Science.gov

Sample records for repetitive extragenic palindromes

  1. Repetitive extragenic palindromic elements within the genomes of biocontrol Pseudomonas spp.

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Repetitive extragenic palindromic (REP) sequence elements have been identified within the genome sequences of many bacterial species, including a number of animal and plant pathogenic Pseudomonas spp. Several functions have been proposed for these sequences, e.g., binding or target sites for DNA rep...

  2. Genomic fingerprinting Acinetobacter baumannii: amplification of multiple inter-repetitive extragenic palindromic sequences.

    PubMed

    Sheehan, C; Lynch, M; Cullen, C; Cryan, B; Greer, P; Fanning, S

    1995-09-01

    Acinetobacter species are important nosocomial pathogens. A rapid and sensitive identification system, capable of providing strain identity at the genetic level, is required to identify outbreak strains and facilitate the early implementation of infection control procedures. Repetitive extragenic palindromic (REP) elements, have been identified in numerous bacteria and these genomic sequences provide useful targets for DNA amplification. A method for amplifying inter-REP DNA sequences, REP-multiple arbitrary amplicon profiling (REP-MAAP), is described and applied to 29 Acinetobacter baumannii from clinical samples. Amplified polymorphic DNA patterns were demonstrated for all isolates and those displaying identical REP-MAAP patterns were considered identical at the genetic level. In the spring of 1993, 10 intensive care unit patients had endotracheal colonization with A. baumannii (five with REP-MAAP I and five with REP-MAAP II patterns). These findings suggested nosocomial transmission of organisms which was terminated by standard infection control measures. No further A. baumannii were detected until the winter of 1993 when isolates of different REP-MAAP groups emerged, suggesting that factors other than nosocomial transmission were implicated.

  3. Clonal Relationship and Differentiation among Mycobacterium abscessus Isolates as Determined Using the Semiautomated Repetitive Extragenic Palindromic Sequence PCR-Based DiversiLab System

    PubMed Central

    Mougari, Faiza; Raskine, Laurent; Ferroni, Agnes; Marcon, Estelle; Sermet-Gaudelus, Isabelle; Veziris, Nicolas; Heym, Beate; Gaillard, Jean-Louis; Nassif, Xavier

    2014-01-01

    Mycobacterium abscessus is a rapidly growing mycobacterium that causes respiratory tract infections in predisposed patients, such as those with cystic fibrosis and nosocomial skin and soft tissue infections. In order to investigate the clonal relationships between the strains causing epidemic episodes, we evaluated the discriminatory power of the semiautomated DiversiLab (DL) repetitive extragenic palindromic sequence PCR (REP-PCR) test for M. abscessus genotyping. Since M. abscessus was shown to be composed of subspecies (M. abscessus subsp. massiliense, M. abscessus subsp. bolletii, and M. abscessus subsp. abscessus), we also evaluated the ability of this technique to differentiate subspecies. The technique was applied to two collections of clinical isolates, (i) 83 M. abscessus original isolates (43 M. abscessus subsp. abscessus, 12 M. abscessus subsp. bolletii, and 28 M. abscessus subsp. massiliense) from infected patients and (ii) 35 repeated isolates obtained over 1 year from four cystic fibrosis patients. The DL REP-PCR test was standardized for DNA extraction, DNA amplification, and electrophoresis pattern comparisons. Among the isolates from distinct patients, 53/83 (62%) isolates showed a specific pattern, and 30 were distributed in 11 clusters and 6 patterns, with 2 to 4 isolates per pattern. The clusters and patterns did not fully correlate with multilocus sequence typing (MLST) analysis results. This revealed a high genomic diversity between patients, with a discriminatory power of 98% (Simpson's diversity index). However, since some isolates shared identical patterns, this raises the question of whether it is due to transmission between patients or a common reservoir. Multiple isolates from the same patient showed identical patterns, except for one patient infected by two strains. Between the M. abscessus subspecies, the indexes were <70%, indicating that the DL REP-PCR test is not an accurate tool for identifying organisms to the subspecies level

  4. Clonal relationship and differentiation among Mycobacterium abscessus isolates as determined using the semiautomated repetitive extragenic palindromic sequence PCR-based DiversiLab system.

    PubMed

    Mougari, Faiza; Raskine, Laurent; Ferroni, Agnes; Marcon, Estelle; Sermet-Gaudelus, Isabelle; Veziris, Nicolas; Heym, Beate; Gaillard, Jean-Louis; Nassif, Xavier; Cambau, Emmanuelle

    2014-06-01

    Mycobacterium abscessus is a rapidly growing mycobacterium that causes respiratory tract infections in predisposed patients, such as those with cystic fibrosis and nosocomial skin and soft tissue infections. In order to investigate the clonal relationships between the strains causing epidemic episodes, we evaluated the discriminatory power of the semiautomated DiversiLab (DL) repetitive extragenic palindromic sequence PCR (REP-PCR) test for M. abscessus genotyping. Since M. abscessus was shown to be composed of subspecies (M. abscessus subsp. massiliense, M. abscessus subsp. bolletii, and M. abscessus subsp. abscessus), we also evaluated the ability of this technique to differentiate subspecies. The technique was applied to two collections of clinical isolates, (i) 83 M. abscessus original isolates (43 M. abscessus subsp. abscessus, 12 M. abscessus subsp. bolletii, and 28 M. abscessus subsp. massiliense) from infected patients and (ii) 35 repeated isolates obtained over 1 year from four cystic fibrosis patients. The DL REP-PCR test was standardized for DNA extraction, DNA amplification, and electrophoresis pattern comparisons. Among the isolates from distinct patients, 53/83 (62%) isolates showed a specific pattern, and 30 were distributed in 11 clusters and 6 patterns, with 2 to 4 isolates per pattern. The clusters and patterns did not fully correlate with multilocus sequence typing (MLST) analysis results. This revealed a high genomic diversity between patients, with a discriminatory power of 98% (Simpson's diversity index). However, since some isolates shared identical patterns, this raises the question of whether it is due to transmission between patients or a common reservoir. Multiple isolates from the same patient showed identical patterns, except for one patient infected by two strains. Between the M. abscessus subspecies, the indexes were <70%, indicating that the DL REP-PCR test is not an accurate tool for identifying organisms to the subspecies level

  5. Genetic relationships among strains of Xanthomonas fragariae based on random amplified polymorphic DNA PCR, repetitive extragenic palindromic PCR, and enterobacterial repetitive intergenic consensus PCR data and generation of multiplexed PCR primers useful for the identification of this phytopathogen.

    PubMed Central

    Pooler, M R; Ritchie, D F; Hartung, J S

    1996-01-01

    Genetic relationships among 25 isolates of Xanthomonas fragariae from diverse geographic regions were determined by three PCR methods that rely on different amplification priming strategies: random amplified polymorphic DNA (RAPD) PCR, repetitive extragenic palindromic (REP) PCR, and enterobacterial repetitive intergenic consensus (ERIC) PCR. The results of these assays are mutually consistent and indicate that pathogenic strains are very closely related to each other. RAPD, ERIC, and REP PCR assays identified nine, four, and two genotypes, respectively, within X. fragariae isolates. A single nonpathogenic isolate of X. fragariae was not distinguishable by these methods. The results of the PCR assays were also fully confirmed by physiological tests. There was no correlation between DNA amplification product patterns and geographic sites of isolation, suggesting that this bacterium has spread largely through exchange of infected plant germ plasm. Sequences identified through the RAPD assays were used to develop three primer pairs for standard PCR assays to identify X. fragariae. In addition, we developed a stringent multiplexed PCR assay to identify X. fragariae by simultaneously using the three independently derived sets of primers specific for pathogenic strains of the bacteria. PMID:8795198

  6. Genotypic Characterization of Bradyrhizobium Strains Nodulating Endemic Woody Legumes of the Canary Islands by PCR-Restriction Fragment Length Polymorphism Analysis of Genes Encoding 16S rRNA (16S rDNA) and 16S-23S rDNA Intergenic Spacers, Repetitive Extragenic Palindromic PCR Genomic Fingerprinting, and Partial 16S rDNA Sequencing

    PubMed Central

    Vinuesa, Pablo; Rademaker, Jan L. W.; de Bruijn, Frans J.; Werner, Dietrich

    1998-01-01

    We present a phylogenetic analysis of nine strains of symbiotic nitrogen-fixing bacteria isolated from nodules of tagasaste (Chamaecytisus proliferus) and other endemic woody legumes of the Canary Islands, Spain. These and several reference strains were characterized genotypically at different levels of taxonomic resolution by computer-assisted analysis of 16S ribosomal DNA (rDNA) PCR-restriction fragment length polymorphisms (PCR-RFLPs), 16S-23S rDNA intergenic spacer (IGS) RFLPs, and repetitive extragenic palindromic PCR (rep-PCR) genomic fingerprints with BOX, ERIC, and REP primers. Cluster analysis of 16S rDNA restriction patterns with four tetrameric endonucleases grouped the Canarian isolates with the two reference strains, Bradyrhizobium japonicum USDA 110spc4 and Bradyrhizobium sp. strain (Centrosema) CIAT 3101, resolving three genotypes within these bradyrhizobia. In the analysis of IGS RFLPs with three enzymes, six groups were found, whereas rep-PCR fingerprinting revealed an even greater genotypic diversity, with only two of the Canarian strains having similar fingerprints. Furthermore, we show that IGS RFLPs and even very dissimilar rep-PCR fingerprints can be clustered into phylogenetically sound groupings by combining them with 16S rDNA RFLPs in computer-assisted cluster analysis of electrophoretic patterns. The DNA sequence analysis of a highly variable 264-bp segment of the 16S rRNA genes of these strains was found to be consistent with the fingerprint-based classification. Three different DNA sequences were obtained, one of which was not previously described, and all belonged to the B. japonicum/Rhodopseudomonas rDNA cluster. Nodulation assays revealed that none of the Canarian isolates nodulated Glycine max or Leucaena leucocephala, but all nodulated Acacia pendula, C. proliferus, Macroptilium atropurpureum, and Vigna unguiculata. PMID:9603820

  7. Indole acetic acid production by fluorescent Pseudomonas spp. from the rhizosphere of Plectranthus amboinicus (Lour.) Spreng. and their variation in extragenic repetitive DNA sequences.

    PubMed

    Sethia, Bedhya; Mustafa, Mariam; Manohar, Sneha; Patil, Savita V; Jayamohan, Nellickal Subramanian; Kumudini, Belur Satyan

    2015-06-01

    Fluorescent Pseudomonas (FP) is a heterogenous group of growth promoting rhizobacteria that regulate plant growth by releasing secondary metabolic compounds viz., indole acetic acid (IAA), siderophores, ammonia and hydrogen cyanide. In the present study, IAA producing FPs from the rhizosphere of Plectranthus amboinicus were characterized morphologically, biochemically and at the molecular level. Molecular identification of the isolates were carried out using Pseudomonas specific primers. The effect of varying time (24, 48, 72 and 96 h), Trp concentrations (100, 200, 300, 400 and 500 μg x ml(-1)), temperature (10, 26, 37 and 50 ± 2 degrees C) and pH (6, 7 and 8) on IAA production by 10 best isolates were studied. Results showed higher IAA production at 72 h incubation, at 300 μg x ml(-1) Trp concentration, temperature 26 ± 2 degrees C and pH 7. TLC with acidified ethyl acetate extract showed that the IAA produced has a similar Rf value to that of the standard IAA. Results of TLC were confirmed by HPLC analysis. Genetic diversity of the isolates was also studied using 40 RAPD and 4 Rep primers. Genetic diversity parameters such as dominance, Shannon index and Simpson index were calculated. Out of 40 RAPD primers tested, 9 (2 OP-D series and 7 OP-E series) were shortlisted for further analysis. Studies using RAPD, ERIC, BOX, REP and GTG5 primers revealed that isolates exhibit significant diversity in repetitive DNA sequences irrespective of the rhizosphere. PMID:26155673

  8. GTAG- and CGTC-tagged palindromic DNA repeats in prokaryotes

    PubMed Central

    2013-01-01

    Background REPs (Repetitive Extragenic Palindromes) are small (20–40 bp) palindromic repeats found in high copies in some prokaryotic genomes, hypothesized to play a role in DNA supercoiling, transcription termination, mRNA stabilization. Results We have monitored a large number of REP elements in prokaryotic genomes, and found that most can be sorted into two large DNA super-families, as they feature at one end unpaired motifs fitting either the GTAG or the CGTC consensus. Tagged REPs have been identified in >80 species in 8 different phyla. GTAG and CGTC repeats reside predominantly in microorganisms of the gamma and alpha division of Proteobacteria, respectively. However, the identification of members of both super- families in deeper branching phyla such Cyanobacteria and Planctomycetes supports the notion that REPs are old components of the bacterial chromosome. On the basis of sequence content and overall structure, GTAG and CGTC repeats have been assigned to 24 and 4 families, respectively. Of these, some are species-specific, others reside in multiple species, and several organisms contain different REP types. In many families, most units are close to each other in opposite orientation, and may potentially fold into larger secondary structures. In different REP-rich genomes the repeats are predominantly located between unidirectionally and convergently transcribed ORFs. REPs are predominantly located downstream from coding regions, and many are plausibly transcribed and function as RNA elements. REPs located inside genes have been identified in several species. Many lie within replication and global genome repair genes. It has been hypothesized that GTAG REPs are miniature transposons mobilized by specific transposases known as RAYTs (REP associated tyrosine transposases). RAYT genes are flanked either by GTAG repeats or by long terminal inverted repeats (TIRs) unrelated to GTAG repeats. Moderately abundant families of TIRs have been identified in

  9. Why Chromosome Palindromes?

    PubMed Central

    Betrán, Esther; Demuth, Jeffery P.; Williford, Anna

    2012-01-01

    We look at sex-limited chromosome (Y or W) evolution with particular emphasis on the importance of palindromes. Y chromosome palindromes consist of inverted duplicates that allow for local recombination in an otherwise nonrecombining chromosome. Since palindromes enable intrachromosomal gene conversion that can help eliminate deleterious mutations, they are often highlighted as mechanisms to protect against Y degeneration. However, the adaptive significance of recombination resides in its ability to decouple the evolutionary fates of linked mutations, leading to both a decrease in degeneration rate and an increase in adaptation rate. Our paper emphasizes the latter, that palindromes may exist to accelerate adaptation by increasing the potential targets and fixation rates of incoming beneficial mutations. This hypothesis helps reconcile two enigmatic features of the “palindromes as protectors” view: (1) genes that are not located in palindromes have been retained under purifying selection for tens of millions of years, and (2) under models that only consider deleterious mutations, gene conversion benefits duplicate gene maintenance but not initial fixation. We conclude by looking at ways to test the hypothesis that palindromes enhance the rate of adaptive evolution of Y-linked genes and whether this effect can be extended to palindromes on other chromosomes. PMID:22844637

  10. Analysis of relationships among isolates of Citrobacter diversus by using DNA fingerprints generated by repetitive sequence-based primers in the polymerase chain reaction.

    PubMed Central

    Woods, C R; Versalovic, J; Koeuth, T; Lupski, J R

    1992-01-01

    Oligonucleotide probes which match consensus sequences of the repetitive extragenic palindromic (REP) element hybridize to genomic DNA of diverse bacterial species. Primers based on the REP sequence generate complex band patterns with genomic DNA in the polymerase chain reaction (PCR), a technique named REP-PCR. We used REP-PCR with genomic DNA to fingerprint 47 isolates of Citrobacter diversus. Previously, 37 were assigned electrophoretic types (ETs) by multilocus enzyme electrophoresis and 35 were evaluated by using outer membrane protein profiles. Fingerprints were compared by visual inspection and by similarity coefficients (SimCs) based on the number of common bands versus total bands between two given isolates. DNA fingerprints were highly similar visually for patient pairs and outbreak-related sets. SimCs for these were > or = 0.952. Fingerprints of isolates with different ETs generally were distinctive. Among 21 unrelated isolates representing 15 ETs, only 6 of 210 comparisons had SimCs of > or = 0.952. REP-PCR rapidly generated DNA fingerprints which were highly similar for epidemiologically linked isolates of C. diversus and distinct for previously characterized strains within this species. The ability of this method to discriminate between C. diversus isolates with the same biotype was similar to that of multilocus enzyme electrophoresis and outer membrane protein profiles. REP-PCR may be useful in evaluation of apparent outbreaks of this or other bacterial species which possess these extragenic, repetitive elements. Images PMID:1452663

  11. Analysis of the pan genome of Campylobacter jejuni isolates recovered from poultry by pulsed-field gel electrophoresis, multilocus sequence typing (MLST), and repetitive sequence polymerase chain reaction (rep-PCR) reveals different discriminatory capabilities.

    PubMed

    Wilson, Melissa K; Lane, Alison B; Law, Bibiana F; Miller, William G; Joens, Lynn A; Konkel, Michael E; White, Bryan A

    2009-11-01

    Campylobacter jejuni is one of the leading bacterial causes of food-borne illness in the USA. Molecular typing methods are often used in food safety for identifying sources of infection and pathways of transmission. Moreover, the identification of genetically related isolates (i.e., clades) may facilitate the development of intervention strategies for control and prevention of food-borne diseases. We analyzed the pan genome (i.e., core and variable genes) of 63 C. jejuni isolates recovered from chickens raised in conventional, organic, and free-range poultry flocks to gain insight into the genetic diversity of C. jejuni isolates recovered from different environments. We assessed the discriminatory power of three genotyping methods [i.e., pulsed-field gel electrophoresis (PFGE), multilocus sequence typing (MLST), and repetitive extragenic palindromic polymerase chain reaction (rep-PCR)]. The rep-PCR fingerprint was generated by determining the presence of repetitive sequences that are interspersed throughout the genome via repetitive extragenic palindromic PCR, enterobacterial repetitive intergenic consensus sequence PCR (ERIC-PCR), and BOX element PCR (BOX-PCR) and combining the data to form a composite fingerprint. The genetic fingerprints were subjected to computer-assisted pattern analysis. Comparison of the three genotypic methods revealed that repREB-PCR showed greater discriminatory power than PFGE and MLST. ERIC-PCR and BOX-PCR yielded the highest number of PCR products and greatest reproducibility. Regardless of the genotyping method, C. jejuni isolates recovered from chickens reared in conventional, organic, and free-range environments all exhibit a high level of genotypic diversity.

  12. A W-linked palindrome and gene conversion in New World sparrows and blackbirds.

    PubMed

    Davis, Jamie K; Thomas, Pamela J; Thomas, James W

    2010-07-01

    A hallmark feature of the male-specific region of the human Y chromosome is the presence of large and near-identical palindromes. These palindromes are maintained in a state of near identity via gene conversion between the arms of the palindrome, and both neutral and selection-based theories have been proposed to explain their enrichment on the human Y and X chromosomes. While those proposed theories would be applicable to sex chromosomes in other species, it has not been established whether near-identical palindromes are a common feature of sex chromosomes in a broader range of taxa, including other tetrapods. Here, we report the genomic sequencing and features of a 279-kb region of the non-recombining portion of the W chromosome spanning the CHD1W locus in a New World sparrow, the white-throated sparrow (Zonotrichia albicollis), and the corresponding region on the Z chromosome. As has been observed for other Y and W chromosomes, we detected a high repetitive element content (51%) and low gene content on the white-throated sparrow W chromosome. In addition, we identified a 22-kb near-identical (>99%) palindrome on the W chromosome that flanks the 5' end of the CHD1W gene. Signatures of gene conversion were readily detected between the arms of this palindrome, as was the presence of this palindrome in other New World sparrows and blackbirds. Near-identical palindromes are therefore present on the avian W chromosome and may persist due to the same forces proposed for the enrichment of these elements on the human sex chromosomes.

  13. A W-linked palindrome and gene conversion in New World sparrows and blackbirds.

    PubMed

    Davis, Jamie K; Thomas, Pamela J; Thomas, James W

    2010-07-01

    A hallmark feature of the male-specific region of the human Y chromosome is the presence of large and near-identical palindromes. These palindromes are maintained in a state of near identity via gene conversion between the arms of the palindrome, and both neutral and selection-based theories have been proposed to explain their enrichment on the human Y and X chromosomes. While those proposed theories would be applicable to sex chromosomes in other species, it has not been established whether near-identical palindromes are a common feature of sex chromosomes in a broader range of taxa, including other tetrapods. Here, we report the genomic sequencing and features of a 279-kb region of the non-recombining portion of the W chromosome spanning the CHD1W locus in a New World sparrow, the white-throated sparrow (Zonotrichia albicollis), and the corresponding region on the Z chromosome. As has been observed for other Y and W chromosomes, we detected a high repetitive element content (51%) and low gene content on the white-throated sparrow W chromosome. In addition, we identified a 22-kb near-identical (>99%) palindrome on the W chromosome that flanks the 5' end of the CHD1W gene. Signatures of gene conversion were readily detected between the arms of this palindrome, as was the presence of this palindrome in other New World sparrows and blackbirds. Near-identical palindromes are therefore present on the avian W chromosome and may persist due to the same forces proposed for the enrichment of these elements on the human sex chromosomes. PMID:20535633

  14. Musical Palindromes for Liberal Arts Students

    ERIC Educational Resources Information Center

    von Renesse, Christine

    2012-01-01

    This paper shows how to teach a mathematics for liberal arts class in an inquiry-based way using ideas from music to launch the mathematical activities. No musical knowledge is required to understand and teach the material. The main activity is analyzing the differences between two kinds of rhythmic palindromes. The content is mathematically…

  15. Large-scale production of palindrome DNA fragments

    SciTech Connect

    Palmer, E.L.; Gewiess, A.; Harp, J.M.

    1995-10-10

    Our structural studies of nucleosomes necessitated the production of over 100 mg of a 146-bp perfect palindrome DNA for use in the reconstitution of perfectly symmetrical nucleosome core particles for detailed X-ray crystallographic analysis. The propagation of palindromic DNA sequences by bacterial culture is hindered by the instability of these sequences during bacterial replication and recombination. While the loss of some palindrome sequences can be elminated by the use of sbcB or sbcC mutants of Escherichia coli, not all palindrome-containing plasmids are faithfully maintained by these strains. The production of large quantities of palindrome DNA can therefore be extremely difficult. After trying several approaches, we were able to develop a reliable procedure for production of large quantities of palindrome DNA that involves production of plasmid containing multiple copies of the repeating unit of the palindrome which are isolated by restriction digestion and ligated in vitro to form the palindrome DNA. The procedure has resulted in the production of over 20 mg of a 146-bp DNA fragment in 2 weeks.

  16. 100 Repetitions

    ERIC Educational Resources Information Center

    Benson, Jeffrey

    2012-01-01

    One hundred repetitions--100 "useful" repetitions. This notion has guided the author's work in alternative education programs for almost 20 years, dealing with the most challenging students, from addicts to conduct-disordered adolescents to traumatized 5th graders. There are no magic tricks. The role of educators is to align with the healthy…

  17. Extragenic Suppressors of Mar2(sir3) Mutations in Saccharomyces Cerevisiae

    PubMed Central

    Lin, CIP.; Livi, G. P.; Ivy, J. M.; Klar, AJS.

    1990-01-01

    The silent mating-type genes (HML and HMR) of Saccharomyces cerevisiae are kept under negative transcriptional control by four trans-acting MAR (or SIR) loci. We have isolated extragenic suppressors of the mar2-1 mutation which, based on genetic complementation tests, define two additional loci involved in regulating the expression of HML and HMR. A strain with the genotype HMLa MATα HMRa mar2-1 is sterile due to the simultaneous expression of a and α information. Two mutants exhibiting an α phenotype (which may result from the restoration of MAR/SIR repression) were isolated and genetically characterized. The mutations in these strains: (1) are recessive, (2) are capable of suppressing a mar2-deletion mutation, (3) are unlinked to MAT, (4) complement one another as well as the previously identified sum1-1 mutation, and (5) are not new alleles of the known MAR/SIR loci. We designate these new regulatory loci SUM2 and SUM3 (supressor of mar). Unlike the sum1-1 mutation, suppression by sum2-1 and sum3-1 is mar2-locus specific. Both sum2-1 and sum3-1 affect the expression of a information at the HM loci. Transcript analysis shows a significant reduction in HMLa and HMRa gene transcription in mar2-1 sum2-1 and mar2-1 sum3-1 cells. Furthermore, we have found genetic evidence to suggest that mar2-1 sum2-1 cells exhibit only partial expression of silent α information. We conclude that the SUM2 and SUM3 gene products are required for expression of the HM loci and act downstream of the MAR2 (SIR3) gene function. Possible mechanisms for the action of the SUM gene products are discussed. PMID:2199314

  18. Intragenic and Extragenic Suppressors of Mutations in the Heptapeptide Repeat Domain of Saccharomyces Cerevisiae RNA Polymerase II

    PubMed Central

    Nonet, M. L.; Young, R. A.

    1989-01-01

    The largest subunit of RNA polymerase II contains a repeated heptapeptide sequence at its carboxy terminus. Yeast mutants with certain partial deletions of the carboxy-terminal repeat (CTR) domain are temperature-sensitive, cold-sensitive and are inositol auxotrophs. Intragenic and extragenic suppressors of the cold-sensitive phenotype of CTR domain deletion mutants were isolated and studied to investigate the function of this domain. Two types of intragenic suppressing mutations suppress the temperature-sensitivity, cold-sensitivity and inositol auxotrophy of CTR domain deletion mutants. Most intragenic mutations enlarge the repeat domain by duplicating various portions of the repeat coding sequence. Other intragenic suppressing mutations are point mutations in a conserved segment of the large subunit. An extragenic suppressing mutation (SRB2-1) was isolated that strongly suppresses the conditional and auxotrophic phenotypes of CTR domain mutations. The SRB2 gene was isolated and mapped, and an SRB2 partial deletion mutation (srb2Δ10) was constructed. The srb2Δ10 mutants are temperature-sensitive, cold-sensitive and are inositol auxotrophs. These phenotypes are characteristic of mutations in genes encoding components of the transcription apparatus. We propose that the SRB2 gene encodes a factor that is involved in RNA synthesis and may interact with the CTR domain of the large subunit of RNA polymerase II. PMID:2693207

  19. Palindromes drive the re-assortment in Influenza A.

    PubMed

    Zubaer, Abdullah; Thapa, Simrika

    2011-01-01

    Different subtypes of Influenza A virus are associated with species specific, zoonotic or pandemic Influenza. The cause of its severity underlies in complicated evolution of its segmented RNA genome. Although genetic shift and genetic drift are well known in the evolution of this virus, we reported the significant role of unique RNA palindromes in its evolution. Our computational approach identified the existence of unique palindromes in each subtype of Influenza A virus with its absence in Influenza B relating the fact of virulence and vigorous genetic hitchhiking in Influenza A. The current study focused on the re-assortment event responsible for the emergence of pandemic-2009 H1N1 virus, which is associated with outgrow of new palindrome and in turn, changing its RNA structure. We hypothesize that the change in RNA structure due to the presence of palindrome facilitates the event of re-assortment in Influenza A. Thus the evolutionary process of Influenza A is much more complicated as previously known, and that has been demonstrated in this study.

  20. Repetition reduction: Lexical repetition in the absence of referent repetition

    PubMed Central

    Lam, Tuan Q.; Watson, Duane G.

    2014-01-01

    Repeated words are produced with reduced acoustic prominence compared to words that are new to a discourse. Although these effects are often attributed to priming in the production system, the locus of the effect within the production system remains unresolved because in natural speech, repetition often involves repetition of referents and lexical items simultaneously. Therefore, repetition reduction could be due to repeated mention of a referent, or repetition of a word or referring expression. In our study, we test whether repetition reduction is due to repetition of lexical items or repeated mention of referents using an event description task. The results show that repeated lexical items lead to reduced duration and intensity even in the absence of referent repetition whereas repeated referents lead to reduced intensity alone. The general pattern suggests that repetition reduction is due most strongly to repetition of the lexical item, rather than repeated mention of the referent. PMID:24548320

  1. The 45-kb unit of major urinary protein gene organization is a gigantic imperfect palindrome.

    PubMed

    Bishop, J O; Selman, G G; Hickman, J; Black, L; Saunders, R D; Clark, A J

    1985-07-01

    The multigene family which codes for the mouse major urinary proteins consists of about 35 genes. Most of these are members of two distinct groups, group 1 and group 2. The group 1 and group 2 genes are organized in head-to-head pairs within 12 to 15 remarkably uniform chromosomal units or domains about 45 kilobase pairs (kb) in size. The 45-kb units are located on chromosome 4, and many of them are adjacent to each other. We propose that the 45-kb unit is a unit both of organization and of evolutionary change. In this study the homologies within the unit were observed by examining, in an electron microscope, heteroduplex and foldback structures made from cloned major urinary protein genes. These show that the 45-kb unit is a gigantic imperfect palindrome. Each arm of the palindrome contains two regions of inverted symmetry of 9.5 and 4.5 kb separated by a 3-kb nonsymmetrical region. We argue that the nonsymmetrical regions arose by a series of deletion events in the two arms of the palindrome. The center of the 45-kb unit is an 8-kb sequence without inverted symmetry flanked by the 9.5-kb regions, which contain the 4-kb genes and their immediate 5' and 3' flanking regions. The junction between adjacent 45-kb units is a 2- to 4-kb sequence without inverted symmetry flanked by the 4.5-kb regions. Some of the 45-kb units are arranged as direct tandem repeats. Others appear to be in inverted orientation with respect to a neighboring unit. Cloned major urinary protein genes show few incidences of the repetitive elements B1, B2, R, and MIF. Two elements, a B1 and an R, may be a constant feature of the 45-kb units. If so, in those cases in which the units are in tandem array, both of these elements will occur with a 45-kb periodicity. A comparison of corresponding parts of different 45-kb units shows that they differ because of a number of deletion or insertion events, particularly in the regions 3' to the genes.

  2. Repeat Sequences and Base Correlations in Human Y Chromosome Palindromes

    NASA Astrophysics Data System (ADS)

    Jin, Neng-zhi; Liu, Zi-xian; Qi, Yan-jiao; Qiu, Wen-yuan

    2009-06-01

    On the basis of information theory and statistical methods, we use mutual information, n-tuple entropy and conditional entropy, combined with biological characteristics, to analyze the long range correlation and short range correlation in human Y chromosome palindromes. The magnitude distribution of the long range correlation which can be reflected by the mutual information is P5>P5a>P5b (P5a and P5b are the sequences that replace solely Alu repeats and all interspersed repeats with random uncorrelated sequences in human Y chromosome palindrome 5, respectively); and the magnitude distribution of the short range correlation which can be reflected by the n-tuple entropy and the conditional entropy is P5>P5a>P5b>random uncorrelated sequence. In other words, when the Alu repeats and all interspersed repeats replace with random uncorrelated sequence, the long range and short range correlation decrease gradually. However, the random uncorrelated sequence has no correlation. This research indicates that more repeat sequences result in stronger correlation between bases in human Y chromosome. The analyses may be helpful to understand the special structures of human Y chromosome palindromes profoundly.

  3. Symmetry Analysis of an X-palindrome in Human and Chimpanzee

    NASA Astrophysics Data System (ADS)

    Qi, Yan-jiao; Qiu, Wen-yuan

    2009-08-01

    We analyze for the first time the rules of breaking in an X-palindrome between human and chimpanzee. Results indicate that although the overall changes that occurred in the human X-palindrome are fewer than in the chimpanzee, mutations occurring between the left arm and right arm were nearly equivalent both in human and chimpanzee when compared with orangutan, which implies evolutionary synchronization. However, there are many more A/T→G/C changes than G/C→A/T in a single arm, which would lead to an increasing trend in GC content and suggest that the composition is not at equilibrium. In addition, it is remarkable to find that there are much more asymmetrical nucleotide changes between the two arms of the human palindrome than that of the chimpanzee palindrome, and these mutations are prone to occur between bases with similar chemical structures. The symmetry seems higher in the chimpanzee palindrome than in the human X-palindrome.

  4. Extragenic Suppressors of Mutations in the Cytoplasmic C Terminus of Sec63 Define Five Genes in Saccharomyces Cerevisae

    PubMed Central

    Nelson, M. K.; Kurihara, T.; Silver, P. A.

    1993-01-01

    Mutations in the SEC63 gene of Saccharomyces cerevisiae affect both nuclear protein localization and translocation of proteins into the endoplasmic reticulum. We now report the isolation of suppressors of sec63-101 (formerly npl1-1), a temperature-sensitive allele of SEC63. Five complementation groups of extragenic mutations, son1-son5 (suppressor of npl1-1), were identified among the recessive suppressors. The son mutations are specific to SEC63, are not bypass suppressors, and are not new alleles of previously identified secretory (SEC61, SEC62, KAR2) or nuclear protein localization genes (NPL3, NPL4, NPL6). son1 mutations show regional specificity of suppression of sec63 alleles. At low temperatures, son1 mutants grow slowly and show partial mislocalization of nuclear antigens. The SON1 gene maps to chromosome IV and encodes a nuclear protein of 531 amino acids that contains two acidic stretches and a putative nuclear localization sequence. We show that son1 mutations suppress sec63-101 by elimination of Son1p function. PMID:8514125

  5. Clustered regularly interspaced short palindromic repeats (CRISPRs) analysis of members of the Mycobacterium tuberculosis complex.

    PubMed

    Botelho, Ana; Canto, Ana; Leão, Célia; Cunha, Mónica V

    2015-01-01

    Typical CRISPR (clustered, regularly interspaced, short palindromic repeat) regions are constituted by short direct repeats (DRs), interspersed with similarly sized non-repetitive spacers, derived from transmissible genetic elements, acquired when the cell is challenged with foreign DNA. The analysis of the structure, in number and nature, of CRISPR spacers is a valuable tool for molecular typing since these loci are polymorphic among strains, originating characteristic signatures. The existence of CRISPR structures in the genome of the members of Mycobacterium tuberculosis complex (MTBC) enabled the development of a genotyping method, based on the analysis of the presence or absence of 43 oligonucleotide spacers separated by conserved DRs. This method, called spoligotyping, consists on PCR amplification of the DR chromosomal region and recognition after hybridization of the spacers that are present. The workflow beneath this methodology implies that the PCR products are brought onto a membrane containing synthetic oligonucleotides that have complementary sequences to the spacer sequences. Lack of hybridization of the PCR products to a specific oligonucleotide sequence indicates absence of the correspondent spacer sequence in the examined strain. Spoligotyping gained great notoriety as a robust identification and typing tool for members of MTBC, enabling multiple epidemiological studies on human and animal tuberculosis.

  6. CRISPR Recognition Tool (CRT): a tool for automatic detection ofclustered regularly interspaced palindromic repeats

    SciTech Connect

    Bland, Charles; Ramsey, Teresa L.; Sabree, Fareedah; Lowe,Micheal; Brown, Kyndall; Kyrpides, Nikos C.; Hugenholtz, Philip

    2007-05-01

    Clustered Regularly Interspaced Palindromic Repeats (CRISPRs) are a novel type of direct repeat found in a wide range of bacteria and archaea. CRISPRs are beginning to attract attention because of their proposed mechanism; that is, defending their hosts against invading extrachromosomal elements such as viruses. Existing repeat detection tools do a poor job of identifying CRISPRs due to the presence of unique spacer sequences separating the repeats. In this study, a new tool, CRT, is introduced that rapidly and accurately identifies CRISPRs in large DNA strings, such as genomes and metagenomes. CRT was compared to CRISPR detection tools, Patscan and Pilercr. In terms of correctness, CRT was shown to be very reliable, demonstrating significant improvements over Patscan for measures precision, recall and quality. When compared to Pilercr, CRT showed improved performance for recall and quality. In terms of speed, CRT also demonstrated superior performance, especially for genomes containing large numbers of repeats. In this paper a new tool was introduced for the automatic detection of CRISPR elements. This tool, CRT, was shown to be a significant improvement over the current techniques for CRISPR identification. CRT's approach to detecting repetitive sequences is straightforward. It uses a simple sequential scan of a DNA sequence and detects repeats directly without any major conversion or preprocessing of the input. This leads to a program that is easy to describe and understand; yet it is very accurate, fast and memory efficient, being O(n) in space and O(nm/l) in time.

  7. Repetition Reduction: Lexical Repetition in the Absence of Referent Repetition

    ERIC Educational Resources Information Center

    Lam, Tuan Q.; Watson, Duane G.

    2014-01-01

    Compared to words that are new to a discourse, repeated words are produced with reduced acoustic prominence. Although these effects are often attributed to priming in the production system, the locus of the effect within the production system remains unresolved because, in natural speech, repetition often involves repetition of referents and…

  8. Palindrome-Mediated Translocations in Humans: A New Mechanistic Model for Gross Chromosomal Rearrangements

    PubMed Central

    Inagaki, Hidehito; Kato, Takema; Tsutsumi, Makiko; Ouchi, Yuya; Ohye, Tamae; Kurahashi, Hiroki

    2016-01-01

    Palindromic DNA sequences, which can form secondary structures, are widely distributed in the human genome. Although the nature of the secondary structure—single-stranded “hairpin” or double-stranded “cruciform”—has been extensively investigated in vitro, the existence of such unusual non-B DNA in vivo remains controversial. Here, we review palindrome-mediated gross chromosomal rearrangements possibly induced by non-B DNA in humans. Recent advances in next-generation sequencing have not yet overcome the difficulty of palindromic sequence analysis. However, a dozen palindromic AT-rich repeat (PATRR) sequences have been identified at the breakpoints of recurrent or non-recurrent chromosomal translocations in humans. The breakages always occur at the center of the palindrome. Analyses of polymorphisms within the palindromes indicate that the symmetry and length of the palindrome affect the frequency of the de novo occurrence of these palindrome-mediated translocations, suggesting the involvement of non-B DNA. Indeed, experiments using a plasmid-based model system showed that the formation of non-B DNA is likely the key to palindrome-mediated genomic rearrangements. Some evidence implies a new mechanism that cruciform DNAs may come close together first in nucleus and illegitimately joined. Analysis of PATRR-mediated translocations in humans will provide further understanding of gross chromosomal rearrangements in many organisms. PMID:27462347

  9. Extragenic suppressors of paralyzed flagellar mutations in Chlamydomonas reinhardtii identify loci that alter the inner dynein arms

    PubMed Central

    1992-01-01

    We have analyzed extragenic suppressors of paralyzed flagella mutations in Chlamydomonas reinhardtii in an effort to identify new dynein mutations. A temperature-sensitive allele of the PF16 locus was mutagenized and then screened for revertants that could swim at the restrictive temperature (Dutcher et al. 1984. J. Cell Biol. 98:229- 236). In backcrosses of one of the revertant strains to wild-type, we recovered both the original pf16 mutation and a second, unlinked suppressor mutation with its own flagellar phenotype. This mutation has been identified by both recombination and complementation tests as a new allele of the previously uncharacterized PF9 locus on linkage group XII/XIII. SDS-PAGE analysis of isolated flagellar axonemes and dynein extracts has demonstrated that the pf9 strains are missing four polypeptides that form the I1 inner arm dynein subunit. The primary effect of the loss of the I1 subunit is a decrease in the forward swimming velocity due to a change in the flagellar waveform. Both the flagellar beat frequency and the axonemal ATPase activity are nearly wild-type. Examination of axonemes by thin section electron microscopy and image averaging methods reveals that a specific domain of the inner arm complex is missing in the pf9 mutant strains (see accompanying paper by Mastronarde et al.). When combined with other flagellar defects, the loss of the I1 subunit has synergistic effects on both flagellar assembly and flagellar motility. These synthetic phenotypes provide a screen for new suppressor mutations in other loci. Using this approach, we have identified the first interactive suppressors of a dynein arm mutation and an unusual bypass suppressor mutation. PMID:1387404

  10. Characteristics of palindromic sequences in DNA of the sea urchin Stronglyocentrotus intermedius

    SciTech Connect

    Brykov, V.A.; Kukhlevskii, A.D.

    1986-03-20

    The fraction of palindromic sequences in the nuclear DNA of the sea urchin S. intermedius was characterized. Using chromatography on hydroxyapatite and treatment with S1 nuclease, it was shown that the fraction of palindromic sequences more than doubles when the sodium concentration in solution is increased or the temperature of reassociation is lowered. The increase is due to the involvement of inverted repeats in reassociation, which are characterized by a substantial nonhomologous character and/or the presence of an extended intervening DNA sequence. It was found by the method of reassociation of a nicked palindrome fraction with an excess of total homologous DNA that most of the inverted repeats in the sea urchin genome are unique sequences. The complexity of the palindrome fraction was estimated at 8.2 x 10/sup 7/ nucleotide pairs, and the number of palindromes per haploid genome approx. 500,000.

  11. Screens for Extragenic Mutations That Fail to Complement Act1 Alleles Identify Genes That Are Important for Actin Function in Saccharomyces Cerevisiae

    PubMed Central

    Welch, M. D.; Vinh, DBN.; Okamura, H. H.; Drubin, D. G.

    1993-01-01

    Null mutations in SAC6 and ABP1, genes that encode actin-binding proteins, failed to complement the temperature-sensitive phenotype caused by a mutation in the ACT1 gene. To identify novel genes whose protein products interact with actin, mutations that fail to complement act1-1 or act1-4, two temperature-sensitive alleles of ACT1, were isolated. A total of 14 extragenic noncomplementing mutations and 12 new alleles of ACT1 were identified in two independent screens. The 14 extragenic noncomplementing mutations represent alleles of at least four different genes, ANC1, ANC2, ANC3 and ANC4 (Actin NonComplementing). Mutations in the ANC1 gene were shown to cause osmosensitivity and defects in actin organization; phenotypes that are similar to those caused by act1 mutations. We conclude that the ANC1 gene product plays an important role in actin cytoskeletal function. The 12 new alleles of ACT1 will be useful for further elucidation of the functions of actin in yeast. PMID:8243992

  12. Telomere Dysfunction Triggers Palindrome Formation Independently of Double-Strand Break Repair Mechanisms

    PubMed Central

    Raykov, Vasil; Marvin, Marcus E.; Louis, Edward J.; Maringele, Laura

    2016-01-01

    Inverted chromosome duplications or palindromes are linked with genetic disorders and malignant transformation. They are considered by-products of DNA double-strand break (DSB) repair: the homologous recombination (HR) and the nonhomologous end joining (NHEJ). Palindromes near chromosome ends are often triggered by telomere losses. An important question is to what extent their formation depends upon DSB repair mechanisms. Here we addressed this question using yeast genetics and comparative genomic hybridization. We induced palindrome formation by passaging cells lacking any form of telomere maintenance (telomerase and telomere recombination). Surprisingly, we found that DNA ligase 4, essential for NHEJ, did not make a significant contribution to palindrome formation induced by telomere losses. Moreover RAD51, important for certain HR-derived mechanisms, had little effect. Furthermore RAD52, which is essential for HR in yeast, appeared to decrease the number of palindromes in cells proliferating without telomeres. This study also uncovered an important role for Rev3 and Rev7 (but not for Pol32) subunits of polymerase ζ in the survival of cells undergoing telomere losses and forming palindromes. We propose a model called short-inverted repeat-induced synthesis in which DNA synthesis, rather than DSB repair, drives the inverted duplication triggered by telomere dysfunction. PMID:27334270

  13. Gene Conversion Violates the Stepwise Mutation Model for Microsatellites in Y-Chromosomal Palindromic Repeats

    PubMed Central

    Balaresque, Patricia; King, Turi E; Parkin, Emma J; Heyer, Evelyne; Carvalho-Silva, Denise; Kraaijenbrink, Thirsa; de Knijff, Peter; Tyler-Smith, Chris; Jobling, Mark A

    2014-01-01

    The male-specific region of the human Y chromosome (MSY) contains eight large inverted repeats (palindromes), in which high-sequence similarity between repeat arms is maintained by gene conversion. These palindromes also harbor microsatellites, considered to evolve via a stepwise mutation model (SMM). Here, we ask whether gene conversion between palindrome microsatellites contributes to their mutational dynamics. First, we study the duplicated tetranucleotide microsatellite DYS385a,b lying in palindrome P4. We show, by comparing observed data with simulated data under a SMM within haplogroups, that observed heteroallelic combinations in which the modal repeat number difference between copies was large, can give rise to homoallelic combinations with zero-repeats difference, equivalent to many single-step mutations. These are unlikely to be generated under a strict SMM, suggesting the action of gene conversion. Second, we show that the intercopy repeat number difference for a large set of duplicated microsatellites in all palindromes in the MSY reference sequence is significantly reduced compared with that for nonpalindrome-duplicated microsatellites, suggesting that the former are characterized by unusual evolutionary dynamics. These observations indicate that gene conversion violates the SMM for microsatellites in palindromes, homogenizing copies within individual Y chromosomes, but increasing overall haplotype diversity among chromosomes within related groups. PMID:24610746

  14. Grammatical Change through Repetition.

    ERIC Educational Resources Information Center

    Arevart, Supot

    1989-01-01

    The effect of repetition on grammatical change in an unrehearsed talk is examined based on a case study of a single learner. It was found that repetition allows for accuracy monitoring in that errors committed in repeated contexts undergo correction. Implications for teaching are discussed. (23 references) (LB)

  15. Replicating repetitive DNA.

    PubMed

    Tognetti, Silvia; Speck, Christian

    2016-05-27

    The function and regulation of repetitive DNA, the 'dark matter' of the genome, is still only rudimentarily understood. Now a study investigating DNA replication of repetitive centromeric chromosome segments has started to expose a fascinating replication program that involves suppression of ATR signalling, in particular during replication stress. PMID:27230530

  16. The Negative Repetition Effect

    ERIC Educational Resources Information Center

    Mulligan, Neil W.; Peterson, Daniel J.

    2013-01-01

    A fundamental property of human memory is that repetition enhances memory. Peterson and Mulligan (2012) recently documented a surprising "negative repetition effect," in which participants who studied a list of cue-target pairs twice recalled fewer targets than a group who studied the pairs only once. Words within a pair rhymed, and…

  17. Repetitive Stress Injuries

    MedlinePlus

    ... any problems since. What Are Repetitive Stress Injuries? Repetitive stress injuries (RSIs) are injuries that happen when too much stress is placed on a part of the body, resulting in inflammation (pain and swelling), muscle strain, or tissue damage. This stress generally occurs from ...

  18. Repetitive stereotyped behaviors.

    PubMed

    Berkson, G

    1983-11-01

    This paper points to factors that determine whether repetitive stereotyped behavior occur in the behavior repertoire. The analysis pits an "intrinsic oscillator" mechanism against a "self-stimulation" theory and chooses to emphasize the latter. The paper accounts for the repetitive and rhythmic nature of stereotypy by suggesting that repetition in a rhythmic way is the most efficient way of self-stimulation. It proposes that rhythm may be a reinforcement in at least some cases. It raises the question of whether control of stimulation by the person is a necessary condition for maintaining stereotypy. The paper recognizes the possibility that stereotyped behaviors may have their origin in the common repetitive behaviors of infancy but emphasizes that pathological stereotypy may involve more than immature repetition. It suggests that there is reason to believe that early intervention to prevent pathological stereotyped behavior might be effective but that we do not know much about how stereotypies get started.

  19. Roles of repetitive sequences

    SciTech Connect

    Bell, G.I.

    1991-12-31

    The DNA of higher eukaryotes contains many repetitive sequences. The study of repetitive sequences is important, not only because many have important biological function, but also because they provide information on genome organization, evolution and dynamics. In this paper, I will first discuss some generic effects that repetitive sequences will have upon genome dynamics and evolution. In particular, it will be shown that repetitive sequences foster recombination among, and turnover of, the elements of a genome. I will then consider some examples of repetitive sequences, notably minisatellite sequences and telomere sequences as examples of tandem repeats, without and with respectively known function, and Alu sequences as an example of interspersed repeats. Some other examples will also be considered in less detail.

  20. Repetition priming in music.

    PubMed

    Hutchins, Sean; Palmer, Caroline

    2008-06-01

    The authors explore priming effects of pitch repetition in music in 3 experiments. Musically untrained participants heard a short melody and sang the last pitch of the melody as quickly as possible. Each experiment manipulated (a) whether or not the tone to be sung (target) was heard earlier in the melody (primed) and (b) the prime-target distance (measured in events). Experiment 1 used variable-length melodies, whereas Experiments 2 and 3 used fixed-length melodies. Experiment 3 changed the timbre of the target tone. In all experiments, fast-responding participants produced repeated tones faster than nonrepeated tones, and this repetition benefit decreased as prime-target distances increased. All participants produced expected tonic endings faster than less expected nontonic endings. Repetition and tonal priming effects are compared with harmonic priming effects in music and with repetition priming effects in language. PMID:18505332

  1. Repetition priming in music.

    PubMed

    Hutchins, Sean; Palmer, Caroline

    2008-06-01

    The authors explore priming effects of pitch repetition in music in 3 experiments. Musically untrained participants heard a short melody and sang the last pitch of the melody as quickly as possible. Each experiment manipulated (a) whether or not the tone to be sung (target) was heard earlier in the melody (primed) and (b) the prime-target distance (measured in events). Experiment 1 used variable-length melodies, whereas Experiments 2 and 3 used fixed-length melodies. Experiment 3 changed the timbre of the target tone. In all experiments, fast-responding participants produced repeated tones faster than nonrepeated tones, and this repetition benefit decreased as prime-target distances increased. All participants produced expected tonic endings faster than less expected nontonic endings. Repetition and tonal priming effects are compared with harmonic priming effects in music and with repetition priming effects in language.

  2. Clustered regularly interspaced short palindromic repeats (CRISPRs): the hallmark of an ingenious antiviral defense mechanism in prokaryotes.

    PubMed

    Al-Attar, Sinan; Westra, Edze R; van der Oost, John; Brouns, Stan J J

    2011-04-01

    Many prokaryotes contain the recently discovered defense system against mobile genetic elements. This defense system contains a unique type of repetitive DNA stretches, termed Clustered Regularly Interspaced Short Palindromic Repeats (CRISPRs). CRISPRs consist of identical repeated DNA sequences (repeats), interspaced by highly variable sequences referred to as spacers. The spacers originate from either phages or plasmids and comprise the prokaryotes' 'immunological memory'. CRISPR-associated (cas) genes encode conserved proteins that together with CRISPRs make-up the CRISPR/Cas system, responsible for defending the prokaryotic cell against invaders. CRISPR-mediated resistance has been proposed to involve three stages: (i) CRISPR-Adaptation, the invader DNA is encountered by the CRISPR/Cas machinery and an invader-derived short DNA fragment is incorporated in the CRISPR array. (ii) CRISPR-Expression, the CRISPR array is transcribed and the transcript is processed by Cas proteins. (iii) CRISPR-Interference, the invaders' nucleic acid is recognized by complementarity to the crRNA and neutralized. An application of the CRISPR/Cas system is the immunization of industry-relevant prokaryotes (or eukaryotes) against mobile-genetic invasion. In addition, the high variability of the CRISPR spacer content can be exploited for phylogenetic and evolutionary studies. Despite impressive progress during the last couple of years, the elucidation of several fundamental details will be a major challenge in future research.

  3. Molecular identification and characterization of clustered regularly interspaced short palindromic repeat (CRISPR) gene cluster in Taylorella equigenitalis.

    PubMed

    Hara, Yasushi; Hayashi, Kyohei; Nakajima, Takuya; Kagawa, Shizuko; Tazumi, Akihiro; Moore, John E; Matsuda, Motoo

    2013-09-01

    Clustered regularly interspaced short palindromic repeats (CRISPRs), of approximately 10,000 base pairs (bp) in length, were shown to occur in the Japanese Taylorella equigenitalis strain, EQ59. The locus was composed of the putative CRISPRs-associated with 5 (cas5), RAMP csd1, csd2, recB, cas1, a leader region, 13 CRISPR consensus sequence repeats (each 32 bp; 5'-TCAGCCACGTTCGCGTGGCTGTGTGTTTAAAG-3'). These were in turn separated by 12 non repetitive unique spacer regions of similar length. In addition, a leader region, a transposase/IS protein, a leader region, and cas3 were also seen. All seven putative open reading frames carry their ribosome binding sites. Promoter consensus sequences at the -35 and -10 regions and putative intrinsic ρ-independent transcription terminator regions also occurred. A possible long overlap of 170 bp in length occurred between the recB and cas1 loci. Positive reverse transcription PCR signals of cas5, RAMP csd1, csd2-recB/cas1, and cas3 were generated. A putative secondary structure of the CRISPR consensus repeats was constructed. Following this, CRISPR results of the T. equigenitalis EQ59 isolate were subsequently compared with those from the Taylorella asinigenitalis MCE3 isolate.

  4. Palindromic Genes in the Linear Mitochondrial Genome of the Nonphotosynthetic Green Alga Polytomella magna

    PubMed Central

    Smith, David Roy; Hua, Jimeng; Archibald, John M.; Lee, Robert W.

    2013-01-01

    Organelle DNA is no stranger to palindromic repeats. But never has a mitochondrial or plastid genome been described in which every coding region is part of a distinct palindromic unit. While sequencing the mitochondrial DNA of the nonphotosynthetic green alga Polytomella magna, we uncovered precisely this type of genic arrangement. The P. magna mitochondrial genome is linear and made up entirely of palindromes, each containing 1–7 unique coding regions. Consequently, every gene in the genome is duplicated and in an inverted orientation relative to its partner. And when these palindromic genes are folded into putative stem-loops, their predicted translational start sites are often positioned in the apex of the loop. Gel electrophoresis results support the linear, 28-kb monomeric conformation of the P. magna mitochondrial genome. Analyses of other Polytomella taxa suggest that palindromic mitochondrial genes were present in the ancestor of the Polytomella lineage and lost or retained to various degrees in extant species. The possible origins and consequences of this bizarre genomic architecture are discussed. PMID:23940100

  5. Deciphering the importance of the palindromic architecture of the immunoglobulin heavy-chain 3' regulatory region.

    PubMed

    Saintamand, Alexis; Vincent-Fabert, Christelle; Garot, Armand; Rouaud, Pauline; Oruc, Zeliha; Magnone, Virginie; Cogné, Michel; Denizot, Yves

    2016-01-01

    The IgH 3' regulatory region (3'RR) controls class switch recombination (CSR) and somatic hypermutation (SHM) in B cells. The mouse 3'RR contains four enhancer elements with hs1,2 flanked by inverted repeated sequences and the centre of a 25-kb palindrome bounded by two hs3 enhancer inverted copies (hs3a and hs3b). hs4 lies downstream of the palindrome. In mammals, evolution maintained this unique palindromic arrangement, suggesting that it is functionally significant. Here we report that deconstructing the palindromic IgH 3'RR strongly affects its function even when enhancers are preserved. CSR and IgH transcription appear to be poorly dependent on the 3'RR architecture and it is more or less preserved, provided 3'RR enhancers are present. By contrast, a 'palindromic effect' significantly lowers VH germline transcription, AID recruitment and SHM. In conclusion, this work indicates that the IgH 3'RR does not simply pile up enhancer units but also optimally exposes them into a functional architecture of crucial importance. PMID:26883548

  6. Deciphering the importance of the palindromic architecture of the immunoglobulin heavy-chain 3' regulatory region.

    PubMed

    Saintamand, Alexis; Vincent-Fabert, Christelle; Garot, Armand; Rouaud, Pauline; Oruc, Zeliha; Magnone, Virginie; Cogné, Michel; Denizot, Yves

    2016-02-17

    The IgH 3' regulatory region (3'RR) controls class switch recombination (CSR) and somatic hypermutation (SHM) in B cells. The mouse 3'RR contains four enhancer elements with hs1,2 flanked by inverted repeated sequences and the centre of a 25-kb palindrome bounded by two hs3 enhancer inverted copies (hs3a and hs3b). hs4 lies downstream of the palindrome. In mammals, evolution maintained this unique palindromic arrangement, suggesting that it is functionally significant. Here we report that deconstructing the palindromic IgH 3'RR strongly affects its function even when enhancers are preserved. CSR and IgH transcription appear to be poorly dependent on the 3'RR architecture and it is more or less preserved, provided 3'RR enhancers are present. By contrast, a 'palindromic effect' significantly lowers VH germline transcription, AID recruitment and SHM. In conclusion, this work indicates that the IgH 3'RR does not simply pile up enhancer units but also optimally exposes them into a functional architecture of crucial importance.

  7. Deciphering the importance of the palindromic architecture of the immunoglobulin heavy-chain 3' regulatory region

    PubMed Central

    Saintamand, Alexis; Vincent-Fabert, Christelle; Garot, Armand; Rouaud, Pauline; Oruc, Zeliha; Magnone, Virginie; Cogné, Michel; Denizot, Yves

    2016-01-01

    The IgH 3' regulatory region (3'RR) controls class switch recombination (CSR) and somatic hypermutation (SHM) in B cells. The mouse 3'RR contains four enhancer elements with hs1,2 flanked by inverted repeated sequences and the centre of a 25-kb palindrome bounded by two hs3 enhancer inverted copies (hs3a and hs3b). hs4 lies downstream of the palindrome. In mammals, evolution maintained this unique palindromic arrangement, suggesting that it is functionally significant. Here we report that deconstructing the palindromic IgH 3'RR strongly affects its function even when enhancers are preserved. CSR and IgH transcription appear to be poorly dependent on the 3'RR architecture and it is more or less preserved, provided 3'RR enhancers are present. By contrast, a ‘palindromic effect' significantly lowers VH germline transcription, AID recruitment and SHM. In conclusion, this work indicates that the IgH 3'RR does not simply pile up enhancer units but also optimally exposes them into a functional architecture of crucial importance. PMID:26883548

  8. Characterizing temporal repetition

    SciTech Connect

    Cukierman, D.; Delgrande, J.

    1996-12-31

    We are investigating the representation and reasoning about schedulable, repeated activities, specified using calendars. Examples of such activities include meeting every Tuesday and Thursday during a semester and attending a seminar every first day of a month. This research provides for a valuable framework for scheduling systems, financial systems and, in general, date-based systems. Very recently work has been done related to reasoning about repetition in the Artificial Intelligence community and others. A partial reference list is provided here. However, to our knowledge no extensive taxonomy of repetition has been proposed in the literature. We believe that reasoning about repeated activities calls for a study and precise definition of the topological characteristics in a repetitive series. In this abstract we summarize a proposal to classify types of repetition according to parameters. The combination of all possible values of these parameters provides a complete taxonomy of repetitive classes with respect to the proposed parameters. Several notions of repetition are considered, some are extremely general, some are very specific.

  9. Indirect decentralized repetitive control

    NASA Technical Reports Server (NTRS)

    Lee, Soo Cheol; Longman, Richard W.

    1993-01-01

    Learning control refers to controllers that learn to improve their performance at executing a given task, based on experience performing this specific task. In a previous work, the authors presented a theory of indirect decentralized learning control based on use of indirect adaptive control concepts employing simultaneous identification and control. This paper extends these results to apply to the indirect repetitive control problem in which a periodic (i.e., repetitive) command is given to a control system. Decentralized indirect repetitive control algorithms are presented that have guaranteed convergence to zero tracking error under very general conditions. The original motivation of the repetitive control and learning control fields was learning in robots doing repetitive tasks such as on an assembly line. This paper starts with decentralized discrete time systems, and progresses to the robot application, modeling the robot as a time varying linear system in the neighborhood of the desired trajectory. Decentralized repetitive control is natural for this application because the feedback control for link rotations is normally implemented in a decentralized manner, treating each link as if it is independent of the other links.

  10. The negative repetition effect.

    PubMed

    Mulligan, Neil W; Peterson, Daniel J

    2013-09-01

    A fundamental property of human memory is that repetition enhances memory. Peterson and Mulligan (2012) recently documented a surprising negative repetition effect, in which participants who studied a list of cue-target pairs twice recalled fewer targets than a group who studied the pairs only once. Words within a pair rhymed, and across pairs, the target words were drawn from a small set of categories. In the repetition condition, the pairs were initially presented in a random order and then presented a 2nd time blocked by the category of the target words. In the single presentation condition, the pairs were presented only in the blocked order. Participants in the former condition recalled fewer target words on a free recall test despite having seen the word pairs twice (the negative repetition effect). This phenomenon is explored in a series of 5 experiments assessing 3 theoretical accounts of the effect. The experiments demonstrate that the negative repetition effect generalizes over multiple encoding conditions (reading and generative encoding), over different memory tests (free and cued recall), and over delay (5 min and 2 days). The results argue against a retrieval account and a levels-of-processing account but are consistent with the item-specific-relational account, the account upon which the effect was initially predicated. PMID:23421508

  11. An intramolecular recombination mechanism for the formation of the rRNA gene palindrome of Tetrahymena thermophila

    SciTech Connect

    Butler, D.K.; Yasuda, L.E.; Yao, Meng-Chao

    1995-12-01

    This report discusses the formation of rRNA gene palindrome in Tetrahymena thermophila and the involvement of intramolecular recombination. This, along with the authors` previous study, is the first to define a molecular pathway of palindrome formation. 48 refs., 6 figs.

  12. Clustered Regularly Interspaced Short Palindromic Repeats (CRISPRi) plasmids | Office of Cancer Genomics

    Cancer.gov

    CTD2 researchers at the University of California in San Francisco developed a modified Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) CRISPR/dCas9 system. Catalytically inactive dCas9 enables modular and programmable RNA-guided genome regulation in eukaryotes.

  13. Clustered Regularly Interspaced Short Palindromic Repeats (CRISPRi) plasmids | Office of Cancer Genomics

    Cancer.gov

    CTD2 researchers at the University of California in San Francisco developed a modified Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) CRISPR/dCas9 system. Catalytically inactive dCas9 enables modular and programmable RNA-guided genome regulation in eukaryotes.

  14. [Advances in clustered regularly interspaced short palindromic repeats--a review].

    PubMed

    Wang, Lili; He, Jin; Wang, Jieping

    2011-08-01

    The recently discovered Clustered Regularly Interspaced Short Palindromic Repeat (CRISPRs) can protect bacteria and archaea with adaptive and heritable defense systems against the invasion of phage- and plasmid- associated mobile genetic elements. Here, we review the structure, diversity, mechanism of interference and self versus non-self discrimination of CRISPR systems. We also discuss the potential applications of this novel interference system.

  15. Chromosome evolution with naked eye: Palindromic context of the life origin

    NASA Astrophysics Data System (ADS)

    Larionov, Sergei; Loskutov, Alexander; Ryadchenko, Eugeny

    2008-03-01

    Based on the representation of the DNA sequence as a two-dimensional (2D) plane walk, we consider the problem of identification and comparison of functional and structural organizations of chromosomes of different organisms. According to the characteristic design of 2D walks we identify telomere sites, palindromes of various sizes and complexity, areas of ribosomal RNA, transposons, as well as diverse satellite sequences. As an interesting result of the application of the 2D walk method, a new duplicated gigantic palindrome in the X human chromosome is detected. A schematic mechanism leading to the formation of such a duplicated palindrome is proposed. Analysis of a large number of the different genomes shows that some chromosomes (or their fragments) of various species appear as imperfect gigantic palindromes, which are disintegrated by many inversions and the mutation drift on different scales. A spread occurrence of these types of sequences in the numerous chromosomes allows us to develop a new insight of some accepted points of the genome evolution in the prebiotic phase.

  16. Repetitive strain injury.

    PubMed

    Al-Otaibi, S T

    2001-05-01

    Repetitive strain injury is a group of musculoskeletal disorders affecting muscles, tendons, nerves and blood vessels. These disorders could be attributed to occupational causes; however non-occupational causes should be excluded. The management of these cases required a multidisciplinary team approach.

  17. Repetition Priming in Music

    ERIC Educational Resources Information Center

    Hutchins, Sean; Palmer, Caroline

    2008-01-01

    The authors explore priming effects of pitch repetition in music in 3 experiments. Musically untrained participants heard a short melody and sang the last pitch of the melody as quickly as possible. Each experiment manipulated (a) whether or not the tone to be sung (target) was heard earlier in the melody (primed) and (b) the prime-target distance…

  18. Extragenic bypass suppressors of mutations in the essential gene BLD2 promote assembly of basal bodies with abnormal microtubules in Chlamydomonas reinhardtii.

    PubMed Central

    Preble, A M; Giddings, T H; Dutcher, S K

    2001-01-01

    bld2-1 mutant Chlamydomonas reinhardtii strains assemble basal bodies with singlet microtubules; bld2-1 cells display flagellar assembly defects as well as positioning defects of the mitotic spindle and cleavage furrow. To further understand the role of the BLD2 gene, we have isolated three new bld2 alleles and three partially dominant extragenic suppressors, rgn1-1, rgn1-2, and rgn1-3. bld2 rgn1-1 strains have phenotypes intermediate between those of bld2 and wild-type strains with respect to flagellar number, microtubule rootlet organization, cleavage furrow positioning, and basal body structural phenotypes. Instead of the triplet microtubules of wild-type cells, bld2 rgn1-1 basal bodies have mixtures of no, singlet, doublet, and triplet microtubules. The bld2-4 allele was made by insertional mutagenesis and identified in a noncomplementation screen in a diploid strain. The bld2-4 allele has a lethal phenotype based on mitotic segregation in diploid strains and in haploid strains generated by meiotic recombination. The lethal phenotype in haploid strains is suppressed by rgn1-1; these suppressed strains have similar phenotypes to other bld2 rgn1-1 double mutants. It is likely that BLD2 is an essential gene that is needed for basal body assembly and function. PMID:11139500

  19. Molecular identification and characterization of clustered regularly interspaced short palindromic repeats (CRISPRs) in a urease-positive thermophilic Campylobacter sp. (UPTC).

    PubMed

    Tasaki, E; Hirayama, J; Tazumi, A; Hayashi, K; Hara, Y; Ueno, H; Moore, J E; Millar, B C; Matsuda, M

    2012-02-01

    Novel clustered regularly-interspaced short palindromic repeats (CRISPRs) locus [7,500 base pairs (bp) in length] occurred in the urease-positive thermophilic Campylobacter (UPTC) Japanese isolate, CF89-12. The 7,500 bp gene loci consisted of the 5'-methylaminomethyl-2-thiouridylate methyltransferase gene, putative (P) CRISPR associated (p-Cas), putative open reading frames, Cas1 and Cas2, leader sequence region (146 bp), 12 CRISPRs consensus sequence repeats (each 36 bp) separated by a non-repetitive unique spacer region of similar length (26-31 bp) and the phosphatidyl glycerophosphatase A gene. When the CRISPRs loci in the UPTC CF89-12 and five C. jejuni isolates were compared with one another, these six isolates contained p-Cas, Cas1 and Cas2 within the loci. Four to 12 CRISPRs consensus sequence repeats separated by a non-repetitive unique spacer region occurred in six isolates and the nucleotide sequences of those repeats gave approximately 92-100% similarity with each other. However, no sequence similarity occurred in the unique spacer regions among these isolates. The putative σ(70) transcriptional promoter and the hypothetical ρ-independent terminator structures for the CRISPRs and Cas were detected. No in vivo transcription of p-Cas, Cas1 and Cas2 was confirmed in the UPTC cells.

  20. Development of a novel molecular detection method for clustered regularly interspaced short palindromic repeats (CRISPRs) in Taylorella organisms.

    PubMed

    Hara, Yasushi; Nakajima, Takuya; Akamatsu, Marie; Yahiro, Motoki; Kagawa, Shizuko; Petry, Sandrine; Matsuda, Motoo; Moore, John E

    2015-07-01

    Contagious equine metritis is a bacterial infectious disease of horses caused by Taylorella equigenitalis, a Gram-negative eubacterium. The disease has been described in several continents, including Europe, North America and Asia. A novel molecular method was developed to detect clustered regularly interspaced short palindromic repeats (CRISPRs), which were separated by non-repetitive unique spacer regions (NRUSRs) of similar length, in the Taylorella equigenitalis EQ59 strain using a primer pair, f-/r-TeCRISPR-ladder, by PCR amplification. In total, 31 Taylorella isolates (17 T. equigenitalis and 14 Taylorella asinigenitalis) were examined. The T. equigenitalis isolates came from thoroughbred and cold-blooded horses from nine countries during 1980-1996, whilst the T. asinigenitalis isolates all originated from donkey jacks in France and the USA during 1997-2006. PAGE fractionated all of the 13 CRISPRs separated by 12 NRUSRs in T. equigenitalis EQ59. Permutation examples of CRISPRs, which were separated by NRUSRs for small-sized ladders, consisting of two doublet bands were shown. Putative CRISPRs separated by NRUSRs were amplified with 14/17 (82.4 %) geographically disparate T. equigenitalis isolates using the newly designed primer pair. Approximately 82.4 % of the T. equigenitalis isolates had CRISPRs separated by NRUSRs. The CRISPR locus was also found in the French T. asinigenitalis strain MCE3. Putative CRISPRs separated by NRUSRs were detected similarly in 4/14 (28.6 %) T. asinigenitalis isolates. Overall, a more detailed understanding of the molecular biology of CRISPRs within Taylorella organisms may help elucidate the pathogenic virulence and transmission mechanisms associated with this important equine pathogen.

  1. Development of a novel molecular detection method for clustered regularly interspaced short palindromic repeats (CRISPRs) in Taylorella organisms.

    PubMed

    Hara, Yasushi; Nakajima, Takuya; Akamatsu, Marie; Yahiro, Motoki; Kagawa, Shizuko; Petry, Sandrine; Matsuda, Motoo; Moore, John E

    2015-07-01

    Contagious equine metritis is a bacterial infectious disease of horses caused by Taylorella equigenitalis, a Gram-negative eubacterium. The disease has been described in several continents, including Europe, North America and Asia. A novel molecular method was developed to detect clustered regularly interspaced short palindromic repeats (CRISPRs), which were separated by non-repetitive unique spacer regions (NRUSRs) of similar length, in the Taylorella equigenitalis EQ59 strain using a primer pair, f-/r-TeCRISPR-ladder, by PCR amplification. In total, 31 Taylorella isolates (17 T. equigenitalis and 14 Taylorella asinigenitalis) were examined. The T. equigenitalis isolates came from thoroughbred and cold-blooded horses from nine countries during 1980-1996, whilst the T. asinigenitalis isolates all originated from donkey jacks in France and the USA during 1997-2006. PAGE fractionated all of the 13 CRISPRs separated by 12 NRUSRs in T. equigenitalis EQ59. Permutation examples of CRISPRs, which were separated by NRUSRs for small-sized ladders, consisting of two doublet bands were shown. Putative CRISPRs separated by NRUSRs were amplified with 14/17 (82.4 %) geographically disparate T. equigenitalis isolates using the newly designed primer pair. Approximately 82.4 % of the T. equigenitalis isolates had CRISPRs separated by NRUSRs. The CRISPR locus was also found in the French T. asinigenitalis strain MCE3. Putative CRISPRs separated by NRUSRs were detected similarly in 4/14 (28.6 %) T. asinigenitalis isolates. Overall, a more detailed understanding of the molecular biology of CRISPRs within Taylorella organisms may help elucidate the pathogenic virulence and transmission mechanisms associated with this important equine pathogen. PMID:25934548

  2. [Bioinformatics Analysis of Clustered Regularly Interspaced Short Palindromic Repeats in the Genomes of Shigella].

    PubMed

    Wang, Pengfei; Wang, Yingfang; Duan, Guangcai; Xue, Zerun; Wang, Linlin; Guo, Xiangjiao; Yang, Haiyan; Xi, Yuanlin

    2015-04-01

    This study was aimed to explore the features of clustered regularly interspaced short palindromic repeats (CRISPR) structures in Shigella by using bioinformatics. We used bioinformatics methods, including BLAST, alignment and RNA structure prediction, to analyze the CRISPR structures of Shigella genomes. The results showed that the CRISPRs existed in the four groups of Shigella, and the flanking sequences of upstream CRISPRs could be classified into the same group with those of the downstream. We also found some relatively conserved palindromic motifs in the leader sequences. Repeat sequences had the same group with corresponding flanking sequences, and could be classified into two different types by their RNA secondary structures, which contain "stem" and "ring". Some spacers were found to homologize with part sequences of plasmids or phages. The study indicated that there were correlations between repeat sequences and flanking sequences, and the repeats might act as a kind of recognition mechanism to mediate the interaction between foreign genetic elements and Cas proteins.

  3. [Clustered regularly interspaced short palindromic repeats: structure, function and application--a review].

    PubMed

    Cui, Yujun; Li, Yanjun; Yan, Yanfeng; Yang, Ruifu

    2008-11-01

    CRISPRs (Clustered Regularly Interspaced Short Palindromic Repeats), the basis of spoligotyping technology, can provide prokaryotes with heritable adaptive immunity against phages' invasion. Studies on CRISPR loci and their associated elements, including various CAS (CRISPR-associated) proteins and leader sequences, are still in its infant period. We introduce the brief history', structure, function, bioinformatics research and application of this amazing immunity system in prokaryotic organism for inspiring more scientists to find their interest in this developing topic.

  4. Structural basis of Ets1 cooperative binding to palindromic sequences on stromelysin-1 promoter DNA

    SciTech Connect

    Babayeva, Nigar D.; Wilder, Phillip J.; Shiina, Masaaki; Mino, Koshiki; Desler, Michelle; Ogata, Kazuhiro; Rizzino, Angie; Tahirov, Tahir H.

    2010-09-03

    Ets1 is a member of the Ets family of transcription factors. Ets1 is autoinhibited and its activation requires heterodimerization with a partner protein or DNA-mediated homodimerization for cooperative DNA binding. In the latter case, Ets1 molecules bind to palindromic sequences in which two Ets-binding sites (EBS) are separated by four base pairs, for example in the promoters of stromelysin-1 and p53. Interestingly, counteraction of autoinhibition requires the autoinhibitory region encoded by exon VII of the gene. The structural basis for the requirement of autoinhibitory sequences for Ets1 binding to palindromic EBS still remains unresolved. Here we report the crystal structure of two Ets1 molecules bound to an EBS palindrome of the stromelysin-1 promoter DNA, providing a plausible explanation for the requirement of exon VII-encoded sequences for Ets1 cooperative DNA binding. The proposed mechanism was verified both in vitro by surface plasmon resonance and in vivo by transcription-based assays.

  5. A 160-bp palindrome is a Rad50.Rad32-dependent mitotic recombination hotspot in Schizosaccharomyces pombe.

    PubMed Central

    Farah, Joseph A; Hartsuiker, Edgar; Mizuno, Ken-Ichi; Ohta, Kunihiro; Smith, Gerald R

    2002-01-01

    Palindromic sequences can form hairpin and cruciform structures that pose a threat to genome integrity. We found that a 160-bp palindrome (an inverted repeat of 80 bp) conferred a mitotic recombination hotspot relative to a control nonpalindromic sequence when inserted into the ade6 gene of Schizosaccharomyces pombe. The hotspot activity of the palindrome, but not the basal level of recombination, was abolished by a rad50 deletion, by a rad50S "separation of function" mutation, or by a rad32-D25A mutation in the nuclease domain of the Rad32 protein, an Mre11 homolog. We propose that upon extrusion of the palindrome the Rad50.Rad32 nuclease complex recognizes and cleaves the secondary structure thus formed and generates a recombinogenic break in the DNA. PMID:12019258

  6. Repetitive strain injury.

    PubMed

    van Tulder, Maurits; Malmivaara, Antti; Koes, Bart

    2007-05-26

    Repetitive strain injury remains a controversial topic. The term repetitive strain injury includes specific disorders such as carpal tunnel syndrome, cubital tunnel syndrome, Guyon canal syndrome, lateral epicondylitis, and tendonitis of the wrist or hand. The diagnosis is usually made on the basis of history and clinical examination. Large high-quality studies using newer imaging techniques, such as MRI and ultrasonography are few. Consequently, the role of such imaging in diagnosis of upper limb disorders remains unclear. In many cases, no specific diagnosis can be established and complaints are labelled as non-specific. Little is known about the effectiveness of treatment options for upper limb disorders. Strong evidence for any intervention is scarce and the effect, if any, is mainly short-term pain relief. Exercise is beneficial for non-specific upper limb disorders. Immobilising hand braces and open carpal tunnel surgery release are beneficial for carpal tunnel syndrome, and topical and oral non-steroidal anti-inflammatory drugs, and corticosteroid injections are helpful for lateral epicondylitis. Exercise is probably beneficial for neck pain, as are corticosteroid injections and exercise for shoulder pain. Although upper limb disorders occur frequently in the working population, most trials have not exclusively included a working population or assessed effects on work-related outcomes. Further high-quality trials should aim to include sufficient sample sizes, working populations, and work-related outcomes.

  7. Repetitive resonant railgun power supply

    DOEpatents

    Honig, E.M.; Nunnally, W.C.

    1985-06-19

    A repetitive resonant railgun power supply provides energy for repetitively propelling projectiles from a pair of parallel rails. The supply comprises an energy storage capacitor, a storage inductor to form a resonant circuit with the energy storage capacitor and a magnetic switch to transfer energy between the resonant circuit and the pair of parallel rails for the propelling of projectiles.

  8. Repetitive resonant railgun power supply

    DOEpatents

    Honig, Emanuel M.; Nunnally, William C.

    1988-01-01

    A repetitive resonant railgun power supply provides energy for repetitively propelling projectiles from a pair of parallel rails. The supply comprises an energy storage capacitor, a storage inductor to form a resonant circuit with the energy storage capacitor and a magnetic switch to transfer energy between the resonant circuit and the pair of parallel rails for the propelling of projectiles.

  9. Structural and functional evaluation of the palindromic alanine-rich antimicrobial peptide Pa-MAP2.

    PubMed

    Migliolo, Ludovico; Felício, Mário R; Cardoso, Marlon H; Silva, Osmar N; Xavier, Mary-Ann E; Nolasco, Diego O; de Oliveira, Adeliana Silva; Roca-Subira, Ignasi; Vila Estape, Jordi; Teixeira, Leandro D; Freitas, Sonia M; Otero-Gonzalez, Anselmo J; Gonçalves, Sónia; Santos, Nuno C; Franco, Octavio L

    2016-07-01

    Recently, several peptides have been studied regarding the defence process against pathogenic microorganisms, which are able to act against different targets, with the purpose of developing novel bioactive compounds. The present work focuses on the structural and functional evaluation of the palindromic antimicrobial peptide Pa-MAP2, designed based on the peptide Pa-MAP from Pleuronectes americanus. For a better structural understanding, molecular modelling analyses were carried out, together with molecular dynamics and circular dichroism, in different media. Antibacterial activity against Gram-negative and positive bacteria was evaluated, as well as cytotoxicity against human erythrocytes, RAW 264.7, Vero and L6 cells. In silico docking experiments, lipid vesicle studies, and atomic force microscopy (AFM) imaging were carried out to explore the activity of the peptide. In vivo studies on infected mice were also done. The palindromic primary sequence favoured an α-helix structure that was pH dependent, only present on alkaline environment, with dynamic N- and C-terminals that are stabilized in anionic media. Pa-MAP2 only showed activity against Gram-negative bacteria, with a MIC of 3.2 μM, and without any cytotoxic effect. In silico, lipid vesicles and AFM studies confirm the preference for anionic lipids (POPG, POPS, DPPE, DPPG and LPS), with the positively charged lysine residues being essential for the initial electrostatic interaction. In vivo studies showed that Pa-MAP2 increases to 100% the survival rate of mice infected with Escherichia coli. Data here reported indicated that palindromic Pa-MAP2 could be an alternative candidate for use in therapeutics against Gram-negative bacterial infections.

  10. Structural and functional evaluation of the palindromic alanine-rich antimicrobial peptide Pa-MAP2.

    PubMed

    Migliolo, Ludovico; Felício, Mário R; Cardoso, Marlon H; Silva, Osmar N; Xavier, Mary-Ann E; Nolasco, Diego O; de Oliveira, Adeliana Silva; Roca-Subira, Ignasi; Vila Estape, Jordi; Teixeira, Leandro D; Freitas, Sonia M; Otero-Gonzalez, Anselmo J; Gonçalves, Sónia; Santos, Nuno C; Franco, Octavio L

    2016-07-01

    Recently, several peptides have been studied regarding the defence process against pathogenic microorganisms, which are able to act against different targets, with the purpose of developing novel bioactive compounds. The present work focuses on the structural and functional evaluation of the palindromic antimicrobial peptide Pa-MAP2, designed based on the peptide Pa-MAP from Pleuronectes americanus. For a better structural understanding, molecular modelling analyses were carried out, together with molecular dynamics and circular dichroism, in different media. Antibacterial activity against Gram-negative and positive bacteria was evaluated, as well as cytotoxicity against human erythrocytes, RAW 264.7, Vero and L6 cells. In silico docking experiments, lipid vesicle studies, and atomic force microscopy (AFM) imaging were carried out to explore the activity of the peptide. In vivo studies on infected mice were also done. The palindromic primary sequence favoured an α-helix structure that was pH dependent, only present on alkaline environment, with dynamic N- and C-terminals that are stabilized in anionic media. Pa-MAP2 only showed activity against Gram-negative bacteria, with a MIC of 3.2 μM, and without any cytotoxic effect. In silico, lipid vesicles and AFM studies confirm the preference for anionic lipids (POPG, POPS, DPPE, DPPG and LPS), with the positively charged lysine residues being essential for the initial electrostatic interaction. In vivo studies showed that Pa-MAP2 increases to 100% the survival rate of mice infected with Escherichia coli. Data here reported indicated that palindromic Pa-MAP2 could be an alternative candidate for use in therapeutics against Gram-negative bacterial infections. PMID:27063608

  11. Palindromic rheumatism with rheumatoid nodules: a case report with ultrastructural studies.

    PubMed Central

    Schreiber, S; Schumacher, H R; Cherian, P V

    1986-01-01

    Rheumatoid nodules developed on the finger tips of a patient with palindromic rheumatism. The patient had no bone cysts or erosions and had no rheumatoid factor. A light microscopic and ultrastructural study of a nodule showed a necrotic centre with fibrin, collagen, and granular material surrounded by large histiocytes, fibrocytes, lymphocytes, and vessels with adjacent mast cells as has been seen with nodules in classical rheumatoid arthritis (RA). We describe the first immunoperoxidase studies on a rheumatoid nodule and have identified reaction products for immunoglobulins and C3 in perivascular and endothelial cell vacuoles and in the necrotic centre. Images PMID:3954461

  12. Novel Method Developed to Further the Understanding of DNA Palindromes | Poster

    Cancer.gov

    Editor's note: Platinum Highlight articles are noteworthy publications selected periodically by Dr. Craig Reynolds, associate director, National Cancer Institute, from among the most recently published Platinum Publications. When Alison Rattray and colleagues in the Gene Regulation and Chromosome Biology Laboratory (GRCBL) examined a mutant yeast cell they had isolated in a screen, they noticed something strange. The DNA exhibited a “very specific, but weird, rearrangement,” she explained. The arrangement turned out to be a DNA palindrome, “opening the door to studying these elusive DNA motifs,” she said.

  13. Clustered regularly interspaced short palindromic repeats (CRISPRs) for the genotyping of bacterial pathogens.

    PubMed

    Grissa, Ibtissem; Vergnaud, Gilles; Pourcel, Christine

    2009-01-01

    Clustered regularly interspaced short palindromic repeats (CRISPRs) are DNA sequences composed of a succession of repeats (23- to 47-bp long) separated by unique sequences called spacers. Polymorphism can be observed in different strains of a species and may be used for genotyping. We describe protocols and bioinformatics tools that allow the identification of CRISPRs from sequenced genomes, their comparison, and their component determination (the direct repeats and the spacers). A schematic representation of the spacer organization can be produced, allowing an easy comparison between strains.

  14. Heterogeneous diversity of spacers within CRISPR (clustered regularly interspaced short palindromic repeats).

    PubMed

    He, Jiankui; Deem, Michael W

    2010-09-17

    Clustered regularly interspaced short palindromic repeats (CRISPR) in bacterial and archaeal DNA have recently been shown to be a new type of antiviral immune system in these organisms. We here study the diversity of spacers in CRISPR under selective pressure. We propose a population dynamics model that explains the biological observation that the leader-proximal end of CRISPR is more diversified and the leader-distal end of CRISPR is more conserved. This result is shown to be in agreement with recent experiments. Our results show that the CRISPR spacer structure is influenced by and provides a record of the viral challenges that bacteria face.

  15. Heterogeneous Diversity of Spacers within CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats)

    NASA Astrophysics Data System (ADS)

    He, Jiankui; Deem, Michael W.

    2010-09-01

    Clustered regularly interspaced short palindromic repeats (CRISPR) in bacterial and archaeal DNA have recently been shown to be a new type of antiviral immune system in these organisms. We here study the diversity of spacers in CRISPR under selective pressure. We propose a population dynamics model that explains the biological observation that the leader-proximal end of CRISPR is more diversified and the leader-distal end of CRISPR is more conserved. This result is shown to be in agreement with recent experiments. Our results show that the CRISPR spacer structure is influenced by and provides a record of the viral challenges that bacteria face.

  16. Experimental definition of a clustered regularly interspaced short palindromic duplicon in Escherichia coli.

    PubMed

    Goren, Moran G; Yosef, Ido; Auster, Oren; Qimron, Udi

    2012-10-12

    We analyzed sequences of newly inserted repeats in an Escherichia coli CRISPR (clustered regularly interspaced short palindromic repeats) array in vivo and showed that a base previously thought to belong to the repeat is actually derived from a protospacer. Based on further experimental results, we propose to use the term "duplicon" for a repeated sequence in a CRISPR array that serves as a template for a new duplicon. Our findings suggest the possibility of redrawing the borders between repeats, spacers, and protospacer adjacent motifs.

  17. Clustered Regularly Interspaced Short Palindromic Repeats (CRISPRi) plasmids | Office of Cancer Genomics

    Cancer.gov

    CTD2 researchers at the University of California in San Francisco developed a modified Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) CRISPR/dCas9 system. Catalytically inactive dCas9 enables modular and programmable RNA-guided genome regulation in eukaryotes. The CRISPR/dCas9 system has several advantages:  i) enables robust gene repression (CRISPRi) or activation (CRISPRa) in human cells, ii) allows specific knockdown with minimal off-target effects in human cells, iii) works efficiently in human and yeast cells, and iv) does not cause  double-strand breaks.

  18. Repetitive strain injury.

    PubMed

    Helliwell, P S; Taylor, W J

    2004-08-01

    Pain in the forearm is relatively common in the community. In the workplace forearm pain is associated with work involving frequent repetition, high forces, and prolonged abnormal postures. Nevertheless, other factors are involved in the presentation and the continuation of the pain. Notable among these factors are psychosocial issues and the workplace environment-the attitude to workers and their welfare, the physical conditions, and design of the job. Primary prevention may be effective but active surveillance is important with early intervention and an active management approach. Physical treatments have not been extensively evaluated. In the established case, management should be multidisciplinary, addressing physical aspects of the job but also addressing the "yellow, blue, and black flags" which should be viewed as obstacles to recovery. For the worker "on sick" a dialogue should be established between the worker, the primary care physician, and the workplace. Return to work should be encouraged and facilitated by medical interventions and light duty options. Rehabilitation programmes may be of use in chronic cases.

  19. Perceptual Repetition Blindness Effects

    NASA Technical Reports Server (NTRS)

    Hochhaus, Larry; Johnston, James C.; Null, Cynthia H. (Technical Monitor)

    1994-01-01

    The phenomenon of repetition blindness (RB) may reveal a new limitation on human perceptual processing. Recently, however, researchers have attributed RB to post-perceptual processes such as memory retrieval and/or reporting biases. The standard rapid serial visual presentation (RSVP) paradigm used in most RB studies is, indeed, open to such objections. Here we investigate RB using a "single-frame" paradigm introduced by Johnston and Hale (1984) in which memory demands are minimal. Subjects made only a single judgement about whether one masked target word was the same or different than a post-target probe. Confidence ratings permitted use of signal detection methods to assess sensitivity and bias effects. In the critical condition for RB a precue of the post-target word was provided prior to the target stimulus (identity precue), so that the required judgement amounted to whether the target did or did not repeat the precue word. In control treatments, the precue was either an unrelated word or a dummy.

  20. Neural Basis of Repetition Priming during Mathematical Cognition: Repetition Suppression or Repetition Enhancement?

    ERIC Educational Resources Information Center

    Salimpoor, Valorie N.; Chang, Catie; Menon, Vinod

    2010-01-01

    We investigated the neural basis of repetition priming (RP) during mathematical cognition. Previous studies of RP have focused on repetition suppression as the basis of behavioral facilitation, primarily using word and object identification and classification tasks. More recently, researchers have suggested associative stimulus-response learning…

  1. Numerical taxonomy of the genus Pestivirus based on palindromic nucleotide substitutions in the 5' untranslated region.

    PubMed

    Giangaspero, Massimo; Harasawa, Ryô

    2007-12-01

    The palindromic nucleotide substitutions (PNS) at the three variable loci (V1, V2 and V3) in the 5' untranslated region (UTR) of Pestivirus RNA have been considered for taxonomical segregation of species, through the evaluation of 430 genomic sequences. On the basis of qualitative and quantitative secondary structure characteristics, six species have been identified: Bovine viral diarrhea virus 1 (BVDV-1), Bovine viral diarrhea virus 2 (BVDV-2), Classical swine fever virus (CSFV), Border disease virus (BDV), the tentative species Giraffe and a new proposed taxon named Pronghorn. The first step was qualitative and consisted in the characterization of the different positions of the three stems and loops in the 5' UTR sequences of all the strains under consideration belonging to the genus. Secondary structure sequences showing divergent base-pair combinations have been aligned for comparison. Palindromic positions have been characterized according to changes in nucleotide base-pairs identifying low-variable positions (LVP) including base-pairs present in less than 80% of the genus. The second step was quantitative, allowing the identification of genomic groups by clustering the base-pair combinations according to LVP. Relatedness among types was evaluated to identify homogeneous groups. Cross comparisons between types within the genus have been evaluated by computing the divergence percentage thus clarifying borderline and multirelated sequences. PMID:17719098

  2. Clustered Regularly Interspaced Short Palindromic Repeats: Challenges in Treating Retinal Disease.

    PubMed

    Chrenek, Micah A; Nickerson, John M; Boatright, Jeffrey H

    2016-01-01

    Ophthalmic researchers and clinicians arguably have led the way for safe, effective gene therapy, most notably with adeno-associated viral gene supplementation in the treatment for patients with Leber congenital amaurosis type 2 with mutations in the RPE65 gene. These successes notwithstanding, most other genetic retinal disease will be refractory to supplementation. The ideal gene therapy approach would correct gene mutations to restore normal function in the affected cells. Gene editing in which a mutant allele is inactivated or converted to sequence that restores normal function is hypothetically one such approach. Such editing involves site-specific digestion of mutant genomic DNA followed by repair. Previous experimental approaches were hampered by inaccurate and high rates of off-site lesioning and by overall low digestion rates. A new tool, clustered regularly interspaced short palindromic repeats coupled with the nuclease Cas9, may address both shortcomings. Some of the many challenges that must be addressed in moving clustered regularly interspaced short palindromic repeats coupled with the nuclease Cas9 therapies to the ophthalmic clinic are discussed here.

  3. Short inverted repeats initiate gene amplification through the formation of a large DNA palindrome in mammalian cells.

    PubMed

    Tanaka, Hisashi; Tapscott, Stephen J; Trask, Barbara J; Yao, Meng-Chao

    2002-06-25

    Gene amplification is a common form of genomic instability in a wide variety of organisms and is often associated with tumor progression in mammals. One striking feature of many amplified genes is their organization as large inverted duplications (palindromes). Here, we describe a molecular mechanism for palindrome formation in mammalian cells that is also conserved in protists. We introduced a short (79 or 229 bp) inverted repeat into the genome of Chinese hamster ovary cells and showed that it promoted the formation of a large DNA palindrome after an adjacent DNA double-strand break. This finding suggests that short inverted repeats in the mammalian genome can have a critical role in the initiation of gene amplification. This specific mechanism may provide a novel target for cancer therapies.

  4. Neural repetition suppression reflects fulfilled perceptual expectations

    PubMed Central

    Summerfield, Christopher; Monti, Jim M.P.; Trittschuh, Emily H.; Mesulam, M.-Marsel; Egner, Tobias

    2009-01-01

    Stimulus-evoked neural activity is attenuated upon stimulus repetition (‘repetition suppression’), a phenomenon attributed to largely automatic processes in sensory neurons. By manipulating the likelihood of stimulus repetition, we show that repetition suppression in the human brain is reduced when stimulus repetitions are improbable (and thus, unexpected). These data suggest that repetition suppression reflects a relative reduction in top-down perceptual ‘prediction error’ when processing an expected compared to an unexpected stimulus. PMID:19160497

  5. Paucity of moderately repetitive sequences

    SciTech Connect

    Schmid, C.W.

    1991-01-01

    We examined clones of renatured repetitive human DNA to find novel repetitive DNAs. After eliminating known repeats, the remaining clones were subjected to sequence analysis. These clones also corresponded to known repeats, but with greater sequence diversity. This indicates that either these libraries were depleted of short interspersed repeats in construction, or these repeats are much less prevalent in the human genome than is indicated by data from {und Xenopus} or sea urchin studies. We directly investigated the sequence composition of human DNA through traditional renaturation techniques with the goal of estimating the limits of abundance of repetitive sequence classes in human DNA. Our results sharply limit the maximum possible abundance to 1--2% of the human genome. Our estimate, minus the known repeats in this fraction, leaves about 1% (3 {times} 10{sup 7} nucleotides) of the human genome for novel repetitive elements. 2 refs. (MHB)

  6. A Perceptual Repetition Blindness Effect

    NASA Technical Reports Server (NTRS)

    Hochhaus, Larry; Johnston, James C.; Null, Cynthia H. (Technical Monitor)

    1994-01-01

    Before concluding Repetition Blindness is a perceptual phenomenon, alternative explanations based on memory retrieval problems and report bias must be rejected. Memory problems were minimized by requiring a judgment about only a single briefly displayed field. Bias and sensitivity effects were empirically measured with an ROC-curve analysis method based on confidence ratings. Results from five experiments support the hypothesis that Repetition Blindness can be a perceptual phenomenon.

  7. Unusual structure of a human middle repetitive DNA

    SciTech Connect

    Ratnasinghe, D.D.

    1993-01-01

    The L2Hs sequences are a polymorphic, interspersed, middle repetitive DNA family unique to human genomes. Genomic fingerprinting indicates that these DNAs vary from one individual to another and between tissues of the same individual. Sequence analysis reveals that they are AT-rich (76%) and contain many unusual sequence arrangements (palindromes, inverted and direct repeats). These sequence properties confer on the L2Hs elements the potential to fold into non-B-form structures, a characteristic of recombination hot spots. To test this hypothesis carbodiimide, osmium tetroxide and S[sub 1] nuclease were used as single-strand specific probes to study a recombinant plasmid, pN6.4.39, containing a single L2Hs segment. Different forms of the plasmid substrate were analyzed, including linear molecules and circular forms of DNA in growing E. coli cells were analyzed. Modified plasmid DNA was analyzed by primer extension in a sequencing-type reaction format. These studies demonstrate that the L2Hs sequences: (1) assume non-B-form structures both in vitro and in vivo, (2) map to predicted cruciform structures, (3) behave as C-type extrusion sequences, and (4) that these unusual DNA structures are dependent on plasmid superhelicity.

  8. The ocs element: a 16 base pair palindrome essential for activity of the octopine synthase enhancer

    PubMed Central

    Ellis, J. G.; Llewellyn, D. J.; Walker, J. C.; Dennis, E. S.; Peacock, W. J.

    1987-01-01

    A 176 bp DNA sequence lying upstream of the octopine synthase (ocs) promoter, previously shown to have enhancer-like properties in transgenic tobacco [Ellis et al. (1987) EMBO J., 6, 11-16], functions as an enhancer in protoplasts of Zea mays (a monocot plant) and Nicotiana plumbaginifolia (a dicotplant). We have characterized this element by transient expression assays using a linked alcohol dehydrogenase (Adh1) promoter from Z. mays and the chloramphenicol acetyltransferase coding sequences. The ocs sequence functions in both orientations but its enhancing activity is dependent upon its distance from the Adh1 promoter. Transient expression assays using deletion mutants and synthetic oligonucleotides show that a 16 bp palindrome ACGTAAGCGCTTACGT, contained within the 176 bp fragment, is essential and sufficient for enhancing activity in transient expression assays. ImagesFig. 2.Fig. 4.Fig. 5. PMID:16453801

  9. [Progress of genome engineering technology via clustered regularly interspaced short palindromic repeats--a review].

    PubMed

    Li, Hao; Qiu, Shaofu; Song, Hongbin

    2013-10-01

    In survival competition with phage, bacteria and archaea gradually evolved the acquired immune system--Clustered regularly interspaced short palindromic repeats (CRISPR), presenting the trait of transcribing the crRNA and the CRISPR-associated protein (Cas) to silence or cleaving the foreign double-stranded DNA specifically. In recent years, strong interest arises in prokaryotes primitive immune system and many in-depth researches are going on. Recently, researchers successfully repurposed CRISPR as an RNA-guided platform for sequence-specific gene expression, which provides a simple approach for selectively perturbing gene expression on a genome-wide scale. It will undoubtedly bring genome engineering into a more convenient and accurate new era.

  10. Assembling the Streptococcus thermophilus clustered regularly interspaced short palindromic repeats (CRISPR) array for multiplex DNA targeting.

    PubMed

    Guo, Lijun; Xu, Kun; Liu, Zhiyuan; Zhang, Cunfang; Xin, Ying; Zhang, Zhiying

    2015-06-01

    In addition to the advantages of scalable, affordable, and easy to engineer, the clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated protein (Cas) technology is superior for multiplex targeting, which is laborious and inconvenient when achieved by cloning multiple gRNA expressing cassettes. Here, we report a simple CRISPR array assembling method which will facilitate multiplex targeting usage. First, the Streptococcus thermophilus CRISPR3/Cas locus was cloned. Second, different CRISPR arrays were assembled with different crRNA spacers. Transformation assays using different Escherichia coli strains demonstrated efficient plasmid DNA targeting, and we achieved targeting efficiency up to 95% with an assembled CRISPR array with three crRNA spacers.

  11. Sequence and structure of the extrachromosomal palindrome encoding the ribosomal RNA genes in Dictyostelium.

    PubMed

    Sucgang, Richard; Chen, Guokai; Liu, Wen; Lindsay, Ryan; Lu, Jing; Muzny, Donna; Shaulsky, Gad; Loomis, William; Gibbs, Richard; Kuspa, Adam

    2003-05-01

    Ribosomal RNAs (rRNAs) are encoded by multicopy families of identical genes. In Dictyostelium and other protists, the rDNA is carried on extrachromosomal palindromic elements that comprise up to 20% of the nuclear DNA. We present the sequence of the 88 kb Dictyostelium rDNA element, noting that the rRNA genes are likely to be the only transcribed regions. By interrogating a library of ordered YAC clones, we provide evidence for a chromosomal copy of the rDNA on chromosome 4. This locus may provide master copies for the stable transmission of the extrachromosomal elements. The extrachromosomal elements were also found to form chromosome-sized clusters of DNA within nuclei of nocodazole-treated cells arrested in mitosis. These clusters resemble true chromosomes and may allow the efficient segregation of the rDNA during mitosis. These rDNA clusters may also explain the cytological observations of a seventh chromosome in this organism.

  12. A unique junctional palindromic sequence in mitochondrial DNA from a patient with progressive external ophthalmoplegia.

    PubMed

    Saiwaki, T; Shiga, K; Fukuyama, R; Tsutsumi, Y; Fushiki, S

    2000-12-01

    A polymerase chain reaction (PCR) based procedure was modified to determine the deletion of mitochondrial DNA (mtDNA). The protocol consists of coamplification both of deleted and wild-type segments of mtDNA using a long PCR technique; evaluation of the deleted portion within the amplified DNA segments by restriction enzyme digestion followed by densitometrical analysis; and direct subcloning into a plasmid vector for DNA sequencing. The procedure revealed a 5.3 kb deletion of mtDNA in the biopsied muscle tissue obtained from a patient clinically diagnosed with progressive external ophthalmoplegia. The 5' and 3' sequences at both sides of the breakpoint comprise a 17 bp palindrome and 5 bp tandem repeats, suggesting that the deletion might occur through slipped mispairing and other novel mechanisms. This improved procedure has the potential to detect deletions occurring in the entire length of mtDNA, and mighty be useful for clinical screening of progressive external ophthalmoplegia.

  13. Chronic occupational repetitive strain injury.

    PubMed Central

    O'Neil, B. A.; Forsythe, M. E.; Stanish, W. D.

    2001-01-01

    OBJECTIVE: To review common repetitive strain injuries (RSIs) that occur in the workplace, emphasizing diagnosis, treatment, and etiology of these conditions. QUALITY OF EVIDENCE: A MEDLINE search from January 1966 to June 1999 focused on articles published since 1990 because RSIs are relatively new diagnoses. MeSH headings that were explored using the thesaurus included "cumulative trauma disorder," "overuse injury," and "repetitive strain injury." The search was limited to English articles only, and preference was given to randomized controlled trials. MAIN MESSAGE: Repetitive strain injuries result from repeated stress to the body's soft tissue structures including muscles, tendons, and nerves. They often occur in patients who perform repetitive movements either in their jobs or in extracurricular activities. Common RSIs include tendon-related disorders, such as rotator cuff tendonitis, and peripheral nerve entrapment disorders, such as carpal tunnel syndrome. A careful history and physical examination often lead to the diagnosis, but newer imaging techniques, such as magnetic resonance imaging and ultrasound, can help in refractory cases. Conservative management with medication, physiotherapy, or bracing is the mainstay of treatment. Surgery is reserved for cases that do not respond to treatment. CONCLUSION: Repetitive strain injury is common; primary care physicians must establish a diagnosis and, more importantly, its relationship to occupation. Treatment can be offered by family physicians who refer to specialists for cases refractory to conservative management. PMID:11228032

  14. Between memory and destiny: repetition.

    PubMed

    Marucco, Norberto Carlos

    2007-04-01

    This essay focuses mainly on the topic of repetition (agieren)-on its metapsychological, clinical, and technical conceptions. It contains a core problem, that is, the question of the represented, the nonrepresented, and the unrepresentable in the psyche. This problem, in turn, brings to light the dialectical relation between drive and object and its specific articulation with the traumatic. The author attributes special significance to its clinical expression as 'destiny.' He points out a shift in the theory of the cure from recollection and the unveiling of unconscious desire, to the possibility of understanding 'pure' repetition, which would constitute the very essence of the drive. The author highlights three types of repetition, namely, 'representative' (oedipal) repetition, the repetition of the 'nonrepresented' (narcissistic), which may gain representation, and that of the 'unrepresentable' (sensory impressions, 'lived experiences from primal times,' 'prelinguistic signifiers,' 'ungovernable mnemic traces'). The concept-the metaphor-drive embryo brings the author close to the question of the archaic in psychoanalysis, where the repetition in the act would express itself. 'Another unconscious' would zealously conceal the entombed (verschüttet) that we are not yet able to describe-the 'innermost' rather than the 'buried' (untergegangen) or the 'annihilated' (zugrunde gegangen)-through a mechanism whose way of expression is repetition in the act. With 'Constructions in analysis' as its starting point, this paper suggests a different technical implementation from that of the Freudian construction; its main material is what emerges in the present of the transference as the repetition of 'something' lacking as history. The memory of the analytic process offers a historical diachrony whereby a temporality freed from repetition and utterly unique might unfold in the analysis. This diachrony would no longer be the historical reconstruction of material truth, but the

  15. Between memory and destiny: repetition.

    PubMed

    Marucco, Norberto Carlos

    2007-04-01

    This essay focuses mainly on the topic of repetition (agieren)-on its metapsychological, clinical, and technical conceptions. It contains a core problem, that is, the question of the represented, the nonrepresented, and the unrepresentable in the psyche. This problem, in turn, brings to light the dialectical relation between drive and object and its specific articulation with the traumatic. The author attributes special significance to its clinical expression as 'destiny.' He points out a shift in the theory of the cure from recollection and the unveiling of unconscious desire, to the possibility of understanding 'pure' repetition, which would constitute the very essence of the drive. The author highlights three types of repetition, namely, 'representative' (oedipal) repetition, the repetition of the 'nonrepresented' (narcissistic), which may gain representation, and that of the 'unrepresentable' (sensory impressions, 'lived experiences from primal times,' 'prelinguistic signifiers,' 'ungovernable mnemic traces'). The concept-the metaphor-drive embryo brings the author close to the question of the archaic in psychoanalysis, where the repetition in the act would express itself. 'Another unconscious' would zealously conceal the entombed (verschüttet) that we are not yet able to describe-the 'innermost' rather than the 'buried' (untergegangen) or the 'annihilated' (zugrunde gegangen)-through a mechanism whose way of expression is repetition in the act. With 'Constructions in analysis' as its starting point, this paper suggests a different technical implementation from that of the Freudian construction; its main material is what emerges in the present of the transference as the repetition of 'something' lacking as history. The memory of the analytic process offers a historical diachrony whereby a temporality freed from repetition and utterly unique might unfold in the analysis. This diachrony would no longer be the historical reconstruction of material truth, but the

  16. Constructive and Unconstructive Repetitive Thought

    ERIC Educational Resources Information Center

    Watkins, Edward R.

    2008-01-01

    The author reviews research showing that repetitive thought (RT) can have constructive or unconstructive consequences. The main unconstructive consequences of RT are (a) depression, (b) anxiety, and (c) difficulties in physical health. The main constructive consequences of RT are (a) recovery from upsetting and traumatic events, (b) adaptive…

  17. Unintended Imitation in Nonword Repetition

    ERIC Educational Resources Information Center

    Kappes, Juliane; Baumgaertner, Annette; Peschke, Claudia; Ziegler, Wolfram

    2009-01-01

    Verbal repetition is conventionally considered to require motor-reproduction of only the phonologically relevant content of a perceived linguistic stimulus, while imitation of incidental acoustic properties of the stimulus is not an explicit part of this task. Exemplar-based theories of speech processing, however, would predict that imitation…

  18. Repetitive elements in parasitic protozoa.

    PubMed

    Clayton, Christine

    2010-01-01

    A recent paper published in BMC Genomics suggests that retrotransposition may be active in the human gut parasite Entamoeba histolytica. This adds to our knowledge of the various types of repetitive elements in parasitic protists and the potential influence of such elements on pathogenicity.

  19. Repetitive DNA in eukaryotic genomes.

    PubMed

    Biscotti, Maria Assunta; Olmo, Ettore; Heslop-Harrison, J S Pat

    2015-09-01

    Repetitive DNA--sequence motifs repeated hundreds or thousands of times in the genome--makes up the major proportion of all the nuclear DNA in most eukaryotic genomes. However, the significance of repetitive DNA in the genome is not completely understood, and it has been considered to have both structural and functional roles, or perhaps even no essential role. High-throughput DNA sequencing reveals huge numbers of repetitive sequences. Most bioinformatic studies focus on low-copy DNA including genes, and hence, the analyses collapse repeats in assemblies presenting only one or a few copies, often masking out and ignoring them in both DNA and RNA read data. Chromosomal studies are proving vital to examine the distribution and evolution of sequences because of the challenges of analysis of sequence data. Many questions are open about the origin, evolutionary mode and functions that repetitive sequences might have in the genome. Some, the satellite DNAs, are present in long arrays of similar motifs at a small number of sites, while others, particularly the transposable elements (DNA transposons and retrotranposons), are dispersed over regions of the genome; in both cases, sequence motifs may be located at relatively specific chromosome domains such as centromeres or subtelomeric regions. Here, we overview a range of works involving detailed characterization of the nature of all types of repetitive sequences, in particular their organization, abundance, chromosome localization, variation in sequence within and between chromosomes, and, importantly, the investigation of their transcription or expression activity. Comparison of the nature and locations of sequences between more, and less, related species is providing extensive information about their evolution and amplification. Some repetitive sequences are extremely well conserved between species, while others are among the most variable, defining differences between even closely relative species. These data suggest

  20. Species characterization in the genus Pestivirus according to palindromic nucleotide substitutions in the 5'-untranslated region.

    PubMed

    Giangaspero, Massimo; Harasawa, Ryô

    2011-06-01

    The palindromic nucleotide substitutions (PNS) at the three variable loci (V1, V2 and V3) in the 5'-untranslated region (UTR) of the Pestivirus genome have been considered for taxonomical segregation of the species, through the evaluation of 534 strains. On the basis of qualitative and quantitative secondary structure characteristics, species have been identified within the genus, determining genetic distances between species isolates, clarifying borderline and multirelated sequences, and characterizing and clustering the Pestivirus strains showing unexpected genomic sequences. Nine genomic groups have been identified: the species Bovine viral diarrhea virus 1 (BVDV-1), Bovine viral diarrhea virus 2 (BVDV-2), Border disease virus (BDV) and Classical swine fever virus (CSFV) and the tentative species Pronghorn, Giraffe, Bovine viral diarrhea virus 3 (BVDV-3) (HoBi group), Border disease virus 2 (BDV-2) (Italian small ruminant isolates) and Bungowannah. Palindromic positions have been characterized according to changes in nucleotide base-pairs identifying low variable positions (LVP) including base-pairs present in less than 80% of the genus. The determination of divergence between single strain sequences or genetic groups was obtained easily by comparing base-pairing combinations from aligned secondary structures. This provided clear information such as the level of heterogeneity within a species, the relatedness between species, or facilitating the characterization and clustering of specific strains. The BVDV-1 and BDV species resulted heterogeneous, showing isolates located on a borderline in the species. Within the BVDV-2 species, two main genogroups were identified, with strains showing common sequence characteristics to both groups (multirelated strains). They could be allocated correctly by quantitative analysis. Similarly, the relation between CSFV and BDV species appeared very clearly. Also in this case, ambiguous strain sequences could be clustered in the

  1. Correlations in a Mozart's music score (K-73x) with palindromic and upside-down structure

    NASA Astrophysics Data System (ADS)

    Dagdug, Leonardo; Alvarez-Ramirez, Jose; Lopez, Carlos; Moreno, Rodolfo; Hernandez-Lemus, Enrique

    2007-09-01

    In this work, we study long-range correlations in a “Scherzo-Duetto di Mozart” score (K-73x) for two violins. This is a fascinating piece, as the second violin part is upside down on the same sheet below the first violin, and some parts are like a palindrome. Given such ingenious structure, it is expected the existence of long-range correlations in the score structure. In order to quantify long-range correlations, we considered the music score as a sequence of integer numbers, each of them corresponding to last common denominator units of note. By using detrended fluctuation analysis (DFA), correlations are quantified by means of the scaling exponent that reflects the type of correlations for a given distance between neighbors note. The following conclusions can be drawn from the analysis: (a) For about 10-25 neighbor note distances, correlations are similar to 1/f-noise. This is an interesting finding since it has been shown that pleasant sounds for humans display a behavior similar to 1/f noise. (b) As the neighbor note distance increases, the long-range correlations decays continuously. For some score sections, the music score behaves like non-correlated (i.e., purely random) noise. Summing up, the results show that the studied Mozart's score contains a certain degree of correlation for relatively small note distances, and becomes close to non-correlated behavior for long note distances. We considered also the sequence constructed by considering the distance between the simultaneously played notes of the two violins. Interestingly, for relatively small neighbor note distances, a scaling behavior similar to that found for individual violins is also displayed. In some sense, this is an expression of the specific structure (palindromes plus upside down construction) used by Mozart in the composition of this music score. Although we focused on a particular high-art music score, our results suggest that modern methods borrowed from statistical physics can be

  2. Evolutionary dynamics of clustered irregularly interspaced short palindromic repeat systems in the ocean metagenome.

    PubMed

    Sorokin, Valery A; Gelfand, Mikhail S; Artamonova, Irena I

    2010-04-01

    Clustered regularly interspaced short palindromic repeats (CRISPRs) form a recently characterized type of prokaryotic antiphage defense system. The phage-host interactions involving CRISPRs have been studied in experiments with selected bacterial or archaeal species and, computationally, in completely sequenced genomes. However, these studies do not allow one to take prokaryotic population diversity and phage-host interaction dynamics into account. This gap can be filled by using metagenomic data: in particular, the largest existing data set, generated from the Sorcerer II Global Ocean Sampling expedition. The application of three publicly available CRISPR recognition programs to the Global Ocean metagenome produced a large proportion of false-positive results. To address this problem, a filtering procedure was designed. It resulted in about 200 reliable CRISPR cassettes, which were then studied in detail. The repeat consensuses were clustered into several stable classes that differed from the existing classification. Short fragments of DNA similar to the cassette spacers were more frequently present in the same geographical location than in other locations (P, <0.0001). We developed a catalogue of elementary CRISPR-forming events and reconstructed the likely evolutionary history of cassettes that had common spacers. Metagenomic collections allow for relatively unbiased analysis of phage-host interactions and CRISPR evolution. The results of this study demonstrate that CRISPR cassettes retain the memory of the local virus population at a particular ocean location. CRISPR evolution may be described using a limited vocabulary of elementary events that have a natural biological interpretation.

  3. CRISPRFinder: a web tool to identify clustered regularly interspaced short palindromic repeats.

    PubMed

    Grissa, Ibtissem; Vergnaud, Gilles; Pourcel, Christine

    2007-07-01

    Clustered regularly interspaced short palindromic repeats (CRISPRs) constitute a particular family of tandem repeats found in a wide range of prokaryotic genomes (half of eubacteria and almost all archaea). They consist of a succession of highly conserved regions (DR) varying in size from 23 to 47 bp, separated by similarly sized unique sequences (spacer) of usually viral origin. A CRISPR cluster is flanked on one side by an AT-rich sequence called the leader and assumed to be a transcriptional promoter. Recent studies suggest that this structure represents a putative RNA-interference-based immune system. Here we describe CRISPRFinder, a web service offering tools to (i) detect CRISPRs including the shortest ones (one or two motifs); (ii) define DRs and extract spacers; (iii) get the flanking sequences to determine the leader; (iv) blast spacers against Genbank database and (v) check if the DR is found elsewhere in prokaryotic sequenced genomes. CRISPRFinder is freely accessible at http://crispr.u-psud.fr/Server/CRISPRfinder.php.

  4. Function and regulation of clustered regularly interspaced short palindromic repeats (CRISPR) / CRISPR associated (Cas) systems.

    PubMed

    Richter, Corinna; Chang, James T; Fineran, Peter C

    2012-10-19

    Phages are the most abundant biological entities on earth and pose a constant challenge to their bacterial hosts. Thus, bacteria have evolved numerous 'innate' mechanisms of defense against phage, such as abortive infection or restriction/modification systems. In contrast, the clustered regularly interspaced short palindromic repeats (CRISPR) systems provide acquired, yet heritable, sequence-specific 'adaptive' immunity against phage and other horizontally-acquired elements, such as plasmids. Resistance is acquired following viral infection or plasmid uptake when a short sequence of the foreign genome is added to the CRISPR array. CRISPRs are then transcribed and processed, generally by CRISPR associated (Cas) proteins, into short interfering RNAs (crRNAs), which form part of a ribonucleoprotein complex. This complex guides the crRNA to the complementary invading nucleic acid and targets this for degradation. Recently, there have been rapid advances in our understanding of CRISPR/Cas systems. In this review, we will present the current model(s) of the molecular events involved in both the acquisition of immunity and interference stages and will also address recent progress in our knowledge of the regulation of CRISPR/Cas systems.

  5. Lactobacillus buchneri genotyping on the basis of clustered regularly interspaced short palindromic repeat (CRISPR) locus diversity.

    PubMed

    Briner, Alexandra E; Barrangou, Rodolphe

    2014-02-01

    Clustered regularly interspaced short palindromic repeats (CRISPR) in combination with associated sequences (cas) constitute the CRISPR-Cas immune system, which uptakes DNA from invasive genetic elements as novel "spacers" that provide a genetic record of immunization events. We investigated the potential of CRISPR-based genotyping of Lactobacillus buchneri, a species relevant for commercial silage, bioethanol, and vegetable fermentations. Upon investigating the occurrence and diversity of CRISPR-Cas systems in Lactobacillus buchneri genomes, we observed a ubiquitous occurrence of CRISPR arrays containing a 36-nucleotide (nt) type II-A CRISPR locus adjacent to four cas genes, including the universal cas1 and cas2 genes and the type II signature gene cas9. Comparative analysis of CRISPR spacer content in 26 L. buchneri pickle fermentation isolates associated with spoilage revealed 10 unique locus genotypes that contained between 9 and 29 variable spacers. We observed a set of conserved spacers at the ancestral end, reflecting a common origin, as well as leader-end polymorphisms, reflecting recent divergence. Some of these spacers showed perfect identity with phage sequences, and many spacers showed homology to Lactobacillus plasmid sequences. Following a comparative analysis of sequences immediately flanking protospacers that matched CRISPR spacers, we identified a novel putative protospacer-adjacent motif (PAM), 5'-AAAA-3'. Overall, these findings suggest that type II-A CRISPR-Cas systems are valuable for genotyping of L. buchneri.

  6. CRISPRcompar: a website to compare clustered regularly interspaced short palindromic repeats.

    PubMed

    Grissa, Ibtissem; Vergnaud, Gilles; Pourcel, Christine

    2008-07-01

    Clustered regularly interspaced short palindromic repeat (CRISPR) elements are a particular family of tandem repeats present in prokaryotic genomes, in almost all archaea and in about half of bacteria, and which participate in a mechanism of acquired resistance against phages. They consist in a succession of direct repeats (DR) of 24-47 bp separated by similar sized unique sequences (spacers). In the large majority of cases, the direct repeats are highly conserved, while the number and nature of the spacers are often quite diverse, even among strains of a same species. Furthermore, the acquisition of new units (DR + spacer) was shown to happen almost exclusively on one side of the locus. Therefore, the CRISPR presents an interesting genetic marker for comparative and evolutionary analysis of closely related bacterial strains. CRISPRcompar is a web service created to assist biologists in the CRISPR typing process. Two tools facilitates the in silico investigation: CRISPRcomparison and CRISPRtionary. This website is freely accessible at http://crispr.u-psud.fr/CRISPRcompar/.

  7. Repetition blindness for pseudoobject pictures.

    PubMed

    Arnell, K M; Jolicoeur, P

    1997-08-01

    In this study the nature of type activations that underlie repetition blindness (RB) was addressed. According to the token individuation hypothesis put forward to explain RB, both instances of a repeated stimulus make contact with the mental representation, or type, for that stimulus. In the resulting confusion only the first stimulus is encoded as an episodic instance or token. Type representations have traditionally been thought of as preexisting and are often linked within a network of nodes. The authors developed and tested a picture frequency task, which does not require stimulus naming, and used it to examine repetition performance for unfamiliar nonobject pictures. RB was found for these stimuli, despite the fact that they had no prior phonological or semantic representation. These results suggest that the reactivation of a newly formed visual type is sufficient to produce RB. Implications for the role of types in the token individuation hypothesis are discussed.

  8. High-resolution DNA melt curve analysis of the clustered, regularly interspaced short-palindromic-repeat locus of Campylobacter jejuni.

    PubMed

    Price, Erin P; Smith, Helen; Huygens, Flavia; Giffard, Philip M

    2007-05-01

    A novel method for genotyping the clustered, regularly interspaced short-palindromic-repeat (CRISPR) locus of Campylobacter jejuni is described. Following real-time PCR, CRISPR products were subjected to high-resolution melt (HRM) analysis, a new technology that allows precise melt profile determination of amplicons. This investigation shows that the CRISPR HRM assay provides a powerful addition to existing C. jejuni genotyping methods and emphasizes the potential of HRM for genotyping short sequence repeats in other species.

  9. Workshop on Repetitive Opening Switches

    NASA Astrophysics Data System (ADS)

    Kristiansen, M.; Schoenbach, K. H.

    1981-04-01

    A workshop on Repetitive Opening Switches was conducted by Texas Tech University for the U.S. Army Research Office. Several papers on a wide range of innovative opening switch concepts were presented. Discussions about the research needs to advance the state-of-the-art in this important, emerging field are summarized. A concensus on research topics and their importance is summarized and a suggested research priority list given.

  10. Chromosome specific repetitive DNA sequences

    DOEpatents

    Moyzis, Robert K.; Meyne, Julianne

    1991-01-01

    A method is provided for determining specific nucleotide sequences useful in forming a probe which can identify specific chromosomes, preferably through in situ hybridization within the cell itself. In one embodiment, chromosome preferential nucleotide sequences are first determined from a library of recombinant DNA clones having families of repetitive sequences. Library clones are identified with a low homology with a sequence of repetitive DNA families to which the first clones respectively belong and variant sequences are then identified by selecting clones having a pattern of hybridization with genomic DNA dissimilar to the hybridization pattern shown by the respective families. In another embodiment, variant sequences are selected from a sequence of a known repetitive DNA family. The selected variant sequence is classified as chromosome specific, chromosome preferential, or chromosome nonspecific. Sequences which are classified as chromosome preferential are further sequenced and regions are identified having a low homology with other regions of the chromosome preferential sequence or with known sequences of other family me This invention is the result of a contract with the Department of Energy (Contract No. W-7405-ENG-36).

  11. Palindrome analyser - A new web-based server for predicting and evaluating inverted repeats in nucleotide sequences.

    PubMed

    Brázda, Václav; Kolomazník, Jan; Lýsek, Jiří; Hároníková, Lucia; Coufal, Jan; Št'astný, Jiří

    2016-09-30

    DNA cruciform structures play an important role in the regulation of natural processes including gene replication and expression, as well as nucleosome structure and recombination. They have also been implicated in the evolution and development of diseases such as cancer and neurodegenerative disorders. Cruciform structures are formed by inverted repeats, and their stability is enhanced by DNA supercoiling and protein binding. They have received broad attention because of their important roles in biology. Computational approaches to study inverted repeats have allowed detailed analysis of genomes. However, currently there are no easily accessible and user-friendly tools that can analyse inverted repeats, especially among long nucleotide sequences. We have developed a web-based server, Palindrome analyser, which is a user-friendly application for analysing inverted repeats in various DNA (or RNA) sequences including genome sequences and oligonucleotides. It allows users to search and retrieve desired gene/nucleotide sequence entries from the NCBI databases, and provides data on length, sequence, locations and energy required for cruciform formation. Palindrome analyser also features an interactive graphical data representation of the distribution of the inverted repeats, with options for sorting according to the length of inverted repeat, length of loop, and number of mismatches. Palindrome analyser can be accessed at http://bioinformatics.ibp.cz.

  12. A 140-Bp-Long Palindromic Sequence Induces Double-Strand Breaks during Meiosis in the Yeast Saccharomyces Cerevisiae

    PubMed Central

    Nag, D. K.; Kurst, A.

    1997-01-01

    Palindromic sequences have the potential to form hairpin or cruciform structures, which are putative substrates for several nucleases and mismatch repair enzymes. A genetic method was developed to detect such structures in vivo in the yeast Saccharomyces cerevisiae. Using this method we previously showed that short hairpin structures are poorly repaired by the mismatch repair system in S. cerevisiae. We show here that mismatches, when present in the stem of the hairpin structure, are not processed by the repair machinery, suggesting that they are treated differently than those in the interstrand base-paired duplex DNA. A 140-bp-long palindromic sequence, on the contrary, acts as a meiotic recombination hotspot by generating a site for a double-strand break, an initiator of meiotic recombination. We suggest that long palindromic sequences undergo cruciform extrusion more readily than short ones. This cruciform structure then acts as a substrate for structure-specific nucleases resulting in the formation of a double-strand break during meiosis in yeast. In addition, we show that residual repair of the short hairpin structure occurs in an MSH2-independent pathway. PMID:9215890

  13. Palindrome analyser - A new web-based server for predicting and evaluating inverted repeats in nucleotide sequences.

    PubMed

    Brázda, Václav; Kolomazník, Jan; Lýsek, Jiří; Hároníková, Lucia; Coufal, Jan; Št'astný, Jiří

    2016-09-30

    DNA cruciform structures play an important role in the regulation of natural processes including gene replication and expression, as well as nucleosome structure and recombination. They have also been implicated in the evolution and development of diseases such as cancer and neurodegenerative disorders. Cruciform structures are formed by inverted repeats, and their stability is enhanced by DNA supercoiling and protein binding. They have received broad attention because of their important roles in biology. Computational approaches to study inverted repeats have allowed detailed analysis of genomes. However, currently there are no easily accessible and user-friendly tools that can analyse inverted repeats, especially among long nucleotide sequences. We have developed a web-based server, Palindrome analyser, which is a user-friendly application for analysing inverted repeats in various DNA (or RNA) sequences including genome sequences and oligonucleotides. It allows users to search and retrieve desired gene/nucleotide sequence entries from the NCBI databases, and provides data on length, sequence, locations and energy required for cruciform formation. Palindrome analyser also features an interactive graphical data representation of the distribution of the inverted repeats, with options for sorting according to the length of inverted repeat, length of loop, and number of mismatches. Palindrome analyser can be accessed at http://bioinformatics.ibp.cz. PMID:27603574

  14. Palindrome regeneration by template strand-switching mechanism at the origin of DNA replication of porcine circovirus via the rolling-circle melting-pot replication model.

    PubMed

    Cheung, Andrew K

    2004-09-01

    Palindromic sequences (inverted repeats) flanking the origin of DNA replication with the potential of forming single-stranded stem-loop cruciform structures have been reported to be essential for replication of the circular genomes of many prokaryotic and eukaryotic systems. In this study, mutant genomes of porcine circovirus with deletions in the origin-flanking palindrome and incapable of forming any cruciform structures invariably yielded progeny viruses containing longer and more stable palindromes. These results suggest that origin-flanking palindromes are essential for termination but not for initiation of DNA replication. Detection of template strand switching in the middle of an inverted repeat strand among the progeny viruses demonstrated that both the minus genome and a corresponding palindromic strand served as templates simultaneously during DNA biosynthesis and supports the recently proposed rolling-circle "melting-pot" replication model. The genome configuration presented by this model, a four-stranded tertiary structure, provides insights into the mechanisms of DNA replication, inverted repeat correction (or conversion), and illegitimate recombination of any circular DNA molecule with an origin-flanking palindrome.

  15. Characterization of highly and moderately repetitive 500 bp Eco RI fragments from Xenopus laevis DNA.

    PubMed Central

    Hummel, S; Meyerhof, W; Korge, E; Knöchel, W

    1984-01-01

    Three different types of repetitive Eco RI fragments, which comigrate within a visible band of approximately 500 bp at gel electrophoresis of Xenopus laevis DNA Eco RI digests have been cloned and sequenced. These sequences are designated as Repetitive Eco RI Monomers: REM 1, REM 2 and REM 3. The sequences contain direct repeats, inverted repeats and palindromic elements. Genomic organization of the most abundant sequence (REM 1; 0.4% of total DNA) is that of an interspersed sequence. REM 2 (0.08%) is partly organized as an interspersed element and partly found in tandem arrangement, whereas REM 3 (0.02%) represents the tandemly repeated monomeric unit of a satellite DNA. In situ hybridization has shown that REM 1 and REM 2 sequences are found on most chromosomes, REM 1 being preferentially located on specific chromosomal loci. REM 3 is located near the centromere region of only one chromosome pair (presumably number 1). Hybridization of Northern blots from RNAs of different developmental stages revealed that REM 1, REM 2 and REM 3 sequences are transcribed and that transcription is under developmental control. Images PMID:6330690

  16. Optimal Packaging of FIV Genomic RNA Depends upon a Conserved Long-range Interaction and a Palindromic Sequence within gag

    PubMed Central

    Rizvi, Tahir A.; Kenyon, Julia C.; Ali, Jahabar; Aktar, Suriya J.; Phillip, Pretty S.; Ghazawi, Akela; Mustafa, Farah; Lever, Andrew M.L.

    2010-01-01

    The feline immunodeficiency virus (FIV) is a lentivirus that is related to human immunodeficiency virus (HIV), causing a similar pathology in cats. It is a potential small animal model for AIDS and the FIV-based vectors are also being pursued for human gene therapy. Previous studies have mapped the FIV packaging signal (ψ) to two or more discontinuous regions within the 5′ 511 nt of the genomic RNA and structural analyses have determined its secondary structure. The 5′ and 3′ sequences within ψ region interact through extensive long-range interactions (LRIs), including a conserved heptanucleotide interaction between R/U5 and gag. Other secondary structural elements identified include a conserved 150 nt stem–loop (SL2) and a small palindromic stem–loop within gag open reading frame that might act as a viral dimerization initiation site. We have performed extensive mutational analysis of these sequences and structures and ascertained their importance in FIV packaging using a trans-complementation assay. Disrupting the conserved heptanucleotide LRI to prevent base pairing between R/U5 and gag reduced packaging by 2.8–5.5 fold. Restoration of pairing using an alternative, non-wild type (wt) LRI sequence restored RNA packaging and propagation to wt levels, suggesting that it is the structure of the LRI, rather than its sequence, that is important for FIV packaging. Disrupting the palindrome within gag reduced packaging by 1.5–3-fold, but substitution with a different palindromic sequence did not restore packaging completely, suggesting that the sequence of this region as well as its palindromic nature is important. Mutation of individual regions of SL2 did not have a pronounced effect on FIV packaging, suggesting that either it is the structure of SL2 as a whole that is necessary for optimal packaging, or that there is redundancy within this structure. The mutational analysis presented here has further validated the previously predicted RNA secondary

  17. Pressure rig for repetitive casting

    SciTech Connect

    Vasquez, P.; Hutto, W.R.; Philips, A.R.

    1989-09-12

    This patent describes a pressure rig for repetitive casting. It comprises: a hollow ceramic inner shell: an outer steel housing disposed around the outside of the ceramic inner shell. The housing having a pressure end at the lower end thereof and a mold end at the upper end thereof; a rubber diaphragm attached to the pressure end of the outer steel housing; a slideable transit plate located above the rubber diaphragm; a layer of blanket insulating material lining the remaining portion of the hollow ceramic inner shell, thereby defining an inner cavity wherein a casing material is located; a pressure means located at the lower end of the pressure rig for applying pressure to the lower end of the rubber diaphragm; whereby the casting material in the inner cavity is forced out of the pressure rig into a mold when pressure is applied to the lower end of the rubber diaphragm.

  18. Constructive and Unconstructive Repetitive Thought

    PubMed Central

    Watkins, Edward R.

    2008-01-01

    The author reviews research showing that repetitive thought (RT) can have constructive or unconstructive consequences. The main unconstructive consequences of RT are (a) depression, (b) anxiety, and (c) difficulties in physical health. The main constructive consequences of RT are (a) recovery from upsetting and traumatic events, (b) adaptive preparation and anticipatory planning, (c) recovery from depression, and (d) uptake of health-promoting behaviors. Several potential principles accounting for these distinct consequences of RT are identified within this review: (a) the valence of thought content, (b) the intrapersonal and situational context in which RT occurs, and (c) the level of construal (abstract vs. concrete processing) adopted during RT. Of the existing models of RT, it is proposed that an elaborated version of the control theory account provides the best theoretical framework to account for its distinct consequences. PMID:18298268

  19. Pressure rig for repetitive casting

    NASA Technical Reports Server (NTRS)

    Vasquez, Peter (Inventor); Hutto, William R. (Inventor); Philips, Albert R. (Inventor)

    1989-01-01

    The invention is a pressure rig for repetitive casting of metal. The pressure rig performs like a piston for feeding molten metal into a mold. Pressure is applied to an expandable rubber diaphragm which expands like a balloon to force the metal into the mold. A ceramic cavity which holds molten metal is lined with blanket-type insulating material, necessitating only a relining for subsequent use and eliminating the lengthy cavity preparation inherent in previous rigs. In addition, the expandable rubber diaphragm is protected by the insulating material thereby decreasing its vulnerability to heat damage. As a result of the improved design the life expectancy of the pressure rig contemplated by the present invention is more than doubled. Moreover, the improved heat protection has allowed the casting of brass and other alloys with higher melting temperatures than possible in the conventional pressure rigs.

  20. A Nonword Repetition Task for Speakers with Misarticulations: The Syllable Repetition Task (SRT)

    ERIC Educational Resources Information Center

    Shriberg, Lawrence D.; Lohmeier, Heather L.; Campbell, Thomas F.; Dollaghan, Christine A.; Green, Jordan R.; Moore, Christopher A.

    2009-01-01

    Purpose: Conceptual and methodological confounds occur when non(sense) word repetition tasks are administered to speakers who do not have the target speech sounds in their phonetic inventories or who habitually misarticulate targeted speech sounds. In this article, the authors (a) describe a nonword repetition task, the Syllable Repetition Task…

  1. Using a color-coded ambigraphic nucleic acid notation to visualize conserved palindromic motifs within and across genomes

    PubMed Central

    2014-01-01

    Background Ambiscript is a graphically-designed nucleic acid notation that uses symbol symmetries to support sequence complementation, highlight biologically-relevant palindromes, and facilitate the analysis of consensus sequences. Although the original Ambiscript notation was designed to easily represent consensus sequences for multiple sequence alignments, the notation’s black-on-white ambiguity characters are unable to reflect the statistical distribution of nucleotides found at each position. We now propose a color-augmented ambigraphic notation to encode the frequency of positional polymorphisms in these consensus sequences. Results We have implemented this color-coding approach by creating an Adobe Flash® application ( http://www.ambiscript.org) that shades and colors modified Ambiscript characters according to the prevalence of the encoded nucleotide at each position in the alignment. The resulting graphic helps viewers perceive biologically-relevant patterns in multiple sequence alignments by uniquely combining color, shading, and character symmetries to highlight palindromes and inverted repeats in conserved DNA motifs. Conclusion Juxtaposing an intuitive color scheme over the deliberate character symmetries of an ambigraphic nucleic acid notation yields a highly-functional nucleic acid notation that maximizes information content and successfully embodies key principles of graphic excellence put forth by the statistician and graphic design theorist, Edward Tufte. PMID:24447494

  2. Serial Position Effects in Nonword Repetition

    ERIC Educational Resources Information Center

    Gupta, P.; Lipinski, J.; Abbs, B.; Lin, P.H.

    2005-01-01

    A growing body of research has emphasized the linkage between performance in immediate serial recall of lists, nonword repetition, and word learning. Recently, it has been reported that primacy and recency effects are obtained in repetition of individual syllables within nonwords (Gupta, in press). Five experiments examined whether such…

  3. Grade Repetition in Queensland State Prep Classes

    ERIC Educational Resources Information Center

    Anderson, Robyn

    2012-01-01

    The current study considers grade repetition rates in the early years of schooling in Queensland state schools with specific focus on the pre-schooling year, Prep. In particular, it provides empirical evidence of grade repetition in Queensland state schools along with groups of students who are more often repeated. At the same time, much of the…

  4. Repetition priming results in sensitivity attenuation

    PubMed Central

    Allenmark, Fredrik; Hsu, Yi-Fang; Roussel, Cedric; Waszak, Florian

    2015-01-01

    Repetition priming refers to the change in the ability to perform a task on a stimulus as a consequence of a former encounter with that very same item. Usually, repetition results in faster and more accurate performance. In the present study, we used a contrast discrimination protocol to assess perceptual sensitivity and response bias of Gabor gratings that are either repeated (same orientation) or alternated (different orientation). We observed that contrast discrimination performance is worse, not better, for repeated than for alternated stimuli. In a second experiment, we varied the probability of stimulus repetition, thus testing whether the repetition effect is due to bottom-up or top-down factors. We found that it is top-down expectation that determines the effect. We discuss the implication of these findings for repetition priming and related phenomena as sensory attenuation. This article is part of a Special Issue entitled SI: Prediction and Attention. PMID:25819554

  5. Fast repetition rate (FRR) flasher

    DOEpatents

    Kolber, Zbigniew; Falkowski, Paul

    1997-02-11

    A fast repetition rate (FRR) flasher suitable for high flash photolysis including kinetic chemical and biological analysis. The flasher includes a power supply, a discharge capacitor operably connected to be charged by the power supply, and a flash lamp for producing a series of flashes in response to discharge of the discharge capacitor. A triggering circuit operably connected to the flash lamp initially ionizes the flash lamp. A current switch is operably connected between the flash lamp and the discharge capacitor. The current switch has at least one insulated gate bipolar transistor for switching current that is operable to initiate a controllable discharge of the discharge capacitor through the flash lamp. Control means connected to the current switch for controlling the rate of discharge of the discharge capacitor thereby to effectively keep the flash lamp in an ionized state between Successive discharges of the discharge capacitor. Advantageously, the control means is operable to discharge the discharge capacitor at a rate greater than 10,000 Hz and even up to a rate greater than about 250,000 Hz.

  6. Strategies for Using Repetition as a Powerful Teaching Tool

    ERIC Educational Resources Information Center

    Saville, Kirt

    2011-01-01

    Brain research indicates that repetition is of vital importance in the learning process. Repetition is an especially useful tool in the area of music education. The success of repetition can be enhanced by accurate and timely feedback. From "simple repetition" to "repetition with the addition or subtraction of degrees of freedom," there are many…

  7. Dispersed repetitive DNA sequence of Mucor racemosus.

    PubMed Central

    Dewar, R; Katayama, C; Sypherd, P S; Cihlar, R L

    1985-01-01

    A dispersed repetitive DNA sequence has been identified within the genome of the fungus Mucor racemosus. Recombinant phage clones, as well as a plasmid harboring the sequence, have been isolated. Examination of cloned fragments comprising part of the repetitive sequence has led to a partial characterization of the element. The sequence has been detected in other Mucor species, and although the apparent number and chromosomal position of the repetitive sequence vary from strain to strain, it is clear that at least portions of the element have been conserved. Images PMID:3980442

  8. Design superiority of palindromic DNA sites for site-specific recognition of proteins: tests using protein stitchery.

    PubMed Central

    Park, C; Campbell, J L; Goddard, W A

    1993-01-01

    Using protein stitchery with appropriate attachment of cysteines linking to either C or N termini of the basic region of the v-Jun leucine zipper gene-regulatory protein, we constructed three dimers--pCC, pCN, and pNN. All three bind specifically to the appropriately rearranged DNA recognition sites for v-Jun: ATGAcgTCAT, ATGAcgATGA, and TCATcgTCAT, respectively (Kd, approximately 4 nM at 4 degrees C). Results of DNase I footprinting provide strong support for bent recognition helices in leucine zipper protein-DNA complexes. Comparison of the results for pCC and pNN with those for pCN shows the design superiority of palindromic sequences for protein recognition. Images Fig. 1 Fig. 2 Fig. 3 PMID:8506333

  9. Numerical taxonomy of the genus Pestivirus: new software for genotyping based on the palindromic nucleotide substitutions method.

    PubMed

    Giangaspero, Massimo; Apicella, Claudio; Harasawa, Ryô

    2013-09-01

    The genus Pestivirus from the family Flaviviridae is represented by four established species; Bovine viral diarrhea virus 1 (BVDV-1); Bovine viral diarrhea virus 2 (BVDV-2); Border disease virus (BDV); and Classical swine fever virus (CSFV); as well a tentative species from a Giraffe. The palindromic nucleotide substitutions (PNS) in the 5' untranslated region (UTR) of Pestivirus RNA has been described as a new, simple and practical method for genotyping. New software is described, also named PNS, that was prepared specifically for this PNS genotyping procedure. Pestivirus identification using PNS was evaluated on five hundred and forty-three sequences at genus, species and genotype level using this software. The software is freely available at www.pns-software.com. PMID:23684846

  10. Crystal Structure of the Dimeric Oct6 (Pou3fl) POU Domain Bound to Palindromic MORE DNA

    SciTech Connect

    R Jauch; S Choo; C Ng; P Kolatkar

    2011-12-31

    POU domains (named after their identification in Pit1, Oct1 unc86) are found in around 15 transcription factors encoded in mammalian genomes many of which feature prominently as key regulators at development bifurcations. For example, the POU III class Octamer binding protein 6 (Oct6) is expressed in embryonic stem cells and during neural development and drives the differentia5tion of myelinated cells in the central and peripheral nervous system. Defects in oct6 expression levels are linked to neurological disorders such as schizophrenia. POU proteins contain a bi-partite DNA binding domain that assembles on various DNA motifs with differentially configured subdomains. Intriguingly, alternative configurations of POU domains on different DNA sites were shown to affect the subsequent recruitment of transcriptional coactivators. Namely, binding of Oct1 to a Palindromic Oct-factor Recognition Element (PORE) was shown to facilitate the recruitment of the OBF1 coactivator whereas More of PORE (MORE) bound Oct1 does not. Moreover, Pit1 was shown to recruit the corepressor N-CoR only when bound to a variant MORE motif with a 2 bp half-site spacing. Therefore, POU proteins are seen as a paradigm for DNA induced allosteric effects on transcription factors modulating their regulatory potential. However, a big unresolved conundrum for the POU class and for most if not all other transcription factor classes is how highly similar proteins regulate different sets of genes causing fundamentally different biological responses. Ultimately, there must be subtle features enabling those factors to engage in contrasting molecular interactions in the cell. Thus, the dissection of the molecular details of the transcription-DNA recognition in general, and the formation of multimeric regulatory complexes, in particular, is highly desirable. To contribute to these efforts they solved the 2.05 {angstrom} crystal structure of Oct6 bound as a symmetrical homodimer to palindromic MORE DNA.

  11. Minor and repetitive head injury.

    PubMed

    Buki, Andras; Kovacs, Noemi; Czeiter, Endre; Schmid, Kara; Berger, Rachel P; Kobeissy, Firas; Italiano, Domenico; Hayes, Ronald L; Tortella, Frank C; Mezosi, Emese; Schwarcz, Attila; Toth, Arnold; Nemes, Orsolya; Mondello, Stefania

    2015-01-01

    Traumatic brain injury (TBI) is the leading cause of death and disability in the young, active population and expected to be the third leading cause of death in the whole world until 2020. The disease is frequently referred to as the silent epidemic, and many authors highlight the "unmet medical need" associated with TBI.The term traumatically evoked brain injury covers a heterogeneous group ranging from mild/minor/minimal to severe/non-salvageable damages. Severe TBI has long been recognized to be a major socioeconomical health-care issue as saving young lives and sometimes entirely restituting health with a timely intervention can indeed be extremely cost efficient.Recently it has been recognized that mild or minor TBI should be considered similarly important because of the magnitude of the patient population affected. Other reasons behind this recognition are the association of mild head injury with transient cognitive disturbances as well as long-term sequelae primarily linked to repeat (sport-related) injuries.The incidence of TBI in developed countries can be as high as 2-300/100,000 inhabitants; however, if we consider the injury pyramid, it turns out that severe and moderate TBI represents only 25-30 % of all cases, while the overwhelming majority of TBI cases consists of mild head injury. On top of that, or at the base of the pyramid, are the cases that never show up at the ER - the unreported injuries.Special attention is turned to mild TBI as in recent military conflicts it is recognized as "signature injury."This chapter aims to summarize the most important features of mild and repetitive traumatic brain injury providing definitions, stratifications, and triage options while also focusing on contemporary knowledge gathered by imaging and biomarker research.Mild traumatic brain injury is an enigmatic lesion; the classification, significance, and its consequences are all far less defined and explored than in more severe forms of brain injury

  12. Repetitive strain injury: causes, treatment and prevention.

    PubMed

    Shuttleworth, Ann

    Repetitive strain injury (RSI) has become increasingly prevalent with the growth of computer-based and automated occupations. While environmental factors such as work stations and repetitive tasks are primary causes, a number of secondary causes can increase a person's risk of RSI. Various treatments provide relief but the rate of recovery varies widely. Prevention involves adopting a range of measures that will also promote recovery in those with RSI.

  13. Global familiarity of visual stimuli affects repetition-related neural plasticity but not repetition priming

    PubMed Central

    Soldan, Anja; Zarahn, Eric; Hilton, H. John; Stern, Yaakov

    2007-01-01

    In this study we tested the prediction of the component process model of priming (Henson, 2003) that repetition priming of familiar and unfamiliar objects produces qualitatively different neural repetition effects. In an fMRI study, subjects viewed four repetitions of familiar objects and globally unfamiliar objects with familiar components. Reliable behavioral priming occurred for both item types across the four presentations and was of a similar magnitude for both stimulus types. The imaging data was analyzed using multivariate linear modeling, which permits explicit testing of the hypothesis that the repetition effects for familiar and unfamiliar objects are qualitatively different (i.e., non-scaled versions of one another). The results showed the presence of two qualitatively different latent spatial patterns of repetition effects from presenation one to presentation four for familiar and unfamilar objects, indicating that familiarity with an object’s global structural, semantic, or lexical features is an important factor in priming-related neural plasticity. The first latent spatial pattern strongly weighted regions with a similar repetition effect for both item types. The second pattern strongly weighted regions contributing a repetition suppression effect for the familiar objects and repetition enhancement for the unfamiliar objects, particularly the posterior insula, superior temporal gyrus, precentral gyrus, and cingulate cortex. This differential repetition effect might reflect the formation of novel memory representations for the unfamiliar items, which already exist for the familiar objects, consistent with the component-process model of priming. PMID:17913513

  14. The Prevalence and Phenomenology of Repetitive Behavior in Genetic Syndromes

    ERIC Educational Resources Information Center

    Moss, Joanna; Oliver, Chris; Arron, Kate; Burbidge, Cheryl; Berg, Katy

    2009-01-01

    We investigated the prevalence and phenomenology of repetitive behavior in genetic syndromes to detail profiles of behavior. The Repetitive Behaviour Questionnaire (RBQ) provides fine-grained identification of repetitive behaviors. The RBQ was employed to examine repetitive behavior in Angelman (N = 104), Cornelia de Lange (N = 101), Cri-du-Chat…

  15. Repetition Priming and Repetition Suppression: A Case for Enhanced Efficiency Through Neural Synchronization

    PubMed Central

    Gotts, Stephen J.; Chow, Carson C.; Martin, Alex

    2012-01-01

    Stimulus repetition in identification tasks leads to improved behavioral performance ("repetition priming") but attenuated neural responses ("repetition suppression") throughout task-engaged cortical regions. While it's clear that this pervasive brain-behavior relationship reflects some form of improved processing efficiency, the exact form that it takes remains elusive. In this Discussion Paper, we review four different theoretical proposals that have the potential to link repetition suppression and priming, with a particular focus on a proposal that stimulus repetition affects improved efficiency through enhanced neural synchronization. We argue that despite exciting recent work on the role of neural synchronization in cognitive processes such as attention and perception, similar studies in the domain of learning and memory - and priming, in particular - have been lacking. We emphasize the need for new studies with adequate spatiotemporal resolution, formulate several novel predictions, and discuss our ongoing efforts to disentangle the current proposals. PMID:23144664

  16. Chromatin diminution in the copepod Mesocyclops edax: elimination of both highly repetitive and nonhighly repetitive DNA.

    PubMed

    McKinnon, Christian; Drouin, Guy

    2013-01-01

    Chromatin diminution, a developmentally regulated process of DNA elimination, is found in numerous eukaryotic species. In the copepod Mesocyclops edax, some 90% of its genomic DNA is eliminated during the differentiation of embryonic cells into somatic cells. Previous studies have shown that the eliminated DNA contains highly repetitive sequences. Here, we sequenced DNA fragments from pre- and postdiminution cells to determine whether nonhighly repetitive sequences are also eliminated during the process of chromatin diminution. Comparative analyses of these sequences, as well as the sequences eliminated from the genome of the copepod Cyclops kolensis, show that they all share similar abundances of tandem repeats, dispersed repeats, transposable elements, and various coding and noncoding sequences. This suggests that, in the chromatin diminution observed in M. edax, both highly repetitive and nonhighly repetitive sequences are eliminated and that there is no bias in the type of nonhighly repetitive DNA being eliminated.

  17. Conservative treatment for repetitive strain injury.

    PubMed

    Konijnenberg, H S; de Wilde, N S; Gerritsen, A A; van Tulder, M W; de Vet, H C

    2001-10-01

    Various conservative treatment options for repetitive strain injury are widely used, despite questionable evidence of their effectiveness. This systematic review evaluates the effectiveness of these treatment options for relieving symptoms of repetitive strain injury and improving activities of daily living. Searches in Medline and Embase, with additional reference checking resulted in 15 eligible trials for this review. Methodological quality was assessed, and data-extraction was performed. With the use of a "best-evidence synthesis", no strong evidence was found for the effectiveness of any of the treatment options. There is limited evidence that multidisciplinary rehabilitation, ergonomic intervention measures, exercises, and spinal manipulation combined with soft tissue therapy are effective in providing symptom relief or improving activities of daily living. There is conflicting evidence for the effectiveness of behavioral therapy. In conclusion, little is known about the effectiveness of conservative treatment options for repetitive strain injury. To establish strong evidence, more high-quality trials are needed.

  18. Gene Repression in Haloarchaea Using the CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats)-Cas I-B System*

    PubMed Central

    Stachler, Aris-Edda; Marchfelder, Anita

    2016-01-01

    The clustered regularly interspaced short palindromic repeats (CRISPR)-Cas system is used by bacteria and archaea to fend off foreign genetic elements. Since its discovery it has been developed into numerous applications like genome editing and regulation of transcription in eukaryotes and bacteria. For archaea currently no tools for transcriptional repression exist. Because molecular biology analyses in archaea become more and more widespread such a tool is vital for investigating the biological function of essential genes in archaea. Here we use the model archaeon Haloferax volcanii to demonstrate that its endogenous CRISPR-Cas system I-B can be harnessed to repress gene expression in archaea. Deletion of cas3 and cas6b genes results in efficient repression of transcription. crRNAs targeting the promoter region reduced transcript levels down to 8%. crRNAs targeting the reading frame have only slight impact on transcription. crRNAs that target the coding strand repress expression only down to 88%, whereas crRNAs targeting the template strand repress expression down to 8%. Repression of an essential gene results in reduction of transcription levels down to 22%. Targeting efficiencies can be enhanced by expressing a catalytically inactive Cas3 mutant. Genes can be targeted on plasmids or on the chromosome, they can be monocistronic or part of a polycistronic operon. PMID:27226589

  19. Double-stranded endonuclease activity in Bacillus halodurans clustered regularly interspaced short palindromic repeats (CRISPR)-associated Cas2 protein.

    PubMed

    Nam, Ki Hyun; Ding, Fran; Haitjema, Charles; Huang, Qingqiu; DeLisa, Matthew P; Ke, Ailong

    2012-10-19

    The CRISPR (clustered regularly interspaced short palindromic repeats) system is a prokaryotic RNA-based adaptive immune system against extrachromosomal genetic elements. Cas2 is a universally conserved core CRISPR-associated protein required for the acquisition of new spacers for CRISPR adaptation. It was previously characterized as an endoribonuclease with preference for single-stranded (ss)RNA. Here, we show using crystallography, mutagenesis, and isothermal titration calorimetry that the Bacillus halodurans Cas2 (Bha_Cas2) from the subtype I-C/Dvulg CRISPR instead possesses metal-dependent endonuclease activity against double-stranded (ds)DNA. This activity is consistent with its putative function in producing new spacers for insertion into the 5'-end of the CRISPR locus. Mutagenesis and isothermal titration calorimetry studies revealed that a single divalent metal ion (Mg(2+) or Mn(2+)), coordinated by a symmetric Asp pair in the Bha_Cas2 dimer, is involved in the catalysis. We envision that a pH-dependent conformational change switches Cas2 into a metal-binding competent conformation for catalysis. We further propose that the distinct substrate preferences among Cas2 proteins may be determined by the sequence and structure in the β1-α1 loop.

  20. Clustered Regularly Interspaced Short Palindromic Repeats Are emm Type-Specific in Highly Prevalent Group A Streptococci.

    PubMed

    Zheng, Po-Xing; Chan, Yuen-Chi; Chiou, Chien-Shun; Chiang-Ni, Chuan; Wang, Shu-Ying; Tsai, Pei-Jane; Chuang, Woei-Jer; Lin, Yee-Shin; Liu, Ching-Chuan; Wu, Jiunn-Jong

    2015-01-01

    Clustered regularly interspaced short palindromic repeats (CRISPR) are the bacterial adaptive immune system against foreign nucleic acids. Given the variable nature of CRISPR, it could be a good marker for molecular epidemiology. Group A streptococcus is one of the major human pathogens. It has two CRISPR loci, including CRISPR01 and CRISPR02. The aim of this study was to analyze the distribution of CRISPR-associated gene cassettes (cas) and CRISPR arrays in highly prevalent emm types. The cas cassette and CRISPR array in two CRISPR loci were analyzed in a total of 332 strains, including emm1, emm3, emm4, emm12, and emm28 strains. The CRISPR type was defined by the spacer content of each CRISPR array. All strains had at least one cas cassette or CRISPR array. More than 90% of the spacers were found in one emm type, specifically. Comparing the consistency between emm and CRISPR types by Simpson's index of diversity and the adjusted Wallace coefficient, CRISPR01 type was concordant to emm type, and CRISPR02 showed unidirectional congruence to emm type, suggesting that at least for the majority of isolates causing infection in high income countries, the emm type can be inferred from CRISPR analysis, which can further discriminate isolates sharing the same emm type.

  1. Comparisons of clustered regularly interspaced short palindromic repeats and viromes in human saliva reveal bacterial adaptations to salivary viruses.

    PubMed

    Pride, David T; Salzman, Julia; Relman, David A

    2012-09-01

    Explorations of human microbiota have provided substantial insight into microbial community composition; however, little is known about interactions between various microbial components in human ecosystems. In response to the powerful impact of viral predation, bacteria have acquired potent defences, including an adaptive immune response based on the clustered regularly interspaced short palindromic repeats (CRISPRs)/Cas system. To improve our understanding of the interactions between bacteria and their viruses in humans, we analysed 13 977 streptococcal CRISPR sequences and compared them with 2 588 172 virome reads in the saliva of four human subjects over 17 months. We found a diverse array of viruses and CRISPR spacers, many of which were specific to each subject and time point. There were numerous viral sequences matching CRISPR spacers; these matches were highly specific for salivary viruses. We determined that spacers and viruses coexist at the same time, which suggests that streptococcal CRISPR/Cas systems are under constant pressure from salivary viruses. CRISPRs in some subjects were just as likely to match viral sequences from other subjects as they were to match viruses from the same subject. Because interactions between bacteria and viruses help to determine the structure of bacterial communities, CRISPR-virus analyses are likely to provide insight into the forces shaping the human microbiome.

  2. Diversity, evolution, and functionality of clustered regularly interspaced short palindromic repeat (CRISPR) regions in the fire blight pathogen Erwinia amylovora.

    PubMed

    Rezzonico, Fabio; Smits, Theo H M; Duffy, Brion

    2011-06-01

    The clustered regularly interspaced short palindromic repeat (CRISPR)/Cas system confers acquired heritable immunity against mobile nucleic acid elements in prokaryotes, limiting phage infection and horizontal gene transfer of plasmids. In CRISPR arrays, characteristic repeats are interspersed with similarly sized nonrepetitive spacers derived from transmissible genetic elements and acquired when the cell is challenged with foreign DNA. New spacers are added sequentially and the number and type of CRISPR units can differ among strains, providing a record of phage/plasmid exposure within a species and giving a valuable typing tool. The aim of this work was to investigate CRISPR diversity in the highly homogeneous species Erwinia amylovora, the causal agent of fire blight. A total of 18 CRISPR genotypes were defined within a collection of 37 cosmopolitan strains. Strains from Spiraeoideae plants clustered in three major groups: groups II and III were composed exclusively of bacteria originating from the United States, whereas group I generally contained strains of more recent dissemination obtained in Europe, New Zealand, and the Middle East. Strains from Rosoideae and Indian hawthorn (Rhaphiolepis indica) clustered separately and displayed a higher intrinsic diversity than that of isolates from Spiraeoideae plants. Reciprocal exclusion was generally observed between plasmid content and cognate spacer sequences, supporting the role of the CRISPR/Cas system in protecting against foreign DNA elements. However, in several group III strains, retention of plasmid pEU30 is inconsistent with a functional CRISPR/Cas system.

  3. Gene Repression in Haloarchaea Using the CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats)-Cas I-B System.

    PubMed

    Stachler, Aris-Edda; Marchfelder, Anita

    2016-07-15

    The clustered regularly interspaced short palindromic repeats (CRISPR)-Cas system is used by bacteria and archaea to fend off foreign genetic elements. Since its discovery it has been developed into numerous applications like genome editing and regulation of transcription in eukaryotes and bacteria. For archaea currently no tools for transcriptional repression exist. Because molecular biology analyses in archaea become more and more widespread such a tool is vital for investigating the biological function of essential genes in archaea. Here we use the model archaeon Haloferax volcanii to demonstrate that its endogenous CRISPR-Cas system I-B can be harnessed to repress gene expression in archaea. Deletion of cas3 and cas6b genes results in efficient repression of transcription. crRNAs targeting the promoter region reduced transcript levels down to 8%. crRNAs targeting the reading frame have only slight impact on transcription. crRNAs that target the coding strand repress expression only down to 88%, whereas crRNAs targeting the template strand repress expression down to 8%. Repression of an essential gene results in reduction of transcription levels down to 22%. Targeting efficiencies can be enhanced by expressing a catalytically inactive Cas3 mutant. Genes can be targeted on plasmids or on the chromosome, they can be monocistronic or part of a polycistronic operon.

  4. A novel family of sequence-specific endoribonucleases associated with the clustered regularly interspaced short palindromic repeats.

    PubMed

    Beloglazova, Natalia; Brown, Greg; Zimmerman, Matthew D; Proudfoot, Michael; Makarova, Kira S; Kudritska, Marina; Kochinyan, Samvel; Wang, Shuren; Chruszcz, Maksymilian; Minor, Wladek; Koonin, Eugene V; Edwards, Aled M; Savchenko, Alexei; Yakunin, Alexander F

    2008-07-18

    Clustered regularly interspaced short palindromic repeats (CRISPRs) together with the associated CAS proteins protect microbial cells from invasion by foreign genetic elements using presently unknown molecular mechanisms. All CRISPR systems contain proteins of the CAS2 family, suggesting that these uncharacterized proteins play a central role in this process. Here we show that the CAS2 proteins represent a novel family of endoribonucleases. Six purified CAS2 proteins from diverse organisms cleaved single-stranded RNAs preferentially within U-rich regions. A representative CAS2 enzyme, SSO1404 from Sulfolobus solfataricus, cleaved the phosphodiester linkage on the 3'-side and generated 5'-phosphate- and 3'-hydroxyl-terminated oligonucleotides. The crystal structure of SSO1404 was solved at 1.6A resolution revealing the first ribonuclease with a ferredoxin-like fold. Mutagenesis of SSO1404 identified six residues (Tyr-9, Asp-10, Arg-17, Arg-19, Arg-31, and Phe-37) that are important for enzymatic activity and suggested that Asp-10 might be the principal catalytic residue. Thus, CAS2 proteins are sequence-specific endoribonucleases, and we propose that their role in the CRISPR-mediated anti-phage defense might involve degradation of phage or cellular mRNAs.

  5. A Novel Family of Sequence-specific Endoribonucleases Associated with the Clustered Regularly Interspaced Short Palindromic Repeats

    SciTech Connect

    Beloglazova, Natalia; Brown, Greg; Zimmerman, Matthew D.; Proudfoot, Michael; Makarova, Kira S.; Kudritska, Marina; Kochinyan, Samvel; Wang, Shuren; Chruszcz, Maksymilian; Minor, Wladek; Koonin, Eugene V.; Edwards, Aled M.; Savchenko, Alexei; Yakunin, Alexander F.

    2008-07-28

    Clustered regularly interspaced short palindromic repeats (CRISPRs) together with the associated CAS proteins protect microbial cells from invasion by foreign genetic elements using presently unknown molecular mechanisms. All CRISPR systems contain proteins of the CAS2 family, suggesting that these uncharacterized proteins play a central role in this process. Here we show that the CAS2 proteins represent a novel family of endoribonucleases. Six purified CAS2 proteins from diverse organisms cleaved single-stranded RNAs preferentially within U-rich regions. A representative CAS2 enzyme, SSO1404 from Sulfolobus solfataricus, cleaved the phosphodiester linkage on the 3'-side and generated 5'-phosphate- and 3'-hydroxyl-terminated oligonucleotides. The crystal structure of SSO1404 was solved at 1.6{angstrom} resolution revealing the first ribonuclease with a ferredoxin-like fold. Mutagenesis of SSO1404 identified six residues (Tyr-9, Asp-10, Arg-17, Arg-19, Arg-31, and Phe-37) that are important for enzymatic activity and suggested that Asp-10 might be the principal catalytic residue. Thus, CAS2 proteins are sequence-specific endoribonucleases, and we propose that their role in the CRISPR-mediated anti-phage defense might involve degradation of phage or cellular mRNAs.

  6. Clustered Regularly Interspaced Short Palindromic Repeats Are emm Type-Specific in Highly Prevalent Group A Streptococci

    PubMed Central

    Zheng, Po-Xing; Chan, Yuen-Chi; Chiou, Chien-Shun; Chiang-Ni, Chuan; Wang, Shu-Ying; Tsai, Pei-Jane; Chuang, Woei-Jer; Lin, Yee-Shin; Liu, Ching-Chuan; Wu, Jiunn-Jong

    2015-01-01

    Clustered regularly interspaced short palindromic repeats (CRISPR) are the bacterial adaptive immune system against foreign nucleic acids. Given the variable nature of CRISPR, it could be a good marker for molecular epidemiology. Group A streptococcus is one of the major human pathogens. It has two CRISPR loci, including CRISPR01 and CRISPR02. The aim of this study was to analyze the distribution of CRISPR-associated gene cassettes (cas) and CRISPR arrays in highly prevalent emm types. The cas cassette and CRISPR array in two CRISPR loci were analyzed in a total of 332 strains, including emm1, emm3, emm4, emm12, and emm28 strains. The CRISPR type was defined by the spacer content of each CRISPR array. All strains had at least one cas cassette or CRISPR array. More than 90% of the spacers were found in one emm type, specifically. Comparing the consistency between emm and CRISPR types by Simpson’s index of diversity and the adjusted Wallace coefficient, CRISPR01 type was concordant to emm type, and CRISPR02 showed unidirectional congruence to emm type, suggesting that at least for the majority of isolates causing infection in high income countries, the emm type can be inferred from CRISPR analysis, which can further discriminate isolates sharing the same emm type. PMID:26710228

  7. FRB repetition and non-Poissonian statistics

    NASA Astrophysics Data System (ADS)

    Connor, Liam; Pen, Ue-Li; Oppermann, Niels

    2016-05-01

    We discuss some of the claims that have been made regarding the statistics of fast radio bursts (FRBs). In an earlier Letter, we conjectured that flicker noise associated with FRB repetition could show up in non-cataclysmic neutron star emission models, like supergiant pulses. We show how the current limits of repetition would be significantly weakened if their repeat rate really were non-Poissonian and had a pink or red spectrum. Repetition and its statistics have implications for observing strategy, generally favouring shallow wide-field surveys, since in the non-repeating scenario survey depth is unimportant. We also discuss the statistics of the apparent latitudinal dependence of FRBs, and offer a simple method for calculating the significance of this effect. We provide a generalized Bayesian framework for addressing this problem, which allows for direct model comparison. It is shown how the evidence for a steep latitudinal gradient of the FRB rate is less strong than initially suggested and simple explanations like increased scattering and sky temperature in the plane are sufficient to decrease the low-latitude burst rate, given current data. The reported dearth of bursts near the plane is further complicated if FRBs have non-Poissonian repetition, since in that case the event rate inferred from observation depends on observing strategy.

  8. Temporal Processing Capabilities in Repetition Conduction Aphasia

    ERIC Educational Resources Information Center

    Sidiropoulos, Kyriakos; Ackermann, Hermann; Wannke, Michael; Hertrich, Ingo

    2010-01-01

    This study investigates the temporal resolution capacities of the central-auditory system in a subject (NP) suffering from repetition conduction aphasia. More specifically, the patient was asked to detect brief gaps between two stretches of broadband noise (gap detection task) and to evaluate the duration of two biphasic (WN-3) continuous noise…

  9. Assessment of anomalous sentences repetition test

    PubMed Central

    Rai, G S; Stewart, K; Scott, L C

    1990-01-01

    Use of Anomalous Sentences Repetition Test (ASRT) in 16 patients with diagnosis of dementia of Alzheimer's type, 16 normal elderly and 18 patients with depression revealed no difference in the age adjusted scores between the three groups, suggesting that it is not a good test for diagnosing dementia or differentiating dementia from depression. PMID:2391527

  10. Social Interaction and Repetitive Motor Behaviors

    ERIC Educational Resources Information Center

    Loftin, Rachel L.; Odom, Samuel L.; Lantz, Johanna F.

    2008-01-01

    Students with autism have difficulty initiating social interactions and may exhibit repetitive motor behavior (e.g., body rocking, hand flapping). Increasing social interaction by teaching new skills may lead to reductions in problem behavior, such as motor stereotypies. Additionally, self-monitoring strategies can increase the maintenance of…

  11. Large-scale detection of repetitions.

    PubMed

    Smyth, W F

    2014-05-28

    Combinatorics on words began more than a century ago with a demonstration that an infinitely long string with no repetitions could be constructed on an alphabet of only three letters. Computing all the repetitions (such as ∙∙∙TTT ∙∙∙ or ∙∙∙ CGACGA ∙∙∙ ) in a given string x of length n is one of the oldest and most important problems of computational stringology, requiring time in the worst case. About a dozen years ago, it was discovered that repetitions can be computed as a by-product of the Θ(n)-time computation of all the maximal periodicities or runs in x. However, even though the computation is linear, it is also brute force: global data structures, such as the suffix array, the longest common prefix array and the Lempel-Ziv factorization, need to be computed in a preprocessing phase. Furthermore, all of this effort is required despite the fact that the expected number of runs in a string is generally a small fraction of the string length. In this paper, I explore the possibility that repetitions (perhaps also other regularities in strings) can be computed in a manner commensurate with the size of the output.

  12. Using Repetition to Make Ideas Stick

    ERIC Educational Resources Information Center

    Lykins, Alicia N.

    2015-01-01

    In elementary school, the use of repetitive songs to help children remember concepts is commonplace and is usually very effective. Unfortunately for many students, this strategy is generally not used in later grades. A group of mathematics teachers at Westerville South High School in Westerville, Ohio, have taken this approach to a new creative…

  13. A repetitive elements perspective in Polycomb epigenetics.

    PubMed

    Casa, Valentina; Gabellini, Davide

    2012-01-01

    Repetitive elements comprise over two-thirds of the human genome. For a long time, these elements have received little attention since they were considered non-functional. On the contrary, recent evidence indicates that they play central roles in genome integrity, gene expression, and disease. Indeed, repeats display meiotic instability associated with disease and are located within common fragile sites, which are hotspots of chromosome re-arrangements in tumors. Moreover, a variety of diseases have been associated with aberrant transcription of repetitive elements. Overall this indicates that appropriate regulation of repetitive elements' activity is fundamental. Polycomb group (PcG) proteins are epigenetic regulators that are essential for the normal development of multicellular organisms. Mammalian PcG proteins are involved in fundamental processes, such as cellular memory, cell proliferation, genomic imprinting, X-inactivation, and cancer development. PcG proteins can convey their activity through long-distance interactions also on different chromosomes. This indicates that the 3D organization of PcG proteins contributes significantly to their function. However, it is still unclear how these complex mechanisms are orchestrated and which role PcG proteins play in the multi-level organization of gene regulation. Intriguingly, the greatest proportion of Polycomb-mediated chromatin modifications is located in genomic repeats and it has been suggested that they could provide a binding platform for Polycomb proteins. Here, these lines of evidence are woven together to discuss how repetitive elements could contribute to chromatin organization in the 3D nuclear space.

  14. Large-scale detection of repetitions.

    PubMed

    Smyth, W F

    2014-05-28

    Combinatorics on words began more than a century ago with a demonstration that an infinitely long string with no repetitions could be constructed on an alphabet of only three letters. Computing all the repetitions (such as ∙∙∙TTT ∙∙∙ or ∙∙∙ CGACGA ∙∙∙ ) in a given string x of length n is one of the oldest and most important problems of computational stringology, requiring time in the worst case. About a dozen years ago, it was discovered that repetitions can be computed as a by-product of the Θ(n)-time computation of all the maximal periodicities or runs in x. However, even though the computation is linear, it is also brute force: global data structures, such as the suffix array, the longest common prefix array and the Lempel-Ziv factorization, need to be computed in a preprocessing phase. Furthermore, all of this effort is required despite the fact that the expected number of runs in a string is generally a small fraction of the string length. In this paper, I explore the possibility that repetitions (perhaps also other regularities in strings) can be computed in a manner commensurate with the size of the output. PMID:24751872

  15. Repetition effects in human ERPs to faces.

    PubMed

    Schweinberger, Stefan R; Neumann, Markus F

    2016-07-01

    In the present paper, we review research conducted over the past 25 years addressing the effects of repeating various kinds of information in faces (e.g., pictorial, spatial configural, identity, semantic) on different components in human event-related brain potentials (ERPs). This body of evidence suggests that several ERP components are systematically linked to different functional components of face identity processing. Specifically, we argue (1) that repetition of the category of faces (categorical adaptation) strongly affects the occipitotemporal N170 amplitude, which is systematically suppressed when a face is preceded by another face, irrespective of its identity, whereas (2) the prototypicality of a face's second order spatial configuration has a prominent effect on the subsequent occipitotemporal P200. Longer-latency repetition effects are related to the processing of individual facial identities. These include (3) an ERP correlate of the transient activation of individual representations of repeated faces in the form of an enhanced occipitotemporal N250r as seen in repetition priming experiments, and (4) a correlate of the acquisition of individual face identity representations during learning as seen in a topographically similar long-lasting N250 effect. Finally, (5) the repetition of semantic information in familiar person recognition elicits a central-parietal N400 ERP effect. We hope that this overview will encourage researchers to further exploit the potential of ERPs to provide a continuous time window to neuronal correlates of multiple processes in face perception under comparatively natural viewing conditions. PMID:26672902

  16. Verbal Repetitions and Echolalia in Alzheimer's Discourse

    ERIC Educational Resources Information Center

    Da Cruz, Fernanda Miranda

    2010-01-01

    This article reports on an investigation of echolalic repetition in Alzheimer's disease (AD). A qualitative analysis of data from spontaneous conversations with MHI, a woman with AD, is presented. The data come from the DALI Corpus, a corpus of spontaneous conversations involving subjects with AD. This study argues that echolalic effects can be…

  17. Sentence Repetition: What Does the Task Measure?

    ERIC Educational Resources Information Center

    Polišenská, Kamila; Chiat, Shula; Roy, Penny

    2015-01-01

    Background: Sentence repetition is gaining increasing attention as a source of information about children's sentence-level abilities in clinical assessment, and as a clinical marker of specific language impairment. However, it is widely debated what the task is testing and therefore how informative it is. Aims: (1) To evaluate the effects of…

  18. Analysis of the spacing between the two palindromes of activation sequence-1 with respect to binding to different TGA factors and transcriptional activation potential.

    PubMed

    Krawczyk, Stefanie; Thurow, Corinna; Niggeweg, Ricarda; Gatz, Christiane

    2002-02-01

    In higher plants, activation sequence-1 (as-1) of the cauliflower mosaic virus 35S promoter mediates both salicylic acid- and auxin-inducible transcriptional activation. Originally found in viral and T-DNA promoters, as-1-like elements are also functional elements of plant promoters activated in the course of a defence response upon pathogen attack. as-1-like elements are characterised by two imperfect palindromes with the palindromic centres being spaced by 12 bp. They are recognised by plant nuclear as-1-binding factor ASF-1, the major component of which is basic/leucine zipper (bZIP) protein TGA2.2 (approximately 80%) in Nicotiana tabacum. In electrophoretic mobility shift assays, ASF-1 as well as bZIP proteins TGA2.2, TGA2.1 and TGA1a showed a 3-10-fold reduced binding affinity to mutant as-1 elements encoding insertions of 2, 4, 6, 8 or 10 bp between the palindromes, respectively. This correlated with a 5-10-fold reduction in transcriptional activation from these elements in transient expression assays. Although ASF-1 and TGA factors bound efficiently to a mutant element carrying a 2 bp deletion between the palindromes [as-1/(-2)], the latter was strongly compromised with respect to mediating gene expression in vivo. A fusion protein consisting of TGA2.2 and a constitutive activation domain mediated transactivation from as-1/(-2) demonstrating binding of TGA factors in vivo. We therefore conclude that both DNA binding and transactivation require optimal positioning of TGA factors on the as-1 element.

  19. Analysis of the spacing between the two palindromes of activation sequence-1 with respect to binding to different TGA factors and transcriptional activation potential

    PubMed Central

    Krawczyk, Stefanie; Thurow, Corinna; Niggeweg, Ricarda; Gatz, Christiane

    2002-01-01

    In higher plants, activation sequence-1 (as-1) of the cauliflower mosaic virus 35S promoter mediates both salicylic acid- and auxin-inducible transcriptional activation. Originally found in viral and T-DNA promoters, as-1-like elements are also functional elements of plant promoters activated in the course of a defence response upon pathogen attack. as-1-like elements are characterised by two imperfect palindromes with the palindromic centres being spaced by 12 bp. They are recognised by plant nuclear as-1-binding factor ASF-1, the major component of which is basic/leucine zipper (bZIP) protein TGA2.2 (∼80%) in Nicotiana tabacum. In electrophoretic mobility shift assays, ASF-1 as well as bZIP proteins TGA2.2, TGA2.1 and TGA1a showed a 3–10-fold reduced binding affinity to mutant as-1 elements encoding insertions of 2, 4, 6, 8 or 10 bp between the palindromes, respectively. This correlated with a 5–10-fold reduction in transcriptional activation from these elements in transient expression assays. Although ASF-1 and TGA factors bound efficiently to a mutant element carrying a 2 bp deletion between the palindromes [as-1/(–2)], the latter was strongly compromised with respect to mediating gene expression in vivo. A fusion protein consisting of TGA2.2 and a constitutive activation domain mediated transactivation from as-1/(–2) demonstrating binding of TGA factors in vivo. We therefore conclude that both DNA binding and transactivation require optimal positioning of TGA factors on the as-1 element. PMID:11809891

  20. Relative contractile motion of the rings in a switchable palindromic [3]rotaxane in aqueous solution driven by radical-pairing interactions.

    PubMed

    Witus, Leah S; Hartlieb, Karel J; Wang, Yuping; Prokofjevs, Aleksandrs; Frasconi, Marco; Barnes, Jonathan C; Dale, Edward J; Fahrenbach, Albert C; Stoddart, J Fraser

    2014-08-28

    Artificial muscles are an essential component for the development of next-generation prosthetic devices, minimally invasive surgical tools, and robotics. This communication describes the design, synthesis, and characterisation of a mechanically interlocked molecule (MIM), capable of switchable and reversible linear molecular motion in aqueous solution that mimics muscular contraction and extension. Compatibility with aqueous solution was achieved in the doubly bistable palindromic [3]rotaxane design by using radical-based molecular recognition as the driving force to induce switching. PMID:25010832

  1. [Repetitive strain injuries. Forearm pain caused by tissue responses to repetitive strain].

    PubMed

    Sorgatz, H

    2002-10-01

    According to the National Research Council, painful work-related upper limb disorders are caused by different pathophysiological mechanisms, one of which is repetitive strain injury (RSI). Forearm pain, tenderness, and paresthesias are thought to result from a continual risk of exceeding limits of "cumulative trauma load tolerance" (CTLT, cf. NRC 2001) in soft tissue by thousands of high-frequency, repetitive movements. On the other hand, repetitive painful stimulations also produce neuroplastic changes in the spinal and supraspinal nociceptive systems. Thus, repetitive motor and nociceptive impulses become part of the same motor programs, which are also responsible for high-frequency movements and tissue damage. In this way RSI pain may be felt as a task-related response, even after all injuries are completely healed. Consequences of this neuroplastic CTLT model for RSI prevention and therapy are discussed.

  2. A Nonword Repetition Task for Speakers with Misarticulations: The Syllable Repetition Task (SRT)

    PubMed Central

    Shriberg, Lawrence D.; Lohmeier, Heather L.; Campbell, Thomas F.; Dollaghan, Christine A.; Green, Jordan R.; Moore, Christopher A.

    2010-01-01

    Purpose Conceptual and methodological confounds occur when non(sense) repetition tasks are administered to speakers who do not have the target speech sounds in their phonetic inventories or who habitually misarticulate targeted speech sounds. We describe a nonword repetition task, the Syllable Repetiton Task (SRT) that eliminates this confound and report findings from three validity studies. Method Ninety-five preschool children with Speech Delay and 63 with Typical Speech, completed an assessment battery that included the Nonword Repetition Task (NRT: Dollaghan & Campbell, 1998) and the SRT. SRT stimuli include only four of the earliest occurring consonants and one early occurring vowel. Results Study 1 findings indicated that the SRT eliminated the speech confound in nonword testing with speakers who misarticulate. Study 2 findings indicated that the accuracy of the SRT to identify expressive language impairment was comparable to findings for the NRT. Study 3 findings illustrated the SRT’s potential to interrogate speech processing constraints underlying poor nonword repetition accuracy. Results supported both memorial and auditory-perceptual encoding constraints underlying nonword repetition errors in children with speech-language impairment. Conclusion The SRT appears to be a psychometrically stable and substantively informative nonword repetition task for emerging genetic and other research with speakers who misarticulate. PMID:19635944

  3. If you negate, you may forget: negated repetitions impair memory compared with affirmative repetitions.

    PubMed

    Mayo, Ruth; Schul, Yaacov; Rosenthal, Meytal

    2014-08-01

    One of the most robust laws of memory is that repeated activation improves memory. Our study shows that the nature of repetition matters. Specifically, although both negated repetition and affirmative repetition improve memory compared with no repetition, negated repetition hinders memory compared with affirmative repetition. After showing participants different entities, we asked them about features of these entities, leading to either "yes" or "no" responses. Our findings show that correctly negating an incorrect feature of an entity elicits an active forgetting effect compared with correctly affirming its true features. For example, after seeing someone drink a glass of white wine, answering "no" to "was it red wine?" may lead one to greater memory loss of the individual drinking wine at all compared with answering "yes" to "was it white wine?" We find this negation-induced forgetting effect in 4 experiments that differ in (a) the meaning given for the negation, (b) the type of stimuli (visual or verbal), and (c) the memory measure (recognition or free recall). We discuss possible underlying mechanisms and offer theoretical and applied implications of the negation-induced forgetting effect in relation to other known inhibition effects. PMID:24635186

  4. Short communication: Determination of Salmonella clustered regularly interspaced short palindromic repeats (CRISPR) diversity on dairy farms in Wisconsin and Minnesota.

    PubMed

    Wehnes, C A; Rehberger, T G; Barrangou, R; Smith, A H

    2014-10-01

    Salmonella enterica ssp. enterica is a foodborne pathogen able to cause disease in both humans and animals. Diverse serovars of this pathogen exist, some of which are host specific, causing a range of clinical symptoms from asymptomatic infection through morbidity and mortality. According to a 2007 survey by the USDA National Animal Health Monitoring System, fecal shedding of Salmonella from healthy cows occurs on 39.7% of dairy farms in the United States. Certain serovars are frequently isolated from dairy farms and the majority of isolates from the National Animal Health Monitoring System study were represented by 5 serovars; however, genotypic diversity was not examined. The objective of this study was to determine the diversity of clustered regularly interspaced short palindromic repeats (CRISPR) loci in Salmonella collected from 8 dairy farms with a previous history of salmonellosis. None of the cows or calves sampled on 2 of the 8 dairy farms were shedding Salmonella, although Salmonella was detected in a cow bedding sample on 1 of these farms. Salmonella populations were discrete on each farm, according to CRISPR typing, with the exception of an Anatum var. 15+ type on farms 5 and 6 and the Montevideo type on farms 1 and 2. One to 4 distinct CRISPR genotypes were identified per farm. The CRISPR typing differed within serovars, as Montevideo, Anatum var. 15+, and Muenster serovars had no overlap of spacer content, even on the same farm, reflecting between- and within-serovar genetic diversity. The dynamic nature of Salmonella populations was shown in a farm that was sampled longitudinally over 13.5 mo. Changes in serovar from 3,19:-:z27 to Montevideo was observed between the first sampling time and 8 mo later, with concomitant change in CRISPR alleles. The results indicate that Salmonella strains present in smaller dairy herds (<500 head) are specific to that farm and new Salmonella strains may emerge over time.

  5. Structure-function analyses involving palindromic analogs of tritrypticin suggest autonomy of anti-endotoxin and antibacterial activities.

    PubMed

    Kaur, Kanwal J; Sarkar, Pampi; Nagpal, Sushma; Khan, Tarique; Salunke, Dinakar M

    2008-03-01

    Neutralization of invading pathogens by gene-encoded peptide antibiotics has been suggested to manifest in a variety of different modes. Some of these modes require internalization of the peptide through a pathway that involves LPS-mediated uptake of the peptide antibiotics. Many proline/tryptophan-rich cationic peptides for which this mode has been invoked do, indeed, show LPS (endotoxin) binding. If the mechanism of antibiotic action involves the LPS-mediated pathway, a positive correlation ought to manifest between the binding to LPS, its neutralization, and the bacterial killing. No such correlation was evident based on our studies involving minimal active analogs of tritrypticin. The anti-endotoxin activities of these analogs appear not to relate directly to their antibiotic potential. The two palindromic analogs of tritrypticin, NT7 (RRFPWWW) and CT7 (WWWPFRR), showed comparable antibacterial activities. However, while NT7 exhibited anti-endotoxin activity, CT7 did not. The LPS binding of two tritrypticin analogs correlated with their corresponding structures, but the antibacterial activities did not. Further structure-function analysis indicated specific structural implications of the antibacterial activity at the molecular level. Studies involving designed analogs of NT7 incorporating either rigid or flexible linkers between the specifically distanced hydrophobic and cationic clusters modulate the LPS binding. On the other hand, not knowing the target receptor for antibacterial activity is a drawback since the precise epitope for antibacterial activity is not definable. It is apparent that the anti-endotoxin and antibacterial activities represent two independent functions of tritrypticin, consistent with the emerging multifunctionality in the nature of cathelicidins.

  6. Repetitively pulsed plasma illumination source improvements

    NASA Astrophysics Data System (ADS)

    Root, Robert G.; Falkos, Paul

    1999-05-01

    A repetitively pulsed broad band visible illumination system has been developed that is suitable for capturing images of high speed motion over sizable areas. At full pulse energy, a two lamp system can illuminate 60 square feet for movies at f/4 with 400 ASA color film and framing rates as high as 1700 fps. At reduced energy, for smaller area applications, the framing rate can be doubled. The short pulse length (4.5 microsecond(s) at full energy, 1.5 microsecond(s) at reduced energy) produces sharp images of high speed objects. This paper reports developments since the last presentation, including: (1) higher pulse repetition rates (a few kilohertz), (2) synchronization with high speed camera, (3) full scale burst of several thousand pulses, (4) characteristics of a compact demonstration system, and (5) demonstration of the ability of the short pulse to freeze motion.

  7. Repetition probability effects for inverted faces.

    PubMed

    Grotheer, Mareike; Hermann, Petra; Vidnyánszky, Zoltán; Kovács, Gyula

    2014-11-15

    It has been shown, that the repetition related reduction of the blood-oxygen level dependent (BOLD) signal is modulated by the probability of repetitions (P(rep)) for faces (Summerfield et al., 2008), providing support for the predictive coding (PC) model of visual perception (Rao and Ballard, 1999). However, the stage of face processing where repetition suppression (RS) is modulated by P(rep) is still unclear. Face inversion is known to interrupt higher level configural/holistic face processing steps and if modulation of RS by P(rep) takes place at these stages of face processing, P(rep) effects are expected to be reduced for inverted when compared to upright faces. Therefore, here we aimed at investigating whether P(rep) effects on RS observed for face stimuli originate at the higher-level configural/holistic stages of face processing by comparing these effects for upright and inverted faces. Similarly to previous studies, we manipulated P(rep) for pairs of stimuli in individual blocks of fMRI recordings. This manipulation significantly influenced repetition suppression in the posterior FFA, the OFA and the LO, independently of stimulus orientation. Our results thus reveal that RS in the ventral visual stream is modulated by P(rep) even in the case of face inversion and hence strongly compromised configural/holistic face processing. An additional whole-brain analysis could not identify any areas where the modulatory effect of probability was orientation specific either. These findings imply that P(rep) effects on RS might originate from the earlier stages of face processing.

  8. Modeling repetitive motions using structured light.

    PubMed

    Xu, Yi; Aliaga, Daniel G

    2010-01-01

    Obtaining models of dynamic 3D objects is an important part of content generation for computer graphics. Numerous methods have been extended from static scenarios to model dynamic scenes. If the states or poses of the dynamic object repeat often during a sequence (but not necessarily periodically), we call such a repetitive motion. There are many objects, such as toys, machines, and humans, undergoing repetitive motions. Our key observation is that when a motion-state repeats, we can sample the scene under the same motion state again but using a different set of parameters; thus, providing more information of each motion state. This enables robustly acquiring dense 3D information difficult for objects with repetitive motions using only simple hardware. After the motion sequence, we group temporally disjoint observations of the same motion state together and produce a smooth space-time reconstruction of the scene. Effectively, the dynamic scene modeling problem is converted to a series of static scene reconstructions, which are easier to tackle. The varying sampling parameters can be, for example, structured-light patterns, illumination directions, and viewpoints resulting in different modeling techniques. Based on this observation, we present an image-based motion-state framework and demonstrate our paradigm using either a synchronized or an unsynchronized structured-light acquisition method.

  9. The Dfam database of repetitive DNA families

    PubMed Central

    Hubley, Robert; Finn, Robert D.; Clements, Jody; Eddy, Sean R.; Jones, Thomas A.; Bao, Weidong; Smit, Arian F.A.; Wheeler, Travis J.

    2016-01-01

    Repetitive DNA, especially that due to transposable elements (TEs), makes up a large fraction of many genomes. Dfam is an open access database of families of repetitive DNA elements, in which each family is represented by a multiple sequence alignment and a profile hidden Markov model (HMM). The initial release of Dfam, featured in the 2013 NAR Database Issue, contained 1143 families of repetitive elements found in humans, and was used to produce more than 100 Mb of additional annotation of TE-derived regions in the human genome, with improved speed. Here, we describe recent advances, most notably expansion to 4150 total families including a comprehensive set of known repeat families from four new organisms (mouse, zebrafish, fly and nematode). We describe improvements to coverage, and to our methods for identifying and reducing false annotation. We also describe updates to the website interface. The Dfam website has moved to http://dfam.org. Seed alignments, profile HMMs, hit lists and other underlying data are available for download. PMID:26612867

  10. The Dfam database of repetitive DNA families.

    PubMed

    Hubley, Robert; Finn, Robert D; Clements, Jody; Eddy, Sean R; Jones, Thomas A; Bao, Weidong; Smit, Arian F A; Wheeler, Travis J

    2016-01-01

    Repetitive DNA, especially that due to transposable elements (TEs), makes up a large fraction of many genomes. Dfam is an open access database of families of repetitive DNA elements, in which each family is represented by a multiple sequence alignment and a profile hidden Markov model (HMM). The initial release of Dfam, featured in the 2013 NAR Database Issue, contained 1143 families of repetitive elements found in humans, and was used to produce more than 100 Mb of additional annotation of TE-derived regions in the human genome, with improved speed. Here, we describe recent advances, most notably expansion to 4150 total families including a comprehensive set of known repeat families from four new organisms (mouse, zebrafish, fly and nematode). We describe improvements to coverage, and to our methods for identifying and reducing false annotation. We also describe updates to the website interface. The Dfam website has moved to http://dfam.org. Seed alignments, profile HMMs, hit lists and other underlying data are available for download.

  11. The Dfam database of repetitive DNA families.

    PubMed

    Hubley, Robert; Finn, Robert D; Clements, Jody; Eddy, Sean R; Jones, Thomas A; Bao, Weidong; Smit, Arian F A; Wheeler, Travis J

    2016-01-01

    Repetitive DNA, especially that due to transposable elements (TEs), makes up a large fraction of many genomes. Dfam is an open access database of families of repetitive DNA elements, in which each family is represented by a multiple sequence alignment and a profile hidden Markov model (HMM). The initial release of Dfam, featured in the 2013 NAR Database Issue, contained 1143 families of repetitive elements found in humans, and was used to produce more than 100 Mb of additional annotation of TE-derived regions in the human genome, with improved speed. Here, we describe recent advances, most notably expansion to 4150 total families including a comprehensive set of known repeat families from four new organisms (mouse, zebrafish, fly and nematode). We describe improvements to coverage, and to our methods for identifying and reducing false annotation. We also describe updates to the website interface. The Dfam website has moved to http://dfam.org. Seed alignments, profile HMMs, hit lists and other underlying data are available for download. PMID:26612867

  12. Phosphor thermometry at high repetition rates

    NASA Astrophysics Data System (ADS)

    Fuhrmann, N.; Brübach, J.; Dreizler, A.

    2013-09-01

    Phosphor thermometry is a semi-invasive surface temperature measurement technique utilizing the luminescence properties of thermographic phosphors. Typically these ceramic materials are coated onto the object of interest and are excited by a short UV laser pulse. Photomultipliers and high-speed camera systems are used to transiently detect the subsequently emitted luminescence decay point wise or two-dimensionally resolved. Based on appropriate calibration measurements, the luminescence lifetime is converted to temperature. Up to now, primarily Q-switched laser systems with repetition rates of 10 Hz were employed for excitation. Accordingly, this diagnostic tool was not applicable to resolve correlated temperature transients at time scales shorter than 100 ms. For the first time, the authors realized a high-speed phosphor thermometry system combining a highly repetitive laser in the kHz regime and a fast decaying phosphor. A suitable material was characterized regarding its temperature lifetime characteristic and precision. Additionally, the influence of laser power on the phosphor coating in terms of heating effects has been investigated. A demonstration of this high-speed technique has been conducted inside the thermally highly transient system of an optically accessible internal combustion engine. Temperatures have been measured with a repetition rate of one sample per crank angle degree at an engine speed of 1000 rpm. This experiment has proven that high-speed phosphor thermometry is a promising diagnostic tool for the resolution of surface temperature transients.

  13. Lingual Kinematics during Rapid Syllable Repetition in Parkinson's Disease

    ERIC Educational Resources Information Center

    Wong, Min Ney; Murdoch, Bruce E.; Whelan, Brooke-Mai

    2012-01-01

    Background: Rapid syllable repetition tasks are commonly used in the assessment of motor speech disorders. However, little is known about the articulatory kinematics during rapid syllable repetition in individuals with Parkinson's disease (PD). Aims: To investigate and compare lingual kinematics during rapid syllable repetition in dysarthric…

  14. Repetition Blindness: An Emergent Property of Inter-Item Competition

    ERIC Educational Resources Information Center

    Morris, Alison L.; Still, Mary L.; Caldwell-Harris, Catherine L.

    2009-01-01

    Repeating an item in a brief or rapid display usually produces faster or more accurate identification of the item (repetition priming), but sometimes produces the opposite effect (repetition blindness). We present a theory of short-term repetition effects, the "competition hypothesis," which explains these paradoxical outcomes. The central tenet…

  15. Repetitive Behaviours in Typically Developing 2-Year-Olds

    ERIC Educational Resources Information Center

    Leekam, Susan; Tandos, Jonathan; McConachie, Helen; Meins, Elizabeth; Parkinson, Kathryn; Wright, Charlotte; Turner, Michelle; Arnott, Bronia; Vittorini, Lucia; Le Couteur, Ann

    2007-01-01

    Background: Repetitive behaviours are an essential part of the diagnosis of autism but are also commonly seen in typically developing children. The current study investigated the frequency and factor structure of repetitive behaviours in a large community sample of 2-year-olds. Methods: A new measure, the Repetitive Behaviour Questionnaire (RBQ-2)…

  16. Experimental models of repetitive brain injuries.

    PubMed

    Weber, John T

    2007-01-01

    Repetitive traumatic brain injury (TBI) occurs in a significant portion of trauma patients, especially in specific populations, such as child abuse victims or athletes involved in contact sports (e.g. boxing, football, hockey, and soccer). A continually emerging hypothesis is that repeated mild injuries may cause cumulative damage to the brain, resulting in long-term cognitive dysfunction. The growing attention to this hypothesis is reflected in several recent experimental studies of repeated mild TBI in vivo. These reports generally demonstrate cellular and cognitive dysfunction after repetitive injury using rodent TBI models. In some cases, data suggests that the effects of a second mild TBI may be synergistic, rather than additive. In addition, some studies have found increases in cellular markers associated with Alzheimer's disease after repeated mild injuries, which demonstrates a direct experimental link between repetitive TBI and neurodegenerative disease. To complement the findings from humans and in vivo experimentation, my laboratory group has investigated the effects of repeated trauma in cultured brain cells using a model of stretch-induced mechanical injury in vitro. In these studies, hippocampal cells exhibited cumulative damage when mild stretch injuries were repeated at either 1-h or 24-h intervals. Interestingly, the extent of damage to the cells was dependent on the time between repeated injuries. Also, a very low level of stretch, which produced no cell damage on its own, induced cell damage when it was repeated several times at a short interval (every 2 min). Although direct comparisons to the clinical situation are difficult, these types of repetitive, low-level, mechanical stresses may be similar to the insults received by certain athletes, such as boxers, or hockey and soccer players. This type of in vitro model could provide a reliable system in which to study the mechanisms underlying cellular dysfunction following repeated injuries. As

  17. The Adult Repetitive Behaviours Questionnaire-2 (RBQ-2A): A Self-Report Measure of Restricted and Repetitive Behaviours

    ERIC Educational Resources Information Center

    Barrett, Sarah L.; Uljarevic, Mirko; Baker, Emma K.; Richdale, Amanda L.; Jones, Catherine R. G.; Leekam, Susan R.

    2015-01-01

    In two studies we developed and tested a new self-report measure of restricted and repetitive behaviours (RRB) suitable for adults. In Study 1, The Repetitive Behaviours Questionnaire-2 for adults (RBQ-2A) was completed by a sample of 163 neurotypical adults. Principal components analysis revealed two components: Repetitive Motor Behaviours and…

  18. A role for palindromic structures in the cis-region of maize Sirevirus LTRs in transposable element evolution and host epigenetic response

    PubMed Central

    Bousios, Alexandros; Diez, Concepcion M.; Takuno, Shohei; Bystry, Vojtech; Darzentas, Nikos; Gaut, Brandon S.

    2016-01-01

    Transposable elements (TEs) proliferate within the genome of their host, which responds by silencing them epigenetically. Much is known about the mechanisms of silencing in plants, particularly the role of siRNAs in guiding DNA methylation. In contrast, little is known about siRNA targeting patterns along the length of TEs, yet this information may provide crucial insights into the dynamics between hosts and TEs. By focusing on 6456 carefully annotated, full-length Sirevirus LTR retrotransposons in maize, we show that their silencing associates with underlying characteristics of the TE sequence and also uncover three features of the host–TE interaction. First, siRNA mapping varies among families and among elements, but particularly along the length of elements. Within the cis-regulatory portion of the LTRs, a complex palindrome-rich region acts as a hotspot of both siRNA matching and sequence evolution. These patterns are consistent across leaf, tassel, and immature ear libraries, but particularly emphasized for floral tissues and 21- to 22-nt siRNAs. Second, this region has the ability to form hairpins, making it a potential template for the production of miRNA-like, hairpin-derived small RNAs. Third, Sireviruses are targeted by siRNAs as a decreasing function of their age, but the oldest elements remain highly targeted, partially by siRNAs that cross-map to the youngest elements. We show that the targeting of older Sireviruses reflects their conserved palindromes. Altogether, we hypothesize that the palindromes aid the silencing of active elements and influence transposition potential, siRNA targeting levels, and ultimately the fate of an element within the genome. PMID:26631490

  19. KorB protein of promiscuous plasmid RP4 recognizes inverted sequence repetitions in regions essential for conjugative plasmid transfer.

    PubMed Central

    Balzer, D; Ziegelin, G; Pansegrau, W; Kruft, V; Lanka, E

    1992-01-01

    We have constructed a RP4 KorB overproducing strain and purified the protein to near homogeneity. KorB is a DNA binding protein recognizing defined palindromic 13-bp sequences (TTTAGCSGCTAAA). Inverted sequence repetitions of this type, designated OB, are present on RP4 12 times. OB-sequences are localized in replication and maintenance regions as well as in the regions Tra1 and Tra2 essential for conjugative transfer. All sites found in Tra regions by computer search act as targets for specific binding of KorB protein. KorB-DNA complexes were detected by DNA fragment retardation assay using polyacrylamide gels. The 13-bp symmetric arrangement of the consensus OB-sequence constitutes the core for binding KorB protein since any truncation of this sequence prevents complex assembly or leads to a considerable destabilization of the KorB-DNA complexes. A hydroxyl radical footprint analysis demonstrated complex formation of KorB with the OB-sequence directly and suggests the presence of an unusual DNA structure within the nucleoprotein complex. Images PMID:1579485

  20. [Guidelines for redesigning jobs with repetitive tasks].

    PubMed

    Colombini, D; Occhipinti, E; Meroni, M; Menoni, O; Bergamasco, R; Girola, C; Grea, V; Vendola, D

    1996-01-01

    Preventive measures aimed at minimising the occurrence of work-related musculo-skeletal disorders of the upper limbs (WMSDs) associated with repetitive tasks can be divided into 3 categories: structural, organisational and educational. Whenever specific risk and injury assessments have shown the need for preventive action, this is most often implemented within the framework of a range of assorted measures. In particular, structural measures pertain to optimising the layout of the work area and furnishings, and the "ergonomic" properties of work tools and equipment. Such measures serve to alleviate the problems caused by the use of excessive force and improper postures. The authors refer to the principles guiding such structural measures, in the light of the extensive literature that has been published on the subject. Organisational (or re-organisational) measures essentially relate to job design (i.e. distribution of tasks, speeds and pauses). They serve to alleviate problems connected with highly repetitive and frequent actions, excessively lengthy tasks and inadequate recovery periods. Very few relevant findings are available: the authors therefore illustrate in some detail a practical trial conducted in a major engineering firm. The objective was to lower to acceptable limits the frequency of certain repetitive tasks performed by workers using their upper limbs. The trial made it possible to identify a suitable plan and schedule of measures taking into due consideration the impact of the plan on production levels (and costs). The fundamental principles guiding the adoption of specific educational and training programmes for the workers and their supervisors are presented and discussed.

  1. Repetitive DNA alterations in human skin cancers.

    PubMed

    Ribeiro, Gil R H; Francisco, Guilherme; Teixeira, Lúcia V S; Romão-Correia, Rosana F; Sanches, José A; Neto, Cyro Festa; Ruiz, Itamar R G

    2004-11-01

    Repetitive sequences constitute landmarks for genome regulation, evolution, and chromatin architecture. Patterns of specific and non-specific repetitive sequences change in many types and stages of tumor cells, characterized by band loss, gain, and (de) increased staining of pre-existing bands. In this work, repetitive DNA was studied in search of genome instability of skin cancers: basal and squamous cell carcinomas (BCC and SCC), malignant melanoma (MM), melanocytic nevus (MN), and actinic keratosis (AK) lesions. DNAs were extracted from blood and tumor samples from 21 BCC, 7 SCC, 11 MM and 7 lesions. Banding patterns were obtained by random amplification of polymorphic DNA (RAPD), and specific D9S50 and D9S52 microsatellites (9p21). D9S50 patterns revealed microsatellite instability (MSI) and/or loss of heterozygosity (LOH) in 36% BCC, 25% SCC, and 57% MM tumors. D9S52 microsatellite showed 28.5%; 42.8%; and 71.4% altered tumors, respectively. No microsatellite alterations were found in MN and AK. On the other hand, genomic rearrangements detected by RAPD were present in 100% tumors. In BCC, the mean number of tumor DNA alterations showed predominant gain of bands. On the contrary, MM samples presented loss, or decreased intensity signal of RAPD bands. Genome alterations in skin cancers would result from chromosomal rearrangements, aneuploidy and/or polysomies. The low-cost and quick RAPD technique may reveal unknown genes or DNA sequences associated with tumor development and progression, and may be easily implemented in clinical diagnosis.

  2. Gene targeting technologies in rats: zinc finger nucleases, transcription activator-like effector nucleases, and clustered regularly interspaced short palindromic repeats.

    PubMed

    Mashimo, Tomoji

    2014-01-01

    The laboratory rat has been widely used as an animal model in biomedical science for more than 150 years. Applying zinc-finger nucleases or transcription activator-like effector nucleases to rat embryos via microinjection is an efficient genome editing tool for generating targeted knockout rats. Recently, clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated endonucleases have been used as an effective tool for precise and multiplex genome editing in mice and rats. In this review, the advantages and disadvantages of these site-specific nuclease technologies for genetic analysis and manipulation in rats are discussed.

  3. Repetitive Head Impacts and Chronic Traumatic Encephalopathy.

    PubMed

    McKee, Ann C; Alosco, Michael L; Huber, Bertrand R

    2016-10-01

    Chronic traumatic encephalopathy (CTE) is a distinctive neurodegenerative disease that occurs as a result of repetitive head impacts. CTE can only be diagnosed by postmortem neuropathologic examination of brain tissue. CTE is a unique disorder with a pathognomonic lesion that can be reliably distinguished from other neurodegenerative diseases. CTE is associated with violent behaviors, explosivity, loss of control, depression, suicide, memory loss and cognitive changes. There is increasing evidence that CTE affects amateur athletes as well as professional athletes and military veterans. CTE has become a major public health concern.

  4. AUTOSIM: An automated repetitive software testing tool

    NASA Technical Reports Server (NTRS)

    Dunham, J. R.; Mcbride, S. E.

    1985-01-01

    AUTOSIM is a software tool which automates the repetitive run testing of software. This tool executes programming tasks previously performed by a programmer with one year of programming experience. Use of the AUTOSIM tool requires a knowledge base containing information about known faults, code fixes, and the fault diagnosis-correction process. AUTOSIM can be considered as an expert system which replaces a low level of programming expertise. Reference information about the design and implementation of the AUTOSIM software test tool provides flowcharts to assist in maintaining the software code and a description of how to use the tool.

  5. Repetitive Head Impacts and Chronic Traumatic Encephalopathy.

    PubMed

    McKee, Ann C; Alosco, Michael L; Huber, Bertrand R

    2016-10-01

    Chronic traumatic encephalopathy (CTE) is a distinctive neurodegenerative disease that occurs as a result of repetitive head impacts. CTE can only be diagnosed by postmortem neuropathologic examination of brain tissue. CTE is a unique disorder with a pathognomonic lesion that can be reliably distinguished from other neurodegenerative diseases. CTE is associated with violent behaviors, explosivity, loss of control, depression, suicide, memory loss and cognitive changes. There is increasing evidence that CTE affects amateur athletes as well as professional athletes and military veterans. CTE has become a major public health concern. PMID:27637402

  6. Software reliability: Repetitive run experimentation and modeling

    NASA Technical Reports Server (NTRS)

    Nagel, P. M.; Skrivan, J. A.

    1982-01-01

    A software experiment conducted with repetitive run sampling is reported. Independently generated input data was used to verify that interfailure times are very nearly exponentially distributed and to obtain good estimates of the failure rates of individual errors and demonstrate how widely they vary. This fact invalidates many of the popular software reliability models now in use. The log failure rate of interfailure time was nearly linear as a function of the number of errors corrected. A new model of software reliability is proposed that incorporates these observations.

  7. Prevalence and genetic characterization of Vibrio vulnificus in raw seafood and seawater in Malaysia.

    PubMed

    Paydar, Mohammadjavad; Thong, Kwai Lin

    2013-10-01

    Vibrio vulnificus is a highly invasive human pathogen that exists naturally in estuarine environment and coastal waters. In this study, we used different PCR assays to detect V. vulnificus in 260 seafood and 80 seawater samples. V. vulnificus was present in about 34 (13%) of the 260 seafood samples and 18 (23%) of the 80 seawater samples. Repetitive extragenic palindromic PCR (REP-PCR) and enterobacterial repetitive intergenic consensus PCR (ERIC-PCR) were applied to subtype the V. vulnificus isolates. Twenty-five REP profiles and 45 ERIC profiles were observed, and the isolates were categorized into 9 and 10 distinct clusters at the similarity of 80%, by REP-PCR and ERIC-PCR, respectively. ERIC-PCR is more discriminative than REP-PCR in subtyping V. vulnificus, demonstrating high genetic diversity among the isolates.

  8. Pull-production in repetitive remanufacturing

    SciTech Connect

    McCaskey, D.W. Jr.

    1992-09-01

    In the past, production activity control practices in most repetitive remanufacturing facilities resembled those used in intermittent production operations. These operations were characterized by large amounts of work-in-process (WIP), frequent work stoppages due to part shortages, excessive overtime, low product velocity, informal scheduling between dependent operations, low employee and management moral, and a lot of wasted time, material, labor, and space. Improvement in production activity control (PAC) methods for repetitive remanufactures has been hampered by uncertainty in: supply of incoming assets, configuration of assets, process times to refurbish assets, and yields in reclamation processes. collectively these uncertainties make shop floor operations seem uncontrollable. However, one United States Army depot has taken on the challenge. Through management supported, cross-functional teams, the Tooele Army Depot has designed and implemented pull-production systems for two of its major products, with several others to follow. This article presents a generalized version of Tooele's pull-production system and highlights design characteristics which are specific to remanufacturing applications.

  9. Pull-production in repetitive remanufacturing

    SciTech Connect

    McCaskey, D.W. Jr.

    1992-09-01

    In the past, production activity control practices in most repetitive remanufacturing facilities resembled those used in intermittent production operations. These operations were characterized by large amounts of work-in-process (WIP), frequent work stoppages due to part shortages, excessive overtime, low product velocity, informal scheduling between dependent operations, low employee and management moral, and a lot of wasted time, material, labor, and space. Improvement in production activity control (PAC) methods for repetitive remanufactures has been hampered by uncertainty in: supply of incoming assets, configuration of assets, process times to refurbish assets, and yields in reclamation processes. collectively these uncertainties make shop floor operations seem uncontrollable. However, one United States Army depot has taken on the challenge. Through management supported, cross-functional teams, the Tooele Army Depot has designed and implemented pull-production systems for two of its major products, with several others to follow. This article presents a generalized version of Tooele`s pull-production system and highlights design characteristics which are specific to remanufacturing applications.

  10. Investigation of a repetitive pulsed electrothermal thruster

    NASA Technical Reports Server (NTRS)

    Burton, R. L.; Fleischer, D.; Goldstein, S. A.; Tidman, D. A.; Winsor, N. K.

    1986-01-01

    A pulsed electrothermal (PET) thruster with 1000:1 ratio nozzle is tested in a repetitive mode on water propellant. The thruster is driven by a 60J pulse forming network at repetition rates up to 10 Hz (600W). The pulse forming network has a .31 ohm impedance, well matched to the capillary discharge resistance of .40 ohm, and is directly coupled to the thruster electrodes without a switch. The discharge is initiated by high voltage breakdown, typically at 2500V, through the water vapor in the interelectrode gap. Water is injected as a jet through a .37 mm orifice on the thruster axis. Thruster voltage, current and impulse bit are recorded for several seconds at various power supply currents. Thruster to power ratio is typically T/P = .07 N/kW. Tank background pressure precludes direct measurement of exhaust velocity which is inferred from calculated pressure and temperature in the discharge to be about 14 km/sec. Efficiency, based on this velocity and measured T/P is .54 + or - .07. Thruster ablation is zero at the throat and becomes measurable further upstream, indicating that radiative ablation is occurring late in the pulse.

  11. Classification of the uptake hydrogenase-positive (Hup+) bean rhizobia as Rhizobium tropici.

    PubMed Central

    van Berkum, P; Navarro, R B; Vargas, A A

    1994-01-01

    Phenotypic and genetic characterization indicated that Hup+ bean rhizobial strains are type IIA and type IIB Rhizobium tropici. The Hup+ strain USDA 2840, which did not cluster with either of the two types of R. tropici in a restriction fragment length polymorphism analysis, had electrophoretic patterns of PCR products generated with primers for repetitive extragenic palindromic and enterobacterial repetitive intergeneric consensus sequences similar to those of three reference strains of R. tropici type IIA. The Hup+ strain USDA 2738, which clustered with the reference strain of R. tropici IIB in a restriction fragment length polymorphism analysis, had electrophoretic patterns of PCR products generated with primers for repetitive extragenic palindromic and enterobacterial repetitive intergeneric consensus sequences more closely resembling those of the reference strains of R. tropici type IIA than those of type IIB. DNA amplification with the Y1 and Y2 primers to generate a portion of the 16S rDNA operon was useful to distinguish R. tropici type IIA strains from other bean rhizobial strains. The phylogenetic position of the type IIA strain of R. tropici USDA 2840, determined from the partial 16S rDNA sequence, indicated a more distant relationship with the type IIB strain of R. tropici CIAT899 than with the as yet unnamed rhizobial species of Leucaena leucocephala, TAL 1145. Therefore, we suggest that it may be appropriate either to separate R. tropici types IIA and IIB into two different species or to identify TAL 1145 to the species level as a third type of R. tropici. Images PMID:8135515

  12. Context and repetition in word learning

    PubMed Central

    Horst, Jessica S.

    2013-01-01

    Young children learn words from a variety of situations, including shared storybook reading. A recent study by Horst et al. (2011a) demonstrates that children learned more new words during shared storybook reading if they were read the same stories repeatedly than if they were read different stories that had the same number of target words. The current paper reviews this study and further examines the effect of contextual repetition on children's word learning in both shared storybook reading and other situations, including fast mapping by mutual exclusivity. The studies reviewed here suggest that the same cognitive mechanisms support word learning in a variety of situations. Both practical considerations for experimental design and directions for future research are discussed. PMID:23580347

  13. Context and repetition in word learning.

    PubMed

    Horst, Jessica S

    2013-01-01

    Young children learn words from a variety of situations, including shared storybook reading. A recent study by Horst et al. (2011a) demonstrates that children learned more new words during shared storybook reading if they were read the same stories repeatedly than if they were read different stories that had the same number of target words. The current paper reviews this study and further examines the effect of contextual repetition on children's word learning in both shared storybook reading and other situations, including fast mapping by mutual exclusivity. The studies reviewed here suggest that the same cognitive mechanisms support word learning in a variety of situations. Both practical considerations for experimental design and directions for future research are discussed.

  14. A review of neuroimaging findings in repetitive brain trauma.

    PubMed

    Koerte, Inga K; Lin, Alexander P; Willems, Anna; Muehlmann, Marc; Hufschmidt, Jakob; Coleman, Michael J; Green, Isobel; Liao, Huijun; Tate, David F; Wilde, Elisabeth A; Pasternak, Ofer; Bouix, Sylvain; Rathi, Yogesh; Bigler, Erin D; Stern, Robert A; Shenton, Martha E

    2015-05-01

    Chronic traumatic encephalopathy (CTE) is a neurodegenerative disease confirmed at postmortem. Those at highest risk are professional athletes who participate in contact sports and military personnel who are exposed to repetitive blast events. All neuropathologically confirmed CTE cases, to date, have had a history of repetitive head impacts. This suggests that repetitive head impacts may be necessary for the initiation of the pathogenetic cascade that, in some cases, leads to CTE. Importantly, while all CTE appears to result from repetitive brain trauma, not all repetitive brain trauma results in CTE. Magnetic resonance imaging has great potential for understanding better the underlying mechanisms of repetitive brain trauma. In this review, we provide an overview of advanced imaging techniques currently used to investigate brain anomalies. We also provide an overview of neuroimaging findings in those exposed to repetitive head impacts in the acute/subacute and chronic phase of injury and in more neurodegenerative phases of injury, as well as in military personnel exposed to repetitive head impacts. Finally, we discuss future directions for research that will likely lead to a better understanding of the underlying mechanisms separating those who recover from repetitive brain trauma vs. those who go on to develop CTE. PMID:25904047

  15. A review of neuroimaging findings in repetitive brain trauma.

    PubMed

    Koerte, Inga K; Lin, Alexander P; Willems, Anna; Muehlmann, Marc; Hufschmidt, Jakob; Coleman, Michael J; Green, Isobel; Liao, Huijun; Tate, David F; Wilde, Elisabeth A; Pasternak, Ofer; Bouix, Sylvain; Rathi, Yogesh; Bigler, Erin D; Stern, Robert A; Shenton, Martha E

    2015-05-01

    Chronic traumatic encephalopathy (CTE) is a neurodegenerative disease confirmed at postmortem. Those at highest risk are professional athletes who participate in contact sports and military personnel who are exposed to repetitive blast events. All neuropathologically confirmed CTE cases, to date, have had a history of repetitive head impacts. This suggests that repetitive head impacts may be necessary for the initiation of the pathogenetic cascade that, in some cases, leads to CTE. Importantly, while all CTE appears to result from repetitive brain trauma, not all repetitive brain trauma results in CTE. Magnetic resonance imaging has great potential for understanding better the underlying mechanisms of repetitive brain trauma. In this review, we provide an overview of advanced imaging techniques currently used to investigate brain anomalies. We also provide an overview of neuroimaging findings in those exposed to repetitive head impacts in the acute/subacute and chronic phase of injury and in more neurodegenerative phases of injury, as well as in military personnel exposed to repetitive head impacts. Finally, we discuss future directions for research that will likely lead to a better understanding of the underlying mechanisms separating those who recover from repetitive brain trauma vs. those who go on to develop CTE.

  16. The use of repetition suppression paradigms in developmental cognitive neuroscience.

    PubMed

    Nordt, Marisa; Hoehl, Stefanie; Weigelt, Sarah

    2016-07-01

    Repetition suppression paradigms allow a more detailed look at brain functioning than classical paradigms and have been applied vigorously in adult cognitive neuroscience. These paradigms are well suited for studies in the field of developmental cognitive neuroscience as they can be applied without collecting a behavioral response and across all age groups. Furthermore, repetition suppression paradigms can be employed in various neuroscience techniques, such as functional magnetic resonance imaging (fMRI), functional near-infrared spectroscopy (fNIRS), electroencephalography (EEG) and magnetoencephalography (MEG). In the present article we review studies using repetition suppression paradigms in developmental cognitive neuroscience covering the age range from infancy to adolescence. Our first goal is to point out characteristics of developmental repetition suppression effects. In doing so, we discuss the relationship of the direction of repetition effects (suppression vs enhancement) with developmental factors, and address the question how the direction of repetition effects might be related to looking-time effects in behavioral infant paradigms, the most prominently used behavioral measure in infant research. To highlight the potential of repetition suppression paradigms, our second goal is to provide an overview on the insights recently obtained by applying repetition paradigms in neurodevelopmental studies, including research on children with autism spectrum disorders (ASDs). We conclude that repetition suppression paradigms are valuable tools for investigating neurodevelopmental processes, while at the same time we highlight the necessity for further studies that disentangle methodological and developmental factors.

  17. The golden ratio of gait harmony: repetitive proportions of repetitive gait phases.

    PubMed

    Iosa, Marco; Fusco, Augusto; Marchetti, Fabio; Morone, Giovanni; Caltagirone, Carlo; Paolucci, Stefano; Peppe, Antonella

    2013-01-01

    In nature, many physical and biological systems have structures showing harmonic properties. Some of them were found related to the irrational number φ known as the golden ratio that has important symmetric and harmonic properties. In this study, the spatiotemporal gait parameters of 25 healthy subjects were analyzed using a stereophotogrammetric system with 25 retroreflective markers located on their skin. The proportions of gait phases were compared with φ, the value of which is about 1.6180. The ratio between the entire gait cycle and stance phase resulted in 1.620 ± 0.058, that between stance and the swing phase was 1.629 ± 0.173, and that between swing and the double support phase was 1.684 ± 0.357. All these ratios did not differ significantly from each other (F = 0.870, P = 0.422, repeated measure analysis of variance) or from φ (P = 0.670, 0.820, 0.422, resp., t-tests). The repetitive gait phases of physiological walking were found in turn in repetitive proportions with each other, revealing an intrinsic harmonic structure. Harmony could be the key for facilitating the control of repetitive walking. Harmony is a powerful unifying factor between seemingly disparate fields of nature, including human gait.

  18. GRAPE - GIS Repetition Using Audio-Visual Repetition Units and its Leanring Effectiveness

    NASA Astrophysics Data System (ADS)

    Niederhuber, M.; Brugger, S.

    2011-09-01

    A new audio-visual learning medium has been developed at the Department of Environmental Sciences at ETH Zurich (Switzerland), for use in geographical information sciences (GIS) courses. This new medium, presented in the form of Repetition Units, allows students to review and consolidate the most important learning concepts on an individual basis. The new material consists of: a) a short enhanced podcast (recorded and spoken slide show) with a maximum duration of 5 minutes, which focuses on only one important aspect of a lecture's theme; b) one or two relevant exercises, covering different cognitive levels of learning, with a maximum duration of 10 minutes; and c), solutions for the exercises. During a pilot phase in 2010, six Repetition Units were produced by the lecturers. Twenty more Repetition Units will be produced by our students during the fall semester of 2011 and 2012. The project is accompanied by a 5-year study (2009 - 2013) that investigates learning success using the new material, focussing on the question, whether or not the new material help to consolidate and refresh basic GIS knowledge. It will be analysed based on longitudinal studies. Initial results indicate that the new medium helps to refresh knowledge as the test groups scored higher than the control group. These results are encouraging and suggest that the new material with its combination of short audio-visual podcasts and relevant exercises help to consolidate students' knowledge.

  19. Early Grade Repetition and Inattention Associated with Neurofibromatosis Type 1

    ERIC Educational Resources Information Center

    Coude, Francois X.; Mignot, Claire; Lyonnet, Stanislas; Munnich, Arnold

    2007-01-01

    Objective: The authors analyze the occurrence of grade repetition and inattention in children diagnosed with neurofibromatosis type 1 (NF1). Method: The participant group consisted of 310 patients with NF1 and a control group of 242 individuals. The number of grade repetitions for each participant during his or her time in elementary, middle, and…

  20. Pre-Lexical Disorders in Repetition Conduction Aphasia

    ERIC Educational Resources Information Center

    Sidiropoulos, Kyriakos; de Bleser, Ria; Ackermann, Hermann; Preilowski, Bruno

    2008-01-01

    At the level of clinical speech/language evaluation, the repetition type of conduction aphasia is characterized by repetition difficulties concomitant with reduced short-term memory capacities, in the presence of fluent spontaneous speech as well as unimpaired naming and reading abilities. It is still unsettled which dysfunctions of the…

  1. Conversational Characteristics of Children with Fragile X Syndrome: Repetitive Speech.

    ERIC Educational Resources Information Center

    Belser, Richard C.; Sudhalter, Vicki

    2001-01-01

    Comparison of the production of repetitive speech during conversations in 30 people with either fragile X syndrome, autistic disorder, or mental retardation not caused by fragile X found repetitive speech more prevalent among those with fragile X. Results support the hypothesis that such speech dysfluency reflects the effects of physiological…

  2. A Negative Effect of Repetition in Episodic Memory

    ERIC Educational Resources Information Center

    Peterson, Daniel J.; Mulligan, Neil W.

    2012-01-01

    One of the foundational principles of human memory is that repetition (i.e., being presented with a stimulus multiple times) improves recall. In the current study a group of participants who studied a list of cue-target pairs twice recalled fewer targets than a group who studied the pairs only once, a negative repetition effect. Such a…

  3. 10 CFR 63.23 - Elimination of repetition.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 10 Energy 2 2010-01-01 2010-01-01 false Elimination of repetition. 63.23 Section 63.23 Energy NUCLEAR REGULATORY COMMISSION (CONTINUED) DISPOSAL OF HIGH-LEVEL RADIOACTIVE WASTES IN A GEOLOGIC REPOSITORY AT YUCCA MOUNTAIN, NEVADA Licenses License Application § 63.23 Elimination of repetition. In...

  4. 10 CFR 63.23 - Elimination of repetition.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 10 Energy 2 2012-01-01 2012-01-01 false Elimination of repetition. 63.23 Section 63.23 Energy NUCLEAR REGULATORY COMMISSION (CONTINUED) DISPOSAL OF HIGH-LEVEL RADIOACTIVE WASTES IN A GEOLOGIC REPOSITORY AT YUCCA MOUNTAIN, NEVADA Licenses License Application § 63.23 Elimination of repetition. In...

  5. 10 CFR 63.23 - Elimination of repetition.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 10 Energy 2 2013-01-01 2013-01-01 false Elimination of repetition. 63.23 Section 63.23 Energy NUCLEAR REGULATORY COMMISSION (CONTINUED) DISPOSAL OF HIGH-LEVEL RADIOACTIVE WASTES IN A GEOLOGIC REPOSITORY AT YUCCA MOUNTAIN, NEVADA Licenses License Application § 63.23 Elimination of repetition. In...

  6. 10 CFR 63.23 - Elimination of repetition.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 10 Energy 2 2011-01-01 2011-01-01 false Elimination of repetition. 63.23 Section 63.23 Energy NUCLEAR REGULATORY COMMISSION (CONTINUED) DISPOSAL OF HIGH-LEVEL RADIOACTIVE WASTES IN A GEOLOGIC REPOSITORY AT YUCCA MOUNTAIN, NEVADA Licenses License Application § 63.23 Elimination of repetition. In...

  7. 10 CFR 63.23 - Elimination of repetition.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 10 Energy 2 2014-01-01 2014-01-01 false Elimination of repetition. 63.23 Section 63.23 Energy NUCLEAR REGULATORY COMMISSION (CONTINUED) DISPOSAL OF HIGH-LEVEL RADIOACTIVE WASTES IN A GEOLOGIC REPOSITORY AT YUCCA MOUNTAIN, NEVADA Licenses License Application § 63.23 Elimination of repetition. In...

  8. 10 CFR 61.21 - Elimination of repetition.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 10 Energy 2 2012-01-01 2012-01-01 false Elimination of repetition. 61.21 Section 61.21 Energy NUCLEAR REGULATORY COMMISSION (CONTINUED) LICENSING REQUIREMENTS FOR LAND DISPOSAL OF RADIOACTIVE WASTE Licenses § 61.21 Elimination of repetition. In its application, the applicant may incorporate by...

  9. 10 CFR 60.23 - Elimination of repetition.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 10 Energy 2 2010-01-01 2010-01-01 false Elimination of repetition. 60.23 Section 60.23 Energy NUCLEAR REGULATORY COMMISSION (CONTINUED) DISPOSAL OF HIGH-LEVEL RADIOACTIVE WASTES IN GEOLOGIC REPOSITORIES Licenses License Applications § 60.23 Elimination of repetition. In its application,...

  10. 10 CFR 60.23 - Elimination of repetition.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 10 Energy 2 2011-01-01 2011-01-01 false Elimination of repetition. 60.23 Section 60.23 Energy NUCLEAR REGULATORY COMMISSION (CONTINUED) DISPOSAL OF HIGH-LEVEL RADIOACTIVE WASTES IN GEOLOGIC REPOSITORIES Licenses License Applications § 60.23 Elimination of repetition. In its application,...

  11. 10 CFR 60.23 - Elimination of repetition.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 10 Energy 2 2014-01-01 2014-01-01 false Elimination of repetition. 60.23 Section 60.23 Energy NUCLEAR REGULATORY COMMISSION (CONTINUED) DISPOSAL OF HIGH-LEVEL RADIOACTIVE WASTES IN GEOLOGIC REPOSITORIES Licenses License Applications § 60.23 Elimination of repetition. In its application,...

  12. 10 CFR 60.23 - Elimination of repetition.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 10 Energy 2 2013-01-01 2013-01-01 false Elimination of repetition. 60.23 Section 60.23 Energy NUCLEAR REGULATORY COMMISSION (CONTINUED) DISPOSAL OF HIGH-LEVEL RADIOACTIVE WASTES IN GEOLOGIC REPOSITORIES Licenses License Applications § 60.23 Elimination of repetition. In its application,...

  13. 10 CFR 60.23 - Elimination of repetition.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 10 Energy 2 2012-01-01 2012-01-01 false Elimination of repetition. 60.23 Section 60.23 Energy NUCLEAR REGULATORY COMMISSION (CONTINUED) DISPOSAL OF HIGH-LEVEL RADIOACTIVE WASTES IN GEOLOGIC REPOSITORIES Licenses License Applications § 60.23 Elimination of repetition. In its application,...

  14. 10 CFR 61.21 - Elimination of repetition.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 10 Energy 2 2010-01-01 2010-01-01 false Elimination of repetition. 61.21 Section 61.21 Energy NUCLEAR REGULATORY COMMISSION (CONTINUED) LICENSING REQUIREMENTS FOR LAND DISPOSAL OF RADIOACTIVE WASTE Licenses § 61.21 Elimination of repetition. In its application, the applicant may incorporate by...

  15. 10 CFR 61.21 - Elimination of repetition.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 10 Energy 2 2014-01-01 2014-01-01 false Elimination of repetition. 61.21 Section 61.21 Energy NUCLEAR REGULATORY COMMISSION (CONTINUED) LICENSING REQUIREMENTS FOR LAND DISPOSAL OF RADIOACTIVE WASTE Licenses § 61.21 Elimination of repetition. In its application, the applicant may incorporate by...

  16. 10 CFR 61.21 - Elimination of repetition.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 10 Energy 2 2013-01-01 2013-01-01 false Elimination of repetition. 61.21 Section 61.21 Energy NUCLEAR REGULATORY COMMISSION (CONTINUED) LICENSING REQUIREMENTS FOR LAND DISPOSAL OF RADIOACTIVE WASTE Licenses § 61.21 Elimination of repetition. In its application, the applicant may incorporate by...

  17. 10 CFR 61.21 - Elimination of repetition.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 10 Energy 2 2011-01-01 2011-01-01 false Elimination of repetition. 61.21 Section 61.21 Energy NUCLEAR REGULATORY COMMISSION (CONTINUED) LICENSING REQUIREMENTS FOR LAND DISPOSAL OF RADIOACTIVE WASTE Licenses § 61.21 Elimination of repetition. In its application, the applicant may incorporate by...

  18. Varieties of Repetitive Behavior in Autism: Comparisons to Mental Retardation.

    ERIC Educational Resources Information Center

    Bodfish, James W.; Symons, Frank J.; Parker, Dawn E.; Lewis, Mark H.

    2000-01-01

    A study compared specific repetitive behaviors in 32 adults with autism with 34 controls with mental retardation. The occurrence of each behavior category, except dyskinesias, was higher in individuals with autism and they showed a greater number of topographies of stereotypy and compulsions. Repetitive behavior severity also predicated autism…

  19. Repetition Blindness: Out of Sight or Out of Mind?

    ERIC Educational Resources Information Center

    Morris, Alison L.; Harris, Catherine L.

    2004-01-01

    Does repetition blindness represent a failure of perception or of memory? In Experiment 1, participants viewed rapid serial visual presentation (RSVP) sentences. When critical words (C1 and C2) were orthographically similar, C2 was frequently omitted from serial report; however, repetition priming for C2 on a postsentence lexical decision task was…

  20. 10 CFR 52.8 - Combining licenses; elimination of repetition.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 10 Energy 2 2014-01-01 2014-01-01 false Combining licenses; elimination of repetition. 52.8 Section 52.8 Energy NUCLEAR REGULATORY COMMISSION (CONTINUED) LICENSES, CERTIFICATIONS, AND APPROVALS FOR NUCLEAR POWER PLANTS General Provisions § 52.8 Combining licenses; elimination of repetition. (a)...

  1. 10 CFR 52.8 - Combining licenses; elimination of repetition.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 10 Energy 2 2012-01-01 2012-01-01 false Combining licenses; elimination of repetition. 52.8 Section 52.8 Energy NUCLEAR REGULATORY COMMISSION (CONTINUED) LICENSES, CERTIFICATIONS, AND APPROVALS FOR NUCLEAR POWER PLANTS General Provisions § 52.8 Combining licenses; elimination of repetition. (a)...

  2. 10 CFR 52.8 - Combining licenses; elimination of repetition.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 10 Energy 2 2013-01-01 2013-01-01 false Combining licenses; elimination of repetition. 52.8 Section 52.8 Energy NUCLEAR REGULATORY COMMISSION (CONTINUED) LICENSES, CERTIFICATIONS, AND APPROVALS FOR NUCLEAR POWER PLANTS General Provisions § 52.8 Combining licenses; elimination of repetition. (a)...

  3. 10 CFR 52.8 - Combining licenses; elimination of repetition.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 10 Energy 2 2011-01-01 2011-01-01 false Combining licenses; elimination of repetition. 52.8 Section 52.8 Energy NUCLEAR REGULATORY COMMISSION (CONTINUED) LICENSES, CERTIFICATIONS, AND APPROVALS FOR NUCLEAR POWER PLANTS General Provisions § 52.8 Combining licenses; elimination of repetition. (a)...

  4. 10 CFR 52.8 - Combining licenses; elimination of repetition.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 10 Energy 2 2010-01-01 2010-01-01 false Combining licenses; elimination of repetition. 52.8 Section 52.8 Energy NUCLEAR REGULATORY COMMISSION (CONTINUED) LICENSES, CERTIFICATIONS, AND APPROVALS FOR NUCLEAR POWER PLANTS General Provisions § 52.8 Combining licenses; elimination of repetition. (a)...

  5. Repetitive sequence families in Alces alces americana.

    PubMed

    Blake, R D; Wang, J Z; Beauregard, L

    1997-05-01

    High-resolution derivative melting was used to obtain detailed distributions of local (G + C) contents in a number of ruminant DNAs. Profiles over low (G + C) regions [20-36% (G + C)] are congruent for all ruminants. This region represents 45-50% of the nuclear DNA content and primarily contains intergenic and intron sequences. The high (G + C) region, where most coding sequences are found [38-68% (G + C)], is marked by satellite bands denoting the presence of transcriptionally inert, tandemly repetitive sequence families. These bands can be analyzed for the abundance, base composition, and sequence divergence of satellite families with relatively high precision. Band patterns are unique to each species; even closely related species can be readily distinguished by their base distribution profiles. Variations in nuclear DNA contents in ruminants, determined by flow cytometry, are primarily due to variations in abundances of these repetitive sequence families. Thus, A. alces (moose) is found to have 8.85 +/- 0.2 pg DNA/cell, 25% more than the average in ruminants, while the base distribution curve indicates the presence of an unusually abundant satellite of 52.6% (G + C). The size (1 kb) and sequence of this satellite corresponds to satellite-I of other cervids, and in consequence it is designated Alces-I. The sequence of a cloned repeat of Alces-I has a length of 968 bp, a (G + C) content of 52.6%, and contributes 35%, or almost 3 million copies to the nuclear DNA, exceeding by approximately 300% the average array size of this repeat family in related cervids. In situ hybridization indicates the repeat is distributed throughout centromeric regions of all 62 acrocentric autosomes. Alces-I has much greater-than-expected numbers of GG, GA, and AG and far fewer numbers of TA and CG duplets, characteristics of all tandem repeats. The sequence is judged to be orthologous with satellite-I sequences from Rangifer tarandus (caribou), Capreolus capreolus (roe deer), Muntiacus

  6. Transgenerational effects of environmental enrichment on repetitive motor behavior development.

    PubMed

    Bechard, Allison R; Lewis, Mark H

    2016-07-01

    The favorable consequences of environmental enrichment (EE) on brain and behavior development are well documented. Much less is known, however, about transgenerational benefits of EE on non-enriched offspring. We explored whether transgenerational effects of EE might extend to the development of repetitive motor behaviors in deer mice. Repetitive motor behaviors are invariant patterns of movement that, across species, can be reduced by EE. We found that EE not only attenuated the development of repetitive behavior in dams, but also in their non-enriched offspring. Moreover, maternal behavior did not seem to mediate the transgenerational effect we found, although repetitive behavior was affected by reproductive experience. These data support a beneficial transgenerational effect of EE on repetitive behavior development and suggest a novel benefit of reproductive experience.

  7. Transgenerational effects of environmental enrichment on repetitive motor behavior development.

    PubMed

    Bechard, Allison R; Lewis, Mark H

    2016-07-01

    The favorable consequences of environmental enrichment (EE) on brain and behavior development are well documented. Much less is known, however, about transgenerational benefits of EE on non-enriched offspring. We explored whether transgenerational effects of EE might extend to the development of repetitive motor behaviors in deer mice. Repetitive motor behaviors are invariant patterns of movement that, across species, can be reduced by EE. We found that EE not only attenuated the development of repetitive behavior in dams, but also in their non-enriched offspring. Moreover, maternal behavior did not seem to mediate the transgenerational effect we found, although repetitive behavior was affected by reproductive experience. These data support a beneficial transgenerational effect of EE on repetitive behavior development and suggest a novel benefit of reproductive experience. PMID:27059336

  8. Repetition is easy: Why repeated referents have reduced prominence

    PubMed Central

    Lam, Tuan Q.; Watson, Duane G.

    2011-01-01

    The repetition and predictability of a word in a conversation are two factors that are believed to affect whether or not it is emphasized: predictable, repeated words are less acoustically prominent than unpredictable, new words. However, because predictability and repetition are correlated, it is unclear whether speakers lengthen unpredictable words to facilitate comprehension or whether this lengthening is the result of difficulties in accessing a new (non-repeated) lexical item. In this paper, we investigate the relationship between acoustic prominence, repetition, and predictability in a description task. In Experiment 1, we find that repeated referents are produced with reduced prominence, even when these referents are unexpected. In Experiment 2, we find that predictability and repetition both have independent effects on duration and intensity. However, word duration was primarily determined by repetition, and intensity was primarily determined by predictability. The data are most consistent with an account in which multiple cognitive factors influence the acoustic prominence of a word. PMID:21156876

  9. Repetition and Emotive Communication in Music Versus Speech

    PubMed Central

    Margulis, Elizabeth Hellmuth

    2013-01-01

    Music and speech are often placed alongside one another as comparative cases. Their relative overlaps and disassociations have been well explored (e.g., Patel, 2008). But one key attribute distinguishing these two domains has often been overlooked: the greater preponderance of repetition in music in comparison to speech. Recent fMRI studies have shown that familiarity – achieved through repetition – is a critical component of emotional engagement with music (Pereira et al., 2011). If repetition is fundamental to emotional responses to music, and repetition is a key distinguisher between the domains of music and speech, then close examination of the phenomenon of repetition might help clarify the ways that music elicits emotion differently than speech. PMID:23576998

  10. Self-controlled KR schedules: does repetition order matter?

    PubMed

    Patterson, Jae T; Carter, Michael J; Hansen, Steve

    2013-08-01

    The impact of an experimenter-defined repetition schedule on the utility of a self-controlled KR context during motor skill acquisition was examined. Participants were required to learn three novel spatial-temporal tasks in either a random or blocked repetition schedule with or without the opportunity to control their KR. Results from the retention period showed that participants provided control over their KR schedule in a random repetition schedule demonstrated superior learning. However, performance measures from the transfer test showed that, independent of repetition schedule, learners provided the opportunity to control their KR schedule demonstrated superior transfer performance compared to their yoked counterparts. The dissociated impact of repetition schedule and self-controlled KR schedules on retention and transfer is discussed.

  11. The repetition of large-earthquake ruptures.

    PubMed Central

    Sieh, K

    1996-01-01

    This survey of well-documented repeated fault rupture confirms that some faults have exhibited a "characteristic" behavior during repeated large earthquakes--that is, the magnitude, distribution, and style of slip on the fault has repeated during two or more consecutive events. In two cases faults exhibit slip functions that vary little from earthquake to earthquake. In one other well-documented case, however, fault lengths contrast markedly for two consecutive ruptures, but the amount of offset at individual sites was similar. Adjacent individual patches, 10 km or more in length, failed singly during one event and in tandem during the other. More complex cases of repetition may also represent the failure of several distinct patches. The faults of the 1992 Landers earthquake provide an instructive example of such complexity. Together, these examples suggest that large earthquakes commonly result from the failure of one or more patches, each characterized by a slip function that is roughly invariant through consecutive earthquake cycles. The persistence of these slip-patches through two or more large earthquakes indicates that some quasi-invariant physical property controls the pattern and magnitude of slip. These data seem incompatible with theoretical models that produce slip distributions that are highly variable in consecutive large events. Images Fig. 3 Fig. 7 Fig. 9 PMID:11607662

  12. A chenopod extensin lacks repetitive tetrahydroxyproline blocks

    SciTech Connect

    Li, Xiongbiao; Kieliszewski, M.; Lamport, D.T.A. )

    1990-02-01

    An extensin isolated from sugar beet (Beta vulgaris) cell suspension cultures fulfills all criteria for membership of the extensin family save one, notably, lack of the diagnostic pentamer Ser-Hyp-Hyp-Hyp-Hyp. However, sequence analysis of the major tryptic peptides shows that sugar beet extensin shares a motif in common with tomato extensin P1 but differs by the position of an insertion sequence (X) or (Y) which, in sugar beet, splits the tetrahydroxyproline block: Ser-Hyp-Hyp-(X)-Hyp-Hyp-Thr-Hyp-Val-Tyr-Lys, where (X) is (Val-His-Glu/Lys-Tyr-Pro), while in tomato the insertion sequence (Y) = (Val-Lys-Pro-Tyr-His-Pro) and, when it occurs, immediately follows the tetrahydroxyproline block: Ser-Hyp-Hyp-Hyp-Hyp-(Y)-Thr-Hyp-Val-Tyr-Lys. Based on these data were reinterpret three highly repetitive cDNA sequences, including nodulin N75 from soybean and wound-induced P33 of carrot, as extensins with split tetra(hydroxy)proline blocks.

  13. Understanding communicative actions: a repetitive TMS study.

    PubMed

    Stolk, Arjen; Noordzij, Matthijs L; Volman, Inge; Verhagen, Lennart; Overeem, Sebastiaan; van Elswijk, Gijs; Bloem, Bas; Hagoort, Peter; Toni, Ivan

    2014-02-01

    Despite the ambiguity inherent in human communication, people are remarkably efficient in establishing mutual understanding. Studying how people communicate in novel settings provides a window into the mechanisms supporting the human competence to rapidly generate and understand novel shared symbols, a fundamental property of human communication. Previous work indicates that the right posterior superior temporal sulcus (pSTS) is involved when people understand the intended meaning of novel communicative actions. Here, we set out to test whether normal functioning of this cerebral structure is required for understanding novel communicative actions using inhibitory low-frequency repetitive transcranial magnetic stimulation (rTMS). A factorial experimental design contrasted two tightly matched stimulation sites (right pSTS vs left MT+, i.e., a contiguous homotopic task-relevant region) and tasks (a communicative task vs a visual tracking task that used the same sequences of stimuli). Overall task performance was not affected by rTMS, whereas changes in task performance over time were disrupted according to TMS site and task combinations. Namely, rTMS over pSTS led to a diminished ability to improve action understanding on the basis of recent communicative history, while rTMS over MT+ perturbed improvement in visual tracking over trials. These findings qualify the contributions of the right pSTS to human communicative abilities, showing that this region might be necessary for incorporating previous knowledge, accumulated during interactions with a communicative partner, to constrain the inferential process that leads to action understanding. PMID:24268321

  14. Development of a repetitive compact torus injector

    NASA Astrophysics Data System (ADS)

    Onchi, Takumi; McColl, David; Dreval, Mykola; Rohollahi, Akbar; Xiao, Chijin; Hirose, Akira; Zushi, Hideki

    2013-10-01

    A system for Repetitive Compact Torus Injection (RCTI) has been developed at the University of Saskatchewan. CTI is a promising fuelling technology to directly fuel the core region of tokamak reactors. In addition to fuelling, CTI has also the potential for (a) optimization of density profile and thus bootstrap current and (b) momentum injection. For steady-state reactor operation, RCTI is necessary. The approach to RCTI is to charge a storage capacitor bank with a large capacitance and quickly charge the CT capacitor bank through a stack of integrated-gate bipolar transistors (IGBTs). When the CT bank is fully charged, the IGBT stack will be turned off to isolate banks, and CT formation/acceleration sequence will start. After formation of each CT, the fast bank will be replenished and a new CT will be formed and accelerated. Circuits for the formation and the acceleration in University of Saskatchewan CT Injector (USCTI) have been modified. Three CT shots at 10 Hz or eight shots at 1.7 Hz have been achieved. This work has been sponsored by the CRC and NSERC, Canada.

  15. Repetitive Interrogation of 2-Level Quantum Systems

    NASA Technical Reports Server (NTRS)

    Prestage, John D.; Chung, Sang K.

    2010-01-01

    Trapped ion clocks derive information from a reference atomic transition by repetitive interrogations of the same quantum system, either a single ion or ionized gas of many millions of ions. Atomic beam frequency standards, by contrast, measure reference atomic transitions in a continuously replenished "flow through" configuration where initial ensemble atomic coherence is zero. We will describe some issues and problems that can arise when atomic state selection and preparation of the quantum atomic system is not completed, that is, optical pumping has not fully relaxed the coherence and also not fully transferred atoms to the initial state. We present a simple two-level density matrix analysis showing how frequency shifts during the state-selection process can cause frequency shifts of the measured clock transition. Such considerations are very important when a low intensity lamp light source is used for state selection, where there is relatively weak relaxation and re-pumping of ions to an initial state and much weaker 'environmental' relaxation of the atomic coherence set-up in the atomic sample.

  16. Understanding communicative actions: a repetitive TMS study.

    PubMed

    Stolk, Arjen; Noordzij, Matthijs L; Volman, Inge; Verhagen, Lennart; Overeem, Sebastiaan; van Elswijk, Gijs; Bloem, Bas; Hagoort, Peter; Toni, Ivan

    2014-02-01

    Despite the ambiguity inherent in human communication, people are remarkably efficient in establishing mutual understanding. Studying how people communicate in novel settings provides a window into the mechanisms supporting the human competence to rapidly generate and understand novel shared symbols, a fundamental property of human communication. Previous work indicates that the right posterior superior temporal sulcus (pSTS) is involved when people understand the intended meaning of novel communicative actions. Here, we set out to test whether normal functioning of this cerebral structure is required for understanding novel communicative actions using inhibitory low-frequency repetitive transcranial magnetic stimulation (rTMS). A factorial experimental design contrasted two tightly matched stimulation sites (right pSTS vs left MT+, i.e., a contiguous homotopic task-relevant region) and tasks (a communicative task vs a visual tracking task that used the same sequences of stimuli). Overall task performance was not affected by rTMS, whereas changes in task performance over time were disrupted according to TMS site and task combinations. Namely, rTMS over pSTS led to a diminished ability to improve action understanding on the basis of recent communicative history, while rTMS over MT+ perturbed improvement in visual tracking over trials. These findings qualify the contributions of the right pSTS to human communicative abilities, showing that this region might be necessary for incorporating previous knowledge, accumulated during interactions with a communicative partner, to constrain the inferential process that leads to action understanding.

  17. Can the Edinburgh Risk of Repetition Scale Predict Repetition of Deliberate Self-Poisoning in an Australian Clinical Setting?

    ERIC Educational Resources Information Center

    Carter, Gregory Leigh; Clover, Kerrie Ann; Bryant, Jennifer Lynn; Whyte, Ian MacGregor

    2002-01-01

    Tests the ability of the Edinburgh Risk of Repetition Scale (ERRS) to identify patients at high risk for repeat deliberate self-poisoning (DSP). A statistically significant relationship between ERRS scores and repetition was observed; however, sensitivity and specificity were low. The ERRS had limited value in identifying patients at high risk of…

  18. Skill learning in mirror reading: how repetition determines acquisition.

    PubMed

    Ofen-Noy, N; Dudai, Y; Karni, A

    2003-07-01

    Practice makes perfect, but the role of repetitions in skill learning is not yet fully understood. For example, given a similar number of trials on a given task, it is debated whether repeating and non-repeating items are learned by the same neural process. When one is given training with both types of items--does one learn two separate skills, or only one? Here we show, using a mirror reading task, that practice trials with trial-unique words, and practice trials with repeated words, count towards learning to a different degree. There was no interaction between the time-course of learning repeated and unique words even within the same individuals given mixed training. While repeated words were learned faster than unique words, the repetitions-dependent gains diminished with training beyond a small number of repetitions. Moreover, the gains in performance could not be accounted for solely by the number of repetitions, as assumed by power-law models of learning; rather, the passage of time was a critical factor. Finally, our results suggest that although both repeated and new words were learned by both declarative and procedural memory mechanisms, even a single repetition of specific words could lead to the establishment of a selective differential representation in memory. The results are compatible with the notion of a repetition-sensitive process, triggered by specific repeating events. This 'repetition counter' may be a critical trigger for the effective formation of procedural as well as some type of declarative memory.

  19. Hairpin-duplex equilibrium reflected in the A-->B transition in an undecamer quasi-palindrome present in the locus control region of the human beta-globin gene cluster.

    PubMed

    Kaushik, Mahima; Kukreti, Ritushree; Grover, Deepak; Brahmachari, Samir K; Kukreti, Shrikant

    2003-12-01

    Our recent work on an A-->G single nucleotide polymorphism (SNP) at the quasi-palindromic sequence d(TGGGG[A/G]CCCCA) of HS4 of the human beta-globin locus control region in an Indian population showed a significant association between the G allele and the occurrence of beta-thalassemia. Using UV-thermal denaturation, gel assay, circular dichroism (CD) and nuclease digestion experiments we have demonstrated that the undecamer quasi- palindromic sequence d(TGGGGACCCCA) (HPA11) and its reported polymorphic (SNP) version d(TGG GGGCCCCA) (HPG11) exist in hairpin-duplex equilibria. The biphasic nature of the melting profiles for both the oligonucleotides persisted at low as well as high salt concentrations. The HPG11 hairpin showed a higher T(m) than HPA11. The presence of unimolecular and bimolecular species was also shown by non-denaturating gel electrophoresis experiments. The CD spectra of both oligonucleotides showed features of the A- as well as B-type conformations and, moreover, exhibited a concentration dependence. The disappearance of the 265 nm positive CD signal in an oligomer concentration-dependent manner is indicative of an A-->B transition. The results give unprecedented insight into the in vitro structure of the quasi-palindromic sequence and provide the first report in which a hairpin-duplex equilibrium has been correlated with an A-->B interconversion of DNA. The nuclease-dependent degradation suggests that HPG11 is more resistant to nuclease than HPA11. Multiple sequence alignment of the HS4 region of the beta-globin gene cluster from different organisms revealed that this quasi-palindromic stretch is unique to Homo sapiens. We propose that quasi-palindromic sequences may form stable mini- hairpins or cruciforms in the HS4 region and might play a role in regulating beta-globin gene expression by affecting the binding of transcription factors. PMID:14627823

  20. Repetition enhancement and memory effects for duration.

    PubMed

    Wiener, Martin; Thompson, James C

    2015-06-01

    A remarkable aspect of conscious perception is that moments carryover from one to the next, also known as temporal continuity. This ability is thus crucial for detecting regularities, such as in speech and music, and may rely on an accurate perception of time. Investigations of human time perception have detailed two electroencephalographic (EEG) components associated with timing, the contingent negative variation (CNV) and late positive component of timing (LPCt); however, the precise roles of these components in timing remain elusive. Recently, we demonstrated that the perception of duration is influenced by durations presented on prior trials, which we explained by the creation of an implicit memory standard that adapts to local changes in sequence presentation. Here, we turn to the neural basis of this effect. Human participants performed a temporal bisection task in which they were required to classify the duration of auditory stimuli into short and long duration categories; crucially, the presentation order was first-order counterbalanced, allowing us to measure the effect of each presented duration on the next. EEG recordings revealed that the CNV and LPCt signals both covaried with the duration presented on the current trial, with CNV predicting reaction time and LPCt predicting choice. Additionally, both signals covaried with the duration presented in the prior trial but in different ways, with the CNV amplitude reflecting the change in the memory standard and the LPCt reflecting decision uncertainty. Furthermore, we observed a repetition enhancement effect of duration only for the CNV, suggesting that this signal additionally indexes the similarity of successive durations. These findings demonstrate dissociable roles for the CNV and LPCt, and demonstrate that both signals are continuously updated on a trial-by-trial basis that reflects shifts in temporal decisions. PMID:25818689

  1. Epithelial topography for repetitive tooth formation

    PubMed Central

    Gaete, Marcia; Fons, Juan Manuel; Popa, Elena Mădălina; Chatzeli, Lemonia; Tucker, Abigail S.

    2015-01-01

    ABSTRACT During the formation of repetitive ectodermally derived organs such as mammary glands, lateral line and teeth, the tissue primordium iteratively initiates new structures. In the case of successional molar development, new teeth appear sequentially in the posterior region of the jaw from Sox2+ cells in association with the posterior aspect of a pre-existing tooth. The sequence of molar development is well known, however, the epithelial topography involved in the formation of a new tooth is unclear. Here, we have examined the morphology of the molar dental epithelium and its development at different stages in the mouse in vivo and in molar explants. Using regional lineage tracing we show that within the posterior tail of the first molar the primordium for the second and third molar are organized in a row, with the tail remaining in connection with the surface, where a furrow is observed. The morphology and Sox2 expression of the tail retains characteristics reminiscent of the earlier stages of tooth development, such that position along the A-P axes of the tail correlates with different temporal stages. Sox9, a stem/progenitor cell marker in other organs, is expressed mainly in the suprabasal epithelium complementary with Sox2 expression. This Sox2 and Sox9 expressing molar tail contains actively proliferating cells with mitosis following an apico-basal direction. Snail2, a transcription factor implicated in cell migration, is expressed at high levels in the tip of the molar tail while E-cadherin and laminin are decreased. In conclusion, our studies propose a model in which the epithelium of the molar tail can grow by posterior movement of epithelial cells followed by infolding and stratification involving a population of Sox2+/Sox9+ cells. PMID:26538639

  2. Repetition enhancement and memory effects for duration.

    PubMed

    Wiener, Martin; Thompson, James C

    2015-06-01

    A remarkable aspect of conscious perception is that moments carryover from one to the next, also known as temporal continuity. This ability is thus crucial for detecting regularities, such as in speech and music, and may rely on an accurate perception of time. Investigations of human time perception have detailed two electroencephalographic (EEG) components associated with timing, the contingent negative variation (CNV) and late positive component of timing (LPCt); however, the precise roles of these components in timing remain elusive. Recently, we demonstrated that the perception of duration is influenced by durations presented on prior trials, which we explained by the creation of an implicit memory standard that adapts to local changes in sequence presentation. Here, we turn to the neural basis of this effect. Human participants performed a temporal bisection task in which they were required to classify the duration of auditory stimuli into short and long duration categories; crucially, the presentation order was first-order counterbalanced, allowing us to measure the effect of each presented duration on the next. EEG recordings revealed that the CNV and LPCt signals both covaried with the duration presented on the current trial, with CNV predicting reaction time and LPCt predicting choice. Additionally, both signals covaried with the duration presented in the prior trial but in different ways, with the CNV amplitude reflecting the change in the memory standard and the LPCt reflecting decision uncertainty. Furthermore, we observed a repetition enhancement effect of duration only for the CNV, suggesting that this signal additionally indexes the similarity of successive durations. These findings demonstrate dissociable roles for the CNV and LPCt, and demonstrate that both signals are continuously updated on a trial-by-trial basis that reflects shifts in temporal decisions.

  3. Contextual repetition facilitates word learning via fast mapping.

    PubMed

    Axelsson, Emma L; Horst, Jessica S

    2014-10-01

    The current study explores whether contextual repetition during fast mapping facilitates word learning. Three-year-old children completed fast mapping and test trials using a touchscreen computer. For half of the children, the non-targets (competitors) repeated across learning trials and for other children there was no repetition. All children received the same test trials. Children who experienced contextual repetition, that is, children for whom the competitors repeated during the initial fast mapping task, demonstrated word learning. These data demonstrate that children's word learning is facilitated by the presence of extraneous yet predictable information in the initial fast mapping task.

  4. The repetitive high energy pulsed power module

    SciTech Connect

    Harjes, H.C.; Reed, K.W.; Buttram, M.T.; Turman, B.N.; Neau, E.L.; Martinez, L.; Adcock, J.; Weinbrecht, E.A.; Mann, G.A.; Morgan, F.A.; Laderach, G.E.; Pena, G.; Butler, M.; Schneider, L.X.; Wavrik, R.W.; Penn, K.J.; Weber, G.J.

    1990-01-01

    High average power magnetic pulse compression systems are being considered for use in several applications. One of the key issues in the design of a pulsed power driver for these applications is component reliability, efficiency, and lifetime. In the Repetitive High Energy Pulsed Power (RHEPP) module, pulse compression is done exclusively with magnetic switches (saturable reactors) because such switches have the potential of performing efficiently and reliably for >10{sup 10} shots. The objective of the RHEPP project is to explore the feasibility of using magnetic pulse compression technology in continuous high average power applications. The RHEPP system consists of a compressor which drives a linear induction voltage adder with a diode load. Prime power for the module is supplied by a 600 kW, 120 Hz, alternator (furnished by Westinghouse Electric Corporation). At present, construction and initial testing in a bipolar mode of the first two stages of the compressor has been completed. This system has operated for a total of 332 minutes (4.8 {times} 10{sup 6} pulses) at full power (600 kW) with an efficiency of 94+/{minus}3%. The first stage magnetic switch (MS1) has a pulse compression factor of 8.4 (4.2 ms to 500 {mu}s time to peak). It has two, parallel connected, 67 turn copper coils and a 760 kg core of 2 mil silicon steel with a magnetic cross sectional area of 0. 065 m{sup 2}. The second stage magnetic switch (MS2) has a pulse compression factor of 3 (500 {mu}s to 170 {mu}s). It has two, parallel connected, 36 turn copper coils and a 361 kg core of field annealed 2605CO Metglas with a magnetic area of 0.019 m{sup 2}. A discussion of RHEPP compressor design effort and its baseline design is given. In addition, initial results from the operation of the first two stages are presented. 11 refs., 8 figs., 4 tabs.

  5. Neural dynamics during repetitive visual stimulation

    NASA Astrophysics Data System (ADS)

    Tsoneva, Tsvetomira; Garcia-Molina, Gary; Desain, Peter

    2015-12-01

    Objective. Steady-state visual evoked potentials (SSVEPs), the brain responses to repetitive visual stimulation (RVS), are widely utilized in neuroscience. Their high signal-to-noise ratio and ability to entrain oscillatory brain activity are beneficial for their applications in brain-computer interfaces, investigation of neural processes underlying brain rhythmic activity (steady-state topography) and probing the causal role of brain rhythms in cognition and emotion. This paper aims at analyzing the space and time EEG dynamics in response to RVS at the frequency of stimulation and ongoing rhythms in the delta, theta, alpha, beta, and gamma bands. Approach.We used electroencephalography (EEG) to study the oscillatory brain dynamics during RVS at 10 frequencies in the gamma band (40-60 Hz). We collected an extensive EEG data set from 32 participants and analyzed the RVS evoked and induced responses in the time-frequency domain. Main results. Stable SSVEP over parieto-occipital sites was observed at each of the fundamental frequencies and their harmonics and sub-harmonics. Both the strength and the spatial propagation of the SSVEP response seem sensitive to stimulus frequency. The SSVEP was more localized around the parieto-occipital sites for higher frequencies (>54 Hz) and spread to fronto-central locations for lower frequencies. We observed a strong negative correlation between stimulation frequency and relative power change at that frequency, the first harmonic and the sub-harmonic components over occipital sites. Interestingly, over parietal sites for sub-harmonics a positive correlation of relative power change and stimulation frequency was found. A number of distinct patterns in delta (1-4 Hz), theta (4-8 Hz), alpha (8-12 Hz) and beta (15-30 Hz) bands were also observed. The transient response, from 0 to about 300 ms after stimulation onset, was accompanied by increase in delta and theta power over fronto-central and occipital sites, which returned to baseline

  6. Distractibility during infants' examining and repetitive rhythmic activity.

    PubMed

    Doolittle, E J; Ruff, H A

    1998-05-01

    The goal of this study was to assess the role of examining and repetitive rhythmic activity in infants' exploration of novel objects. Sixteen 8-month-old infants played with novel toys as auditory-visual slide distractors occurred on one side at random intervals. The results showed that examining, but not repetitive activities, declined with exposure to the objects. They also showed that infants had different patterns of distractibility during examining and repetitive rhythmic activities. The infants were slower to turn to the distractor if they were examining the toy than if they were engaged in other activity, but the probability of a response did not differ. In contrast, when engaged in repetitive rhythmic activity, infants were less likely to respond to the distractor than when engaged in other activities, including examining; the speed with which they responded, however, did not differ. The results suggest that, during these two activities, the mechanisms for resisting distraction are quite different. PMID:9589216

  7. Fixture tests bellows reliability through repetitive pressure/temperature cycling

    NASA Technical Reports Server (NTRS)

    Levinson, C.

    1967-01-01

    Fixture explores the reliability of bellows used in precision in inertial systems. The fixture establishes the ability of the bellows to withstand repetitive over-stress pressure cycling at elevated temperatures. It is applicable in quality control and reliability programs.

  8. Repetition in visual word identification: benefits and costs.

    PubMed

    Burt, Jennifer S; Kipps, Tahli J; Matthews, Julian R

    2014-10-01

    University students performed lexical tasks with visually presented target words after the presentation of an identical or unrelated prime, at short (80-120 ms) or longer (410-710 ms) prime-target stimulus onset asynchronies (SOAs). Experiment 1 showed perceptual identification benefits in vocal responding at a short SOA that were reduced (accuracy) or reversed (latency) at a longer SOA. Experiment 2 showed a transition from a repetition benefit to a cost over 3 SOAs in a target-masked version of the lexical decision task (LDT; target displayed for only 141 ms). In Experiment 3 the repetition cost was replicated at a 530-ms SOA in the LDT with masked targets, but a repetition benefit was observed in the conventional LDT (target displayed until response). The dependence of repetition costs on target masking is more consistent with biases based on episodic confusions than refractoriness of lexical representations.

  9. Repetitive behaviour in kennelled domestic dog: stereotypical or not?

    PubMed

    Denham, Hamish D C; Bradshaw, John W S; Rooney, Nicola J

    2014-04-10

    Repetitive behaviour is common in kennelled dogs, yet its motivational basis remains relatively unexplored. We examine the repetitive behaviour of 30 kennelled working dogs in ten contexts both coinciding with, and in the absence of, commonly occurring arousing stimuli, such as care staff, other dogs and food preparation. A large proportion (93%) of subjects performed some repetitive behaviour, most commonly bouncing, but only 17% in the absence of the arousing stimuli. Subjects could be divided into four groups according to the stimuli eliciting, and the duration, of their repetitive behaviour, and these groups were compared on the basis of their cortisol response to an acute psychogenic stressor--a veterinary examination. Urinary cortisol/creatinine response curves differed significantly between the groups. In particular, those dogs which performed repetitive behaviour at times of minimal stimulation, showed a distinctly different pattern of response, with cortisol levels decreasing, as compared to increasing, after the veterinary examination. We conclude that dogs showing repetitive behaviours at times of high arousal are motivationally distinct from those "stereotyping" in the absence of stimulation. We suggest that those dogs showing spontaneous repetitive behaviours may have past experiences and/or temperaments that affect both their reactions to a veterinary examination and to long-term kennelling. For example, some dogs may find isolation from humans particularly aversive, hence affecting their reactions both to being left in a kennel and to being taken to the veterinary surgeon. Alternatively, such dogs may have atypical responsiveness of their hypothalamic-pituitary-adrenal (HPA) axis, possibly brought about through chronic stress. High levels of repetitive behaviours in response to inaccessible husbandry events may be explained if such behaviour has inadvertently been reinforced by attention from staff, and therefore may not always be indicative of

  10. Repetition of Attempted Suicide Among Immigrants in Europe

    PubMed Central

    Lipsicas, Cendrine Bursztein; Mäkinen, Ilkka Henrik; Wasserman, Danuta; Apter, Alan; Kerkhof, Ad; Michel, Konrad; Renberg, Ellinor Salander; van Heeringen, Kees; Värnik, Airi; Schmidtke, Armin

    2014-01-01

    Objectives To compare frequencies of suicide attempt repetition in immigrants and local European populations, and the timing of repetition in these groups. Method: Data from 7 European countries, comprising 10 574 local and 3032 immigrant subjects, were taken from the World Health Organization European Multicentre Study on Suicidal Behaviour and the ensuing Monitoring Suicidal Behaviour in Europe (commonly referred to as MONSUE) project. The relation between immigrant status and repetition of suicide attempt within 12-months following first registered attempt was analyzed with binary logistic regression, controlling for sex, age, and method of attempt. Timing of repetition was controlled for sex, age, and the recommended type of aftercare. Results: Lower odds of repeating a suicide attempt were found in Eastern European (OR 0.50; 95% CI 0.41 to 0.61, P < 0.001) and non-European immigrants (OR 0.68; 95% CI 0.51 to 0.90, P < 0.05), compared with the locals. Similar patterns were identified in the sex-specific analysis. Eastern European immigrants tended to repeat their attempt much later than locals (OR 0.58; 95% CI 0.35 to 0.93, P < 0.05). In general, 32% of all repetition occurred within 30 days. Repetition tended to decrease with age and was more likely in females using harder methods in their index attempt (OR 1.29; 95% CI 1.08 to 1.54, P < 0.01). Large variations in the general repetition frequency were identified between the collecting centres, thus influencing the results. Conclusions: The lower repetition frequencies in non-Western immigrants, compared with locals, in Europe stands in contrast to their markedly higher tendency to attempt suicide in general, possibly pointing to situational stress factors related to their suicidal crisis that are less persistent over time. Our findings also raise the possibility that suicide attempters and repeaters constitute only partially overlapping populations. PMID:25565687

  11. Repetitive strain injuries: has the Australian epidemic burnt out?

    PubMed

    Awerbuch, M

    2004-07-01

    In the 1980s Australia experienced an epidemic of medically certified claims for non-specific arm symptoms described as repetitive strain injury. Although a number of factors were mooted as causal of the epidemic, no single factor emerged as a compelling putative candidate. The present paper discusses the results of research which was published only after the epidemic had waned. It provides possible insights into the rise and fall of repetitive strain injury.

  12. Properties of water surface discharge at different pulse repetition rates

    SciTech Connect

    Ruma,; Yoshihara, K.; Hosseini, S. H. R. Sakugawa, T.; Akiyama, H.; Akiyama, M.; Lukeš, P.

    2014-09-28

    The properties of water surface discharge plasma for variety of pulse repetition rates are investigated. A magnetic pulse compression (MPC) pulsed power modulator able to deliver pulse repetition rates up to 1000 Hz, with 0.5 J per pulse energy output at 25 kV, was used as the pulsed power source. Positive pulse with a point-to-plane electrode configuration was used for the experiments. The concentration and production yield of hydrogen peroxide (H₂O₂) were quantitatively measured and orange II organic dye was treated, to evaluate the chemical properties of the discharge reactor. Experimental results show that the physical and chemical properties of water surface discharge are not influenced by pulse repetition rate, very different from those observed for under water discharge. The production yield of H₂O₂ and degradation rate per pulse of the dye did not significantly vary at different pulse repetition rates under a constant discharge mode on water surface. In addition, the solution temperature, pH, and conductivity for both water surface and underwater discharge reactors were measured to compare their plasma properties for different pulse repetition rates. The results confirm that surface discharge can be employed at high pulse repetition rates as a reliable and advantageous method for industrial and environmental decontamination applications.

  13. FMRI repetition suppression for voices is modulated by stimulus expectations.

    PubMed

    Andics, Attila; Gál, Viktor; Vicsi, Klára; Rudas, Gábor; Vidnyánszky, Zoltán

    2013-04-01

    According to predictive coding models of sensory processing, stimulus expectations have a profound effect on sensory cortical responses. This was supported by experimental results, showing that fMRI repetition suppression (fMRI RS) for face stimuli is strongly modulated by the probability of stimulus repetitions throughout the visual cortical processing hierarchy. To test whether processing of voices is also affected by stimulus expectations, here we investigated the effect of repetition probability on fMRI RS in voice-selective cortical areas. Changing ('alt') and identical ('rep') voice stimulus pairs were presented to the listeners in blocks, with a varying probability of alt and rep trials across blocks. We found auditory fMRI RS in the nonprimary voice-selective cortical regions, including the bilateral posterior STS, the right anterior STG and the right IFC, as well as in the IPL. Importantly, fMRI RS effects in all of these areas were strongly modulated by the probability of stimulus repetition: auditory fMRI RS was reduced or not present in blocks with low repetition probability. Our results revealed that auditory fMRI RS in higher-level voice-selective cortical regions is modulated by repetition probabilities and thus suggest that in audition, similarly to the visual modality, processing of sensory information is shaped by stimulus expectation processes. PMID:23268783

  14. Application of a clustering-based peak alignment algorithm to analyze various DNA fingerprinting data.

    PubMed

    Ishii, Satoshi; Kadota, Koji; Senoo, Keishi

    2009-09-01

    DNA fingerprinting analysis such as amplified ribosomal DNA restriction analysis (ARDRA), repetitive extragenic palindromic PCR (rep-PCR), ribosomal intergenic spacer analysis (RISA), and denaturing gradient gel electrophoresis (DGGE) are frequently used in various fields of microbiology. The major difficulty in DNA fingerprinting data analysis is the alignment of multiple peak sets. We report here an R program for a clustering-based peak alignment algorithm, and its application to analyze various DNA fingerprinting data, such as ARDRA, rep-PCR, RISA, and DGGE data. The results obtained by our clustering algorithm and by BioNumerics software showed high similarity. Since several R packages have been established to statistically analyze various biological data, the distance matrix obtained by our R program can be used for subsequent statistical analyses, some of which were not previously performed but are useful in DNA fingerprinting studies.

  15. Genetic analyses of Xanthomonas axonopodis pv. dieffenbachiae strains reveal distinct phylogenetic groups.

    PubMed

    Donahoo, R S; Jones, J B; Lacy, G H; Stromberg, V K; Norman, D J

    2013-03-01

    A comprehensive analysis of 175 Xanthomonas axonopodis pv. dieffenbachiae strains isolated from 10 Araceae hosts was done to identify pathogen variation. The strains were subjected to repetitive extragenic palindromic sequence polymerase chain reaction and four major phylogenetic clusters were generated. A subset of 40 strains isolated from Anthurium, Dieffenbachia, and Syngonium was further defined by amplified fragment length polymorphism and fatty acid methyl ester analysis and the same four phylogenetic clusters were observed. Comparison of representative strains in the first three clusters using DNA-DNA hybridization and multilocus sequence analysis supports the previous reclassification of strains in cluster I, including the X. axonopodis pv. dieffenbachiae pathovar reference strain (LMG695), to X. citri. Our research findings indicate that strains in cluster I, isolated primarily from anthurium, probably represent an undescribed pathovar. Other phylogenetic subclusters consisting primarily of strains isolated from xanthosoma and philodendron in clusters III and IV, respectively, may yet represent other undescribed species or pathovars of Xanthomonas. PMID:23134337

  16. The Composition of Fluorescent Pseudomonad Populations Associated with Roots Is Influenced by Plant and Soil Type

    PubMed Central

    Latour, X.; Corberand, T.; Laguerre, G.; Allard, F.; Lemanceau, P.

    1996-01-01

    Populations of fluorescent pseudomonads isolated from an uncultivated soil and from the roots of two plant species were previously shown to differ (P. Lemanceau, T. Corberand, L. Gardan, X. Latour, G. Laguerre, J.-M. Boeufgras, and C. Alabouvette, Appl. Environ. Microbiol. 61:1004-1012, 1995). The diversities of fluorescent pseudomonads, from two uncultivated soils and from the roots of two plant species cultivated in these two soils, were compared. The phenotypic diversity of the bacterial isolates was characterized on the basis of biochemical and physiological tests and on the basis of their ability to utilize 147 different organic compounds. The genotypic diversity of the isolates was characterized on the basis of the types of 16S genes coding for rRNA (rDNA), their repetitive extragenic palindromic patterns by PCR, and plasmid profiles. Taxonomic identification of the isolates was achieved with both biochemical and physiological tests and by comparing their 16S rDNA types to those of reference and type strains of fluorescent Pseudomonas spp. Numerical analysis of phenotypic characteristics allowed the clustering of isolates that showed high levels of similarity. This analysis indicated that both soil type and host plant had an effect on the diversity of fluorescent pseudomonads. However, of the two factors studied, the soil was clearly the dominating one. Indeed, the populations associated with the roots of each plant species varied from one soil to the other. This variation could possibly be ascribed to the differences recorded between the phenotypically diverse populations of fluorescent pseudomonads from the two uncultivated soils. The plant selection was, at least partly, plant specific. It was not related to bacterial species and biovars or to the presence of plasmid DNA. The phenotypic clustering of isolates was well correlated with genotypic characterization by repetitive extragenic palindrome-PCR fingerprinting. PMID:16535355

  17. Place field repetition and spatial learning in a multicompartment environment

    PubMed Central

    Grieves, Roddy M.; Jenkins, Bryan W.; Harland, Bruce C.

    2015-01-01

    Abstract Recent studies have shown that place cells in the hippocampus possess firing fields that repeat in physically similar, parallel environments. These results imply that it should be difficult for animals to distinguish parallel environments at a behavioral level. To test this, we trained rats on a novel odor‐location task in an environment with four parallel compartments which had previously been shown to yield place field repetition. A second group of animals was trained on the same task, but with the compartments arranged in different directions, an arrangement we hypothesised would yield less place field repetition. Learning of the odor‐location task in the parallel compartments was significantly impaired relative to learning in the radially arranged compartments. Fewer animals acquired the full discrimination in the parallel compartments compared to those trained in the radial compartments, and the former also required many more sessions to reach criterion compared to the latter. To confirm that the arrangement of compartments yielded differences in place cell repetition, in a separate group of animals we recorded from CA1 place cells in both environments. We found that CA1 place cells exhibited repeated fields across four parallel local compartments, but did not do so when the same compartments were arranged radially. To confirm that the differences in place field repetition across the parallel and radial compartments depended on their angular arrangement, and not incidental differences in access to an extra‐maze visual landmark, we repeated the recordings in a second set of rats in the absence of the orientation landmark. We found, once again, that place fields showed repetition in parallel compartments, and did not do so in radially arranged compartments. Thus place field repetition, or lack thereof, in these compartments was not dependent on extra‐maze cues. Together, these results imply that place field repetition constrains spatial learning

  18. Place field repetition and spatial learning in a multicompartment environment.

    PubMed

    Grieves, Roddy M; Jenkins, Bryan W; Harland, Bruce C; Wood, Emma R; Dudchenko, Paul A

    2016-01-01

    Recent studies have shown that place cells in the hippocampus possess firing fields that repeat in physically similar, parallel environments. These results imply that it should be difficult for animals to distinguish parallel environments at a behavioral level. To test this, we trained rats on a novel odor-location task in an environment with four parallel compartments which had previously been shown to yield place field repetition. A second group of animals was trained on the same task, but with the compartments arranged in different directions, an arrangement we hypothesised would yield less place field repetition. Learning of the odor-location task in the parallel compartments was significantly impaired relative to learning in the radially arranged compartments. Fewer animals acquired the full discrimination in the parallel compartments compared to those trained in the radial compartments, and the former also required many more sessions to reach criterion compared to the latter. To confirm that the arrangement of compartments yielded differences in place cell repetition, in a separate group of animals we recorded from CA1 place cells in both environments. We found that CA1 place cells exhibited repeated fields across four parallel local compartments, but did not do so when the same compartments were arranged radially. To confirm that the differences in place field repetition across the parallel and radial compartments depended on their angular arrangement, and not incidental differences in access to an extra-maze visual landmark, we repeated the recordings in a second set of rats in the absence of the orientation landmark. We found, once again, that place fields showed repetition in parallel compartments, and did not do so in radially arranged compartments. Thus place field repetition, or lack thereof, in these compartments was not dependent on extra-maze cues. Together, these results imply that place field repetition constrains spatial learning.

  19. Clustered regulatory interspaced short palindromic repeats (CRISPR)-mediated mutagenesis and phenotype rescue by piggyBac transgenesis in a nonmodel Drosophila species.

    PubMed

    Tanaka, R; Murakami, H; Ote, M; Yamamoto, D

    2016-08-01

    How behavioural diversity emerged in evolution is an unexplored subject in biology. To tackle this problem, genes and circuits for a behaviour need to be determined in different species for phylogenetic comparisons. The recently developed clustered regulatory interspaced short palindromic repeats/CRISPR associated protein9 (CRISPR/Cas9) system made such a challenge possible by providing the means to induce mutations in a gene of interest in any organism. Aiming at elucidating diversification in genetic and neural networks for courtship behaviour, we attempted to generate a genetic tool kit in Drosophila subobscura, a nonmodel species distantly related to the genetic model Drosophila melanogaster. Here we report the generation of yellow (y) and white mutations with the aid of the CRISPR/Cas9 system, and the rescue of the y mutant phenotype by germline transformation of the newly established y mutant fly line with a y(+) -marked piggyBac vector. This successful mutagenesis and transformation in D. subobscura open up an avenue for comprehensive genetic analyses of higher functions in this and other nonmodel Drosophila species, representing a key step toward systematic comparisons of genes and circuitries underlying behaviour amongst species. PMID:27015359

  20. Escaping the cut by restriction enzymes through single-strand self-annealing of host-edited 12-bp and longer synthetic palindromes.

    PubMed

    Castro-Chavez, Fernando

    2012-02-01

    Palindromati, the massive host-edited synthetic palindromic contamination found in GenBank, is illustrated and exemplified. Millions of contaminated sequences with portions or tandems of such portions derived from the ZAP adaptor or related linkers are shown (1) by the 12-bp sequence reported elsewhere, exon Xb, 5' CCCGAATTCGGG 3', (2) by a 22-bp related sequence 5' CTCGTGCCGAATTCGGCACGAG 3', and (3) by a longer 44-bp related sequence: 5' CTCGTGCCGAATTCGGCACGAGCTCGTGCCGAATTCGGCACGAG 3'. Possible reasons for why those long contaminating sequences continue in the databases are presented here: (1) the recognition site for the plus strand (+) is single-strand self-annealed; (2) the recognition site for the minus strand (-) is not only single-strand self-annealed but also located far away from the single-strand self-annealed plus strand, rendering impossible the formation of the active EcoRI enzyme dimer to cut on 5' G/AATTC 3', its target sequence. As a possible solution, it is suggested to rely on at least two or three independent results, such as sequences obtained by independent laboratories with the use, preferably, of independent sequencing methodologies. This information may help to develop tools for bioinformatics capable to detect/remove these contaminants and to infer why some damaged sequences which cause genetic diseases escape detection by the molecular quality control mechanism of cells and organisms, being undesirably transferred unchecked through the generations.

  1. An Active Immune Defense with a Minimal CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) RNA and without the Cas6 Protein*

    PubMed Central

    Maier, Lisa-Katharina; Stachler, Aris-Edda; Saunders, Sita J.; Backofen, Rolf; Marchfelder, Anita

    2015-01-01

    The prokaryotic immune system CRISPR-Cas (clustered regularly interspaced short palindromic repeats-CRISPR-associated) is a defense system that protects prokaryotes against foreign DNA. The short CRISPR RNAs (crRNAs) are central components of this immune system. In CRISPR-Cas systems type I and III, crRNAs are generated by the endonuclease Cas6. We developed a Cas6b-independent crRNA maturation pathway for the Haloferax type I-B system in vivo that expresses a functional crRNA, which we termed independently generated crRNA (icrRNA). The icrRNA is effective in triggering degradation of an invader plasmid carrying the matching protospacer sequence. The Cas6b-independent maturation of the icrRNA allowed mutation of the repeat sequence without interfering with signals important for Cas6b processing. We generated 23 variants of the icrRNA and analyzed them for activity in the interference reaction. icrRNAs with deletions or mutations of the 3′ handle are still active in triggering an interference reaction. The complete 3′ handle could be removed without loss of activity. However, manipulations of the 5′ handle mostly led to loss of interference activity. Furthermore, we could show that in the presence of an icrRNA a strain without Cas6b (Δcas6b) is still active in interference. PMID:25512373

  2. Mature clustered, regularly interspaced, short palindromic repeats RNA (crRNA) length is measured by a ruler mechanism anchored at the precursor processing site.

    PubMed

    Hatoum-Aslan, Asma; Maniv, Inbal; Marraffini, Luciano A

    2011-12-27

    Precise RNA processing is fundamental to all small RNA-mediated interference pathways. In prokaryotes, clustered, regularly interspaced, short palindromic repeats (CRISPR) loci encode small CRISPR RNAs (crRNAs) that protect against invasive genetic elements by antisense targeting. CRISPR loci are transcribed as a long precursor that is cleaved within repeat sequences by CRISPR-associated (Cas) proteins. In many organisms, this primary processing generates crRNA intermediates that are subject to additional nucleolytic trimming to render mature crRNAs of specific lengths. The molecular mechanisms underlying this maturation event remain poorly understood. Here, we defined the genetic requirements for crRNA primary processing and maturation in Staphylococcus epidermidis. We show that changes in the position of the primary processing site result in extended or diminished maturation to generate mature crRNAs of constant length. These results indicate that crRNA maturation occurs by a ruler mechanism anchored at the primary processing site. We also show that maturation is mediated by specific cas genes distinct from those genes involved in primary processing, showing that this event is directed by CRISPR/Cas loci.

  3. Structural and functional characterization of an archaeal clustered regularly interspaced short palindromic repeat (CRISPR)-associated complex for antiviral defense (CASCADE).

    PubMed

    Lintner, Nathanael G; Kerou, Melina; Brumfield, Susan K; Graham, Shirley; Liu, Huanting; Naismith, James H; Sdano, Matthew; Peng, Nan; She, Qunxin; Copié, Valérie; Young, Mark J; White, Malcolm F; Lawrence, C Martin

    2011-06-17

    In response to viral infection, many prokaryotes incorporate fragments of virus-derived DNA into loci called clustered regularly interspaced short palindromic repeats (CRISPRs). The loci are then transcribed, and the processed CRISPR transcripts are used to target invading viral DNA and RNA. The Escherichia coli "CRISPR-associated complex for antiviral defense" (CASCADE) is central in targeting invading DNA. Here we report the structural and functional characterization of an archaeal CASCADE (aCASCADE) from Sulfolobus solfataricus. Tagged Csa2 (Cas7) expressed in S. solfataricus co-purifies with Cas5a-, Cas6-, Csa5-, and Cas6-processed CRISPR-RNA (crRNA). Csa2, the dominant protein in aCASCADE, forms a stable complex with Cas5a. Transmission electron microscopy reveals a helical complex of variable length, perhaps due to substoichiometric amounts of other CASCADE components. A recombinant Csa2-Cas5a complex is sufficient to bind crRNA and complementary ssDNA. The structure of Csa2 reveals a crescent-shaped structure unexpectedly composed of a modified RNA-recognition motif and two additional domains present as insertions in the RNA-recognition motif. Conserved residues indicate potential crRNA- and target DNA-binding sites, and the H160A variant shows significantly reduced affinity for crRNA. We propose a general subunit architecture for CASCADE in other bacteria and Archaea.

  4. Arrangement and number of clustered regularly interspaced short palindromic repeat spacers are associated with erythromycin susceptibility in emm12, emm75 and emm92 of group A streptococcus.

    PubMed

    Zheng, P-X; Chiang-Ni, C; Wang, S-Y; Tsai, P-J; Kuo, C-F; Chuang, W-J; Lin, Y-S; Liu, C-C; Wu, J-J

    2014-06-01

    Clustered regularly interspaced short palindromic repeats (CRISPR) are composed of numerous repeat-spacer units and are considered a prokaryotic defence system against foreign nucleic acids. Since antibiotic-resistant genes are frequently encoded in foreign nucleic acids, the aim of this study was to test whether erythromycin susceptibility in group A streptococcus (Streptococcus pyogenes) is associated with characteristics of CRISPR elements. Erythromycin susceptibility of 330 isolates collected between 1997 and 2003 was analysed. Among 29 emm types, emm12, emm75 and emm92 showed significant changes in erythromycin-resistance rates. By sequencing the spacers from two CRISPR loci, spacer contents in emm12, emm75 and emm92 strains were associated with erythromycin susceptibility. Strains with fewer spacers were more resistant to erythromycin. Moreover, in emm4 strains, which showed no significant change in their annual erythromycin-resistance rate, CRISPR type and number of spacers were not correlated with erythromycin susceptibility. These results highlight a novel association between CRISPR spacer content and erythromycin susceptibility in group A streptococcus.

  5. An active immune defense with a minimal CRISPR (clustered regularly interspaced short palindromic repeats) RNA and without the Cas6 protein.

    PubMed

    Maier, Lisa-Katharina; Stachler, Aris-Edda; Saunders, Sita J; Backofen, Rolf; Marchfelder, Anita

    2015-02-13

    The prokaryotic immune system CRISPR-Cas (clustered regularly interspaced short palindromic repeats-CRISPR-associated) is a defense system that protects prokaryotes against foreign DNA. The short CRISPR RNAs (crRNAs) are central components of this immune system. In CRISPR-Cas systems type I and III, crRNAs are generated by the endonuclease Cas6. We developed a Cas6b-independent crRNA maturation pathway for the Haloferax type I-B system in vivo that expresses a functional crRNA, which we termed independently generated crRNA (icrRNA). The icrRNA is effective in triggering degradation of an invader plasmid carrying the matching protospacer sequence. The Cas6b-independent maturation of the icrRNA allowed mutation of the repeat sequence without interfering with signals important for Cas6b processing. We generated 23 variants of the icrRNA and analyzed them for activity in the interference reaction. icrRNAs with deletions or mutations of the 3' handle are still active in triggering an interference reaction. The complete 3' handle could be removed without loss of activity. However, manipulations of the 5' handle mostly led to loss of interference activity. Furthermore, we could show that in the presence of an icrRNA a strain without Cas6b (Δcas6b) is still active in interference.

  6. Intricate interactions between the bloom-forming cyanobacterium Microcystis aeruginosa and foreign genetic elements, revealed by diversified clustered regularly interspaced short palindromic repeat (CRISPR) signatures.

    PubMed

    Kuno, Sotaro; Yoshida, Takashi; Kaneko, Takakazu; Sako, Yoshihiko

    2012-08-01

    Clustered regularly interspaced short palindromic repeats (CRISPR) confer sequence-dependent, adaptive resistance in prokaryotes against viruses and plasmids via incorporation of short sequences, called spacers, derived from foreign genetic elements. CRISPR loci are thus considered to provide records of past infections. To describe the host-parasite (i.e., cyanophages and plasmids) interactions involving the bloom-forming freshwater cyanobacterium Microcystis aeruginosa, we investigated CRISPR in four M. aeruginosa strains and in two previously sequenced genomes. The number of spacers in each locus was larger than the average among prokaryotes. All spacers were strain specific, except for a string of 11 spacers shared in two closely related strains, suggesting diversification of the loci. Using CRISPR repeat-based PCR, 24 CRISPR genotypes were identified in a natural cyanobacterial community. Among 995 unique spacers obtained, only 10 sequences showed similarity to M. aeruginosa phage Ma-LMM01. Of these, six spacers showed only silent or conservative nucleotide mutations compared to Ma-LMM01 sequences, suggesting a strategy by the cyanophage to avert CRISPR immunity dependent on nucleotide identity. These results imply that host-phage interactions can be divided into M. aeruginosa-cyanophage combinations rather than pandemics of population-wide infectious cyanophages. Spacer similarity also showed frequent exposure of M. aeruginosa to small cryptic plasmids that were observed only in a few strains. Thus, the diversification of CRISPR implies that M. aeruginosa has been challenged by diverse communities (almost entirely uncharacterized) of cyanophages and plasmids.

  7. High-temperature protein G is essential for activity of the Escherichia coli clustered regularly interspaced short palindromic repeats (CRISPR)/Cas system.

    PubMed

    Yosef, Ido; Goren, Moran G; Kiro, Ruth; Edgar, Rotem; Qimron, Udi

    2011-12-13

    Prokaryotic DNA arrays arranged as clustered regularly interspaced short palindromic repeats (CRISPR), along with their associated proteins, provide prokaryotes with adaptive immunity by RNA-mediated targeting of alien DNA or RNA matching the sequences between the repeats. Here, we present a thorough screening system for the identification of bacterial proteins participating in immunity conferred by the Escherichia coli CRISPR system. We describe the identification of one such protein, high-temperature protein G (HtpG), a homolog of the eukaryotic chaperone heat-shock protein 90. We demonstrate that in the absence of htpG, the E. coli CRISPR system loses its suicidal activity against λ prophage and its ability to provide immunity from lysogenization. Transcomplementation of htpG restores CRISPR activity. We further show that inactivity of the CRISPR system attributable to htpG deficiency can be suppressed by expression of Cas3, a protein that is essential for its activity. Accordingly, we also find that the steady-state level of overexpressed Cas3 is significantly enhanced following HtpG expression. We conclude that HtpG is a newly identified positive modulator of the CRISPR system that is essential for maintaining functional levels of Cas3.

  8. Structural and biochemical analysis of nuclease domain of clustered regularly interspaced short palindromic repeat (CRISPR)-associated protein 3 (Cas3).

    PubMed

    Mulepati, Sabin; Bailey, Scott

    2011-09-01

    RNA transcribed from clustered regularly interspaced short palindromic repeats (CRISPRs) protects many prokaryotes from invasion by foreign DNA such as viruses, conjugative plasmids, and transposable elements. Cas3 (CRISPR-associated protein 3) is essential for this CRISPR protection and is thought to mediate cleavage of the foreign DNA through its N-terminal histidine-aspartate (HD) domain. We report here the 1.8 Å crystal structure of the HD domain of Cas3 from Thermus thermophilus HB8. Structural and biochemical studies predict that this enzyme binds two metal ions at its active site. We also demonstrate that the single-stranded DNA endonuclease activity of this T. thermophilus domain is activated not by magnesium but by transition metal ions such as manganese and nickel. Structure-guided mutagenesis confirms the importance of the metal-binding residues for the nuclease activity and identifies other active site residues. Overall, these results provide a framework for understanding the role of Cas3 in the CRISPR system.

  9. Subtyping Salmonella enterica serovar enteritidis isolates from different sources by using sequence typing based on virulence genes and clustered regularly interspaced short palindromic repeats (CRISPRs).

    PubMed

    Liu, Fenyun; Kariyawasam, Subhashinie; Jayarao, Bhushan M; Barrangou, Rodolphe; Gerner-Smidt, Peter; Ribot, Efrain M; Knabel, Stephen J; Dudley, Edward G

    2011-07-01

    Salmonella enterica subsp. enterica serovar Enteritidis is a major cause of food-borne salmonellosis in the United States. Two major food vehicles for S. Enteritidis are contaminated eggs and chicken meat. Improved subtyping methods are needed to accurately track specific strains of S. Enteritidis related to human salmonellosis throughout the chicken and egg food system. A sequence typing scheme based on virulence genes (fimH and sseL) and clustered regularly interspaced short palindromic repeats (CRISPRs)-CRISPR-including multi-virulence-locus sequence typing (designated CRISPR-MVLST)-was used to characterize 35 human clinical isolates, 46 chicken isolates, 24 egg isolates, and 63 hen house environment isolates of S. Enteritidis. A total of 27 sequence types (STs) were identified among the 167 isolates. CRISPR-MVLST identified three persistent and predominate STs circulating among U.S. human clinical isolates and chicken, egg, and hen house environmental isolates in Pennsylvania, and an ST that was found only in eggs and humans. It also identified a potential environment-specific sequence type. Moreover, cluster analysis based on fimH and sseL identified a number of clusters, of which several were found in more than one outbreak, as well as 11 singletons. Further research is needed to determine if CRISPR-MVLST might help identify the ecological origins of S. Enteritidis strains that contaminate chickens and eggs.

  10. Crystal structure of clustered regularly interspaced short palindromic repeats (CRISPR)-associated Csn2 protein revealed Ca2+-dependent double-stranded DNA binding activity.

    PubMed

    Nam, Ki Hyun; Kurinov, Igor; Ke, Ailong

    2011-09-01

    Clustered regularly interspaced short palindromic repeats (CRISPR) and their associated protein genes (cas genes) are widespread in bacteria and archaea. They form a line of RNA-based immunity to eradicate invading bacteriophages and malicious plasmids. A key molecular event during this process is the acquisition of new spacers into the CRISPR loci to guide the selective degradation of the matching foreign genetic elements. Csn2 is a Nmeni subtype-specific cas gene required for new spacer acquisition. Here we characterize the Enterococcus faecalis Csn2 protein as a double-stranded (ds-) DNA-binding protein and report its 2.7 Å tetrameric ring structure. The inner circle of the Csn2 tetrameric ring is ∼26 Å wide and populated with conserved lysine residues poised for nonspecific interactions with ds-DNA. Each Csn2 protomer contains an α/β domain and an α-helical domain; significant hinge motion was observed between these two domains. Ca(2+) was located at strategic positions in the oligomerization interface. We further showed that removal of Ca(2+) ions altered the oligomerization state of Csn2, which in turn severely decreased its affinity for ds-DNA. In summary, our results provided the first insight into the function of the Csn2 protein in CRISPR adaptation by revealing that it is a ds-DNA-binding protein functioning at the quaternary structure level and regulated by Ca(2+) ions.

  11. An active immune defense with a minimal CRISPR (clustered regularly interspaced short palindromic repeats) RNA and without the Cas6 protein.

    PubMed

    Maier, Lisa-Katharina; Stachler, Aris-Edda; Saunders, Sita J; Backofen, Rolf; Marchfelder, Anita

    2015-02-13

    The prokaryotic immune system CRISPR-Cas (clustered regularly interspaced short palindromic repeats-CRISPR-associated) is a defense system that protects prokaryotes against foreign DNA. The short CRISPR RNAs (crRNAs) are central components of this immune system. In CRISPR-Cas systems type I and III, crRNAs are generated by the endonuclease Cas6. We developed a Cas6b-independent crRNA maturation pathway for the Haloferax type I-B system in vivo that expresses a functional crRNA, which we termed independently generated crRNA (icrRNA). The icrRNA is effective in triggering degradation of an invader plasmid carrying the matching protospacer sequence. The Cas6b-independent maturation of the icrRNA allowed mutation of the repeat sequence without interfering with signals important for Cas6b processing. We generated 23 variants of the icrRNA and analyzed them for activity in the interference reaction. icrRNAs with deletions or mutations of the 3' handle are still active in triggering an interference reaction. The complete 3' handle could be removed without loss of activity. However, manipulations of the 5' handle mostly led to loss of interference activity. Furthermore, we could show that in the presence of an icrRNA a strain without Cas6b (Δcas6b) is still active in interference. PMID:25512373

  12. Escaping the Cut by Restriction Enzymes Through Single-Strand Self-Annealing of Host-Edited 12-bp and Longer Synthetic Palindromes

    PubMed Central

    2012-01-01

    Palindromati, the massive host-edited synthetic palindromic contamination found in GenBank, is illustrated and exemplified. Millions of contaminated sequences with portions or tandems of such portions derived from the ZAP adaptor or related linkers are shown (1) by the 12-bp sequence reported elsewhere, exon Xb, 5′ CCCGAATTCGGG 3′, (2) by a 22-bp related sequence 5′ CTCGTGCCGAATTCGGCACGAG 3′, and (3) by a longer 44-bp related sequence: 5′ CTCGTGCCGAATTCGGCACGAGCTCGTGCCGAATTCGGCACGAG 3′. Possible reasons for why those long contaminating sequences continue in the databases are presented here: (1) the recognition site for the plus strand (+) is single-strand self-annealed; (2) the recognition site for the minus strand (−) is not only single-strand self-annealed but also located far away from the single-strand self-annealed plus strand, rendering impossible the formation of the active EcoRI enzyme dimer to cut on 5′ G/AATTC 3′, its target sequence. As a possible solution, it is suggested to rely on at least two or three independent results, such as sequences obtained by independent laboratories with the use, preferably, of independent sequencing methodologies. This information may help to develop tools for bioinformatics capable to detect/remove these contaminants and to infer why some damaged sequences which cause genetic diseases escape detection by the molecular quality control mechanism of cells and organisms, being undesirably transferred unchecked through the generations. PMID:21895510

  13. Crystal Structure of Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)-associated Csn2 Protein Revealed Ca[superscript 2+]-dependent Double-stranded DNA Binding Activity

    SciTech Connect

    Nam, Ki Hyun; Kurinov, Igor; Ke, Ailong

    2012-05-22

    Clustered regularly interspaced short palindromic repeats (CRISPR) and their associated protein genes (cas genes) are widespread in bacteria and archaea. They form a line of RNA-based immunity to eradicate invading bacteriophages and malicious plasmids. A key molecular event during this process is the acquisition of new spacers into the CRISPR loci to guide the selective degradation of the matching foreign genetic elements. Csn2 is a Nmeni subtype-specific cas gene required for new spacer acquisition. Here we characterize the Enterococcus faecalis Csn2 protein as a double-stranded (ds-) DNA-binding protein and report its 2.7 {angstrom} tetrameric ring structure. The inner circle of the Csn2 tetrameric ring is {approx}26 {angstrom} wide and populated with conserved lysine residues poised for nonspecific interactions with ds-DNA. Each Csn2 protomer contains an {alpha}/{beta} domain and an {alpha}-helical domain; significant hinge motion was observed between these two domains. Ca{sup 2+} was located at strategic positions in the oligomerization interface. We further showed that removal of Ca{sup 2+} ions altered the oligomerization state of Csn2, which in turn severely decreased its affinity for ds-DNA. In summary, our results provided the first insight into the function of the Csn2 protein in CRISPR adaptation by revealing that it is a ds-DNA-binding protein functioning at the quaternary structure level and regulated by Ca{sup 2+} ions.

  14. Combination of the clustered regularly interspaced short palindromic repeats (CRISPR)-associated 9 technique with the piggybac transposon system for mouse in utero electroporation to study cortical development.

    PubMed

    Cheng, Man; Jin, Xubin; Mu, Lili; Wang, Fangyu; Li, Wei; Zhong, Xiaoling; Liu, Xuan; Shen, Wenchen; Liu, Ying; Zhou, Yan

    2016-09-01

    In utero electroporation (IUE) is commonly used to study cortical development of cerebrum by downregulating or overexpressing genes of interest in neural progenitor cells (NPCs) of small mammals. However, exogenous plasmids are lost or diluted over time. Furthermore, gene knockdown based on short-hairpin RNAs may exert nonspecific effects that lead to aberrant neuronal migration. Genomic engineering by the clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated 9 (Cas9) system has great research and therapeutic potentials. Here we integrate the CRISPR/Cas9 components into the piggyBac (PB) transposon system (the CRISPR/Cas9-PB toolkit) for cortical IUEs. The mouse Sry-related HMG box-2 (Sox2) gene was selected as the target for its application. Most transduced cortical NPCs were depleted of SOX2 protein as early as 3 days post-IUE, whereas expressions of SOX1 and PAX6 remained intact. Furthermore, both the WT Cas9 and the D10A nickase mutant Cas9n showed comparable knockout efficiency. Transduced cortical cells were purified with fluorescence-activated cell sorting, and effective gene editing at the Sox2 loci was confirmed. Thus, application of the CRISPR/Cas9-PB toolkit in IUE is a promising strategy to study gene functions in cortical NPCs and their progeny. © 2016 Wiley Periodicals, Inc. PMID:27317429

  15. Structural and Functional Characterization of an Archaeal Clustered Regularly Interspaced Short Palindromic Repeat (CRISPR)-associated Complex for Antiviral Defense (CASCADE)*

    PubMed Central

    Lintner, Nathanael G.; Kerou, Melina; Brumfield, Susan K.; Graham, Shirley; Liu, Huanting; Naismith, James H.; Sdano, Matthew; Peng, Nan; She, Qunxin; Copié, Valérie; Young, Mark J.; White, Malcolm F.; Lawrence, C. Martin

    2011-01-01

    In response to viral infection, many prokaryotes incorporate fragments of virus-derived DNA into loci called clustered regularly interspaced short palindromic repeats (CRISPRs). The loci are then transcribed, and the processed CRISPR transcripts are used to target invading viral DNA and RNA. The Escherichia coli “CRISPR-associated complex for antiviral defense” (CASCADE) is central in targeting invading DNA. Here we report the structural and functional characterization of an archaeal CASCADE (aCASCADE) from Sulfolobus solfataricus. Tagged Csa2 (Cas7) expressed in S. solfataricus co-purifies with Cas5a-, Cas6-, Csa5-, and Cas6-processed CRISPR-RNA (crRNA). Csa2, the dominant protein in aCASCADE, forms a stable complex with Cas5a. Transmission electron microscopy reveals a helical complex of variable length, perhaps due to substoichiometric amounts of other CASCADE components. A recombinant Csa2-Cas5a complex is sufficient to bind crRNA and complementary ssDNA. The structure of Csa2 reveals a crescent-shaped structure unexpectedly composed of a modified RNA-recognition motif and two additional domains present as insertions in the RNA-recognition motif. Conserved residues indicate potential crRNA- and target DNA-binding sites, and the H160A variant shows significantly reduced affinity for crRNA. We propose a general subunit architecture for CASCADE in other bacteria and Archaea. PMID:21507944

  16. Combination of the clustered regularly interspaced short palindromic repeats (CRISPR)-associated 9 technique with the piggybac transposon system for mouse in utero electroporation to study cortical development.

    PubMed

    Cheng, Man; Jin, Xubin; Mu, Lili; Wang, Fangyu; Li, Wei; Zhong, Xiaoling; Liu, Xuan; Shen, Wenchen; Liu, Ying; Zhou, Yan

    2016-09-01

    In utero electroporation (IUE) is commonly used to study cortical development of cerebrum by downregulating or overexpressing genes of interest in neural progenitor cells (NPCs) of small mammals. However, exogenous plasmids are lost or diluted over time. Furthermore, gene knockdown based on short-hairpin RNAs may exert nonspecific effects that lead to aberrant neuronal migration. Genomic engineering by the clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated 9 (Cas9) system has great research and therapeutic potentials. Here we integrate the CRISPR/Cas9 components into the piggyBac (PB) transposon system (the CRISPR/Cas9-PB toolkit) for cortical IUEs. The mouse Sry-related HMG box-2 (Sox2) gene was selected as the target for its application. Most transduced cortical NPCs were depleted of SOX2 protein as early as 3 days post-IUE, whereas expressions of SOX1 and PAX6 remained intact. Furthermore, both the WT Cas9 and the D10A nickase mutant Cas9n showed comparable knockout efficiency. Transduced cortical cells were purified with fluorescence-activated cell sorting, and effective gene editing at the Sox2 loci was confirmed. Thus, application of the CRISPR/Cas9-PB toolkit in IUE is a promising strategy to study gene functions in cortical NPCs and their progeny. © 2016 Wiley Periodicals, Inc.

  17. A palindromic regulatory site within vertebrate GATA-1 promoters requires both zinc fingers of the GATA-1 DNA-binding domain for high-affinity interaction.

    PubMed

    Trainor, C D; Omichinski, J G; Vandergon, T L; Gronenborn, A M; Clore, G M; Felsenfeld, G

    1996-05-01

    GATA-1, a transcription factor essential for the development of the erythroid lineage, contains two adjacent highly conserved zinc finger motifs. The carboxy-terminal finger is necessary and sufficient for specific binding to the consensus GATA recognition sequence: mutant proteins containing only the amino-terminal finger do not bind. Here we identify a DNA sequence (GATApal) for which the GATA-1 amino-terminal finger makes a critical contribution to the strength of binding. The site occurs in the GATA-1 gene promoters of chickens, mice, and humans but occurs very infrequently in other vertebrate genes known to be regulated by GATA proteins. GATApal is a palindromic site composed of one complete [(A/T)GATA(A/G)] and one partial (GAT) canonical motif. Deletion of the partial motif changes the site to a normal GATA site and also reduces by as much as eightfold the activity of the GATA-1 promoter in an erythroid precursor cell. We propose that GATApal is important for positive regulation of GATA-1 expression in erythroid cells. PMID:8628290

  18. Repetitively Q-switched Nd:BeL lasers

    NASA Technical Reports Server (NTRS)

    Degnan, J.; Birnbaum, M.; Deshazer, L. G.

    1979-01-01

    The thermal and mechanical characteristics which will ultimately limit the performance of Nd:BeL at high average power levels were investigated. The output beam characteristics (pulse width, peak power, beam dimensions and collimation) were determined at high repetition rates for both Nd:BeL and Nd:YAG. The output of Nd:BeL was shown to exceed that of Nd:YAG by a factor of 2.7 at low Q-switched repetition rates (1 Hz). This result follows from the smaller stimulated emission cross section of x-axis Nb:BeL compared to that of NdYAG by the same factor. At high repetition rates (10 Hz) the output of Nd:Bel falls to a level of three-fifths of its low repetition rate value while under similar tests the output of Nd:YAG remains essentially constant. A comparison of the measured values of the elasto-optic coefficients, the dn/dT values and the linear expansion coefficients for BeL and YAG failed to provide an explanation for the performance of BeL; however, thermal lensing was observed in Nd:BeL. Results imply that the output of a high repetition rate Q-switched Nd:BeL laser (high thermal loading) could be dramatically increased by utilization of a resonator design to compensate for the thermal lensing effects.

  19. Characterizing exploration behavior in spatial neglect: omissions and repetitive search.

    PubMed

    Olk, Bettina; Harvey, Monika

    2006-11-01

    In search tasks, patients with spatial neglect typically fail to respond to stimuli on the contralesional side. Such behavior has been associated with hyperattention to the ipsilesional side and a deficit in disengaging from attended stimuli. The present study investigated whether such explanations can also account for a further kind of behavior frequently shown by neglect patients: repetitive returns to previously indicated stimuli, particularly on the ipsilesional side. A group of neglect patients was tested along with a group of healthy participants and a patient control group without neglect. Participants performed an exploration task in which they searched for targets defined by their shape or for all stimuli either with the aid of vision or blindfolded. The results showed differential effects of reducing the salience of visual stimuli by blindfolding. For a subgroup of patients, detection rate improved, while for others the percentage of omissions increased. However, contrary to the control groups, blindfolding had no effect on repetitive search in the neglect group, inconsistent with hyperattention, a disengage or impaired working memory deficits. The rate of repetitive returns to previously indicated locations did not seem to be associated with the percentage of omitted stimuli, suggesting that repetitive returns may be best explained by a disruption of systematic search and lack of volitional control in spatial neglect. The results further underline the importance of considering repetitive search behavior in addition to omissions in standard neglect assessments. PMID:16979143

  20. Selective scanpath repetition during memory-guided visual search

    PubMed Central

    Wynn, Jordana S.; Bone, Michael B.; Dragan, Michelle C.; Hoffman, Kari L.; Buchsbaum, Bradley R.; Ryan, Jennifer D.

    2016-01-01

    ABSTRACT Visual search efficiency improves with repetition of a search display, yet the mechanisms behind these processing gains remain unclear. According to Scanpath Theory, memory retrieval is mediated by repetition of the pattern of eye movements or “scanpath” elicited during stimulus encoding. Using this framework, we tested the prediction that scanpath recapitulation reflects relational memory guidance during repeated search events. Younger and older subjects were instructed to find changing targets within flickering naturalistic scenes. Search efficiency (search time, number of fixations, fixation duration) and scanpath similarity (repetition) were compared across age groups for novel (V1) and repeated (V2) search events. Younger adults outperformed older adults on all efficiency measures at both V1 and V2, while the search time benefit for repeated viewing (V1–V2) did not differ by age. Fixation-binned scanpath similarity analyses revealed repetition of initial and final (but not middle) V1 fixations at V2, with older adults repeating more initial V1 fixations than young adults. In young adults only, early scanpath similarity correlated negatively with search time at test, indicating increased efficiency, whereas the similarity of V2 fixations to middle V1 fixations predicted poor search performance. We conclude that scanpath compression mediates increased search efficiency by selectively recapitulating encoding fixations that provide goal-relevant input. Extending Scanpath Theory, results suggest that scanpath repetition varies as a function of time and memory integrity. PMID:27570471

  1. Characterizing exploration behavior in spatial neglect: omissions and repetitive search.

    PubMed

    Olk, Bettina; Harvey, Monika

    2006-11-01

    In search tasks, patients with spatial neglect typically fail to respond to stimuli on the contralesional side. Such behavior has been associated with hyperattention to the ipsilesional side and a deficit in disengaging from attended stimuli. The present study investigated whether such explanations can also account for a further kind of behavior frequently shown by neglect patients: repetitive returns to previously indicated stimuli, particularly on the ipsilesional side. A group of neglect patients was tested along with a group of healthy participants and a patient control group without neglect. Participants performed an exploration task in which they searched for targets defined by their shape or for all stimuli either with the aid of vision or blindfolded. The results showed differential effects of reducing the salience of visual stimuli by blindfolding. For a subgroup of patients, detection rate improved, while for others the percentage of omissions increased. However, contrary to the control groups, blindfolding had no effect on repetitive search in the neglect group, inconsistent with hyperattention, a disengage or impaired working memory deficits. The rate of repetitive returns to previously indicated locations did not seem to be associated with the percentage of omitted stimuli, suggesting that repetitive returns may be best explained by a disruption of systematic search and lack of volitional control in spatial neglect. The results further underline the importance of considering repetitive search behavior in addition to omissions in standard neglect assessments.

  2. Chromosomal distribution and evolution of repetitive DNAs in fish.

    PubMed

    Cioffi, M B; Bertollo, L A C

    2012-01-01

    Fish exhibit the greatest diversity of all vertebrates, making this group extremely attractive for the study of a number of evolutionary questions. Fish genomes have intrinsic characteristics that may be responsible for the amazing diversity of fish species observed, but little is known about their structure and organization. A large amount of data from mapping of repetitive DNA sequences of several species has been generated, providing an important source of information for better understanding the involvement of repetitive DNA sequences in chromosomal organization. Almost all classes of repeated DNAs have been mapped in fishes, and all fish genomes analyzed contain at least one, mostly all types of repetitive DNAs. DNA sequence data combined with the chromosomal mapping of these repeated elements by means of cytogenetic techniques can provide a clearer picture of the genome, which is not yet clearly defined, even if already sequenced. In this chapter, we do not aim to analyze all available data on the chromosomal distribution of repetitive DNAs in fish species, but instead wish to draw attention to the impact of repetitive DNA sequences on fish karyotyping and genome evolution, with a particular focus on B chromosome origin and maintenance and on the differentiation of sex chromosomes. We also discuss the integration of chromosome analysis and genomic data, which represents a promising tool for fish cytogenomics.

  3. Flexible high-repetition-rate ultrafast fiber laser

    PubMed Central

    Mao, Dong; Liu, Xueming; Sun, Zhipei; Lu, Hua; Han, Dongdong; Wang, Guoxi; Wang, Fengqiu

    2013-01-01

    High-repetition-rate pulses have widespread applications in the fields of fiber communications, frequency comb, and optical sensing. Here, we have demonstrated high-repetition-rate ultrashort pulses in an all-fiber laser by exploiting an intracavity Mach-Zehnder interferometer (MZI) as a comb filter. The repetition rate of the laser can be tuned flexibly from about 7 to 1100 GHz by controlling the optical path difference between the two arms of the MZI. The pulse duration can be reduced continuously from about 10.1 to 0.55 ps with the spectral width tunable from about 0.35 to 5.7 nm by manipulating the intracavity polarization controller. Numerical simulations well confirm the experimental observations and show that filter-driven four-wave mixing effect, induced by the MZI, is the main mechanism that governs the formation of the high-repetition-rate pulses. This all-fiber-based laser is a simple and low-cost source for various applications where high-repetition-rate pulses are necessary. PMID:24226153

  4. Masked repetition priming and proportion effects under cognitive load.

    PubMed

    Bodner, Glen E; Stalinski, Stephanie M

    2008-06-01

    The authors used a cognitive load manipulation (rehearsing a string of digits during the trial) to test the automaticity of (a) masked repetition priming and (b) the masked repetition proportion (RP) effect (i.e., greater priming when the proportion of repetition-prime trials is higher) in the lexical decision task. The RP (.2 vs. .8) was varied across blocks. Masked priming was not reduced under load compared with a no-load group. Surprisingly, only the load group showed an RP effect in response latencies, although the no-load group showed an RP effect in the error rates. Our results show that masked priming is automatic, yet the influence of masked primes can nonetheless be adjusted at an unconscious level. Implications for accounts of masked priming are discussed. PMID:18572990

  5. Body-focused repetitive behavior disorders in ICD-11.

    PubMed

    Grant, Jon E; Stein, Dan J

    2014-01-01

    This article addresses the question of how body-focused repetitive behavior disorders (e.g., trichotillomania and skin-picking disorder) should be characterized in ICD-11. The article reviews the historical nosology of the two disorders and the current approaches in DSM-5 and ICD-10. Although data are limited and mixed regarding the optimal relationship between body-focused repetitive behavior disorders and nosological categories, these conditions should be included within the obsessive-compulsive and related disorders category, as this is how most clinicians see these behaviors, and as this may optimize clinical utility. The descriptions of these disorders should largely mirror those in DSM-5, given the evidence from recent field surveys. The recommendations regarding ICD-11 and body-focused repetitive behavior disorders should promote the global identification and treatment of these conditions in primary care settings. PMID:25388613

  6. Body-focused repetitive behavior disorders in ICD-11.

    PubMed

    Grant, Jon E; Stein, Dan J

    2014-01-01

    This article addresses the question of how body-focused repetitive behavior disorders (e.g., trichotillomania and skin-picking disorder) should be characterized in ICD-11. The article reviews the historical nosology of the two disorders and the current approaches in DSM-5 and ICD-10. Although data are limited and mixed regarding the optimal relationship between body-focused repetitive behavior disorders and nosological categories, these conditions should be included within the obsessive-compulsive and related disorders category, as this is how most clinicians see these behaviors, and as this may optimize clinical utility. The descriptions of these disorders should largely mirror those in DSM-5, given the evidence from recent field surveys. The recommendations regarding ICD-11 and body-focused repetitive behavior disorders should promote the global identification and treatment of these conditions in primary care settings.

  7. Repeated text in unrelated passages: Repetition versus meaning selection effects.

    PubMed

    Klin, Celia M; Drumm, April M; Ralano, Angela S

    2009-07-01

    Despite previous findings, Klin, Ralano, and Weingartner (2007) found transfer benefits across unrelated passages. After processing an ambiguous phrase in Story A that was biased toward its sarcastic meaning, readers were more likely to interpret the identical phrase in Story B as sarcastic, even though it contained no disambiguating information. In the present experiments, we found both repetition effects (a benefit for the lexical items) and meaning selection effects (a benefit for the selected meaning of the phrase) with short delays between Stories A and B; with longer delays, only repetition effects were found. Whereas decreasing the elaboration of the phrase eliminated both effects, moving the disambiguating context from before to after the phrase eliminated meaning selection effects only. We conclude that meaning selection effects, which are based on conceptual overlap, are more sensitive to context changes and less robust than repetition effects, which are based on both perceptual and conceptual overlap.

  8. Repetition-induced plasticity of motor representations of action sounds.

    PubMed

    Bourquin, Nathalie M-P; Simonin, Alexandre; Clarke, Stephanie

    2013-01-01

    Action-related sounds are known to increase the excitability of motoneurones within the primary motor cortex (M1), but the role of this auditory input remains unclear. We investigated repetition priming-induced plasticity, which is characteristic of semantic representations, in M1 by applying transcranial magnetic stimulation pulses to the hand area. Motor evoked potentials (MEPs) were larger while subjects were listening to sounds related versus unrelated to manual actions. Repeated exposure to the same manual-action-related sound yielded a significant decrease in MEPs when right, hand area was stimulated; no repetition effect was observed for manual-action-unrelated sounds. The shared repetition priming characteristics suggest that auditory input to the right primary motor cortex is part of auditory semantic representations. PMID:23064984

  9. Harmonic Current Suppression for PMSM by Repetitive Perfect Tracking Control

    NASA Astrophysics Data System (ADS)

    Nakai, Takahiro; Fujimoto, Hiroshi

    PM motor drives are widely used for high performance servo applications. However, PM motor has imperfect sinusoidal flux distribution which causes harmonic current. Dead time of inverter and current measurement error leads to harmonic current, too. The repetitive control method was applied to the harmonic current suppression. For the repetitive control which is based on the internal model principle, the characteristic of the harmonic suppression is excellent. However, it amplifies inter-harmonic components. The inter-harmonic components have frequencies with non-integral multiples of the fundamental frequency. Therefore, the feedforward compensation is applied for the harmonic current to improve a suppression characteristic. Authors proposed harmonic current suppression control of PM motor in αβ coordinate by using repetitive perfect tracking control with PWM-hold model. Finally, we show the advantages of proposed method by simulations and experiments.

  10. Oral Language Skills Moderate Nonword Repetition Skills in Children with Dyslexia: A Meta-Analysis of the Role of Nonword Repetition Skills in Dyslexia

    ERIC Educational Resources Information Center

    Melby-Lervag, Monica; Lervag, Arne

    2012-01-01

    We present a meta-analysis reviewing studies that have focused on the relationship between dyslexia and nonword repetition. The results show that children with dyslexia have poorer nonword repetition skills when compared to both chronological-age and reading-level controls. However, the severity of the nonword repetition problem varies…

  11. Repetition of Deliberate Self-Harm: A Study of the Characteristics and Subsequent Deaths in Patients Presenting to a General Hospital According to Extent of Repetition

    ERIC Educational Resources Information Center

    Haw, Camilla; Bergen, Helen; Casey, Deborah; Hawton, Keith

    2007-01-01

    Repetition of deliberate self-harm (DSH) is common. Some patients repeat multiple times. We have investigated the characteristics of repeaters, and mortality in three groups of DSH patients by repetition status. Data collected by the Oxford Monitoring System for Attempted Suicide were used to examine the pattern of repetition of DSH patients…

  12. Medium Repetition Rate TEA Laser For Industrial Applications

    NASA Astrophysics Data System (ADS)

    Walter, Bruno

    1987-09-01

    The design and performance of an inexpensive compact repetitively pulsed TEA CO2 laser is described. The device uses a modified corona preionization technique and a fast transverse gas flow to achieve high repetition rates. An output energy of 500 mJ per pulse and an out-put power of 6.2W at 40Hz have been obtained. Due to the small energy needed for preionization, the efficiency of the device is high, whereas the gas dissociation is low when compared with commercial laser systems. This results in the relatively small fresh laser gas exchange of 20 ltr h-1 for long term operation.

  13. Prediction of Muscle Performance During Dynamic Repetitive Exercise

    NASA Technical Reports Server (NTRS)

    Byerly, D. L.; Byerly, K. A.; Sognier, M. A.; Squires, W. G.

    2002-01-01

    A method for predicting human muscle performance was developed. Eight test subjects performed a repetitive dynamic exercise to failure using a Lordex spinal machine. Electromyography (EMG) data was collected from the erector spinae. Evaluation of the EMG data using a 5th order Autoregressive (AR) model and statistical regression analysis revealed that an AR parameter, the mean average magnitude of AR poles, can predict performance to failure as early as the second repetition of the exercise. Potential applications to the space program include evaluating on-orbit countermeasure effectiveness, maximizing post-flight recovery, and future real-time monitoring capability during Extravehicular Activity.

  14. Psychopharmacologic interventions for repetitive behaviors in autism spectrum disorders.

    PubMed

    Soorya, Latha; Kiarashi, Jessica; Hollander, Eric

    2008-10-01

    This article provides an overview of psychopharmacological treatments for repetitive behaviors in autism spectrum disorders (ASDs) in the context of current conceptualizations of this understudied core symptom domain. The available literature on the widely used selective serotonin reuptake inhibitors (SSRIs), including fluvoxamine, fluoxetine, citalopram, escitalopram, and sertraline, are reviewed. In addition to SSRIs, research on effects of other pharmacologic interventions such as divalproex sodium, risperidone, and the neuropeptide oxytocin are presented. To date, data are mixed for interventions commonly prescribed in clinical practice and suggest several areas of investigation in advancing research on the medication management of repetitive behaviors.

  15. Characterizing caregiver responses to restricted and repetitive behaviors in toddlers with autism spectrum disorder.

    PubMed

    Harrop, Clare; Gulsrud, Amanda; Shih, Wendy; Hovsepyan, Lilit; Kasari, Connie

    2016-04-01

    Restricted and repetitive behaviors are a core feature of autism spectrum disorder. This descriptive study documented the presence of restricted and repetitive behaviors in 85 toddlers with autism spectrum disorder as they interacted with their caregiver in a play interaction. For each child restricted and repetitive behavior, a caregiver response/non-response was coded. Caregiver responses were rated as successful or unsuccessful. In all, 83 toddlers demonstrated at least one restricted and repetitive behavior in 10 min. The most common child restricted and repetitive behavior was repetitive object use with 72 children displaying at least one instance of this category of restricted and repetitive behavior. Overall, caregivers responded to fewer than half of their child's restricted and repetitive behaviors, and caregiver response varied by child restricted and repetitive behavior type. The most common response was redirection. Success varied by child restricted and repetitive behavior type and caregiver response--redirections were most successful for child verbal and motor restricted and repetitive behaviors, whereas physical or verbal responses were rated more successful for repetitive object use and visual restricted and repetitive behaviors. This study represents the first attempt to characterize how caregivers respond to restricted and repetitive behaviors. Toddlers with autism spectrum disorder are already demonstrating a variety of restricted and repetitive behaviors within the context of a free play sessions, and caregivers differentially and naturally respond to them.

  16. Generation of Hypertension-Associated STK39 Polymorphism Knockin Cell Lines With the Clustered Regularly Interspaced Short Palindromic Repeats/Cas9 System.

    PubMed

    Mandai, Shintaro; Mori, Takayasu; Sohara, Eisei; Rai, Tatemitsu; Uchida, Shinichi

    2015-12-01

    Previous genome-wide association studies identified serine threonine kinase 39 (STK39), encoding STE20/SPS1-related proline/alanine-rich kinase, as one of a limited number of hypertension susceptibility genes. A recent meta-analysis confirmed the association of STK39 intronic polymorphism rs3754777 with essential hypertension, among previously reported hypertension-associated STK39 polymorphisms. However, the biochemical function of this polymorphism in the mechanism responsible for hypertension is yet to be clarified. We generated rs3754777G>A knockin human cell lines with clustered regularly interspaced short palindromic repeats-mediated genome engineering. Homozygous (A/A) and heterozygous (G/A) knockin human embryonic kidney cell lines were generated using a double nickase, single-guide RNAs targeting STK39 intron 5 around single-nucleotide polymorphism, and a 100-bp donor single-stranded DNA oligonucleotide. Reverse transcription polymerase chain reaction with sequencing analyses revealed the identical STK39 transcripts among the wild-type and both knockin cell lines. Quantitative reverse transcription polymerase chain reaction showed increased STK39 mRNA expression, and immunoblot analysis revealed increases in total and phosphorylated STE20/SPS1-related proline/alanine-rich kinase with increased phosphorylated Na-K-Cl cotransporter isoform 1 in both knockin cell lines. The largest increases in these molecules were observed in the homozygous cell line. These findings indicated that this intronic polymorphism increases STK39 transcription, leading to activation of the STE20/SPS1-related proline/alanine-rich kinase-solute carrier family 12A signaling cascade. Increased interactions between STE20/SPS1-related proline/alanine-rich kinase and the target cation-chloride cotransporters may be responsible for hypertension susceptibility in individuals with this polymorphism.

  17. Association of clustered regularly interspaced short palindromic repeat (CRISPR) elements with specific serotypes and virulence potential of shiga toxin-producing Escherichia coli.

    PubMed

    Toro, Magaly; Cao, Guojie; Ju, Wenting; Allard, Marc; Barrangou, Rodolphe; Zhao, Shaohua; Brown, Eric; Meng, Jianghong

    2014-02-01

    Shiga toxin-producing Escherichia coli (STEC) strains (n = 194) representing 43 serotypes and E. coli K-12 were examined for clustered regularly interspaced short palindromic repeat (CRISPR) arrays to study genetic relatedness among STEC serotypes. A subset of the strains (n = 81) was further analyzed for subtype I-E cas and virulence genes to determine a possible association of CRISPR elements with potential virulence. Four types of CRISPR arrays were identified. CRISPR1 and CRISPR2 were present in all strains tested; 1 strain also had both CRISPR3 and CRISPR4, whereas 193 strains displayed a short, combined array, CRISPR3-4. A total of 3,353 spacers were identified, representing 528 distinct spacers. The average length of a spacer was 32 bp. Approximately one-half of the spacers (54%) were unique and found mostly in strains of less common serotypes. Overall, CRISPR spacer contents correlated well with STEC serotypes, and identical arrays were shared between strains with the same H type (O26:H11, O103:H11, and O111:H11). There was no association identified between the presence of subtype I-E cas and virulence genes, but the total number of spacers had a negative correlation with potential pathogenicity (P < 0.05). Fewer spacers were found in strains that had a greater probability of causing outbreaks and disease than in those with lower virulence potential (P < 0.05). The relationship between the CRISPR-cas system and potential virulence needs to be determined on a broader scale, and the biological link will need to be established.

  18. New clustered regularly interspaced short palindromic repeat locus spacer pair typing method based on the newly incorporated spacer for Salmonella enterica.

    PubMed

    Li, Hao; Li, Peng; Xie, Jing; Yi, Shengjie; Yang, Chaojie; Wang, Jian; Sun, Jichao; Liu, Nan; Wang, Xu; Wu, Zhihao; Wang, Ligui; Hao, Rongzhang; Wang, Yong; Jia, Leili; Li, Kaiqin; Qiu, Shaofu; Song, Hongbin

    2014-08-01

    A clustered regularly interspaced short palindromic repeat (CRISPR) typing method has recently been developed and used for typing and subtyping of Salmonella spp., but it is complicated and labor intensive because it has to analyze all spacers in two CRISPR loci. Here, we developed a more convenient and efficient method, namely, CRISPR locus spacer pair typing (CLSPT), which only needs to analyze the two newly incorporated spacers adjoining the leader array in the two CRISPR loci. We analyzed a CRISPR array of 82 strains belonging to 21 Salmonella serovars isolated from humans in different areas of China by using this new method. We also retrieved the newly incorporated spacers in each CRISPR locus of 537 Salmonella isolates which have definite serotypes in the Pasteur Institute's CRISPR Database to evaluate this method. Our findings showed that this new CLSPT method presents a high level of consistency (kappa = 0.9872, Matthew's correlation coefficient = 0.9712) with the results of traditional serotyping, and thus, it can also be used to predict serotypes of Salmonella spp. Moreover, this new method has a considerable discriminatory power (discriminatory index [DI] = 0.8145), comparable to those of multilocus sequence typing (DI = 0.8088) and conventional CRISPR typing (DI = 0.8684). Because CLSPT only costs about $5 to $10 per isolate, it is a much cheaper and more attractive method for subtyping of Salmonella isolates. In conclusion, this new method will provide considerable advantages over other molecular subtyping methods, and it may become a valuable epidemiologic tool for the surveillance of Salmonella infections.

  19. The evolutionary divergence of Shiga toxin-producing Escherichia coli is reflected in clustered regularly interspaced short palindromic repeat (CRISPR) spacer composition.

    PubMed

    Yin, Shuang; Jensen, Mark A; Bai, Jiawei; Debroy, Chitrita; Barrangou, Rodolphe; Dudley, Edward G

    2013-09-01

    The Shiga toxin-producing Escherichia coli (STEC) strains, including those of O157:H7 and the "big six" serogroups (i.e., serogroups O26, O45, O103, O111, O121, and O145), are a group of pathogens designated food adulterants in the United States. The relatively conserved nature of clustered regularly interspaced short palindromic repeats (CRISPRs) in phylogenetically related E. coli strains makes them potential subtyping markers for STEC detection, and a quantitative PCR (qPCR)-based assay was previously developed for O26:H11, O45:H2, O103:H2, O111:H8, O121:H19, O145:H28, and O157:H7 isolates. To better evaluate the sensitivity and specificity of this qPCR method, the CRISPR loci of 252 O157 and big-six STEC isolates were sequenced and analyzed along with 563 CRISPR1 and 624 CRISPR2 sequences available in GenBank. General conservation of spacer content and order was observed within each O157 and big-six serogroup, validating the qPCR method. Meanwhile, it was found that spacer deletion, the presence of an insertion sequence, and distinct alleles within a serogroup are sources of false-negative reactions. Conservation of CRISPR arrays among isolates expressing the same flagellar antigen, specifically, H7, H2, and H11, suggested that these isolates share an ancestor and provided an explanation for the false positives previously observed in the qPCR results. An analysis of spacer distribution across E. coli strains provided limited evidence for temporal spacer acquisition. Conversely, comparison of CRISPR sequences between strains along the stepwise evolution of O157:H7 from its O55:H7 ancestor revealed that, over this ∼7,000-year span, spacer deletion was the primary force generating CRISPR diversity.

  20. The Evolutionary Divergence of Shiga Toxin-Producing Escherichia coli Is Reflected in Clustered Regularly Interspaced Short Palindromic Repeat (CRISPR) Spacer Composition

    PubMed Central

    Yin, Shuang; Jensen, Mark A.; Bai, Jiawei; DebRoy, Chitrita; Barrangou, Rodolphe

    2013-01-01

    The Shiga toxin-producing Escherichia coli (STEC) strains, including those of O157:H7 and the “big six” serogroups (i.e., serogroups O26, O45, O103, O111, O121, and O145), are a group of pathogens designated food adulterants in the United States. The relatively conserved nature of clustered regularly interspaced short palindromic repeats (CRISPRs) in phylogenetically related E. coli strains makes them potential subtyping markers for STEC detection, and a quantitative PCR (qPCR)-based assay was previously developed for O26:H11, O45:H2, O103:H2, O111:H8, O121:H19, O145:H28, and O157:H7 isolates. To better evaluate the sensitivity and specificity of this qPCR method, the CRISPR loci of 252 O157 and big-six STEC isolates were sequenced and analyzed along with 563 CRISPR1 and 624 CRISPR2 sequences available in GenBank. General conservation of spacer content and order was observed within each O157 and big-six serogroup, validating the qPCR method. Meanwhile, it was found that spacer deletion, the presence of an insertion sequence, and distinct alleles within a serogroup are sources of false-negative reactions. Conservation of CRISPR arrays among isolates expressing the same flagellar antigen, specifically, H7, H2, and H11, suggested that these isolates share an ancestor and provided an explanation for the false positives previously observed in the qPCR results. An analysis of spacer distribution across E. coli strains provided limited evidence for temporal spacer acquisition. Conversely, comparison of CRISPR sequences between strains along the stepwise evolution of O157:H7 from its O55:H7 ancestor revealed that, over this ∼7,000-year span, spacer deletion was the primary force generating CRISPR diversity. PMID:23851088

  1. Comparing one repetition maximum and three repetition maximum between conventional and eccentrically loaded deadlifts.

    PubMed

    Bishop, Alan; DeBeliso, Mark; Sevene, Trish G; Adams, Kent J

    2014-07-01

    This study determined if an eccentrically loaded deadlift yields a higher 1 repetition maximum (1RM) and 3RM than a conventional deadlift and if the 1RM conventional and eccentrically loaded deadlift can be accurately estimated from the 3RM (3RM = 93% of 1RM). Division 1 football players (n = 15; 20.3 ± 1.9 years; 95.8 ± 18.2 kg; 184.4 ± 6.6 cm) participated. Deadlift 1RM and 3RM were measured in the conventional and eccentrically loaded deadlift. Dependent t-tests showed no significant difference between the 3RM and 1RM conventional deadlift and the 3RM and 1RM eccentrically loaded deadlift (p = 0.30 and p = 0.20, respectively). Pearson correlation between the 1RM conventional deadlift estimate and 1RM conventional deadlift actual was r = 0.91 (p ≤ 0.01); a dependent t-test indicated the 1RM conventional deadlift estimate was significantly less than the 1RM conventional deadlift actual (p = 0.007). Pearson correlation between the 1RM eccentrically loaded deadlift estimate and 1RM eccentrically loaded deadlift actual was r = 0.84 (p ≤ 0.01); a dependent t-test indicated the 1RM eccentrically loaded deadlift estimate was nearly significantly less than the 1RM eccentrically loaded deadlift actual (p = 0.061). Results suggest that conventional and eccentrically loaded deadlifts may be interchangeable within a training program; this may elicit the benefits of using a broader variety of ground-based multijoint compound movements in an athlete's strength and power training. Additionally, because of differences between predicted and actual 1RM scores in the deadlift, strength coaches should prioritize actual 1RM testing of their athletes to optimize deadlift training loads across the RM continuum. PMID:24276311

  2. Do Stimulus-Action Associations Contribute to Repetition Priming?

    ERIC Educational Resources Information Center

    Dennis, Ian; Perfect, Timothy J.

    2013-01-01

    Despite evidence that response learning makes a major contribution to repetition priming, the involvement of response representations at the level of motor actions remains uncertain. Levels of response representation were investigated in 4 experiments that used different tasks at priming and test. Priming for stimuli that required congruent…

  3. Repetitive Behaviors in Autism: Relationships with Associated Clinical Features

    ERIC Educational Resources Information Center

    Gabriels, Robin L.; Cuccaro, Michael L.; Hill, Dina E.; Ivers, Bonnie J.; Goldson, Edward

    2005-01-01

    Relationships between repetitive behaviors (RBs) and associated clinical features (i.e., cognitive and adaptive functioning levels, sleep problems, medication use, and other behavioral problems) were examined in two groups (High nonverbal IQ greater than or equal to 97 versus Low nonverbal IQ less than or equal to 56) of children with autism…

  4. Context-Dependent Repetition Effects on Recognition Memory

    ERIC Educational Resources Information Center

    Opitz, Bertram

    2010-01-01

    One widely acknowledged way to improve our memory performance is to repeatedly study the to be learned material. One aspect that has received little attention in past research regards the context sensitivity of this repetition effect, that is whether the item is repeated within the same or within different contexts. The predictions of a…

  5. Modifying Repetitive Verbalizations of Community-Dwelling Patients with AD.

    ERIC Educational Resources Information Center

    Bourgeois, Michelle S.; And Others

    1997-01-01

    Reports on behavior management training given to seven caregivers of a home-dwelling spouse with Alzheimer's disease. Results reveal that trained caregivers were successful at decreasing patient repetitions using written cues. Patients of control subjects showed no systematic changes in behavioral disturbances. Intervention effects lasted for 16…

  6. Memory, emotion, and pupil diameter: Repetition of natural scenes.

    PubMed

    Bradley, Margaret M; Lang, Peter J

    2015-09-01

    Recent studies have suggested that pupil diameter, like the "old-new" ERP, may be a measure of memory. Because the amplitude of the old-new ERP is enhanced for items encoded in the context of repetitions that are distributed (spaced), compared to massed (contiguous), we investigated whether pupil diameter is similarly sensitive to repetition. Emotional and neutral pictures of natural scenes were viewed once or repeated with massed (contiguous) or distributed (spaced) repetition during incidental free viewing and then tested on an explicit recognition test. Although an old-new difference in pupil diameter was found during successful recognition, pupil diameter was not enhanced for distributed, compared to massed, repetitions during either recognition or initial free viewing. Moreover, whereas a significant old-new difference was found for erotic scenes that had been seen only once during encoding, this difference was absent when erotic scenes were repeated. Taken together, the data suggest that pupil diameter is not a straightforward index of prior occurrence for natural scenes. PMID:25943211

  7. Processing Speaker Variability in Repetition and Semantic/Associative Priming

    ERIC Educational Resources Information Center

    Lee, Chao-Yang; Zhang, Yu

    2015-01-01

    The effect of speaker variability on accessing the form and meaning of spoken words was evaluated in two short-term priming experiments. In the repetition priming experiment, participants listened to repeated or unrelated prime-target pairs, in which the prime and target were produced by the same speaker or different speakers. The results showed…

  8. Piriform Spider Silk Sequences Reveal Unique Repetitive Elements

    PubMed Central

    Perry, David J.; Bittencourt, Daniela; Siltberg-Liberles, Jessica; Rech, Elibio L.; Lewis, Randolph V.

    2010-01-01

    Orb-weaving spider silk fibers are assembled from very large, highly repetitive proteins. The repeated segments contain, in turn, short, simple repetitive amino acid motifs that account for the physical and mechanical properties of the assembled fiber. Of the six orb-weaver silk fibroins, the piriform silk that makes the attachment discs, which lashes the joints of the web and attaches dragline silk to surfaces has not been previously characterized. Piriform silk protein cDNAs were isolated from phage libraries of three species, A. trifasciata, N. clavipes, and N. cruentata. The deduced amino acid sequences from these genes revealed two new repetitive motifs: an alternating proline motif where every other amino acid is proline, and a glutamine-rich motif of 6 to 8 amino acids. Similar to other spider silk proteins, the repeated segments are large (>200 amino acids) and highly homogenized within a species. There is also substantial sequence similarity across the genes from the three species with particular conservation of the repetitive motifs. Northern blot analysis revealed that the messenger RNA is larger than 11kb and is expressed exclusively in the piriform glands of the spider. Phylogenetic analysis of the C-terminal regions of the new proteins with published spidroins robustly shows that the pirifom sequences form an ortholog group. PMID:20954740

  9. 10 CFR 72.18 - Elimination of repetition.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 10 Energy 2 2011-01-01 2011-01-01 false Elimination of repetition. 72.18 Section 72.18 Energy NUCLEAR REGULATORY COMMISSION (CONTINUED) LICENSING REQUIREMENTS FOR THE INDEPENDENT STORAGE OF SPENT NUCLEAR FUEL, HIGH-LEVEL RADIOACTIVE WASTE, AND REACTOR-RELATED GREATER THAN CLASS C WASTE...

  10. 10 CFR 72.18 - Elimination of repetition.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 10 Energy 2 2014-01-01 2014-01-01 false Elimination of repetition. 72.18 Section 72.18 Energy NUCLEAR REGULATORY COMMISSION (CONTINUED) LICENSING REQUIREMENTS FOR THE INDEPENDENT STORAGE OF SPENT NUCLEAR FUEL, HIGH-LEVEL RADIOACTIVE WASTE, AND REACTOR-RELATED GREATER THAN CLASS C WASTE...

  11. 10 CFR 72.18 - Elimination of repetition.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 10 Energy 2 2013-01-01 2013-01-01 false Elimination of repetition. 72.18 Section 72.18 Energy NUCLEAR REGULATORY COMMISSION (CONTINUED) LICENSING REQUIREMENTS FOR THE INDEPENDENT STORAGE OF SPENT NUCLEAR FUEL, HIGH-LEVEL RADIOACTIVE WASTE, AND REACTOR-RELATED GREATER THAN CLASS C WASTE...

  12. 10 CFR 72.18 - Elimination of repetition.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 10 Energy 2 2012-01-01 2012-01-01 false Elimination of repetition. 72.18 Section 72.18 Energy NUCLEAR REGULATORY COMMISSION (CONTINUED) LICENSING REQUIREMENTS FOR THE INDEPENDENT STORAGE OF SPENT NUCLEAR FUEL, HIGH-LEVEL RADIOACTIVE WASTE, AND REACTOR-RELATED GREATER THAN CLASS C WASTE...

  13. Repetition across Successive Sentences Facilitates Young Children's Word Learning

    ERIC Educational Resources Information Center

    Schwab, Jessica F.; Lew-Williams, Casey

    2016-01-01

    Young children who hear more child-directed speech (CDS) tend to have larger vocabularies later in childhood, but the specific characteristics of CDS underlying this link are currently underspecified. The present study sought to elucidate how the structure of language input boosts learning by investigating whether repetition of object labels in…

  14. Decomposition of Repetition Priming Components in Picture Naming

    ERIC Educational Resources Information Center

    Francis, Wendy S.; Corral, Nuvia I.; Jones, Mary L.; Saenz, Silvia P.

    2008-01-01

    Cognitive mechanisms underlying repetition priming in picture naming were decomposed in several experiments. Sets of encoding manipulations meant to selectively prime or reduce priming in object identification or word production components of picture naming were combined factorially to dissociate processes underlying priming in picture naming.…

  15. Dissociable forms of repetition priming: a computational model.

    PubMed

    Makukhin, Kirill; Bolland, Scott

    2014-04-01

    Nondeclarative memory and novelty processing in the brain is an actively studied field of neuroscience, and reducing neural activity with repetition of a stimulus (repetition suppression) is a commonly observed phenomenon. Recent findings of an opposite trend-specifically, rising activity for unfamiliar stimuli-question the generality of repetition suppression and stir debate over the underlying neural mechanisms. This letter introduces a theory and computational model that extend existing theories and suggests that both trends are, in principle, the rising and falling parts of an inverted U-shaped dependence of activity with respect to stimulus novelty that may naturally emerge in a neural network with Hebbian learning and lateral inhibition. We further demonstrate that the proposed model is sufficient for the simulation of dissociable forms of repetition priming using real-world stimuli. The results of our simulation also suggest that the novelty of stimuli used in neuroscientific research must be assessed in a particularly cautious way. The potential importance of the inverted-U in stimulus processing and its relationship to the acquisition of knowledge and competencies in humans is also discussed.

  16. The Repetition of Chunks in Korean Middle School English Textbooks

    ERIC Educational Resources Information Center

    Lee, Jinkyong

    2015-01-01

    The current study aims to examine the use of chunks and the extent of repetition in Korean middle school English textbooks. Also, the number of chunks shared by three publishers is examined. To create the corpora, 9 textbooks from three publishers were filed and processed by Simple Concordance Program. The results showed that chunk expressions…

  17. Process of labeling specific chromosomes using recombinant repetitive DNA

    DOEpatents

    Moyzis, R.K.; Meyne, J.

    1988-02-12

    Chromosome preferential nucleotide sequences are first determined from a library of recombinant DNA clones having families of repetitive sequences. Library clones are identified with a low homology with a sequence of repetitive DNA families to which the first clones respectively belong and variant sequences are then identified by selecting clones having a pattern of hybridization with genomic DNA dissimilar to the hybridization pattern shown by the respective families. In another embodiment, variant sequences are selected from a sequence of a known repetitive DNA family. The selected variant sequence is classified as chromosome specific, chromosome preferential, or chromosome nonspecific. Sequences which are classified as chromosome preferential are further sequenced and regions are identified having a low homology with other regions of the chromosome preferential sequence or with known sequences of other family members and consensus sequences of the repetitive DNA families for the chromosome preferential sequences. The selected low homology regions are then hybridized with chromosomes to determine those low homology regions hybridized with a specific chromosome under normal stringency conditions.

  18. Cross-Language Nonword Repetition by Bilingual and Monolingual Children

    ERIC Educational Resources Information Center

    Windsor, Jennifer; Kohnert, Kathryn; Lobitz, Kelann F.; Pham, Giang T.

    2010-01-01

    Purpose: Identifying children with primary or specific language impairment (LI) in languages other than English continues to present a diagnostic challenge. This study examined the utility of English and Spanish nonword repetition (NWR) to identify children known to have LI. Method: Participants were 4 groups of school-age children (N = 187).…

  19. Avoiding Repetitions Reduces ADHD Children's Management Problems in the Classroom

    ERIC Educational Resources Information Center

    Kapalka, George M.

    2005-01-01

    Students with attention-deficit hyperactivity disorder (ADHD) often exhibit non-compliance that presents a significant management problem for classroom teachers. Student behavior management training programs suggest that reducing repetitions of commands improves student compliance. To examine this claim, 86 teachers of ADHD students between the…

  20. Repetitive Domain-Referenced Testing Using Computers: the TITA System.

    ERIC Educational Resources Information Center

    Olympia, P. L., Jr.

    The TITA (Totally Interactive Testing and Analysis) System algorithm for the repetitive construction of domain-referenced tests utilizes a compact data bank, is highly portable, is useful in any discipline, requires modest computer hardware, and does not present a security problem. Clusters of related keyphrases, statement phrases, and distractors…

  1. Nonword Repetition in Children and Adults: Effects on Movement Coordination

    ERIC Educational Resources Information Center

    Sasisekaran, Jayanthi; Smith, Anne; Sadagopan, Neeraja; Weber-Fox, Christine

    2010-01-01

    Hearing and repeating novel phonetic sequences, or novel nonwords, is a task that taps many levels of processing, including auditory decoding, phonological processing, working memory, speech motor planning and execution. Investigations of nonword repetition abilities have been framed within models of psycholinguistic processing, while the motor…

  2. A repetitive 0.14 THz relativistic surface wave oscillator

    SciTech Connect

    Wang Guangqiang; Tong Changjiang; Li Xiaoze; Wang Xuefeng; Li Shuang; Lu Xicheng; Wang Jianguo

    2013-04-15

    Preliminary experimental results of a repetitive 0.14 THz overmoded relativistic surface wave oscillator (RSWO) are presented in this paper. The repetitive RSWO is developed by using a rectangularly corrugated slow-wave structure with overmoded ratio of 3 and a foilless diode emitting annular electron beam with thickness of 0.5 mm. The high quality electron beams at the repetition rate of 10 are obtained over a wide range of diode voltage (180 kV < U < 240 kV) and current (700 A < I < 1.2 kA). The generation experiments of RSWO are conducted at an axial pulsed magnetic field whose maximum strength and duration can reach about 2.7 T and 1 s, respectively. The experimental results show that the RSWO successfully produces reasonable uniform terahertz pulses at repetition rate of 10, and the pulse duration, frequency, and power of a single pulse are about 1.5 ns, 0.154 THz, and 2.6 MW, respectively, whereas the dominated radiation mode of the RSWO is TM{sub 02}.

  3. Effects of repetition on memory for pragmatic inferences.

    PubMed

    McDermott, Kathleen B; Chan, Jason C K

    2006-09-01

    Social interaction requires active inferential processing on the part of the listener. Such inferences can affect memory. For example, after hearing the karate champion hit the cinder block, one might erroneously recollect having heard the verb broke (Brewer, 1977)--a reasonable inference, but one not logically necessitated. The mechanisms behind this type of erroneous recollection have not been much explored. Experiments in the present article assessed the influence of repetition, response deadline, and age (cf. Jacoby, 1999), in an effort to demonstrate the dual contributions of familiarity and recollection underlying this phenomenon. For older adults, repetition at encoding increased the later likelihood of erroneously recognizing pragmatic inferences. For younger adults, repetition exerted the opposite effect. Both age groups, however, benefited from a second study-test trial. Experiment 2 demonstrated a similar interaction on a cued recall test for younger adults, whereby repetition exerted different influences as a function of time permitted during retrieval. Implications for theories of memory and discourse processing are considered.

  4. 10 CFR 72.18 - Elimination of repetition.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 10 Energy 2 2010-01-01 2010-01-01 false Elimination of repetition. 72.18 Section 72.18 Energy NUCLEAR REGULATORY COMMISSION (CONTINUED) LICENSING REQUIREMENTS FOR THE INDEPENDENT STORAGE OF SPENT NUCLEAR FUEL, HIGH-LEVEL RADIOACTIVE WASTE, AND REACTOR-RELATED GREATER THAN CLASS C WASTE...

  5. 10 CFR 50.32 - Elimination of repetition.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 10 Energy 1 2010-01-01 2010-01-01 false Elimination of repetition. 50.32 Section 50.32 Energy NUCLEAR REGULATORY COMMISSION DOMESTIC LICENSING OF PRODUCTION AND UTILIZATION FACILITIES Applications for..., That such references are clear and specific....

  6. 10 CFR 62.17 - Elimination of repetition.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 10 Energy 2 2011-01-01 2011-01-01 false Elimination of repetition. 62.17 Section 62.17 Energy NUCLEAR REGULATORY COMMISSION (CONTINUED) CRITERIA AND PROCEDURES FOR EMERGENCY ACCESS TO NON-FEDERAL AND... these references are updated, clear, and specific....

  7. 10 CFR 62.17 - Elimination of repetition.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 10 Energy 2 2010-01-01 2010-01-01 false Elimination of repetition. 62.17 Section 62.17 Energy NUCLEAR REGULATORY COMMISSION (CONTINUED) CRITERIA AND PROCEDURES FOR EMERGENCY ACCESS TO NON-FEDERAL AND... these references are updated, clear, and specific....

  8. Nonword Repetition and Levels of Abstraction in Phonological Knowledge

    ERIC Educational Resources Information Center

    Munson, Benjamin

    2006-01-01

    Susan Gathercole's Keynote Article (2006) is an impressive summary of the literature on nonword repetition and its relationship to word learning and vocabulary size. When considering research by Mary Beckman, Jan Edwards, and myself, Gathercole speculates that our finding of a stronger relationship between vocabulary measures and repetition…

  9. Piriform spider silk sequences reveal unique repetitive elements.

    PubMed

    Perry, David J; Bittencourt, Daniela; Siltberg-Liberles, Jessica; Rech, Elibio L; Lewis, Randolph V

    2010-11-01

    Orb-weaving spider silk fibers are assembled from very large, highly repetitive proteins. The repeated segments contain, in turn, short, simple, and repetitive amino acid motifs that account for the physical and mechanical properties of the assembled fiber. Of the six orb-weaver silk fibroins, the piriform silk that makes the attachment discs, which lashes the joints of the web and attaches dragline silk to surfaces, has not been previously characterized. Piriform silk protein cDNAs were isolated from phage libraries of three species: A. trifasciata , N. clavipes , and N. cruentata . The deduced amino acid sequences from these genes revealed two new repetitive motifs: an alternating proline motif, where every other amino acid is proline, and a glutamine-rich motif of 6-8 amino acids. Similar to other spider silk proteins, the repeated segments are large (>200 amino acids) and highly homogenized within a species. There is also substantial sequence similarity across the genes from the three species, with particular conservation of the repetitive motifs. Northern blot analysis revealed that the mRNA is larger than 11 kb and is expressed exclusively in the piriform glands of the spider. Phylogenetic analysis of the C-terminal regions of the new proteins with published spidroins robustly shows that the piriform sequences form an ortholog group.

  10. Practicing Novel, Praxis-Like Movements: Physiological Effects of Repetition

    PubMed Central

    Ewen, Joshua B.; Pillai, Ajay S.; McAuliffe, Danielle; Lakshmanan, Balaji M.; Ament, Katarina; Hallett, Mark; Crone, Nathan E.; Mostofsky, Stewart H.

    2016-01-01

    Our primary goal was to develop and validate a task that could provide evidence about how humans learn praxis gestures, such as those involving the use of tools. To that end, we created a video-based task in which subjects view a model performing novel, meaningless one-handed actions with kinematics similar to praxis gestures. Subjects then imitated the movements with their right hand. Trials were repeated six times to examine practice effects. EEG was recorded during the task. As a control, subjects watched videos of a model performing a well-established (over learned) tool-use gesture. These gestures were also imitated six times. Demonstrating convergent validity, EEG measures of task-related cortical activation were similar in topography and frequency between the novel gesture task and the overlearned, praxis gesture task. As in studies assessing motor skill learning with simpler tasks, cortical activation during novel gesture learning decreased as the same gestures were repeated. In the control condition, repetition of overlearned tool-use gestures were also associated with reductions in activation, though to a lesser degree. Given that even overlearned, praxis gestures show constriction of EEG activity with repetition, it is possible that that attentional effects drive some of the repetition effects seen in EEG measures of activation during novel gesture repetition. PMID:26903835

  11. Synesthesia in twins: incomplete concordance in monozygotes suggests extragenic factors.

    PubMed

    Bosley, Hannah G; Eagleman, David M

    2015-06-01

    Colored-sequence synesthesia (CSS) is a neurological condition in which sequential stimuli such as letters, numbers, or days of the week trigger simultaneous, involuntary color perception. Although the condition appears to run in families and several studies have sought a genetic link, the genetic contribution to synesthesia remains unclear. We conducted the first comparative twin study of CSS and found that CSS has a pairwise concordance of 73.9% in monozygotic twins, and a pairwise concordance of 36.4% in dizygotic twins. In line with previous studies, our results suggest a heritable element of synesthesia. However, consonant with the findings of previous single-pair case studies, our large sample size verifies that synesthesia is not completely conferred by genetics; if it were, monozygotic twins should have 100% concordance. These findings implicate a genetic mechanism of CSS that may work differently than previously thought: collectively, our data suggest that synesthesia is a heritable condition with incomplete penetrance that is substantially influenced by epigenetic and environmental factors.

  12. Synesthesia in twins: incomplete concordance in monozygotes suggests extragenic factors.

    PubMed

    Bosley, Hannah G; Eagleman, David M

    2015-06-01

    Colored-sequence synesthesia (CSS) is a neurological condition in which sequential stimuli such as letters, numbers, or days of the week trigger simultaneous, involuntary color perception. Although the condition appears to run in families and several studies have sought a genetic link, the genetic contribution to synesthesia remains unclear. We conducted the first comparative twin study of CSS and found that CSS has a pairwise concordance of 73.9% in monozygotic twins, and a pairwise concordance of 36.4% in dizygotic twins. In line with previous studies, our results suggest a heritable element of synesthesia. However, consonant with the findings of previous single-pair case studies, our large sample size verifies that synesthesia is not completely conferred by genetics; if it were, monozygotic twins should have 100% concordance. These findings implicate a genetic mechanism of CSS that may work differently than previously thought: collectively, our data suggest that synesthesia is a heritable condition with incomplete penetrance that is substantially influenced by epigenetic and environmental factors. PMID:25704836

  13. Amplification of moderately repetitive DNA sequences during chick cartilage differentiation.

    PubMed Central

    Strom, C M; Dorfman, A

    1976-01-01

    A 5-bromo-2'-[3H]deoxyuridine (BrdUrd) probe was isolated to analyze DNAs obtained from various chick tissues and cell types. [3H]BrdUrd-substituted DNA, prepared from limb bud cultures, was sheared and freed from palindromic DNA. Nonradioactive DNA was prepared from embryonic liver, undifferentiated limb bud mesenchyme, sternal cartilage, differentiated limb bud cultures, and BrdUrd-blocked cultures, and was sheared. These DNAs were used in 100-fold excess to drive the reassociation of the [3H]-BrdUrd-DNA probe. Purified mature cartilage DNAs of embryonic sternae or differentiated limb bud cultures drove the reassociation of the probe approximately two times faster than did DNA from liver, undifferentiated limb bud, or BrdUrd-blocked cells. These data indicate that cartilage DNA contains a greater number of sequences complementary to the BrdUrd probe than do DNAs of noncartilage or undifferentiated precartilage cells. Calculations determined an average substitution of 10% of thymidine residues by BrdUrd in purified probe, whereas CsCl density gradients of unsheared probe revealed radioactive peaks of greater than 20% substitution. The BrdUrd appears to be clustered in the genome. PMID:1068455

  14. Investigating repetition and change in musical rhythm by functional MRI.

    PubMed

    Danielsen, A; Otnæss, M K; Jensen, J; Williams, S C R; Ostberg, B C

    2014-09-01

    Groove-based rhythm is a basic and much appreciated feature of Western popular music. It is commonly associated with dance, movement and pleasure and is characterized by the repetition of a basic rhythmic pattern. At various points in the musical course, drum breaks occur, representing a change compared to the repeated pattern of the groove. In the present experiment, we investigated the brain response to such drum breaks in a repetitive groove. Participants were scanned with functional magnetic resonance imaging (fMRI) while listening to a previously unheard naturalistic groove with drum breaks at uneven intervals. The rhythmic pattern and the timing of its different parts as performed were the only aspects that changed from the repetitive sections to the breaks. Differences in blood oxygen level-dependent activation were analyzed. In contrast to the repetitive parts, the drum breaks activated the left cerebellum, the right inferior frontal gyrus (RIFG), and the superior temporal gyri (STG) bilaterally. A tapping test using the same stimulus showed an increase in the standard deviation of inter-tap-intervals in the breaks versus the repetitive parts, indicating extra challenges for auditory-motor integration in the drum breaks. Both the RIFG and STG have been associated with structural irregularity and increase in musical-syntactical complexity in several earlier studies, whereas the left cerebellum is known to play a part in timing. Together these areas may be recruited in the breaks due to a prediction error process whereby the internal model is being updated. This concurs with previous research suggesting a network for predictive feed-forward control that comprises the cerebellum and the cortical areas that were activated in the breaks. PMID:24972303

  15. Dual Routes for Verbal Repetition: Articulation-Based and Acoustic-Phonetic Codes for Pseudoword and Word Repetition, Respectively

    ERIC Educational Resources Information Center

    Yoo, Sejin; Chung, Jun-Young; Jeon, Hyeon-Ae; Lee, Kyoung-Min; Kim, Young-Bo; Cho, Zang-Hee

    2012-01-01

    Speech production is inextricably linked to speech perception, yet they are usually investigated in isolation. In this study, we employed a verbal-repetition task to identify the neural substrates of speech processing with two ends active simultaneously using functional MRI. Subjects verbally repeated auditory stimuli containing an ambiguous vowel…

  16. The Effect of Repetitive Passive and Active Movements on Proprioception Ability in Forearm Supination

    PubMed Central

    Kwon, OhSung; Lee, SeungWon; Lee, YoungWoo; Seo, DongKwon; Jung, SangWoo; Choi, WonJae

    2013-01-01

    [Purpose] This study was conducted in order to investigate the effect of repetitive passive movement and repetitive active movement on proprioception in forearm supination. [Subjects] This study had a cross-sectional design. Twenty-three right-handed healthy subjects were recruited. All subjects randomly received both repetitive passive movement and repetitive active movement (repetitive passive/active movement at 120°/s with 60 repetitions over a 0–80° range). Active and passive joint repositioning of all subjects was measured using the error score for position sense, both before and after repositioning intervention. [Results] In the repetitive passive movement test, there was a statistically significant decrease in the pre- versus post-repositioning error scores in the active and passive angle examinations. In the repetitive active movement test, there was a statistically significant increase in pre- versus post-repositioning error scores in the active and passive angle examinations. In the comparison of position sense, there was a statistically significant decrease in both active and passive angle repositioning error scores in repetitive passive movement versus repetitive active movement. [Conclusion] Repetitive passive movement improved the proprioception results for forearm supination, compared to repetitive active movement. Results of this study indicate that repetitive passive movement can be recommended to clinicians for rehabilitation therapy as it provides greater proprioception benefits. PMID:24259808

  17. Effect of interrepetition rest intervals on weight training repetition power output.

    PubMed

    Lawton, Trent W; Cronin, John B; Lindsell, Rod P

    2006-02-01

    The purpose of this study was to determine the change in weight training repetition power output as a consequence of interrepetition rest intervals. Twenty-six elite junior male basketball and soccer players performed bench presses using a 6 repetition maximum (6RM) load. The power output for each repetition was recorded using a linear encoder sampling each 10 ms (100 Hz). Subjects were assigned to 1 of 3 intervention groups, differentiated by the arrangement of rest intervals within the 6 repetitions: 6 x 1 repetition with 20-second rest periods between each repetition (Singles); 3 x 2 repetitions with 50 seconds between each pair of repetitions (Doubles); or 2 x 3 repetitions with 100 seconds of rest between each 3 repetitions (Triples). A timer was used to ensure that the rest interval and duration to complete all interrepetition interventions was equated across groups (118 seconds). Significantly (p < 0.05) greater repetition power outputs (25-49%) were observed in the later repetitions (4-6) of the Singles, Doubles, and Triples loading schemes. Significantly greater total power output (21.6-25.1%) was observed for all interrepetition rest interventions when compared to traditional continuous 6RM total power output. No significant between-group differences were found (p = 0.96). We conclude that utilizing interrepetition rest intervals enables greater repetition and total power output in comparison to traditional loading parameters.

  18. High repetition rate plasma mirror device for attosecond science

    SciTech Connect

    Borot, A.; Douillet, D.; Iaquaniello, G.; Lefrou, T.; Lopez-Martens, R.; Audebert, P.; Geindre, J.-P.

    2014-01-15

    This report describes an active solid target positioning device for driving plasma mirrors with high repetition rate ultra-high intensity lasers. The position of the solid target surface with respect to the laser focus is optically monitored and mechanically controlled on the nm scale to ensure reproducible interaction conditions for each shot at arbitrary repetition rate. We demonstrate the target capabilities by driving high-order harmonic generation from plasma mirrors produced on glass targets with a near-relativistic intensity few-cycle pulse laser system operating at 1 kHz. During experiments, residual target surface motion can be actively stabilized down to 47 nm (root mean square), which ensures sub-300-as relative temporal stability of the plasma mirror as a secondary source of coherent attosecond extreme ultraviolet radiation in pump-probe experiments.

  19. Evolved gas composition monitoring by repetitive injection gas chromatography.

    PubMed

    White, Robert L

    2015-11-20

    Performance characteristics and applications of a small volume gas chromatograph oven are described. Heating and cooling properties of the apparatus are evaluated and examples are given illustrating the advantages of greatly reducing the air bath volume surrounding fused silica columns. Fast heating and cooling of the oven permit it to be employed for repetitive injection analyses. By using fast gas chromatography separations to achieve short assay cycle times, the apparatus can be employed for on-line species-specific gas stream composition monitoring when volatile species concentrations vary on time scales of a few minutes or longer. This capability facilitates repeated sampling and fast gas chromatographic separations of volatile product mixtures produced during thermal analyses. Applications of repetitive injection gas chromatography-mass spectrometry evolved gas analyses to monitoring purge gas effluent streams containing volatile acid catalyzed polymer cracking products are described. The influence of thermal analysis and chromatographic experimental parameters on effluent sampling frequency are delineated.

  20. Bubble Phenomena caused by High Repetitive Plasmas in Water

    NASA Astrophysics Data System (ADS)

    Akiyama, Masahiro; Oikawa, Takuma; Fue, Masatoshi; Ogata, Ryoma; Takaki, Koich; Akiyama, Hidenori; Iwate Univ Team; Kumamoto Univ Collaboration

    2015-09-01

    Streamer discharges in water were generated by a pulsed power generator. The streamer shape changed depending on pulse repetition rate. Streamer discharges at 500 pulses per second (pps) resulted in a ball shape. Under this formation, small bubbles gather near the electrode tip. Our aims are the analysis and discussion of the bubble phenomena caused by high repetitive plasmas produced in water. Pulsed power with a maximum output of 1 J/pulse was applied to an electrode of 0.8 mm in diameter covered by an insulator of 2 mm thickness. The electrode was inserted into tap water with conductivity of 170 uS/cm. The polarity was positive. Phenomena, in which the resulting gas bubbles oscillate and gather, were found to have an important role in producing ball shape streamer discharges.

  1. Evidence-Based Behavioral Interventions for Repetitive Behaviors in Autism

    PubMed Central

    McDonough, Stephen G.; Bodfish, James W.

    2013-01-01

    Restricted and repetitive behaviors (RRBs) are a core symptom of autism spectrum disorders (ASD). There has been an increased research emphasis on repetitive behaviors; however, this research primarily has focused on phenomenology and mechanisms. Thus, the knowledge base on interventions is lagging behind other areas of research. The literature suggests there are evidence-based practices to treat “lower order” RRBs in ASD (e.g., stereotypies); yet, there is a lack of a focused program of intervention research for “higher order” behaviors (e.g., insistence on sameness). This paper will (a) discuss barriers to intervention development for RRBs; (b) review evidence-based interventions to treat RRBs in ASD, with a focus on higher order behaviors; and (c) conclude with recommendations for practice and research. PMID:21584849

  2. How familiarization and repetition modulate the picture naming network

    PubMed Central

    Llorens, Anaïs; Trébuchon, Agnès; Riès, Stéphanie; Liégeois-Chauvel, Catherine; Alario, F.-Xavier

    2014-01-01

    A common strategy to reveal the components of the speech production network is to use psycholinguistic manipulations previously tested in behavioral protocols. This often disregards how implementation aspects that are nonessential for interpreting behavior may affect the neural response. We compared the electrophysiological (EEG) signature of two popular picture naming protocols involving either unfamiliar pictures without repetitions or repeated familiar pictures. We observed significant semantic interference effects in behavior but not in the EEG, contrary to some previous findings. Remarkably, the two protocols elicited clearly distinct EEG responses. These were not due to naming latency differences nor did they reflect a homogeneous modulation of amplitude over the trial time-window. The effect of protocol is attributed to the familiarization induced by the first encounter with the materials. Picture naming processes can be substantially modulated by specific protocol requirements controlled by familiarity and, to a much lesser degree, the repetition of materials. PMID:24785306

  3. Coreference and Lexical Repetition: Mechanisms of Discourse Integration

    PubMed Central

    Ledoux, Kerry; Gordon, Peter C.; Camblin, C. Christine; Swaab, Tamara Y.

    2006-01-01

    The use of repeated expressions to establish coreference allows an investigation of the relationship between basic processes of word recognition and higher-level language processes that involve the integration of information into a discourse model. In two experiments on reading, we used eye tracking and event-related potentials (ERPs) to examine whether repeated expressions that are coreferential within a local discourse context show the kind of repetition priming that is shown in lists of words. In both experiments, effects of lexical repetition were modulated by effects of local discourse context that arose from manipulations of the linguistic prominence of the antecedent of a coreferentially repeated name. These results are interpreted within the context of discourse prominence theory, which suggests that processes of coreferential interpretation interact with basic mechanisms of memory integration during the construction of a model of discourse. PMID:17848036

  4. Repbase Update, a database of eukaryotic repetitive elements.

    PubMed

    Jurka, J; Kapitonov, V V; Pavlicek, A; Klonowski, P; Kohany, O; Walichiewicz, J

    2005-01-01

    Repbase Update is a comprehensive database of repetitive elements from diverse eukaryotic organisms. Currently, it contains over 3600 annotated sequences representing different families and subfamilies of repeats, many of which are unreported anywhere else. Each sequence is accompanied by a short description and references to the original contributors. Repbase Update includes Repbase Reports, an electronic journal publishing newly discovered transposable elements, and the Transposon Pub, a web-based browser of selected chromosomal maps of transposable elements. Sequences from Repbase Update are used to screen and annotate repetitive elements using programs such as Censor and RepeatMasker. Repbase Update is available on the worldwide web at http://www.girinst.org/Repbase_Update.html.

  5. Repetitively pulsed Cr:LiSAF laser for lidar applications

    SciTech Connect

    Shimada, Tsutomu; Early, J.W.; Lester, C.S.; Cockroft, N.J.

    1994-03-01

    A Cr:LiSAF laser has been successfully operated at time averaged powers up to 11 W and at pulse repetition rates to 12 Hz. During Q-switch operation, output energy as high as 450 mJ (32 ns FWHM) was obtained. Finally, line narrowed Q-switched pulses (< 0.1 nm) from the Cr:LiSAF laser were successfully used as a tunable light source for lidar to measure atmospheric water content.

  6. The Effect of Syllable Repetition Rate on Vocal Characteristics

    ERIC Educational Resources Information Center

    Topbas, Oya; Orlikoff, Robert F.; St. Louis, Kenneth O.

    2012-01-01

    This study examined whether mean vocal fundamental frequency ("F"[subscript 0]) or speech sound pressure level (SPL) varies with changes in syllable repetition rate. Twenty-four young adults (12 M and 12 F) repeated the syllables/p[inverted v]/,/p[inverted v]t[schwa]/, and/p[inverted v]t[schwa]k[schwa]/at a modeled "slow" rate of approximately one…

  7. The Role of Memory Processes in Repetition Blindness

    NASA Technical Reports Server (NTRS)

    Johnston, James C.; Hochhaus, Larry; Null, Cynthia H. (Technical Monitor)

    1995-01-01

    We investigated whether Repetition Blindness (RB) in processing RSVP strings depends critically on memory demands. When all items in the sequence had to be reported, strong RB was found. When only the 2 critical items (cued by color) had to be reported, no RB was found. Preliminary results show that imposing a separate memory load, while reporting only the critical items, also produces little RB. Implications for the processing locus of RB will be discussed.

  8. Paleoclimate controls on stratigraphic repetition of chemical and siliciclastic rocks

    SciTech Connect

    Cecil, C.B. )

    1990-06-01

    Climate is a primary control on sediment flux from continental sources into sedimentary systems. In warm climates, siliciclastic input is greatest under highly seasonal rainfall. Nonseasonal conditions favor formation of end member chemical rocks; perennially wet climates are conductive to coal formation, whereas dry climates produce carbonates and/or evaporites. Stratigraphic repetition of siliciclastic and chemical rocks therefore appears to be related to paleoclimate cycles as well as to transgressive-regressive events and tectonics.

  9. Magnetic and photoconductive repetitive rail-gun opening switches

    SciTech Connect

    Nunnally, W.C.

    1984-07-01

    This report investigates the use of a transformer with a saturable ferromagnetic core and a photoconductive element as a possible opening switch for a repetitive rail gun. A basic rail gun is first analyzed to determine the voltage, current, and power requirements for the switch. Then, each switch concept is analyzed to determine the characteristic size and operating parameters necessary to operate in the rail-gun system. The analysis is used to determine concept feasibility.

  10. Repetitive motor behavior: further characterization of development and temporal dynamics.

    PubMed

    Muehlmann, Amber M; Bliznyuk, Nikolay; Duerr, Isaac; Lewis, Mark H

    2015-03-01

    Repetitive behaviors are diagnostic for autism spectrum disorders, common in related neurodevelopmental disorders, and normative in typical development. In order to identify factors that mediate repetitive behavior development, it is necessary to characterize the expression of these behaviors from an early age. Extending previous findings, we characterized further the ontogeny of stereotyped motor behavior both in terms of frequency and temporal organization in deer mice. A three group trajectory model provided a good fit to the frequencies of stereotyped behavior across eight developmental time points. Group based trajectory analysis using a measure of temporal organization of stereotyped behavior also resulted in a three group solution. Additionally, as the frequency of stereotyped behavior increased with age, the temporal distribution of stereotyped responses became increasingly regular or organized indicating a strong association between these measures. Classification tree and principal components analysis showed that accurate classification of trajectory group could be done with fewer observations. This ability to identify trajectory group membership earlier in development allows for examination of a wide range of variables, both experiential and biological, to determine their impact on altering the expected trajectory of repetitive behavior across development. Such studies would have important implications for treatment efforts in neurodevelopmental disorders such as autism. PMID:25631623

  11. Reversing-counterpulse repetitive-pulse inductive storage circuit

    DOEpatents

    Honig, E.M.

    1987-02-10

    A high-power reversing-counterpulse repetitive-pulse inductive storage and transfer circuit includes an opening switch, a main energy storage coil, a counterpulse capacitor and a small inductor. After counterpulsing the opening switch off, the counterpulse capacitor is recharged by the main energy storage coil before the load pulse is initiated. This gives the counterpulse capacitor sufficient energy for the next counterpulse operation, although the polarity of the capacitor's voltage must be reversed before that can occur. By using a current-zero switch as the counterpulse start switch, the capacitor is disconnected from the circuit (with a full charge) when the load pulse is initiated, preventing the capacitor from depleting its energy store by discharging through the load. After the load pulse is terminated by reclosing the main opening switch, the polarity of the counterpulse capacitor voltage is reversed by discharging the capacitor through a small inductor and interrupting the discharge current oscillation at zero current and peak reversed voltage. The circuit enables high-power, high-repetition-rate operation with reusable switches and features total control (pulse-to-pulse) over output pulse initiation, duration, repetition rate, and, to some extent, risetime. 10 figs.

  12. A compact, repetitive accelerator for military and industrial applications

    SciTech Connect

    Zutavern, F.J.; O`Malley, M.W.; Ruebush, M.H.; Rinehart, L.F.; Loubriel, G.M.; Babcock, S.R.; Denison, G.J.

    1998-04-01

    A compact, short pulse, repetitive accelerator has many useful military and commercial applications in biological counter proliferation, materials processing, radiography, and sterilization (medical instruments, waste, and food). The goal of this project was to develop and demonstrate a small, 700 kV accelerator, which can produce 7 kA particle beams with pulse lengths of 10--30 ns at rates up to 50 Hz. At reduced power levels, longer pulses or higher repetition rates (up to 10 kHz) could be achieved. Two switching technologies were tested: (1) spark gaps, which have been used to build low repetition rate accelerators for many years; and (2) high gain photoconductive semiconductor switches (PCSS), a new solid state switching technology. This plan was economical, because it used existing hardware for the accelerator, and the PCSS material and fabrication for one module was relatively inexpensive. It was research oriented, because it provided a test bed to examine the utility of other emerging switching technologies, such as magnetic switches. At full power, the accelerator will produce 700 kV and 7 kA with either the spark gap or PCSS pulser.

  13. Repetitive motor behavior: further characterization of development and temporal dynamics.

    PubMed

    Muehlmann, Amber M; Bliznyuk, Nikolay; Duerr, Isaac; Lewis, Mark H

    2015-03-01

    Repetitive behaviors are diagnostic for autism spectrum disorders, common in related neurodevelopmental disorders, and normative in typical development. In order to identify factors that mediate repetitive behavior development, it is necessary to characterize the expression of these behaviors from an early age. Extending previous findings, we characterized further the ontogeny of stereotyped motor behavior both in terms of frequency and temporal organization in deer mice. A three group trajectory model provided a good fit to the frequencies of stereotyped behavior across eight developmental time points. Group based trajectory analysis using a measure of temporal organization of stereotyped behavior also resulted in a three group solution. Additionally, as the frequency of stereotyped behavior increased with age, the temporal distribution of stereotyped responses became increasingly regular or organized indicating a strong association between these measures. Classification tree and principal components analysis showed that accurate classification of trajectory group could be done with fewer observations. This ability to identify trajectory group membership earlier in development allows for examination of a wide range of variables, both experiential and biological, to determine their impact on altering the expected trajectory of repetitive behavior across development. Such studies would have important implications for treatment efforts in neurodevelopmental disorders such as autism.

  14. Distinct pharmacologic substrate in lidocaine-sensitive, repetitive atrial tachycardia.

    PubMed

    Chiale, Pablo A; Faivelis, Luciano; Garro, Hugo A; Fernández, Pablo A; Herrera Paz, Juan J; Elizari, Marcelo V

    2012-06-01

    Lidocaine-sensitive, repetitive atrial tachycardia is an uncommon arrhythmia. The electrophysiologic substrate is still unknown, and the pharmacologic responses have not been fully explored. The aim of this study was to investigate the effects of intravenous adenosine and verapamil in patients with lidocaine-sensitive atrial tachycardia. In 9 patients with repetitive uniform atrial tachycardia, the response to intravenous adenosine (12 mg), lidocaine (1 mg/kg body weight), and verapamil (10 mg) were sequentially investigated. Simultaneous 12-lead electrocardiogram (ECG) was recorded at baseline and continuously monitored thereafter. Tracings were obtained at regularly timed intervals right after the administration of each drug to evaluate changes in the arrhythmia characteristics. Repetitive atrial tachycardia was abolished by intravenous lidocaine in the 9 patients within the first 2 minutes after the end of injection. Adenosine suppressed the arrhythmia in 2 patients and shortened the runs of atrial ectopic activity in 1 patient, while verapamil was effective in 2 patients, 1 of them insensitive to adenosine and the other 1 sensitive to this agent. In 5 patients, the arrhythmia was abolished by radiofrequency ablation at different sites of the right atrium. Lidocaine-sensitive atrial tachycardia may eventually be also suppressed by adenosine and/or verapamil. This suggests that this enigmatic arrhythmia may be caused by different underlying electrophysiologic substrates and that at least in some cases, delayed afterdepolarizations seem to play a determining role.

  15. The infogram: Entropic evidence of the signature of repetitive transients

    NASA Astrophysics Data System (ADS)

    Antoni, Jerome

    2016-06-01

    A classical symptom of rotating machines faults in vibration signals is the presence of repetitive transients, whose distinctive signature is both impulsive and cyclostationary. Typical approaches for their detection proceed in the time or frequency domains, with tools such as the spectral kurtosis, the kurtogram, or the envelope spectrum. The object of this paper is to extend and somehow connect these concepts in order to capture the signature of repetitive transients in both domains. Motivated by ideas borrowed from the field of thermodynamics where transients are seen as departures from a state of equilibrium, it is proposed to measure the negentropy of the squared envelope (SE) and of the squared envelope spectrum (SES) of the signal. This defines the SE infogram, the SES infogram, and their average which is theoretically maximum for a Dirac comb according to Hirschman's uncertainty principle. It is demonstrated that the joint consideration of the infograms significantly extends the domain of applicability of the kurtogram, in particular to situations corrupted with impulsive noise or when the relaxation time of the transients is low as compared to their rate of repetition. This is illustrated on both synthetic and actual vibration signals. This paper is part of a special issue in honor of Professor Simon Braun and pays tribute to his early contribution to the field of mechanical signature analysis.

  16. Repetition suppression: a means to index neural representations using BOLD?

    PubMed Central

    Behrens, Timothy E. J.

    2016-01-01

    Understanding how the human brain gives rise to complex cognitive processes remains one of the biggest challenges of contemporary neuroscience. While invasive recording in animal models can provide insight into neural processes that are conserved across species, our understanding of cognition more broadly relies upon investigation of the human brain itself. There is therefore an imperative to establish non-invasive tools that allow human brain activity to be measured at high spatial and temporal resolution. In recent years, various attempts have been made to refine the coarse signal available in functional magnetic resonance imaging (fMRI), providing a means to investigate neural activity at the meso-scale, i.e. at the level of neural populations. The most widely used techniques include repetition suppression and multivariate pattern analysis. Human neuroscience can now use these techniques to investigate how representations are encoded across neural populations and transformed by relevant computations. Here, we review the physiological basis, applications and limitations of fMRI repetition suppression with a brief comparison to multivariate techniques. By doing so, we show how fMRI repetition suppression holds promise as a tool to reveal complex neural mechanisms that underlie human cognitive function. This article is part of the themed issue ‘Interpreting BOLD: a dialogue between cognitive and cellular neuroscience’. PMID:27574308

  17. Repetition suppression: a means to index neural representations using BOLD?

    PubMed

    Barron, Helen C; Garvert, Mona M; Behrens, Timothy E J

    2016-10-01

    Understanding how the human brain gives rise to complex cognitive processes remains one of the biggest challenges of contemporary neuroscience. While invasive recording in animal models can provide insight into neural processes that are conserved across species, our understanding of cognition more broadly relies upon investigation of the human brain itself. There is therefore an imperative to establish non-invasive tools that allow human brain activity to be measured at high spatial and temporal resolution. In recent years, various attempts have been made to refine the coarse signal available in functional magnetic resonance imaging (fMRI), providing a means to investigate neural activity at the meso-scale, i.e. at the level of neural populations. The most widely used techniques include repetition suppression and multivariate pattern analysis. Human neuroscience can now use these techniques to investigate how representations are encoded across neural populations and transformed by relevant computations. Here, we review the physiological basis, applications and limitations of fMRI repetition suppression with a brief comparison to multivariate techniques. By doing so, we show how fMRI repetition suppression holds promise as a tool to reveal complex neural mechanisms that underlie human cognitive function.This article is part of the themed issue 'Interpreting BOLD: a dialogue between cognitive and cellular neuroscience'. PMID:27574308

  18. Chromosomal organization of repetitive DNA in Sorubim lima (Teleostei; Pimelodidae).

    PubMed

    Sczepanski, T S; Vicari, M R; de Almeida, M C; Nogaroto, V; Artoni, R F

    2013-01-01

    Interspaced repetitive DNA elements and segmental duplications have been extensively analyzed in fishes through physical chromosome mapping methods, providing a better comprehension of the structure and organization of the genome of this group. In order to contribute to this scenario, a sequence integration study of different classes of repetitive DNA with high resolution physical chromosome mapping was performed in Sorubim lima. Fluorescence in situ hybridization (FISH) and fiber-FISH with probes for 18S and 5S rRNA genes, TTAGGGn sequence and non-LTR retrotransposon family members Rex1, Rex3 and Rex6 showed that non-LTR elements may be dispersed in the chromosome set with relative concentration in heterochromatic regions, as shown by Rex1, or may even intercalate in 45S rDNA and the telomeric sequence, as found for Rex3 and Rex6. These results reinforce the presence of preferential regions of retroelement accumulation and contribute to a better understanding of the genomic organization of some repetitive DNA classes in fishes. PMID:24060610

  19. Bipolar high-repetition-rate high-voltage nanosecond pulser

    SciTech Connect

    Tian Fuqiang; Wang Yi; Shi Hongsheng; Lei Qingquan

    2008-06-15

    The pulser designed is mainly used for producing corona plasma in waste water treatment system. Also its application in study of dielectric electrical properties will be discussed. The pulser consists of a variable dc power source for high-voltage supply, two graded capacitors for energy storage, and the rotating spark gap switch. The key part is the multielectrode rotating spark gap switch (MER-SGS), which can ensure wider range modulation of pulse repetition rate, longer pulse width, shorter pulse rise time, remarkable electrical field distortion, and greatly favors recovery of the gap insulation strength, insulation design, the life of the switch, etc. The voltage of the output pulses switched by the MER-SGS is in the order of 3-50 kV with pulse rise time of less than 10 ns and pulse repetition rate of 1-3 kHz. An energy of 1.25-125 J per pulse and an average power of up to 10-50 kW are attainable. The highest pulse repetition rate is determined by the driver motor revolution and the electrode number of MER-SGS. Even higher voltage and energy can be switched by adjusting the gas pressure or employing N{sub 2} as the insulation gas or enlarging the size of MER-SGS to guarantee enough insulation level.

  20. Reversing-counterpulse repetitive-pulse inductive storage circuit

    DOEpatents

    Honig, Emanuel M.

    1987-01-01

    A high-power reversing-counterpulse repetitive-pulse inductive storage and transfer circuit includes an opening switch, a main energy storage coil, a counterpulse capacitor and a small inductor. After counterpulsing the opening switch off, the counterpulse capacitor is recharged by the main energy storage coil before the load pulse is initiated. This gives the counterpulse capacitor sufficient energy for the next counterpulse operation, although the polarity of the capacitor's voltage must be reversed before that can occur. By using a current-zero switch as the counterpulse start switch, the capacitor is disconnected from the circuit (with a full charge) when the load pulse is initiated, preventing the capacitor from depleting its energy store by discharging through the load. After the load pulse is terminated by reclosing the main opening switch, the polarity of the counterpulse capacitor voltage is reversed by discharging the capacitor through a small inductor and interrupting the discharge current oscillation at zero current and peak reversed voltage. The circuit enables high-power, high-repetition-rate operation with reusable switches and features total control (pulse-to-pulse) over output pulse initiation, duration, repetition rate, and, to some extent, risetime.

  1. Reversing-counterpulse repetitive-pulse inductive storage circuit

    DOEpatents

    Honig, E.M.

    1984-06-05

    A high power reversing-counterpulse repetitive-pulse inductive storage and transfer circuit includes an opening switch, a main energy storage coil, a counterpulse capacitor and a small inductor. After counterpulsing the opening switch off, the counterpulse capacitor is recharged by the main energy storage coil before the load pulse is initiated. This gives the counterpulse capacitor sufficient energy for the next counterpulse operation, although the polarity of the capacitor's voltage must be reversed before that can occur. By using a current-zero switch as the counterpulse start switch, the capacitor is disconnected from the circuit (with a full charge) when the load pulse is initiated, preventing the capacitor from depleting its energy store by discharging through the load. After the load pulse is terminated by reclosing the main opening switch, the polarity of the counterpulse capacitor voltage is reversed by discharging the capacitor through a small inductor and interrupting the discharge current oscillation at zero current and peak reversed voltage. The circuit enables high-power, high-repetition-rate operation with reusable switches and features total control (pulse-to-pulse) over output pulse initiation, duration, repetition rate, and, to some extent, risetime.

  2. [Trauma repetition and revictimization following physical and sexual abuse].

    PubMed

    Wöller, W

    2005-02-01

    The tendency of victims of physical or sexual childhood abuse to become revictimized in later life has well been documented empirically. Moreover, there is a high stability of violent and abusive relationships. The aim of this paper was to summarize perspectives from psychodynamic theory, attachment theory, and posttraumatic stress research to explain revictimization phenomena. The term repetition compulsion has little explanatory value without additional theoretical assumptions. Within the psychodynamic framework, an ego-psychological view conceives trauma repetition as an attempt to master traumatic experience, while in the object relations perspective, revictimization is explained by the influence of traumatic introjects. Negative cognitions of being worthless, bad and guilty can endorse the conviction that abuse is justified and reduce the capacity of self-care. Negative learning experiences from traumatic helplessness and powerlessness account for low self-efficacy expectations and prevent the establishment of self-boundaries. Trauma repetition can also be understood as an enactment in the service of affect regulation. Research in the field of attachment theory identified attachment styles predisposing to revictimization. Research dealing with posttraumatic stress disorder emphasizes the importance of traumatic affects recurring in daily life and, consequently, the tendency of abuse victims to actively produce dangerous situations in order to cope with these affects, furthermore, the role of dissociation in missing warning signals of impending traumatization. For therapeutically addressing revictimization, a detailed analysis of underlying phenomena is required. PMID:15685492

  3. Serial Assessment of Physiological Evaluation Indices for Repetitive Mental Workload

    NASA Astrophysics Data System (ADS)

    Nozawa, Akio; Karita, Keita

    The objective of this study is to evaluate the effect of daily repetitive mental workload on physiological indices. Especially, the index derived from the nasal skin temperature(NST) measured by the infrared thermography was focused. The NST was the physiological index representing the sympathetic nervous system activity. The NST declines with the sympathetic nervous system's activation. The mental workload causes sympathetic nervous system's activation, so the mental workload can be measured by NST as a declining temperature. We have found that the relationship between the amount of mental workload and the NST declining under time pressure, even more complex stimuli. However, there's no study on evaluating the NST measured for the repetitive mental workload for certain period of time. In this paper, the NST and other physiological indices, which were Fmθ wave component of Electroencephalograms(EEG) and high frequency component(HF) of R-wave interval time series of Electrocardiograms(ECG) were serially measured and evaluated on repetitive mental workload. Significant difference was found between those NST indices in each experiment by paired t-test. A stability of NST as an evaluation index for MWL was proved.

  4. Repetitive, small-bore two-stage light gas gun

    SciTech Connect

    Combs, S.K.; Foust, C.R.; Fehling, D.T.; Gouge, M.J.; Milora, S.L.

    1991-01-01

    A repetitive two-stage light gas gun for high-speed pellet injection has been developed at Oak Ridge National Laboratory. In general, applications of the two-stage light gas gun have been limited to only single shots, with a finite time (at least minutes) needed for recovery and preparation for the next shot. The new device overcomes problems associated with repetitive operation, including rapidly evacuating the propellant gases, reloading the gun breech with a new projectile, returning the piston to its initial position, and refilling the first- and second-stage gas volumes to the appropriate pressure levels. In addition, some components are subjected to and must survive severe operating conditions, which include rapid cycling to high pressures and temperatures (up to thousands of bars and thousands of kelvins) and significant mechanical shocks. Small plastic projectiles (4-mm nominal size) and helium gas have been used in the prototype device, which was equipped with a 1-m-long pump tube and a 1-m-long gun barrel, to demonstrate repetitive operation (up to 1 Hz) at relatively high pellet velocities (up to 3000 m/s). The equipment is described, and experimental results are presented. 124 refs., 6 figs., 5 tabs.

  5. Prediction of muscle performance during dynamic repetitive movement

    NASA Technical Reports Server (NTRS)

    Byerly, D. L.; Byerly, K. A.; Sognier, M. A.; Squires, W. G.

    2003-01-01

    BACKGROUND: During long-duration spaceflight, astronauts experience progressive muscle atrophy and often perform strenuous extravehicular activities. Post-flight, there is a lengthy recovery period with an increased risk for injury. Currently, there is a critical need for an enabling tool to optimize muscle performance and to minimize the risk of injury to astronauts while on-orbit and during post-flight recovery. Consequently, these studies were performed to develop a method to address this need. METHODS: Eight test subjects performed a repetitive dynamic exercise to failure at 65% of their upper torso weight using a Lordex spinal machine. Surface electromyography (SEMG) data was collected from the erector spinae back muscle. The SEMG data was evaluated using a 5th order autoregressive (AR) model and linear regression analysis. RESULTS: The best predictor found was an AR parameter, the mean average magnitude of AR poles, with r = 0.75 and p = 0.03. This parameter can predict performance to failure as early as the second repetition of the exercise. CONCLUSION: A method for predicting human muscle performance early during dynamic repetitive exercise was developed. The capability to predict performance to failure has many potential applications to the space program including evaluating countermeasure effectiveness on-orbit, optimizing post-flight recovery, and potential future real-time monitoring capability during extravehicular activity.

  6. A repetitive sequence assembler based on next-generation sequencing.

    PubMed

    Lian, S; Tu, Y; Wang, Y; Chen, X; Wang, L

    2016-01-01

    Repetitive sequences of variable length are common in almost all eukaryotic genomes, and most of them are presumed to have important biomedical functions and can cause genomic instability. Next-generation sequencing (NGS) technologies provide the possibility of identifying capturing these repetitive sequences directly from the NGS data. In this study, we assessed the performances in identifying capturing repeats of leading assemblers, such as Velvet, SOAPdenovo, SGA, MSR-CA, Bambus2, ALLPATHS-LG, and AByss using three real NGS datasets. Our results indicated that most of them performed poorly in capturing the repeats. Consequently, we proposed a repetitive sequence assembler, named NGSReper, for capturing repeats from NGS data. Simulated datasets were used to validate the feasibility of NGSReper. The results indicate that the completeness of capturing repeat is up to 99%. Cross validation was performed in three real NGS datasets, and extensive comparisons indicate that NGSReper performed best in terms of completeness and accuracy in capturing repeats. In conclusion, NGSReper is an appropriate and suitable tool for capturing repeats directly from NGS data. PMID:27525861

  7. [Trauma repetition and revictimization following physical and sexual abuse].

    PubMed

    Wöller, W

    2005-02-01

    The tendency of victims of physical or sexual childhood abuse to become revictimized in later life has well been documented empirically. Moreover, there is a high stability of violent and abusive relationships. The aim of this paper was to summarize perspectives from psychodynamic theory, attachment theory, and posttraumatic stress research to explain revictimization phenomena. The term repetition compulsion has little explanatory value without additional theoretical assumptions. Within the psychodynamic framework, an ego-psychological view conceives trauma repetition as an attempt to master traumatic experience, while in the object relations perspective, revictimization is explained by the influence of traumatic introjects. Negative cognitions of being worthless, bad and guilty can endorse the conviction that abuse is justified and reduce the capacity of self-care. Negative learning experiences from traumatic helplessness and powerlessness account for low self-efficacy expectations and prevent the establishment of self-boundaries. Trauma repetition can also be understood as an enactment in the service of affect regulation. Research in the field of attachment theory identified attachment styles predisposing to revictimization. Research dealing with posttraumatic stress disorder emphasizes the importance of traumatic affects recurring in daily life and, consequently, the tendency of abuse victims to actively produce dangerous situations in order to cope with these affects, furthermore, the role of dissociation in missing warning signals of impending traumatization. For therapeutically addressing revictimization, a detailed analysis of underlying phenomena is required.

  8. Sound Segregation via Embedded Repetition Is Robust to Inattention

    PubMed Central

    2015-01-01

    The segregation of sound sources from the mixture of sounds that enters the ear is a core capacity of human hearing, but the extent to which this process is dependent on attention remains unclear. This study investigated the effect of attention on the ability to segregate sounds via repetition. We utilized a dual task design in which stimuli to be segregated were presented along with stimuli for a “decoy” task that required continuous monitoring. The task to assess segregation presented a target sound 10 times in a row, each time concurrent with a different distractor sound. McDermott, Wrobleski, and Oxenham (2011) demonstrated that repetition causes the target sound to be segregated from the distractors. Segregation was queried by asking listeners whether a subsequent probe sound was identical to the target. A control task presented similar stimuli but probed discrimination without engaging segregation processes. We present results from 3 different decoy tasks: a visual multiple object tracking task, a rapid serial visual presentation (RSVP) digit encoding task, and a demanding auditory monitoring task. Load was manipulated by using high- and low-demand versions of each decoy task. The data provide converging evidence of a small effect of attention that is nonspecific, in that it affected the segregation and control tasks to a similar extent. In all cases, segregation performance remained high despite the presence of a concurrent, objectively demanding decoy task. The results suggest that repetition-based segregation is robust to inattention. PMID:26480248

  9. Characterizing Caregiver Responses to Restricted and Repetitive Behaviors in Toddlers with Autism Spectrum Disorder

    ERIC Educational Resources Information Center

    Harrop, Clare; Gulsrud, Amanda; Shih, Wendy; Hovsepyan, Lilit; Kasari, Connie

    2016-01-01

    Restricted and repetitive behaviors are a core feature of autism spectrum disorder. This descriptive study documented the presence of restricted and repetitive behaviors in 85 toddlers with autism spectrum disorder as they interacted with their caregiver in a play interaction. For each child restricted and repetitive behavior, a caregiver…

  10. Analysis of the Encoding Factors That Produce the Negative Repetition Effect

    ERIC Educational Resources Information Center

    Mulligan, Neil W.; Peterson, Daniel J.

    2014-01-01

    Perhaps the most basic finding in memory research is the repetition effect--the fact that repetition enhances memory. Peterson and Mulligan (2012) recently documented a surprising "negative repetition effect," in which participants who studied a list of cue-target pairs twice recalled "fewer" targets than a group who studied…

  11. The Effect of Repetition Types on Listening Tests in an EFL Setting

    ERIC Educational Resources Information Center

    Horness, Paul

    2013-01-01

    This study was an investigation into the effects of repetition on a listening comprehension test for second language learners. Repetition has been previously examined in a cursory way, usually as a secondary question to a primary treatment. Additionally, the method of repetition was limited to one way and to one treatment condition; therefore, it…

  12. Effects of Material Emotional Valence on the Time Course of Massive Repetition Priming

    ERIC Educational Resources Information Center

    Hu, Zhiguo; Liu, Hongyan; Zhang, John X.

    2010-01-01

    Learning through repetition is a fundamental form and also an effective method of language learning critical for achieving proficient and automatic language use. Massive repetition priming as a common research paradigm taps into the dynamic processes involved in repetition learning. Research with this paradigm has so far used only emotionally…

  13. Effects of Spaced Repetition on Long-Term Map Knowledge Recall

    ERIC Educational Resources Information Center

    Zirkle, David M.; Ellis, Arthur K.

    2010-01-01

    Sixth-grade students studying Latin America were placed in experimental and comparison groups to test the effects of map-study repetition on long-term memory. Mean scores on place-name repetition indicated that the experimental (repetition) group out-performed the comparison group at a statistically significant level with respect to both posttest…

  14. Examining Restricted and Repetitive Behaviors in Young Children with Autism Spectrum Disorder during Two Observational Contexts

    ERIC Educational Resources Information Center

    Stronach, Sheri; Wetherby, Amy M.

    2014-01-01

    This prospective study of the FIRST WORDS® Project examined restricted and repetitive behaviors in a sample of 55 toddlers at a mean age of 20 months who were later diagnosed with autism spectrum disorder. Restricted and repetitive behaviors were coded using the Repetitive Movement and Restricted Interest Scales in two video-recorded observation…

  15. Repetitive Behaviour in Children with High Functioning Autism and Obsessive Compulsive Disorder

    ERIC Educational Resources Information Center

    Zandt, Fiona; Prior, Margot; Kyrios, Michael

    2007-01-01

    Children with Autism Spectrum Disorders (ASD) and children with Obsessive Compulsive Disorder (OCD) were compared on a range of repetitive behaviours. Parents reported similar levels of sameness behaviour and repetitive movements in the clinical groups, although children with OCD engaged in more repetitive behaviour focussed around routines and…

  16. Repetition suppression and repetition enhancement underlie auditory memory-trace formation in the human brain: an MEG study.

    PubMed

    Recasens, Marc; Leung, Sumie; Grimm, Sabine; Nowak, Rafal; Escera, Carles

    2015-03-01

    The formation of echoic memory traces has traditionally been inferred from the enhanced responses to its deviations. The mismatch negativity (MMN), an auditory event-related potential (ERP) elicited between 100 and 250ms after sound deviation is an indirect index of regularity encoding that reflects a memory-based comparison process. Recently, repetition positivity (RP) has been described as a candidate ERP correlate of direct memory trace formation. RP consists of repetition suppression and enhancement effects occurring in different auditory components between 50 and 250ms after sound onset. However, the neuronal generators engaged in the encoding of repeated stimulus features have received little interest. This study intends to investigate the neuronal sources underlying the formation and strengthening of new memory traces by employing a roving-standard paradigm, where trains of different frequencies and different lengths are presented randomly. Source generators of repetition enhanced (RE) and suppressed (RS) activity were modeled using magnetoencephalography (MEG) in healthy subjects. Our results show that, in line with RP findings, N1m (~95-150ms) activity is suppressed with stimulus repetition. In addition, we observed the emergence of a sustained field (~230-270ms) that showed RE. Source analysis revealed neuronal generators of RS and RE located in both auditory and non-auditory areas, like the medial parietal cortex and frontal areas. The different timing and location of neural generators involved in RS and RE points to the existence of functionally separated mechanisms devoted to acoustic memory-trace formation in different auditory processing stages of the human brain.

  17. Carpal tunnel syndrome and work organisation in repetitive work: a cross sectional study in France. Study Group on Repetitive Work

    PubMed Central

    Leclerc, A.; Franchi, P.; Cristofari, M. F.; Delemotte, B.; Mereau, P.; Teyssier-Cotte, C.; Touranchet, A.

    1998-01-01

    OBJECTIVES: To study the determinants of signs of carpal tunnel syndrome (CTS) in repetitive industrial work, with special attention to occupational constraints at group level and management practices of the companies. METHOD: A cross sectional study was conducted in three sectors: assembly line; clothing and shoe industry; food industry. A total of 1210 workers in repetitive work, from 53 different companies, was compared with a control group of 337 workers. Constraints at the workplace were partly self declared, and partly assessed by the occupational physicians in charge of the employees of the company. The definition of CTS was based on a standardised clinical examination. RESULTS: CTS was associated with repetitive work, especially packaging. It was more frequent among subjects who declared psychological and psychosomatic problems and those with a body mass index > or = 27. Dissatisfaction with work, lack of job control, short cycle time, and having to press repeatedly with the hand were associated with the syndrome. An odds ratio (OR) of 2.24 was found for "just in time" production. CONCLUSION: The results emphasise the complexity of the determinants of CTS, the role of psychosocial factors at work and the potentially negative effects of some practices of the companies aimed at enhancing their competitiveness.   PMID:9624269

  18. PCR amplification of repetitive sequences as a possible approach in relative species quantification.

    PubMed

    Ballin, N Z; Vogensen, F K; Karlsson, A H

    2012-02-01

    Both relative and absolute quantifications are possible in species quantification when single copy genomic DNA is used. However, amplification of single copy genomic DNA does not allow a limit of detection as low as one obtained from amplification of repetitive sequences. Amplification of repetitive sequences is therefore frequently used in absolute quantification but problems occur in relative quantification as the number of repetitive sequences is unknown. A promising approach was developed where data from amplification of repetitive sequences were used in relative quantification of species in binary mixtures. PCR LUX primers were designed that amplify repetitive and single copy sequences to establish the species dependent number (constants) (SDC) of amplified repetitive sequences per genome. The SDCs and data from amplification of repetitive sequences were tested for their applicability to relatively quantify the amount of chicken DNA in a binary mixture of chicken DNA and pig DNA. However, the designed PCR primers lack the specificity required for regulatory species control.

  19. [Relationship to Carcinogenesis of Repetitive Low-Dose Radiation Exposure].

    PubMed

    Ootsuyama, Akira

    2016-06-01

    We studied the carcinogenic effects caused by repetitive irradiation at a low dose, which has received attention in recent years, and examined the experimental methods used to evaluate radiation-induced carcinogenesis. For this experiment, we selected a mouse with as few autochthonous cancers as possible. Skin cancer was selected as the target for analysis, because it is a rare cancer in mice. Beta-rays were selected as the radiation source. The advantage of using beta-rays is weaker penetration power into tissues, thus protecting organs, such as the digestive and hematogenous organs. The benefit of our experimental method is that only skin cancer requires monitoring, and it is possible to perform long-term experiments. The back skin of mice was exposed repetitively to beta-rays three times a week until the occurrence of cancer or death, and the dose per exposure ranged from 0.5 to 11.8 Gy. With the high-dose range (2.5-11.8 Gy), the latency period and carcinogenic rate were almost the same in each experimental group. When the dose was reduced to 1-1.5 Gy, the latency period increased, but the carcinogenic rate remained. When the dose was further reduced to 0.5 Gy, skin cancer never happened, even though we continued irradiation until death of the last mouse in this group. The lifespan of 0.5 Gy group mice was the same as that of the controls. We showed that the 0.5 Gy dose did not cause cancer, even in mice exposed repetitively throughout their life span, and thus refer to 0.5 Gy as the threshold-like dose. PMID:27302731

  20. [Relationship to Carcinogenesis of Repetitive Low-Dose Radiation Exposure].

    PubMed

    Ootsuyama, Akira

    2016-06-01

    We studied the carcinogenic effects caused by repetitive irradiation at a low dose, which has received attention in recent years, and examined the experimental methods used to evaluate radiation-induced carcinogenesis. For this experiment, we selected a mouse with as few autochthonous cancers as possible. Skin cancer was selected as the target for analysis, because it is a rare cancer in mice. Beta-rays were selected as the radiation source. The advantage of using beta-rays is weaker penetration power into tissues, thus protecting organs, such as the digestive and hematogenous organs. The benefit of our experimental method is that only skin cancer requires monitoring, and it is possible to perform long-term experiments. The back skin of mice was exposed repetitively to beta-rays three times a week until the occurrence of cancer or death, and the dose per exposure ranged from 0.5 to 11.8 Gy. With the high-dose range (2.5-11.8 Gy), the latency period and carcinogenic rate were almost the same in each experimental group. When the dose was reduced to 1-1.5 Gy, the latency period increased, but the carcinogenic rate remained. When the dose was further reduced to 0.5 Gy, skin cancer never happened, even though we continued irradiation until death of the last mouse in this group. The lifespan of 0.5 Gy group mice was the same as that of the controls. We showed that the 0.5 Gy dose did not cause cancer, even in mice exposed repetitively throughout their life span, and thus refer to 0.5 Gy as the threshold-like dose.

  1. An Experiment on Repetitive Pulse Operation of Microwave Rocket

    SciTech Connect

    Oda, Yasuhisa; Shibata, Teppei; Komurasaki, Kimiya; Takahashi, Koji; Kasugai, Atsushi; Sakamoto, Keishi

    2008-04-28

    Microwave Rocket was operated with repetitive pulses. The microwave rocket model with forced breathing system was used. The pressure history in the thruster was measured and the thrust impulse was deduced. As a result, the impulse decreased at second pulse and impulses at latter pulses were constant. The dependence of the thrust performance on the partial filling rate of the thruster was compared to the thrust generation model based on the shock wave driven by microwave plasma. The experimental results showed good agreement to the predicted dependency.

  2. 1-kHz-repetition-rate femtosecond Raman laser

    NASA Astrophysics Data System (ADS)

    Didenko, N. V.; Konyashchenko, A. V.; Kostryukov, P. V.; Losev, L. L.; Pazyuk, V. S.; Tenyakov, S. Yu

    2016-07-01

    A femtosecond Raman laser utilising compressed hydrogen is experimentally investigated under pumping by radiation from a 1-kHz-repetition-rate Ti : sapphire laser. In the regime of double-pulse pumping, the conditions are determined, which correspond to the minimal energy dispersion of Stokes pulses. The optical scheme is realised, which is capable of ensuring the long-term stability of the average power of the first Stokes component with a variation of less than 2%. The Stokes pulses are produced with a pulse duration of 60 fs and energy of 0.26 mJ at a conversion efficiency of 14%.

  3. Rotated balance in humans due to repetitive rotational movement

    NASA Astrophysics Data System (ADS)

    Zakynthinaki, M. S.; Madera Milla, J.; López Diaz De Durana, A.; Cordente Martínez, C. A.; Rodríguez Romo, G.; Sillero Quintana, M.; Sampedro Molinuevo, J.

    2010-03-01

    We show how asymmetries in the movement patterns during the process of regaining balance after perturbation from quiet stance can be modeled by a set of coupled vector fields for the derivative with respect to time of the angles between the resultant ground reaction forces and the vertical in the anteroposterior and mediolateral directions. In our model, which is an adaption of the model of Stirling and Zakynthinaki (2004), the critical curve, defining the set of maximum angles one can lean to and still correct to regain balance, can be rotated and skewed so as to model the effects of a repetitive training of a rotational movement pattern. For the purposes of our study a rotation and a skew matrix is applied to the critical curve of the model. We present here a linear stability analysis of the modified model, as well as a fit of the model to experimental data of two characteristic "asymmetric" elite athletes and to a "symmetric" elite athlete for comparison. The new adapted model has many uses not just in sport but also in rehabilitation, as many work place injuries are caused by excessive repetition of unaligned and rotational movement patterns.

  4. Repetitive magnetic stimulation induces plasticity of inhibitory synapses

    PubMed Central

    Lenz, Maximilian; Galanis, Christos; Müller-Dahlhaus, Florian; Opitz, Alexander; Wierenga, Corette J.; Szabó, Gábor; Ziemann, Ulf; Deller, Thomas; Funke, Klaus; Vlachos, Andreas

    2016-01-01

    Repetitive transcranial magnetic stimulation (rTMS) is used as a therapeutic tool in neurology and psychiatry. While repetitive magnetic stimulation (rMS) has been shown to induce plasticity of excitatory synapses, it is unclear whether rMS can also modify structural and functional properties of inhibitory inputs. Here we employed 10-Hz rMS of entorhinohippocampal slice cultures to study plasticity of inhibitory neurotransmission on CA1 pyramidal neurons. Our experiments reveal a rMS-induced reduction in GABAergic synaptic strength (2–4 h after stimulation), which is Ca2+-dependent and accompanied by the remodelling of postsynaptic gephyrin scaffolds. Furthermore, we present evidence that 10-Hz rMS predominantly acts on dendritic, but not somatic inhibition. Consistent with this finding, a reduction in clustered gephyrin is detected in CA1 stratum radiatum of rTMS-treated anaesthetized mice. These results disclose that rTMS induces coordinated Ca2+-dependent structural and functional changes of specific inhibitory postsynapses on principal neurons. PMID:26743822

  5. Spontaneous repetitive thoughts can be adaptive: postscript on "mind wandering".

    PubMed

    Baars, Bernard J

    2010-03-01

    When researchers use the term mind wandering for task-unrelated thoughts in signal detection tasks, we may fall into the trap of believing that spontaneous thoughts are task unrelated in a deeper sense. Similar negative connotations are attached to common terms like cognitive failures, resting state, rumination, distraction, attentional failures, absent-mindedness, repetitiveness, mind lapses, going AWOL in the brain, cortical idling, and the like. Nevertheless, it seems obvious that mathematicians and scientists often engage in spontaneous repetitive thoughts and that the results of those thoughts are by no means maladaptive. Yet that seems to be implied by the standard use of common terms in the research literature. As humans, we know that spontaneous ideation goes on during all of our waking hours, during dreams and even in slow-wave sleep. It is unlikely that such a great allocation of mental resources has no useful adaptive function. This view of the spontaneous stream is consistent with the perspective of global workspace theory on conscious contents, which suggests that conscious events are not like unconscious cognitive representations. Rather, conscious events trigger widespread adaptive changes in the brain, far beyond their cortical origins. The brain evidence for such "global broadcasting" triggered by conscious (but not matched unconscious) events throughout the cortex is now quite compelling. Spontaneous conscious thoughts, even if they appear to be arbitrary, irrelevant, unwanted, or intrusive, may still play an important adaptive role in life-relevant problem solving and learning.

  6. PROCESSING OF NANOSTRUCTURED COPPER BY REPETITIVE CORRUGATION AND STRAIGHTENING (RCS)

    SciTech Connect

    Zhu, Y.T.; Jiang, H.

    2000-10-01

    A new process, Repetitive Corrugation and Straightening (RCS), has been developed to create bulk, nanostructured copper. In this investigation, a high purity (99.99%). copper bar measuring 6 x 6 x 50 mm with an average grain size of 765 {micro}m was used as the starting material. It was repetitively corrugated and straightened for 14 times with 90{degree} rotations along its longitudinal axis between consecutive corrugation-straightening cycles. The copper was cooled to below room temperature before each RCS cycle. The grain size obtained after the RCS process was in the range of twenty to a few hundred nanometers, and microhardness was increased by 100%. Both equilibrium and non-equilibrium grain boundaries are observed. This work demonstrates the capability of the RCS process in refining grain size of metal materials. The RCS process can be easily adapted to large-scale industrial production and has the potential to pave the way to large-scale structural applications of nanostructured materials.

  7. Unstable high molecular weight inverted repetitive DNA in human lymphocytes.

    PubMed Central

    Rogers, J C; Rucinsky, T E

    1982-01-01

    About 1% of newly synthesized DNA from PHA-stimulated human lymphocytes can be isolated as large (up to 90 kilobase pairs) double stranded fragments that resist sequential alkali and heat denaturation steps but are not closed circular. By electron microscopy about 1% have single-strand hairpin loops at one end and therefore present inverted repetitive sequences (IR-DNA). Most of the remainder have a blunt-appearing double-strand terminus at both ends (78%) or one end (18%). Indirect evidence indicates that these also are inverted complementary structures with terminal hairpin loops too small to be visualized: (1) Treatment with either a 5' or 3' single-strand exonuclease generates essentially only fragments with a single strand at one end; (2) with partial denaturation, the number of fragments with identifiable single-strand hairpin loops increases (to about 20%); (3) after S1 nuclease digestion, greater than 95% can be fully heat denatured. Cot analysis indicates that these fragments are derived from dispersed sites throughout the genome. Up to 25% of DNA released from lymphocytes during growth similarly resists denaturation, and released DNA and IR-DNA are both enriched in the same set of repetitive sequences. Thus at least a portion of IR-DNA appears to be unstable. Images PMID:7145706

  8. Resistance to change of operant variation and repetition.

    PubMed

    Doughty, A H; Lattal, K A

    2001-09-01

    A multiple chained schedule was used to compare the relative resistance to change of variable and fixed four-peck response sequences in pigeons. In one terminal link, a response sequence produced food only if it occurred infrequently relative to 15 other response sequences (vary). In the other terminal link, a single response sequence produced food (repeat). Identical variable-interval schedules operated in the initial links. During baseline, lower response rates generally occurred in the vary initial link, and similar response and reinforcement rates occurred in each terminal link. Resistance of responding to prefeeding and three rates of response-independent food delivered during the intercomponent intervals then was compared between components. During each disruption condition, initial- and terminal-link response rates generally were more resistant in the vary component than in the repeat component. During the response-independent food conditions, terminal-link response rates were more resistant than initial-link response rates in each component, but this did not occur during prefeeding. Variation (in vary) and repetition (in repeat) both decreased during the response-independent food conditions in the respective components, but with relatively greater disruption in repeat. These results extend earlier findings demonstrating that operant variation is more resistant to disruption than is operant repetition and suggest that theories of response strength, such as behavioral momentum theory, must consider factors other than reinforcement rate. The implications of the results for understanding operant response classes are discussed.

  9. Obesity-related changes in prolonged repetitive lifting performance.

    PubMed

    Ghesmaty Sangachin, Mahboobeh; Cavuoto, Lora A

    2016-09-01

    Despite the rising prevalence of obesity, little is known about its moderating effects on injury risk factors, such as fatigue, in occupational settings. This study investigated the effect of obesity, prolonged repetitive lifting and their interaction on lifting performance of 14 participants, 7 obese (mean body mass index (BMI): 33.2 kg m(-2)) and 7 non-obese (mean BMI: 22.2 kg m(-2)) subjects. To present a physically challenging task, subjects performed repetitive lifting for 1 h at 120% of their maximum acceptable weight of lift. Generalized linear mixed models were fit to posture and acceleration data. The obese group bent to a ∼10° lower peak trunk sagittal flexion angle, had 17% lower root mean square (RMS) jerk and took 0.8 s longer per lift. Over time, the obese group increased their trunk transverse and sagittal posterior accelerations while the non-obese maintained theirs. Although the majority of lifting variables were unaffected by BMI or its interaction with prolonged lifting duration, the observed differences, combined with a greater upper body mass, necessitate a more cautious use of existing psychophysical lifting limits for individuals who are obese, particularly when fatigued.

  10. A bottleneck in face identification: repetition priming from flanker images.

    PubMed

    Bindemann, Markus; Jenkins, Rob; Burton, A Mike

    2007-01-01

    There is evidence that face processing is capacity-limited in distractor interference tasks and in tasks requiring overt recognition memory. We examined whether capacity limits for faces can be observed with a more sensitive measure of visual processing, by measuring repetition priming of flanker faces that were presented alongside a face or a nonface target. In Experiment 1, we found identity priming for face flankers, by measuring repetition priming across a change in image, during task-relevant nonface processing, but not during the processing of a concurrently-presented face target. Experiment 2 showed perceptual priming of the flanker faces, across identical images at prime and test, when they were presented alongside a face target. In a third Experiment, all of these effects were replicated by measuring identity priming and perceptual priming within the same task. Overall, these results imply that face processing is capacity limited, such that only a single face can be identified at one time. Merely attending to a target face appears sufficient to trigger these capacity limits, thereby extinguishing identification of a second face in the display, although our results demonstrate that the additional face remains at least subject to superficial image processing. PMID:17725160

  11. Effect of Airflows on Repetitive Nanosecond Volume Discharges

    NASA Astrophysics Data System (ADS)

    Tang, Jingfeng; Wei, Liqiu; Huo, Yuxin; Song, Jian; Yu, Daren; Zhang, Chaohai

    2016-03-01

    Atmospheric pressure discharges excited by repetitive nanosecond pulses have attracted significant attention for various applications. In this paper, a plate-plate discharge with airflows is excited by a repetitive nanosecond pulse generator. Under different experiment conditions, the applied voltages, discharge currents, and discharge images are recorded. The plasma images presented here indicate that the volume discharge modes vary with airflow speeds, and a diffuse and homogeneous volume discharge occurs at the speed of more than 35 m/s. The role of airflows provides different effects on the 2-stage pulse discharges. The 1st pulse currents nearly maintain consistency for different airflow speeds. However, the 2nd pulse current has a change trend of first decreasing and then rapidly increasing, and the value difference for 2nd pulse currents is about 20 A under different airflows. In addition, the experimental results are discussed according to the electrical parameters and discharge images. supported by National Natural Science Foundation of China (Nos. 51006027, 51437002, and 51477035)

  12. Repetitive Transcranial Magnetic Stimulation Activates Specific Regions in Rat Brain

    NASA Astrophysics Data System (ADS)

    Ji, Ru-Rong; Schlaepfer, Thomas E.; Aizenman, Carlos D.; Epstein, Charles M.; Qiu, Dike; Huang, Justin C.; Rupp, Fabio

    1998-12-01

    Repetitive transcranial magnetic stimulation (rTMS) is a noninvasive technique to induce electric currents in the brain. Although rTMS is being evaluated as a possible alternative to electroconvulsive therapy for the treatment of refractory depression, little is known about the pattern of activation induced in the brain by rTMS. We have compared immediate early gene expression in rat brain after rTMS and electroconvulsive stimulation, a well-established animal model for electroconvulsive therapy. Our result shows that rTMS applied in conditions effective in animal models of depression induces different patterns of immediate-early gene expression than does electroconvulsive stimulation. In particular, rTMS evokes strong neural responses in the paraventricular nucleus of the thalamus (PVT) and in other regions involved in the regulation of circadian rhythms. The response in PVT is independent of the orientation of the stimulation probe relative to the head. Part of this response is likely because of direct activation, as repetitive magnetic stimulation also activates PVT neurons in brain slices.

  13. Final Report, Photocathodes for High Repetition Rate Light Sources

    SciTech Connect

    Ben-Zvi, Ilan

    2014-04-20

    This proposal brought together teams at Brookhaven National Laboratory (BNL), Lawrence Berkeley National Laboratory (LBNL) and Stony Brook University (SBU) to study photocathodes for high repetition rate light sources such as Free Electron Lasers (FEL) and Energy Recovery Linacs (ERL). The work done under this grant comprises a comprehensive program on critical aspects of the production of the electron beams needed for future user facilities. Our program pioneered in situ and in operando diagnostics for alkali antimonide growth. The focus is on development of photocathodes for high repetition rate Free Electron Lasers (FELs) and Energy Recovery Linacs (ERLs), including testing SRF photoguns, both normal-conducting and superconducting. Teams from BNL, LBNL and Stony Brook University (SBU) led this research, and coordinated their work over a range of topics. The work leveraged a robust infrastructure of existing facilities and the support was used for carrying out the research at these facilities. The program concentrated in three areas: a) Physics and chemistry of alkali-antimonide cathodes b) Development and testing of a diamond amplifier for photocathodes c) Tests of both cathodes in superconducting RF photoguns and copper RF photoguns

  14. Improved Limits on Gamma-Ray Burst Repetition from BATSE

    NASA Technical Reports Server (NTRS)

    Tegmark, Max; Hartmann, Dieter H.; Briggs, Michael S.; Hakkila, Jon; Meegan, Charles A.

    1996-01-01

    We tighten previous upper limits on gamma-ray burst repetition by analyzing the angular power spectrum of the BATSE 3B catalog of 1122 bursts. At 95% confidence, we find that no more than 2% of all observed bursts can be labeled as repeaters, even if no sources are observed to repeat more than once. If a fraction f of all observed bursts can be labeled as repeaters that are observed to burst upsilon times each, then all models with (upsilon - 1)f greater than or equal to 0.05 are ruled out at 99% confidence, as compared to the best previous 99% limit (upsilon - 1)f greater than or equal to 0.27. At 95% confidence, our new limit is (upsilon - 1)f greater than or equal to 0.02. Thus, even a cluster of six events from a single source would have caused excess power above that present in the 3B catalog. We conclude that the current BATSE data are consistent with no repetition of classical gamma-ray bursts and that any repeater model is severely constrained by the near-perfect isotropy of their angular distribution.

  15. Improved Limits on Gamma-Ray Burst Repetition from BATSE

    NASA Technical Reports Server (NTRS)

    Tegmark, Max; Hartmann, Dieter H.; Briggs, Michael S.; Meegan, Charles A.; Hakkila, Jon

    1996-01-01

    We tighten previous upper limits on gamma-ray burst repetition by analyzing the angular power spectrum of the BATSE 3B catalog of 1122 bursts. At 95% confidence, we find that no more than 2% of all observed bursts can be labeled as repeaters, even if no sources are observed to repeat more than once. If a fraction f of all observed bursts can be labeled as repeaters that are observed to burst nu times each, then all models with (nu - 1)f greater than or equal to 0.05 are ruled out at 99% confidence, as compared to the best previous 99% limit (nu - 1)f greater than or equal to 0.27. At 95% confidence, our new limit is (nu - 1)f greater than or equal to 0.02. Thus, even a cluster of six events from a single source would have caused excess power above that present in the 3B catalog. We conclude that the current BATSE data are consistent with no repetition of classical gamma-ray bursts and that any repeater model is severely constrained by the near-perfect isotropy of their angular dis- tribution.

  16. Neuroimaging evidence for processes underlying repetition of ignored stimuli.

    PubMed

    Bauer, Eva; Gebhardt, Helge; Ruprecht, Christoph; Gallhofer, Bernd; Sammer, Gebhard

    2012-01-01

    Prolonged response times are observed with targets having been presented as distractors immediately before, called negative priming effect. Among others, inhibitory and retrieval processes have been suggested underlying this behavioral effect. As those processes would involve different neural activation patterns, a functional magnetic resonance imaging (fMRI) study including 28 subjects was conducted. Two tasks were used to investigate stimulus repetition effects. One task focused on target location, the other on target identity. Both tasks are known to elicit the expected response time effects. However, there is less agreement about the relationship of those tasks with the explanatory accounts under consideration. Based on within-subject comparisons we found clear differences between the experimental repetition conditions and the neutral control condition on neural level for both tasks. Hemodynamic fronto-striatal activation patterns occurred for the location-based task favoring the selective inhibition account. Hippocampal activation found for the identity-based task suggests an assignment to the retrieval account; however, this task lacked a behavioral effect. PMID:22563478

  17. Word and nonword repetition in bilingual subjects: a PET study.

    PubMed

    Klein, Denise; Watkins, Kate E; Zatorre, Robert J; Milner, Brenda

    2006-02-01

    Learning a specific skill during childhood may partly determine the functional organization of the adult brain. This hypothesis led us to study brain activation patterns using positron emission tomography (PET), in which we compared word and nonword repetition in 10 right-handed native English-speakers (L1) who were proficient in their second language, French (L2), which was learned after the age of 5 years. Regional cerebral blood flow (rCBF) was measured by the H2 15O intravenous bolus method with intersubject averaging and coregistration of magnetic resonance and PET images. A comparison of CBF changes when repeating words in L2 with those seen when repeating words in (L1) demonstrated that the pattern of CBF was similar across the two conditions, with several significant CBF differences in the vicinity of the left insular cortex, ventral premotor region, and in the striatum. We hypothesize that these regions are activated when subjects are required to repeat known words, showing increased activity when there are increased articulatory demands imposed by speaking L2. Comparisons of nonword repetition in L1 and L2 revealed increased activity for L2 in the left ventral premotor region and in the cerebellum; rCBF increases were also observed in these regions in both L1 and L2 with increased number of syllables and increased articulatory complexity, suggesting a role for these regions in the complex motor control needed for the production of novel sequences.

  18. On the relationship between persistent delay activity, repetition enhancement and priming

    PubMed Central

    Tartaglia, Elisa M.; Mongillo, Gianluigi; Brunel, Nicolas

    2015-01-01

    Human efficiency in processing incoming stimuli (in terms of speed and/or accuracy) is typically enhanced by previous exposure to the same, or closely related stimuli—a phenomenon referred to as priming. In spite of the large body of knowledge accumulated in behavioral studies about the conditions conducive to priming, and its relationship with other forms of memory, the underlying neuronal correlates of priming are still under debate. The idea has repeatedly been advanced that a major neuronal mechanism supporting behaviorally-expressed priming is repetition suppression, a widespread reduction of spiking activity upon stimulus repetition which has been routinely exposed by single-unit recordings in non-human primates performing delayed-response, as well as passive fixation tasks. This proposal is mainly motivated by the observation that, in human fMRI studies, priming is associated to a significant reduction of the BOLD signal (widely interpreted as a proxy of the level of spiking activity) upon stimulus repetition. Here, we critically re-examine a large part of the electrophysiological literature on repetition suppression in non-human primates and find that repetition suppression is systematically accompanied by stimulus-selective delay period activity, together with repetition enhancement, an increase of spiking activity upon stimulus repetition in small neuronal populations. We argue that repetition enhancement constitutes a more viable candidate for a putative neuronal substrate of priming, and propose a minimal framework that links together, mechanistically and functionally, repetition suppression, stimulus-selective delay activity and repetition enhancement. PMID:25657630

  19. Examining restricted and repetitive behaviors in young children with autism spectrum disorder during two observational contexts.

    PubMed

    Stronach, Sheri; Wetherby, Amy M

    2014-02-01

    This prospective study of the FIRST WORDS® Project examined restricted and repetitive behaviors in a sample of 55 toddlers at a mean age of 20 months who were later diagnosed with autism spectrum disorder. Restricted and repetitive behaviors were coded using the Repetitive Movement and Restricted Interest Scales in two video-recorded observation methods-structured sampling procedures in a clinic and naturalistic everyday activities at home. Measures of restricted and repetitive behaviors were higher in the clinic setting than in the home observation, especially for behaviors involving object use. Repetitive movements with objects in the clinic predicted nonverbal developmental scores and Autism Diagnostic Observation Schedule social affect scores at later follow-up. In contrast, repetitive movements with objects at home significantly predicted later Autism Diagnostic Observation Schedule restricted and repetitive behaviors scores. These results support the utility of the Repetitive Movement and Restricted Interest Scales to detect restricted and repetitive behaviors in toddlers and suggest that observations of restricted and repetitive behaviors in clinic and home settings may provide unique and important diagnostic information for improving early detection of autism spectrum disorder.

  20. Neural mechanisms of repetition priming of familiar and globally unfamiliar visual objects

    PubMed Central

    Soldan, Anja; Habeck, Christian; Gazes, Yunglin; Stern, Yaakov

    2010-01-01

    Functional magnetic resonance imaging (fMRI) studies have shown that repetition priming of visual objects is typically accompanied by a reduction in activity for repeated compared to new stimuli (repetition suppression). However, the spatial distribution and direction (suppression vs. enhancement) of neural repetition effects can depend on the pre-experimental familiarity of stimuli. The first goal of this study was to further probe the link between repetition priming and repetition suppression/enhancement for visual objects and how this link is affected by stimulus familiarity. A second goal was to examine whether priming of familiar and unfamiliar objects following a single stimulus repetition is supported by the same processes as priming following multiple repetitions within the same task. In this endeavor, we examined both between and within subjects correlations between priming and fMRI repetition effects for familiar and globally unfamiliar visual objects during the first and third repetition of the stimuli. We included reaction time of individual trials as a linear regressor to identify brain regions whose repetition effects varied with response facilitation on a trial-by-trial basis. The results showed that repetition suppression in bilateral fusiform gyrus, was selectively correlated with priming of familiar objects that had been repeated once, likely reflecting facilitated perceptual processing or the sharpening of perceptual representations. Priming during the third repetition was correlated with repetition suppression in prefrontal and parietal areas for both familiar and unfamiliar stimuli, possibly reflecting a shift from top-down controlled to more automatic processing that occurs for both item types. PMID:20450898

  1. An Adapting Auditory-motor Feedback Loop Can Contribute to Generating Vocal Repetition

    PubMed Central

    Brainard, Michael S.; Jin, Dezhe Z.

    2015-01-01

    Consecutive repetition of actions is common in behavioral sequences. Although integration of sensory feedback with internal motor programs is important for sequence generation, if and how feedback contributes to repetitive actions is poorly understood. Here we study how auditory feedback contributes to generating repetitive syllable sequences in songbirds. We propose that auditory signals provide positive feedback to ongoing motor commands, but this influence decays as feedback weakens from response adaptation during syllable repetitions. Computational models show that this mechanism explains repeat distributions observed in Bengalese finch song. We experimentally confirmed two predictions of this mechanism in Bengalese finches: removal of auditory feedback by deafening reduces syllable repetitions; and neural responses to auditory playback of repeated syllable sequences gradually adapt in sensory-motor nucleus HVC. Together, our results implicate a positive auditory-feedback loop with adaptation in generating repetitive vocalizations, and suggest sensory adaptation is important for feedback control of motor sequences. PMID:26448054

  2. Diversities in virulence, antifungal activity, pigmentation and DNA fingerprint among strains of Burkholderia glumae.

    PubMed

    Karki, Hari S; Shrestha, Bishnu K; Han, Jae Woo; Groth, Donald E; Barphagha, Inderjit K; Rush, Milton C; Melanson, Rebecca A; Kim, Beom Seok; Ham, Jong Hyun

    2012-01-01

    Burkholderia glumae is the primary causal agent of bacterial panicle blight of rice. In this study, 11 naturally avirulent and nine virulent strains of B. glumae native to the southern United States were characterized in terms of virulence in rice and onion, toxofalvin production, antifungal activity, pigmentation and genomic structure. Virulence of B. glumae strains on rice panicles was highly correlated to virulence on onion bulb scales, suggesting that onion bulb can be a convenient alternative host system to efficiently determine the virulence of B. glumae strains. Production of toxoflavin, the phytotoxin that functions as a major virulence factor, was closely associated with the virulence phenotypes of B. glumae strains in rice. Some strains of B. glumae showed various levels of antifungal activity against Rhizoctonia solani, the causal agent of sheath blight, and pigmentation phenotypes on casamino acid-peptone-glucose (CPG) agar plates regardless of their virulence traits. Purple and yellow-green pigments were partially purified from a pigmenting strain of B. glumae, 411gr-6, and the purple pigment fraction showed a strong antifungal activity against Collectotrichum orbiculare. Genetic variations were detected among the B. glumae strains from DNA fingerprinting analyses by repetitive element sequence-based PCR (rep-PCR) for BOX-A1R-based repetitive extragenic palindromic (BOX) or enterobacterial repetitive intergenic consensus (ERIC) sequences of bacteria; and close genetic relatedness among virulent but pigment-deficient strains were revealed by clustering analyses of DNA fingerprints from BOX-and ERIC-PCR.

  3. Genotypic and phenotypic diversity of PGPR fluorescent pseudomonads isolated from the rhizosphere of sugarcane (Saccharum officinarum L.).

    PubMed

    Rameshkumar, Neelamegam; Ayyadurai, Niraikulam; Kayalvizhi, Nagarajan; Gunasekaran, Paramasamy

    2012-01-01

    The genetic diversity of plant growth-promoting rhizobacterial (PGPR) fluorescent pseudomonads associated with the sugarcane (Saccharum officinarum L.) rhizosphere was analyzed. Selected isolates were screened for plant growthpromoting properties including production of indole acetic acid, phosphate solubilization, denitrification ability, and production of antifungal metabolites. Furthermore, 16S rDNA sequence analysis was performed to identify and differentiate these isolates. Based on 16S rDNA sequence similarity, the isolates were designated as Pseudomonas plecoglossicida, P. fluorescens, P. libaniensis, and P. aeruginosa. Differentiation of isolates belonging to the same group was achieved through different genomic DNA fingerprinting techniques, including randomly amplified polymorphic DNA (RAPD), amplified ribosomal DNA restriction analysis (ARDRA), repetitive extragenic palindromic (REP), enterobacterial repetitive intergenic consensus (ERIC), and bacterial repetitive BOX elements (BOX) analyses. The genetic diversity observed among the isolates and rep-PCR-generated fingerprinting patterns revealed that PGPR fluorescent pseudomonads are associated with the rhizosphere of sugarcane and that P. plecoglossicida is a dominant species. The knowledge obtained herein regarding the genetic and functional diversity of fluorescent pseudomonads associated with the sugarcane rhizosphere is useful for understanding their ecological role and potential utilization in sustainable agriculture.

  4. rTMS of the occipital cortex abolishes Braille reading and repetition priming in blind subjects.

    PubMed

    Kupers, R; Pappens, M; de Noordhout, A Maertens; Schoenen, J; Ptito, M; Fumal, A

    2007-02-27

    To study the functional involvement of the visual cortex in Braille reading, we applied repetitive transcranial magnetic stimulation (rTMS) over midoccipital (MOC) and primary somatosensory (SI) cortex in blind subjects. After rTMS of MOC, but not SI, subjects made significantly more errors and showed an abolishment of the improvement in reading speed following repetitive presentation of the same word list, suggesting a role of the visual cortex in repetition priming in the blind.

  5. Task variation versus task repetition for people with profound developmental disabilities: an assessment of preferences.

    PubMed

    Lancioni, G E; O'Reilly, M F; Campodonico, F; Mantini, M

    1998-01-01

    An assessment of preferences between task variation and task repetition with four adults with profound developmental disabilities was implemented. After participants were exposed to both task variation and task repetition conditions, they were allowed to choose between them. Results showed that all participants had strong preferences; three preferred task variation and one task repetition. Aspects of the assessment and use of assessment data for planning daily work conditions were discussed.

  6. RN-BSN curricula: designed for transition, not repetition.

    PubMed

    Allen, Patricia E; Armstrong, Myrna L

    2013-01-01

    Combined efforts of professional mandates, employer preferences for increased educational levels of staff registered nurses (RNs), Magnet's higher environmental ratings, the Institute of Medicine report, and Aiken's (2003, 2008, & 2011) clinical research outcomes have spawn renewed attention for RN-baccalaureate degree of science in nursing (BSN) education. Yet, nationally, only 21.6% of associate degree nurses are continuing their education (Health Resources and Services Administration, 2010). Designing programs with the student as the center, where student/faculty engagement is the goal, has enabled one school of nursing to develop a quality on-line RN-to-BSN program. Core values of the program reveal a faculty who is committed to development of education to transition the associate degree and/or diploma graduate to professional nursing practice without repetition of content and learning activities.

  7. Simple filtered repetitively pulsed vacuum arc plasma source

    SciTech Connect

    Chekh, Yu.; Zhirkov, I. S.; Delplancke-Ogletree, M. P.

    2010-02-15

    A very simple design of cathodic filtered vacuum arc plasma source is proposed. The source without filter has only four components and none of them require precise machining. The source operates in a repetitively pulsed regime, and for laboratory experiments it can be used without water cooling. Despite the simple construction, the source provides high ion current at the filter outlet reaching 2.5% of 400 A arc current, revealing stable operation in a wide pressure range from high vacuum to oxygen pressure up to more than 10{sup -2} mbar. There is no need in complicated power supply system for this plasma source, only one power supply can be used to ignite the arc, to provide the current for the arc itself, to generate the magnetic field in the filter, and provide its positive electric biasing without any additional high power resistance.

  8. Methodological considerations when assessing restricted and repetitive behaviors and aggression

    PubMed Central

    Keefer, A.J.; Kalb, L.; Mazurek, M.O.; Kanne, S.M.; Freedman, B.; Vasa, R.A.

    2016-01-01

    Methodological issues impacting the relationship between aggression and restricted, repetitive, and stereotyped behaviors and interests (RRSBI) were examined in 2648 children and adolescents with autism spectrum disorders (ASD) using a multi-method, multi-informant analysis model to assess the effects of informant, assessment method, and aggression phenotype. Overall, a significant, but small relationship was found between RRSBI and aggression (p < .05). There was significant heterogeneity of estimates with large effect sizes observed when utilizing teacher report and a broad phenotype of aggression. Variance in estimates was attributed to differences in informant and assessment method with two times greater effect attributed to informant. Results suggest strategies to optimize future investigations of the relationship between RRSBI and aggression. Findings also provide the opportunity for the development of targeted interventions for aggression in youth with ASD. PMID:27239223

  9. Series-counterpulse repetitive-pulse inductive storage circuit

    DOEpatents

    Honig, E.M.

    1984-06-05

    A high-power series-counterpulse repetitive-pulse inductive energy storage and transfer circuit includes an opening switch, a main energy storage coil, and a counterpulse capacitor. The local pulse is initiated simultaneously with the initiation of the counterpulse used to turn the opening switch off. There is no delay from command to output pulse. During the load pulse, the counterpulse capacitor is automatically charged with sufficient energy to accomplish the load counterpulse which terminates the load pulse and turns the load switch off. When the main opening switch is reclosed to terminate the load pulse, the counterpulse capacitor discharges through the load, causing a rapid, sharp cutoff of the load pulse as well as recovering any energy remaining in the load inductance. The counterpulse capacitor is recharged to its original condition by the main energy storage coil after the load pulse is over, not before it begins.

  10. Repetitive transcranial magnetic stimulation in anorexia nervosa: a pilot study.

    PubMed

    Van den Eynde, F; Guillaume, S; Broadbent, H; Campbell, I C; Schmidt, U

    2013-02-01

    The search for new treatments to improve outcome in people with anorexia nervosa continues. This pilot study investigated whether one session of high frequency repetitive transcranial magnetic stimulation (rTMS) delivered to the left dorsolateral prefrontal cortex reduces eating disorder related symptoms following exposure to visual and real food stimuli. Safety and tolerability were also assessed. Ten right-handed people with anorexia nervosa underwent one session of rTMS. Subjective experiences related to the eating disorder (e.g. urge to restrict, feeling full etc.) were assessed before and after rTMS. Non-parametric repeated measures tests were used. rTMS was safe and well-tolerated, and resulted in reduced levels of feeling full, feeling fat and feeling anxious. Thus, rTMS may reduce core symptoms of anorexia nervosa. Future research should establish the therapeutic potential of rTMS in anorexia nervosa. PMID:21880470

  11. Effects of Neighborhood Density on Adult Word Repetition

    PubMed Central

    Freedman, Skott E.; Barlow, Jessica A.

    2015-01-01

    Presumable lexical competition has been found to result in higher perceptual accuracy for words with few versus many neighbors. Previous studies have typically only analyzed the lexical-semantic level, however. In order to also explore the possibility of phonological effects, a word repetition task was administered to 46 typical adults in which 80 stimuli differed only in neighborhood density. In contrast to previous studies, verbal responses were elicited in order to analyze productions holistically and segmentally at the phonological level. An additional error analysis examined differences in neighborhood density between target words and substitutions. Findings revealed that words with more neighbors facilitated recognition, and were more accurately repeated than those with fewer neighbors. When a target word was misperceived, its substitution tended to be higher in neighborhood density, unrelated to word frequency. In order to interpret these results, an account of lexical competition is re-visited with consideration of characteristics of the lexicon discovered using graph theory (Vitevitch, 2008). PMID:26435762

  12. CAVITATION DAMAGE STUDY VIA A NOVEL REPETITIVE PRESSURE PULSE APPROACH

    SciTech Connect

    Wang, Jy-An John; Ren, Fei; Wang, Hong

    2010-01-01

    Cavitation damage can significantly affect system performance. Thus, there is great interest in characterizing cavitation damage and improving materials resistance to cavitation damage. In this paper, we present a novel methodology to simulate cavitation environment. A pulsed laser is utilized to induce optical breakdown in the cavitation media, with the emission of shock wave and the generation of bubbles. The pressure waves induced by the optical breakdown fluctuate/propagate within the media, which enables the cavitation to occur and to further develop cavitation damage at the solid boundary. Using the repetitive pulsed-pressure apparatus developed in the current study, cavitation damage in water media was verified on stainless steel and aluminum samples. Characteristic cavitation damages such as pitting and indentation are observed on sample surfaces using scanning electron microscopy.

  13. High repetition rate laser systems: targets, diagnostics and radiation protection

    SciTech Connect

    Gizzi, Leonida A.; Clark, Eugene; Neely, David; Tolley, Martin; Roso, Luis

    2010-02-02

    Accessing the high repetition regime of ultra intense laser-target interactions at small or moderate laser energies is now possible at a large number of facilities worldwide. New projects such as HiPER and ELI promise to extend this regime to the high energy realm at the multi-kJ level. This opportunity raises several issues on how best to approach this new regime of operation in a safe and efficient way. At the same time, a new class of experiments or a new generation of secondary sources of particles and radiation may become accessible, provided that target fabrication and diagnostics are capable of handling this rep-rated regime. In this paper, we explore this scenario and analyse existing and perspective techniques that promise to address some of the above issues.

  14. Nonword repetition in lexical decision: support for two opposing processes.

    PubMed

    Wagenmakers, Eric-Jan; Zeelenberg, René; Steyvers, Mark; Shiffrin, Richard; Raaijmakers, Jeroen

    2004-10-01

    We tested and confirmed the hypothesis that the prior presentation of nonwords in lexical decision is the net result of two opposing processes: (1) a relatively fast inhibitory process based on global familiarity; and (2) a relatively slow facilitatory process based on the retrieval of specific episodic information. In three studies, we manipulated speed-stress to influence the balance between the two processes. Experiment 1 showed item-specific improvement for repeated nonwords in a standard "respond-when-ready" lexical decision task. Experiment 2 used a 400-ms deadline procedure and showed performance for nonwords to be unaffected by up to four prior presentations. In Experiment 3 we used a signal-to-respond procedure with variable time intervals and found negative repetition priming for repeated nonwords. These results can be accounted for by dual-process models of lexical decision.

  15. BANSHEE: High-voltage repetitively pulsed electron-beam driver

    SciTech Connect

    VanHaaften, F.

    1992-01-01

    BANSHEE (Beam Accelerator for a New Source of High-Energy Electrons) this is a high-voltage modulator is used to produce a high-current relativistic electron beam for high-power microwave tube development. The goal of the BANSHEE research is first to achieve a voltage pulse of 700--750 kV with a 1-{mu}s pulse width driving a load of {approximately}100 {Omega}, the pulse repetition frequency (PRF) of a few hertz. The ensuing goal is to increase the pulse amplitude to a level approaching 1 MV. We conducted tests using half the modulator with an output load of 200 {Omega}, up to a level of {approximately}650 kV at a PRF of 1 Hz and 525 kV at a PRF of 5 Hz. We then conducted additional testing using the complete system driving a load of {approximately}100 {Omega}.

  16. BANSHEE: High-voltage repetitively pulsed electron-beam driver

    SciTech Connect

    VanHaaften, F.

    1992-08-01

    BANSHEE (Beam Accelerator for a New Source of High-Energy Electrons) this is a high-voltage modulator is used to produce a high-current relativistic electron beam for high-power microwave tube development. The goal of the BANSHEE research is first to achieve a voltage pulse of 700--750 kV with a 1-{mu}s pulse width driving a load of {approximately}100 {Omega}, the pulse repetition frequency (PRF) of a few hertz. The ensuing goal is to increase the pulse amplitude to a level approaching 1 MV. We conducted tests using half the modulator with an output load of 200 {Omega}, up to a level of {approximately}650 kV at a PRF of 1 Hz and 525 kV at a PRF of 5 Hz. We then conducted additional testing using the complete system driving a load of {approximately}100 {Omega}.

  17. Long-life power sources for continuous and repetitive loads

    SciTech Connect

    Young, T.J.

    1982-03-01

    Long life electrical power sources compatible with continuous and repetitive pulse loads are of increasing interest for Sandia systems. Both primary chemical batteries and radioisotopic thermoelectric generators (RTG) are capable of supplying power for long periods of time. However, each has its particular advantages and disadvantages and neither alone may represent a good match to the system constraints. The purpose of this report is to provide some insight into the power, volume, and cost trade-offs between either of these sources alone and between hybrids consisting of RTGs with primary batteries, secondary batteries, or capacitors. These trade-offs suggest that the hybrid power sources may have significant volume and cost advantages for many applications.

  18. Repetition blindness and homophone blindness in young and older adults.

    PubMed

    Tyrrell, Caitlin J; James, Lori E; Noble, Paula M

    2016-11-01

    We tested age effects on repetition blindness (RB), defined as the reduced probability of reporting a target word following presentation of the same word in a rapidly presented list. We also tested age effects on homophone blindness (HB), in which the first word is a homophone of the target word rather than a repeated word. Thirty young and 28 older adults viewed rapidly presented lists of words containing repeated, homophone, or unrepeated word pairs and reported all of the words immediately after each list. Older adults exhibited a greater degree of RB and HB than young adults using a conditional scoring method that provides certainty that blindness has occurred. The existence of RB and HB for both age groups, and increased blindness for older compared to young adults, supports predictions of a binding theory that has successfully accounted for a wide range of phenomena in cognitive aging.

  19. Report on computation of repetitive hyperbaric-hypobaric decompression tables

    NASA Technical Reports Server (NTRS)

    Edel, P. O.

    1975-01-01

    The tables were constructed specifically for NASA's simulated weightlessness training program; they provide for 8 depth ranges covering depths from 7 to 47 FSW, with exposure times of 15 to 360 minutes. These tables were based up on an 8 compartment model using tissue half-time values of 5 to 360 minutes and Workmanline M-values for control of the decompression obligation resulting from hyperbaric exposures. Supersaturation ratios of 1.55:1 to 2:1 were used for control of ascents to altitude following such repetitive dives. Adequacy of the method and the resultant tables were determined in light of past experience with decompression involving hyperbaric-hypobaric interfaces in human exposures. Using these criteria, the method showed conformity with empirically determined values. In areas where a discrepancy existed, the tables would err in the direction of safety.

  20. Resistive Wall Heating of the Undulator in High Repetition Rate

    SciTech Connect

    Qiang, J; Corlett, J; Emma, P; Wu, J

    2012-05-20

    In next generation high repetition rate FELs, beam energy loss due to resistive wall wakefields will produce significant amount of heat. The heat load for a superconducting undulator (operating at low temperature), must be removed and will be expensive to remove. In this paper, we study this effect in an undulator proposed for a Next Generation Light Source (NGLS) at LBNL. We benchmark our calculations with measurements at the LCLS and carry out detailed parameter studies using beam from a start-to-end simulation. Our preliminarym results suggest that the heat load in the undulator is about 2 W/m or lower with an aperture size of 6 mm for nominal NGLS preliminary design parameters.

  1. Electrodermal and behavioral responses of children with autism spectrum disorders to sensory and repetitive stimuli.

    PubMed

    McCormick, Carolyn; Hessl, David; Macari, Suzanne L; Ozonoff, Sally; Green, Cherie; Rogers, Sally J

    2014-08-01

    Parents frequently report that their children with autism spectrum disorders (ASD) respond atypically to sensory stimuli. Repetitive behaviors are also part of the ASD behavioral profile. Abnormal physiological arousal may underlie both of these symptoms. Electrodermal activity (EDA) is an index of sympathetic nervous system arousal. The goals of this study were twofold: (1) to pilot methods for collecting EDA data in young children and (2) to examine hypothesized relationships among EDA, and sensory symptoms and repetitive behaviors in children with ASD as compared with children with typical development. EDA was recorded on 54 young children with ASD and on 33 children with typical development (TD) during a protocol that included baseline, exposure to sensory and repetitive stimuli, and play. Parents completed standardized questionnaires regarding their child's sensory symptoms and repetitive behaviors. Frequency and type of repetitive behavior during play was coded offline. Comparisons between EDA data for ASD and TD groups indicated no significant between-group differences in any measures. Parents of children with ASD reported more abnormal responses to sensory stimuli and more repetitive behaviors, but scores on these measures were not significantly correlated with EDA or with frequency of observed repetitive behaviors. Parent report of frequency and severity of sensory symptoms was significantly correlated with reports of repetitive behaviors in both groups. Although parents of children with ASD report high levels of sensory symptoms and repetitive behaviors, these differences are not related to measured EDA arousal or reactivity. PMID:24788961

  2. Fast repetition rate (FRR) fluorometer and method for measuring fluorescence and photosynthetic parameters

    DOEpatents

    Kolber, Z.; Falkowski, P.

    1995-06-20

    A fast repetition rate fluorometer device and method for measuring in vivo fluorescence of phytoplankton or higher plants chlorophyll and photosynthetic parameters of phytoplankton or higher plants is revealed. The phytoplankton or higher plants are illuminated with a series of fast repetition rate excitation flashes effective to bring about and measure resultant changes in fluorescence yield of their Photosystem II. The series of fast repetition rate excitation flashes has a predetermined energy per flash and a rate greater than 10,000 Hz. Also, disclosed is a flasher circuit for producing the series of fast repetition rate flashes. 14 figs.

  3. Imaging distributed and massed repetitions of natural scenes: spontaneous retrieval and maintenance.

    PubMed

    Bradley, Margaret M; Costa, Vincent D; Ferrari, Vera; Codispoti, Maurizio; Fitzsimmons, Jeffrey R; Lang, Peter J

    2015-04-01

    Repetitions that are distributed (spaced) across time prompt enhancement of a memory-related event-related potential, compared to when repetitions are massed (contiguous). Here, we used fMRI to investigate neural enhancement and suppression effects during free viewing of natural scenes that were either novel or repeated four times with massed or distributed repetitions. Distributed repetition was uniquely associated with a repetition enhancement effect in a bilateral posterior parietal cluster that included the precuneus and posterior cingulate and which has previously been implicated in episodic memory retrieval. Unique to massed repetition, conversely, was enhancement in a right dorsolateral prefrontal cluster that has been implicated in short-term maintenance. Repetition suppression effects for both types of spacing were widespread in regions activated during novel picture processing. Taken together, the data are consistent with a hypothesis that distributed repetition prompts spontaneous retrieval of prior occurrences, whereas massed repetition prompts short-term maintenance of the episodic representation, due to contiguous presentation. These processing differences may mediate the classic spacing effect in learning and memory.

  4. Fast repetition rate (FRR) fluorometer and method for measuring fluorescence and photosynthetic parameters

    DOEpatents

    Kolber, Zbigniew; Falkowski, Paul

    1995-06-20

    A fast repetition rate fluorometer device and method for measuring in vivo fluorescence of phytoplankton or higher plants chlorophyll and photosynthetic parameters of phytoplankton or higher plants by illuminating the phytoplankton or higher plants with a series of fast repetition rate excitation flashes effective to bring about and measure resultant changes in fluorescence yield of their Photosystem II. The series of fast repetition rate excitation flashes has a predetermined energy per flash and a rate greater than 10,000 Hz. Also, disclosed is a flasher circuit for producing the series of fast repetition rate flashes.

  5. Examining the Interaction of Force and Repetition on Musculoskeletal Disorder Risk: A Systematic Literature Review

    PubMed Central

    Gallagher, Sean; Heberger, John R.

    2015-01-01

    Objective Our aims were (a) to perform a systematic literature review of epidemiological studies that examined the interaction of force and repetition with respect to musculoskeletal disorder (MSD) risk, (b) to assess the relationship of force and repetition in fatigue failure studies of musculoskeletal tissues, and (c) to synthesize these findings. Background Many epidemiological studies have examined the effects of force and repetition on MSD risk; however, relatively few have examined the interaction between these risk factors. Method In a literature search, we identified 12 studies that allowed evaluation of a force−repetition interaction with respect to MSD risk. Identified studies were subjected to a methodological quality assessment and critical review. We evaluated laboratory studies of fatigue failure to examine tissue failure responses to force and repetition. Results Of the 12 epidemiological studies that tested a Force × Repetition interaction, 10 reported evidence of interaction. Based on these results, the suggestion is made that force and repetition may be interdependent in terms of their influence on MSD risk. Fatigue failure studies of musculoskeletal tissues show a pattern of failure that mirrors the MSD risk observed in epidemiological studies. Conclusions Evidence suggests that there may be interdependence between force and repetition with respect to MSD risk. Repetition seems to result in modest increases in risk for low−force tasks but rapid increases in risk for high−force tasks. This interaction may be representative of a fatigue failure process in affected tissues. PMID:23516797

  6. Detecting, grouping, and structure inference for invariant repetitive patterns in images.

    PubMed

    Cai, Yunliang; Baciu, George

    2013-06-01

    The efficient and robust extraction of invariant patterns from an image is a long-standing problem in computer vision. Invariant structures are often related to repetitive or near-repetitive patterns. The perception of repetitive patterns in an image is strongly linked to the visual interpretation and composition of textures. Repetitive patterns are products of both repetitive structures as well as repetitive reflections or color patterns. In other words, patterns that exhibit near-stationary behavior provide rich information about objects, their shapes, and their texture in an image. In this paper, we propose a new algorithm for repetitive pattern detection and grouping. The algorithm follows the classical region growing image segmentation scheme. It utilizes a mean-shift-like dynamic to group local image patches into clusters. It exploits a continuous joint alignment to: 1) match similar patches, and 2) refine the subspace grouping. We also propose an algorithm for inferring the composition structure of the repetitive patterns. The inference algorithm constructs a data-driven structural completion field, which merges the detected repetitive patterns into specific global geometric structures. The result of higher level grouping for image patterns can be used to infer the geometry of objects and estimate the general layout of a crowded scene. PMID:23481858

  7. Chromatin and RNAi factors protect the C. elegans germline against repetitive sequences

    PubMed Central

    Robert, Valérie J.P.; Sijen, Titia; van Wolfswinkel, Josien; Plasterk, Ronald H.A.

    2005-01-01

    Protection of genomes against invasion by repetitive sequences, such as transposons, viruses, and repetitive transgenes, involves strong and selective silencing of these sequences. During silencing of repetitive transgenes, a trans effect (“cosuppression”) occurs that results in silencing of cognate endogenous genes. Here we report RNA interference (RNAi) screens performed to catalog genes required for cosuppression in the Caenorhabditis elegans germline. We find factors with a putative role in chromatin remodeling and factors involved in RNAi. Together with molecular data also presented in this study, these results suggest that in C. elegans repetitive sequences trigger transcriptional gene silencing using RNAi and chromatin factors. PMID:15774721

  8. Electrodermal and behavioral responses of children with autism spectrum disorders to sensory and repetitive stimuli.

    PubMed

    McCormick, Carolyn; Hessl, David; Macari, Suzanne L; Ozonoff, Sally; Green, Cherie; Rogers, Sally J

    2014-08-01

    Parents frequently report that their children with autism spectrum disorders (ASD) respond atypically to sensory stimuli. Repetitive behaviors are also part of the ASD behavioral profile. Abnormal physiological arousal may underlie both of these symptoms. Electrodermal activity (EDA) is an index of sympathetic nervous system arousal. The goals of this study were twofold: (1) to pilot methods for collecting EDA data in young children and (2) to examine hypothesized relationships among EDA, and sensory symptoms and repetitive behaviors in children with ASD as compared with children with typical development. EDA was recorded on 54 young children with ASD and on 33 children with typical development (TD) during a protocol that included baseline, exposure to sensory and repetitive stimuli, and play. Parents completed standardized questionnaires regarding their child's sensory symptoms and repetitive behaviors. Frequency and type of repetitive behavior during play was coded offline. Comparisons between EDA data for ASD and TD groups indicated no significant between-group differences in any measures. Parents of children with ASD reported more abnormal responses to sensory stimuli and more repetitive behaviors, but scores on these measures were not significantly correlated with EDA or with frequency of observed repetitive behaviors. Parent report of frequency and severity of sensory symptoms was significantly correlated with reports of repetitive behaviors in both groups. Although parents of children with ASD report high levels of sensory symptoms and repetitive behaviors, these differences are not related to measured EDA arousal or reactivity.

  9. Repetitive, plasma switched, gigawatt, ultra-wideband impulse transmitter development

    SciTech Connect

    Clark, R.S.; Rinehart, L.F.; Buttram, M.T.; Aurand, J.F.; Lundstrom, J.M.; Patterson, P.E.; Roose, L.D.; Crowe, W.

    1992-09-01

    Sandia National Laboratories has developed several repetitive, ultra-wideband (UWB), impulse transmitters to address impulse source, and to support experimental applications. The sources fall into two different classes, pulse peaking and pulse shorting. SNIPER (Sub-Nanosecond ImPulsE Radiator) is a source which uses an oil peaking switch to obtain a fast risetime (250-pS) pulse of 2-nS duration. The output voltage ranges between few tens of kilovolts to 250-kV. EMBL (EnantioMorphic Blumlein) is a similar device (presently under development) which uses a gas switch to short the falling portion of a 2-nS pulse to approximately 100-pS. To date, an output voltage of approximately 600-kV has been obtained (700-kV is the design goal). Depending upon the source, repetitive operation from single shot to 5-kHz (1-kHz nominal) has been obtained with excellent reliability and repeatability. Both sources are plasma switched impulse transmitters using a Hydrogen-thyratron based modulator, an oil-filled Blumlein (of two types), a peaking (or shorting) switch and a wideband TEM horn. Powers exceeding one-gigawatt are routinely generated. This technology appears to be extendable to at least 10-gigawatts. The frequency spectrum of the radiated pulse from these sources include the spectrum of 100-MHz to 3-GHz. The pulse is generated externally and then injected into the antenna. Due to the high powers involved and the need to radiate a broad spectrum of frequencies, Sandia has concentrated on TEM horn antennas. Several TEM horns have been built and used during this program. In those cases where higher gains are desired for the higher frequencies, TEM horn-fed dish antennas have been employed. A detailed overview of the UWB Transmitters along with measured radiated electric field strengths will be presented.

  10. Repetitive, plasma switched, gigawatt, ultra-wideband impulse transmitter development

    SciTech Connect

    Clark, R.S.; Rinehart, L.F.; Buttram, M.T.; Aurand, J.F.; Lundstrom, J.M.; Patterson, P.E.; Roose, L.D.; Crowe, W.

    1992-01-01

    Sandia National Laboratories has developed several repetitive, ultra-wideband (UWB), impulse transmitters to address impulse source, and to support experimental applications. The sources fall into two different classes, pulse peaking and pulse shorting. SNIPER (Sub-Nanosecond ImPulsE Radiator) is a source which uses an oil peaking switch to obtain a fast risetime (250-pS) pulse of 2-nS duration. The output voltage ranges between few tens of kilovolts to 250-kV. EMBL (EnantioMorphic Blumlein) is a similar device (presently under development) which uses a gas switch to short the falling portion of a 2-nS pulse to approximately 100-pS. To date, an output voltage of approximately 600-kV has been obtained (700-kV is the design goal). Depending upon the source, repetitive operation from single shot to 5-kHz (1-kHz nominal) has been obtained with excellent reliability and repeatability. Both sources are plasma switched impulse transmitters using a Hydrogen-thyratron based modulator, an oil-filled Blumlein (of two types), a peaking (or shorting) switch and a wideband TEM horn. Powers exceeding one-gigawatt are routinely generated. This technology appears to be extendable to at least 10-gigawatts. The frequency spectrum of the radiated pulse from these sources include the spectrum of 100-MHz to 3-GHz. The pulse is generated externally and then injected into the antenna. Due to the high powers involved and the need to radiate a broad spectrum of frequencies, Sandia has concentrated on TEM horn antennas. Several TEM horns have been built and used during this program. In those cases where higher gains are desired for the higher frequencies, TEM horn-fed dish antennas have been employed. A detailed overview of the UWB Transmitters along with measured radiated electric field strengths will be presented.

  11. Energy coupling to the plasma in repetitive nanosecond pulse discharges

    SciTech Connect

    Adamovich, Igor V.; Nishihara, Munetake; Choi, Inchul; Uddi, Mruthunjaya; Lempert, Walter R.

    2009-11-15

    A new analytic quasi-one-dimensional model of energy coupling to nanosecond pulse discharge plasmas in plane-to-plane geometry has been developed. The use of a one-dimensional approach is based on images of repetitively pulsed nanosecond discharge plasmas in dry air demonstrating that the plasma remains diffuse and uniform on a nanosecond time scale over a wide range of pressures. The model provides analytic expressions for the time-dependent electric field and electron density in the plasma, electric field in the sheath, sheath boundary location, and coupled pulse energy. The analytic model predictions are in very good agreement with numerical calculations. The model demonstrates that (i) the energy coupled to the plasma during an individual nanosecond discharge pulse is controlled primarily by the capacitance of the dielectric layers and by the breakdown voltage and (ii) the pulse energy coupled to the plasma during a burst of nanosecond pulses decreases as a function of the pulse number in the burst. This occurs primarily because of plasma temperature rise and resultant reduction in breakdown voltage, such that the coupled pulse energy varies approximately proportionally to the number density. Analytic expression for coupled pulse energy scaling has been incorporated into the air plasma chemistry model, validated previously by comparing with atomic oxygen number density measurements in nanosecond pulse discharges. The results of kinetic modeling using the modified air plasma chemistry model are compared with time-resolved temperature measurements in a repetitively pulsed nanosecond discharge in air, by emission spectroscopy, and purely rotational coherent anti-Stokes Raman spectroscopy showing good agreement.

  12. Energy coupling to the plasma in repetitive nanosecond pulse discharges

    NASA Astrophysics Data System (ADS)

    Adamovich, Igor V.; Nishihara, Munetake; Choi, Inchul; Uddi, Mruthunjaya; Lempert, Walter R.

    2009-11-01

    A new analytic quasi-one-dimensional model of energy coupling to nanosecond pulse discharge plasmas in plane-to-plane geometry has been developed. The use of a one-dimensional approach is based on images of repetitively pulsed nanosecond discharge plasmas in dry air demonstrating that the plasma remains diffuse and uniform on a nanosecond time scale over a wide range of pressures. The model provides analytic expressions for the time-dependent electric field and electron density in the plasma, electric field in the sheath, sheath boundary location, and coupled pulse energy. The analytic model predictions are in very good agreement with numerical calculations. The model demonstrates that (i) the energy coupled to the plasma during an individual nanosecond discharge pulse is controlled primarily by the capacitance of the dielectric layers and by the breakdown voltage and (ii) the pulse energy coupled to the plasma during a burst of nanosecond pulses decreases as a function of the pulse number in the burst. This occurs primarily because of plasma temperature rise and resultant reduction in breakdown voltage, such that the coupled pulse energy varies approximately proportionally to the number density. Analytic expression for coupled pulse energy scaling has been incorporated into the air plasma chemistry model, validated previously by comparing with atomic oxygen number density measurements in nanosecond pulse discharges. The results of kinetic modeling using the modified air plasma chemistry model are compared with time-resolved temperature measurements in a repetitively pulsed nanosecond discharge in air, by emission spectroscopy, and purely rotational coherent anti-Stokes Raman spectroscopy showing good agreement.

  13. Semantic congruence affects hippocampal response to repetition of visual associations.

    PubMed

    McAndrews, Mary Pat; Girard, Todd A; Wilkins, Leanne K; McCormick, Cornelia

    2016-09-01

    Recent research has shown complementary engagement of the hippocampus and medial prefrontal cortex (mPFC) in encoding and retrieving associations based on pre-existing or experimentally-induced schemas, such that the latter supports schema-congruent information whereas the former is more engaged for incongruent or novel associations. Here, we attempted to explore some of the boundary conditions in the relative involvement of those structures in short-term memory for visual associations. The current literature is based primarily on intentional evaluation of schema-target congruence and on study-test paradigms with relatively long delays between learning and retrieval. We used a continuous recognition paradigm to investigate hippocampal and mPFC activation to first and second presentations of scene-object pairs as a function of semantic congruence between the elements (e.g., beach-seashell versus schoolyard-lamp). All items were identical at first and second presentation and the context scene, which was presented 500ms prior to the appearance of the target object, was incidental to the task which required a recognition response to the central target only. Very short lags 2-8 intervening stimuli occurred between presentations. Encoding the targets with congruent contexts was associated with increased activation in visual cortical regions at initial presentation and faster response time at repetition, but we did not find enhanced activation in mPFC relative to incongruent stimuli at either presentation. We did observe enhanced activation in the right anterior hippocampus, as well as regions in visual and lateral temporal and frontal cortical regions, for the repetition of incongruent scene-object pairs. This pattern demonstrates rapid and incidental effects of schema processing in hippocampal, but not mPFC, engagement during continuous recognition. PMID:27449709

  14. Repetitive Pediatric Anesthesia in a Non-Hospital Setting

    SciTech Connect

    Buchsbaum, Jeffrey C.; McMullen, Kevin P.; Douglas, James G.; Jackson, Jeffrey L.; Simoneaux, R. Victor; Hines, Matthew; Bratton, Jennifer; Kerstiens, John; Johnstone, Peter A.S.

    2013-04-01

    Purpose: Repetitive sedation/anesthesia (S/A) for children receiving fractionated radiation therapy requires induction and recovery daily for several weeks. In the vast majority of cases, this is accomplished in an academic center with direct access to pediatric faculty and facilities in case of an emergency. Proton radiation therapy centers are more frequently free-standing facilities at some distance from specialized pediatric care. This poses a potential dilemma in the case of children requiring anesthesia. Methods and Materials: The records of the Indiana University Health Proton Therapy Center were reviewed for patients requiring anesthesia during proton beam therapy (PBT) between June 1, 2008, and April 12, 2012. Results: A total of 138 children received daily anesthesia during this period. A median of 30 fractions (range, 1-49) was delivered over a median of 43 days (range, 1-74) for a total of 4045 sedation/anesthesia procedures. Three events (0.0074%) occurred, 1 fall from a gurney during anesthesia recovery and 2 aspiration events requiring emergency department evaluation. All 3 children did well. One aspiration patient needed admission to the hospital and mechanical ventilation support. The other patient returned the next day for treatment without issue. The patient who fell was not injured. No patient required cessation of therapy. Conclusions: This is the largest reported series of repetitive pediatric anesthesia in radiation therapy, and the only available data from the proton environment. Strict adherence to rigorous protocols and a well-trained team can safely deliver daily sedation/anesthesia in free-standing proton centers.

  15. Dissecting the functional anatomy of auditory word repetition

    PubMed Central

    Hope, Thomas M. H.; Prejawa, Susan; Parker Jones, ‘Ōiwi; Oberhuber, Marion; Seghier, Mohamed L.; Green, David W.; Price, Cathy J.

    2013-01-01

    This fMRI study used a single, multi-factorial, within-subjects design to dissociate multiple linguistic and non-linguistic processing areas that are all involved in repeating back heard words. The study compared: (1) auditory to visual inputs; (2) phonological to non-phonological inputs; (3) semantic to non-semantic inputs; and (4) speech production to finger-press responses. The stimuli included words (semantic and phonological inputs), pseudowords (phonological input), pictures and sounds of animals or objects (semantic input), and colored patterns and hums (non-semantic and non-phonological). The speech production tasks involved auditory repetition, reading, and naming while the finger press tasks involved one-back matching. The results from the main effects and interactions were compared to predictions from a previously reported functional anatomical model of language based on a meta-analysis of many different neuroimaging experiments. Although many findings from the current experiment replicated many of those predicted, our within-subject design also revealed novel results by providing sufficient anatomical precision to dissect several different regions within the anterior insula, pars orbitalis, anterior cingulate, SMA, and cerebellum. For example, we found one part of the pars orbitalis was involved in phonological processing and another in semantic processing. We also dissociated four different types of phonological effects in the left superior temporal sulcus (STS), left putamen, left ventral premotor cortex, and left pars orbitalis. Our findings challenge some of the commonly-held opinions on the functional anatomy of language, and resolve some previously conflicting findings about specific brain regions—and our experimental design reveals details of the word repetition process that are not well captured by current models. PMID:24834043

  16. Repetition priming in selective attention: A TVA analysis.

    PubMed

    Ásgeirsson, Árni Gunnar; Kristjánsson, Árni; Bundesen, Claus

    2015-09-01

    Current behavior is influenced by events in the recent past. In visual attention, this is expressed in many variations of priming effects. Here, we investigate color priming in a brief exposure digit-recognition task. Observers performed a masked odd-one-out singleton recognition task where the target-color either repeated or changed between subsequent trials. Performance was measured by recognition accuracy over exposure durations. The purpose of the study was to replicate earlier findings of perceptual priming in brief displays and to model those results based on a Theory of Visual Attention (TVA; Bundesen, 1990). We tested 4 different definitions of a generic TVA-model and assessed their explanatory power. Our hypothesis was that priming effects could be explained by selective mechanisms, and that target-color repetitions would only affect the selectivity parameter (α) of our models. Repeating target colors enhanced performance for all 12 observers. As predicted, this was only true under conditions that required selection of a target among distractors, but not when a target was presented alone. Model fits by TVA were obtained with a trial-by-trial maximum likelihood estimation procedure that estimated 4-15 free parameters, depending on the particular model. We draw two main conclusions. Color priming can be modeled simply as a change in selectivity between conditions of repetition or swap of target color. Depending on the desired resolution of analysis; priming can accurately be modeled by a simple four parameter model, where VSTM capacity and spatial biases of attention are ignored, or more fine-grained by a 10 parameter model that takes these aspects into account.

  17. Nonword Repetition in Children and Adults: Effects on Movement Coordination

    PubMed Central

    Sasisekaran, Jayanthi; Smith, Anne; Sadagopan, Neeraja; Weber-Fox, Christine

    2009-01-01

    Hearing and repeating novel phonetic sequences, or novel nonwords, is a task that taps many levels of processing, including auditory decoding, phonological processing, working memory, speech motor planning and execution. Investigations of nonword repetition abilities have been framed within models of psycholinguistic processing, while the motor aspects, which also are critical for task performance, have been largely ignored. We focused our investigation on both the behavioral and speech motor performance characteristics of this task as performed in a learning paradigm by 9- and-10 year-old children and young adults. Behavioral (percent correct productions) and kinematic (movement duration, lip aperture variability -an index of the consistency of inter-articulator coordination on repeated trials) measures were obtained in order to investigate the short-term (Day 1, first 5 vs. next 5 trials) and longer-term (Day 1 vs. Day 2, first 5 vs. next 5 trials) changes associated with practice within and between sessions. Overall, as expected, young adults showed higher levels of behavioral accuracy and greater levels of coordinative consistency than the children. Both groups, however, showed a learning effect, such that in general, later Day 1 trials and Day 2 trials were shorter in duration and more consistent in coordination patterns than Day 1 early trials. Phonemic complexity of the nonwords had a profound effect on both the behavioral and speech motor aspects of performance. The children showed marked learning effects on all nonwords that they could produce accurately, while adults’ performance improved only when challenged by the more complex nonword stimuli in the set. The findings point to a critical role for speech motor processes within models of nonword repetition and suggest that young adults, similar to children, show short- and longer-term improvements in coordinative consistency with repeated production of complex nonwords. There is also a clear

  18. [Repetitive strain injury (RSI): occurrence, etiology, therapy and prevention].

    PubMed

    Bongers, P M; de Vet, H C W; Blatter, B M

    2002-10-19

    In the Netherlands, work related upper-limb disorders are called Repetitive Strain Injuries (RSI). RSI is not a diagnosis but a catch-all term for symptoms and signs located in the neck, upper back, shoulder, arm, elbow, hand, wrist and fingers. These symptoms may include pain, stiffness, tingling, clumsiness, loss of co-ordination, loss of strength, skin discoloration and temperature differences. Each year, 8% of working Dutch citizens take time off work due to RSI symptoms. Although the number of people claiming disability benefit due to RSI is limited, this figure has risen consecutively over the last three years. There is consensus that repetitive work at a high frequency and possibly accompanied by exertion of force is accompanied by RSI symptoms. There are indications of a relation between visual display unit use and these symptoms. However, these relations have not been established in a longitudinal study of adequate quality. High perceived job stress and a high workload are thought to be related to RSI, and women report more symptoms than men. There is insufficient information available on the role of different coping styles, perfectionism and dealing with symptoms. There is little information on the underlying mechanisms in the development of RSI, the diagnostics, therapy and prevention. In view of the lack of clear diagnostic criteria, suggestions have been made for a standardised description of the symptoms involved in the syndrome. A multidisciplinary treatment is likely to have the most effect. In terms of prevention, an integrated approach aimed at improving the working posture, reduction of static load and job stress and at individual factors is assumed to be the most effective.

  19. Hemispheric Asymmetries in Repetition Enhancement and Suppression Effects in the Newborn Brain

    PubMed Central

    Bouchon, Camillia; Nazzi, Thierry; Gervain, Judit

    2015-01-01

    Background The repeated presentation of stimuli typically attenuates neural responses (repetition suppression) or, less commonly, increases them (repetition enhancement) when stimuli are highly complex, degraded or presented under noisy conditions. In adult functional neuroimaging research, these repetition effects are considered as neural correlates of habituation. The development and respective functional significance of these effects in infancy remain largely unknown. Objective This study investigates repetition effects in newborns using functional near-infrared spectroscopy, and specifically the role of stimulus complexity in evoking a repetition enhancement vs. a repetition suppression response, following up on Gervain et al. (2008). In that study, abstract rule-learning was found at birth in cortical areas specific to speech processing, as evidenced by a left-lateralized repetition enhancement of the hemodynamic response to highly variable speech sequences conforming to a repetition-based ABB artificial grammar, but not to a random ABC grammar. Methods Here, the same paradigm was used to investigate how simpler stimuli (12 different sequences per condition as opposed to 140), and simpler presentation conditions (blocked rather than interleaved) would influence repetition effects at birth. Results Results revealed that the two grammars elicited different dynamics in the two hemispheres. In left fronto-temporal areas, we reproduce the early perceptual discrimination of the two grammars, with ABB giving rise to a greater response at the beginning of the experiment than ABC. In addition, the ABC grammar evoked a repetition enhancement effect over time, whereas a stable response was found for the ABB grammar. Right fronto-temporal areas showed neither initial discrimination, nor change over time to either pattern. Conclusion Taken together with Gervain et al. (2008), this is the first evidence that manipulating methodological factors influences the presence or

  20. The Effect of Muscle Hypoperfusion-Hyperemia on Repetitive Vertical Jump Performance.

    ERIC Educational Resources Information Center

    Howell, Amy K.; Gaughan, John P.; Cairns, Marilyn A.; Faigenbaum, Avery D.; Libonati, Joseph R.

    2001-01-01

    Determined the effects of brief hypoperfusion-hyperemia (by femoral cuff occlusion) on repetitive vertical jump performance among recreationally trained men and women. Results indicated that in a protocol of maximal repetitive vertical jumps, the power output declined by approximately 20 percent. Hypoperfusion- hyperemia had no significant effect…

  1. Nonword Repetition with Spectrally Reduced Speech: Some Developmental and Clinical Findings from Pediatric Cochlear Implantation

    ERIC Educational Resources Information Center

    Burkholder-Juhasz, Rose A.; Levi, Susannah V.; Dillon, Caitlin M.; Pisoni, David B.

    2007-01-01

    Nonword repetition skills were examined in 24 pediatric cochlear implant (CI) users and 18 normal-hearing (NH) adult listeners listening through a CI simulator. Two separate groups of NH adult listeners assigned accuracy ratings to the nonword responses of the pediatric CI users and the NH adult speakers. Overall, the nonword repetitions of…

  2. Word Repetition, Masked Orthographic Priming, and Language Switching: Bilingual Studies and BIA+ Simulations

    ERIC Educational Resources Information Center

    Lam, Kevin J. Y.; Dijkstra, Ton

    2010-01-01

    Daily conversations contain many repetitions of identical and similar word forms. For bilinguals, the words can even come from the same or different languages. How do such repetitions affect the human word recognition system? The Bilingual Interactive Activation Plus (BIA+) model provides a theoretical and computational framework for understanding…

  3. A Comparison of Repetitive Behaviors in Aspergers Disorder and High Functioning Autism

    ERIC Educational Resources Information Center

    Cuccaro, Michael L.; Nations, Laura; Brinkley, Jason; Abramson, Ruth K.; Wright, Harry H.; Hall, Alicia; Gilbert, John; Pericak-Vance, Margaret A.

    2007-01-01

    In this study we compared 33 IQ and age matched pairs of individuals with Aspergers Disorder (ASP) and high functioning autism (HFA) on measures of repetitive behavior. On the Repetitive Behavior Scale-Revised (RBS-R), the ASP and HFA groups showed no differences in RBS-R Intensity score (severity) score or Frequency score (number of problems…

  4. Method for generating high-energy and high repetition rate laser pulses from CW amplifiers

    DOEpatents

    Zhang, Shukui

    2013-06-18

    A method for obtaining high-energy, high repetition rate laser pulses simultaneously using continuous wave (CW) amplifiers is described. The method provides for generating micro-joule level energy in pico-second laser pulses at Mega-hertz repetition rates.

  5. Effects of Repetitions and Questions at Varying Lags during Self-Paced Learning from Text.

    ERIC Educational Resources Information Center

    Hayes-Roth, Barbara

    The present study investigated the effects of repetitions and questions (without feedback) at varying lags during self-paced learning from text. High school students read a series of unrelated paragraphs, each of which was repeated or tested after a variable lag. In a mixed condition, texts and repetitions of particular sentences were combined…

  6. Measuring Repetitive Behaviors as a Treatment Endpoint in Youth with Autism Spectrum Disorder

    ERIC Educational Resources Information Center

    Scahill, Lawrence; Aman, Michael G.; Lecavalier, Luc; Halladay, Alycia K.; Bishop, Somer L.; Bodfish, James W.; Grondhuis, Sabrina; Jones, Nancy; Horrigan, Joseph P.; Cook, Edwin H.; Handen, Benjamin L.; King, Bryan H.; Pearson, Deborah A.; McCracken, James T.; Sullivan, Katherine Anne; Dawson, Geraldine

    2015-01-01

    Restricted interests and repetitive behaviors vary widely in type, frequency, and intensity among children and adolescents with autism spectrum disorder. They can be stigmatizing and interfere with more constructive activities. Accordingly, restricted interests and repetitive behaviors may be a target of intervention. Several standardized…

  7. The Relationship between Anxiety and Repetitive Behaviours in Autism Spectrum Disorder

    ERIC Educational Resources Information Center

    Rodgers, J.; Glod, M.; Connolly, B.; McConachie, H.

    2012-01-01

    Children with Autism Spectrum Disorder are vulnerable to anxiety. Repetitive behaviours are a core feature of Autism Spectrum Disorder (ASD) and have been associated with anxiety. This study examined repetitive behaviours and anxiety in two groups of children with autism spectrum disorder, those with high anxiety and those with lower levels of…

  8. Nonword Repetition and Serial Recall: Equivalent Measures of Verbal Short-Term Memory?

    ERIC Educational Resources Information Center

    Archibald, Lisa M. D.; Gathercole, Susan E.

    2007-01-01

    Evidence that the abilities to repeat nonwords and to learn language are very closely related to one another has led to widespread interest in the cognitive processes underlying nonword repetition. One suggestion is that nonword repetition is a relatively pure measure of phonological short-term memory closely associated with other measures of…

  9. Repetitive Sequences in Plant Nuclear DNA: Types, Distribution, Evolution and Function

    PubMed Central

    Mehrotra, Shweta; Goyal, Vinod

    2014-01-01

    Repetitive DNA sequences are a major component of eukaryotic genomes and may account for up to 90% of the genome size. They can be divided into minisatellite, microsatellite and satellite sequences. Satellite DNA sequences are considered to be a fast-evolving component of eukaryotic genomes, comprising tandemly-arrayed, highly-repetitive and highly-conserved monomer sequences. The monomer unit of satellite DNA is 150–400 base pairs (bp) in length. Repetitive sequences may be species- or genus-specific, and may be centromeric or subtelomeric in nature. They exhibit cohesive and concerted evolution caused by molecular drive, leading to high sequence homogeneity. Repetitive sequences accumulate variations in sequence and copy number during evolution, hence they are important tools for taxonomic and phylogenetic studies, and are known as “tuning knobs” in the evolution. Therefore, knowledge of repetitive sequences assists our understanding of the organization, evolution and behavior of eukaryotic genomes. Repetitive sequences have cytoplasmic, cellular and developmental effects and play a role in chromosomal recombination. In the post-genomics era, with the introduction of next-generation sequencing technology, it is possible to evaluate complex genomes for analyzing repetitive sequences and deciphering the yet unknown functional potential of repetitive sequences. PMID:25132181

  10. Target-to-Target Repetition Cost and Location Negative Priming Are Dissociable: Evidence for Different Mechanisms

    ERIC Educational Resources Information Center

    Chao, Hsuan-Fu

    2011-01-01

    In a location-selection task, the repetition of a prior distractor location as the target location would slow down the response. This effect is termed the location negative priming (NP) effect. Recently, it has been demonstrated that repetition of a prior target location as the current target location would also slow down response. Because such…

  11. Evidence for a Non-Lexical Influence on Children's Auditory Repetition of Familiar Words

    ERIC Educational Resources Information Center

    Budd, Mary-Jane; Hanley, J. Richard; Nozari, Nazbanou

    2012-01-01

    This paper examines evidence for a nonlexical influence on children's repetition of real words. We investigate the extent to which two computational models of auditory repetition can simulate the performance of 68 children aged between 5 and 11 years-old when they are attempting to repeat familiar words. Both computational accounts were derived…

  12. Repetition Strengthens Target Recognition but Impairs Similar Lure Discrimination: Evidence for Trace Competition

    ERIC Educational Resources Information Center

    Reagh, Zachariah M.; Yassa, Michael A.

    2014-01-01

    Most theories of memory assume that representations are strengthened with repetition. We recently proposed Competitive Trace Theory, building on the hippocampus' powerful capacity to orthogonalize inputs into distinct outputs. We hypothesized that repetition elicits a similar but nonidentical memory trace, and that contextual details of…

  13. Repetitive, duplicate, and redundant publications: a review for authors and readers.

    PubMed

    Johnson, Claire

    2006-09-01

    Repetitive, duplicate, and redundant publications are an important concern in the scientific literature. Their occurrence affects science and carries with it sanctions of consequence. This editorial provides a brief review of the definitions, classifications, impact, sanctions, and prevention strategies regarding repetitive, duplicate, and redundant publications.

  14. On the Road to Science Literacy: Building Confidence and Competency in Technical Language through Choral Repetition

    ERIC Educational Resources Information Center

    Hohenshell, Liesl M.; Woller, Michael J.; Sherlock, Wallace

    2013-01-01

    In order to be successful, students must acquire the language of science for both oral and written communication. In this article we examine an oral language learning technique called choral repetition for its role in building literacy in the context of an animal physiology course. For 3 weeks, the instructor conducted choral repetitions of nine…

  15. The Function of Repeating: The Relation between Word Class and Repetition Type in Developmental Stuttering

    ERIC Educational Resources Information Center

    Buhr, Anthony P.; Jones, Robin M.; Conture, Edward G.; Kelly, Ellen M.

    2016-01-01

    Background: It is already known that preschool-age children who stutter (CWS) tend to stutter on function words at the beginning of sentences. It is also known that phonological errors potentially resulting in part-word repetitions tend to occur on content words. However, the precise relation between word class and repetition type in preschool-age…

  16. Examining the Relationship between Executive Functions and Restricted, Repetitive Symptoms of Autistic Disorder

    ERIC Educational Resources Information Center

    Lopez, Brian R.; Lincoln, Alan J.; Ozonoff, Sally; Lai, Zona

    2005-01-01

    The executive function theory was utilized to examine the relationship between cognitive process and the restricted, repetitive symptoms of Autistic Disorder (AD). Seventeen adults with AD were compared to 17 nonautistic controls on a new executive function battery (Delis-Kaplin Executive Function Scales). Restricted, repetitive symptoms were…

  17. Repetitive Behavior in Rubinstein-Taybi Syndrome: Parallels with Autism Spectrum Phenomenology

    ERIC Educational Resources Information Center

    Waite, Jane; Moss, Joanna; Beck, Sarah R.; Richards, Caroline; Nelson, Lisa; Arron, Kate; Burbidge, Cheryl; Berg, Katy; Oliver, Chris

    2015-01-01

    Syndrome specific repetitive behavior profiles have been described previously. A detailed profile is absent for Rubinstein-Taybi syndrome (RTS). The Repetitive Behaviour Questionnaire and Social Communication Questionnaire were completed for children and adults with RTS (N = 87), Fragile-X (N = 196) and Down (N = 132) syndromes, and individuals…

  18. Validation of the Repetitive Behaviour Questionnaire for Use with Children with Autism Spectrum Disorder

    ERIC Educational Resources Information Center

    Honey, Emma; McConachie, Helen; Turner, Michelle; Rodgers, Jacqui

    2012-01-01

    The repetitive behaviour questionnaire (RBQ) (Turner, 1995) is one of the three most commonly used interview/questionnaire measures of repetitive behaviour (Honey et al., in preparation). Despite this there is a scarcity of information concerning its structure, reliability and validity. The psychometric properties of the RBQ were examined when…

  19. Comparing Communicative Competence in Child and Chimp: The Pragmatics of Repetition.

    ERIC Educational Resources Information Center

    Greenfield, Patricia M.; Savage-Rumbaugh, E. Sue

    1993-01-01

    Through analysis of chimpanzee-human discourse, study shows that four chimpanzees exposed to humanly devised symbol system use partial or complete repetition of others' symbols. They do not produce rote imitations but use repetition to fulfill variety of pragmatic functions in discourse. Theories are advanced regarding meaning of two differences…

  20. Topic Repetitiveness after Traumatic Brain Injury: An Emergent, Jointly Managed Behaviour

    ERIC Educational Resources Information Center

    Body, Richard; Parker, Mark

    2005-01-01

    Topic repetitiveness is a common component of pragmatic impairment and a powerful contributor to social exclusion. Despite this, description, characterization and intervention remain underdeveloped. This article explores the nature of repetitiveness in traumatic brain injury (TBI). A case study of one individual after TBI provides the basis for a…

  1. The Repetitive Behavior Scale-Revised: Independent Validation in Individuals with Autism Spectrum Disorders

    ERIC Educational Resources Information Center

    Lam, Kristen S. L.; Aman, Michael G.

    2007-01-01

    A key feature of autism is restricted repetitive behavior (RRB). Despite the significance of RRBs, little is known about their phenomenology, assessment, and treatment. The Repetitive Behavior Scale-Revised (RBS-R) is a recently-developed questionnaire that captures the breadth of RRB in autism. To validate the RBS-R in an independent sample, we…

  2. Not All Disfluencies Are Are Equal: The Effects of Disfluent Repetitions on Language Comprehension

    ERIC Educational Resources Information Center

    MacGregor, Lucy J.; Corley, Martin; Donaldson, David I.

    2009-01-01

    Disfluencies can affect language comprehension, but to date, most studies have focused on disfluent pauses such as "er". We investigated whether disfluent repetitions in speech have discernible effects on listeners during language comprehension, and whether repetitions affect the linguistic processing of subsequent words in speech in ways which…

  3. Repetitive and Ritualistic Behaviour in Children with Prader-Willi Syndrome and Children with Autism

    ERIC Educational Resources Information Center

    Greaves, N.; Prince, E.; Evans, D. W.; Charman, T.

    2006-01-01

    Background: Recent research has shown that the range of repetitive behaviour seen in individuals with Prader-Willi syndrome (PWS) extends beyond food-related behaviour. Methods: The presence and intensity of repetitive, rigid and routinized behaviour in children with PWS was compared with that seen in children with another neurodevelopmental…

  4. Feature Integration and Task Switching: Diminished Switch Costs after Controlling for Stimulus, Response, and Cue Repetitions

    PubMed Central

    Schmidt, James R.; Liefooghe, Baptist

    2016-01-01

    This report presents data from two versions of the task switching procedure in which the separate influence of stimulus repetitions, response key repetitions, conceptual response repetitions, cue repetitions, task repetitions, and congruency are considered. Experiment 1 used a simple alternating runs procedure with parity judgments of digits and consonant/vowel decisions of letters as the two tasks. Results revealed sizable effects of stimulus and response repetitions, and controlling for these effects reduced the switch cost. Experiment 2 was a cued version of the task switch paradigm with parity and magnitude judgments of digits as the two tasks. Results again revealed large effects of stimulus and response repetitions, in addition to cue repetition effects. Controlling for these effects again reduced the switch cost. Congruency did not interact with our novel “unbiased” measure of switch costs. We discuss how the task switch paradigm might be thought of as a more complex version of the feature integration paradigm and propose an episodic learning account of the effect. We further consider to what extent appeals to higher-order control processes might be unnecessary and propose that controls for feature integration biases should be standard practice in task switching experiments. PMID:26964102

  5. Repetition of Words and Non-Words in Typically Developing Children: The Role of Prosody

    ERIC Educational Resources Information Center

    Sundström, Simon; Samuelsson, Christina; Lyxell, Björn

    2014-01-01

    In this study, segmental and prosodic aspects of word repetition and non-word repetition in typically developing children aged four to six years were investigated. Focus was on developmental differences, and on how tonal word accent and word length affect segment production accuracy. Prosodically controlled words and non-words were repeated by 44…

  6. Motor Control and Nonword Repetition in Specific Working Memory Impairment and SLI

    ERIC Educational Resources Information Center

    Archibald, Lisa M. D.; Joanisse, Marc F.; Munson, Benjamin

    2013-01-01

    Purpose: Debate around the underlying cognitive factors leading to poor performance in the repetition of nonwords by children with developmental impairments in language has centered around phonological short-term memory, lexical knowledge, and other factors. This study examines the impact of motor control demands on nonword repetition in groups of…

  7. Sentence Repetition as a Language Assessment Technique; Some Issues and Applications.

    ERIC Educational Resources Information Center

    Natalicio, Diana S.

    The need for adequate language assessment techniques has grown as schools attempt to deal with linguistically different pupils. Many testing procedures have been developed to meet this need; sentence repetition is one such procedure. This paper briefly reviews three issues which have been raised concerning sentence repetition as a language…

  8. Repetitive Behavior Profiles in Asperger Syndrome and High-Functioning Autism

    ERIC Educational Resources Information Center

    South, Mikle; Ozonoff, Sally; McMahon, William M.

    2005-01-01

    Although repetitive behaviors are a core diagnostic domain for autism spectrum disorders, research in this area has been neglected. This study had two major aims (1) to provide a detailed characterization of repetitive behaviors in individuals with Asperger Syndrome (AS), high-functioning autism (HFA), and typically developing controls (TD); and…

  9. Social Promotion or Grade Repetition: What's Best for the 21st Century Student?

    ERIC Educational Resources Information Center

    Hernandez-Tutop, Jeanne

    2012-01-01

    This paper investigates the issue of social promotion and grade repetition. The first section of the literature review examines research from the past 30 to 40 years which looks at the negative and positive effects of grade repetition. Next, recent studies are examined from the late twentieth and the twenty-first century which questions the…

  10. Relatively normal repetition performance despite severe disruption of the left arcuate fasciculus.

    PubMed

    Epstein-Peterson, Zachary; Vasconcellos Faria, Andreia; Mori, Susumu; Hillis, Argye E; Tsapkini, Kyrana

    2012-01-01

    The arcuate fasciculus (AF) is believed to be fundamental to the neural circuitry behind many important cognitive processes. Connecting Wernicke's and Broca's area, these fibers are thought to be especially important for repetition. In this case study we present evidence from a patient that set doubt on these assumptions. We present structural imaging, diffusion tensor imaging, and language data on a patient with a large left-sided stroke and severely damaged left AF who showed intact word repetition and relatively intact sentence repetition performance. Specifically, his sentence repetition is more fluent and grammatical, with less hesitation than spontaneous speech, and with rare omissions only during the longest sentences. These results challenge classical theories that maintain the left AF is the dominant language processing pathway or mechanism for repetition. PMID:22229646

  11. Resistance, rupture and repetition: Civil society strategies against intimate partner violence in Cambodia.

    PubMed

    Lilja, Mona; Baaz, Mikael

    2016-01-01

    This paper offers a new interpretation of the 'resistance' carried out by local civil society organisations in Cambodia against intimate partner violence (IPV). In this, the paper explores the nexus between 'rupture', 'resistance' and 'repetition' and concludes that different 'repetitions' can contribute to acts of violence while simultaneously creating possibilities for resisting IPV. In regard to the latter, the concept of 'rupture' is investigated as a performative politics through which organisations try to disrupt the 'repetitions' of violent masculinities. Furthermore, it is argued that the importance of 'repetitions' and the concept of time should be acknowledged. The French criminal defence lawyer Jacques Vergès' understanding of 'rupture' and the French philosopher Gilles Deleuze's notions of 'repetition' inform the analysis. To exemplify our discussion and findings, the paper embraces stories of a number of civil society workers who facilitate various men's groups in Cambodia in order to negotiate the practice of IPV.

  12. Sensory features and repetitive behaviors in children with autism and developmental delays.

    PubMed

    Boyd, Brian A; Baranek, Grace T; Sideris, John; Poe, Michele D; Watson, Linda R; Patten, Elena; Miller, Heather

    2010-04-01

    This study combined parent and observational measures to examine the association between aberrant sensory features and restricted, repetitive behaviors in children with autism (N=67) and those with developmental delays (N=42). Confirmatory factor analysis was used to empirically validate three sensory constructs of interest: hyperresponsiveness, hyporesponsiveness, and sensory seeking. Examining the association between the three derived sensory factor scores and scores on the Repetitive Behavior Scales--Revised revealed the co-occurrence of these behaviors in both clinical groups. Specifically, high levels of hyperresponsive behaviors predicted high levels of repetitive behaviors, and the relationship between these variables remained the same controlling for mental age. We primarily found non-significant associations between hyporesponsiveness or sensory seeking and repetitive behaviors, with the exception that sensory seeking was associated with ritualistic/sameness behaviors. These findings suggest that shared neurobiological mechanisms may underlie hyperresponsive sensory symptoms and repetitive behaviors and have implications for diagnostic classification as well as intervention.

  13. Nanosecond repetitively pulsed discharge control of premixed lean methane-air combustion

    NASA Astrophysics Data System (ADS)

    Bak, Moon Soo; Cappelli, Mark A.

    2012-10-01

    Two-dimensional kinetic simulations are carried out to investigate the effects of the discharge repetition rate and pulse width of nanosecond repetitively pulsed discharges on stabilizing premixed lean methane-air combustion. The repetition rate and pulse widths are varied from 10 kHz to 50 kHz and from 9 ns to 2 ns respectively, while the total power is held constant. The lower repetition rates, because of their higher pulse energies, produce a larger fraction of radicals such as O, H, and OH. Surprisingly, however, the effect on flame stabilization is found to be essentially the same for all of the tested repetition rates. The shorter pulse width is found to favor the production of species in higher electronic states, but the varying effects on stabilization is also found to be small. Our results indicate that the total deposited power is the critical element that determines the extent of stabilization over this range of discharge properties studied.

  14. Attentional modulation of masked repetition and categorical priming in young and older adults.

    PubMed

    Fabre, Ludovic; Lemaire, Patrick; Grainger, Jonathan

    2007-12-01

    Three experiments examined the effects of temporal attention and aging on masked repetition and categorical priming for numbers and words. Participants' temporal attention was manipulated by varying the stimulus onset asynchrony (i.e., constant or variable SOA). In Experiment 1, participants performed a parity judgment task and a lexical decision task in which categorical priming and repetition priming were, respectively, tested. Experiment 2 used a semantic categorization task testing categorical priming. In Experiment 3, repetition and categorical priming were tested in the same semantic categorization task with the same stimuli. The results of the three experiments showed that masked repetition priming is insensitive to manipulations of temporal attention whereas categorical priming is. Furthermore, no differences were found between young and older adults in repetition priming effects, again contrasting with the categorical priming results for which older adults were more sensitive to attentional manipulations than young adults.

  15. Word repetition priming induced oscillations in auditory cortex: a magnetoencephalography study

    PubMed Central

    Tavabi, Kambiz; Embick, David; Roberts, Timothy P.L.

    2011-01-01

    Magnetoencephalography was used in a passive repetition priming paradigm. Words in two frequency bins (high/low) were presented to subjects auditorily. Subjects’ brain responses to these stimuli were analyzed using synthetic aperture magnetometry. The main finding is that single word repetition of low frequency word pairs significantly attenuated the post-second word event related desynchronization in the theta-alpha (5–15Hz) bands, 200–600ms post second word stimulus onset. Peak significance between repeated high and low frequency words was evident at ~365–465ms post target onset. This finding has implications for (i) the role of theta-alpha ERD in lexical representation and access; (ii) the study of repetition suppression in the spectral-temporal domain; and (iii) the connection of neuronal repetition suppression with behavioral effects of repetition priming. PMID:21968323

  16. Nonword-repetition ability does not appear to be a causal influence on children's vocabulary development.

    PubMed

    Melby-Lervåg, Monica; Lervåg, Arne; Lyster, Solveig-Alma Halaas; Klem, Marianne; Hagtvet, Bente; Hulme, Charles

    2012-10-01

    In the study reported here, we assessed the theory that vocabulary learning in children depends critically on the capacity of a "phonological loop" that is indexed by nonword-repetition ability. A 3-year longitudinal study of 219 children assessed nonword-repetition ability and vocabulary knowledge at yearly intervals between the ages of 4 and 7 years. There was a considerable degree of longitudinal stability in children's vocabulary and nonword-repetition skills, but there was no evidence of any influence of nonword-repetition ability on later vocabulary knowledge. These results seriously call into question the claim that vocabulary learning in children is constrained by nonword-repetition ability, and they cast doubt on the broader theory that the phonological loop functions as a language-learning device.

  17. Sensory Features and Repetitive Behaviors in Children with Autism and Developmental Delays

    PubMed Central

    Boyd, Brian A.; Baranek, Grace T.; Sideris, John; Poe, Michele D.; Watson, Linda R.; Patten, Elena; Miller, Heather

    2010-01-01

    This study combined parent and observational measures to examine the association between aberrant sensory features and restricted, repetitive behaviors in children with autism (N = 67) and those with developmental delays (N = 42). Confirmatory factor analysis was used to empirically validate three sensory constructs of interest: hyperresponsiveness, hyporesponsiveness, and sensory seeking. Examining the association between the three derived sensory factor scores and scores on the Repetitive Behavior Scales—Revised revealed the co-occurrence of these behaviors in both clinical groups. Specifically, high levels of hyperresponsive behaviors predicted high levels of repetitive behaviors, and the relationship between these variables remained the same controlling for mental age. We primarily found non-significant associations between hyporesponsiveness or sensory seeking and repetitive behaviors, with the exception that sensory seeking was associated with ritualistic/sameness behaviors. These findings suggest that shared neurobiological mechanisms may underlie hyperresponsive sensory symptoms and repetitive behaviors and have implications for diagnostic classification as well as intervention. PMID:20437603

  18. The use of nonword repetition as a test of phonological memory in children with Down syndrome.

    PubMed

    Laws, G

    1998-11-01

    Recent research suggests a significant relationship between verbal short-term memory and normal language development. Although poor short-term memory and impaired language are features of Down syndrome there has been little investigation of the relationship between these functions in this population, and no studies have included the nonword repetition test devised by Gathercole and Baddeley on which much of the evidence from normal development is based. This study reports the use of nonword repetition with 33 children and teenagers with Down syndrome aged from 5 to 18 years, and investigates the relationship between this test and other memory and language measures. Word repetition was included as an indirect control for the perceptual and speech impairments often associated with this group. Words were repeated significantly more successfully than nonwords and both these tasks were sensitive to word length. Nonword repetition was significantly correlated with age, and when age and nonverbal cognitive ability were controlled, nonword repetition was significantly correlated with all other language-based memory measures, i.e. auditory digit span, word span, sentence repetition, and fluency, and also with memory for a sequence of hand movements, but not with memory for faces or a visual digit span task. There was also a significant relationship between nonword repetition and receptive vocabulary, language comprehension, and reading. When performance on the word repetition task was controlled in addition to age and nonverbal ability, significant correlations between nonword repetition and word span, sentence memory, hand movements, language comprehension, and reading remained. Fewer relationships between auditory digit span and these other measures were established; in particular, there was no association between digit span and the language and reading measures. Results suggest that nonword repetition is a reliable measure of phonological memory in Down syndrome and can

  19. Repetitive transcranial magnetic stimulator with controllable pulse parameters

    NASA Astrophysics Data System (ADS)

    Peterchev, Angel V.; Murphy, David L.; Lisanby, Sarah H.

    2011-06-01

    The characteristics of transcranial magnetic stimulation (TMS) pulses influence the physiological effect of TMS. However, available TMS devices allow very limited adjustment of the pulse parameters. We describe a novel TMS device that uses a circuit topology incorporating two energy storage capacitors and two insulated-gate bipolar transistor (IGBT) modules to generate near-rectangular electric field pulses with adjustable number, polarity, duration, and amplitude of the pulse phases. This controllable pulse parameter TMS (cTMS) device can induce electric field pulses with phase widths of 10-310 µs and positive/negative phase amplitude ratio of 1-56. Compared to conventional monophasic and biphasic TMS, cTMS reduces energy dissipation up to 82% and 57% and decreases coil heating up to 33% and 41%, respectively. We demonstrate repetitive TMS trains of 3000 pulses at frequencies up to 50 Hz with electric field pulse amplitude and width variability less than the measurement resolution (1.7% and 1%, respectively). Offering flexible pulse parameter adjustment and reduced power consumption and coil heating, cTMS enhances existing TMS paradigms, enables novel research applications and could lead to clinical applications with potentially enhanced potency.

  20. Characterizing Aciniform Silk Repetitive Domain Backbone Dynamics and Hydrodynamic Modularity.

    PubMed

    Tremblay, Marie-Laurence; Xu, Lingling; Sarker, Muzaddid; Liu, Xiang-Qin; Rainey, Jan K

    2016-01-01

    Spider aciniform (wrapping) silk is a remarkable fibrillar biomaterial with outstanding mechanical properties. It is a modular protein consisting, in Argiope trifasciata, of a core repetitive domain of 200 amino acid units (W units). In solution, the W units comprise a globular folded core, with five α-helices, and disordered tails that are linked to form a ~63-residue intrinsically disordered linker in concatemers. Herein, we present nuclear magnetic resonance (NMR) spectroscopy-based (15)N spin relaxation analysis, allowing characterization of backbone dynamics as a function of residue on the ps-ns timescale in the context of the single W unit (W₁) and the two unit concatemer (W₂). Unambiguous mapping of backbone dynamics throughout W₂ was made possible by segmental NMR active isotope-enrichment through split intein-mediated trans-splicing. Spectral density mapping for W₁ and W₂ reveals a striking disparity in dynamics between the folded core and the disordered linker and tail regions. These data are also consistent with rotational diffusion behaviour where each globular domain tumbles almost independently of its neighbour. At a localized level, helix 5 exhibits elevated high frequency dynamics relative to the proximal helix 4, supporting a model of fibrillogenesis where this helix unfolds as part of the transition to a mixed α-helix/β-sheet fibre. PMID:27517921

  1. Series-counterpulse repetitive-pulse inductive storage circuit

    DOEpatents

    Honig, Emanuel M.

    1986-01-01

    A high-power series-counterpulse repetitive-pulse inductive energy storage and transfer circuit includes an opening switch, a main energy storage coil, and a counterpulse capacitor. The load pulse is initiated simultaneously with the initiation of the counterpulse which is used to turn the opening switch off. There is no delay from command to output pulse. During the load pulse, the counterpulse capacitor is first discharged and then recharged in the opposite polarity with sufficient energy to accomplish the load counterpulse which terminates the load pulse and turns the load switch off. When the main opening switch is triggered closed again to terminate the load pulse, the counterpulse capacitor discharges in the reverse direction through the load switch and through the load, causing a rapid, sharp cutoff of the load pulse as well as recovering any energy remaining in the load inductance. The counterpulse capacitor is recharged to its original condition by the main energy storage coil after the load pulse is over, not before it begins.

  2. Acute sports-related traumatic brain injury and repetitive concussion.

    PubMed

    Guskiewicz, Kevin M; Broglio, Steven P

    2015-01-01

    Concussions are described as functional, not structural injuries, and therefore cannot be easily detected through standard diagnostic imaging. The vast differences between individual athletes makes identifying and evaluating sport-related concussion one of the most complex and perplexing injuries faced by medical personnel. The literature, as well as most consensus statements, supports the use of a multifaceted approach to concussion evaluation on the sideline of the athletic field. Using a standardized clinical examination that is supported by objective measures of concussion-related symptoms, cognitive function, and balance provides clinicians with the ability to track recovery in an objective manner. When used in combination, these tests allow for more informed diagnosis and treatment plan, which should involve a graduated return to play progression. Establishing a comprehensive emergency action plan that can guide the on-field management of a more serious and potentially catastrophic brain injury is also essential. This review will address these management issues, as well as the recent concerns about the risk of long-term neurologic conditions believed to be associated with repetitive concussion.

  3. Predicting Affective Information - An Evaluation of Repetition Suppression Effects.

    PubMed

    Trapp, Sabrina; Kotz, Sonja A

    2016-01-01

    Both theoretical proposals and empirical studies suggest that the brain interprets sensory input based on expectations to mitigate computational burden. However, as social beings, much of sensory input is affectively loaded - e.g., the smile of a partner, the critical voice of a boss, or the welcoming gesture of a friend. Given that affective information is highly complex and often ambiguous, building up expectations of upcoming affective sensory input may greatly contribute to its rapid and efficient processing. This review points to the role of affective information in the context of the 'predictive brain'. It particularly focuses on repetition suppression (RS) effects that have recently been linked to prediction processes. The findings are interpreted as evidence for more pronounced prediction processes with affective material. Importantly, it is argued that bottom-up attention inflates the neural RS effect, and because affective stimuli tend to attract more bottom-up attention, it thereby particularly overshadows the magnitude of RS effects for this information. Finally, anxiety disorders, such as social phobia, are briefly discussed as manifestations of modulations in affective prediction. PMID:27667980

  4. Repetitive Transcranial Magnetic Stimulator with Controllable Pulse Parameters

    PubMed Central

    Peterchev, Angel V; Murphy, David L; Lisanby, Sarah H

    2013-01-01

    The characteristics of transcranial magnetic stimulation (TMS) pulses influence the physiological effect of TMS. However, available TMS devices allow very limited adjustment of the pulse parameters. We describe a novel TMS device that uses a circuit topology incorporating two energy storage capacitors and two insulated-gate bipolar transistor (IGBT) modules to generate near-rectangular electric field pulses with adjustable number, polarity, duration, and amplitude of the pulse phases. This controllable pulse parameter TMS (cTMS) device can induce electric field pulses with phase widths of 10–310 μs and positive/negative phase amplitude ratio of 1–56. Compared to conventional monophasic and biphasic TMS, cTMS reduces energy dissipation by up to 82% and 57%, and decreases coil heating by up to 33% and 41%, respectively. We demonstrate repetitive TMS trains of 3,000 pulses at frequencies up to 50 Hz with electric field pulse amplitude and width variability less than the measurement resolution (1.7% and 1%, respectively). Offering flexible pulse parameter adjustment and reduced power consumption and coil heating, cTMS enhances existing TMS paradigms, enables novel research applications, and could lead to clinical applications with potentially enhanced potency. PMID:21540487

  5. Mechanical fatigue in repetitively stretched single molecules of titin.

    PubMed Central

    Kellermayer, M S; Smith, S B; Bustamante, C; Granzier, H L

    2001-01-01

    Relaxed striated muscle cells exhibit mechanical fatigue when exposed to repeated stretch and release cycles. To understand the molecular basis of such mechanical fatigue, single molecules of the giant filamentous protein titin, which is the main determinant of sarcomeric elasticity, were repetitively stretched and released while their force response was characterized with optical tweezers. During repeated stretch-release cycles titin becomes mechanically worn out in a process we call molecular fatigue. The process is characterized by a progressive shift of the stretch-force curve toward increasing end-to-end lengths, indicating that repeated mechanical cycles increase titin's effective contour length. Molecular fatigue occurs only in a restricted force range (0-25 pN) during the initial part of the stretch half-cycle, whereas the rest of the force response is repeated from one mechanical cycle to the other. Protein-folding models fail to explain molecular fatigue on the basis of an incomplete refolding of titin's globular domains. Rather, the process apparently derives from the formation of labile nonspecific bonds cross-linking various sites along a pre-unfolded titin segment. Because titin's molecular fatigue occurs in a physiologically relevant force range, the process may play an important role in dynamically adjusting muscle's response to the recent history of mechanical perturbations. PMID:11159452

  6. Genome organization of repetitive elements in the rodent, Peromyscus leucopus.

    PubMed

    Janecek, L L; Longmire, J L; Wichman, H A; Baker, R J

    1993-01-01

    To document the frequency and distribution of repetitive elements in Peromyscus leucopus, the white-footed mouse, a cosmid genomic library was examined. Two thousand thirteen randomly chosen recombinants, with an average insert size of 35 kb and representing 2.35% of the haploid genome of P. leucopus, were screened with probes representing microsatellites, tandem repeats, and transposable elements. Of the four dinucleotides, (GT)n was present in 87% of the clones, (CT)n was present in 59% of the clones, and (AT)n and (GC)n each was represented in our sample by a single clone (0.05%). (TCC)n was present in 8% of the clones. Of the tandem repeats, the 28S ribosomal probe and the (TTAGGG)n telomere probe were not represented in the library, whereas a heterochromatic fragment was present in 9% of the clones. A transposable element, mys, was estimated to occur in 4700 copies, whereas a long interspersed element (LINE) was estimated to occur in about 41,000 copies per haploid genome. LINE and mys occurred together in the same clones more frequently than expected on the basis of chance. Hybridizing the library to genomic DNA from P. leucopus, Reithrodontomys fulvescens, Mus musculus, and human produced general agreement between phylogenetic relatedness and intensity of hybridization. However, dinucleotide repeats appeared to account for a disproportionately high number of positive clones in the more distantly related taxa.

  7. Characterizing Aciniform Silk Repetitive Domain Backbone Dynamics and Hydrodynamic Modularity

    PubMed Central

    Tremblay, Marie-Laurence; Xu, Lingling; Sarker, Muzaddid; Liu, Xiang-Qin; Rainey, Jan K.

    2016-01-01

    Spider aciniform (wrapping) silk is a remarkable fibrillar biomaterial with outstanding mechanical properties. It is a modular protein consisting, in Argiope trifasciata, of a core repetitive domain of 200 amino acid units (W units). In solution, the W units comprise a globular folded core, with five α-helices, and disordered tails that are linked to form a ~63-residue intrinsically disordered linker in concatemers. Herein, we present nuclear magnetic resonance (NMR) spectroscopy-based 15N spin relaxation analysis, allowing characterization of backbone dynamics as a function of residue on the ps–ns timescale in the context of the single W unit (W1) and the two unit concatemer (W2). Unambiguous mapping of backbone dynamics throughout W2 was made possible by segmental NMR active isotope-enrichment through split intein-mediated trans-splicing. Spectral density mapping for W1 and W2 reveals a striking disparity in dynamics between the folded core and the disordered linker and tail regions. These data are also consistent with rotational diffusion behaviour where each globular domain tumbles almost independently of its neighbour. At a localized level, helix 5 exhibits elevated high frequency dynamics relative to the proximal helix 4, supporting a model of fibrillogenesis where this helix unfolds as part of the transition to a mixed α-helix/β-sheet fibre. PMID:27517921

  8. Repetition across successive sentences facilitates young children's word learning.

    PubMed

    Schwab, Jessica F; Lew-Williams, Casey

    2016-06-01

    Young children who hear more child-directed speech (CDS) tend to have larger vocabularies later in childhood, but the specific characteristics of CDS underlying this link are currently underspecified. The present study sought to elucidate how the structure of language input boosts learning by investigating whether repetition of object labels in successive sentences-a common feature of natural CDS-promotes young children's efficiency in learning new words. Using a looking-while-listening paradigm, 2-year-old children were taught the names of novel objects, with exposures either repeated across successive sentences or distributed throughout labeling episodes. Results showed successful learning only when label-object pairs had been repeated in blocks of successive sentences, suggesting that immediate opportunities to detect recurring structure facilitate young children's learning. These findings offer insight into how the information flow within CDS might influence vocabulary development, and we consider the findings alongside research showing the benefits of distributing information across time. (PsycINFO Database Record PMID:27148781

  9. Alternative approach for cavitation damage study utilizing repetitive laser pulses

    SciTech Connect

    Ren, Fei; Wang, Jy-An John; Wang, Hong

    2010-01-01

    Cavitation is a common phenomenon in fluid systems that can lead to dramatic degradation of solid materials surface in contact with the cavitating media. Study of cavitation damage has great significance in many engineering fields. Current techniques for cavitation damage study either require large scale equipments or tend to introduce damages from other mechanisms. In this project, we utilized the cavitation phenomenon induced by laser optical breakdown and developed a prototype apparatus for cavitation damage study. In our approach, cavitation was generated by the repetitive pressure waves induced by high-power laser pulses. As proof of principal study, stainless steel and aluminum samples were tested using the novel apparatus. Surface characterization via scanning electron microscopy revealed damages such as indentation and surface pitting, which were similar to those reported in literature using other state-of-the-art techniques. These preliminary results demonstrated the new device was capable of generating cavitation damages and could be used as an alternative method for cavitation damage study.

  10. Power neodymium-glass amplifier of a repetitively pulsed laser

    SciTech Connect

    Vinogradov, Aleksandr V; Gaganov, V E; Garanin, Sergey G; Zhidkov, N V; Krotov, V A; Martynenko, S P; Pozdnyakov, E V; Solomatin, I I

    2011-11-30

    A neodymium-glass diode-pumped amplifier with a zigzag laser beam propagation through the active medium was elaborated; the amplifier is intended for operation in a repetitively pulsed laser. An amplifier unit with an aperture of 20 Multiplication-Sign 25 mm and a {approx}40-cm long active medium was put to a test. The energy of pump radiation amounts to 140 J at a wavelength of 806 nm for a pump duration of 550 {mu}s. The energy parameters of the amplifier were experimentally determined: the small-signal gain per pass {approx}3.2, the linear gain {approx}0.031 cm{sup -1} with a nonuniformity of its distribution over the aperture within 15%, the stored energy of 0.16 - 0.21 J cm{sup -3}. The wavefront distortions in the zigzag laser-beam propagation through the active element of the amplifier did not exceed 0.4{lambda} ({lambda} = 0.63 {mu}m is the probing radiation wavelength).

  11. Language repetition and short-term memory: an integrative framework

    PubMed Central

    Majerus, Steve

    2013-01-01

    Short-term maintenance of verbal information is a core factor of language repetition, especially when reproducing multiple or unfamiliar stimuli. Many models of language processing locate the verbal short-term maintenance function in the left posterior superior temporo-parietal area and its connections with the inferior frontal gyrus. However, research in the field of short-term memory has implicated bilateral fronto-parietal networks, involved in attention and serial order processing, as being critical for the maintenance and reproduction of verbal sequences. We present here an integrative framework aimed at bridging research in the language processing and short-term memory fields. This framework considers verbal short-term maintenance as an emergent function resulting from synchronized and integrated activation in dorsal and ventral language processing networks as well as fronto-parietal attention and serial order processing networks. To-be-maintained item representations are temporarily activated in the dorsal and ventral language processing networks, novel phoneme and word serial order information is proposed to be maintained via a right fronto-parietal serial order processing network, and activation in these different networks is proposed to be coordinated and maintained via a left fronto-parietal attention processing network. This framework provides new perspectives for our understanding of information maintenance at the non-word-, word- and sentence-level as well as of verbal maintenance deficits in case of brain injury. PMID:23874280

  12. Predicting Affective Information – An Evaluation of Repetition Suppression Effects

    PubMed Central

    Trapp, Sabrina; Kotz, Sonja A.

    2016-01-01

    Both theoretical proposals and empirical studies suggest that the brain interprets sensory input based on expectations to mitigate computational burden. However, as social beings, much of sensory input is affectively loaded – e.g., the smile of a partner, the critical voice of a boss, or the welcoming gesture of a friend. Given that affective information is highly complex and often ambiguous, building up expectations of upcoming affective sensory input may greatly contribute to its rapid and efficient processing. This review points to the role of affective information in the context of the ‘predictive brain’. It particularly focuses on repetition suppression (RS) effects that have recently been linked to prediction processes. The findings are interpreted as evidence for more pronounced prediction processes with affective material. Importantly, it is argued that bottom-up attention inflates the neural RS effect, and because affective stimuli tend to attract more bottom-up attention, it thereby particularly overshadows the magnitude of RS effects for this information. Finally, anxiety disorders, such as social phobia, are briefly discussed as manifestations of modulations in affective prediction.

  13. Decreased aggression and increased repetitive behavior in Pten haploinsufficient mice.

    PubMed

    Clipperton-Allen, A E; Page, D T

    2015-02-01

    Aggression is an aspect of social behavior that can be elevated in some individuals with autism spectrum disorder (ASD) and a concern for peers and caregivers. Mutations in Phosphatase and tensin homolog (PTEN), one of several ASD risk factors encoding negative regulators of the PI3K-Akt-mTOR pathway, have been reported in individuals with ASD and comorbid macrocephaly. We previously showed that a mouse model of Pten germline haploinsufficiency (Pten(+/-) ) has selective deficits, primarily in social behavior, along with broad overgrowth of the brain. Here, we further examine the social behavior of Pten(+/-) male mice in the resident-intruder test of aggression, using a comprehensive behavioral analysis to obtain an overall picture of the agonistic, non-agonistic and non-social behavior patterns of Pten(+/-) mice during a free interaction with a novel conspecific. Pten(+/-) male mice were involved in less aggression than their wild-type littermates. Pten(+/-) mice also performed less social investigation, including anogenital investigation and approaching and/or attending to the intruder, which is consistent with our previous finding of decreased sociability in the social approach test. In contrast to these decreases in social behaviors, Pten(+/-) mice showed increased digging. In summary, we report decreased aggression and increased repetitive behavior in Pten(+/-) mice, thus extending our characterization of this model of an ASD risk factor that features brain overgrowth and social deficits.

  14. Predicting Affective Information – An Evaluation of Repetition Suppression Effects

    PubMed Central

    Trapp, Sabrina; Kotz, Sonja A.

    2016-01-01

    Both theoretical proposals and empirical studies suggest that the brain interprets sensory input based on expectations to mitigate computational burden. However, as social beings, much of sensory input is affectively loaded – e.g., the smile of a partner, the critical voice of a boss, or the welcoming gesture of a friend. Given that affective information is highly complex and often ambiguous, building up expectations of upcoming affective sensory input may greatly contribute to its rapid and efficient processing. This review points to the role of affective information in the context of the ‘predictive brain’. It particularly focuses on repetition suppression (RS) effects that have recently been linked to prediction processes. The findings are interpreted as evidence for more pronounced prediction processes with affective material. Importantly, it is argued that bottom-up attention inflates the neural RS effect, and because affective stimuli tend to attract more bottom-up attention, it thereby particularly overshadows the magnitude of RS effects for this information. Finally, anxiety disorders, such as social phobia, are briefly discussed as manifestations of modulations in affective prediction. PMID:27667980

  15. Auditory phonological priming in children and adults during word repetition

    NASA Astrophysics Data System (ADS)

    Cleary, Miranda; Schwartz, Richard G.

    2001-05-01

    Short-term auditory phonological priming effects involve changes in the speed with which words are processed by a listener as a function of recent exposure to other similar-sounding words. Activation of phonological/lexical representations appears to persist beyond the immediate offset of a word, influencing subsequent processing. Priming effects are commonly cited as demonstrating concurrent activation of word/phonological candidates during word identification. Phonological priming is controversial, the direction of effects (facilitating versus slowing) varying with the prime-target relationship. In adults, it has repeatedly been demonstrated, however, that hearing a prime word that rhymes with the following target word (ISI=50 ms) decreases the time necessary to initiate repetition of the target, relative to when the prime and target have no phonemic overlap. Activation of phonological representations in children has not typically been studied using this paradigm, auditory-word + picture-naming tasks being used instead. The present study employed an auditory phonological priming paradigm being developed for use with normal-hearing and hearing-impaired children. Initial results from normal-hearing adults replicate previous reports of faster naming times for targets following a rhyming prime word than for targets following a prime having no phonemes in common. Results from normal-hearing children will also be reported. [Work supported by NIH-NIDCD T32DC000039.

  16. Impaired endothelial function and blood flow in repetitive strain injury.

    PubMed

    Brunnekreef, J; Brunnekreef, J J; Benda, N; Benda, N M M; Schreuder, T; Schreuder, T H A; Hopman, M; Hopman, M T E; Thijssen, D; Thijssen, D H J

    2012-10-01

    Repetitive Strain Injury (RSI) is a disabling upper extremity overuse injury that may be associated with pathophysiological changes in the vasculature. In this study we investigated whether RSI is associated with endothelial dysfunction and impaired exercise-induced blood flow in the affected forearm. 10 patients with RSI (age, 40.2 ± 10.3; BMI, 23.8 ± 3.3) and 10 gender- and age-matched control subjects (age, 38.0 ± 12.4; BMI, 22.7 ± 3.4) participated in this study. Brachial artery blood flow was measured at rest and during 3-min periods of isometric handgrip exercise at 15%, 30% and 45% of the individual maximal voluntary contraction. Brachial artery endothelial function was assessed as the flow mediated dilation (FMD), by measuring brachial artery diameter and velocity before and after 5-min ischemic occlusion. We found a lower exercise-induced brachial artery blood flow in patients with RSI than in controls (p=0.04). Brachial artery FMD was significantly lower in patients with RSI than in controls (p<0.01), whilst a lower FMD was also found in patient with unilateral RSI when comparing the affected arm with the non-affected arm (p=0.04). Our results suggest that patients with RSI have an attenuated exercise-induced blood flow and an impaired endothelial function in the affected arm. These findings importantly improve our understanding of the pathophysiological mechanism of RSI.

  17. Extreme-ultraviolet ultrafast ARPES at high repetition rates

    NASA Astrophysics Data System (ADS)

    Buss, Jan; Wang, He; Xu, Yiming; Stoll, Sebastian; Zeng, Lingkun; Ulonska, Stefan; Denlinger, Jonathan; Hussain, Zahid; Jozwiak, Chris; Lanzara, Alessandra; Kaindl, Robert

    Time- and angle-resolved photoemission spectroscopy (trARPES) represents a powerful approach to resolve the electronic structure and quasiparticle dynamics in complex materials, yet is often limited in either momentum space (incident photon energy), probe sensitivity (pulse repetition rate), or energy resolution. We demonstrate a novel table-top trARPES setup that combines a bright 50-kHz source of narrowband, extreme ultraviolet (XUV) pulses at 22.3 eV with UHV photoemission instrumentation to sensitively access dynamics for a large momentum space. The output of a high-power Ti:sapphire amplifier is split to provide the XUV probe and intense photoexcitation (up to mJ/cm2) . A vacuum beamline delivers spectral and flux characterization, differential pumping, as well as XUV beam steering and toroidal refocusing onto the sample with high incident flux of 3x1011 ph/s. Photoemission studies are carried out in a customized UHV chamber equipped with a hemispherical analyzer (R4000), six-axis sample cryostat, and side chambers for sample loading, storage and preparation. An ARPES energy resolution down to 70 meV with the direct XUV output is demonstrated. We will discuss initial applications of this setup including Fermi surface mapping and trARPES of complex materials.

  18. Power neodymium-glass amplifier of a repetitively pulsed laser

    NASA Astrophysics Data System (ADS)

    Vinogradov, Aleksandr V.; Gaganov, V. E.; Garanin, Sergey G.; Zhidkov, N. V.; Krotov, V. A.; Martynenko, S. P.; Pozdnyakov, E. V.; Solomatin, I. I.

    2011-11-01

    A neodymium-glass diode-pumped amplifier with a zigzag laser beam propagation through the active medium was elaborated; the amplifier is intended for operation in a repetitively pulsed laser. An amplifier unit with an aperture of 20 × 25 mm and a ~40-cm long active medium was put to a test. The energy of pump radiation amounts to 140 J at a wavelength of 806 nm for a pump duration of 550 μs. The energy parameters of the amplifier were experimentally determined: the small-signal gain per pass ~3.2, the linear gain ~0.031 cm-1 with a nonuniformity of its distribution over the aperture within 15%, the stored energy of 0.16 — 0.21 J cm-3. The wavefront distortions in the zigzag laser-beam propagation through the active element of the amplifier did not exceed 0.4λ (λ = 0.63 μm is the probing radiation wavelength).

  19. Repetitive transcranial magnetic stimulator with controllable pulse parameters.

    PubMed

    Peterchev, Angel V; Murphy, David L; Lisanby, Sarah H

    2011-06-01

    The characteristics of transcranial magnetic stimulation (TMS) pulses influence the physiological effect of TMS. However, available TMS devices allow very limited adjustment of the pulse parameters. We describe a novel TMS device that uses a circuit topology incorporating two energy storage capacitors and two insulated-gate bipolar transistor (IGBT) modules to generate near-rectangular electric field pulses with adjustable number, polarity, duration, and amplitude of the pulse phases. This controllable pulse parameter TMS (cTMS) device can induce electric field pulses with phase widths of 10-310 µs and positive/negative phase amplitude ratio of 1-56. Compared to conventional monophasic and biphasic TMS, cTMS reduces energy dissipation up to 82% and 57% and decreases coil heating up to 33% and 41%, respectively. We demonstrate repetitive TMS trains of 3000 pulses at frequencies up to 50 Hz with electric field pulse amplitude and width variability less than the measurement resolution (1.7% and 1%, respectively). Offering flexible pulse parameter adjustment and reduced power consumption and coil heating, cTMS enhances existing TMS paradigms, enables novel research applications and could lead to clinical applications with potentially enhanced potency. PMID:21540487

  20. Characterization and distribution of repetitive elements in association with genes in the human genome.

    PubMed

    Liang, Kai-Chiang; Tseng, Joseph T; Tsai, Shaw-Jenq; Sun, H Sunny

    2015-08-01

    Repetitive elements constitute more than 50% of the human genome. Recent studies implied that the complexity of living organisms is not just a direct outcome of a number of coding sequences; the repetitive elements, which do not encode proteins, may also play a significant role. Though scattered studies showed that repetitive elements in the regulatory regions of a gene control gene expression, no systematic survey has been done to report the characterization and distribution of various types of these repetitive elements in the human genome. Sequences from 5' and 3' untranslated regions and upstream and downstream of a gene were downloaded from the Ensembl database. The repetitive elements in the neighboring of each gene were identified and classified using cross-matching implemented in the RepeatMasker. The annotation and distribution of distinct classes of repetitive elements associated with individual gene were collected to characterize genes in association with different types of repetitive elements using systems biology program. We identified a total of 1,068,400 repetitive elements which belong to 37-class families and 1235 subclasses that are associated with 33,761 genes and 57,365 transcripts. In addition, we found that the tandem repeats preferentially locate proximal to the transcription start site (TSS) of genes and the major function of these genes are involved in developmental processes. On the other hand, interspersed repetitive elements showed a tendency to be accumulated at distal region from the TSS and the function of interspersed repeat-containing genes took part in the catabolic/metabolic processes. Results from the distribution analysis were collected and used to construct a gene-based repetitive element database (GBRED; http://www.binfo.ncku.edu.tw/GBRED/index.html). A user-friendly web interface was designed to provide the information of repetitive elements associated with any particular gene(s). This is the first study focusing on the gene