significantly greater than the random TF pairs at the subpathway level, pathway level, and pathway class level. For example, HNF4A (hepatocyte nuclear factor 4, alpha) and NR1I3 (nuclear receptor subfamily 1, group I, member 3) were a pair of TFs with common motif, common family, and common tissue. They were involved in drug metabolism pathways and were liver-specific factors required for physiological transcription. In short, we inferred that the cofunctional subpathways were regulated by common-motif, common-family, or common-tissue TFs.

  19. Negative regulatory element associated with potentially functional promoter and enhancer elements in the long terminal repeats of endogenous murine leukemia virus-related proviral sequences

    SciTech Connect

    Ch'ang, L.Y.; Yang, W.K.; Myer, F.E.; Yang, D.M.


    Three series of recombinant DNA clones were constructed, with the bacterial chloramphenical acetyltransferase (CAT) gene as a quantitative indicator, to examine the activities of promoter and enhancer sequence elements in the 5' long terminal repeat (LTR) of murine leukemia virus (MuLV)-related proviral sequences isolated from the mouse genome. Transient CAT expression was determined in mouse NIH 3T3, human HT1080, and mink CCL64 cultured cells transfected with the LTR-CAT constructs. The 700-base pair (bp) LTRs of three polytropic MuLV-related proviral clones and the 750-bp LTRs of four modified polytropic proviral clones, in complete structures either with or without the adjacent downstream sequences, all showed very little or negligible activities for CAT expression, while ecotropic MuLV LTRs were highly active. The MuLV-related LTRs were divided into three portions and examined separately. The 3' portion of the MuLV-related LTRs that contains the CCAAC and TATAA boxes was found to be a functional promoter, being about one-half to one-third as active as the corresponding portion of the ecotropic MuLV LTRs. A MboI-Bg/II fragment, representing the distinct 190- to 200-pb inserted segment in the middle, was found to be a potential enhancer, especially when examined in combination with the simian virus 40 promoter in CCL64 cells. A PstI-MboI fragment of the 5' portion, which contains the protein-binding motifs on the enhancer segment as well as the upstream LTF sequences, showed moderate enhancer activities in CCL6 cells but was virtually inactive in NIH 3T3 cells and HT1080 cells; addition of this fragment to the ecotropic LTR-CAT constructs depressed CAT expression.

  20. Multiple regulatory mechanisms of hepatocyte growth factor expression in malignant cells with a short poly(dA) sequence in the HGF gene promoter.


    Sakai, Kazuko; Takeda, Masayuki; Okamoto, Isamu; Nakagawa, Kazuhiko; Nishio, Kazuto


    Hepatocyte growth factor (HGF) expression is a poor prognostic factor in various types of cancer. Expression levels of HGF have been reported to be regulated by shorter poly(dA) sequences in the promoter region. In the present study, the poly(dA) mononucleotide tract in various types of human cancer cell lines was examined and compared with the HGF expression levels in those cells. Short deoxyadenosine repeat sequences were detected in five of the 55 cell lines used in the present study. The H69, IM95, CCK-81, Sui73 and H28 cells exhibited a truncated poly(dA) sequence in which the number of poly(dA) repeats was reduced by ≥5 bp. Two of the cell lines exhibited high HGF expression, determined by reverse transcription quantitative polymerase chain reaction and enzyme-linked immunosorbent assay. The CCK-81, Sui73 and H28 cells with shorter poly(dA) sequences exhibited low HGF expression. The cause of the suppression of HGF expression in the CCK-81, Sui73 and H28 cells was clarified by two approaches, suppression by methylation and single nucleotide polymorphisms in the HGF gene. Exposure to 5-Aza-dC, an inhibitor of DNA methyltransferase 1, induced an increased expression of HGF in the CCK-81 cells, but not in the other cells. Single-nucleotide polymorphism (SNP) rs72525097 in intron 1 was detected in the Sui73 and H28 cells. Taken together, it was found that the defect of poly(dA) in the HGF promoter was present in various types of cancer, including lung, stomach, colorectal, pancreas and mesothelioma. The present study proposes the negative regulation mechanisms by methylation and SNP in intron 1 of HGF for HGF expression in cancer cells with short poly(dA).

  1. Nucleotide diversity of a genomic sequence similar to SHATTERPROOF (PvSHP1) in domesticated and wild common bean (Phaseolus vulgaris L.).


    Nanni, L; Bitocchi, E; Bellucci, E; Rossi, M; Rau, D; Attene, G; Gepts, P; Papa, R


    Evolutionary studies in plant and animal breeding are aimed at understanding the structure and organization of genetic variations of species. We have identified and characterized a genomic sequence in Phaseolus vulgaris of 1,200 bp (PvSHP1) that is homologous to SHATTERPROOF-1 (SHP1), a gene involved in control of fruit shattering in Arabidopsis thaliana. The PvSHP1 fragment was mapped to chromosome Pv06 in P. vulgaris and is linked to the flower and seed color gene V. Amplification of the PvSHP1 sequence from the most agronomically important legume species showed a high degree of interspecies diversity in the introns within the Phaseoleae, while the coding region was conserved across distant taxa. Sequencing of the PvSHP1 sequence in a sample of 91 wild and domesticated genotypes that span the geographic distribution of this species in the centers of origin showed that PvSHP1 is highly polymorphic and, therefore, particularly useful to further investigate the origin and domestication history of P. vulgaris. Our data confirm the gene pool structure seen in P. vulgaris along with independent domestication processes in the Andes and Mesoamerica; they provide additional evidence for a single domestication event in Mesoamerica. Moreover, our results support the Mesoamerican origin of this species. Finally, we have developed three indel-spanning markers that will be very useful for bean germplasm characterization, and particularly to trace the distribution of the domesticated Andean and Mesoamerican gene pools.

  2. Development of 65 novel polymorphic cDNA-SSR markers in common vetch (Vicia sativa subsp. sativa) using next generation sequencing.


    Chung, Jong-Wook; Kim, Tae-Sung; Suresh, Sundan; Lee, Sok-Young; Cho, Gyu-Taek


    Vetch (Vicia sativa L.) is one of the most important annual forage legumes in the World due to its multiple uses (i.e., hay, grain, silage and green manure) and high nutritional value. However, detrimental cyanoalanine toxins in its plant parts including seeds and its vulnerability to hard winter conditions are currently reducing the agronomic values of vetch varieties. Moreover, the existence in the public domain of very few genomic resources, especially molecular markers, has further hampered breeding efforts. Polymorphic simple sequence repeat markers from transcript sequences (cDNA; simple sequence repeat [SSR]) were developed for Vicia sativa subsp. sativa. We found 3,811 SSR loci from 31,504 individual sequence reads, and 300 primer pairs were designed and synthesized. In total, 65 primer pairs were found to be consistently scorable when 32 accessions were tested. The numbers of alleles ranged from 2 to 19, frequency of major alleles per locus were 0.27-0.87, the genotype number was 2-19, the overall polymorphism information content (PIC) values were 0.20-0.86, and the observed and expected heterozygosity values were 0.00-0.41 and 0.264-0.852, respectively. These markers provide a useful tool for assessing genetic diversity, population structure, and positional cloning, facilitating vetch breeding programs.

  3. Deep Sequencing-Based Transcriptome Analysis Reveals the Regulatory Mechanism of Bemisia tabaci (Hemiptera: Aleyrodidae) Nymph Parasitized by Encarsia sophia (Hymenoptera: Aphelinidae)

    PubMed Central

    Wang, Ran; Li, Fei; Zhang, Fan; Wang, Su


    The whitefly Bemisia tabaci is a genetically diverse complex with multiple cryptic species, and some are the most destructive invasive pests of many ornamentals and crops worldwide. Encarsia sophia is an autoparasitoid wasp that demonstrated high efficiency as bio-control agent of whiteflies. However, the immune mechanism of B. tabaci parasitization by E. sophia is unknown. In order to investigate immune response of B. tabaci to E. Sophia parasitization, the transcriptome of E. sophia parasitized B. tabaci nymph was sequenced by Illumina sequencing. De novo assembly generated 393,063 unigenes with average length of 616 bp, in which 46,406 unigenes (15.8% of all unigenes) were successfully mapped. Parasitization by E. sophia had significant effects on the transcriptome profile of B. tabaci nymph. A total of 1482 genes were significantly differentially expressed, of which 852 genes were up-regulated and 630 genes were down-regulated. These genes were mainly involved in immune response, development, metabolism and host signaling pathways. At least 52 genes were found to be involved in the host immune response, 33 genes were involved in the development process, and 29 genes were involved in host metabolism. Taken together, the assembled and annotated transcriptome sequences provided a valuable genomic resource for further understanding the molecular mechanism of immune response of B. tabaci parasitization by E. sophia. PMID:27332546

  4. A common class of transcripts with 5′-intron depletion, distinct early coding sequence features, and N1-methyladenosine modification

    PubMed Central

    Cenik, Can; Chua, Hon Nian; Singh, Guramrit; Akef, Abdalla; Snyder, Michael P.; Palazzo, Alexander F.


    Introns are found in 5′ untranslated regions (5′UTRs) for 35% of all human transcripts. These 5′UTR introns are not randomly distributed: Genes that encode secreted, membrane-bound and mitochondrial proteins are less likely to have them. Curiously, transcripts lacking 5′UTR introns tend to harbor specific RNA sequence elements in their early coding regions. To model and understand the connection between coding-region sequence and 5′UTR intron status, we developed a classifier that can predict 5′UTR intron status with >80% accuracy using only sequence features in the early coding region. Thus, the classifier identifies transcripts with 5′ proximal-intron-minus-like-coding regions (“5IM” transcripts). Unexpectedly, we found that the early coding sequence features defining 5IM transcripts are widespread, appearing in 21% of all human RefSeq transcripts. The 5IM class of transcripts is enriched for non-AUG start codons, more extensive secondary structure both preceding the start codon and near the 5′ cap, greater dependence on eIF4E for translation, and association with ER-proximal ribosomes. 5IM transcripts are bound by the exon junction complex (EJC) at noncanonical 5′ proximal positions. Finally, N1-methyladenosines are specifically enriched in the early coding regions of 5IM transcripts. Taken together, our analyses point to the existence of a distinct 5IM class comprising ∼20% of human transcripts. This class is defined by depletion of 5′ proximal introns, presence of specific RNA sequence features associated with low translation efficiency, N1-methyladenosines in the early coding region, and enrichment for noncanonical binding by the EJC. PMID:27994090

  5. Intra-individual internal transcribed spacer 1 (ITS1) and ITS2 ribosomal sequence variation linked with multiple rDNA loci: a case of triploid Atractolytocestus huronensis, the monozoic cestode of common carp.


    Králová-Hromadová, Ivica; Stefka, Jan; Spakulová, Marta; Orosová, Martina; Bombarová, Marta; Hanzelová, Vladimíra; Bazsalovicsová, Eva; Scholz, Tomás


    Complete sequences of the ribosomal internal transcribed spacers (ITS1 and ITS2) and karyological characters of the monozoic (unsegmented) tapeworm Atractolytocestus huronensis Anthony, 1958 (Cestoda: Caryophyllidea) from Slovakia were analysed, revealing considerable intra-genomic variability and triploidy in all analysed specimens. Analysis of 20 sequences of each ITS1 and ITS2 spacer yielded eight and 10 different sequence types, respectively. In individual tapeworms, two to four ITS1 and three to four ITS2 sequence types were found. Divergent intra-genomic ITS copies were mostly induced by nucleotide substitutions and different numbers of short repetitive motifs within the sequence. In addition, triploidy was found to be a common feature of A. huronensis. The karyotype of Slovakian A. huronensis possesses three sets of chromosomes (3n=24, n=4m+3st+1minute chromosome), similar to the previously described triploidy in conspecific tapeworms from North America. Fluorescent in situ hybridisation (FISH) with a ssrDNA probe revealed two distinct rDNA clusters for each homologue of the triplet number 2. To date, A. huronensis is the only cestode species in which intra-individual ITS sequence variants were found in parallel with its triploid nature and multiple rDNA loci. Some of these molecular and genetic features were observed in several other species of basal or nearly basal tapeworms of the orders Caryophyllidea and Diphyllobothriidea, which indicates that the phenomena may be characteristic for evolutionarily lower tapeworms and deserve more attention in future studies.

  6. An internal regulatory element controls troponin I gene expression

    SciTech Connect

    Yutzey, K.E.; Kline, R.L.; Konieczmy, S.F. . Dept. of Biological Sciences)


    During skeletal myogenesis, approximately 20 contractile proteins and related gene products temporally accumulate as the cells fuse to form multinucleated muscle fibers. In most instances, the contractile protein genes are regulated transcriptionally, which suggests that a common molecular mechanism may coordinate the expression of this diverse and evolutionarily unrelated gene set. Recent studies have examined the muscle-specific cis-acting elements associated with numerous contractile protein genes. All of the identified regulatory elements are positioned in the 5'-flanking regions, usually within 1,500 base pairs of the transcription start site. Surprisingly, a DNA consensus sequence that is common to each contractile protein gene has not been identified. In contrast to the results of these earlier studies, the authors have found that the 5'-flanking region of the quail troponin I (TnI) gene is not sufficient to permit the normal myofiber transcriptional activation of the gene. Instead, the TnI gene utilizes a unique internal regulatory element that is responsible for the correct myofiber-specific expression pattern associated with the TnI gene. This is the first example in which a contractile protein gene has been shown to rely primarily on an internal regulatory element to elicit transcriptional activation during myogenesis. The diversity of regulatory elements associated with the contractile protein genes suggests that the temporal expression of the genes may involve individual cis-trans regulatory components specific for each gene.

  7. A cis-Regulatory Signature for Chordate Anterior Neuroectodermal Genes

    PubMed Central

    Christiaen, Lionel; Joly, Jean-Stéphane


    One of the striking findings of comparative developmental genetics was that expression patterns of core transcription factors are extraordinarily conserved in bilaterians. However, it remains unclear whether cis-regulatory elements of their target genes also exhibit common signatures associated with conserved embryonic fields. To address this question, we focused on genes that are active in the anterior neuroectoderm and non-neural ectoderm of the ascidian Ciona intestinalis. Following the dissection of a prototypic anterior placodal enhancer, we searched all genomic conserved non-coding elements for duplicated motifs around genes showing anterior neuroectodermal expression. Strikingly, we identified an over-represented pentamer motif corresponding to the binding site of the homeodomain protein OTX, which plays a pivotal role in the anterior development of all bilaterian species. Using an in vivo reporter gene assay, we observed that 10 of 23 candidate cis-regulatory elements containing duplicated OTX motifs are active in the anterior neuroectoderm, thus showing that this cis-regulatory signature is predictive of neuroectodermal enhancers. These results show that a common cis-regulatory signature corresponding to K50-Paired homeodomain transcription factors is found in non-coding sequences flanking anterior neuroectodermal genes in chordate embryos. Thus, field-specific selector genes impose architectural constraints in the form of combinations of short tags on their target enhancers. This could account for the strong evolutionary conservation of the regulatory elements controlling field-specific selector genes responsible for body plan formation. PMID:20419150

  8. Suppression of signal sequence defects and azide resistance in Escherichia coli commonly result from the same mutations in secA.


    Huie, J L; Silhavy, T J


    The SecA protein of Escherichia coli is required for protein translocation from the cytoplasm. The complexity of SecA function is reflected by missense mutations in the secA gene that confer several different phenotypes: (i) conditional-lethal alleles cause a generalized block in protein secretion, resulting in the cytoplasmic accumulation of the precursor forms of secreted proteins; (ii) azi alleles confer resistance to azide at concentrations up to 4 mM; and (iii) prlD alleles suppress a number of signal sequence mutations in several different genes. To gain further insights into the role of SecA in protein secretion, we have isolated and characterized a large number of prlD mutations, reasoning that these mutations alter a normal function of wild-type SecA. Our results reveal a striking coincidence of signal sequence suppression and azide resistance: the majority of prlD alleles also confer azide resistance, and all azi alleles tested are suppressors. We suggest that this correlation reflects the mechanism(s) of signal sequence suppression. There are two particularly interesting subclasses of prlD and azi alleles. First, four of the prlD and azi alleles exhibit special properties: (i) as suppressors they are potent enough to allow PrlD (SecA) inactivation by a toxic LacZ fusion protein marked with a signal sequence mutation (suppressor-directed inactivation), (ii) they confer azide resistance, and (iii) they cause modest defects in the secretion of wild-type proteins. Sequence analysis reveals that all four of these alleles alter Tyr-134 in SecA, changing it to Ser, Cys, or Asn. The second subclass consists of seven prlD alleles that confer azide supersensitivity, and sequence analysis reveals that six of these alleles are changes of Ala-507 to Val. Both of the affected amino acids are located within different putative ATP-binding regions of SecA and thus may affect ATPase activities of SecA. We suggest that the four azide-resistant mutations slow an ATPase

  9. Common formin-regulating sequences in Smy1 and Bud14 are required for the control of actin cable assembly in vivo.


    Eskin, Julian A; Rankova, Aneliya; Johnston, Adam B; Alioto, Salvatore L; Goode, Bruce L


    Formins comprise a large family of proteins with diverse roles in remodeling the actin cytoskeleton. However, the spatiotemporal mechanisms used by cells to control formin activities are only beginning to be understood. Here we dissected Smy1, which has dual roles in regulating formins and myosin. Using mutagenesis, we identified specific sequences in Smy1 critical for its in vitro inhibitory effects on the FH2 domain of the formin Bnr1. By integrating smy1 alleles targeting those sequences, we genetically uncoupled Smy1's functions in regulating formins and myosin. Quantitative imaging analysis further demonstrated that the ability of Smy1 to directly control Bnr1 activity is crucial in vivo for proper actin cable length, shape, and velocity and, in turn, efficient secretory vesicle transport. A Smy1-like sequence motif was also identified in a different Bnr1 regulator, Bud14, and found to be essential for Bud14 functions in regulating actin cable architecture and function in vivo. Together these observations reveal unanticipated mechanistic ties between two distinct formin regulators. Further, they emphasize the importance of tightly controlling formin activities in vivo to generate specialized geometries and dynamics of actin structures tailored to their physiological roles.

  10. High density genome wide genotyping-by-sequencing and association identifies common and low frequency SNPs, and novel candidate genes influencing cow milk traits

    PubMed Central

    Ibeagha-Awemu, Eveline M.; Peters, Sunday O.; Akwanji, Kingsley A.; Imumorin, Ikhide G.; Zhao, Xin


    High-throughput sequencing technologies have increased the ability to detect sequence variations for complex trait improvement. A high throughput genome wide genotyping-by-sequencing (GBS) method was used to generate 515,787 single nucleotide polymorphisms (SNPs), from which 76,355 SNPs with call rates >85% and minor allele frequency ≥1.5% were used in genome wide association study (GWAS) of 44 milk traits in 1,246 Canadian Holstein cows. GWAS was accomplished with a mixed linear model procedure implementing the additive and dominant models. A strong signal within the centromeric region of bovine chromosome 14 was associated with test day fat percentage. Several SNPs were associated with eicosapentaenoic acid, docosapentaenoic acid, arachidonic acid, CLA:9c11t and gamma linolenic acid. Most of the significant SNPs for 44 traits studied are novel and located in intergenic regions or introns of genes. Novel potential candidate genes for milk traits or mammary gland functions include ERCC6, TONSL, NPAS2, ACER3, ITGB4, GGT6, ACOX3, MECR, ADAM12, ACHE, LRRC14, FUK, NPRL3, EVL, SLCO3A1, PSMA4, FTO, ADCK5, PP1R16A and TEP1. Our study further demonstrates the utility of the GBS approach for identifying population-specific SNPs for use in improvement of complex dairy traits. PMID:27506634

  11. Heterozygous triplication of upstream regulatory sequences leads to dysregulation of matrix metalloproteinase 19 (MMP19) in patients with cavitary optic disc anomaly (CODA)

    PubMed Central

    Hazlewood, Ralph J.; Roos, Benjamin R.; Solivan-Timpe, Frances; Honkanen, Robert A.; Jampol, Lee M.; Gieser, Stephen C.; Meyer, Kacie J.; Mullins, Robert F.; Kuehn, Markus H.; Scheetz, Todd E.; Kwon, Young H.; Alward, Wallace L.M.; Stone, Edwin M.; Fingert, John H.


    Patients with a congenital optic nerve disease, cavitary optic disc anomaly (CODA), are born with profound excavation of the optic nerve resembling glaucoma. We previously mapped the gene that causes autosomal dominant CODA in a large pedigree to a chromosome 12q locus. Using comparative genomic hybridization and quantitative PCR analysis of this pedigree, we report identifying a 6Kbp heterozygous triplication upstream of the matrix metalloproteinase 19 (MMP19) gene, present in all 17 affected family members and no normal members. Moreover, the triplication was not detected in 78 control subjects or in the Database of Genomic Variants. We further detected the same 6Kbp triplication in 1 of 24 unrelated CODA patients and in none of 172 glaucoma patients. Analysis with a luciferase assay showed that the 6Kbp sequence has transcription enhancer activity. A 773bp fragment of the 6Kbp DNA segment increased downstream gene expression 8-fold, suggesting that triplication of this sequence may lead to dysregulation of the downstream gene, MMP19, in CODA patients. Lastly, immunohistochemical analysis of human donor eyes revealed strong expression of MMP19 in optic nerve head. These data strongly suggest that triplication of an enhancer may lead to overexpression of MMP19 in the optic nerve which causes CODA. PMID:25581579

  12. Sequence and expression of GLN3, a positive nitrogen regulatory gene of Saccharomyces cerevisiae encoding a protein with a putative zinc finger DNA-binding domain.

    PubMed Central

    Minehart, P L; Magasanik, B


    The GLN3 gene of Saccharomyces cerevisiae is required for the activation of transcription of a number of genes in response to the replacement of glutamine by glutamate as source of nitrogen. We cloned the GLN3 gene and constructed null alleles by gene disruption. GLN3 is not essential for growth, but increased copies of GLN3 lead to a drastic decrease in growth rate. The complete nucleotide sequence of the GLN3 gene was determined, revealing one open reading frame encoding a polypeptide of 730 amino acids, with a molecular weight of approximately 80,000. The GLN3 protein contains a single putative Cys2/Cys2 zinc finger which has homology to the Neurospora crassa NIT2 protein, the Aspergillus nidulans AREA protein, and the erythroid-specific transcription factor GATA-1. Immunoprecipitation experiments indicated that the GLN3 protein binds the nitrogen upstream activation sequence of GLN1, the gene encoding glutamine synthetase. Neither control of transcription nor control of initiation of translation of GLN3 is important for regulation in response to glutamine availability. Images PMID:1682800

  13. Multiple ESBL-Producing Escherichia coli Sequence Types Carrying Quinolone and Aminoglycoside Resistance Genes Circulating in Companion and Domestic Farm Animals in Mwanza, Tanzania, Harbor Commonly Occurring Plasmids.


    Seni, Jeremiah; Falgenhauer, Linda; Simeo, Nabina; Mirambo, Mariam M; Imirzalioglu, Can; Matee, Mecky; Rweyemamu, Mark; Chakraborty, Trinad; Mshana, Stephen E


    The increased presence of extended-spectrum beta-lactamase (ESBL)-producing bacteria in humans, animals, and their surrounding environments is of global concern. Currently there is limited information on ESBL presence in rural farming communities worldwide. We performed a cross-sectional study in Mwanza, Tanzania, involving 600 companion and domestic farm animals between August/September 2014. Rectal swab/cloaca specimens were processed to identify ESBL-producing Enterobacteriaceae. We detected 130 (21.7%) animals carrying ESBL-producing bacteria, the highest carriage being among dogs and pigs [39.2% (51/130) and 33.1% (43/130), respectively]. The majority of isolates were Escherichia coli [93.3% (125/134)] and exotic breed type [OR (95%CI) = 2.372 (1.460-3.854), p-value < 0.001] was found to be a predictor of ESBL carriage among animals. Whole-genome sequences of 25 ESBL-producing E. coli were analyzed for phylogenetic relationships using multi-locus sequence typing (MLST) and core genome comparisons. Fourteen different sequence types were detected of which ST617 (7/25), ST2852 (3/25), ST1303 (3/25) were the most abundant. All isolates harbored the bla CTX-M-15 allele, 22/25 carried strA and strB, 12/25 aac(6')-lb-cr, and 11/25 qnrS1. Antibiotic resistance was associated with IncF, IncY, as well as non-typable plasmids. Eleven isolates carried pPGRT46-related plasmids, previously reported from isolates in Nigeria. Five isolates had plasmids exhibiting 85-99% homology to pCA28, previously detected in isolates from the US. Our findings indicate a pan-species distribution of ESBL-producing E. coli clonal groups in farming communities and provide evidence for plasmids harboring antibiotic resistances of regional and international impact.

  14. Microbial regulatory and metabolic networks.


    Cho, Byung-Kwan; Charusanti, Pep; Herrgård, Markus J; Palsson, Bernhard O


    Reconstruction of transcriptional regulatory and metabolic networks is the foundation of large-scale microbial systems and synthetic biology. An enormous amount of information including the annotated genomic sequences and the genomic locations of DNA-binding regulatory proteins can be used to define metabolic and regulatory networks in cells. In particular, advances in experimental methods to map regulatory networks in microbial cells have allowed reliable data-driven reconstruction of these networks. Recent work on metabolic engineering and experimental evolution of microbes highlights the key role of global regulatory networks in controlling specific metabolic processes and the need to consider the integrated function of multiple types of networks for both scientific and engineering purposes.

  15. Evaluating aggregate effects of rare and common variants in the 1000 Genomes Project exon sequencing data using latent variable structural equation modeling.


    Nock, Nl; Zhang, Lx


    Methods that can evaluate aggregate effects of rare and common variants are limited. Therefore, we applied a two-stage approach to evaluate aggregate gene effects in the 1000 Genomes Project data, which contain 24,487 single-nucleotide polymorphisms (SNPs) in 697 unrelated individuals from 7 populations. In stage 1, we identified potentially interesting genes (PIGs) as those having at least one SNP meeting Bonferroni correction using univariate, multiple regression models. In stage 2, we evaluate aggregate PIG effects on trait, Q1, by modeling each gene as a latent construct, which is defined by multiple common and rare variants, using the multivariate statistical framework of structural equation modeling (SEM). In stage 1, we found that PIGs varied markedly between a randomly selected replicate (replicate 137) and 100 other replicates, with the exception of FLT1. In stage 1, collapsing rare variants decreased false positives but increased false negatives. In stage 2, we developed a good-fitting SEM model that included all nine genes simulated to affect Q1 (FLT1, KDR, ARNT, ELAV4, FLT4, HIF1A, HIF3A, VEGFA, VEGFC) and found that FLT1 had the largest effect on Q1 (βstd = 0.33 ± 0.05). Using replicate 137 estimates as population values, we found that the mean relative bias in the parameters (loadings, paths, residuals) and their standard errors across 100 replicates was on average, less than 5%. Our latent variable SEM approach provides a viable framework for modeling aggregate effects of rare and common variants in multiple genes, but more elegant methods are needed in stage 1 to minimize type I and type II error.

  16. Swine Leukocyte Antigen (SLA) class I allele typing of Danish swine herds and identification of commonly occurring haplotypes using sequence specific low and high resolution primers.


    Pedersen, Lasse Eggers; Jungersen, Gregers; Sorensen, Maria Rathmann; Ho, Chak-Sum; Vadekær, Dorte Fink


    The swine major histocompatibility complex (MHC) genomic region (SLA) is extremely polymorphic comprising high numbers of different alleles, many encoding a distinct MHC class I molecule, which binds and presents endogenous peptides to circulating T cells of the immune system. Upon recognition of such peptide-MHC complexes (pMHC) naïve T cells can become activated and respond to a given pathogen leading to its elimination and the generation of memory cells. Hence SLA plays a crucial role in maintaining overall adaptive immunologic resistance to pathogens. Knowing which SLA alleles that are commonly occurring can be of great importance in regard to future vaccine development and the establishment of immune protection in swine through broad coverage, highly specific, subunit based vaccination against viruses such as swine influenza, porcine reproductive and respiratory syndrome virus, vesicular stomatitis virus, foot-and-mouth-disease virus and others. Here we present the use of low- and high-resolution PCR-based typing methods to identify individual and commonly occurring SLA class I alleles in Danish swine. A total of 101 animals from seven different herds were tested, and by low resolution typing the top four most frequent SLA class I alleles were those of the allele groups SLA-3*04XX, SLA-1*08XX, SLA-2*02XX, and SLA-1*07XX, respectively. Customised high resolution primers were used to identify specific alleles within the above mentioned allele groups as well as within the SLA-2*05XX allele group. Our studies also suggest the most common haplotype in Danish pigs to be Lr-4.0 expressing the SLA-1*04XX, SLA-2*04XX, and SLA-3*04XX allele combination.

  17. Common Cold


    ... nose, coughing - everyone knows the symptoms of the common cold. It is probably the most common illness. In ... avoid colds. There is no cure for the common cold. For relief, try Getting plenty of rest Drinking ...

  18. Interstitial telomeric sequences in human chromosomes cluster with common fragile sites, mutagen sensitive sites, viral integration sites, cancer breakpoints, proto-oncogenes and breakpoints involved in primate evolution

    SciTech Connect

    Adekunle, S.S.A.; Wyandt, H.; Mark, H.F.L.


    Recently we mapped the telomeric repeat sequences to 111 interstitial sites in the human genome and to sites of gaps and breaks induced by aphidicolin and sister chromatid exchange sites detected by BrdU. Many of these sites correspond to conserved fragile sites in man, gorilla and chimpazee, to sites of conserved sister chromatid exchange in the mammalian X chromosome, to mutagenic sensitive sites, mapped locations of proto-oncogenes, breakpoints implicated in primate evolution and to breakpoints indicated as the sole anomaly in neoplasia. This observation prompted us to investigate if the interstitial telomeric sites cluster with these sites. An extensive literature search was carried out to find all the available published sites mentioned above. For comparison, we also carried out a statistical analysis of the clustering of the sites of the telomeric repeats with the gene locations where only nucleotide mutations have been observed as the only chromosomal abnormality. Our results indicate that the telomeric repeats cluster most with fragile sites, mutagenic sensitive sites and breakpoints implicated in primate evolution and least with cancer breakpoints, mapped locations of proto-oncogenes and other genes with nucleotide mutations.

  19. The core regulatory network in human cells.


    Kim, Man-Sun; Kim, Dongsan; Kang, Nam Sook; Kim, Jeong-Rae


    In order to discover the common characteristics of various cell types in the human body, many researches have been conducted to find the set of genes commonly expressed in various cell types and tissues. However, the functional characteristics of a cell is determined by the complex regulatory relationships among the genes rather than by expressed genes themselves. Therefore, it is more important to identify and analyze a core regulatory network where all regulatory relationship between genes are active across all cell types to uncover the common features of various cell types. Here, based on hundreds of tissue-specific gene regulatory networks constructed by recent genome-wide experimental data, we constructed the core regulatory network. Interestingly, we found that the core regulatory network is organized by simple cascade and has few complex regulations such as feedback or feed-forward loops. Moreover, we discovered that the regulatory links from genes in the core regulatory network to genes in the peripheral regulatory network are much more abundant than the reverse direction links. These results suggest that the core regulatory network locates at the top of regulatory network and plays a role as a 'hub' in terms of information flow, and the information that is common to all cells can be modified to achieve the tissue-specific characteristics through various types of feedback and feed-forward loops in the peripheral regulatory networks. We also found that the genes in the core regulatory network are evolutionary conserved, essential and non-disease, non-druggable genes compared to the peripheral genes. Overall, our study provides an insight into how all human cells share a common function and generate tissue-specific functional traits by transmitting and processing information through regulatory network.

  20. A root chicory MADS box sequence and the Arabidopsis flowering repressor FLC share common features that suggest conserved function in vernalization and de-vernalization responses.


    Périlleux, Claire; Pieltain, Alexandra; Jacquemin, Guillaume; Bouché, Frédéric; Detry, Nathalie; D'Aloia, Maria; Thiry, Laura; Aljochim, Pierre; Delansnay, Martin; Mathieu, Anne-Sophie; Lutts, Stanley; Tocquin, Pierre


    Root chicory (Cichorium intybus var. sativum) is a biennial crop, but is harvested to obtain root inulin at the end of the first growing season before flowering. However, cold temperatures may vernalize seeds or plantlets, leading to incidental early flowering, and hence understanding the molecular basis of vernalization is important. A MADS box sequence was isolated by RT-PCR and named FLC-LIKE1 (CiFL1) because of its phylogenetic positioning within the same clade as the floral repressor Arabidopsis FLOWERING LOCUS C (AtFLC). Moreover, over-expression of CiFL1 in Arabidopsis caused late flowering and prevented up-regulation of the AtFLC target FLOWERING LOCUS T by photoperiod, suggesting functional conservation between root chicory and Arabidopsis. Like AtFLC in Arabidopsis, CiFL1 was repressed during vernalization of seeds or plantlets of chicory, but repression of CiFL1 was unstable when the post-vernalization temperature was favorable to flowering and when it de-vernalized the plants. This instability of CiFL1 repression may be linked to the bienniality of root chicory compared with the annual lifecycle of Arabidopsis. However, re-activation of AtFLC was also observed in Arabidopsis when a high temperature treatment was used straight after seed vernalization, eliminating the promotive effect of cold on flowering. Cold-induced down-regulation of a MADS box floral repressor and its re-activation by high temperature thus appear to be conserved features of the vernalization and de-vernalization responses in distant species.

  1. Binding of tissue-specific forms of alpha A-CRYBP1 to their regulatory sequence in the mouse alpha A-crystallin-encoding gene: double-label immunoblotting of UV-crosslinked complexes.


    Kantorow, M; Becker, K; Sax, C M; Ozato, K; Piatigorsky, J


    The alpha A-CRYBP1 regulatory sequence (alpha A-CRYBP1RS), at nucleotides -66 to -57 of the mouse alpha A-crystallin-encoding gene (alpha A-CRY) promoter, is an important control element involved in the regulation of mouse alpha A-CRY expression. The gene encoding a protein (alpha A-CRYBP1) that specifically binds to the alpha A-CRYBP1RS sequence has been cloned from a cultured mouse lens cell line. In the present study, we have used an antibody (specific to the alpha A-CRYBP1 protein and made against a synthetic peptide) to directly identify UV-crosslinked protein-DNA complexes via a double-label immunoblotting technique. Multiple alpha A-CRYB1 antigenically related proteins interacted with alpha A-CRYBP1RS in nuclear extracts from both a cloned mouse lens cell line (alpha TN4-1) that expresses alpha A-CRY and a mouse fibroblast line (L929) that does not express the gene. Two sizes (50 kDa and 90 kDa) of proteins reacting with the alpha A-CRYBP1-specific Ab were detected in both cell lines and, in addition, a > 200-kDa protein reacting with the Ab was unique to the fibroblast line. Thus, alpha A-CRYBP1 antigenically related proteins interact with alpha A-CRYBP1RS regardless of alpha A-CRY expression. Moreover, differential processing of the alpha A-CRYBP1 protein and/or alternative splicing of the alpha A-CRY transcript may affect expression of alpha A-CRY.

  2. Accelerated Evolution of Conserved Noncoding Sequences in theHuman Genome

    SciTech Connect

    Prambhakar, Shyam; Noonan, James P.; Paabo, Svante; Rubin, EdwardM.


    Genomic comparisons between human and distant, non-primatemammals are commonly used to identify cis-regulatory elements based onconstrained sequence evolution. However, these methods fail to detect"cryptic" functional elements, which are too weakly conserved amongmammals to distinguish from nonfunctional DNA. To address this problem,we explored the potential of deep intra-primate sequence comparisons. Wesequenced the orthologs of 558 kb of human genomic sequence, coveringmultiple loci involved in cholesterol homeostasis, in 6 nonhumanprimates. Our analysis identified 6 noncoding DNA elements displayingsignificant conservation among primates, but undetectable in more distantcomparisons. In vitro and in vivo tests revealed that at least three ofthese 6 elements have regulatory function. Notably, the mouse orthologsof these three functional human sequences had regulatory activity despitetheir lack of significant sequence conservation, indicating that they arecryptic ancestral cis-regulatory elements. These regulatory elementscould still be detected in a smaller set of three primate speciesincluding human, rhesus and marmoset. Since the human and rhesus genomesequences are already available, and the marmoset genome is activelybeing sequenced, the primate-specific conservation analysis describedhere can be applied in the near future on a whole-genome scale, tocomplement the annotation provided by more distant speciescomparisons.

  3. Phylogenetic relationships of some common Indo-Pacific snappers (Perciformes: Lutjanidae) based on mitochondrial DNA sequences, with comments on the taxonomic position of the Caesioninae.


    Miller, Terrence L; Cribb, Thomas H


    The phylogenetic relationships of 27 species of common Indo-Pacific snappers (Lutjanidae) were explored using the 16S ribosomal RNA and cytochrome b mitochondrial genes with minimum evolution, maximum parsimony, maximum likelihood and Bayesian inference analyses. Included were species representing four subfamilies, the Caesioninae, Etelinae, Paradicichthyinae, and Lutjaninae. Members of the closely related families Haemulidae, Lethrinidae, Nemipteridae and Sparidae, were included for outgroup comparisons and to explore the relationships between the Haemuloidea, Lutjanoidea and Sparoidea. Monophyly of the Lutjanidae was resolved. The Caesioninae was nested within the Lutjaninae, supporting the recent view that the Caesionidae should be treated as a synonym of the Lutjanidae. The subfamilies Etelinae and Paradicichthyinae were resolved as sister taxa to the remainder of the Lutjanidae, which corroborates previous cladistic analyses conducted to determine relationships of lutjanid subfamilies. Bayesian inference and maximum likelihood analyses suggest that Macolor is the sister taxon to the Caesioninae and may represent a transitional form between the Lutjaninae and Caesioninae. Three species of Western Atlantic lutjanids, Lutjanus campechanus, L. synagris, and Rhomboplites aurorubens, were included in the analyses to examine their relationships to Indo-Pacific species; they formed a well-supported clade nested within Pacific lutjanines suggesting that Atlantic species of Lutjaninae are derived from an Indo-Pacific lineage. Results of our molecular phylogenetic analyses are congruent with the general morphology and external colouration of the resolved groups of species of Lutjanus. The "black spot" complex containing L. fulviflamma, L. monostigma, and L. russelli was resolved with strong support, and had L. carponotatus nested within. The morphology of L. carponotatus suggests a close relationship to this group, and the lack of the black spot near the lateral line

  4. Rapid Sequence Evolution of Transcription Factors Controlling Neuron Differentiation in Caenorhabditis

    PubMed Central


    Whether phenotypic evolution proceeds predominantly through changes in regulatory sequences is a controversial issue in evolutionary genetics. Ample evidence indicates that the evolution of gene regulatory networks via changes in cis-regulatory sequences is an important determinant of phenotypic diversity. However, recent experimental work suggests that the role of transcription factor (TF) divergence in developmental evolution may be underestimated. In order to help understand what levels of constraints are acting on the coding sequence of developmental regulatory genes, evolutionary rates were investigated among 48 TFs required for neuronal development in Caenorhabditis elegans. Allelic variation was then sampled for 28 of these genes within a population of the related species Caenorhabditis remanei. Neuronal TFs are more divergent, both within and between species, than structural genes. TFs affecting different neuronal classes are under different levels of selective constraints. The regulatory genes controlling the differentiation of chemosensory neurons evolve particularly fast and exhibit higher levels of within- and between-species nucleotide variation than TFs required for the development of several neuronal classes and TFs required for motorneuron differentiation. The TFs affecting chemosensory neuron development are also more divergent than chemosensory genes expressed in the neurons they differentiate. These results illustrate that TFs are not as highly constrained as commonly thought and suggest that the role of divergence in developmental regulatory genes during the evolution of gene regulatory networks requires further attention. PMID:19589887

  5. Common cold


    ... this page: // Common cold To use the sharing features on this page, please enable JavaScript. The common cold most often causes a runny nose, nasal congestion, ...

  6. The miRNAs and their regulatory networks responsible for pollen abortion in Ogura-CMS Chinese cabbage revealed by high-throughput sequencing of miRNAs, degradomes, and transcriptomes.


    Wei, Xiaochun; Zhang, Xiaohui; Yao, Qiuju; Yuan, Yuxiang; Li, Xixiang; Wei, Fang; Zhao, Yanyan; Zhang, Qiang; Wang, Zhiyong; Jiang, Wusheng; Zhang, Xiaowei


    Chinese cabbage (Brassica rapa ssp. pekinensis) is one of the most important vegetables in Asia and is cultivated across the world. Ogura-type cytoplasmic male sterility (Ogura-CMS) has been widely used in the hybrid breeding industry for Chinese cabbage and many other cruciferous vegetables. Although, the cause of Ogura-CMS has been localized to the orf138 locus in the mitochondrial genome, however, the mechanism by which nuclear genes respond to the mutation of the mitochondrial orf138 locus is unclear. In this study, a series of whole genome small RNA, degradome and transcriptome analyses were performed on both Ogura-CMS and its maintainer Chinese cabbage buds using deep sequencing technology. A total of 289 known miRNAs derived from 69 families (including 23 new families first reported in B. rapa) and 426 novel miRNAs were identified. Among these novel miRNAs, both 3-p and 5-p miRNAs were detected on the hairpin arms of 138 precursors. Ten known and 49 novel miRNAs were down-regulated, while one known and 27 novel miRNAs were up-regulated in Ogura-CMS buds compared to the fertile plants. Using degradome analysis, a total of 376 mRNAs were identified as targets of 30 known miRNA families and 100 novel miRNAs. A large fraction of the targets were annotated as reproductive development related. Our transcriptome profiling revealed that the expression of the targets was finely tuned by the miRNAs. Two novel miRNAs were identified that were specifically highly expressed in Ogura-CMS buds and sufficiently suppressed two pollen development essential genes: sucrose transporter SUC1 and H (+) -ATPase 6. These findings provide clues for the contribution of a potential miRNA regulatory network to bud development and pollen engenderation. This study contributes new insights to the communication between the mitochondria and chromosome and takes one step toward filling the gap in the regulatory network from the orf138 locus to pollen abortion in Ogura-CMS plants from a mi

  7. The miRNAs and their regulatory networks responsible for pollen abortion in Ogura-CMS Chinese cabbage revealed by high-throughput sequencing of miRNAs, degradomes, and transcriptomes

    PubMed Central

    Wei, Xiaochun; Zhang, Xiaohui; Yao, Qiuju; Yuan, Yuxiang; Li, Xixiang; Wei, Fang; Zhao, Yanyan; Zhang, Qiang; Wang, Zhiyong; Jiang, Wusheng; Zhang, Xiaowei


    Chinese cabbage (Brassica rapa ssp. pekinensis) is one of the most important vegetables in Asia and is cultivated across the world. Ogura-type cytoplasmic male sterility (Ogura-CMS) has been widely used in the hybrid breeding industry for Chinese cabbage and many other cruciferous vegetables. Although, the cause of Ogura-CMS has been localized to the orf138 locus in the mitochondrial genome, however, the mechanism by which nuclear genes respond to the mutation of the mitochondrial orf138 locus is unclear. In this study, a series of whole genome small RNA, degradome and transcriptome analyses were performed on both Ogura-CMS and its maintainer Chinese cabbage buds using deep sequencing technology. A total of 289 known miRNAs derived from 69 families (including 23 new families first reported in B. rapa) and 426 novel miRNAs were identified. Among these novel miRNAs, both 3-p and 5-p miRNAs were detected on the hairpin arms of 138 precursors. Ten known and 49 novel miRNAs were down-regulated, while one known and 27 novel miRNAs were up-regulated in Ogura-CMS buds compared to the fertile plants. Using degradome analysis, a total of 376 mRNAs were identified as targets of 30 known miRNA families and 100 novel miRNAs. A large fraction of the targets were annotated as reproductive development related. Our transcriptome profiling revealed that the expression of the targets was finely tuned by the miRNAs. Two novel miRNAs were identified that were specifically highly expressed in Ogura-CMS buds and sufficiently suppressed two pollen development essential genes: sucrose transporter SUC1 and H+-ATPase 6. These findings provide clues for the contribution of a potential miRNA regulatory network to bud development and pollen engenderation. This study contributes new insights to the communication between the mitochondria and chromosome and takes one step toward filling the gap in the regulatory network from the orf138 locus to pollen abortion in Ogura-CMS plants from a mi

  8. Evidence for a common evolutionary rate in metazoan transcriptional networks.


    Carvunis, Anne-Ruxandra; Wang, Tina; Skola, Dylan; Yu, Alice; Chen, Jonathan; Kreisberg, Jason F; Ideker, Trey


    Genome sequences diverge more rapidly in mammals than in other animal lineages, such as birds or insects. However, the effect of this rapid divergence on transcriptional evolution remains unclear. Recent reports have indicated a faster divergence of transcription factor binding in mammals than in insects, but others found the reverse for mRNA expression. Here, we show that these conflicting interpretations resulted from differing methodologies. We performed an integrated analysis of transcriptional network evolution by examining mRNA expression, transcription factor binding and cis-regulatory motifs across >25 animal species, including mammals, birds and insects. Strikingly, we found that transcriptional networks evolve at a common rate across the three animal lineages. Furthermore, differences in rates of genome divergence were greatly reduced when restricting comparisons to chromatin-accessible sequences. The evolution of transcription is thus decoupled from the global rate of genome sequence evolution, suggesting that a small fraction of the genome regulates transcription.

  9. Regulatory Forum.


    Peden, W Michael


    Revision of the International Council for Harmonization (ICH) S1 guidance for rat carcinogenicity studies to be more selective of compounds requiring a 2-year rat carcinogenicity study has been proposed following extensive evaluation of rat carcinogenicity and chronic toxicity studies by industry and drug regulatory authorities. To inform the ICH S1 expert working group in their potential revision of ICH S1, a prospective evaluation study was initiated in 2013, in which sponsors would assess the pharmacologic and toxicologic findings present in the chronic toxicity studies and predict a positive or negative carcinogenicity outcome using a weight of evidence argument (a carcinogenicity assessment document [CAD]). The Scientific and Regulatory Policy Committee was asked by the Society of Toxicology Pathology (STP) executive committee to track these changes with ICH S1 and inform the STP membership of status changes. This commentary is intended to provide a brief summary of recent changes to the CAD guidance and highlight the importance of STP membership participation in the process of CAD submissions.

  10. Expression of the human granulocyte-macrophage colony stimulating factor (hGM-CSF) gene under control of the 5'-regulatory sequence of the goat alpha-S1-casein gene with and without a MAR element in transgenic mice.


    Burkov, I A; Serova, I A; Battulin, N R; Smirnov, A V; Babkin, I V; Andreeva, L E; Dvoryanchikov, G A; Serov, O L


    Expression of the human granulocyte-macrophage colony-stimulating factor (hGM-CSF) gene under the control of the 5'-regulatory sequence of the goat alpha-S1-casein gene with and without a matrix attachment region (MAR) element from the Drosophila histone 1 gene was studied in four and eight transgenic mouse lines, respectively. Of the four transgenic lines carrying the transgene without MAR, three had correct tissues-specific expression of the hGM-CSF gene in the mammary gland only and no signs of cell mosaicism. The concentration of hGM-CSF in the milk of transgenic females varied from 1.9 to 14 μg/ml. One line presented hGM-CSF in the blood serum, indicating ectopic expression. The values of secretion of hGM-CSF in milk of 6 transgenic lines carrying the transgene with MAR varied from 0.05 to 0.7 μg/ml, and two of these did not express hGM-CSF. Three of the four examined animals from lines of this group showed ectopic expression of the hGM-CSF gene, as determined by RT-PCR and immunofluorescence analyses, as well as the presence of hGM-CSF in the blood serum. Mosaic expression of the hGM-CSF gene in mammary epithelial cells was specific to all examined transgenic mice carrying the transgene with MAR but was never observed in the transgenic mice without MAR. The mosaic expression was not dependent on transgene copy number. Thus, the expected "protective or enhancer effect" from the MAR element on the hGM-CSF gene expression was not observed.

  11. Combinatorial Gene Regulatory Functions Underlie Ultraconserved Elements in Drosophila.


    Warnefors, Maria; Hartmann, Britta; Thomsen, Stefan; Alonso, Claudio R


    Ultraconserved elements (UCEs) are discrete genomic elements conserved across large evolutionary distances. Although UCEs have been linked to multiple facets of mammalian gene regulation their extreme evolutionary conservation remains largely unexplained. Here, we apply a computational approach to investigate this question in Drosophila, exploring the molecular functions of more than 1,500 UCEs shared across the genomes of 12 Drosophila species. Our data indicate that Drosophila UCEs are hubs for gene regulatory functions and suggest that UCE sequence invariance originates from their combinatorial roles in gene control. We also note that the gene regulatory roles of intronic and intergenic UCEs (iUCEs) are distinct from those found in exonic UCEs (eUCEs). In iUCEs, transcription factor (TF) and epigenetic factor binding data strongly support iUCE roles in transcriptional and epigenetic regulation. In contrast, analyses of eUCEs indicate that they are two orders of magnitude more likely than the expected to simultaneously include protein-coding sequence, TF-binding sites, splice sites, and RNA editing sites but have reduced roles in transcriptional or epigenetic regulation. Furthermore, we use a Drosophila cell culture system and transgenic Drosophila embryos to validate the notion of UCE combinatorial regulatory roles using an eUCE within the Hox gene Ultrabithorax and show that its protein-coding region also contains alternative splicing regulatory information. Taken together our experiments indicate that UCEs emerge as a result of combinatorial gene regulatory roles and highlight common features in mammalian and insect UCEs implying that similar processes might underlie ultraconservation in diverse animal taxa.

  12. Combinatorial Gene Regulatory Functions Underlie Ultraconserved Elements in Drosophila

    PubMed Central

    Warnefors, Maria; Hartmann, Britta; Thomsen, Stefan; Alonso, Claudio R.


    Ultraconserved elements (UCEs) are discrete genomic elements conserved across large evolutionary distances. Although UCEs have been linked to multiple facets of mammalian gene regulation their extreme evolutionary conservation remains largely unexplained. Here, we apply a computational approach to investigate this question in Drosophila, exploring the molecular functions of more than 1,500 UCEs shared across the genomes of 12 Drosophila species. Our data indicate that Drosophila UCEs are hubs for gene regulatory functions and suggest that UCE sequence invariance originates from their combinatorial roles in gene control. We also note that the gene regulatory roles of intronic and intergenic UCEs (iUCEs) are distinct from those found in exonic UCEs (eUCEs). In iUCEs, transcription factor (TF) and epigenetic factor binding data strongly support iUCE roles in transcriptional and epigenetic regulation. In contrast, analyses of eUCEs indicate that they are two orders of magnitude more likely than the expected to simultaneously include protein-coding sequence, TF-binding sites, splice sites, and RNA editing sites but have reduced roles in transcriptional or epigenetic regulation. Furthermore, we use a Drosophila cell culture system and transgenic Drosophila embryos to validate the notion of UCE combinatorial regulatory roles using an eUCE within the Hox gene Ultrabithorax and show that its protein-coding region also contains alternative splicing regulatory information. Taken together our experiments indicate that UCEs emerge as a result of combinatorial gene regulatory roles and highlight common features in mammalian and insect UCEs implying that similar processes might underlie ultraconservation in diverse animal taxa. PMID:27247329

  13. Clays, common

    USGS Publications Warehouse

    Virta, R.L.


    Part of a special section on the state of industrial minerals in 1997. The state of the common clay industry worldwide for 1997 is discussed. Sales of common clay in the U.S. increased from 26.2 Mt in 1996 to an estimated 26.5 Mt in 1997. The amount of common clay and shale used to produce structural clay products in 1997 was estimated at 13.8 Mt.

  14. A genomic regulatory network for development

    NASA Technical Reports Server (NTRS)

    Davidson, Eric H.; Rast, Jonathan P.; Oliveri, Paola; Ransick, Andrew; Calestani, Cristina; Yuh, Chiou-Hwa; Minokawa, Takuya; Amore, Gabriele; Hinman, Veronica; Arenas-Mena, Cesar; Otim, Ochan; Brown, C. Titus; Livi, Carolina B.; Lee, Pei Yun; Revilla, Roger; Rust, Alistair G.; Pan, Zheng jun; Schilstra, Maria J.; Clarke, Peter J C.; Arnone, Maria I.; Rowen, Lee; Cameron, R. Andrew; McClay, David R.; Hood, Leroy; Bolouri, Hamid


    Development of the body plan is controlled by large networks of regulatory genes. A gene regulatory network that controls the specification of endoderm and mesoderm in the sea urchin embryo is summarized here. The network was derived from large-scale perturbation analyses, in combination with computational methodologies, genomic data, cis-regulatory analysis, and molecular embryology. The network contains over 40 genes at present, and each node can be directly verified at the DNA sequence level by cis-regulatory analysis. Its architecture reveals specific and general aspects of development, such as how given cells generate their ordained fates in the embryo and why the process moves inexorably forward in developmental time.

  15. Regulatory Anatomy

    PubMed Central


    This article proposes the term “safety logics” to understand attempts within the European Union (EU) to harmonize member state legislation to ensure a safe and stable supply of human biological material for transplants and transfusions. With safety logics, I refer to assemblages of discourses, legal documents, technological devices, organizational structures, and work practices aimed at minimizing risk. I use this term to reorient the analytical attention with respect to safety regulation. Instead of evaluating whether safety is achieved, the point is to explore the types of “safety” produced through these logics as well as to consider the sometimes unintended consequences of such safety work. In fact, the EU rules have been giving rise to complaints from practitioners finding the directives problematic and inadequate. In this article, I explore the problems practitioners face and why they arise. In short, I expose the regulatory anatomy of the policy landscape. PMID:26139952

  16. Regulatory Physiology

    NASA Technical Reports Server (NTRS)

    Lane, Helen W.; Whitson, Peggy A.; Putcha, Lakshmi; Baker, Ellen; Smith, Scott M.; Stewart, Karen; Gretebeck, Randall; Nimmagudda, R. R.; Schoeller, Dale A.; Davis-Street, Janis


    As noted elsewhere in this report, a central goal of the Extended Duration Orbiter Medical Project (EDOMP) was to ensure that cardiovascular and muscle function were adequate to perform an emergency egress after 16 days of spaceflight. The goals of the Regulatory Physiology component of the EDOMP were to identify and subsequently ameliorate those biochemical and nutritional factors that deplete physiological reserves or increase risk for disease, and to facilitate the development of effective muscle, exercise, and cardiovascular countermeasures. The component investigations designed to meet these goals focused on biochemical and physiological aspects of nutrition and metabolism, the risk of renal (kidney) stone formation, gastrointestinal function, and sleep in space. Investigations involved both ground-based protocols to validate proposed methods and flight studies to test those methods. Two hardware tests were also completed.

  17. Discovery of regulatory elements is improved by a discriminatory approach.


    Valen, Eivind; Sandelin, Albin; Winther, Ole; Krogh, Anders


    A major goal in post-genome biology is the complete mapping of the gene regulatory networks for every organism. Identification of regulatory elements is a prerequisite for realizing this ambitious goal. A common problem is finding regulatory patterns in promoters of a group of co-expressed genes, but contemporary methods are challenged by the size and diversity of regulatory regions in higher metazoans. Two key issues are the small amount of information contained in a pattern compared to the large promoter regions and the repetitive characteristics of genomic DNA, which both lead to "pattern drowning". We present a new computational method for identifying transcription factor binding sites in promoters using a discriminatory approach with a large negative set encompassing a significant sample of the promoters from the relevant genome. The sequences are described by a probabilistic model and the most discriminatory motifs are identified by maximizing the probability of the sets given the motif model and prior probabilities of motif occurrences in both sets. Due to the large number of promoters in the negative set, an enhanced suffix array is used to improve speed and performance. Using our method, we demonstrate higher accuracy than the best of contemporary methods, high robustness when extending the length of the input sequences and a strong correlation between our objective function and the correct solution. Using a large background set of real promoters instead of a simplified model leads to higher discriminatory power and markedly reduces the need for repeat masking; a common pre-processing step for other pattern finders.

  18. Student Commons

    ERIC Educational Resources Information Center

    Gordon, Douglas


    Student commons are no longer simply congregation spaces for students with time on their hands. They are integral to providing a welcoming environment and effective learning space for students. Many student commons have been transformed into spaces for socialization, an environment for alternative teaching methods, a forum for large group meetings…

  19. Specific sequences commonly found in the V3 domain of HIV-1 subtype C isolates affect the overall conformation of native Env and induce a neutralization-resistant phenotype independent of V1/V2 masking.


    Salomon, Aidy; Krachmarov, Chavdar; Lai, Zhong; Honnen, William; Zingman, Barry S; Sarlo, Julie; Gorny, Miroslaw K; Zolla-Pazner, Susan; Robinson, James E; Pinter, Abraham


    Primary HIV-1 isolates are relatively resistant to neutralization by antibodies commonly induced after infection or vaccination. This is generally attributed to masking of sensitive epitopes by the V1/V2 domain and/or glycans situated at various positions in Env. Here we identified a novel masking effect mediated by subtype C-specific V3 sequences that contributes to the V1/V2-independent and glycan-independent neutralization resistance of chimeric and primary Envs to antibodies directed against multiple neutralization domains. Positions at several conserved charged and hydrophobic sites in the V3 crown and stem were also shown to affect neutralization phenotype. These results indicated that substitutions typically present in subtype C and related V3 sequences influence the overall conformation of native Env in a way that occludes multiple neutralization targets located both within and outside of the V3 domain, and may reflect an alternative mechanism for neutralization resistance that is particularly active in subtype C and related isolates.

  20. Common File Formats.


    Mills, Lauren


    An overview of the many file formats commonly used in bioinformatics and genome sequence analysis is presented, including various data file formats, alignment file formats, and annotation file formats. Example workflows illustrate how some of the different file types are typically used.

  1. Common-Cause Failure Analysis in Event Assessment

    SciTech Connect

    Dana L. Kelly; Dale M. Rasmuson


    This paper describes the approach taken by the U. S. Nuclear Regulatory Commission to the treatment of common-cause failure in probabilistic risk assessment of operational events. The approach is based upon the Basic Parameter Model for common-cause failure, and examples are illustrated using the alpha-factor parameterization, the approach adopted by the NRC in their Standardized Plant Analysis Risk (SPAR) models. The cases of a failed component (with and without shared common-cause failure potential) and a component being unavailable due to preventive maintenance or testing are addressed. The treatment of two related failure modes (e.g., failure to start and failure to run) is a new feature of this paper. These methods are being applied by the NRC in assessing the risk significance of operational events for the Significance Determination Process (SDP) and the Accident Sequence Precursor (ASP) program.

  2. Sequence analysis of chromatin immunoprecipitation data for transcription factors

    PubMed Central

    Fraenkel, Ernest


    Chromatin immunoprecipitation (ChIP) experiments allow the location of transcription factors to be determined across the genome. Subsequent analysis of the sequences of the identified regions allows binding to be localized at a higher resolution than can be achieved by current high-throughput experiments without sequence analysis, and may provide important insight into the regulatory programs enacted by the protein of interest. In this chapter we review the tools, workflow, and common pitfalls of such analyses, and recommend strategies for effective motif discovery from these data. PMID:20827592

  3. 47 CFR 69.727 - Regulatory relief.

    Code of Federal Regulations, 2011 CFR


    ... 47 Telecommunication 3 2011-10-01 2011-10-01 false Regulatory relief. 69.727 Section 69.727 Telecommunication FEDERAL COMMUNICATIONS COMMISSION (CONTINUED) COMMON CARRIER SERVICES (CONTINUED) ACCESS CHARGES Pricing Flexibility § 69.727 Regulatory relief. (a) Phase I relief. Upon satisfaction of the Phase...

  4. 47 CFR 69.727 - Regulatory relief.

    Code of Federal Regulations, 2014 CFR


    ... 47 Telecommunication 3 2014-10-01 2014-10-01 false Regulatory relief. 69.727 Section 69.727 Telecommunication FEDERAL COMMUNICATIONS COMMISSION (CONTINUED) COMMON CARRIER SERVICES (CONTINUED) ACCESS CHARGES Pricing Flexibility § 69.727 Regulatory relief. (a) Phase I relief. Upon satisfaction of the Phase...

  5. 47 CFR 69.727 - Regulatory relief.

    Code of Federal Regulations, 2012 CFR


    ... 47 Telecommunication 3 2012-10-01 2012-10-01 false Regulatory relief. 69.727 Section 69.727 Telecommunication FEDERAL COMMUNICATIONS COMMISSION (CONTINUED) COMMON CARRIER SERVICES (CONTINUED) ACCESS CHARGES Pricing Flexibility § 69.727 Regulatory relief. (a) Phase I relief. Upon satisfaction of the Phase...

  6. 47 CFR 69.727 - Regulatory relief.

    Code of Federal Regulations, 2013 CFR


    ... 47 Telecommunication 3 2013-10-01 2013-10-01 false Regulatory relief. 69.727 Section 69.727 Telecommunication FEDERAL COMMUNICATIONS COMMISSION (CONTINUED) COMMON CARRIER SERVICES (CONTINUED) ACCESS CHARGES Pricing Flexibility § 69.727 Regulatory relief. (a) Phase I relief. Upon satisfaction of the Phase...

  7. Qualitative de novo analysis of full length cDNA and quantitative analysis of gene expression for common marmoset (Callithrix jacchus) transcriptomes using parallel long-read technology and short-read sequencing.


    Shimizu, Makiko; Iwano, Shunsuke; Uno, Yasuhiro; Uehara, Shotaro; Inoue, Takashi; Murayama, Norie; Onodera, Jun; Sasaki, Erika; Yamazaki, Hiroshi


    The common marmoset (Callithrix jacchus) is a non-human primate that could prove useful as human pharmacokinetic and biomedical research models. The cytochromes P450 (P450s) are a superfamily of enzymes that have critical roles in drug metabolism and disposition via monooxygenation of a broad range of xenobiotics; however, information on some marmoset P450s is currently limited. Therefore, identification and quantitative analysis of tissue-specific mRNA transcripts, including those of P450s and flavin-containing monooxygenases (FMO, another monooxygenase family), need to be carried out in detail before the marmoset can be used as an animal model in drug development. De novo assembly and expression analysis of marmoset transcripts were conducted with pooled liver, intestine, kidney, and brain samples from three male and three female marmosets. After unique sequences were automatically aligned by assembling software, the mean contig length was 718 bp (with a standard deviation of 457 bp) among a total of 47,883 transcripts. Approximately 30% of the total transcripts were matched to known marmoset sequences. Gene expression in 18 marmoset P450- and 4 FMO-like genes displayed some tissue-specific patterns. Of these, the three most highly expressed in marmoset liver were P450 2D-, 2E-, and 3A-like genes. In extrahepatic tissues, including brain, gene expressions of these monooxygenases were lower than those in liver, although P450 3A4 (previously P450 3A21) in intestine and P450 4A11- and FMO1-like genes in kidney were relatively highly expressed. By means of massive parallel long-read sequencing and short-read technology applied to marmoset liver, intestine, kidney, and brain, the combined next-generation sequencing analyses reported here were able to identify novel marmoset drug-metabolizing P450 transcripts that have until now been little reported. These results provide a foundation for mechanistic studies and pave the way for the use of marmosets as model animals

  8. Qualitative De Novo Analysis of Full Length cDNA and Quantitative Analysis of Gene Expression for Common Marmoset (Callithrix jacchus) Transcriptomes Using Parallel Long-Read Technology and Short-Read Sequencing

    PubMed Central

    Uno, Yasuhiro; Uehara, Shotaro; Inoue, Takashi; Murayama, Norie; Onodera, Jun; Sasaki, Erika; Yamazaki, Hiroshi


    The common marmoset (Callithrix jacchus) is a non-human primate that could prove useful as human pharmacokinetic and biomedical research models. The cytochromes P450 (P450s) are a superfamily of enzymes that have critical roles in drug metabolism and disposition via monooxygenation of a broad range of xenobiotics; however, information on some marmoset P450s is currently limited. Therefore, identification and quantitative analysis of tissue-specific mRNA transcripts, including those of P450s and flavin-containing monooxygenases (FMO, another monooxygenase family), need to be carried out in detail before the marmoset can be used as an animal model in drug development. De novo assembly and expression analysis of marmoset transcripts were conducted with pooled liver, intestine, kidney, and brain samples from three male and three female marmosets. After unique sequences were automatically aligned by assembling software, the mean contig length was 718 bp (with a standard deviation of 457 bp) among a total of 47,883 transcripts. Approximately 30% of the total transcripts were matched to known marmoset sequences. Gene expression in 18 marmoset P450- and 4 FMO-like genes displayed some tissue-specific patterns. Of these, the three most highly expressed in marmoset liver were P450 2D-, 2E-, and 3A-like genes. In extrahepatic tissues, including brain, gene expressions of these monooxygenases were lower than those in liver, although P450 3A4 (previously P450 3A21) in intestine and P450 4A11- and FMO1-like genes in kidney were relatively highly expressed. By means of massive parallel long-read sequencing and short-read technology applied to marmoset liver, intestine, kidney, and brain, the combined next-generation sequencing analyses reported here were able to identify novel marmoset drug-metabolizing P450 transcripts that have until now been little reported. These results provide a foundation for mechanistic studies and pave the way for the use of marmosets as model animals

  9. LOESS correction for length variation in gene set-based genomic sequence analysis

    PubMed Central

    Aboukhalil, Anton; Bulyk, Martha L.


    Motivation: Sequence analysis algorithms are often applied to sets of DNA, RNA or protein sequences to identify common or distinguishing features. Controlling for sequence length variation is critical to properly score sequence features and identify true biological signals rather than length-dependent artifacts. Results: Several cis-regulatory module discovery algorithms exhibit a substantial dependence between DNA sequence score and sequence length. Our newly developed LOESS method is flexible in capturing diverse score-length relationships and is more effective in correcting DNA sequence scores for length-dependent artifacts, compared with four other approaches. Application of this method to genes co-expressed during Drosophila melanogaster embryonic mesoderm development or neural development scored by the Lever motif analysis algorithm resulted in successful recovery of their biologically validated cis-regulatory codes. The LOESS length-correction method is broadly applicable, and may be useful not only for more accurate inference of cis-regulatory codes, but also for detection of other types of patterns in biological sequences. Availability: Source code and compiled code are available from Contact: Supplementary information: Supplementary data are available at Bioinformatics online. PMID:22492312

  10. QCI Common

    SciTech Connect

    McCaskey, Alexander J.


    There are many common software patterns and utilities for the ORNL Quantum Computing Institute that can and should be shared across projects. Otherwise we find duplication of code which adds unwanted complexity. This is a software product seeks to alleviate this by providing common utilities such as object factories, graph data structures, parameter input mechanisms, etc., for other software products within the ORNL Quantum Computing Institute. This work enables pure basic research, has no export controlled utilities, and has no real commercial value.

  11. Evolutionary conservation of the eumetazoan gene regulatory landscape

    PubMed Central

    Schwaiger, Michaela; Schönauer, Anna; Rendeiro, André F.; Pribitzer, Carina; Schauer, Alexandra; Gilles, Anna F.; Schinko, Johannes B.; Renfer, Eduard; Fredman, David; Technau, Ulrich


    Despite considerable differences in morphology and complexity of body plans among animals, a great part of the gene set is shared among Bilateria and their basally branching sister group, the Cnidaria. This suggests that the common ancestor of eumetazoans already had a highly complex gene repertoire. At present it is therefore unclear how morphological diversification is encoded in the genome. Here we address the possibility that differences in gene regulation could contribute to the large morphological divergence between cnidarians and bilaterians. To this end, we generated the first genome-wide map of gene regulatory elements in a nonbilaterian animal, the sea anemone Nematostella vectensis. Using chromatin immunoprecipitation followed by deep sequencing of five chromatin modifications and a transcriptional cofactor, we identified over 5000 enhancers in the Nematostella genome and could validate 75% of the tested enhancers in vivo. We found that in Nematostella, but not in yeast, enhancers are characterized by the same combination of histone modifications as in bilaterians, and these enhancers preferentially target developmental regulatory genes. Surprisingly, the distribution and abundance of gene regulatory elements relative to these genes are shared between Nematostella and bilaterian model organisms. Our results suggest that complex gene regulation originated at least 600 million yr ago, predating the common ancestor of eumetazoans. PMID:24642862

  12. RNA Sequencing Analysis of the msl2msl3, crl, and ggps1 Mutants Indicates that Diverse Sources of Plastid Dysfunction Do Not Alter Leaf Morphology Through a Common Signaling Pathway

    PubMed Central

    Luesse, Darron R.; Wilson, Margaret E.; Haswell, Elizabeth S.


    Determining whether individual genes function in the same or in different pathways is an important aspect of genetic analysis. As an alternative to the construction of higher-order mutants, we used contemporary expression profiling methods to perform pathway analysis on several Arabidopsis thaliana mutants, including the mscS-like (msl)2msl3 double mutant. MSL2 and MSL3 are implicated in plastid ion homeostasis, and msl2msl3 double mutants exhibit leaves with a lobed periphery, a rumpled surface, and disturbed mesophyll cell organization. Similar developmental phenotypes are also observed in other mutants with defects in a range of other chloroplast or mitochondrial functions, including biogenesis, gene expression, and metabolism. We wished to test the hypothesis that the common leaf morphology phenotypes of these mutants are the result of a characteristic nuclear expression pattern that is generated in response to organelle dysfunction. RNA-Sequencing was performed on aerial tissue of msl2msl3 geranylgeranyl diphosphate synthase 1 (ggps1), and crumpled leaf (crl) mutants. While large groups of co-expressed genes were identified in pairwise comparisons between genotypes, we were only able to identify a small set of genes that showed similar expression profiles in all three genotypes. Subsequent comparison to the previously published gene expression profiles of two other mutants, yellow variegated 2 (var2) and scabra3 (sca3), failed to reveal a common pattern of gene expression associated with superficially similar leaf morphology defects. Nor did we observe overlap between genes differentially expressed in msl2msl3, crl, and ggps1 and a previously identified retrograde core response module. These data suggest that a common retrograde signaling pathway initiated by organelle dysfunction either does not exist in these mutants or cannot be identified through transcriptomic methods. Instead, the leaf developmental defects observed in these mutants may be achieved

  13. RNA Sequencing Analysis of the msl2msl3, crl, and ggps1 Mutants Indicates that Diverse Sources of Plastid Dysfunction Do Not Alter Leaf Morphology Through a Common Signaling Pathway.


    Luesse, Darron R; Wilson, Margaret E; Haswell, Elizabeth S


    Determining whether individual genes function in the same or in different pathways is an important aspect of genetic analysis. As an alternative to the construction of higher-order mutants, we used contemporary expression profiling methods to perform pathway analysis on several Arabidopsis thaliana mutants, including the mscS-like (msl)2msl3 double mutant. MSL2 and MSL3 are implicated in plastid ion homeostasis, and msl2msl3 double mutants exhibit leaves with a lobed periphery, a rumpled surface, and disturbed mesophyll cell organization. Similar developmental phenotypes are also observed in other mutants with defects in a range of other chloroplast or mitochondrial functions, including biogenesis, gene expression, and metabolism. We wished to test the hypothesis that the common leaf morphology phenotypes of these mutants are the result of a characteristic nuclear expression pattern that is generated in response to organelle dysfunction. RNA-Sequencing was performed on aerial tissue of msl2msl3 geranylgeranyl diphosphate synthase 1 (ggps1), and crumpled leaf (crl) mutants. While large groups of co-expressed genes were identified in pairwise comparisons between genotypes, we were only able to identify a small set of genes that showed similar expression profiles in all three genotypes. Subsequent comparison to the previously published gene expression profiles of two other mutants, yellow variegated 2 (var2) and scabra3 (sca3), failed to reveal a common pattern of gene expression associated with superficially similar leaf morphology defects. Nor did we observe overlap between genes differentially expressed in msl2msl3, crl, and ggps1 and a previously identified retrograde core response module. These data suggest that a common retrograde signaling pathway initiated by organelle dysfunction either does not exist in these mutants or cannot be identified through transcriptomic methods. Instead, the leaf developmental defects observed in these mutants may be achieved

  14. The limits of regulatory toxicology

    SciTech Connect

    Carrington, Clark D.; Bolger, P. Michael


    The Acceptable Daily Intake (ADI) has been used by regulatory and public health organizations (e.g., the U.S. Food and Drug and Administration, and the World Health Organization) for chemicals for more than 50 years. The ADI concept was also initially employed at the U.S. Environmental Protection Agency at its inception in 1971, although with the adoption of newer terminology, it later became known as the Reference Dose (RfD). It is clear from the literature that both were first devised as instruments of regulatory policy. In the intervening years, it has become common to use language that implies that these standards are statements of scientific fact. Similarly, some of the discretionary or default values that are used to derive regulatory standards are represented as scientific assumptions when in fact they also represent regulatory policy. This confusion impedes both the best use of the available science and informed public participation in policy making. In addition, the misconception of the ADI or the RfD as statements of scientific fact may impede the consideration of alternative means to reduce exposure to chemicals that may be harmful, including regulatory measures that do not involve prescribing a regulatory concentration limit.

  15. Discovering cis-Regulatory RNAs in Shewanella Genomes by Support Vector Machines

    PubMed Central

    Xu, Xing; Ji, Yongmei; Stormo, Gary D.


    An increasing number of cis-regulatory RNA elements have been found to regulate gene expression post-transcriptionally in various biological processes in bacterial systems. Effective computational tools for large-scale identification of novel regulatory RNAs are strongly desired to facilitate our exploration of gene regulation mechanisms and regulatory networks. We present a new computational program named RSSVM (RNA Sampler+Support Vector Machine), which employs Support Vector Machines (SVMs) for efficient identification of functional RNA motifs from random RNA secondary structures. RSSVM uses a set of distinctive features to represent the common RNA secondary structure and structural alignment predicted by RNA Sampler, a tool for accurate common RNA secondary structure prediction, and is trained with functional RNAs from a variety of bacterial RNA motif/gene families covering a wide range of sequence identities. When tested on a large number of known and random RNA motifs, RSSVM shows a significantly higher sensitivity than other leading RNA identification programs while maintaining the same false positive rate. RSSVM performs particularly well on sets with low sequence identities. The combination of RNA Sampler and RSSVM provides a new, fast, and efficient pipeline for large-scale discovery of regulatory RNA motifs. We applied RSSVM to multiple Shewanella genomes and identified putative regulatory RNA motifs in the 5′ untranslated regions (UTRs) in S. oneidensis, an important bacterial organism with extraordinary respiratory and metal reducing abilities and great potential for bioremediation and alternative energy generation. From 1002 sets of 5′-UTRs of orthologous operons, we identified 166 putative regulatory RNA motifs, including 17 of the 19 known RNA motifs from Rfam, an additional 21 RNA motifs that are supported by literature evidence, 72 RNA motifs overlapping predicted transcription terminators or attenuators, and other candidate regulatory RNA

  16. Plant nitrogen regulatory P-PII genes


    Coruzzi, Gloria M.; Lam, Hon-Ming; Hsieh, Ming-Hsiun


    The present invention generally relates to plant nitrogen regulatory PII gene (hereinafter P-PII gene), a gene involved in regulating plant nitrogen metabolism. The invention provides P-PII nucleotide sequences, expression constructs comprising said nucleotide sequences, and host cells and plants having said constructs and, optionally expressing the P-PII gene from said constructs. The invention also provides substantially pure P-PII proteins. The P-PII nucleotide sequences and constructs of the

  17. An arthropod cis-regulatory element functioning in sensory organ precursor development dates back to the Cambrian

    PubMed Central


    Background An increasing number of publications demonstrate conservation of function of cis-regulatory elements without sequence similarity. In invertebrates such functional conservation has only been shown for closely related species. Here we demonstrate the existence of an ancient arthropod regulatory element that functions during the selection of neural precursors. The activity of genes of the achaete-scute (ac-sc) family endows cells with neural potential. An essential, conserved characteristic of proneural genes is their ability to restrict their own activity to single or a small number of progenitor cells from their initially broad domains of expression. This is achieved through a process called lateral inhibition. A regulatory element, the sensory organ precursor enhancer (SOPE), is required for this process. First identified in Drosophila, the SOPE contains discrete binding sites for four regulatory factors. The SOPE of the Drosophila asense gene is situated in the 5' UTR. Results Through a manual comparison of consensus binding site sequences we have been able to identify a SOPE in UTR sequences of asense-like genes in species belonging to all four arthropod groups (Crustacea, Myriapoda, Chelicerata and Insecta). The SOPEs of the spider Cupiennius salei and the insect Tribolium castaneum are shown to be functional in transgenic Drosophila. This would place the origin of this regulatory sequence as far back as the last common ancestor of the Arthropoda, that is, in the Cambrian, 550 million years ago. Conclusions The SOPE is not detectable by inter-specific sequence comparison, raising the possibility that other ancient regulatory modules in invertebrates might have escaped detection. PMID:20868489

  18. 10 CFR 50.40 - Common standards.

    Code of Federal Regulations, 2010 CFR


    ... 10 Energy 1 2010-01-01 2010-01-01 false Common standards. 50.40 Section 50.40 Energy NUCLEAR..., Certifications, and Regulatory Approvals § 50.40 Common standards. In determining that a construction permit or..., in the opinion of the Commission, be inimical to the common defense and security or to the health...

  19. 18 CFR 357.1 - Common carriers.

    Code of Federal Regulations, 2010 CFR


    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Common carriers. 357.1 Section 357.1 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY COMMISSION, DEPARTMENT... SUBJECT TO PART I OF THE INTERSTATE COMMERCE ACT § 357.1 Common carriers. All common carriers by...

  20. High regulatory gene use in sea urchin embryogenesis: Implications for bilaterian development and evolution.


    Howard-Ashby, Meredith; Materna, Stefan C; Brown, C Titus; Tu, Qiang; Oliveri, Paola; Cameron, R Andrew; Davidson, Eric H


    A global scan of transcription factor usage in the sea urchin embryo was carried out in the context of the Strongylocentrotus purpuratus genome sequencing project, and results from six individual studies are here considered. Transcript prevalence data were obtained for over 280 regulatory genes encoding sequence-specific transcription factors of every known family, but excluding genes encoding zinc finger proteins. This is a statistically inclusive proxy for the total "regulome" of the sea urchin genome. Close to 80% of the regulome is expressed at significant levels by the late gastrula stage. Most regulatory genes must be used repeatedly for different functions as development progresses. An evolutionary implication is that animal complexity at the stage when the regulome first evolved was far simpler than even the last common bilaterian ancestor, and is thus of deep antiquity.

  1. Stochastic Models for Common Failures of Components.

    DTIC Science & Technology


    common cause model, NUREG /CR-1401, 1980. [3] Church, J. D. and Harris, B., The estimation of reliability from stress- strength relationship...Fachband 2/1, 1980. [11] Lewis, H. W., Chairman, Risk Assessment Review Group Report to the U. S. Nuclear Regulatory Commission, NUREG /CR-0400, 1978. [12...Regulatory Commission, P.R.A. Procedures Guide, NUREG / CR-2300, 1983. [18] Vesely, W. E., Estimating Common Cause Failure Probabilities in Reliability and

  2. The Regulatory Plan

    Federal Register 2010, 2011, 2012, 2013, 2014


    ... [The Regulatory Plan and Unified Agenda of Federal Regulatory and Deregulatory Actions] #7; #7; The Regulatory Plan #7; #7; ] OPEN GOVERNMENT AND EVIDENCE-BASED REGULATION There is a close connection, even an inextricable relationship, between open government and evidence- based regulation. If regulatory choices are based on careful analysis of...

  3. Conserved Noncoding Sequences in the Grasses4

    PubMed Central

    Inada, Dan Choffnes; Bashir, Ali; Lee, Chunghau; Thomas, Brian C.; Ko, Cynthia; Goff, Stephen A.; Freeling, Michael


    As orthologous genes from related species diverge over time, some sequences are conserved in noncoding regions. In mammals, large phylogenetic footprints, or conserved noncoding sequences (CNSs), are known to be common features of genes. Here we present the first large-scale analysis of plant genes for CNSs. We used maize and rice, maximally diverged members of the grass family of monocots. Using a local sequence alignment set to deliver only significant alignments, we found one or more CNSs in the noncoding regions of the majority of genes studied. Grass genes have dramatically fewer and much smaller CNSs than mammalian genes. Twenty-seven percent of grass gene comparisons revealed no CNSs. Genes functioning in upstream regulatory roles, such as transcription factors, are greatly enriched for CNSs relative to genes encoding enzymes or structural proteins. Further, we show that a CNS cluster in an intron of the knotted1 homeobox gene serves as a site of negative regulation. We showthat CNSs in the adh1 gene do not correlate with known cis-acting sites. We discuss the potential meanings of CNSs and their value as analytical tools and evolutionary characters. We advance the idea that many CNSs function to lock-in gene regulatory decisions. PMID:12952874

  4. Making the Common Good Common

    ERIC Educational Resources Information Center

    Chase, Barbara


    How are independent schools to be useful to the wider world? Beyond their common commitment to educate their students for meaningful lives in service of the greater good, can they educate a broader constituency and, thus, share their resources and skills more broadly? Their answers to this question will be shaped by their independence. Any…

  5. Pleasure: the common currency.


    Cabanac, M


    At present as physiologists studying various homeostatic behaviors, such as thermoregulatory behavior and food and fluid intake, we have no common currency that allows us to equate the strength of the motivational drive that accompanies each regulatory need, in terms of how an animal or a person will choose to satisfy his needs when there is a conflict between two or more of them. Yet the behaving organism must rank his priorities and needs a common currency to achieve the ranking (McFarland & Sibly, 1975, Phil. Trans. R. Soc. Lond. 270 Biol 265-293). A theory is proposed here according to which pleasure is this common currency. The perception of pleasure, as measured operationally and quantitatively by choice behavior (in the case of animals), or by the rating of the intensity of pleasure or displeasure (in the case of humans) can serve as such a common currency. The tradeoffs between various motivations would thus be accomplished by simple maximization of pleasure. In what follows, the scientific work arising recently on this subject, with be reviewed briefly and our recent experimental findings will be presented. This will serve as the support for the theoretical position formulated in this essay.

  6. Recognizing Sequences of Sequences

    PubMed Central

    Kiebel, Stefan J.; von Kriegstein, Katharina; Daunizeau, Jean; Friston, Karl J.


    The brain's decoding of fast sensory streams is currently impossible to emulate, even approximately, with artificial agents. For example, robust speech recognition is relatively easy for humans but exceptionally difficult for artificial speech recognition systems. In this paper, we propose that recognition can be simplified with an internal model of how sensory input is generated, when formulated in a Bayesian framework. We show that a plausible candidate for an internal or generative model is a hierarchy of ‘stable heteroclinic channels’. This model describes continuous dynamics in the environment as a hierarchy of sequences, where slower sequences cause faster sequences. Under this model, online recognition corresponds to the dynamic decoding of causal sequences, giving a representation of the environment with predictive power on several timescales. We illustrate the ensuing decoding or recognition scheme using synthetic sequences of syllables, where syllables are sequences of phonemes and phonemes are sequences of sound-wave modulations. By presenting anomalous stimuli, we find that the resulting recognition dynamics disclose inference at multiple time scales and are reminiscent of neuronal dynamics seen in the real brain. PMID:19680429

  7. The Common Denominator of Learning

    ERIC Educational Resources Information Center

    Feder, Hubert C.


    The common denominator of learning is conceived as a guideline in organizing the learning material in support of learning continuity. As to its effect, the common denominator is thought of as a habit-forming element in realizing learning as a (continuous) sequence of relative rather than absolute experiences. (Author/HB)

  8. Conservation of the sizes of 53 introns and over 100 intronic sequences for the binding of common transcription factors in the human and mouse genes for type II procollagen (COL2A1).

    PubMed Central

    Ala-Kokko, L; Kvist, A P; Metsäranta, M; Kivirikko, K I; de Crombrugghe, B; Prockop, D J; Vuorio, E


    Over 11,000 bp of previously undefined sequences of the human COL2A1 gene were defined. The results made it possible to compare the intron structures of a highly complex gene from man and mouse. Surprisingly, the sizes of the 53 introns of the two genes were highly conserved with a mean difference of 13%. After alignment of the sequences, 69% of the intron sequences were identical. The introns contained consensus sequences for the binding of over 100 different transcription factors that were conserved in the introns of the two genes. The first intron of the gene contained 80 conserved consensus sequences and the remaining 52 introns of the gene contained 106 conserved sequences for the binding of transcription factors. The 5'-end of intron 2 in both genes had a potential for forming a stem loop in RNA transcripts. Images Figure 4 PMID:8948452

  9. A Provisional Gene Regulatory Atlas for Mouse Heart Development

    PubMed Central

    Chen, Hailin; VanBuren, Vincent


    Congenital Heart Disease (CHD) is one of the most common birth defects. Elucidating the molecular mechanisms underlying normal cardiac development is an important step towards early identification of abnormalities during the developmental program and towards the creation of early intervention strategies. We developed a novel computational strategy for leveraging high-content data sets, including a large selection of microarray data associated with mouse cardiac development, mouse genome sequence, ChIP-seq data of selected mouse transcription factors and Y2H data of mouse protein-protein interactions, to infer the active transcriptional regulatory network of mouse cardiac development. We identified phase-specific expression activity for 765 overlapping gene co-expression modules that were defined for obtained cardiac lineage microarray data. For each co-expression module, we identified the phase of cardiac development where gene expression for that module was higher than other phases. Co-expression modules were found to be consistent with biological pathway knowledge in Wikipathways, and met expectations for enrichment of pathways involved in heart lineage development. Over 359,000 transcription factor-target relationships were inferred by analyzing the promoter sequences within each gene module for overrepresentation against the JASPAR database of Transcription Factor Binding Site (TFBS) motifs. The provisional regulatory network will provide a framework of studying the genetic basis of CHD. PMID:24421884

  10. Internationalization of regulatory requirements.


    Juillet, Y


    The aim of harmonisation of medicines regulatory requirements is to allow the patient quicker access to new drugs and to avoid animal and human duplications. Harmonisation in the European Union (EU) is now completed, and has led to the submission of one dossier in one language study leading to European marketing authorizations, thanks in particular to efficacy guidelines published at the European level. With the benefit of the European experience since 1989, more than 40 guidelines have been harmonised amongst the EU, Japan and the USA through the International Conference on Harmonisation (ICH). ICH is a unique process gathering regulators and industry experts from the three regions. Its activity is built on expertise and trust. The Common Technical Document (CTD), an agreed common format for application in the three regions, is a logical follow-up to the ICH first phase harmonising the content of the dossier. The CTD final implementation in July 2003 will have considerable influence on the review process and on the exchange of information in the three regions.

  11. Predicting gene regulatory networks of soybean nodulation from RNA-Seq transcriptome data

    PubMed Central


    Background High-throughput RNA sequencing (RNA-Seq) is a revolutionary technique to study the transcriptome of a cell under various conditions at a systems level. Despite the wide application of RNA-Seq techniques to generate experimental data in the last few years, few computational methods are available to analyze this huge amount of transcription data. The computational methods for constructing gene regulatory networks from RNA-Seq expression data of hundreds or even thousands of genes are particularly lacking and urgently needed. Results We developed an automated bioinformatics method to predict gene regulatory networks from the quantitative expression values of differentially expressed genes based on RNA-Seq transcriptome data of a cell in different stages and conditions, integrating transcriptional, genomic and gene function data. We applied the method to the RNA-Seq transcriptome data generated for soybean root hair cells in three different development stages of nodulation after rhizobium infection. The method predicted a soybean nodulation-related gene regulatory network consisting of 10 regulatory modules common for all three stages, and 24, 49 and 70 modules separately for the first, second and third stage, each containing both a group of co-expressed genes and several transcription factors collaboratively controlling their expression under different conditions. 8 of 10 common regulatory modules were validated by at least two kinds of validations, such as independent DNA binding motif analysis, gene function enrichment test, and previous experimental data in the literature. Conclusions We developed a computational method to reliably reconstruct gene regulatory networks from RNA-Seq transcriptome data. The method can generate valuable hypotheses for interpreting biological data and designing biological experiments such as ChIP-Seq, RNA interference, and yeast two hybrid experiments. PMID:24053776

  12. Spectral sum rules and search for periodicities in DNA sequences

    NASA Astrophysics Data System (ADS)

    Chechetkin, V. R.


    Periodic patterns play the important regulatory and structural roles in genomic DNA sequences. Commonly, the underlying periodicities should be understood in a broad statistical sense, since the corresponding periodic patterns have been strongly distorted by the random point mutations and insertions/deletions during molecular evolution. The latent periodicities in DNA sequences can be efficiently displayed by Fourier transform. The criteria of significance for observed periodicities are obtained via the comparison versus the counterpart characteristics of the reference random sequences. We show that the restrictions imposed on the significance criteria by the rigorous spectral sum rules can be rationally described with De Finetti distribution. This distribution provides the convenient intermediate asymptotic form between Rayleigh distribution and exact combinatoric theory.

  13. Genomics in the land of regulatory science.


    Tong, Weida; Ostroff, Stephen; Blais, Burton; Silva, Primal; Dubuc, Martine; Healy, Marion; Slikker, William


    Genomics science has played a major role in the generation of new knowledge in the basic research arena, and currently question arises as to its potential to support regulatory processes. However, the integration of genomics in the regulatory decision-making process requires rigorous assessment and would benefit from consensus amongst international partners and research communities. To that end, the Global Coalition for Regulatory Science Research (GCRSR) hosted the fourth Global Summit on Regulatory Science (GSRS2014) to discuss the role of genomics in regulatory decision making, with a specific emphasis on applications in food safety and medical product development. Challenges and issues were discussed in the context of developing an international consensus for objective criteria in the analysis, interpretation and reporting of genomics data with an emphasis on transparency, traceability and "fitness for purpose" for the intended application. It was recognized that there is a need for a global path in the establishment of a regulatory bioinformatics framework for the development of transparent, reliable, reproducible and auditable processes in the management of food and medical product safety risks. It was also recognized that training is an important mechanism in achieving internationally consistent outcomes. GSRS2014 provided an effective venue for regulators andresearchers to meet, discuss common issues, and develop collaborations to address the challenges posed by the application of genomics to regulatory science, with the ultimate goal of wisely integrating novel technical innovations into regulatory decision-making.

  14. Common Cause Failure Modeling

    NASA Technical Reports Server (NTRS)

    Hark, Frank; Britton, Paul; Ring, Rob; Novack, Steven D.


    Common Cause Failures (CCFs) are a known and documented phenomenon that defeats system redundancy. CCFS are a set of dependent type of failures that can be caused by: system environments; manufacturing; transportation; storage; maintenance; and assembly, as examples. Since there are many factors that contribute to CCFs, the effects can be reduced, but they are difficult to eliminate entirely. Furthermore, failure databases sometimes fail to differentiate between independent and CCF (dependent) failure and data is limited, especially for launch vehicles. The Probabilistic Risk Assessment (PRA) of NASA's Safety and Mission Assurance Directorate at Marshall Space Flight Center (MFSC) is using generic data from the Nuclear Regulatory Commission's database of common cause failures at nuclear power plants to estimate CCF due to the lack of a more appropriate data source. There remains uncertainty in the actual magnitude of the common cause risk estimates for different systems at this stage of the design. Given the limited data about launch vehicle CCF and that launch vehicles are a highly redundant system by design, it is important to make design decisions to account for a range of values for independent and CCFs. When investigating the design of the one-out-of-two component redundant system for launch vehicles, a response surface was constructed to represent the impact of the independent failure rate versus a common cause beta factor effect on a system's failure probability. This presentation will define a CCF and review estimation calculations. It gives a summary of reduction methodologies and a review of examples of historical CCFs. Finally, it presents the response surface and discusses the results of the different CCFs on the reliability of a one-out-of-two system.

  15. Common Cause Failure Modeling

    NASA Technical Reports Server (NTRS)

    Hark, Frank; Britton, Paul; Ring, Rob; Novack, Steven D.


    Common Cause Failures (CCFs) are a known and documented phenomenon that defeats system redundancy. CCFS are a set of dependent type of failures that can be caused by: system environments; manufacturing; transportation; storage; maintenance; and assembly, as examples. Since there are many factors that contribute to CCFs, the effects can be reduced, but they are difficult to eliminate entirely. Furthermore, failure databases sometimes fail to differentiate between independent and CCF (dependent) failure and data is limited, especially for launch vehicles. The Probabilistic Risk Assessment (PRA) of NASA's Safety and Mission Assurance Directorate at Marshal Space Flight Center (MFSC) is using generic data from the Nuclear Regulatory Commission's database of common cause failures at nuclear power plants to estimate CCF due to the lack of a more appropriate data source. There remains uncertainty in the actual magnitude of the common cause risk estimates for different systems at this stage of the design. Given the limited data about launch vehicle CCF and that launch vehicles are a highly redundant system by design, it is important to make design decisions to account for a range of values for independent and CCFs. When investigating the design of the one-out-of-two component redundant system for launch vehicles, a response surface was constructed to represent the impact of the independent failure rate versus a common cause beta factor effect on a system's failure probability. This presentation will define a CCF and review estimation calculations. It gives a summary of reduction methodologies and a review of examples of historical CCFs. Finally, it presents the response surface and discusses the results of the different CCFs on the reliability of a one-out-of-two system.

  16. The last common bilaterian ancestor

    NASA Technical Reports Server (NTRS)

    Erwin, Douglas H.; Davidson, Eric H.


    Many regulatory genes appear to be utilized in at least superficially similar ways in the development of particular body parts in Drosophila and in chordates. These similarities have been widely interpreted as functional homologies, producing the conventional view of the last common protostome-deuterostome ancestor (PDA) as a complex organism that possessed some of the same body parts as modern bilaterians. Here we discuss an alternative view, in which the last common PDA had a less complex body plan than is frequently conceived. This reconstruction alters expectations for Neoproterozoic fossil remains that could illustrate the pathways of bilaterian evolution.

  17. Biotools: Patenting DNA sequences

    SciTech Connect

    Yablonsky, M.D.; Hone, W.J.


    The decision, known as In re Deuel{sup 2}, rejects the PTO`s interpretation of a previous decision of the Federal Circuit and makes it more possible that a {open_quotes}nucleic acid of a particular sequence{close_quotes} - commonly known as a gene sequence - may be patentable. 15 refs.

  18. Regulatory gene networks and the properties of the developmental process

    NASA Technical Reports Server (NTRS)

    Davidson, Eric H.; McClay, David R.; Hood, Leroy


    Genomic instructions for development are encoded in arrays of regulatory DNA. These specify large networks of interactions among genes producing transcription factors and signaling components. The architecture of such networks both explains and predicts developmental phenomenology. Although network analysis is yet in its early stages, some fundamental commonalities are already emerging. Two such are the use of multigenic feedback loops to ensure the progressivity of developmental regulatory states and the prevalence of repressive regulatory interactions in spatial control processes. Gene regulatory networks make it possible to explain the process of development in causal terms and eventually will enable the redesign of developmental regulatory circuitry to achieve different outcomes.

  19. Advances in sequence analysis.


    Califano, A


    In its early days, the entire field of computational biology revolved almost entirely around biological sequence analysis. Over the past few years, however, a number of new non-sequence-based areas of investigation have become mainstream, from the analysis of gene expression data from microarrays, to whole-genome association discovery, and to the reverse engineering of gene regulatory pathways. Nonetheless, with the completion of private and public efforts to map the human genome, as well as those of other organisms, sequence data continue to be a veritable mother lode of valuable biological information that can be mined in a variety of contexts. Furthermore, the integration of sequence data with a variety of alternative information is providing valuable and fundamentally new insight into biological processes, as well as an array of new computational methodologies for the analysis of biological data.

  20. Target activation by regulatory RNAs in bacteria

    PubMed Central

    Papenfort, Kai; Vanderpool, Carin K.


    Bacterial small regulatory RNAs (sRNAs) are commonly known to repress gene expression by base pairing to target mRNAs. In many cases, sRNAs base pair with and sequester mRNA ribosome-binding sites, resulting in translational repression and accelerated transcript decay. In contrast, a growing number of examples of translational activation and mRNA stabilization by sRNAs have now been documented. A given sRNA often employs a conserved region to interact with and regulate both repressed and activated targets. However, the mechanisms underlying activation differ substantially from repression. Base pairing resulting in target activation can involve sRNA interactions with the 5′ untranslated region (UTR), the coding sequence or the 3′ UTR of the target mRNAs. Frequently, the activities of protein factors such as cellular ribonucleases and the RNA chaperone Hfq are required for activation. Bacterial sRNAs, including those that function as activators, frequently control stress response pathways or virulence-associated functions required for immediate responses to changing environments. This review aims to summarize recent advances in knowledge regarding target mRNA activation by bacterial sRNAs, highlighting the molecular mechanisms and biological relevance of regulation. PMID:25934124

  1. Realistic artificial DNA sequences as negative controls for computational genomics

    PubMed Central

    Caballero, Juan; Smit, Arian F. A.; Hood, Leroy; Glusman, Gustavo


    A common practice in computational genomic analysis is to use a set of ‘background’ sequences as negative controls for evaluating the false-positive rates of prediction tools, such as gene identification programs and algorithms for detection of cis-regulatory elements. Such ‘background’ sequences are generally taken from regions of the genome presumed to be intergenic, or generated synthetically by ‘shuffling’ real sequences. This last method can lead to underestimation of false-positive rates. We developed a new method for generating artificial sequences that are modeled after real intergenic sequences in terms of composition, complexity and interspersed repeat content. These artificial sequences can serve as an inexhaustible source of high-quality negative controls. We used artificial sequences to evaluate the false-positive rates of a set of programs for detecting interspersed repeats, ab initio prediction of coding genes, transcribed regions and non-coding genes. We found that RepeatMasker is more accurate than PClouds, Augustus has the lowest false-positive rate of the coding gene prediction programs tested, and Infernal has a low false-positive rate for non-coding gene detection. A web service, source code and the models for human and many other species are freely available at PMID:24803667

  2. Conserved cis-regulatory modules in promoters of genes encoding wheat high-molecular-weight glutenin subunits

    PubMed Central

    Ravel, Catherine; Fiquet, Samuel; Boudet, Julie; Dardevet, Mireille; Vincent, Jonathan; Merlino, Marielle; Michard, Robin; Martre, Pierre


    The concentration and composition of the gliadin and glutenin seed storage proteins (SSPs) in wheat flour are the most important determinants of its end-use value. In cereals, the synthesis of SSPs is predominantly regulated at the transcriptional level by a complex network involving at least five cis-elements in gene promoters. The high-molecular-weight glutenin subunits (HMW-GS) are encoded by two tightly linked genes located on the long arms of group 1 chromosomes. Here, we sequenced and annotated the HMW-GS gene promoters of 22 electrophoretic wheat alleles to identify putative cis-regulatory motifs. We focused on 24 motifs known to be involved in SSP gene regulation. Most of them were identified in at least one HMW-GS gene promoter sequence. A common regulatory framework was observed in all the HMW-GS gene promoters, as they shared conserved cis-regulatory modules (CCRMs) including all the five motifs known to regulate the transcription of SSP genes. This common regulatory framework comprises a composite box made of the GATA motifs and GCN4-like Motifs (GLMs) and was shown to be functional as the GLMs are able to bind a bZIP transcriptional factor SPA (Storage Protein Activator). In addition to this regulatory framework, each HMW-GS gene promoter had additional motifs organized differently. The promoters of most highly expressed x-type HMW-GS genes contain an additional box predicted to bind R2R3-MYB transcriptional factors. However, the differences in annotation between promoter alleles could not be related to their level of expression. In summary, we identified a common modular organization of HMW-GS gene promoters but the lack of correlation between the cis-motifs of each HMW-GS gene promoter and their level of expression suggests that other cis-elements or other mechanisms regulate HMW-GS gene expression. PMID:25429295

  3. Motif Yggdrasil: sampling sequence motifs from a tree mixture model.


    Andersson, Samuel A; Lagergren, Jens


    In phylogenetic foot-printing, putative regulatory elements are found in upstream regions of orthologous genes by searching for common motifs. Motifs in different upstream sequences are subject to mutations along the edges of the corresponding phylogenetic tree, consequently taking advantage of the tree in the motif search is an appealing idea. We describe the Motif Yggdrasil sampler; the first Gibbs sampler based on a general tree that uses unaligned sequences. Previous tree-based Gibbs samplers have assumed a star-shaped tree or partially aligned upstream regions. We give a probabilistic model (MY model) describing upstream sequences with regulatory elements and build a Gibbs sampler with respect to this model. The model allows toggling, i.e., the restriction of a position to a subset of nucleotides, but does not require aligned sequences nor edge lengths, which may be difficult to come by. We apply the collapsing technique to eliminate the need to sample nuisance parameters, and give a derivation of the predictive update formula. We show that the MY model improves the modeling of difficult motif instances and that the use of the tree achieves a substantial increase in nucleotide level correlation coefficient both for synthetic data and 37 bacterial lexA genes. We investigate the sensitivity to errors in the tree and show that using random trees MY sampler still has a performance similar to the original version.

  4. Identification of plant promoter constituents by analysis of local distribution of short sequences

    PubMed Central

    Yamamoto, Yoshiharu Y; Ichida, Hiroyuki; Matsui, Minami; Obokata, Junichi; Sakurai, Tetsuya; Satou, Masakazu; Seki, Motoaki; Shinozaki, Kazuo; Abe, Tomoko


    Background Plant promoter architecture is important for understanding regulation and evolution of the promoters, but our current knowledge about plant promoter structure, especially with respect to the core promoter, is insufficient. Several promoter elements including TATA box, and several types of transcriptional regulatory elements have been found to show local distribution within promoters, and this feature has been successfully utilized for extraction of promoter constituents from human genome. Results LDSS (Local Distribution of Short Sequences) profiles of short sequences along the plant promoter have been analyzed in silico, and hundreds of hexamer and octamer sequences have been identified as having localized distributions within promoters of Arabidopsis thaliana and rice. Based on their localization patterns, the identified sequences could be classified into three groups, pyrimidine patch (Y Patch), TATA box, and REG (Regulatory Element Group). Sequences of the TATA box group are consistent with the ones reported in previous studies. The REG group includes more than 200 sequences, and half of them correspond to known cis-elements. The other REG subgroups, together with about a hundred uncategorized sequences, are suggested to be novel cis-regulatory elements. Comparison of LDSS-positive sequences between Arabidopsis and rice has revealed moderate conservation of elements and common promoter architecture. In addition, a dimer motif named the YR Rule (C/T A/G) has been identified at the transcription start site (-1/+1). This rule also fits both Arabidopsis and rice promoters. Conclusion LDSS was successfully applied to plant genomes and hundreds of putative promoter elements have been extracted as LDSS-positive octamers. Identified promoter architecture of monocot and dicot are well conserved, but there are moderate variations in the utilized sequences. PMID:17346352

  5. Cloning, expression and functional characterization of the putative regeneration and tolerance factor (RTF/TJ6) as a functional vacuolar ATPase proton pump regulatory subunit with a conserved sequence of immunoreceptor tyrosine-based activation motif.


    Babichev, Yael; Tamir, Ami; Park, Meeyoug; Muallem, Shmuel; Isakov, Noah


    In an attempt to identify new immunoreceptor tyrosine-based activation motif (ITAM)-containing human molecules that may regulate hitherto unknown immune cell functions, we BLAST searched the National Center for Biotechnology Information database for ITAM-containing sequences. A human expressed sequence tag showing partial homology to the murine TJ6 (mTJ6) gene and encoding a putative ITAM sequence has been identified and used to clone the human TJ6 (hTJ6) gene from an HL-60-derived cDNA library. hTJ6 was found to encode a protein of 856 residues with a calculated mass of 98 155 Da. Immunolocalization and sequence analysis revealed that hTJ6 is a membrane protein with predicted six transmembrane-spanning regions, typical of ion channels, and a single putative ITAM (residues 452-466) in a juxtamembrane or hydrophobic intramembrane region. hTJ6 is highly homologous to Bos taurus 116-kDa subunit of the vacuolar proton-translocating ATPase. Over-expression of hTJ6 in HEK 293 cells increased H+ uptake into intracellular organelles, an effect that was sensitive to inhibition by bafilomycin, a selective inhibitor of vacuolar H+ pump. Northern blot analysis demonstrated three different hybridizing mRNA transcripts corresponding to 3.2, 5.0 and 7.3 kb, indicating the presence of several splice variants. Significant differences in hTJ6 mRNA levels in human tissues of different origins point to possible tissue-specific function. Although hTJ6 was found to be a poor substrate for tyrosine-phosphorylating enzymes, suggesting that its ITAM sequence is non-functional in protein tyrosine kinase-mediated signaling pathways, its role in organellar H+ pumping suggests that hTJ6 function may participate in protein trafficking/processing.

  6. Regulatory RNAs in Planarians.


    Pawlicka, Kamila; Perrigue, Patrick M; Barciszewski, Jan


    The full scope of regulatory RNA evolution and function in epigenetic processes is still not well understood. The development of planarian flatworms to be used as a simple model organism for research has shown a great potential to address gaps in the knowledge in this field of study. The genomes of planarians encode a wide array of regulatory RNAs that function in gene regulation. Here, we review planarians as a suitable model organism for the identification and function of regulatory RNAs.

  7. Regulatory Information By Sector

    EPA Pesticide Factsheets

    Find environmental regulatory, compliance, & enforcement information for various business, industry and government sectors, listed by NAICS code. Sectors include agriculture, automotive, petroleum manufacturing, oil & gas extraction & other manufacturing

  8. Raising the estimate of functional human sequences.


    Pheasant, Michael; Mattick, John S


    While less than 1.5% of the mammalian genome encodes proteins, it is now evident that the vast majority is transcribed, mainly into non-protein-coding RNAs. This raises the question of what fraction of the genome is functional, i.e., composed of sequences that yield functional products, are required for the expression (regulation or processing) of these products, or are required for chromosome replication and maintenance. Many of the observed noncoding transcripts are differentially expressed, and, while most have not yet been studied, increasing numbers are being shown to be functional and/or trafficked to specific subcellular locations, as well as exhibit subtle evidence of selection. On the other hand, analyses of conservation patterns indicate that only approximately 5% (3%-8%) of the human genome is under purifying selection for functions common to mammals. However, these estimates rely on the assumption that reference sequences (usually ancient transposon-derived sequences) have evolved neutrally, which may not be the case, and if so would lead to an underestimate of the fraction of the genome under evolutionary constraint. These analyses also do not detect functional sequences that are evolving rapidly and/or have acquired lineage-specific functions. Indeed, many regulatory sequences and known functional noncoding RNAs, including many microRNAs, are not conserved over significant evolutionary distances, and recent evidence from the ENCODE project suggests that many functional elements show no detectable level of sequence constraint. Thus, it is likely that much more than 5% of the genome encodes functional information, and although the upper bound is unknown, it may be considerably higher than currently thought.

  9. Cis-regulatory elements are harbored in Intron5 of the RUNX1 gene

    PubMed Central


    Background Human RUNX1 gene is one of the most frequent target for chromosomal translocations associated with acute myeloid leukemia (AML) and acute lymphoid leukemia (ALL). The highest prevalence in AML is noted with (8; 21) translocation; which represents 12 to 15% of all AML cases. Interestingly, all the breakpoints mapped to date in t(8;21) are clustered in intron 5 of the RUNX1 gene and intron 1 of the ETO gene. No homologous sequences have been found at the recombination regions; but DNase I hypersensitive sites (DHS) have been mapped to the areas of the genes involved in t(8;21). Presence of DHS sites is commonly associated with regulatory elements such as promoters, enhancers and silencers, among others. Results In this study we used a combination of comparative genomics, cloning and transfection assays to evaluate potential regulatory elements located in intron 5 of the RUNX1 gene. Our genomic analysis identified nine conserved non-coding sequences that are evolutionarily conserved among rat, mouse and human. We cloned two of these regions in pGL-3 Promoter plasmid in order to analyze their transcriptional regulatory activity. Our results demonstrate that the identified regions can indeed regulate transcription of a reporter gene in a distance and position independent manner; moreover, their transcriptional effect is cell type specific. Conclusions We have identified nine conserved non coding sequence that are harbored in intron 5 of the RUNX1 gene. We have also demonstrated that two of these regions can regulate transcriptional activity in vitro. Taken together our results suggest that intron 5 of the RUNX1 gene contains multiple potential cis-regulatory elements. PMID:24655352

  10. metagene Profiles Analyses Reveal Regulatory Element’s Factor-Specific Recruitment Patterns

    PubMed Central

    Samb, Rawane; Lemaçon, Audrey; Bilodeau, Steve; Droit, Arnaud


    ChIP-Sequencing (ChIP-Seq) provides a vast amount of information regarding the localization of proteins across the genome. The aggregation of ChIP-Seq enrichment signal in a metagene plot is an approach commonly used to summarize data complexity and to obtain a high level visual representation of the general occupancy pattern of a protein. Here we present the R package metagene, the graphical interface Imetagene and the companion package similaRpeak. Together, they provide a framework to integrate, summarize and compare the ChIP-Seq enrichment signal from complex experimental designs. Those packages identify and quantify similarities or dissimilarities in patterns between large numbers of ChIP-Seq profiles. We used metagene to investigate the differential occupancy of regulatory factors at noncoding regulatory regions (promoters and enhancers) in relation to transcriptional activity in GM12878 B-lymphocytes. The relationships between occupancy patterns and transcriptional activity suggest two different mechanisms of action for transcriptional control: i) a “gradient effect” where the regulatory factor occupancy levels follow transcription and ii) a “threshold effect” where the regulatory factor occupancy levels max out prior to reaching maximal transcription. metagene, Imetagene and similaRpeak are implemented in R under the Artistic license 2.0 and are available on Bioconductor. PMID:27538250

  11. metagene Profiles Analyses Reveal Regulatory Element's Factor-Specific Recruitment Patterns.


    Joly Beauparlant, Charles; Lamaze, Fabien C; Deschênes, Astrid; Samb, Rawane; Lemaçon, Audrey; Belleau, Pascal; Bilodeau, Steve; Droit, Arnaud


    ChIP-Sequencing (ChIP-Seq) provides a vast amount of information regarding the localization of proteins across the genome. The aggregation of ChIP-Seq enrichment signal in a metagene plot is an approach commonly used to summarize data complexity and to obtain a high level visual representation of the general occupancy pattern of a protein. Here we present the R package metagene, the graphical interface Imetagene and the companion package similaRpeak. Together, they provide a framework to integrate, summarize and compare the ChIP-Seq enrichment signal from complex experimental designs. Those packages identify and quantify similarities or dissimilarities in patterns between large numbers of ChIP-Seq profiles. We used metagene to investigate the differential occupancy of regulatory factors at noncoding regulatory regions (promoters and enhancers) in relation to transcriptional activity in GM12878 B-lymphocytes. The relationships between occupancy patterns and transcriptional activity suggest two different mechanisms of action for transcriptional control: i) a "gradient effect" where the regulatory factor occupancy levels follow transcription and ii) a "threshold effect" where the regulatory factor occupancy levels max out prior to reaching maximal transcription. metagene, Imetagene and similaRpeak are implemented in R under the Artistic license 2.0 and are available on Bioconductor.

  12. Genome Sequencing.


    Verma, Mansi; Kulshrestha, Samarth; Puri, Ayush


    Genome sequencing is an important step toward correlating genotypes with phenotypic characters. Sequencing technologies are important in many fields in the life sciences, including functional genomics, transcriptomics, oncology, evolutionary biology, forensic sciences, and many more. The era of sequencing has been divided into three generations. First generation sequencing involved sequencing by synthesis (Sanger sequencing) and sequencing by cleavage (Maxam-Gilbert sequencing). Sanger sequencing led to the completion of various genome sequences (including human) and provided the foundation for development of other sequencing technologies. Since then, various techniques have been developed which can overcome some of the limitations of Sanger sequencing. These techniques are collectively known as "Next-generation sequencing" (NGS), and are further classified into second and third generation technologies. Although NGS methods have many advantages in terms of speed, cost, and parallelism, the accuracy and read length of Sanger sequencing is still superior and has confined the use of NGS mainly to resequencing genomes. Consequently, there is a continuing need to develop improved real time sequencing techniques. This chapter reviews some of the options currently available and provides a generic workflow for sequencing a genome.

  13. 78 FR 44279 - Regulatory Agenda

    Federal Register 2010, 2011, 2012, 2013, 2014


    ... Regulatory Flexibility Act, 5 U.S.C. sections 601 to 612 (1988). FOR FURTHER INFORMATION CONTACT: Robert... mandated for the regulatory flexibility agendas required by the Regulatory Flexibility Act (5 U.S.C. 602... regulatory flexibility agenda, in accordance with the Regulatory Flexibility Act, because they are likely...

  14. Transcriptomic profiling of 39 commonly-used neuroblastoma cell lines.


    Harenza, Jo Lynne; Diamond, Maura A; Adams, Rebecca N; Song, Michael M; Davidson, Heather L; Hart, Lori S; Dent, Maiah H; Fortina, Paolo; Reynolds, C Patrick; Maris, John M


    Neuroblastoma cell lines are an important and cost-effective model used to study oncogenic drivers of the disease. While many of these cell lines have been previously characterized with SNP, methylation, and/or mRNA expression microarrays, there has not been an effort to comprehensively sequence these cell lines. Here, we present raw whole transcriptome data generated by RNA sequencing of 39 commonly-used neuroblastoma cell lines. These data can be used to perform differential expression analysis based on a genetic aberration or phenotype in neuroblastoma (e.g., MYCN amplification status, ALK mutation status, chromosome arm 1p, 11q and/or 17q status, sensitivity to pharmacologic perturbation). Additionally, we designed this experiment to enable structural variant and/or long-noncoding RNA analysis across these cell lines. Finally, as more DNase/ATAC and histone/transcription factor ChIP sequencing is performed in these cell lines, our RNA-Seq data will be an important complement to inform transcriptional targets as well as regulatory (enhancer or repressor) elements in neuroblastoma.

  15. Transcriptomic profiling of 39 commonly-used neuroblastoma cell lines

    PubMed Central

    Harenza, Jo Lynne; Diamond, Maura A.; Adams, Rebecca N.; Song, Michael M.; Davidson, Heather L.; Hart, Lori S.; Dent, Maiah H.; Fortina, Paolo; Reynolds, C. Patrick; Maris, John M.


    Neuroblastoma cell lines are an important and cost-effective model used to study oncogenic drivers of the disease. While many of these cell lines have been previously characterized with SNP, methylation, and/or mRNA expression microarrays, there has not been an effort to comprehensively sequence these cell lines. Here, we present raw whole transcriptome data generated by RNA sequencing of 39 commonly-used neuroblastoma cell lines. These data can be used to perform differential expression analysis based on a genetic aberration or phenotype in neuroblastoma (e.g., MYCN amplification status, ALK mutation status, chromosome arm 1p, 11q and/or 17q status, sensitivity to pharmacologic perturbation). Additionally, we designed this experiment to enable structural variant and/or long-noncoding RNA analysis across these cell lines. Finally, as more DNase/ATAC and histone/transcription factor ChIP sequencing is performed in these cell lines, our RNA-Seq data will be an important complement to inform transcriptional targets as well as regulatory (enhancer or repressor) elements in neuroblastoma. PMID:28350380

  16. Evidence for a common evolutionary rate in metazoan transcriptional networks

    PubMed Central

    Carvunis, Anne-Ruxandra; Wang, Tina; Skola, Dylan; Yu, Alice; Chen, Jonathan; Kreisberg, Jason F; Ideker, Trey


    Genome sequences diverge more rapidly in mammals than in other animal lineages, such as birds or insects. However, the effect of this rapid divergence on transcriptional evolution remains unclear. Recent reports have indicated a faster divergence of transcription factor binding in mammals than in insects, but others found the reverse for mRNA expression. Here, we show that these conflicting interpretations resulted from differing methodologies. We performed an integrated analysis of transcriptional network evolution by examining mRNA expression, transcription factor binding and cis-regulatory motifs across >25 animal species, including mammals, birds and insects. Strikingly, we found that transcriptional networks evolve at a common rate across the three animal lineages. Furthermore, differences in rates of genome divergence were greatly reduced when restricting comparisons to chromatin-accessible sequences. The evolution of transcription is thus decoupled from the global rate of genome sequence evolution, suggesting that a small fraction of the genome regulates transcription. DOI: PMID:26682651

  17. Review and development of common nomenclature for naming and labeling schemes for probabilistic risk assessment

    SciTech Connect

    Trusty, A.D.; Mackowiak, D.P. )


    This report describes the review and development of common nomenclature for naming and labeling schemes for probabilistic risk assessments (PRAS) conducted by the Idaho National Engineering Laboratory (INEL). Based on the review, the INEL recommends using an existing basic event labeling scheme and existing naming schemes for systems, component types, and component failure modes. The review showed no adequate accident sequence labeling schemes currently exist. Therefore, the INEL developed a scheme that would meet the review requirements of not exceeding 16 characters and being highly descriptive of the accident sequence involved. As parts of the developed accident sequence labeling scheme, the INEL also developed transient and loss-of-coolant accident initiating event codes, a sequence naming scheme, and accident type codes. Applications of the accident sequence labeling scheme are presented along with tables to allow changes from other schemes to the recommended naming schemes. The review and development were conducted to provide the Nuclear Regulatory Commission with the means to coordinate and integrate their internal activities through a common nomenclature for their many data bases.

  18. Definition of a GC-rich motif as regulatory sequence of the human IL-3 gene: coordinate regulation of the IL-3 gene by CLE2/GC box of the GM-CSF gene in T cell activation.


    Nishida, J; Yoshida, M; Arai, K; Yokota, T


    The human IL-3 gene, located on chromosome 5, contains several cis-acting DNA sequences, i.e. CLE (conserved lymphokine element) and a GC-rich region, similar to the GM-CSF gene. To investigate the role of these elements, the 5' flanking region of the IL-3 gene was attached to a bacterial chloramphenicol acetyltransferase (CAT) gene. The fusion plasmids were analyzed by an in vitro transcription system using Jurkat cell nuclear extract prepared from cells stimulated with phorbol-12-myristate-13-acetate and calcium ionophore (PMA/A23187), introduced into Jurkat cells, expressed transiently, and stimulated by co-transfection of human T cell leukemia virus type I (HTLV-I) encoded transactivator, p40tax. The GC-rich region enhanced TATA-dependent transcription in the in vitro transcription system and also strongly responded to p40tax stimulation in the in vivo cotransfection assay. Using this GC-rich region as a probe, we identified a constitutive DNA-protein complex, alpha, whose binding specificity correlates with transcription activity. However, this element is not sufficient for the expression of the IL-3 gene in response to T cell activation signals (PMA/A23187) and no sequence was found within the IL-3 gene which mediates the response to PMA/A23187. The enhancer sequence which responds to T cell activation signals may be located outside the IL-3 gene and may be shared by other lymphokines, possibly by GM-CSF. We propose that the GM-CSF enhancer (CLE2/GC box) which mediates the response to T cell activation signals may stimulate the expression of the IL-3 gene.

  19. [Clonage of the "malA" region of "Escherichia coli" K12: nucleotide sequence of the regulatory region and the promoters, identification and purification of the MalT-activator protein (author's transl)].


    Raibaud, O; Débarbouillé, M; Cossart, P


    A 5,800-bp (base pair) HindIII-EcoRI DNA fragment containing malT, the positive regulator gene of the maltose regulon, and most of malP, the structural gene for maltodextrin phosphorylase, was cloned into pBR322. A sequence of 802 bp was established in a DNA segment containing the promotor for malPQ and the promoter for malT. A total of 611 bp separates the initiation codons for these two genes, which are transcribed in opposite directions. The malT product was identified as a 94,000 dalton polypeptide.

  20. Mapping the Shh long-range regulatory domain

    PubMed Central

    Anderson, Eve; Devenney, Paul S.; Hill, Robert E.; Lettice, Laura A.


    Coordinated gene expression controlled by long-distance enhancers is orchestrated by DNA regulatory sequences involving transcription factors and layers of control mechanisms. The Shh gene and well-established regulators are an example of genomic composition in which enhancers reside in a large desert extending into neighbouring genes to control the spatiotemporal pattern of expression. Exploiting the local hopping activity of the Sleeping Beauty transposon, the lacZ reporter gene was dispersed throughout the Shh region to systematically map the genomic features responsible for expression activity. We found that enhancer activities are retained inside a genomic region that corresponds to the topological associated domain (TAD) defined by Hi-C. This domain of approximately 900 kb is in an open conformation over its length and is generally susceptible to all Shh enhancers. Similar to the distal enhancers, an enhancer residing within the Shh second intron activates the reporter gene located at distances of hundreds of kilobases away, suggesting that both proximal and distal enhancers have the capacity to survey the Shh topological domain to recognise potential promoters. The widely expressed Rnf32 gene lying within the Shh domain evades enhancer activities by a process that may be common among other housekeeping genes that reside in large regulatory domains. Finally, the boundaries of the Shh TAD do not represent the absolute expression limits of enhancer activity, as expression activity is lost stepwise at a number of genomic positions at the verges of these domains. PMID:25252942

  1. Plant nitrogen regulatory P-PII polypeptides


    Coruzzi, Gloria M.; Lam, Hon-Ming; Hsieh, Ming-Hsiun


    The present invention generally relates to plant nitrogen regulatory PII gene (hereinafter P-PII gene), a gene involved in regulating plant nitrogen metabolism. The invention provides P-PII nucleotide sequences, expression constructs comprising said nucleotide sequences, and host cells and plants having said constructs and, optionally expressing the P-PII gene from said constructs. The invention also provides substantially pure P-PII proteins. The P-PII nucleotide sequences and constructs of the invention may be used to engineer organisms to overexpress wild-type or mutant P-PII regulatory protein. Engineered plants that overexpress or underexpress P-PII regulatory protein may have increased nitrogen assimilation capacity. Engineered organisms may be used to produce P-PII proteins which, in turn, can be used for a variety of purposes including in vitro screening of herbicides. P-PII nucleotide sequences have additional uses as probes for isolating additional genomic clones having the promoters of P-PII gene. P-PII promoters are light- and/or sucrose-inducible and may be advantageously used in genetic engineering of plants.

  2. Epigenetics and Common Ophthalmic Diseases

    PubMed Central

    Li, Wendy; Liu, Ji; Galvin, Jennifer A.


    The study of ocular diseases and epigenetic dysregulation is an emerging area of research. The knowledge from the epigenetic mechanisms of DNA methylation, histone modifications, chromatin remodeling, and non-coding RNAs regarding the pathogenesis of ocular diseases will be helpful for improved treatment modalities for our patients. In particular, we focus upon the how epigenetic regulatory mechanisms impact five common ocular diseases: age related macular degeneration, age-related cataract, pterygium, retinoblastoma, and uveal melanoma. Hence, the foundation of this research paves the way for future specific therapeutic targets to treat and prevent vision loss. PMID:28018148

  3. Finding Nested Common Intervals Efficiently

    NASA Astrophysics Data System (ADS)

    Blin, Guillaume; Stoye, Jens

    In this paper, we study the problem of efficiently finding gene clusters formalized by nested common intervals between two genomes represented either as permutations or as sequences. Considering permutations, we give several algorithms whose running time depends on the size of the actual output rather than the output in the worst case. Indeed, we first provide a straightforward O(n 3) time algorithm for finding all nested common intervals. We reduce this complexity by providing an O(n 2) time algorithm computing an irredundant output. Finally, we show, by providing a third algorithm, that finding only the maximal nested common intervals can be done in linear time. Considering sequences, we provide solutions (modifications of previously defined algorithms and a new algorithm) for different variants of the problem, depending on the treatment one wants to apply to duplicated genes.

  4. Regulatory guidance document

    SciTech Connect


    The Office of Civilian Radioactive Waste Management (OCRWM) Program Management System Manual requires preparation of the OCRWM Regulatory Guidance Document (RGD) that addresses licensing, environmental compliance, and safety and health compliance. The document provides: regulatory compliance policy; guidance to OCRWM organizational elements to ensure a consistent approach when complying with regulatory requirements; strategies to achieve policy objectives; organizational responsibilities for regulatory compliance; guidance with regard to Program compliance oversight; and guidance on the contents of a project-level Regulatory Compliance Plan. The scope of the RGD includes site suitability evaluation, licensing, environmental compliance, and safety and health compliance, in accordance with the direction provided by Section 4.6.3 of the PMS Manual. Site suitability evaluation and regulatory compliance during site characterization are significant activities, particularly with regard to the YW MSA. OCRWM`s evaluation of whether the Yucca Mountain site is suitable for repository development must precede its submittal of a license application to the Nuclear Regulatory Commission (NRC). Accordingly, site suitability evaluation is discussed in Chapter 4, and the general statements of policy regarding site suitability evaluation are discussed in Section 2.1. Although much of the data and analyses may initially be similar, the licensing process is discussed separately in Chapter 5. Environmental compliance is discussed in Chapter 6. Safety and Health compliance is discussed in Chapter 7.

  5. Potential use of DNA barcodes in regulatory science: applications of the Regulatory Fish Encyclopedia.


    Yancy, Haile F; Zemlak, Tyler S; Mason, Jacquline A; Washington, Jewell D; Tenge, Bradley J; Nguyen, Ngoc-Lan T; Barnett, James D; Savary, Warren E; Hill, Walter E; Moore, Michelle M; Fry, Frederick S; Randolph, Spring C; Rogers, Patricia L; Hebert, Paul D N


    The use of a DNA-based identification system (DNA barcoding) founded on the mitochondrial gene cytochrome c oxidase subunit I (COI) was investigated for updating the U.S. Food and Drug Administration Regulatory Fish Encyclopedia (RFE; The RFE is a compilation of data used to identify fish species. It was compiled to help regulators identify species substitution that could result in potential adverse health consequences or could be a source of economic fraud. For each of many aquatic species commonly sold in the United States, the RFE includes high-resolution photographs of whole fish and their marketed product forms and species-specific biochemical patterns for authenticated fish species. These patterns currently include data from isoelectric focusing studies. In this article, we describe the generation of DNA barcodes for 172 individual authenticated fish representing 72 species from 27 families contained in the RFE. These barcode sequences can be used as an additional identification resource. In a blind study, 60 unknown fish muscle samples were barcoded, and the results were compared with the RFE barcode reference library. All 60 samples were correctly identified to species based on the barcoding data. Our study indicates that DNA barcoding can be a powerful tool for species identification and has broad potential applications.

  6. Regulatory principles governing Salmonella and Yersinia virulence

    PubMed Central

    Erhardt, Marc; Dersch, Petra


    Enteric pathogens such as Salmonella and Yersinia evolved numerous strategies to survive and proliferate in different environmental reservoirs and mammalian hosts. Deciphering common and pathogen-specific principles for how these bacteria adjust and coordinate spatiotemporal expression of virulence determinants, stress adaptation, and metabolic functions is fundamental to understand microbial pathogenesis. In order to manage sudden environmental changes, attacks by the host immune systems and microbial competition, the pathogens employ a plethora of transcriptional and post-transcriptional control elements, including transcription factors, sensory and regulatory RNAs, RNAses, and proteases, to fine-tune and control complex gene regulatory networks. Many of the contributing global regulators and the molecular mechanisms of regulation are frequently conserved between Yersinia and Salmonella. However, the interplay, arrangement, and composition of the control elements vary between these closely related enteric pathogens, which generate phenotypic differences leading to distinct pathogenic properties. In this overview we present common and different regulatory networks used by Salmonella and Yersinia to coordinate the expression of crucial motility, cell adhesion and invasion determinants, immune defense strategies, and metabolic adaptation processes. We highlight evolutionary changes of the gene regulatory circuits that result in different properties of the regulatory elements and how this influences the overall outcome of the infection process. PMID:26441883

  7. Reducing Uncertainty About Common-Mode Failures

    DTIC Science & Technology


    other types of diversity such as functional diversity , independent and diverse sensors, and timing diversity. Clearly these two nuclear regulatory...programs from failing identically, or from failing simultaneously. To protect against common design errors, diversity in design is employed. Functional ... diversity involves specifying that different programs have different functional requirements. For example, one program might do a linear search, while

  8. 18 CFR 357.1 - Common carriers.

    Code of Federal Regulations, 2011 CFR


    ... 18 Conservation of Power and Water Resources 1 2011-04-01 2011-04-01 false Common carriers. 357.1 Section 357.1 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY COMMISSION, DEPARTMENT OF ENERGY APPROVED FORMS, INTERSTATE COMMERCE ACT ANNUAL SPECIAL OR PERIODIC REPORTS:...

  9. Genome-wide methylation sequencing of paired primary and metastatic cell lines identifies common DNA methylation changes and a role for EBF3 as a candidate epigenetic driver of melanoma metastasis

    PubMed Central

    Chatterjee, Aniruddha; Stockwell, Peter A; Ahn, Antonio; Rodger, Euan J; Leichter, Anna L; Eccles, Michael R


    Epigenetic alterations are increasingly implicated in metastasis, whereas very few genetic mutations have been identified as authentic drivers of cancer metastasis. Yet, to date, few studies have identified metastasis-related epigenetic drivers, in part because a framework for identifying driver epigenetic changes in metastasis has not been established. Using reduced representation bisulfite sequencing (RRBS), we mapped genome-wide DNA methylation patterns in three cutaneous primary and metastatic melanoma cell line pairs to identify metastasis-related epigenetic drivers. Globally, metastatic melanoma cell lines were hypomethylated compared to the matched primary melanoma cell lines. Using whole genome RRBS we identified 75 shared (10 hyper- and 65 hypomethylated) differentially methylated fragments (DMFs), which were associated with 68 genes showing significant methylation differences. One gene, Early B Cell Factor 3 (EBF3), exhibited promoter hypermethylation in metastatic cell lines, and was validated with bisulfite sequencing and in two publicly available independent melanoma cohorts (n = 40 and 458 melanomas, respectively). We found that hypermethylation of the EBF3 promoter was associated with increased EBF3 mRNA levels in metastatic melanomas and subsequent inhibition of DNA methylation reduced EBF3 expression. RNAi-mediated knockdown of EBF3 mRNA levels decreased proliferation, migration and invasion in primary and metastatic melanoma cell lines. Overall, we have identified numerous epigenetic changes characterising metastatic melanoma cell lines, including EBF3-induced aggressive phenotypic behaviour with elevated EBF3 expression in metastatic melanoma, suggesting that EBF3 promoter hypermethylation may be a candidate epigenetic driver of metastasis. PMID:28030832

  10. Motif co-regulation and co-operativity are common mechanisms in transcriptional, post-transcriptional and post-translational regulation.


    Van Roey, Kim; Davey, Norman E


    A substantial portion of the regulatory interactions in the higher eukaryotic cell are mediated by simple sequence motifs in the regulatory segments of genes and (pre-)mRNAs, and in the intrinsically disordered regions of proteins. Although these regulatory modules are physicochemically distinct, they share an evolutionary plasticity that has facilitated a rapid growth of their use and resulted in their ubiquity in complex organisms. The ease of motif acquisition simplifies access to basal housekeeping functions, facilitates the co-regulation of multiple biomolecules allowing them to respond in a coordinated manner to changes in the cell state, and supports the integration of multiple signals for combinatorial decision-making. Consequently, motifs are indispensable for temporal, spatial, conditional and basal regulation at the transcriptional, post-transcriptional and post-translational level. In this review, we highlight that many of the key regulatory pathways of the cell are recruited by motifs and that the ease of motif acquisition has resulted in large networks of co-regulated biomolecules. We discuss how co-operativity allows simple static motifs to perform the conditional regulation that underlies decision-making in higher eukaryotic biological systems. We observe that each gene and its products have a unique set of DNA, RNA or protein motifs that encode a regulatory program to define the logical circuitry that guides the life cycle of these biomolecules, from transcription to degradation. Finally, we contrast the regulatory properties of protein motifs and the regulatory elements of DNA and (pre-)mRNAs, advocating that co-regulation, co-operativity, and motif-driven regulatory programs are common mechanisms that emerge from the use of simple, evolutionarily plastic regulatory modules.

  11. Select Biosolids Regulatory Processes

    EPA Pesticide Factsheets

    Historical Regulatory Development and activities EPA has undertaken to respond to statutory obligations, respond to the National Academy of Sciences, understand pollutants that may occur in sewage sludge, and address dioxins in sewage sludge.

  12. Regulatory T cell memory

    PubMed Central

    Rosenblum, Michael D.; Way, Sing Sing; Abbas, Abul K.


    Memory for antigen is a defining feature of adaptive immunity. Antigen-specific lymphocyte populations show an increase in number and function after antigen encounter and more rapidly re-expand upon subsequent antigen exposure. Studies of immune memory have primarily focused on effector B cells and T cells with microbial specificity, using prime challenge models of infection. However, recent work has also identified persistently expanded populations of antigen-specific regulatory T cells that protect against aberrant immune responses. In this Review, we consider the parallels between memory effector T cells and memory regulatory T cells, along with the functional implications of regulatory memory in autoimmunity, antimicrobial host defence and maternal fetal tolerance. In addition, we discuss emerging evidence for regulatory T cell memory in humans and key unanswered questions in this rapidly evolving field. PMID:26688349

  13. 3 CFR - Regulatory Compliance

    Code of Federal Regulations, 2012 CFR


    ... protecting the air we breathe and the water we drink. Consistent regulatory enforcement also levels the... can lead the Government to hold itself more accountable, encouraging agencies to identify and...

  14. 3 CFR - Regulatory Review

    Code of Federal Regulations, 2010 CFR


    ... in general—should be revisited. I therefore direct the Director of OMB, in consultation with... delay; clarify the role of the behavioral sciences in formulating regulatory policy; and identify...

  15. Transphyletic conservation of developmental regulatory state in animal evolution.


    Royo, José Luis; Maeso, Ignacio; Irimia, Manuel; Gao, Feng; Peter, Isabelle S; Lopes, Carla S; D'Aniello, Salvatore; Casares, Fernando; Davidson, Eric H; Garcia-Fernández, Jordi; Gómez-Skarmeta, José Luis


    Specific regulatory states, i.e., sets of expressed transcription factors, define the gene expression capabilities of cells in animal development. Here we explore the functional significance of an unprecedented example of regulatory state conservation from the cnidarian Nematostella to Drosophila, sea urchin, fish, and mammals. Our probe is a deeply conserved cis-regulatory DNA module of the SRY-box B2 (soxB2), recognizable at the sequence level across many phyla. Transphyletic cis-regulatory DNA transfer experiments reveal that the plesiomorphic control function of this module may have been to respond to a regulatory state associated with neuronal differentiation. By introducing expression constructs driven by this module from any phyletic source into the genomes of diverse developing animals, we discover that the regulatory state to which it responds is used at different levels of the neurogenic developmental process, including patterning and development of the vertebrate forebrain and neurogenesis in the Drosophila optic lobe and brain. The regulatory state recognized by the conserved DNA sequence may have been redeployed to different levels of the developmental regulatory program during evolution of complex central nervous systems.

  16. High-Throughput Sequencing Technologies

    PubMed Central

    Reuter, Jason A.; Spacek, Damek; Snyder, Michael P.


    Summary The human genome sequence has profoundly altered our understanding of biology, human diversity and disease. The path from the first draft sequence to our nascent era of personal genomes and genomic medicine has been made possible only because of the extraordinary advancements in DNA sequencing technologies over the past ten years. Here, we discuss commonly used high-throughput sequencing platforms, the growing array of sequencing assays developed around them as well as the challenges facing current sequencing platforms and their clinical application. PMID:26000844

  17. Physical and functional domains of the herpes simplex virus transcriptional regulatory protein ICP4.

    PubMed Central

    DeLuca, N A; Schaffer, P A


    A characteristic common to DNA animal viruses is the expression early in infection of viral proteins that act in trans to regulate subsequent RNA polymerase II-dependent transcription of the remainder of the viral genome. The predominant transcriptional regulatory protein specified by herpes simplex virus type 1 is the immediate-early protein ICP4. ICP4 is a complex multifunctional protein required for the activation of many herpes simplex virus type 1 transcriptional units and for repression of its own transcription. In the present study we have introduced nonsense and deletion mutations into both genome copies of the ICP4 gene such that the resulting mutants express only defined subsets of the primary ICP4 amino acid sequence. The partial peptides retain activities and physical properties of the intact ICP4 molecule, permitting one to attribute individual activities and properties to defined amino acid sequences. Images PMID:2828668

  18. A regulatory role for Staphylococcus aureus toxin-antitoxin system PemIKSa.


    Bukowski, Michal; Lyzen, Robert; Helbin, Weronika M; Bonar, Emilia; Szalewska-Palasz, Agnieszka; Wegrzyn, Grzegorz; Dubin, Grzegorz; Dubin, Adam; Wladyka, Benedykt


    Toxin-antitoxin systems were shown to be involved in plasmid maintenance when they were initially discovered, but other roles have been demonstrated since. Here we identify and characterize a novel toxin-antitoxin system (pemIKSa) located on Staphylococcus aureus plasmid pCH91. The toxin (PemKSa) is a sequence-specific endoribonuclease recognizing the tetrad sequence U↓AUU, and the antitoxin (PemISa) inhibits toxin activity by physical interaction. Although the toxin-antitoxin system is responsible for stable plasmid maintenance our data suggest the participation of pemIKSa in global regulation of staphylococcal virulence by alteration of the translation of large pools of genes. We propose a common mechanism of reversible activation of toxin-antitoxin systems based on antitoxin transcript resistance to toxin cleavage. Elucidation of this mechanism is particularly interesting because reversible activation is a prerequisite for the proposed general regulatory role of toxin-antitoxin systems.

  19. Assessing the regulatory picture

    SciTech Connect

    Not Available


    This article addresses the safety of the nation's drinking water supply and discusses compliance of the Clean Water Act. Right now, the shape of the regulatory future is uncertain. The results of the D-DBP regulatory negotiation are imminent. Congress is ready to begin debating reauthorization of the Safe Drinking Water Act, and utilities are trying to comply with the regulations while trying not to price water out of the reach of some of their customers.

  20. NRC regulatory initiatives

    SciTech Connect

    Johnson, T.C.


    The US Nuclear Regulatory Commission (NRC) is addressing several low-level waste disposal issues that will be important to waste generators and to States and Compacts developing new disposal capacity. These issues include Greater-Than-Class C (GTCC) waste, mixed waste, below regulatory concern (BRC) waste, and the low-level waste data base. This paper discusses these issues and their current status.

  1. Revealing global regulatory perturbations across human cancers

    PubMed Central

    Goodarzi, Hani; Elemento, Olivier; Tavazoie, Saeed


    Summary The discovery of pathways and regulatory networks whose perturbation contributes to neoplastic transformation remains a fundamental challenge for cancer biology. We show that such pathway perturbations, and the cis-regulatory elements through which they operate, can be efficiently extracted from global gene-expression profiles. Our approach utilizes information-theoretic analysis of expression levels, pathways, and genomic sequences. Analysis across a diverse set of human cancers reveals the majority of previously known cancer pathways. Through de novo motif discovery we associate these pathways with transcription-factor binding sites and miRNA targets, including those of E2F, NF-Y, p53, and let-7. Follow-up experiments confirmed that these predictions correspond to functional in vivo regulatory interactions. Strikingly, the majority of the perturbations, associated with putative cis-regulatory elements, fall outside of known cancer pathways. Our study provides a systems-level dissection of regulatory perturbations in cancer—an essential component of a rational strategy for therapeutic intervention and drug-target discovery. PMID:20005852

  2. Single-Nucleotide Mutations in FMR1 Reveal Novel Functions and Regulatory Mechanisms of the Fragile X Syndrome Protein FMRP

    PubMed Central

    Suhl, Joshua A.; Warren, Stephen T.


    Fragile X syndrome is a monogenic disorder and a common cause of intellectual disability. Despite nearly 25 years of research on FMR1, the gene underlying the syndrome, very few pathological mutations other than the typical CGG-repeat expansion have been reported. This is in contrast to other X-linked, monogenic, intellectual disability disorders, such as Rett syndrome, where many point mutations have been validated as causative of the disorder. As technology has improved and significantly driven down the cost of sequencing, allowing for whole genes to be sequenced with relative ease, in-depth sequencing studies on FMR1 have recently been performed. These studies have led to the identification of novel variants in FMR1, where some of which have been functionally evaluated and are likely pathogenic. In this review, we discuss recently identified FMR1 variants, the ways these novel variants cause dysfunction, and how they reveal new regulatory mechanisms and functionalities of the gene. PMID:26819560

  3. Evolutionary conservation of regulatory elements in vertebrate HOX gene clusters

    SciTech Connect

    Santini, Simona; Boore, Jeffrey L.; Meyer, Axel


    Due to their high degree of conservation, comparisons of DNA sequences among evolutionarily distantly-related genomes permit to identify functional regions in noncoding DNA. Hox genes are optimal candidate sequences for comparative genome analyses, because they are extremely conserved in vertebrates and occur in clusters. We aligned (Pipmaker) the nucleotide sequences of HoxA clusters of tilapia, pufferfish, striped bass, zebrafish, horn shark, human and mouse (over 500 million years of evolutionary distance). We identified several highly conserved intergenic sequences, likely to be important in gene regulation. Only a few of these putative regulatory elements have been previously described as being involved in the regulation of Hox genes, while several others are new elements that might have regulatory functions. The majority of these newly identified putative regulatory elements contain short fragments that are almost completely conserved and are identical to known binding sites for regulatory proteins (Transfac). The conserved intergenic regions located between the most rostrally expressed genes in the developing embryo are longer and better retained through evolution. We document that presumed regulatory sequences are retained differentially in either A or A clusters resulting from a genome duplication in the fish lineage. This observation supports both the hypothesis that the conserved elements are involved in gene regulation and the Duplication-Deletion-Complementation model.

  4. No Common Opinion on the Common Core

    ERIC Educational Resources Information Center

    Henderson, Michael B.; Peterson, Paul E.; West, Martin R.


    According to the three authors of this article, the 2014 "EdNext" poll yields four especially important new findings: (1) Opinion with respect to the Common Core has yet to coalesce. The idea of a common set of standards across the country has wide appeal, and the Common Core itself still commands the support of a majority of the public.…

  5. cis-Regulatory control circuits in development.


    Howard, Meredith L; Davidson, Eric H


    During development, an organism undergoes many rounds of pattern formation, generating ever-greater complexity with each ensuing round of cell division and specification. The instructions for executing this process are encoded in the cis-regulatory modules that direct the expression of developmental transcription factors and signaling molecules. Each transcription factor binding site within a cis-regulatory module contributes information about when, where, or how much a gene is turned on, and by dissecting the modules driving a given gene, all the inputs governing expression of the gene can be accurately identified. Furthermore, by mapping the output of each gene to the inputs of other genes, it is possible to reverse engineer developmental circuits and even whole networks. At this higher level of organization, common bilaterian strategies for specifying progenitor fields, locking down regulatory states, and driving development forward emerge.

  6. 75 FR 61530 - Issuance of Regulatory Guides

    Federal Register 2010, 2011, 2012, 2013, 2014


    ... Engineering, Office of Nuclear Regulatory Research, U.S. Nuclear Regulatory Commission, Washington, DC 20555... From the Federal Register Online via the Government Publishing Office NUCLEAR REGULATORY COMMISSION Issuance of Regulatory Guides AGENCY: Nuclear Regulatory Commission. ACTION: Notice. SUMMARY:...

  7. SRD: a Staphylococcus regulatory RNA database

    PubMed Central

    Sassi, Mohamed; Augagneur, Yoann; Mauro, Tony; Ivain, Lorraine; Chabelskaya, Svetlana; Hallier, Marc; Sallou, Olivier; Felden, Brice


    An overflow of regulatory RNAs (sRNAs) was identified in a wide range of bacteria. We designed and implemented a new resource for the hundreds of sRNAs identified in Staphylococci, with primary focus on the human pathogen Staphylococcus aureus. The “Staphylococcal Regulatory RNA Database” (SRD, compiled all published data in a single interface including genetic locations, sequences and other features. SRD proposes novel and simplified identifiers for Staphylococcal regulatory RNAs (srn) based on the sRNA's genetic location in S. aureus strain N315 which served as a reference. From a set of 894 sequences and after an in-depth cleaning, SRD provides a list of 575 srn exempt of redundant sequences. For each sRNA, their experimental support(s) is provided, allowing the user to individually assess their validity and significance. RNA-seq analysis performed on strains N315, NCTC8325, and Newman allowed us to provide further details, upgrade the initial annotation, and identified 159 RNA-seq independent transcribed sRNAs. The lists of 575 and 159 sRNAs sequences were used to predict the number and location of srns in 18 S. aureus strains and 10 other Staphylococci. A comparison of the srn contents within 32 Staphylococcal genomes revealed a poor conservation between species. In addition, sRNA structure predictions obtained with MFold are accessible. A BLAST server and the intaRNA program, which is dedicated to target prediction, were implemented. SRD is the first sRNA database centered on a genus; it is a user-friendly and scalable device with the possibility to submit new sequences that should spread in the literature. PMID:25805861

  8. Structure of Proximal and Distant Regulatory Elements in the Human Genome

    NASA Astrophysics Data System (ADS)

    Ovcharenko, Ivan

    Clustering of multiple transcription factor binding sites (TFBSs) for the same transcription factor (TF) is a common feature of cis-regulatory modules in invertebrate animals, but the occurrence of such homotypic clusters of TFBSs (HCTs) in the human genome has remained largely unknown. To explore whether HCTs are also common in human and other vertebrates, we used known binding motifs for vertebrate TFs and a hidden Markov model-based approach to detect HCTs in the human, mouse, chicken, and fugu genomes, and examined their association with cis-regulatory modules. We found that evolutionarily conserved HCTs occupy nearly 2% of the human genome, with experimental evidence for individual TFs supporting their binding to predicted HCTs. More than half of promoters of human genes contain HCTs, with a distribution around the transcription start site in agreement with the experimental data from the ENCODE project. In addition, almost half of 487 experimentally validated developmental enhancers contain them as well - a number more than 25-fold larger than expected by chance. We also found evidence of negative selection acting on TFBSs within HCTs, as the conservation of TFBSs is stronger than the conservation of sequences separating them. The important role of HCTs as components of developmental enhancers is additionally supported by a strong correlation between HCTs and the binding of the enhancer-associated co-activator protein p300. Experimental validation of HCT-containing elements in both zebrafish and mouse suggest that HCTs could be used to predict both the presence of enhancers and their tissue specificity, and are thus a feature that can be effectively used in deciphering the gene regulatory code. In conclusion, our results indicate that HCTs are a pervasive feature of human cis-regulatory modules and suggest that they play an important role in gene regulation in the human and other vertebrate genomes.

  9. Quantitative Sequencing for the Determination of Kdr-type Resistance Allele (V419L, L925I, I936F) Frequencies in Common Bed Bug (Hemiptera: Cimicidae) Populations Collected from Israel.


    Palenchar, Daniel J; Gellatly, Kyle J; Yoon, Kyong Sup; Mumcuoglu, Kosta Y; Shalom, Uri; Clark, J Marshall


    Human bed bug infestations have dramatically increased worldwide since the mid-1990s. A similar phenomenon was also observed in Israel since 2005, when infestations were reported from all over the country. Two single nucleotide polymorphisms (V419L and L925I) in the bed bug voltage-sensitive sodium channel confer kdr-type resistance to pyrethroids. Using quantitative sequencing (QS), the resistance allele frequencies of Israeli bed bug populations from across the country were determined. Genomic DNA was extracted from samples of 12 populations of bed bugs collected from Israel and DNA fragments containing the V419L or L925I and I936F mutations sites were PCR amplified. The PCR products were analyzed by QS and the nucleotide signal ratios calculated and used to predict the resistance allele frequencies of the unknown populations. Results of the genetic analysis show that resistant nucleotide signals are highly correlated to resistance allele frequencies for both mutations. Ten of the 12 tested populations had 100% of the L925I mutation and 0% of the V419L mutation. One population was heterogeneous for the L925I mutation and had 0% of the V419L mutation and another population was heterogeneous for the V419L mutation and had 100% of the L925I mutation. I936F occurred only at low levels. These results indicate that bed bugs in Israel are genetically resistant to pyrethroids. Thus, pyrethroids should only be used for bed bug management with caution using effective application and careful monitoring procedures. Additionally, new and novel-acting insecticides and nonchemical means of controlling bed bugs should be explored.

  10. High Throughput Sequencing: An Overview of Sequencing Chemistry.


    Ambardar, Sheetal; Gupta, Rikita; Trakroo, Deepika; Lal, Rup; Vakhlu, Jyoti


    In the present century sequencing is to the DNA science, what gel electrophoresis was to it in the last century. From 1977 to 2016 three generation of the sequencing technologies of various types have been developed. Second and third generation sequencing technologies referred commonly to as next generation sequencing technology, has evolved significantly with increase in sequencing speed, decrease in sequencing cost, since its inception in 2004. GS FLX by 454 Life Sciences/Roche diagnostics, Genome Analyzer, HiSeq, MiSeq and NextSeq by Illumina, Inc., SOLiD by ABI, Ion Torrent by Life Technologies are various type of the sequencing platforms available for second generation sequencing. The platforms available for the third generation sequencing are Helicos™ Genetic Analysis System by SeqLL, LLC, SMRT Sequencing by Pacific Biosciences, Nanopore sequencing by Oxford Nanopore's, Complete Genomics by Beijing Genomics Institute and GnuBIO by BioRad, to name few. The present article is an overview of the principle and the sequencing chemistry of these high throughput sequencing technologies along with brief comparison of various types of sequencing platforms available.

  11. Evolutionary conservation of regulatory elements in vertebrate Hox gene clusters.


    Santini, Simona; Boore, Jeffrey L; Meyer, Axel


    Comparisons of DNA sequences among evolutionarily distantly related genomes permit identification of conserved functional regions in noncoding DNA. Hox genes are highly conserved in vertebrates, occur in clusters, and are uninterrupted by other genes. We aligned (PipMaker) the nucleotide sequences of the HoxA clusters of tilapia, pufferfish, striped bass, zebrafish, horn shark, human, and mouse, which are separated by approximately 500 million years of evolution. In support of our approach, several identified putative regulatory elements known to regulate the expression of Hox genes were recovered. The majority of the newly identified putative regulatory elements contain short fragments that are almost completely conserved and are identical to known binding sites for regulatory proteins (Transfac database). The regulatory intergenic regions located between the genes that are expressed most anteriorly in the embryo are longer and apparently more evolutionarily conserved than those at the other end of Hox clusters. Different presumed regulatory sequences are retained in either the Aalpha or Abeta duplicated Hox clusters in the fish lineages. This suggests that the conserved elements are involved in different gene regulatory networks and supports the duplication-deletion-complementation model of functional divergence of duplicated genes.

  12. Plant DNA sequencing for phylogenetic analyses: from plants to sequences.


    Neves, Susana S; Forrest, Laura L


    DNA sequences are important sources of data for phylogenetic analysis. Nowadays, DNA sequencing is a routine technique in molecular biology laboratories. However, there are specific questions associated with project design and sequencing of plant samples for phylogenetic analysis, which may not be familiar to researchers starting in the field. This chapter gives an overview of methods and protocols involved in the sequencing of plant samples, including general recommendations on the selection of species/taxa and DNA regions to be sequenced, and field collection of plant samples. Protocols of plant sample preparation, DNA extraction, PCR and cloning, which are critical to the success of molecular phylogenetic projects, are described in detail. Common problems of sequencing (using the Sanger method) are also addressed. Possible applications of second-generation sequencing techniques in plant phylogenetics are briefly discussed. Finally, orientation on the preparation of sequence data for phylogenetic analyses and submission to public databases is also given.

  13. Characterization of the Neisseria gonorrhoeae Iron and Fur Regulatory Network

    PubMed Central

    Yu, Chunxiao; McClure, Ryan; Daou, Nadine


    ABSTRACT The Neisseria gonorrhoeae ferric uptake regulator (Fur) protein controls expression of iron homeostasis genes in response to intracellular iron levels. In this study, using transcriptome sequencing (RNA-seq) analysis of an N. gonorrhoeae fur strain, we defined the gonococcal Fur and iron regulons and characterized Fur-controlled expression of an ArsR-like DNA binding protein. We observed that 158 genes (8% of the genome) showed differential expression in response to iron in an N. gonorrhoeae wild-type or fur strain, while 54 genes exhibited differential expression in response to Fur. The Fur regulon was extended to additional regulators, including NrrF and 13 other small RNAs (sRNAs), and two transcriptional factors. One transcriptional factor, coding for an ArsR-like regulator (ArsR), exhibited increased expression under iron-replete conditions in the wild-type strain but showed decreased expression across iron conditions in the fur strain, an effect that was reversed in a fur-complemented strain. Fur was shown to bind to the promoter region of the arsR gene downstream of a predicted σ70 promoter region. Electrophoretic mobility shift assay (EMSA) analysis confirmed binding of the ArsR protein to the norB promoter region, and sequence analysis identified two additional putative targets, NGO1411 and NGO1646. A gonococcal arsR strain demonstrated decreased survival in human endocervical epithelial cells compared to that of the wild-type and arsR-complemented strains, suggesting that the ArsR regulon includes genes required for survival in host cells. Collectively, these results demonstrate that the N. gonorrhoeae Fur functions as a global regulatory protein to repress or activate expression of a large repertoire of genes, including additional transcriptional regulatory proteins. IMPORTANCE Gene regulation in bacteria in response to environmental stimuli, including iron, is of paramount importance to both bacterial replication and, in the case of pathogenic

  14. Sequencing technologies and genome sequencing.


    Pareek, Chandra Shekhar; Smoczynski, Rafal; Tretyn, Andrzej


    The high-throughput - next generation sequencing (HT-NGS) technologies are currently the hottest topic in the field of human and animals genomics researches, which can produce over 100 times more data compared to the most sophisticated capillary sequencers based on the Sanger method. With the ongoing developments of high throughput sequencing machines and advancement of modern bioinformatics tools at unprecedented pace, the target goal of sequencing individual genomes of living organism at a cost of $1,000 each is seemed to be realistically feasible in the near future. In the relatively short time frame since 2005, the HT-NGS technologies are revolutionizing the human and animal genome researches by analysis of chromatin immunoprecipitation coupled to DNA microarray (ChIP-chip) or sequencing (ChIP-seq), RNA sequencing (RNA-seq), whole genome genotyping, genome wide structural variation, de novo assembling and re-assembling of genome, mutation detection and carrier screening, detection of inherited disorders and complex human diseases, DNA library preparation, paired ends and genomic captures, sequencing of mitochondrial genome and personal genomics. In this review, we addressed the important features of HT-NGS like, first generation DNA sequencers, birth of HT-NGS, second generation HT-NGS platforms, third generation HT-NGS platforms: including single molecule Heliscope™, SMRT™ and RNAP sequencers, Nanopore, Archon Genomics X PRIZE foundation, comparison of second and third HT-NGS platforms, applications, advances and future perspectives of sequencing technologies on human and animal genome research.

  15. Rationales for regulatory activity

    SciTech Connect

    Perhac, R.M.


    The author provides an outline which touches on the types of concerns about risk evaluation which are addressed in the process of establishing regulatory guides. Broadly he says regulatory activity serves three broad constituents: (1) Paternalism (private risk); (2) Promotion of social welfare (public risks); (3) Protection of individual rights (public risks). He then discusses some of the major issues encountered in reaching a decision on what is an acceptable level of risk within each of these areas, and how one establishes such a level.

  16. Analysis of the COL1A1 and COL1A2 genes by PCR amplification and scanning by conformation-sensitive gel electrophoresis identifies only COL1A1 mutations in 15 patients with osteogenesis imperfecta type I: identification of common sequences of null-allele mutations.

    PubMed Central

    Körkkö, J; Ala-Kokko, L; De Paepe, A; Nuytinck, L; Earley, J; Prockop, D J


    Although >90% of patients with osteogenesis imperfecta (OI) have been estimated to have mutations in the COL1A1 and COL1A2 genes for type I procollagen, mutations have been difficult to detect in all patients with the mildest forms of the disease (i.e., type I). In this study, we first searched for mutations in type I procollagen by analyses of protein and mRNA in fibroblasts from 10 patients with mild OI; no evidence of a mutation was found in 2 of the patients by the protein analyses, and no evidence of a mutation was found in 5 of the patients by the RNA analyses. We then searched for mutations in the original 10 patients and in 5 additional patients with mild OI, by analysis of genomic DNA. To assay the genomic DNA, we established a consensus sequence for the first 12 kb of the COL1A1 gene and for 30 kb of new sequences of the 38-kb COL1A2 gene. The sequences were then used to develop primers for PCR for the 103 exons and exon boundaries of the two genes. The PCR products were first scanned for heteroduplexes by conformation-sensitive gel electrophoresis, and then products containing heteroduplexes were sequenced. The results detected disease-causing mutations in 13 of the 15 patients and detected two additional probable disease-causing mutations in the remaining 2 patients. Analysis of the data developed in this study and elsewhere revealed common sequences for mutations causing null alleles. PMID:9443882

  17. 76 FR 70768 - Common-Cause Failure Analysis in Event and Condition Assessment: Guidance and Research, Draft...

    Federal Register 2010, 2011, 2012, 2013, 2014


    ... From the Federal Register Online via the Government Publishing Office NUCLEAR REGULATORY COMMISSION Common-Cause Failure Analysis in Event and Condition Assessment: Guidance and Research, Draft Report for Comment; Correction AGENCY: Nuclear Regulatory Commission. ACTION: Draft NUREG; request...

  18. Common NICU Equipment


    ... care unit (NICU) > Common NICU equipment Common NICU equipment E-mail to a friend Please fill in ... understand how they can help your baby. What equipment is commonly used in the NICU? Providers use ...

  19. Common Cause Failure Modeling

    NASA Technical Reports Server (NTRS)

    Hark, Frank; Britton, Paul; Ring, Robert; Novack, Steven


    Space Launch System (SLS) Agenda: Objective; Key Definitions; Calculating Common Cause; Examples; Defense against Common Cause; Impact of varied Common Cause Failure (CCF) and abortability; Response Surface for various CCF Beta; Takeaways.

  20. Terminology of developmental abnormalities in common laboratory mammals (version 1).


    Wise, L D; Beck, S L; Beltrame, D; Beyer, B K; Chahoud, I; Clark, R L; Clark, R; Druga, A M; Feuston, M H; Guittin, P; Henwood, S M; Kimmel, C A; Lindstrom, P; Palmer, A K; Petrere, J A; Solomon, H M; Yasuda, M; York, R G


    This paper presents the first version of an internationally-developed glossary of terms for structural developmental abnormalities in common laboratory animals. The glossary is put forward by the International Federation of Teratology Societies (IFTS) Committee on International Harmonization of Nomenclature in Developmental Toxicology, and represents considerable progress toward harmonization of terminology in this area. The purpose of this effort is to provide a common vocabulary that will reduce confusion and ambiguity in the description of developmental effects, particularly in submissions to regulatory agencies worldwide. The glossary contains a primary term or phrase, a definition of the abnormality, and notes, where appropriate. Selected synonyms or related terms, which reflect a similar or closely related concept, are noted. Nonpreferred terms are indicated where their usage may be incorrect. Modifying terms used repeatedly in the glossary (e.g., absent, branched) are listed and defined separately, instead of repeating their definitions for each observation. Syndrome names are generally excluded from the glossary, but are listed separately in an appendix. The glossary is organized into broad sections for external, visceral, and skeletal observations, then subdivided into regions, structures, or organs in a general overall head to tail sequence. Numbering is sequential, and not in any regional or hierarchical order. Uses and misuses of the glossary are discussed. Comments, questions, suggestions, and additions from practitioners in the field of developmental toxicology are welcomed on the organization of the glossary as well as on the specific terms and definitions. Updates of the glossary are planned based on the comments received.

  1. Cis- and Trans-Regulatory Mechanisms of Gene Expression in the ASJ Sensory Neuron of Caenorhabditis elegans

    PubMed Central

    González-Barrios, María; Fierro-González, Juan Carlos; Krpelanova, Eva; Mora-Lorca, José Antonio; Pedrajas, José Rafael; Peñate, Xenia; Chavez, Sebastián; Swoboda, Peter; Jansen, Gert; Miranda-Vizuete, Antonio


    The identity of a given cell type is determined by the expression of a set of genes sharing common cis-regulatory motifs and being regulated by shared transcription factors. Here, we identify cis and trans regulatory elements that drive gene expression in the bilateral sensory neuron ASJ, located in the head of the nematode Caenorhabditis elegans. For this purpose, we have dissected the promoters of the only two genes so far reported to be exclusively expressed in ASJ, trx-1 and ssu-1. We hereby identify the ASJ motif, a functional cis-regulatory bipartite promoter region composed of two individual 6 bp elements separated by a 3 bp linker. The first element is a 6 bp CG-rich sequence that presumably binds the Sp family member zinc-finger transcription factor SPTF-1. Interestingly, within the C. elegans nervous system SPTF-1 is also found to be expressed only in ASJ neurons where it regulates expression of other genes in these neurons and ASJ cell fate. The second element of the bipartite motif is a 6 bp AT-rich sequence that is predicted to potentially bind a transcription factor of the homeobox family. Together, our findings identify a specific promoter signature and SPTF-1 as a transcription factor that functions as a terminal selector gene to regulate gene expression in C. elegans ASJ sensory neurons. PMID:25769980

  2. The regulatory horizon

    NASA Technical Reports Server (NTRS)

    Cook, ED


    The author briefly discusses the FAA's position as it relates to cockpit resource management. For example, if Cockpit Resource Management (CRM) is a positive concept, why isn't everyone required to implement it? The regulatory practice of the FAA is discussed and questions and answers are presented.

  3. Toxicogenomics in Regulatory Ecotoxicology

    EPA Science Inventory

    The potential utility of toxicogenomics in toxicological research and regulatory activities has been the subject of scientific discussions, and as with any new technology, there is a wide range of opinion. The purpose of this feature article is to consider roles of toxicogenomic...

  4. Identification of two homologous mitochondrial DNA sequences, which bind strongly and specifically to a mitochondrial protein of Paracentrotus lividus.

    PubMed Central

    Roberti, M; Mustich, A; Gadaleta, M N; Cantatore, P


    Using a combination of band shift and DNasel protection experiments, two Paracentrotus lividus mitochondrial sequences, able to bind tightly and selectively to a mitochondrial protein from sea urchin embryos, have been found. The two sequences, which compete with each other for binding to the protein, are located in two genome regions which are thought to contain regulatory signals for mitochondrial replication and transcription. A computer analysis suggests that the sequence TTTTRTANNTCYYATCAYA, common to the two binding regions, is the minimal recognition signal for the binding to the protein. We discuss the hypothesis that the protein binding capacity of these two sequences is involved in the control of sea urchin mtDNA replication during developmental stages. Images PMID:1956785

  5. Identification of transcriptional regulatory nodes in soybean defense networks using transient co-transactivation assays

    PubMed Central

    Wang, Yongli; Wang, Hui; Ma, Yujie; Du, Haiping; Yang, Qing; Yu, Deyue


    Plant responses to major environmental stressors, such as insect feeding, not only occur via the functions of defense genes but also involve a series of regulatory factors. Our previous transcriptome studies proposed that, in addition to two defense-related genes, GmVSPβ and GmN:IFR, a high proportion of transcription factors (TFs) participate in the incompatible soybean-common cutworm interaction networks. However, the regulatory mechanisms and effects of these TFs on those induced defense-related genes remain unknown. In the present work, we isolated and identified 12 genes encoding MYB, WRKY, NAC, bZIP, and DREB TFs from a common cutworm-induced cDNA library of a resistant soybean line. Sequence analysis of the promoters of three co-expressed genes, including GmVSPα, GmVSPβ, and GmN:IFR, revealed the enrichment of various TF-binding sites for defense and stress responses. To further identify the regulatory nodes composed of these TFs and defense gene promoters, we performed extensive transient co-transactivation assays to directly test the transcriptional activity of the 12 TFs binding at different levels to the three co-expressed gene promoters. The results showed that all 12 TFs were able to transactivate the GmVSPβ and GmN:IFR promoters. GmbZIP110 and GmMYB75 functioned as distinct regulators of GmVSPα/β and GmN:IFR expression, respectively, while GmWRKY39 acted as a common central regulator of GmVSPα/β and GmN:IFR expression. These corresponding TFs play crucial roles in coordinated plant defense regulation, which provides valuable information for understanding the molecular mechanisms involved in insect-induced transcriptional regulation in soybean. More importantly, the identified TFs and suitable promoters can be used to engineer insect-resistant plants in molecular breeding studies. PMID:26579162

  6. Identification of transcriptional regulatory nodes in soybean defense networks using transient co-transactivation assays.


    Wang, Yongli; Wang, Hui; Ma, Yujie; Du, Haiping; Yang, Qing; Yu, Deyue


    Plant responses to major environmental stressors, such as insect feeding, not only occur via the functions of defense genes but also involve a series of regulatory factors. Our previous transcriptome studies proposed that, in addition to two defense-related genes, GmVSPβ and GmN:IFR, a high proportion of transcription factors (TFs) participate in the incompatible soybean-common cutworm interaction networks. However, the regulatory mechanisms and effects of these TFs on those induced defense-related genes remain unknown. In the present work, we isolated and identified 12 genes encoding MYB, WRKY, NAC, bZIP, and DREB TFs from a common cutworm-induced cDNA library of a resistant soybean line. Sequence analysis of the promoters of three co-expressed genes, including GmVSPα, GmVSPβ, and GmN:IFR, revealed the enrichment of various TF-binding sites for defense and stress responses. To further identify the regulatory nodes composed of these TFs and defense gene promoters, we performed extensive transient co-transactivation assays to directly test the transcriptional activity of the 12 TFs binding at different levels to the three co-expressed gene promoters. The results showed that all 12 TFs were able to transactivate the GmVSPβ and GmN:IFR promoters. GmbZIP110 and GmMYB75 functioned as distinct regulators of GmVSPα/β and GmN:IFR expression, respectively, while GmWRKY39 acted as a common central regulator of GmVSPα/β and GmN:IFR expression. These corresponding TFs play crucial roles in coordinated plant defense regulation, which provides valuable information for understanding the molecular mechanisms involved in insect-induced transcriptional regulation in soybean. More importantly, the identified TFs and suitable promoters can be used to engineer insect-resistant plants in molecular breeding studies.

  7. The Role of cis Regulatory Evolution in Maize Domestication

    PubMed Central

    Lemmon, Zachary H.; Bukowski, Robert; Sun, Qi; Doebley, John F.


    Gene expression differences between divergent lineages caused by modification of cis regulatory elements are thought to be important in evolution. We assayed genome-wide cis and trans regulatory differences between maize and its wild progenitor, teosinte, using deep RNA sequencing in F1 hybrid and parent inbred lines for three tissue types (ear, leaf and stem). Pervasive regulatory variation was observed with approximately 70% of ∼17,000 genes showing evidence of regulatory divergence between maize and teosinte. However, many fewer genes (1,079 genes) show consistent cis differences with all sampled maize and teosinte lines. For ∼70% of these 1,079 genes, the cis differences are specific to a single tissue. The number of genes with cis regulatory differences is greatest for ear tissue, which underwent a drastic transformation in form during domestication. As expected from the domestication bottleneck, maize possesses less cis regulatory variation than teosinte with this deficit greatest for genes showing maize-teosinte cis regulatory divergence, suggesting selection on cis regulatory differences during domestication. Consistent with selection on cis regulatory elements, genes with cis effects correlated strongly with genes under positive selection during maize domestication and improvement, while genes with trans regulatory effects did not. We observed a directional bias such that genes with cis differences showed higher expression of the maize allele more often than the teosinte allele, suggesting domestication favored up-regulation of gene expression. Finally, this work documents the cis and trans regulatory changes between maize and teosinte in over 17,000 genes for three tissues. PMID:25375861

  8. Common Career Technical Core: Common Standards, Common Vision for CTE

    ERIC Educational Resources Information Center

    Green, Kimberly


    This article provides an overview of the National Association of State Directors of Career Technical Education Consortium's (NASDCTEc) Common Career Technical Core (CCTC), a state-led initiative that was created to ensure that career and technical education (CTE) programs are consistent and high quality across the United States. Forty-two states,…

  9. Dna Sequencing


    Tabor, Stanley; Richardson, Charles C.


    A method for sequencing a strand of DNA, including the steps off: providing the strand of DNA; annealing the strand with a primer able to hybridize to the strand to give an annealed mixture; incubating the mixture with four deoxyribonucleoside triphosphates, a DNA polymerase, and at least three deoxyribonucleoside triphosphates in different amounts, under conditions in favoring primer extension to form nucleic acid fragments complementory to the DNA to be sequenced; labelling the nucleic and fragments; separating them and determining the position of the deoxyribonucleoside triphosphates by differences in the intensity of the labels, thereby to determine the DNA sequence.

  10. Toxicogenomics and the Regulatory Framework

    EPA Science Inventory

    Toxicogenomics presents regulatory agencies with the opportunity to revolutionize their analyses by enabling the collection of information on a broader range of responses than currently considered in traditional regulatory decision making. Analyses of genomic responses are expec...

  11. Using FAIRE (Formaldehyde-Assisted Isolation of Regulatory Elements) to isolate active regulatory DNA

    PubMed Central

    Simon, Jeremy M.; Giresi, Paul G.; Davis, Ian J.; Lieb, Jason D.


    Eviction or destabilization of nucleosomes from chromatin is a hallmark of functional regulatory elements of the eukaryotic genome. Historically identified by nuclease hypersensitivity, these regulatory elements are typically bound by transcription factors or other regulatory proteins. FAIRE (Formaldehyde-Assisted Isolation of Regulatory Elements) is an alternative approach to identify these genomic regions and has proven successful in a multitude of eukaryotic cell and tissue types. Cells or dissociated tissues are crosslinked briefly with formaldehyde, lysed, and sonicated. Sheared chromatin is subjected to phenol-chloroform extraction and the isolated DNA, typically encompassing 1–3% of the human genome, is purified. We provide guidelines for quantitative analysis by PCR, microarrays, or next-generation sequencing. Regulatory elements enriched by FAIRE display high concordance with those identified by nuclease hypersensitivity or ChIP, and the entire procedure can be completed in three days. FAIRE exhibits low technical variability, which allows its use in large-scale studies of chromatin from normal or diseased tissues. PMID:22262007

  12. Functional footprinting of regulatory DNA

    PubMed Central

    Vierstra, Jeff; Reik, Andreas; Chang, Kai-Hsin; Stehling-Sun, Sandra; Zhou, Yuan-Yue; Hinkley, Sarah J.; Paschon, David E.; Zhang, L.; Psatha, Nikoletta; Bendana, Yuri R.; O'Neill, Colleen M.; Song, Alex H.; Mich, Andrea; Liu, Pei-Qi; Lee, Gary; Bauer, Daniel E.; Holmes, Michael C.; Orkin, Stuart H.; Papayannopoulou, Thalia; Stamatoyannopoulos, George; Rebar, Edward J.; Gregory, Philip D.; Urnov, Fyodor D.; Stamatoyannopoulos, John A.


    Regulatory regions harbor multiple transcription factor recognition sites; however, the contribution of individual sites to regulatory function remains challenging to define. We describe a facile approach that exploits the error-prone nature of genome editing-induced double-strand break repair to map functional elements within regulatory DNA at nucleotide resolution. We demonstrate the approach on a human erythroid enhancer, revealing single TF recognition sites that gate the majority of downstream regulatory function. PMID:26322838

  13. Nuclear Regulatory Commission information digest

    SciTech Connect



    The Nuclear Regulatory Commission information digest provides summary information regarding the US Nuclear Regulatory Commission, its regulatory responsibilities, and areas licensed by the commission. This is an annual publication for the general use of the NRC Staff and is available to the public. The digest is divided into two parts: the first presents an overview of the US Nuclear Regulatory Commission and the second provides data on NRC commercial nuclear reactor licensees and commercial nuclear power reactors worldwide.

  14. Characterization of a disease-associated mutation affecting a putative splicing regulatory element in intron 6b of the cystic fibrosis transmembrane conductance regulator (CFTR) gene.


    Faà, Valeria; Incani, Federica; Meloni, Alessandra; Corda, Denise; Masala, Maddalena; Baffico, A Maria; Seia, Manuela; Cao, Antonio; Rosatelli, M Cristina


    Cystic fibrosis (CF) is a common recessive disorder caused by >1600 mutations in the CF transmembrane conductance regulator (CFTR) gene. About 13% of CFTR mutations are classified as "splicing mutations," but for almost 40% of these, their role in affecting the pre-mRNA splicing of the gene is not yet defined. In this work, we describe a new splicing mutation detected in three unrelated Italian CF patients. By DNA analyses and mRNA studies, we identified the c.1002-1110_1113delTAAG mutation localized in intron 6b of the CFTR gene. At the mRNA level, this mutation creates an aberrant inclusion of a sequence of 101 nucleotides between exons 6b and 7. This sequence corresponds to a portion of intron 6b and resembles a cryptic exon because it is characterized by an upstream ag and a downstream gt sequence, which are most probably recognized as 5'- and 3'-splice sites by the spliceosome. Through functional analysis of this splicing defect, we show that this mutation abolishes the interaction of the splicing regulatory protein heterogeneous nuclear ribonucleoprotein A2/B1 with an intronic splicing regulatory element and creates a new recognition motif for the SRp75 splicing factor, causing activation of the cryptic exon. Our results show that the c.1002-1110_1113delTAAG mutation creates a new intronic splicing regulatory element in intron 6b of the CFTR gene exclusively recognized by SRp75.

  15. Multiplex parallel pair-end-ditag sequencing approaches in system biology.


    Ruan, Yijun; Wei, Chia-Lin


    Characterization of all the functional components constituted in human genome relies in our ability to completely elucidate the genetic/epigenetic regulatory networks, chromatin states, nuclear architectures, and genome variations. Such endeavors demand for the development of robust and effective genomic technologies. In the past few years, the availability of disruptive next generation DNA sequencing technologies has offered new promise for whole genome interrogation. However, despite the massive parallel and ultra-high throughput capacity, the common nature of short read lengths found within these platforms limits their applications for many types of whole genome-based analyses. To overcome such constrain, pair end ditag (PET) based sequencing concept was conceived as an immediate solution to expand the information content and extend the linear coverage. By sequencing paired end signatures from any desired DNA fragment and mapping them to the reference genome, PET strategy allows the accurate demarcation of target DNA boundaries and defines their locations on the genomic landscape. Furthermore, the ability to delineate relationship between two ends of a DNA molecule enables the full scale discovery of unconventional gene products, genome rearrangements, and chromatin interactions. Coupling with the massively parallel and ultra-high throughput sequencing platforms, such unique features of PET strategy have the potential to revolutionize the approaches used to decipher regulatory networks in system biology, define the genome organizations, and characterize genome variations; which ultimately leads to the development of strategies for personalized medicine.

  16. Cognitive regulatory control therapies.


    Bowins, Brad


    Cognitive regulatory control processes play an essential but typically unappreciated role in maintaining mental health. The purpose of the current paper is to identify this role and demonstrate how cognitive-behavioral and related techniques can compensate for impairments. Impaired cognitive regulation contributes to the overly intense emotional states present in anxiety disorders, depression, and personality disorders; progression of adaptive hypomania to mania; expression of psychosis in the conscious and awake state; dominance of immature defense mechanisms in borderline and other personality disorders. A wide variety of standard (monitoring, reappraisal, response inhibition, relaxation training) and more novel (suppression therapy, willful detachment, cost-benefit analysis, normalization, mature defense mechanism training) cognitive-behavioral and related techniques can be applied to compensate for cognitive regulatory control impairments, and their success probably aligns with this capacity.

  17. Conservation of trans-acting networks during mammalian regulatory evolution

    PubMed Central

    Stergachis, Andrew B.; Neph, Shane; Sandstrom, Richard; Haugen, Eric; Reynolds, Alex P.; Zhang, Miaohua; Byron, Rachel; Canfield, Theresa; Stelhing-Sun, Sandra; Lee, Kristen; Thurman, Robert E.; Vong, Shinny; Bates, Daniel; Neri, Fidencio; Diegel, Morgan; Giste, Erika; Dunn, Douglas; Hansen, R. Scott; Johnson, Audra K.; Sabo, Peter J.; Wilken, Matthew S.; Reh, Thomas A.; Treuting, Piper M.; Kaul, Rajinder; Groudine, Mark; Bender, M.A.; Borenstein, Elhanan; Stamatoyannopoulos, John A.


    The fundamental body plan and major physiological axes have been highly conserved during mammalian evolution, despite constraint of only a fraction of the human genome sequence. To quantify cis- vs. trans-regulatory contributions to mammalian regulatory evolution, we performed genomic DNase I footprinting of the mouse genome across 25 cell and tissue types, collectively defining >8.6 million TF occupancy sites at nucleotide resolution. Here we show that mouse TF footprints encode a regulatory lexicon of >600 motifs that is >95% similar with that recognized in vivo by human TFs. However, only ~20% of mouse TF footprints have human orthologues. Despite substantial turnover of the cis-regulatory landscape around each TF gene, nearly half of all pairwise regulatory interactions connecting mouse TF genes have been maintained in orthologous human cell types through evolutionary innovation of TF recognition sequences. Strikingly, the higher-level organization of mouse TF-to-TF connections into cellular network architectures is nearly identical with human. Our results suggest that evolutionary selection on mammalian gene regulation is targeted chiefly at the level of trans-regulatory circuitry. PMID:25409825

  18. Automated Identification of Nucleotide Sequences

    NASA Technical Reports Server (NTRS)

    Osman, Shariff; Venkateswaran, Kasthuri; Fox, George; Zhu, Dian-Hui


    STITCH is a computer program that processes raw nucleotide-sequence data to automatically remove unwanted vector information, perform reverse-complement comparison, stitch shorter sequences together to make longer ones to which the shorter ones presumably belong, and search against the user s choice of private and Internet-accessible public 16S rRNA databases. ["16S rRNA" denotes a ribosomal ribonucleic acid (rRNA) sequence that is common to all organisms.] In STITCH, a template 16S rRNA sequence is used to position forward and reverse reads. STITCH then automatically searches known 16S rRNA sequences in the user s chosen database(s) to find the sequence most similar to (the sequence that lies at the smallest edit distance from) each spliced sequence. The result of processing by STITCH is the identification of the most similar well-described bacterium. Whereas previously commercially available software for analyzing genetic sequences operates on one sequence at a time, STITCH can manipulate multiple sequences simultaneously to perform the aforementioned operations. A typical analysis of several dozen sequences (length of the order of 103 base pairs) by use of STITCH is completed in a few minutes, whereas such an analysis performed by use of prior software takes hours or days.

  19. Genome Sequence of the Immunomodulatory Strain Bifidobacterium bifidum LMG 13195

    PubMed Central

    Gueimonde, Miguel; Ventura, Marco; Margolles, Abelardo


    In this work, we report the genome sequences of Bifidobacterium bifidum strain LMG13195. Results from our research group show that this strain is able to interact with human immune cells, generating functional regulatory T cells. PMID:23209243

  20. 75 FR 61531 - Issuance of Regulatory Guide

    Federal Register 2010, 2011, 2012, 2013, 2014


    ... E. Norris, Component Integrity Branch, Division of Engineering, Office of Nuclear Regulatory... From the Federal Register Online via the Government Publishing Office NUCLEAR REGULATORY COMMISSION Issuance of Regulatory Guide AGENCY: Nuclear Regulatory Commission. ACTION: Notice. SUMMARY:...

  1. Automatic Command Sequence Generation

    NASA Technical Reports Server (NTRS)

    Fisher, Forest; Gladded, Roy; Khanampompan, Teerapat


    Automatic Sequence Generator (Autogen) Version 3.0 software automatically generates command sequences for the Mars Reconnaissance Orbiter (MRO) and several other JPL spacecraft operated by the multi-mission support team. Autogen uses standard JPL sequencing tools like APGEN, ASP, SEQGEN, and the DOM database to automate the generation of uplink command products, Spacecraft Command Message Format (SCMF) files, and the corresponding ground command products, DSN Keywords Files (DKF). Autogen supports all the major multi-mission mission phases including the cruise, aerobraking, mapping/science, and relay mission phases. Autogen is a Perl script, which functions within the mission operations UNIX environment. It consists of two parts: a set of model files and the autogen Perl script. Autogen encodes the behaviors of the system into a model and encodes algorithms for context sensitive customizations of the modeled behaviors. The model includes knowledge of different mission phases and how the resultant command products must differ for these phases. The executable software portion of Autogen, automates the setup and use of APGEN for constructing a spacecraft activity sequence file (SASF). The setup includes file retrieval through the DOM (Distributed Object Manager), an object database used to store project files. This step retrieves all the needed input files for generating the command products. Depending on the mission phase, Autogen also uses the ASP (Automated Sequence Processor) and SEQGEN to generate the command product sent to the spacecraft. Autogen also provides the means for customizing sequences through the use of configuration files. By automating the majority of the sequencing generation process, Autogen eliminates many sequence generation errors commonly introduced by manually constructing spacecraft command sequences. Through the layering of commands into the sequence by a series of scheduling algorithms, users are able to rapidly and reliably construct the

  2. Genetic regulatory signatures underlying islet gene expression and type 2 diabetes

    PubMed Central

    Varshney, Arushi; Scott, Laura J.; Welch, Ryan P.; Erdos, Michael R.; Chines, Peter S.; Narisu, Narisu; Albanus, Ricardo D’O.; Orchard, Peter; Wolford, Brooke N.; Kursawe, Romy; Vadlamudi, Swarooparani; Cannon, Maren E.; Didion, John P.; Hensley, John; Kirilusha, Anthony; Bonnycastle, Lori L.; Taylor, D. Leland; Watanabe, Richard; Mohlke, Karen L.; Boehnke, Michael; Collins, Francis S.; Parker, Stephen C. J.; Stitzel, Michael L.


    Genome-wide association studies (GWAS) have identified >100 independent SNPs that modulate the risk of type 2 diabetes (T2D) and related traits. However, the pathogenic mechanisms of most of these SNPs remain elusive. Here, we examined genomic, epigenomic, and transcriptomic profiles in human pancreatic islets to understand the links between genetic variation, chromatin landscape, and gene expression in the context of T2D. We first integrated genome and transcriptome variation across 112 islet samples to produce dense cis-expression quantitative trait loci (cis-eQTL) maps. Additional integration with chromatin-state maps for islets and other diverse tissue types revealed that cis-eQTLs for islet-specific genes are specifically and significantly enriched in islet stretch enhancers. High-resolution chromatin accessibility profiling using assay for transposase-accessible chromatin sequencing (ATAC-seq) in two islet samples enabled us to identify specific transcription factor (TF) footprints embedded in active regulatory elements, which are highly enriched for islet cis-eQTL. Aggregate allelic bias signatures in TF footprints enabled us de novo to reconstruct TF binding affinities genetically, which support the high-quality nature of the TF footprint predictions. Interestingly, we found that T2D GWAS loci were strikingly and specifically enriched in islet Regulatory Factor X (RFX) footprints. Remarkably, within and across independent loci, T2D risk alleles that overlap with RFX footprints uniformly disrupt the RFX motifs at high-information content positions. Together, these results suggest that common regulatory variations have shaped islet TF footprints and the transcriptome and that a confluent RFX regulatory grammar plays a significant role in the genetic component of T2D predisposition. PMID:28193859

  3. Genetic regulatory signatures underlying islet gene expression and type 2 diabetes.


    Varshney, Arushi; Scott, Laura J; Welch, Ryan P; Erdos, Michael R; Chines, Peter S; Narisu, Narisu; Albanus, Ricardo D'O; Orchard, Peter; Wolford, Brooke N; Kursawe, Romy; Vadlamudi, Swarooparani; Cannon, Maren E; Didion, John P; Hensley, John; Kirilusha, Anthony; Bonnycastle, Lori L; Taylor, D Leland; Watanabe, Richard; Mohlke, Karen L; Boehnke, Michael; Collins, Francis S; Parker, Stephen C J; Stitzel, Michael L


    Genome-wide association studies (GWAS) have identified >100 independent SNPs that modulate the risk of type 2 diabetes (T2D) and related traits. However, the pathogenic mechanisms of most of these SNPs remain elusive. Here, we examined genomic, epigenomic, and transcriptomic profiles in human pancreatic islets to understand the links between genetic variation, chromatin landscape, and gene expression in the context of T2D. We first integrated genome and transcriptome variation across 112 islet samples to produce dense cis-expression quantitative trait loci (cis-eQTL) maps. Additional integration with chromatin-state maps for islets and other diverse tissue types revealed that cis-eQTLs for islet-specific genes are specifically and significantly enriched in islet stretch enhancers. High-resolution chromatin accessibility profiling using assay for transposase-accessible chromatin sequencing (ATAC-seq) in two islet samples enabled us to identify specific transcription factor (TF) footprints embedded in active regulatory elements, which are highly enriched for islet cis-eQTL. Aggregate allelic bias signatures in TF footprints enabled us de novo to reconstruct TF binding affinities genetically, which support the high-quality nature of the TF footprint predictions. Interestingly, we found that T2D GWAS loci were strikingly and specifically enriched in islet Regulatory Factor X (RFX) footprints. Remarkably, within and across independent loci, T2D risk alleles that overlap with RFX footprints uniformly disrupt the RFX motifs at high-information content positions. Together, these results suggest that common regulatory variations have shaped islet TF footprints and the transcriptome and that a confluent RFX regulatory grammar plays a significant role in the genetic component of T2D predisposition.

  4. TFM-Explorer: mining cis-regulatory regions in genomes

    PubMed Central

    Tonon, Laurie; Varré, Jean-Stéphane


    DNA-binding transcription factors (TFs) play a central role in transcription regulation, and computational approaches that help in elucidating complex mechanisms governing this basic biological process are of great use. In this perspective, we present the TFM-Explorer web server that is a toolbox to identify putative TF binding sites within a set of upstream regulatory sequences of genes sharing some regulatory mechanisms. TFM-Explorer finds local regions showing overrepresentation of binding sites. Accepted organisms are human, mouse, rat, chicken and drosophila. The server employs a number of features to help users to analyze their data: visualization of selected binding sites on genomic sequences, and selection of cis-regulatory modules. TFM-Explorer is available at PMID:20522509

  5. Fungal regulatory evolution: cis and trans in the balance

    PubMed Central

    Thompson, Dawn Anne; Regev, Aviv


    Regulatory divergence is likely a major driving force in evolution. Comparative genomics is being increasingly used to infer the evolution of gene regulation. Ascomycota fungi are uniquely suited among eukaryotes for regulatory evolution studies, due to broad phylogenetic scope, many sequenced genomes, and tractability of genomic analysis. Here we review recent advances in the identification of the contribution of cis and trans factors to expression divergence. Whereas current strategies have led to the discovery of surprising signatures and mechanisms, we still understand very little about the adaptive role of regulatory evolution. Empirical studies including experimental evolution, comparative functional genomics and hybrid and engineered strains are showing early promise toward deciphering the contribution of regulatory divergence to adaptation. PMID:19914250

  6. Common Tests for Arrhythmia


    ... Venous Thromboembolism Aortic Aneurysm More Common Tests for Arrhythmia Updated:Dec 21,2016 Several tests can help ... View an animation of arrhythmia . Common Tests for Arrhythmia Holter monitor (continuous ambulatory electrocardiographic monitor) Suspected arrhythmias ...

  7. Finding Common Ground with the Common Core

    ERIC Educational Resources Information Center

    Moisan, Heidi


    This article examines the journey of museum educators at the Chicago History Museum in understanding the Common Core State Standards and implementing them in our work with the school audience. The process raised questions about our teaching philosophy and our responsibility to our audience. Working with colleagues inside and outside of our…

  8. How Common Is the Common Core?

    ERIC Educational Resources Information Center

    Thomas, Amande; Edson, Alden J.


    Since the introduction of the Common Core State Standards for Mathematics (CCSSM) in 2010, stakeholders in adopting states have engaged in a variety of activities to understand CCSSM standards and transition from previous state standards. These efforts include research, professional development, assessment and modification of curriculum resources,…

  9. Analyses of Expressed Sequence Tags from Apple1

    PubMed Central

    Newcomb, Richard D.; Crowhurst, Ross N.; Gleave, Andrew P.; Rikkerink, Erik H.A.; Allan, Andrew C.; Beuning, Lesley L.; Bowen, Judith H.; Gera, Emma; Jamieson, Kim R.; Janssen, Bart J.; Laing, William A.; McArtney, Steve; Nain, Bhawana; Ross, Gavin S.; Snowden, Kimberley C.; Souleyre, Edwige J.F.; Walton, Eric F.; Yauk, Yar-Khing


    The domestic apple (Malus domestica; also known as Malus pumila Mill.) has become a model fruit crop in which to study commercial traits such as disease and pest resistance, grafting, and flavor and health compound biosynthesis. To speed the discovery of genes involved in these traits, develop markers to map genes, and breed new cultivars, we have produced a substantial expressed sequence tag collection from various tissues of apple, focusing on fruit tissues of the cultivar Royal Gala. Over 150,000 expressed sequence tags have been collected from 43 different cDNA libraries representing 34 different tissues and treatments. Clustering of these sequences results in a set of 42,938 nonredundant sequences comprising 17,460 tentative contigs and 25,478 singletons, together representing what we predict are approximately one-half the expressed genes from apple. Many potential molecular markers are abundant in the apple transcripts. Dinucleotide repeats are found in 4,018 nonredundant sequences, mainly in the 5′-untranslated region of the gene, with a bias toward one repeat type (containing AG, 88%) and against another (repeats containing CG, 0.1%). Trinucleotide repeats are most common in the predicted coding regions and do not show a similar degree of sequence bias in their representation. Bi-allelic single-nucleotide polymorphisms are highly abundant with one found, on average, every 706 bp of transcribed DNA. Predictions of the numbers of representatives from protein families indicate the presence of many genes involved in disease resistance and the biosynthesis of flavor and health-associated compounds. Comparisons of some of these gene families with Arabidopsis (Arabidopsis thaliana) suggest instances where there have been duplications in the lineages leading to apple of biosynthetic and regulatory genes that are expressed in fruit. This resource paves the way for a concerted functional genomics effort in this important temperate fruit crop. PMID:16531485

  10. Effects of Four Different Regulatory Mechanisms on the Dynamics of Gene Regulatory Cascades

    PubMed Central

    Hansen, Sabine; Krishna, Sandeep; Semsey, Szabolcs; Lo Svenningsen, Sine


    Gene regulatory cascades (GRCs) are common motifs in cellular molecular networks. A given logical function in these cascades, such as the repression of the activity of a transcription factor, can be implemented by a number of different regulatory mechanisms. The potential consequences for the dynamic performance of the GRC of choosing one mechanism over another have not been analysed systematically. Here, we report the construction of a synthetic GRC in Escherichia coli, which allows us for the first time to directly compare and contrast the dynamics of four different regulatory mechanisms, affecting the transcription, translation, stability, or activity of a transcriptional repressor. We developed a biologically motivated mathematical model which is sufficient to reproduce the response dynamics determined by experimental measurements. Using the model, we explored the potential response dynamics that the constructed GRC can perform. We conclude that dynamic differences between regulatory mechanisms at an individual step in a GRC are often concealed in the overall performance of the GRC, and suggest that the presence of a given regulatory mechanism in a certain network environment does not necessarily mean that it represents a single optimal evolutionary solution. PMID:26184971

  11. Conservation and evolution of cis-regulatory systems in ascomycete fungi

    SciTech Connect

    Gasch, Audrey P.; Moses, Alan M.; Chiang, Derek Y.; Fraser, Hunter B.; Berardini, Mark; Eisen, Michael B.


    Relatively little is known about the mechanisms through which gene expression regulation evolves. To investigate this, we systematically explored the conservation of regulatory networks in fungi by examining the cis-regulatory elements that govern the expression of coregulated genes. We first identified groups of coregulated Saccharomyces cerevisiae genes enriched for genes with known upstream or downstream cis-regulatory sequences. Reasoning that many of these gene groups are coregulated in related species as well, we performed similar analyses on orthologs of coregulated S. cerevisiae genes in 13 other ascomycete species. We find that many species-specific gene groups are enriched for the same flanking regulatory sequences as those found in the orthologous gene groups from S. cerevisiae, indicating that those regulatory systems have been conserved in multiple ascomycete species. In addition to these clear cases of regulatory conservation, we find examples of cis-element evolution that suggest multiple modes of regulatory diversification, including alterations in transcription factor-binding specificity, incorporation of new gene targets into an existing regulatory system, and cooption of regulatory systems to control a different set of genes. We investigated one example in greater detail by measuring the in vitro activity of the S. cerevisiae transcription factor Rpn4p and its orthologs from Candida albicans and Neurospora crassa. Our results suggest that the DNA binding specificity of these proteins has coevolved with the sequences found upstream of the Rpn4p target genes and suggest that Rpn4p has a different function in N. crassa.

  12. Canonical Commonality Analysis.

    ERIC Educational Resources Information Center

    Leister, K. Dawn

    Commonality analysis is a method of partitioning variance that has advantages over more traditional "OVA" methods. Commonality analysis indicates the amount of explanatory power that is "unique" to a given predictor variable and the amount of explanatory power that is "common" to or shared with at least one predictor…

  13. Knowledge representation for commonality

    NASA Technical Reports Server (NTRS)

    Yeager, Dorian P.


    Domain-specific knowledge necessary for commonality analysis falls into two general classes: commonality constraints and costing information. Notations for encoding such knowledge should be powerful and flexible and should appeal to the domain expert. The notations employed by the Commonality Analysis Problem Solver (CAPS) analysis tool are described. Examples are given to illustrate the main concepts.

  14. Comprehensive Rare Variant Analysis via Whole-Genome Sequencing to Determine the Molecular Pathology of Inherited Retinal Disease.


    Carss, Keren J; Arno, Gavin; Erwood, Marie; Stephens, Jonathan; Sanchis-Juan, Alba; Hull, Sarah; Megy, Karyn; Grozeva, Detelina; Dewhurst, Eleanor; Malka, Samantha; Plagnol, Vincent; Penkett, Christopher; Stirrups, Kathleen; Rizzo, Roberta; Wright, Genevieve; Josifova, Dragana; Bitner-Glindzicz, Maria; Scott, Richard H; Clement, Emma; Allen, Louise; Armstrong, Ruth; Brady, Angela F; Carmichael, Jenny; Chitre, Manali; Henderson, Robert H H; Hurst, Jane; MacLaren, Robert E; Murphy, Elaine; Paterson, Joan; Rosser, Elisabeth; Thompson, Dorothy A; Wakeling, Emma; Ouwehand, Willem H; Michaelides, Michel; Moore, Anthony T; Webster, Andrew R; Raymond, F Lucy


    Inherited retinal disease is a common cause of visual impairment and represents a highly heterogeneous group of conditions. Here, we present findings from a cohort of 722 individuals with inherited retinal disease, who have had whole-genome sequencing (n = 605), whole-exome sequencing (n = 72), or both (n = 45) performed, as part of the NIHR-BioResource Rare Diseases research study. We identified pathogenic variants (single-nucleotide variants, indels, or structural variants) for 404/722 (56%) individuals. Whole-genome sequencing gives unprecedented power to detect three categories of pathogenic variants in particular: structural variants, variants in GC-rich regions, which have significantly improved coverage compared to whole-exome sequencing, and variants in non-coding regulatory regions. In addition to previously reported pathogenic regulatory variants, we have identified a previously unreported pathogenic intronic variant in CHM in two males with choroideremia. We have also identified 19 genes not previously known to be associated with inherited retinal disease, which harbor biallelic predicted protein-truncating variants in unsolved cases. Whole-genome sequencing is an increasingly important comprehensive method with which to investigate the genetic causes of inherited retinal disease.

  15. Transcriptome Analysis of an Insecticide Resistant Housefly Strain: Insights about SNPs and Regulatory Elements in Cytochrome P450 Genes

    PubMed Central

    Asp, Torben; Kristensen, Michael


    Background Insecticide resistance in the housefly, Musca domestica, has been investigated for more than 60 years. It will enter a new era after the recent publication of the housefly genome and the development of multiple next generation sequencing technologies. The genetic background of the xenobiotic response can now be investigated in greater detail. Here, we investigate the 454-pyrosequencing transcriptome of the spinosad-resistant 791spin strain in relation to the housefly genome with focus on P450 genes. Results The de novo assembly of clean reads gave 35,834 contigs consisting of 21,780 sequences of the spinosad resistant strain. The 3,648 sequences were annotated with an enzyme code EC number and were mapped to 124 KEGG pathways with metabolic processes as most highly represented pathway. One hundred and twenty contigs were annotated as P450s covering 44 different P450 genes of housefly. Eight differentially expressed P450s genes were identified and investigated for SNPs, CpG islands and common regulatory motifs in promoter and coding regions. Functional annotation clustering of metabolic related genes and motif analysis of P450s revealed their association with epigenetic, transcription and gene expression related functions. The sequence variation analysis resulted in 12 SNPs and eight of them found in cyp6d1. There is variation in location, size and frequency of CpG islands and specific motifs were also identified in these P450s. Moreover, identified motifs were associated to GO terms and transcription factors using bioinformatic tools. Conclusion Transcriptome data of a spinosad resistant strain provide together with genome data fundamental support for future research to understand evolution of resistance in houseflies. Here, we report for the first time the SNPs, CpG islands and common regulatory motifs in differentially expressed P450s. Taken together our findings will serve as a stepping stone to advance understanding of the mechanism and role of P450s

  16. Returning common sense to regulations

    SciTech Connect

    Fox, M.R.


    While these sessions of the November 1995 meeting of the American Nuclear Society are being devoted to the Linear Theory of harm from radiation, it must be realized that the low-level radiation issue, as important as it may be, is but a subset of an entire body of environmental issues running afoul of common sense. Cellular phones, electromagnetic fields, asbestos, dioxin, acid rain, and others especially in their public portrayals, some in their regulatory treatment, are based upon exaggerated or misunderstood risks. One must recognize that what lies ahead is an immense effort to revisit the underlying science of the existing regulations of radiation exposures. New evidence has been published, and most importantly, it is now recognized that many of these regulations--promulgated with the best of intentions--have been extraordinarily harmful to the public. In many cases, the harm has been exaggerated, and has created in the public policy arena the notion that the public is at great risk from the smallest sources of radiation. The national cost of compliance with these regulations has been enormous. To the extent that existing environmental regulations are not being moderated, they pose major economic threats to present and future industries involving nuclear materials and technology. These would include the pharmaceutical industries as well as those seeking U.S. isotope markets in separations, purification, labeling, and manufacturing of new radiopharmaceuticals for cancer therapy, diagnosis, pain mitigation, treatment of arthritis, and other new applications. For those who are not aware of the results of recent advances in radiopharmaceuticals, clinical trials have demonstrated an 80% remission rate in the treatment of b-cell lymphoma and leukemia. New isotopes and new isotope technology promise greater effectiveness in the treatment of cancer and other diseases. The regulatory problems and their enormous costs exist at all stages in nuclear medicine, from the

  17. Promoter G-quadruplex sequences are targets for base oxidation and strand cleavage during hypoxia-induced transcription.


    Clark, David W; Phang, Tzu; Edwards, Michael G; Geraci, Mark W; Gillespie, Mark N


    The G-quadruplex, a non-B DNA motif that forms in certain G-rich sequences, is often located near transcription start sites in growth regulatory genes. Multiple lines of evidence show that reactive oxygen species generated as second messengers during physiologic signaling target specific DNA sequences for oxidative base modifications. Because guanine repeats are uniquely sensitive to oxidative damage, and G4 sequences are known "hot spots" for genetic mutation and DNA translocation, we hypothesized that G4 sequences are targeted for oxidative base modifications in hypoxic signaling. Approximately 25% of hypoxia-regulated genes in pulmonary artery endothelial cells harbored G4 sequences within their promoters. Chromatin immunoprecipitation showed that common base oxidation product 8-oxoguanine was selectively introduced into G4s, in promoters of hypoxia up-, down-, and nonregulated genes. Additionally, base excision DNA repair (BER) enzymes were recruited, and transient strand breaks formed in these sequences. Transcription factor Sp1, constitutively bound to G4 sequences in normoxia, was evicted as 8-oxoguanine accumulated during hypoxic exposure. Blocking hypoxia-induced oxidant production prevented both base modifications and decreased Sp1 binding. These findings suggest that oxidant stress in hypoxia causes oxidative base modifications, recruitment of BER enzymes, and transient strand breaks in G4 promoter sequences potentially altering G4 integrity and function.

  18. Development of candidate gene markers associated to common bacterial blight resistance in common bean

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Common bacterial blight (CBB), caused by Xanthomonas axonopodis pv. phaseoli (Xap), is a major yield-limiting factor of common bean (Phaseolus vulgaris L.) production around the world. Two major CBB-resistant quantitative trait loci (QTL), linked to the sequence characterized amplified region marker...

  19. Comprehensive genomic studies: emerging regulatory, strategic, and quality assurance challenges for biorepositories.


    McDonald, Sandra A; Mardis, Elaine R; Ota, David; Watson, Mark A; Pfeifer, John D; Green, Jonathan M


    As part of the molecular revolution sweeping medicine, comprehensive genomic studies are adding powerful dimensions to medical research. However, their power exposes new regulatory, strategic, and quality assurance challenges for biorepositories. A key issue is that unlike other research techniques commonly applied to banked specimens, nucleic acid