Science.gov

Sample records for repetitive extragenic palindromes

  1. Predicting Salmonella enterica subsp. enterica Serotypes by Repetitive Extragenic Palindromic Sequence-Based PCR

    USDA-ARS?s Scientific Manuscript database

    The DiversiLabTM System, which employs repetitive extragenic palindromic sequence-based PCR (rep-PCR) to genotype microorganisms, was evaluated as a method to predict the serotype of Salmonella isolates. Two hundred and thirty-three Salmonella isolates belonging to 14 frequently isolated serotypes f...

  2. Repetitive extragenic palindromic sequences in the Pseudomonas syringae pv. tomato DC3000 genome: extragenic signals for genome reannotation.

    PubMed

    Tobes, Raquel; Pareja, Eduardo

    2005-04-01

    Repetitive extragenic palindromic (REPs) sequences were first described in enterobacteriacea and later in Pseudomonas putida. We have detected a new variant (51 base pairs) of REP sequences that appears to be disseminated in more than 300 copies in the Pseudomonas syringae DC3000 genome. The finding of REP sequences in P. syringae confirms the broad presence of this type of repetitive sequence in bacteria. We analyzed the distribution of REP sequences and the structure of the clusters, and we show that palindromy is conserved. REP sequences appear to be allocated to the extragenic space, with a special preference for the intergenic spaces limited by convergent genes, while their presence is scarce between divergent genes. Using REP sequences as markers of extragenicity we re-annotated a set of genes of the P. syringae DC3000 genome demonstrating that REP sequences can be used for refinement of annotation of a genome. The similarity detected between virulence genes from evolutionarily distant pathogenic bacteria suggests the acquisition of clusters of virulence genes by horizontal gene transfer. We did not detect the presence of P. syringae REP elements in the principal pathogenicity gene clusters. This absence suggests that genome fragments lacking REP sequences could point to regions recently acquired from other organisms, and REP sequences might be new tracers for gaining insight into key aspects of bacterial genome evolution, especially when studying pathogenicity acquisition. In addition, as the P. syringae REP sequence is species-specific with respect to the sequenced genomes, it is an exceptional candidate for use as a fingerprint in precise genotyping and epidemiological studies.

  3. Bacterial repetitive extragenic palindromic sequences are DNA targets for Insertion Sequence elements

    PubMed Central

    Tobes, Raquel; Pareja, Eduardo

    2006-01-01

    Background Mobile elements are involved in genomic rearrangements and virulence acquisition, and hence, are important elements in bacterial genome evolution. The insertion of some specific Insertion Sequences had been associated with repetitive extragenic palindromic (REP) elements. Considering that there are a sufficient number of available genomes with described REPs, and exploiting the advantage of the traceability of transposition events in genomes, we decided to exhaustively analyze the relationship between REP sequences and mobile elements. Results This global multigenome study highlights the importance of repetitive extragenic palindromic elements as target sequences for transposases. The study is based on the analysis of the DNA regions surrounding the 981 instances of Insertion Sequence elements with respect to the positioning of REP sequences in the 19 available annotated microbial genomes corresponding to species of bacteria with reported REP sequences. This analysis has allowed the detection of the specific insertion into REP sequences for ISPsy8 in Pseudomonas syringae DC3000, ISPa11 in P. aeruginosa PA01, ISPpu9 and ISPpu10 in P. putida KT2440, and ISRm22 and ISRm19 in Sinorhizobium meliloti 1021 genome. Preference for insertion in extragenic spaces with REP sequences has also been detected for ISPsy7 in P. syringae DC3000, ISRm5 in S. meliloti and ISNm1106 in Neisseria meningitidis MC58 and Z2491 genomes. Probably, the association with REP elements that we have detected analyzing genomes is only the tip of the iceberg, and this association could be even more frequent in natural isolates. Conclusion Our findings characterize REP elements as hot spots for transposition and reinforce the relationship between REP sequences and genomic plasticity mediated by mobile elements. In addition, this study defines a subset of REP-recognizer transposases with high target selectivity that can be useful in the development of new tools for genome manipulation. PMID

  4. Conformational Diversity of Single-Stranded DNA from Bacterial Repetitive Extragenic Palindromes: Implications for the DNA Recognition Elements of Transposases

    PubMed Central

    Charnavets, Tatsiana; Nunvar, Jaroslav; Nečasová, Iva; Völker, Jens; Breslauer, Kenneth J; Schneider, Bohdan

    2015-01-01

    Repetitive extragenic palindrome (REP)—associated tyrosine transposase enzymes (RAYTs) bind REP DNA domains and catalyze their cleavage. Genomic sequence analyses identify potential noncoding REP sequences associated with RAYT-encoding genes. To probe the conformational space of potential RAYT DNA binding domains, we report here spectroscopic and calorimetric measurements that detect and partially characterize the solution conformational heterogeneity of REP oligonucleotides from six bacterial species. Our data reveal most of these REP oligonucleotides adopt multiple conformations, suggesting that RAYTs confront a landscape of potential DNA substrates in dynamic equilibrium that could be selected, enriched, and/or induced via differential binding. Thus, the transposase-bound DNA motif may not be the predominant conformation of the isolated REP domain. Intriguingly, for several REPs, the circular dichroism spectra suggest guanine tetraplexes as potential alternative or additional RAYT recognition elements, an observation consistent with these REP domains being highly nonrandom, with tetraplex-favoring 5′-G and 3′-C-rich segments. In fact, the conformational heterogeneity of REP domains detected and reported here, including the formation of noncanonical DNA secondary structures, may reflect a general feature required for recognition by RAYT transposases. Based on our biophysical data, we propose guanine tetraplexes as an additional DNA recognition element for binding by RAYT transposase enzymes. © 2015 Wiley Periodicals, Inc. Biopolymers 103: 585–596, 2015. PMID:25951997

  5. Repetitive extragenic palindromic PCR (REP-PCR) as a method used for bulking process detection in activated sludge.

    PubMed

    Sołtysik, Dagna; Bednarek, Ilona; Loch, Tomasz; Gałka, Sabina; Sypniewski, Daniel

    2011-05-01

    Bulking of activated sludge is a world-widely prevalent problem and can lead to loss of bio-oxidation, further deterioration of effluent quality, and even to a complete breakdown of the entire treatment process. Most common reasons of bulking are bacterial community changes, especially excessive growth of filamentous bacteria or excess of biopolymers on surface of non-filamentous microbes. Because of complex nature of the bulking phenomenon, the successful bulking control strategy finding is still a very important need awaiting new options and advices. The repetitive extragenic palindromic PCR (REP-PCR) fingerprinting method has been applied to distinguish bacterial community in non-bulking and bulking activated sludge. The characteristic REP-PCR fingerprinting patterns, using the Ward's clustering method, have been analyzed to determine homology/similarity relation between particular non-bulking and bulking sludge sampling. The received clustering results were in high concordance with activated sludge typing done based on physicochemical sludge analysis. The choice and application of molecular typing method in sludge analysis will depend upon the needs, skill level, and resources of the laboratory. The proposed REP-PCR method and statistical analysis of fingerprinting patterns seems to be simple, rapid, and effective methods to show differences between population in non-bulking and bulking activated sludge. It is easy to implement, and it may be useful for routinely activated sludge monitoring as well as may be helpful in early detection of bulking process.

  6. Characterization of the Pseudomonas putida Mobile Genetic Element ISPpu10: an Occupant of Repetitive Extragenic Palindromic Sequences

    PubMed Central

    Ramos-González, María Isabel; Campos, María Jesús; Ramos, Juan Luis; Espinosa-Urgel, Manuel

    2006-01-01

    We have characterized the Pseudomonas putida KT2440 insertion element ISPpu10. This insertion sequence encodes a transposase which exhibits homology to the transposases and specific recombinases of the Piv/Moov family, and no inverted repeats are present at the borders of its left and right ends, thus constituting a new member of the atypical IS110/IS492 family. ISPpu10 was found in at least seven identical loci in the KT2440 genome, and variants were identified having an extra insertion at distinct loci. ISPpu10 always appeared within the core of specific repetitive extragenic palindromic (REP) sequences TCGCGGGTAAACCCGCTCCTAC, exhibiting high target stringency. One intragenic target was found associated with the truncation of a GGDEF/EAL domain protein. After active in vitro transposition to a plasmid-borne target, a duplication of the CT (underlined above) at the junction as a consequence of the ISPpu10 insertion was experimentally demonstrated for the first time in the IS110/IS492 family. The same duplication was observed after transposition of ISPpu10 from a plasmid to the chromosome of P. putida DOT-T1E, an ISPpu10-free strain with REPs similar to those of strain KT2440. Plasmid ISPpu10-mediated rearrangements were observed in vivo under laboratory conditions and in the plant rhizosphere. PMID:16352819

  7. Clonal Relationship and Differentiation among Mycobacterium abscessus Isolates as Determined Using the Semiautomated Repetitive Extragenic Palindromic Sequence PCR-Based DiversiLab System

    PubMed Central

    Mougari, Faiza; Raskine, Laurent; Ferroni, Agnes; Marcon, Estelle; Sermet-Gaudelus, Isabelle; Veziris, Nicolas; Heym, Beate; Gaillard, Jean-Louis; Nassif, Xavier

    2014-01-01

    Mycobacterium abscessus is a rapidly growing mycobacterium that causes respiratory tract infections in predisposed patients, such as those with cystic fibrosis and nosocomial skin and soft tissue infections. In order to investigate the clonal relationships between the strains causing epidemic episodes, we evaluated the discriminatory power of the semiautomated DiversiLab (DL) repetitive extragenic palindromic sequence PCR (REP-PCR) test for M. abscessus genotyping. Since M. abscessus was shown to be composed of subspecies (M. abscessus subsp. massiliense, M. abscessus subsp. bolletii, and M. abscessus subsp. abscessus), we also evaluated the ability of this technique to differentiate subspecies. The technique was applied to two collections of clinical isolates, (i) 83 M. abscessus original isolates (43 M. abscessus subsp. abscessus, 12 M. abscessus subsp. bolletii, and 28 M. abscessus subsp. massiliense) from infected patients and (ii) 35 repeated isolates obtained over 1 year from four cystic fibrosis patients. The DL REP-PCR test was standardized for DNA extraction, DNA amplification, and electrophoresis pattern comparisons. Among the isolates from distinct patients, 53/83 (62%) isolates showed a specific pattern, and 30 were distributed in 11 clusters and 6 patterns, with 2 to 4 isolates per pattern. The clusters and patterns did not fully correlate with multilocus sequence typing (MLST) analysis results. This revealed a high genomic diversity between patients, with a discriminatory power of 98% (Simpson's diversity index). However, since some isolates shared identical patterns, this raises the question of whether it is due to transmission between patients or a common reservoir. Multiple isolates from the same patient showed identical patterns, except for one patient infected by two strains. Between the M. abscessus subspecies, the indexes were <70%, indicating that the DL REP-PCR test is not an accurate tool for identifying organisms to the subspecies level

  8. Comparison of a Repetitive Extragenic Palindromic Sequence-Based PCR Method and Clinical and Microbiological Methods for Determining Strain Sources in Cases of Nosocomial Acinetobacter baumannii Bacteremia

    PubMed Central

    Martín-Lozano, David; Cisneros, José Miguel; Becerril, Berta; Cuberos, Lucila; Prados, Trinidad; Ortíz-Leyba, Carlos; Cañas, Elías; Pachón, Jerónimo

    2002-01-01

    Using a repetitive extragenic palindromic PCR (REP-PCR), we genotypically characterized strains causing nosocomial Acinetobacter baumannii infections and analyzed the source of bacteremia in 67 patients from an institution in which infections by this bacterium were endemic. Six different genotypes were found, including 21, 27, 3, 9, 3, and 4 strains. The probable source of bacteremia, according to clinical and/or microbiological criteria, was known in 42 patients (63%): respiratory tract (n = 19), surgical sites (n = 12), intravascular catheters (n = 5), burns (n = 3), and urinary tract (n = 3). The definite source of bacteremia, according to REP-PCR, could be established in 30 (71%) out of the 42 patients with strains from blood and other sites; in these cases clinical and microbiological criteria for the source of bacteremia were thus confirmed. In the remaining 12 patients (29%) the probable source was refuted by the REP-PCR method. The definite sources of bacteremia according to genotype were as follows: respiratory tract in 13 patients (31%), surgical sites in 8 (19%), intravascular catheters in 4 (9%), burns in 3 (7%), and urinary tract in 2 (5%). A comparison of strains from blood cultures and other sites with regard to their REP-PCR and antimicrobial resistance profiles was also made. Taking the REP-PCR as the “gold standard,” the positive predictive value of antibiotype was 77% and the negative predictive value was 42%. In summary, the utility of the diagnosis of the source of nosocomial A. baumannii bacteremia using clinical and/or microbiological criteria, including antibiotyping, is limited, as demonstrated by REP-PCR. PMID:12454154

  9. Typing of Ochrobactrum anthropi clinical isolates using automated repetitive extragenic palindromic-polymerase chain reaction DNA fingerprinting and matrix-assisted laser desorption/ionization–time-of-flight mass spectrometry

    PubMed Central

    2014-01-01

    Background Ochrobactrum anthropi (O. anthropi), is a non-fermenting gram-negative bacillus usually found in the environment. Nevertheless, during the past decade it has been identified as pathogenic to immunocompromised patients. In this study, we assessed the usefulness of the automated repetitive extragenic palindromic-polymerase chain reaction (rep-PCR-based DiversiLab™ system, bioMèrieux, France) and of matrix-assisted laser desorption/ionization-time-of-flight (MALDI-TOF MS) for typing of twentythree O. anthropi clinical isolates that we found over a four-months period (from April 2011 to August 2011) in bacteriemic patients admitted in the same operative unit of our hospital. Pulsed-field gel electrophoresis (PFGE), commonly accepted as the gold standard technique for typing, was also used. Analysis was carried out using the Pearson correlation coefficient to determine the distance matrice and the unweighted pair group method with arithmetic mean (UPGMA) to generate dendogram. Results Rep-PCR analysis identified four different patterns: three that clustered together with 97% or more pattern similarity, and one whose members showed < 95% pattern similarity. Interestingly, strains isolated later (from 11/06/2011 to 24/08/2011) displayed a pattern with 99% similarity. MALDI-TOF MS evaluation clustered the twentythree strains of O. anthropi into a single group containing four distinct subgroups, each comprising the majority of strains clustering below 5 distance levels, indicating a high similarity between the isolates. Conclusions Our results indicate that these isolates are clonally-related and the methods used afforded a valuable contribution to the epidemiology, prevention and control of the infections caused by this pathogen. PMID:24655432

  10. Epidemiological typing of isolates from an outbreak of infection with multidrug-resistant Enterobacter cloacae by repetitive extragenic palindromic unit b1-primed PCR and pulsed-field gel electrophoresis.

    PubMed Central

    Shi, Z Y; Liu, P Y; Lau, Y J; Lin, Y H; Hu, B S

    1996-01-01

    An outbreak of multidrug-resistant Enterobacter cloacae infection lasted for 4 months in a neonatal intensive care unit (NICU). Forty-six isolates from the NICU and 20 epidemiologically unrelated strains were characterized by pulsed-field gel electrophoresis (PFGE) and repetitive extragenic palindromic unit b1-primed PCR (REPUb1-PCR) typing. The PFGE patterns after XbaI restriction of the bacterial DNA were analyzed by computer software (Gelcompar) using the UPGMA (unweighted pair group method with arithmetic averages) clustering method and the Dice coefficient. The 46 isolates from the NICU were classified by PFGE typing into five clusters: A (further classified into 7 subtypes, A1 to A7), B, C, D, and E. This outbreak was attributed to multiple genetically related strains of cluster A which had a similarity of 85.8% +/- 4.6%. The minor band differences among strains of cluster A were probably due to minor genetic mutations. The type A1 and A3 strains were isolated from the clinical specimens of patients and hands of nurses. It was probable that these outbreak strains were transmitted among patients via the hands of personnel. REPUb1-PCR typing of the 46 isolates also demonstrated five types, in agreement with results obtained by the PFGE technique, but could not detect the minor mutations among the cluster A strains. Twenty epidemiologically unrelated strains were well distinguished by both PFGE and REPUb1-PCR typing. We conclude that PFGE is a highly discriminatory but time-consuming method for epidemiological typing of E. cloacae and that REPUb1-PCR is a more rapid method with good reproducibility and discriminatory power comparable to that of PFGE. PMID:8897183

  11. Validation of use of whole-cell repetitive extragenic palindromic sequence-based PCR (REP-PCR) for typing strains belonging to the Acinetobacter calcoaceticus-Acinetobacter baumannii complex and application of the method to the investigation of a hospital outbreak.

    PubMed Central

    Snelling, A M; Gerner-Smidt, P; Hawkey, P M; Heritage, J; Parnell, P; Porter, C; Bodenham, A R; Inglis, T

    1996-01-01

    Acinetobacter spp. are being reported with increasing frequency as causes of nosocomial infection. In order to identify reservoirs of infection as quickly as possible, a rapid typing method that can differentiate epidemic strains from environmental and nonepidemic strains is needed. In 1993, a cluster of Acinetobacter baumannii isolates from five patients in the adult intensive therapy unit of our tertiary-care teaching hospital led us to develop and optimize a rapid repetitive extragenic palindromic sequence-based PCR (REP-PCR) typing protocol for members of the Acinetobacter calcoaceticus-A. baumannii complex that uses boiled colonies and consensus primers aimed at repetitive extragenic palindromic sequences. Four of the five patient isolates gave the same REP-PCR typing pattern as isolates of A. baumannii obtained from the temperature probe of a Bennett humidifier; the fifth isolate had a unique profile. Disinfection of the probe with 70% ethanol, as recommended by the manufacturer, proved ineffective, as A. baumannii with the same REP-PCR pattern was isolated from it 10 days after cleaning, necessitating a change in our decontamination procedure. Results obtained with REP-PCR were subsequently confirmed by ribotyping. To evaluate the discriminatory power (D) of REP-PCR for typing members of the A. calcoaceticus-A. baumannii complex, compared with that of ribotyping, we have applied both methods to a collection of 85 strains that included representatives of six DNA groups within the complex. Ribotyping using EcoRI digests yielded 53 patterns (D = 0.98), whereas 68 different REP-PCR patterns were observed (D = 0.99). By computer-assisted analysis of gel images, 74 patterns were observed with REP-PCR (D = 1.0). Overall, REP-PCR typing proved to be slightly more discriminatory than ribotyping. Our results indicate that REP-PCR typing used boiled colonies is a simple, rapid, and effective means of typing members of the A. calcoaceticus-A. baumannii complex. PMID

  12. Palindromic repetitive DNA elements with coding potential in Methanocaldococcus jannaschii.

    PubMed

    Suyama, Mikita; Lathe, Warren C; Bork, Peer

    2005-10-10

    We have identified 141 novel palindromic repetitive elements in the genome of euryarchaeon Methanocaldococcus jannaschii. The total length of these elements is 14.3kb, which corresponds to 0.9% of the total genomic sequence and 6.3% of all extragenic regions. The elements can be divided into three groups (MJRE1-3) based on the sequence similarity. The low sequence identity within each of the groups suggests rather old origin of these elements in M. jannaschii. Three MJRE2 elements were located within the protein coding regions without disrupting the coding potential of the host genes, indicating that insertion of repeats might be a widespread mechanism to enhance sequence diversity in coding regions.

  13. Cutting edge: natural DNA repetitive extragenic sequences from gram-negative pathogens strongly stimulate TLR9.

    PubMed

    Magnusson, Mattias; Tobes, Raquel; Sancho, Jaime; Pareja, Eduardo

    2007-07-01

    Bacterial DNA exerts immunostimulatory effects on mammalian cells via the intracellular TLR9. Although broad analysis of TLR9-mediated immunostimulatory potential of synthetic oligonucleotides has been developed, which kinds of natural bacterial DNA sequences are responsible for immunostimulation are not known. This work provides evidence that the natural DNA sequences named repetitive extragenic palindromic (REPs) sequences present in Gram-negative bacteria are able to produce innate immune system stimulation via TLR9. A strong induction of IFN-alpha production by REPs from Escherichia coli, Salmonella enterica, Pseudomonas aeruginosa, and Neisseria meningitidis was detected in splenocytes from 129 mice. In addition, the involvement of TLR9 in immune stimulation by REPs was confirmed using B6.129P2-Tlr9(tm1Aki) knockout mice. Considering the involvement of TLRs in Gram-negative septic shock, it is conceivable that REPs play a role in its pathogenesis. This study highlights REPs as a potential novel target in septic shock treatment.

  14. Variation in extragenic repetitive DNA sequences in Pseudomonas syringae and potential use of modified REP primers in the identification of closely related isolates

    PubMed Central

    Çepni, Elif; Gürel, Filiz

    2012-01-01

    In this study, Pseudomonas syringe pathovars isolated from olive, tomato and bean were identified by species-specific PCR and their genetic diversity was assessed by repetitive extragenic palindromic (REP)-PCR. Reverse universal primers for REP-PCR were designed by using the bases of A, T, G or C at the positions of 1, 4 and 11 to identify additional polymorphism in the banding patterns. Binding of the primers to different annealing sites in the genome revealed additional fingerprint patterns in eight isolates of P. savastanoi pv. savastanoi and two isolates of P. syringae pv. tomato. The use of four different bases in the primer sequences did not affect the PCR reproducibility and was very efficient in revealing intra-pathovar diversity, particularly in P. savastanoi pv. savastanoi. At the pathovar level, the primer BOX1AR yielded shared fragments, in addition to five bands that discriminated among the pathovars P. syringae pv. phaseolicola, P. savastanoi pv. savastanoi and P. syringae pv. tomato. REP-PCR with a modified primer containing C produced identical bands among the isolates in a pathovar but separated three pathovars more distinctly than four other primers. Although REP- and BOX-PCRs have been successfully used in the molecular identification of Pseudomonas isolates from Turkish flora, a PCR based on inter-enterobacterial repetitive intergenic concensus (ERIC) sequences failed to produce clear banding patterns in this study. PMID:23055805

  15. Repetitive extragenic palindromic PCR (REP-PCR) as an alternative method for detection of bulking in activated sludge.

    PubMed

    Sołtysik, Dagna A; Bednarek, Ilona A; Loch, Tomasz M; Gałka, Sabina E; Sypniewski, Daniel J; Machnik, Grzegorz M; Błaszczyk, Daria K

    2010-01-01

    Bulking of activated sludge is a world-wide problem which negatively affects wastewater treatment efficiency. The most common reasons of bulking are bacterial community changes, especially excessive growth of filamentous bacteria (filamentous bulking) or excess of biopolymers on the surface of non-filamentous microbes (non-filamentous or Zoogleal bulking). Because of the complex nature of the bulking phenomenon finding a successful bulking control strategy remains a very important issue that awaits new options and advices. The REP-PCR fingerprinting method has been applied to distinguish a bacterial community in non-bulking and bulking activated sludge. The characteristic REP-PCR fingerprinting patterns were compared with each other in terms of the presence or absence of bands and in terms of measured integrated optical density (IOD) of the bands. The obtained fingerprinting patterns, using Ward's clustering method, have been analyzed to determine homology/similarity relations between specific non-bulking and bulking sludge sampling. The received clustering results were in high concordance with activated sludge typing which generally is done based on physicochemical sludge analysis. The proposed REP-PCR method and statistical analysis of fingerprinting patterns seems to be a simple, rapid and effective method revealing differences between populations in non-bulking and bulking activated sludge. It may be useful for routine activated sludge monitoring and may be helpful in the early detection of the bulking process.

  16. Use of Repetitive Element Palindromic-PCR (rep-PCR) for the Epidemiologic Discrimination of Food-Borne Pathogens

    USDA-ARS?s Scientific Manuscript database

    The use of defined primers for polymerase chain reactions (PCR) amplicifcations of interspersed repetitive DNA elements present at distinct locations in prokaryotic genomes is referred to as Repetitive Element Palindromic Sequences Based-Polymerase Chain Reactions, rep-PCR. The initial discovery of...

  17. Rapid proliferation of repetitive palindromic elements in mtDNA of the endemic Baikalian sponge Lubomirskia baicalensis.

    PubMed

    Lavrov, Dennis V

    2010-04-01

    Animal mitochondrial DNA (mtDNA) is a remarkably compact molecule largely because of the scarcity of noncoding "selfish" DNA. Recently, however, we found that mitochondrial genomes of several phylogenetically diverse species of demosponges contain small repetitive palindromic sequences, interspersed within intergenic regions and fused in protein and ribosomal RNA genes. Here, I report and analyze the proliferation of such elements in the mitochondrial genome of the endemic sponge of Lake Baikal Lubomirskia baicalensis. Because Baikal sponges are closely related to the circumglobally distributed freshwater sponge Ephydatia muelleri with which they shared a common ancestor approximately 3-10 Ma, both the rate of single nucleotide substitutions and the rate of palindromic repeat insertions can be calculated in this system. I found the rate of nucleotide substitutions in mtDNA of freshwater sponges to be extremely low (0.5-1.6 x 10(-9) per site per year), more similar to that in plants than bilaterian animals. By contrast, the per/nucleotide rate of insertions of repetitive elements is at least four times higher. This rapid rate of proliferation combined with the broad phylogenetic distribution of hairpin elements can make them a defining force in the evolution of mitochondrial genomes of demosponges.

  18. Evaluation of UV-C induced changes in Escherichia coli DNA using repetitive extragenic palindromic-polymerase chain reaction (REP-PCR).

    PubMed

    Trombert, Alejandro; Irazoqui, Horacio; Martín, Carlos; Zalazar, Fabián

    2007-11-12

    Ultraviolet radiation is an efficient inactivation method for a broad range of bacteria, viruses and parasites. Inactivation of microorganisms by UV-B and UV-C radiation is driven through modifications in their genomic DNA, being the most stable DNA-lesions different kinds of pyrimidine dimers (PDs) (e.g., cyclobutane pyrimidine dimers (CPDs) and other photoproducts). Taking into account that these modifications inhibit the DNA polymerization in vivo as well as in vitro, in the present work the usefulness of the REP-PCR assay to detect UV-induced changes in the Escherichia coli DNA was evaluated. In vitro amplification of DNA extracted at different times after UV treatment showed a disappearance of amplicons of higher size as time of treatment increases. When the bacteria were let to progress through their dark repair process, modifications in the electrophoretic patterns by REP-PCR were observed again. Amplified bacterial DNA tended to recover the profile showed at the beginning of treatment. In addition, the reappearance of bands of higher molecular size was associated to an increase in their signal intensity probably due to a higher amplification rate. Results of REP-PCR were correlated to the colony-forming ability of E. coli. It was concluded that REP-PCR appears as a rapid, robust, useful complementary methodology to monitor the impact of UV irradiation--at a molecular level--on the inactivation and the mechanisms of repair, applicable on a broad spectrum of microorganisms.

  19. Indole acetic acid production by fluorescent Pseudomonas spp. from the rhizosphere of Plectranthus amboinicus (Lour.) Spreng. and their variation in extragenic repetitive DNA sequences.

    PubMed

    Sethia, Bedhya; Mustafa, Mariam; Manohar, Sneha; Patil, Savita V; Jayamohan, Nellickal Subramanian; Kumudini, Belur Satyan

    2015-06-01

    Fluorescent Pseudomonas (FP) is a heterogenous group of growth promoting rhizobacteria that regulate plant growth by releasing secondary metabolic compounds viz., indole acetic acid (IAA), siderophores, ammonia and hydrogen cyanide. In the present study, IAA producing FPs from the rhizosphere of Plectranthus amboinicus were characterized morphologically, biochemically and at the molecular level. Molecular identification of the isolates were carried out using Pseudomonas specific primers. The effect of varying time (24, 48, 72 and 96 h), Trp concentrations (100, 200, 300, 400 and 500 μg x ml(-1)), temperature (10, 26, 37 and 50 ± 2 degrees C) and pH (6, 7 and 8) on IAA production by 10 best isolates were studied. Results showed higher IAA production at 72 h incubation, at 300 μg x ml(-1) Trp concentration, temperature 26 ± 2 degrees C and pH 7. TLC with acidified ethyl acetate extract showed that the IAA produced has a similar Rf value to that of the standard IAA. Results of TLC were confirmed by HPLC analysis. Genetic diversity of the isolates was also studied using 40 RAPD and 4 Rep primers. Genetic diversity parameters such as dominance, Shannon index and Simpson index were calculated. Out of 40 RAPD primers tested, 9 (2 OP-D series and 7 OP-E series) were shortlisted for further analysis. Studies using RAPD, ERIC, BOX, REP and GTG5 primers revealed that isolates exhibit significant diversity in repetitive DNA sequences irrespective of the rhizosphere.

  20. ExtraTrain: a database of Extragenic regions and Transcriptional information in prokaryotic organisms

    PubMed Central

    Pareja, Eduardo; Pareja-Tobes, Pablo; Manrique, Marina; Pareja-Tobes, Eduardo; Bonal, Javier; Tobes, Raquel

    2006-01-01

    Background Transcriptional regulation processes are the principal mechanisms of adaptation in prokaryotes. In these processes, the regulatory proteins and the regulatory DNA signals located in extragenic regions are the key elements involved. As all extragenic spaces are putative regulatory regions, ExtraTrain covers all extragenic regions of available genomes and regulatory proteins from bacteria and archaea included in the UniProt database. Description ExtraTrain provides integrated and easily manageable information for 679816 extragenic regions and for the genes delimiting each of them. In addition ExtraTrain supplies a tool to explore extragenic regions, named Palinsight, oriented to detect and search palindromic patterns. This interactive visual tool is totally integrated in the database, allowing the search for regulatory signals in user defined sets of extragenic regions. The 26046 regulatory proteins included in ExtraTrain belong to the families AraC/XylS, ArsR, AsnC, Cold shock domain, CRP-FNR, DeoR, GntR, IclR, LacI, LuxR, LysR, MarR, MerR, NtrC/Fis, OmpR and TetR. The database follows the InterPro criteria to define these families. The information about regulators includes manually curated sets of references specifically associated to regulator entries. In order to achieve a sustainable and maintainable knowledge database ExtraTrain is a platform open to the contribution of knowledge by the scientific community providing a system for the incorporation of textual knowledge. Conclusion ExtraTrain is a new database for exploring Extragenic regions and Transcriptional information in bacteria and archaea. ExtraTrain database is available at . PMID:16539733

  1. Distribution of repetitive DNA sequences in eubacteria and application to fingerprinting of bacterial genomes.

    PubMed Central

    Versalovic, J; Koeuth, T; Lupski, J R

    1991-01-01

    Dispersed repetitive DNA sequences have been described recently in eubacteria. To assess the distribution and evolutionary conservation of two distinct prokaryotic repetitive elements, consensus oligonucleotides were used in polymerase chain reaction [PCR] amplification and slot blot hybridization experiments with genomic DNA from diverse eubacterial species. Oligonucleotides matching Repetitive Extragenic Palindromic [REP] elements and Enterobacterial Repetitive Intergenic Consensus [ERIC] sequences were synthesized and tested as opposing PCR primers in the amplification of eubacterial genomic DNA. REP and ERIC consensus oligonucleotides produced clearly resolvable bands by agarose gel electrophoresis following PCR amplification. These band patterns provided unambiguous DNA fingerprints of different eubacterial species and strains. Both REP and ERIC probes hybridized preferentially to genomic DNA from Gram-negative enteric bacteria and related species. Widespread distribution of these repetitive DNA elements in the genomes of various microorganisms should enable rapid identification of bacterial species and strains, and be useful for the analysis of prokaryotic genomes. Images PMID:1762913

  2. Typing of Listeria monocytogenes Strains by Repetitive Element Sequence-Based PCR

    PubMed Central

    Jeršek, B.; Gilot, P.; Gubina, M.; Klun, N.; Mehle, J.; Tcherneva, E.; Rijpens, N.; Herman, L.

    1999-01-01

    Listeria monocytogenes strains possess short repetitive extragenic palindromic (REP) elements and enterobacterial repetitive intergenic consensus (ERIC) sequences. We used repetitive element sequence-based PCR (rep-PCR) to evaluate the potential of REP and ERIC elements for typing L. monocytogenes strains isolated from humans, animals, and foods. On the basis of rep-PCR fingerprints, L. monocytogenes strains were divided into four major clusters matching origin of isolation. rep-PCR fingerprints of human and animal isolates were different from those of food isolates. Computer evaluation of rep-PCR fingerprints allowed discrimination among the tested serotypes 1/2a, 1/2b, 1/2c, 3b, and 4b within each major cluster. The index of discrimination calculated for 52 epidemiologically unrelated isolates of L. monocytogenes was 0.98 for REP- and ERIC-PCR. Our results suggest that rep-PCR can provide an alternative method for L. monocytogenes typing. PMID:9854072

  3. GTAG- and CGTC-tagged palindromic DNA repeats in prokaryotes

    PubMed Central

    2013-01-01

    Background REPs (Repetitive Extragenic Palindromes) are small (20–40 bp) palindromic repeats found in high copies in some prokaryotic genomes, hypothesized to play a role in DNA supercoiling, transcription termination, mRNA stabilization. Results We have monitored a large number of REP elements in prokaryotic genomes, and found that most can be sorted into two large DNA super-families, as they feature at one end unpaired motifs fitting either the GTAG or the CGTC consensus. Tagged REPs have been identified in >80 species in 8 different phyla. GTAG and CGTC repeats reside predominantly in microorganisms of the gamma and alpha division of Proteobacteria, respectively. However, the identification of members of both super- families in deeper branching phyla such Cyanobacteria and Planctomycetes supports the notion that REPs are old components of the bacterial chromosome. On the basis of sequence content and overall structure, GTAG and CGTC repeats have been assigned to 24 and 4 families, respectively. Of these, some are species-specific, others reside in multiple species, and several organisms contain different REP types. In many families, most units are close to each other in opposite orientation, and may potentially fold into larger secondary structures. In different REP-rich genomes the repeats are predominantly located between unidirectionally and convergently transcribed ORFs. REPs are predominantly located downstream from coding regions, and many are plausibly transcribed and function as RNA elements. REPs located inside genes have been identified in several species. Many lie within replication and global genome repair genes. It has been hypothesized that GTAG REPs are miniature transposons mobilized by specific transposases known as RAYTs (REP associated tyrosine transposases). RAYT genes are flanked either by GTAG repeats or by long terminal inverted repeats (TIRs) unrelated to GTAG repeats. Moderately abundant families of TIRs have been identified in

  4. Why Chromosome Palindromes?

    PubMed Central

    Betrán, Esther; Demuth, Jeffery P.; Williford, Anna

    2012-01-01

    We look at sex-limited chromosome (Y or W) evolution with particular emphasis on the importance of palindromes. Y chromosome palindromes consist of inverted duplicates that allow for local recombination in an otherwise nonrecombining chromosome. Since palindromes enable intrachromosomal gene conversion that can help eliminate deleterious mutations, they are often highlighted as mechanisms to protect against Y degeneration. However, the adaptive significance of recombination resides in its ability to decouple the evolutionary fates of linked mutations, leading to both a decrease in degeneration rate and an increase in adaptation rate. Our paper emphasizes the latter, that palindromes may exist to accelerate adaptation by increasing the potential targets and fixation rates of incoming beneficial mutations. This hypothesis helps reconcile two enigmatic features of the “palindromes as protectors” view: (1) genes that are not located in palindromes have been retained under purifying selection for tens of millions of years, and (2) under models that only consider deleterious mutations, gene conversion benefits duplicate gene maintenance but not initial fixation. We conclude by looking at ways to test the hypothesis that palindromes enhance the rate of adaptive evolution of Y-linked genes and whether this effect can be extended to palindromes on other chromosomes. PMID:22844637

  5. Palindromic Rheumatism: Does It Cause Joint Pain?

    MedlinePlus

    ... rheumatoid arthritis? Is palindromic rheumatism a precursor to rheumatoid arthritis? Answers from April Chang-Miller, M.D. About a third of the ... have palindromic rheumatism will go on to develop rheumatoid arthritis. Palindromic rheumatism is characterized by sudden and recurrent ...

  6. Molecular typing of Candida albicans strains isolated from denture wearers by repetitive sequence-based PCR.

    PubMed

    Abaci, O; Haliki-Uztan, A; Ozturk, B; Toksavul, S; Ulusoy, M; Boyacioglu, H

    2011-02-01

    Long-term use of prosthesis is the most important risk factor for the colonization of Candida species on the mucosal surfaces, which can lead to the development of denture-related stomatitis (DRS). Some individuals wearing prosthesis develop DRS and others do not. C. albicans strains isolated from both groups were genotypically compared. The purpose of this study was to determine whether the strain causing prosthesis stomatitis was different from the other strains genotypically. The study included 90 individuals wearing different prostheses and 20 control individuals with natural teeth. In the study 109 C. albicans strains were used which were isolated from the saliva samples and the mucosal surfaces of the tongues and palates of 51 individuals and then defined phenotypically. Phenotypic diagnosis of the isolates was genotypically verified by using species-specific PCR. For molecular typing, repetitive extragenic palindromic sequence polymerase chain reaction (REP-PCR) was employed. The results of the study revealed that REP-PCR had the capability to separate 109 C. albicans strains and six reference strains into 44 genotypes. Whereas C. albicans strains showed heterogenic distribution, C. albicans strains isolated from the individuals suffering from prosthesis stomatitis showed no specific genotypes. REP-PCR is a simple, fast and low-cost method and helped work on a great number of samples.

  7. A W-linked palindrome and gene conversion in New World sparrows and blackbirds

    PubMed Central

    Davis, Jamie K.; Thomas, Pamela J.

    2010-01-01

    A hallmark feature of the male-specific region of the human Y chromosome is the presence of large and near-identical palindromes. These palindromes are maintained in a state of near identity via gene conversion between the arms of the palindrome, and both neutral and selection-based theories have been proposed to explain their enrichment on the human Y and X chromosomes. While those proposed theories would be applicable to sex chromosomes in other species, it has not been established whether near-identical palindromes are a common feature of sex chromosomes in a broader range of taxa, including other tetrapods. Here, we report the genomic sequencing and features of a 279-kb region of the non-recombining portion of the W chromosome spanning the CHD1W locus in a New World sparrow, the white-throated sparrow (Zonotrichia albicollis), and the corresponding region on the Z chromosome. As has been observed for other Y and W chromosomes, we detected a high repetitive element content (51%) and low gene content on the white-throated sparrow W chromosome. In addition, we identified a 22-kb near-identical (>99%) palindrome on the W chromosome that flanks the 5′ end of the CHD1W gene. Signatures of gene conversion were readily detected between the arms of this palindrome, as was the presence of this palindrome in other New World sparrows and blackbirds. Near-identical palindromes are therefore present on the avian W chromosome and may persist due to the same forces proposed for the enrichment of these elements on the human sex chromosomes. PMID:20535633

  8. A W-linked palindrome and gene conversion in New World sparrows and blackbirds.

    PubMed

    Davis, Jamie K; Thomas, Pamela J; Thomas, James W

    2010-07-01

    A hallmark feature of the male-specific region of the human Y chromosome is the presence of large and near-identical palindromes. These palindromes are maintained in a state of near identity via gene conversion between the arms of the palindrome, and both neutral and selection-based theories have been proposed to explain their enrichment on the human Y and X chromosomes. While those proposed theories would be applicable to sex chromosomes in other species, it has not been established whether near-identical palindromes are a common feature of sex chromosomes in a broader range of taxa, including other tetrapods. Here, we report the genomic sequencing and features of a 279-kb region of the non-recombining portion of the W chromosome spanning the CHD1W locus in a New World sparrow, the white-throated sparrow (Zonotrichia albicollis), and the corresponding region on the Z chromosome. As has been observed for other Y and W chromosomes, we detected a high repetitive element content (51%) and low gene content on the white-throated sparrow W chromosome. In addition, we identified a 22-kb near-identical (>99%) palindrome on the W chromosome that flanks the 5' end of the CHD1W gene. Signatures of gene conversion were readily detected between the arms of this palindrome, as was the presence of this palindrome in other New World sparrows and blackbirds. Near-identical palindromes are therefore present on the avian W chromosome and may persist due to the same forces proposed for the enrichment of these elements on the human sex chromosomes.

  9. Musical Palindromes for Liberal Arts Students

    ERIC Educational Resources Information Center

    von Renesse, Christine

    2012-01-01

    This paper shows how to teach a mathematics for liberal arts class in an inquiry-based way using ideas from music to launch the mathematical activities. No musical knowledge is required to understand and teach the material. The main activity is analyzing the differences between two kinds of rhythmic palindromes. The content is mathematically…

  10. Musical Palindromes for Liberal Arts Students

    ERIC Educational Resources Information Center

    von Renesse, Christine

    2012-01-01

    This paper shows how to teach a mathematics for liberal arts class in an inquiry-based way using ideas from music to launch the mathematical activities. No musical knowledge is required to understand and teach the material. The main activity is analyzing the differences between two kinds of rhythmic palindromes. The content is mathematically…

  11. Large-scale production of palindrome DNA fragments

    SciTech Connect

    Palmer, E.L.; Gewiess, A.; Harp, J.M.

    1995-10-10

    Our structural studies of nucleosomes necessitated the production of over 100 mg of a 146-bp perfect palindrome DNA for use in the reconstitution of perfectly symmetrical nucleosome core particles for detailed X-ray crystallographic analysis. The propagation of palindromic DNA sequences by bacterial culture is hindered by the instability of these sequences during bacterial replication and recombination. While the loss of some palindrome sequences can be elminated by the use of sbcB or sbcC mutants of Escherichia coli, not all palindrome-containing plasmids are faithfully maintained by these strains. The production of large quantities of palindrome DNA can therefore be extremely difficult. After trying several approaches, we were able to develop a reliable procedure for production of large quantities of palindrome DNA that involves production of plasmid containing multiple copies of the repeating unit of the palindrome which are isolated by restriction digestion and ligated in vitro to form the palindrome DNA. The procedure has resulted in the production of over 20 mg of a 146-bp DNA fragment in 2 weeks.

  12. GAP-Seq: a method for identification of DNA palindromes.

    PubMed

    Yang, Hui; Volfovsky, Natalia; Rattray, Alison; Chen, Xiongfong; Tanaka, Hisashi; Strathern, Jeffrey

    2014-05-22

    Closely spaced long inverted repeats, also known as DNA palindromes, can undergo intrastrand annealing to form DNA hairpins. The ability to form these hairpins results in genome instability, difficulties in maintaining clones in Escherichia coli and major problems for most DNA sequencing approaches. Because of their role in genomic instability and gene amplification in some human cancers, it is important to develop systematic approaches to detect and characterize DNA palindromes. We developed a new protocol to identify palindromes that couples the S1 nuclease treated Cot0 DNA (GAPF) with high-throughput sequencing (GAP-Seq). Unlike earlier protocols, it does not involve restriction enzymatic digestion prior to DNA snap-back thereby preserving longer DNA sequences. It also indicates the location of the novel junction, which can then be recovered. Using MCF-7 breast cancer cell line as the proof-of-principle analysis, we have identified 35 palindrome candidates and physically characterized the top 5 candidates and their junctions. Because this protocol eliminates many of the false positives that plague earlier techniques, we have improved palindrome identification. The GAP-Seq approach underscores the importance of developing new tools for identifying and characterizing palindromes, and provides a new strategy to systematically assess palindromes in genomes. It will be useful for studying human cancers and other diseases associated with palindromes.

  13. arc-dependent thermal regulation and extragenic suppression of the Escherichia coli cytochrome d operon.

    PubMed

    Wall, D; Delaney, J M; Fayet, O; Lipinska, B; Yamamoto, T; Georgopoulos, C

    1992-10-01

    In a screen for Escherichia coli genes whose products are required for high-temperature growth, we identified and characterized a mini-Tn10 insertion that allows the formation of wild-type-size colonies at 30 degrees C but results in microcolony formation at 36 degrees C and above (Ts- phenotype). Mapping, molecular cloning, and DNA sequencing analyses showed that the mini-Tn10 insertion resides in the cydB gene, the distal gene of the cydAB operon (cytochrome d). The Ts- growth phenotype was also shown to be associated with previously described cyd alleles. In addition, all cyd mutants were found to be extremely sensitive to hydrogen peroxide. Northern (RNA) blot analysis showed that cyd-specific mRNA levels accumulate following a shift to high temperature. Interestingly, this heat shock induction of the cyd operon was not affected in an rpoH delta background but was totally absent in an arcA or arcB mutant background. Extragenic suppressors of the Cyd Ts- phenotype are found at approximately 10(-3). Two extragenic suppressors were shown to be null alleles in either arcA or arcB. One interpretation of our results is that in the absence of ArcA or ArcB, which are required for the repression of the cyo operon (cytochrome o), elevated levels of Cyo are produced, thus compensating for the missing cytochrome d function. Consistent with this interpretation, the presence of the cyo gene on a multicopy plasmid suppressed the Ts- and hydrogen peroxide-sensitive phenotypes of cyd mutants.

  14. Palindromic 3-stage splitting integrators, a roadmap

    NASA Astrophysics Data System (ADS)

    Campos, Cédric M.; Sanz-Serna, J. M.

    2017-10-01

    The implementation of multi-stage splitting integrators is essentially the same as the implementation of the familiar Strang/Verlet method. Therefore multi-stage formulas may be easily incorporated into software that now uses the Strang/Verlet integrator. We study in detail the two-parameter family of palindromic, three-stage splitting formulas and identify choices of parameters that may outperform the Strang/Verlet method. One of these choices leads to a method of effective order four suitable to integrate in time some partial differential equations. Other choices may be seen as perturbations of the Strang method that increase efficiency in molecular dynamics simulations and in Hybrid Monte Carlo sampling.

  15. Repetitive Elements in Mycoplasma hyopneumoniae Transcriptional Regulation.

    PubMed

    Cattani, Amanda Malvessi; Siqueira, Franciele Maboni; Guedes, Rafael Lucas Muniz; Schrank, Irene Silveira

    2016-01-01

    Transcriptional regulation, a multiple-step process, is still poorly understood in the important pig pathogen Mycoplasma hyopneumoniae. Basic motifs like promoters and terminators have already been described, but no other cis-regulatory elements have been found. DNA repeat sequences have been shown to be an interesting potential source of cis-regulatory elements. In this work, a genome-wide search for tandem and palindromic repetitive elements was performed in the intergenic regions of all coding sequences from M. hyopneumoniae strain 7448. Computational analysis demonstrated the presence of 144 tandem repeats and 1,171 palindromic elements. The DNA repeat sequences were distributed within the 5' upstream regions of 86% of transcriptional units of M. hyopneumoniae strain 7448. Comparative analysis between distinct repetitive sequences found in related mycoplasma genomes demonstrated different percentages of conservation among pathogenic and nonpathogenic strains. qPCR assays revealed differential expression among genes showing variable numbers of repetitive elements. In addition, repeats found in 206 genes already described to be differentially regulated under different culture conditions of M. hyopneumoniae strain 232 showed almost 80% conservation in relation to M. hyopneumoniae strain 7448 repeats. Altogether, these findings suggest a potential regulatory role of tandem and palindromic DNA repeats in the M. hyopneumoniae transcriptional profile.

  16. Repetitive Elements in Mycoplasma hyopneumoniae Transcriptional Regulation

    PubMed Central

    Cattani, Amanda Malvessi; Siqueira, Franciele Maboni; Guedes, Rafael Lucas Muniz; Schrank, Irene Silveira

    2016-01-01

    Transcriptional regulation, a multiple-step process, is still poorly understood in the important pig pathogen Mycoplasma hyopneumoniae. Basic motifs like promoters and terminators have already been described, but no other cis-regulatory elements have been found. DNA repeat sequences have been shown to be an interesting potential source of cis-regulatory elements. In this work, a genome-wide search for tandem and palindromic repetitive elements was performed in the intergenic regions of all coding sequences from M. hyopneumoniae strain 7448. Computational analysis demonstrated the presence of 144 tandem repeats and 1,171 palindromic elements. The DNA repeat sequences were distributed within the 5’ upstream regions of 86% of transcriptional units of M. hyopneumoniae strain 7448. Comparative analysis between distinct repetitive sequences found in related mycoplasma genomes demonstrated different percentages of conservation among pathogenic and nonpathogenic strains. qPCR assays revealed differential expression among genes showing variable numbers of repetitive elements. In addition, repeats found in 206 genes already described to be differentially regulated under different culture conditions of M. hyopneumoniae strain 232 showed almost 80% conservation in relation to M. hyopneumoniae strain 7448 repeats. Altogether, these findings suggest a potential regulatory role of tandem and palindromic DNA repeats in the M. hyopneumoniae transcriptional profile. PMID:28005945

  17. Retroviruses integrate into a shared, non-palindromic DNA motif.

    PubMed

    Kirk, Paul D W; Huvet, Maxime; Melamed, Anat; Maertens, Goedele N; Bangham, Charles R M

    2016-11-14

    Many DNA-binding factors, such as transcription factors, form oligomeric complexes with structural symmetry that bind to palindromic DNA sequences(1). Palindromic consensus nucleotide sequences are also found at the genomic integration sites of retroviruses(2-6) and other transposable elements(7-9), and it has been suggested that this palindromic consensus arises as a consequence of the structural symmetry in the integrase complex(2,3). However, we show here that the palindromic consensus sequence is not present in individual integration sites of human T-cell lymphotropic virus type 1 (HTLV-1) and human immunodeficiency virus type 1 (HIV-1), but arises in the population average as a consequence of the existence of a non-palindromic nucleotide motif that occurs in approximately equal proportions on the plus strand and the minus strand of the host genome. We develop a generally applicable algorithm to sort the individual integration site sequences into plus-strand and minus-strand subpopulations, and use this to identify the integration site nucleotide motifs of five retroviruses of different genera: HTLV-1, HIV-1, murine leukaemia virus (MLV), avian sarcoma leucosis virus (ASLV) and prototype foamy virus (PFV). The results reveal a non-palindromic motif that is shared between these retroviruses.

  18. 100 Repetitions

    ERIC Educational Resources Information Center

    Benson, Jeffrey

    2012-01-01

    One hundred repetitions--100 "useful" repetitions. This notion has guided the author's work in alternative education programs for almost 20 years, dealing with the most challenging students, from addicts to conduct-disordered adolescents to traumatized 5th graders. There are no magic tricks. The role of educators is to align with the healthy…

  19. 100 Repetitions

    ERIC Educational Resources Information Center

    Benson, Jeffrey

    2012-01-01

    One hundred repetitions--100 "useful" repetitions. This notion has guided the author's work in alternative education programs for almost 20 years, dealing with the most challenging students, from addicts to conduct-disordered adolescents to traumatized 5th graders. There are no magic tricks. The role of educators is to align with the healthy…

  20. AT-rich palindromes mediate the constitutional t(11;22) translocation.

    PubMed

    Edelmann, L; Spiteri, E; Koren, K; Pulijaal, V; Bialer, M G; Shanske, A; Goldberg, R; Morrow, B E

    2001-01-01

    The constitutional t(11;22) translocation is the only known recurrent non-Robertsonian translocation in humans. Offspring are susceptible to der(22) syndrome, a severe congenital anomaly disorder caused by 3&rcolon;1 meiotic nondisjunction events. We previously localized the t(11;22) translocation breakpoint to a region on 22q11 within a low-copy repeat termed "LCR22" and within an AT-rich repeat on 11q23. The LCR22s are implicated in mediating different rearrangements on 22q11, leading to velocardiofacial syndrome/DiGeorge syndrome and cat-eye syndrome by homologous recombination mechanisms. The LCR22s contain AT-rich repetitive sequences, suggesting that such repeats may mediate the t(11;22) translocation. To determine the molecular basis of the translocation, we cloned and sequenced the t(11;22) breakpoint in the derivative 11 and 22 chromosomes in 13 unrelated carriers, including two de novo cases and der(22) syndrome offspring. We found that, in all cases examined, the reciprocal exchange occurred between similar AT-rich repeats on both chromosomes 11q23 and 22q11. To understand the mechanism, we examined the sequence of the breakpoint intervals in the derivative chromosomes and compared this with the deduced normal chromosomal sequence. A palindromic AT-rich sequence with a near-perfect hairpin could form, by intrastrand base-pairing, on the parental chromosomes. The sequence of the breakpoint junction in both derivatives indicates that the exchange events occurred at the center of symmetry of the palindromes, and this resulted in small, overlapping staggered deletions in this region among the different carriers. On the basis of previous studies performed in diverse organisms, we hypothesize that double-strand breaks may occur in the center of the palindrome, the tip of the putative hairpin, leading to illegitimate recombination events between similar AT-rich sequences on chromosomes 11 and 22, resulting in deletions and loss of the palindrome, which then

  1. Characterization of Erwinia amylovora strains from different host plants using repetitive-sequences PCR analysis, and restriction fragment length polymorphism and short-sequence DNA repeats of plasmid pEA29.

    PubMed

    Barionovi, D; Giorgi, S; Stoeger, A R; Ruppitsch, W; Scortichini, M

    2006-05-01

    The three main aims of the study were the assessment of the genetic relationship between a deviating Erwinia amylovora strain isolated from Amelanchier sp. (Maloideae) grown in Canada and other strains from Maloideae and Rosoideae, the investigation of the variability of the PstI fragment of the pEA29 plasmid using restriction fragment length polymorphism (RFLP) analysis and the determination of the number of short-sequence DNA repeats (SSR) by DNA sequence analysis in representative strains. Ninety-three strains obtained from 12 plant genera and different geographical locations were examined by repetitive-sequences PCR using Enterobacterial Repetitive Intergenic Consensus, BOX and Repetitive Extragenic Palindromic primer sets. Upon the unweighted pair group method with arithmetic mean analysis, a deviating strain from Amelanchier sp. was analysed using amplified ribosomal DNA restriction analysis (ARDRA) analysis and the sequencing of the 16S rDNA gene. This strain showed 99% similarity to other E. amylovora strains in the 16S gene and the same banding pattern with ARDRA. The RFLP analysis of pEA29 plasmid using MspI and Sau3A restriction enzymes showed a higher variability than that previously observed and no clear-cut grouping of the strains was possible. The number of SSR units reiterated two to 12 times. The strains obtained from pear orchards showing for the first time symptoms of fire blight had a low number of SSR units. The strains from Maloideae exhibit a wider genetic variability than previously thought. The RFLP analysis of a fragment of the pEA29 plasmid would not seem a reliable method for typing E. amylovora strains. A low number of SSR units was observed with first epidemics of fire blight. The current detection techniques are mainly based on the genetic similarities observed within the strains from the cultivated tree-fruit crops. For a more reliable detection of the fire blight pathogen also in wild and ornamentals Rosaceous plants the genetic

  2. Intragenic and Extragenic Suppressors of Mutations in the Heptapeptide Repeat Domain of Saccharomyces Cerevisiae RNA Polymerase II

    PubMed Central

    Nonet, M. L.; Young, R. A.

    1989-01-01

    The largest subunit of RNA polymerase II contains a repeated heptapeptide sequence at its carboxy terminus. Yeast mutants with certain partial deletions of the carboxy-terminal repeat (CTR) domain are temperature-sensitive, cold-sensitive and are inositol auxotrophs. Intragenic and extragenic suppressors of the cold-sensitive phenotype of CTR domain deletion mutants were isolated and studied to investigate the function of this domain. Two types of intragenic suppressing mutations suppress the temperature-sensitivity, cold-sensitivity and inositol auxotrophy of CTR domain deletion mutants. Most intragenic mutations enlarge the repeat domain by duplicating various portions of the repeat coding sequence. Other intragenic suppressing mutations are point mutations in a conserved segment of the large subunit. An extragenic suppressing mutation (SRB2-1) was isolated that strongly suppresses the conditional and auxotrophic phenotypes of CTR domain mutations. The SRB2 gene was isolated and mapped, and an SRB2 partial deletion mutation (srb2Δ10) was constructed. The srb2Δ10 mutants are temperature-sensitive, cold-sensitive and are inositol auxotrophs. These phenotypes are characteristic of mutations in genes encoding components of the transcription apparatus. We propose that the SRB2 gene encodes a factor that is involved in RNA synthesis and may interact with the CTR domain of the large subunit of RNA polymerase II. PMID:2693207

  3. Hypertrophic osteoarthropathy: a palindrome with a pathogenic connotation.

    PubMed

    Martinez-Lavin, Manuel; Vargas, Angélica; Rivera-Viñas, Miguel

    2008-01-01

    The review seeks to update advances on the pathogenesis of hypertrophic osteoarthropathy, describe a previously unrecognized palindrome that occurs in hypertrophic osteoarthropathy and that may have pathogenic implications, and review the role of bisphosphonates in the treatment of this condition. Some patients with primary hypertrophic osteoarthropathy display an interesting palindrome. Many years after the onset of the osteoarthropathy, they develop diseases that in other circumstances are known to generate secondary hypertrophic osteoarthropathy. This palindrome has been reported in cases of patent ductus arteriosus, Crohn's disease and myelofibrosis. Additionally, primary hypertrophic osteoarthropathy and POEMS syndrome share important clinical features. The many diseases associated with hypertrophic osteoarthropathy have in common abnormal production of vascular endothelial growth factor. This cytokine has been proposed to play a major role in the pathogenesis of Crohn's disease, myelofibrosis and POEMS syndrome. A controlled study showed that vascular endothelial growth factor is abnormally expressed in cases of hypertrophic osteoarthropathy. The biologic effects of vascular endothelial growth factor may explain hypertrophic osteoarthropathy histological features. Several isolated reports suggest that pamidronate is effective in relieving painful osteoarthropathy. Hypertrophic osteoarthropathy is a palindromic syndrome. Anomalous vascular endothelial growth factor expression may explain this phenomenon. Bisphosphonates may have a role in the symptomatic treatment of hypertrophic osteoarthropathy.

  4. Repetition reduction: Lexical repetition in the absence of referent repetition

    PubMed Central

    Lam, Tuan Q.; Watson, Duane G.

    2014-01-01

    Repeated words are produced with reduced acoustic prominence compared to words that are new to a discourse. Although these effects are often attributed to priming in the production system, the locus of the effect within the production system remains unresolved because in natural speech, repetition often involves repetition of referents and lexical items simultaneously. Therefore, repetition reduction could be due to repeated mention of a referent, or repetition of a word or referring expression. In our study, we test whether repetition reduction is due to repetition of lexical items or repeated mention of referents using an event description task. The results show that repeated lexical items lead to reduced duration and intensity even in the absence of referent repetition whereas repeated referents lead to reduced intensity alone. The general pattern suggests that repetition reduction is due most strongly to repetition of the lexical item, rather than repeated mention of the referent. PMID:24548320

  5. Symmetry Analysis of an X-palindrome in Human and Chimpanzee

    NASA Astrophysics Data System (ADS)

    Qi, Yan-jiao; Qiu, Wen-yuan

    2009-08-01

    We analyze for the first time the rules of breaking in an X-palindrome between human and chimpanzee. Results indicate that although the overall changes that occurred in the human X-palindrome are fewer than in the chimpanzee, mutations occurring between the left arm and right arm were nearly equivalent both in human and chimpanzee when compared with orangutan, which implies evolutionary synchronization. However, there are many more A/T→G/C changes than G/C→A/T in a single arm, which would lead to an increasing trend in GC content and suggest that the composition is not at equilibrium. In addition, it is remarkable to find that there are much more asymmetrical nucleotide changes between the two arms of the human palindrome than that of the chimpanzee palindrome, and these mutations are prone to occur between bases with similar chemical structures. The symmetry seems higher in the chimpanzee palindrome than in the human X-palindrome.

  6. CRISPR Recognition Tool (CRT): a tool for automatic detection ofclustered regularly interspaced palindromic repeats

    SciTech Connect

    Bland, Charles; Ramsey, Teresa L.; Sabree, Fareedah; Lowe,Micheal; Brown, Kyndall; Kyrpides, Nikos C.; Hugenholtz, Philip

    2007-05-01

    Clustered Regularly Interspaced Palindromic Repeats (CRISPRs) are a novel type of direct repeat found in a wide range of bacteria and archaea. CRISPRs are beginning to attract attention because of their proposed mechanism; that is, defending their hosts against invading extrachromosomal elements such as viruses. Existing repeat detection tools do a poor job of identifying CRISPRs due to the presence of unique spacer sequences separating the repeats. In this study, a new tool, CRT, is introduced that rapidly and accurately identifies CRISPRs in large DNA strings, such as genomes and metagenomes. CRT was compared to CRISPR detection tools, Patscan and Pilercr. In terms of correctness, CRT was shown to be very reliable, demonstrating significant improvements over Patscan for measures precision, recall and quality. When compared to Pilercr, CRT showed improved performance for recall and quality. In terms of speed, CRT also demonstrated superior performance, especially for genomes containing large numbers of repeats. In this paper a new tool was introduced for the automatic detection of CRISPR elements. This tool, CRT, was shown to be a significant improvement over the current techniques for CRISPR identification. CRT's approach to detecting repetitive sequences is straightforward. It uses a simple sequential scan of a DNA sequence and detects repeats directly without any major conversion or preprocessing of the input. This leads to a program that is easy to describe and understand; yet it is very accurate, fast and memory efficient, being O(n) in space and O(nm/l) in time.

  7. Clustered regularly interspaced short palindromic repeats (CRISPRs) analysis of members of the Mycobacterium tuberculosis complex.

    PubMed

    Botelho, Ana; Canto, Ana; Leão, Célia; Cunha, Mónica V

    2015-01-01

    Typical CRISPR (clustered, regularly interspaced, short palindromic repeat) regions are constituted by short direct repeats (DRs), interspersed with similarly sized non-repetitive spacers, derived from transmissible genetic elements, acquired when the cell is challenged with foreign DNA. The analysis of the structure, in number and nature, of CRISPR spacers is a valuable tool for molecular typing since these loci are polymorphic among strains, originating characteristic signatures. The existence of CRISPR structures in the genome of the members of Mycobacterium tuberculosis complex (MTBC) enabled the development of a genotyping method, based on the analysis of the presence or absence of 43 oligonucleotide spacers separated by conserved DRs. This method, called spoligotyping, consists on PCR amplification of the DR chromosomal region and recognition after hybridization of the spacers that are present. The workflow beneath this methodology implies that the PCR products are brought onto a membrane containing synthetic oligonucleotides that have complementary sequences to the spacer sequences. Lack of hybridization of the PCR products to a specific oligonucleotide sequence indicates absence of the correspondent spacer sequence in the examined strain. Spoligotyping gained great notoriety as a robust identification and typing tool for members of MTBC, enabling multiple epidemiological studies on human and animal tuberculosis.

  8. Palindromic amplification of the ERBB2 oncogene in primary HER2-positive breast tumors

    PubMed Central

    Marotta, Michael; Onodera, Taku; Johnson, Jeffrey; Budd, G. Thomas; Watanabe, Takaaki; Cui, Xiaojiang; Giuliano, Armando E.; Niida, Atsushi; Tanaka, Hisashi

    2017-01-01

    Oncogene amplification confers a growth advantage to tumor cells for clonal expansion. There are several, recurrently amplified oncogenes throughout the human genome. However, it remains unclear whether this recurrent amplification is solely a manifestation of increased fitness resulting from random amplification mechanisms, or if a genomic locus-specific amplification mechanism plays a role. Here we show that the ERBB2 oncogene at 17q12 is susceptible to palindromic gene amplification, a mechanism characterized by the inverted (palindromic) duplication of genomic segments, in HER2-positive breast tumors. We applied two genomic approaches to investigate amplification mechanisms: sequencing of DNA libraries enriched with tumor-derived palindromic DNA (Genome-wide Analysis of Palindrome Formation) and whole genome sequencing (WGS). We observed significant enrichment of palindromic DNA within amplified ERBB2 genomic segments. Palindromic DNA was particularly enriched at amplification peaks and at boundaries between amplified and normal copy-number regions. Thus, palindromic gene amplification shaped the amplified ERBB2 locus. The enrichment of palindromic DNA throughout the amplified segments leads us to propose that the ERBB2 locus is amplified through the mechanism that repeatedly generates palindromic DNA, such as Breakage-Fusion-Bridge cycles. The genomic architecture surrounding ERBB2 in the normal genome, such as segmental duplications, could promote the locus-specific mechanism. PMID:28211519

  9. Unusually long palindromes are abundant in mitochondrial control regions of insects and nematodes.

    PubMed

    Arunkumar, K P; Nagaraju, Javaregowda

    2006-12-20

    Palindromes are known to be involved in a variety of biological processes. In the present investigation we carried out a comprehensive analysis of palindromes in the mitochondrial control regions (CRs) of several animal groups to study their frequency, distribution and architecture to gain insights into the origin of replication of mtDNA. Many species of Arthropoda, Nematoda, Mollusca and Annelida harbor palindromes and inverted repeats (IRs) in their CRs. Lower animals like cnidarians and higher animal groups like chordates are almost devoid of palindromes and IRs. The study revealed that palindrome occurrence is positively correlated with the AT content of CRs, and that IRs are likely to give rise to longer palindromes. The present study attempts to explain possible reasons and gives in silico evidence for absence of palindromes and IRs from CR of vertebrate mtDNA and acquisition and retention of the same in insects. Study of CRs of different animal phyla uncovered unique architecture of this locus, be it high abundance of long palindromes and IRs in CRs of Insecta and Nematoda, or short IRs of 10-20 nucleotides with a spacer region of 12-14 bases in subphylum Chelicerata, or nearly complete of absence of any long palindromes and IRs in Vertebrata, Cnidaria and Echinodermata.

  10. Palindrome-Mediated Translocations in Humans: A New Mechanistic Model for Gross Chromosomal Rearrangements

    PubMed Central

    Inagaki, Hidehito; Kato, Takema; Tsutsumi, Makiko; Ouchi, Yuya; Ohye, Tamae; Kurahashi, Hiroki

    2016-01-01

    Palindromic DNA sequences, which can form secondary structures, are widely distributed in the human genome. Although the nature of the secondary structure—single-stranded “hairpin” or double-stranded “cruciform”—has been extensively investigated in vitro, the existence of such unusual non-B DNA in vivo remains controversial. Here, we review palindrome-mediated gross chromosomal rearrangements possibly induced by non-B DNA in humans. Recent advances in next-generation sequencing have not yet overcome the difficulty of palindromic sequence analysis. However, a dozen palindromic AT-rich repeat (PATRR) sequences have been identified at the breakpoints of recurrent or non-recurrent chromosomal translocations in humans. The breakages always occur at the center of the palindrome. Analyses of polymorphisms within the palindromes indicate that the symmetry and length of the palindrome affect the frequency of the de novo occurrence of these palindrome-mediated translocations, suggesting the involvement of non-B DNA. Indeed, experiments using a plasmid-based model system showed that the formation of non-B DNA is likely the key to palindrome-mediated genomic rearrangements. Some evidence implies a new mechanism that cruciform DNAs may come close together first in nucleus and illegitimately joined. Analysis of PATRR-mediated translocations in humans will provide further understanding of gross chromosomal rearrangements in many organisms. PMID:27462347

  11. Repetition Reduction: Lexical Repetition in the Absence of Referent Repetition

    ERIC Educational Resources Information Center

    Lam, Tuan Q.; Watson, Duane G.

    2014-01-01

    Compared to words that are new to a discourse, repeated words are produced with reduced acoustic prominence. Although these effects are often attributed to priming in the production system, the locus of the effect within the production system remains unresolved because, in natural speech, repetition often involves repetition of referents and…

  12. Repetition Reduction: Lexical Repetition in the Absence of Referent Repetition

    ERIC Educational Resources Information Center

    Lam, Tuan Q.; Watson, Duane G.

    2014-01-01

    Compared to words that are new to a discourse, repeated words are produced with reduced acoustic prominence. Although these effects are often attributed to priming in the production system, the locus of the effect within the production system remains unresolved because, in natural speech, repetition often involves repetition of referents and…

  13. Characteristics of palindromic sequences in DNA of the sea urchin Stronglyocentrotus intermedius

    SciTech Connect

    Brykov, V.A.; Kukhlevskii, A.D.

    1986-03-20

    The fraction of palindromic sequences in the nuclear DNA of the sea urchin S. intermedius was characterized. Using chromatography on hydroxyapatite and treatment with S1 nuclease, it was shown that the fraction of palindromic sequences more than doubles when the sodium concentration in solution is increased or the temperature of reassociation is lowered. The increase is due to the involvement of inverted repeats in reassociation, which are characterized by a substantial nonhomologous character and/or the presence of an extended intervening DNA sequence. It was found by the method of reassociation of a nicked palindrome fraction with an excess of total homologous DNA that most of the inverted repeats in the sea urchin genome are unique sequences. The complexity of the palindrome fraction was estimated at 8.2 x 10/sup 7/ nucleotide pairs, and the number of palindromes per haploid genome approx. 500,000.

  14. Trapping of palindromic ligands within native transthyretin prevents amyloid formation

    PubMed Central

    Kolstoe, Simon E.; Mangione, Palma P.; Bellotti, Vittorio; Taylor, Graham W.; Tennent, Glenys A.; Deroo, Stéphanie; Morrison, Angus J.; Cobb, Alexander J. A.; Coyne, Anthony; McCammon, Margaret G.; Warner, Timothy D.; Mitchell, Jane; Gill, Raj; Smith, Martin D.; Ley, Steven V.; Robinson, Carol V.; Wood, Stephen P.; Pepys, Mark B.

    2010-01-01

    Transthyretin (TTR) amyloidosis is a fatal disease for which new therapeutic approaches are urgently needed. We have designed two palindromic ligands, 2,2'-(4,4'-(heptane-1,7-diylbis(oxy))bis(3,5-dichloro-4,1-phenylene)) bis(azanediyl)dibenzoic acid (mds84) and 2,2'-(4,4'-(undecane-1,11-diylbis(oxy))bis(3,5-dichloro-4,1-phenylene)) bis(azanediyl)dibenzoic acid (4ajm15), that are rapidly bound by native wild-type TTR in whole serum and even more avidly by amyloidogenic TTR variants. One to one stoichiometry, demonstrable in solution and by MS, was confirmed by X-ray crystallographic analysis showing simultaneous occupation of both T4 binding sites in each tetrameric TTR molecule by the pair of ligand head groups. Ligand binding by native TTR was irreversible under physiological conditions, and it stabilized the tetrameric assembly and inhibited amyloidogenic aggregation more potently than other known ligands. These superstabilizers are orally bioavailable and exhibit low inhibitory activity against cyclooxygenase (COX). They offer a promising platform for development of drugs to treat and prevent TTR amyloidosis. PMID:21059958

  15. Extragenic Suppression of a Mutation in Herpes Simplex Virus 1 UL34 That Affects Lamina Disruption and Nuclear Egress

    PubMed Central

    Vu, Amber; Poyzer, Chelsea

    2016-01-01

    ABSTRACT Nuclear egress of herpesviruses is accompanied by changes in the architecture of the nuclear membrane and nuclear lamina that are thought to facilitate capsid access to the inner nuclear membrane (INM) and curvature of patches of the INM around the capsid during budding. Here we report the properties of a point mutant of pUL34 (Q163A) that fails to induce gross changes in nuclear architecture or redistribution of lamin A/C. The UL34(Q163A) mutant shows a roughly 100-fold defect in single-step growth, and it forms small plaques. This mutant has a defect in nuclear egress, and furthermore, it fails to disrupt nuclear shape or cause observable displacement of lamin A/C despite retaining the ability to recruit the pUS3 and PKC protein kinases and to mediate phosphorylation of emerin. Extragenic suppressors of the UL34(Q163A) phenotype were isolated, and all of them carry a single mutation of arginine 229 to leucine in UL31. Surprisingly, although this UL31 mutation largely restores virus replication, it does not correct the lamina disruption defect, suggesting that, in Vero cells, changes in nuclear shape and gross displacements of lamin A/C may facilitate but are unnecessary for nuclear egress. IMPORTANCE Herpesvirus nuclear egress is an essential and conserved process that requires close association of the viral capsid with the inner nuclear membrane and budding of the capsid into that membrane. Access to the nuclear membrane and tight curvature of that membrane are thought to require disruption of the nuclear lamina that underlies the inner nuclear membrane, and consistent with this idea, herpesvirus infection induces biochemical and architectural changes at the nuclear membrane. The significance of the nuclear membrane architectural changes is poorly characterized. The results presented here address that deficiency in our understanding and show that a combination of mutations in two of the viral nuclear egress factors results in a failure to accomplish at

  16. Wavelet analysis of DNA walks on the human and chimpanzee MAGE/CSAG-palindromes.

    PubMed

    Qi, Yanjiao; Jin, Nengzhi; Ai, Duiyuan

    2012-08-01

    The palindrome is one class of symmetrical duplications with reverse complementary characters, which is widely distributed in many organisms. Graphical representation of DNA sequence provides a simple way of viewing and comparing various genomic structures. Through 3-D DNA walk analysis, the similarity and differences in nucleotide composition, as well as the evolutionary relationship between human and chimpanzee MAGE/CSAG-palindromes, can be clearly revealed. Further wavelet analysis indicated that duplicated segments have irregular patterns compared to their surrounding sequences. However, sequence similarity analysis suggests that there is possible common ancestor between human and chimpanzee MAGE/CSAG-palindromes. Based on the specific distribution and orientation of the repeated sequences, a simple possible evolutionary model of the palindromes is suggested, which may help us to better understand the evolutionary course of the genes and the symmetrical sequences.

  17. Screens for Extragenic Mutations That Fail to Complement Act1 Alleles Identify Genes That Are Important for Actin Function in Saccharomyces Cerevisiae

    PubMed Central

    Welch, M. D.; Vinh, DBN.; Okamura, H. H.; Drubin, D. G.

    1993-01-01

    Null mutations in SAC6 and ABP1, genes that encode actin-binding proteins, failed to complement the temperature-sensitive phenotype caused by a mutation in the ACT1 gene. To identify novel genes whose protein products interact with actin, mutations that fail to complement act1-1 or act1-4, two temperature-sensitive alleles of ACT1, were isolated. A total of 14 extragenic noncomplementing mutations and 12 new alleles of ACT1 were identified in two independent screens. The 14 extragenic noncomplementing mutations represent alleles of at least four different genes, ANC1, ANC2, ANC3 and ANC4 (Actin NonComplementing). Mutations in the ANC1 gene were shown to cause osmosensitivity and defects in actin organization; phenotypes that are similar to those caused by act1 mutations. We conclude that the ANC1 gene product plays an important role in actin cytoskeletal function. The 12 new alleles of ACT1 will be useful for further elucidation of the functions of actin in yeast. PMID:8243992

  18. Telomere Dysfunction Triggers Palindrome Formation Independently of Double-Strand Break Repair Mechanisms

    PubMed Central

    Raykov, Vasil; Marvin, Marcus E.; Louis, Edward J.; Maringele, Laura

    2016-01-01

    Inverted chromosome duplications or palindromes are linked with genetic disorders and malignant transformation. They are considered by-products of DNA double-strand break (DSB) repair: the homologous recombination (HR) and the nonhomologous end joining (NHEJ). Palindromes near chromosome ends are often triggered by telomere losses. An important question is to what extent their formation depends upon DSB repair mechanisms. Here we addressed this question using yeast genetics and comparative genomic hybridization. We induced palindrome formation by passaging cells lacking any form of telomere maintenance (telomerase and telomere recombination). Surprisingly, we found that DNA ligase 4, essential for NHEJ, did not make a significant contribution to palindrome formation induced by telomere losses. Moreover RAD51, important for certain HR-derived mechanisms, had little effect. Furthermore RAD52, which is essential for HR in yeast, appeared to decrease the number of palindromes in cells proliferating without telomeres. This study also uncovered an important role for Rev3 and Rev7 (but not for Pol32) subunits of polymerase ζ in the survival of cells undergoing telomere losses and forming palindromes. We propose a model called short-inverted repeat-induced synthesis in which DNA synthesis, rather than DSB repair, drives the inverted duplication triggered by telomere dysfunction. PMID:27334270

  19. Database of repetitive elements in complete genomes and data mining using transcription factor binding sites.

    PubMed

    Horng, Jorng-Tzong; Lin, F M; Lin, J H; Huang, H D; Liu, B J

    2003-06-01

    Approximately 43% of the human genome is occupied by repetitive elements. Even more, around 51% of the rice genome is occupied by repetitive elements. The analysis presented here indicates that repetitive elements in complete genomes may have been very important in the evolutionary genomics. In this study, a database, called the Repeat Sequence Database, is first designed and implemented to store complete and comprehensive repetitive sequences. See http://rsdb.csie.ncu.edu.tw for more information. The database contains direct, inverted and palindromic repetitive sequences, and each repetitive sequence has a variable length ranging from seven to many hundred nucleotides. The repetitive sequences in the database are explored using a mathematical algorithm to mine rules on how combinations of individual binding sites are distributed among repetitive sequences in the database. Combinations of transcription factor binding sites in the repetitive sequences are obtained and then data mining techniques are applied to mine association rules from these combinations. The discovered associations are further pruned to remove insignificant associations and obtain a set of associations. The mined association rules facilitate efforts to identify gene classes regulated by similar mechanisms and accurately predict regulatory elements. Experiments are performed on several genomes including C. elegans, human chromosome 22, and yeast.

  20. Deciphering the importance of the palindromic architecture of the immunoglobulin heavy-chain 3' regulatory region

    PubMed Central

    Saintamand, Alexis; Vincent-Fabert, Christelle; Garot, Armand; Rouaud, Pauline; Oruc, Zeliha; Magnone, Virginie; Cogné, Michel; Denizot, Yves

    2016-01-01

    The IgH 3' regulatory region (3'RR) controls class switch recombination (CSR) and somatic hypermutation (SHM) in B cells. The mouse 3'RR contains four enhancer elements with hs1,2 flanked by inverted repeated sequences and the centre of a 25-kb palindrome bounded by two hs3 enhancer inverted copies (hs3a and hs3b). hs4 lies downstream of the palindrome. In mammals, evolution maintained this unique palindromic arrangement, suggesting that it is functionally significant. Here we report that deconstructing the palindromic IgH 3'RR strongly affects its function even when enhancers are preserved. CSR and IgH transcription appear to be poorly dependent on the 3'RR architecture and it is more or less preserved, provided 3'RR enhancers are present. By contrast, a ‘palindromic effect' significantly lowers VH germline transcription, AID recruitment and SHM. In conclusion, this work indicates that the IgH 3'RR does not simply pile up enhancer units but also optimally exposes them into a functional architecture of crucial importance. PMID:26883548

  1. Molecular identification and characterization of clustered regularly interspaced short palindromic repeat (CRISPR) gene cluster in Taylorella equigenitalis.

    PubMed

    Hara, Yasushi; Hayashi, Kyohei; Nakajima, Takuya; Kagawa, Shizuko; Tazumi, Akihiro; Moore, John E; Matsuda, Motoo

    2013-09-01

    Clustered regularly interspaced short palindromic repeats (CRISPRs), of approximately 10,000 base pairs (bp) in length, were shown to occur in the Japanese Taylorella equigenitalis strain, EQ59. The locus was composed of the putative CRISPRs-associated with 5 (cas5), RAMP csd1, csd2, recB, cas1, a leader region, 13 CRISPR consensus sequence repeats (each 32 bp; 5'-TCAGCCACGTTCGCGTGGCTGTGTGTTTAAAG-3'). These were in turn separated by 12 non repetitive unique spacer regions of similar length. In addition, a leader region, a transposase/IS protein, a leader region, and cas3 were also seen. All seven putative open reading frames carry their ribosome binding sites. Promoter consensus sequences at the -35 and -10 regions and putative intrinsic ρ-independent transcription terminator regions also occurred. A possible long overlap of 170 bp in length occurred between the recB and cas1 loci. Positive reverse transcription PCR signals of cas5, RAMP csd1, csd2-recB/cas1, and cas3 were generated. A putative secondary structure of the CRISPR consensus repeats was constructed. Following this, CRISPR results of the T. equigenitalis EQ59 isolate were subsequently compared with those from the Taylorella asinigenitalis MCE3 isolate.

  2. Clustered regularly interspaced short palindromic repeats (CRISPRs): the hallmark of an ingenious antiviral defense mechanism in prokaryotes.

    PubMed

    Al-Attar, Sinan; Westra, Edze R; van der Oost, John; Brouns, Stan J J

    2011-04-01

    Many prokaryotes contain the recently discovered defense system against mobile genetic elements. This defense system contains a unique type of repetitive DNA stretches, termed Clustered Regularly Interspaced Short Palindromic Repeats (CRISPRs). CRISPRs consist of identical repeated DNA sequences (repeats), interspaced by highly variable sequences referred to as spacers. The spacers originate from either phages or plasmids and comprise the prokaryotes' 'immunological memory'. CRISPR-associated (cas) genes encode conserved proteins that together with CRISPRs make-up the CRISPR/Cas system, responsible for defending the prokaryotic cell against invaders. CRISPR-mediated resistance has been proposed to involve three stages: (i) CRISPR-Adaptation, the invader DNA is encountered by the CRISPR/Cas machinery and an invader-derived short DNA fragment is incorporated in the CRISPR array. (ii) CRISPR-Expression, the CRISPR array is transcribed and the transcript is processed by Cas proteins. (iii) CRISPR-Interference, the invaders' nucleic acid is recognized by complementarity to the crRNA and neutralized. An application of the CRISPR/Cas system is the immunization of industry-relevant prokaryotes (or eukaryotes) against mobile-genetic invasion. In addition, the high variability of the CRISPR spacer content can be exploited for phylogenetic and evolutionary studies. Despite impressive progress during the last couple of years, the elucidation of several fundamental details will be a major challenge in future research.

  3. The Negative Repetition Effect

    ERIC Educational Resources Information Center

    Mulligan, Neil W.; Peterson, Daniel J.

    2013-01-01

    A fundamental property of human memory is that repetition enhances memory. Peterson and Mulligan (2012) recently documented a surprising "negative repetition effect," in which participants who studied a list of cue-target pairs twice recalled fewer targets than a group who studied the pairs only once. Words within a pair rhymed, and…

  4. The Negative Repetition Effect

    ERIC Educational Resources Information Center

    Mulligan, Neil W.; Peterson, Daniel J.

    2013-01-01

    A fundamental property of human memory is that repetition enhances memory. Peterson and Mulligan (2012) recently documented a surprising "negative repetition effect," in which participants who studied a list of cue-target pairs twice recalled fewer targets than a group who studied the pairs only once. Words within a pair rhymed, and…

  5. Roles of repetitive sequences

    SciTech Connect

    Bell, G.I.

    1991-12-31

    The DNA of higher eukaryotes contains many repetitive sequences. The study of repetitive sequences is important, not only because many have important biological function, but also because they provide information on genome organization, evolution and dynamics. In this paper, I will first discuss some generic effects that repetitive sequences will have upon genome dynamics and evolution. In particular, it will be shown that repetitive sequences foster recombination among, and turnover of, the elements of a genome. I will then consider some examples of repetitive sequences, notably minisatellite sequences and telomere sequences as examples of tandem repeats, without and with respectively known function, and Alu sequences as an example of interspersed repeats. Some other examples will also be considered in less detail.

  6. Schrödinger operators with Rudin-Shapiro potentials are not palindromic

    NASA Astrophysics Data System (ADS)

    Allouche, J.-P.

    1997-04-01

    We prove a conjecture of A. Hof, O. Knill and B. Simon [Commun. Math. Phys. 174, 149-159 (1995)] by showing that the Rudin-Shapiro sequence is not palindromic, i.e., does not contain arbitrarily long palindromes. We prove actually this property for all paperfolding sequences and all Rudin-Shapiro sequences deduced from paperfolding sequences. As a consequence and as guessed by the above authors, their method cannot be used for establishing that discrete Schrödinger operators with Rudin-Shapiro potentials have a purely singular continuous spectrum.

  7. Trialogue: Preparation, Repetition and...

    ERIC Educational Resources Information Center

    Oberg, Antoinette; And Others

    1996-01-01

    This paper interrogates both curriculum theory and the limits and potentials of textual forms. A set of overlapping discourses (a trialogue) focuses on inquiring into the roles of obsession and repetition in creating deeply interpretive locations for understanding. (SM)

  8. Repetition priming in music.

    PubMed

    Hutchins, Sean; Palmer, Caroline

    2008-06-01

    The authors explore priming effects of pitch repetition in music in 3 experiments. Musically untrained participants heard a short melody and sang the last pitch of the melody as quickly as possible. Each experiment manipulated (a) whether or not the tone to be sung (target) was heard earlier in the melody (primed) and (b) the prime-target distance (measured in events). Experiment 1 used variable-length melodies, whereas Experiments 2 and 3 used fixed-length melodies. Experiment 3 changed the timbre of the target tone. In all experiments, fast-responding participants produced repeated tones faster than nonrepeated tones, and this repetition benefit decreased as prime-target distances increased. All participants produced expected tonic endings faster than less expected nontonic endings. Repetition and tonal priming effects are compared with harmonic priming effects in music and with repetition priming effects in language.

  9. An intramolecular recombination mechanism for the formation of the rRNA gene palindrome of Tetrahymena thermophila

    SciTech Connect

    Butler, D.K.; Yasuda, L.E.; Yao, Meng-Chao

    1995-12-01

    This report discusses the formation of rRNA gene palindrome in Tetrahymena thermophila and the involvement of intramolecular recombination. This, along with the authors` previous study, is the first to define a molecular pathway of palindrome formation. 48 refs., 6 figs.

  10. Characterizing temporal repetition

    SciTech Connect

    Cukierman, D.; Delgrande, J.

    1996-12-31

    We are investigating the representation and reasoning about schedulable, repeated activities, specified using calendars. Examples of such activities include meeting every Tuesday and Thursday during a semester and attending a seminar every first day of a month. This research provides for a valuable framework for scheduling systems, financial systems and, in general, date-based systems. Very recently work has been done related to reasoning about repetition in the Artificial Intelligence community and others. A partial reference list is provided here. However, to our knowledge no extensive taxonomy of repetition has been proposed in the literature. We believe that reasoning about repeated activities calls for a study and precise definition of the topological characteristics in a repetitive series. In this abstract we summarize a proposal to classify types of repetition according to parameters. The combination of all possible values of these parameters provides a complete taxonomy of repetitive classes with respect to the proposed parameters. Several notions of repetition are considered, some are extremely general, some are very specific.

  11. Indirect decentralized repetitive control

    NASA Technical Reports Server (NTRS)

    Lee, Soo Cheol; Longman, Richard W.

    1993-01-01

    Learning control refers to controllers that learn to improve their performance at executing a given task, based on experience performing this specific task. In a previous work, the authors presented a theory of indirect decentralized learning control based on use of indirect adaptive control concepts employing simultaneous identification and control. This paper extends these results to apply to the indirect repetitive control problem in which a periodic (i.e., repetitive) command is given to a control system. Decentralized indirect repetitive control algorithms are presented that have guaranteed convergence to zero tracking error under very general conditions. The original motivation of the repetitive control and learning control fields was learning in robots doing repetitive tasks such as on an assembly line. This paper starts with decentralized discrete time systems, and progresses to the robot application, modeling the robot as a time varying linear system in the neighborhood of the desired trajectory. Decentralized repetitive control is natural for this application because the feedback control for link rotations is normally implemented in a decentralized manner, treating each link as if it is independent of the other links.

  12. Chromosome evolution with naked eye: Palindromic context of the life origin

    NASA Astrophysics Data System (ADS)

    Larionov, Sergei; Loskutov, Alexander; Ryadchenko, Eugeny

    2008-03-01

    Based on the representation of the DNA sequence as a two-dimensional (2D) plane walk, we consider the problem of identification and comparison of functional and structural organizations of chromosomes of different organisms. According to the characteristic design of 2D walks we identify telomere sites, palindromes of various sizes and complexity, areas of ribosomal RNA, transposons, as well as diverse satellite sequences. As an interesting result of the application of the 2D walk method, a new duplicated gigantic palindrome in the X human chromosome is detected. A schematic mechanism leading to the formation of such a duplicated palindrome is proposed. Analysis of a large number of the different genomes shows that some chromosomes (or their fragments) of various species appear as imperfect gigantic palindromes, which are disintegrated by many inversions and the mutation drift on different scales. A spread occurrence of these types of sequences in the numerous chromosomes allows us to develop a new insight of some accepted points of the genome evolution in the prebiotic phase.

  13. Clustered Regularly Interspaced Short Palindromic Repeats (CRISPRi) plasmids | Office of Cancer Genomics

    Cancer.gov

    CTD2 researchers at the University of California in San Francisco developed a modified Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) CRISPR/dCas9 system. Catalytically inactive dCas9 enables modular and programmable RNA-guided genome regulation in eukaryotes.

  14. Clustered Regularly Interspaced Short Palindromic Repeats (CRISPRi) plasmids | Office of Cancer Genomics

    Cancer.gov

    CTD2 researchers at the University of California in San Francisco developed a modified Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) CRISPR/dCas9 system. Catalytically inactive dCas9 enables modular and programmable RNA-guided genome regulation in eukaryotes.

  15. Clustered Regularly Interspaced Short Palindromic Repeats (CRISPRi) plasmids | Office of Cancer Genomics

    Cancer.gov

    CTD2 researchers at the University of California in San Francisco developed a modified Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) CRISPR/dCas9 system. Catalytically inactive dCas9 enables modular and programmable RNA-guided genome regulation in eukaryotes.

  16. [Advances in clustered regularly interspaced short palindromic repeats--a review].

    PubMed

    Wang, Lili; He, Jin; Wang, Jieping

    2011-08-01

    The recently discovered Clustered Regularly Interspaced Short Palindromic Repeat (CRISPRs) can protect bacteria and archaea with adaptive and heritable defense systems against the invasion of phage- and plasmid- associated mobile genetic elements. Here, we review the structure, diversity, mechanism of interference and self versus non-self discrimination of CRISPR systems. We also discuss the potential applications of this novel interference system.

  17. Chromosome evolution with naked eye: palindromic context of the life origin.

    PubMed

    Larionov, Sergei; Loskutov, Alexander; Ryadchenko, Eugeny

    2008-03-01

    Based on the representation of the DNA sequence as a two-dimensional (2D) plane walk, we consider the problem of identification and comparison of functional and structural organizations of chromosomes of different organisms. According to the characteristic design of 2D walks we identify telomere sites, palindromes of various sizes and complexity, areas of ribosomal RNA, transposons, as well as diverse satellite sequences. As an interesting result of the application of the 2D walk method, a new duplicated gigantic palindrome in the X human chromosome is detected. A schematic mechanism leading to the formation of such a duplicated palindrome is proposed. Analysis of a large number of the different genomes shows that some chromosomes (or their fragments) of various species appear as imperfect gigantic palindromes, which are disintegrated by many inversions and the mutation drift on different scales. A spread occurrence of these types of sequences in the numerous chromosomes allows us to develop a new insight of some accepted points of the genome evolution in the prebiotic phase.

  18. Molecular identification and characterization of clustered regularly interspaced short palindromic repeats (CRISPRs) in a urease-positive thermophilic Campylobacter sp. (UPTC).

    PubMed

    Tasaki, E; Hirayama, J; Tazumi, A; Hayashi, K; Hara, Y; Ueno, H; Moore, J E; Millar, B C; Matsuda, M

    2012-02-01

    Novel clustered regularly-interspaced short palindromic repeats (CRISPRs) locus [7,500 base pairs (bp) in length] occurred in the urease-positive thermophilic Campylobacter (UPTC) Japanese isolate, CF89-12. The 7,500 bp gene loci consisted of the 5'-methylaminomethyl-2-thiouridylate methyltransferase gene, putative (P) CRISPR associated (p-Cas), putative open reading frames, Cas1 and Cas2, leader sequence region (146 bp), 12 CRISPRs consensus sequence repeats (each 36 bp) separated by a non-repetitive unique spacer region of similar length (26-31 bp) and the phosphatidyl glycerophosphatase A gene. When the CRISPRs loci in the UPTC CF89-12 and five C. jejuni isolates were compared with one another, these six isolates contained p-Cas, Cas1 and Cas2 within the loci. Four to 12 CRISPRs consensus sequence repeats separated by a non-repetitive unique spacer region occurred in six isolates and the nucleotide sequences of those repeats gave approximately 92-100% similarity with each other. However, no sequence similarity occurred in the unique spacer regions among these isolates. The putative σ(70) transcriptional promoter and the hypothetical ρ-independent terminator structures for the CRISPRs and Cas were detected. No in vivo transcription of p-Cas, Cas1 and Cas2 was confirmed in the UPTC cells.

  19. Development of a novel molecular detection method for clustered regularly interspaced short palindromic repeats (CRISPRs) in Taylorella organisms.

    PubMed

    Hara, Yasushi; Nakajima, Takuya; Akamatsu, Marie; Yahiro, Motoki; Kagawa, Shizuko; Petry, Sandrine; Matsuda, Motoo; Moore, John E

    2015-07-01

    Contagious equine metritis is a bacterial infectious disease of horses caused by Taylorella equigenitalis, a Gram-negative eubacterium. The disease has been described in several continents, including Europe, North America and Asia. A novel molecular method was developed to detect clustered regularly interspaced short palindromic repeats (CRISPRs), which were separated by non-repetitive unique spacer regions (NRUSRs) of similar length, in the Taylorella equigenitalis EQ59 strain using a primer pair, f-/r-TeCRISPR-ladder, by PCR amplification. In total, 31 Taylorella isolates (17 T. equigenitalis and 14 Taylorella asinigenitalis) were examined. The T. equigenitalis isolates came from thoroughbred and cold-blooded horses from nine countries during 1980-1996, whilst the T. asinigenitalis isolates all originated from donkey jacks in France and the USA during 1997-2006. PAGE fractionated all of the 13 CRISPRs separated by 12 NRUSRs in T. equigenitalis EQ59. Permutation examples of CRISPRs, which were separated by NRUSRs for small-sized ladders, consisting of two doublet bands were shown. Putative CRISPRs separated by NRUSRs were amplified with 14/17 (82.4 %) geographically disparate T. equigenitalis isolates using the newly designed primer pair. Approximately 82.4 % of the T. equigenitalis isolates had CRISPRs separated by NRUSRs. The CRISPR locus was also found in the French T. asinigenitalis strain MCE3. Putative CRISPRs separated by NRUSRs were detected similarly in 4/14 (28.6 %) T. asinigenitalis isolates. Overall, a more detailed understanding of the molecular biology of CRISPRs within Taylorella organisms may help elucidate the pathogenic virulence and transmission mechanisms associated with this important equine pathogen.

  20. Repetition through Successive Approximations.

    ERIC Educational Resources Information Center

    Littell, Katherine M.

    This study was conducted in an attempt to provide an alternative to the long-established method of tape listening and repetition drills, a method that has had disappointing results. It is suggested that the rate of speed of phonic presentation is not commensurate with the rate of comprehension. The proposed method seeks to prevent cognitive…

  1. Repetitive strain injury.

    PubMed

    Al-Otaibi, S T

    2001-05-01

    Repetitive strain injury is a group of musculoskeletal disorders affecting muscles, tendons, nerves and blood vessels. These disorders could be attributed to occupational causes; however non-occupational causes should be excluded. The management of these cases required a multidisciplinary team approach.

  2. Repetition Priming in Music

    ERIC Educational Resources Information Center

    Hutchins, Sean; Palmer, Caroline

    2008-01-01

    The authors explore priming effects of pitch repetition in music in 3 experiments. Musically untrained participants heard a short melody and sang the last pitch of the melody as quickly as possible. Each experiment manipulated (a) whether or not the tone to be sung (target) was heard earlier in the melody (primed) and (b) the prime-target distance…

  3. Genetic relatedness among tdh+ and trh+ Vibrio parahaemolyticus cultured from Gulf of Mexico oysters (Crassostrea virginica) and surrounding water and sediment.

    PubMed

    Johnson, C N; Flowers, A R; Young, V C; Gonzalez-Escalona, N; DePaola, A; Noriea, N F; Grimes, D J

    2009-04-01

    Pathogenic Vibrio parahaemolyticus (Vp) (tdh(+)/trh(+)) represent a small percentage of environmental Vp populations, and very little is known about this subpopulation. Repetitive extragenic palindromic PCR and multilocus sequence analysis revealed heterogeneity among 41 Vp containing thermostable direct hemolysin (tdh) and tdh-related hemolysin (trh) that were isolated from Mississippi coastal environments from October 2006 to April 2007. There was no source-specific sequestering in oysters, water, or sediment.

  4. A case of postoperative breast infection by Mycobacterium fortuitum associated with the hospital water supply.

    PubMed

    Jaubert, Julien; Mougari, Faiza; Picot, Sandrine; Boukerrou, Malik; Barau, Georges; Ali Ahmed, Sitty-Amina; Raskine, Laurent; Camuset, Guillaume; Michault, Alain; Simac, Catherine; Cambau, Emmanuelle

    2015-04-01

    This report describes the first known laboratory-confirmed case of Mycobacterium fortuitum breast infection related to the hospital water supply. The source of the M fortuitum infection was identified by repetitive extragenic palindromic sequence-based polymerase chain reaction genotyping. In addition, we discuss appropriate infection control measures to minimize patient exposure to waterborne pathogens, in particular, in the context of nontuberculous mycobacteria, which is difficult to eradicate from the water supply network.

  5. Virulence Factors and Clonal Relationships among Escherichia coli Strains Isolated from Broiler Chickens with Cellulitis

    PubMed Central

    de Brito, Benito Guimarães; Gaziri, Luiz Carlos J.; Vidotto, Marilda C.

    2003-01-01

    In this study, we compared Escherichia coli isolates from chickens with avian cellulitis with those from feces of healthy chickens. Cellulitis-derived strains presented phenotypic and genotypic characteristics of greater virulence than did the fecal isolates. Phylogenetic analysis by repetitive extragenic palindromic-PCR showed that, in agreement with their virulence characteristics, the cellulitis isolates form two clonal groups distinct from the fecal isolates. PMID:12819112

  6. [Bioinformatics Analysis of Clustered Regularly Interspaced Short Palindromic Repeats in the Genomes of Shigella].

    PubMed

    Wang, Pengfei; Wang, Yingfang; Duan, Guangcai; Xue, Zerun; Wang, Linlin; Guo, Xiangjiao; Yang, Haiyan; Xi, Yuanlin

    2015-04-01

    This study was aimed to explore the features of clustered regularly interspaced short palindromic repeats (CRISPR) structures in Shigella by using bioinformatics. We used bioinformatics methods, including BLAST, alignment and RNA structure prediction, to analyze the CRISPR structures of Shigella genomes. The results showed that the CRISPRs existed in the four groups of Shigella, and the flanking sequences of upstream CRISPRs could be classified into the same group with those of the downstream. We also found some relatively conserved palindromic motifs in the leader sequences. Repeat sequences had the same group with corresponding flanking sequences, and could be classified into two different types by their RNA secondary structures, which contain "stem" and "ring". Some spacers were found to homologize with part sequences of plasmids or phages. The study indicated that there were correlations between repeat sequences and flanking sequences, and the repeats might act as a kind of recognition mechanism to mediate the interaction between foreign genetic elements and Cas proteins.

  7. [Clustered regularly interspaced short palindromic repeats: structure, function and application--a review].

    PubMed

    Cui, Yujun; Li, Yanjun; Yan, Yanfeng; Yang, Ruifu

    2008-11-01

    CRISPRs (Clustered Regularly Interspaced Short Palindromic Repeats), the basis of spoligotyping technology, can provide prokaryotes with heritable adaptive immunity against phages' invasion. Studies on CRISPR loci and their associated elements, including various CAS (CRISPR-associated) proteins and leader sequences, are still in its infant period. We introduce the brief history', structure, function, bioinformatics research and application of this amazing immunity system in prokaryotic organism for inspiring more scientists to find their interest in this developing topic.

  8. Palindromic GOLGA8 core duplicons promote chromosome 15q13.3 microdeletion and evolutionary instability

    PubMed Central

    Antonacci, Francesca; Dennis, Megan Y.; Huddleston, John; Sudmant, Peter H.; Steinberg, Karyn Meltz; Rosenfeld, Jill A.; Miroballo, Mattia; Graves, Tina A.; Vives, Laura; Malig, Maika; Denman, Laura; Raja, Archana; Stuart, Andrew; Tang, Joyce; Munson, Brenton; Shaffer, Lisa G.; Amemiya, Chris T.; Wilson, Richard K.; Eichler, Evan E.

    2014-01-01

    Recurrent deletions of chromosome 15q13.3 associate with intellectual disability, schizophrenia, autism and epilepsy. To gain insight into its instability, we sequenced the region in patients, normal individuals and nonhuman primates. We discovered five structural configurations of the human chromosome 15q13.3 region ranging in size from 2 to 3 Mbp. These configurations arose recently (~0.5–0.9 million years ago) as a result of human-specific expansions of segmental duplications and two independent inversion events. All inversion breakpoints map near GOLGA8 core duplicons—a ~14 kbp primate-specific chromosome 15 repeat that became organized into larger palindromic structures. GOLGA8-flanked palindromes also demarcate the breakpoints of recurrent 15q13.3 microdeletions, the expansion of chromosome 15 segmental duplications in the human lineage, and independent structural changes in apes. The significant clustering (p=0.002) of breakpoints provides mechanistic evidence for the role of this core duplicon and its palindromic architecture in promoting evolutionary and disease-related instability of chromosome 15. PMID:25326701

  9. Impaired DNA replication prompts deletions within palindromic sequences, but does not induce translocations in human cells.

    PubMed

    Kurahashi, Hiroki; Inagaki, Hidehito; Kato, Takema; Hosoba, Eriko; Kogo, Hiroshi; Ohye, Tamae; Tsutsumi, Makiko; Bolor, Hasbaira; Tong, Maoqing; Emanuel, Beverly S

    2009-09-15

    Palindromic regions are unstable and susceptible to deletion in prokaryotes and eukaryotes possibly due to stalled or slow replication. In the human genome, they also appear to become partially or completely deleted, while two palindromic AT-rich repeats (PATRR) contribute to known recurrent constitutional translocations. To explore the mechanism that causes the development of palindrome instabilities in humans, we compared the incidence of de novo translocations and deletions at PATRRs in human cells. Using a highly sensitive PCR assay that can detect single molecules, de novo deletions were detected neither in human somatic cells nor in sperm. However, deletions were detected at low frequency in cultured cell lines. Inhibition of DNA replication by administration of siRNA against the DNA polymerase alpha 1 (POLA1) gene or introduction of POLA inhibitors increased the frequency. This is in contrast to PATRR-mediated translocations that were never detected in similar conditions but were observed frequently in human sperm samples. Further deletions were found to take place during both leading- and lagging-strand synthesis. Our data suggest that stalled or slow replication induces deletions within PATRRs, but that other mechanisms might contribute to PATRR-mediated recurrent translocations in humans.

  10. Nearby inverted repeats fuse to generate acentric and dicentric palindromic chromosomes by a replication template exchange mechanism.

    PubMed

    Mizuno, Ken'Ichi; Lambert, Sarah; Baldacci, Giuseppe; Murray, Johanne M; Carr, Antony M

    2009-12-15

    Gene amplification plays important roles in the progression of cancer and contributes to acquired drug resistance during treatment. Amplification can initiate via dicentric palindromic chromosome production and subsequent breakage-fusion-bridge cycles. Here we show that, in fission yeast, acentric and dicentric palindromic chromosomes form by homologous recombination protein-dependent fusion of nearby inverted repeats, and that these fusions occur frequently when replication forks arrest within the inverted repeats. Genetic and molecular analyses suggest that these acentric and dicentric palindromic chromosomes arise not by previously described mechanisms, but by a replication template exchange mechanism that does not involve a DNA double-strand break. We thus propose an alternative mechanism for the generation of palindromic chromosomes dependent on replication fork arrest at closely spaced inverted repeats.

  11. A perfect palindrome in the Escherichia coli chromosome forms DNA hairpins on both leading- and lagging-strands.

    PubMed

    Azeroglu, Benura; Lincker, Frédéric; White, Martin A; Jain, Devanshi; Leach, David R F

    2014-12-01

    DNA palindromes are hotspots for DNA double strand breaks, inverted duplications and intra-chromosomal translocations in a wide spectrum of organisms from bacteria to humans. These reactions are mediated by DNA secondary structures such as hairpins and cruciforms. In order to further investigate the pathways of formation and cleavage of these structures, we have compared the processing of a 460 base pair (bp) perfect palindrome in the Escherichia coli chromosome with the same construct interrupted by a 20 bp spacer to form a 480 bp interrupted palindrome. We show here that the perfect palindrome can form hairpin DNA structures on the templates of the leading- and lagging-strands in a replication-dependent reaction. In the presence of the hairpin endonuclease SbcCD, both copies of the replicated chromosome containing the perfect palindrome are cleaved, resulting in the formation of an unrepairable DNA double-strand break and cell death. This contrasts with the interrupted palindrome, which forms a hairpin on the lagging-strand template that is processed to form breaks, which can be repaired by homologous recombination.

  12. Intragenic and extragenic disruptions of FOXL2 mapped by whole genome low-coverage sequencing in two BPES families with chromosome reciprocal translocation.

    PubMed

    Yang, Yongjia; Yang, Chuanchun; Zhu, Yimin; Chen, Haixiao; Zhao, Rui; He, Xinyu; Tao, Lijuan; Wang, Pin; Zhou, Lijun; Zhao, Liu; Tu, Ming; Dong, Zirui; Chen, Hui; Xie, Zhiguo

    2014-09-01

    Blepharophimosis-ptosis-epicanthus inversus syndrome (BPES) is a rare autosomal dominant disorder that affects craniofacial development and ovarian function. FOXL2 is the only gene known to be responsible for BPES. The majority of BPES patients show intragenic mutations of FOXL2. Recently, a 7.4 kb sequence disruption, which was 283 kb upstream of FOXL2, was identified to independently contribute to the BPES phenotype. Several breakpoints nearing FOXL2 (0 Mb to 1.2 Mb, several of which were distant from the 7.4 kb sequence disruption) have been mapped or deduced through a traditional method in BPES patients with chromosome reciprocal translocation. In this study, two BPES families with chromosome reciprocal translocation were investigated. Intragenic mutations of FOXL2 or pathogenic copy number variations were excluded for the two BPES families. All of the four breakpoints were identified at a base-precise manner using Giemsa banding and whole genome low-coverage sequencing (WGLCS). In family 01, the breakpoints were found at chr1:95,609,998 and chr3:138,879, 114 (213,132 bp upstream of FOXL2). In family 02, the breakpoints were located at chr3:138,665,431 (intragenic disruptions of FOXL2) and chr20:56,924,609. Results indicate that the intragenic and extragenic interruptions of FOXL2 can be accurately and rapidly detected using WGLCS. In addition, both the 213 kb upstream and intragenic interruptions of FOXL2 can cause BPES phenotype. Copyright © 2014 Elsevier Inc. All rights reserved.

  13. Computer-Related Repetitive Stress Injuries

    MedlinePlus

    ... Games, and the Internet Computer-Related Repetitive Stress Injuries KidsHealth > For Parents > Computer-Related Repetitive Stress Injuries ... and how to prevent them. About Repetitive Stress Injuries Repetitive stress injuries (RSIs) are conditions caused by ...

  14. Structural and functional evaluation of the palindromic alanine-rich antimicrobial peptide Pa-MAP2.

    PubMed

    Migliolo, Ludovico; Felício, Mário R; Cardoso, Marlon H; Silva, Osmar N; Xavier, Mary-Ann E; Nolasco, Diego O; de Oliveira, Adeliana Silva; Roca-Subira, Ignasi; Vila Estape, Jordi; Teixeira, Leandro D; Freitas, Sonia M; Otero-Gonzalez, Anselmo J; Gonçalves, Sónia; Santos, Nuno C; Franco, Octavio L

    2016-07-01

    Recently, several peptides have been studied regarding the defence process against pathogenic microorganisms, which are able to act against different targets, with the purpose of developing novel bioactive compounds. The present work focuses on the structural and functional evaluation of the palindromic antimicrobial peptide Pa-MAP2, designed based on the peptide Pa-MAP from Pleuronectes americanus. For a better structural understanding, molecular modelling analyses were carried out, together with molecular dynamics and circular dichroism, in different media. Antibacterial activity against Gram-negative and positive bacteria was evaluated, as well as cytotoxicity against human erythrocytes, RAW 264.7, Vero and L6 cells. In silico docking experiments, lipid vesicle studies, and atomic force microscopy (AFM) imaging were carried out to explore the activity of the peptide. In vivo studies on infected mice were also done. The palindromic primary sequence favoured an α-helix structure that was pH dependent, only present on alkaline environment, with dynamic N- and C-terminals that are stabilized in anionic media. Pa-MAP2 only showed activity against Gram-negative bacteria, with a MIC of 3.2 μM, and without any cytotoxic effect. In silico, lipid vesicles and AFM studies confirm the preference for anionic lipids (POPG, POPS, DPPE, DPPG and LPS), with the positively charged lysine residues being essential for the initial electrostatic interaction. In vivo studies showed that Pa-MAP2 increases to 100% the survival rate of mice infected with Escherichia coli. Data here reported indicated that palindromic Pa-MAP2 could be an alternative candidate for use in therapeutics against Gram-negative bacterial infections.

  15. Repetitive strain injury.

    PubMed

    van Tulder, Maurits; Malmivaara, Antti; Koes, Bart

    2007-05-26

    Repetitive strain injury remains a controversial topic. The term repetitive strain injury includes specific disorders such as carpal tunnel syndrome, cubital tunnel syndrome, Guyon canal syndrome, lateral epicondylitis, and tendonitis of the wrist or hand. The diagnosis is usually made on the basis of history and clinical examination. Large high-quality studies using newer imaging techniques, such as MRI and ultrasonography are few. Consequently, the role of such imaging in diagnosis of upper limb disorders remains unclear. In many cases, no specific diagnosis can be established and complaints are labelled as non-specific. Little is known about the effectiveness of treatment options for upper limb disorders. Strong evidence for any intervention is scarce and the effect, if any, is mainly short-term pain relief. Exercise is beneficial for non-specific upper limb disorders. Immobilising hand braces and open carpal tunnel surgery release are beneficial for carpal tunnel syndrome, and topical and oral non-steroidal anti-inflammatory drugs, and corticosteroid injections are helpful for lateral epicondylitis. Exercise is probably beneficial for neck pain, as are corticosteroid injections and exercise for shoulder pain. Although upper limb disorders occur frequently in the working population, most trials have not exclusively included a working population or assessed effects on work-related outcomes. Further high-quality trials should aim to include sufficient sample sizes, working populations, and work-related outcomes.

  16. Novel Method Developed to Further the Understanding of DNA Palindromes | Poster

    Cancer.gov

    Editor's note: Platinum Highlight articles are noteworthy publications selected periodically by Dr. Craig Reynolds, associate director, National Cancer Institute, from among the most recently published Platinum Publications. When Alison Rattray and colleagues in the Gene Regulation and Chromosome Biology Laboratory (GRCBL) examined a mutant yeast cell they had isolated in a screen, they noticed something strange. The DNA exhibited a “very specific, but weird, rearrangement,” she explained. The arrangement turned out to be a DNA palindrome, “opening the door to studying these elusive DNA motifs,” she said.

  17. Novel Method Developed to Further the Understanding of DNA Palindromes | Poster

    Cancer.gov

    Editor's note: Platinum Highlight articles are noteworthy publications selected periodically by Dr. Craig Reynolds, associate director, National Cancer Institute, from among the most recently published Platinum Publications. When Alison Rattray and colleagues in the Gene Regulation and Chromosome Biology Laboratory (GRCBL) examined a mutant yeast cell they had isolated in a screen, they noticed something strange. The DNA exhibited a “very specific, but weird, rearrangement,” she explained. The arrangement turned out to be a DNA palindrome, “opening the door to studying these elusive DNA motifs,” she said.

  18. Heterogeneous diversity of spacers within CRISPR (clustered regularly interspaced short palindromic repeats).

    PubMed

    He, Jiankui; Deem, Michael W

    2010-09-17

    Clustered regularly interspaced short palindromic repeats (CRISPR) in bacterial and archaeal DNA have recently been shown to be a new type of antiviral immune system in these organisms. We here study the diversity of spacers in CRISPR under selective pressure. We propose a population dynamics model that explains the biological observation that the leader-proximal end of CRISPR is more diversified and the leader-distal end of CRISPR is more conserved. This result is shown to be in agreement with recent experiments. Our results show that the CRISPR spacer structure is influenced by and provides a record of the viral challenges that bacteria face.

  19. Experimental definition of a clustered regularly interspaced short palindromic duplicon in Escherichia coli.

    PubMed

    Goren, Moran G; Yosef, Ido; Auster, Oren; Qimron, Udi

    2012-10-12

    We analyzed sequences of newly inserted repeats in an Escherichia coli CRISPR (clustered regularly interspaced short palindromic repeats) array in vivo and showed that a base previously thought to belong to the repeat is actually derived from a protospacer. Based on further experimental results, we propose to use the term "duplicon" for a repeated sequence in a CRISPR array that serves as a template for a new duplicon. Our findings suggest the possibility of redrawing the borders between repeats, spacers, and protospacer adjacent motifs. Copyright © 2012 Elsevier Ltd. All rights reserved.

  20. Clustered regularly interspaced short palindromic repeats (CRISPRs) for the genotyping of bacterial pathogens.

    PubMed

    Grissa, Ibtissem; Vergnaud, Gilles; Pourcel, Christine

    2009-01-01

    Clustered regularly interspaced short palindromic repeats (CRISPRs) are DNA sequences composed of a succession of repeats (23- to 47-bp long) separated by unique sequences called spacers. Polymorphism can be observed in different strains of a species and may be used for genotyping. We describe protocols and bioinformatics tools that allow the identification of CRISPRs from sequenced genomes, their comparison, and their component determination (the direct repeats and the spacers). A schematic representation of the spacer organization can be produced, allowing an easy comparison between strains.

  1. Heterogeneous Diversity of Spacers within CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats)

    NASA Astrophysics Data System (ADS)

    He, Jiankui; Deem, Michael W.

    2010-09-01

    Clustered regularly interspaced short palindromic repeats (CRISPR) in bacterial and archaeal DNA have recently been shown to be a new type of antiviral immune system in these organisms. We here study the diversity of spacers in CRISPR under selective pressure. We propose a population dynamics model that explains the biological observation that the leader-proximal end of CRISPR is more diversified and the leader-distal end of CRISPR is more conserved. This result is shown to be in agreement with recent experiments. Our results show that the CRISPR spacer structure is influenced by and provides a record of the viral challenges that bacteria face.

  2. Numerical taxonomy of the genus Pestivirus based on palindromic nucleotide substitutions in the 5' untranslated region.

    PubMed

    Giangaspero, Massimo; Harasawa, Ryô

    2007-12-01

    The palindromic nucleotide substitutions (PNS) at the three variable loci (V1, V2 and V3) in the 5' untranslated region (UTR) of Pestivirus RNA have been considered for taxonomical segregation of species, through the evaluation of 430 genomic sequences. On the basis of qualitative and quantitative secondary structure characteristics, six species have been identified: Bovine viral diarrhea virus 1 (BVDV-1), Bovine viral diarrhea virus 2 (BVDV-2), Classical swine fever virus (CSFV), Border disease virus (BDV), the tentative species Giraffe and a new proposed taxon named Pronghorn. The first step was qualitative and consisted in the characterization of the different positions of the three stems and loops in the 5' UTR sequences of all the strains under consideration belonging to the genus. Secondary structure sequences showing divergent base-pair combinations have been aligned for comparison. Palindromic positions have been characterized according to changes in nucleotide base-pairs identifying low-variable positions (LVP) including base-pairs present in less than 80% of the genus. The second step was quantitative, allowing the identification of genomic groups by clustering the base-pair combinations according to LVP. Relatedness among types was evaluated to identify homogeneous groups. Cross comparisons between types within the genus have been evaluated by computing the divergence percentage thus clarifying borderline and multirelated sequences.

  3. Clustered Regularly Interspaced Short Palindromic Repeats: Challenges in Treating Retinal Disease.

    PubMed

    Chrenek, Micah A; Nickerson, John M; Boatright, Jeffrey H

    2016-01-01

    Ophthalmic researchers and clinicians arguably have led the way for safe, effective gene therapy, most notably with adeno-associated viral gene supplementation in the treatment for patients with Leber congenital amaurosis type 2 with mutations in the RPE65 gene. These successes notwithstanding, most other genetic retinal disease will be refractory to supplementation. The ideal gene therapy approach would correct gene mutations to restore normal function in the affected cells. Gene editing in which a mutant allele is inactivated or converted to sequence that restores normal function is hypothetically one such approach. Such editing involves site-specific digestion of mutant genomic DNA followed by repair. Previous experimental approaches were hampered by inaccurate and high rates of off-site lesioning and by overall low digestion rates. A new tool, clustered regularly interspaced short palindromic repeats coupled with the nuclease Cas9, may address both shortcomings. Some of the many challenges that must be addressed in moving clustered regularly interspaced short palindromic repeats coupled with the nuclease Cas9 therapies to the ophthalmic clinic are discussed here.

  4. Repetitive resonant railgun power supply

    DOEpatents

    Honig, E.M.; Nunnally, W.C.

    1985-06-19

    A repetitive resonant railgun power supply provides energy for repetitively propelling projectiles from a pair of parallel rails. The supply comprises an energy storage capacitor, a storage inductor to form a resonant circuit with the energy storage capacitor and a magnetic switch to transfer energy between the resonant circuit and the pair of parallel rails for the propelling of projectiles.

  5. Repetitive resonant railgun power supply

    SciTech Connect

    Honig, Emanuel M.; Nunnally, William C.

    1988-01-01

    A repetitive resonant railgun power supply provides energy for repetitively propelling projectiles from a pair of parallel rails. The supply comprises an energy storage capacitor, a storage inductor to form a resonant circuit with the energy storage capacitor and a magnetic switch to transfer energy between the resonant circuit and the pair of parallel rails for the propelling of projectiles.

  6. Repetition Blindness for Rotated Objects

    ERIC Educational Resources Information Center

    Hayward, William G.; Zhou, Guomei; Man, Wai-Fung; Harris, Irina M.

    2010-01-01

    Repetition blindness (RB) is the finding that observers often miss the repetition of an item within a rapid stream of words or objects. Recent studies have shown that RB for objects is largely unaffected by variations in viewpoint between the repeated items. In 5 experiments, we tested RB under different axes of rotation, with different types of…

  7. Repetition priming: Is music special?

    PubMed

    Bigand, E; Tillmann, B; Poulin-Charronnat, B; Manderlier, D

    2005-11-01

    Using short and long contexts, the present study investigated musical priming effects that are based on chord repetition and harmonic relatedness. A musical target (a chord) was preceded by either an identical prime or a different but harmonically related prime. In contrast to words, pictures, and environmental sounds, chord processing was not facilitated by repetition. Experiments 1 and 2 using single-chord primes showed either no significant difference between chord repetition and harmonic relatedness or facilitated processing for harmonically related targets. Experiment 3 using longer prime contexts showed that musical priming depended more on the musical function of the target in the preceding context than on target repetition. The effect of musical function was decreased, but not qualitatively changed, by chord repetition. The outcome of this study challenges predictions of sensory approaches and supports a cognitive approach of musical priming.

  8. Symmetry and repetition in perspective.

    PubMed

    van der Vloed, Gert; Csathó, Arpád; van der Helm, Peter A

    2005-09-01

    Although ecologically relevant, perspective views of symmetries and repetitions have hardly been investigated. Any symmetry or repetition that is not oriented orthogonally to the line of sight yields perspective distortions on the retina. In this study, these distortions are analyzed in terms of first-order structures (i.e., virtual lines between corresponding points) and second-order structures (i.e., correlation quadrangles formed by two virtual lines). In the literature, these structures have been proposed to guide the detection of fron to parallel symmetry and repetition. But what about perspective views? First, the analysis in this study shows that perspective distorts the retinal first-order and second-order structures of symmetry and repetition differently. Second, the results of two experiments on this distortion difference suggest that, in perspective views, symmetry and repetition detection is not preceded by normalization but occurs directly on the basis of the retinal first-order and second-order structures.

  9. Perceptual Repetition Blindness Effects

    NASA Technical Reports Server (NTRS)

    Hochhaus, Larry; Johnston, James C.; Null, Cynthia H. (Technical Monitor)

    1994-01-01

    The phenomenon of repetition blindness (RB) may reveal a new limitation on human perceptual processing. Recently, however, researchers have attributed RB to post-perceptual processes such as memory retrieval and/or reporting biases. The standard rapid serial visual presentation (RSVP) paradigm used in most RB studies is, indeed, open to such objections. Here we investigate RB using a "single-frame" paradigm introduced by Johnston and Hale (1984) in which memory demands are minimal. Subjects made only a single judgement about whether one masked target word was the same or different than a post-target probe. Confidence ratings permitted use of signal detection methods to assess sensitivity and bias effects. In the critical condition for RB a precue of the post-target word was provided prior to the target stimulus (identity precue), so that the required judgement amounted to whether the target did or did not repeat the precue word. In control treatments, the precue was either an unrelated word or a dummy.

  10. Orthographic repetition blindness.

    PubMed

    Harris, C L; Morris, A L

    2000-11-01

    Repetition blindness (RB) is the failure to report the second occurrence of a repeated word, when words are sequentially and briefly displayed (Kanwisher, 1987). RB is also observed for non-identical words, such as home, dome. Explanations for non-identity RB assume that similarity at the level of the whole word causes the second word to be suppressed ("similarity inhibition"). Three experiments demonstrate that RB is robust for diverse types of orthographic relatedness, including critical words that share only their first initial letter, their last two letters, first three letters, middle three letters, beginning and final letters, three alternating letters, and three non-aligned letters (as in chance hand). The theoretical construct of similarity inhibition may be able to account for these data, although one mechanism previously proposed in the literature, neighbourhood inhibition, is probably not a useful way to explain the data on RB for words sharing only one or two letters. We introduce an alternative explanation for orthographic RB: Only the repeated letters are suppressed, and amount of RB depends on how easily the perceiver can reconstruct the target word from the non-suppressed letters.

  11. Repetitive strain injury.

    PubMed

    Helliwell, P S; Taylor, W J

    2004-08-01

    Pain in the forearm is relatively common in the community. In the workplace forearm pain is associated with work involving frequent repetition, high forces, and prolonged abnormal postures. Nevertheless, other factors are involved in the presentation and the continuation of the pain. Notable among these factors are psychosocial issues and the workplace environment-the attitude to workers and their welfare, the physical conditions, and design of the job. Primary prevention may be effective but active surveillance is important with early intervention and an active management approach. Physical treatments have not been extensively evaluated. In the established case, management should be multidisciplinary, addressing physical aspects of the job but also addressing the "yellow, blue, and black flags" which should be viewed as obstacles to recovery. For the worker "on sick" a dialogue should be established between the worker, the primary care physician, and the workplace. Return to work should be encouraged and facilitated by medical interventions and light duty options. Rehabilitation programmes may be of use in chronic cases.

  12. Perceptual repetition blindness effects.

    PubMed

    Hochhaus, L; Johnston, J C

    1996-04-01

    Repetition blindness (RB) may reveal a new limitation on human perceptual processing. Recently, however, researchers have attributed RB to postperceptual processes. The standard rapid serial visual presentation (RSVP) paradigm used in most RB studies is open to such objections. The "single-frame" paradigm introduced by J. C. Johnston and B. L. Hale (1984) allowed investigation of RB with minimal memory demands. Participants made a judgment about whether 1 masked target word was the same or different than a posttarget probe. Confidence ratings permitted use of signal detection methods. In the critical condition for RB, a precue of the posttarget word was provided prior to the target stimulus so that the required judgment amounted to whether the target did or did not repeat the precue word. In control treatments, the precue was an unrelated word or a dummy. Results showed that perceptual sensitivity was significantly reduced in the RB condition relative to baseline control conditions. The data showed that RB can be obtained under conditions in which memory problems are minimal and perceptual sensitivity is assessed independently of biases. RB therefore can be a perceptual phenomenon.

  13. Neural Basis of Repetition Priming during Mathematical Cognition: Repetition Suppression or Repetition Enhancement?

    ERIC Educational Resources Information Center

    Salimpoor, Valorie N.; Chang, Catie; Menon, Vinod

    2010-01-01

    We investigated the neural basis of repetition priming (RP) during mathematical cognition. Previous studies of RP have focused on repetition suppression as the basis of behavioral facilitation, primarily using word and object identification and classification tasks. More recently, researchers have suggested associative stimulus-response learning…

  14. Neural Basis of Repetition Priming during Mathematical Cognition: Repetition Suppression or Repetition Enhancement?

    ERIC Educational Resources Information Center

    Salimpoor, Valorie N.; Chang, Catie; Menon, Vinod

    2010-01-01

    We investigated the neural basis of repetition priming (RP) during mathematical cognition. Previous studies of RP have focused on repetition suppression as the basis of behavioral facilitation, primarily using word and object identification and classification tasks. More recently, researchers have suggested associative stimulus-response learning…

  15. [Progress of genome engineering technology via clustered regularly interspaced short palindromic repeats--a review].

    PubMed

    Li, Hao; Qiu, Shaofu; Song, Hongbin

    2013-10-04

    In survival competition with phage, bacteria and archaea gradually evolved the acquired immune system--Clustered regularly interspaced short palindromic repeats (CRISPR), presenting the trait of transcribing the crRNA and the CRISPR-associated protein (Cas) to silence or cleaving the foreign double-stranded DNA specifically. In recent years, strong interest arises in prokaryotes primitive immune system and many in-depth researches are going on. Recently, researchers successfully repurposed CRISPR as an RNA-guided platform for sequence-specific gene expression, which provides a simple approach for selectively perturbing gene expression on a genome-wide scale. It will undoubtedly bring genome engineering into a more convenient and accurate new era.

  16. Assembling the Streptococcus thermophilus clustered regularly interspaced short palindromic repeats (CRISPR) array for multiplex DNA targeting.

    PubMed

    Guo, Lijun; Xu, Kun; Liu, Zhiyuan; Zhang, Cunfang; Xin, Ying; Zhang, Zhiying

    2015-06-01

    In addition to the advantages of scalable, affordable, and easy to engineer, the clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated protein (Cas) technology is superior for multiplex targeting, which is laborious and inconvenient when achieved by cloning multiple gRNA expressing cassettes. Here, we report a simple CRISPR array assembling method which will facilitate multiplex targeting usage. First, the Streptococcus thermophilus CRISPR3/Cas locus was cloned. Second, different CRISPR arrays were assembled with different crRNA spacers. Transformation assays using different Escherichia coli strains demonstrated efficient plasmid DNA targeting, and we achieved targeting efficiency up to 95% with an assembled CRISPR array with three crRNA spacers. Copyright © 2015 Elsevier Inc. All rights reserved.

  17. Emerging ethical perspectives in the clustered regularly interspaced short palindromic repeats genome-editing debate

    PubMed Central

    Camporesi, Silvia; Cavaliere, Giulia

    2016-01-01

    This paper provides an overview of the ethical issues in the international clustered regularly interspaced short palindromic repeats (CRISPR) genome editing debate from March 2015 to September 2016. We present the regulatory framework for embryo research in the UK, and explain why CRISPR is not a significant break with the past. We discuss the ethical issues arising from CRISPR applications beyond human embryos, namely the use of gene drive-engineered mosquitoes to eradicate diseases, engineering nonhuman animals to harvest organs for human transplant and engineering crops. We discuss the experiments that have demonstrated the technical feasibility of cultivating embryos in vitro for up to 14 days, and possibly beyond this limit, and the ethical issues arising from the proposal to extend the limit beyond 14 days. PMID:28757883

  18. Emerging ethical perspectives in the clustered regularly interspaced short palindromic repeats genome-editing debate.

    PubMed

    Camporesi, Silvia; Cavaliere, Giulia

    2016-11-01

    This paper provides an overview of the ethical issues in the international clustered regularly interspaced short palindromic repeats (CRISPR) genome editing debate from March 2015 to September 2016. We present the regulatory framework for embryo research in the UK, and explain why CRISPR is not a significant break with the past. We discuss the ethical issues arising from CRISPR applications beyond human embryos, namely the use of gene drive-engineered mosquitoes to eradicate diseases, engineering nonhuman animals to harvest organs for human transplant and engineering crops. We discuss the experiments that have demonstrated the technical feasibility of cultivating embryos in vitro for up to 14 days, and possibly beyond this limit, and the ethical issues arising from the proposal to extend the limit beyond 14 days.

  19. [Clustered regularly interspaced short palindromic repeats (CRISPR) site in Bacillus anthracis].

    PubMed

    Gao, Zhiqi; Wang, Dongshu; Feng, Erling; Wang, Bingxiang; Hui, Yiming; Han, Shaobo; Jiao, Lei; Liu, Xiankai; Wang, Hengliang

    2014-11-04

    To investigate the polymorphism of clustered regularly interspaced short palindromic repeats (CRISPR) in Bacillu santhracis and the application to molecular typing based on the polymorphism of CRISPR in B. anthracis. We downloaded the whole genome sequence of 6 B. anthracis strains and extracted the CRISPR sites. We designed the primers of CRISPR sites and amplified the CRISPR fragments in 193 B. anthracis strains by PCR and sequenced these fragments. In order to reveal the polymorphism of CRISPR in B. anthracis, wealigned all the extracted sequences and sequenced results by local blasting. At the same time, we also analyzed the CRISPR sites in B. cereus and B. thuringiensis. We did not find any polymorphism of CRISPR in B. anthracis. The molecular typing approach based on CRISPR polymorphism is not suitable for B. anthracis, but it is possible for us to distinguish B. anthracis from B. cereus and B. thuringiensis.

  20. [Repetitive monomorphic ventricular tachycardia].

    PubMed

    Maia, I G; Cruz Filho, F; Costa, A M; Boghossian, S H; Fagundes, M; Ribeiro, J C; Sá, R; Alves, P A

    1994-01-01

    To evaluate retrospectively clinical features of repetitive monomorphic ventricular tachycardia (RMVT). Files of 11 patients with RMVT were analyzed (9 females, mean-age 37 +/- 17 years). All patients were submitted to clinical evaluation, ECG, Holter monitoring stress test, high-resolution ECG and echocardiogram; they were treated with antiarrhythmic drugs. Patients were in NYHA class I or II, 9 asymptomatics and 2 with palpitations. The ECG was normal in all of them. Cardiac memory was observed in 3. A left bundle branch block with inferior axis deviation in the frontal plane was present during RMVT in all patients (right ventricular outflow tract focus). Holter monitoring revealed mean of 12031 +/- 8345 isolated PVC/24h; 2892 +/- 234 ventricular couplets/24h and 1367 +/- 890 VTs/24h (mainly nonsustained). In 6 patients RMVT was suppressed during maximal exercise treadmill. High-resolution ECG was negative in all group. Five patients had a normal echocardiogram while 5 showed mitral valve prolapse. One patient developed tachycardiomyopathy. The arrhythmia was controlled with 320mg of oral sotalol in 3 of 4 that used this drug and with 120mg oral propranolol in one of 6 that used this drug. Drug resistance was present in the others. The mean follow-up period was 38 +/- 16 months. The results demonstrate that RMVT is a benign form of VT with no detectable anatomic substract by the currently used methods. It is probably induced by nonreentrant mechanism and frequently drug resistance is observed. Among the antiarrhythmic drugs commonly used, sotalol showed to be the most effective.

  1. [Repetitive work and psychosomatic complaints].

    PubMed

    Liebrich, J; Geiger, L; Rupp, M

    1978-08-01

    200 workers of the Swiss watch industry were examined in an interdisciplinary study on the effect of repetitive work on the wellbeing of the worker. Women doing repetitive work with little autonomy complained more often about psychosomatic problems than the male workers doing non-repetitive work. This difference is interpreted as a difference of sexe rather than one of the work situation. However, there is a significant difference in the complaint about nervosity between women being paid monthly and women who were paid by piece or by hour with a premium.

  2. Emotional response to musical repetition.

    PubMed

    Livingstone, Steven R; Palmer, Caroline; Schubert, Emery

    2012-06-01

    Two experiments examined the effects of repetition on listeners' emotional response to music. Listeners heard recordings of orchestral music that contained a large section repeated twice. The music had a symmetric phrase structure (same-length phrases) in Experiment 1 and an asymmetric phrase structure (different-length phrases) in Experiment 2, hypothesized to alter the predictability of sensitivity to musical repetition. Continuous measures of arousal and valence were compared across music that contained identical repetition, variation (related), or contrasting (unrelated) structure. Listeners' emotional arousal ratings differed most for contrasting music, moderately for variations, and least for repeating musical segments. A computational model for the detection of repeated musical segments was applied to the listeners' emotional responses. The model detected the locations of phrase boundaries from the emotional responses better than from performed tempo or physical intensity in both experiments. These findings indicate the importance of repetition in listeners' emotional response to music and in the perceptual segmentation of musical structure.

  3. Repetitively pumped electron beam device

    DOEpatents

    Schlitt, L.G.

    1979-07-24

    Disclosed is an apparatus for producing fast, repetitive pulses of controllable length of an electron beam by phased energy storage in a transmission line of length matched to the number of pulses and specific pulse lengths desired. 12 figs.

  4. Paucity of moderately repetitive sequences

    SciTech Connect

    Schmid, C.W.

    1991-01-01

    We examined clones of renatured repetitive human DNA to find novel repetitive DNAs. After eliminating known repeats, the remaining clones were subjected to sequence analysis. These clones also corresponded to known repeats, but with greater sequence diversity. This indicates that either these libraries were depleted of short interspersed repeats in construction, or these repeats are much less prevalent in the human genome than is indicated by data from {und Xenopus} or sea urchin studies. We directly investigated the sequence composition of human DNA through traditional renaturation techniques with the goal of estimating the limits of abundance of repetitive sequence classes in human DNA. Our results sharply limit the maximum possible abundance to 1--2% of the human genome. Our estimate, minus the known repeats in this fraction, leaves about 1% (3 {times} 10{sup 7} nucleotides) of the human genome for novel repetitive elements. 2 refs. (MHB)

  5. A Perceptual Repetition Blindness Effect

    NASA Technical Reports Server (NTRS)

    Hochhaus, Larry; Johnston, James C.; Null, Cynthia H. (Technical Monitor)

    1994-01-01

    Before concluding Repetition Blindness is a perceptual phenomenon, alternative explanations based on memory retrieval problems and report bias must be rejected. Memory problems were minimized by requiring a judgment about only a single briefly displayed field. Bias and sensitivity effects were empirically measured with an ROC-curve analysis method based on confidence ratings. Results from five experiments support the hypothesis that Repetition Blindness can be a perceptual phenomenon.

  6. Unusual structure of a human middle repetitive DNA

    SciTech Connect

    Ratnasinghe, D.D.

    1993-01-01

    The L2Hs sequences are a polymorphic, interspersed, middle repetitive DNA family unique to human genomes. Genomic fingerprinting indicates that these DNAs vary from one individual to another and between tissues of the same individual. Sequence analysis reveals that they are AT-rich (76%) and contain many unusual sequence arrangements (palindromes, inverted and direct repeats). These sequence properties confer on the L2Hs elements the potential to fold into non-B-form structures, a characteristic of recombination hot spots. To test this hypothesis carbodiimide, osmium tetroxide and S[sub 1] nuclease were used as single-strand specific probes to study a recombinant plasmid, pN6.4.39, containing a single L2Hs segment. Different forms of the plasmid substrate were analyzed, including linear molecules and circular forms of DNA in growing E. coli cells were analyzed. Modified plasmid DNA was analyzed by primer extension in a sequencing-type reaction format. These studies demonstrate that the L2Hs sequences: (1) assume non-B-form structures both in vitro and in vivo, (2) map to predicted cruciform structures, (3) behave as C-type extrusion sequences, and (4) that these unusual DNA structures are dependent on plasmid superhelicity.

  7. Correlations in a Mozart's music score (K-73x) with palindromic and upside-down structure

    NASA Astrophysics Data System (ADS)

    Dagdug, Leonardo; Alvarez-Ramirez, Jose; Lopez, Carlos; Moreno, Rodolfo; Hernandez-Lemus, Enrique

    2007-09-01

    In this work, we study long-range correlations in a “Scherzo-Duetto di Mozart” score (K-73x) for two violins. This is a fascinating piece, as the second violin part is upside down on the same sheet below the first violin, and some parts are like a palindrome. Given such ingenious structure, it is expected the existence of long-range correlations in the score structure. In order to quantify long-range correlations, we considered the music score as a sequence of integer numbers, each of them corresponding to last common denominator units of note. By using detrended fluctuation analysis (DFA), correlations are quantified by means of the scaling exponent that reflects the type of correlations for a given distance between neighbors note. The following conclusions can be drawn from the analysis: (a) For about 10-25 neighbor note distances, correlations are similar to 1/f-noise. This is an interesting finding since it has been shown that pleasant sounds for humans display a behavior similar to 1/f noise. (b) As the neighbor note distance increases, the long-range correlations decays continuously. For some score sections, the music score behaves like non-correlated (i.e., purely random) noise. Summing up, the results show that the studied Mozart's score contains a certain degree of correlation for relatively small note distances, and becomes close to non-correlated behavior for long note distances. We considered also the sequence constructed by considering the distance between the simultaneously played notes of the two violins. Interestingly, for relatively small neighbor note distances, a scaling behavior similar to that found for individual violins is also displayed. In some sense, this is an expression of the specific structure (palindromes plus upside down construction) used by Mozart in the composition of this music score. Although we focused on a particular high-art music score, our results suggest that modern methods borrowed from statistical physics can be

  8. Species characterization in the genus Pestivirus according to palindromic nucleotide substitutions in the 5'-untranslated region.

    PubMed

    Giangaspero, Massimo; Harasawa, Ryô

    2011-06-01

    The palindromic nucleotide substitutions (PNS) at the three variable loci (V1, V2 and V3) in the 5'-untranslated region (UTR) of the Pestivirus genome have been considered for taxonomical segregation of the species, through the evaluation of 534 strains. On the basis of qualitative and quantitative secondary structure characteristics, species have been identified within the genus, determining genetic distances between species isolates, clarifying borderline and multirelated sequences, and characterizing and clustering the Pestivirus strains showing unexpected genomic sequences. Nine genomic groups have been identified: the species Bovine viral diarrhea virus 1 (BVDV-1), Bovine viral diarrhea virus 2 (BVDV-2), Border disease virus (BDV) and Classical swine fever virus (CSFV) and the tentative species Pronghorn, Giraffe, Bovine viral diarrhea virus 3 (BVDV-3) (HoBi group), Border disease virus 2 (BDV-2) (Italian small ruminant isolates) and Bungowannah. Palindromic positions have been characterized according to changes in nucleotide base-pairs identifying low variable positions (LVP) including base-pairs present in less than 80% of the genus. The determination of divergence between single strain sequences or genetic groups was obtained easily by comparing base-pairing combinations from aligned secondary structures. This provided clear information such as the level of heterogeneity within a species, the relatedness between species, or facilitating the characterization and clustering of specific strains. The BVDV-1 and BDV species resulted heterogeneous, showing isolates located on a borderline in the species. Within the BVDV-2 species, two main genogroups were identified, with strains showing common sequence characteristics to both groups (multirelated strains). They could be allocated correctly by quantitative analysis. Similarly, the relation between CSFV and BDV species appeared very clearly. Also in this case, ambiguous strain sequences could be clustered in the

  9. Chronic occupational repetitive strain injury.

    PubMed

    O'Neil, B A; Forsythe, M E; Stanish, W D

    2001-02-01

    To review common repetitive strain injuries (RSIs) that occur in the workplace, emphasizing diagnosis, treatment, and etiology of these conditions. A MEDLINE search from January 1966 to June 1999 focused on articles published since 1990 because RSIs are relatively new diagnoses. MeSH headings that were explored using the thesaurus included "cumulative trauma disorder," "overuse injury," and "repetitive strain injury." The search was limited to English articles only, and preference was given to randomized controlled trials. Repetitive strain injuries result from repeated stress to the body's soft tissue structures including muscles, tendons, and nerves. They often occur in patients who perform repetitive movements either in their jobs or in extracurricular activities. Common RSIs include tendon-related disorders, such as rotator cuff tendonitis, and peripheral nerve entrapment disorders, such as carpal tunnel syndrome. A careful history and physical examination often lead to the diagnosis, but newer imaging techniques, such as magnetic resonance imaging and ultrasound, can help in refractory cases. Conservative management with medication, physiotherapy, or bracing is the mainstay of treatment. Surgery is reserved for cases that do not respond to treatment. Repetitive strain injury is common; primary care physicians must establish a diagnosis and, more importantly, its relationship to occupation. Treatment can be offered by family physicians who refer to specialists for cases refractory to conservative management.

  10. Chronic occupational repetitive strain injury.

    PubMed Central

    O'Neil, B. A.; Forsythe, M. E.; Stanish, W. D.

    2001-01-01

    OBJECTIVE: To review common repetitive strain injuries (RSIs) that occur in the workplace, emphasizing diagnosis, treatment, and etiology of these conditions. QUALITY OF EVIDENCE: A MEDLINE search from January 1966 to June 1999 focused on articles published since 1990 because RSIs are relatively new diagnoses. MeSH headings that were explored using the thesaurus included "cumulative trauma disorder," "overuse injury," and "repetitive strain injury." The search was limited to English articles only, and preference was given to randomized controlled trials. MAIN MESSAGE: Repetitive strain injuries result from repeated stress to the body's soft tissue structures including muscles, tendons, and nerves. They often occur in patients who perform repetitive movements either in their jobs or in extracurricular activities. Common RSIs include tendon-related disorders, such as rotator cuff tendonitis, and peripheral nerve entrapment disorders, such as carpal tunnel syndrome. A careful history and physical examination often lead to the diagnosis, but newer imaging techniques, such as magnetic resonance imaging and ultrasound, can help in refractory cases. Conservative management with medication, physiotherapy, or bracing is the mainstay of treatment. Surgery is reserved for cases that do not respond to treatment. CONCLUSION: Repetitive strain injury is common; primary care physicians must establish a diagnosis and, more importantly, its relationship to occupation. Treatment can be offered by family physicians who refer to specialists for cases refractory to conservative management. PMID:11228032

  11. Between memory and destiny: repetition.

    PubMed

    Marucco, Norberto Carlos

    2007-04-01

    This essay focuses mainly on the topic of repetition (agieren)-on its metapsychological, clinical, and technical conceptions. It contains a core problem, that is, the question of the represented, the nonrepresented, and the unrepresentable in the psyche. This problem, in turn, brings to light the dialectical relation between drive and object and its specific articulation with the traumatic. The author attributes special significance to its clinical expression as 'destiny.' He points out a shift in the theory of the cure from recollection and the unveiling of unconscious desire, to the possibility of understanding 'pure' repetition, which would constitute the very essence of the drive. The author highlights three types of repetition, namely, 'representative' (oedipal) repetition, the repetition of the 'nonrepresented' (narcissistic), which may gain representation, and that of the 'unrepresentable' (sensory impressions, 'lived experiences from primal times,' 'prelinguistic signifiers,' 'ungovernable mnemic traces'). The concept-the metaphor-drive embryo brings the author close to the question of the archaic in psychoanalysis, where the repetition in the act would express itself. 'Another unconscious' would zealously conceal the entombed (verschüttet) that we are not yet able to describe-the 'innermost' rather than the 'buried' (untergegangen) or the 'annihilated' (zugrunde gegangen)-through a mechanism whose way of expression is repetition in the act. With 'Constructions in analysis' as its starting point, this paper suggests a different technical implementation from that of the Freudian construction; its main material is what emerges in the present of the transference as the repetition of 'something' lacking as history. The memory of the analytic process offers a historical diachrony whereby a temporality freed from repetition and utterly unique might unfold in the analysis. This diachrony would no longer be the historical reconstruction of material truth, but the

  12. Evolutionary dynamics of clustered irregularly interspaced short palindromic repeat systems in the ocean metagenome.

    PubMed

    Sorokin, Valery A; Gelfand, Mikhail S; Artamonova, Irena I

    2010-04-01

    Clustered regularly interspaced short palindromic repeats (CRISPRs) form a recently characterized type of prokaryotic antiphage defense system. The phage-host interactions involving CRISPRs have been studied in experiments with selected bacterial or archaeal species and, computationally, in completely sequenced genomes. However, these studies do not allow one to take prokaryotic population diversity and phage-host interaction dynamics into account. This gap can be filled by using metagenomic data: in particular, the largest existing data set, generated from the Sorcerer II Global Ocean Sampling expedition. The application of three publicly available CRISPR recognition programs to the Global Ocean metagenome produced a large proportion of false-positive results. To address this problem, a filtering procedure was designed. It resulted in about 200 reliable CRISPR cassettes, which were then studied in detail. The repeat consensuses were clustered into several stable classes that differed from the existing classification. Short fragments of DNA similar to the cassette spacers were more frequently present in the same geographical location than in other locations (P, <0.0001). We developed a catalogue of elementary CRISPR-forming events and reconstructed the likely evolutionary history of cassettes that had common spacers. Metagenomic collections allow for relatively unbiased analysis of phage-host interactions and CRISPR evolution. The results of this study demonstrate that CRISPR cassettes retain the memory of the local virus population at a particular ocean location. CRISPR evolution may be described using a limited vocabulary of elementary events that have a natural biological interpretation.

  13. RNA∶DNA Hybrids Initiate Quasi-Palindrome-Associated Mutations in Highly Transcribed Yeast DNA

    PubMed Central

    Kim, Nayun; Cho, Jang-Eun; Li, Yue C.; Jinks-Robertson, Sue

    2013-01-01

    RNase H enzymes promote genetic stability by degrading aberrant RNA∶DNA hybrids and by removing ribonucleotide monophosphates (rNMPs) that are present in duplex DNA. Here, we report that loss of RNase H2 in yeast is associated with mutations that extend identity between the arms of imperfect inverted repeats (quasi-palindromes or QPs), a mutation type generally attributed to a template switch during DNA synthesis. QP events were detected using frameshift-reversion assays and were only observed under conditions of high transcription. In striking contrast to transcription-associated short deletions that also are detected by these assays, QP events do not require Top1 activity. QP mutation rates are strongly affected by the direction of DNA replication and, in contrast to their elevation in the absence of RNase H2, are reduced when RNase H1 is additionally eliminated. Finally, transcription-associated QP events are limited by components of the nucleotide excision repair pathway and are promoted by translesion synthesis DNA polymerases. We suggest that QP mutations reflect either a transcription-associated perturbation of Okazaki-fragment processing, or the use of a nascent transcript to resume replication following a transcription-replication conflict. PMID:24244191

  14. RNA∶DNA hybrids initiate quasi-palindrome-associated mutations in highly transcribed yeast DNA.

    PubMed

    Kim, Nayun; Cho, Jang-Eun; Li, Yue C; Jinks-Robertson, Sue

    2013-11-01

    RNase H enzymes promote genetic stability by degrading aberrant RNA:DNA hybrids and by removing ribonucleotide monophosphates (rNMPs) that are present in duplex DNA. Here, we report that loss of RNase H2 in yeast is associated with mutations that extend identity between the arms of imperfect inverted repeats (quasi-palindromes or QPs), a mutation type generally attributed to a template switch during DNA synthesis. QP events were detected using frameshift-reversion assays and were only observed under conditions of high transcription. In striking contrast to transcription-associated short deletions that also are detected by these assays, QP events do not require Top1 activity. QP mutation rates are strongly affected by the direction of DNA replication and, in contrast to their elevation in the absence of RNase H2, are reduced when RNase H1 is additionally eliminated. Finally, transcription-associated QP events are limited by components of the nucleotide excision repair pathway and are promoted by translesion synthesis DNA polymerases. We suggest that QP mutations reflect either a transcription-associated perturbation of Okazaki-fragment processing, or the use of a nascent transcript to resume replication following a transcription-replication conflict.

  15. Clustered regularly interspaced short palindrome repeats (CRISPRs) have spacers of extrachromosomal origin.

    PubMed

    Bolotin, Alexander; Quinquis, Benoit; Sorokin, Alexei; Ehrlich, S Dusko

    2005-08-01

    Numerous prokaryote genomes contain structures known as clustered regularly interspaced short palindromic repeats (CRISPRs), composed of 25-50 bp repeats separated by unique sequence spacers of similar length. CRISPR structures are found in the vicinity of four genes named cas1 to cas4. In silico analysis revealed another cluster of three genes associated with CRISPR structures in many bacterial species, named here as cas1B, cas5 and cas6, and also revealed a certain number of spacers that have homology with extant genes, most frequently derived from phages, but also derived from other extrachromosomal elements. Sequence analysis of CRISPR structures from 24 strains of Streptococcus thermophilus and Streptococcus vestibularis confirmed the homology of spacers with extrachromosomal elements. Phage sensitivity of S. thermophilus strains appears to be correlated with the number of spacers in the CRISPR locus the strain carries. The authors suggest that the spacer elements are the traces of past invasions by extrachromosomal elements, and hypothesize that they provide the cell immunity against phage infection, and more generally foreign DNA expression, by coding an anti-sense RNA. The presence of gene fragments in CRISPR structures and the nuclease motifs in cas genes of both cluster types suggests that CRISPR formation involves a DNA degradation step.

  16. Clustered regularly interspaced short palindrome repeats (CRISPRs) have spacers of extrachromosomal origin.

    PubMed

    Bolotin, Alexander; Quinquis, Benoit; Sorokin, Alexei; Ehrlich, S Dusko

    2005-08-01

    Numerous prokaryote genomes contain structures known as clustered regularly interspaced short palindromic repeats (CRISPRs), composed of 25-50 bp repeats separated by unique sequence spacers of similar length. CRISPR structures are found in the vicinity of four genes named cas1 to cas4. In silico analysis revealed another cluster of three genes associated with CRISPR structures in many bacterial species, named here as cas1B, cas5 and cas6, and also revealed a certain number of spacers that have homology with extant genes, most frequently derived from phages, but also derived from other extrachromosomal elements. Sequence analysis of CRISPR structures from 24 strains of Streptococcus thermophilus and Streptococcus vestibularis confirmed the homology of spacers with extrachromosomal elements. Phage sensitivity of S. thermophilus strains appears to be correlated with the number of spacers in the CRISPR locus the strain carries. The authors suggest that the spacer elements are the traces of past invasions by extrachromosomal elements, and hypothesize that they provide the cell immunity against phage infection, and more generally foreign DNA expression, by coding an anti-sense RNA. The presence of gene fragments in CRISPR structures and the nuclease motifs in cas genes of both cluster types suggests that CRISPR formation involves a DNA degradation step.

  17. Single palindromic molecular beacon-based amplification for genetic analysis of cancers.

    PubMed

    Li, Feng; Zhao, Hui; Wang, Zheng-Yong; Wu, Zai-Sheng; Yang, Zhe; Li, Cong-Cong; Xu, Huo; Lyu, Jian-Xin; Shen, Zhi-Fa

    2017-05-15

    The detection of biomarkers is of crucial importance in reducing the morbidity and mortality of complex diseases. Thus, there is a great desire to develop highly efficient and simple sensing methods to fulfill the different diagnostic and therapeutic purposes. Herein, using tumor suppressor p53 gene as model target DNA, we developed a novel palindromic fragment-incorporated molecular beacon (P-MB) that can perform multiple functions, including recognition element, signal reporter, polymerization template and primer. Upon specific hybridization with target DNA, P-MBs can interact with each other and are extended by polymerase without any additional probes. As a result, hybridized targets are peeled off from P-MBs and initiate the next round of reactions, leading to the unique strand displacement amplification (SDA). The newly-proposed enzymatic amplification displays the detection limit as low as 100pM and excellent selectivity in distinguishing single-base mutation with the linear response range from 100pM to 75nM. This is the simplest SDA sensing system so far because of only involving one type of DNA probe. This impressive sensing paradigm is expected to provide new insight into developing new-type of DNA probes that hold tremendous potential with important applications in molecular biology research and clinical diagnosis. Copyright © 2017 Elsevier B.V. All rights reserved.

  18. CRISPRFinder: a web tool to identify clustered regularly interspaced short palindromic repeats.

    PubMed

    Grissa, Ibtissem; Vergnaud, Gilles; Pourcel, Christine

    2007-07-01

    Clustered regularly interspaced short palindromic repeats (CRISPRs) constitute a particular family of tandem repeats found in a wide range of prokaryotic genomes (half of eubacteria and almost all archaea). They consist of a succession of highly conserved regions (DR) varying in size from 23 to 47 bp, separated by similarly sized unique sequences (spacer) of usually viral origin. A CRISPR cluster is flanked on one side by an AT-rich sequence called the leader and assumed to be a transcriptional promoter. Recent studies suggest that this structure represents a putative RNA-interference-based immune system. Here we describe CRISPRFinder, a web service offering tools to (i) detect CRISPRs including the shortest ones (one or two motifs); (ii) define DRs and extract spacers; (iii) get the flanking sequences to determine the leader; (iv) blast spacers against Genbank database and (v) check if the DR is found elsewhere in prokaryotic sequenced genomes. CRISPRFinder is freely accessible at http://crispr.u-psud.fr/Server/CRISPRfinder.php.

  19. [Molecular characteristics of Clustered Regularly Interspaced Short Palindromic Repeat in Shigella].

    PubMed

    Xue, Zerun; Wang, Yingfang; Duan, Guangcai; Yang, Haiyan; Xi, Yuanlin; Wang, Pengfei; Wang, Linlin; Guo, Xiangjiao

    2015-08-01

    To detect the molecular characteristics of Clustered Regularly Interspaced Short Palindromic Repeat (CRISPR) in Shigella and to analyze the distribution of CRISPR related to the time of isolation. Of the 52 Shigella strains, 41 were isolated from Henan, 6 from Jiangxi and 5 isolated from Beijing. Both CRISPR locus of S1, S2, S3 and S4 in Shigella were detected by polymerase chain reaction (PCR). The PCR products were sequenced and compared. The positive rates of CRISPR locus in Shigella were 33.69% (S1), 50.00% (S2), 82.69% (S3) and 73.08% (S4), respectively. Two subtypes were discovered in S1 and S3 locus. Three subtypes were discovered in S2 locus. Four different subtypes were discovered in S4 locus. The isolates from Henan strains were divided into two groups by the time of isolation. Distributions of S1 were different, before or after 2004, on Shigella. S1 could not be detected after 2004. There were no statistical differences of S2, S3 and S4 in two groups. Different CRISPR subtypes or Shigella were discovered. A significant correlation was noticed between the CRISPR S1 related to the time of isolation but not between S2, S3 or S4 on the time of isolation.

  20. CRISPRcompar: a website to compare clustered regularly interspaced short palindromic repeats.

    PubMed

    Grissa, Ibtissem; Vergnaud, Gilles; Pourcel, Christine

    2008-07-01

    Clustered regularly interspaced short palindromic repeat (CRISPR) elements are a particular family of tandem repeats present in prokaryotic genomes, in almost all archaea and in about half of bacteria, and which participate in a mechanism of acquired resistance against phages. They consist in a succession of direct repeats (DR) of 24-47 bp separated by similar sized unique sequences (spacers). In the large majority of cases, the direct repeats are highly conserved, while the number and nature of the spacers are often quite diverse, even among strains of a same species. Furthermore, the acquisition of new units (DR + spacer) was shown to happen almost exclusively on one side of the locus. Therefore, the CRISPR presents an interesting genetic marker for comparative and evolutionary analysis of closely related bacterial strains. CRISPRcompar is a web service created to assist biologists in the CRISPR typing process. Two tools facilitates the in silico investigation: CRISPRcomparison and CRISPRtionary. This website is freely accessible at http://crispr.u-psud.fr/CRISPRcompar/.

  1. Lactobacillus buchneri genotyping on the basis of clustered regularly interspaced short palindromic repeat (CRISPR) locus diversity.

    PubMed

    Briner, Alexandra E; Barrangou, Rodolphe

    2014-02-01

    Clustered regularly interspaced short palindromic repeats (CRISPR) in combination with associated sequences (cas) constitute the CRISPR-Cas immune system, which uptakes DNA from invasive genetic elements as novel "spacers" that provide a genetic record of immunization events. We investigated the potential of CRISPR-based genotyping of Lactobacillus buchneri, a species relevant for commercial silage, bioethanol, and vegetable fermentations. Upon investigating the occurrence and diversity of CRISPR-Cas systems in Lactobacillus buchneri genomes, we observed a ubiquitous occurrence of CRISPR arrays containing a 36-nucleotide (nt) type II-A CRISPR locus adjacent to four cas genes, including the universal cas1 and cas2 genes and the type II signature gene cas9. Comparative analysis of CRISPR spacer content in 26 L. buchneri pickle fermentation isolates associated with spoilage revealed 10 unique locus genotypes that contained between 9 and 29 variable spacers. We observed a set of conserved spacers at the ancestral end, reflecting a common origin, as well as leader-end polymorphisms, reflecting recent divergence. Some of these spacers showed perfect identity with phage sequences, and many spacers showed homology to Lactobacillus plasmid sequences. Following a comparative analysis of sequences immediately flanking protospacers that matched CRISPR spacers, we identified a novel putative protospacer-adjacent motif (PAM), 5'-AAAA-3'. Overall, these findings suggest that type II-A CRISPR-Cas systems are valuable for genotyping of L. buchneri.

  2. Function and regulation of clustered regularly interspaced short palindromic repeats (CRISPR) / CRISPR associated (Cas) systems.

    PubMed

    Richter, Corinna; Chang, James T; Fineran, Peter C

    2012-10-19

    Phages are the most abundant biological entities on earth and pose a constant challenge to their bacterial hosts. Thus, bacteria have evolved numerous 'innate' mechanisms of defense against phage, such as abortive infection or restriction/modification systems. In contrast, the clustered regularly interspaced short palindromic repeats (CRISPR) systems provide acquired, yet heritable, sequence-specific 'adaptive' immunity against phage and other horizontally-acquired elements, such as plasmids. Resistance is acquired following viral infection or plasmid uptake when a short sequence of the foreign genome is added to the CRISPR array. CRISPRs are then transcribed and processed, generally by CRISPR associated (Cas) proteins, into short interfering RNAs (crRNAs), which form part of a ribonucleoprotein complex. This complex guides the crRNA to the complementary invading nucleic acid and targets this for degradation. Recently, there have been rapid advances in our understanding of CRISPR/Cas systems. In this review, we will present the current model(s) of the molecular events involved in both the acquisition of immunity and interference stages and will also address recent progress in our knowledge of the regulation of CRISPR/Cas systems.

  3. [Clustered regularly interspaced short palindromic repeat associated protein genes cas1 and cas2 in Shigella].

    PubMed

    Xue, Zerun; Wang, Yingfang; Duan, Guangcai; Wang, Pengfei; Wang, Linlin; Guo, Xiangjiao; Xi, Yuanlin

    2014-05-01

    To detect the distribution of clustered regularly interspaced short palindromic repeat (CRISPR) associated protein genes cas1 and cas2 in Shigella and to understand the characteristics of CRISPR with relationship between CRISPR and related characteristics on drug resistance. CRISPR associated protein genes cas1 and cas2 in Shigella were detected by PCR, with its products sequenced and compared. The CRISPR-associated protein genes cas1 and cas2 were found in all the 196 Shigella isolates which were isolated at different times and locations in China. Consistencies showed through related sequencing appeared as follows: cas2, cas1 (a) and cas1 (b) were 96.44%, 97.61% and 96.97%, respectively. There were two mutations including 3177129 site(C→G)and 3177126 site (G→C) of cas1 (b) gene in 2003135 strain which were not found in the corresponding sites of Z23 and 2008113. showed that in terms of both susceptibility and antibiotic-resistance, strain 2003135 was stronger than Z23 and 2008113. CRISPR system widely existed in Shigella, with the level of drug resistance in cas1 (b) gene mutant strains higher than in wild strains. Cas1 (b) gene mutation might be one of the reasons causing the different levels of resistance.

  4. Function and Regulation of Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) / CRISPR Associated (Cas) Systems

    PubMed Central

    Richter, Corinna; Chang, James T.; Fineran, Peter C.

    2012-01-01

    Phages are the most abundant biological entities on earth and pose a constant challenge to their bacterial hosts. Thus, bacteria have evolved numerous ‘innate’ mechanisms of defense against phage, such as abortive infection or restriction/modification systems. In contrast, the clustered regularly interspaced short palindromic repeats (CRISPR) systems provide acquired, yet heritable, sequence-specific ‘adaptive’ immunity against phage and other horizontally-acquired elements, such as plasmids. Resistance is acquired following viral infection or plasmid uptake when a short sequence of the foreign genome is added to the CRISPR array. CRISPRs are then transcribed and processed, generally by CRISPR associated (Cas) proteins, into short interfering RNAs (crRNAs), which form part of a ribonucleoprotein complex. This complex guides the crRNA to the complementary invading nucleic acid and targets this for degradation. Recently, there have been rapid advances in our understanding of CRISPR/Cas systems. In this review, we will present the current model(s) of the molecular events involved in both the acquisition of immunity and interference stages and will also address recent progress in our knowledge of the regulation of CRISPR/Cas systems. PMID:23202464

  5. Lactobacillus buchneri Genotyping on the Basis of Clustered Regularly Interspaced Short Palindromic Repeat (CRISPR) Locus Diversity

    PubMed Central

    Briner, Alexandra E.

    2014-01-01

    Clustered regularly interspaced short palindromic repeats (CRISPR) in combination with associated sequences (cas) constitute the CRISPR-Cas immune system, which uptakes DNA from invasive genetic elements as novel “spacers” that provide a genetic record of immunization events. We investigated the potential of CRISPR-based genotyping of Lactobacillus buchneri, a species relevant for commercial silage, bioethanol, and vegetable fermentations. Upon investigating the occurrence and diversity of CRISPR-Cas systems in Lactobacillus buchneri genomes, we observed a ubiquitous occurrence of CRISPR arrays containing a 36-nucleotide (nt) type II-A CRISPR locus adjacent to four cas genes, including the universal cas1 and cas2 genes and the type II signature gene cas9. Comparative analysis of CRISPR spacer content in 26 L. buchneri pickle fermentation isolates associated with spoilage revealed 10 unique locus genotypes that contained between 9 and 29 variable spacers. We observed a set of conserved spacers at the ancestral end, reflecting a common origin, as well as leader-end polymorphisms, reflecting recent divergence. Some of these spacers showed perfect identity with phage sequences, and many spacers showed homology to Lactobacillus plasmid sequences. Following a comparative analysis of sequences immediately flanking protospacers that matched CRISPR spacers, we identified a novel putative protospacer-adjacent motif (PAM), 5′-AAAA-3′. Overall, these findings suggest that type II-A CRISPR-Cas systems are valuable for genotyping of L. buchneri. PMID:24271175

  6. Defective Artemis nuclease is characterized by coding joints with microhomology in long palindromic-nucleotide stretches.

    PubMed

    van der Burg, Mirjam; Verkaik, Nicole S; den Dekker, Alexander T; Barendregt, Barbara H; Pico-Knijnenburg, Ingrid; Tezcan, Ilhan; vanDongen, Jacques J M; van Gent, Dik C

    2007-12-01

    T-B-NK+ severe combined immunodeficiency (SCID) is caused by a defect in V(D)J recombination. A subset of these patients has a mutation in one of the non-homologous end joining (NHEJ) genes, most frequently the Artemis gene. Artemis is involved in opening of hairpin-sealed coding ends. The low levels of residual DH-JH junctions that could be amplified from patients' bone marrow precursor B cells showed high numbers of palindromic (P)-nucleotides. In 25% of junctions, microhomology was observed in the P-nucleotide regions, whereas this phenomenon was never observed in junctions amplified from bone marrow precursor B cells from healthy controls. We utilized this difference between Artemis-deficient cells and normal controls to develop a V(D)J recombination assay to determine hairpin-opening activity. Mutational analysis of the Artemis gene confirmed and extended the mapping of an N-terminal nuclease active site, which contains several indispensable aspartate residues. C-terminal deletion mutants did not show such severe defects in the V(D)J recombination assay using transient overexpression of (mutated) Artemis protein. However, a C-terminal deletion mutation causes T-B-NK+ SCID, indicating that the Artemis C terminus is essential for V(D)J recombination at the normal Artemis expression level. The V(D)J recombination assays used in this study contribute to the diagnostic strategy for T-B-NK+ SCID patients.

  7. High-resolution DNA melt curve analysis of the clustered, regularly interspaced short-palindromic-repeat locus of Campylobacter jejuni.

    PubMed

    Price, Erin P; Smith, Helen; Huygens, Flavia; Giffard, Philip M

    2007-05-01

    A novel method for genotyping the clustered, regularly interspaced short-palindromic-repeat (CRISPR) locus of Campylobacter jejuni is described. Following real-time PCR, CRISPR products were subjected to high-resolution melt (HRM) analysis, a new technology that allows precise melt profile determination of amplicons. This investigation shows that the CRISPR HRM assay provides a powerful addition to existing C. jejuni genotyping methods and emphasizes the potential of HRM for genotyping short sequence repeats in other species.

  8. A 140-Bp-Long Palindromic Sequence Induces Double-Strand Breaks during Meiosis in the Yeast Saccharomyces Cerevisiae

    PubMed Central

    Nag, D. K.; Kurst, A.

    1997-01-01

    Palindromic sequences have the potential to form hairpin or cruciform structures, which are putative substrates for several nucleases and mismatch repair enzymes. A genetic method was developed to detect such structures in vivo in the yeast Saccharomyces cerevisiae. Using this method we previously showed that short hairpin structures are poorly repaired by the mismatch repair system in S. cerevisiae. We show here that mismatches, when present in the stem of the hairpin structure, are not processed by the repair machinery, suggesting that they are treated differently than those in the interstrand base-paired duplex DNA. A 140-bp-long palindromic sequence, on the contrary, acts as a meiotic recombination hotspot by generating a site for a double-strand break, an initiator of meiotic recombination. We suggest that long palindromic sequences undergo cruciform extrusion more readily than short ones. This cruciform structure then acts as a substrate for structure-specific nucleases resulting in the formation of a double-strand break during meiosis in yeast. In addition, we show that residual repair of the short hairpin structure occurs in an MSH2-independent pathway. PMID:9215890

  9. A novel palindromic triple-stranded structure formed by homopyrimidine dodecamer d-CTTCTCCTCTTC and homopurine hexamer d-GAAGAG.

    PubMed Central

    Bhaumik, S R; Chary, K V; Govil, G; Liu, K; Miles, H T

    1998-01-01

    We have carried out NMR and molecular mechanics studies on a complex formed when a palindromic homopyrimidine dodecamer (d-CTTCTCCTCTTC) and a homopurine hexamer (d-GAAGAG) are mixed in 1:1 molar ratio in aqueous solutions. Such studies unequivocally establish that two strands of each oligomer combine to form a triple-stranded DNA structure with a palindromic symmetry and with six T.A:T and six C+. G:C hydrogen-bonded base triads. The two purine strands are placed head to head, with their 3' ends facing each other in the center of the structure. One-half of each pyrimidine strand contains protonated and the other half contains non-protonated cytosines. The two half segments containing protonated cytosines are hydrogen bonded to each of the two purine hexamers through Hoogsteen T.A and C+.G base pairing. The segments containing non-protonated cytosines are involved in Watson-Crick (A:T and G:C) base pairing. This leads to a palindromic triplex with a C2-dyad symmetry with respect to the center of the structure. The complex is less stable at neutral pH, but the cytosines involved in Hoogsteen base pairing remain protonated even under these conditions. Molecular mechanics calculations using NMR constraints have provided a detailed three-dimensional structure of the complex. The entire stretches of purine, and the pyrimidine nucleotides have a conformation close to B-DNA. PMID:9611244

  10. [Comparative analysis of clustered regularly interspaced short palindromic repeats (CRISPRs) loci in the genomes of halophilic archaea].

    PubMed

    Zhang, Fan; Zhang, Bing; Xiang, Hua; Hu, Songnian

    2009-11-01

    Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) is a widespread system that provides acquired resistance against phages in bacteria and archaea. Here we aim to genome-widely analyze the CRISPR in extreme halophilic archaea, of which the whole genome sequences are available at present time. We used bioinformatics methods including alignment, conservation analysis, GC content and RNA structure prediction to analyze the CRISPR structures of 7 haloarchaeal genomes. We identified the CRISPR structures in 5 halophilic archaea and revealed a conserved palindromic motif in the flanking regions of these CRISPR structures. In addition, we found that the repeat sequences of large CRISPR structures in halophilic archaea were greatly conserved, and two types of predicted RNA secondary structures derived from the repeat sequences were likely determined by the fourth base of the repeat sequence. Our results support the proposal that the leader sequence may function as recognition site by having palindromic structures in flanking regions, and the stem-loop secondary structure formed by repeat sequences may function in mediating the interaction between foreign genetic elements and CAS-encoded proteins.

  11. Precautions regarding Nonword Repetition Tasks

    ERIC Educational Resources Information Center

    Smith, Bruce

    2006-01-01

    Using nonword repetition tasks as an experimental approach with both adults and children has become quite common in the past 10 to 15 years for studying lexical learning and phonological processing (e.g., Bailey & Hahn, 2001; Gathercole, Frankish, Pickering & Peaker, 1998; Munson, Edwards, & Beckman, 2005; Storkel, 2001; Vitevich & Luce, 2005). In…

  12. Constructive and Unconstructive Repetitive Thought

    ERIC Educational Resources Information Center

    Watkins, Edward R.

    2008-01-01

    The author reviews research showing that repetitive thought (RT) can have constructive or unconstructive consequences. The main unconstructive consequences of RT are (a) depression, (b) anxiety, and (c) difficulties in physical health. The main constructive consequences of RT are (a) recovery from upsetting and traumatic events, (b) adaptive…

  13. Repetition Blindness Occurs in Nonwords

    ERIC Educational Resources Information Center

    Harris, Catherine L.; Morris, Alison L.

    2004-01-01

    Theorists have predicted that repetition blindness (RB) should be absent for nonwords because they do not activate preexisting mental types. The authors hypothesized that RB would be observed for nonwords because RB can occur at a sublexical level. Four experiments showed that RB is observed for word-nonword pairs (noon noof), orthographically…

  14. Constructive and Unconstructive Repetitive Thought

    ERIC Educational Resources Information Center

    Watkins, Edward R.

    2008-01-01

    The author reviews research showing that repetitive thought (RT) can have constructive or unconstructive consequences. The main unconstructive consequences of RT are (a) depression, (b) anxiety, and (c) difficulties in physical health. The main constructive consequences of RT are (a) recovery from upsetting and traumatic events, (b) adaptive…

  15. COMPUTER SIMULATION STUDY OF AMYLOID FIBRIL FORMATION BY PALINDROMIC SEQUENCES IN PRION PEPTIDES

    PubMed Central

    Wagoner, Victoria; Cheon, Mookyung; Chang, Iksoo; Hall, Carol

    2011-01-01

    We simulate the aggregation of large systems containing palindromic peptides from the Syrian hamster prion protein SHaPrP 113–120 (AGAAAAGA) and the mouse prion protein MoPrP 111–120 (VAGAAAAGAV) and eight sequence variations: GAAAAAAG, (AG)4, A8, GAAAGAAA, A10, V10, GAVAAAAVAG, and VAVAAAAVAV The first two peptides are thought to act as the Velcro that holds the parent prion proteins together in amyloid structures and can form fibrils themselves. Kinetic events along the fibrillization pathway influence the types of structures that occur and variations in the sequence affect aggregation kinetics and fibrillar structure. Discontinuous molecular dynamics simulations using the PRIME20 force field are performed on systems containing 48 peptides starting from a random coil configuration. Depending on the sequence, fibrillar structures form spontaneously over a range of temperatures, below which amorphous aggregates form and above which no aggregation occurs. AGAAAAGA forms well organized fibrillar structures whereas VAGAAAAGAV forms less well organized structures that are partially fibrillar and partially amorphous. The degree of order in the fibrillar structure stems in part from the types of kinetic events leading up to its formation, with AGAAAAGA forming less amorphous structures early in the simulation than VAGAAAAGAV. The ability to form fibrils increases as the chain length and the length of the stretch of hydrophobic residues increase. However as the hydrophobicity of the sequence increases, the ability to form well-ordered structures decreases. Thus, longer hydrophobic sequences form slightly disordered aggregates that are partially fibrillar and partially amorphous. Subtle changes in sequence result in slightly different fibril structures. PMID:21557317

  16. Insight into microevolution of Yersinia pestis by clustered regularly interspaced short palindromic repeats.

    PubMed

    Cui, Yujun; Li, Yanjun; Gorgé, Olivier; Platonov, Mikhail E; Yan, Yanfeng; Guo, Zhaobiao; Pourcel, Christine; Dentovskaya, Svetlana V; Balakhonov, Sergey V; Wang, Xiaoyi; Song, Yajun; Anisimov, Andrey P; Vergnaud, Gilles; Yang, Ruifu

    2008-07-09

    Yersinia pestis, the pathogen of plague, has greatly influenced human history on a global scale. Clustered Regularly Interspaced Short Palindromic Repeat (CRISPR), an element participating in immunity against phages' invasion, is composed of short repeated sequences separated by unique spacers and provides the basis of the spoligotyping technology. In the present research, three CRISPR loci were analyzed in 125 strains of Y. pestis from 26 natural plague foci of China, the former Soviet Union and Mongolia were analyzed, for validating CRISPR-based genotyping method and better understanding adaptive microevolution of Y. pestis. Using PCR amplification, sequencing and online data processing, a high degree of genetic diversity was revealed in all three CRISPR elements. The distribution of spacers and their arrays in Y. pestis strains is strongly region and focus-specific, allowing the construction of a hypothetic evolutionary model of Y. pestis. This model suggests transmission route of microtus strains that encircled Takla Makan Desert and ZhunGer Basin. Starting from Tadjikistan, one branch passed through the Kunlun Mountains, and moved to the Qinghai-Tibet Plateau. Another branch went north via the Pamirs Plateau, the Tianshan Mountains, the Altai Mountains and the Inner Mongolian Plateau. Other Y. pestis lineages might be originated from certain areas along those routes. CRISPR can provide important information for genotyping and evolutionary research of bacteria, which will help to trace the source of outbreaks. The resulting data will make possible the development of very low cost and high-resolution assays for the systematic typing of any new isolate.

  17. Clustered, regularly interspaced short palindromic repeat (CRISPR) diversity and virulence factor distribution in avian Escherichia coli.

    PubMed

    Fu, Qiang; Su, Zhixin; Cheng, Yuqiang; Wang, Zhaofei; Li, Shiyu; Wang, Heng'an; Sun, Jianhe; Yan, Yaxian

    In order to investigate the diverse characteristics of clustered, regularly interspaced short palindromic repeat (CRISPR) arrays and the distribution of virulence factor genes in avian Escherichia coli, 80 E. coli isolates obtained from chickens with avian pathogenic E. coli (APEC) or avian fecal commensal E. coli (AFEC) were identified. Using the multiplex polymerase chain reaction (PCR), five genes were subjected to phylogenetic typing and examined for CRISPR arrays to study genetic relatedness among the strains. The strains were further analyzed for CRISPR loci and virulence factor genes to determine a possible association between their CRISPR elements and their potential virulence. The strains were divided into five phylogenetic groups: A, B1, B2, D and E. It was confirmed that two types of CRISPR arrays, CRISPR1 and CRISPR2, which contain up to 246 distinct spacers, were amplified in most of the strains. Further classification of the isolates was achieved by sorting them into nine CRISPR clusters based on their spacer profiles, which indicates a candidate typing method for E. coli. Several significant differences in invasion-associated gene distribution were found between the APEC isolates and the AFEC isolates. Our results identified the distribution of 11 virulence genes and CRISPR diversity in 80 strains. It was demonstrated that, with the exception of iucD and aslA, there was no sharp demarcation in the gene distribution between the pathogenic (APEC) and commensal (AFEC) strains, while the total number of indicated CRISPR spacers may have a positive correlation with the potential pathogenicity of the E. coli isolates. Copyright © 2016. Published by Elsevier Masson SAS.

  18. Expectancy and Repetition in Task Preparation

    NASA Technical Reports Server (NTRS)

    Ruthruff, E.; Remington, R. W.; Johnston, James C.; Null, Cynthia H. (Technical Monitor)

    1996-01-01

    We studied the mechanisms of task preparation using a design that pitted task expectancy against task repetition. In one experiment, two simple cognitive tasks were presented in a predictable sequence containing both repetitions and non-repetitions. The typical task sequence was AABBAABB. Occasional violations of this sequence allowed us to measure the effects of valid versus invalid expectancy. With this design, we were able to study the effects of task expectancy, task repetition, and interaction.

  19. Repetitively pulsed vacuum insulator flashover

    SciTech Connect

    Ginn, J.W.; Buttram, M.T.

    1987-01-01

    Experiments were performed to determine the flashover strength of various vacuum insulators under conditions of repetitive pulsing. The pulse duration was 30 ns, and the thickness of a typical insulator sample was 1.8 cm. Data were taken for 45 insulators from five different materials. An insulator was subjected to an extended series of pulses at a given repetition rate and field. If flashover was not detected, the field level was increased and the sequence repeated. At rates up to 50 pulses per second, there was no apparent dependence of flashover field on rate. In addition, some ''single shot'' data were taken, including various modifications of the geometries and surface textures of the insulators. Only two to the modifications increased the flashover strength significantly over that of a 45 sample: (1) annealing some plastics (roughly a 35% increase), and (2) extending the insulator to cover the surfaces of both electrodes (an increase of nearly a factor of two).

  20. Chromosome specific repetitive DNA sequences

    DOEpatents

    Moyzis, Robert K.; Meyne, Julianne

    1991-01-01

    A method is provided for determining specific nucleotide sequences useful in forming a probe which can identify specific chromosomes, preferably through in situ hybridization within the cell itself. In one embodiment, chromosome preferential nucleotide sequences are first determined from a library of recombinant DNA clones having families of repetitive sequences. Library clones are identified with a low homology with a sequence of repetitive DNA families to which the first clones respectively belong and variant sequences are then identified by selecting clones having a pattern of hybridization with genomic DNA dissimilar to the hybridization pattern shown by the respective families. In another embodiment, variant sequences are selected from a sequence of a known repetitive DNA family. The selected variant sequence is classified as chromosome specific, chromosome preferential, or chromosome nonspecific. Sequences which are classified as chromosome preferential are further sequenced and regions are identified having a low homology with other regions of the chromosome preferential sequence or with known sequences of other family me This invention is the result of a contract with the Department of Energy (Contract No. W-7405-ENG-36).

  1. A versatile palindromic amphipathic repeat coding sequence horizontally distributed among diverse bacterial and eucaryotic microbes.

    PubMed

    Röske, Kerstin; Foecking, Mark F; Yooseph, Shibu; Glass, John I; Calcutt, Michael J; Wise, Kim S

    2010-07-13

    -genomic shuffling. We describe novel features of PARCELs (Palindromic Amphipathic Repeat Coding ELements), a set of widely distributed repeat protein domains and coding sequences that were likely acquired through HGT by diverse unicellular microbes, further mobilized and diversified within genomes, and co-opted for expression in the membrane proteome of some taxa. Disseminated by multiple gene-centric vehicles, ORFs harboring these elements enhance accessory gene pools as part of the "mobilome" connecting genomes of various clades, in taxa sharing common niches.

  2. Unique palindromic sequences in synthetic oligonucleotides are required to induce IFN [correction of INF] and augment IFN-mediated [correction of INF] natural killer activity.

    PubMed

    Yamamoto, S; Yamamoto, T; Kataoka, T; Kuramoto, E; Yano, O; Tokunaga, T

    1992-06-15

    Thirty-mer single-stranded oligonucleotides, with a sequence chosen from the known cDNA encoding the 64-kDa protein named Ag A or the MPB-70 protein of Mycobacterium bovis BCG and the human cellular proteins such as complement component 1 inhibitor and Ig rearranged lambda-chain, were used to dissect the capability to induce IFN and to augment NK cell activity of mouse spleen cells by coincubation in vitro. Three with the hexamer palindromic sequence as GACGTC were active, whereas two kinds of oligonucleotides with no palindrome were inactive. The oligonucleotides containing at least one of the different palindromic sequences showed no activity. When a portion of the sequence of the inactive oligonucleotides was substituted with either palindromic sequence of GACGTC, AGCGCT, or AACGTT, the oligonucleotide acquired the ability to augment NK activity. In contrast, the oligonucleotides substituted with another palindromic sequence such as ACCGGT was without effect. Furthermore, exchange of two neighboring mononucleotides within, but not outside, the active palindromic sequence destroyed the ability of the oligonucleotides to augment NK cell activity. Stimulation of spleen cells with the substituted oligonucleotide, A4a-AAC, induced production of significant amounts of IFN-alpha/beta and small amounts of IFN-gamma. Augmentation of NK activity of the cells by the oligonucleotide was ascribed to IFN-alpha/beta production. These results strongly suggest that the presence of the unique palindromic sequences, such as GACGTC, AGCGCT, and AACGTT, but not ACCGGT, is essential for the immunostimulatory activity of oligonucleotides.

  3. Weak Palindromic Consensus Sequences Are a Common Feature Found at the Integration Target Sites of Many Retroviruses

    PubMed Central

    Wu, Xiaolin; Li, Yuan; Crise, Bruce; Burgess, Shawn M.; Munroe, David J.

    2005-01-01

    Integration into the host genome is one of the hallmarks of the retroviral life cycle and is catalyzed by virus-encoded integrases. While integrase has strict sequence requirements for the viral DNA ends, target site sequences have been shown to be very diverse. We carefully examined a large number of integration target site sequences from several retroviruses, including human immunodeficiency virus type 1, simian immunodeficiency virus, murine leukemia virus, and avian sarcoma-leukosis virus, and found that a statistical palindromic consensus, centered on the virus-specific duplicated target site sequence, was a common feature at integration target sites for these retroviruses. PMID:15795304

  4. A Large Palindrome With Interchromosomal Gene Duplications in the Pericentromeric Region of the D. melanogaster Y Chromosome

    PubMed Central

    Méndez-Lago, María; Bergman, Casey M.; de Pablos, Beatriz; Tracey, Alan; Whitehead, Siobhan L.; Villasante, Alfredo

    2011-01-01

    The non-recombining Y chromosome is expected to degenerate over evolutionary time, however, gene gain is a common feature of Y chromosomes of mammals and Drosophila. Here, we report that a large palindrome containing interchromosomal segmental duplications is located in the vicinity of the first amplicon detected in the Y chromosome of D. melanogaster. The recent appearance of such amplicons suggests that duplications to the Y chromosome, followed by the amplification of the segmental duplications, are a mechanism for the continuing evolution of Drosophila Y chromosomes. PMID:21297157

  5. Characterization of highly and moderately repetitive 500 bp Eco RI fragments from Xenopus laevis DNA.

    PubMed Central

    Hummel, S; Meyerhof, W; Korge, E; Knöchel, W

    1984-01-01

    Three different types of repetitive Eco RI fragments, which comigrate within a visible band of approximately 500 bp at gel electrophoresis of Xenopus laevis DNA Eco RI digests have been cloned and sequenced. These sequences are designated as Repetitive Eco RI Monomers: REM 1, REM 2 and REM 3. The sequences contain direct repeats, inverted repeats and palindromic elements. Genomic organization of the most abundant sequence (REM 1; 0.4% of total DNA) is that of an interspersed sequence. REM 2 (0.08%) is partly organized as an interspersed element and partly found in tandem arrangement, whereas REM 3 (0.02%) represents the tandemly repeated monomeric unit of a satellite DNA. In situ hybridization has shown that REM 1 and REM 2 sequences are found on most chromosomes, REM 1 being preferentially located on specific chromosomal loci. REM 3 is located near the centromere region of only one chromosome pair (presumably number 1). Hybridization of Northern blots from RNAs of different developmental stages revealed that REM 1, REM 2 and REM 3 sequences are transcribed and that transcription is under developmental control. Images PMID:6330690

  6. Circuit considerations for repetitive railguns

    SciTech Connect

    Honih, E.M.

    1986-01-01

    Railgun electromagnetic launchers have significant military and scientific potential. They provide direct conversion of electrical energy to projectile kinetic energy, and they offer the hope of achieving projectile velocities greatly exceeding the limits of conventional guns. With over 10 km/sec already demonstrated, railguns are attracting attention for tactical and strategic weapons systems and for scientific equation-of-state research. The full utilization of railguns will require significant improvements in every aspect of system design - projectile, barrel, and power source - to achieve operation on a large scale. This paper will review fundamental aspects of railguns, with emphasis on circuit considerations and repetitive operation.

  7. Using a color-coded ambigraphic nucleic acid notation to visualize conserved palindromic motifs within and across genomes.

    PubMed

    Rozak, David A; Rozak, Anthony J

    2014-01-22

    Ambiscript is a graphically-designed nucleic acid notation that uses symbol symmetries to support sequence complementation, highlight biologically-relevant palindromes, and facilitate the analysis of consensus sequences. Although the original Ambiscript notation was designed to easily represent consensus sequences for multiple sequence alignments, the notation's black-on-white ambiguity characters are unable to reflect the statistical distribution of nucleotides found at each position. We now propose a color-augmented ambigraphic notation to encode the frequency of positional polymorphisms in these consensus sequences. We have implemented this color-coding approach by creating an Adobe Flash® application ( http://www.ambiscript.org) that shades and colors modified Ambiscript characters according to the prevalence of the encoded nucleotide at each position in the alignment. The resulting graphic helps viewers perceive biologically-relevant patterns in multiple sequence alignments by uniquely combining color, shading, and character symmetries to highlight palindromes and inverted repeats in conserved DNA motifs. Juxtaposing an intuitive color scheme over the deliberate character symmetries of an ambigraphic nucleic acid notation yields a highly-functional nucleic acid notation that maximizes information content and successfully embodies key principles of graphic excellence put forth by the statistician and graphic design theorist, Edward Tufte.

  8. Using a color-coded ambigraphic nucleic acid notation to visualize conserved palindromic motifs within and across genomes

    PubMed Central

    2014-01-01

    Background Ambiscript is a graphically-designed nucleic acid notation that uses symbol symmetries to support sequence complementation, highlight biologically-relevant palindromes, and facilitate the analysis of consensus sequences. Although the original Ambiscript notation was designed to easily represent consensus sequences for multiple sequence alignments, the notation’s black-on-white ambiguity characters are unable to reflect the statistical distribution of nucleotides found at each position. We now propose a color-augmented ambigraphic notation to encode the frequency of positional polymorphisms in these consensus sequences. Results We have implemented this color-coding approach by creating an Adobe Flash® application ( http://www.ambiscript.org) that shades and colors modified Ambiscript characters according to the prevalence of the encoded nucleotide at each position in the alignment. The resulting graphic helps viewers perceive biologically-relevant patterns in multiple sequence alignments by uniquely combining color, shading, and character symmetries to highlight palindromes and inverted repeats in conserved DNA motifs. Conclusion Juxtaposing an intuitive color scheme over the deliberate character symmetries of an ambigraphic nucleic acid notation yields a highly-functional nucleic acid notation that maximizes information content and successfully embodies key principles of graphic excellence put forth by the statistician and graphic design theorist, Edward Tufte. PMID:24447494

  9. Neuroimaging in repetitive brain trauma.

    PubMed

    Ng, Thomas Sc; Lin, Alexander P; Koerte, Inga K; Pasternak, Ofer; Liao, Huijun; Merugumala, Sai; Bouix, Sylvain; Shenton, Martha E

    2014-01-01

    Sports-related concussions are one of the major causes of mild traumatic brain injury. Although most patients recover completely within days to weeks, those who experience repetitive brain trauma (RBT) may be at risk for developing a condition known as chronic traumatic encephalopathy (CTE). While this condition is most commonly observed in athletes who experience repetitive concussive and/or subconcussive blows to the head, such as boxers, football players, or hockey players, CTE may also affect soldiers on active duty. Currently, the only means by which to diagnose CTE is by the presence of phosphorylated tau aggregations post-mortem. Non-invasive neuroimaging, however, may allow early diagnosis as well as improve our understanding of the underlying pathophysiology of RBT. The purpose of this article is to review advanced neuroimaging methods used to investigate RBT, including diffusion tensor imaging, magnetic resonance spectroscopy, functional magnetic resonance imaging, susceptibility weighted imaging, and positron emission tomography. While there is a considerable literature using these methods in brain injury in general, the focus of this review is on RBT and those subject populations currently known to be susceptible to RBT, namely athletes and soldiers. Further, while direct detection of CTE in vivo has not yet been achieved, all of the methods described in this review provide insight into RBT and will likely lead to a better characterization (diagnosis), in vivo, of CTE than measures of self-report.

  10. Neuroimaging in repetitive brain trauma

    PubMed Central

    2014-01-01

    Sports-related concussions are one of the major causes of mild traumatic brain injury. Although most patients recover completely within days to weeks, those who experience repetitive brain trauma (RBT) may be at risk for developing a condition known as chronic traumatic encephalopathy (CTE). While this condition is most commonly observed in athletes who experience repetitive concussive and/or subconcussive blows to the head, such as boxers, football players, or hockey players, CTE may also affect soldiers on active duty. Currently, the only means by which to diagnose CTE is by the presence of phosphorylated tau aggregations post-mortem. Non-invasive neuroimaging, however, may allow early diagnosis as well as improve our understanding of the underlying pathophysiology of RBT. The purpose of this article is to review advanced neuroimaging methods used to investigate RBT, including diffusion tensor imaging, magnetic resonance spectroscopy, functional magnetic resonance imaging, susceptibility weighted imaging, and positron emission tomography. While there is a considerable literature using these methods in brain injury in general, the focus of this review is on RBT and those subject populations currently known to be susceptible to RBT, namely athletes and soldiers. Further, while direct detection of CTE in vivo has not yet been achieved, all of the methods described in this review provide insight into RBT and will likely lead to a better characterization (diagnosis), in vivo, of CTE than measures of self-report. PMID:25031630

  11. [Repetition and fear of dying].

    PubMed

    Lerner, B D

    1995-03-01

    In this paper a revision is made of the qualifications of Repetition (R) in Freuds work, i.e. its being at the service of the Pleasure Principle and, beyond it, the binding of free energy due to trauma. Freud intends to explain with this last concept the "fort-da" and the traumatic dreams (obsessively reiterated self-reproaches may be added to them). The main thesis of this work is that R. is not only a defense against the recollection of the ominous past (as in the metaphorical deaths of abandonment and desertion) but also a way of maintaining life and identify fighting against the inescapable omninous future (known but yet experienced), i.e. our own death. Some forms of R. like habits, identificatory behaviors and sometimes even magic, are geared to serve the life instinct. A literary illustration shows this desperate fight.

  12. Pressure rig for repetitive casting

    NASA Technical Reports Server (NTRS)

    Vasquez, Peter (Inventor); Hutto, William R. (Inventor); Philips, Albert R. (Inventor)

    1989-01-01

    The invention is a pressure rig for repetitive casting of metal. The pressure rig performs like a piston for feeding molten metal into a mold. Pressure is applied to an expandable rubber diaphragm which expands like a balloon to force the metal into the mold. A ceramic cavity which holds molten metal is lined with blanket-type insulating material, necessitating only a relining for subsequent use and eliminating the lengthy cavity preparation inherent in previous rigs. In addition, the expandable rubber diaphragm is protected by the insulating material thereby decreasing its vulnerability to heat damage. As a result of the improved design the life expectancy of the pressure rig contemplated by the present invention is more than doubled. Moreover, the improved heat protection has allowed the casting of brass and other alloys with higher melting temperatures than possible in the conventional pressure rigs.

  13. Repetition blindness is orientation blind.

    PubMed

    Corballis, Michael C; Armstrong, Cole

    2007-03-01

    In identifying rapid sequences of three letters, subjects were worse at identifying the first and third letters when they were the same than when they were different, indicating repetition blindness (RB). This effect occurred regardless of the angular orientations of the letters, but was more pronounced when the orientations of the repeated letters were different than when they were the same. In a second experiment, RB was also evident when the first and third letters were lowercase bs or ds, presented upright or inverted, even though they are differently named when inverted (q and p, respectively). Conversely, a third experiment showed that RB occurred when the letters had the same names but were repeated in different case. These results suggest that the early extraction of letter shape is independent of its orientation and left-right sense, and that RB can occur at the levels of both shape and name.

  14. Constructive and Unconstructive Repetitive Thought

    PubMed Central

    Watkins, Edward R.

    2008-01-01

    The author reviews research showing that repetitive thought (RT) can have constructive or unconstructive consequences. The main unconstructive consequences of RT are (a) depression, (b) anxiety, and (c) difficulties in physical health. The main constructive consequences of RT are (a) recovery from upsetting and traumatic events, (b) adaptive preparation and anticipatory planning, (c) recovery from depression, and (d) uptake of health-promoting behaviors. Several potential principles accounting for these distinct consequences of RT are identified within this review: (a) the valence of thought content, (b) the intrapersonal and situational context in which RT occurs, and (c) the level of construal (abstract vs. concrete processing) adopted during RT. Of the existing models of RT, it is proposed that an elaborated version of the control theory account provides the best theoretical framework to account for its distinct consequences. PMID:18298268

  15. Socio-Economic Status Affects Sentence Repetition, but Not Non-Word Repetition, in Chilean Preschoolers

    ERIC Educational Resources Information Center

    Balladares, Jaime; Marshall, Chloë; Griffiths, Yvonne

    2016-01-01

    Sentence repetition and non-word repetition tests are widely used measures of language processing which are sensitive to language ability. Surprisingly little previous work has investigated whether children's socio-economic status (SES) affects their sentence and non-word repetition accuracy. This study investigates sentence and non-word…

  16. A Nonword Repetition Task for Speakers with Misarticulations: The Syllable Repetition Task (SRT)

    ERIC Educational Resources Information Center

    Shriberg, Lawrence D.; Lohmeier, Heather L.; Campbell, Thomas F.; Dollaghan, Christine A.; Green, Jordan R.; Moore, Christopher A.

    2009-01-01

    Purpose: Conceptual and methodological confounds occur when non(sense) word repetition tasks are administered to speakers who do not have the target speech sounds in their phonetic inventories or who habitually misarticulate targeted speech sounds. In this article, the authors (a) describe a nonword repetition task, the Syllable Repetition Task…

  17. Numerical taxonomy of the genus Pestivirus: new software for genotyping based on the palindromic nucleotide substitutions method.

    PubMed

    Giangaspero, Massimo; Apicella, Claudio; Harasawa, Ryô

    2013-09-01

    The genus Pestivirus from the family Flaviviridae is represented by four established species; Bovine viral diarrhea virus 1 (BVDV-1); Bovine viral diarrhea virus 2 (BVDV-2); Border disease virus (BDV); and Classical swine fever virus (CSFV); as well a tentative species from a Giraffe. The palindromic nucleotide substitutions (PNS) in the 5' untranslated region (UTR) of Pestivirus RNA has been described as a new, simple and practical method for genotyping. New software is described, also named PNS, that was prepared specifically for this PNS genotyping procedure. Pestivirus identification using PNS was evaluated on five hundred and forty-three sequences at genus, species and genotype level using this software. The software is freely available at www.pns-software.com.

  18. Serial Position Effects in Nonword Repetition

    ERIC Educational Resources Information Center

    Gupta, P.; Lipinski, J.; Abbs, B.; Lin, P.H.

    2005-01-01

    A growing body of research has emphasized the linkage between performance in immediate serial recall of lists, nonword repetition, and word learning. Recently, it has been reported that primacy and recency effects are obtained in repetition of individual syllables within nonwords (Gupta, in press). Five experiments examined whether such…

  19. Repetitions: A Cross-Cultural Study.

    ERIC Educational Resources Information Center

    Murata, Kumiko

    1995-01-01

    This study investigated how repetition is used in conversation among native speakers of British English, native speakers of Japanese, and Japanese speakers of English. Five interactional functions of repetition (interruption-orientated, solidarity, silence-avoidance, hesitation, and reformulation) were identified, as well as the cultural factors…

  20. Grade Repetition in Queensland State Prep Classes

    ERIC Educational Resources Information Center

    Anderson, Robyn

    2012-01-01

    The current study considers grade repetition rates in the early years of schooling in Queensland state schools with specific focus on the pre-schooling year, Prep. In particular, it provides empirical evidence of grade repetition in Queensland state schools along with groups of students who are more often repeated. At the same time, much of the…

  1. Task Repetition and Second Language Speech Processing

    ERIC Educational Resources Information Center

    Lambert, Craig; Kormos, Judit; Minn, Danny

    2017-01-01

    This study examines the relationship between the repetition of oral monologue tasks and immediate gains in L2 fluency. It considers the effect of aural-oral task repetition on speech rate, frequency of clause-final and midclause filled pauses, and overt self-repairs across different task types and proficiency levels and relates these findings to…

  2. Crystal Structure of the Dimeric Oct6 (Pou3fl) POU Domain Bound to Palindromic MORE DNA

    SciTech Connect

    R Jauch; S Choo; C Ng; P Kolatkar

    2011-12-31

    POU domains (named after their identification in Pit1, Oct1 unc86) are found in around 15 transcription factors encoded in mammalian genomes many of which feature prominently as key regulators at development bifurcations. For example, the POU III class Octamer binding protein 6 (Oct6) is expressed in embryonic stem cells and during neural development and drives the differentia5tion of myelinated cells in the central and peripheral nervous system. Defects in oct6 expression levels are linked to neurological disorders such as schizophrenia. POU proteins contain a bi-partite DNA binding domain that assembles on various DNA motifs with differentially configured subdomains. Intriguingly, alternative configurations of POU domains on different DNA sites were shown to affect the subsequent recruitment of transcriptional coactivators. Namely, binding of Oct1 to a Palindromic Oct-factor Recognition Element (PORE) was shown to facilitate the recruitment of the OBF1 coactivator whereas More of PORE (MORE) bound Oct1 does not. Moreover, Pit1 was shown to recruit the corepressor N-CoR only when bound to a variant MORE motif with a 2 bp half-site spacing. Therefore, POU proteins are seen as a paradigm for DNA induced allosteric effects on transcription factors modulating their regulatory potential. However, a big unresolved conundrum for the POU class and for most if not all other transcription factor classes is how highly similar proteins regulate different sets of genes causing fundamentally different biological responses. Ultimately, there must be subtle features enabling those factors to engage in contrasting molecular interactions in the cell. Thus, the dissection of the molecular details of the transcription-DNA recognition in general, and the formation of multimeric regulatory complexes, in particular, is highly desirable. To contribute to these efforts they solved the 2.05 {angstrom} crystal structure of Oct6 bound as a symmetrical homodimer to palindromic MORE DNA.

  3. Repetition priming results in sensitivity attenuation

    PubMed Central

    Allenmark, Fredrik; Hsu, Yi-Fang; Roussel, Cedric; Waszak, Florian

    2015-01-01

    Repetition priming refers to the change in the ability to perform a task on a stimulus as a consequence of a former encounter with that very same item. Usually, repetition results in faster and more accurate performance. In the present study, we used a contrast discrimination protocol to assess perceptual sensitivity and response bias of Gabor gratings that are either repeated (same orientation) or alternated (different orientation). We observed that contrast discrimination performance is worse, not better, for repeated than for alternated stimuli. In a second experiment, we varied the probability of stimulus repetition, thus testing whether the repetition effect is due to bottom-up or top-down factors. We found that it is top-down expectation that determines the effect. We discuss the implication of these findings for repetition priming and related phenomena as sensory attenuation. This article is part of a Special Issue entitled SI: Prediction and Attention. PMID:25819554

  4. Strategies for Using Repetition as a Powerful Teaching Tool

    ERIC Educational Resources Information Center

    Saville, Kirt

    2011-01-01

    Brain research indicates that repetition is of vital importance in the learning process. Repetition is an especially useful tool in the area of music education. The success of repetition can be enhanced by accurate and timely feedback. From "simple repetition" to "repetition with the addition or subtraction of degrees of freedom," there are many…

  5. Strategies for Using Repetition as a Powerful Teaching Tool

    ERIC Educational Resources Information Center

    Saville, Kirt

    2011-01-01

    Brain research indicates that repetition is of vital importance in the learning process. Repetition is an especially useful tool in the area of music education. The success of repetition can be enhanced by accurate and timely feedback. From "simple repetition" to "repetition with the addition or subtraction of degrees of freedom," there are many…

  6. Fast repetition rate (FRR) flasher

    DOEpatents

    Kolber, Zbigniew; Falkowski, Paul

    1997-02-11

    A fast repetition rate (FRR) flasher suitable for high flash photolysis including kinetic chemical and biological analysis. The flasher includes a power supply, a discharge capacitor operably connected to be charged by the power supply, and a flash lamp for producing a series of flashes in response to discharge of the discharge capacitor. A triggering circuit operably connected to the flash lamp initially ionizes the flash lamp. A current switch is operably connected between the flash lamp and the discharge capacitor. The current switch has at least one insulated gate bipolar transistor for switching current that is operable to initiate a controllable discharge of the discharge capacitor through the flash lamp. Control means connected to the current switch for controlling the rate of discharge of the discharge capacitor thereby to effectively keep the flash lamp in an ionized state between Successive discharges of the discharge capacitor. Advantageously, the control means is operable to discharge the discharge capacitor at a rate greater than 10,000 Hz and even up to a rate greater than about 250,000 Hz.

  7. Fast repetition rate (FRR) flasher

    DOEpatents

    Kolber, Z.; Falkowski, P.

    1997-02-11

    A fast repetition rate (FRR) flasher is described suitable for high flash photolysis including kinetic chemical and biological analysis. The flasher includes a power supply, a discharge capacitor operably connected to be charged by the power supply, and a flash lamp for producing a series of flashes in response to discharge of the discharge capacitor. A triggering circuit operably connected to the flash lamp initially ionizes the flash lamp. A current switch is operably connected between the flash lamp and the discharge capacitor. The current switch has at least one insulated gate bipolar transistor for switching current that is operable to initiate a controllable discharge of the discharge capacitor through the flash lamp. Control means connected to the current switch for controlling the rate of discharge of the discharge capacitor thereby to effectively keep the flash lamp in an ionized state between successive discharges of the discharge capacitor. Advantageously, the control means is operable to discharge the discharge capacitor at a rate greater than 10,000 Hz and even up to a rate greater than about 250,000 Hz. 14 figs.

  8. Precision markedly attenuates repetitive lift capacity.

    PubMed

    Collier, Brooke R; Holland, Laura; McGhee, Deirdre; Sampson, John A; Bell, Alison; Stapley, Paul J; Groeller, Herbert

    2014-01-01

    This study investigated the effect of precision on time to task failure in a repetitive whole-body manual handling task. Twelve participants were required to repetitively lift a box weighing 65% of their single repetition maximum to shoulder height using either precise or unconstrained box placement. Muscle activity, forces exerted at the ground, 2D body kinematics, box acceleration and psychophysical measures of performance were recorded until task failure was reached. With precision, time to task failure for repetitive lifting was reduced by 72%, whereas the duration taken to complete a single lift and anterior deltoid muscle activation increased by 39% and 25%, respectively. Yet, no significant difference was observed in ratings of perceived exertion or heart rate at task failure. In conclusion, our results suggest that when accuracy is a characteristic of a repetitive manual handling task, physical work capacity will decline markedly. The capacity to lift repetitively to shoulder height was reduced by 72% when increased accuracy was required to place a box upon a shelf. Lifting strategy and muscle activity were also modified, confirming practitioners should take into consideration movement precision when evaluating the demands of repetitive manual handling tasks.

  9. Item repetition in short-term memory: Ranschburg repeated.

    PubMed

    Henson, R N

    1998-09-01

    In serial recall from short-term memory, repeated items are recalled well when close together (repetition facilitation), but not when far apart (repetition inhibition; the Ranschburg effect). These effects were re-examined with a new scoring scheme that addresses the possibility that repetitions are distinct tokens in memory. Repetition facilitation and repetition inhibition proved robust, and were shown to interact with the temporal grouping of items (Experiment 1), which affected the probability of detecting repetition (Experiments 2A and 2B). It is argued that detection of a repetition is necessary for repetition facilitation, attributable to the tagging of immediate repetition, whereas the failure to detect or remember a repetition results in repetition inhibition, attributable to an automatic suppression of previous responses and a bias against guessing repeated items (Experiment 3). The findings are discussed in relation to models of short-term memory and the phenomenon of repetition blindness.

  10. Minor and repetitive head injury.

    PubMed

    Buki, Andras; Kovacs, Noemi; Czeiter, Endre; Schmid, Kara; Berger, Rachel P; Kobeissy, Firas; Italiano, Domenico; Hayes, Ronald L; Tortella, Frank C; Mezosi, Emese; Schwarcz, Attila; Toth, Arnold; Nemes, Orsolya; Mondello, Stefania

    2015-01-01

    Traumatic brain injury (TBI) is the leading cause of death and disability in the young, active population and expected to be the third leading cause of death in the whole world until 2020. The disease is frequently referred to as the silent epidemic, and many authors highlight the "unmet medical need" associated with TBI.The term traumatically evoked brain injury covers a heterogeneous group ranging from mild/minor/minimal to severe/non-salvageable damages. Severe TBI has long been recognized to be a major socioeconomical health-care issue as saving young lives and sometimes entirely restituting health with a timely intervention can indeed be extremely cost efficient.Recently it has been recognized that mild or minor TBI should be considered similarly important because of the magnitude of the patient population affected. Other reasons behind this recognition are the association of mild head injury with transient cognitive disturbances as well as long-term sequelae primarily linked to repeat (sport-related) injuries.The incidence of TBI in developed countries can be as high as 2-300/100,000 inhabitants; however, if we consider the injury pyramid, it turns out that severe and moderate TBI represents only 25-30 % of all cases, while the overwhelming majority of TBI cases consists of mild head injury. On top of that, or at the base of the pyramid, are the cases that never show up at the ER - the unreported injuries.Special attention is turned to mild TBI as in recent military conflicts it is recognized as "signature injury."This chapter aims to summarize the most important features of mild and repetitive traumatic brain injury providing definitions, stratifications, and triage options while also focusing on contemporary knowledge gathered by imaging and biomarker research.Mild traumatic brain injury is an enigmatic lesion; the classification, significance, and its consequences are all far less defined and explored than in more severe forms of brain injury

  11. Repetitive strain injury: causes, treatment and prevention.

    PubMed

    Shuttleworth, Ann

    Repetitive strain injury (RSI) has become increasingly prevalent with the growth of computer-based and automated occupations. While environmental factors such as work stations and repetitive tasks are primary causes, a number of secondary causes can increase a person's risk of RSI. Various treatments provide relief but the rate of recovery varies widely. Prevention involves adopting a range of measures that will also promote recovery in those with RSI.

  12. Repetitive sequence environment distinguishes housekeeping genes

    PubMed Central

    Eller, C. Daniel; Regelson, Moira; Merriman, Barry; Nelson, Stan; Horvath, Steve; Marahrens, York

    2007-01-01

    Housekeeping genes are expressed across a wide variety of tissues. Since repetitive sequences have been reported to influence the expression of individual genes, we employed a novel approach to determine whether housekeeping genes can be distinguished from tissue-specific genes their repetitive sequence context. We show that Alu elements are more highly concentrated around housekeeping genes while various longer (>400-bp) repetitive sequences ("repeats"), including Long Interspersed Nuclear Element 1 (LINE-1) elements, are excluded from these regions. We further show that isochore membership does not distinguish housekeeping genes from tissue-specific genes and that repetitive sequence environment distinguishes housekeeping genes from tissue-specific genes in every isochore. The distinct repetitive sequence environment, in combination with other previously published sequence properties of housekeeping genes, were used to develop a method of predicting housekeeping genes on the basis of DNA sequence alone. Using expression across tissue types as a measure of success, we demonstrate that repetitive sequence environment is by far the most important sequence feature identified to date for distinguishing housekeeping genes. PMID:17141428

  13. Taxonomy of genus Hepacivirus. Application of palindromic nucleotide substitutions for the determination of genotypes of human hepatitis C virus species.

    PubMed

    Giangaspero, M; Harasawa, R; Zanetti, A

    2008-11-01

    The palindromic nucleotide substitutions (PNS) in the 5'-untranslated region (UTR) of Pestivirus RNA have been described as a new, simple and practical method for genotyping. Given the genetic relatedness between Pestivirus and hepatitis C virus species, the application of the method was investigated preliminarily on 180 isolates, including reference strains. The keys for hepatitis C virus identification have been determined at the genus, species, genotype and subtype levels. Secondary structure nucleotide substitutions were characteristics to the genus included in a complex stem-loop structure composed of 112-115 nucleotides. Due to the worldwide importance of hepatitis C virus, and the difficulties encountered in the control of the disease, it is, therefore, important to understand the genetic aspects of the virus. The application of the PNS method might represent an additional useful tool for determining the genetic variations among hepatitis C virus strains. The identification of viral types or subtypes based on genetic changes should improve our understanding of hepatitis C virus and might provide markers for biological differences, such as virulence, and improve understanding of the evolution of the virus.

  14. The palindromic DNA-bound USP/EcR nuclear receptor adopts an asymmetric organization with allosteric domain positioning.

    PubMed

    Maletta, Massimiliano; Orlov, Igor; Roblin, Pierre; Beck, Yannick; Moras, Dino; Billas, Isabelle M L; Klaholz, Bruno P

    2014-06-19

    Nuclear receptors (NRs) regulate gene expression through DNA- and ligand-binding and thus represent crucial therapeutic targets. The ultraspiracle protein/ecdysone receptor (USP/EcR) complex binds to half-sites with a one base pair spaced inverted repeat (IR1), a palindromic DNA response element (RE) reminiscent of IRs observed for vertebrate steroid hormone receptors. Here we present the cryo electron microscopy structure of the USP/EcR complex bound to an IR1 RE which provides the first description of a full IR-bound NR complex. The structure reveals that even though the DNA is almost symmetric, the complex adopts a highly asymmetric architecture in which the ligand-binding domains (LBDs) are positioned 5' off-centred. Additional interactions of the USP LBD with the 5'-flanking sequence trigger transcription activity as monitored by transfection assays. The comparison with DR-bound NR complexes suggests that DNA is the major allosteric driver in inversely positioning the LBDs, which serve as the main binding-site for transcriptional regulators.

  15. Double-stranded Endonuclease Activity in Bacillus halodurans Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)-associated Cas2 Protein*

    PubMed Central

    Nam, Ki Hyun; Ding, Fran; Haitjema, Charles; Huang, Qingqiu; DeLisa, Matthew P.; Ke, Ailong

    2012-01-01

    The CRISPR (clustered regularly interspaced short palindromic repeats) system is a prokaryotic RNA-based adaptive immune system against extrachromosomal genetic elements. Cas2 is a universally conserved core CRISPR-associated protein required for the acquisition of new spacers for CRISPR adaptation. It was previously characterized as an endoribonuclease with preference for single-stranded (ss)RNA. Here, we show using crystallography, mutagenesis, and isothermal titration calorimetry that the Bacillus halodurans Cas2 (Bha_Cas2) from the subtype I-C/Dvulg CRISPR instead possesses metal-dependent endonuclease activity against double-stranded (ds)DNA. This activity is consistent with its putative function in producing new spacers for insertion into the 5′-end of the CRISPR locus. Mutagenesis and isothermal titration calorimetry studies revealed that a single divalent metal ion (Mg2+ or Mn2+), coordinated by a symmetric Asp pair in the Bha_Cas2 dimer, is involved in the catalysis. We envision that a pH-dependent conformational change switches Cas2 into a metal-binding competent conformation for catalysis. We further propose that the distinct substrate preferences among Cas2 proteins may be determined by the sequence and structure in the β1–α1 loop. PMID:22942283

  16. Differing specificities and isotypes of anti-citrullinated peptide/protein antibodies in palindromic rheumatism and rheumatoid arthritis.

    PubMed

    Cabrera-Villalba, Sonia; Gomara, María José; Cañete, Juan D; Ramírez, Julio; Salvador, Georgina; Ruiz-Esquide, Virginia; Hernández, Maria Victoria; Inciarte-Mundo, José; Haro, Isabel; Sanmartí, Raimon

    2017-06-15

    To analyze differences in the recognition of anti-citrullinated peptide/protein antibody (ACPA) citrullinated epitopes and isotypes in patients with palindromic rheumatism (PR) and rheumatoid arthritis (RA). ACPA fine specificities (citrullinated peptides of enolase, fibrin, and vimentin) and isotypes (IgG, IgM, and IgA) were analyzed in 54 patients with longstanding PR and 54 patients with established RA. CCP2 tested positive in 66.7% of patients with PR and RA. The ACPA distribution of fine specificities and isotypes differed between PR and RA patients. PR patients had a lower frequency of fine ACPA specificities than RA patients, which was significant in the case of a peptide derived from vimentin (PR 24.1% vs. 59.3% RA; p < 0.001). The mean number of ACPA specificities was lower in PR than in RA patients, and only 25.9% of PR patients recognized ≥2 additional specificities compared with 46.3% of RA patients. Significantly less isotype usage, especially IgA, was observed in PR patients. The ACPA immune response differed in patients with PR and RA, with fewer fine specificities and isotype usage in patients with PR. Some patients with PR may have impaired maturation of the B-cell response against citrullinated peptides with no progression to RA.

  17. Clinical Analysis of Behcet Disease: Arthritic Manifestations in Behcet Disease may present as Seronegative Rheumatoid Arthritis or Palindromic Rheumatism

    PubMed Central

    Park, Jae-Ho

    1999-01-01

    Objectives To analyze arthritic manifestations in Behcet disease, which is one of the most common manifestations of Behcet disease. Methods Among the patients who visited the Rheumatology Division, Keimyung University Dongsan Medical Center, Taegu, Korea from March 1997 to February 1998, 35 patients, with more than 3 months follow-up, were compatible for the diagnosis of Behcet disease according to the Shimizu criteria, after exclusion of uncertain or possible Behcet cases. The presence of various manifestations was evaluated. Regarding the joint manifestations, the involved joint, signs and the pattern of the articular symptoms were examined. Basic laboratory tests, HLA studies and simple radiologic studies were done. Results All 35 patients had evident, recurrent, painful oral ulcers by the study definition. Genital ulcers were found in 29%, skin lesions in 77%, uveitis in 9%, gastrointestinal ulcerations in 6% and vascular manifestations in 6%. Joint manifestations appeared in 97%. Knee(91%), proximal interphalangeal (53%) and metacarpophalangeal joints(21%) were the main sites. Tenderness was prominent in 91% and swelling in 44%. Polyarticular presentation was found in 47%. In most cases (76.4%), the articular symptom was short-lasting. C-reactive protein was likely to be positive in active Behcet disease. HLA B51 was positive in 46%. Conclusions In Behcet disease, various manifestations can be found. The arthritic manifestation seems quite common, it may present as seronegative rheumatoid arthritis. Otherwise, it may present as palindromic rheumatism. PMID:10063316

  18. Clustered Regularly Interspaced Short Palindromic Repeats Are emm Type-Specific in Highly Prevalent Group A Streptococci

    PubMed Central

    Zheng, Po-Xing; Chan, Yuen-Chi; Chiou, Chien-Shun; Chiang-Ni, Chuan; Wang, Shu-Ying; Tsai, Pei-Jane; Chuang, Woei-Jer; Lin, Yee-Shin; Liu, Ching-Chuan; Wu, Jiunn-Jong

    2015-01-01

    Clustered regularly interspaced short palindromic repeats (CRISPR) are the bacterial adaptive immune system against foreign nucleic acids. Given the variable nature of CRISPR, it could be a good marker for molecular epidemiology. Group A streptococcus is one of the major human pathogens. It has two CRISPR loci, including CRISPR01 and CRISPR02. The aim of this study was to analyze the distribution of CRISPR-associated gene cassettes (cas) and CRISPR arrays in highly prevalent emm types. The cas cassette and CRISPR array in two CRISPR loci were analyzed in a total of 332 strains, including emm1, emm3, emm4, emm12, and emm28 strains. The CRISPR type was defined by the spacer content of each CRISPR array. All strains had at least one cas cassette or CRISPR array. More than 90% of the spacers were found in one emm type, specifically. Comparing the consistency between emm and CRISPR types by Simpson’s index of diversity and the adjusted Wallace coefficient, CRISPR01 type was concordant to emm type, and CRISPR02 showed unidirectional congruence to emm type, suggesting that at least for the majority of isolates causing infection in high income countries, the emm type can be inferred from CRISPR analysis, which can further discriminate isolates sharing the same emm type. PMID:26710228

  19. Double-stranded endonuclease activity in Bacillus halodurans clustered regularly interspaced short palindromic repeats (CRISPR)-associated Cas2 protein.

    PubMed

    Nam, Ki Hyun; Ding, Fran; Haitjema, Charles; Huang, Qingqiu; DeLisa, Matthew P; Ke, Ailong

    2012-10-19

    The CRISPR (clustered regularly interspaced short palindromic repeats) system is a prokaryotic RNA-based adaptive immune system against extrachromosomal genetic elements. Cas2 is a universally conserved core CRISPR-associated protein required for the acquisition of new spacers for CRISPR adaptation. It was previously characterized as an endoribonuclease with preference for single-stranded (ss)RNA. Here, we show using crystallography, mutagenesis, and isothermal titration calorimetry that the Bacillus halodurans Cas2 (Bha_Cas2) from the subtype I-C/Dvulg CRISPR instead possesses metal-dependent endonuclease activity against double-stranded (ds)DNA. This activity is consistent with its putative function in producing new spacers for insertion into the 5'-end of the CRISPR locus. Mutagenesis and isothermal titration calorimetry studies revealed that a single divalent metal ion (Mg(2+) or Mn(2+)), coordinated by a symmetric Asp pair in the Bha_Cas2 dimer, is involved in the catalysis. We envision that a pH-dependent conformational change switches Cas2 into a metal-binding competent conformation for catalysis. We further propose that the distinct substrate preferences among Cas2 proteins may be determined by the sequence and structure in the β1-α1 loop.

  20. A novel family of sequence-specific endoribonucleases associated with the clustered regularly interspaced short palindromic repeats.

    PubMed

    Beloglazova, Natalia; Brown, Greg; Zimmerman, Matthew D; Proudfoot, Michael; Makarova, Kira S; Kudritska, Marina; Kochinyan, Samvel; Wang, Shuren; Chruszcz, Maksymilian; Minor, Wladek; Koonin, Eugene V; Edwards, Aled M; Savchenko, Alexei; Yakunin, Alexander F

    2008-07-18

    Clustered regularly interspaced short palindromic repeats (CRISPRs) together with the associated CAS proteins protect microbial cells from invasion by foreign genetic elements using presently unknown molecular mechanisms. All CRISPR systems contain proteins of the CAS2 family, suggesting that these uncharacterized proteins play a central role in this process. Here we show that the CAS2 proteins represent a novel family of endoribonucleases. Six purified CAS2 proteins from diverse organisms cleaved single-stranded RNAs preferentially within U-rich regions. A representative CAS2 enzyme, SSO1404 from Sulfolobus solfataricus, cleaved the phosphodiester linkage on the 3'-side and generated 5'-phosphate- and 3'-hydroxyl-terminated oligonucleotides. The crystal structure of SSO1404 was solved at 1.6A resolution revealing the first ribonuclease with a ferredoxin-like fold. Mutagenesis of SSO1404 identified six residues (Tyr-9, Asp-10, Arg-17, Arg-19, Arg-31, and Phe-37) that are important for enzymatic activity and suggested that Asp-10 might be the principal catalytic residue. Thus, CAS2 proteins are sequence-specific endoribonucleases, and we propose that their role in the CRISPR-mediated anti-phage defense might involve degradation of phage or cellular mRNAs.

  1. Gene Repression in Haloarchaea Using the CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats)-Cas I-B System.

    PubMed

    Stachler, Aris-Edda; Marchfelder, Anita

    2016-07-15

    The clustered regularly interspaced short palindromic repeats (CRISPR)-Cas system is used by bacteria and archaea to fend off foreign genetic elements. Since its discovery it has been developed into numerous applications like genome editing and regulation of transcription in eukaryotes and bacteria. For archaea currently no tools for transcriptional repression exist. Because molecular biology analyses in archaea become more and more widespread such a tool is vital for investigating the biological function of essential genes in archaea. Here we use the model archaeon Haloferax volcanii to demonstrate that its endogenous CRISPR-Cas system I-B can be harnessed to repress gene expression in archaea. Deletion of cas3 and cas6b genes results in efficient repression of transcription. crRNAs targeting the promoter region reduced transcript levels down to 8%. crRNAs targeting the reading frame have only slight impact on transcription. crRNAs that target the coding strand repress expression only down to 88%, whereas crRNAs targeting the template strand repress expression down to 8%. Repression of an essential gene results in reduction of transcription levels down to 22%. Targeting efficiencies can be enhanced by expressing a catalytically inactive Cas3 mutant. Genes can be targeted on plasmids or on the chromosome, they can be monocistronic or part of a polycistronic operon. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  2. Comparisons of clustered regularly interspaced short palindromic repeats and viromes in human saliva reveal bacterial adaptations to salivary viruses.

    PubMed

    Pride, David T; Salzman, Julia; Relman, David A

    2012-09-01

    Explorations of human microbiota have provided substantial insight into microbial community composition; however, little is known about interactions between various microbial components in human ecosystems. In response to the powerful impact of viral predation, bacteria have acquired potent defences, including an adaptive immune response based on the clustered regularly interspaced short palindromic repeats (CRISPRs)/Cas system. To improve our understanding of the interactions between bacteria and their viruses in humans, we analysed 13 977 streptococcal CRISPR sequences and compared them with 2 588 172 virome reads in the saliva of four human subjects over 17 months. We found a diverse array of viruses and CRISPR spacers, many of which were specific to each subject and time point. There were numerous viral sequences matching CRISPR spacers; these matches were highly specific for salivary viruses. We determined that spacers and viruses coexist at the same time, which suggests that streptococcal CRISPR/Cas systems are under constant pressure from salivary viruses. CRISPRs in some subjects were just as likely to match viral sequences from other subjects as they were to match viruses from the same subject. Because interactions between bacteria and viruses help to determine the structure of bacterial communities, CRISPR-virus analyses are likely to provide insight into the forces shaping the human microbiome. © 2012 Society for Applied Microbiology and Blackwell Publishing Ltd.

  3. Diversity, evolution, and functionality of clustered regularly interspaced short palindromic repeat (CRISPR) regions in the fire blight pathogen Erwinia amylovora.

    PubMed

    Rezzonico, Fabio; Smits, Theo H M; Duffy, Brion

    2011-06-01

    The clustered regularly interspaced short palindromic repeat (CRISPR)/Cas system confers acquired heritable immunity against mobile nucleic acid elements in prokaryotes, limiting phage infection and horizontal gene transfer of plasmids. In CRISPR arrays, characteristic repeats are interspersed with similarly sized nonrepetitive spacers derived from transmissible genetic elements and acquired when the cell is challenged with foreign DNA. New spacers are added sequentially and the number and type of CRISPR units can differ among strains, providing a record of phage/plasmid exposure within a species and giving a valuable typing tool. The aim of this work was to investigate CRISPR diversity in the highly homogeneous species Erwinia amylovora, the causal agent of fire blight. A total of 18 CRISPR genotypes were defined within a collection of 37 cosmopolitan strains. Strains from Spiraeoideae plants clustered in three major groups: groups II and III were composed exclusively of bacteria originating from the United States, whereas group I generally contained strains of more recent dissemination obtained in Europe, New Zealand, and the Middle East. Strains from Rosoideae and Indian hawthorn (Rhaphiolepis indica) clustered separately and displayed a higher intrinsic diversity than that of isolates from Spiraeoideae plants. Reciprocal exclusion was generally observed between plasmid content and cognate spacer sequences, supporting the role of the CRISPR/Cas system in protecting against foreign DNA elements. However, in several group III strains, retention of plasmid pEU30 is inconsistent with a functional CRISPR/Cas system.

  4. Gene Repression in Haloarchaea Using the CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats)-Cas I-B System*

    PubMed Central

    Stachler, Aris-Edda; Marchfelder, Anita

    2016-01-01

    The clustered regularly interspaced short palindromic repeats (CRISPR)-Cas system is used by bacteria and archaea to fend off foreign genetic elements. Since its discovery it has been developed into numerous applications like genome editing and regulation of transcription in eukaryotes and bacteria. For archaea currently no tools for transcriptional repression exist. Because molecular biology analyses in archaea become more and more widespread such a tool is vital for investigating the biological function of essential genes in archaea. Here we use the model archaeon Haloferax volcanii to demonstrate that its endogenous CRISPR-Cas system I-B can be harnessed to repress gene expression in archaea. Deletion of cas3 and cas6b genes results in efficient repression of transcription. crRNAs targeting the promoter region reduced transcript levels down to 8%. crRNAs targeting the reading frame have only slight impact on transcription. crRNAs that target the coding strand repress expression only down to 88%, whereas crRNAs targeting the template strand repress expression down to 8%. Repression of an essential gene results in reduction of transcription levels down to 22%. Targeting efficiencies can be enhanced by expressing a catalytically inactive Cas3 mutant. Genes can be targeted on plasmids or on the chromosome, they can be monocistronic or part of a polycistronic operon. PMID:27226589

  5. A Novel Family of Sequence-specific Endoribonucleases Associated with the Clustered Regularly Interspaced Short Palindromic Repeats

    SciTech Connect

    Beloglazova, Natalia; Brown, Greg; Zimmerman, Matthew D.; Proudfoot, Michael; Makarova, Kira S.; Kudritska, Marina; Kochinyan, Samvel; Wang, Shuren; Chruszcz, Maksymilian; Minor, Wladek; Koonin, Eugene V.; Edwards, Aled M.; Savchenko, Alexei; Yakunin, Alexander F.

    2008-07-28

    Clustered regularly interspaced short palindromic repeats (CRISPRs) together with the associated CAS proteins protect microbial cells from invasion by foreign genetic elements using presently unknown molecular mechanisms. All CRISPR systems contain proteins of the CAS2 family, suggesting that these uncharacterized proteins play a central role in this process. Here we show that the CAS2 proteins represent a novel family of endoribonucleases. Six purified CAS2 proteins from diverse organisms cleaved single-stranded RNAs preferentially within U-rich regions. A representative CAS2 enzyme, SSO1404 from Sulfolobus solfataricus, cleaved the phosphodiester linkage on the 3'-side and generated 5'-phosphate- and 3'-hydroxyl-terminated oligonucleotides. The crystal structure of SSO1404 was solved at 1.6{angstrom} resolution revealing the first ribonuclease with a ferredoxin-like fold. Mutagenesis of SSO1404 identified six residues (Tyr-9, Asp-10, Arg-17, Arg-19, Arg-31, and Phe-37) that are important for enzymatic activity and suggested that Asp-10 might be the principal catalytic residue. Thus, CAS2 proteins are sequence-specific endoribonucleases, and we propose that their role in the CRISPR-mediated anti-phage defense might involve degradation of phage or cellular mRNAs.

  6. Clustered Regularly Interspaced Short Palindromic Repeats Are emm Type-Specific in Highly Prevalent Group A Streptococci.

    PubMed

    Zheng, Po-Xing; Chan, Yuen-Chi; Chiou, Chien-Shun; Chiang-Ni, Chuan; Wang, Shu-Ying; Tsai, Pei-Jane; Chuang, Woei-Jer; Lin, Yee-Shin; Liu, Ching-Chuan; Wu, Jiunn-Jong

    2015-01-01

    Clustered regularly interspaced short palindromic repeats (CRISPR) are the bacterial adaptive immune system against foreign nucleic acids. Given the variable nature of CRISPR, it could be a good marker for molecular epidemiology. Group A streptococcus is one of the major human pathogens. It has two CRISPR loci, including CRISPR01 and CRISPR02. The aim of this study was to analyze the distribution of CRISPR-associated gene cassettes (cas) and CRISPR arrays in highly prevalent emm types. The cas cassette and CRISPR array in two CRISPR loci were analyzed in a total of 332 strains, including emm1, emm3, emm4, emm12, and emm28 strains. The CRISPR type was defined by the spacer content of each CRISPR array. All strains had at least one cas cassette or CRISPR array. More than 90% of the spacers were found in one emm type, specifically. Comparing the consistency between emm and CRISPR types by Simpson's index of diversity and the adjusted Wallace coefficient, CRISPR01 type was concordant to emm type, and CRISPR02 showed unidirectional congruence to emm type, suggesting that at least for the majority of isolates causing infection in high income countries, the emm type can be inferred from CRISPR analysis, which can further discriminate isolates sharing the same emm type.

  7. High-Resolution DNA Melt Curve Analysis of the Clustered, Regularly Interspaced Short-Palindromic-Repeat Locus of Campylobacter jejuni▿ †

    PubMed Central

    Price, Erin P.; Smith, Helen; Huygens, Flavia; Giffard, Philip M.

    2007-01-01

    A novel method for genotyping the clustered, regularly interspaced short-palindromic-repeat (CRISPR) locus of Campylobacter jejuni is described. Following real-time PCR, CRISPR products were subjected to high-resolution melt (HRM) analysis, a new technology that allows precise melt profile determination of amplicons. This investigation shows that the CRISPR HRM assay provides a powerful addition to existing C. jejuni genotyping methods and emphasizes the potential of HRM for genotyping short sequence repeats in other species. PMID:17400785

  8. 21 CFR 882.5805 - Repetitive transcranial magnetic stimulation system.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 21 Food and Drugs 8 2013-04-01 2013-04-01 false Repetitive transcranial magnetic stimulation....5805 Repetitive transcranial magnetic stimulation system. (a) Identification. A repetitive transcranial magnetic stimulation system is an external device that delivers transcranial repetitive pulsed...

  9. 21 CFR 882.5805 - Repetitive transcranial magnetic stimulation system.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 21 Food and Drugs 8 2012-04-01 2012-04-01 false Repetitive transcranial magnetic stimulation....5805 Repetitive transcranial magnetic stimulation system. (a) Identification. A repetitive transcranial magnetic stimulation system is an external device that delivers transcranial repetitive pulsed...

  10. 21 CFR 882.5805 - Repetitive transcranial magnetic stimulation system.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 8 2014-04-01 2014-04-01 false Repetitive transcranial magnetic stimulation....5805 Repetitive transcranial magnetic stimulation system. (a) Identification. A repetitive transcranial magnetic stimulation system is an external device that delivers transcranial repetitive pulsed...

  11. The Prevalence and Phenomenology of Repetitive Behavior in Genetic Syndromes

    ERIC Educational Resources Information Center

    Moss, Joanna; Oliver, Chris; Arron, Kate; Burbidge, Cheryl; Berg, Katy

    2009-01-01

    We investigated the prevalence and phenomenology of repetitive behavior in genetic syndromes to detail profiles of behavior. The Repetitive Behaviour Questionnaire (RBQ) provides fine-grained identification of repetitive behaviors. The RBQ was employed to examine repetitive behavior in Angelman (N = 104), Cornelia de Lange (N = 101), Cri-du-Chat…

  12. The Prevalence and Phenomenology of Repetitive Behavior in Genetic Syndromes

    ERIC Educational Resources Information Center

    Moss, Joanna; Oliver, Chris; Arron, Kate; Burbidge, Cheryl; Berg, Katy

    2009-01-01

    We investigated the prevalence and phenomenology of repetitive behavior in genetic syndromes to detail profiles of behavior. The Repetitive Behaviour Questionnaire (RBQ) provides fine-grained identification of repetitive behaviors. The RBQ was employed to examine repetitive behavior in Angelman (N = 104), Cornelia de Lange (N = 101), Cri-du-Chat…

  13. Toxin inhibition in C. crescentus VapBC1 is mediated by a flexible pseudo-palindromic protein motif and modulated by DNA binding

    PubMed Central

    Bendtsen, Kirstine L.; Xu, Kehan; Luckmann, Majbritt; Winther, Kristoffer S.; Shah, Shiraz A.; Pedersen, Christian N. S.

    2017-01-01

    Abstract Expression of bacterial type II toxin-antitoxin (TA) systems is regulated at the transcriptional level through direct binding of the antitoxin to pseudo-palindromic sequences on operator DNA. In this context, the toxin functions as a co-repressor by stimulating DNA binding through direct interaction with the antitoxin. Here, we determine crystal structures of the complete 90 kDa heterooctameric VapBC1 complex from Caulobacter crescentus CB15 both in isolation and bound to its cognate DNA operator sequence at 1.6 and 2.7 Å resolution, respectively. DNA binding is associated with a dramatic architectural rearrangement of conserved TA interactions in which C-terminal extended structures of the antitoxin VapB1 swap positions to interlock the complex in the DNA-bound state. We further show that a pseudo-palindromic protein sequence in the antitoxin is responsible for this interaction and required for binding and inactivation of the VapC1 toxin dimer. Sequence analysis of 4127 orthologous VapB sequences reveals that such palindromic protein sequences are widespread and unique to bacterial and archaeal VapB antitoxins suggesting a general principle governing regulation of VapBC TA systems. Finally, a structure of C-terminally truncated VapB1 bound to VapC1 reveals discrete states of the TA interaction that suggest a structural basis for toxin activation in vivo. PMID:27998932

  14. A Survey of Repetitive Control for Nonlinear Systems

    NASA Astrophysics Data System (ADS)

    Quan, Quan; Cai, Kai-Yuan

    2010-10-01

    In aerospace engineering and industry, control tasks are often of a periodic nature, while repetitive control is especially suitable for tracking and rejection of periodic exogenous signals. Because of limited research effort on nonlinear systems, we give a survey of repetitive control for nonlinear systems in this paper. First, a brief introduction of repetitive control is presented. Then, after giving a brief overview of repetitive control for linear systems, this paper summarizes design methods and existing problems of repetitive control for nonlinear systems in detail. Lastly, relationships between repetitive control and other control schemes are analyzed to recognize repetitive control from different aspects more insightfully.

  15. Sequencing of long stretches of repetitive DNA

    PubMed Central

    De Bustos, Alfredo; Cuadrado, Angeles; Jouve, Nicolás

    2016-01-01

    Repetitive DNA is widespread in eukaryotic genomes, in some cases making up more than 80% of the total. SSRs are a type of repetitive DNA formed by short motifs repeated in tandem arrays. In some species, SSRs may be organized into long stretches, usually associated with the constitutive heterochromatin. Variation in repeats can alter the expression of genes, and changes in the number of repeats have been linked to certain human diseases. Unfortunately, the molecular characterization of these repeats has been hampered by technical limitations related to cloning and sequencing. Indeed, most sequenced genomes contain gaps owing to repetitive DNA-related assembly difficulties. This paper reports an alternative method for sequencing of long stretches of repetitive DNA based on the combined use of 1) a linear vector to stabilize the cloning process, and 2) the use of exonuclease III for obtaining progressive deletions of SSR-rich fragments. This strategy allowed the sequencing of a fragment containing a stretch of 6.2 kb of continuous SSRs. To demonstrate that this procedure can sequence other kinds of repetitive DNA, it was used to examine a 4.5 kb fragment containing a cluster of 15 repeats of the 5S rRNA gene of barley. PMID:27819354

  16. DNA polymerase-catalyzed elongation of repetitive hexanucleotide sequences: application to creation of repetitive DNA libraries.

    PubMed

    Kurihara, Hiroyuki; Nagamune, Teruyuki

    2004-01-01

    We demonstrate the elongation of various hexanucleotide sequences with thermophilic DNA polymerase, under isothermal or thermal cyclic reaction conditions. We prepared 10 types of double repeat hexanucleotide duplexes with various GC compositions containing between 0 and 6 GC nucleotides per repeat and incubated these duplexes with thermophilic Taq DNA polymerase and dNTPs at various temperatures. All of the model repetitive short duplexes were elongated under the isothermal incubation conditions, although there were some differences in the elongation efficiencies derived from the GC composition in the repetitive sequences. It was also found that all of the model repetitive duplexes were extended more effectively by a 3-step thermal cyclic reaction involving denaturation, annealing, and extension. On the basis of this technique, we prepared a glutamate-encoding short repetitive duplex and created long repetitive DNAs under isothermal and thermal cyclic reaction conditions. DNA sequencing analysis of the cloned repetitive DNA revealed that well-ordered long repetitive DNAs of various chain lengths were created by this DNA polymerase-catalyzed ligation method, and these were easily cloned into vectors by the TA-cloning method. This method could be useful for obtaining DNAs encoding arbitrary long repetitive amino acid sequences more effectively than the conventional T4 ligase-catalyzed ligation method.

  17. Repetition Priming and Repetition Suppression: A Case for Enhanced Efficiency Through Neural Synchronization

    PubMed Central

    Gotts, Stephen J.; Chow, Carson C.; Martin, Alex

    2012-01-01

    Stimulus repetition in identification tasks leads to improved behavioral performance ("repetition priming") but attenuated neural responses ("repetition suppression") throughout task-engaged cortical regions. While it's clear that this pervasive brain-behavior relationship reflects some form of improved processing efficiency, the exact form that it takes remains elusive. In this Discussion Paper, we review four different theoretical proposals that have the potential to link repetition suppression and priming, with a particular focus on a proposal that stimulus repetition affects improved efficiency through enhanced neural synchronization. We argue that despite exciting recent work on the role of neural synchronization in cognitive processes such as attention and perception, similar studies in the domain of learning and memory - and priming, in particular - have been lacking. We emphasize the need for new studies with adequate spatiotemporal resolution, formulate several novel predictions, and discuss our ongoing efforts to disentangle the current proposals. PMID:23144664

  18. Repetitive foreign body ingestion: ethical considerations.

    PubMed

    Lytle, Sarah; Stagno, Susan J; Daly, Barb

    2013-01-01

    The treatment of persons who frequently present to the healthcare system following repetitive foreign body ingestion has been addressed in the psychiatric literature. However, there has been little exploration of the ethical considerations regarding the treatment of these patients. The complexity of their medical and psychiatric presentation raises fundamental ethical questions regarding the duty to treat, patient autonomy, justice, and futility. Careful ethical analysis is particularly important in this context, since the frustration that medical professionals may feel in response may lead to false assumptions that can negatively impact patient care. A careful exploration of these questions can increase awareness and understanding, which in turn can lead to improved treatment of patients who repetitively ingest foreign bodies. Care for patients who inflict self-harm, particularly by repetitive foreign body ingestion, is not futile. The patients have a right to treatment and are entitled to resources. Efforts should be made to provide a more comprehensive treatment approach to these patients.

  19. Conservative treatment for repetitive strain injury.

    PubMed

    Konijnenberg, H S; de Wilde, N S; Gerritsen, A A; van Tulder, M W; de Vet, H C

    2001-10-01

    Various conservative treatment options for repetitive strain injury are widely used, despite questionable evidence of their effectiveness. This systematic review evaluates the effectiveness of these treatment options for relieving symptoms of repetitive strain injury and improving activities of daily living. Searches in Medline and Embase, with additional reference checking resulted in 15 eligible trials for this review. Methodological quality was assessed, and data-extraction was performed. With the use of a "best-evidence synthesis", no strong evidence was found for the effectiveness of any of the treatment options. There is limited evidence that multidisciplinary rehabilitation, ergonomic intervention measures, exercises, and spinal manipulation combined with soft tissue therapy are effective in providing symptom relief or improving activities of daily living. There is conflicting evidence for the effectiveness of behavioral therapy. In conclusion, little is known about the effectiveness of conservative treatment options for repetitive strain injury. To establish strong evidence, more high-quality trials are needed.

  20. Model for repetitive cycles of large earthquakes

    SciTech Connect

    Newman, W.I.; Knopoff, L.

    1983-04-01

    The theory of the fusion of small cracks into large ones reproduces certain features also observed in the clustering of earthquake sequences. By modifying our earlier model to take into account the stress release associated with the occurrence of large earthquakes, we obtain repetitive periodic cycles of large earthquakes. A preliminary conclusion is that a combination of the stress release or elastic rebound mechanism plus time delays in the fusion process are sufficient to destabilize the crack populations and, ultimately, give rise to repetitive episodes of seismicity.

  1. Association between periodontitis and the risk of palindromic rheumatism: A nationwide, population-based, case-control study.

    PubMed

    Lin, Ching-Heng; Chen, Der-Yuan; Chao, Wen-Cheng; Liao, Tsai-Ling; Chen, Yi-Ming; Chen, Hsin-Hua

    2017-01-01

    To estimate the association between a history of periodontitis (PD) and the risk of incident palindromic rheumatism (PR). Using a nationwide, administrative database, this study identified 4,421 newly-diagnosed PR cases from 2007 to 2012 and randomly selected 44,210 non-PR controls matched (1:10) for sex, age and the year of the index date. After adjusting for comorbid diabetes mellitus, we estimated the odds ratios (ORs) with 95% confidence intervals (CIs) using conditional logistic regression analysis to quantify the association between a history of PD and the risk of PR. The influences of the lag time and severity of PD were examined by calculating ORs for subgroups of patients based on the time interval between the last PD-related visit and the index date and PD-related cumulative cost and number of visit. This study showed an association between a history of PD and incident PR (OR, 1.51; 95% CI, 1.41-1.61). The association remained significant after variation of PD definitions. The magnitude of the association was greater in those with shorter lag time between the latest date of PD diagnosis and PR index date and those who had a higher number of visits for PD or a greater cumulative cost for PD-related visits. After excluding 569 PR patients who developed rheumatoid arthritis after the index date, we found a consistent time- and dose-dependent association between PD and PR risk. This study demonstrated a time- and dose-dependent association between PD exposure and PR risk.

  2. Association between periodontitis and the risk of palindromic rheumatism: A nationwide, population-based, case-control study

    PubMed Central

    Chao, Wen-Cheng; Liao, Tsai-Ling; Chen, Yi-Ming

    2017-01-01

    Objective To estimate the association between a history of periodontitis (PD) and the risk of incident palindromic rheumatism (PR). Methods Using a nationwide, administrative database, this study identified 4,421 newly-diagnosed PR cases from 2007 to 2012 and randomly selected 44,210 non-PR controls matched (1:10) for sex, age and the year of the index date. After adjusting for comorbid diabetes mellitus, we estimated the odds ratios (ORs) with 95% confidence intervals (CIs) using conditional logistic regression analysis to quantify the association between a history of PD and the risk of PR. The influences of the lag time and severity of PD were examined by calculating ORs for subgroups of patients based on the time interval between the last PD-related visit and the index date and PD-related cumulative cost and number of visit. Results This study showed an association between a history of PD and incident PR (OR, 1.51; 95% CI, 1.41–1.61). The association remained significant after variation of PD definitions. The magnitude of the association was greater in those with shorter lag time between the latest date of PD diagnosis and PR index date and those who had a higher number of visits for PD or a greater cumulative cost for PD-related visits. After excluding 569 PR patients who developed rheumatoid arthritis after the index date, we found a consistent time- and dose-dependent association between PD and PR risk. Conclusion This study demonstrated a time- and dose-dependent association between PD exposure and PR risk. PMID:28771535

  3. Short communication: Determination of Salmonella clustered regularly interspaced short palindromic repeats (CRISPR) diversity on dairy farms in Wisconsin and Minnesota.

    PubMed

    Wehnes, C A; Rehberger, T G; Barrangou, R; Smith, A H

    2014-10-01

    Salmonella enterica ssp. enterica is a foodborne pathogen able to cause disease in both humans and animals. Diverse serovars of this pathogen exist, some of which are host specific, causing a range of clinical symptoms from asymptomatic infection through morbidity and mortality. According to a 2007 survey by the USDA National Animal Health Monitoring System, fecal shedding of Salmonella from healthy cows occurs on 39.7% of dairy farms in the United States. Certain serovars are frequently isolated from dairy farms and the majority of isolates from the National Animal Health Monitoring System study were represented by 5 serovars; however, genotypic diversity was not examined. The objective of this study was to determine the diversity of clustered regularly interspaced short palindromic repeats (CRISPR) loci in Salmonella collected from 8 dairy farms with a previous history of salmonellosis. None of the cows or calves sampled on 2 of the 8 dairy farms were shedding Salmonella, although Salmonella was detected in a cow bedding sample on 1 of these farms. Salmonella populations were discrete on each farm, according to CRISPR typing, with the exception of an Anatum var. 15+ type on farms 5 and 6 and the Montevideo type on farms 1 and 2. One to 4 distinct CRISPR genotypes were identified per farm. The CRISPR typing differed within serovars, as Montevideo, Anatum var. 15+, and Muenster serovars had no overlap of spacer content, even on the same farm, reflecting between- and within-serovar genetic diversity. The dynamic nature of Salmonella populations was shown in a farm that was sampled longitudinally over 13.5 mo. Changes in serovar from 3,19:-:z27 to Montevideo was observed between the first sampling time and 8 mo later, with concomitant change in CRISPR alleles. The results indicate that Salmonella strains present in smaller dairy herds (<500 head) are specific to that farm and new Salmonella strains may emerge over time. Copyright © 2014 American Dairy Science

  4. Characterization of the clustered regularly interspaced short palindromic repeats sites in Streptococcus mutans isolated from early childhood caries patients.

    PubMed

    Chen, Jing; Li, Tiancheng; Zhou, Xuedong; Cheng, Lei; Huo, Yuanyuan; Zou, Jing; Li, Yuqing

    2017-11-01

    The aim of this study was to analyze the characteristics of the clustered regularly interspaced short palindromic repeats (CRISPR) sites in 45 clinical Streptococcus mutans strains and their relationship to the clinical manifestations of early childhood caries (ECC). Forty-five S. mutans strains were isolated from the plaque samples taken from sixty-three children. CRISPR sites were sequenced and BLAST was used to compare these sites to those in the CRISPRTarget database. The association between the distribution of CRISPR sites and the manifestation of caries was analyzed by Chi-Square test. Further, biofilm formation (by crystal violet staining) and the synthesis of polysaccharide (by anthrone-sulfuric method) of all clinical isolated S. mutans strains with both CRISPR sites and no CRISPR site were comapared. Finally, acidogenicity and acidurity of two typical strains were determined using pH drop and acid tolerance assays. Biofilm formation and EPS synthesis by two typical strains were compared by 3D CLSM (Confocal Laser Scanning Microscope) assays and the expression of gtf genes were evaluated using qPCR. We found that most of the spacers in the clinical S. mutans strains were derived from Streptococcus phages APCM01 and M102. The number of CRISPR sites in these strains was associated with the clinical manifestations of ECC. Moreover, we found that the biofilm formation and EPS synthesis ability of the S. mutans strains with both CRISPR sites was significant improved. An association was found between the distribution of CRISPR sites and the clinical manifestations of caries. The CRISPR sites might contribute to the cariogenic potential of S. mutans. Copyright © 2017 Elsevier Ltd. All rights reserved.

  5. Verbal Repetitions and Echolalia in Alzheimer's Discourse

    ERIC Educational Resources Information Center

    Da Cruz, Fernanda Miranda

    2010-01-01

    This article reports on an investigation of echolalic repetition in Alzheimer's disease (AD). A qualitative analysis of data from spontaneous conversations with MHI, a woman with AD, is presented. The data come from the DALI Corpus, a corpus of spontaneous conversations involving subjects with AD. This study argues that echolalic effects can be…

  6. Large-scale detection of repetitions.

    PubMed

    Smyth, W F

    2014-05-28

    Combinatorics on words began more than a century ago with a demonstration that an infinitely long string with no repetitions could be constructed on an alphabet of only three letters. Computing all the repetitions (such as ∙∙∙TTT ∙∙∙ or ∙∙∙ CGACGA ∙∙∙ ) in a given string x of length n is one of the oldest and most important problems of computational stringology, requiring time in the worst case. About a dozen years ago, it was discovered that repetitions can be computed as a by-product of the Θ(n)-time computation of all the maximal periodicities or runs in x. However, even though the computation is linear, it is also brute force: global data structures, such as the suffix array, the longest common prefix array and the Lempel-Ziv factorization, need to be computed in a preprocessing phase. Furthermore, all of this effort is required despite the fact that the expected number of runs in a string is generally a small fraction of the string length. In this paper, I explore the possibility that repetitions (perhaps also other regularities in strings) can be computed in a manner commensurate with the size of the output.

  7. Large-scale detection of repetitions

    PubMed Central

    Smyth, W. F.

    2014-01-01

    Combinatorics on words began more than a century ago with a demonstration that an infinitely long string with no repetitions could be constructed on an alphabet of only three letters. Computing all the repetitions (such as ⋯TTT⋯ or ⋯CGACGA⋯ ) in a given string x of length n is one of the oldest and most important problems of computational stringology, requiring time in the worst case. About a dozen years ago, it was discovered that repetitions can be computed as a by-product of the Θ(n)-time computation of all the maximal periodicities or runs in x. However, even though the computation is linear, it is also brute force: global data structures, such as the suffix array, the longest common prefix array and the Lempel–Ziv factorization, need to be computed in a preprocessing phase. Furthermore, all of this effort is required despite the fact that the expected number of runs in a string is generally a small fraction of the string length. In this paper, I explore the possibility that repetitions (perhaps also other regularities in strings) can be computed in a manner commensurate with the size of the output. PMID:24751872

  8. Sentence Repetition: What Does the Task Measure?

    ERIC Educational Resources Information Center

    Polišenská, Kamila; Chiat, Shula; Roy, Penny

    2015-01-01

    Background: Sentence repetition is gaining increasing attention as a source of information about children's sentence-level abilities in clinical assessment, and as a clinical marker of specific language impairment. However, it is widely debated what the task is testing and therefore how informative it is. Aims: (1) To evaluate the effects of…

  9. Using Repetition to Make Ideas Stick

    ERIC Educational Resources Information Center

    Lykins, Alicia N.

    2015-01-01

    In elementary school, the use of repetitive songs to help children remember concepts is commonplace and is usually very effective. Unfortunately for many students, this strategy is generally not used in later grades. A group of mathematics teachers at Westerville South High School in Westerville, Ohio, have taken this approach to a new creative…

  10. Sentence Repetition: What Does the Task Measure?

    ERIC Educational Resources Information Center

    Polišenská, Kamila; Chiat, Shula; Roy, Penny

    2015-01-01

    Background: Sentence repetition is gaining increasing attention as a source of information about children's sentence-level abilities in clinical assessment, and as a clinical marker of specific language impairment. However, it is widely debated what the task is testing and therefore how informative it is. Aims: (1) To evaluate the effects of…

  11. The Treatment Effect of Grade Repetitions

    ERIC Educational Resources Information Center

    Mahjoub, Mohamed-Badrane

    2017-01-01

    This paper estimates the treatment effect of grade repetitions in French junior high schools, using a value-added test score as outcome and quarter of birth as instrument. With linear two-stage least squares, local average treatment effect is estimated at around 1.6 times the standard deviation of the achievement gain. With non-linear…

  12. Verbal Repetitions and Echolalia in Alzheimer's Discourse

    ERIC Educational Resources Information Center

    Da Cruz, Fernanda Miranda

    2010-01-01

    This article reports on an investigation of echolalic repetition in Alzheimer's disease (AD). A qualitative analysis of data from spontaneous conversations with MHI, a woman with AD, is presented. The data come from the DALI Corpus, a corpus of spontaneous conversations involving subjects with AD. This study argues that echolalic effects can be…

  13. Bystanders' Reactions to Witnessing Repetitive Abuse Experiences

    ERIC Educational Resources Information Center

    Janson, Gregory R.; Carney, JoLynn V.; Hazler, Richard J.; Oh, Insoo

    2009-01-01

    The Impact of Event Scale-Revised (D. S. Weiss & C. R. Marmar, 1997) was used to obtain self-reported trauma levels from 587 young adults recalling childhood or adolescence experiences as witnesses to common forms of repetitive abuse defined as bullying. Mean participant scores were in a range suggesting potential need for clinical assessment…

  14. Social Interaction and Repetitive Motor Behaviors

    ERIC Educational Resources Information Center

    Loftin, Rachel L.; Odom, Samuel L.; Lantz, Johanna F.

    2008-01-01

    Students with autism have difficulty initiating social interactions and may exhibit repetitive motor behavior (e.g., body rocking, hand flapping). Increasing social interaction by teaching new skills may lead to reductions in problem behavior, such as motor stereotypies. Additionally, self-monitoring strategies can increase the maintenance of…

  15. Repetition Priming and Hyperpriming in Semantic Dementia

    ERIC Educational Resources Information Center

    Cumming, T. B.; Graham, K. S.; Patterson, K.

    2006-01-01

    Evidence from neurologically normal subjects suggests that repetition priming (RP) is independent of semantic processing. Therefore, we may expect patients with a selective deficit to conceptual knowledge to exhibit RP for words regardless of the integrity of their semantic representations. We tested six patients with semantic dementia (SD) on a…

  16. Repetition effects in human ERPs to faces.

    PubMed

    Schweinberger, Stefan R; Neumann, Markus F

    2016-07-01

    In the present paper, we review research conducted over the past 25 years addressing the effects of repeating various kinds of information in faces (e.g., pictorial, spatial configural, identity, semantic) on different components in human event-related brain potentials (ERPs). This body of evidence suggests that several ERP components are systematically linked to different functional components of face identity processing. Specifically, we argue (1) that repetition of the category of faces (categorical adaptation) strongly affects the occipitotemporal N170 amplitude, which is systematically suppressed when a face is preceded by another face, irrespective of its identity, whereas (2) the prototypicality of a face's second order spatial configuration has a prominent effect on the subsequent occipitotemporal P200. Longer-latency repetition effects are related to the processing of individual facial identities. These include (3) an ERP correlate of the transient activation of individual representations of repeated faces in the form of an enhanced occipitotemporal N250r as seen in repetition priming experiments, and (4) a correlate of the acquisition of individual face identity representations during learning as seen in a topographically similar long-lasting N250 effect. Finally, (5) the repetition of semantic information in familiar person recognition elicits a central-parietal N400 ERP effect. We hope that this overview will encourage researchers to further exploit the potential of ERPs to provide a continuous time window to neuronal correlates of multiple processes in face perception under comparatively natural viewing conditions.

  17. EFFECTIVENESS OF INCREASED REPETITION IN CLASSROOM LEARNING.

    DTIC Science & Technology

    Mechanic Course at Fort Jackson. Achievement was measured with multiple choice test items given in regular course examinations two days and 24 days...instructed by the experimental method made passing scores on the test items at both testing times. It is recommended that repetition of major points be increased in classroom instruction. (Author)

  18. Temporal Processing Capabilities in Repetition Conduction Aphasia

    ERIC Educational Resources Information Center

    Sidiropoulos, Kyriakos; Ackermann, Hermann; Wannke, Michael; Hertrich, Ingo

    2010-01-01

    This study investigates the temporal resolution capacities of the central-auditory system in a subject (NP) suffering from repetition conduction aphasia. More specifically, the patient was asked to detect brief gaps between two stretches of broadband noise (gap detection task) and to evaluate the duration of two biphasic (WN-3) continuous noise…

  19. The Value of Repetition in Articulation Learning

    ERIC Educational Resources Information Center

    Locke, John L.

    1970-01-01

    Exact analysis of an experiment involving children from the ages of 4 to 12 learning three new articulations revealed that most of the articulation learning took place on the second attempt with relatively moderate improvement in subsequent trials, thus placing the value of repetition in articulation learning in question. (FB)

  20. Reducing Repetitive Speech: Effects of Strategy Instruction.

    ERIC Educational Resources Information Center

    Dipipi, Caroline M.; Jitendra, Asha K.; Miller, Judith A.

    2001-01-01

    This article describes an intervention with an 18-year-old young woman with mild mental retardation and a seizure disorder, which focused on her repetitive echolalic verbalizations. The intervention included time delay, differential reinforcement of other behaviors, and self-monitoring. Overall, the intervention was successful in facilitating…

  1. Using Repetition to Make Ideas Stick

    ERIC Educational Resources Information Center

    Lykins, Alicia N.

    2015-01-01

    In elementary school, the use of repetitive songs to help children remember concepts is commonplace and is usually very effective. Unfortunately for many students, this strategy is generally not used in later grades. A group of mathematics teachers at Westerville South High School in Westerville, Ohio, have taken this approach to a new creative…

  2. FRB repetition and non-Poissonian statistics

    NASA Astrophysics Data System (ADS)

    Connor, Liam; Pen, Ue-Li; Oppermann, Niels

    2016-05-01

    We discuss some of the claims that have been made regarding the statistics of fast radio bursts (FRBs). In an earlier Letter, we conjectured that flicker noise associated with FRB repetition could show up in non-cataclysmic neutron star emission models, like supergiant pulses. We show how the current limits of repetition would be significantly weakened if their repeat rate really were non-Poissonian and had a pink or red spectrum. Repetition and its statistics have implications for observing strategy, generally favouring shallow wide-field surveys, since in the non-repeating scenario survey depth is unimportant. We also discuss the statistics of the apparent latitudinal dependence of FRBs, and offer a simple method for calculating the significance of this effect. We provide a generalized Bayesian framework for addressing this problem, which allows for direct model comparison. It is shown how the evidence for a steep latitudinal gradient of the FRB rate is less strong than initially suggested and simple explanations like increased scattering and sky temperature in the plane are sufficient to decrease the low-latitude burst rate, given current data. The reported dearth of bursts near the plane is further complicated if FRBs have non-Poissonian repetition, since in that case the event rate inferred from observation depends on observing strategy.

  3. Effect of Repetitive Film Showings on Learning.

    ERIC Educational Resources Information Center

    Mc Tavish, C. L.

    In a study made in 1949 to determine the increment in learning that could be attributed to repetition, four general science films were shown to each of four groups of college students in such a way that each group saw one of the films once, a second film twice, a third film three times, and a fourth film four times. The experimental population…

  4. EFFECT OF REPETITIVE FILM SHOWINGS ON LEARNING.

    ERIC Educational Resources Information Center

    MCTAVISH, C.L.; AND OTHERS

    A DETERMINATION OF THE INCREMENT IN LEARNING ATTRIBUTABLE SOLELY TO ONE, TWO, AND THREE REPETITIONS OF A FILM OVER AND ABOVE A SINGLE SHOWING WAS INVESTIGATED. THE SUBJECTS WERE 319 COLLEGE FRESHMEN WHO WERE DIVIDED INTO FOUR GROUPS AND WHO WERE SHOWN FOUR GENERAL SCIENCE FILMS. EACH GROUP SAW ONE OF THE FILMS ONCE, A SECOND FILM TWICE, A THIRD…

  5. Pressure wave charged repetitively pulsed gas laser

    DOEpatents

    Kulkarny, Vijay A.

    1982-01-01

    A repetitively pulsed gas laser in which a system of mechanical shutters bracketing the laser cavity manipulate pressure waves resulting from residual energy in the cavity gas following a lasing event so as to draw fresh gas into the cavity and effectively pump spent gas in a dynamic closed loop.

  6. Nonword Repetition and Vocabulary Use in Toddlers

    ERIC Educational Resources Information Center

    Stokes, Stephanie F.; Moran, Catherine; George, Anjali

    2013-01-01

    Purpose: There is general consensus that the ability to repeat nonsense words is related to vocabulary size in young children, but there is considerable debate about the nature of the relationship and the mechanisms that underlie it. Research with adults has proposed a shared neural substrate for nonword repetition (NWR) and language production,…

  7. Temporal Processing Capabilities in Repetition Conduction Aphasia

    ERIC Educational Resources Information Center

    Sidiropoulos, Kyriakos; Ackermann, Hermann; Wannke, Michael; Hertrich, Ingo

    2010-01-01

    This study investigates the temporal resolution capacities of the central-auditory system in a subject (NP) suffering from repetition conduction aphasia. More specifically, the patient was asked to detect brief gaps between two stretches of broadband noise (gap detection task) and to evaluate the duration of two biphasic (WN-3) continuous noise…

  8. [Repetitive strain injuries. Forearm pain caused by tissue responses to repetitive strain].

    PubMed

    Sorgatz, H

    2002-10-01

    According to the National Research Council, painful work-related upper limb disorders are caused by different pathophysiological mechanisms, one of which is repetitive strain injury (RSI). Forearm pain, tenderness, and paresthesias are thought to result from a continual risk of exceeding limits of "cumulative trauma load tolerance" (CTLT, cf. NRC 2001) in soft tissue by thousands of high-frequency, repetitive movements. On the other hand, repetitive painful stimulations also produce neuroplastic changes in the spinal and supraspinal nociceptive systems. Thus, repetitive motor and nociceptive impulses become part of the same motor programs, which are also responsible for high-frequency movements and tissue damage. In this way RSI pain may be felt as a task-related response, even after all injuries are completely healed. Consequences of this neuroplastic CTLT model for RSI prevention and therapy are discussed.

  9. A Nonword Repetition Task for Speakers with Misarticulations: The Syllable Repetition Task (SRT)

    PubMed Central

    Shriberg, Lawrence D.; Lohmeier, Heather L.; Campbell, Thomas F.; Dollaghan, Christine A.; Green, Jordan R.; Moore, Christopher A.

    2010-01-01

    Purpose Conceptual and methodological confounds occur when non(sense) repetition tasks are administered to speakers who do not have the target speech sounds in their phonetic inventories or who habitually misarticulate targeted speech sounds. We describe a nonword repetition task, the Syllable Repetiton Task (SRT) that eliminates this confound and report findings from three validity studies. Method Ninety-five preschool children with Speech Delay and 63 with Typical Speech, completed an assessment battery that included the Nonword Repetition Task (NRT: Dollaghan & Campbell, 1998) and the SRT. SRT stimuli include only four of the earliest occurring consonants and one early occurring vowel. Results Study 1 findings indicated that the SRT eliminated the speech confound in nonword testing with speakers who misarticulate. Study 2 findings indicated that the accuracy of the SRT to identify expressive language impairment was comparable to findings for the NRT. Study 3 findings illustrated the SRT’s potential to interrogate speech processing constraints underlying poor nonword repetition accuracy. Results supported both memorial and auditory-perceptual encoding constraints underlying nonword repetition errors in children with speech-language impairment. Conclusion The SRT appears to be a psychometrically stable and substantively informative nonword repetition task for emerging genetic and other research with speakers who misarticulate. PMID:19635944

  10. A role for palindromic structures in the cis-region of maize Sirevirus LTRs in transposable element evolution and host epigenetic response

    PubMed Central

    Bousios, Alexandros; Diez, Concepcion M.; Takuno, Shohei; Bystry, Vojtech; Darzentas, Nikos; Gaut, Brandon S.

    2016-01-01

    Transposable elements (TEs) proliferate within the genome of their host, which responds by silencing them epigenetically. Much is known about the mechanisms of silencing in plants, particularly the role of siRNAs in guiding DNA methylation. In contrast, little is known about siRNA targeting patterns along the length of TEs, yet this information may provide crucial insights into the dynamics between hosts and TEs. By focusing on 6456 carefully annotated, full-length Sirevirus LTR retrotransposons in maize, we show that their silencing associates with underlying characteristics of the TE sequence and also uncover three features of the host–TE interaction. First, siRNA mapping varies among families and among elements, but particularly along the length of elements. Within the cis-regulatory portion of the LTRs, a complex palindrome-rich region acts as a hotspot of both siRNA matching and sequence evolution. These patterns are consistent across leaf, tassel, and immature ear libraries, but particularly emphasized for floral tissues and 21- to 22-nt siRNAs. Second, this region has the ability to form hairpins, making it a potential template for the production of miRNA-like, hairpin-derived small RNAs. Third, Sireviruses are targeted by siRNAs as a decreasing function of their age, but the oldest elements remain highly targeted, partially by siRNAs that cross-map to the youngest elements. We show that the targeting of older Sireviruses reflects their conserved palindromes. Altogether, we hypothesize that the palindromes aid the silencing of active elements and influence transposition potential, siRNA targeting levels, and ultimately the fate of an element within the genome. PMID:26631490

  11. X-linked congenital hypertrichosis syndrome is associated with interchromosomal insertions mediated by a human-specific palindrome near SOX3.

    PubMed

    Zhu, Hongwen; Shang, Dandan; Sun, Miao; Choi, Sunju; Liu, Qing; Hao, Jiajie; Figuera, Luis E; Zhang, Feng; Choy, Kwong Wai; Ao, Yang; Liu, Yang; Zhang, Xiao-Lin; Yue, Fengzhen; Wang, Ming-Rong; Jin, Li; Patel, Pragna I; Jing, Tao; Zhang, Xue

    2011-06-10

    X-linked congenital generalized hypertrichosis (CGH), an extremely rare condition characterized by universal overgrowth of terminal hair, was first mapped to chromosome Xq24-q27.1 in a Mexican family. However, the underlying genetic defect remains unknown. We ascertained a large Chinese family with an X-linked congenital hypertrichosis syndrome combining CGH, scoliosis, and spina bifida and mapped the disease locus to a 5.6 Mb critical region within the interval defined by the previously reported Mexican family. Through the combination of a high-resolution copy-number variation (CNV) scan and targeted genomic sequencing, we identified an interchromosomal insertion at Xq27.1 of a 125,577 bp intragenic fragment of COL23A1 on 5q35.3, with one X breakpoint within and the other very close to a human-specific short palindromic sequence located 82 kb downstream of SOX3. In the Mexican family, we found an interchromosomal insertion at the same Xq27.1 site of a 300,036 bp genomic fragment on 4q31.2, encompassing PRMT10 and TMEM184C and involving parts of ARHGAP10 and EDNRA. Notably, both of the two X breakpoints were within the short palindrome. The two palindrome-mediated insertions fully segregate with the CGH phenotype in each of the families, and the CNV gains of the respective autosomal genomic segments are not present in the public database and were not found in 1274 control individuals. Analysis of control individuals revealed deletions ranging from 173 bp to 9104 bp at the site of the insertions with no phenotypic consequence. Taken together, our results strongly support the pathogenicity of the identified insertions and establish X-linked congenital hypertrichosis syndrome as a genomic disorder.

  12. Toxin inhibition in C. crescentus VapBC1 is mediated by a flexible pseudo-palindromic protein motif and modulated by DNA binding.

    PubMed

    Bendtsen, Kirstine L; Xu, Kehan; Luckmann, Majbritt; Winther, Kristoffer S; Shah, Shiraz A; Pedersen, Christian N S; Brodersen, Ditlev E

    2017-03-17

    Expression of bacterial type II toxin-antitoxin (TA) systems is regulated at the transcriptional level through direct binding of the antitoxin to pseudo-palindromic sequences on operator DNA. In this context, the toxin functions as a co-repressor by stimulating DNA binding through direct interaction with the antitoxin. Here, we determine crystal structures of the complete 90 kDa heterooctameric VapBC1 complex from Caulobacter crescentus CB15 both in isolation and bound to its cognate DNA operator sequence at 1.6 and 2.7 Å resolution, respectively. DNA binding is associated with a dramatic architectural rearrangement of conserved TA interactions in which C-terminal extended structures of the antitoxin VapB1 swap positions to interlock the complex in the DNA-bound state. We further show that a pseudo-palindromic protein sequence in the antitoxin is responsible for this interaction and required for binding and inactivation of the VapC1 toxin dimer. Sequence analysis of 4127 orthologous VapB sequences reveals that such palindromic protein sequences are widespread and unique to bacterial and archaeal VapB antitoxins suggesting a general principle governing regulation of VapBC TA systems. Finally, a structure of C-terminally truncated VapB1 bound to VapC1 reveals discrete states of the TA interaction that suggest a structural basis for toxin activation in vivo. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  13. Gene targeting technologies in rats: zinc finger nucleases, transcription activator-like effector nucleases, and clustered regularly interspaced short palindromic repeats.

    PubMed

    Mashimo, Tomoji

    2014-01-01

    The laboratory rat has been widely used as an animal model in biomedical science for more than 150 years. Applying zinc-finger nucleases or transcription activator-like effector nucleases to rat embryos via microinjection is an efficient genome editing tool for generating targeted knockout rats. Recently, clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated endonucleases have been used as an effective tool for precise and multiplex genome editing in mice and rats. In this review, the advantages and disadvantages of these site-specific nuclease technologies for genetic analysis and manipulation in rats are discussed. © 2013 The Author Development, Growth & Differentiation © 2013 Japanese Society of Developmental Biologists.

  14. Verbal repetitions and echolalia in Alzheimer's discourse.

    PubMed

    Da Cruz, Fernanda Miranda

    2010-11-01

    This article reports on an investigation of echolalic repetition in Alzheimer's disease (AD). A qualitative analysis of data from spontaneous conversations with MHI, a woman with AD, is presented. The data come from the DALI Corpus, a corpus of spontaneous conversations involving subjects with AD. This study argues that echolalic effects can be explained through an analysis of their formal linguistic aspects, such as intonational-prosodic and enunciative-syntactic features. The analysis shows that the description of echolalic repetitions in these terms can help find parameters for the description of the linguistic and communicative characteristics of AD. This analysis even shows how a previous speech turn serves as a base for the elaboration of the next turn by the participant with AD. It also contributes to the understanding of echolalic productions in AD.

  15. Repetition probability effects depend on prior experiences.

    PubMed

    Grotheer, Mareike; Kovács, Gyula

    2014-05-07

    The magnitude of repetition suppression (RS) in the Fusiform Face Area is influenced by the probability of repetitions of faces (Summerfield et al., 2008), implying that perceptual expectations affect repetition-related processes. Surprisingly, however, macaque single-cell (Kaliukhovich and Vogels, 2011) and human fMRI (Kovács et al., 2013) studies have failed to find repetition probability [P(rep)] modulations of RS with nonface stimuli in the occipitotemporal cortex, suggesting that the effect is face specific. One possible explanation of this category selectivity is that the extensive experience humans have with faces affects the neural mechanisms of RS specifically, creating P(rep) modulatory effects. To address this question, we used fMRI to test the P(rep) effects for another well trained stimulus category, upright letters of the roman alphabet as well as for unfamiliar false fonts. We observed significant RS for both stimulus sets in the Letter Form Area as well as in the caudodorsal part of the lateral occipital complex. Interestingly, the influence of P(rep) on RS was dependent on the stimulus: while we observed P(rep) modulations for the roman letters, no such effects were found for the unfamiliar false fonts in either area. Our findings suggest that P(rep) effects on RS are manifest for nonface stimuli as well, but that they depend on the experience of the subjects with the stimulus category. This shows, for the first time, that prior experience affects the influence of contextual predictive information on RS in the human occipitotemporal cortex.

  16. Repetition Blindness: An Emergent Property of Inter-Item Competition

    ERIC Educational Resources Information Center

    Morris, Alison L.; Still, Mary L.; Caldwell-Harris, Catherine L.

    2009-01-01

    Repeating an item in a brief or rapid display usually produces faster or more accurate identification of the item (repetition priming), but sometimes produces the opposite effect (repetition blindness). We present a theory of short-term repetition effects, the "competition hypothesis," which explains these paradoxical outcomes. The central tenet…

  17. Lingual Kinematics during Rapid Syllable Repetition in Parkinson's Disease

    ERIC Educational Resources Information Center

    Wong, Min Ney; Murdoch, Bruce E.; Whelan, Brooke-Mai

    2012-01-01

    Background: Rapid syllable repetition tasks are commonly used in the assessment of motor speech disorders. However, little is known about the articulatory kinematics during rapid syllable repetition in individuals with Parkinson's disease (PD). Aims: To investigate and compare lingual kinematics during rapid syllable repetition in dysarthric…

  18. Grade Repetition and Primary School Dropout in Uganda

    ERIC Educational Resources Information Center

    Kabay, Sarah

    2016-01-01

    Research on education in low-income countries rarely focuses on grade repetition. When addressed, repetition is typically presented along with early school dropout as the "wasting" of educational resources. Simplifying grade repetition in this way often fails to recognize significant methodological concerns and also overlooks the unique…

  19. Grade Repetition and Primary School Dropout in Uganda

    ERIC Educational Resources Information Center

    Kabay, Sarah

    2016-01-01

    Research on education in low-income countries rarely focuses on grade repetition. When addressed, repetition is typically presented along with early school dropout as the "wasting" of educational resources. Simplifying grade repetition in this way often fails to recognize significant methodological concerns and also overlooks the unique…

  20. Lingual Kinematics during Rapid Syllable Repetition in Parkinson's Disease

    ERIC Educational Resources Information Center

    Wong, Min Ney; Murdoch, Bruce E.; Whelan, Brooke-Mai

    2012-01-01

    Background: Rapid syllable repetition tasks are commonly used in the assessment of motor speech disorders. However, little is known about the articulatory kinematics during rapid syllable repetition in individuals with Parkinson's disease (PD). Aims: To investigate and compare lingual kinematics during rapid syllable repetition in dysarthric…

  1. Naming and Repetition in Aphasia: Steps, Routes, and Frequency Effects

    ERIC Educational Resources Information Center

    Nozari, Nazbanou; Kittredge, Audrey K.; Dell, Gary S.; Schwartz, Myrna F.

    2010-01-01

    This paper investigates the cognitive processes underlying picture naming and auditory word repetition. In the two-step model of lexical access, both the semantic and phonological steps are involved in naming, but the former has no role in repetition. Assuming recognition of the to-be-repeated word, repetition could consist of retrieving the…

  2. Neural Correlates of Restricted, Repetitive Behaviors in Autism Spectrum Disorders

    DTIC Science & Technology

    2012-10-01

    Repetitive Behaviors in Autism Spectrum Disorders PRINCIPAL INVESTIGATOR: Dara Manoach CONTRACTING ORGANIZATION: Massachusetts...Annual 3. DATES COVERED 06September2011–05September2012 4. TITLE AND SUBTITLE Neural Correlates of Restricted , Repetitive Behaviors in Autism ...complete, we will test the hypothesis that restrictive , repetitive behaviors (RRBs) are associated with specific reductions in brain

  3. Repetitive Behaviours in Typically Developing 2-Year-Olds

    ERIC Educational Resources Information Center

    Leekam, Susan; Tandos, Jonathan; McConachie, Helen; Meins, Elizabeth; Parkinson, Kathryn; Wright, Charlotte; Turner, Michelle; Arnott, Bronia; Vittorini, Lucia; Le Couteur, Ann

    2007-01-01

    Background: Repetitive behaviours are an essential part of the diagnosis of autism but are also commonly seen in typically developing children. The current study investigated the frequency and factor structure of repetitive behaviours in a large community sample of 2-year-olds. Methods: A new measure, the Repetitive Behaviour Questionnaire (RBQ-2)…

  4. Phosphor thermometry at high repetition rates

    NASA Astrophysics Data System (ADS)

    Fuhrmann, N.; Brübach, J.; Dreizler, A.

    2013-09-01

    Phosphor thermometry is a semi-invasive surface temperature measurement technique utilizing the luminescence properties of thermographic phosphors. Typically these ceramic materials are coated onto the object of interest and are excited by a short UV laser pulse. Photomultipliers and high-speed camera systems are used to transiently detect the subsequently emitted luminescence decay point wise or two-dimensionally resolved. Based on appropriate calibration measurements, the luminescence lifetime is converted to temperature. Up to now, primarily Q-switched laser systems with repetition rates of 10 Hz were employed for excitation. Accordingly, this diagnostic tool was not applicable to resolve correlated temperature transients at time scales shorter than 100 ms. For the first time, the authors realized a high-speed phosphor thermometry system combining a highly repetitive laser in the kHz regime and a fast decaying phosphor. A suitable material was characterized regarding its temperature lifetime characteristic and precision. Additionally, the influence of laser power on the phosphor coating in terms of heating effects has been investigated. A demonstration of this high-speed technique has been conducted inside the thermally highly transient system of an optically accessible internal combustion engine. Temperatures have been measured with a repetition rate of one sample per crank angle degree at an engine speed of 1000 rpm. This experiment has proven that high-speed phosphor thermometry is a promising diagnostic tool for the resolution of surface temperature transients.

  5. Repetitive element hypermethylation in multiple sclerosis patients.

    PubMed

    Neven, K Y; Piola, M; Angelici, L; Cortini, F; Fenoglio, C; Galimberti, D; Pesatori, A C; Scarpini, E; Bollati, V

    2016-06-18

    Multiple sclerosis (MS) is a complex disorder of the central nervous system whose cause is currently unknown. Evidence is increasing that DNA methylation alterations could be involved in inflammatory and neurodegenerative diseases and could contribute to MS pathogenesis. Repetitive elements Alu, LINE-1 and SAT-α, are widely known as estimators of global DNA methylation. We investigated Alu, LINE-1 and SAT-α methylation levels to evaluate their difference in a case-control setup and their role as a marker of disability. We obtained blood samples from 51 MS patients and 137 healthy volunteers matched by gender, age and smoking. Methylation was assessed using bisulfite-PCR-pyrosequencing. For all participants, medical history, physical and neurological examinations and screening laboratory tests were collected. All repetitive elements were hypermethylated in MS patients compared to healthy controls. A lower Expanded Disability Status Scale (EDSS) score was associated with a lower levels of LINE-1 methylation for 'EDSS = 1.0' and '1.5 ≤ EDSS ≤ 2.5' compared to an EDSS higher than 3, while Alu was associated with a higher level of methylation in these groups: 'EDSS = 1.0' and '1.5 ≤ EDSS ≤ 2.5'. MS patients exhibit an hypermethylation in repetitive elements compared to healthy controls. Alu and LINE-1 were associated with degree of EDSS score. Forthcoming studies focusing on epigenetics and the multifactorial pathogenetic mechanism of MS could elucidate these links further.

  6. Abnormal repetitive behaviours: shared phenomenology and pathophysiology.

    PubMed

    Muehlmann, A M; Lewis, M H

    2012-05-01

    Self-injurious behaviour (SIB) is a devastating problem observed in individuals with various neurodevelopmental disorders, including specific genetic syndromes as well as idiopathic intellectual and developmental disability. Although an increased prevalence of SIB has been documented in specific genetic mutations, little is known about the neurobiological basis of SIB. This makes vulnerability assessment and pharmacological treatment incredibly challenging. Here we review evidence that SIB and other repetitive, invariant behaviours, such as stereotypy, compulsions and tics, share many phenotypic similarities, are often co-morbidly expressed and have common inducing conditions. This argues for shared or overlapping pathophysiology. As much more is known about the neurobiology of these related disorders, this should make the neurobiology of SIB a more tractable problem. Stereotypy, compulsions and tics are diagnostic for disorders that have received focused neurobiological investigation (autism, obsessive compulsive disorder, Tourette syndrome, respectively). In addition, animal models of these repetitive behaviours have been well characterised. Collectively, these studies have found that cortical basal ganglia circuitry dysfunction mediates repetitive behaviour. Moreover, these studies provide more detailed information and potentially testable hypotheses about specific aspects of the circuitry that may be operative in SIB. We can use available information from clinical and animal models to make more precise hypotheses regarding the particular pathophysiology driving SIB. The results of testing such hypotheses should generate pharmacological strategies that may prove efficacious in reducing SIB. © 2012 The Authors. Journal of Intellectual Disability Research © 2012 Blackwell Publishing Ltd.

  7. Modeling repetitive motions using structured light.

    PubMed

    Xu, Yi; Aliaga, Daniel G

    2010-01-01

    Obtaining models of dynamic 3D objects is an important part of content generation for computer graphics. Numerous methods have been extended from static scenarios to model dynamic scenes. If the states or poses of the dynamic object repeat often during a sequence (but not necessarily periodically), we call such a repetitive motion. There are many objects, such as toys, machines, and humans, undergoing repetitive motions. Our key observation is that when a motion-state repeats, we can sample the scene under the same motion state again but using a different set of parameters; thus, providing more information of each motion state. This enables robustly acquiring dense 3D information difficult for objects with repetitive motions using only simple hardware. After the motion sequence, we group temporally disjoint observations of the same motion state together and produce a smooth space-time reconstruction of the scene. Effectively, the dynamic scene modeling problem is converted to a series of static scene reconstructions, which are easier to tackle. The varying sampling parameters can be, for example, structured-light patterns, illumination directions, and viewpoints resulting in different modeling techniques. Based on this observation, we present an image-based motion-state framework and demonstrate our paradigm using either a synchronized or an unsynchronized structured-light acquisition method.

  8. A PCR technique based on the Hip1 interspersed repetitive sequence distinguishes cyanobacterial species and strains.

    PubMed

    Smith, J K; Parry, J D; Day, J G; Smith, R J

    1998-10-01

    The use of primers based on the Hip1 sequence as a typing technique for cyanobacteria has been investigated. The discovery of short repetitive sequence structures in bacterial DNA during the last decade has led to the development of PCR-based methods for typing, i.e., distinguishing and identifying, bacterial species and strains. An octameric palindromic sequence known as Hip1 has been shown to be present in the chromosomal DNA of many species of cyanobacteria as a highly repetitious interspersed sequence. PCR primers were constructed that extended the Hip1 sequence at the 3' end by two bases. Five of the 16 possible extended primers were tested. Each of the five primers produced a different set of products when used to prime PCR from cyanobacterial genomic DNA. Each primer produced a distinct set of products for each of the 15 cyanobacterial species tested. The ability of Hip1-based PCR to resolve taxonomic differences was assessed by analysis of independent isolates of Anabaena flos-aquae and Nostoc ellipsosporum obtained from the CCAP (Culture Collection of Algae and Protozoa, IFE, Cumbria, UK). A PCR-based RFLP analysis of products amplified from the 23S-16S rDNA intergenic region was used to characterize the isolates and to compare with the Hip1 typing data. The RFLP and Hip1 typing yielded similar results and both techniques were able to distinguish different strains. On the basis of these results it is suggested that the Hip1 PCR technique may assist in distinguishing cyanobacterial species and strains.

  9. Experimental models of repetitive brain injuries.

    PubMed

    Weber, John T

    2007-01-01

    Repetitive traumatic brain injury (TBI) occurs in a significant portion of trauma patients, especially in specific populations, such as child abuse victims or athletes involved in contact sports (e.g. boxing, football, hockey, and soccer). A continually emerging hypothesis is that repeated mild injuries may cause cumulative damage to the brain, resulting in long-term cognitive dysfunction. The growing attention to this hypothesis is reflected in several recent experimental studies of repeated mild TBI in vivo. These reports generally demonstrate cellular and cognitive dysfunction after repetitive injury using rodent TBI models. In some cases, data suggests that the effects of a second mild TBI may be synergistic, rather than additive. In addition, some studies have found increases in cellular markers associated with Alzheimer's disease after repeated mild injuries, which demonstrates a direct experimental link between repetitive TBI and neurodegenerative disease. To complement the findings from humans and in vivo experimentation, my laboratory group has investigated the effects of repeated trauma in cultured brain cells using a model of stretch-induced mechanical injury in vitro. In these studies, hippocampal cells exhibited cumulative damage when mild stretch injuries were repeated at either 1-h or 24-h intervals. Interestingly, the extent of damage to the cells was dependent on the time between repeated injuries. Also, a very low level of stretch, which produced no cell damage on its own, induced cell damage when it was repeated several times at a short interval (every 2 min). Although direct comparisons to the clinical situation are difficult, these types of repetitive, low-level, mechanical stresses may be similar to the insults received by certain athletes, such as boxers, or hockey and soccer players. This type of in vitro model could provide a reliable system in which to study the mechanisms underlying cellular dysfunction following repeated injuries. As

  10. The Adult Repetitive Behaviours Questionnaire-2 (RBQ-2A): A Self-Report Measure of Restricted and Repetitive Behaviours

    ERIC Educational Resources Information Center

    Barrett, Sarah L.; Uljarevic, Mirko; Baker, Emma K.; Richdale, Amanda L.; Jones, Catherine R. G.; Leekam, Susan R.

    2015-01-01

    In two studies we developed and tested a new self-report measure of restricted and repetitive behaviours (RRB) suitable for adults. In Study 1, The Repetitive Behaviours Questionnaire-2 for adults (RBQ-2A) was completed by a sample of 163 neurotypical adults. Principal components analysis revealed two components: Repetitive Motor Behaviours and…

  11. The Adult Repetitive Behaviours Questionnaire-2 (RBQ-2A): A Self-Report Measure of Restricted and Repetitive Behaviours

    ERIC Educational Resources Information Center

    Barrett, Sarah L.; Uljarevic, Mirko; Baker, Emma K.; Richdale, Amanda L.; Jones, Catherine R. G.; Leekam, Susan R.

    2015-01-01

    In two studies we developed and tested a new self-report measure of restricted and repetitive behaviours (RRB) suitable for adults. In Study 1, The Repetitive Behaviours Questionnaire-2 for adults (RBQ-2A) was completed by a sample of 163 neurotypical adults. Principal components analysis revealed two components: Repetitive Motor Behaviours and…

  12. fMRI repetition suppression: neuronal adaptation or stimulus expectation?

    PubMed

    Larsson, Jonas; Smith, Andrew T

    2012-03-01

    Measurements of repetition suppression with functional magnetic resonance imaging (fMRI adaptation) have been used widely to probe neuronal population response properties in human cerebral cortex. fMRI adaptation techniques assume that fMRI repetition suppression reflects neuronal adaptation, an assumption that has been challenged on the basis of evidence that repetition-related response changes may reflect unrelated factors, such as attention and stimulus expectation. Specifically, Summerfield et al. (Summerfield C, Trittschuh EH, Monti JM, Mesulam MM, Egner T. 2008. Neural repetition suppression reflects fulfilled perceptual expectations. Nat Neurosci. 11:1004-1006) reported that the relative frequency of stimulus repetitions and non-repetitions influenced the magnitude of repetition suppression in the fusiform face area, suggesting that stimulus expectation accounted for most of the effect of repetition. We confirm that stimulus expectation can significantly influence fMRI repetition suppression throughout visual cortex and show that it occurs with long as well as short adaptation durations. However, the effect was attention dependent: When attention was diverted away from the stimuli, the effects of stimulus expectation completely disappeared. Nonetheless, robust and significant repetition suppression was still evident. These results suggest that fMRI repetition suppression reflects a combination of neuronal adaptation and attention-dependent expectation effects that can be experimentally dissociated. This implies that with an appropriate experimental design, fMRI adaptation can provide valid measures of neuronal adaptation and hence response specificity.

  13. Imbalance between abstract and concrete repetitive thinking modes in schizophrenia.

    PubMed

    Maurage, Pierre; Philippot, Pierre; Grynberg, Delphine; Leleux, Dominique; Delatte, Benoît; Mangelinckx, Camille; Belge, Jan-Baptist; Constant, Eric

    2017-10-01

    Repetitive thoughts can be divided in two modes: abstract/analytic (decontextualized and dysfunctional) and concrete/experiential (problem-focused and adaptive). They constitute a transdiagnostic process involved in many psychopathological states but have received little attention in schizophrenia, as earlier studies only indexed increased ruminations (related to dysfunctional repetitive thoughts) without jointly exploring both modes. This study explored the two repetitive thinking modes, beyond ruminations, to determine their imbalance in schizophrenia. Thirty stabilized patients with schizophrenia and 30 matched controls completed the Repetitive Response Scale and the Mini Cambridge-Exeter Repetitive Thought Scale, both measuring repetitive thinking modes. Complementary measures related to schizophrenic symptomatology, depression and anxiety were also conducted. Compared to controls, patients with schizophrenia presented an imbalance between repetitive thinking modes, with increased abstract/analytic and reduced concrete/experiential thoughts, even after controlling for comorbidities. Schizophrenia is associated with stronger dysfunctional repetitive thoughts (i.e. abstract thinking) and impaired ability to efficiently use repetitive thinking for current problem-solving (i.e. concrete thinking). This imbalance confirms the double-faced nature of repetitive thinking modes, whose influence on schizophrenia's symptomatology should be further investigated. The present results also claim for evaluating these processes in clinical settings and for rehabilitating the balance between opposite repetitive thinking modes. Copyright © 2017 Elsevier Inc. All rights reserved.

  14. Specific interaction of the nonstructural protein NS1 of minute virus of mice (MVM) with [ACCA](2) motifs in the centre of the right-end MVM DNA palindrome induces hairpin-primed viral DNA replication.

    PubMed

    Willwand, Kurt; Moroianu, Adela; Hörlein, Rita; Stremmel, Wolfgang; Rommelaere, Jean

    2002-07-01

    The linear single-stranded DNA genome of minute virus of mice (MVM) is replicated via a double-stranded replicative form (RF) intermediate DNA. Amplification of viral RF DNA requires the structural transition of the right-end palindrome from a linear duplex into a double-hairpin structure, which serves for the repriming of unidirectional DNA synthesis. This conformational transition was found previously to be induced by the MVM nonstructural protein NS1. Elimination of the cognate NS1-binding sites, [ACCA](2), from the central region of the right-end palindrome next to the axis of symmetry was shown to markedly reduce the efficiency of hairpin-primed DNA replication, as measured in a reconstituted in vitro replication system. Thus, [ACCA](2) sequence motifs are essential as NS1-binding elements in the context of the structural transition of the right-end MVM palindrome.

  15. Aspects of speech motor control: programing of repetitive versus non-repetitive speech.

    PubMed

    Schönle, P W; Hong, G; Benecke, R; Conrad, B

    1986-01-16

    The aim of the present study was to investigate whether time to program repetitive speech movements (RS) would be distinct from time to program non-repetitive speech movements (NRS) when the length of sequences is kept constant. Using an oral reading task, latencies for the initiation of RS and NRS were measured under two conditions which allowed delineation of the time necessary for perceptual processing separated from actual motor programing. The results show that latencies for NRS were significantly longer than for RS, indicating that the nature of an utterance, not simply its length, is a determinant of program complexity.

  16. Sentence repetition: what does the task measure?

    PubMed

    Polišenská, Kamila; Chiat, Shula; Roy, Penny

    2015-01-01

    Sentence repetition is gaining increasing attention as a source of information about children's sentence-level abilities in clinical assessment, and as a clinical marker of specific language impairment. However, it is widely debated what the task is testing and therefore how informative it is. (1) To evaluate the effects of different types of long-term linguistic knowledge on immediate recall, (2) to assess age sensitivity of repetition tasks designed to evaluate these effects, and (3) to establish if the effects are similar across typologically different languages. The study also considers the implications of the findings for the use of sentence repetition as a research and clinical assessment tool. Participants were 50 English-speaking and 50 Czech-speaking typically developing 4-5-year-olds. Children's ability to recall sequences of items was compared in seven linguistic conditions ranging from fully well-formed sentences to sequences of non-words. In each condition, children repeated blocks of successively longer stimuli to establish their span. Results showed significant but differential effects of all linguistic factors in both languages. While syntactic violations and presence of non-words dramatically reduced children's span, semantic implausibility and the removal of sentence prosody played a significant but much smaller role. Familiarity of function words was more important than familiarity of content words. The effects of different linguistic factors on spans were the same for both languages and did not change between 4 and 5 years, although average spans increased over this age range. Children's ability to repeat sentences is more dependent on their familiarity with morphosyntax and lexical phonology than semantics or prosody, with function words of particular importance. Findings have implications for the use of recall in clinical assessment and as a research tool. © 2014 Royal College of Speech and Language Therapists.

  17. [Guidelines for redesigning jobs with repetitive tasks].

    PubMed

    Colombini, D; Occhipinti, E; Meroni, M; Menoni, O; Bergamasco, R; Girola, C; Grea, V; Vendola, D

    1996-01-01

    Preventive measures aimed at minimising the occurrence of work-related musculo-skeletal disorders of the upper limbs (WMSDs) associated with repetitive tasks can be divided into 3 categories: structural, organisational and educational. Whenever specific risk and injury assessments have shown the need for preventive action, this is most often implemented within the framework of a range of assorted measures. In particular, structural measures pertain to optimising the layout of the work area and furnishings, and the "ergonomic" properties of work tools and equipment. Such measures serve to alleviate the problems caused by the use of excessive force and improper postures. The authors refer to the principles guiding such structural measures, in the light of the extensive literature that has been published on the subject. Organisational (or re-organisational) measures essentially relate to job design (i.e. distribution of tasks, speeds and pauses). They serve to alleviate problems connected with highly repetitive and frequent actions, excessively lengthy tasks and inadequate recovery periods. Very few relevant findings are available: the authors therefore illustrate in some detail a practical trial conducted in a major engineering firm. The objective was to lower to acceptable limits the frequency of certain repetitive tasks performed by workers using their upper limbs. The trial made it possible to identify a suitable plan and schedule of measures taking into due consideration the impact of the plan on production levels (and costs). The fundamental principles guiding the adoption of specific educational and training programmes for the workers and their supervisors are presented and discussed.

  18. Software reliability: Repetitive run experimentation and modeling

    NASA Technical Reports Server (NTRS)

    Nagel, P. M.; Skrivan, J. A.

    1982-01-01

    A software experiment conducted with repetitive run sampling is reported. Independently generated input data was used to verify that interfailure times are very nearly exponentially distributed and to obtain good estimates of the failure rates of individual errors and demonstrate how widely they vary. This fact invalidates many of the popular software reliability models now in use. The log failure rate of interfailure time was nearly linear as a function of the number of errors corrected. A new model of software reliability is proposed that incorporates these observations.

  19. Severe repetitive exercise and haematological status.

    PubMed Central

    Ross, J. H.; Attwood, E. C.

    1984-01-01

    The effects of severe repetitive exercise on certain haematological measurements were studied. Decreases in haematocrit and haemoglobin (13% in one group of participants) took place during the first 2 weeks but not the third week of increasingly severe exertion and the reasons for this are discussed. Haemolysis probably plays only a small part and plasma volume expansion is likely to be the main cause of this phenomenon. It is suggested that there is no stimulus for the haemoglobin concentration to be increased to match the increased plasma volume as tissue oxygen tension is maintained satisfactorily. PMID:6462992

  20. Repetition of educational AIDS advertising affects attitudes.

    PubMed

    Schindler, Simon; Reinhard, Marc-André; Stahlberg, Dagmar

    2011-06-01

    In educational AIDS campaigns, initiators often use advertisements to warn about the threat of AIDS. The present Internet study (N = 283) tested the assumption of an inverted U-shaped relationship between the number of educational AIDS advertisements in a magazine and the perceived threat of AIDS among different groups (i.e., homosexual men and heterosexual men and women). This expectation was primarily based on signaling theory, which assumes that recipients use repetition frequency as a cue for judgments about the message. Results provided support for the expected inverted U-curve.

  1. Repetitively pulsed high power stacked Blumlein generators

    NASA Astrophysics Data System (ADS)

    Davanloo, F.; Borovina, D. L.; Collins, C. B.; Agee, F. J.; Kingsley, L. E.

    1995-05-01

    The stacked Blumlein pulse generators developed at the University of Texas at Dallas consist of several triaxial Blumleins stacked in series at one end. The lines are charged in parallel and synchronously commuted with a single switching element at the other end. In this way, relatively low charging voltages are multiplied to give the desired discharge voltage across an arbitrary load. Described here is the progress in development and characterization of these novel pulse-power generators capable of discharging at high repetition rates. The introduction of a tapered transmission line concept to the stacked Blumlein design provided fine tuning of output waveforms.

  2. Repetitive Head Impacts and Chronic Traumatic Encephalopathy.

    PubMed

    McKee, Ann C; Alosco, Michael L; Huber, Bertrand R

    2016-10-01

    Chronic traumatic encephalopathy (CTE) is a distinctive neurodegenerative disease that occurs as a result of repetitive head impacts. CTE can only be diagnosed by postmortem neuropathologic examination of brain tissue. CTE is a unique disorder with a pathognomonic lesion that can be reliably distinguished from other neurodegenerative diseases. CTE is associated with violent behaviors, explosivity, loss of control, depression, suicide, memory loss and cognitive changes. There is increasing evidence that CTE affects amateur athletes as well as professional athletes and military veterans. CTE has become a major public health concern.

  3. Repetition enhancement and perceptual processing of visual word form

    PubMed Central

    Lebreton, Karine; Villain, Nicolas; Chételat, Gaël; Landeau, Brigitte; Seghier, Mohamed L.; Lazeyras, François; Eustache, Francis; Ibanez, Vicente

    2012-01-01

    The current study investigated the cerebral basis of word perceptual repetition priming with fMRI during a letter detection task that manipulated the familiarity of perceptual word form and the number of repetitions. Some neuroimaging studies have reported increases, instead of decreases, in brain activations (called “repetition enhancement”) associated with repetition priming of unfamiliar stimuli which have been interpreted as the creation of new perceptual representations for unfamiliar items. According to this interpretation, several repetitions of unfamiliar items would then be necessary for the repetition priming to occur, a hypothesis not explicitly tested in prior studies. In the present study, using a letter detection task on briefly flashed words, we explored the effect of familiarity on brain response for word visual perceptual priming using both words with usual (i.e., familiar) and unusual (i.e., unfamiliar) font, presented up to four times for stimuli with unusual font. This allows potential changes in the brain responses for unfamiliar items to be assessed over several repetitions, i.e., repetition enhancement to suppression. Our results reveal significant increases of activity in the bilateral occipital areas related to repetition of words in both familiar and unfamiliar conditions. Our findings support the sharpening hypothesis, showing a lack of cerebral economy with repetition when the task requires the processing of all word features, whatever the familiarity of the material, and emphasize the influence of the nature of stimuli processing on its neuronal manifestation. PMID:22807895

  4. Animal models of restricted repetitive behavior in autism

    PubMed Central

    Lewis, Mark H.; Tanimura, Yoko; Lee, Linda W.; Bodfish, James W.

    2013-01-01

    Restricted, repetitive behavior, along with deficits in social reciprocity and communication, is diagnostic of autism. Animal models relevant to this domain generally fall into three classes: repetitive behavior associated with targeted insults to the CNS; repetitive behavior induced by pharmacological agents; and repetitive behavior associated with restricted environments and experience. The extant literature provides potential models of the repetitive behavioral phenotype in autism rather than attempts to model the etiology or pathophysiology of restricted, repetitive behavior, as these are poorly understood. This review focuses on our work with deer mice which exhibit repetitive behaviors associated with environmental restriction. Repetitive behaviors are the most common category of abnormal behavior observed in confined animals and larger, more complex environments substantially reduce the development and expression of such behavior. Studies with this model, including environmental enrichment effects, suggest alterations in cortical-basal ganglia circuitry in the development and expression of repetitive behavior. Considerably more work needs to be done in this area, particularly in modeling the development of aberrant repetitive behavior. As mutant mouse models continue to proliferate, there should be a number of promising genetic models to pursue. PMID:16997392

  5. The repetitive landscape of the chicken genome.

    PubMed

    Wicker, Thomas; Robertson, Jon S; Schulze, Stefan R; Feltus, F Alex; Magrini, Vincent; Morrison, Jason A; Mardis, Elaine R; Wilson, Richard K; Peterson, Daniel G; Paterson, Andrew H; Ivarie, Robert

    2005-01-01

    Cot-based cloning and sequencing (CBCS) is a powerful tool for isolating and characterizing the various repetitive components of any genome, combining the established principles of DNA reassociation kinetics with high-throughput sequencing. CBCS was used to generate sequence libraries representing the high, middle, and low-copy fractions of the chicken genome. Sequencing high-copy DNA of chicken to about 2.7 x coverage of its estimated sequence complexity led to the initial identification of several new repeat families, which were then used for a survey of the newly released first draft of the complete chicken genome. The analysis provided insight into the diversity and biology of known repeat structures such as CR1 and CNM, for which only limited sequence data had previously been available. Cot sequence data also resulted in the identification of four novel repeats (Birddawg, Hitchcock, Kronos, and Soprano), two new subfamilies of CR1 repeats, and many elements absent from the chicken genome assembly. Multiple autonomous elements were found for a novel Mariner-like transposon, Galluhop, in addition to nonautonomous deletion derivatives. Phylogenetic analysis of the high-copy repeats CR1, Galluhop, and Birddawg provided insight into two distinct genome dispersion strategies. This study also exemplifies the power of the CBCS method to create representative databases for the repetitive fractions of genomes for which only limited sequence data is available.

  6. Investigation of a repetitive pulsed electrothermal thruster

    NASA Technical Reports Server (NTRS)

    Burton, R. L.; Fleischer, D.; Goldstein, S. A.; Tidman, D. A.; Winsor, N. K.

    1986-01-01

    A pulsed electrothermal (PET) thruster with 1000:1 ratio nozzle is tested in a repetitive mode on water propellant. The thruster is driven by a 60J pulse forming network at repetition rates up to 10 Hz (600W). The pulse forming network has a .31 ohm impedance, well matched to the capillary discharge resistance of .40 ohm, and is directly coupled to the thruster electrodes without a switch. The discharge is initiated by high voltage breakdown, typically at 2500V, through the water vapor in the interelectrode gap. Water is injected as a jet through a .37 mm orifice on the thruster axis. Thruster voltage, current and impulse bit are recorded for several seconds at various power supply currents. Thruster to power ratio is typically T/P = .07 N/kW. Tank background pressure precludes direct measurement of exhaust velocity which is inferred from calculated pressure and temperature in the discharge to be about 14 km/sec. Efficiency, based on this velocity and measured T/P is .54 + or - .07. Thruster ablation is zero at the throat and becomes measurable further upstream, indicating that radiative ablation is occurring late in the pulse.

  7. Incidence of shoulder pain in repetitive work

    PubMed Central

    Leclerc, A; Chastang, J; Niedhammer, I; Landre, M; Roquelaure, Y

    2004-01-01

    Aims: To determine the predictiveness of personal and occupational factors for the onset of shoulder pain in occupations requiring repetitive work. Methods: A sample of 598 workers in five activity sectors completed a self administered questionnaire in 1993–94 and again three years later. Both questionnaires included questions about shoulder pain. The associations between various factors at baseline and subsequent shoulder pain were studied among subjects free from shoulder pain at baseline. Results: The incidence of shoulder pain was associated with several independent risk factors: depressive symptoms, low level of job control, and biomechanical constraints. After adjustment for other risk factors, the presence of depressive symptoms predicted occurrence of shoulder pain. A low level of job control was also associated with the onset of shoulder pain in both sexes. For men, repetitive use of a tool was a strong predictor, while the two most important biomechanical risk factors for women were use of vibrating tools and working with arms above shoulder level. Conclusion: This study used a longitudinal approach to examine different sets of risk factors for shoulder pain simultaneously. The results confirm the role of several biomechanical constraints. Psychological symptoms and a low level of job control also play a role. PMID:14691271

  8. Intranuclear Anchoring of Repetitive DNA Sequences

    PubMed Central

    Weipoltshammer, Klara; Schöfer, Christian; Almeder, Marlene; Philimonenko, Vlada V.; Frei, Klemens; Wachtler, Franz; Hozák, Pavel

    1999-01-01

    Centromeres, telomeres, and ribosomal gene clusters consist of repetitive DNA sequences. To assess their contributions to the spatial organization of the interphase genome, their interactions with the nucleoskeleton were examined in quiescent and activated human lymphocytes. The nucleoskeletons were prepared using “physiological” conditions. The resulting structures were probed for specific DNA sequences of centromeres, telomeres, and ribosomal genes by in situ hybridization; the electroeluted DNA fractions were examined by blot hybridization. In both nonstimulated and stimulated lymphocytes, centromeric alpha-satellite repeats were almost exclusively found in the eluted fraction, while telomeric sequences remained attached to the nucleoskeleton. Ribosomal genes showed a transcription-dependent attachment pattern: in unstimulated lymphocytes, transcriptionally inactive ribosomal genes located outside the nucleolus were eluted completely. When comparing transcription unit and intergenic spacer, significantly more of the intergenic spacer was removed. In activated lymphocytes, considerable but similar amounts of both rDNA fragments were eluted. The results demonstrate that: (a) the various repetitive DNA sequences differ significantly in their intranuclear anchoring, (b) telomeric rather than centromeric DNA sequences form stable attachments to the nucleoskeleton, and (c) different attachment mechanisms might be responsible for the interaction of ribosomal genes with the nucleoskeleton. PMID:10613900

  9. Repetitive Head Impacts and Chronic Traumatic Encephalopathy

    PubMed Central

    McKee, Ann C.; Alosco, Michael; Huber, Bertrand R.

    2016-01-01

    There are growing concerns that cumulative repetitive head impact exposure through routine participation in contact and collision sports is associated with increased risk of long-term problems in memory and cognition, including the development of chronic traumatic encephalopathy (CTE). CTE is a distinctive neurodegenerative disease that occurs as a result of repetitive head impacts (RHI) including concussion and subconcussion. Like most neurodegenerative diseases, CTE can only be diagnosed by postmortem neuropathologic examination of brain tissue. Recently a panel of exerts concluded that CTE is a unique disorder with a pathognomonic lesion that can be reliably distinguished from other neurodegenerative diseases, such as Alzheimer’s disease and frontotemporal lobar degeneration. The pathognomonic lesion of CTE consists of a perivascular accumulation of hyperphosphorylated tau protein in neurons and astrocytes in an irregular pattern, and is typically most prominent at the depths of the cerebral sulci. Clinically CTE is associated with violent behaviors, explosivity, a loss of control, depression, suicide, memory loss and cognitive changes. While the exact incidence and prevalence of CTE remain unknown, there is increasing evidence that CTE affects amateur atheletes as well as professional athletes and military veterans. Given the millions of contact sport athletes and military service members who are exposed to RHI each year, CTE has become a major public health concern. There is a critical need for identification of CTE during life, improved understanding of the epidemiology and pathobiology, and the development of effective prevention and treatment strategies for CTE. PMID:27637402

  10. Synergy Repetition Training versus Task Repetition Training in Acquiring New Skill

    PubMed Central

    Patel, Vrajeshri; Craig, Jamie; Schumacher, Michelle; Burns, Martin K.; Florescu, Ionut; Vinjamuri, Ramana

    2017-01-01

    Traditionally, repetitive practice of a task is used to learn a new skill, exhibiting as immediately improved performance. Research suggests, however, that a more experience-based rather than exposure-based training protocol may allow for better transference of the skill to related tasks. In synergy-based motor control theory, fundamental motor skills, such as hand grasping, are represented with a synergy subspace that captures essential motor patterns. In this study, we propose that motor-skill learning through synergy-based mechanisms may provide advantages over traditional task repetition learning. A new task was designed to highlight the range of motion and dexterity of the human hand. Two separate training strategies were tested in healthy subjects: task repetition training and synergy training versus a control. All three groups showed improvements when retested on the same task. When tested on a similar, but different set of tasks, only the synergy group showed improvements in accuracy (9.27% increase) compared to the repetition (3.24% decline) and control (3.22% decline) groups. A kinematic analysis revealed that although joint angular peak velocities decreased, timing benefits stemmed from the initial feed-forward portion of the task (reaction time). Accuracy improvements may have derived from general improved coordination among the four involved fingers. These preliminary results warrant further investigation of synergy-based motor training in healthy individuals, as well as in individuals undergoing hand-based rehabilitative therapy. PMID:28289680

  11. The role of short-term memory impairment in nonword repetition, real word repetition, and nonword decoding: A case study.

    PubMed

    Peter, Beate

    2017-09-21

    In a companion study, adults with dyslexia and adults with a probable history of childhood apraxia of speech showed evidence of difficulty with processing sequential information during nonword repetition, multisyllabic real word repetition and nonword decoding. Results suggested that some errors arose in visual encoding during nonword reading, all levels of processing but especially short-term memory storage/retrieval during nonword repetition, and motor planning and programming during complex real word repetition. To further investigate the role of short-term memory, a participant with short-term memory impairment (MI) was recruited. MI was confirmed with poor performance during a sentence repetition and three nonword repetition tasks, all of which have a high short-term memory load, whereas typical performance was observed during tests of reading, spelling, and static verbal knowledge, all with low short-term memory loads. Experimental results show error-free performance during multisyllabic real word repetition but high counts of sequence errors, especially migrations and assimilations, during nonword repetition, supporting short-term memory as a locus of sequential processing deficit during nonword repetition. Results are also consistent with the hypothesis that during complex real word repetition, short-term memory is bypassed as the word is recognized and retrieved from long-term memory prior to producing the word.

  12. Amphimeric mitochondrial genomes of petite mutants of yeast. I. Flip-flop amphimers make up the mitochondrial genomes of "palindromic" petite mutants of yeast.

    PubMed

    Rayko, E; Goursot, R

    1996-07-31

    The mitochondrial (mt) genomes of three spontaneous cytoplasmic "palindromic" petite mutants of yeast were studied by restriction-enzyme analysis. These mt genomes were shown to be made up of an amplified "master basic unit" consisting of two inverted segments (a and A) and of two different unique segments (d and t) separating them. The basic unit was called "amphimeric", this term having been first proposed for certain lambda-phage mutants. We propose that in the mt genomes of the petite mutants studied, the four possible variants of the amphimeric basic unit form two - "flip" and "flop" - tetra-amphimeric repeat units datA-datA-DaTA-DaTA and DatA-DatA-daTA-daTA, respectively. These repeat units make two types of "amphimeric" mt genomes which exist in equal proportions in the cell. In each mt genome, the duplicated segment regularly alternates in its direct and inverted orientation (a...A...a...A...), whereas the unique segments are arranged twice in tandem fashion and twice in inverted fashion (d...d...D...D...d...d...andt...t...T...T...t...t...). The only difference between flip and flop amphimeric mt petite genomes is the different relative orientation of the unique segments in the mono-amphimers. In the mono-amphimers of flip mt genomes, both unique segments are arranged in the same direction (d...t and D...T), whereas in the mono-amphimers of flop mt genomes, both unique segments are arranged in opposite directions (D...t and d...T). Control experiments on one spontaneous petite mutant (which was an ancestor of the mutants studied here) and on three independent, previously investigated, EtBr-induced mutants showed that all of them were, in fact, organized in the same way. Analysing our experimental data and the results published by others, we conclude that amphimeric organization is a general feature of mt petite genomes of yeast previously called "palindromic" or "rearranged".

  13. Possible functional co-operation of palindromes hr3 and hr4 in the genome of Cydia pomonella granulovirus affects viral replication capacity.

    PubMed

    Elmenofy, Wael H; Jehle, Johannes A

    2015-09-01

    After previous studies had shown that natural transposon insertion between the two homologous regions hr3 and hr4 of the genome of the Mexican (M) strain of Cydia pomonella granulovirus (CpGV-M) resulted in a loss of viral competitiveness, the function of these homologous regions was investigated. A CpGV-based bacmid (CpBAC) was constructed and mutants with deleted hr3 and hr4 palindromes (CpBAChr3/hr4KO) and a construct (CpBAChr3-kan-hr4) with physically separated hr3 and hr4 repeats were generated to investigate their involvement in in vivo replication. Based on median lethal concentration (LC50) and median survival time (ST50) of the mutant viruses vCpBAChr3/hr4KO and vCpBAChr3-kan-hr4 it was found that the infectivity of both mutants for codling moth Cydia pomonella L. (Lep.: Tortricidae) larvae was not influenced compared with the parental virus vCpBAC. Co-infection experiments with vCpBAChr3-kan-hr4 and vCpBAC using different virus ratios revealed that vCpBAChr3-kan-hr4 was efficiently out-competed by vCpBAC during in vivo replication. These findings suggested that the separation of hr3 and hr4 resulted in a replication disadvantage of the mutant similar to the observation made in previous co-infection experiments using the transposon-carrying mutant CpGV-MCp5 and WT CpGV-M. It was concluded that the palindromes hr3 and hr4 may play a non-essential but co-functional role in the replication of CpGV-M.

  14. The use of repetition suppression paradigms in developmental cognitive neuroscience.

    PubMed

    Nordt, Marisa; Hoehl, Stefanie; Weigelt, Sarah

    2016-07-01

    Repetition suppression paradigms allow a more detailed look at brain functioning than classical paradigms and have been applied vigorously in adult cognitive neuroscience. These paradigms are well suited for studies in the field of developmental cognitive neuroscience as they can be applied without collecting a behavioral response and across all age groups. Furthermore, repetition suppression paradigms can be employed in various neuroscience techniques, such as functional magnetic resonance imaging (fMRI), functional near-infrared spectroscopy (fNIRS), electroencephalography (EEG) and magnetoencephalography (MEG). In the present article we review studies using repetition suppression paradigms in developmental cognitive neuroscience covering the age range from infancy to adolescence. Our first goal is to point out characteristics of developmental repetition suppression effects. In doing so, we discuss the relationship of the direction of repetition effects (suppression vs enhancement) with developmental factors, and address the question how the direction of repetition effects might be related to looking-time effects in behavioral infant paradigms, the most prominently used behavioral measure in infant research. To highlight the potential of repetition suppression paradigms, our second goal is to provide an overview on the insights recently obtained by applying repetition paradigms in neurodevelopmental studies, including research on children with autism spectrum disorders (ASDs). We conclude that repetition suppression paradigms are valuable tools for investigating neurodevelopmental processes, while at the same time we highlight the necessity for further studies that disentangle methodological and developmental factors. Copyright © 2016 Elsevier Ltd. All rights reserved.

  15. A review of neuroimaging findings in repetitive brain trauma.

    PubMed

    Koerte, Inga K; Lin, Alexander P; Willems, Anna; Muehlmann, Marc; Hufschmidt, Jakob; Coleman, Michael J; Green, Isobel; Liao, Huijun; Tate, David F; Wilde, Elisabeth A; Pasternak, Ofer; Bouix, Sylvain; Rathi, Yogesh; Bigler, Erin D; Stern, Robert A; Shenton, Martha E

    2015-05-01

    Chronic traumatic encephalopathy (CTE) is a neurodegenerative disease confirmed at postmortem. Those at highest risk are professional athletes who participate in contact sports and military personnel who are exposed to repetitive blast events. All neuropathologically confirmed CTE cases, to date, have had a history of repetitive head impacts. This suggests that repetitive head impacts may be necessary for the initiation of the pathogenetic cascade that, in some cases, leads to CTE. Importantly, while all CTE appears to result from repetitive brain trauma, not all repetitive brain trauma results in CTE. Magnetic resonance imaging has great potential for understanding better the underlying mechanisms of repetitive brain trauma. In this review, we provide an overview of advanced imaging techniques currently used to investigate brain anomalies. We also provide an overview of neuroimaging findings in those exposed to repetitive head impacts in the acute/subacute and chronic phase of injury and in more neurodegenerative phases of injury, as well as in military personnel exposed to repetitive head impacts. Finally, we discuss future directions for research that will likely lead to a better understanding of the underlying mechanisms separating those who recover from repetitive brain trauma vs. those who go on to develop CTE.

  16. Visual and phonological codes in repetition blindness.

    PubMed

    Bavelier, D; Potter, M C

    1992-02-01

    Repetition blindness (RB) is the inability to detect or recall a repeated word in rapid serial visual presentation. The role of visual versus phonological (name) similarity in RB was examined. RB was found for single letters, whether printed in the same or different cases, and for single digits, whether represented verbally (nine), as arabic numerals (9), or in a mixture of the 2 formats. Hence, visual similarity is not necessary to produce RB. RB was obtained between homophonic pairs (won/one), showing that phonological similarity is sufficient to produce RB, although visual identity also contributes to RB. It is proposed that RB results when the codes used for initial registration of the targets in short-term memory are similar. This initial code may be predominantly visual or predominantly phonological.

  17. Visual identity and uncertainty in repetition blindness.

    PubMed

    Brill, Gary A; Glass, Arnold L; Rashid, Hanin; Hussey, Erika

    2008-01-01

    Repetition blindness (RB) was investigated in 6 experiments. In the first 3 experiments participants detected vowel targets in 11-letter sequences. When all letters were uppercase, detection was poorer for same (e.g., AA) than for different (e.g., AO) targets. However, when one target was uppercase and the other lowercase, RB was found only for targets visually identical except for size (e.g., Oo), not for visually different pairs (e.g., Aa). Experiment 4 found RB for visually identical versus different consonant-vowel-consonant words. Experiments 5 and 6 replicated Kanwisher's (1987) experiment in which RB was insensitive to word case but revealed these effects to be artifacts of poor recognition of 5-letter words coupled with a biased guessing strategy. Overall, these experiments found RB only at a low level of visual information processing.

  18. Context and repetition in word learning.

    PubMed

    Horst, Jessica S

    2013-01-01

    Young children learn words from a variety of situations, including shared storybook reading. A recent study by Horst et al. (2011a) demonstrates that children learned more new words during shared storybook reading if they were read the same stories repeatedly than if they were read different stories that had the same number of target words. The current paper reviews this study and further examines the effect of contextual repetition on children's word learning in both shared storybook reading and other situations, including fast mapping by mutual exclusivity. The studies reviewed here suggest that the same cognitive mechanisms support word learning in a variety of situations. Both practical considerations for experimental design and directions for future research are discussed.

  19. Low-Intensity Repetitive Exercise Induced Rhabdomyolysis.

    PubMed

    Tran, Mina; Hayden, Nicholas; Garcia, Brandon; Tucci, Veronica

    2015-01-01

    Rhabdomyolysis is a rare condition caused by the proteins of damaged muscle cells entering the bloodstream and damaging the kidneys. Common symptoms of rhabdomyolysis are muscle pain and fatigue in conjunction with dark urine; kidney damage is a common symptom among these patients. We present a case of a 23-year-old woman who displayed myalgia in the upper extremities caused by low-intensity and high-repetition exercise. She was successfully diagnosed and treated for exertional rhabdomyolysis. This patient had no significant medical history that would induce this condition. We urge the emergency medical community to observe and monitor patients that complain of myalgia to ensure they are not suffering from rhabdomyolysis even in atypical cases.

  20. Repetitive DNA sequences in Mycoplasma pneumoniae.

    PubMed Central

    Wenzel, R; Herrmann, R

    1988-01-01

    Two types of different repetitive DNA sequences called RepMP1 and RepMP2 were identified in the genome of Mycoplasma pneumoniae. The number of these repeated elements, their nucleotide sequence and their localization on a physical map of the M. pneumoniae genome were determined. The results show that RepMP1 appears at least 10 times and RepMP2 at least 8 times in the genome. The repeated elements are dispersed on the chromosome and, in three cases, linked to each other by a homologous DNA sequence of 400 bp. The elements themselves are 300 bp (for RepMP1) and 150 bp (for RepMP2) long showing a high degree of homology. One copy of RepMP2 is a translated part of the gene for the major cytadhesin protein P1 which is responsible for the adsorption of M. pneumoniae to its host cell. Images PMID:3138660

  1. A miniature high repetition rate shock tube.

    PubMed

    Tranter, R S; Lynch, P T

    2013-09-01

    A miniature high repetition rate shock tube with excellent reproducibility has been constructed to facilitate high temperature, high pressure, gas phase experiments at facilities such as synchrotron light sources where space is limited and many experiments need to be averaged to obtain adequate signal levels. The shock tube is designed to generate reaction conditions of T > 600 K, P < 100 bars at a cycle rate of up to 4 Hz. The design of the apparatus is discussed in detail, and data are presented to demonstrate that well-formed shock waves with predictable characteristics are created, repeatably. Two synchrotron-based experiments using this apparatus are also briefly described here, demonstrating the potential of the shock tube for research at synchrotron light sources.

  2. Repetitive control of electrically driven robot manipulators

    NASA Astrophysics Data System (ADS)

    Fateh, Mohammad Mehdi; Ahsani Tehrani, Hojjat; Karbassi, Seyed Mehdi

    2013-04-01

    This article presents a novel robust discrete repetitive control of electrically driven robot manipulators for tracking of a periodic trajectory. We propose a novel model, which presents the highly non-linear dynamics of robot manipulator in the form of linear discrete-time time-varying system. Based on the proposed model, we develop a two-term control law. The first term is an ordinary time-optimal and minimum-norm (TOMN) control by employing parametric controllers to guarantee stability. The second term is a novel robust control to improve the control performance in the face of uncertainties. The robust control estimates and compensates uncertainties including the parametric uncertainty, unmodelled dynamics and external disturbances. Performance of the proposed method is compared with two discrete methods, namely the TOMN control and an adaptive iterative learning (AIL) control. Simulation results confirm superiority of the proposed method in terms of the convergence speed and precision.

  3. Object color affects identification and repetition priming.

    PubMed

    Uttl, Bob; Graf, Peter; Santacruz, Pilar

    2006-10-01

    We investigated the influence of color on the identification of both non-studied and studied objects. Participants studied black and white and color photos of common objects and memory was assessed with an identification test. Consistent with our meta-analysis of prior research, we found that objects were easier to identify from color than from black and white photos. We also found substantial priming in all conditions, and study-to-test changes in an object's color reduced the magnitude of priming. Color-specific priming effects were large for color-complex objects, but minimal for color-simple objects. The pattern and magnitude of priming effects was not influenced either by the extent to which an object always appears in the same color (i.e., whether a color is symptomatic of an object) or by the object's origin (natural versus fabricated). We discuss the implications of our findings for theoretical accounts of object perception and repetition priming.

  4. Capillary underwater discharges in repetitive pulse regime

    NASA Astrophysics Data System (ADS)

    de Baerdemaeker, F.; Monte, M.; Leys, C.

    2004-03-01

    In this study a capillary underwater discharge, that is sustained with AC (50 Hz) voltages up to 7.5 kV, is investigated. In a capillary discharge scheme, the current is, at some point along its path between two submerged electrodes, flowing through a narrow elongated bore in a dielectric material. When the current density is sufficiently high, local boiling and subsequent vapour breakdown results in the formation of a plasma within this capillary. At the same time the capillary emits an intense jet of vapour bubbles. Time-dependent electrical current, voltage and light emission curves are recorded for discharges in solutions of NaCl in distilled water and reveal different discharge regimes, depending on the conductivity and the excitation voltage, ranging from repetitive microsecond discharge pulses to a quasi-continuous discharge with a glow-like voltage-current characteristic.

  5. Low-Intensity Repetitive Exercise Induced Rhabdomyolysis

    PubMed Central

    Tran, Mina; Hayden, Nicholas; Garcia, Brandon; Tucci, Veronica

    2015-01-01

    Rhabdomyolysis is a rare condition caused by the proteins of damaged muscle cells entering the bloodstream and damaging the kidneys. Common symptoms of rhabdomyolysis are muscle pain and fatigue in conjunction with dark urine; kidney damage is a common symptom among these patients. We present a case of a 23-year-old woman who displayed myalgia in the upper extremities caused by low-intensity and high-repetition exercise. She was successfully diagnosed and treated for exertional rhabdomyolysis. This patient had no significant medical history that would induce this condition. We urge the emergency medical community to observe and monitor patients that complain of myalgia to ensure they are not suffering from rhabdomyolysis even in atypical cases. PMID:26693360

  6. Movement consistency during repetitive tool use action

    PubMed Central

    Baber, Chris

    2017-01-01

    The consistency and repeatability of movement patterns has been of long-standing interest in locomotor biomechanics, but less well explored in other domains. Tool use is one of such a domain; while the complex dynamics of the human-tool-environment system have been approached from various angles, to date it remains unknown how the rhythmicity of repetitive tool-using action emerges. To examine whether the spontaneously adopted movement frequency is a variable susceptible to individual execution approaches or emerges as constant behaviour, we recorded sawing motion across a range of 14 experimental conditions using various manipulations. This was compared to free and pantomimed arm movements. We found that a mean (SD) sawing frequency of 2.0 (0.4) Hz was employed across experimental conditions. Most experimental conditions did not significantly affect the sawing frequency, signifying the robustness of this spontaneously emerging movement. Free horizontal arm translation and miming of sawing was performed at half the movement frequency with more than double the excursion distance, showing that not all arm movements spontaneously emerge at the observed sawing parameters. Observed movement frequencies across all conditions could be closely predicted from movement time reference data for generic arm movements found in the Methods Time Measurement literature, highlighting a generic biomechanical relationship between the time taken for a given distance travelled underlying the observed behaviour. We conclude that our findings lend support to the hypothesis that repetitive movements during tool use are executed according to generic and predictable musculoskeletal mechanics and constraints, albeit in the context of the general task (sawing) and environmental constraints such as friction, rather than being subject to task-specific control or individual cognitive schemata. PMID:28278273

  7. The Golden Ratio of Gait Harmony: Repetitive Proportions of Repetitive Gait Phases

    PubMed Central

    Iosa, Marco; Marchetti, Fabio; Morone, Giovanni; Caltagirone, Carlo; Paolucci, Stefano; Peppe, Antonella

    2013-01-01

    In nature, many physical and biological systems have structures showing harmonic properties. Some of them were found related to the irrational number ϕ known as the golden ratio that has important symmetric and harmonic properties. In this study, the spatiotemporal gait parameters of 25 healthy subjects were analyzed using a stereophotogrammetric system with 25 retroreflective markers located on their skin. The proportions of gait phases were compared with ϕ, the value of which is about 1.6180. The ratio between the entire gait cycle and stance phase resulted in 1.620 ± 0.058, that between stance and the swing phase was 1.629 ± 0.173, and that between swing and the double support phase was 1.684 ± 0.357. All these ratios did not differ significantly from each other (F = 0.870, P = 0.422, repeated measure analysis of variance) or from ϕ (P = 0.670, 0.820, 0.422, resp., t-tests). The repetitive gait phases of physiological walking were found in turn in repetitive proportions with each other, revealing an intrinsic harmonic structure. Harmony could be the key for facilitating the control of repetitive walking. Harmony is a powerful unifying factor between seemingly disparate fields of nature, including human gait. PMID:23862161

  8. GRAPE - GIS Repetition Using Audio-Visual Repetition Units and its Leanring Effectiveness

    NASA Astrophysics Data System (ADS)

    Niederhuber, M.; Brugger, S.

    2011-09-01

    A new audio-visual learning medium has been developed at the Department of Environmental Sciences at ETH Zurich (Switzerland), for use in geographical information sciences (GIS) courses. This new medium, presented in the form of Repetition Units, allows students to review and consolidate the most important learning concepts on an individual basis. The new material consists of: a) a short enhanced podcast (recorded and spoken slide show) with a maximum duration of 5 minutes, which focuses on only one important aspect of a lecture's theme; b) one or two relevant exercises, covering different cognitive levels of learning, with a maximum duration of 10 minutes; and c), solutions for the exercises. During a pilot phase in 2010, six Repetition Units were produced by the lecturers. Twenty more Repetition Units will be produced by our students during the fall semester of 2011 and 2012. The project is accompanied by a 5-year study (2009 - 2013) that investigates learning success using the new material, focussing on the question, whether or not the new material help to consolidate and refresh basic GIS knowledge. It will be analysed based on longitudinal studies. Initial results indicate that the new medium helps to refresh knowledge as the test groups scored higher than the control group. These results are encouraging and suggest that the new material with its combination of short audio-visual podcasts and relevant exercises help to consolidate students' knowledge.

  9. The golden ratio of gait harmony: repetitive proportions of repetitive gait phases.

    PubMed

    Iosa, Marco; Fusco, Augusto; Marchetti, Fabio; Morone, Giovanni; Caltagirone, Carlo; Paolucci, Stefano; Peppe, Antonella

    2013-01-01

    In nature, many physical and biological systems have structures showing harmonic properties. Some of them were found related to the irrational number φ known as the golden ratio that has important symmetric and harmonic properties. In this study, the spatiotemporal gait parameters of 25 healthy subjects were analyzed using a stereophotogrammetric system with 25 retroreflective markers located on their skin. The proportions of gait phases were compared with φ, the value of which is about 1.6180. The ratio between the entire gait cycle and stance phase resulted in 1.620 ± 0.058, that between stance and the swing phase was 1.629 ± 0.173, and that between swing and the double support phase was 1.684 ± 0.357. All these ratios did not differ significantly from each other (F = 0.870, P = 0.422, repeated measure analysis of variance) or from φ (P = 0.670, 0.820, 0.422, resp., t-tests). The repetitive gait phases of physiological walking were found in turn in repetitive proportions with each other, revealing an intrinsic harmonic structure. Harmony could be the key for facilitating the control of repetitive walking. Harmony is a powerful unifying factor between seemingly disparate fields of nature, including human gait.

  10. 10 CFR 72.18 - Elimination of repetition.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 10 Energy 2 2012-01-01 2012-01-01 false Elimination of repetition. 72.18 Section 72.18 Energy NUCLEAR REGULATORY COMMISSION (CONTINUED) LICENSING REQUIREMENTS FOR THE INDEPENDENT STORAGE OF SPENT... Application, Form, and Contents § 72.18 Elimination of repetition. In any application under this part,...

  11. Neural Correlates of Restricted, Repetitive Behaviors in Autism Spectrum Disorders

    DTIC Science & Technology

    2012-10-01

    Repetitive Behaviors in Autism Spectrum Disorders PRINCIPAL INVESTIGATOR: Santangelo, Susan L CONTRACTING ORGANIZATION: Massachusetts...Neural Correlates of Restricted, Repetitive Behaviors in Autism Spectrum Disorders 5a. CONTRACT NUMBER 5b. GRANT NUMBER W81XWH-11-1-0773...The Neurodevelopmental Disorders Phenotyping Program at Children’s Hospital Boston and the Transcend Lab (Treatment Research and Neuroscience

  12. Repetitive and Stereotyped Behaviours in Pervasive Developmental Disorders

    ERIC Educational Resources Information Center

    Carcani-Rathwell, Iris; Rabe-Hasketh, Sophia; Santosh, Paramala J.

    2006-01-01

    Background: Repetitive and stereotyped behaviours are a heterogeneous group of behaviours present in many neuropsychiatric disorders. Despite their core significance in PDD, it is not clear whether there are distinct groups of these behaviours with different specificity to autism. Methods: A two-factor model of the repetitive behaviours, namely…

  13. Pre-Lexical Disorders in Repetition Conduction Aphasia

    ERIC Educational Resources Information Center

    Sidiropoulos, Kyriakos; de Bleser, Ria; Ackermann, Hermann; Preilowski, Bruno

    2008-01-01

    At the level of clinical speech/language evaluation, the repetition type of conduction aphasia is characterized by repetition difficulties concomitant with reduced short-term memory capacities, in the presence of fluent spontaneous speech as well as unimpaired naming and reading abilities. It is still unsettled which dysfunctions of the…

  14. Iconicity in Discourse: The Case of Repetition in Japanese.

    ERIC Educational Resources Information Center

    Ishikawa, Minako

    This analysis of repeated utterances in Japanese conversational discourse focuses on repetition as an expression of iconicity. In the analysis of a 30-minute conversation among 4 Japanese speakers, the iconic meanings expressed by both reduplication and conversational repetition are highlighted. The iconicity characteristic of conversational data…

  15. A Negative Effect of Repetition in Episodic Memory

    ERIC Educational Resources Information Center

    Peterson, Daniel J.; Mulligan, Neil W.

    2012-01-01

    One of the foundational principles of human memory is that repetition (i.e., being presented with a stimulus multiple times) improves recall. In the current study a group of participants who studied a list of cue-target pairs twice recalled fewer targets than a group who studied the pairs only once, a negative repetition effect. Such a…

  16. 10 CFR 60.23 - Elimination of repetition.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 10 Energy 2 2012-01-01 2012-01-01 false Elimination of repetition. 60.23 Section 60.23 Energy NUCLEAR REGULATORY COMMISSION (CONTINUED) DISPOSAL OF HIGH-LEVEL RADIOACTIVE WASTES IN GEOLOGIC REPOSITORIES Licenses License Applications § 60.23 Elimination of repetition. In its application,...

  17. 10 CFR 61.21 - Elimination of repetition.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 10 Energy 2 2014-01-01 2014-01-01 false Elimination of repetition. 61.21 Section 61.21 Energy NUCLEAR REGULATORY COMMISSION (CONTINUED) LICENSING REQUIREMENTS FOR LAND DISPOSAL OF RADIOACTIVE WASTE Licenses § 61.21 Elimination of repetition. In its application, the applicant may incorporate by...

  18. 10 CFR 60.23 - Elimination of repetition.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 10 Energy 2 2013-01-01 2013-01-01 false Elimination of repetition. 60.23 Section 60.23 Energy NUCLEAR REGULATORY COMMISSION (CONTINUED) DISPOSAL OF HIGH-LEVEL RADIOACTIVE WASTES IN GEOLOGIC REPOSITORIES Licenses License Applications § 60.23 Elimination of repetition. In its application,...

  19. 10 CFR 60.23 - Elimination of repetition.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 10 Energy 2 2011-01-01 2011-01-01 false Elimination of repetition. 60.23 Section 60.23 Energy NUCLEAR REGULATORY COMMISSION (CONTINUED) DISPOSAL OF HIGH-LEVEL RADIOACTIVE WASTES IN GEOLOGIC REPOSITORIES Licenses License Applications § 60.23 Elimination of repetition. In its application,...

  20. 10 CFR 61.21 - Elimination of repetition.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 10 Energy 2 2012-01-01 2012-01-01 false Elimination of repetition. 61.21 Section 61.21 Energy NUCLEAR REGULATORY COMMISSION (CONTINUED) LICENSING REQUIREMENTS FOR LAND DISPOSAL OF RADIOACTIVE WASTE Licenses § 61.21 Elimination of repetition. In its application, the applicant may incorporate by...

  1. 10 CFR 60.23 - Elimination of repetition.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 10 Energy 2 2014-01-01 2014-01-01 false Elimination of repetition. 60.23 Section 60.23 Energy NUCLEAR REGULATORY COMMISSION (CONTINUED) DISPOSAL OF HIGH-LEVEL RADIOACTIVE WASTES IN GEOLOGIC REPOSITORIES Licenses License Applications § 60.23 Elimination of repetition. In its application,...

  2. 10 CFR 61.21 - Elimination of repetition.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 10 Energy 2 2013-01-01 2013-01-01 false Elimination of repetition. 61.21 Section 61.21 Energy NUCLEAR REGULATORY COMMISSION (CONTINUED) LICENSING REQUIREMENTS FOR LAND DISPOSAL OF RADIOACTIVE WASTE Licenses § 61.21 Elimination of repetition. In its application, the applicant may incorporate by...

  3. 10 CFR 61.21 - Elimination of repetition.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 10 Energy 2 2011-01-01 2011-01-01 false Elimination of repetition. 61.21 Section 61.21 Energy NUCLEAR REGULATORY COMMISSION (CONTINUED) LICENSING REQUIREMENTS FOR LAND DISPOSAL OF RADIOACTIVE WASTE Licenses § 61.21 Elimination of repetition. In its application, the applicant may incorporate by...

  4. 10 CFR 61.21 - Elimination of repetition.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 10 Energy 2 2010-01-01 2010-01-01 false Elimination of repetition. 61.21 Section 61.21 Energy NUCLEAR REGULATORY COMMISSION (CONTINUED) LICENSING REQUIREMENTS FOR LAND DISPOSAL OF RADIOACTIVE WASTE Licenses § 61.21 Elimination of repetition. In its application, the applicant may incorporate by...

  5. 10 CFR 60.23 - Elimination of repetition.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 10 Energy 2 2010-01-01 2010-01-01 false Elimination of repetition. 60.23 Section 60.23 Energy NUCLEAR REGULATORY COMMISSION (CONTINUED) DISPOSAL OF HIGH-LEVEL RADIOACTIVE WASTES IN GEOLOGIC REPOSITORIES Licenses License Applications § 60.23 Elimination of repetition. In its application,...

  6. Early Grade Repetition and Inattention Associated with Neurofibromatosis Type 1

    ERIC Educational Resources Information Center

    Coude, Francois X.; Mignot, Claire; Lyonnet, Stanislas; Munnich, Arnold

    2007-01-01

    Objective: The authors analyze the occurrence of grade repetition and inattention in children diagnosed with neurofibromatosis type 1 (NF1). Method: The participant group consisted of 310 patients with NF1 and a control group of 242 individuals. The number of grade repetitions for each participant during his or her time in elementary, middle, and…

  7. Varieties of Repetitive Behavior in Autism: Comparisons to Mental Retardation.

    ERIC Educational Resources Information Center

    Bodfish, James W.; Symons, Frank J.; Parker, Dawn E.; Lewis, Mark H.

    2000-01-01

    A study compared specific repetitive behaviors in 32 adults with autism with 34 controls with mental retardation. The occurrence of each behavior category, except dyskinesias, was higher in individuals with autism and they showed a greater number of topographies of stereotypy and compulsions. Repetitive behavior severity also predicated autism…

  8. A Negative Effect of Repetition in Episodic Memory

    ERIC Educational Resources Information Center

    Peterson, Daniel J.; Mulligan, Neil W.

    2012-01-01

    One of the foundational principles of human memory is that repetition (i.e., being presented with a stimulus multiple times) improves recall. In the current study a group of participants who studied a list of cue-target pairs twice recalled fewer targets than a group who studied the pairs only once, a negative repetition effect. Such a…

  9. Conversational Characteristics of Children with Fragile X Syndrome: Repetitive Speech.

    ERIC Educational Resources Information Center

    Belser, Richard C.; Sudhalter, Vicki

    2001-01-01

    Comparison of the production of repetitive speech during conversations in 30 people with either fragile X syndrome, autistic disorder, or mental retardation not caused by fragile X found repetitive speech more prevalent among those with fragile X. Results support the hypothesis that such speech dysfluency reflects the effects of physiological…

  10. Repetition Blindness: Out of Sight or Out of Mind?

    ERIC Educational Resources Information Center

    Morris, Alison L.; Harris, Catherine L.

    2004-01-01

    Does repetition blindness represent a failure of perception or of memory? In Experiment 1, participants viewed rapid serial visual presentation (RSVP) sentences. When critical words (C1 and C2) were orthographically similar, C2 was frequently omitted from serial report; however, repetition priming for C2 on a postsentence lexical decision task was…

  11. Evidence-Based Behavioral Interventions for Repetitive Behaviors in Autism

    ERIC Educational Resources Information Center

    Boyd, Brian A.; McDonough, Stephen G.; Bodfish, James W.

    2012-01-01

    Restricted and repetitive behaviors (RRBs) are a core symptom of autism spectrum disorders (ASD). There has been an increased research emphasis on repetitive behaviors; however, this research primarily has focused on phenomenology and mechanisms. Thus, the knowledge base on interventions is lagging behind other areas of research. The literature…

  12. Neural Correlates of Restricted, Repetitive Behaviors in Autism Spectrum Disorders

    DTIC Science & Technology

    2013-10-01

    Restricted , Repetitive Behaviors in Autism Spectrum Disorders 5a. CONTRACT NUMBER 5b. GRANT NUMBER W81XWH-11-1-0774 5c... Repetitive Behaviors in Autism Spectrum Disorders PRINCIPAL INVESTIGATOR: Associate Professor of Psychiatry Manoach, Dara CONTRACTING...speech network of individuals with autism spectrum disorder NeuroImage: Clinical. in press. CONCLUSION

  13. 10 CFR 63.23 - Elimination of repetition.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 10 Energy 2 2013-01-01 2013-01-01 false Elimination of repetition. 63.23 Section 63.23 Energy NUCLEAR REGULATORY COMMISSION (CONTINUED) DISPOSAL OF HIGH-LEVEL RADIOACTIVE WASTES IN A GEOLOGIC REPOSITORY AT YUCCA MOUNTAIN, NEVADA Licenses License Application § 63.23 Elimination of repetition. In its...

  14. 10 CFR 63.23 - Elimination of repetition.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 10 Energy 2 2012-01-01 2012-01-01 false Elimination of repetition. 63.23 Section 63.23 Energy NUCLEAR REGULATORY COMMISSION (CONTINUED) DISPOSAL OF HIGH-LEVEL RADIOACTIVE WASTES IN A GEOLOGIC REPOSITORY AT YUCCA MOUNTAIN, NEVADA Licenses License Application § 63.23 Elimination of repetition. In its...

  15. 10 CFR 63.23 - Elimination of repetition.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 10 Energy 2 2014-01-01 2014-01-01 false Elimination of repetition. 63.23 Section 63.23 Energy NUCLEAR REGULATORY COMMISSION (CONTINUED) DISPOSAL OF HIGH-LEVEL RADIOACTIVE WASTES IN A GEOLOGIC REPOSITORY AT YUCCA MOUNTAIN, NEVADA Licenses License Application § 63.23 Elimination of repetition. In its...

  16. 10 CFR 63.23 - Elimination of repetition.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 10 Energy 2 2011-01-01 2011-01-01 false Elimination of repetition. 63.23 Section 63.23 Energy NUCLEAR REGULATORY COMMISSION (CONTINUED) DISPOSAL OF HIGH-LEVEL RADIOACTIVE WASTES IN A GEOLOGIC REPOSITORY AT YUCCA MOUNTAIN, NEVADA Licenses License Application § 63.23 Elimination of repetition. In its...

  17. 10 CFR 63.23 - Elimination of repetition.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 10 Energy 2 2010-01-01 2010-01-01 false Elimination of repetition. 63.23 Section 63.23 Energy NUCLEAR REGULATORY COMMISSION (CONTINUED) DISPOSAL OF HIGH-LEVEL RADIOACTIVE WASTES IN A GEOLOGIC REPOSITORY AT YUCCA MOUNTAIN, NEVADA Licenses License Application § 63.23 Elimination of repetition. In its...

  18. Early Grade Repetition and Inattention Associated with Neurofibromatosis Type 1

    ERIC Educational Resources Information Center

    Coude, Francois X.; Mignot, Claire; Lyonnet, Stanislas; Munnich, Arnold

    2007-01-01

    Objective: The authors analyze the occurrence of grade repetition and inattention in children diagnosed with neurofibromatosis type 1 (NF1). Method: The participant group consisted of 310 patients with NF1 and a control group of 242 individuals. The number of grade repetitions for each participant during his or her time in elementary, middle, and…

  19. 10 CFR 52.8 - Combining licenses; elimination of repetition.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 10 Energy 2 2012-01-01 2012-01-01 false Combining licenses; elimination of repetition. 52.8 Section 52.8 Energy NUCLEAR REGULATORY COMMISSION (CONTINUED) LICENSES, CERTIFICATIONS, AND APPROVALS FOR NUCLEAR POWER PLANTS General Provisions § 52.8 Combining licenses; elimination of repetition. (a) An...

  20. 10 CFR 52.8 - Combining licenses; elimination of repetition.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 10 Energy 2 2013-01-01 2013-01-01 false Combining licenses; elimination of repetition. 52.8 Section 52.8 Energy NUCLEAR REGULATORY COMMISSION (CONTINUED) LICENSES, CERTIFICATIONS, AND APPROVALS FOR NUCLEAR POWER PLANTS General Provisions § 52.8 Combining licenses; elimination of repetition. (a) An...

  1. 10 CFR 52.8 - Combining licenses; elimination of repetition.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 10 Energy 2 2010-01-01 2010-01-01 false Combining licenses; elimination of repetition. 52.8 Section 52.8 Energy NUCLEAR REGULATORY COMMISSION (CONTINUED) LICENSES, CERTIFICATIONS, AND APPROVALS FOR NUCLEAR POWER PLANTS General Provisions § 52.8 Combining licenses; elimination of repetition. (a) An...

  2. 10 CFR 52.8 - Combining licenses; elimination of repetition.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 10 Energy 2 2011-01-01 2011-01-01 false Combining licenses; elimination of repetition. 52.8 Section 52.8 Energy NUCLEAR REGULATORY COMMISSION (CONTINUED) LICENSES, CERTIFICATIONS, AND APPROVALS FOR NUCLEAR POWER PLANTS General Provisions § 52.8 Combining licenses; elimination of repetition. (a) An...

  3. 10 CFR 52.8 - Combining licenses; elimination of repetition.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 10 Energy 2 2014-01-01 2014-01-01 false Combining licenses; elimination of repetition. 52.8 Section 52.8 Energy NUCLEAR REGULATORY COMMISSION (CONTINUED) LICENSES, CERTIFICATIONS, AND APPROVALS FOR NUCLEAR POWER PLANTS General Provisions § 52.8 Combining licenses; elimination of repetition. (a) An...

  4. Pre-Lexical Disorders in Repetition Conduction Aphasia

    ERIC Educational Resources Information Center

    Sidiropoulos, Kyriakos; de Bleser, Ria; Ackermann, Hermann; Preilowski, Bruno

    2008-01-01

    At the level of clinical speech/language evaluation, the repetition type of conduction aphasia is characterized by repetition difficulties concomitant with reduced short-term memory capacities, in the presence of fluent spontaneous speech as well as unimpaired naming and reading abilities. It is still unsettled which dysfunctions of the…

  5. Nonword Repetition and Speech Motor Control in Children

    PubMed Central

    Reuterskiöld, Christina; Grigos, Maria I.

    2015-01-01

    This study examined how familiarity of word structures influenced articulatory control in children and adolescents during repetition of real words (RWs) and nonwords (NWs). A passive reflective marker system was used to track articulator movement. Measures of accuracy were obtained during repetition of RWs and NWs, and kinematic analysis of movement duration and variability was conducted. Participants showed greater consonant and vowel accuracy during RW than NW repetition. Jaw movement duration was longer in NWs compared to RWs across age groups, and younger children produced utterances with longer jaw movement duration compared to older children. Jaw movement variability was consistently greater during repetition of NWs than RWs in both groups of participants. The results indicate that increases in phonological short-term memory demands affect articulator movement. This effect is most pronounced in younger children. A range of skills may develop during childhood, which supports NW repetition skills. PMID:26557688

  6. Self-controlled KR schedules: does repetition order matter?

    PubMed

    Patterson, Jae T; Carter, Michael J; Hansen, Steve

    2013-08-01

    The impact of an experimenter-defined repetition schedule on the utility of a self-controlled KR context during motor skill acquisition was examined. Participants were required to learn three novel spatial-temporal tasks in either a random or blocked repetition schedule with or without the opportunity to control their KR. Results from the retention period showed that participants provided control over their KR schedule in a random repetition schedule demonstrated superior learning. However, performance measures from the transfer test showed that, independent of repetition schedule, learners provided the opportunity to control their KR schedule demonstrated superior transfer performance compared to their yoked counterparts. The dissociated impact of repetition schedule and self-controlled KR schedules on retention and transfer is discussed. Copyright © 2013 Elsevier B.V. All rights reserved.

  7. Repetition and Emotive Communication in Music Versus Speech

    PubMed Central

    Margulis, Elizabeth Hellmuth

    2013-01-01

    Music and speech are often placed alongside one another as comparative cases. Their relative overlaps and disassociations have been well explored (e.g., Patel, 2008). But one key attribute distinguishing these two domains has often been overlooked: the greater preponderance of repetition in music in comparison to speech. Recent fMRI studies have shown that familiarity – achieved through repetition – is a critical component of emotional engagement with music (Pereira et al., 2011). If repetition is fundamental to emotional responses to music, and repetition is a key distinguisher between the domains of music and speech, then close examination of the phenomenon of repetition might help clarify the ways that music elicits emotion differently than speech. PMID:23576998

  8. Soliton repetition rate in a silicon-nitride microresonator.

    PubMed

    Bao, Chengying; Xuan, Yi; Wang, Cong; Jaramillo-Villegas, Jose A; Leaird, Daniel E; Qi, Minghao; Weiner, Andrew M

    2017-02-15

    The repetition rate of a Kerr comb composed of a single soliton in an anomalous group velocity dispersion silicon-nitride microcavity is measured as a function of pump frequency. By comparing operation in the soliton and non-soliton states, the contributions from the Raman soliton self-frequency shift (SSFS) and the thermal effects are evaluated; the SSFS is found to dominate the changes in the repetition rate, similar to silica cavities. The relationship between the changes in the repetition rate and the pump frequency detuning is found to be independent of the nonlinearity coefficient and dispersion of the cavity. Modeling of the repetition rate change by using the generalized Lugiato-Lefever equation is discussed; the Kerr shock is found to have only a minor effect on repetition rate for cavity solitons with duration down to ∼50  fs.

  9. Nonword Repetition and Speech Motor Control in Children.

    PubMed

    Reuterskiöld, Christina; Grigos, Maria I

    2015-01-01

    This study examined how familiarity of word structures influenced articulatory control in children and adolescents during repetition of real words (RWs) and nonwords (NWs). A passive reflective marker system was used to track articulator movement. Measures of accuracy were obtained during repetition of RWs and NWs, and kinematic analysis of movement duration and variability was conducted. Participants showed greater consonant and vowel accuracy during RW than NW repetition. Jaw movement duration was longer in NWs compared to RWs across age groups, and younger children produced utterances with longer jaw movement duration compared to older children. Jaw movement variability was consistently greater during repetition of NWs than RWs in both groups of participants. The results indicate that increases in phonological short-term memory demands affect articulator movement. This effect is most pronounced in younger children. A range of skills may develop during childhood, which supports NW repetition skills.

  10. Impaired speech repetition and left parietal lobe damage.

    PubMed

    Fridriksson, Julius; Kjartansson, Olafur; Morgan, Paul S; Hjaltason, Haukur; Magnusdottir, Sigridur; Bonilha, Leonardo; Rorden, Christopher

    2010-08-18

    Patients with left hemisphere damage and concomitant aphasia usually have difficulty repeating others' speech. Although impaired speech repetition, the primary symptom of conduction aphasia, has been associated with involvement of the left arcuate fasciculus, its specific lesion correlate remains elusive. This research examined speech repetition among 45 stroke patients who underwent aphasia testing and MRI examination. Based on lesion-behavior mapping, the primary structural damage most closely associated with impaired speech repetition was found in the posterior portion of the left arcuate fasciculus. However, perfusion-weighted MRI revealed that tissue dysfunction, in the form of either frank damage or hypoperfusion, to the left inferior parietal lobe, rather than the underlying white matter, was associated with impaired speech repetition. This latter result suggests that integrity of the left inferior parietal lobe is important for speech repetition and, as importantly, highlights the importance of examining cerebral perfusion for the purpose of lesion-behavior mapping in acute stroke.

  11. Photocathodes for High Repetition Rate Light Sources

    SciTech Connect

    Ben-Zvi, Ilan

    2014-04-20

    This proposal brought together teams at Brookhaven National Laboratory (BNL), Lawrence Berkeley National Laboratory (LBNL) and Stony Brook University (SBU) to study photocathodes for high repetition rate light sources such as Free Electron Lasers (FEL) and Energy Recovery Linacs (ERL). Below details the Principal Investigators and contact information. Each PI submits separately for a budget through his corresponding institute. The work done under this grant comprises a comprehensive program on critical aspects of the production of the electron beams needed for future user facilities. Our program pioneered in situ and in operando diagnostics for alkali antimonide growth. The focus is on development of photocathodes for high repetition rate Free Electron Lasers (FELs) and Energy Recovery Linacs (ERLs), including testing SRF photoguns, both normal-­conducting and superconducting. Teams from BNL, LBNL and Stony Brook University (SBU) led this research, and coordinated their work over a range of topics. The work leveraged a robust infrastructure of existing facilities and the support was used for carrying out the research at these facilities. The program concentrated in three areas: a) Physics and chemistry of alkali-­antimonide cathodes (BNL – LBNL) b) Development and testing of a diamond amplifier for photocathodes (SBU -­ BNL) c) Tests of both cathodes in superconducting RF photoguns (SBU) and copper RF photoguns (LBNL) Our work made extensive use of synchrotron radiation materials science techniques, such as powder-­ and single-­crystal diffraction, x-­ray fluorescence, EXAFS and variable energy XPS. BNL and LBNL have many complementary facilities at the two light sources associated with these laboratories (NSLS and ALS, respectively); use of these will be a major thrust of our program and bring our understanding of these complex materials to a new level. In addition, CHESS at Cornell will be used to continue seamlessly throughout the NSLS dark period and

  12. Physical Characteristics Underpinning Repetitive Lunging in Fencing.

    PubMed

    Turner, Anthony N; Marshall, Geoff; Phillips, James; Noto, Angelo; Buttigieg, Conor; Chavda, Shyam; Downing, William; Atlay, Nathan; Dimitriou, Lygeri; Kilduff, Laim

    2016-11-01

    Turner, AN, Marshall, G, Phillips, J, Noto, A, Buttigieg, C, Chavda, S, Downing, W, Atlay, N, Dimitriou, L, and Kilduff, L. Physical characteristics underpinning repetitive lunging in fencing. J Strength Cond Res 30(11): 3134-3139, 2016-Given the repetitive demand to execute lunging and changes in direction within fencing, the ability to sustain these at maximal capacity is fundamental to performance. The aim of this study was threefold. First, to provide normative values for this variable referred to as repeat lunge ability (RLA) and second to identify the physical characteristics that underpin it. Third, was to establish if a cause and effect relationship existed by training the associated characteristics. Assessment of lower-body power, reactive strength, speed, change of direction speed (CODS), and a sport-specific RLA were conducted on senior and junior elite male fencers (n = 36). Fencers were on average (±SD) 18.9 ± 3.2 years of age, 174.35 ± 10.42 cm tall, 70.67 ± 7.35 kg in mass, and 8.5 ± 4.2 years fencing experience. The RLA test had average work times of 16.03 ± 1.40 seconds and demonstrated "large" to "very large" associations with all tested variables, but in particular CODS (r = 0.70) and standing broad jump (SBJ; r = -0.68). Through linear regression analysis, these also provided a 2-predictor model accounting for 61% of the common variance associated with RLA. A cause and effect relationship with SBJ and CODS was confirmed by the training group, where RLA performance in these fencers improved from 15.80 ± 1.07 to 14.90 ± 0.86 seconds, with the magnitude of change reported as "moderate" (effect size (ES) = 0.93). Concurrent improvements were also noted in both SBJ (216.86 ± 17.15 vs. 221.71 ± 17.59 cm) and CODS (4.44 ± 0.29 vs. 4.31 ± 0.09 seconds) and while differences were only significant in SBJ, magnitudes of change were classed as "small" (ES = 0.28) and "moderate" (ES = 0.61), respectively. In conclusion, to improve RLA strength

  13. Can the Edinburgh Risk of Repetition Scale Predict Repetition of Deliberate Self-Poisoning in an Australian Clinical Setting?

    ERIC Educational Resources Information Center

    Carter, Gregory Leigh; Clover, Kerrie Ann; Bryant, Jennifer Lynn; Whyte, Ian MacGregor

    2002-01-01

    Tests the ability of the Edinburgh Risk of Repetition Scale (ERRS) to identify patients at high risk for repeat deliberate self-poisoning (DSP). A statistically significant relationship between ERRS scores and repetition was observed; however, sensitivity and specificity were low. The ERRS had limited value in identifying patients at high risk of…

  14. Can the Edinburgh Risk of Repetition Scale Predict Repetition of Deliberate Self-Poisoning in an Australian Clinical Setting?

    ERIC Educational Resources Information Center

    Carter, Gregory Leigh; Clover, Kerrie Ann; Bryant, Jennifer Lynn; Whyte, Ian MacGregor

    2002-01-01

    Tests the ability of the Edinburgh Risk of Repetition Scale (ERRS) to identify patients at high risk for repeat deliberate self-poisoning (DSP). A statistically significant relationship between ERRS scores and repetition was observed; however, sensitivity and specificity were low. The ERRS had limited value in identifying patients at high risk of…

  15. Generation of low-timing-jitter femtosecond pulse trains with 2 GHz repetition rate via external repetition rate multiplication.

    PubMed

    Chen, Jian; Sickler, Jason W; Fendel, Peter; Ippen, Erich P; Kärtner, Franz X; Wilken, Tobias; Holzwarth, Ronald; Hänsch, Theodor W

    2008-05-01

    Generation of low-timing-jitter 150 fs pulse trains at 1560 nm with 2 GHz repetition rate is demonstrated by locking a 200 MHz fundamental polarization additive-pulse mode-locked erbium fiber laser to high-finesse external Fabry-Perot cavities. The timing jitter and relative intensity noise of the repetition-rate multiplied pulse train are investigated.

  16. SI Engine with repetitive NS spark plug

    NASA Astrophysics Data System (ADS)

    Pancheshniy, Sergey; Nikipelov, Andrey; Anokhin, Eugeny; Starikovskiy, Andrey; Laplase Team; Mipt Team; Pu Team

    2013-09-01

    Now de-facto the only technology for fuel-air mixtures ignition in IC engines exists. It is a spark discharge of millisecond duration in a short discharge gap. The reason for such a small variety of methods of ignition initiation is very specific conditions of the engine operation. First, it is very high-pressure of fuel-air mixture - from 5-7 atmospheres in old-type engines and up to 40-50 atmospheres on the operating mode of HCCI. Second, it is a very wide range of variation of the oxidizer/fuel ratio in the mixture - from almost stoichiometric (0.8-0.9) at full load to very lean (φ = 0.3-0.5) mixtures at idle and/or economical cruising mode. Third, the high velocity of the gas in the combustion chamber (up to 30-50 m/s) resulting in a rapid compression of swirling inlet flow. The paper presents the results of tests of distributed spark ignition system powered by repetitive pulse nanosecond discharge. Dynamic pressure measurements show the increased pressure and frequency stability for nanosecond excitation in comparison with the standard spark plug. Excitation by single nanosecond high-voltage pulse and short train of pulses was examined. In all regimes the nanosecond pulsed excitation demonstrate a better performance.

  17. [Rehabilitation Using Repetitive Transcranial Magnetic Stimulation].

    PubMed

    Takeuchi, Naoyuki; Izumi, Shin-Ichi

    2017-03-01

    Various novel stroke rehabilitative methods have been developed based on findings in basic science and clinical research. Recently, many reports have shown that repetitive transcranial magnetic stimulation (rTMS) improves function in stroke patients by altering the excitability of the human cortex. The interhemispheric competition model proposes that deficits in stroke patients are due to reduced output from the affected hemisphere and excessive interhemispheric inhibition from the unaffected hemisphere to the affected hemisphere. The interhemispheric competition model indicates that improvement in deficits can be achieved either by increasing the excitability of the affected hemisphere using excitatory rTMS or by decreasing the excitability of the unaffected hemisphere using inhibitory rTMS. Recovery after stroke is related to neural plasticity, which involves developing new neural connections, acquiring new functions, and compensating for impairments. Artificially modulating the neural network by rTMS may induce a more suitable environment for use-dependent plasticity and also may interfere with maladaptive neural activation, which weakens function and limits recovery. There is potential, therefore, for rTMS to be used as an adjuvant therapy for developed neurorehabilitation techniques in stroke patients.

  18. Development of a repetitive compact torus injector

    NASA Astrophysics Data System (ADS)

    Onchi, Takumi; McColl, David; Dreval, Mykola; Rohollahi, Akbar; Xiao, Chijin; Hirose, Akira; Zushi, Hideki

    2013-10-01

    A system for Repetitive Compact Torus Injection (RCTI) has been developed at the University of Saskatchewan. CTI is a promising fuelling technology to directly fuel the core region of tokamak reactors. In addition to fuelling, CTI has also the potential for (a) optimization of density profile and thus bootstrap current and (b) momentum injection. For steady-state reactor operation, RCTI is necessary. The approach to RCTI is to charge a storage capacitor bank with a large capacitance and quickly charge the CT capacitor bank through a stack of integrated-gate bipolar transistors (IGBTs). When the CT bank is fully charged, the IGBT stack will be turned off to isolate banks, and CT formation/acceleration sequence will start. After formation of each CT, the fast bank will be replenished and a new CT will be formed and accelerated. Circuits for the formation and the acceleration in University of Saskatchewan CT Injector (USCTI) have been modified. Three CT shots at 10 Hz or eight shots at 1.7 Hz have been achieved. This work has been sponsored by the CRC and NSERC, Canada.

  19. A chenopod extensin lacks repetitive tetrahydroxyproline blocks

    SciTech Connect

    Li, Xiongbiao; Kieliszewski, M.; Lamport, D.T.A. )

    1990-02-01

    An extensin isolated from sugar beet (Beta vulgaris) cell suspension cultures fulfills all criteria for membership of the extensin family save one, notably, lack of the diagnostic pentamer Ser-Hyp-Hyp-Hyp-Hyp. However, sequence analysis of the major tryptic peptides shows that sugar beet extensin shares a motif in common with tomato extensin P1 but differs by the position of an insertion sequence (X) or (Y) which, in sugar beet, splits the tetrahydroxyproline block: Ser-Hyp-Hyp-(X)-Hyp-Hyp-Thr-Hyp-Val-Tyr-Lys, where (X) is (Val-His-Glu/Lys-Tyr-Pro), while in tomato the insertion sequence (Y) = (Val-Lys-Pro-Tyr-His-Pro) and, when it occurs, immediately follows the tetrahydroxyproline block: Ser-Hyp-Hyp-Hyp-Hyp-(Y)-Thr-Hyp-Val-Tyr-Lys. Based on these data were reinterpret three highly repetitive cDNA sequences, including nodulin N75 from soybean and wound-induced P33 of carrot, as extensins with split tetra(hydroxy)proline blocks.

  20. Repetitive transcranial magnetic stimulation and drug addiction.

    PubMed

    Barr, Mera S; Farzan, Faranak; Wing, Victoria C; George, Tony P; Fitzgerald, Paul B; Daskalakis, Zafiris J

    2011-10-01

    Repetitive transcranial magnetic stimulation (rTMS) is a non-invasive brain stimulation technique that is now being tested for its ability to treat addiction. This review discusses current research approaches and results of studies which measured the therapeutic use of rTMS to treat tobacco, alcohol and illicit drug addiction. The research in this area is limited and therefore all studies evaluating the therapeutic use of rTMS in tobacco, alcohol or illicit drug addiction were retained including case studies through NCBI PubMed ( http://www.ncbi.nlm.nih.gov ) and manual searches. A total of eight studies were identified that examined the ability of rTMS to treat tobacco, alcohol and cocaine addiction. The results of this review indicate that rTMS is effective in reducing the level of cravings for smoking, alcohol, and cocaine when applied at high frequencies to the dorsolateral prefrontal cortex (DLPFC). Furthermore, these studies suggest that repeated sessions of high frequency rTMS over the DLPFC may be most effective in reducing the level of smoking and alcohol consumption. Although work in this area is limited, this review indicates that rTMS is a promising modality for treating drug addiction.

  1. Repetitive Interrogation of 2-Level Quantum Systems

    NASA Technical Reports Server (NTRS)

    Prestage, John D.; Chung, Sang K.

    2010-01-01

    Trapped ion clocks derive information from a reference atomic transition by repetitive interrogations of the same quantum system, either a single ion or ionized gas of many millions of ions. Atomic beam frequency standards, by contrast, measure reference atomic transitions in a continuously replenished "flow through" configuration where initial ensemble atomic coherence is zero. We will describe some issues and problems that can arise when atomic state selection and preparation of the quantum atomic system is not completed, that is, optical pumping has not fully relaxed the coherence and also not fully transferred atoms to the initial state. We present a simple two-level density matrix analysis showing how frequency shifts during the state-selection process can cause frequency shifts of the measured clock transition. Such considerations are very important when a low intensity lamp light source is used for state selection, where there is relatively weak relaxation and re-pumping of ions to an initial state and much weaker 'environmental' relaxation of the atomic coherence set-up in the atomic sample.

  2. Repetitive switching for an electromagnetic rail gun

    NASA Astrophysics Data System (ADS)

    Gruden, J. M.

    1983-12-01

    Previous testing on a repetitive opening switch for inductive energy storage has proved the feasibility of the rotary switch concept. The concept consists of a rotating copper disk (rotor) with a pie-shaped insulator section and brushes which slide along each of the rotor surfaces. While on top of the copper surface, the brushes and rotor conduct current allowing the energy storage inductor to charge. When the brushes slide onto the insulator section, the current cannot pass through the rotor and is diverted into the load. This study investigates two new brush designs and a rotor modification designed to improve the current commutating capabilities of the switch. One brush design (fringe fiber) employs carbon fibers on the leading and trailing edge of the brush to increase the resistive commutating action as the switch opens and closes. The other brush design uses fingers to conduct current to the rotor surface, effectively increasing the number of brush contact points. The rotor modification was the placement of tungsten inserts at the copper-insulator interfaces.

  3. Repetitive Interrogation of 2-Level Quantum Systems

    NASA Technical Reports Server (NTRS)

    Prestage, John D.; Chung, Sang K.

    2010-01-01

    Trapped ion clocks derive information from a reference atomic transition by repetitive interrogations of the same quantum system, either a single ion or ionized gas of many millions of ions. Atomic beam frequency standards, by contrast, measure reference atomic transitions in a continuously replenished "flow through" configuration where initial ensemble atomic coherence is zero. We will describe some issues and problems that can arise when atomic state selection and preparation of the quantum atomic system is not completed, that is, optical pumping has not fully relaxed the coherence and also not fully transferred atoms to the initial state. We present a simple two-level density matrix analysis showing how frequency shifts during the state-selection process can cause frequency shifts of the measured clock transition. Such considerations are very important when a low intensity lamp light source is used for state selection, where there is relatively weak relaxation and re-pumping of ions to an initial state and much weaker 'environmental' relaxation of the atomic coherence set-up in the atomic sample.

  4. Understanding communicative actions: a repetitive TMS study.

    PubMed

    Stolk, Arjen; Noordzij, Matthijs L; Volman, Inge; Verhagen, Lennart; Overeem, Sebastiaan; van Elswijk, Gijs; Bloem, Bas; Hagoort, Peter; Toni, Ivan

    2014-02-01

    Despite the ambiguity inherent in human communication, people are remarkably efficient in establishing mutual understanding. Studying how people communicate in novel settings provides a window into the mechanisms supporting the human competence to rapidly generate and understand novel shared symbols, a fundamental property of human communication. Previous work indicates that the right posterior superior temporal sulcus (pSTS) is involved when people understand the intended meaning of novel communicative actions. Here, we set out to test whether normal functioning of this cerebral structure is required for understanding novel communicative actions using inhibitory low-frequency repetitive transcranial magnetic stimulation (rTMS). A factorial experimental design contrasted two tightly matched stimulation sites (right pSTS vs left MT+, i.e., a contiguous homotopic task-relevant region) and tasks (a communicative task vs a visual tracking task that used the same sequences of stimuli). Overall task performance was not affected by rTMS, whereas changes in task performance over time were disrupted according to TMS site and task combinations. Namely, rTMS over pSTS led to a diminished ability to improve action understanding on the basis of recent communicative history, while rTMS over MT+ perturbed improvement in visual tracking over trials. These findings qualify the contributions of the right pSTS to human communicative abilities, showing that this region might be necessary for incorporating previous knowledge, accumulated during interactions with a communicative partner, to constrain the inferential process that leads to action understanding.

  5. Repetition reduction during word and concept overlap in bilinguals

    PubMed Central

    Lam, Tuan Q.; Marian, Viorica

    2015-01-01

    In natural conversation, speakers often mention the same referents multiple times. While referents that have been previously mentioned are produced with less prominence than those that have not been mentioned, it is unclear whether prominence reduction is due to repetition of concepts, words, or a combination of the two. In the current study, we dissociate these sources of repetition by examining bilingual speakers, who have more than one word for the same concept across their two languages. Three groups of Korean-English bilinguals (balanced, English-dominant, and Korean-dominant) performed an event description task involving repetition of referents within a single language (i.e., repetition of word and concept) or across languages (i.e., repetition of concept only). While balanced bilinguals reduced prominence both within and across languages, unbalanced bilinguals only reduced prominence when repetition occurred within a language. These patterns suggest that the degree to which words and concepts are linked within a speaker’s language system determines the source of repetition reduction. PMID:26166943

  6. Is conflict adaptation triggered by feature repetitions? An unexpected finding

    PubMed Central

    Lierde, Elke Van; Desender, Kobe; den Bussche, Eva Van

    2015-01-01

    For decades, cognitive adaptation to response conflict has been considered to be the hallmark of cognitive control. Notwithstanding a vast amount of evidence ruling out low-level interpretations of these findings, disbelief still exists with regard to the underlying cause of the observed effects. Especially when considering cognitive adaptation to unconscious conflict, it is still a matter of debate whether repetitions of features between trials might explain this intriguing finding rather than the involvement of unconscious control. To this purpose, we conducted two masked priming experiments in which four different responses to four different stimuli were required. This allowed us to completely eliminate repetitions of prime and target over consecutive trials. Independent of whether conflicting information was presented clearly visible or almost imperceptible, the results showed an unexpected pattern. Contrary to the regular congruency sequence effect (CSE; i.e., classic Gratton effect), in both experiments the congruency effect increased following incongruent trials. Interestingly, this reversed effect completely disappeared when we eliminated all trials with feature repetitions from the analysis. A third experiment, in which feature repetitions were excluded a priori, showed a small but regular CSE in the error rates only. Given that feature repetitions are theoretically thought to create a regular CSE, our results are not in line with an interpretation in terms of feature repetitions nor with an interpretation in terms of cognitive control. We conclude that examining cognitive adaptation with or without feature repetitions might be more difficult to conceive than is often suggested in the literature. PMID:25698982

  7. Abstract and concrete repetitive thinking modes in alcohol-dependence.

    PubMed

    Grynberg, Delphine; de Timary, Philippe; Philippot, Pierre; D'Hondt, Fabien; Briane, Yasmine; Devynck, Faustine; Douilliez, Céline; Billieux, Joël; Heeren, Alexandre; Maurage, Pierre

    2016-01-01

    Emotional and interpersonal deficits play a crucial role in alcohol-related disorders as they predict alcohol consumption and relapse. Recent models of emotion regulation in psychopathology postulate that these deficits are centrally related to increased abstract/analytic repetitive thinking, combined with reduced concrete/experiential repetitive thinking. As this assumption has not been tested in addictions, this study aimed at investigating repetitive thinking modes in a large sample of alcohol-dependent individuals. One hundred recently detoxified alcohol-dependent individuals (29 females; mean age = 49.51-years-old) recruited during the 3rd week of their treatment in a detoxification center were compared to 100 healthy controls (29 females; mean age = 48.51-years-old) recruited in the experimenters' social network, matched at the group level for age, gender, and educational level. All participants completed the Mini Cambridge Exeter Repetitive Thought Scale measuring abstract/analytic and concrete/experiential repetitive thinking modes as well as complementary psychopathological measures (Beck Depression Inventory and State/Trait Anxiety Inventory). Alcohol-dependent individuals have similar levels of concrete repetitive thinking as controls but report significantly higher levels of abstract repetitive thinking (p < 0.001; d = 1.28). This effect remains significant after controlling for depression and anxiety. Relative to healthy controls, alcohol-dependent patients report more frequent use of abstract/analytic repetitive thinking, with preserved concrete/experiential thinking. Despite the cross-sectional nature of the study, the frequent use of abstract repetitive thinking thus appears to constitute a main feature of alcohol-dependence.

  8. Application of a clustering-based peak alignment algorithm to analyze various DNA fingerprinting data.

    PubMed

    Ishii, Satoshi; Kadota, Koji; Senoo, Keishi

    2009-09-01

    DNA fingerprinting analysis such as amplified ribosomal DNA restriction analysis (ARDRA), repetitive extragenic palindromic PCR (rep-PCR), ribosomal intergenic spacer analysis (RISA), and denaturing gradient gel electrophoresis (DGGE) are frequently used in various fields of microbiology. The major difficulty in DNA fingerprinting data analysis is the alignment of multiple peak sets. We report here an R program for a clustering-based peak alignment algorithm, and its application to analyze various DNA fingerprinting data, such as ARDRA, rep-PCR, RISA, and DGGE data. The results obtained by our clustering algorithm and by BioNumerics software showed high similarity. Since several R packages have been established to statistically analyze various biological data, the distance matrix obtained by our R program can be used for subsequent statistical analyses, some of which were not previously performed but are useful in DNA fingerprinting studies.

  9. Emergence of Extensively Drug-Resistant Haemophilus parainfluenzae in Switzerland

    PubMed Central

    Tinguely, Regula; Seiffert, Salome N.; Furrer, Hansjakob; Perreten, Vincent; Droz, Sara

    2013-01-01

    Two homosexual men were colonized in the urethra with Haemophilus parainfluenzae nonsusceptible to ampicillin (MIC, 8 μg/ml), amoxicillin-clavulanate (MIC, 4 μg/ml), cefotaxime (MIC, 1.5 μg/ml), cefepime (MIC, 3 μg/ml), meropenem (MIC, 0.5 μg/ml), cefuroxime, azithromycin, ciprofloxacin, tetracycline, and chloramphenicol (all MICs, ≥32 μg/ml). Repetitive extragenic palindromic PCR (rep-PCR) showed that the strains were indistinguishable. The isolates had amino acid substitutions in PBP3, L4, GyrA, and ParC and possessed Mef(A), Tet(M), and CatS resistance mechanisms. This is the first report of extensively drug-resistant (XDR) H. parainfluenzae. PMID:23545526

  10. Genetic analyses of Xanthomonas axonopodis pv. dieffenbachiae strains reveal distinct phylogenetic groups.

    PubMed

    Donahoo, R S; Jones, J B; Lacy, G H; Stromberg, V K; Norman, D J

    2013-03-01

    A comprehensive analysis of 175 Xanthomonas axonopodis pv. dieffenbachiae strains isolated from 10 Araceae hosts was done to identify pathogen variation. The strains were subjected to repetitive extragenic palindromic sequence polymerase chain reaction and four major phylogenetic clusters were generated. A subset of 40 strains isolated from Anthurium, Dieffenbachia, and Syngonium was further defined by amplified fragment length polymorphism and fatty acid methyl ester analysis and the same four phylogenetic clusters were observed. Comparison of representative strains in the first three clusters using DNA-DNA hybridization and multilocus sequence analysis supports the previous reclassification of strains in cluster I, including the X. axonopodis pv. dieffenbachiae pathovar reference strain (LMG695), to X. citri. Our research findings indicate that strains in cluster I, isolated primarily from anthurium, probably represent an undescribed pathovar. Other phylogenetic subclusters consisting primarily of strains isolated from xanthosoma and philodendron in clusters III and IV, respectively, may yet represent other undescribed species or pathovars of Xanthomonas.

  11. Epithelial topography for repetitive tooth formation

    PubMed Central

    Gaete, Marcia; Fons, Juan Manuel; Popa, Elena Mădălina; Chatzeli, Lemonia; Tucker, Abigail S.

    2015-01-01

    ABSTRACT During the formation of repetitive ectodermally derived organs such as mammary glands, lateral line and teeth, the tissue primordium iteratively initiates new structures. In the case of successional molar development, new teeth appear sequentially in the posterior region of the jaw from Sox2+ cells in association with the posterior aspect of a pre-existing tooth. The sequence of molar development is well known, however, the epithelial topography involved in the formation of a new tooth is unclear. Here, we have examined the morphology of the molar dental epithelium and its development at different stages in the mouse in vivo and in molar explants. Using regional lineage tracing we show that within the posterior tail of the first molar the primordium for the second and third molar are organized in a row, with the tail remaining in connection with the surface, where a furrow is observed. The morphology and Sox2 expression of the tail retains characteristics reminiscent of the earlier stages of tooth development, such that position along the A-P axes of the tail correlates with different temporal stages. Sox9, a stem/progenitor cell marker in other organs, is expressed mainly in the suprabasal epithelium complementary with Sox2 expression. This Sox2 and Sox9 expressing molar tail contains actively proliferating cells with mitosis following an apico-basal direction. Snail2, a transcription factor implicated in cell migration, is expressed at high levels in the tip of the molar tail while E-cadherin and laminin are decreased. In conclusion, our studies propose a model in which the epithelium of the molar tail can grow by posterior movement of epithelial cells followed by infolding and stratification involving a population of Sox2+/Sox9+ cells. PMID:26538639

  12. Repetition enhancement and memory effects for duration.

    PubMed

    Wiener, Martin; Thompson, James C

    2015-06-01

    A remarkable aspect of conscious perception is that moments carryover from one to the next, also known as temporal continuity. This ability is thus crucial for detecting regularities, such as in speech and music, and may rely on an accurate perception of time. Investigations of human time perception have detailed two electroencephalographic (EEG) components associated with timing, the contingent negative variation (CNV) and late positive component of timing (LPCt); however, the precise roles of these components in timing remain elusive. Recently, we demonstrated that the perception of duration is influenced by durations presented on prior trials, which we explained by the creation of an implicit memory standard that adapts to local changes in sequence presentation. Here, we turn to the neural basis of this effect. Human participants performed a temporal bisection task in which they were required to classify the duration of auditory stimuli into short and long duration categories; crucially, the presentation order was first-order counterbalanced, allowing us to measure the effect of each presented duration on the next. EEG recordings revealed that the CNV and LPCt signals both covaried with the duration presented on the current trial, with CNV predicting reaction time and LPCt predicting choice. Additionally, both signals covaried with the duration presented in the prior trial but in different ways, with the CNV amplitude reflecting the change in the memory standard and the LPCt reflecting decision uncertainty. Furthermore, we observed a repetition enhancement effect of duration only for the CNV, suggesting that this signal additionally indexes the similarity of successive durations. These findings demonstrate dissociable roles for the CNV and LPCt, and demonstrate that both signals are continuously updated on a trial-by-trial basis that reflects shifts in temporal decisions. Copyright © 2015 Elsevier Inc. All rights reserved.

  13. Clinical application of repetitive transcranial magnetic stimulation in stroke rehabilitation☆

    PubMed Central

    Shin, Joonho; Yang, EunJoo; Cho, KyeHee; Barcenas, Carmelo L; Kim, Woo Jin; Min, Yusun; Paik, Nam-Jong

    2012-01-01

    Proper stimulation to affected cerebral hemisphere would promote the functional recovery of patients with stroke. Effects of repetitive transcranial magnetic stimulation on cortical excitability can be can be altered by the stimulation frequency, intensity and duration. There has been no consistent recognition regarding the best stimulation frequency and intensity. This study reviews the intervention effects of repetitive transcranial stimulation on motor impairment, dysphagia, visuospatial neglect and aphasia, and summarizes the stimulation frequency, intensity and area for repetitive transcranial magnetic stimulation to yield the best therapeutic effects. PMID:25745455

  14. Progress in developing repetitive pulse systems utilizing inductive energy storage

    SciTech Connect

    Honig, E.M.

    1983-01-01

    High-power, fast-recovery vacuum switches were used in a new repetitive counterpulse and transfer circuit to deliver a 5-kHz pulse train with a peak power of 75 MW (at 8.6 kA) to a 1-..cap omega.. load, resulting in the first demonstration of fully controlled, high-power, high-repetition-rate operation of an inductive energy-storage and transfer system with nondestructive switches. New circuits, analytical and experimental results, and feasibility of 100-kV repetitive pulse generation are discussed. A new switching concept for railgun loads is presented.

  15. Cumulative effects of repetitive mild traumatic brain injury.

    PubMed

    Bailes, Julian E; Dashnaw, Matthew L; Petraglia, Anthony L; Turner, Ryan C

    2014-01-01

    The majority of traumatic brain injuries (TBI) in the USA are mild in severity. Sports, particularly American football, and military experience are especially associated with repetitive, mild TBI (mTBI). The consequences of repetitive brain injury have garnered increasing scientific and public attention following reports of altered mood and behavior, as well as progressive neurological dysfunction many years after injury. This report provides an up-to-date review of the clinical, pathological, and pathophysiological changes associated with repetitive mTBI, and their potential for cumulative effects in certain individuals.

  16. Transgenic Clustered Regularly Interspaced Short Palindromic Repeat/Cas9-Mediated Viral Gene Targeting for Antiviral Therapy of Bombyx mori Nucleopolyhedrovirus

    PubMed Central

    Chen, Shuqing; Hou, Chengxiang; Bi, Honglun; Wang, Yueqiang; Xu, Jun; Li, Muwang; James, Anthony A.

    2017-01-01

    ABSTRACT We developed a novel antiviral strategy by combining transposon-based transgenesis and the clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated 9 (Cas9) system for the direct cleavage of Bombyx mori nucleopolyhedrovirus (BmNPV) genome DNA to promote virus clearance in silkworms. We demonstrate that transgenic silkworms constitutively expressing Cas9 and guide RNAs targeting the BmNPV immediate early-1 (ie-1) and me53 genes effectively induce target-specific cleavage and subsequent mutagenesis, especially large (∼7-kbp) segment deletions in BmNPV genomes, and thus exhibit robust suppression of BmNPV proliferation. Transgenic animals exhibited higher and inheritable resistance to BmNPV infection than wild-type animals. Our approach will not only contribute to modern sericulture but also shed light on future antiviral therapy. IMPORTANCE Pathogen genome targeting has shown its potential in antiviral research. However, transgenic CRISPR/Cas9 system-mediated viral genome targeting has not been reported as an antiviral strategy in a natural animal host of a virus. Our data provide an effective approach against BmNPV infection in a real-world biological system and demonstrate the potential of transgenic CRISPR/Cas9 systems in antiviral research in other species. PMID:28122981

  17. Escaping the cut by restriction enzymes through single-strand self-annealing of host-edited 12-bp and longer synthetic palindromes.

    PubMed

    Castro-Chavez, Fernando

    2012-02-01

    Palindromati, the massive host-edited synthetic palindromic contamination found in GenBank, is illustrated and exemplified. Millions of contaminated sequences with portions or tandems of such portions derived from the ZAP adaptor or related linkers are shown (1) by the 12-bp sequence reported elsewhere, exon Xb, 5' CCCGAATTCGGG 3', (2) by a 22-bp related sequence 5' CTCGTGCCGAATTCGGCACGAG 3', and (3) by a longer 44-bp related sequence: 5' CTCGTGCCGAATTCGGCACGAGCTCGTGCCGAATTCGGCACGAG 3'. Possible reasons for why those long contaminating sequences continue in the databases are presented here: (1) the recognition site for the plus strand (+) is single-strand self-annealed; (2) the recognition site for the minus strand (-) is not only single-strand self-annealed but also located far away from the single-strand self-annealed plus strand, rendering impossible the formation of the active EcoRI enzyme dimer to cut on 5' G/AATTC 3', its target sequence. As a possible solution, it is suggested to rely on at least two or three independent results, such as sequences obtained by independent laboratories with the use, preferably, of independent sequencing methodologies. This information may help to develop tools for bioinformatics capable to detect/remove these contaminants and to infer why some damaged sequences which cause genetic diseases escape detection by the molecular quality control mechanism of cells and organisms, being undesirably transferred unchecked through the generations.

  18. Clustered regulatory interspaced short palindromic repeats (CRISPR)-mediated mutagenesis and phenotype rescue by piggyBac transgenesis in a nonmodel Drosophila species.

    PubMed

    Tanaka, R; Murakami, H; Ote, M; Yamamoto, D

    2016-08-01

    How behavioural diversity emerged in evolution is an unexplored subject in biology. To tackle this problem, genes and circuits for a behaviour need to be determined in different species for phylogenetic comparisons. The recently developed clustered regulatory interspaced short palindromic repeats/CRISPR associated protein9 (CRISPR/Cas9) system made such a challenge possible by providing the means to induce mutations in a gene of interest in any organism. Aiming at elucidating diversification in genetic and neural networks for courtship behaviour, we attempted to generate a genetic tool kit in Drosophila subobscura, a nonmodel species distantly related to the genetic model Drosophila melanogaster. Here we report the generation of yellow (y) and white mutations with the aid of the CRISPR/Cas9 system, and the rescue of the y mutant phenotype by germline transformation of the newly established y mutant fly line with a y(+) -marked piggyBac vector. This successful mutagenesis and transformation in D. subobscura open up an avenue for comprehensive genetic analyses of higher functions in this and other nonmodel Drosophila species, representing a key step toward systematic comparisons of genes and circuitries underlying behaviour amongst species. © 2016 The Royal Entomological Society.

  19. Diversity, Evolution, and Functionality of Clustered Regularly Interspaced Short Palindromic Repeat (CRISPR) Regions in the Fire Blight Pathogen Erwinia amylovora▿†

    PubMed Central

    Rezzonico, Fabio; Smits, Theo H. M.; Duffy, Brion

    2011-01-01

    The clustered regularly interspaced short palindromic repeat (CRISPR)/Cas system confers acquired heritable immunity against mobile nucleic acid elements in prokaryotes, limiting phage infection and horizontal gene transfer of plasmids. In CRISPR arrays, characteristic repeats are interspersed with similarly sized nonrepetitive spacers derived from transmissible genetic elements and acquired when the cell is challenged with foreign DNA. New spacers are added sequentially and the number and type of CRISPR units can differ among strains, providing a record of phage/plasmid exposure within a species and giving a valuable typing tool. The aim of this work was to investigate CRISPR diversity in the highly homogeneous species Erwinia amylovora, the causal agent of fire blight. A total of 18 CRISPR genotypes were defined within a collection of 37 cosmopolitan strains. Strains from Spiraeoideae plants clustered in three major groups: groups II and III were composed exclusively of bacteria originating from the United States, whereas group I generally contained strains of more recent dissemination obtained in Europe, New Zealand, and the Middle East. Strains from Rosoideae and Indian hawthorn (Rhaphiolepis indica) clustered separately and displayed a higher intrinsic diversity than that of isolates from Spiraeoideae plants. Reciprocal exclusion was generally observed between plasmid content and cognate spacer sequences, supporting the role of the CRISPR/Cas system in protecting against foreign DNA elements. However, in several group III strains, retention of plasmid pEU30 is inconsistent with a functional CRISPR/Cas system. PMID:21460108

  20. Characterization of genomic deletion efficiency mediated by clustered regularly interspaced palindromic repeats (CRISPR)/Cas9 nuclease system in mammalian cells.

    PubMed

    Canver, Matthew C; Bauer, Daniel E; Dass, Abhishek; Yien, Yvette Y; Chung, Jacky; Masuda, Takeshi; Maeda, Takahiro; Paw, Barry H; Orkin, Stuart H

    2014-08-01

    The clustered regularly interspaced palindromic repeats (CRISPR)/CRISPR-associated (Cas) 9 nuclease system has provided a powerful tool for genome engineering. Double strand breaks may trigger nonhomologous end joining repair, leading to frameshift mutations, or homology-directed repair using an extrachromosomal template. Alternatively, genomic deletions may be produced by a pair of double strand breaks. The efficiency of CRISPR/Cas9-mediated genomic deletions has not been systematically explored. Here, we present a methodology for the production of deletions in mammalian cells, ranging from 1.3 kb to greater than 1 Mb. We observed a high frequency of intended genomic deletions. Nondeleted alleles are nonetheless often edited with inversions or small insertion/deletions produced at CRISPR recognition sites. Deleted alleles also typically include small insertion/deletions at predicted deletion junctions. We retrieved cells with biallelic deletion at a frequency exceeding that of probabilistic expectation. We demonstrate an inverse relationship between deletion frequency and deletion size. This work suggests that CRISPR/Cas9 is a robust system to produce a spectrum of genomic deletions to allow investigation of genes and genetic elements.

  1. Characterization of Genomic Deletion Efficiency Mediated by Clustered Regularly Interspaced Palindromic Repeats (CRISPR)/Cas9 Nuclease System in Mammalian Cells*♦

    PubMed Central

    Canver, Matthew C.; Bauer, Daniel E.; Dass, Abhishek; Yien, Yvette Y.; Chung, Jacky; Masuda, Takeshi; Maeda, Takahiro; Paw, Barry H.; Orkin, Stuart H.

    2014-01-01

    The clustered regularly interspaced palindromic repeats (CRISPR)/CRISPR-associated (Cas) 9 nuclease system has provided a powerful tool for genome engineering. Double strand breaks may trigger nonhomologous end joining repair, leading to frameshift mutations, or homology-directed repair using an extrachromosomal template. Alternatively, genomic deletions may be produced by a pair of double strand breaks. The efficiency of CRISPR/Cas9-mediated genomic deletions has not been systematically explored. Here, we present a methodology for the production of deletions in mammalian cells, ranging from 1.3 kb to greater than 1 Mb. We observed a high frequency of intended genomic deletions. Nondeleted alleles are nonetheless often edited with inversions or small insertion/deletions produced at CRISPR recognition sites. Deleted alleles also typically include small insertion/deletions at predicted deletion junctions. We retrieved cells with biallelic deletion at a frequency exceeding that of probabilistic expectation. We demonstrate an inverse relationship between deletion frequency and deletion size. This work suggests that CRISPR/Cas9 is a robust system to produce a spectrum of genomic deletions to allow investigation of genes and genetic elements. PMID:24907273

  2. Clinical analysis of Behçet disease: arthritic manifestations in Behçet disease may present as seronegative rheumatoid arthritis or palindromic rheumatism.

    PubMed

    Park, J H

    1999-01-01

    To analyze arthritic manifestations in Behcet disease, which is one of the most common manifestations of Behcet disease. Among the patients who visited the Rheumatology Division, Keimyung University Dongsan Medical Center, Taegu, Korea from March 1997 to February 1998, 35 patients, with more than 3 months follow-up, were compatible for the diagnosis of Behcet disease according to the Shimizu criteria, after exclusion of uncertain or possible Behcet cases. The presence of various manifestations was evaluated. Regarding the joint manifestations, the involved joint, signs and the pattern of the articular symptoms were examined. Basic laboratory tests, HLA studies and simple radiologic studies were done. All 35 patients had evident, recurrent, painful oral ulcers by the study definition. Genital ulcers were found in 29%, skin lesions in 77%, uveitis in 9%, gastrointestinal ulcerations in 6% and vascular manifestations in 6%. Joint manifestations appeared in 97%. Knee(91%), proximal interphalangeal (53%) and metacarpophalangeal joints(21%) were the main sites. Tenderness was prominent in 91% and swelling in 44%. Polyarticular presentation was found in 47%. In most cases (76.4%), the articular symptom was short-lasting. C-reactive protein was likely to be positive in active Behcet disease. HLA B51 was positive in 46%. In Behcet disease, various manifestations can be found. The arthritic manifestation seems quite common. It may present as seronegative rheumatoid arthritis. Otherwise, it may present as palindromic rheumatism.

  3. High-temperature protein G is essential for activity of the Escherichia coli clustered regularly interspaced short palindromic repeats (CRISPR)/Cas system

    PubMed Central

    Yosef, Ido; Goren, Moran G.; Kiro, Ruth; Edgar, Rotem; Qimron, Udi

    2011-01-01

    Prokaryotic DNA arrays arranged as clustered regularly interspaced short palindromic repeats (CRISPR), along with their associated proteins, provide prokaryotes with adaptive immunity by RNA-mediated targeting of alien DNA or RNA matching the sequences between the repeats. Here, we present a thorough screening system for the identification of bacterial proteins participating in immunity conferred by the Escherichia coli CRISPR system. We describe the identification of one such protein, high-temperature protein G (HtpG), a homolog of the eukaryotic chaperone heat-shock protein 90. We demonstrate that in the absence of htpG, the E. coli CRISPR system loses its suicidal activity against λ prophage and its ability to provide immunity from lysogenization. Transcomplementation of htpG restores CRISPR activity. We further show that inactivity of the CRISPR system attributable to htpG deficiency can be suppressed by expression of Cas3, a protein that is essential for its activity. Accordingly, we also find that the steady-state level of overexpressed Cas3 is significantly enhanced following HtpG expression. We conclude that HtpG is a newly identified positive modulator of the CRISPR system that is essential for maintaining functional levels of Cas3. PMID:22114197

  4. Subtyping Salmonella enterica serovar enteritidis isolates from different sources by using sequence typing based on virulence genes and clustered regularly interspaced short palindromic repeats (CRISPRs).

    PubMed

    Liu, Fenyun; Kariyawasam, Subhashinie; Jayarao, Bhushan M; Barrangou, Rodolphe; Gerner-Smidt, Peter; Ribot, Efrain M; Knabel, Stephen J; Dudley, Edward G

    2011-07-01

    Salmonella enterica subsp. enterica serovar Enteritidis is a major cause of food-borne salmonellosis in the United States. Two major food vehicles for S. Enteritidis are contaminated eggs and chicken meat. Improved subtyping methods are needed to accurately track specific strains of S. Enteritidis related to human salmonellosis throughout the chicken and egg food system. A sequence typing scheme based on virulence genes (fimH and sseL) and clustered regularly interspaced short palindromic repeats (CRISPRs)-CRISPR-including multi-virulence-locus sequence typing (designated CRISPR-MVLST)-was used to characterize 35 human clinical isolates, 46 chicken isolates, 24 egg isolates, and 63 hen house environment isolates of S. Enteritidis. A total of 27 sequence types (STs) were identified among the 167 isolates. CRISPR-MVLST identified three persistent and predominate STs circulating among U.S. human clinical isolates and chicken, egg, and hen house environmental isolates in Pennsylvania, and an ST that was found only in eggs and humans. It also identified a potential environment-specific sequence type. Moreover, cluster analysis based on fimH and sseL identified a number of clusters, of which several were found in more than one outbreak, as well as 11 singletons. Further research is needed to determine if CRISPR-MVLST might help identify the ecological origins of S. Enteritidis strains that contaminate chickens and eggs.

  5. Mature clustered, regularly interspaced, short palindromic repeats RNA (crRNA) length is measured by a ruler mechanism anchored at the precursor processing site.

    PubMed

    Hatoum-Aslan, Asma; Maniv, Inbal; Marraffini, Luciano A

    2011-12-27

    Precise RNA processing is fundamental to all small RNA-mediated interference pathways. In prokaryotes, clustered, regularly interspaced, short palindromic repeats (CRISPR) loci encode small CRISPR RNAs (crRNAs) that protect against invasive genetic elements by antisense targeting. CRISPR loci are transcribed as a long precursor that is cleaved within repeat sequences by CRISPR-associated (Cas) proteins. In many organisms, this primary processing generates crRNA intermediates that are subject to additional nucleolytic trimming to render mature crRNAs of specific lengths. The molecular mechanisms underlying this maturation event remain poorly understood. Here, we defined the genetic requirements for crRNA primary processing and maturation in Staphylococcus epidermidis. We show that changes in the position of the primary processing site result in extended or diminished maturation to generate mature crRNAs of constant length. These results indicate that crRNA maturation occurs by a ruler mechanism anchored at the primary processing site. We also show that maturation is mediated by specific cas genes distinct from those genes involved in primary processing, showing that this event is directed by CRISPR/Cas loci.

  6. Crystal Structure of Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)-associated Csn2 Protein Revealed Ca[superscript 2+]-dependent Double-stranded DNA Binding Activity

    SciTech Connect

    Nam, Ki Hyun; Kurinov, Igor; Ke, Ailong

    2012-05-22

    Clustered regularly interspaced short palindromic repeats (CRISPR) and their associated protein genes (cas genes) are widespread in bacteria and archaea. They form a line of RNA-based immunity to eradicate invading bacteriophages and malicious plasmids. A key molecular event during this process is the acquisition of new spacers into the CRISPR loci to guide the selective degradation of the matching foreign genetic elements. Csn2 is a Nmeni subtype-specific cas gene required for new spacer acquisition. Here we characterize the Enterococcus faecalis Csn2 protein as a double-stranded (ds-) DNA-binding protein and report its 2.7 {angstrom} tetrameric ring structure. The inner circle of the Csn2 tetrameric ring is {approx}26 {angstrom} wide and populated with conserved lysine residues poised for nonspecific interactions with ds-DNA. Each Csn2 protomer contains an {alpha}/{beta} domain and an {alpha}-helical domain; significant hinge motion was observed between these two domains. Ca{sup 2+} was located at strategic positions in the oligomerization interface. We further showed that removal of Ca{sup 2+} ions altered the oligomerization state of Csn2, which in turn severely decreased its affinity for ds-DNA. In summary, our results provided the first insight into the function of the Csn2 protein in CRISPR adaptation by revealing that it is a ds-DNA-binding protein functioning at the quaternary structure level and regulated by Ca{sup 2+} ions.

  7. [Knocking-out extra domain A alternative splice fragment of fibronectin using a clustered regularly interspaced short palindromic repeats/associated proteins 9 system].

    PubMed

    Yang, Yue; Wang, Haicheng; Xu, Shuyu; Peng, Jing; Jiang, Jiuhui; Li, Cuiying

    2015-08-01

    To investigate the effect of the fibronectin extra domain A on the aggressiveness of salivary adenoid cystic carcinoma (SACC) cells, via the clustered regularly interspaced short palindromic repeats (CRISPR)/ associated proteins (Cas) system. One sgRNA was designed to target the upstream of the genome sequences of extra domain A(EDA) exon and the downstream. Then the sgRNA was linked into plasmid PX-330 and transfected into SACC-83 cells. PCR and DNA sequence were used to testify the knockout cells, and the monoclones of EDA absent SACC cells were selected (A+C-2, A+C-6, B+C-10). CCK-8 cell proliferation and invasion was then tested in control group and the experimental group. The sgRNA was successfully linked into PX-330 plasmid. Part of adenoid cystic carcinoma cells' SACC-83 genomic EDA exon was knocked out, and the knockdown efficiency was above 70%, but the total amount of fibronectin did not change significantly. Three monoclones of EDA absent SACC- 83 cells were successfully selected with diminished migration and proliferation. The CRISPR/Cas9 system was a simplified system with relatively high knockout efficiency and EDA knockout could inhibiting SACC cell's mobility and invasiveness.

  8. An Active Immune Defense with a Minimal CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) RNA and without the Cas6 Protein*

    PubMed Central

    Maier, Lisa-Katharina; Stachler, Aris-Edda; Saunders, Sita J.; Backofen, Rolf; Marchfelder, Anita

    2015-01-01

    The prokaryotic immune system CRISPR-Cas (clustered regularly interspaced short palindromic repeats-CRISPR-associated) is a defense system that protects prokaryotes against foreign DNA. The short CRISPR RNAs (crRNAs) are central components of this immune system. In CRISPR-Cas systems type I and III, crRNAs are generated by the endonuclease Cas6. We developed a Cas6b-independent crRNA maturation pathway for the Haloferax type I-B system in vivo that expresses a functional crRNA, which we termed independently generated crRNA (icrRNA). The icrRNA is effective in triggering degradation of an invader plasmid carrying the matching protospacer sequence. The Cas6b-independent maturation of the icrRNA allowed mutation of the repeat sequence without interfering with signals important for Cas6b processing. We generated 23 variants of the icrRNA and analyzed them for activity in the interference reaction. icrRNAs with deletions or mutations of the 3′ handle are still active in triggering an interference reaction. The complete 3′ handle could be removed without loss of activity. However, manipulations of the 5′ handle mostly led to loss of interference activity. Furthermore, we could show that in the presence of an icrRNA a strain without Cas6b (Δcas6b) is still active in interference. PMID:25512373

  9. Intricate interactions between the bloom-forming cyanobacterium Microcystis aeruginosa and foreign genetic elements, revealed by diversified clustered regularly interspaced short palindromic repeat (CRISPR) signatures.

    PubMed

    Kuno, Sotaro; Yoshida, Takashi; Kaneko, Takakazu; Sako, Yoshihiko

    2012-08-01

    Clustered regularly interspaced short palindromic repeats (CRISPR) confer sequence-dependent, adaptive resistance in prokaryotes against viruses and plasmids via incorporation of short sequences, called spacers, derived from foreign genetic elements. CRISPR loci are thus considered to provide records of past infections. To describe the host-parasite (i.e., cyanophages and plasmids) interactions involving the bloom-forming freshwater cyanobacterium Microcystis aeruginosa, we investigated CRISPR in four M. aeruginosa strains and in two previously sequenced genomes. The number of spacers in each locus was larger than the average among prokaryotes. All spacers were strain specific, except for a string of 11 spacers shared in two closely related strains, suggesting diversification of the loci. Using CRISPR repeat-based PCR, 24 CRISPR genotypes were identified in a natural cyanobacterial community. Among 995 unique spacers obtained, only 10 sequences showed similarity to M. aeruginosa phage Ma-LMM01. Of these, six spacers showed only silent or conservative nucleotide mutations compared to Ma-LMM01 sequences, suggesting a strategy by the cyanophage to avert CRISPR immunity dependent on nucleotide identity. These results imply that host-phage interactions can be divided into M. aeruginosa-cyanophage combinations rather than pandemics of population-wide infectious cyanophages. Spacer similarity also showed frequent exposure of M. aeruginosa to small cryptic plasmids that were observed only in a few strains. Thus, the diversification of CRISPR implies that M. aeruginosa has been challenged by diverse communities (almost entirely uncharacterized) of cyanophages and plasmids.

  10. Clustered, Regularly Interspaced Short Palindromic Repeats (CRISPR)/Cas9-coupled Affinity Purification/Mass Spectrometry Analysis Revealed a Novel Role of Neurofibromin in mTOR Signaling.

    PubMed

    Li, Xu; Gao, Min; Choi, Jong Min; Kim, Beom-Jun; Zhou, Mao-Tian; Chen, Zhen; Jain, Antrix N; Jung, Sung Yun; Yuan, Jingsong; Wang, Wenqi; Wang, Yi; Chen, Junjie

    2017-04-01

    Neurofibromin (NF1) is a well known tumor suppressor that is commonly mutated in cancer patients. It physically interacts with RAS and negatively regulates RAS GTPase activity. Despite the importance of NF1 in cancer, a high quality endogenous NF1 interactome has yet to be established. In this study, we combined clustered, regularly interspaced short palindromic repeats (CRISPR)/Cas9-mediated gene knock-out technology with affinity purification using antibodies against endogenous proteins, followed by mass spectrometry analysis, to sensitively and accurately detect NF1 protein-protein interactions in unaltered in vivo settings. Using this system, we analyzed endogenous NF1-associated protein complexes and identified 49 high-confidence candidate interaction proteins, including RAS and other functionally relevant proteins. Through functional validation, we found that NF1 negatively regulates mechanistic target of rapamycin signaling (mTOR) in a LAMTOR1-dependent manner. In addition, the cell growth and survival of NF1-deficient cells have become dependent on hyperactivation of the mTOR pathway, and the tumorigenic properties of these cells have become dependent on LAMTOR1. Taken together, our findings may provide novel insights into therapeutic approaches targeting NF1-deficient tumors. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  11. Arrangement and number of clustered regularly interspaced short palindromic repeat spacers are associated with erythromycin susceptibility in emm12, emm75 and emm92 of group A streptococcus.

    PubMed

    Zheng, P-X; Chiang-Ni, C; Wang, S-Y; Tsai, P-J; Kuo, C-F; Chuang, W-J; Lin, Y-S; Liu, C-C; Wu, J-J

    2014-06-01

    Clustered regularly interspaced short palindromic repeats (CRISPR) are composed of numerous repeat-spacer units and are considered a prokaryotic defence system against foreign nucleic acids. Since antibiotic-resistant genes are frequently encoded in foreign nucleic acids, the aim of this study was to test whether erythromycin susceptibility in group A streptococcus (Streptococcus pyogenes) is associated with characteristics of CRISPR elements. Erythromycin susceptibility of 330 isolates collected between 1997 and 2003 was analysed. Among 29 emm types, emm12, emm75 and emm92 showed significant changes in erythromycin-resistance rates. By sequencing the spacers from two CRISPR loci, spacer contents in emm12, emm75 and emm92 strains were associated with erythromycin susceptibility. Strains with fewer spacers were more resistant to erythromycin. Moreover, in emm4 strains, which showed no significant change in their annual erythromycin-resistance rate, CRISPR type and number of spacers were not correlated with erythromycin susceptibility. These results highlight a novel association between CRISPR spacer content and erythromycin susceptibility in group A streptococcus. © 2013 The Authors Clinical Microbiology and Infection © 2013 European Society of Clinical Microbiology and Infectious Diseases.

  12. Crystal structure of clustered regularly interspaced short palindromic repeats (CRISPR)-associated Csn2 protein revealed Ca2+-dependent double-stranded DNA binding activity.

    PubMed

    Nam, Ki Hyun; Kurinov, Igor; Ke, Ailong

    2011-09-02

    Clustered regularly interspaced short palindromic repeats (CRISPR) and their associated protein genes (cas genes) are widespread in bacteria and archaea. They form a line of RNA-based immunity to eradicate invading bacteriophages and malicious plasmids. A key molecular event during this process is the acquisition of new spacers into the CRISPR loci to guide the selective degradation of the matching foreign genetic elements. Csn2 is a Nmeni subtype-specific cas gene required for new spacer acquisition. Here we characterize the Enterococcus faecalis Csn2 protein as a double-stranded (ds-) DNA-binding protein and report its 2.7 Å tetrameric ring structure. The inner circle of the Csn2 tetrameric ring is ∼26 Å wide and populated with conserved lysine residues poised for nonspecific interactions with ds-DNA. Each Csn2 protomer contains an α/β domain and an α-helical domain; significant hinge motion was observed between these two domains. Ca(2+) was located at strategic positions in the oligomerization interface. We further showed that removal of Ca(2+) ions altered the oligomerization state of Csn2, which in turn severely decreased its affinity for ds-DNA. In summary, our results provided the first insight into the function of the Csn2 protein in CRISPR adaptation by revealing that it is a ds-DNA-binding protein functioning at the quaternary structure level and regulated by Ca(2+) ions.

  13. The clustered regularly interspaced short palindromic repeats/associated proteins system for the induction of gene mutations and phenotypic changes in Bombyx mori.

    PubMed

    Song, Jia; Che, Jiaqian; You, Zhengying; Ye, Xiaogang; Li, Jisheng; Ye, Lupeng; Zhang, Yuyu; Qian, Qiujie; Zhong, Boxiong

    2016-12-01

    To probe the general phenomena of gene mutations, Bombyx mori, the lepidopterous model organism, was chosen as the experimental model. To easily detect phenotypic variations, the piggyBac system was utilized to introduce two marker genes into the silkworm, and 23.4% transposition efficiency aided in easily breeding a new strain for the entire experiment. Then, the clustered regularly interspaced short palindromic repeats/an associated protein (Cas9) system was utilized. The results showed that the Cas9 system can induce efficient gene mutations and the base changes could be detected since the G0 individuals in B. mori; and that the mutation rates on different target sites were diverse. Next, the gRNA2-targeted site that generated higher mutation rate was chosen, and the experimental results were enumerated. First, the mutation proportion in G1 generation was 30.1%, and some gene mutations were not inherited from the G0 generation; second, occasionally, base substitutions did not lead to variation in the amino-acid sequence, which decreased the efficiency of phenotypic changes compared with that of genotypic changes. These results laid the foundation for better use of the Cas9 system in silkworm gene editing. © The Author 2016. Published by Oxford University Press on behalf of the Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  14. An active immune defense with a minimal CRISPR (clustered regularly interspaced short palindromic repeats) RNA and without the Cas6 protein.

    PubMed

    Maier, Lisa-Katharina; Stachler, Aris-Edda; Saunders, Sita J; Backofen, Rolf; Marchfelder, Anita

    2015-02-13

    The prokaryotic immune system CRISPR-Cas (clustered regularly interspaced short palindromic repeats-CRISPR-associated) is a defense system that protects prokaryotes against foreign DNA. The short CRISPR RNAs (crRNAs) are central components of this immune system. In CRISPR-Cas systems type I and III, crRNAs are generated by the endonuclease Cas6. We developed a Cas6b-independent crRNA maturation pathway for the Haloferax type I-B system in vivo that expresses a functional crRNA, which we termed independently generated crRNA (icrRNA). The icrRNA is effective in triggering degradation of an invader plasmid carrying the matching protospacer sequence. The Cas6b-independent maturation of the icrRNA allowed mutation of the repeat sequence without interfering with signals important for Cas6b processing. We generated 23 variants of the icrRNA and analyzed them for activity in the interference reaction. icrRNAs with deletions or mutations of the 3' handle are still active in triggering an interference reaction. The complete 3' handle could be removed without loss of activity. However, manipulations of the 5' handle mostly led to loss of interference activity. Furthermore, we could show that in the presence of an icrRNA a strain without Cas6b (Δcas6b) is still active in interference. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  15. Intricate Interactions between the Bloom-Forming Cyanobacterium Microcystis aeruginosa and Foreign Genetic Elements, Revealed by Diversified Clustered Regularly Interspaced Short Palindromic Repeat (CRISPR) Signatures

    PubMed Central

    Kuno, Sotaro; Kaneko, Takakazu; Sako, Yoshihiko

    2012-01-01

    Clustered regularly interspaced short palindromic repeats (CRISPR) confer sequence-dependent, adaptive resistance in prokaryotes against viruses and plasmids via incorporation of short sequences, called spacers, derived from foreign genetic elements. CRISPR loci are thus considered to provide records of past infections. To describe the host-parasite (i.e., cyanophages and plasmids) interactions involving the bloom-forming freshwater cyanobacterium Microcystis aeruginosa, we investigated CRISPR in four M. aeruginosa strains and in two previously sequenced genomes. The number of spacers in each locus was larger than the average among prokaryotes. All spacers were strain specific, except for a string of 11 spacers shared in two closely related strains, suggesting diversification of the loci. Using CRISPR repeat-based PCR, 24 CRISPR genotypes were identified in a natural cyanobacterial community. Among 995 unique spacers obtained, only 10 sequences showed similarity to M. aeruginosa phage Ma-LMM01. Of these, six spacers showed only silent or conservative nucleotide mutations compared to Ma-LMM01 sequences, suggesting a strategy by the cyanophage to avert CRISPR immunity dependent on nucleotide identity. These results imply that host-phage interactions can be divided into M. aeruginosa-cyanophage combinations rather than pandemics of population-wide infectious cyanophages. Spacer similarity also showed frequent exposure of M. aeruginosa to small cryptic plasmids that were observed only in a few strains. Thus, the diversification of CRISPR implies that M. aeruginosa has been challenged by diverse communities (almost entirely uncharacterized) of cyanophages and plasmids. PMID:22636003

  16. High-temperature protein G is essential for activity of the Escherichia coli clustered regularly interspaced short palindromic repeats (CRISPR)/Cas system.

    PubMed

    Yosef, Ido; Goren, Moran G; Kiro, Ruth; Edgar, Rotem; Qimron, Udi

    2011-12-13

    Prokaryotic DNA arrays arranged as clustered regularly interspaced short palindromic repeats (CRISPR), along with their associated proteins, provide prokaryotes with adaptive immunity by RNA-mediated targeting of alien DNA or RNA matching the sequences between the repeats. Here, we present a thorough screening system for the identification of bacterial proteins participating in immunity conferred by the Escherichia coli CRISPR system. We describe the identification of one such protein, high-temperature protein G (HtpG), a homolog of the eukaryotic chaperone heat-shock protein 90. We demonstrate that in the absence of htpG, the E. coli CRISPR system loses its suicidal activity against λ prophage and its ability to provide immunity from lysogenization. Transcomplementation of htpG restores CRISPR activity. We further show that inactivity of the CRISPR system attributable to htpG deficiency can be suppressed by expression of Cas3, a protein that is essential for its activity. Accordingly, we also find that the steady-state level of overexpressed Cas3 is significantly enhanced following HtpG expression. We conclude that HtpG is a newly identified positive modulator of the CRISPR system that is essential for maintaining functional levels of Cas3.

  17. Abundant and Diverse Clustered Regularly Interspaced Short Palindromic Repeat Spacers in Clostridium difficile Strains and Prophages Target Multiple Phage Types within This Pathogen

    PubMed Central

    Hargreaves, Katherine R.; Flores, Cesar O.; Lawley, Trevor D.

    2014-01-01

    ABSTRACT Clostridium difficile is an important human-pathogenic bacterium causing antibiotic-associated nosocomial infections worldwide. Mobile genetic elements and bacteriophages have helped shape C. difficile genome evolution. In many bacteria, phage infection may be controlled by a form of bacterial immunity called the clustered regularly interspaced short palindromic repeats/CRISPR-associated (CRISPR/Cas) system. This uses acquired short nucleotide sequences (spacers) to target homologous sequences (protospacers) in phage genomes. C. difficile carries multiple CRISPR arrays, and in this paper we examine the relationships between the host- and phage-carried elements of the system. We detected multiple matches between spacers and regions in 31 C. difficile phage and prophage genomes. A subset of the spacers was located in prophage-carried CRISPR arrays. The CRISPR spacer profiles generated suggest that related phages would have similar host ranges. Furthermore, we show that C. difficile strains of the same ribotype could either have similar or divergent CRISPR contents. Both synonymous and nonsynonymous mutations in the protospacer sequences were identified, as well as differences in the protospacer adjacent motif (PAM), which could explain how phages escape this system. This paper illustrates how the distribution and diversity of CRISPR spacers in C. difficile, and its prophages, could modulate phage predation for this pathogen and impact upon its evolution and pathogenicity. PMID:25161187

  18. Combination of the clustered regularly interspaced short palindromic repeats (CRISPR)-associated 9 technique with the piggybac transposon system for mouse in utero electroporation to study cortical development.

    PubMed

    Cheng, Man; Jin, Xubin; Mu, Lili; Wang, Fangyu; Li, Wei; Zhong, Xiaoling; Liu, Xuan; Shen, Wenchen; Liu, Ying; Zhou, Yan

    2016-09-01

    In utero electroporation (IUE) is commonly used to study cortical development of cerebrum by downregulating or overexpressing genes of interest in neural progenitor cells (NPCs) of small mammals. However, exogenous plasmids are lost or diluted over time. Furthermore, gene knockdown based on short-hairpin RNAs may exert nonspecific effects that lead to aberrant neuronal migration. Genomic engineering by the clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated 9 (Cas9) system has great research and therapeutic potentials. Here we integrate the CRISPR/Cas9 components into the piggyBac (PB) transposon system (the CRISPR/Cas9-PB toolkit) for cortical IUEs. The mouse Sry-related HMG box-2 (Sox2) gene was selected as the target for its application. Most transduced cortical NPCs were depleted of SOX2 protein as early as 3 days post-IUE, whereas expressions of SOX1 and PAX6 remained intact. Furthermore, both the WT Cas9 and the D10A nickase mutant Cas9n showed comparable knockout efficiency. Transduced cortical cells were purified with fluorescence-activated cell sorting, and effective gene editing at the Sox2 loci was confirmed. Thus, application of the CRISPR/Cas9-PB toolkit in IUE is a promising strategy to study gene functions in cortical NPCs and their progeny. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  19. Structural and biochemical analysis of nuclease domain of clustered regularly interspaced short palindromic repeat (CRISPR)-associated protein 3 (Cas3).

    PubMed

    Mulepati, Sabin; Bailey, Scott

    2011-09-09

    RNA transcribed from clustered regularly interspaced short palindromic repeats (CRISPRs) protects many prokaryotes from invasion by foreign DNA such as viruses, conjugative plasmids, and transposable elements. Cas3 (CRISPR-associated protein 3) is essential for this CRISPR protection and is thought to mediate cleavage of the foreign DNA through its N-terminal histidine-aspartate (HD) domain. We report here the 1.8 Å crystal structure of the HD domain of Cas3 from Thermus thermophilus HB8. Structural and biochemical studies predict that this enzyme binds two metal ions at its active site. We also demonstrate that the single-stranded DNA endonuclease activity of this T. thermophilus domain is activated not by magnesium but by transition metal ions such as manganese and nickel. Structure-guided mutagenesis confirms the importance of the metal-binding residues for the nuclease activity and identifies other active site residues. Overall, these results provide a framework for understanding the role of Cas3 in the CRISPR system.

  20. Structural and functional characterization of an archaeal clustered regularly interspaced short palindromic repeat (CRISPR)-associated complex for antiviral defense (CASCADE).

    PubMed

    Lintner, Nathanael G; Kerou, Melina; Brumfield, Susan K; Graham, Shirley; Liu, Huanting; Naismith, James H; Sdano, Matthew; Peng, Nan; She, Qunxin; Copié, Valérie; Young, Mark J; White, Malcolm F; Lawrence, C Martin

    2011-06-17

    In response to viral infection, many prokaryotes incorporate fragments of virus-derived DNA into loci called clustered regularly interspaced short palindromic repeats (CRISPRs). The loci are then transcribed, and the processed CRISPR transcripts are used to target invading viral DNA and RNA. The Escherichia coli "CRISPR-associated complex for antiviral defense" (CASCADE) is central in targeting invading DNA. Here we report the structural and functional characterization of an archaeal CASCADE (aCASCADE) from Sulfolobus solfataricus. Tagged Csa2 (Cas7) expressed in S. solfataricus co-purifies with Cas5a-, Cas6-, Csa5-, and Cas6-processed CRISPR-RNA (crRNA). Csa2, the dominant protein in aCASCADE, forms a stable complex with Cas5a. Transmission electron microscopy reveals a helical complex of variable length, perhaps due to substoichiometric amounts of other CASCADE components. A recombinant Csa2-Cas5a complex is sufficient to bind crRNA and complementary ssDNA. The structure of Csa2 reveals a crescent-shaped structure unexpectedly composed of a modified RNA-recognition motif and two additional domains present as insertions in the RNA-recognition motif. Conserved residues indicate potential crRNA- and target DNA-binding sites, and the H160A variant shows significantly reduced affinity for crRNA. We propose a general subunit architecture for CASCADE in other bacteria and Archaea.

  1. Transgenic Clustered Regularly Interspaced Short Palindromic Repeat/Cas9-Mediated Viral Gene Targeting for Antiviral Therapy of Bombyx mori Nucleopolyhedrovirus.

    PubMed

    Chen, Shuqing; Hou, Chengxiang; Bi, Honglun; Wang, Yueqiang; Xu, Jun; Li, Muwang; James, Anthony A; Huang, Yongping; Tan, Anjiang

    2017-04-15

    We developed a novel antiviral strategy by combining transposon-based transgenesis and the clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated 9 (Cas9) system for the direct cleavage of Bombyx mori nucleopolyhedrovirus (BmNPV) genome DNA to promote virus clearance in silkworms. We demonstrate that transgenic silkworms constitutively expressing Cas9 and guide RNAs targeting the BmNPV immediate early-1 (ie-1) and me53 genes effectively induce target-specific cleavage and subsequent mutagenesis, especially large (∼7-kbp) segment deletions in BmNPV genomes, and thus exhibit robust suppression of BmNPV proliferation. Transgenic animals exhibited higher and inheritable resistance to BmNPV infection than wild-type animals. Our approach will not only contribute to modern sericulture but also shed light on future antiviral therapy.IMPORTANCE Pathogen genome targeting has shown its potential in antiviral research. However, transgenic CRISPR/Cas9 system-mediated viral genome targeting has not been reported as an antiviral strategy in a natural animal host of a virus. Our data provide an effective approach against BmNPV infection in a real-world biological system and demonstrate the potential of transgenic CRISPR/Cas9 systems in antiviral research in other species. Copyright © 2017 Chen et al.

  2. Escaping the Cut by Restriction Enzymes Through Single-Strand Self-Annealing of Host-Edited 12-bp and Longer Synthetic Palindromes

    PubMed Central

    2012-01-01

    Palindromati, the massive host-edited synthetic palindromic contamination found in GenBank, is illustrated and exemplified. Millions of contaminated sequences with portions or tandems of such portions derived from the ZAP adaptor or related linkers are shown (1) by the 12-bp sequence reported elsewhere, exon Xb, 5′ CCCGAATTCGGG 3′, (2) by a 22-bp related sequence 5′ CTCGTGCCGAATTCGGCACGAG 3′, and (3) by a longer 44-bp related sequence: 5′ CTCGTGCCGAATTCGGCACGAGCTCGTGCCGAATTCGGCACGAG 3′. Possible reasons for why those long contaminating sequences continue in the databases are presented here: (1) the recognition site for the plus strand (+) is single-strand self-annealed; (2) the recognition site for the minus strand (−) is not only single-strand self-annealed but also located far away from the single-strand self-annealed plus strand, rendering impossible the formation of the active EcoRI enzyme dimer to cut on 5′ G/AATTC 3′, its target sequence. As a possible solution, it is suggested to rely on at least two or three independent results, such as sequences obtained by independent laboratories with the use, preferably, of independent sequencing methodologies. This information may help to develop tools for bioinformatics capable to detect/remove these contaminants and to infer why some damaged sequences which cause genetic diseases escape detection by the molecular quality control mechanism of cells and organisms, being undesirably transferred unchecked through the generations. PMID:21895510

  3. The Composition of Fluorescent Pseudomonad Populations Associated with Roots Is Influenced by Plant and Soil Type

    PubMed Central

    Latour, X.; Corberand, T.; Laguerre, G.; Allard, F.; Lemanceau, P.

    1996-01-01

    Populations of fluorescent pseudomonads isolated from an uncultivated soil and from the roots of two plant species were previously shown to differ (P. Lemanceau, T. Corberand, L. Gardan, X. Latour, G. Laguerre, J.-M. Boeufgras, and C. Alabouvette, Appl. Environ. Microbiol. 61:1004-1012, 1995). The diversities of fluorescent pseudomonads, from two uncultivated soils and from the roots of two plant species cultivated in these two soils, were compared. The phenotypic diversity of the bacterial isolates was characterized on the basis of biochemical and physiological tests and on the basis of their ability to utilize 147 different organic compounds. The genotypic diversity of the isolates was characterized on the basis of the types of 16S genes coding for rRNA (rDNA), their repetitive extragenic palindromic patterns by PCR, and plasmid profiles. Taxonomic identification of the isolates was achieved with both biochemical and physiological tests and by comparing their 16S rDNA types to those of reference and type strains of fluorescent Pseudomonas spp. Numerical analysis of phenotypic characteristics allowed the clustering of isolates that showed high levels of similarity. This analysis indicated that both soil type and host plant had an effect on the diversity of fluorescent pseudomonads. However, of the two factors studied, the soil was clearly the dominating one. Indeed, the populations associated with the roots of each plant species varied from one soil to the other. This variation could possibly be ascribed to the differences recorded between the phenotypically diverse populations of fluorescent pseudomonads from the two uncultivated soils. The plant selection was, at least partly, plant specific. It was not related to bacterial species and biovars or to the presence of plasmid DNA. The phenotypic clustering of isolates was well correlated with genotypic characterization by repetitive extragenic palindrome-PCR fingerprinting. PMID:16535355

  4. Class 1 integrons in non-clonal multidrug-resistant Acinetobacter baumannii from Iran, description of the new blaIMP-55 allele in In1243.

    PubMed

    Azizi, Omid; Shakibaie, Mohammad Reza; Badmasti, Farzad; Modarresi, Farzan; Ramazanzadeh, Rashid; Mansouri, Shahla; Shahcheraghi, Fereshteh

    2016-09-01

    Infections and outbreaks caused by multidrug-resistant Acinetobacter baumannii (MDR-AB) are prevalent and have been reported worldwide over the past 20 or more years. Class 1 integron in MDR-AB plays an important role in the spread of antibiotic resistance in clinical settings. This study has been conducted to evaluate the detection of metallo-β-lactamase, characterization of class 1 integron and determination of clonal relatedness among A. baumannii hospital isolates. Sixty-five clinical isolates of MDR-AB were recovered from two Iranian hospital's intensive care units from February to August 2013. Integrase (intI1) and blaIMP genes were detected in 70.8 % (n=46/65) and 9.23 % (n=6/65) of the isolates using PCR assay, respectively. No other metallo-β-lactamase genes (blaVIM, blaSIM and blaNDM) were detected. PCR sequencing of integron gene cassette revealed the following arrays: blaOXA10-aacA4-blaIMP-55-cmlA5 (as a novel array was designated In1243), aacC1 and aadA1. Analysis of blaIMP gene revealed a new allele designated as blaIMP-55. Gene transfer experiment by conjugation showed the 36 kb conjugative plasmid harbouring In1243. The clonal assessment by repetitive extragenic palindromic PCR demonstrated a high-degree relatedness among the strains, but strains harbouring In1243 displayed a different repetitive extragenic palindromic PCR profile. In this study, we found that a novel class 1 integron (In1243) that encoded a new blaIMP allele resided on a transferable plasmid in non-clonal strains of MDR-AB.

  5. Modified repetition in poems elicited from young children.

    PubMed

    Dowker, A D

    1991-10-01

    Attempts were made to elicit poems from 133 children between the ages of 2;3 and 6;11. Seventy-eight of the children produced 606 poems between them. Forty-five per cent of the poems contained the syntactic device of modified repetition: a substitution exercise where a grammatical frame is repeated and the substitution occurs in part of the grammatical frame. This was so despite the fact that modified repetition was not present in the examples that were used to elicit poems from the children. The frequency and types of modified repetition used by the children did not vary much with age. The question of whether children's use of modified repetition in their rhythmical poems has the function of helping them to practise grammatical forms, or whether it is simply one reflection of a general human tendency towards the use of pattern in language, is discussed.

  6. Neural dynamics during repetitive visual stimulation

    NASA Astrophysics Data System (ADS)

    Tsoneva, Tsvetomira; Garcia-Molina, Gary; Desain, Peter

    2015-12-01

    Objective. Steady-state visual evoked potentials (SSVEPs), the brain responses to repetitive visual stimulation (RVS), are widely utilized in neuroscience. Their high signal-to-noise ratio and ability to entrain oscillatory brain activity are beneficial for their applications in brain-computer interfaces, investigation of neural processes underlying brain rhythmic activity (steady-state topography) and probing the causal role of brain rhythms in cognition and emotion. This paper aims at analyzing the space and time EEG dynamics in response to RVS at the frequency of stimulation and ongoing rhythms in the delta, theta, alpha, beta, and gamma bands. Approach.We used electroencephalography (EEG) to study the oscillatory brain dynamics during RVS at 10 frequencies in the gamma band (40-60 Hz). We collected an extensive EEG data set from 32 participants and analyzed the RVS evoked and induced responses in the time-frequency domain. Main results. Stable SSVEP over parieto-occipital sites was observed at each of the fundamental frequencies and their harmonics and sub-harmonics. Both the strength and the spatial propagation of the SSVEP response seem sensitive to stimulus frequency. The SSVEP was more localized around the parieto-occipital sites for higher frequencies (>54 Hz) and spread to fronto-central locations for lower frequencies. We observed a strong negative correlation between stimulation frequency and relative power change at that frequency, the first harmonic and the sub-harmonic components over occipital sites. Interestingly, over parietal sites for sub-harmonics a positive correlation of relative power change and stimulation frequency was found. A number of distinct patterns in delta (1-4 Hz), theta (4-8 Hz), alpha (8-12 Hz) and beta (15-30 Hz) bands were also observed. The transient response, from 0 to about 300 ms after stimulation onset, was accompanied by increase in delta and theta power over fronto-central and occipital sites, which returned to baseline

  7. Repetitive strain injuries: has the Australian epidemic burnt out?

    PubMed

    Awerbuch, M

    2004-07-01

    In the 1980s Australia experienced an epidemic of medically certified claims for non-specific arm symptoms described as repetitive strain injury. Although a number of factors were mooted as causal of the epidemic, no single factor emerged as a compelling putative candidate. The present paper discusses the results of research which was published only after the epidemic had waned. It provides possible insights into the rise and fall of repetitive strain injury.

  8. Repetition of Attempted Suicide Among Immigrants in Europe

    PubMed Central

    Lipsicas, Cendrine Bursztein; Mäkinen, Ilkka Henrik; Wasserman, Danuta; Apter, Alan; Kerkhof, Ad; Michel, Konrad; Renberg, Ellinor Salander; van Heeringen, Kees; Värnik, Airi; Schmidtke, Armin

    2014-01-01

    Objectives To compare frequencies of suicide attempt repetition in immigrants and local European populations, and the timing of repetition in these groups. Method: Data from 7 European countries, comprising 10 574 local and 3032 immigrant subjects, were taken from the World Health Organization European Multicentre Study on Suicidal Behaviour and the ensuing Monitoring Suicidal Behaviour in Europe (commonly referred to as MONSUE) project. The relation between immigrant status and repetition of suicide attempt within 12-months following first registered attempt was analyzed with binary logistic regression, controlling for sex, age, and method of attempt. Timing of repetition was controlled for sex, age, and the recommended type of aftercare. Results: Lower odds of repeating a suicide attempt were found in Eastern European (OR 0.50; 95% CI 0.41 to 0.61, P < 0.001) and non-European immigrants (OR 0.68; 95% CI 0.51 to 0.90, P < 0.05), compared with the locals. Similar patterns were identified in the sex-specific analysis. Eastern European immigrants tended to repeat their attempt much later than locals (OR 0.58; 95% CI 0.35 to 0.93, P < 0.05). In general, 32% of all repetition occurred within 30 days. Repetition tended to decrease with age and was more likely in females using harder methods in their index attempt (OR 1.29; 95% CI 1.08 to 1.54, P < 0.01). Large variations in the general repetition frequency were identified between the collecting centres, thus influencing the results. Conclusions: The lower repetition frequencies in non-Western immigrants, compared with locals, in Europe stands in contrast to their markedly higher tendency to attempt suicide in general, possibly pointing to situational stress factors related to their suicidal crisis that are less persistent over time. Our findings also raise the possibility that suicide attempters and repeaters constitute only partially overlapping populations. PMID:25565687

  9. Laser nanoablation of diamond surface at high pulse repetition rates

    NASA Astrophysics Data System (ADS)

    Kononenko, V. V.; Gololobov, V. M.; Pashinin, V. P.; Konov, V. I.

    2016-10-01

    The chemical etching of the surface of a natural diamond single crystal irradiated by subpicosecond laser pulses with a high repetition rate (f ≤slant 500 {\\text{kHz}}) in air is experimentally investigated. The irradiation has been performed by the second-harmonic (515 {\\text{nm}}) radiation of a disk Yb : YAG laser. Dependences of the diamond surface etch rate on the laser energy density and pulse repetition rate are obtained.

  10. Analysis of repetitive DNA in chromosomes by flow cytometry.

    PubMed

    Brind'Amour, Julie; Lansdorp, Peter M

    2011-06-01

    We developed a flow cytometry method, chromosome flow fluorescence in situ hybridization (FISH), called CFF, to analyze repetitive DNA in chromosomes using FISH with directly labeled peptide nucleic acid (PNA) probes. We used CFF to measure the abundance of interstitial telomeric sequences in Chinese hamster chromosomes and major satellite sequences in mouse chromosomes. Using CFF we also identified parental homologs of human chromosome 18 with different amounts of repetitive DNA.

  11. Human Scalp Electroencephalography Reveals that Repetition Suppression Varies with Expectation

    PubMed Central

    Summerfield, Christopher; Wyart, Valentin; Johnen, Vanessa Mareike; de Gardelle, Vincent

    2011-01-01

    Repetitions of a sensory event elicit lower levels of brain activity than its initial presentation (“repetition suppression,” RS). According to one view, RS depends on the biophysics of neuronal discharge, and is thus an automatic consequence of stimulus processing (“fatigue” model). Another account suggests that RS depends on the statistical structure of the environment, and occurs when repeated stimuli are less surprising than novel stimuli (“surprise reduction” model). In support of the latter view, functional magnetic resonance imaging studies have shown that RS is modulated by the local probability of repetition. However, single-cell recordings from macaque inferotemporal area (IT) have failed to replicate this finding. Here, we recorded scalp electroencephalography from human participants viewing pairs of faces that repeated (face1–face1) or alternated (face1–face2), in contexts in which repetitions were expected or unexpected. As previously described, event-related potentials in the range of 100–400 ms recorded at posterior electrode sites and at the vertex differed between repetitions and alternations. Critically, at central electrodes, we observed that the difference between repeated and alternating stimuli was attenuated when repetitions were unexpected, as predicted by the surprise reduction model. These findings demonstrate that the modulation of RS by repetition probability is observable using direct neural recording methods in human participants, and that it occurs relatively late (>300 ms) post-stimulus. Finally, we found that theta-band (4–8 Hz) spectral power over central electrodes varied with the three-way interaction between of repetition, expectation, and the rate of change of the environment, consistent with recent reports that frontal theta may be a hallmark of learning processes originating in the anterior cingulate and medial prefrontal cortex. PMID:21847378

  12. Repetitive behaviour in kennelled domestic dog: stereotypical or not?

    PubMed

    Denham, Hamish D C; Bradshaw, John W S; Rooney, Nicola J

    2014-04-10

    Repetitive behaviour is common in kennelled dogs, yet its motivational basis remains relatively unexplored. We examine the repetitive behaviour of 30 kennelled working dogs in ten contexts both coinciding with, and in the absence of, commonly occurring arousing stimuli, such as care staff, other dogs and food preparation. A large proportion (93%) of subjects performed some repetitive behaviour, most commonly bouncing, but only 17% in the absence of the arousing stimuli. Subjects could be divided into four groups according to the stimuli eliciting, and the duration, of their repetitive behaviour, and these groups were compared on the basis of their cortisol response to an acute psychogenic stressor--a veterinary examination. Urinary cortisol/creatinine response curves differed significantly between the groups. In particular, those dogs which performed repetitive behaviour at times of minimal stimulation, showed a distinctly different pattern of response, with cortisol levels decreasing, as compared to increasing, after the veterinary examination. We conclude that dogs showing repetitive behaviours at times of high arousal are motivationally distinct from those "stereotyping" in the absence of stimulation. We suggest that those dogs showing spontaneous repetitive behaviours may have past experiences and/or temperaments that affect both their reactions to a veterinary examination and to long-term kennelling. For example, some dogs may find isolation from humans particularly aversive, hence affecting their reactions both to being left in a kennel and to being taken to the veterinary surgeon. Alternatively, such dogs may have atypical responsiveness of their hypothalamic-pituitary-adrenal (HPA) axis, possibly brought about through chronic stress. High levels of repetitive behaviours in response to inaccessible husbandry events may be explained if such behaviour has inadvertently been reinforced by attention from staff, and therefore may not always be indicative of

  13. Electrophysiological evidence for cortical plasticity with movement repetition.

    PubMed

    Halder, Pascal; Sterr, Annette; Brem, Silvia; Bucher, Kerstin; Kollias, Spyros; Brandeis, Daniel

    2005-04-01

    The role of movement repetition and practice has been extensively studied as an aspect of motor skill learning but has rarely been investigated in its own right. As practice is considered a prerequisite for motor learning we expected that even the repetitive execution of a simple movement would rapidly induce changes in neural activations without changing performance. We used 64-channel event-related potential mapping to investigate these effects of movement repetition on corresponding brain activity in humans. Ten healthy right-handed young adults performed a power grip task under visual force control to ensure constant behaviour during the experimental session. The session consisted of two parts intersected by a break. For analysis each part was subdivided into two runs to control for potential attention or fatigue effects, which would be expected to disappear during the break. Microstate analysis revealed that distinct topographies and source configurations during movement preparation, movement execution and feedback integration are responsive to repetition. The observed patterns of changes differed for the three microstates, suggesting that different, repetition-sensitive neural mechanisms are involved. Moreover, this study clearly confirms that movement repetition, in the absence of skill learning, is capable of inducing changes in neural networks.

  14. Naming and repetition in aphasia: Steps, routes, and frequency effects

    PubMed Central

    Nozari, Nazbanou; Kittredge, Audrey K.; Dell, Gary S.; Schwartz, Myrna F.

    2010-01-01

    This paper investigates the cognitive processes underlying picture naming and auditory word repetition. In the 2-step model of lexical access, both the semantic and phonological steps are involved in naming, but the former has no role in repetition. Assuming recognition of the to-be-repeated word, repetition could consist of retrieving the word’s output phonemes from the lexicon (the lexical-route model), retrieving the output phonology directly from input phonology (the nonlexical-route model) or employing both routes together (the summation dual-route model). We tested these accounts by comparing the size of the word frequency effect (an index of lexical retrieval) in naming and repetition data from 59 aphasic patients with simulations of naming and repetition models. The magnitude of the frequency effect (and the influence of other lexical variables) was found to be comparable in naming and repetition, and equally large for both the lexical and summation dual-route models. However, only the dual-route model was fully consistent with data from patients, suggesting that nonlexical input is added on top of a fully-utilized lexical route. PMID:21076661

  15. Recency, repetition, and the multidimensional basis of recognition memory.

    PubMed

    Buchsbaum, Bradley R; Lemire-Rodger, Sabrina; Bondad, Ashley; Chepesiuk, Alexander

    2015-02-25

    Recency and repetition are two factors that have large effects on human memory performance. One way of viewing the beneficial impact of these variables on recognition memory is to assume that both factors modulate a unidimensional memory trace strength. Although previous functional neuroimaging studies have indicated that recency and repetition may modulate similar brain structures, particularly in the region of the inferior parietal cortex, there is extensive behavioral evidence that human subjects can make independent and accurate recognition memory judgments about both an item's recency and its frequency. In the present study, we used fMRI to examine patterns of brain activity during recognition memory for auditory-verbal stimuli that were parametrically and orthogonally manipulated in terms of recency and number of repetitions. We found in a continuous recognition paradigm that the lateral inferior parietal cortex, a region that has previously been associated with recollective forms of memory, is highly sensitive to recency but not repetition. In a multivariate analysis of whole-brain activation patterns, we found orthogonal components that dissociated recency and repetition variables, indicating largely independent neural bases underlying these two factors. The results demonstrate that although both recency and repetition dramatically improve recognition memory performance, the neural bases for this improvement are dissociable, and thus are difficult to explain in terms of access to a unitary memory trace. Copyright © 2015 the authors 0270-6474/15/353544-11$15.00/0.

  16. Repetitive RNA unwinding by RNA helicase A facilitates RNA annealing.

    PubMed

    Koh, Hye Ran; Xing, Li; Kleiman, Lawrence; Myong, Sua

    2014-07-01

    Helicases contribute to diverse biological processes including replication, transcription and translation. Recent reports suggest that unwinding of some helicases display repetitive activity, yet the functional role of the repetitiveness requires further investigation. Using single-molecule fluorescence assays, we elucidated a unique unwinding mechanism of RNA helicase A (RHA) that entails discrete substeps consisting of binding, activation, unwinding, stalling and reactivation stages. This multi-step process is repeated many times by a single RHA molecule without dissociation, resulting in repetitive unwinding/rewinding cycles. Our kinetic and mutational analysis indicates that the two double stand RNA binding domains at the N-terminus of RHA are responsible for such repetitive unwinding behavior in addition to providing an increased binding affinity to RNA. Further, the repetitive unwinding induces an efficient annealing of a complementary RNA by making the unwound strand more accessible. The complex and unusual mechanism displayed by RHA may help in explaining how the repetitive unwinding of helicases contributes to their biological functions.

  17. Properties of water surface discharge at different pulse repetition rates

    SciTech Connect

    Ruma,; Yoshihara, K.; Hosseini, S. H. R. Sakugawa, T.; Akiyama, H.; Akiyama, M.; Lukeš, P.

    2014-09-28

    The properties of water surface discharge plasma for variety of pulse repetition rates are investigated. A magnetic pulse compression (MPC) pulsed power modulator able to deliver pulse repetition rates up to 1000 Hz, with 0.5 J per pulse energy output at 25 kV, was used as the pulsed power source. Positive pulse with a point-to-plane electrode configuration was used for the experiments. The concentration and production yield of hydrogen peroxide (H₂O₂) were quantitatively measured and orange II organic dye was treated, to evaluate the chemical properties of the discharge reactor. Experimental results show that the physical and chemical properties of water surface discharge are not influenced by pulse repetition rate, very different from those observed for under water discharge. The production yield of H₂O₂ and degradation rate per pulse of the dye did not significantly vary at different pulse repetition rates under a constant discharge mode on water surface. In addition, the solution temperature, pH, and conductivity for both water surface and underwater discharge reactors were measured to compare their plasma properties for different pulse repetition rates. The results confirm that surface discharge can be employed at high pulse repetition rates as a reliable and advantageous method for industrial and environmental decontamination applications.

  18. The future-oriented repetitive thought (FoRT) scale: A measure of repetitive thinking about the future.

    PubMed

    Miranda, Regina; Wheeler, Alyssa; Polanco-Roman, Lillian; Marroquín, Brett

    2017-01-01

    Repetitive thinking about the future has been suggested as one way in which individuals may become hopeless about the future. We report on a new scale assessing future-oriented repetitive thinking, termed the Future-Oriented Repetitive Thought (FoRT) Scale. In Study 1, an exploratory factor analysis was conducted with data from 1071 individuals who completed the scale. Study 2 describes a confirmatory factor analysis with a revised version of the scale on a sample of 612 individuals, a subsample of whom (N=99) also completed measures of repetitive thought (rumination, worry), hopelessness-related cognitions, and symptoms of depression and generalized anxiety disorder in order to examine evidence for the measure's convergent, discriminant, and concurrent validity. Study 3 examined the scale's concurrent validity in distinguishing between individuals with and without a history of suicidal ideation and attempts. A three-factor solution emerged in Study 1, and this solution was confirmed in Study 2. In addition, the FoRT scale demonstrated moderate associations with other measures of repetitive thought (rumination, worry), with hopelessness-related cognitions, and with symptoms of depression and generalized anxiety. Finally, the FoRT scale distinguished between individuals with and without a history of suicidal ideation and attempts. Cross-sectional data limit conclusions that can be drawn about directionality. These findings suggest that the newly developed FoRT scale is a reliable and valid measure of future-oriented repetitive thought. Copyright © 2016 Elsevier B.V. All rights reserved.

  19. Similarity Grouping and Repetition Blindness are Both Influenced by Attention

    PubMed Central

    de Haan, Bianca; Rorden, Chris

    2009-01-01

    Previous studies have reported seemingly conflicting results regarding how the amount of stimulus similarity between two simultaneously presented target stimuli impacts perceptual performance. There are many reports of ‘repetition blindness’, where individuals do worse when shown two similar stimuli relative to two different stimuli. On the other hand, there are reports of ‘similarity grouping’, where participants perform better when identifying two similar objects relative to two different objects. This manuscript posits that repetition blindness and similarity grouping coexist and can be elicited in the same subjects in a single task. This not only explains the previous opposite effects of stimulus similarity on task performance, but also provides a unique opportunity to directly compare these opposite effects of stimulus similarity with respect to susceptibility to a modulating factor. Since previous studies have provided inconclusive results on whether attentional relevance can modulate the effect of stimulus similarity on task performance, the current manuscript aims to compare repetition blindness and similarity grouping with respect to their susceptibility to attentional relevance. The results of the first experiment confirmed that both repetition blindness and similarity grouping can be elicited in the same experiment, suggesting that repetition blindness and similarity grouping coexist. The results of the second experiment suggest that both repetition blindness and similarity grouping can be modulated by attentional relevance. These results support the explanation of repetition blindness as a token individuation failure. Furthermore, these results suggest that supposedly pre-attentional grouping mechanisms might not operate as independently from top-down attentional modulations as traditionally thought. PMID:20300466

  20. Repetitive sequences: the hidden diversity of heterochromatin in prochilodontid fish

    PubMed Central

    Terencio, Maria L.; Schneider, Carlos H.; Gross, Maria C.; do Carmo, Edson Junior; Nogaroto, Viviane; de Almeida, Mara Cristina; Artoni, Roberto Ferreira; Vicari, Marcelo R.; Feldberg, Eliana

    2015-01-01

    Abstract The structure and organization of repetitive elements in fish genomes are still relatively poorly understood, although most of these elements are believed to be located in heterochromatic regions. Repetitive elements are considered essential in evolutionary processes as hotspots for mutations and chromosomal rearrangements, among other functions – thus providing new genomic alternatives and regulatory sites for gene expression. The present study sought to characterize repetitive DNA sequences in the genomes of Semaprochilodus insignis (Jardine & Schomburgk, 1841) and Semaprochilodus taeniurus (Valenciennes, 1817) and identify regions of conserved syntenic blocks in this genome fraction of three species of Prochilodontidae (Semaprochilodus insignis, Semaprochilodus taeniurus, and Prochilodus lineatus (Valenciennes, 1836) by cross-FISH using Cot-1 DNA (renaturation kinetics) probes. We found that the repetitive fractions of the genomes of Semaprochilodus insignis and Semaprochilodus taeniurus have significant amounts of conserved syntenic blocks in hybridization sites, but with low degrees of similarity between them and the genome of Prochilodus lineatus, especially in relation to B chromosomes. The cloning and sequencing of the repetitive genomic elements of Semaprochilodus insignis and Semaprochilodus taeniurus using Cot-1 DNA identified 48 fragments that displayed high similarity with repetitive sequences deposited in public DNA databases and classified as microsatellites, transposons, and retrotransposons. The repetitive fractions of the Semaprochilodus insignis and Semaprochilodus taeniurus genomes exhibited high degrees of conserved syntenic blocks in terms of both the structures and locations of hybridization sites, but a low degree of similarity with the syntenic blocks of the Prochilodus lineatus genome. Future comparative analyses of other prochilodontidae species will be needed to advance our understanding of the organization and evolution of

  1. The Parameterization of All Robust Stabilizing Simple Repetitive Controllers

    NASA Astrophysics Data System (ADS)

    Yamada, Kou; Sakanushi, Tatsuya; Ando, Yoshinori; Hagiwara, Takaaki; Murakami, Iwanori; Takenaga, Hiroshi; Tanaka, Hiroshi; Matsuura, Shun

    The modified repetitive control system is a type of servomechanism for the periodic reference input. That is, the modified repetitive control system follows the periodic reference input with small steady state error, even if a periodic disturbance or an uncertainty exists in the plant. Using previously proposed modified repetitive controllers, even if the plant does not include time-delay, transfer functions from the periodic reference input to the output and from the disturbance to the output have infinite numbers of poles. When transfer functions from the periodic reference input to the output and from the disturbance to the output have infinite numbers of poles, it is difficult to specify the input-output characteristic and the disturbance attenuation characteristic. From the practical point of view, it is desirable that the input-output characteristic and the disturbance attenuation characteristic are easily specified. In order to specify the input-output characteristic and the disturbance attenuation characteristic easily, transfer functions from the periodic reference input to the output and from the disturbance to the output are desirable to have finite numbers of poles. From this viewpoint, Yamada et al. proposed the concept of simple repetitive control systems such that the controller works as a modified repetitive controller and transfer functions from the periodic reference input to the output and from the disturbance to the output have finite numbers of poles. In addition, Yamada et al. clarified the parameterization of all stabilizing simple repetitive controllers. However, the method by Yamada et al. cannot be applied for the plant with uncertainty. The purpose of this paper is to propose the parameterization of all robust stabilizing simple repetitive controllers for the plant with uncertainty.

  2. A design method for robust stabilizing simple repetitive control systems

    NASA Astrophysics Data System (ADS)

    Yamada, Kou; Takenaga, Hiroshi; Tanaka, Hiroshi

    2007-12-01

    The modified repetitive control system is a type of servomechanism for the periodic reference input. That is, the modified repetitive control system follows the periodic reference input with small steady state error, even if a periodic disturbance or uncertainty exists in the plant. Using previously proposed modified repetitive controllers, even if the plants does not includes time-delay, the transfer function from the periodic reference input to the output and that from the disturbance to the output have an infinite number of poles. When the transfer function from the periodic reference input to the output and that from the disturbance to the output have an infinite number of poles, it is difficult to specify the input-output characteristic and the disturbance attenuation characteristic. From the practical point of view, it is desirable that the input-output characteristic and the disturbance attenuation characteristic are easily specified. In order to specify the input-output characteristic and the disturbance attenuation characteristic easily, the transfer function from the periodic reference input to the output and that from the disturbance to the output are desirable to have a finite number of poles. Yamada et al. proposed the concept of simple repetitive control systems such that the controller works as a modified repetitive controller and the transfer function from the periodic reference input to the output and that from the disturbance to the output have a finite number of poles. In addition, Yamada et al. clarified the parametrization of all stabilizing simple repetitive controllers. However the method by Yamada et al. cannot be applied for the plant with uncertainty. The purpose of this paper is to propose the parametrization of all robust stabilizing simple repetitive controllers for the plant with uncertainty.

  3. Place field repetition and spatial learning in a multicompartment environment.

    PubMed

    Grieves, Roddy M; Jenkins, Bryan W; Harland, Bruce C; Wood, Emma R; Dudchenko, Paul A

    2016-01-01

    Recent studies have shown that place cells in the hippocampus possess firing fields that repeat in physically similar, parallel environments. These results imply that it should be difficult for animals to distinguish parallel environments at a behavioral level. To test this, we trained rats on a novel odor-location task in an environment with four parallel compartments which had previously been shown to yield place field repetition. A second group of animals was trained on the same task, but with the compartments arranged in different directions, an arrangement we hypothesised would yield less place field repetition. Learning of the odor-location task in the parallel compartments was significantly impaired relative to learning in the radially arranged compartments. Fewer animals acquired the full discrimination in the parallel compartments compared to those trained in the radial compartments, and the former also required many more sessions to reach criterion compared to the latter. To confirm that the arrangement of compartments yielded differences in place cell repetition, in a separate group of animals we recorded from CA1 place cells in both environments. We found that CA1 place cells exhibited repeated fields across four parallel local compartments, but did not do so when the same compartments were arranged radially. To confirm that the differences in place field repetition across the parallel and radial compartments depended on their angular arrangement, and not incidental differences in access to an extra-maze visual landmark, we repeated the recordings in a second set of rats in the absence of the orientation landmark. We found, once again, that place fields showed repetition in parallel compartments, and did not do so in radially arranged compartments. Thus place field repetition, or lack thereof, in these compartments was not dependent on extra-maze cues. Together, these results imply that place field repetition constrains spatial learning. © 2015 Wiley

  4. Place field repetition and spatial learning in a multicompartment environment

    PubMed Central

    Grieves, Roddy M.; Jenkins, Bryan W.; Harland, Bruce C.

    2015-01-01

    Abstract Recent studies have shown that place cells in the hippocampus possess firing fields that repeat in physically similar, parallel environments. These results imply that it should be difficult for animals to distinguish parallel environments at a behavioral level. To test this, we trained rats on a novel odor‐location task in an environment with four parallel compartments which had previously been shown to yield place field repetition. A second group of animals was trained on the same task, but with the compartments arranged in different directions, an arrangement we hypothesised would yield less place field repetition. Learning of the odor‐location task in the parallel compartments was significantly impaired relative to learning in the radially arranged compartments. Fewer animals acquired the full discrimination in the parallel compartments compared to those trained in the radial compartments, and the former also required many more sessions to reach criterion compared to the latter. To confirm that the arrangement of compartments yielded differences in place cell repetition, in a separate group of animals we recorded from CA1 place cells in both environments. We found that CA1 place cells exhibited repeated fields across four parallel local compartments, but did not do so when the same compartments were arranged radially. To confirm that the differences in place field repetition across the parallel and radial compartments depended on their angular arrangement, and not incidental differences in access to an extra‐maze visual landmark, we repeated the recordings in a second set of rats in the absence of the orientation landmark. We found, once again, that place fields showed repetition in parallel compartments, and did not do so in radially arranged compartments. Thus place field repetition, or lack thereof, in these compartments was not dependent on extra‐maze cues. Together, these results imply that place field repetition constrains spatial learning

  5. Relationship between drug resistance and the clustered, regularly interspaced, short, palindromic repeat-associated protein genes cas1 and cas2 in Shigella from giant panda dung

    PubMed Central

    Ren, Lu; Deng, Lin-Hua; Zhang, Ri-Peng; Wang, Cheng-Dong; Li, De-Sheng; Xi, Li-Xin; Chen, Zhen-rong; Yang, Rui; Huang, Jie; Zeng, Yang-ru; Wu, Hong-Lin; Cao, San-Jie; Wu, Rui; Huang, Yong; Yan, Qi-Gui

    2017-01-01

    Abstract Background: To detect drug resistance in Shigella obtained from the dung of the giant panda, explore the factors leading to drug resistance in Shigella, understand the characteristics of clustered, regularly interspaced, short, palindromic repeats (CRISPR), and assess the relationship between CRISPR and drug resistance. Methods: We collected fresh feces from 27 healthy giant pandas in the Giant Panda Conservation base (Wolong, China). We identified the strains of Shigella in the samples by using nucleotide sequence analysis. Further, the Kirby-Bauer paper method was used to determine drug sensitivity of the Shigella strains. CRISPR-associated protein genes cas1 and cas2 in Shigella were detected by polymerase chain reaction (PCR), and the PCR products were sequenced and compared. Results: We isolated and identified 17 strains of Shigella from 27 samples, including 14 strains of Shigella flexneri, 2 strains of Shigella sonnei, and 1 strain of Shigella dysenteriae. Further, drug resistance to cefazolin, imipenem, and amoxicillin–clavulanic acid was identified as a serious problem, as multidrug-resistant strains were detected. Further, cas1 and cas2 showed different degrees of point mutations. Conclusion: The CRISPR system widely exists in Shigella and shares homology with that in Escherichia coli. The cas1 and cas 2 mutations contribute to the different levels of resistance. Point mutations at sites 3176455, 3176590, and 3176465 in cas1 (a); sites 3176989, 3176992, and 3176995 in cas1 (b); sites 3176156 and 3176236 in cas2 may affect the resistance of bacteria, cause emergence of multidrug resistance, and increase the types of drug resistance. PMID:28207509

  6. Stimulation of the human intercellular adhesion molecule-1 promoter by interleukin-6 and interferon-gamma involves binding of distinct factors to a palindromic response element.

    PubMed

    Caldenhoven, E; Coffer, P; Yuan, J; Van de Stolpe, A; Horn, F; Kruijer, W; Van der Saag, P T

    1994-08-19

    Intercellular adhesion molecule-1 (ICAM-1) is a transmembrane glycoprotein that promotes adhesion in immunological and inflammatory reactions. ICAM-1 is expressed on cells of many lineages and is induced by interleukin-6 (IL-6) and interferon-gamma (IFN-gamma). Functional analysis of ICAM-1 promoter-luciferase constructs in HepG2 cells enabled us to identify a region between -110 and -37 mediating IL-6 and IFN-gamma responsiveness and containing a palindromic IL-6/IFN-gamma response element (pIRE). Site-directed mutagenesis of key nucleotides in the ICAM-1 pIRE abolished the effect of both IL-6 and IFN-gamma stimulation, while this pIRE element was sufficient to confer IL-6 and IFN-gamma responsiveness to a heterologous promoter. We further show by gel retardation analysis that distinct nuclear factors induced by both IL-6 or IFN-gamma specifically bind to this pIRE. Furthermore, treatment with IL-6 results in the formation of multiple complexes while IFN-gamma induces a single binding complex, both in HepG2 and monocytic U937 cells. Differentiation of U937 cells by exposure to 12-O-tetradecanoyl phorbol-13-acetate abolishes response to IL-6 but not IFN-gamma. Supershift data utilizing the ICAM-1 pIRE revealed that IFN-gamma and IL-6 both induce a factor antigenically related to IFN-gamma activation factor. We further provide data suggesting that IL-6 additionally activates an ICAM-1 pIRE binding factor related to the previously described acute-phase response factor in disparate cell types. We therefore conclude that the activation of these related nuclear factors by IL-6 and IFN-gamma is important in the regulation of ICAM-1 gene expression.

  7. The evolutionary divergence of Shiga toxin-producing Escherichia coli is reflected in clustered regularly interspaced short palindromic repeat (CRISPR) spacer composition.

    PubMed

    Yin, Shuang; Jensen, Mark A; Bai, Jiawei; Debroy, Chitrita; Barrangou, Rodolphe; Dudley, Edward G

    2013-09-01

    The Shiga toxin-producing Escherichia coli (STEC) strains, including those of O157:H7 and the "big six" serogroups (i.e., serogroups O26, O45, O103, O111, O121, and O145), are a group of pathogens designated food adulterants in the United States. The relatively conserved nature of clustered regularly interspaced short palindromic repeats (CRISPRs) in phylogenetically related E. coli strains makes them potential subtyping markers for STEC detection, and a quantitative PCR (qPCR)-based assay was previously developed for O26:H11, O45:H2, O103:H2, O111:H8, O121:H19, O145:H28, and O157:H7 isolates. To better evaluate the sensitivity and specificity of this qPCR method, the CRISPR loci of 252 O157 and big-six STEC isolates were sequenced and analyzed along with 563 CRISPR1 and 624 CRISPR2 sequences available in GenBank. General conservation of spacer content and order was observed within each O157 and big-six serogroup, validating the qPCR method. Meanwhile, it was found that spacer deletion, the presence of an insertion sequence, and distinct alleles within a serogroup are sources of false-negative reactions. Conservation of CRISPR arrays among isolates expressing the same flagellar antigen, specifically, H7, H2, and H11, suggested that these isolates share an ancestor and provided an explanation for the false positives previously observed in the qPCR results. An analysis of spacer distribution across E. coli strains provided limited evidence for temporal spacer acquisition. Conversely, comparison of CRISPR sequences between strains along the stepwise evolution of O157:H7 from its O55:H7 ancestor revealed that, over this ∼7,000-year span, spacer deletion was the primary force generating CRISPR diversity.

  8. Association of Clustered Regularly Interspaced Short Palindromic Repeat (CRISPR) Elements with Specific Serotypes and Virulence Potential of Shiga Toxin-Producing Escherichia coli

    PubMed Central

    Toro, Magaly; Cao, Guojie; Ju, Wenting; Allard, Marc; Barrangou, Rodolphe; Zhao, Shaohua; Brown, Eric

    2014-01-01

    Shiga toxin-producing Escherichia coli (STEC) strains (n = 194) representing 43 serotypes and E. coli K-12 were examined for clustered regularly interspaced short palindromic repeat (CRISPR) arrays to study genetic relatedness among STEC serotypes. A subset of the strains (n = 81) was further analyzed for subtype I-E cas and virulence genes to determine a possible association of CRISPR elements with potential virulence. Four types of CRISPR arrays were identified. CRISPR1 and CRISPR2 were present in all strains tested; 1 strain also had both CRISPR3 and CRISPR4, whereas 193 strains displayed a short, combined array, CRISPR3-4. A total of 3,353 spacers were identified, representing 528 distinct spacers. The average length of a spacer was 32 bp. Approximately one-half of the spacers (54%) were unique and found mostly in strains of less common serotypes. Overall, CRISPR spacer contents correlated well with STEC serotypes, and identical arrays were shared between strains with the same H type (O26:H11, O103:H11, and O111:H11). There was no association identified between the presence of subtype I-E cas and virulence genes, but the total number of spacers had a negative correlation with potential pathogenicity (P < 0.05). Fewer spacers were found in strains that had a greater probability of causing outbreaks and disease than in those with lower virulence potential (P < 0.05). The relationship between the CRISPR-cas system and potential virulence needs to be determined on a broader scale, and the biological link will need to be established. PMID:24334663

  9. Relationship between drug resistance and the clustered, regularly interspaced, short, palindromic repeat-associated protein genes cas1 and cas2 in Shigella from giant panda dung.

    PubMed

    Ren, Lu; Deng, Lin-Hua; Zhang, Ri-Peng; Wang, Cheng-Dong; Li, De-Sheng; Xi, Li-Xin; Chen, Zhen-Rong; Yang, Rui; Huang, Jie; Zeng, Yang-Ru; Wu, Hong-Lin; Cao, San-Jie; Wu, Rui; Huang, Yong; Yan, Qi-Gui

    2017-02-01

    To detect drug resistance in Shigella obtained from the dung of the giant panda, explore the factors leading to drug resistance in Shigella, understand the characteristics of clustered, regularly interspaced, short, palindromic repeats (CRISPR), and assess the relationship between CRISPR and drug resistance. We collected fresh feces from 27 healthy giant pandas in the Giant Panda Conservation base (Wolong, China). We identified the strains of Shigella in the samples by using nucleotide sequence analysis. Further, the Kirby-Bauer paper method was used to determine drug sensitivity of the Shigella strains. CRISPR-associated protein genes cas1 and cas2 in Shigella were detected by polymerase chain reaction (PCR), and the PCR products were sequenced and compared. We isolated and identified 17 strains of Shigella from 27 samples, including 14 strains of Shigella flexneri, 2 strains of Shigella sonnei, and 1 strain of Shigella dysenteriae. Further, drug resistance to cefazolin, imipenem, and amoxicillin-clavulanic acid was identified as a serious problem, as multidrug-resistant strains were detected. Further, cas1 and cas2 showed different degrees of point mutations. The CRISPR system widely exists in Shigella and shares homology with that in Escherichia coli. The cas1 and cas 2 mutations contribute to the different levels of resistance. Point mutations at sites 3176455, 3176590, and 3176465 in cas1 (a); sites 3176989, 3176992, and 3176995 in cas1 (b); sites 3176156 and 3176236 in cas2 may affect the resistance of bacteria, cause emergence of multidrug resistance, and increase the types of drug resistance.

  10. The Evolutionary Divergence of Shiga Toxin-Producing Escherichia coli Is Reflected in Clustered Regularly Interspaced Short Palindromic Repeat (CRISPR) Spacer Composition

    PubMed Central

    Yin, Shuang; Jensen, Mark A.; Bai, Jiawei; DebRoy, Chitrita; Barrangou, Rodolphe

    2013-01-01

    The Shiga toxin-producing Escherichia coli (STEC) strains, including those of O157:H7 and the “big six” serogroups (i.e., serogroups O26, O45, O103, O111, O121, and O145), are a group of pathogens designated food adulterants in the United States. The relatively conserved nature of clustered regularly interspaced short palindromic repeats (CRISPRs) in phylogenetically related E. coli strains makes them potential subtyping markers for STEC detection, and a quantitative PCR (qPCR)-based assay was previously developed for O26:H11, O45:H2, O103:H2, O111:H8, O121:H19, O145:H28, and O157:H7 isolates. To better evaluate the sensitivity and specificity of this qPCR method, the CRISPR loci of 252 O157 and big-six STEC isolates were sequenced and analyzed along with 563 CRISPR1 and 624 CRISPR2 sequences available in GenBank. General conservation of spacer content and order was observed within each O157 and big-six serogroup, validating the qPCR method. Meanwhile, it was found that spacer deletion, the presence of an insertion sequence, and distinct alleles within a serogroup are sources of false-negative reactions. Conservation of CRISPR arrays among isolates expressing the same flagellar antigen, specifically, H7, H2, and H11, suggested that these isolates share an ancestor and provided an explanation for the false positives previously observed in the qPCR results. An analysis of spacer distribution across E. coli strains provided limited evidence for temporal spacer acquisition. Conversely, comparison of CRISPR sequences between strains along the stepwise evolution of O157:H7 from its O55:H7 ancestor revealed that, over this ∼7,000-year span, spacer deletion was the primary force generating CRISPR diversity. PMID:23851088

  11. Generation of Hypertension-Associated STK39 Polymorphism Knockin Cell Lines With the Clustered Regularly Interspaced Short Palindromic Repeats/Cas9 System.

    PubMed

    Mandai, Shintaro; Mori, Takayasu; Sohara, Eisei; Rai, Tatemitsu; Uchida, Shinichi

    2015-12-01

    Previous genome-wide association studies identified serine threonine kinase 39 (STK39), encoding STE20/SPS1-related proline/alanine-rich kinase, as one of a limited number of hypertension susceptibility genes. A recent meta-analysis confirmed the association of STK39 intronic polymorphism rs3754777 with essential hypertension, among previously reported hypertension-associated STK39 polymorphisms. However, the biochemical function of this polymorphism in the mechanism responsible for hypertension is yet to be clarified. We generated rs3754777G>A knockin human cell lines with clustered regularly interspaced short palindromic repeats-mediated genome engineering. Homozygous (A/A) and heterozygous (G/A) knockin human embryonic kidney cell lines were generated using a double nickase, single-guide RNAs targeting STK39 intron 5 around single-nucleotide polymorphism, and a 100-bp donor single-stranded DNA oligonucleotide. Reverse transcription polymerase chain reaction with sequencing analyses revealed the identical STK39 transcripts among the wild-type and both knockin cell lines. Quantitative reverse transcription polymerase chain reaction showed increased STK39 mRNA expression, and immunoblot analysis revealed increases in total and phosphorylated STE20/SPS1-related proline/alanine-rich kinase with increased phosphorylated Na-K-Cl cotransporter isoform 1 in both knockin cell lines. The largest increases in these molecules were observed in the homozygous cell line. These findings indicated that this intronic polymorphism increases STK39 transcription, leading to activation of the STE20/SPS1-related proline/alanine-rich kinase-solute carrier family 12A signaling cascade. Increased interactions between STE20/SPS1-related proline/alanine-rich kinase and the target cation-chloride cotransporters may be responsible for hypertension susceptibility in individuals with this polymorphism. © 2015 American Heart Association, Inc.

  12. Clustered Regularly Interspaced Short Palindromic Repeat-Dependent, Biofilm-Specific Death of Pseudomonas aeruginosa Mediated by Increased Expression of Phage-Related Genes

    PubMed Central

    Heussler, Gary E.; Cady, Kyle C.; Koeppen, Katja; Bhuju, Sabin; Stanton, Bruce A.

    2015-01-01

    ABSTRACT The clustered regularly interspaced short palindromic repeat (CRISPR)/CRISPR-associated (CRISPR/Cas) system is an adaptive immune system present in many archaea and bacteria. CRISPR/Cas systems are incredibly diverse, and there is increasing evidence of CRISPR/Cas systems playing a role in cellular functions distinct from phage immunity. Previously, our laboratory reported one such alternate function in which the type 1-F CRISPR/Cas system of the opportunistic pathogen Pseudomonas aeruginosa strain UCBPP-PA14 (abbreviated as P. aeruginosa PA14) inhibits both biofilm formation and swarming motility when the bacterium is lysogenized by the bacteriophage DMS3. In this study, we demonstrated that the presence of just the DMS3 protospacer and the protospacer-adjacent motif (PAM) on the P. aeruginosa genome is necessary and sufficient for this CRISPR-dependent loss of these group behaviors, with no requirement of additional DMS3 sequences. We also demonstrated that the interaction of the CRISPR system with the DMS3 protospacer induces expression of SOS-regulated phage-related genes, including the well-characterized pyocin operon, through the activity of the nuclease Cas3 and subsequent RecA activation. Furthermore, our data suggest that expression of the phage-related genes results in bacterial cell death on a surface due to the inability of the CRISPR-engaged strain to downregulate phage-related gene expression, while these phage-related genes have minimal impact on growth and viability under planktonic conditions. Deletion of the phage-related genes restores biofilm formation and swarming motility while still maintaining a functional CRISPR/Cas system, demonstrating that the loss of these group behaviors is an indirect effect of CRISPR self-targeting. PMID:25968642

  13. Association of clustered regularly interspaced short palindromic repeat (CRISPR) elements with specific serotypes and virulence potential of shiga toxin-producing Escherichia coli.

    PubMed

    Toro, Magaly; Cao, Guojie; Ju, Wenting; Allard, Marc; Barrangou, Rodolphe; Zhao, Shaohua; Brown, Eric; Meng, Jianghong

    2014-02-01

    Shiga toxin-producing Escherichia coli (STEC) strains (n = 194) representing 43 serotypes and E. coli K-12 were examined for clustered regularly interspaced short palindromic repeat (CRISPR) arrays to study genetic relatedness among STEC serotypes. A subset of the strains (n = 81) was further analyzed for subtype I-E cas and virulence genes to determine a possible association of CRISPR elements with potential virulence. Four types of CRISPR arrays were identified. CRISPR1 and CRISPR2 were present in all strains tested; 1 strain also had both CRISPR3 and CRISPR4, whereas 193 strains displayed a short, combined array, CRISPR3-4. A total of 3,353 spacers were identified, representing 528 distinct spacers. The average length of a spacer was 32 bp. Approximately one-half of the spacers (54%) were unique and found mostly in strains of less common serotypes. Overall, CRISPR spacer contents correlated well with STEC serotypes, and identical arrays were shared between strains with the same H type (O26:H11, O103:H11, and O111:H11). There was no association identified between the presence of subtype I-E cas and virulence genes, but the total number of spacers had a negative correlation with potential pathogenicity (P < 0.05). Fewer spacers were found in strains that had a greater probability of causing outbreaks and disease than in those with lower virulence potential (P < 0.05). The relationship between the CRISPR-cas system and potential virulence needs to be determined on a broader scale, and the biological link will need to be established.

  14. New clustered regularly interspaced short palindromic repeat locus spacer pair typing method based on the newly incorporated spacer for Salmonella enterica.

    PubMed

    Li, Hao; Li, Peng; Xie, Jing; Yi, Shengjie; Yang, Chaojie; Wang, Jian; Sun, Jichao; Liu, Nan; Wang, Xu; Wu, Zhihao; Wang, Ligui; Hao, Rongzhang; Wang, Yong; Jia, Leili; Li, Kaiqin; Qiu, Shaofu; Song, Hongbin

    2014-08-01

    A clustered regularly interspaced short palindromic repeat (CRISPR) typing method has recently been developed and used for typing and subtyping of Salmonella spp., but it is complicated and labor intensive because it has to analyze all spacers in two CRISPR loci. Here, we developed a more convenient and efficient method, namely, CRISPR locus spacer pair typing (CLSPT), which only needs to analyze the two newly incorporated spacers adjoining the leader array in the two CRISPR loci. We analyzed a CRISPR array of 82 strains belonging to 21 Salmonella serovars isolated from humans in different areas of China by using this new method. We also retrieved the newly incorporated spacers in each CRISPR locus of 537 Salmonella isolates which have definite serotypes in the Pasteur Institute's CRISPR Database to evaluate this method. Our findings showed that this new CLSPT method presents a high level of consistency (kappa = 0.9872, Matthew's correlation coefficient = 0.9712) with the results of traditional serotyping, and thus, it can also be used to predict serotypes of Salmonella spp. Moreover, this new method has a considerable discriminatory power (discriminatory index [DI] = 0.8145), comparable to those of multilocus sequence typing (DI = 0.8088) and conventional CRISPR typing (DI = 0.8684). Because CLSPT only costs about $5 to $10 per isolate, it is a much cheaper and more attractive method for subtyping of Salmonella isolates. In conclusion, this new method will provide considerable advantages over other molecular subtyping methods, and it may become a valuable epidemiologic tool for the surveillance of Salmonella infections. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  15. Selective scanpath repetition during memory-guided visual search

    PubMed Central

    Wynn, Jordana S.; Bone, Michael B.; Dragan, Michelle C.; Hoffman, Kari L.; Buchsbaum, Bradley R.; Ryan, Jennifer D.

    2016-01-01

    ABSTRACT Visual search efficiency improves with repetition of a search display, yet the mechanisms behind these processing gains remain unclear. According to Scanpath Theory, memory retrieval is mediated by repetition of the pattern of eye movements or “scanpath” elicited during stimulus encoding. Using this framework, we tested the prediction that scanpath recapitulation reflects relational memory guidance during repeated search events. Younger and older subjects were instructed to find changing targets within flickering naturalistic scenes. Search efficiency (search time, number of fixations, fixation duration) and scanpath similarity (repetition) were compared across age groups for novel (V1) and repeated (V2) search events. Younger adults outperformed older adults on all efficiency measures at both V1 and V2, while the search time benefit for repeated viewing (V1–V2) did not differ by age. Fixation-binned scanpath similarity analyses revealed repetition of initial and final (but not middle) V1 fixations at V2, with older adults repeating more initial V1 fixations than young adults. In young adults only, early scanpath similarity correlated negatively with search time at test, indicating increased efficiency, whereas the similarity of V2 fixations to middle V1 fixations predicted poor search performance. We conclude that scanpath compression mediates increased search efficiency by selectively recapitulating encoding fixations that provide goal-relevant input. Extending Scanpath Theory, results suggest that scanpath repetition varies as a function of time and memory integrity. PMID:27570471

  16. Flexible high-repetition-rate ultrafast fiber laser

    PubMed Central

    Mao, Dong; Liu, Xueming; Sun, Zhipei; Lu, Hua; Han, Dongdong; Wang, Guoxi; Wang, Fengqiu

    2013-01-01

    High-repetition-rate pulses have widespread applications in the fields of fiber communications, frequency comb, and optical sensing. Here, we have demonstrated high-repetition-rate ultrashort pulses in an all-fiber laser by exploiting an intracavity Mach-Zehnder interferometer (MZI) as a comb filter. The repetition rate of the laser can be tuned flexibly from about 7 to 1100 GHz by controlling the optical path difference between the two arms of the MZI. The pulse duration can be reduced continuously from about 10.1 to 0.55 ps with the spectral width tunable from about 0.35 to 5.7 nm by manipulating the intracavity polarization controller. Numerical simulations well confirm the experimental observations and show that filter-driven four-wave mixing effect, induced by the MZI, is the main mechanism that governs the formation of the high-repetition-rate pulses. This all-fiber-based laser is a simple and low-cost source for various applications where high-repetition-rate pulses are necessary. PMID:24226153

  17. Repetitively Q-switched Nd:BeL lasers

    NASA Technical Reports Server (NTRS)

    Degnan, J.; Birnbaum, M.; Deshazer, L. G.

    1979-01-01

    The thermal and mechanical characteristics which will ultimately limit the performance of Nd:BeL at high average power levels were investigated. The output beam characteristics (pulse width, peak power, beam dimensions and collimation) were determined at high repetition rates for both Nd:BeL and Nd:YAG. The output of Nd:BeL was shown to exceed that of Nd:YAG by a factor of 2.7 at low Q-switched repetition rates (1 Hz). This result follows from the smaller stimulated emission cross section of x-axis Nb:BeL compared to that of NdYAG by the same factor. At high repetition rates (10 Hz) the output of Nd:Bel falls to a level of three-fifths of its low repetition rate value while under similar tests the output of Nd:YAG remains essentially constant. A comparison of the measured values of the elasto-optic coefficients, the dn/dT values and the linear expansion coefficients for BeL and YAG failed to provide an explanation for the performance of BeL; however, thermal lensing was observed in Nd:BeL. Results imply that the output of a high repetition rate Q-switched Nd:BeL laser (high thermal loading) could be dramatically increased by utilization of a resonator design to compensate for the thermal lensing effects.

  18. Characterising repetitive behaviours in young boys with fragile X syndrome

    PubMed Central

    Oakes, A.; Thurman, A.J.; McDuffie, A.; Bullard, L.M.; Hagerman, R.J.; Abbeduto, L.

    2015-01-01

    Background Repetitive behaviours are frequently observed in individuals with intellectual disability. The present study examined the profile, inter-correlations, and predictive correlates of repetitive behaviours in males with FXS, the leading inherited cause of intellectual disability. Specific child characteristics examined as predictors included: anxiety, nonverbal cognition, and autism social-affective symptomatology. Method Participants were 39 boys with FXS (aged 6–10 years). Repetitive behaviours were measured using the Repetitive Behavior Scale – Revised (RBS-R) – a 43-item caregiver-report measure normed on individuals with intellectual disability. Results Restricted Interests and Sensory Motor behaviours were reported as most problematic for this sample of boys, whereas Self-injurious behaviours were less problematic. All subscales of the RBS-R were significantly inter-correlated. Nonverbal IQ was negatively related, whereas anxiety and social affective symptoms of ASD were positively related, to scores for Restricted Interests. Anxiety was also positively related to scores for Compulsive behaviours and Ritualistic Sameness behaviours. Conclusions This study provides a preliminary description of repetitive behaviours in males with FXS, which may form the groundwork for future research. PMID:26449367

  19. Quantifying repetitive speech in autism spectrum disorders and language impairment.

    PubMed

    van Santen, Jan P H; Sproat, Richard W; Hill, Alison Presmanes

    2013-10-01

    We report on an automatic technique for quantifying two types of repetitive speech: repetitions of what the child says him/herself (self-repeats) and of what is uttered by an interlocutor (echolalia). We apply this technique to a sample of 111 children between the ages of four and eight: 42 typically developing children (TD), 19 children with specific language impairment (SLI), 25 children with autism spectrum disorders (ASD) plus language impairment (ALI), and 25 children with ASD with normal, non-impaired language (ALN). The results indicate robust differences in echolalia between the TD and ASD groups as a whole (ALN + ALI), and between TD and ALN children. There were no significant differences between ALI and SLI children for echolalia or self-repetitions. The results confirm previous findings that children with ASD repeat the language of others more than other populations of children. On the other hand, self-repetition does not appear to be significantly more frequent in ASD, nor does it matter whether the child's echolalia occurred within one (immediate) or two turns (near-immediate) of the adult's original utterance. Furthermore, non-significant differences between ALN and SLI, between TD and SLI, and between ALI and TD are suggestive that echolalia may not be specific to ALN or to ASD in general. One important innovation of this work is an objective fully automatic technique for assessing the amount of repetition in a transcript of a child's utterances.

  20. Lingual kinematics during rapid syllable repetition in Parkinson's disease.

    PubMed

    Wong, Min Ney; Murdoch, Bruce E; Whelan, Brooke-Mai

    2012-01-01

    Rapid syllable repetition tasks are commonly used in the assessment of motor speech disorders. However, little is known about the articulatory kinematics during rapid syllable repetition in individuals with Parkinson's disease (PD). To investigate and compare lingual kinematics during rapid syllable repetition in dysarthric speakers with PD (DPD), non-dysarthric speakers with PD (NDPD) and a group of healthy controls. Electromagnetic articulography was used to record tongue-tip and tongue-back movement in five DPD and five NDPD participants during rapid repetition of /ta/and /ka/syllables, and matched with six healthy controls. Results revealed significant between-group differences for most of the kinematic parameters measured but comparable rapid syllable repetition rates. Post-hoc analyses indicated that the DPD participants, when compared with the NDPD participants, had similar range but prolonged duration of lingual movement. The DPD and NDPD participants had primarily increased range and prolonged duration of lingual movement accompanied by increased speed parameters, when compared with healthy controls. The findings of the present study contradict theories that suggest that the clinical features of hypokinetic dysarthria, including articulatory imprecision, are the outcome of restrictions in the range of movement of the muscles of the articulators. The observed prolonged duration of lingual movement in PD may plausibly be due to the observed increased range of lingual movement rather than slowness of lingual movement. © 2012 Royal College of Speech and Language Therapists.

  1. Selective scanpath repetition during memory-guided visual search.

    PubMed

    Wynn, Jordana S; Bone, Michael B; Dragan, Michelle C; Hoffman, Kari L; Buchsbaum, Bradley R; Ryan, Jennifer D

    2016-01-02

    Visual search efficiency improves with repetition of a search display, yet the mechanisms behind these processing gains remain unclear. According to Scanpath Theory, memory retrieval is mediated by repetition of the pattern of eye movements or "scanpath" elicited during stimulus encoding. Using this framework, we tested the prediction that scanpath recapitulation reflects relational memory guidance during repeated search events. Younger and older subjects were instructed to find changing targets within flickering naturalistic scenes. Search efficiency (search time, number of fixations, fixation duration) and scanpath similarity (repetition) were compared across age groups for novel (V1) and repeated (V2) search events. Younger adults outperformed older adults on all efficiency measures at both V1 and V2, while the search time benefit for repeated viewing (V1-V2) did not differ by age. Fixation-binned scanpath similarity analyses revealed repetition of initial and final (but not middle) V1 fixations at V2, with older adults repeating more initial V1 fixations than young adults. In young adults only, early scanpath similarity correlated negatively with search time at test, indicating increased efficiency, whereas the similarity of V2 fixations to middle V1 fixations predicted poor search performance. We conclude that scanpath compression mediates increased search efficiency by selectively recapitulating encoding fixations that provide goal-relevant input. Extending Scanpath Theory, results suggest that scanpath repetition varies as a function of time and memory integrity.

  2. Central adaptations during repetitive contractions assessed by the readiness potential.

    PubMed

    Schillings, M L; Kalkman, J S; van der Werf, S P; Bleijenberg, G; van Engelen, B G M; Zwarts, M J

    2006-07-01

    Physiological fatigue, a loss of maximal force producing capacity, may originate both from changes at the peripheral and at the central level. The readiness potential (RP) provides a measure to study adaptations to physiological fatigue at the motor cortex. We have studied the RP in the course of repetitive contractions at a high force level. Fourteen female healthy subjects made repetitive force grip contractions at 70% of their maximal voluntary contraction (MVC) for 30 min. Contractions were self-paced and inter-squeeze interval was about 7 s. During the repetitive contractions, the area under the curve of the RP almost doubled at electrode Cz and increased fourfold at electrodes C3' and C4'. The onset of negativity moved forward from 1.5 to 1.9 s before force onset at Cz and from 1.0 to 1.6 s and 1.7 s before force onset at C3' and C4', respectively. EMG amplitude and median frequency did not change significantly and MVC after the fatiguing exercise was 93% of MVC before, indicating relatively little physiological fatigue. The increase of the RP during the repetitive contractions is clearly in excess of the almost absent signs of peripheral fatigue. Because the increase of the RP does not lead to an increased force production, we propose that it is a central adaptation counteracting the decrease of cortical efficiency during repetitive contractions.

  3. Physical chromosome mapping of repetitive DNA sequences in Nile tilapia Oreochromis niloticus: evidences for a differential distribution of repetitive elements in the sex chromosomes.

    PubMed

    Ferreira, Irani A; Martins, Cesar

    2008-06-01

    Repetitive DNAs have been extensively applied as physical chromosome markers on comparative studies, identification of chromosome rearrangements and sex chromosomes, chromosome evolution analysis, and applied genetics. Here we report the characterization of repetitive DNA sequences from the Nile tilapia (Oreochromis niloticus) genome by construction and screening of plasmid library enriched with repetitive DNAs, analysis of a BAC-based physical map, and hybridization to chromosomes. The physical mapping of BACs enriched with repetitive sequences and C(o)t-1 DNA (DNA enriched for highly and moderately repetitive DNA sequences) to chromosomes using FISH showed a predominant distribution of repetitive elements in the centromeric and telomeric regions and along the entire length of the largest chromosome pair (X and Y sex chromosomes) of the species. The distribution of repetitive DNAs differed significantly between the p arm of X and Y chromosomes. These findings suggest that repetitive DNAs have had an important role in the differentiation of sex chromosomes.

  4. Repetition blindness for faces reflects identity coding but not emotion coding.

    PubMed

    Buttle, Heather

    2010-02-01

    Repetition blindness for visually presented stimuli occurs when only one of two similar items is available to a viewer's conscious awareness. The objective of this experiment was to investigate repetition blindness for faces and to observe whether encoding of similar emotions displayed on different individuals' faces produced repetition blindness. A further aim was to assess whether such an effect could be modulated by attentional task demands (sex judgment or expression judgment). Faces were presented so that four within-participant conditions could be compared: Complete repetition, same emotion/different Identity repetition, same identity/different Emotion repetition, and No repetition trials. The data revealed repetition blindness for Complete and same identity/different Emotion repetitions, but not for same emotion/different Identity repetitions. The lack of an "emotion blindness" effect supports previous reports that emotional expressions do not necessarily lead to automatic attentional biases.

  5. Coordinate replication of dispersed repetitive sequences in Physarum polycephalum.

    PubMed

    Read, C M; Patel, U A; Moss, T

    1989-04-01

    The synchronous macroplasmodial growth phase of the slime mould Physarum polycephalum was used to study the in vivo replication of large chromosomal DNA segments. Newly replicated DNA was isolated at various points in S-phase by its preferential association with the nuclear matrix. This DNA was then used to probe cosmid clones of the Physarum genome. The results indicate that certain dispersed repetitive sequences in the genome are coordinately replicated. The observed pattern of replication may be due either to the presence of a replication origin within each repetitive sequence or to the systematic arrangement of these sequences around a replication origin. The latter appears more likely since the repetitive sequences are probably not randomly scattered within the genome.

  6. The effect of repetition and similarity on sequence learning.

    PubMed

    Monaghan, Padraic; Rowson, Chris

    2008-12-01

    Repetition is a pervasive feature of children's environments, and may be an important contributor to learning such complex sequential structures as language. Endress, Dehaene-Lambertz, and Mehler (2007) found that repeated tone sequences were learned more easily than sequences containing ordinal relations, but there have been no direct comparisons of repeating sequences versus sequences that contain similar, but not identical, stimuli. In Experiment 1, we compared learning from repeating tone sequences to learning from tones that varied in similarity, and confirmed that repetition is a special case for learning. In Experiment 2 we showed that the learning distinction between repeated and similar elements is not affected by whether similarity is variable. We conclude by indicating that repetition provides an important constraint on learning, and we discuss the extent to which such constraints are consistent with general-purpose statistical learning mechanisms.

  7. Body-focused repetitive behavior disorders in ICD-11.

    PubMed

    Grant, Jon E; Stein, Dan J

    2014-01-01

    This article addresses the question of how body-focused repetitive behavior disorders (e.g., trichotillomania and skin-picking disorder) should be characterized in ICD-11. The article reviews the historical nosology of the two disorders and the current approaches in DSM-5 and ICD-10. Although data are limited and mixed regarding the optimal relationship between body-focused repetitive behavior disorders and nosological categories, these conditions should be included within the obsessive-compulsive and related disorders category, as this is how most clinicians see these behaviors, and as this may optimize clinical utility. The descriptions of these disorders should largely mirror those in DSM-5, given the evidence from recent field surveys. The recommendations regarding ICD-11 and body-focused repetitive behavior disorders should promote the global identification and treatment of these conditions in primary care settings.

  8. Location invariance in masked repetition priming of letters and words.

    PubMed

    Marzouki, Yousri; Meeter, Martijn; Grainger, Jonathan

    2013-01-01

    Earlier studies have suggested that information from a prime stimulus can be integrated with target information even when the two stimuli appear at different spatial locations. Here, we examined such location invariance in a masked repetition priming paradigm with single letter and word stimuli. In order to neutralize effects of acuity and spatial attention on prime processing, subliminal prime stimuli always appeared on fixation. Target location varied randomly from trial to trial along the horizontal meridian at one of seven possible locations for letter stimuli (-7° to +7°) and three positions for word stimuli (-4°, 0°, +4°). Speed of responding to letter and word targets was affected by target location, and by priming, but the size of repetition priming effects did not vary as a function of target location. These results suggest that masked repetition priming is mediated by representations that integrate information about object identity independently of object location.

  9. Oral Language Skills Moderate Nonword Repetition Skills in Children with Dyslexia: A Meta-Analysis of the Role of Nonword Repetition Skills in Dyslexia

    ERIC Educational Resources Information Center

    Melby-Lervag, Monica; Lervag, Arne

    2012-01-01

    We present a meta-analysis reviewing studies that have focused on the relationship between dyslexia and nonword repetition. The results show that children with dyslexia have poorer nonword repetition skills when compared to both chronological-age and reading-level controls. However, the severity of the nonword repetition problem varies…

  10. Repetition of Deliberate Self-Harm: A Study of the Characteristics and Subsequent Deaths in Patients Presenting to a General Hospital According to Extent of Repetition

    ERIC Educational Resources Information Center

    Haw, Camilla; Bergen, Helen; Casey, Deborah; Hawton, Keith

    2007-01-01

    Repetition of deliberate self-harm (DSH) is common. Some patients repeat multiple times. We have investigated the characteristics of repeaters, and mortality in three groups of DSH patients by repetition status. Data collected by the Oxford Monitoring System for Attempted Suicide were used to examine the pattern of repetition of DSH patients…

  11. Oral Language Skills Moderate Nonword Repetition Skills in Children with Dyslexia: A Meta-Analysis of the Role of Nonword Repetition Skills in Dyslexia

    ERIC Educational Resources Information Center

    Melby-Lervag, Monica; Lervag, Arne

    2012-01-01

    We present a meta-analysis reviewing studies that have focused on the relationship between dyslexia and nonword repetition. The results show that children with dyslexia have poorer nonword repetition skills when compared to both chronological-age and reading-level controls. However, the severity of the nonword repetition problem varies…

  12. The neural correlates of picture naming facilitated by auditory repetition

    PubMed Central

    2012-01-01

    Background Overt repetition of auditorily presented words can facilitate picture naming performance in both unimpaired speakers and individuals with word retrieval difficulties, but the underlying neurocognitive mechanisms and longevity of such effects remain unclear. This study used functional magnetic resonance imaging to examine whether different neurological mechanisms underlie short-term (within minutes) and long-term (within days) facilitation effects from an auditory repetition task in healthy older adults. Results The behavioral results showed that both short- and long-term facilitated items were named significantly faster than unfacilitated items, with short-term items significantly faster than long-term items. Neuroimaging analyses identified a repetition suppression effect for long-term facilitated items, relative to short-term facilitated and unfacilitated items, in regions known to be associated with both semantic and phonological processing. A repetition suppression effect was also observed for short-term facilitated items when compared to unfacilitated items in a region of the inferior temporal lobe linked to semantic processing and object recognition, and a repetition enhancement effect when compared to long-term facilitated items in a posterior superior temporal region associated with phonological processing. Conclusions These findings suggest that different neurocognitive mechanisms underlie short- and long-term facilitation of picture naming by an auditory repetition task, reflecting both phonological and semantic processing. More specifically, the brain areas engaged were consistent with the view that long-term facilitation may be driven by a strengthening of semantic-phonological connections. Short-term facilitation, however, appears to result in more efficient semantic processing and/or object recognition, possibly in conjunction with active recognition of the phonological form. PMID:22364354

  13. Comparison of concentric and eccentric bench press repetitions to failure.

    PubMed

    Kelly, Stephen B; Brown, Lee E; Hooker, Steven P; Swan, Pamela D; Buman, Matthew P; Alvar, Brent A; Black, Laurie E

    2015-04-01

    Eccentric muscle actions (ECC) are characterized by muscle lengthening, despite actin-myosin crossbridge formation. Muscles acting eccentrically are capable of producing higher levels of force compared with muscles acting concentrically. The purpose of this study was to determine whether ECC bench press yields greater strength than concentric (CON) as determined by 1 repetition maximum (1RM). Additionally, a comparison was made examining differences in the number of repetitions to failure at different relative intensities of 1RM. Thirty healthy men (age = 24.63 ± 5.6 years) were tested for 1RM in CON and ECC bench press and the number of repetitions completed at 60, 70, 80, and 90% 1RM. For CON repetitions, the weight was mechanically lowered to the chest, and the participant pressed it up until the elbows were fully extended. The ECC bench press consisted of lowering a barbell from a fully extended elbow position to the chest in a continuous controlled manner for 3 seconds as determined by electronic metronome. Paired t-tests showed that ECC 1RM (115.99 ± 31.08 kg) was significantly (p ≤ 0.05) greater than CON 1RM (93.56 ± 26.56 kg), and the number of repetitions completed at 90% 1RM was significantly (p ≤ 0.05) greater in ECC (7.67 ± 3.24) as compared with CON (4.57 ± 2.21). There were no significant differences in number of completed repetitions during CON and ECC bench press at 60, 70, and 80% 1RM. These data indicate that ECC actions yield increased force capabilities (∼120%) as compared with CON in the bench press and may be less prone to fatigue, especially at higher intensities. These differences suggest a need to develop unique strategies for training eccentrically.

  14. Characterizing caregiver responses to restricted and repetitive behaviors in toddlers with autism spectrum disorder.

    PubMed

    Harrop, Clare; Gulsrud, Amanda; Shih, Wendy; Hovsepyan, Lilit; Kasari, Connie

    2016-04-01

    Restricted and repetitive behaviors are a core feature of autism spectrum disorder. This descriptive study documented the presence of restricted and repetitive behaviors in 85 toddlers with autism spectrum disorder as they interacted with their caregiver in a play interaction. For each child restricted and repetitive behavior, a caregiver response/non-response was coded. Caregiver responses were rated as successful or unsuccessful. In all, 83 toddlers demonstrated at least one restricted and repetitive behavior in 10 min. The most common child restricted and repetitive behavior was repetitive object use with 72 children displaying at least one instance of this category of restricted and repetitive behavior. Overall, caregivers responded to fewer than half of their child's restricted and repetitive behaviors, and caregiver response varied by child restricted and repetitive behavior type. The most common response was redirection. Success varied by child restricted and repetitive behavior type and caregiver response--redirections were most successful for child verbal and motor restricted and repetitive behaviors, whereas physical or verbal responses were rated more successful for repetitive object use and visual restricted and repetitive behaviors. This study represents the first attempt to characterize how caregivers respond to restricted and repetitive behaviors. Toddlers with autism spectrum disorder are already demonstrating a variety of restricted and repetitive behaviors within the context of a free play sessions, and caregivers differentially and naturally respond to them.

  15. Prediction of Muscle Performance During Dynamic Repetitive Exercise

    NASA Technical Reports Server (NTRS)

    Byerly, D. L.; Byerly, K. A.; Sognier, M. A.; Squires, W. G.

    2002-01-01

    A method for predicting human muscle performance was developed. Eight test subjects performed a repetitive dynamic exercise to failure using a Lordex spinal machine. Electromyography (EMG) data was collected from the erector spinae. Evaluation of the EMG data using a 5th order Autoregressive (AR) model and statistical regression analysis revealed that an AR parameter, the mean average magnitude of AR poles, can predict performance to failure as early as the second repetition of the exercise. Potential applications to the space program include evaluating on-orbit countermeasure effectiveness, maximizing post-flight recovery, and future real-time monitoring capability during Extravehicular Activity.

  16. Interaction of repetitively pulsed high energy laser radiation with matter

    NASA Astrophysics Data System (ADS)

    Hugenschmidt, M.

    1986-05-01

    Laser target interaction processes and methods of improving the overall energy balance are discussed. This can be achieved with high repetition rate pulsed lasers even for initially highly reflecting materials, such as metals. Experiments were performed using a pulsed CO2 laser at mean powers up to 2 KW and repetition rates up to 100 Hz. The rates of temperature rise of aluminum for example are increased by more than a factor of 3 as compared to cw-radiation of comparable power density. Similar improvements are found for the overall absorptivities, that are increased by more than an order of magnitude.

  17. The Length of the Terminal Repetition in Adenovirus-2 DNA

    PubMed Central

    Roberts, Richard J.; Arrand, John R.; Keller, Walter

    1974-01-01

    Adenovirus-2 DNA was end-labeled by partial digestion with Escherichia coli exonuclease III and resynthesis with the DNA polymerase from avian myeloblastosis virus and α-32P-labeled deoxyribonucleoside triphosphates. This end-labeled DNA was cleaved with several specific endonucleases and the terminal fragments were characterized by gel electrophoresis and pyrimidine tract analysis. Two endonucleases gave identical fragments from both ends, presumably from cleavage within the inverted terminal repetition, while all other endonucleases gave dissimilar fragments from the two ends. From the sizes of these fragments it is estimated that the inverted terminal repetition is between 100 and 140 nucleotide pairs long. Images PMID:4139703

  18. Transfer in artificial grammar learning: the role of repetition information.

    PubMed

    Lotz, Anja; Kinder, Annette

    2006-07-01

    In this article, the authors report 2 experiments that investigated the sources of information used in transfer and nontransfer tasks in artificial grammar learning. Multiple regression analyses indicated that 2 types of information about repeating elements were crucial for performance in both tasks: information about the repetition of adjacent elements and information about repetition of elements in the whole item. Similarity of test items to specific training items and chunk information influenced participants' judgments only in nontransfer tasks. Copyright 2006 APA, all rights reserved.

  19. Demonstration of a high repetition rate capillary discharge waveguide

    SciTech Connect

    Gonsalves, A. J. Pieronek, C.; Daniels, J.; Bulanov, S. S.; Waldron, W. L.; Mittelberger, D. E.; Leemans, W. P.; Liu, F.; Antipov, S.; Butler, J. E.; Bobrova, N. A.; Sasorov, P. V.

    2016-01-21

    A hydrogen-filled capillary discharge waveguide operating at kHz repetition rates is presented for parameters relevant to laser plasma acceleration (LPA). The discharge current pulse was optimized for erosion mitigation with laser guiding experiments and MHD simulation. Heat flow simulations and measurements showed modest temperature rise at the capillary wall due to the average heat load at kHz repetition rates with water-cooled capillaries, which is promising for applications of LPAs such as high average power radiation sources.

  20. The Adult Repetitive Behaviours Questionnaire-2 (RBQ-2A): A Self-Report Measure of Restricted and Repetitive Behaviours.

    PubMed

    Barrett, Sarah L; Uljarević, Mirko; Baker, Emma K; Richdale, Amanda L; Jones, Catherine R G; Leekam, Susan R

    2015-11-01

    In two studies we developed and tested a new self-report measure of restricted and repetitive behaviours (RRB) suitable for adults. In Study 1, The Repetitive Behaviours Questionnaire-2 for adults (RBQ-2A) was completed by a sample of 163 neurotypical adults. Principal components analysis revealed two components: Repetitive Motor Behaviours and Insistence on Sameness. In Study 2, the mean RBQ-2A scores of a group of adults with autism spectrum disorder (ASD; N = 29) were compared to an adult neurotypical group (N = 37). The ASD sample had significantly higher total and subscale scores. These results indicate that the RBQ-2A has utility as a self-report questionnaire measure of RRBs suitable for adults, with potential clinical application.

  1. Synesthesia in twins: incomplete concordance in monozygotes suggests extragenic factors.

    PubMed

    Bosley, Hannah G; Eagleman, David M

    2015-06-01

    Colored-sequence synesthesia (CSS) is a neurological condition in which sequential stimuli such as letters, numbers, or days of the week trigger simultaneous, involuntary color perception. Although the condition appears to run in families and several studies have sought a genetic link, the genetic contribution to synesthesia remains unclear. We conducted the first comparative twin study of CSS and found that CSS has a pairwise concordance of 73.9% in monozygotic twins, and a pairwise concordance of 36.4% in dizygotic twins. In line with previous studies, our results suggest a heritable element of synesthesia. However, consonant with the findings of previous single-pair case studies, our large sample size verifies that synesthesia is not completely conferred by genetics; if it were, monozygotic twins should have 100% concordance. These findings implicate a genetic mechanism of CSS that may work differently than previously thought: collectively, our data suggest that synesthesia is a heritable condition with incomplete penetrance that is substantially influenced by epigenetic and environmental factors. Copyright © 2015 Elsevier B.V. All rights reserved.

  2. Characterisation of genotypes among bovine viral diarrhoea virus 2 strains according to palindromic nucleotide substitutions in the 5 untranslated genomic region.

    PubMed

    Giangaspero, M; Harasawa, R

    2004-01-01

    Pestivirus bovine viral diarrhea virus 2 (BVDV-2) strains from 61 isolates from cattle and sheep, and from some adventitious contaminants of biologicals, have been assessed using the palindromic nucleotide substitutions (PNS) method at three variable loci (V1, V2 and V3) located delin the 5' untranslated region (UTR) of genomic RNA. This genotyping procedure is new, simple and practical. Two characteristics of the base pairings common to BVDV-2 species, a C-G or U-A pairing at the V1 locus, and a G*U pairing at the V2 locus, were observed in isolates tested. The PNS method showed six genotypes: BVDV-2a, BVDV-2b, BVDV-2c, BVDV- 2d, BVDV-2e and BVDV-2f. Twenty-five strains showed the BVDV-2a genotype specific combination of three base pairings (A-U in position 1 and C-G or U*G in position 18 in V1 and U-A or U*G in position 4 in V2). Ten strains were identified by a single C-G pairing in position 4 from the bottom of the V2 stem region, characteristic to genotype BVDV-2b. Three strains were assigned to genotype BVDV-2c, due to their recognition by a G*U pairing at the bottom of the V1 stem region. A U-A pairing, characteristic of the BVDV-2d genotype when found in position 18 of the V1 stem region, was observed in fourteen strains. Genotype BVDV- 2e, present in only six South American cattle isolates, was characterized by G-C pairing in position 12, by U-A pairing in position 16 and G_G or G-_A bulges in position 18 in the V1 region. One strain from Argentina was classified as genotype BVDV-2f, showing: A-U pairing in position 9 and 12, U-A in position 16 and G_A bulge in position 18 in V1 region. Two strains were not characterized due to incomplete sequence of V1 locus.

  3. Abundant and diverse clustered regularly interspaced short palindromic repeat spacers in Clostridium difficile strains and prophages target multiple phage types within this pathogen.

    PubMed

    Hargreaves, Katherine R; Flores, Cesar O; Lawley, Trevor D; Clokie, Martha R J

    2014-08-26

    Clostridium difficile is an important human-pathogenic bacterium causing antibiotic-associated nosocomial infections worldwide. Mobile genetic elements and bacteriophages have helped shape C. difficile genome evolution. In many bacteria, phage infection may be controlled by a form of bacterial immunity called the clustered regularly interspaced short palindromic repeats/CRISPR-associated (CRISPR/Cas) system. This uses acquired short nucleotide sequences (spacers) to target homologous sequences (protospacers) in phage genomes. C. difficile carries multiple CRISPR arrays, and in this paper we examine the relationships between the host- and phage-carried elements of the system. We detected multiple matches between spacers and regions in 31 C. difficile phage and prophage genomes. A subset of the spacers was located in prophage-carried CRISPR arrays. The CRISPR spacer profiles generated suggest that related phages would have similar host ranges. Furthermore, we show that C. difficile strains of the same ribotype could either have similar or divergent CRISPR contents. Both synonymous and nonsynonymous mutations in the protospacer sequences were identified, as well as differences in the protospacer adjacent motif (PAM), which could explain how phages escape this system. This paper illustrates how the distribution and diversity of CRISPR spacers in C. difficile, and its prophages, could modulate phage predation for this pathogen and impact upon its evolution and pathogenicity. Clostridium difficile is a significant bacterial human pathogen which undergoes continual genome evolution, resulting in the emergence of new virulent strains. Phages are major facilitators of genome evolution in other bacterial species, and we use sequence analysis-based approaches in order to examine whether the CRISPR/Cas system could control these interactions across divergent C. difficile strains. The presence of spacer sequences in prophages that are homologous to phage genomes raises an

  4. Survey of clustered regularly interspaced short palindromic repeats and their associated Cas proteins (CRISPR/Cas) systems in multiple sequenced strains of Klebsiella pneumoniae.

    PubMed

    Ostria-Hernández, Martha Lorena; Sánchez-Vallejo, Carlos Javier; Ibarra, J Antonio; Castro-Escarpulli, Graciela

    2015-08-04

    In recent years the emergence of multidrug resistant Klebsiella pneumoniae strains has been an increasingly common event. This opportunistic species is one of the five main bacterial pathogens that cause hospital infections worldwide and multidrug resistance has been associated with the presence of high molecular weight plasmids. Plasmids are generally acquired through horizontal transfer and therefore is possible that systems that prevent the entry of foreign genetic material are inactive or absent. One of these systems is CRISPR/Cas. However, little is known regarding the clustered regularly interspaced short palindromic repeats and their associated Cas proteins (CRISPR/Cas) system in K. pneumoniae. The adaptive immune system CRISPR/Cas has been shown to limit the entry of foreign genetic elements into bacterial organisms and in some bacteria it has been shown to be involved in regulation of virulence genes. Thus in this work we used bioinformatics tools to determine the presence or absence of CRISPR/Cas systems in available K. pneumoniae genomes. The complete CRISPR/Cas system was identified in two out of the eight complete K. pneumoniae genomes sequences and in four out of the 44 available draft genomes sequences. The cas genes in these strains comprises eight cas genes similar to those found in Escherichia coli, suggesting they belong to the type I-E group, although their arrangement is slightly different. As for the CRISPR sequences, the average lengths of the direct repeats and spacers were 29 and 33 bp, respectively. BLAST searches demonstrated that 38 of the 116 spacer sequences (33%) are significantly similar to either plasmid, phage or genome sequences, while the remaining 78 sequences (67%) showed no significant similarity to other sequences. The region where the CRISPR/Cas systems were located is the same in all the Klebsiella genomes containing it, it has a syntenic architecture, and is located among genes encoding for proteins likely involved in

  5. Clustered Regularly Interspaced Short Palindromic Repeat-Dependent, Biofilm-Specific Death of Pseudomonas aeruginosa Mediated by Increased Expression of Phage-Related Genes.

    PubMed

    Heussler, Gary E; Cady, Kyle C; Koeppen, Katja; Bhuju, Sabin; Stanton, Bruce A; O'Toole, George A

    2015-05-12

    The clustered regularly interspaced short palindromic repeat (CRISPR)/CRISPR-associated (CRISPR/Cas) system is an adaptive immune system present in many archaea and bacteria. CRISPR/Cas systems are incredibly diverse, and there is increasing evidence of CRISPR/Cas systems playing a role in cellular functions distinct from phage immunity. Previously, our laboratory reported one such alternate function in which the type 1-F CRISPR/Cas system of the opportunistic pathogen Pseudomonas aeruginosa strain UCBPP-PA14 (abbreviated as P. aeruginosa PA14) inhibits both biofilm formation and swarming motility when the bacterium is lysogenized by the bacteriophage DMS3. In this study, we demonstrated that the presence of just the DMS3 protospacer and the protospacer-adjacent motif (PAM) on the P. aeruginosa genome is necessary and sufficient for this CRISPR-dependent loss of these group behaviors, with no requirement of additional DMS3 sequences. We also demonstrated that the interaction of the CRISPR system with the DMS3 protospacer induces expression of SOS-regulated phage-related genes, including the well-characterized pyocin operon, through the activity of the nuclease Cas3 and subsequent RecA activation. Furthermore, our data suggest that expression of the phage-related genes results in bacterial cell death on a surface due to the inability of the CRISPR-engaged strain to downregulate phage-related gene expression, while these phage-related genes have minimal impact on growth and viability under planktonic conditions. Deletion of the phage-related genes restores biofilm formation and swarming motility while still maintaining a functional CRISPR/Cas system, demonstrating that the loss of these group behaviors is an indirect effect of CRISPR self-targeting. The various CRISPR/Cas systems found in both archaea and bacteria are incredibly diverse, and advances in understanding the complex mechanisms of these varied systems has not only increased our knowledge of host

  6. Orthography and phonology in lexical decision: evidence from repetition effects at different lags.

    PubMed

    Bentin, S

    1989-01-01

    Full- and partial- (orthographic or phonemic) repetition effects for Hebrew voweled and unvoweled words and nonwords were examined at Lags 0 and 15 between the first and the second presentations. For voweled words, phonemic and orthographic partial-repetition effects were equivalent at Lag 0, each about half the size of the full-repetition effect. At Lag 15, the full-repetition effect was reduced to the size of phonemic repetition, which was as big as it was at Lag 0. In contrast, the orthographic repetition effect disappeared. For unvoweled words, the phonemic repetition effect was significant only at Lag 0, whereas the full-repetition effect was significant at both lags. Lexical decisions for both voweled and unvoweled nonwords were facilitated only by full repetition at Lag 0. It was concluded that addition of vowel marks attracted the subjects' attention and, therefore, lexical decisions for voweled stimuli were mediated by phonemic analysis.

  7. Variations in Repetition Duration and Repetition Numbers Influence Muscular Activation and Blood Lactate Response in Protocols Equalized by Time Under Tension.

    PubMed

    Lacerda, Lucas T; Martins-Costa, Hugo C; Diniz, Rodrigo C R; Lima, Fernando V; Andrade, André G P; Tourino, Frank D; Bemben, Michael G; Chagas, Mauro H

    2016-01-01

    The aim of this study was to investigate the impact of protocols equalized by the time under tension (TUT) but composed of different repetition durations and repetitions numbers on muscle activation and blood lactate concentration. Twenty-two males with previous experience in resistance training performed 2 training protocols (A and B) with the Smith machine bench press exercise, both with 3 sets, 3 minutes' rest, and 60% of 1 repetition maximum (1RM). Protocol A consisted of 6 repetitions with a 6-second repetition duration for each repetition, whereas in Protocol B the subjects performed 12 repetitions with a 3-second repetition duration for each repetition. Muscular activation was measured in the anterior deltoid, pectoralis major, and triceps brachii muscles while performing the 2 protocols, and the normalized root mean square of the electromyographic signal (EMGRMS) was calculated for each set. Blood lactate concentrations were measured during and until 12 minutes after the completion of each protocol. The results showed that the EMGRMS of all muscles increased during the sets and was higher in Protocol B when compared with Protocol A. Likewise, blood lactate concentrations also increased throughout the sets and were higher in Protocol B both during and after the completion of each training session. The data obtained in this study show that training protocols conducted with the same TUT, but with different configurations, produce distinct neuromuscular and metabolic responses so that performing higher repetition numbers with shorter repetition durations might be a more appropriate strategy to increase muscle activation and blood lactate concentration.

  8. 10 CFR 50.32 - Elimination of repetition.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 10 Energy 1 2013-01-01 2013-01-01 false Elimination of repetition. 50.32 Section 50.32 Energy NUCLEAR REGULATORY COMMISSION DOMESTIC LICENSING OF PRODUCTION AND UTILIZATION FACILITIES Applications for Licenses, Certifications, and Regulatory Approvals; Form; Contents; Ineligibility of Certain...

  9. 10 CFR 50.32 - Elimination of repetition.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 10 Energy 1 2012-01-01 2012-01-01 false Elimination of repetition. 50.32 Section 50.32 Energy NUCLEAR REGULATORY COMMISSION DOMESTIC LICENSING OF PRODUCTION AND UTILIZATION FACILITIES Applications for Licenses, Certifications, and Regulatory Approvals; Form; Contents; Ineligibility of Certain...

  10. 10 CFR 50.32 - Elimination of repetition.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 10 Energy 1 2014-01-01 2014-01-01 false Elimination of repetition. 50.32 Section 50.32 Energy NUCLEAR REGULATORY COMMISSION DOMESTIC LICENSING OF PRODUCTION AND UTILIZATION FACILITIES Applications for Licenses, Certifications, and Regulatory Approvals; Form; Contents; Ineligibility of Certain...

  11. 10 CFR 50.32 - Elimination of repetition.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 10 Energy 1 2011-01-01 2011-01-01 false Elimination of repetition. 50.32 Section 50.32 Energy NUCLEAR REGULATORY COMMISSION DOMESTIC LICENSING OF PRODUCTION AND UTILIZATION FACILITIES Applications for Licenses, Certifications, and Regulatory Approvals; Form; Contents; Ineligibility of Certain...

  12. 10 CFR 50.32 - Elimination of repetition.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 10 Energy 1 2010-01-01 2010-01-01 false Elimination of repetition. 50.32 Section 50.32 Energy NUCLEAR REGULATORY COMMISSION DOMESTIC LICENSING OF PRODUCTION AND UTILIZATION FACILITIES Applications for Licenses, Certifications, and Regulatory Approvals; Form; Contents; Ineligibility of Certain...

  13. Neuroprotective Strategies after Repetitive Mild Traumatic Brain Injury

    DTIC Science & Technology

    2011-06-01

    of nicotinamide (NAD). Scope: In rat model of a repetitive mild cortical controlled injury, we investigated the neuropathological profile of two...mild traumatic brain injury, HBO, nicotinamide , intranasal, MRI, rat 16. SECURITY CLASSIFICATION OF: 17. LIMITATION OF ABSTRACT 18. NUMBER OF...prophylactically or therapeutically in combination with intranasal delivery of nicotinamide would improve the outcomes in a rodent model subjected to

  14. Memory, emotion, and pupil diameter: Repetition of natural scenes.

    PubMed

    Bradley, Margaret M; Lang, Peter J

    2015-09-01

    Recent studies have suggested that pupil diameter, like the "old-new" ERP, may be a measure of memory. Because the amplitude of the old-new ERP is enhanced for items encoded in the context of repetitions that are distributed (spaced), compared to massed (contiguous), we investigated whether pupil diameter is similarly sensitive to repetition. Emotional and neutral pictures of natural scenes were viewed once or repeated with massed (contiguous) or distributed (spaced) repetition during incidental free viewing and then tested on an explicit recognition test. Although an old-new difference in pupil diameter was found during successful recognition, pupil diameter was not enhanced for distributed, compared to massed, repetitions during either recognition or initial free viewing. Moreover, whereas a significant old-new difference was found for erotic scenes that had been seen only once during encoding, this difference was absent when erotic scenes were repeated. Taken together, the data suggest that pupil diameter is not a straightforward index of prior occurrence for natural scenes. © 2015 Society for Psychophysiological Research.

  15. Decomposition of Repetition Priming Components in Picture Naming

    ERIC Educational Resources Information Center

    Francis, Wendy S.; Corral, Nuvia I.; Jones, Mary L.; Saenz, Silvia P.

    2008-01-01

    Cognitive mechanisms underlying repetition priming in picture naming were decomposed in several experiments. Sets of encoding manipulations meant to selectively prime or reduce priming in object identification or word production components of picture naming were combined factorially to dissociate processes underlying priming in picture naming.…

  16. Decomposition of Repetition Priming Processes in Word Translation

    ERIC Educational Resources Information Center

    Francis, Wendy S.; Duran, Gabriela; Augustini, Beatriz K.; Luevano, Genoveva; Arzate, Jose C.; Saenz, Silvia P.

    2011-01-01

    Translation in fluent bilinguals requires comprehension of a stimulus word and subsequent production, or retrieval and articulation, of the response word. Four repetition-priming experiments with Spanish-English bilinguals (N = 274) decomposed these processes using selective facilitation to evaluate their unique priming contributions and factorial…

  17. Highly conserved repetitive DNA sequences are present at human centromeres.

    PubMed Central

    Grady, D L; Ratliff, R L; Robinson, D L; McCanlies, E C; Meyne, J; Moyzis, R K

    1992-01-01

    Highly conserved repetitive DNA sequence clones, largely consisting of (GGAAT)n repeats, have been isolated from a human recombinant repetitive DNA library by high-stringency hybridization with rodent repetitive DNA. This sequence, the predominant repetitive sequence in human satellites II and III, is similar to the essential core DNA of the Saccharomyces cerevisiae centromere, centromere DNA element (CDE) III. In situ hybridization to human telophase and Drosophila polytene chromosomes shows localization of the (GGAAT)n sequence to centromeric regions. Hyperchromicity studies indicate that the (GGAAT)n sequence exhibits unusual hydrogen bonding properties. The purine-rich strand alone has the same thermal stability as the duplex. Hyperchromicity studies of synthetic DNA variants indicate that all sequences with the composition (AATGN)n exhibit this unusual thermal stability. DNA-mobility-shift assays indicate that specific HeLa-cell nuclear proteins recognize this sequence with a relative affinity greater than 10(5). The extreme evolutionary conservation of this DNA sequence, its centromeric location, its unusual hydrogen bonding properties, its high affinity for specific nuclear proteins, and its similarity to functional centromeres isolated from yeast suggest that this sequence may be a component of the functional human centromere. Images PMID:1542662

  18. Multiple cueing dissociates location- and feature-based repetition effects

    PubMed Central

    Hu, Kesong; Zhan, Junya; Li, Bingzhao; He, Shuchang; Samuel, Arthur G.

    2014-01-01

    There is an extensive literature on the phenomenon of inhibition of return (IOR): When attention is drawn to a peripheral location and then removed, response time is delayed if a target appears in the previously inspected location. Recent research suggests that non-spatial attribute repetition (i.e., if a target shares a feature like color with the earlier, cueing, stimulus) can have a similar inhibitory effect, at least when the target appears in the previously cued location. What remains unknown is whether location- and feature-based inhibitory effects can be dissociated. In the present study, we used a multiple cueing approach to investigate the properties of location- and feature-based repetition effects. In two experiments (detection, and discrimination), location-based IOR was absent but feature-based inhibition was consistently observed. Thus, the present results indicate that feature- and location-based inhibitory effects are dissociable. The results also provide support for the view that the attentional consequences of multiple cues reflect the overall center of gravity of the cues. We suggest that the repetition costs associated with feature and location repetition may be best understood as a consequence of the pattern of activation for object files associated with the stimuli present in the displays. PMID:24907677

  19. Multiple cueing dissociates location- and feature-based repetition effects.

    PubMed

    Hu, Kesong; Zhan, Junya; Li, Bingzhao; He, Shuchang; Samuel, Arthur G

    2014-08-01

    There is an extensive literature on the phenomenon of inhibition of return (IOR): When attention is drawn to a peripheral location and then removed, response time is delayed if a target appears in the previously inspected location. Recent research suggests that non-spatial attribute repetition (i.e., if a target shares a feature like color with the earlier, cueing, stimulus) can have a similar inhibitory effect, at least when the target appears in the previously cued location. What remains unknown is whether location- and feature-based inhibitory effects can be dissociated. In the present study, we used a multiple cueing approach to investigate the properties of location- and feature-based repetition effects. In two experiments (detection, and discrimination), location-based IOR was absent but feature-based inhibition was consistently observed. Thus, the present results indicate that feature- and location-based inhibitory effects are dissociable. The results also provide support for the view that the attentional consequences of multiple cues reflect the overall center of gravity of the cues. We suggest that the repetition costs associated with feature and location repetition may be best understood as a consequence of the pattern of activation for object files associated with the stimuli present in the displays. Copyright © 2014 Elsevier Ltd. All rights reserved.

  20. 10 CFR 72.18 - Elimination of repetition.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 10 Energy 2 2011-01-01 2011-01-01 false Elimination of repetition. 72.18 Section 72.18 Energy NUCLEAR REGULATORY COMMISSION (CONTINUED) LICENSING REQUIREMENTS FOR THE INDEPENDENT STORAGE OF SPENT NUCLEAR FUEL, HIGH-LEVEL RADIOACTIVE WASTE, AND REACTOR-RELATED GREATER THAN CLASS C WASTE...

  1. Intrinsic and Extrinsic Motivation for Stereotypic and Repetitive Behavior

    ERIC Educational Resources Information Center

    Joosten, Annette V.; Bundy, Anita C.; Einfeld, Stewart L.

    2009-01-01

    This study provides evidence for intrinsic and extrinsic motivators for stereotypical and repetitive behavior in children with autism and intellectual disability and children with intellectual disability alone. We modified the Motivation Assessment Scale (MAS) (1988b); dividing it into intrinsic and extrinsic measures and adding items to assess…

  2. Repetitive Domain-Referenced Testing Using Computers: the TITA System.

    ERIC Educational Resources Information Center

    Olympia, P. L., Jr.

    The TITA (Totally Interactive Testing and Analysis) System algorithm for the repetitive construction of domain-referenced tests utilizes a compact data bank, is highly portable, is useful in any discipline, requires modest computer hardware, and does not present a security problem. Clusters of related keyphrases, statement phrases, and distractors…

  3. 38 CFR 21.132 - Repetition of the course.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 38 Pensions, Bonuses, and Veterans' Relief 2 2010-07-01 2010-07-01 false Repetition of the course. 21.132 Section 21.132 Pensions, Bonuses, and Veterans' Relief DEPARTMENT OF VETERANS AFFAIRS... all or part of the course. A veteran, having completed a course under Chapter 31 according to the...

  4. Orientation-Invariant Object Recognition: Evidence from Repetition Blindness

    ERIC Educational Resources Information Center

    Harris, Irina M.; Dux, Paul E.

    2005-01-01

    The question of whether object recognition is orientation-invariant or orientation-dependent was investigated using a repetition blindness (RB) paradigm. In RB, the second occurrence of a repeated stimulus is less likely to be reported, compared to the occurrence of a different stimulus, if it occurs within a short time of the first presentation.…

  5. Response to NAS Request for Information on Chamber Repetition Rate

    SciTech Connect

    Meier, Wayne R.

    2011-08-19

    This purpose of this report is to “Provide further information on the issues of repetition rates and chamber clearing issues for dry wall and liquid wall chamber concepts for IFE; namely what are the issues, possible solutions and needed R&D?”

  6. Autism and exergaming: effects on repetitive behaviors and cognition

    PubMed Central

    Anderson-Hanley, Cay; Tureck, Kimberly; Schneiderman, Robyn L

    2011-01-01

    Autism is a neurodevelopmental disorder that leads to impairment in social skills and delay in language development, and results in repetitive behaviors and restricted interests that impede academic and social involvement. Physical exercise has been shown to decrease repetitive behaviors in autistic children and improve cognitive function across the life-span. Exergaming combines physical and mental exercise simultaneously by linking physical activity movements to video game control and may yield better compliance with exercise. In this investigation, two pilot studies explored the potential behavioral and cognitive benefits of exergaming. In Pilot I, twelve children with autism spectrum disorders completed a control task and an acute bout of Dance Dance Revolution (DDR); in Pilot II, ten additional youths completed an acute bout of cyber cycling. Repetitive behaviors and executive function were measured before and after each activity. Repetitive behaviors significantly decreased, while performance on Digits Backwards improved following the exergaming conditions compared with the control condition. Additional research is needed to replicate these findings, and to explore the application of exergaming for the management of behavioral disturbance and to increase cognitive control in children on the autism spectrum. PMID:22114543

  7. Efficient sequential repetitive gene deletions in Neurospora crassa

    USDA-ARS?s Scientific Manuscript database

    Despite its long-standing history as a model organism, Neurospora crassa has limited tools for repetitive gene deletions utilizing recyclable self-excising marker systems. Here we describe, for the first time, the functionality of a bacterial recombination system employing ß-recombinase acting on si...

  8. 10 CFR 72.18 - Elimination of repetition.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 10 Energy 2 2010-01-01 2010-01-01 false Elimination of repetition. 72.18 Section 72.18 Energy NUCLEAR REGULATORY COMMISSION (CONTINUED) LICENSING REQUIREMENTS FOR THE INDEPENDENT STORAGE OF SPENT NUCLEAR FUEL, HIGH-LEVEL RADIOACTIVE WASTE, AND REACTOR-RELATED GREATER THAN CLASS C WASTE...

  9. Context-Dependent Repetition Effects on Recognition Memory

    ERIC Educational Resources Information Center

    Opitz, Bertram

    2010-01-01

    One widely acknowledged way to improve our memory performance is to repeatedly study the to be learned material. One aspect that has received little attention in past research regards the context sensitivity of this repetition effect, that is whether the item is repeated within the same or within different contexts. The predictions of a…

  10. Repetitive peptide boosting progressively enhances functional memory CTLs

    USDA-ARS?s Scientific Manuscript database

    Induction of functional memory CTLs holds promise for fighting critical infectious diseases through vaccination, but so far, no effective regime has been identified. We show here that memory CTLs can be enhanced progressively to high levels by repetitive intravenous boosting with peptide and adjuvan...

  11. Gender Differences in Repetitive Language in Fragile X Syndrome

    ERIC Educational Resources Information Center

    Murphy, M. M.; Abbeduto, L.

    2007-01-01

    Background: Verbal perseveration (i.e. excessive self-repetition) is a characteristic of male individuals with fragile X syndrome; however, little is known about its occurrence among females or its underlying causes. This project examined the relationship between perseveration and (1) gender, (2) cognitive and linguistic ability, and (3) language…

  12. Rock Climbing Injuries: Acute and Chronic Repetitive Trauma.

    PubMed

    Chang, Connie Y; Torriani, Martin; Huang, Ambrose J

    2016-01-01

    Rock climbing has increased in popularity as a sport, and specific injuries related to its practice are becoming more common. Chronic repetitive injuries are more common than acute injuries, although acute injuries tend to be more severe. We review both acute and chronic upper and lower extremity injuries. Understanding the injury pattern in rock climbers is important for accurate diagnosis.

  13. Repetition across Successive Sentences Facilitates Young Children's Word Learning

    ERIC Educational Resources Information Center

    Schwab, Jessica F.; Lew-Williams, Casey

    2016-01-01

    Young children who hear more child-directed speech (CDS) tend to have larger vocabularies later in childhood, but the specific characteristics of CDS underlying this link are currently underspecified. The present study sought to elucidate how the structure of language input boosts learning by investigating whether repetition of object labels in…

  14. Mantram Repetition With Homeless Women: A Pilot Study.

    PubMed

    Weinrich, Sally P; Bormann, Jill E; Glaser, Dale; Hardin, Sally; Barger, Mary; Lizarraga, Cabiria; Del Rio, Juan; Allard, Carolyn B

    Women and families are the fastest growing segment of the homeless population. Negative attitudes of nurses toward homeless women are a major barrier to homeless women seeking health care. This cross-sectional, mixed-methods pilot study, conducted primarily by nurses, tested the Mantram Repetition Program for the first time with 29 homeless women. The Mantram Repetition Program is a spiritually based skills training that teaches mantram (sacred word) repetition as a cost-effective, personalized, portable, and focused strategy for reducing stress and improving well-being. For the cross-sectional, pretest-posttest design portion of the study, the hypothesis that at least half of the homeless women would repeat their mantram at least once a day was supported with 88% of the women repeating their mantram 1 week later. The qualitative portion of this study using phenomenology explored the women's thoughts on mantram week 2. Themes of mantram repetition, mantram benefits, and being cared for emerged. This groundbreaking, interventional, mixed-methods pilot study fills a gap in interventional homeless research.

  15. Repetition priming-induced changes in sensorimotor transmission.

    PubMed

    Svensson, Erik; Evans, Colin G; Cropper, Elizabeth C

    2016-03-01

    When a behavior is repeated performance often improves, i.e., repetition priming occurs. Although repetition priming is ubiquitous, mediating mechanisms are poorly understood. We address this issue in the feeding network ofAplysia Similar to the priming observed elsewhere, priming inAplysiais stimulus specific, i.e., it can be either "ingestive" or "egestive." Previous studies demonstrated that priming alters motor and premotor activity. Here we sought to determine whether sensorimotor transmission is also modified. We report that changes in sensorimotor transmission do occur. We ask how they are mediated and obtain data that strongly suggest a presynaptic mechanism that involves changes in the "background" intracellular Ca(2+)concentration ([Ca(2+)]i) in primary afferents themselves. This form of plasticity has previously been described and generated interest due to its potentially graded nature. Manipulations that alter the magnitude of the [Ca(2+)]iimpact the efficacy of synaptic transmission. It is, however, unclear how graded control is exerted under physiologically relevant conditions. In the feeding system changes in the background [Ca(2+)]iare mediated by the induction of a nifedipine-sensitive current. We demonstrate that the extent to which this current is induced is altered by peptides (i.e., increased by a peptide released during the repetition priming of ingestive activity and decreased by a peptide released during the repetition priming of egestive activity). We suggest that this constitutes a behaviorally relevant mechanism for the graded control of synaptic transmission via the regulation of the [Ca(2+)]iin a neuron.

  16. Do Stimulus-Action Associations Contribute to Repetition Priming?

    ERIC Educational Resources Information Center

    Dennis, Ian; Perfect, Timothy J.

    2013-01-01

    Despite evidence that response learning makes a major contribution to repetition priming, the involvement of response representations at the level of motor actions remains uncertain. Levels of response representation were investigated in 4 experiments that used different tasks at priming and test. Priming for stimuli that required congruent…

  17. Processing Speaker Variability in Repetition and Semantic/Associative Priming

    ERIC Educational Resources Information Center

    Lee, Chao-Yang; Zhang, Yu

    2015-01-01

    The effect of speaker variability on accessing the form and meaning of spoken words was evaluated in two short-term priming experiments. In the repetition priming experiment, participants listened to repeated or unrelated prime-target pairs, in which the prime and target were produced by the same speaker or different speakers. The results showed…

  18. The Perceptual Determinants of Repetition Learning in Auditory Space

    ERIC Educational Resources Information Center

    Parmentier, Fabrice B. R.; Maybery, Murray T.; Huitson, Matthew; Jones, Dylan M.

    2008-01-01

    The present study includes seven experiments examining the effect of repetition learning (Hebb effect) on auditory spatial serial recall. Participants were asked to remember sequences of spatial locations marked by auditory stimuli, where one sequence was repeated across trials. Consistent with the proposition that the spatial scattering of…

  19. Repetitive thought and self-reported sleep disturbance.

    PubMed

    Takano, Keisuke; Iijima, Yudai; Tanno, Yoshihiko

    2012-12-01

    Repetitive thought has been focused upon as a transdiagnostic risk factor for depression, anxiety, and poor physical health. Among the forms of repetitive thought, rumination and worry are considered to play important roles in the onset and maintenance of insomnia. However, there have been few attempts to clarify the similarities, differences, and interaction between the functions of rumination and worry in sleep problems. Furthermore, no study has investigated the prospective relationships between these two forms of repetitive thought and sleep disturbance. In the present study, we examined the prospective associations between repetitive thought and subjective sleep quality, measured by a self-report questionnaire. A total of 208 undergraduates participated in a 2-wave longitudinal survey with an interval of 3weeks between assessments. Hierarchical multiple regression analyses showed that baseline rumination predicted reduction in the follow-up assessment of subjective sleep quality, controlling for levels of depressive and anxious symptoms. This main effect of rumination was qualified by the levels of worry; for individuals with higher levels of worry, rumination was associated with greater reduction in subjective sleep quality. These results suggest that both rumination and worry have unique associations with sleep and that their interaction is especially important in sleep problems. Copyright © 2012. Published by Elsevier Ltd.

  20. Using Repetition and Alternating Levels of Practice in Beginning Typewriting

    ERIC Educational Resources Information Center

    Weise, Barbara

    1975-01-01

    A study of secondary school students from 16 randomly selected typing classes in the Los Angeles County School District revealed that speed and accuracy on straight-copy writings in first-semester work are unaffected by repetition of practice materials and that alternate levels of practice is an effective technique. (AG)