Science.gov

Sample records for repetitive sequence composition

  1. Roles of repetitive sequences

    SciTech Connect

    Bell, G.I.

    1991-12-31

    The DNA of higher eukaryotes contains many repetitive sequences. The study of repetitive sequences is important, not only because many have important biological function, but also because they provide information on genome organization, evolution and dynamics. In this paper, I will first discuss some generic effects that repetitive sequences will have upon genome dynamics and evolution. In particular, it will be shown that repetitive sequences foster recombination among, and turnover of, the elements of a genome. I will then consider some examples of repetitive sequences, notably minisatellite sequences and telomere sequences as examples of tandem repeats, without and with respectively known function, and Alu sequences as an example of interspersed repeats. Some other examples will also be considered in less detail.

  2. Paucity of moderately repetitive sequences

    SciTech Connect

    Schmid, C.W.

    1991-01-01

    We examined clones of renatured repetitive human DNA to find novel repetitive DNAs. After eliminating known repeats, the remaining clones were subjected to sequence analysis. These clones also corresponded to known repeats, but with greater sequence diversity. This indicates that either these libraries were depleted of short interspersed repeats in construction, or these repeats are much less prevalent in the human genome than is indicated by data from {und Xenopus} or sea urchin studies. We directly investigated the sequence composition of human DNA through traditional renaturation techniques with the goal of estimating the limits of abundance of repetitive sequence classes in human DNA. Our results sharply limit the maximum possible abundance to 1--2% of the human genome. Our estimate, minus the known repeats in this fraction, leaves about 1% (3 {times} 10{sup 7} nucleotides) of the human genome for novel repetitive elements. 2 refs. (MHB)

  3. Chromosome specific repetitive DNA sequences

    DOEpatents

    Moyzis, Robert K.; Meyne, Julianne

    1991-01-01

    A method is provided for determining specific nucleotide sequences useful in forming a probe which can identify specific chromosomes, preferably through in situ hybridization within the cell itself. In one embodiment, chromosome preferential nucleotide sequences are first determined from a library of recombinant DNA clones having families of repetitive sequences. Library clones are identified with a low homology with a sequence of repetitive DNA families to which the first clones respectively belong and variant sequences are then identified by selecting clones having a pattern of hybridization with genomic DNA dissimilar to the hybridization pattern shown by the respective families. In another embodiment, variant sequences are selected from a sequence of a known repetitive DNA family. The selected variant sequence is classified as chromosome specific, chromosome preferential, or chromosome nonspecific. Sequences which are classified as chromosome preferential are further sequenced and regions are identified having a low homology with other regions of the chromosome preferential sequence or with known sequences of other family me This invention is the result of a contract with the Department of Energy (Contract No. W-7405-ENG-36).

  4. Analysis of 90 Mb of the potato genome reveals conservation of gene structures and order with tomato but divergence in repetitive sequence composition

    PubMed Central

    Zhu, Wei; Ouyang, Shu; Iovene, Marina; O'Brien, Kimberly; Vuong, Hue; Jiang, Jiming; Buell, C Robin

    2008-01-01

    leveraged in genomic applications including cross-species annotation and genome sequencing initiatives. While tomato and potato share genic features, they differ in their repetitive sequence content and composition suggesting that repetitive sequences may have a more significant role in shaping speciation than previously reported. PMID:18554403

  5. DNA polymerase-catalyzed elongation of repetitive hexanucleotide sequences: application to creation of repetitive DNA libraries.

    PubMed

    Kurihara, Hiroyuki; Nagamune, Teruyuki

    2004-01-01

    We demonstrate the elongation of various hexanucleotide sequences with thermophilic DNA polymerase, under isothermal or thermal cyclic reaction conditions. We prepared 10 types of double repeat hexanucleotide duplexes with various GC compositions containing between 0 and 6 GC nucleotides per repeat and incubated these duplexes with thermophilic Taq DNA polymerase and dNTPs at various temperatures. All of the model repetitive short duplexes were elongated under the isothermal incubation conditions, although there were some differences in the elongation efficiencies derived from the GC composition in the repetitive sequences. It was also found that all of the model repetitive duplexes were extended more effectively by a 3-step thermal cyclic reaction involving denaturation, annealing, and extension. On the basis of this technique, we prepared a glutamate-encoding short repetitive duplex and created long repetitive DNAs under isothermal and thermal cyclic reaction conditions. DNA sequencing analysis of the cloned repetitive DNA revealed that well-ordered long repetitive DNAs of various chain lengths were created by this DNA polymerase-catalyzed ligation method, and these were easily cloned into vectors by the TA-cloning method. This method could be useful for obtaining DNAs encoding arbitrary long repetitive amino acid sequences more effectively than the conventional T4 ligase-catalyzed ligation method.

  6. Repetitive sequence environment distinguishes housekeeping genes

    PubMed Central

    Eller, C. Daniel; Regelson, Moira; Merriman, Barry; Nelson, Stan; Horvath, Steve; Marahrens, York

    2007-01-01

    Housekeeping genes are expressed across a wide variety of tissues. Since repetitive sequences have been reported to influence the expression of individual genes, we employed a novel approach to determine whether housekeeping genes can be distinguished from tissue-specific genes their repetitive sequence context. We show that Alu elements are more highly concentrated around housekeeping genes while various longer (>400-bp) repetitive sequences ("repeats"), including Long Interspersed Nuclear Element 1 (LINE-1) elements, are excluded from these regions. We further show that isochore membership does not distinguish housekeeping genes from tissue-specific genes and that repetitive sequence environment distinguishes housekeeping genes from tissue-specific genes in every isochore. The distinct repetitive sequence environment, in combination with other previously published sequence properties of housekeeping genes, were used to develop a method of predicting housekeeping genes on the basis of DNA sequence alone. Using expression across tissue types as a measure of success, we demonstrate that repetitive sequence environment is by far the most important sequence feature identified to date for distinguishing housekeeping genes. PMID:17141428

  7. Sequencing of long stretches of repetitive DNA

    PubMed Central

    De Bustos, Alfredo; Cuadrado, Angeles; Jouve, Nicolás

    2016-01-01

    Repetitive DNA is widespread in eukaryotic genomes, in some cases making up more than 80% of the total. SSRs are a type of repetitive DNA formed by short motifs repeated in tandem arrays. In some species, SSRs may be organized into long stretches, usually associated with the constitutive heterochromatin. Variation in repeats can alter the expression of genes, and changes in the number of repeats have been linked to certain human diseases. Unfortunately, the molecular characterization of these repeats has been hampered by technical limitations related to cloning and sequencing. Indeed, most sequenced genomes contain gaps owing to repetitive DNA-related assembly difficulties. This paper reports an alternative method for sequencing of long stretches of repetitive DNA based on the combined use of 1) a linear vector to stabilize the cloning process, and 2) the use of exonuclease III for obtaining progressive deletions of SSR-rich fragments. This strategy allowed the sequencing of a fragment containing a stretch of 6.2 kb of continuous SSRs. To demonstrate that this procedure can sequence other kinds of repetitive DNA, it was used to examine a 4.5 kb fragment containing a cluster of 15 repeats of the 5S rRNA gene of barley. PMID:27819354

  8. Highly conserved repetitive DNA sequences are present at human centromeres.

    PubMed Central

    Grady, D L; Ratliff, R L; Robinson, D L; McCanlies, E C; Meyne, J; Moyzis, R K

    1992-01-01

    Highly conserved repetitive DNA sequence clones, largely consisting of (GGAAT)n repeats, have been isolated from a human recombinant repetitive DNA library by high-stringency hybridization with rodent repetitive DNA. This sequence, the predominant repetitive sequence in human satellites II and III, is similar to the essential core DNA of the Saccharomyces cerevisiae centromere, centromere DNA element (CDE) III. In situ hybridization to human telophase and Drosophila polytene chromosomes shows localization of the (GGAAT)n sequence to centromeric regions. Hyperchromicity studies indicate that the (GGAAT)n sequence exhibits unusual hydrogen bonding properties. The purine-rich strand alone has the same thermal stability as the duplex. Hyperchromicity studies of synthetic DNA variants indicate that all sequences with the composition (AATGN)n exhibit this unusual thermal stability. DNA-mobility-shift assays indicate that specific HeLa-cell nuclear proteins recognize this sequence with a relative affinity greater than 10(5). The extreme evolutionary conservation of this DNA sequence, its centromeric location, its unusual hydrogen bonding properties, its high affinity for specific nuclear proteins, and its similarity to functional centromeres isolated from yeast suggest that this sequence may be a component of the functional human centromere. Images PMID:1542662

  9. Intranuclear Anchoring of Repetitive DNA Sequences

    PubMed Central

    Weipoltshammer, Klara; Schöfer, Christian; Almeder, Marlene; Philimonenko, Vlada V.; Frei, Klemens; Wachtler, Franz; Hozák, Pavel

    1999-01-01

    Centromeres, telomeres, and ribosomal gene clusters consist of repetitive DNA sequences. To assess their contributions to the spatial organization of the interphase genome, their interactions with the nucleoskeleton were examined in quiescent and activated human lymphocytes. The nucleoskeletons were prepared using “physiological” conditions. The resulting structures were probed for specific DNA sequences of centromeres, telomeres, and ribosomal genes by in situ hybridization; the electroeluted DNA fractions were examined by blot hybridization. In both nonstimulated and stimulated lymphocytes, centromeric alpha-satellite repeats were almost exclusively found in the eluted fraction, while telomeric sequences remained attached to the nucleoskeleton. Ribosomal genes showed a transcription-dependent attachment pattern: in unstimulated lymphocytes, transcriptionally inactive ribosomal genes located outside the nucleolus were eluted completely. When comparing transcription unit and intergenic spacer, significantly more of the intergenic spacer was removed. In activated lymphocytes, considerable but similar amounts of both rDNA fragments were eluted. The results demonstrate that: (a) the various repetitive DNA sequences differ significantly in their intranuclear anchoring, (b) telomeric rather than centromeric DNA sequences form stable attachments to the nucleoskeleton, and (c) different attachment mechanisms might be responsible for the interaction of ribosomal genes with the nucleoskeleton. PMID:10613900

  10. Repetitive DNA sequences in Mycoplasma pneumoniae.

    PubMed Central

    Wenzel, R; Herrmann, R

    1988-01-01

    Two types of different repetitive DNA sequences called RepMP1 and RepMP2 were identified in the genome of Mycoplasma pneumoniae. The number of these repeated elements, their nucleotide sequence and their localization on a physical map of the M. pneumoniae genome were determined. The results show that RepMP1 appears at least 10 times and RepMP2 at least 8 times in the genome. The repeated elements are dispersed on the chromosome and, in three cases, linked to each other by a homologous DNA sequence of 400 bp. The elements themselves are 300 bp (for RepMP1) and 150 bp (for RepMP2) long showing a high degree of homology. One copy of RepMP2 is a translated part of the gene for the major cytadhesin protein P1 which is responsible for the adsorption of M. pneumoniae to its host cell. Images PMID:3138660

  11. The effect of repetition and similarity on sequence learning.

    PubMed

    Monaghan, Padraic; Rowson, Chris

    2008-12-01

    Repetition is a pervasive feature of children's environments, and may be an important contributor to learning such complex sequential structures as language. Endress, Dehaene-Lambertz, and Mehler (2007) found that repeated tone sequences were learned more easily than sequences containing ordinal relations, but there have been no direct comparisons of repeating sequences versus sequences that contain similar, but not identical, stimuli. In Experiment 1, we compared learning from repeating tone sequences to learning from tones that varied in similarity, and confirmed that repetition is a special case for learning. In Experiment 2 we showed that the learning distinction between repeated and similar elements is not affected by whether similarity is variable. We conclude by indicating that repetition provides an important constraint on learning, and we discuss the extent to which such constraints are consistent with general-purpose statistical learning mechanisms.

  12. Coordinate replication of dispersed repetitive sequences in Physarum polycephalum.

    PubMed

    Read, C M; Patel, U A; Moss, T

    1989-04-01

    The synchronous macroplasmodial growth phase of the slime mould Physarum polycephalum was used to study the in vivo replication of large chromosomal DNA segments. Newly replicated DNA was isolated at various points in S-phase by its preferential association with the nuclear matrix. This DNA was then used to probe cosmid clones of the Physarum genome. The results indicate that certain dispersed repetitive sequences in the genome are coordinately replicated. The observed pattern of replication may be due either to the presence of a replication origin within each repetitive sequence or to the systematic arrangement of these sequences around a replication origin. The latter appears more likely since the repetitive sequences are probably not randomly scattered within the genome.

  13. Interspecific "common" repetitive DNA sequences in salamanders of the genus Plethodon.

    PubMed

    Mizuno, S; Andrews, C; Macgregor, H C

    1976-10-12

    Intermediate repetitive sequences of Plethodon cinereus which comprised about 30% of the genomic DNA were isolated and iodinated with 125I. About 5% of the 125I-repetitive fraction hybridized with a large excess of DNA from P. dunni at Cot 20. About half of the 125I-DNA in the hybrids was resistant to extensive digestion with S-1 nuclease. The average molecular size of the S-1 nuclease-resistant fraction was about 100 nucleotide pairs. The melting temperature of the S-1 nuclease-resistant fraction was about 2 degrees lower than that of the corresponding fraction made with P. cinereus DNA. These results are taken to indicate the presence in the genomes of P. cinereus and P. dunni of evolutionarily stable "common" repetitive sequences. The average frequency of repetition of the common repetitive sequences is about 6,000 X in both species. The common repetitive fraction is also present in the genomes of other species of Plethodon, although the general populations of intermediate repetitive sequences are markedly different from one species to another. The cinereus--dunni common repetitive sequences could not be detected in plethodontids belonging to different tribes, nor in more distantly related amphibians. The profiles of binding of the common repetitive sequences to CsCl or CS2SO4-Ag+ density gradient fractions of P. dunni DNA suggested that these sequences consisted of heterogeneous components with respect to base compositions, and that they did not include large amounts of the genes for ribosomal RNA, 5S RNA, 4S RNA, or histone messenger RNA. In situ hybridization of the 3H-labelled intermediate repetitive sequences of P. cinereus to male meiotic chromosomes of the same species gave autoradiographs after an exposure of seven days showing all 14 chromosomes labelled. The pattern of labelling appeared not to be random, but was impossible to analyse on account of the irregular shapes and different degrees of stretching of diplotene and prometaphase chromosomes. In

  14. Cloning and characterization of a highly repetitive fish nucleotide sequence.

    PubMed

    Datta, U; Dutta, P; Mandal, R K

    1988-01-01

    We have cloned and sequenced a highly repetitive HindIII fragment of DNA from the common carp Cyprinus carpio. It represents a tandemly repeated sequence with a monomeric unit of 245 bp and comprises 8% of the fish genome. Higher units of this monomer appear as a ladder in Southern blots. The monomeric unit has been sequenced; it is A + T-rich with some direct and some inverse-repeat nucleotide clusters.

  15. Storage and retrieval of highly repetitive sequence collections.

    PubMed

    Mäkinen, Veli; Navarro, Gonzalo; Sirén, Jouni; Välimäki, Niko

    2010-03-01

    A repetitive sequence collection is a set of sequences which are small variations of each other. A prominent example are genome sequences of individuals of the same or close species, where the differences can be expressed by short lists of basic edit operations. Flexible and efficient data analysis on such a typically huge collection is plausible using suffix trees. However, the suffix tree occupies much space, which very soon inhibits in-memory analyses. Recent advances in full-text indexing reduce the space of the suffix tree to, essentially, that of the compressed sequences, while retaining its functionality with only a polylogarithmic slowdown. However, the underlying compression model considers only the predictability of the next sequence symbol given the k previous ones, where k is a small integer. This is unable to capture longer-term repetitiveness. For example, r identical copies of an incompressible sequence will be incompressible under this model. We develop new static and dynamic full-text indexes that are able of capturing the fact that a collection is highly repetitive, and require space basically proportional to the length of one typical sequence plus the total number of edit operations. The new indexes can be plugged into a recent dynamic fully-compressed suffix tree, achieving full functionality for sequence analysis, while retaining the reduced space and the polylogarithmic slowdown. Our experimental results confirm the practicality of our proposal.

  16. Repetitive sequences: the hidden diversity of heterochromatin in prochilodontid fish

    PubMed Central

    Terencio, Maria L.; Schneider, Carlos H.; Gross, Maria C.; do Carmo, Edson Junior; Nogaroto, Viviane; de Almeida, Mara Cristina; Artoni, Roberto Ferreira; Vicari, Marcelo R.; Feldberg, Eliana

    2015-01-01

    Abstract The structure and organization of repetitive elements in fish genomes are still relatively poorly understood, although most of these elements are believed to be located in heterochromatic regions. Repetitive elements are considered essential in evolutionary processes as hotspots for mutations and chromosomal rearrangements, among other functions – thus providing new genomic alternatives and regulatory sites for gene expression. The present study sought to characterize repetitive DNA sequences in the genomes of Semaprochilodus insignis (Jardine & Schomburgk, 1841) and Semaprochilodus taeniurus (Valenciennes, 1817) and identify regions of conserved syntenic blocks in this genome fraction of three species of Prochilodontidae (Semaprochilodus insignis, Semaprochilodus taeniurus, and Prochilodus lineatus (Valenciennes, 1836) by cross-FISH using Cot-1 DNA (renaturation kinetics) probes. We found that the repetitive fractions of the genomes of Semaprochilodus insignis and Semaprochilodus taeniurus have significant amounts of conserved syntenic blocks in hybridization sites, but with low degrees of similarity between them and the genome of Prochilodus lineatus, especially in relation to B chromosomes. The cloning and sequencing of the repetitive genomic elements of Semaprochilodus insignis and Semaprochilodus taeniurus using Cot-1 DNA identified 48 fragments that displayed high similarity with repetitive sequences deposited in public DNA databases and classified as microsatellites, transposons, and retrotransposons. The repetitive fractions of the Semaprochilodus insignis and Semaprochilodus taeniurus genomes exhibited high degrees of conserved syntenic blocks in terms of both the structures and locations of hybridization sites, but a low degree of similarity with the syntenic blocks of the Prochilodus lineatus genome. Future comparative analyses of other prochilodontidae species will be needed to advance our understanding of the organization and evolution of

  17. Improving the PCR protocol to amplify a repetitive DNA sequence.

    PubMed

    Riet, J; Ramos, L R V; Lewis, R V; Marins, L F

    2017-09-21

    Although PCR-based techniques have become an essential tool in the field of molecular and genetic research, the amplification of repetitive DNA sequences is limited. This is due to the truncated nature of the amplified sequences, which are also prone to errors during DNA polymerase-based amplification. The complex structure of repetitive DNA can form hairpin loops, which promote dissociation of the polymerase from the template, impairing complete amplification, and leading to the formation of incomplete fragments that serve as megaprimers. These megaprimers anneal with other sequences, generating unexpected fragments in each PCR cycle. Our gene model, MaSp1, is 1037-bp long, with 68% GC content, and its amino acid sequence is characterized by poly-alanine-glycine motifs, which represent the repetitive codon consensus. We describe the amplification of the MaSp1 gene through minor changes in the PCR program. The results show that a denaturation temperature of 98°C is the key determinant in the amplification of the MaSp1 partial gene sequence.

  18. CGGBP1 mitigates cytosine methylation at repetitive DNA sequences.

    PubMed

    Agarwal, Prasoon; Collier, Paul; Fritz, Markus Hsi-Yang; Benes, Vladimir; Wiklund, Helena Jernberg; Westermark, Bengt; Singh, Umashankar

    2015-05-16

    CGGBP1 is a repetitive DNA-binding transcription regulator with target sites at CpG-rich sequences such as CGG repeats and Alu-SINEs and L1-LINEs. The role of CGGBP1 as a possible mediator of CpG methylation however remains unknown. At CpG-rich sequences cytosine methylation is a major mechanism of transcriptional repression. Concordantly, gene-rich regions typically carry lower levels of CpG methylation than the repetitive elements. It is well known that at interspersed repeats Alu-SINEs and L1-LINEs high levels of CpG methylation constitute a transcriptional silencing and retrotransposon inactivating mechanism. Here, we have studied genome-wide CpG methylation with or without CGGBP1-depletion. By high throughput sequencing of bisulfite-treated genomic DNA we have identified CGGBP1 to be a negative regulator of CpG methylation at repetitive DNA sequences. In addition, we have studied CpG methylation alterations on Alu and L1 retrotransposons in CGGBP1-depleted cells using a novel bisulfite-treatment and high throughput sequencing approach. The results clearly show that CGGBP1 is a possible bidirectional regulator of CpG methylation at Alus, and acts as a repressor of methylation at L1 retrotransposons.

  19. Exploiting repetitive sequences and BAC clones in Festuca pratensis karyotyping.

    PubMed

    Majka, Joanna; Książczyk, Tomasz; Kiełbowicz-Matuk, Agnieszka; Kopecký, David; Kosmala, Arkadiusz

    2017-01-01

    The Festuca genus is thought to be the most numerous genus of the Poaceae family. One of the most agronomically important forage grasses, Festuca pratensis Huds. is treated as a model plant to study the molecular mechanisms associated with tolerance to winter stresses, including frost. However, the precise mapping of the genes governing stress tolerance in this species is difficult as its karyotype remains unrecognized. Only two F. pratensis chromosomes with 35S and 5S rDNA sequences can be easily identified, but its remaining chromosomes have not been distinguished to date. Here, two libraries derived from F. pratensis nuclear DNA with various contents of repetitive DNA sequences were used as sources of molecular probes for fluorescent in situ hybridisation (FISH), a BAC library and a library representing sequences most frequently present in the F. pratensis genome. Using FISH, six groups of DNA sequences were revealed in chromosomes on the basis of their signal position, including dispersed-like sequences, chromosome painting-like sequences, centromeric-like sequences, knob-like sequences, a group without hybridization signals, and single locus-like sequences. The last group was exploited to develop cytogenetic maps of diploid and tetraploid F. pratensis, which are presented here for the first time and provide a remarkable progress in karyotype characterization.

  20. Sequence organisation in nuclear DNA from Physarum polycephalum: methylation of repetitive sequences.

    PubMed

    Whittaker, P A; McLachlan, A; Hardman, N

    1981-02-25

    Nuclear DNA from the slime mould Physarum polycephalum is digested by the restriction endonuclease HpaII to generate a high molecular weight and a low molecular weight component. These are referred to as the M+ and the M- compartment, respectively. Sequences that are present in the M+ compartment are cleaved by MspI, the restriction enzyme isoschizomer of HpaII, thus showing that the recognition sequences for these enzymes in M+ DNA contain methylated CpG doublets. The distribution of repetitive sequences in the M+ and M- DNA compartments was investigated by comparison of the 'fingerprint' patterns of total Physarum DNA and isolated M+ DNA after digestion using different restriction endonucleases, and by probing for the presence of specific repetitive sequences in Southern blots of M+ and M- DNA by the use of cloned DNA segments. Both types of experiment indicate that many repetitive sequences are shared by both compartments, though some repetitive sequences appear to be considerably enriched, or are present exclusively, either in M+ DNA or in M- DNA.

  1. Sequence organisation in nuclear DNA from Physarum polycephalum: methylation of repetitive sequences.

    PubMed Central

    Whittaker, P A; McLachlan, A; Hardman, N

    1981-01-01

    Nuclear DNA from the slime mould Physarum polycephalum is digested by the restriction endonuclease HpaII to generate a high molecular weight and a low molecular weight component. These are referred to as the M+ and the M- compartment, respectively. Sequences that are present in the M+ compartment are cleaved by MspI, the restriction enzyme isoschizomer of HpaII, thus showing that the recognition sequences for these enzymes in M+ DNA contain methylated CpG doublets. The distribution of repetitive sequences in the M+ and M- DNA compartments was investigated by comparison of the 'fingerprint' patterns of total Physarum DNA and isolated M+ DNA after digestion using different restriction endonucleases, and by probing for the presence of specific repetitive sequences in Southern blots of M+ and M- DNA by the use of cloned DNA segments. Both types of experiment indicate that many repetitive sequences are shared by both compartments, though some repetitive sequences appear to be considerably enriched, or are present exclusively, either in M+ DNA or in M- DNA. Images PMID:6262717

  2. ReRep: Computational detection of repetitive sequences in genome survey sequences (GSS)

    PubMed Central

    Otto, Thomas D; Gomes, Leonardo HF; Alves-Ferreira, Marcelo; de Miranda, Antonio B; Degrave, Wim M

    2008-01-01

    Background Genome survey sequences (GSS) offer a preliminary global view of a genome since, unlike ESTs, they cover coding as well as non-coding DNA and include repetitive regions of the genome. A more precise estimation of the nature, quantity and variability of repetitive sequences very early in a genome sequencing project is of considerable importance, as such data strongly influence the estimation of genome coverage, library quality and progress in scaffold construction. Also, the elimination of repetitive sequences from the initial assembly process is important to avoid errors and unnecessary complexity. Repetitive sequences are also of interest in a variety of other studies, for instance as molecular markers. Results We designed and implemented a straightforward pipeline called ReRep, which combines bioinformatics tools for identifying repetitive structures in a GSS dataset. In a case study, we first applied the pipeline to a set of 970 GSSs, sequenced in our laboratory from the human pathogen Leishmania braziliensis, the causative agent of leishmaniosis, an important public health problem in Brazil. We also verified the applicability of ReRep to new sequencing technologies using a set of 454-reads of an Escheria coli. The behaviour of several parameters in the algorithm is evaluated and suggestions are made for tuning of the analysis. Conclusion The ReRep approach for identification of repetitive elements in GSS datasets proved to be straightforward and efficient. Several potential repetitive sequences were found in a L. braziliensis GSS dataset generated in our laboratory, and further validated by the analysis of a more complete genomic dataset from the EMBL and Sanger Centre databases. ReRep also identified most of the E. coli K12 repeats prior to assembly in an example dataset obtained by automated sequencing using 454 technology. The parameters controlling the algorithm behaved consistently and may be tuned to the properties of the dataset, in particular

  3. ReRep: computational detection of repetitive sequences in genome survey sequences (GSS).

    PubMed

    Otto, Thomas D; Gomes, Leonardo H F; Alves-Ferreira, Marcelo; de Miranda, Antonio B; Degrave, Wim M

    2008-09-09

    Genome survey sequences (GSS) offer a preliminary global view of a genome since, unlike ESTs, they cover coding as well as non-coding DNA and include repetitive regions of the genome. A more precise estimation of the nature, quantity and variability of repetitive sequences very early in a genome sequencing project is of considerable importance, as such data strongly influence the estimation of genome coverage, library quality and progress in scaffold construction. Also, the elimination of repetitive sequences from the initial assembly process is important to avoid errors and unnecessary complexity. Repetitive sequences are also of interest in a variety of other studies, for instance as molecular markers. We designed and implemented a straightforward pipeline called ReRep, which combines bioinformatics tools for identifying repetitive structures in a GSS dataset. In a case study, we first applied the pipeline to a set of 970 GSSs, sequenced in our laboratory from the human pathogen Leishmania braziliensis, the causative agent of leishmaniosis, an important public health problem in Brazil. We also verified the applicability of ReRep to new sequencing technologies using a set of 454-reads of an Escheria coli. The behaviour of several parameters in the algorithm is evaluated and suggestions are made for tuning of the analysis. The ReRep approach for identification of repetitive elements in GSS datasets proved to be straightforward and efficient. Several potential repetitive sequences were found in a L. braziliensis GSS dataset generated in our laboratory, and further validated by the analysis of a more complete genomic dataset from the EMBL and Sanger Centre databases. ReRep also identified most of the E. coli K12 repeats prior to assembly in an example dataset obtained by automated sequencing using 454 technology. The parameters controlling the algorithm behaved consistently and may be tuned to the properties of the dataset, in particular to the length of sequencing

  4. Repetitive sequences in plant nuclear DNA: types, distribution, evolution and function.

    PubMed

    Mehrotra, Shweta; Goyal, Vinod

    2014-08-01

    Repetitive DNA sequences are a major component of eukaryotic genomes and may account for up to 90% of the genome size. They can be divided into minisatellite, microsatellite and satellite sequences. Satellite DNA sequences are considered to be a fast-evolving component of eukaryotic genomes, comprising tandemly-arrayed, highly-repetitive and highly-conserved monomer sequences. The monomer unit of satellite DNA is 150-400 base pairs (bp) in length. Repetitive sequences may be species- or genus-specific, and may be centromeric or subtelomeric in nature. They exhibit cohesive and concerted evolution caused by molecular drive, leading to high sequence homogeneity. Repetitive sequences accumulate variations in sequence and copy number during evolution, hence they are important tools for taxonomic and phylogenetic studies, and are known as "tuning knobs" in the evolution. Therefore, knowledge of repetitive sequences assists our understanding of the organization, evolution and behavior of eukaryotic genomes. Repetitive sequences have cytoplasmic, cellular and developmental effects and play a role in chromosomal recombination. In the post-genomics era, with the introduction of next-generation sequencing technology, it is possible to evaluate complex genomes for analyzing repetitive sequences and deciphering the yet unknown functional potential of repetitive sequences. Copyright © 2014 The Authors. Production and hosting by Elsevier Ltd.. All rights reserved.

  5. Repetitive Sequences in Plant Nuclear DNA: Types, Distribution, Evolution and Function

    PubMed Central

    Mehrotra, Shweta; Goyal, Vinod

    2014-01-01

    Repetitive DNA sequences are a major component of eukaryotic genomes and may account for up to 90% of the genome size. They can be divided into minisatellite, microsatellite and satellite sequences. Satellite DNA sequences are considered to be a fast-evolving component of eukaryotic genomes, comprising tandemly-arrayed, highly-repetitive and highly-conserved monomer sequences. The monomer unit of satellite DNA is 150–400 base pairs (bp) in length. Repetitive sequences may be species- or genus-specific, and may be centromeric or subtelomeric in nature. They exhibit cohesive and concerted evolution caused by molecular drive, leading to high sequence homogeneity. Repetitive sequences accumulate variations in sequence and copy number during evolution, hence they are important tools for taxonomic and phylogenetic studies, and are known as “tuning knobs” in the evolution. Therefore, knowledge of repetitive sequences assists our understanding of the organization, evolution and behavior of eukaryotic genomes. Repetitive sequences have cytoplasmic, cellular and developmental effects and play a role in chromosomal recombination. In the post-genomics era, with the introduction of next-generation sequencing technology, it is possible to evaluate complex genomes for analyzing repetitive sequences and deciphering the yet unknown functional potential of repetitive sequences. PMID:25132181

  6. Terminal repetitive sequences in herpesvirus saimiri virion DNA.

    PubMed

    Bankier, A T; Dietrich, W; Baer, R; Barrell, B G; Colbère-Garapin, F; Fleckenstein, B; Bodemer, W

    1985-07-01

    The H-DNA repeat unit of Herpesvirus saimiri strain 11 was cloned in plasmid vector pAGO, and the nucleotide sequence was determined by the dideoxy chain termination method. One unit of repetitive DNA has 1,444 base pairs with 70.8% G+C content. The structural features of repeat DNA sequences at the termini of intact virion M-DNA (160 kilobases) and orientation of reiterated DNA were analyzed by radioactive end labeling of M-DNA, followed by cleavage of the end fragments with restriction endonucleases. The termini appeared to be blunt ended with a 5'-phosphate group, probably generated during encapsidation by cleavage in the immediate vicinity of the single ApaI recognition site in the H-DNA repeat unit. The sequence did not reveal sizeable open reading frames, the longest hypothetical peptide from H-DNA being 85 amino acids. There was no evidence for an mRNA promoter or terminator element, and H-DNA-specific transcription could not be found in productively infected cells.

  7. Accurate Prediction of the Statistics of Repetitions in Random Sequences: A Case Study in Archaea Genomes

    PubMed Central

    Régnier, Mireille; Chassignet, Philippe

    2016-01-01

    Repetitive patterns in genomic sequences have a great biological significance and also algorithmic implications. Analytic combinatorics allow to derive formula for the expected length of repetitions in a random sequence. Asymptotic results, which generalize previous works on a binary alphabet, are easily computable. Simulations on random sequences show their accuracy. As an application, the sample case of Archaea genomes illustrates how biological sequences may differ from random sequences. PMID:27376057

  8. Repetitive sequence analysis and karyotyping reveals centromere-associated DNA sequences in radish (Raphanus sativus L.).

    PubMed

    He, Qunyan; Cai, Zexi; Hu, Tianhua; Liu, Huijun; Bao, Chonglai; Mao, Weihai; Jin, Weiwei

    2015-04-18

    Radish (Raphanus sativus L., 2n = 2x = 18) is a major root vegetable crop especially in eastern Asia. Radish root contains various nutritions which play an important role in strengthening immunity. Repetitive elements are primary components of the genomic sequence and the most important factors in genome size variations in higher eukaryotes. To date, studies about repetitive elements of radish are still limited. To better understand genome structure of radish, we undertook a study to evaluate the proportion of repetitive elements and their distribution in radish. We conducted genome-wide characterization of repetitive elements in radish with low coverage genome sequencing followed by similarity-based cluster analysis. Results showed that about 31% of the genome was composed of repetitive sequences. Satellite repeats were the most dominating elements of the genome. The distribution pattern of three satellite repeat sequences (CL1, CL25, and CL43) on radish chromosomes was characterized using fluorescence in situ hybridization (FISH). CL1 was predominantly located at the centromeric region of all chromosomes, CL25 located at the subtelomeric region, and CL43 was a telomeric satellite. FISH signals of two satellite repeats, CL1 and CL25, together with 5S rDNA and 45S rDNA, provide useful cytogenetic markers to identify each individual somatic metaphase chromosome. The centromere-specific histone H3 (CENH3) has been used as a marker to identify centromere DNA sequences. One putative CENH3 (RsCENH3) was characterized and cloned from radish. Its deduced amino acid sequence shares high similarities to those of the CENH3s in Brassica species. An antibody against B. rapa CENH3, specifically stained radish centromeres. Immunostaining and chromatin immunoprecipitation (ChIP) tests with anti-BrCENH3 antibody demonstrated that both the centromere-specific retrotransposon (CR-Radish) and satellite repeat (CL1) are directly associated with RsCENH3 in radish. Proportions

  9. Chromosome mapping of repetitive sequences in Anostomidae species: implications for genomic and sex chromosome evolution

    PubMed Central

    2012-01-01

    Background Members of the Anostomidae family provide an interesting model system for the study of the influence of repetitive elements on genome composition, mainly because they possess numerous heterochromatic segments and a peculiar system of female heterogamety that is restricted to a few species of the Leporinus genus. The aim of this study was to isolate and identify important new repetitive DNA elements in Anostomidae through restriction enzyme digestion, followed by cloning, characterisation and chromosome mapping of this fragment. To identify repetitive elements in other Leporinus species and expand on studies of repetitive elements in Anostomidae, hybridisation experiments were also performed using previously described probes of LeSpeI repetitive elements. Results The 628-base pair (bp) LeSpeII fragment was hybridised to metaphase cells of L. elongatus individuals as well as those of L. macrocephalus, L. obtusidens, L. striatus, L. lacustris, L. friderici, Schizodon borellii and S. isognathus. In L. elongatus, both male and female cells contained small clusters of LeSpeII repetitive elements dispersed on all of the chromosomes, with enrichment near most of the terminal portions of the chromosomes. In the female sex chromosomes of L. elongatus (Z2,Z2/W1W2), however, this repeated element was absent. In the remaining species, a dispersed pattern of hybridisation was observed on all chromosomes irrespective of whether or not they were sex chromosomes. The repetitive element LeSpeI produced positive hybridisations signals only in L. elongatus, L. macrocephalus and L. obtusidens, i.e., species with differentiated sex chromosomes. In the remaining species, the LeSpeI element did not produce hybridisation signals. Conclusions Results are discussed in terms of the effects of repetitive sequences on the differentiation of the Anostomidae genome, especially with respect to sex chromosome evolution. LeSpeII showed hybridisation patterns typical of Long Interspersed

  10. Repetitive telomeric sequences in chromosomal translocations involving chromosome 21

    SciTech Connect

    Qu, J.; Dallaire, L.; Fetni, R.

    1994-09-01

    Telomeres perform key functions in maintaining chromosome integrity. In some structural rearrangements the structure and polymorphism in human telomeres may play a significant role. However, of all the telomeric and subtelomeric sequences, only the terminal TTAGGG repeats are believed essential for telomere function. During the course of a study on the role of telomere structure and polymorphism in chromosomal rearrangements observed in families referred for prenatal diagnosis, we studied three cases in which chromosome 21 was involved. Repetitive TTAGGG sequences for all human chromosomes were used as probes (Oncor). Case 1, a de novo cryptic translocation (2;21) was initially identified as monosomy 21 in a child with psychomotor delay and mild dysmorphism. Using a cosmid probe specific for region 21q22.3 and whole chromosome 21 specific painting probe, the long arm of 21 was found on the short arm of chromosome 2 with an interstitial telomere at the breakpoint junction. All the cells were monosomic for 21pter{yields}q21. Case 2 is a familial (19;21) translocation. GTG-banding and FISH with a satellite probe showed no apparent loss of material at the end of either 19q or 21q, with an interstitial telomere at the fusion site of the two intact chromosomes. In case 3, a four generation reciprocal (20;21) translocation, there was no interstitial telomere. The persistence of an interstitial telomere is a relatively rare event which can now be observed with in situ hybridization. Its study may lead to a better understanding of the dynamics of translocations and of chromosome imbalance.

  11. Physical chromosome mapping of repetitive DNA sequences in Nile tilapia Oreochromis niloticus: evidences for a differential distribution of repetitive elements in the sex chromosomes.

    PubMed

    Ferreira, Irani A; Martins, Cesar

    2008-06-01

    Repetitive DNAs have been extensively applied as physical chromosome markers on comparative studies, identification of chromosome rearrangements and sex chromosomes, chromosome evolution analysis, and applied genetics. Here we report the characterization of repetitive DNA sequences from the Nile tilapia (Oreochromis niloticus) genome by construction and screening of plasmid library enriched with repetitive DNAs, analysis of a BAC-based physical map, and hybridization to chromosomes. The physical mapping of BACs enriched with repetitive sequences and C(o)t-1 DNA (DNA enriched for highly and moderately repetitive DNA sequences) to chromosomes using FISH showed a predominant distribution of repetitive elements in the centromeric and telomeric regions and along the entire length of the largest chromosome pair (X and Y sex chromosomes) of the species. The distribution of repetitive DNAs differed significantly between the p arm of X and Y chromosomes. These findings suggest that repetitive DNAs have had an important role in the differentiation of sex chromosomes.

  12. Bacterial repetitive extragenic palindromic sequences are DNA targets for Insertion Sequence elements

    PubMed Central

    Tobes, Raquel; Pareja, Eduardo

    2006-01-01

    Background Mobile elements are involved in genomic rearrangements and virulence acquisition, and hence, are important elements in bacterial genome evolution. The insertion of some specific Insertion Sequences had been associated with repetitive extragenic palindromic (REP) elements. Considering that there are a sufficient number of available genomes with described REPs, and exploiting the advantage of the traceability of transposition events in genomes, we decided to exhaustively analyze the relationship between REP sequences and mobile elements. Results This global multigenome study highlights the importance of repetitive extragenic palindromic elements as target sequences for transposases. The study is based on the analysis of the DNA regions surrounding the 981 instances of Insertion Sequence elements with respect to the positioning of REP sequences in the 19 available annotated microbial genomes corresponding to species of bacteria with reported REP sequences. This analysis has allowed the detection of the specific insertion into REP sequences for ISPsy8 in Pseudomonas syringae DC3000, ISPa11 in P. aeruginosa PA01, ISPpu9 and ISPpu10 in P. putida KT2440, and ISRm22 and ISRm19 in Sinorhizobium meliloti 1021 genome. Preference for insertion in extragenic spaces with REP sequences has also been detected for ISPsy7 in P. syringae DC3000, ISRm5 in S. meliloti and ISNm1106 in Neisseria meningitidis MC58 and Z2491 genomes. Probably, the association with REP elements that we have detected analyzing genomes is only the tip of the iceberg, and this association could be even more frequent in natural isolates. Conclusion Our findings characterize REP elements as hot spots for transposition and reinforce the relationship between REP sequences and genomic plasticity mediated by mobile elements. In addition, this study defines a subset of REP-recognizer transposases with high target selectivity that can be useful in the development of new tools for genome manipulation. PMID

  13. Isolation and characterization of centromeric repetitive DNA sequences in Saccharum spontaneum

    PubMed Central

    Zhang, Wenpan; Zuo, Sheng; Li, Zhanjie; Meng, Zhuang; Han, Jinlei; Song, Junqi; Pan, Yong-Bao; Wang, Kai

    2017-01-01

    Sugarcane (Saccharum hybrids spp.) is the most important sugar crop that accounts for ~75% of the world’s sugar production. Recently, a whole-genome sequencing project was launched on the wild species S. spontaneum. To obtain information on the DNA composition of the repeat-enriched region of the centromere, we conducted a genome-wide analysis of the DNA sequences associated with CenH3 (a mutant of histone H3 located in eukaryote centromeres) using chromatin immunoprecipitation followed by sequencing (ChIP-seq) method. We demonstrate that the centromeres contain mainly SCEN-like single satellite repeat (Ss1) and several Ty3/gypsy retrotransposon-related repeats (Ss166, Ss51, and Ss68). Ss1 dominates in the centromeric regions and spans up to 500 kb. In contrast, the Ty3/gypsy retrotransposon-related repeats are either clustered spanning over a short range, or dispersed in the centromere regions. Interestingly, Ss1 exhibits a chromosome-specific enrichment in the wild species S. spontaneum and S. robustum, but not in the domesticated species S. officinarum and modern sugarcane cultivars. This finding suggests an autopolyploid genome identity of S. spontaneum with a high level of homology among its eight sub-genomes. We also conducted a genome-wide survey of the repetitive DNAs in S. spontaneum following a similarity-based sequence clustering strategy. These results provide insight into the composition of sugarcane genome as well as the genome assembly of S. spontaneum. PMID:28134354

  14. Repetitive sequences in Eurasian lynx (Lynx lynx L.) mitochondrial DNA control region.

    PubMed

    Sindičić, Magda; Gomerčić, Tomislav; Galov, Ana; Polanc, Primož; Huber, Duro; Slavica, Alen

    2012-06-01

    Mitochondrial DNA (mtDNA) control region (CR) of numerous species is known to include up to five different repetitive sequences (RS1-RS5) that are found at various locations, involving motifs of different length and extensive length heteroplasmy. Two repetitive sequences (RS2 and RS3) on opposite sides of mtDNA central conserved region have been described in domestic cat (Felis catus) and some other felid species. However, the presence of repetitive sequence RS3 has not been detected in Eurasian lynx (Lynx lynx) yet. We analyzed mtDNA CR of 35 Eurasian lynx (L. lynx L.) samples to characterize repetitive sequences and to compare them with those found in other felid species. We confirmed the presence of 80 base pairs (bp) repetitive sequence (RS2) at the 5' end of the Eurasian lynx mtDNA CR L strand and for the first time we described RS3 repetitive sequence at its 3' end, consisting of an array of tandem repeats five to ten bp long. We found that felid species share similar RS3 repetitive pattern and fundamental repeat motif TACAC.

  15. Evolved gas composition monitoring by repetitive injection gas chromatography.

    PubMed

    White, Robert L

    2015-11-20

    Performance characteristics and applications of a small volume gas chromatograph oven are described. Heating and cooling properties of the apparatus are evaluated and examples are given illustrating the advantages of greatly reducing the air bath volume surrounding fused silica columns. Fast heating and cooling of the oven permit it to be employed for repetitive injection analyses. By using fast gas chromatography separations to achieve short assay cycle times, the apparatus can be employed for on-line species-specific gas stream composition monitoring when volatile species concentrations vary on time scales of a few minutes or longer. This capability facilitates repeated sampling and fast gas chromatographic separations of volatile product mixtures produced during thermal analyses. Applications of repetitive injection gas chromatography-mass spectrometry evolved gas analyses to monitoring purge gas effluent streams containing volatile acid catalyzed polymer cracking products are described. The influence of thermal analysis and chromatographic experimental parameters on effluent sampling frequency are delineated. Copyright © 2015 Elsevier B.V. All rights reserved.

  16. Distribution of repetitive DNA sequences in eubacteria and application to fingerprinting of bacterial genomes.

    PubMed Central

    Versalovic, J; Koeuth, T; Lupski, J R

    1991-01-01

    Dispersed repetitive DNA sequences have been described recently in eubacteria. To assess the distribution and evolutionary conservation of two distinct prokaryotic repetitive elements, consensus oligonucleotides were used in polymerase chain reaction [PCR] amplification and slot blot hybridization experiments with genomic DNA from diverse eubacterial species. Oligonucleotides matching Repetitive Extragenic Palindromic [REP] elements and Enterobacterial Repetitive Intergenic Consensus [ERIC] sequences were synthesized and tested as opposing PCR primers in the amplification of eubacterial genomic DNA. REP and ERIC consensus oligonucleotides produced clearly resolvable bands by agarose gel electrophoresis following PCR amplification. These band patterns provided unambiguous DNA fingerprints of different eubacterial species and strains. Both REP and ERIC probes hybridized preferentially to genomic DNA from Gram-negative enteric bacteria and related species. Widespread distribution of these repetitive DNA elements in the genomes of various microorganisms should enable rapid identification of bacterial species and strains, and be useful for the analysis of prokaryotic genomes. Images PMID:1762913

  17. Repetitive part of the banana (Musa acuminata) genome investigated by low-depth 454 sequencing.

    PubMed

    Hribová, Eva; Neumann, Pavel; Matsumoto, Takashi; Roux, Nicolas; Macas, Jirí; Dolezel, Jaroslav

    2010-09-16

    Bananas and plantains (Musa spp.) are grown in more than a hundred tropical and subtropical countries and provide staple food for hundreds of millions of people. They are seed-sterile crops propagated clonally and this makes them vulnerable to a rapid spread of devastating diseases and at the same time hampers breeding improved cultivars. Although the socio-economic importance of bananas and plantains cannot be overestimated, they remain outside the focus of major research programs. This slows down the study of nuclear genome and the development of molecular tools to facilitate banana improvement. In this work, we report on the first thorough characterization of the repeat component of the banana (M. acuminata cv. 'Calcutta 4') genome. Analysis of almost 100 Mb of sequence data (0.15× genome coverage) permitted partial sequence reconstruction and characterization of repetitive DNA, making up about 30% of the genome. The results showed that the banana repeats are predominantly made of various types of Ty1/copia and Ty3/gypsy retroelements representing 16 and 7% of the genome respectively. On the other hand, DNA transposons were found to be rare. In addition to new families of transposable elements, two new satellite repeats were discovered and found useful as cytogenetic markers. To help in banana sequence annotation, a specific Musa repeat database was created, and its utility was demonstrated by analyzing the repeat composition of 62 genomic BAC clones. A low-depth 454 sequencing of banana nuclear genome provided the largest amount of DNA sequence data available until now for Musa and permitted reconstruction of most of the major types of DNA repeats. The information obtained in this study improves the knowledge of the long-range organization of banana chromosomes, and provides sequence resources needed for repeat masking and annotation during the Musa genome sequencing project. It also provides sequence data for isolation of DNA markers to be used in genetic

  18. Repetitive part of the banana (Musa acuminata) genome investigated by low-depth 454 sequencing

    PubMed Central

    2010-01-01

    Background Bananas and plantains (Musa spp.) are grown in more than a hundred tropical and subtropical countries and provide staple food for hundreds of millions of people. They are seed-sterile crops propagated clonally and this makes them vulnerable to a rapid spread of devastating diseases and at the same time hampers breeding improved cultivars. Although the socio-economic importance of bananas and plantains cannot be overestimated, they remain outside the focus of major research programs. This slows down the study of nuclear genome and the development of molecular tools to facilitate banana improvement. Results In this work, we report on the first thorough characterization of the repeat component of the banana (M. acuminata cv. 'Calcutta 4') genome. Analysis of almost 100 Mb of sequence data (0.15× genome coverage) permitted partial sequence reconstruction and characterization of repetitive DNA, making up about 30% of the genome. The results showed that the banana repeats are predominantly made of various types of Ty1/copia and Ty3/gypsy retroelements representing 16 and 7% of the genome respectively. On the other hand, DNA transposons were found to be rare. In addition to new families of transposable elements, two new satellite repeats were discovered and found useful as cytogenetic markers. To help in banana sequence annotation, a specific Musa repeat database was created, and its utility was demonstrated by analyzing the repeat composition of 62 genomic BAC clones. Conclusion A low-depth 454 sequencing of banana nuclear genome provided the largest amount of DNA sequence data available until now for Musa and permitted reconstruction of most of the major types of DNA repeats. The information obtained in this study improves the knowledge of the long-range organization of banana chromosomes, and provides sequence resources needed for repeat masking and annotation during the Musa genome sequencing project. It also provides sequence data for isolation of DNA

  19. The Peculiar Landscape of Repetitive Sequences in the Olive (Olea europaea L.) Genome

    PubMed Central

    Barghini, Elena; Natali, Lucia; Cossu, Rosa Maria; Giordani, Tommaso; Pindo, Massimo; Cattonaro, Federica; Scalabrin, Simone; Velasco, Riccardo; Morgante, Michele; Cavallini, Andrea

    2014-01-01

    Analyzing genome structure in different species allows to gain an insight into the evolution of plant genome size. Olive (Olea europaea L.) has a medium-sized haploid genome of 1.4 Gb, whose structure is largely uncharacterized, despite the growing importance of this tree as oil crop. Next-generation sequencing technologies and different computational procedures have been used to study the composition of the olive genome and its repetitive fraction. A total of 2.03 and 2.3 genome equivalents of Illumina and 454 reads from genomic DNA, respectively, were assembled following different procedures, which produced more than 200,000 differently redundant contigs, with mean length higher than 1,000 nt. Mapping Illumina reads onto the assembled sequences was used to estimate their redundancy. The genome data set was subdivided into highly and medium redundant and nonredundant contigs. By combining identification and mapping of repeated sequences, it was established that tandem repeats represent a very large portion of the olive genome (∼31% of the whole genome), consisting of six main families of different length, two of which were first discovered in these experiments. The other large redundant class in the olive genome is represented by transposable elements (especially long terminal repeat-retrotransposons). On the whole, the results of our analyses show the peculiar landscape of the olive genome, related to the massive amplification of tandem repeats, more than that reported for any other sequenced plant genome. PMID:24671744

  20. The peculiar landscape of repetitive sequences in the olive (Olea europaea L.) genome.

    PubMed

    Barghini, Elena; Natali, Lucia; Cossu, Rosa Maria; Giordani, Tommaso; Pindo, Massimo; Cattonaro, Federica; Scalabrin, Simone; Velasco, Riccardo; Morgante, Michele; Cavallini, Andrea

    2014-04-01

    Analyzing genome structure in different species allows to gain an insight into the evolution of plant genome size. Olive (Olea europaea L.) has a medium-sized haploid genome of 1.4 Gb, whose structure is largely uncharacterized, despite the growing importance of this tree as oil crop. Next-generation sequencing technologies and different computational procedures have been used to study the composition of the olive genome and its repetitive fraction. A total of 2.03 and 2.3 genome equivalents of Illumina and 454 reads from genomic DNA, respectively, were assembled following different procedures, which produced more than 200,000 differently redundant contigs, with mean length higher than 1,000 nt. Mapping Illumina reads onto the assembled sequences was used to estimate their redundancy. The genome data set was subdivided into highly and medium redundant and nonredundant contigs. By combining identification and mapping of repeated sequences, it was established that tandem repeats represent a very large portion of the olive genome (∼31% of the whole genome), consisting of six main families of different length, two of which were first discovered in these experiments. The other large redundant class in the olive genome is represented by transposable elements (especially long terminal repeat-retrotransposons). On the whole, the results of our analyses show the peculiar landscape of the olive genome, related to the massive amplification of tandem repeats, more than that reported for any other sequenced plant genome.

  1. Using suffix tree to discover complex repetitive patterns in DNA sequences.

    PubMed

    He, Dan

    2006-01-01

    The discovery of repetitive patterns is a fundamental problem in bioinformatics. It remains a challenging open problem because most of the existing methods, such as using annotated repeat database and extracting pairs of maximum repeated regions, can not give a correct definition incorporating both the length and frequency factors of the repetitive patterns. There is an algorithm considering both the pattern length and frequency. However, it could only find the simple "elementary" repeats and is not able to reveal the complex structure of the repetitive patterns. Furthermore, its time complexity O(n2 f), where n is the length of the sequence, f is the minimum frequency requirement, could be still too high for long DNA sequences. In this paper, we propose a novel algorithm using suffix tree to reveal the complex structure of the repetitive patterns in DNA sequences. We show that our algorithm achieves an O(n2/f2) time complexity.

  2. An improved protocol for sequencing of repetitive genomic regions and structural variations using mutagenesis and next generation sequencing.

    PubMed

    Sipos, Botond; Massingham, Tim; Stütz, Adrian M; Goldman, Nick

    2012-01-01

    The rise of Next Generation Sequencing (NGS) technologies has transformed de novo genome sequencing into an accessible research tool, but obtaining high quality eukaryotic genome assemblies remains a challenge, mostly due to the abundance of repetitive elements. These also make it difficult to study nucleotide polymorphism in repetitive regions, including certain types of structural variations. One solution proposed for resolving such regions is Sequence Assembly aided by Mutagenesis (SAM), which relies on the fact that introducing enough random mutations breaks the repetitive structure, making assembly possible. Sequencing many different mutated copies permits the sequence of the repetitive region to be inferred by consensus methods. However, this approach relies on molecular cloning in order to isolate and amplify individual mutant copies, making it hard to scale-up the approach for use in conjunction with high-throughput sequencing technologies. To address this problem, we propose NG-SAM, a modified version of the SAM protocol that relies on PCR and dilution steps only, coupled to a NGS workflow. NG-SAM therefore has the potential to be scaled-up, e.g. using emerging microfluidics technologies. We built a realistic simulation pipeline to study the feasibility of NG-SAM, and our results suggest that under appropriate experimental conditions the approach might be successfully put into practice. Moreover, our simulations suggest that NG-SAM is capable of reconstructing robustly a wide range of potential target sequences of varying lengths and repetitive structures.

  3. Identification and annotation of repetitive sequences in fungal genomes

    USDA-ARS?s Scientific Manuscript database

    Cheaper and faster sequencing technologies have fundamentally changed the pace of genome sequencing projects and have contributed to the ever-increasing volume of genomic data. This has been paralleled by an increase in computational power and resources to process and translate raw sequence data int...

  4. Polymerase Chain Reaction-based Suppression of Repetitive Sequences in Whole Chromosome Painting Probes for FISH

    SciTech Connect

    Dugan, L C; Pattee, M; Williams, J; Eklund, M; Bedford, J S; Christian, A T

    2004-04-21

    We have developed a method to suppress the PCR amplification of repetitive sequences in whole chromosome painting probes by adding Cot-1 DNA to the amplification mixture. The repetitive sequences in the Cot-1 DNA bind to their homologous sequences in the probe library, prevent the binding of primers, and interfere with extension of the probe sequences, greatly decreasing PCR efficiency selectively across these blocked regions. A second labeling reaction is then done and this product is resuspended in FISH hybridization mixture without further addition of blocking DNA. The hybridization produces little if any non-specific binding on any other chromosomes. We have been able to successfully use this procedure with both human and rat chromosome probes. This technique should be applicable in producing probes for CGH, M-FISH and SKY, as well as reducing the presence of repetitive DNA in genomic libraries.

  5. The Effects of Delayed Reinforcement on Variability and Repetition of Response Sequences

    ERIC Educational Resources Information Center

    Odum, Amy L.; Ward, Ryan D.; Burke, K. Anne; Barnes, Christopher A.

    2006-01-01

    Four experiments examined the effects of delays to reinforcement on key peck sequences of pigeons maintained under multiple schedules of contingencies that produced variable or repetitive behavior. In Experiments 1, 2, and 4, in the repeat component only the sequence right-right-left-left earned food, and in the vary component four-response…

  6. Identification of individual barley chromosomes based on repetitive sequences: conservative distribution of Afa-family repetitive sequences on the chromosomes of barley and wheat.

    PubMed

    Tsujimoto, H; Mukai, Y; Akagawa, K; Nagaki, K; Fujigaki, J; Yamamoto, M; Sasakuma, T

    1997-10-01

    The Afa-family repetitive sequences were isolated from barley (Hordeum vulgare, 2n = 14) and cloned as pHvA14. This sequence distinguished each barely chromosome by in situ hybridization. Double color fluorescence in situ hybridization using pHvA14 and 5S rDNA or HvRT-family sequence (subtelomeric sequence of barley) allocated individual barley chromosomes showing a specific pattern of pHvA14 to chromosome 1H to 7H. As the case of the D genome chromosomes of Aegilops squarrosa and common wheat (Triticum aestivum) hybridized by its Afa-family sequences, the signals of pHvA14 in barley chromosomes tended to appear in the distal regions that do not carry many chromosome band markers. In the telomeric regions these signals always placed in more proximal portions than those of HvRT-family. Based on the distribution patterns of Afa-family sequences in the chromosomes of barley and D genome chromosomes of wheat, we discuss a possible mechanism of amplification of the repetitive sequences during the evolution of Triticeae. In addition, we show here that HvRT-family also could be used to distinguish individual barley chromosomes from the patterns of in situ hybridization.

  7. Identification and characterization of abundant repetitive sequences in Eragrostis tef cv. Enatite genome.

    PubMed

    Gebre, Yohannes Gedamu; Bertolini, Edoardo; Pè, Mario Enrico; Zuccolo, Andrea

    2016-02-01

    Eragrostis tef is an allotetraploid (2n = 4 × = 40) annual, C4 grass with an estimated nuclear genome size of 730 Mbp. It is widely grown in Ethiopia, where it provides basic nutrition for more than half of the population. Although a draft assembly of the E. tef genome was made available in 2014, characterization of the repetitive portion of the E. tef genome has not been a subject of a detailed analysis. Repetitive sequences constitute most of the DNA in eukaryotic genomes. Transposable elements are usually the most abundant repetitive component in plant genomes. They contribute to genome size variation, cause mutations, can result in chromosomal rearrangements, and influence gene regulation. An extensive and in depth characterization of the repetitive component is essential in understanding the evolution and function of the genome. Using new paired-end sequence data and a de novo repeat identification strategy, we identified the most repetitive elements in the E. tef genome. Putative repeat sequences were annotated based on similarity to known repeat groups in other grasses. Altogether we identified 1,389 medium/highly repetitive sequences that collectively represent about 27% of the teff genome. Phylogenetic analyses of the most important classes of TEs were carried out in a comparative framework including paralog elements from rice and maize. Finally, an abundant tandem repeat accounting for more than 4% of the whole genome was identified and partially characterized. Analyzing a large sample of randomly sheared reads we obtained a library of the repetitive sequences of E. tef. The approach we used was designed to avoid underestimation of repeat contribution; such underestimation is characteristic of whole genome assembly projects. The data collected represent a valuable resource for further analysis of the genome of this important orphan crop.

  8. Molecular analyses of a repetitive DNA sequence in wheat (Triticum aestivum L.).

    PubMed

    Ueng, P P; Hang, A; Tsang, H; Vega, J M; Wang, L; Burton, C S; He, F T; Liu, B

    2000-06-01

    A repetitive sequence designated WE35 was isolated from wheat genomic DNA. This sequence consists of a 320-bp repeat unit and represents approximately 0.002% of the total wheat DNA. It is unidirectionally distributed either continuously or discretely in the genome. Ladder-like banding patterns were observed in Southern blots when the wheat genomic DNA was restricted with endonuclease enzymes EcoRI, HincII, NciI, and NdeI, which is characteristic for tandemly organized sequences. Two DNA fragments in p451 were frequently associated with the WE35 repetitive unit in a majority of lambda wheat genomic clones. A 475-bp fragment homologous to the 5'-end long terminal repeat (LTR) of cereal retroelements was also found in some lambda wheat genomic clones containing the repetitive unit. Physical mapping by fluorescence in situ hybridization (FISH) indicated that one pair of wheat chromosomes could be specifically detected with the WE35 positive probe p551. WE35 can be considered a chromosome-specific repetitive sequence. This repetitive unit could be used as a molecular marker for genetic, phylogenetic, and evolutionary studies in the tribe Triticeae.

  9. Spectral-temporal encoding and decoding of the femtosecond pulses sequences with a THz repetition rate

    NASA Astrophysics Data System (ADS)

    Tcypkin, A. N.; Putilin, S. E.

    2017-01-01

    Experimental and numerical modeling techniques demonstrated the possibilities of the spectral-time encoding and decoding for time division multiplexing sequence of femtosecond subpulses with a repetition rate of up to 6.4 THz. The sequence was formed as a result of the interference of two phase-modulated pulses. We report the limits of the application of the developed method of controlling formed sequence at the spectral-temporal coding.

  10. Isolation, characterization and chromosome localization of repetitive DNA sequences in bananas (Musa spp.).

    PubMed

    Valárik, M; Simková, H; Hribová, E; Safár, J; Dolezelová, M; Dolezel, J

    2002-01-01

    Partial genomic DNA libraries were constructed in Musa acuminata and M. balbisiana and screened for clones carrying repeated sequences, and sequences carrying rDNA. Isolated clones were characterized in terms of copy number, genomic distribution in M. acuminata and M. balbisiana, and sequence similarity to known DNA sequences. Ribosomal RNA genes have been the most abundant sequences recovered. FISH with probes for DNA clones Radkal and Radka7, which carry different fragments of Musa 26S rDNA, and Radka14, for which no homology with known DNA sequences has been found, resulted in clear signals at secondary constrictions. Only one clone carrying 5S rDNA, named Radka2, has been recovered. All remaining DNA clones exhibited more or less pronounced clustering at centromeric regions. The study revealed small differences in genomic distribution of repetitive DNA sequences between M. acuminata and M. balbisiana, the only exception being the 5S rDNA where the two Musa clones under study differed in the number of sites. All repetitive sequences were more abundant in M. acuminata whose genome is about 12% larger than that of M. balbisiana. While, for some sequences, the differences in copy number between the species were relatively small, for some of them, e.g. Radka5, the difference was almost thirty-fold. These observations suggest that repetitive DNA sequences contribute to the difference in genome size between both species, albeit to different extents. Isolation and characterization of new repetitive DNA sequences improves the knowledge of long-range organization of chromosomes in

  11. Identifying satellites and periodic repetitions in biological sequences.

    PubMed

    Sagot, M F; Myers, E W

    1998-01-01

    We present in this paper an algorithm for identifying satellites in DNA sequences. Satellites (simple, micro, or mini) are repeats in number between 30 and as many as 1,000,000 whose lengths vary between 2 and hundreds of base pairs and that appear, with some mutations, in tandem along the sequence. We concentrate here on short to moderately long (up to 30-40 base pairs) approximate tandem repeats where copies may differ up to epsilon = 15-20% from a consensus model of the repeating unit (implying individual units may vary by 2 epsilon from each other). The algorithm is composed of two parts. The first one consists of a filter that basically eliminates all regions whose probability of containing a satellite is less than one in 10(4) when epsilon = 10%. The second part realizes an exhaustive exploration of the space of all possible models for the repeating units present in the sequence. It therefore has the advantage over previous work of being able to report a consensus model, say m, of the repeated unit as well as the span of the satellite. The first phase was designed for efficiency and takes only O (n) time where n is the length of the sequence. The second phase was designed for sensitivity and takes time O (n . N (e, k)) in the worst case where k is the length of the repeating unit m, e = [epsilon k] is the number of differences allowed between each repeat unit and the model m, and N (e, k) is the maximum number of words that are not more than e differences from another word of length k. That is, N (e, k) is the maximum size of an e-neighborhood of a string of length k. Experiments reveal the second phase to be considerably faster in practice than the worst-case complexity bound suggests. Finally, the present algorithm is easily adapted to finding tandem repeats in protein sequences, as well as extended to identifying mixed direct-inverse tandem repeats.

  12. Next-generation sequencing detects repetitive elements expansion in giant genomes of annual killifish genus Austrolebias (Cyprinodontiformes, Rivulidae).

    PubMed

    García, G; Ríos, N; Gutiérrez, V

    2015-06-01

    Among Neotropical fish fauna, the South American killifish genus Austrolebias (Cyprinodontiformes: Rivulidae) constitutes an excellent model to study the genomic evolutionary processes underlying speciation events. Recently, unusually large genome size has been described in 16 species of this genus, with an average DNA content of about 5.95 ± 0.45 pg per diploid cell (mean C-value of about 2.98 pg). In the present paper we explore the possible origin of this unparallel genomic increase by means of comparative analysis of the repetitive components using NGS (454-Roche) technology in the lowest and highest Rivulidae genomes. Here, we provide the first annotated Rivulidae-repeated sequences composition and their relative repetitive fraction in both genomes. Remarkably, the genomic proportion of the moderately repetitive DNA in Austrolebias charrua genome represents approximately twice (45%) of the repetitive components of the highly related rivulinae taxon Cynopoecilus melanotaenia (25%). Present work provides evidence about the impact of the repeat families that could be distinctly proliferated among sublineages within Rivulidae fish group, explaining the great genome size differences encompassing the differentiation and speciation events in this family.

  13. Typing of Listeria monocytogenes Strains by Repetitive Element Sequence-Based PCR

    PubMed Central

    Jeršek, B.; Gilot, P.; Gubina, M.; Klun, N.; Mehle, J.; Tcherneva, E.; Rijpens, N.; Herman, L.

    1999-01-01

    Listeria monocytogenes strains possess short repetitive extragenic palindromic (REP) elements and enterobacterial repetitive intergenic consensus (ERIC) sequences. We used repetitive element sequence-based PCR (rep-PCR) to evaluate the potential of REP and ERIC elements for typing L. monocytogenes strains isolated from humans, animals, and foods. On the basis of rep-PCR fingerprints, L. monocytogenes strains were divided into four major clusters matching origin of isolation. rep-PCR fingerprints of human and animal isolates were different from those of food isolates. Computer evaluation of rep-PCR fingerprints allowed discrimination among the tested serotypes 1/2a, 1/2b, 1/2c, 3b, and 4b within each major cluster. The index of discrimination calculated for 52 epidemiologically unrelated isolates of L. monocytogenes was 0.98 for REP- and ERIC-PCR. Our results suggest that rep-PCR can provide an alternative method for L. monocytogenes typing. PMID:9854072

  14. The Pinus taeda genome is characterized by diverse and highly diverged repetitive sequences

    PubMed Central

    2010-01-01

    Background In today's age of genomic discovery, no attempt has been made to comprehensively sequence a gymnosperm genome. The largest genus in the coniferous family Pinaceae is Pinus, whose 110-120 species have extremely large genomes (c. 20-40 Gb, 2N = 24). The size and complexity of these genomes have prompted much speculation as to the feasibility of completing a conifer genome sequence. Conifer genomes are reputed to be highly repetitive, but there is little information available on the nature and identity of repetitive units in gymnosperms. The pines have extensive genetic resources, with approximately 329000 ESTs from eleven species and genetic maps in eight species, including a dense genetic map of the twelve linkage groups in Pinus taeda. Results We present here the Sanger sequence and annotation of ten P. taeda BAC clones and Genome Analyzer II whole genome shotgun (WGS) sequences representing 7.5% of the genome. Computational annotation of ten BACs predicts three putative protein-coding genes and at least fifteen likely pseudogenes in nearly one megabase of sequence. We found three conifer-specific LTR retroelements in the BACs, and tentatively identified at least 15 others based on evidence from the distantly related angiosperms. Alignment of WGS sequences to the BACs indicates that 80% of BAC sequences have similar copies (≥ 75% nucleotide identity) elsewhere in the genome, but only 23% have identical copies (99% identity). The three most common repetitive elements in the genome were identified and, when combined, represent less than 5% of the genome. Conclusions This study indicates that the majority of repeats in the P. taeda genome are 'novel' and will therefore require additional BAC or genomic sequencing for accurate characterization. The pine genome contains a very large number of diverged and probably defunct repetitive elements. This study also provides new evidence that sequencing a pine genome using a WGS approach is a feasible goal. PMID

  15. Evidence of Anticipatory Eye Movements in the Spatial Hebb Repetition Effect: Insights for Modeling Sequence Learning

    ERIC Educational Resources Information Center

    Tremblay, Sebastien; Saint-Aubin, Jean

    2009-01-01

    In the present study, the authors offer a window onto the mechanisms that drive the Hebb repetition effect through the analysis of eye movement and recall performance. In a spatial serial recall task in which sequences of dots are to be remembered in order, when one particular series is repeated every 4 trials, memory performance markedly improves…

  16. Evidence of Anticipatory Eye Movements in the Spatial Hebb Repetition Effect: Insights for Modeling Sequence Learning

    ERIC Educational Resources Information Center

    Tremblay, Sebastien; Saint-Aubin, Jean

    2009-01-01

    In the present study, the authors offer a window onto the mechanisms that drive the Hebb repetition effect through the analysis of eye movement and recall performance. In a spatial serial recall task in which sequences of dots are to be remembered in order, when one particular series is repeated every 4 trials, memory performance markedly improves…

  17. [Identification of a repetitive sequence element for DNA fingerprinting in Phytophthora sojae].

    PubMed

    Yin, Lihua; Wang, Qinhu; Ning, Feng; Zhu, Xiaoying; Zuo, Yuhu; Shan, Weixing

    2010-04-01

    Establishment of DNA fingerprinting in Phytophthora sojae and an analysis of genetic relationship of Heilongjiang and Xinjiang populations. Bioinformatics tools were used to search repetitive sequences in P. sojae and Southern blot analysis was employed for DNA fingerprinting analysis of P. sojae populations from Heilongjiang and Xinjiang using the identified repetitive sequence. A moderately repetitive sequence was identified and designated as PS1227. Southern blot analysis indicated 34 distinct bands ranging in size from 1.5 kb-23 kb, of which 21 were polymorphic among 49 isolates examined. Analysis of single-zoospore progenies showed that the PS1227 fingerprint pattern was mitotically stable. DNA fingerprinting showed that the P. sojae isolates HP4002, SY6 and GJ0105 of Heilongjiang are genetically identical to DW303, 71228 and 71222 of Xinjiang, respectively. A moderately repetitive sequence designated PS1227 which will be useful for epidemiology and population biology studies of P. sojae was obtained, and a PS1227-based DNA fingerprinting analysis provided molecular evidence that P. sojae in Xinjiang was likely introduced from Heilongjiang.

  18. Predicting Salmonella enterica subsp. enterica Serotypes by Repetitive Extragenic Palindromic Sequence-Based PCR

    USDA-ARS?s Scientific Manuscript database

    The DiversiLabTM System, which employs repetitive extragenic palindromic sequence-based PCR (rep-PCR) to genotype microorganisms, was evaluated as a method to predict the serotype of Salmonella isolates. Two hundred and thirty-three Salmonella isolates belonging to 14 frequently isolated serotypes f...

  19. Mapping of repetitive bovine DNA sequences on cattle Y chromosomes.

    PubMed

    Schwerin, M; Gallagher, D S; Miller, J R; Thomsen, P D

    1992-01-01

    Three male-specific PCR products of the sequences BC1.2, lambda ES6.0, and BRY.1 were used as probes for Southern blot analyses. Each of these probes generated a complex male-specific band pattern, which showed some quantitative variations among bulls. Hybridization patterns obtained with the BC1.2 and lambda ES6.0 PCR products were interrelated. Chromosomal locations of these repeats were determined by hybridizing the tritiated PCR products in situ to male metaphase spreads. The BC1.2 and lambda ES6.0 PCR products hybridized to Yp13-->p12, whereas the BRY.1 PCR product hybridized over the entire Y chromosome. In addition, the BC1.2 and lambda ES6.0 PCR products hybridized to the distal half of the acrocentric Y chromosome of Bos indicus, indicating that the short arm of the B. taurus Y chromosome is homologous with the telomeric end of the B. indicus Y and supporting the notion that the Y chromosomes of these two species differ by a pericentric inversion.

  20. Chromosome mapping of repetitive sequences in four Serrasalmidae species (Characiformes)

    PubMed Central

    Ribeiro, Leila Braga; Matoso, Daniele Aparecida; Feldberg, Eliana

    2014-01-01

    The Serrasalmidae family is composed of a number of commercially interesting species, mainly in the Amazon region where most of these fishes occur. In the present study, we investigated the genomic organization of the 18S and 5S rDNA and telomeric sequences in mitotic chromosomes of four species from the basal clade of the Serrasalmidae family: Colossoma macropomum, Mylossoma aureum, M. duriventre, and Piaractus mesopotamicus, in order to understand the chromosomal evolution in the family. All the species studied had diploid numbers 2n = 54 and exclusively biarmed chromosomes, but variations of the karyotypic formulas were observed. C-banding resulted in similar patterns among the analyzed species, with heterochromatic blocks mainly present in centromeric regions. The 18S rDNA mapping of C. macropomum and P. mesopotamicus revealed multiple sites of this gene; 5S rDNA sites were detected in two chromosome pairs in all species, although not all of them were homeologs. Hybridization with a telomeric probe revealed signals in the terminal portions of chromosomes in all the species and an interstitial signal was observed in one pair of C. macropomum. PMID:24688290

  1. Differential repetitive DNA composition in the centromeric region of chromosomes of Amazonian lizard species in the family Teiidae.

    PubMed

    Carvalho, Natalia D M; Carmo, Edson; Neves, Rogerio O; Schneider, Carlos Henrique; Gross, Maria Claudia

    2016-01-01

    Differences in heterochromatin distribution patterns and its composition were observed in Amazonian teiid species. Studies have shown repetitive DNA harbors heterochromatic blocks which are located in centromeric and telomeric regions in Ameiva ameiva (Linnaeus, 1758), Kentropyx calcarata (Spix, 1825), Kentropyx pelviceps (Cope, 1868), and Tupinambis teguixin (Linnaeus, 1758). In Cnemidophorus sp.1, repetitive DNA has multiple signals along all chromosomes. The aim of this study was to characterize moderately and highly repetitive DNA sequences by C ot1-DNA from Ameiva ameiva and Cnemidophorus sp.1 genomes through cloning and DNA sequencing, as well as mapping them chromosomally to better understand its organization and genome dynamics. The results of sequencing of DNA libraries obtained by C ot1-DNA showed that different microsatellites, transposons, retrotransposons, and some gene families also comprise the fraction of repetitive DNA in the teiid species. FISH using C ot1-DNA probes isolated from both Ameiva ameiva and Cnemidophorus sp.1 showed these sequences mainly located in heterochromatic centromeric, and telomeric regions in Ameiva ameiva, Kentropyx calcarata, Kentropyx pelviceps, and Tupinambis teguixin chromosomes, indicating they play structural and functional roles in the genome of these species. In Cnemidophorus sp.1, C ot1-DNA probe isolated from Ameiva ameiva had multiple interstitial signals on chromosomes, whereas mapping of C ot1-DNA isolated from the Ameiva ameiva and Cnemidophorus sp.1 highlighted centromeric regions of some chromosomes. Thus, the data obtained showed that many repetitive DNA classes are part of the genome of Ameiva ameiva, Cnemidophorus sp.1, Kentroyx calcarata, Kentropyx pelviceps, and Tupinambis teguixin, and these sequences are shared among the analyzed teiid species, but they were not always allocated at the same chromosome position.

  2. Differential repetitive DNA composition in the centromeric region of chromosomes of Amazonian lizard species in the family Teiidae

    PubMed Central

    Carvalho, Natalia D. M.; Carmo, Edson; Neves, Rogerio O.; Schneider, Carlos Henrique; Gross, Maria Claudia

    2016-01-01

    Abstract Differences in heterochromatin distribution patterns and its composition were observed in Amazonian teiid species. Studies have shown repetitive DNA harbors heterochromatic blocks which are located in centromeric and telomeric regions in Ameiva ameiva (Linnaeus, 1758), Kentropyx calcarata (Spix, 1825), Kentropyx pelviceps (Cope, 1868), and Tupinambis teguixin (Linnaeus, 1758). In Cnemidophorus sp.1, repetitive DNA has multiple signals along all chromosomes. The aim of this study was to characterize moderately and highly repetitive DNA sequences by Cot1-DNA from Ameiva ameiva and Cnemidophorus sp.1 genomes through cloning and DNA sequencing, as well as mapping them chromosomally to better understand its organization and genome dynamics. The results of sequencing of DNA libraries obtained by Cot1-DNA showed that different microsatellites, transposons, retrotransposons, and some gene families also comprise the fraction of repetitive DNA in the teiid species. FISH using Cot1-DNA probes isolated from both Ameiva ameiva and Cnemidophorus sp.1 showed these sequences mainly located in heterochromatic centromeric, and telomeric regions in Ameiva ameiva, Kentropyx calcarata, Kentropyx pelviceps, and Tupinambis teguixin chromosomes, indicating they play structural and functional roles in the genome of these species. In Cnemidophorus sp.1, Cot1-DNA probe isolated from Ameiva ameiva had multiple interstitial signals on chromosomes, whereas mapping of Cot1-DNA isolated from the Ameiva ameiva and Cnemidophorus sp.1 highlighted centromeric regions of some chromosomes. Thus, the data obtained showed that many repetitive DNA classes are part of the genome of Ameiva ameiva, Cnemidophorus sp.1, Kentroyx calcarata, Kentropyx pelviceps, and Tupinambis teguixin, and these sequences are shared among the analyzed teiid species, but they were not always allocated at the same chromosome position. PMID:27551343

  3. B chromosome in the beetle Coprophanaeus cyanescens (Scarabaeidae): emphasis in the organization of repetitive DNA sequences

    PubMed Central

    2012-01-01

    Background To contribute to the knowledge of coleopteran cytogenetics, especially with respect to the genomic content of B chromosomes, we analyzed the composition and organization of repetitive DNA sequences in the Coprophanaeus cyanescens karyotype. We used conventional staining and the application of fluorescence in situ hybridization (FISH) mapping using as probes C0t-1 DNA fraction, the 18S and 5S rRNA genes, and the LOA-like non-LTR transposable element (TE). Results The conventional analysis detected 3 individuals (among 50 analyzed) carrying one small metacentric and mitotically unstable B chromosome. The FISH analysis revealed a pericentromeric block of C0t-1 DNA in the B chromosome but no 18S or 5S rDNA clusters in this extra element. Using the LOA-like TE probe, the FISH analysis revealed large pericentromeric blocks in eight autosomal bivalents and in the B chromosome, and a pericentromeric block extending to the short arm in one autosomal pair. No positive hybridization signal was observed for the LOA-like element in the sex chromosomes. Conclusions The results indicate that the origin of the B chromosome is associated with the autosomal elements, as demonstrated by the hybridization with C0t-1 DNA and the LOA-like TE. The present study is the first report on the cytogenetic mapping of a TE in coleopteran chromosomes. These TEs could have been involved in the origin and evolution of the B chromosome in C. cyanescens. PMID:23131070

  4. Control of transcriptional pausing by biased thermal fluctuations on repetitive genomic sequences

    PubMed Central

    Imashimizu, Masahiko; Afek, Ariel; Takahashi, Hiroki; Lubkowska, Lucyna; Lukatsky, David B.

    2016-01-01

    In the process of transcription elongation, RNA polymerase (RNAP) pauses at highly nonrandom positions across genomic DNA, broadly regulating transcription; however, molecular mechanisms responsible for the recognition of such pausing positions remain poorly understood. Here, using a combination of statistical mechanical modeling and high-throughput sequencing and biochemical data, we evaluate the effect of thermal fluctuations on the regulation of RNAP pausing. We demonstrate that diffusive backtracking of RNAP, which is biased by repetitive DNA sequence elements, causes transcriptional pausing. This effect stems from the increased microscopic heterogeneity of an elongation complex, and thus is entropy-dominated. This report shows a linkage between repetitive sequence elements encoded in the genome and regulation of RNAP pausing driven by thermal fluctuations. PMID:27830653

  5. The ubiquitous nature of the Hebb repetition effect: error learning mistaken for the absence of sequence learning.

    PubMed

    Lafond, Daniel; Tremblay, Sébastien; Parmentier, Fabrice

    2010-03-01

    Sequence learning is essential in cognition and underpins activities such as language and skill acquisition. One classical demonstration of sequence learning is that of the Hebb repetition effect, whereby serial recall improves over repetitions on a repeated list relative to random lists. When addressing the question of which mechanism underlies the effect, the traditional approach is to prevent the action of processes thought to be responsible for sequence learning: If the typical Hebb repetition effect is reduced, these processes are key to the effect, researchers claim. By reanalyzing the data of F. B. R. Parmentier, M. T. Maybery, M. Huitson, and D. M. Jones (2008)-who reported no Hebb effect for sequences of auditory-spatial stimuli-we revealed that error learning can be mistaken for the absence of sequence learning. Indeed, incorrect responses are reproduced increasingly over repetitions. Our findings suggest that the Hebb repetition effect can be associated with response learning as well as stimulus processing.

  6. Chromosomal localization of two novel repetitive sequences isolated from the Chenopodium quinoa Willd. genome.

    PubMed

    Kolano, B; Gardunia, B W; Michalska, M; Bonifacio, A; Fairbanks, D; Maughan, P J; Coleman, C E; Stevens, M R; Jellen, E N; Maluszynska, J

    2011-09-01

    The chromosomal organization of two novel repetitive DNA sequences isolated from the Chenopodium quinoa Willd. genome was analyzed across the genomes of selected Chenopodium species. Fluorescence in situ hybridization (FISH) analysis with the repetitive DNA clone 18-24J in the closely related allotetraploids C. quinoa and Chenopodium berlandieri Moq. (2n = 4x = 36) evidenced hybridization signals that were mainly present on 18 chromosomes; however, in the allohexaploid Chenopodium album L. (2n = 6x = 54), cross-hybridization was observed on all of the chromosomes. In situ hybridization with rRNA gene probes indicated that during the evolution of polyploidy, the chenopods lost some of their rDNA loci. Reprobing with rDNA indicated that in the subgenome labeled with 18-24J, one 35S rRNA locus and at least half of the 5S rDNA loci were present. A second analyzed sequence, 12-13P, localized exclusively in pericentromeric regions of each chromosome of C. quinoa and related species. The intensity of the FISH signals differed considerably among chromosomes. The pattern observed on C. quinoa chromosomes after FISH with 12-13P was very similar to GISH results, suggesting that the 12-13P sequence constitutes a major part of the repetitive DNA of C. quinoa.

  7. Tandem repetitive Afa-family sequences from Leymus racemosus and Psathyrostachys juncea (Poaceae)

    PubMed

    Nagaki; Kishii; Tsujimoto; Sasakuma

    1999-12-01

    Tandem repetitive Afa-family sequences of 340 bp are known to occur in wheat and related species of tribe Triticeae. We isolated six and three Afa-family sequences from Leymus racemosus and Psathyrostachys juncea, respectively, both of which are perennial species. The sequences account for 0.5% and 0.2% of L. racemosus and P. juncea genomes, respectively, and using in situ hybridization were located in subtelomeric and interstitial regions of L. racemosus chromosomes. These sequences are clustered with those of Elymus trachycaulus in the phylogenetic tree. Our findings indicate that the Afa-family sequences have been amplified at least twice in the lineage of L. racemosus, P. juncea, and E. trachycaulus.

  8. Chromosomal localization of a novel repetitive sequence in the Chenopodium quinoa genome.

    PubMed

    Kolano, Bozena; Plucienniczak, Andrzej; Kwasniewski, Miroslaw; Maluszynska, Jolanta

    2008-01-01

    In this study, a novel repetitive sequence pTaq10 was isolated from the Taq I digest of the genomic DNA of the pseudocereal Chenopodium quinoa. Sequence analysis indicated that this 286-bp monomer is not homologous to any known retroelement sequence. FISH and Southern blot analysis showed that this sequence is characterized by an interspersed genomic organization. After FISH, hybridization signals were observed as small dots spread throughout all of the chromosomes. pTaq hybridization signals were excluded from 45S rRNA gene loci, but they partly overlapped with 5S rDNA loci. pTaq10 is not a species-specific sequence, as it was also detected in C. berlandieri.

  9. Dynamics of tandem repetitive Afa-family sequences in Triticeae, wheat-related species.

    PubMed

    Nagaki, K; Tsujimoto, H; Sasakuma, T

    1998-08-01

    The Afa-family sequences in wheat-related species, Triticeae, are tandem repetitive sequences of 340 bp. All the analyzed Triticeae species carried the sequences in their genomes, though the copy numbers varied about 100-fold among the species. The nucleotide fragments amplified by PCR were cloned and sequenced, and their behavior in the evolution of Triticeae was analyzed by the neighbor-joining (NJ) method. The sequences in genomes with many copies of this family clustered at independent branches of the phylogenic tree, whereas the sequences in genomes with a few copies did not. This may suggest that Afa-family sequences had amplified several times in the evolution of Triticeae, each using a limited number of different master copies. In addition, the sequences of the A and B genomes of hexaploid common wheat indicated that the Afa-family sequences had not evolved in a concerted manner between the genomes. Furthermore, the sequences of each chromosome of the D genome of this species indicated that the sequences had amplified on all over the D-genome chromosomes in a short period.

  10. Conservation of repetitive DNA sequences in deer species studied by southern blot transfer.

    PubMed

    Lima-de-Faria, A; Arnason, U; Widegren, B; Essen-Möller, J; Isaksson, M; Olsson, E; Jaworska, H

    1984-01-01

    The Cervidae show one of the largest variations in chromosome number found within a mammalian family. The five species of the deer family which are the subject of this study vary in chromosome number from 2n = 70 to 2n = 6. Digestion with the restriction enzymes EcoRI, HpaII, HaeIII and MspI reveals that there is a series of highly repetitive sequences forming similar band patterns in the different species. To obtain information on the degree of homology among these conserved sequences we isolated a HpaII restriction fragment of approximately 990 base pairs from reindeer DNA. This DNA sequence was 32P-labelled and hybridized by the Southern blot technique to DNAs cleaved with HpaII and HaeIII from the reindeer and four other Cervidae species. Hybridization to specific restriction fragments was recorded in all species. The patterns of hybridization showed a higher degree of similarity between reindeer, elk and roe deer than between reindeer and the Asiatic species (fallow deer and muntjac). Homologies are still present between the highly repetitive sequences of the five species despite the drastic reorganization that led to a change in chromosome number from 6 to 70.

  11. Spider minor ampullate silk proteins contain new repetitive sequences and highly conserved non-silk-like "spacer regions".

    PubMed

    Colgin, M A; Lewis, R V

    1998-03-01

    Spider minor ampullate silk is a strong non-elastic deformably stretchable silk used in web formation. This silk from Nephila clavipes is composed of two proteins, MiSp 1 and 2, whose transcripts are 9.5 and 7.5 kb, respectively, as determined by Northern blots. Both MiSp proteins are organized into a predominantly repetitive region and a small nonrepetitive carboxy terminal region. These highly repetitive regions are composed mainly of glycine and alanine, but also contain tyrosine, glutamine, and arginine. The sequences are mainly GGX and GA repeats. The repetitive regions are interrupted by nonrepetitive serine-rich spacer regions. Although the sequences of the spacer regions differ from the repetitive regions, sequences of the spacers from different regions of the proteins are nearly identical. The sequence differences between major and minor ampullate silks may explain the differing mechanical properties of the fibers.

  12. H genome specific repetitive sequence, pEt2, of Elymus trachycaulus in part of Afa family of Triticeae.

    PubMed

    Nagaki, K; Tsujimoto, H; Sasakuma, T

    1998-02-01

    The H genome specific repetitive sequence of Elymus trachycaulus, pEt2, consists of three units of a 337-339 bp repeat aligned in tandem. The sequence is homologous to Afa-family sequences that are widely distributed in the genomes of Triticeae (Gramineae) species.

  13. Methylation Status of Alu and LINE-1 Interspersed Repetitive Sequences in Behcet's Disease Patients

    PubMed Central

    Yüksel, Şahru; Kucukazman, Selma Ozbek; Karataş, Gülten Sungur; Ozturk, Mehmet Akif; Prombhul, Sasiprapa; Hirankarn, Nattiya

    2016-01-01

    Behcet's Disease (BD) is a multisystem chronic inflammatory disease. The pathology is believed to involve both genetic susceptibility and environmental factors. Hypomethylation leading to activation of interspersed repetitive sequences (IRSs) such as LINE-1 and Alu contributes to the pathologies of autoimmune diseases and cancer. Herein, the epigenetic changes of IRSs in BD were evaluated using combined bisulfite restriction analysis-interspersed repetitive sequences (COBRA-IRS). DNA from neutrophils and peripheral blood mononuclear cells (PBMCs) of BD patients with ocular involvement that were in active or inactive states and healthy controls were used to analyze LINE-1 and Alu methylation levels. For Alu sequences, significant differences were observed in the frequency of uCuC alleles between PBMCs of patients and controls (p = 0.03), and between inactive patients and controls (p = 0.03). For neutrophils, the frequency of uCuC was significantly higher between patients and controls (p = 0.006) and between inactive patients and controls (p = 0.002). The partial methylation (uCmC + mCuC) frequencies of Alu between inactive patients and control samples also differed (p = 0.02). No statistically significant differences for LINE-1 were detected. Thus, changes in the methylation level of IRS elements might contribute to the pathogenesis of BD. The role of Alu transcripts in BD should be investigated further. PMID:27123441

  14. MOM1 mediates DNA-methylation-independent silencing of repetitive sequences in Arabidopsis

    PubMed Central

    Vaillant, Isabelle; Schubert, Ingo; Tourmente, Sylvette; Mathieu, Olivier

    2006-01-01

    The heterochromatic regions around centromeres of animal and plant chromosomes are composed of tandem repetitive sequences, interspersed with transposons and transposon derivatives. These sequences are largely transcriptionally silent and highly methylated, and are associated with specifically modified histones. Although embedded in heterochromatin, Arabidopsis 5S ribosomal RNA genes are among the most highly transcribed genes. However, some 5S genes are silenced, and we show here that this silencing can be suppressed by a reduction in CG methylation. Importantly, we show that mutation of MORPHEUS' MOLECULE 1 (MOM1) releases 5S repeat silencing independently of chromatin properties, as illustrated by the absence of detectable alteration of DNA and histone H3 methylation patterns. MOM1 also prevents transcription of 180-bp satellite repeats and 106B dispersed repeats but not of transposons. Our results provide evidence that transcription of densely methylated and highly repetitive heterochromatic sequences is controlled by two distinct epigenetic silencing pathways, one dependent on and the other independent of DNA methylation. PMID:17082821

  15. MOM1 mediates DNA-methylation-independent silencing of repetitive sequences in Arabidopsis.

    PubMed

    Vaillant, Isabelle; Schubert, Ingo; Tourmente, Sylvette; Mathieu, Olivier

    2006-12-01

    The heterochromatic regions around centromeres of animal and plant chromosomes are composed of tandem repetitive sequences, interspersed with transposons and transposon derivatives. These sequences are largely transcriptionally silent and highly methylated, and are associated with specifically modified histones. Although embedded in heterochromatin, Arabidopsis 5S ribosomal RNA genes are among the most highly transcribed genes. However, some 5S genes are silenced, and we show here that this silencing can be suppressed by a reduction in CG methylation. Importantly, we show that mutation of MORPHEUS' MOLECULE 1 (MOM1) releases 5S repeat silencing independently of chromatin properties, as illustrated by the absence of detectable alteration of DNA and histone H3 methylation patterns. MOM1 also prevents transcription of 180-bp satellite repeats and 106B dispersed repeats but not of transposons. Our results provide evidence that transcription of densely methylated and highly repetitive heterochromatic sequences is controlled by two distinct epigenetic silencing pathways, one dependent on and the other independent of DNA methylation.

  16. Methylation Status of Alu and LINE-1 Interspersed Repetitive Sequences in Behcet's Disease Patients.

    PubMed

    Yüksel, Şahru; Kucukazman, Selma Ozbek; Karataş, Gülten Sungur; Ozturk, Mehmet Akif; Prombhul, Sasiprapa; Hirankarn, Nattiya

    2016-01-01

    Behcet's Disease (BD) is a multisystem chronic inflammatory disease. The pathology is believed to involve both genetic susceptibility and environmental factors. Hypomethylation leading to activation of interspersed repetitive sequences (IRSs) such as LINE-1 and Alu contributes to the pathologies of autoimmune diseases and cancer. Herein, the epigenetic changes of IRSs in BD were evaluated using combined bisulfite restriction analysis-interspersed repetitive sequences (COBRA-IRS). DNA from neutrophils and peripheral blood mononuclear cells (PBMCs) of BD patients with ocular involvement that were in active or inactive states and healthy controls were used to analyze LINE-1 and Alu methylation levels. For Alu sequences, significant differences were observed in the frequency of (u)C(u)C alleles between PBMCs of patients and controls (p = 0.03), and between inactive patients and controls (p = 0.03). For neutrophils, the frequency of (u)C(u)C was significantly higher between patients and controls (p = 0.006) and between inactive patients and controls (p = 0.002). The partial methylation ((u)C(m)C + (m)C(u)C) frequencies of Alu between inactive patients and control samples also differed (p = 0.02). No statistically significant differences for LINE-1 were detected. Thus, changes in the methylation level of IRS elements might contribute to the pathogenesis of BD. The role of Alu transcripts in BD should be investigated further.

  17. Sequence conservation in avian CR1: an interspersed repetitive DNA family evolving under functional constraints.

    PubMed Central

    Chen, Z Q; Ritzel, R G; Lin, C C; Hodgetts, R B

    1991-01-01

    CR1 is a short interspersed repetitive DNA element originally identified in the domestic chicken (Gallus gallus). However, unlike virtually all other such sequences described to date, CR1 is not confined to one or a few closely related species. It is probably a ubiquitous component of the avian genome, having been detected in representatives of nine orders encompassing a wide spectrum of the class Aves. This identification was made possible by using the polymerase chain reaction (PCR), which revealed interspecific similarities not detected by conventional Southern analysis. DNA sequence comparisons between a CR1 element isolated from a sarus crane (Grus antigone) and those isolated from an emu (Dromaius novaehollandiae) showed that two short highly conserved regions are present. These are included within two regions previously characterized in the CR1 units of domestic fowl. One of these behaves as a transcriptional silencer and the other is a binding site for a nuclear protein. Our observations suggest that CR1 has evolved under functional constraints and that interspersed repetitive sequences as a class may constitute a more significant component of the eukaryotic genome than is generally acknowledged. Images PMID:1829530

  18. Molecular cytogenetic mapping of Cucumis sativus and C. melo using highly repetitive DNA sequences.

    PubMed

    Koo, Dal-Hoe; Nam, Young-Woo; Choi, Doil; Bang, Jae-Wook; de Jong, Hans; Hur, Yoonkang

    2010-04-01

    Chromosomes often serve as one of the most important molecular aspects of studying the evolution of species. Indeed, most of the crucial mutations that led to differentiation of species during the evolution have occurred at the chromosomal level. Furthermore, the analysis of pachytene chromosomes appears to be an invaluable tool for the study of evolution due to its effectiveness in chromosome identification and precise physical gene mapping. By applying fluorescence in situ hybridization of 45S rDNA and CsCent1 probes to cucumber pachytene chromosomes, here, we demonstrate that cucumber chromosomes 1 and 2 may have evolved from fusions of ancestral karyotype with chromosome number n = 12. This conclusion is further supported by the centromeric sequence similarity between cucumber and melon, which suggests that these sequences evolved from a common ancestor. It may be after or during speciation that these sequences were specifically amplified, after which they diverged and specific sequence variants were homogenized. Additionally, a structural change on the centromeric region of cucumber chromosome 4 was revealed by fiber-FISH using the mitochondrial-related repetitive sequences, BAC-E38 and CsCent1. These showed the former sequences being integrated into the latter in multiple regions. The data presented here are useful resources for comparative genomics and cytogenetics of Cucumis and, in particular, the ongoing genome sequencing project of cucumber.

  19. All-optical repetition rate multiplication of pseudorandom bit sequences by employing power coupler and equalizer

    NASA Astrophysics Data System (ADS)

    Sun, Zhenchao; Wang, Zhi; Wu, Chongqing; Wang, Fu; Li, Qiang

    2015-10-01

    A scheme for all-optical repetition rate multiplication of pseudorandom bit sequences (PRBS) is demonstrated with a precision delay feedback loop cascaded with a terahertz optical asymmetric demultiplexer (TOAD)-based power equalizer. Its feasibility has been verified by experiments, which show a multiplication for PRBS at cycle 2^7-1 from 2.5 to 10 Gb/s. This scheme can be employed for the rate multiplication of a much longer cycle PRBS at a much higher bit rate over 40 Gb/s if the time-delay, the loss, and the dispersion of an optical delay line are all precisely managed.

  20. DNA fingerprinting of thermophilic lactic acid bacteria using repetitive sequence-based polymerase chain reaction.

    PubMed

    De Urraza, P J; Gómez-Zavaglia, A; Lozano, M E; Romanowski, V; De Antoni, G L

    2000-08-01

    DNA fingerprints of lactic acid bacteria were generated by polymerase chain reaction using a primer based on the repetitive elements found in the genome of Streptococcus pneumoniae (BOX-PCR). The method made it possible to identify 37 isolates from raw milk. industrial starters and yogurt. Differentiation at species, subspecies and strain level was possible for Lactobacillus delbrueckii subsp. lactis, Lb. delbrueckii subsp bulgaricus and Str. thermophilus. BOX-PCR was also applied to studying the strain composition of a starter culture and the direct detection of strains in commercial fermented milk.

  1. Use of Repetitive Sequences for Molecular and Cytogenetic Characterization of Avena Species from Portugal

    PubMed Central

    Tomás, Diana; Rodrigues, Joana; Varela, Ana; Veloso, Maria Manuela; Viegas, Wanda; Silva, Manuela

    2016-01-01

    Genomic diversity of Portuguese accessions of Avena species—diploid A. strigosa and hexaploids A. sativa and A. sterilis—was evaluated through molecular and cytological analysis of 45S rDNA, and other repetitive sequences previously studied in cereal species—rye subtelomeric sequence (pSc200) and cereal centromeric sequence (CCS1). Additionally, retrotransposons and microsatellites targeting methodologies—IRAP (inter-retrotransposon amplified polymorphism) and REMAP (retrotransposon-microsatellite amplified polymorphism)—were performed. A very high homology was detected for ribosomal internal transcribed sequences (ITS1 and ITS2) between the species analyzed, although nucleolar organizing regions (NOR) fluorescent in situ hybridization (FISH) analysis revealed distinct number of Nor loci between diploid and hexaploid species. Moreover, morphological diversity, evidenced by FISH signals with different sizes, was observed between distinct accessions within each species. pSc200 sequences were for the first time isolated from Avena species but proven to be highly similar in all genotypes analyzed. The use of primers designed for CCS1 unraveled a sequence homologous to the Ty3/gypsy retrotransposon Cereba, that was mapped to centromeric regions of diploid and hexaploid species, being however restricted to the more related A and D haplomes. Retrotransposon-based methodologies disclosed species- and accessions-specific bands essential for the accurate discrimination of all genotypes studied. Centromeric, IRAP and REMAP profiles therefore allowed accurate assessment of inter and intraspecific variability, demonstrating the potential of these molecular markers on future oat breeding programs. PMID:26861283

  2. Identification of two families of satellite-like repetitive DNA sequences from the zebrafish (Brachydanio rerio).

    PubMed

    Ekker, M; Fritz, A; Westerfield, M

    1992-08-01

    To further our understanding of the structure and organization of the zebrafish genome, we have undertaken the analysis of highly and middle-repetitive DNA sequences. We have cloned and sequenced two families of tandemly repeated DNA fragments. The monomer units of the Type I satellite-like sequence are 186 bp long, A+T-rich (65%), and exhibit a high degree of sequence conservation. The Type I satellite-like sequence constitutes 8% of the zebrafish genome, or approximately 8 x 10(5) copies per haploid genome. Southern analysis of genomic DNA, digested with several restriction endonucleases, shows a ladder of hybridizing bands, consistent with a tandem array, and suggests longer range periodic variations in the sequence of the tandem repeats. The Type II satellite has a monomer length of 165 bp, is also A+T-rich (68%), and constitutes 0.2% of the zebrafish genome (22,000 copies per haploid genome). Southern analysis reveals a complex pattern rather than a ladder of regularly spaced hybridizing bands.

  3. Use of Repetitive Sequences for Molecular and Cytogenetic Characterization of Avena Species from Portugal.

    PubMed

    Tomás, Diana; Rodrigues, Joana; Varela, Ana; Veloso, Maria Manuela; Viegas, Wanda; Silva, Manuela

    2016-02-04

    Genomic diversity of Portuguese accessions of Avena species--diploid A. strigosa and hexaploids A. sativa and A. sterilis--was evaluated through molecular and cytological analysis of 45S rDNA, and other repetitive sequences previously studied in cereal species--rye subtelomeric sequence (pSc200) and cereal centromeric sequence (CCS1). Additionally, retrotransposons and microsatellites targeting methodologies--IRAP (inter-retrotransposon amplified polymorphism) and REMAP (retrotransposon-microsatellite amplified polymorphism)--were performed. A very high homology was detected for ribosomal internal transcribed sequences (ITS1 and ITS2) between the species analyzed, although nucleolar organizing regions (NOR) fluorescent in situ hybridization (FISH) analysis revealed distinct number of Nor loci between diploid and hexaploid species. Moreover, morphological diversity, evidenced by FISH signals with different sizes, was observed between distinct accessions within each species. pSc200 sequences were for the first time isolated from Avena species but proven to be highly similar in all genotypes analyzed. The use of primers designed for CCS1 unraveled a sequence homologous to the Ty3/gypsy retrotransposon Cereba, that was mapped to centromeric regions of diploid and hexaploid species, being however restricted to the more related A and D haplomes. Retrotransposon-based methodologies disclosed species- and accessions-specific bands essential for the accurate discrimination of all genotypes studied. Centromeric, IRAP and REMAP profiles therefore allowed accurate assessment of inter and intraspecific variability, demonstrating the potential of these molecular markers on future oat breeding programs.

  4. Simple Quantitative PCR Approach to Reveal Naturally Occurring and Mutation-Induced Repetitive Sequence Variation on the Drosophila Y Chromosome

    PubMed Central

    Aldrich, John C.; Maggert, Keith A.

    2014-01-01

    Heterochromatin is a significant component of the human genome and the genomes of most model organisms. Although heterochromatin is thought to be largely non-coding, it is clear that it plays an important role in chromosome structure and gene regulation. Despite a growing awareness of its functional significance, the repetitive sequences underlying some heterochromatin remain relatively uncharacterized. We have developed a real-time quantitative PCR-based method for quantifying simple repetitive satellite sequences and have used this technique to characterize the heterochromatic Y chromosome of Drosophila melanogaster. In this report, we validate the approach, identify previously unknown satellite sequence copy number polymorphisms in Y chromosomes from different geographic sources, and show that a defect in heterochromatin formation can induce similar copy number polymorphisms in a laboratory strain. These findings provide a simple method to investigate the dynamic nature of repetitive sequences and characterize conditions which might give rise to long-lasting alterations in DNA sequence. PMID:25285439

  5. Simple quantitative PCR approach to reveal naturally occurring and mutation-induced repetitive sequence variation on the Drosophila Y chromosome.

    PubMed

    Aldrich, John C; Maggert, Keith A

    2014-01-01

    Heterochromatin is a significant component of the human genome and the genomes of most model organisms. Although heterochromatin is thought to be largely non-coding, it is clear that it plays an important role in chromosome structure and gene regulation. Despite a growing awareness of its functional significance, the repetitive sequences underlying some heterochromatin remain relatively uncharacterized. We have developed a real-time quantitative PCR-based method for quantifying simple repetitive satellite sequences and have used this technique to characterize the heterochromatic Y chromosome of Drosophila melanogaster. In this report, we validate the approach, identify previously unknown satellite sequence copy number polymorphisms in Y chromosomes from different geographic sources, and show that a defect in heterochromatin formation can induce similar copy number polymorphisms in a laboratory strain. These findings provide a simple method to investigate the dynamic nature of repetitive sequences and characterize conditions which might give rise to long-lasting alterations in DNA sequence.

  6. Chromosomal structures and repetitive sequences divergence in Cucumis species revealed by comparative cytogenetic mapping.

    PubMed

    Zhang, Yunxia; Cheng, Chunyan; Li, Ji; Yang, Shuqiong; Wang, Yunzhu; Li, Ziang; Chen, Jinfeng; Lou, Qunfeng

    2015-09-25

    Differentiation and copy number of repetitive sequences affect directly chromosome structure which contributes to reproductive isolation and speciation. Comparative cytogenetic mapping has been verified an efficient tool to elucidate the differentiation and distribution of repetitive sequences in genome. In present study, the distinct chromosomal structures of five Cucumis species were revealed through genomic in situ hybridization (GISH) technique and comparative cytogenetic mapping of major satellite repeats. Chromosome structures of five Cucumis species were investigated using GISH and comparative mapping of specific satellites. Southern hybridization was employed to study the proliferation of satellites, whose structural characteristics were helpful for analyzing chromosome evolution. Preferential distribution of repetitive DNAs at the subtelomeric regions was found in C. sativus, C hystrix and C. metuliferus, while majority was positioned at the pericentromeric heterochromatin regions in C. melo and C. anguria. Further, comparative GISH (cGISH) through using genomic DNA of other species as probes revealed high homology of repeats between C. sativus and C. hystrix. Specific satellites including 45S rDNA, Type I/II, Type III, Type IV, CentM and telomeric repeat were then comparatively mapped in these species. Type I/II and Type IV produced bright signals at the subtelomeric regions of C. sativus and C. hystrix simultaneously, which might explain the significance of their amplification in the divergence of Cucumis subgenus from the ancient ancestor. Unique positioning of Type III and CentM only at the centromeric domains of C. sativus and C. melo, respectively, combining with unique southern bands, revealed rapid evolutionary patterns of centromeric DNA in Cucumis. Obvious interstitial telomeric repeats were observed in chromosomes 1 and 2 of C. sativus, which might provide evidence of the fusion hypothesis of chromosome evolution from x = 12 to x = 7 in

  7. Molecular characterization and physical localization of highly repetitive DNA sequences from Brazilian Alstroemeria species.

    PubMed

    Kuipers, A G J; Kamstra, S A; de Jeu, M J; Visser, R G F

    2002-01-01

    Highly repetitive DNA sequences were isolated from genomic DNA libraries of Alstroemeria psittacina and A. inodora. Among the repetitive sequences that were isolated, tandem repeats as well as dispersed repeats could be discerned. The tandem repeats belonged to a family of interlinked Sau3A subfragments with sizes varying from 68-127 bp, and constituted a larger HinfI repeat of approximately 400 bp. Southern hybridization showed a similar molecular organization of the tandem repeats in each of the Brazilian Alstroemeria species tested. None of the repeats hybridized with DNA from Chilean Alstroemeria species, which indicates that they are specific for the Brazilian species. In-situ localization studies revealed the tandem repeats to be localized in clusters on the chromosomes of A. inodora and A. psittacina: distal hybridization sites were found on chromosome arms 2PS, 6PL, 7PS, 7PL and 8PL, interstitial sites on chromosome arms 2PL, 3PL, 4PL and 5PL. The applicability of the tandem repeats for cytogenetic analysis of interspecific hybrids and their role in heterochromatin organization are discussed.

  8. Recondensation level of repetitive sequences in the plant protoplast nucleus is limited by oxidative stress

    PubMed Central

    Ondřej, Vladan; Navrátilová, Božena; Protivánková, Iva; Piterková, Jana; Sedlářová, Michaela; Luhová, Lenka; Lebeda, Aleš

    2010-01-01

    Protoplast cultures are remarkable examples of plant cell dedifferentiation. The state of dedifferentiation is evidenced by changes in cell morphology, genome organization, as well as by the capability of protoplasts to differentiate into multiple types of cells (depending on the type of the stimulus applied). The first change in the genome structure is connected with large-scale chromatin decondensation, affecting chromocentres involving various types of these repetitive sequences. This paper describes not only the de- and recondensation of satellite DNA type I and 5S rDNA repetitive sequences, but it also compares the recondensation level of chromatin with the levels of oxidative stress which were decreased by using an antioxidant, as well as the capabilities of the antioxidative systems within protoplasts, during the first 72 h of their culture. It is demonstrated that the treatment of protoplasts with ascorbic acid not only decreased the level of oxidative stress but also positively stimulated the expression of the ascorbate peroxidase and catalase. It also led to a greater recondensation of the chromatin (when compared to the untreated protoplasts); in addition, it supported cell proliferation. It is concluded that large-scale genome relaxation is more directly connected with oxidative stress than with large changes in the expression of genes; and further, that its recondensation is related to the start of (as well as the level of) protection by the antioxidative systems. PMID:20363868

  9. Unique nucleotide sequence (UNS)-guided assembly of repetitive DNA parts for synthetic biology applications

    PubMed Central

    Torella, Joseph P.; Lienert, Florian; Boehm, Christian R.; Chen, Jan-Hung; Way, Jeffrey C.; Silver, Pamela A.

    2016-01-01

    Recombination-based DNA construction methods, such as Gibson assembly, have made it possible to easily and simultaneously assemble multiple DNA parts and hold promise for the development and optimization of metabolic pathways and functional genetic circuits. Over time, however, these pathways and circuits have become more complex, and the increasing need for standardization and insulation of genetic parts has resulted in sequence redundancies — for example repeated terminator and insulator sequences — that complicate recombination-based assembly. We and others have recently developed DNA assembly methods that we refer to collectively as unique nucleotide sequence (UNS)-guided assembly, in which individual DNA parts are flanked with UNSs to facilitate the ordered, recombination-based assembly of repetitive sequences. Here we present a detailed protocol for UNS-guided assembly that enables researchers to convert multiple DNA parts into sequenced, correctly-assembled constructs, or into high-quality combinatorial libraries in only 2–3 days. If the DNA parts must be generated from scratch, an additional 2–5 days are necessary. This protocol requires no specialized equipment and can easily be implemented by a student with experience in basic cloning techniques. PMID:25101822

  10. Unique nucleotide sequence-guided assembly of repetitive DNA parts for synthetic biology applications

    SciTech Connect

    Torella, JP; Lienert, F; Boehm, CR; Chen, JH; Way, JC; Silver, PA

    2014-08-07

    Recombination-based DNA construction methods, such as Gibson assembly, have made it possible to easily and simultaneously assemble multiple DNA parts, and they hold promise for the development and optimization of metabolic pathways and functional genetic circuits. Over time, however, these pathways and circuits have become more complex, and the increasing need for standardization and insulation of genetic parts has resulted in sequence redundancies-for example, repeated terminator and insulator sequences-that complicate recombination-based assembly. We and others have recently developed DNA assembly methods, which we refer to collectively as unique nucleotide sequence (UNS)-guided assembly, in which individual DNA parts are flanked with UNSs to facilitate the ordered, recombination-based assembly of repetitive sequences. Here we present a detailed protocol for UNS-guided assembly that enables researchers to convert multiple DNA parts into sequenced, correctly assembled constructs, or into high-quality combinatorial libraries in only 2-3 d. If the DNA parts must be generated from scratch, an additional 2-5 d are necessary. This protocol requires no specialized equipment and can easily be implemented by a student with experience in basic cloning techniques.

  11. Complementary intron sequence motifs associated with human exon repetition: a role for intragenic, inter-transcript interactions in gene expression.

    PubMed

    Dixon, Richard J; Eperon, Ian C; Samani, Nilesh J

    2007-01-15

    Exon repetition describes the presence of tandemly repeated exons in mRNA in the absence of duplications in the genome. The regulation of this process is not fully understood. We therefore investigated the entire flanking intronic sequences of exons involved in exon repetition for common sequence elements. A computational analysis of 48 human single exon repetition events identified two common sequence motifs. One of these motifs is pyrimidine-rich and is more common in the upstream intron, whilst the other motif is highly enriched in purines and is more common in the downstream intron. As the two motifs are complementary to each other, they support a model by which exon repetition occurs as a result of trans-splicing between separate pre-mRNA transcripts from the same gene that are brought together during transcription by complementary intronic sequences. The majority of the motif instances overlap with the locations of mobile elements such as Alu elements. We explore the potential importance of complementary intron sequences in a rat gene that undertakes natural exon repetition in a strain specific manner. The possibility that distant complementary sequences can stimulate inter-transcript splicing during transcription suggests an unsuspected new role for potential secondary structures in endogenous genes.

  12. Effects of "D"-Amphetamine and Ethanol on Variable and Repetitive Key-Peck Sequences in Pigeons

    ERIC Educational Resources Information Center

    Ward, Ryan D.; Bailey, Ericka M.; Odum, Amy L.

    2006-01-01

    This experiment assessed the effects of "d"-Amphetamine and ethanol on reinforced variable and repetitive key-peck sequences in pigeons. Pigeons responded on two keys under a multiple schedule of Repeat and Vary components. In the Repeat component, completion of a target sequence of right, right, left, left resulted in food. In the Vary component,…

  13. Effects of "D"-Amphetamine and Ethanol on Variable and Repetitive Key-Peck Sequences in Pigeons

    ERIC Educational Resources Information Center

    Ward, Ryan D.; Bailey, Ericka M.; Odum, Amy L.

    2006-01-01

    This experiment assessed the effects of "d"-Amphetamine and ethanol on reinforced variable and repetitive key-peck sequences in pigeons. Pigeons responded on two keys under a multiple schedule of Repeat and Vary components. In the Repeat component, completion of a target sequence of right, right, left, left resulted in food. In the Vary component,…

  14. Repetitive DNA Sequences and Evolution of ZZ/ZW Sex Chromosomes in Characidium (Teleostei: Characiformes).

    PubMed

    Scacchetti, Priscilla Cardim; Utsunomia, Ricardo; Pansonato-Alves, José Carlos; da Costa Silva, Guilherme José; Vicari, Marcelo Ricardo; Artoni, Roberto Ferreira; Oliveira, Claudio; Foresti, Fausto

    2015-01-01

    Characidium constitutes an interesting model for cytogenetic studies, since a large degree of karyotype variation has been detected in this group, like the presence/absence of sex and supernumerary chromosomes and variable distribution of repetitive sequences in different species/populations. In this study, we performed a comparative cytogenetic analysis in 13 Characidium species collected at different South American river basins in order to investigate the karyotype diversification in this group. Chromosome analyses involved the karyotype characterization, cytogenetic mapping of repetitive DNA sequences and cross-species chromosome painting using a W-specific probe obtained in a previous study from Characidium gomesi. Our results evidenced a conserved diploid chromosome number of 2n = 50, and almost all the species exhibited homeologous ZZ/ZW sex chromosomes in different stages of differentiation, except C. cf. zebra, C. tenue, C. xavante and C. stigmosum. Notably, some ZZ/ZW sex chromosomes showed 5S and/or 18S rDNA clusters, while no U2 snDNA sites could be detected in the sex chromosomes, being restricted to a single chromosome pair in almost all the analyzed species. In addition, the species Characidium sp. aff. C. vidali showed B chromosomes with an inter-individual variation of 1 to 4 supernumerary chromosomes per cell. Notably, these B chromosomes share sequences with the W-specific probe, providing insights about their origin. Results presented here further confirm the extensive karyotype diversity within Characidium in contrast with a conserved diploid chromosome number. Such chromosome differences seem to constitute a significant reproductive barrier, since several sympatric Characidium species had been described during the last few years and no interespecific hybrids were found.

  15. Repetitive DNA Sequences and Evolution of ZZ/ZW Sex Chromosomes in Characidium (Teleostei: Characiformes)

    PubMed Central

    Pansonato-Alves, José Carlos; da Costa Silva, Guilherme José; Vicari, Marcelo Ricardo; Artoni, Roberto Ferreira; Oliveira, Claudio; Foresti, Fausto

    2015-01-01

    Characidium constitutes an interesting model for cytogenetic studies, since a large degree of karyotype variation has been detected in this group, like the presence/absence of sex and supernumerary chromosomes and variable distribution of repetitive sequences in different species/populations. In this study, we performed a comparative cytogenetic analysis in 13 Characidium species collected at different South American river basins in order to investigate the karyotype diversification in this group. Chromosome analyses involved the karyotype characterization, cytogenetic mapping of repetitive DNA sequences and cross-species chromosome painting using a W-specific probe obtained in a previous study from Characidium gomesi. Our results evidenced a conserved diploid chromosome number of 2n = 50, and almost all the species exhibited homeologous ZZ/ZW sex chromosomes in different stages of differentiation, except C. cf. zebra, C. tenue, C. xavante and C. stigmosum. Notably, some ZZ/ZW sex chromosomes showed 5S and/or 18S rDNA clusters, while no U2 snDNA sites could be detected in the sex chromosomes, being restricted to a single chromosome pair in almost all the analyzed species. In addition, the species Characidium sp. aff. C. vidali showed B chromosomes with an inter-individual variation of 1 to 4 supernumerary chromosomes per cell. Notably, these B chromosomes share sequences with the W-specific probe, providing insights about their origin. Results presented here further confirm the extensive karyotype diversity within Characidium in contrast with a conserved diploid chromosome number. Such chromosome differences seem to constitute a significant reproductive barrier, since several sympatric Characidium species had been described during the last few years and no interespecific hybrids were found. PMID:26372604

  16. Repetitive sequences and epigenetic modification: inseparable partners play important roles in the evolution of plant sex chromosomes.

    PubMed

    Li, Shu-Fen; Zhang, Guo-Jun; Yuan, Jin-Hong; Deng, Chuan-Liang; Gao, Wu-Jun

    2016-05-01

    The present review discusses the roles of repetitive sequences played in plant sex chromosome evolution, and highlights epigenetic modification as potential mechanism of repetitive sequences involved in sex chromosome evolution. Sex determination in plants is mostly based on sex chromosomes. Classic theory proposes that sex chromosomes evolve from a specific pair of autosomes with emergence of a sex-determining gene(s). Subsequently, the newly formed sex chromosomes stop recombination in a small region around the sex-determining locus, and over time, the non-recombining region expands to almost all parts of the sex chromosomes. Accumulation of repetitive sequences, mostly transposable elements and tandem repeats, is a conspicuous feature of the non-recombining region of the Y chromosome, even in primitive one. Repetitive sequences may play multiple roles in sex chromosome evolution, such as triggering heterochromatization and causing recombination suppression, leading to structural and morphological differentiation of sex chromosomes, and promoting Y chromosome degeneration and X chromosome dosage compensation. In this article, we review the current status of this field, and based on preliminary evidence, we posit that repetitive sequences are involved in sex chromosome evolution probably via epigenetic modification, such as DNA and histone methylation, with small interfering RNAs as the mediator.

  17. The repetitive component of the sunflower genome as shown by different procedures for assembling next generation sequencing reads

    PubMed Central

    2013-01-01

    Background Next generation sequencing provides a powerful tool to study genome structure in species whose genomes are far from being completely sequenced. In this work we describe and compare different computational approaches to evaluate the repetitive component of the genome of sunflower, by using medium/low coverage Illumina or 454 libraries. Results By varying sequencing technology (Illumina or 454), coverage (0.55 x-1.25 x), assemblers and assembly procedures, six different genomic databases were produced. The annotation of these databases showed that they were composed of different proportions of repetitive DNA families. The final assembly of the sequences belonging to the six databases produced a whole genome set of 283,800 contigs. The redundancy of each contig was estimated by mapping the whole genome set with a large Illumina read set and measuring the number of matched Illumina reads. The repetitive component amounted to 81% of the sunflower genome, that is composed mainly of numerous families of Gypsy and Copia retrotransposons. Also many families of non autonomous retrotransposons and DNA transposons (especially of the Helitron superfamily) were identified. Conclusions The results substantially matched those previously obtained by using a Sanger-sequenced shotgun library and a standard 454 whole-genome-shotgun approach, indicating the reliability of the proposed procedures also for other species. The repetitive sequences were collected to produce a database, SUNREP, that will be useful for the annotation of the sunflower genome sequence and for studying the genome evolution in dicotyledons. PMID:24093210

  18. All-optical repetition rate multiplication of pseudorandom bit sequences based on cascaded TOADs

    NASA Astrophysics Data System (ADS)

    Sun, Zhenchao; Wang, Zhi; Wu, Chongqing; Wang, Fu; Li, Qiang

    2016-03-01

    A scheme for all-optical repetition rate multiplication of pseudorandom bit sequences (PRBS) is demonstrated with all-optical wavelength conversion and optical logic gate 'OR' based on cascaded Tera-Hertz Optical Asymmetric Demultiplexers (TOADs). Its feasibility is verified by multiplication experiments from 500 Mb/s to 4 Gb/s for 23-1 PRBS and from 1 Gb/s to 4 Gb/s for 27-1 PRBS. This scheme can be employed for rate multiplication for much longer cycle PRBS at much higher bit rate over 40 Gb/s when the time-delay, the loss and the dispersion of the optical delay line are all precisely managed. The upper limit of bit rate will be restricted by the recovery time of semiconductor optical amplifier (SOA) finally.

  19. Cutting edge: natural DNA repetitive extragenic sequences from gram-negative pathogens strongly stimulate TLR9.

    PubMed

    Magnusson, Mattias; Tobes, Raquel; Sancho, Jaime; Pareja, Eduardo

    2007-07-01

    Bacterial DNA exerts immunostimulatory effects on mammalian cells via the intracellular TLR9. Although broad analysis of TLR9-mediated immunostimulatory potential of synthetic oligonucleotides has been developed, which kinds of natural bacterial DNA sequences are responsible for immunostimulation are not known. This work provides evidence that the natural DNA sequences named repetitive extragenic palindromic (REPs) sequences present in Gram-negative bacteria are able to produce innate immune system stimulation via TLR9. A strong induction of IFN-alpha production by REPs from Escherichia coli, Salmonella enterica, Pseudomonas aeruginosa, and Neisseria meningitidis was detected in splenocytes from 129 mice. In addition, the involvement of TLR9 in immune stimulation by REPs was confirmed using B6.129P2-Tlr9(tm1Aki) knockout mice. Considering the involvement of TLRs in Gram-negative septic shock, it is conceivable that REPs play a role in its pathogenesis. This study highlights REPs as a potential novel target in septic shock treatment.

  20. Unbiased K-mer Analysis Reveals Changes in Copy Number of Highly Repetitive Sequences During Maize Domestication and Improvement

    PubMed Central

    Liu, Sanzhen; Zheng, Jun; Migeon, Pierre; Ren, Jie; Hu, Ying; He, Cheng; Liu, Hongjun; Fu, Junjie; White, Frank F.; Toomajian, Christopher; Wang, Guoying

    2017-01-01

    The major component of complex genomes is repetitive elements, which remain recalcitrant to characterization. Using maize as a model system, we analyzed whole genome shotgun (WGS) sequences for the two maize inbred lines B73 and Mo17 using k-mer analysis to quantify the differences between the two genomes. Significant differences were identified in highly repetitive sequences, including centromere, 45S ribosomal DNA (rDNA), knob, and telomere repeats. Genotype specific 45S rDNA sequences were discovered. The B73 and Mo17 polymorphic k-mers were used to examine allele-specific expression of 45S rDNA in the hybrids. Although Mo17 contains higher copy number than B73, equivalent levels of overall 45S rDNA expression indicates that transcriptional or post-transcriptional regulation mechanisms operate for the 45S rDNA in the hybrids. Using WGS sequences of B73xMo17 doubled haploids, genomic locations showing differential repetitive contents were genetically mapped, which displayed different organization of highly repetitive sequences in the two genomes. In an analysis of WGS sequences of HapMap2 lines, including maize wild progenitor, landraces, and improved lines, decreases and increases in abundance of additional sets of k-mers associated with centromere, 45S rDNA, knob, and retrotransposons were found among groups, revealing global evolutionary trends of genomic repeats during maize domestication and improvement. PMID:28186206

  1. Isolation and characterization of centromeric repetitive DNA sequences in Saccharum spontaneum

    USDA-ARS?s Scientific Manuscript database

    Sugarcane (Saccharum hybrids spp.) is the most important sugar crop that accounts for ~75% of the world's sugar production. Recently, a whole-genome sequencing project was launched on the wild species S. spontaneum. To obtain information on the DNA composition of the repeat-enriched region of the ce...

  2. A PCR technique based on the Hip1 interspersed repetitive sequence distinguishes cyanobacterial species and strains.

    PubMed

    Smith, J K; Parry, J D; Day, J G; Smith, R J

    1998-10-01

    The use of primers based on the Hip1 sequence as a typing technique for cyanobacteria has been investigated. The discovery of short repetitive sequence structures in bacterial DNA during the last decade has led to the development of PCR-based methods for typing, i.e., distinguishing and identifying, bacterial species and strains. An octameric palindromic sequence known as Hip1 has been shown to be present in the chromosomal DNA of many species of cyanobacteria as a highly repetitious interspersed sequence. PCR primers were constructed that extended the Hip1 sequence at the 3' end by two bases. Five of the 16 possible extended primers were tested. Each of the five primers produced a different set of products when used to prime PCR from cyanobacterial genomic DNA. Each primer produced a distinct set of products for each of the 15 cyanobacterial species tested. The ability of Hip1-based PCR to resolve taxonomic differences was assessed by analysis of independent isolates of Anabaena flos-aquae and Nostoc ellipsosporum obtained from the CCAP (Culture Collection of Algae and Protozoa, IFE, Cumbria, UK). A PCR-based RFLP analysis of products amplified from the 23S-16S rDNA intergenic region was used to characterize the isolates and to compare with the Hip1 typing data. The RFLP and Hip1 typing yielded similar results and both techniques were able to distinguish different strains. On the basis of these results it is suggested that the Hip1 PCR technique may assist in distinguishing cyanobacterial species and strains.

  3. Under-representation of repetitive sequences in whole-genome shotgun sequence databases: an illustration using a recently acquired transposable element.

    PubMed

    Koga, Akihiko

    2012-02-01

    It is widely accepted in a conceptual framework that repetitive sequences, especially those with high sequence homogeneity among copies, tend to be under-represented in whole-genome shotgun sequence databases, because of the difficulty of assembling sequence reads into contigs. Although this is easily inferred, there is no quantitative illustration of this phenomenon. An example using a currently used database is expected to contribute to the intuitive understanding of how serious the under-representation is. The present study provides the first quantitative example (in the case of 16 copies of virtually identical, 4.7-kb sequences in a genome of 7 × 10 (8) bp) by comparing the results of BLAST searches of a sequence database (contig N50; 9.8 kb) with those of Southern blot analysis of genomic DNA. This has revealed that the internal regions of the repetitive sequences are under-represented to a striking extent.

  4. Composition for nucleic acid sequencing

    DOEpatents

    Korlach, Jonas; Webb, Watt W.; Levene, Michael; Turner, Stephen; Craighead, Harold G.; Foquet, Mathieu

    2008-08-26

    The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid, i.e. the activity of a nucleic acid polymerizing enzyme on the template nucleic acid molecule to be sequenced is followed in real time. The sequence is deduced by identifying which base is being incorporated into the growing complementary strand of the target nucleic acid by the catalytic activity of the nucleic acid polymerizing enzyme at each step in the sequence of base additions. A polymerase on the target nucleic acid molecule complex is provided in a position suitable to move along the target nucleic acid molecule and extend the oligonucleotide primer at an active site. A plurality of labelled types of nucleotide analogs are provided proximate to the active site, with each distinguishable type of nucleotide analog being complementary to a different nucleotide in the target nucleic acid sequence. The growing nucleic acid strand is extended by using the polymerase to add a nucleotide analog to the nucleic acid strand at the active site, where the nucleotide analog being added is complementary to the nucleotide of the target nucleic acid at the active site. The nucleotide analog added to the oligonucleotide primer as a result of the polymerizing step is identified. The steps of providing labelled nucleotide analogs, polymerizing the growing nucleic acid strand, and identifying the added nucleotide analog are repeated so that the nucleic acid strand is further extended and the sequence of the target nucleic acid is determined.

  5. Arbitrarily accurate narrowband composite pulse sequences

    SciTech Connect

    Vitanov, Nikolay V.

    2011-12-15

    Narrowband composite pulse sequences containing an arbitrary number N of identical pulses are presented. The composite phases are given by a very simple analytic formula and the transition probability is merely sin{sup 2N}(A/2), where A is the pulse area. These narrowband sequences can be made accurate to any order with respect to variations in A for sufficiently many constituent pulses, i.e., excitation can be suppressed below any desired value for any pulse area but {pi}.

  6. Tracking the evolution of sex chromosome systems in Melanoplinae grasshoppers through chromosomal mapping of repetitive DNA sequences

    PubMed Central

    2013-01-01

    Background The accumulation of repetitive DNA during sex chromosome differentiation is a common feature of many eukaryotes and becomes more evident after recombination has been restricted or abolished. The accumulated repetitive sequences include multigene families, microsatellites, satellite DNAs and mobile elements, all of which are important for the structural remodeling of heterochromatin. In grasshoppers, derived sex chromosome systems, such as neo-XY♂/XX♀ and neo-X1X2Y♂/X1X1X2X2♀, are frequently observed in the Melanoplinae subfamily. However, no studies concerning the evolution of sex chromosomes in Melanoplinae have addressed the role of the repetitive DNA sequences. To further investigate the evolution of sex chromosomes in grasshoppers, we used classical cytogenetic and FISH analyses to examine the repetitive DNA sequences in six phylogenetically related Melanoplinae species with X0♂/XX♀, neo-XY♂/XX♀ and neo-X1X2Y♂/X1X1X2X2♀ sex chromosome systems. Results Our data indicate a non-spreading of heterochromatic blocks and pool of repetitive DNAs (C0t-1 DNA) in the sex chromosomes; however, the spreading of multigene families among the neo-sex chromosomes of Eurotettix and Dichromatos was remarkable, particularly for 5S rDNA. In autosomes, FISH mapping of multigene families revealed distinct patterns of chromosomal organization at the intra- and intergenomic levels. Conclusions These results suggest a common origin and subsequent differential accumulation of repetitive DNAs in the sex chromosomes of Dichromatos and an independent origin of the sex chromosomes of the neo-XY and neo-X1X2Y systems. Our data indicate a possible role for repetitive DNAs in the diversification of sex chromosome systems in grasshoppers. PMID:23937327

  7. Tracking the evolution of sex chromosome systems in Melanoplinae grasshoppers through chromosomal mapping of repetitive DNA sequences.

    PubMed

    Palacios-Gimenez, Octavio M; Castillo, Elio R; Martí, Dardo A; Cabral-de-Mello, Diogo C

    2013-08-09

    The accumulation of repetitive DNA during sex chromosome differentiation is a common feature of many eukaryotes and becomes more evident after recombination has been restricted or abolished. The accumulated repetitive sequences include multigene families, microsatellites, satellite DNAs and mobile elements, all of which are important for the structural remodeling of heterochromatin. In grasshoppers, derived sex chromosome systems, such as neo-XY♂/XX♀ and neo-X1X2Y♂/X1X1X2X2♀, are frequently observed in the Melanoplinae subfamily. However, no studies concerning the evolution of sex chromosomes in Melanoplinae have addressed the role of the repetitive DNA sequences. To further investigate the evolution of sex chromosomes in grasshoppers, we used classical cytogenetic and FISH analyses to examine the repetitive DNA sequences in six phylogenetically related Melanoplinae species with X0♂/XX♀, neo-XY♂/XX♀ and neo-X1X2Y♂/X1X1X2X2♀ sex chromosome systems. Our data indicate a non-spreading of heterochromatic blocks and pool of repetitive DNAs (C0t-1 DNA) in the sex chromosomes; however, the spreading of multigene families among the neo-sex chromosomes of Eurotettix and Dichromatos was remarkable, particularly for 5S rDNA. In autosomes, FISH mapping of multigene families revealed distinct patterns of chromosomal organization at the intra- and intergenomic levels. These results suggest a common origin and subsequent differential accumulation of repetitive DNAs in the sex chromosomes of Dichromatos and an independent origin of the sex chromosomes of the neo-XY and neo-X1X2Y systems. Our data indicate a possible role for repetitive DNAs in the diversification of sex chromosome systems in grasshoppers.

  8. Stem-loop structures of the repetitive DNA sequences located at human centromeres

    SciTech Connect

    Gupta, G.; Garcia, A.E.; Ratliff, R.; Moyzis, R.K.; Catasti, P.; Hong, Lin; Yau, P.; Bradbury, E.M. |

    1993-09-01

    The presence of the highly conserved repetitive DNA sequences in the human centromeres argues for a special role of these sequences in their biological functions - most likely achieved by the formation of unusual structures. This prompted us to carry out quantitative one- and two-dimensional nuclear magnetic resonance (lD/2D NMR) spectroscopy to determine the structural properties of the human centromeric repeats, d(AATGG){sub n.d}(CCATT){sub n}. The studies on centromeric DNAs reveal that the complementary sequence, d(AATGG){sub n.d}(CCATT){sub n}, adopts the usual Watson-Crick B-DNA duplex and the pyrimidine-rich d(CCATT){sub n} strand is essentially a random coil. However, the purine-rich d(AATGG){sub n} strand is shown to adopt unusual stem-loop structures for repeat lengths, n=2,3,4, and 6. In addition to normal Watson-Crick A{center_dot}T pairs, the stem-loop structures are stabilized by mismatch A{center_dot}G and G{center_dot}G pairs in the stem and G-G-A stacking in the loop. Stem-loop structures of d(AATGG)n are independently verified by gel electrophoresis and nuclease digestion studies. Thermal melting studies show that the DNA repeats, d(AATGG){sub n}, are as stable as the corresponding Watson-Crick duplex d(AATGG){sub n.d}(CCATT){sub n}. Therefore, the sequence d(AATGG){sub n} can, indeed, nucleate a stem-loop structure at little free-energy cost and if, during mitosis, they are located on the chromosome surface they can provide specific recognition sites for kinetochore function.

  9. Non-homologous sex chromosomes of birds and snakes share repetitive sequences.

    PubMed

    O'Meally, Denis; Patel, Hardip R; Stiglec, Rami; Sarre, Stephen D; Georges, Arthur; Marshall Graves, Jennifer A; Ezaz, Tariq

    2010-11-01

    Snake sex chromosomes provided Susumo Ohno with the material on which he based his theory of how sex chromosomes differentiate from autosomal pairs. Like birds, snakes have a ZZ male/ZW female sex chromosome system, in which the snake Z is a macrochromosome much the same size as the bird Z. However, the gene content shows clearly that the snake and bird Z chromosomes are completely non-homologous. The molecular aspect of W chromosome degeneration in snakes remains largely unexplored. We used comparative genomic hybridization to identify the female-specific region of the W chromosome in representative species of Australian snakes. Using this approach, we show that an increasingly complex suite of repeats accompanies the evolution of W chromosome heteromorphy. In particular, we found that while the python Liasis fuscus exhibits no sex-specific repeats and indeed, no cytologically recognizable sex-specific region, the colubrid Stegonotus cucullatus shows a large domain on the short arm of the W chromosome that consists of female-specific repeats, and the large W of Notechis scutatus is composed almost entirely of repetitive sequences, including Bkm and 18S rDNA-related elements. FISH mapping of both simple and complex probes shows patterns of repeat amplification concordant with the size of the female-specific region in each species examined. Mapping of intronic sequences of genes that are sex-linked in both birds (DMRT1) and snakes (CTNNB1) reveals massive amplification in discrete domains on the W chromosome of the elapid N. scutatus. Using chicken W chromosome paint, we demonstrate that repetitive sequences are shared between the sex chromosomes of birds and derived snakes. This could be explained by ancestral but as yet undetected shared synteny of bird and snake sex chromosomes or may indicate functional homology of the repeats and suggests that degeneration is a convergent property of sex chromosome evolution. We also establish that synteny of snake Z

  10. Repetitive genomic sequences as a substrate for homologous integration in the Rhizopus oryzae genome.

    PubMed

    Yuzbashev, Tigran V; Larina, Anna S; Vybornaya, Tatiana V; Yuzbasheva, Evgeniya Y; Gvilava, Ilia T; Sineoky, Sergey P

    2015-06-01

    The vast number of repetitive genomic elements was identified in the genome of Rhizopus oryzae. Such genomic repeats can be used as homologous regions for integration of plasmids. Here, we evaluated the use of two different repeats: the short (575 bp) rptZ, widely distributed (about 34 copies per genome) and the long (2053 bp) rptH, less prevalent (about 15 copies). The plasmid carrying rptZ integrated, but did so through a 2256-bp region of homology to the pyrG locus, a unique genomic sequence. Thus, the length of rptZ was below the minimal requirements for homologous strand exchange in this fungus. In contrast, rptH was used efficiently for homologous integration. The plasmid bearing this repeat integrated in multicopy fashion, with up to 25 copies arranged in tandem. The latter vector, pPyrG-H, could be a valuable tool for integration at homologous sequences, for such purposes as high-level expression of proteins. Copyright © 2015 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.

  11. Repetitive reef to ooid sequences near leeward margin of Caicos Platform, British West Indies

    SciTech Connect

    Waltz, M.; Rossinsky, V.; Wanless, H.R.

    1987-05-01

    Drill core transects and outcrops near the leeward margin of the Caicos Platform, BWI, reveal repetitive (one Holocene and two Pleistocene) shallowing-upward sequences of either (a) reefal boundstones overlain by layered oolitic grainstones or (b) burrowed oolitic grainstones overlain by layered oolitic grainstones. Each sediment sequence is separated from the other by a calcrete exposure surface. A transect, perpendicular to the trend of an exposed Pleistocene barrier reef/ooid sand complex, shows two separate sediment packages of reefal boundstones and reef-derived skeletal packstones overlain by layered oolitic grainstones. The well-exposed upper package consists of a shallowing-upward barrier reef, which is immediately overlain by burrowed and cross-bedded oolitic grainstones, beach rock blocks, and coral rubble, capped by layered oolitic grainstones. Separated by an exposure horizon, the lowermost package consists of coral and skeletal sands overlain by layered oolitic grainstones. Cores from a transect in a non-reefal setting north of the barrier reef complex reveal highly burrowed oolitic grainstones capped by layered oolitic grainstones. As a Holocene example, immediately offshore of this transect, modern reefs and bioturbated oolitic grainstones are presently being buried beneath coral rubble, beach rock blocks, and prograding oolitic beaches. Deposition of the capping layered oolitic grainstones appears to occur during stable and falling sea levels. This co-occurrence of reefal sediment and ooid sands suggests that the two are not mutually exclusive and that reef-ooid succession is a reoccurring part of leeward margin platform margin-building.

  12. Repetitive sequences in the ITS1 region of the ribosomal DNA of Tunga penetrans and other flea species (Insecta, Siphonaptera).

    PubMed

    Gamerschlag, Sara; Mehlhorn, Heinz; Heukelbach, Jörg; Feldmeier, Hermann; D'Haese, Jochen

    2008-01-01

    Different Tunga penetrans isolates from various hosts obtained from South America (Fortaleza. Brazil) have been studied by nucleotide sequence comparison of the first and the second internal transcribed spacer (ITS1, ITS2) of the ribosomal deoxyribonucleic acid (rDNA) and part of the mitochondrial 16S rDNA. Results show no significant host-dependent sequence differences. No indication for intraindividual and intraspecific polymorphisms could be detected. Comparing the ITS1 spacer region of T. penetrans from South America with that from Africa (Togo, Cameroon), distinct length variations have been observed caused by a repetitive sequence motif of 99 bp. The ITS1 from the South American T. penetrans contain two tandemly repeated copies, whereas four of these units are present in the spacer of the African T. penetrans. The absence of homogenization of these units indicates a recent separation of both populations. However, the different number of repetitions together with two base substitutions put the evolutionary distance of only 135 years as postulated for the transfer of T. penetrans from South America to Africa into question. Repetitive sequences could also be detected within the ITS1 rDNA region of other flea species Ctenocephalides felis, Echidnophaga gallinacea, Pulex irritans, Spilopsyllus cuniculi, and Xenopsylla cheopis. The repeat units with lengths from 10 to 99 bp are arranged in pure tandem or interspersed. The repetitive elements observed in the ITS1 of various flea species may serve as a valuable tool for phylogeographic studies.

  13. Enterobacterial Repetitive Intergenic Consensus Sequence Repeats in Yersiniae: Genomic Organization and Functional Properties

    PubMed Central

    De Gregorio, Eliana; Silvestro, Giustina; Petrillo, Mauro; Carlomagno, Maria Stella; Di Nocera, Pier Paolo

    2005-01-01

    Genome-wide analyses carried out in silico revealed that the DNA repeats called enterobacterial repetitive intergenic consensus sequences (ERICs), which are present in several Enterobacteriaceae, are overrepresented in yersiniae. From the alignment of DNA regions from the wholly sequenced Yersinia enterocolitica 8081 and Yersinia pestis CO92 strains, we could establish that ERICs are miniature mobile elements whose insertion leads to duplication of the dinucleotide TA. ERICs feature long terminal inverted repeats (TIRs) and can fold as RNA into hairpin structures. The proximity to coding regions suggests that most Y. enterocolitica ERICs are cotranscribed with flanking genes. Elements which either overlap or are located next to stop codons are preferentially inserted in the same (or B) orientation. In contrast, ERICs located far apart from open reading frames are inserted in the opposite (or A) orientation. The expression of genes cotranscribed with A- and B-oriented ERICs has been monitored in vivo. In mRNAs spanning B-oriented ERICs, upstream gene transcripts accumulated at lower levels than downstream gene transcripts. This difference was abolished by treating cells with chloramphenicol. We hypothesize that folding of B-oriented elements is impeded by translating ribosomes. Consequently, upstream RNA degradation is triggered by the unmasking of a site for the RNase E located in the right-hand TIR of ERIC. A-oriented ERICs may act in contrast as upstream RNA stabilizers or may have other functions. The hypothesis that ERICs act as regulatory RNA elements is supported by analyses carried out in Yersinia strains which either lack ERIC sequences or carry alternatively oriented ERICs at specific loci. PMID:16291667

  14. Molecular cytogenetic characterization of chromosome site-specific repetitive sequences in the Arctic lamprey (Lethenteron camtschaticum, Petromyzontidae)

    PubMed Central

    Ishijima, Junko; Uno, Yoshinobu; Nunome, Mitsuo; Nishida, Chizuko; Kuraku, Shigehiro

    2017-01-01

    Abstract All extant lamprey karyotypes are characterized by almost all dot-shaped microchromosomes. To understand the molecular basis of chromosome structure in lampreys, we performed chromosome C-banding and silver staining and chromosome mapping of the 18S–28S and 5S ribosomal RNA (rRNA) genes and telomeric TTAGGG repeats in the Arctic lamprey (Lethenteron camtschaticum). In addition, we cloned chromosome site-specific repetitive DNA sequences and characterized them by nucleotide sequencing, chromosome in situ hybridization, and filter hybridization. Three types of repetitive sequences were detected; a 200-bp AT-rich repetitive sequence, LCA-EcoRIa that co-localized with the 18S–28S rRNA gene clusters of 3 chromosomal pairs; a 364-bp AT-rich LCA-EcoRIb sequence that showed homology to the EcoRI sequence family from the sea lamprey (Petromyzon marinus), which contains short repeats as centromeric motifs; and a GC-rich 702-bp LCA-ApaI sequence that was distributed on nearly all chromosomes and showed significant homology with the integrase-coding region of a Ty3/Gypsy family long terminal repeat (LTR) retrotransposon. All three repetitive sequences are highly conserved within the Petromyzontidae or within Petromyzontidae and Mordaciidae. Molecular cytogenetic characterization of these site-specific repeats showed that they may be correlated with programed genome rearrangement (LCA-EcoRIa), centromere structure and function (LCA-EcoRIb), and site-specific amplification of LTR retroelements through homogenization between non-homologous chromosomes (LCA-ApaI). PMID:28025319

  15. Molecular cytogenetic characterization of chromosome site-specific repetitive sequences in the Arctic lamprey (Lethenteron camtschaticum, Petromyzontidae).

    PubMed

    Ishijima, Junko; Uno, Yoshinobu; Nunome, Mitsuo; Nishida, Chizuko; Kuraku, Shigehiro; Matsuda, Yoichi

    2017-02-01

    All extant lamprey karyotypes are characterized by almost all dot-shaped microchromosomes. To understand the molecular basis of chromosome structure in lampreys, we performed chromosome C-banding and silver staining and chromosome mapping of the 18S-28S and 5S ribosomal RNA (rRNA) genes and telomeric TTAGGG repeats in the Arctic lamprey (Lethenteron camtschaticum). In addition, we cloned chromosome site-specific repetitive DNA sequences and characterized them by nucleotide sequencing, chromosome in situ hybridization, and filter hybridization. Three types of repetitive sequences were detected; a 200-bp AT-rich repetitive sequence, LCA-EcoRIa that co-localized with the 18S-28S rRNA gene clusters of 3 chromosomal pairs; a 364-bp AT-rich LCA-EcoRIb sequence that showed homology to the EcoRI sequence family from the sea lamprey (Petromyzon marinus), which contains short repeats as centromeric motifs; and a GC-rich 702-bp LCA-ApaI sequence that was distributed on nearly all chromosomes and showed significant homology with the integrase-coding region of a Ty3/Gypsy family long terminal repeat (LTR) retrotransposon. All three repetitive sequences are highly conserved within the Petromyzontidae or within Petromyzontidae and Mordaciidae. Molecular cytogenetic characterization of these site-specific repeats showed that they may be correlated with programed genome rearrangement (LCA-EcoRIa), centromere structure and function (LCA-EcoRIb), and site-specific amplification of LTR retroelements through homogenization between non-homologous chromosomes (LCA-ApaI). © The Author 2016. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

  16. Nonconsensus Protein Binding to Repetitive DNA Sequence Elements Significantly Affects Eukaryotic Genomes

    PubMed Central

    Barber-Zucker, Shiran; Gordân, Raluca; Lukatsky, David B.

    2015-01-01

    Recent genome-wide experiments in different eukaryotic genomes provide an unprecedented view of transcription factor (TF) binding locations and of nucleosome occupancy. These experiments revealed that a large fraction of TF binding events occur in regions where only a small number of specific TF binding sites (TFBSs) have been detected. Furthermore, in vitro protein-DNA binding measurements performed for hundreds of TFs indicate that TFs are bound with wide range of affinities to different DNA sequences that lack known consensus motifs. These observations have thus challenged the classical picture of specific protein-DNA binding and strongly suggest the existence of additional recognition mechanisms that affect protein-DNA binding preferences. We have previously demonstrated that repetitive DNA sequence elements characterized by certain symmetries statistically affect protein-DNA binding preferences. We call this binding mechanism nonconsensus protein-DNA binding in order to emphasize the point that specific consensus TFBSs do not contribute to this effect. In this paper, using the simple statistical mechanics model developed previously, we calculate the nonconsensus protein-DNA binding free energy for the entire C. elegans and D. melanogaster genomes. Using the available chromatin immunoprecipitation followed by sequencing (ChIP-seq) results on TF-DNA binding preferences for ~100 TFs, we show that DNA sequences characterized by low predicted free energy of nonconsensus binding have statistically higher experimental TF occupancy and lower nucleosome occupancy than sequences characterized by high free energy of nonconsensus binding. This is in agreement with our previous analysis performed for the yeast genome. We suggest therefore that nonconsensus protein-DNA binding assists the formation of nucleosome-free regions, as TFs outcompete nucleosomes at genomic locations with enhanced nonconsensus binding. In addition, here we perform a new, large-scale analysis using

  17. Nonconsensus Protein Binding to Repetitive DNA Sequence Elements Significantly Affects Eukaryotic Genomes.

    PubMed

    Afek, Ariel; Cohen, Hila; Barber-Zucker, Shiran; Gordân, Raluca; Lukatsky, David B

    2015-08-01

    Recent genome-wide experiments in different eukaryotic genomes provide an unprecedented view of transcription factor (TF) binding locations and of nucleosome occupancy. These experiments revealed that a large fraction of TF binding events occur in regions where only a small number of specific TF binding sites (TFBSs) have been detected. Furthermore, in vitro protein-DNA binding measurements performed for hundreds of TFs indicate that TFs are bound with wide range of affinities to different DNA sequences that lack known consensus motifs. These observations have thus challenged the classical picture of specific protein-DNA binding and strongly suggest the existence of additional recognition mechanisms that affect protein-DNA binding preferences. We have previously demonstrated that repetitive DNA sequence elements characterized by certain symmetries statistically affect protein-DNA binding preferences. We call this binding mechanism nonconsensus protein-DNA binding in order to emphasize the point that specific consensus TFBSs do not contribute to this effect. In this paper, using the simple statistical mechanics model developed previously, we calculate the nonconsensus protein-DNA binding free energy for the entire C. elegans and D. melanogaster genomes. Using the available chromatin immunoprecipitation followed by sequencing (ChIP-seq) results on TF-DNA binding preferences for ~100 TFs, we show that DNA sequences characterized by low predicted free energy of nonconsensus binding have statistically higher experimental TF occupancy and lower nucleosome occupancy than sequences characterized by high free energy of nonconsensus binding. This is in agreement with our previous analysis performed for the yeast genome. We suggest therefore that nonconsensus protein-DNA binding assists the formation of nucleosome-free regions, as TFs outcompete nucleosomes at genomic locations with enhanced nonconsensus binding. In addition, here we perform a new, large-scale analysis using

  18. Molecular typing of Candida albicans strains isolated from denture wearers by repetitive sequence-based PCR.

    PubMed

    Abaci, O; Haliki-Uztan, A; Ozturk, B; Toksavul, S; Ulusoy, M; Boyacioglu, H

    2011-02-01

    Long-term use of prosthesis is the most important risk factor for the colonization of Candida species on the mucosal surfaces, which can lead to the development of denture-related stomatitis (DRS). Some individuals wearing prosthesis develop DRS and others do not. C. albicans strains isolated from both groups were genotypically compared. The purpose of this study was to determine whether the strain causing prosthesis stomatitis was different from the other strains genotypically. The study included 90 individuals wearing different prostheses and 20 control individuals with natural teeth. In the study 109 C. albicans strains were used which were isolated from the saliva samples and the mucosal surfaces of the tongues and palates of 51 individuals and then defined phenotypically. Phenotypic diagnosis of the isolates was genotypically verified by using species-specific PCR. For molecular typing, repetitive extragenic palindromic sequence polymerase chain reaction (REP-PCR) was employed. The results of the study revealed that REP-PCR had the capability to separate 109 C. albicans strains and six reference strains into 44 genotypes. Whereas C. albicans strains showed heterogenic distribution, C. albicans strains isolated from the individuals suffering from prosthesis stomatitis showed no specific genotypes. REP-PCR is a simple, fast and low-cost method and helped work on a great number of samples.

  19. Fast and Non-Toxic In Situ Hybridization without Blocking of Repetitive Sequences

    PubMed Central

    Matthiesen, Steen H.; Hansen, Charles M.

    2012-01-01

    Formamide is the preferred solvent to lower the melting point and annealing temperature of nucleic acid strands in in situ hybridization (ISH). A key benefit of formamide is better preservation of morphology due to a lower incubation temperature. However, in fluorescence in situ hybridization (FISH), against unique DNA targets in tissue sections, an overnight hybridization is required to obtain sufficient signal intensity. Here, we identified alternative solvents and developed a new hybridization buffer that reduces the required hybridization time to one hour (IQFISH method). Remarkably, denaturation and blocking against repetitive DNA sequences to prevent non-specific binding is not required. Furthermore, the new hybridization buffer is less hazardous than formamide containing buffers. The results demonstrate a significant increased hybridization rate at a lowered denaturation and hybridization temperature for both DNA and PNA (peptide nucleic acid) probes. We anticipate that these formamide substituting solvents will become the foundation for changes in the understanding and performance of denaturation and hybridization of nucleic acids. For example, the process time for tissue-based ISH for gene aberration tests in cancer diagnostics can be reduced from days to a few hours. Furthermore, the understanding of the interactions and duplex formation of nucleic acid strands may benefit from the properties of these solvents. PMID:22911704

  20. Epigenetic silencing of endogenous repetitive sequences by MORPHEUS' MOLECULE1 in Arabidopsis thaliana.

    PubMed

    Habu, Yoshiki

    2010-10-01

    Morpheus' molecule1 (MOM1) is a plant-specific epigenetic regulator of transcriptional gene silencing. Mutants of MOM1 release silencing of subsets of endogenous repetitive elements and transgenes without affecting their cytosine methylation status. Although MOM1 is evolutionarily related to chromodomain helicase DNA binding protein3 (CHD3), a family of chromatin remodeling proteins involved in repression of gene expression, MOM1 does not carry the functional ATPase/helicase domain essential for chromatin remodeling activity, and therefore, its mode of action is unknown. We recently performed a genome-wide survey for endogenous targets silenced by MOM1 and identified loci that are concentrated around centromeres and rich in sequences homologous to the 24-nt small interfering RNAs (siRNAs) that accumulate in wild type plants. Further and independent analyses indicated that the degree of contribution of MOM1 to maintenance of the silent states varies in different loci and that other silencing machineries, including those in the RNA-directed DNA methylation (RdDM) pathway, interact genetically with MOM1. In this short article, I review what we know about MOM1 and discuss its possible functions in silencing through examination of other silencing factors that interact genetically with MOM1.

  1. Repetitive DNA sequences as an insight into Aeglidae (Crustacea, Anomura) evolution.

    PubMed

    D'Amato, M E; Corach, D

    1997-08-01

    The evolutionary relationships of five Atlantic Aeglidae species (Aegla neuquensis affinis, A. humahuaca, A. jujuyana, A. platensis, and A. uruguayana) were studied by (i) satellite DNA analysis using a restriction enzyme digestion and hybridization pattern approach and (ii) genome screening by using randomly amplified polymorphic DNA (RAPD) typing. The identical restriction patterns and intense interspecific hybridization patterns obtained in this study strongly suggest a recent cladogenetic event for the Aeglidae. The species-specific amplification products which were detected using RAPD markers allowed species characterization. A total of 49 amplification products were used to construct trees by cluster analysis. The new scheme agrees in part with previous proposals based on biogeography and morphology. We considered that the subdivision northwestern-platensis species was probably due to the rising of the Andes, which started in the Middle Miocene. Divergence due to altitude is suggested by the different altitudinal distribution of three northwestern species along the same river. The possible role of selection by ecological factor/s was observed at the population level in A. jujuyana, which has a wider altitudinal range distribution. RAPD markers revealed a high level of intraspecific diversity and important genetic flow among populations. However, a few markers showed significant differences in frequency or H between the lowermost population and the other populations, located in a different biogeographical region. The differences were not in relation to geographical distance, and we interpreted them as being due to selection. Repetitive sequences constitute an important reservoir of genetic variation, and these results show their usefulness in testing and proposing evolutionary hypothesis in crabs. These sequences seem to have played an important role in aeglid evolution. Ecological factors related to altitude have probably influenced macro- and

  2. Repetitive flanking sequences challenge microsatellite marker development: a case study in the lepidopteran Melanargia galathea.

    PubMed

    Schmid, Max; Csencsics, Daniela; Gugerli, Felix

    2016-11-01

    Microsatellite DNA families (MDF) are stretches of DNA that share similar or identical sequences beside nuclear simple-sequence repeat (nSSR) motifs, potentially causing problems during nSSR marker development. Primers positioned within MDFs can bind several times within the genome and might result in multiple banding patterns. It is therefore common practice to exclude MDF loci in the course of marker development. Here, we propose an approach to deal with multiple primer-binding sites by purposefully positioning primers within the detected repetitive element. We developed a new protocol to determine the family type and the primer position in relation to MDFs using the software packages repark and repeatmasker together with an in-house R script. We re-evaluated newly developed nSSR markers for the lepidopteran Marbled White (Melanargia galathea) and explored the implications of our results with regard to published data sets of the butterfly Euphydryas aurinia, the grasshopper Stethophyma grossum, the conifer Pinus cembra and the crucifer Arabis alpina. For M. galathea, we show that it is not only possible to develop reliable nSSR markers for MDF loci, but even to benefit from their presence in some cases: We used one unlabelled primer, successfully binding within an MDF, for two different loci in a multiplex PCR, combining this family primer with uniquely binding and fluorescently labelled primers outside of MDFs, respectively. As MDFs are abundant in many taxa, we propose to consider these during nSSR marker development in taxa concerned. Our new approach might help in reducing the number of tested primers during nSSR marker development.

  3. Genomic organization and dynamics of repetitive DNA sequences in representatives of three Fagaceae genera.

    PubMed

    Alves, Sofia; Ribeiro, Teresa; Inácio, Vera; Rocheta, Margarida; Morais-Cecílio, Leonor

    2012-05-01

    Oaks, chestnuts, and beeches are economically important species of the Fagaceae. To understand the relationship between these members of this family, a deep knowledge of their genome composition and organization is needed. In this work, we have isolated and characterized several AFLP fragments obtained from Quercus rotundifolia Lam. through homology searches in available databases. Genomic polymorphisms involving some of these sequences were evaluated in two species of Quercus, one of Castanea, and one of Fagus with specific primers. Comparative FISH analysis with generated sequences was performed in interphase nuclei of the four species, and the co-immunolocalization of 5-methylcytosine was also studied. Some of the sequences isolated proved to be genus-specific, while others were present in all the genera. Retroelements, either gypsy-like of the Tat/Athila clade or copia-like, are well represented, and most are dispersed in euchromatic regions of these species with no DNA methylation associated, pointing to an interspersed arrangement of these retroelements with potential gene-rich regions. A particular gypsy-sequence is dispersed in oaks and chestnut nuclei, but its confinement to chromocenters in beech evidences genome restructuring events during evolution of Fagaceae. Several sequences generated in this study proved to be good tools to comparatively study Fagaceae genome organization.

  4. Construction of a small Mus musculus repetitive DNA library: identification of a new satellite sequence in Mus musculus.

    PubMed Central

    Pietras, D F; Bennett, K L; Siracusa, L D; Woodworth-Gutai, M; Chapman, V M; Gross, K W; Kane-Haas, C; Hastie, N D

    1983-01-01

    We report the construction of a small library of recombinant plasmids containing Mus musculus repetitive DNA inserts. The repetitive cloned fraction was derived from denatured genomic DNA by reassociation to a Cot value at which repetitive, but not unique, sequences have reannealed followed by exhaustive S1 nuclease treatment to degrade single stranded DNA. Initial characterizations of this library by colony filter hybridizations have led to the identification of a previously undetected M. musculus minor satellite as well as to clones containing M. musculus major satellite sequences. This new satellite is repeated 10-20 times less than the major satellite in the M. musculus genome. It has a repeat length of 130 nucleotides compared with the M. musculus major satellite with a repeat length of 234 nucleotides. Sequence analysis of the minor satellite has shown that it has a 29 base pair region with extensive homology to one of the major satellite repeating subunits. We also show by in situ hybridization that this minor satellite sequence is located at the centromeres and possibly the arms of at least half the M musculus chromosomes. Sequences related to the minor satellite have been found in the DNA of a related Mus species, Mus spretus, and may represent the major satellite of that species. Images PMID:6314268

  5. Restriction site detection in repetitive nuclear DNA sequences of Trypanosoma evansi for strain differentiation among different isolates.

    PubMed

    Shyma, K P; Gupta, S K; Gupta, J P; Singh, Ajit; Chaudhari, S S; Singh, Veer

    2016-09-01

    The differences or similarities among different isolates of Trypanosoma evansi through endonuclease profile was identified in the present study. The repetitive nuclear DNA of T. evansi isolated from infected cattle, buffalo and equine blood was initially amplified by PCR using specific primers. A panel of restriction enzymes, EcoRI, Eco91l, HindIII and PstI were for complete digestion of PCR products. Agarose gel electrophoresis of digested product did not show cleavage fragments and only single DNA band of the original size was visible in the ethidium bromide stained agarose gel. This indicated that the 227 bp PCR product from repetitive sequence had no site-specific cleavage sites for the REs used in this study. No heterogeneity in the repetitive nuclear DNA restriction endonuclease profile among the different isolates was recorded.

  6. Sequence-Independent Cloning and Post-Translational Modification of Repetitive Protein Polymers through Sortase and Sfp-Mediated Enzymatic Ligation.

    PubMed

    Ott, Wolfgang; Nicolaus, Thomas; Gaub, Hermann E; Nash, Michael A

    2016-04-11

    Repetitive protein-based polymers are important for many applications in biotechnology and biomaterials development. Here we describe the sequential additive ligation of highly repetitive DNA sequences, their assembly into genes encoding protein-polymers with precisely tunable lengths and compositions, and their end-specific post-translational modification with organic dyes and fluorescent protein domains. Our new Golden Gate-based cloning approach relies on incorporation of only type IIS BsaI restriction enzyme recognition sites using PCR, which allowed us to install ybbR-peptide tags, Sortase c-tags, and cysteine residues onto either end of the repetitive gene polymers without leaving residual cloning scars. The assembled genes were expressed in Escherichia coli and purified using inverse transition cycling (ITC). Characterization by cloud point spectrophotometry, and denaturing polyacrylamide gel electrophoresis with fluorescence detection confirmed successful phosphopantetheinyl transferase (Sfp)-mediated post-translational N-terminal labeling of the protein-polymers with a coenzyme A-647 dye (CoA-647) and simultaneous sortase-mediated C-terminal labeling with a GFP domain containing an N-terminal GG-motif in a one-pot reaction. In a further demonstration, we installed an N-terminal cysteine residue into an elastin-like polypeptide (ELP) that was subsequently conjugated to a single chain poly(ethylene glycol)-maleimide (PEG-maleimide) synthetic polymer, noticeably shifting the ELP cloud point. The ability to straightforwardly assemble repetitive DNA sequences encoding ELPs of precisely tunable length and to post-translationally modify them specifically at the N- and C- termini provides a versatile platform for the design and production of multifunctional smart protein-polymeric materials.

  7. New families of site-specific repetitive DNA sequences that comprise constitutive heterochromatin of the Syrian hamster (Mesocricetus auratus, Cricetinae, Rodentia).

    PubMed

    Yamada, Kazuhiko; Kamimura, Eikichi; Kondo, Mariko; Tsuchiya, Kimiyuki; Nishida-Umehara, Chizuko; Matsuda, Yoichi

    2006-02-01

    We molecularly cloned new families of site-specific repetitive DNA sequences from BglII- and EcoRI-digested genomic DNA of the Syrian hamster (Mesocricetus auratus, Cricetrinae, Rodentia) and characterized them by chromosome in situ hybridization and filter hybridization. They were classified into six different types of repetitive DNA sequence families according to chromosomal distribution and genome organization. The hybridization patterns of the sequences were consistent with the distribution of C-positive bands and/or Hoechst-stained heterochromatin. The centromeric major satellite DNA and sex chromosome-specific and telomeric region-specific repetitive sequences were conserved in the same genus (Mesocricetus) but divergent in different genera. The chromosome-2-specific sequence was conserved in two genera, Mesocricetus and Cricetulus, and a low copy number of repetitive sequences on the heterochromatic chromosome arms were conserved in the subfamily Cricetinae but not in the subfamily Calomyscinae. By contrast, the other type of repetitive sequences on the heterochromatic chromosome arms, which had sequence similarities to a LINE sequence of rodents, was conserved through the three subfamilies, Cricetinae, Calomyscinae and Murinae. The nucleotide divergence of the repetitive sequences of heterochromatin was well correlated with the phylogenetic relationships of the Cricetinae species, and each sequence has been independently amplified and diverged in the same genome.

  8. Distinctive patterns of age-dependent hypomethylation in interspersed repetitive sequences.

    PubMed

    Jintaridth, Pornrutsami; Mutirangura, Apiwat

    2010-04-01

    Interspersed repetitive sequences (IRSs) are a major contributor to genome size and may contribute to cellular functions. IRSs are subdivided according to size and functionally related structures into short interspersed elements, long interspersed elements (LINEs), DNA transposons, and LTR-retrotransposons. Many IRSs may produce RNA and regulate genes by a variety of mechanisms. The majority of DNA methylation occurs in IRSs and is believed to suppress IRS activities. Global hypomethylation, or the loss of genome-wide methylation, is a common epigenetic event not only in senescent cells but also in cancer cells. Loss of LINE-1 methylation has been characterized in many cancers. Here, we evaluated the methylation levels of peripheral blood mononuclear cells of LINE-1, Alu, and human endogenous retrovirus K (HERV-K) in 177 samples obtained from volunteers between 20 and 88 yr of age. Age was negatively associated with methylation levels of Alu (r = -0.452, P < 10(-3)) and HERV-K (r = -0.326, P < 10(-3)) but not LINE-1 (r = 0.145, P = 0.055). Loss of methylation of Alu occurred during ages 34-68 yr, and loss of methylation of HERV-K occurred during ages 40-63 yr and again during ages 64-83 yr. Interestingly, methylation of Alu and LINE-1 are directly associated, particularly at ages 49 yr and older (r = 0.49, P < 10(-3)). Therefore, only some types of IRSs lose methylation at certain ages. Moreover, Alu and HERV-K become hypomethylated differently. Finally, there may be several mechanisms of global methylation. However, not all of these mechanisms are age-dependent. This finding may lead to a better understanding of not only the biological causes and consequences of genome-wide hypomethylation but also the role of IRSs in the aging process.

  9. Repetitive extragenic palindromic sequences in the Pseudomonas syringae pv. tomato DC3000 genome: extragenic signals for genome reannotation.

    PubMed

    Tobes, Raquel; Pareja, Eduardo

    2005-04-01

    Repetitive extragenic palindromic (REPs) sequences were first described in enterobacteriacea and later in Pseudomonas putida. We have detected a new variant (51 base pairs) of REP sequences that appears to be disseminated in more than 300 copies in the Pseudomonas syringae DC3000 genome. The finding of REP sequences in P. syringae confirms the broad presence of this type of repetitive sequence in bacteria. We analyzed the distribution of REP sequences and the structure of the clusters, and we show that palindromy is conserved. REP sequences appear to be allocated to the extragenic space, with a special preference for the intergenic spaces limited by convergent genes, while their presence is scarce between divergent genes. Using REP sequences as markers of extragenicity we re-annotated a set of genes of the P. syringae DC3000 genome demonstrating that REP sequences can be used for refinement of annotation of a genome. The similarity detected between virulence genes from evolutionarily distant pathogenic bacteria suggests the acquisition of clusters of virulence genes by horizontal gene transfer. We did not detect the presence of P. syringae REP elements in the principal pathogenicity gene clusters. This absence suggests that genome fragments lacking REP sequences could point to regions recently acquired from other organisms, and REP sequences might be new tracers for gaining insight into key aspects of bacterial genome evolution, especially when studying pathogenicity acquisition. In addition, as the P. syringae REP sequence is species-specific with respect to the sequenced genomes, it is an exceptional candidate for use as a fingerprint in precise genotyping and epidemiological studies.

  10. Comparison of the distribution of the repetitive DNA sequences in three variants of Cucumis sativus reveals their phylogenetic relationships.

    PubMed

    Zhao, Xin; Lu, Jingyuan; Zhang, Zhonghua; Hu, Jiajin; Huang, Sanwen; Jin, Weiwei

    2011-01-01

    Repetitive DNA sequences with variability in copy number or/and sequence polymorphism can be employed as useful molecular markers to study phylogenetics and identify species/chromosomes when combined with fluorescence in situ hybridization (FISH). Cucumis sativus has three variants, Cucumis sativus L. var. sativus, Cucumis sativus L. var. hardwickii and Cucumis sativus L. var. xishuangbannesis. The phylogenetics among these three variants has not been well explored using cytological landmarks. Here, we concentrate on the organization and distribution of highly repetitive DNA sequences in cucumbers, with emphasis on the differences between cultivar and wild cucumber. The diversity of chromosomal karyotypes in cucumber and its relatives was detected in our study. Thereby, sequential FISH with three sets of multi-probe cocktails (combined repetitive DNA with chromosome-specific fosmid clones as probes) were conducted on the same metaphase cell, which helped us to simultaneously identify each of the 7 metaphase chromosomes of wild cucumber C. sativus var. hardwickii. A standardized karyotype of somatic metaphase chromosomes was constructed. Our data also indicated that the relationship between cultivar cucumber and C. s. var. xishuangbannesis was closer than that of C. s. var. xishuangbannesis and C. s. var. hardwickii.

  11. Novel repetitive structures, deviant protein-encoding sequences and unidentified ORFs in the mitochondrial genome of the brachiopod Lingula anatina.

    PubMed

    Endo, Kazuyoshi; Noguchi, Yasuhiro; Ueshima, Rei; Jacobs, Howard T

    2005-07-01

    Complete sequence determination of the brachiopod Lingula anatina mtDNA (28,818 bp) revealed an organization that is remarkably atypical for an animal mt-genome. In addition to the usual set of 37 animal mitochondrial genes, which make up only 57% (16,555 bp) of the entire sequence, the genome contains lengthy unassigned sequences. All the genes are encoded in the same DNA strand, generally in a compact way, whereas the overall gene order is highly divergent in comparison with known animal mtDNA. Individual genes are generally longer and deviate considerably in sequence from their homologues in other animals. The genome contains two major repeat regions, in which 11 units of unassigned sequences and six genes (atp8, trnM, trnQ, trnV, and part of cox2 and nad2) are found in repetition, in the form of nested direct repeats of unparalleled complexity. One of the repeat regions contains unassigned repeat units dispersed among several unique sequences, novel repetitive structure for animal mtDNAs. Each of those unique sequences contains an open reading frame for a polypeptide between 80 and 357 amino acids long, potentially encoding a functional molecule, but none of them has been identified with known proteins. In both repeat regions, tRNA genes or tRNA gene-like sequences flank major repeated units, supporting the view that those structures play a role in the mitochondrial gene rearrangements. Although the intricate repeated organization of this genome can be explained by recurrent tandem duplications and subsequent deletions mediated by replication errors, other mechanisms, such as nonhomologous recombinations, appear to explain certain structures more easily.

  12. Highly differentiated ZW sex microchromosomes in the Australian Varanus species evolved through rapid amplification of repetitive sequences.

    PubMed

    Matsubara, Kazumi; Sarre, Stephen D; Georges, Arthur; Matsuda, Yoichi; Marshall Graves, Jennifer A; Ezaz, Tariq

    2014-01-01

    Transitions between sex determination systems have occurred in many lineages of squamates and it follows that novel sex chromosomes will also have arisen multiple times. The formation of sex chromosomes may be reinforced by inhibition of recombination and the accumulation of repetitive DNA sequences. The karyotypes of monitor lizards are known to be highly conserved yet the sex chromosomes in this family have not been fully investigated. Here, we compare male and female karyotypes of three Australian monitor lizards, Varanus acanthurus, V. gouldii and V. rosenbergi, from two different clades. V. acanthurus belongs to the acanthurus clade and the other two belong to the gouldii clade. We applied C-banding and comparative genomic hybridization to reveal that these species have ZZ/ZW sex micro-chromosomes in which the W chromosome is highly differentiated from the Z chromosome. In combination with previous reports, all six Varanus species in which sex chromosomes have been identified have ZZ/ZW sex chromosomes, spanning several clades on the varanid phylogeny, making it likely that the ZZ/ZW sex chromosome is ancestral for this family. However, repetitive sequences of these ZW chromosome pairs differed among species. In particular, an (AAT)n microsatellite repeat motif mapped by fluorescence in situ hybridization on part of W chromosome in V. acanthurus only, whereas a (CGG)n motif mapped onto the W chromosomes of V. gouldii and V. rosenbergi. Furthermore, the W chromosome probe for V. acanthurus produced hybridization signals only on the centromeric regions of W chromosomes of the other two species. These results suggest that the W chromosome sequences were not conserved between gouldii and acanthurus clades and that these repetitive sequences have been amplified rapidly and independently on the W chromosome of the two clades after their divergence.

  13. Highly Differentiated ZW Sex Microchromosomes in the Australian Varanus Species Evolved through Rapid Amplification of Repetitive Sequences

    PubMed Central

    Matsubara, Kazumi; Sarre, Stephen D.; Georges, Arthur; Matsuda, Yoichi; Marshall Graves, Jennifer A.; Ezaz, Tariq

    2014-01-01

    Transitions between sex determination systems have occurred in many lineages of squamates and it follows that novel sex chromosomes will also have arisen multiple times. The formation of sex chromosomes may be reinforced by inhibition of recombination and the accumulation of repetitive DNA sequences. The karyotypes of monitor lizards are known to be highly conserved yet the sex chromosomes in this family have not been fully investigated. Here, we compare male and female karyotypes of three Australian monitor lizards, Varanus acanthurus, V. gouldii and V. rosenbergi, from two different clades. V. acanthurus belongs to the acanthurus clade and the other two belong to the gouldii clade. We applied C-banding and comparative genomic hybridization to reveal that these species have ZZ/ZW sex micro-chromosomes in which the W chromosome is highly differentiated from the Z chromosome. In combination with previous reports, all six Varanus species in which sex chromosomes have been identified have ZZ/ZW sex chromosomes, spanning several clades on the varanid phylogeny, making it likely that the ZZ/ZW sex chromosome is ancestral for this family. However, repetitive sequences of these ZW chromosome pairs differed among species. In particular, an (AAT)n microsatellite repeat motif mapped by fluorescence in situ hybridization on part of W chromosome in V. acanthurus only, whereas a (CGG)n motif mapped onto the W chromosomes of V. gouldii and V. rosenbergi. Furthermore, the W chromosome probe for V. acanthurus produced hybridization signals only on the centromeric regions of W chromosomes of the other two species. These results suggest that the W chromosome sequences were not conserved between gouldii and acanthurus clades and that these repetitive sequences have been amplified rapidly and independently on the W chromosome of the two clades after their divergence. PMID:24743344

  14. Comparison of multilocus sequence typing (MLST) and repetitive sequence-based PCR (rep-PCR) fingerprinting for differentiation of Campylobacter jejuni isolated from broiler in Chiang Mai, Thailand.

    PubMed

    Patchanee, Prapas; Chokboonmongkol, Chomporn; Zessin, Karl-Hans; Alter, Thomas; Pornaem, Sarinya; Chokesajjawatee, Nipa

    2012-11-01

    We compared rapid fingerprinting using repetitive sequence-based PCR (rep-PCR) for subtyping Campylobacter jejuni isolates to the widely used multilocus sequence typing (MLST). Representative C. jejuni isolates (n = 16) from broilers were analyzed using MLST and rep-PCR. Both techniques demonstrated an equal discriminatory power of 0.8917, and 9 subgroups were identified. Clonal identification of all 16 isolates was identical for both techniques. The rep-PCR as described in this study may be used as a rapid and cost-effective alternative for subtyping of C. jejuni isolates, or as an effective screening tool in large epidemiological studies.

  15. Complex repetitive arrangements of gene sequence in the candidate region of the spinal muscular atrophy gene in 5q13

    SciTech Connect

    Theodosiou, A.M.; Nesbit, A.M.; Daniels, R.J.; Campbell, L.; Francis, M.J.; Christodoulou, Z.; Morrison, K.E.; Davies, K.E. |

    1994-12-01

    Childhood-onset proximal spinal muscular atrophy (SMA) is a heritable neurological disorder, which has been mapped by genetic linkage analysis to chromosome 5q13, in the interval between markers D5S435 and D5S557. Here, we present gene sequences that have been isolated from this interval, several of which show sequence homologies to exons of {beta}-glucuronidase. These gene sequences are repeated several times across the candidate region and are also present on chromosome 5p. The arrangement of these repetitive gene motifs is polymorphic between individuals. The high degree of variability observed may have some influence on the expression of the genes in the region. Since SMA is not inherited as a classical autosomal recessive disease, novel genomic rearrangements arising from aberrant recombination events between the complex repeats may be associated with the phenotype observed.

  16. [Short interspersed repetitive sequences (SINEs) and their use as a phylogenetic tool].

    PubMed

    Kramerov, D A; Vasetskiĭ, N S

    2009-01-01

    The data on one of the most common repetitive elements of eukaryotic genomes, short interspersed elements (SINEs), are reviewed. Their structure, origin, and functioning in the genome are discussed. The variation and abundance of these neutral genomic markers makes them a convenient and reliable tool for phylogenetic analysis. The main methods of such analysis are presented, and the potential and limitations of this approach are discussed using specific examples.

  17. Total DNA transcription in vitro: a procedure to detect highly repetitive and transcribable sequences with tRNA-like structures

    SciTech Connect

    Endoh, H.; Okada, N.

    1986-01-01

    Total DNAs from various animals were transcribed in vitro in a HeLa cell extract, and it was found that one to several discrete RNAs were transcribed by RNA polymerase III. With tortoise (Geoclemys reevessi) and newt (Cynops pyrrhogaster), distinct 6.5S and 8S RNAs were transcribed from these respective DNAs. Representative phage clones carrying the 6.5S and 8S RNA genes were isolated from genomic libraries of these animals, and the sequences of these genes were determined. The 5' parts of highly repetitive and transcribable sequences of tortoise and newt were found to have close resemblance to tRNA/sub 1//sup Lys/ (rabbit) gene (78% homology) and a tRNA/sup Glu/ (Drosophila) gene (74% homology, not counting the aminoacyl stem region), respectively. The homologies extended to secondary structures, homologous nucleotides being located on similar secondary structures. It is proposed that many, if not all, highly repetitive and transcribable sequences detected by total DNA transcription have specific tRNA genes as their progenitors.

  18. Next-Generation Sequencing Reveals the Impact of Repetitive DNA Across Phylogenetically Closely Related Genomes of Orobanchaceae

    PubMed Central

    Piednoël, Mathieu; Aberer, Andre J.; Schneeweiss, Gerald M.; Macas, Jiri; Novak, Petr; Gundlach, Heidrun; Temsch, Eva M.; Renner, Susanne S.

    2013-01-01

    We used next-generation sequencing to characterize the genomes of nine species of Orobanchaceae of known phylogenetic relationships, different life forms, and including a polyploid species. The study species are the autotrophic, nonparasitic Lindenbergia philippensis, the hemiparasitic Schwalbea americana, and seven nonphotosynthetic parasitic species of Orobanche (Orobanche crenata, Orobanche cumana, Orobanche gracilis (tetraploid), and Orobanche pancicii) and Phelipanche (Phelipanche lavandulacea, Phelipanche purpurea, and Phelipanche ramosa). Ty3/Gypsy elements comprise 1.93%–28.34% of the nine genomes and Ty1/Copia elements comprise 8.09%–22.83%. When compared with L. philippensis and S. americana, the nonphotosynthetic species contain higher proportions of repetitive DNA sequences, perhaps reflecting relaxed selection on genome size in parasitic organisms. Among the parasitic species, those in the genus Orobanche have smaller genomes but higher proportions of repetitive DNA than those in Phelipanche, mostly due to a diversification of repeats and an accumulation of Ty3/Gypsy elements. Genome downsizing in the tetraploid O. gracilis probably led to sequence loss across most repeat types. PMID:22723303

  19. Repetitive DNA in the pea (Pisum sativum L.) genome: comprehensive characterization using 454 sequencing and comparison to soybean and Medicago truncatula

    PubMed Central

    Macas, Jiří; Neumann, Pavel; Navrátilová, Alice

    2007-01-01

    Background Extraordinary size variation of higher plant nuclear genomes is in large part caused by differences in accumulation of repetitive DNA. This makes repetitive DNA of great interest for studying the molecular mechanisms shaping architecture and function of complex plant genomes. However, due to methodological constraints of conventional cloning and sequencing, a global description of repeat composition is available for only a very limited number of higher plants. In order to provide further data required for investigating evolutionary patterns of repeated DNA within and between species, we used a novel approach based on massive parallel sequencing which allowed a comprehensive repeat characterization in our model species, garden pea (Pisum sativum). Results Analysis of 33.3 Mb sequence data resulted in quantification and partial sequence reconstruction of major repeat families occurring in the pea genome with at least thousands of copies. Our results showed that the pea genome is dominated by LTR-retrotransposons, estimated at 140,000 copies/1C. Ty3/gypsy elements are less diverse and accumulated to higher copy numbers than Ty1/copia. This is in part due to a large population of Ogre-like retrotransposons which alone make up over 20% of the genome. In addition to numerous types of mobile elements, we have discovered a set of novel satellite repeats and two additional variants of telomeric sequences. Comparative genome analysis revealed that there are only a few repeat sequences conserved between pea and soybean genomes. On the other hand, all major families of pea mobile elements are well represented in M. truncatula. Conclusion We have demonstrated that even in a species with a relatively large genome like pea, where a single 454-sequencing run provided only 0.77% coverage, the generated sequences were sufficient to reconstruct and analyze major repeat families corresponding to a total of 35–48% of the genome. These data provide a starting point for

  20. Observation and Quantification of Telomere and Repetitive Sequences Using Fluorescence In Situ Hybridization (FISH) with PNA Probes in Caenorhabditis elegans.

    PubMed

    Seo, Beomseok; Lee, Junho

    2016-08-04

    Telomere is a ribonucleoprotein structure that protects chromosomal ends from aberrant fusion and degradation. Telomere length is maintained by telomerase or an alternative pathway, known as alternative lengthening of telomeres (ALT)(1). Recently, C. elegans has emerged as a multicellular model organism for the study of telomere and ALT(2). Visualization of repetitive sequences in the genome is critical in understanding the biology of telomeres. While telomere length can be measured by telomere restriction fragment assay or quantitative PCR, these methods only provide the averaged telomere length. On the contrary, fluorescence in situ hybridization (FISH) can provide the information of the individual telomeres in cells. Here, we provide protocols and representative results of the method to determine telomere length of C. elegans by fluorescent in situ hybridization. This method provides a simple, but powerful, in situ procedure that does not cause noticeable damage to morphology. By using fluorescently labeled peptide nucleic acid (PNA) and digoxigenin-dUTP-labeled probe, we were able to visualize two different repetitive sequences: telomere repeats and template of ALT (TALT) in C. elegans embryos and gonads.

  1. Repetitive sequences in the ITS1 region of ribosomal DNA in congeneric microphallid species (Trematoda: Digenea).

    PubMed

    Warberg, Rikke; Jensen, K Thomas; Frydenberg, Jane

    2005-11-01

    In searching for species-specific DNA sequences of microphallid species (Digenea, Trematoda) we examined the ribosomal internal transcribed spacer regions (ITS) of three closely related species (Levinseniella group) hosted by mud snails (first intermediate host) and marine crustaceans (second intermediate host). In the ITS1 region we found consistent patterns of repeating sequences of 130 bp. Within each main repeat there was a varying number of subrepeats specific for each of the species. All repeats including subrepeats were identified by a similar starting sequence: 5'-CCTGTGG-3'. As this sequence has close resemblance to the chi sequence 5'-GCTGGTGG-3' found in phage lambda we speculate if it serves the same function as a recombination hotspot. Alternatively but less likely, it could be an inactive, mutational relic of a sequence that once served this purpose.

  2. Chromosomal Mapping of Repetitive DNA Sequences in the Genus Bryconamericus (Characidae) and DNA Barcoding to Differentiate Populations.

    PubMed

    Santos, Angélica Rossotti Dos; Usso, Mariana Campaner; Gouveia, Juceli Gonzalez; Araya-Jaime, Cristian; Frantine-Silva, Wilson; Giuliano-Caetano, Lucia; Foresti, Fausto; Dias, Ana Lúcia

    2017-06-01

    The mapping of repetitive DNA sites by fluorescence in situ hybridization has been widely used for karyotype studies in different species of fish, especially when dealing with related species or even genera presenting high chromosome variability. This study analyzed three populations of Bryconamericus, with diploid number preserved, but with different karyotype formulae. Bryconamericus ecai, from the Forquetinha river/RS, presented three new cytotypes, increasing the number of karyotype forms to seven in this population. Other two populations of Bryconamericus sp. from the Vermelho stream/PR and Cambuta river/PR exhibited interpopulation variation. The chromosome mapping of rDNA sites revealed unique markings among the three populations, showing inter- and intrapopulation variability located in the terminal region. The molecular analysis using DNA barcoding complementing the cytogenetic analysis also showed differentiation among the three populations. The U2 small nuclear DNA repetitive sequence exhibited conserved features, being located in the interstitial region of a single chromosome pair. This is the first report on its occurrence in the genus Bryconamericus. Data obtained revealed a karyotype variability already assigned to the genus, along with polymorphism of ribosomal sites, demonstrating that this group of fish can be undergoing a divergent evolutionary process, constituting a substantive model for studies of chromosomal evolution.

  3. Monopolin recruits condensin to organize centromere DNA and repetitive DNA sequences

    PubMed Central

    Burrack, Laura S.; Applen Clancey, Shelly E.; Chacón, Jeremy M.; Gardner, Melissa K.; Berman, Judith

    2013-01-01

    The establishment and maintenance of higher-order structure at centromeres is essential for accurate chromosome segregation. The monopolin complex is thought to cross-link multiple kinetochore complexes to prevent merotelic attachments that result in chromosome missegregation. This model is based on structural analysis and the requirement that monopolin execute mitotic and meiotic chromosome segregation in Schizosaccharomyces pombe, which has more than one kinetochore–microtubule attachment/centromere, and co-orient sister chromatids in meiosis I in Saccharomyces cerevisiae. Recent data from S. pombe suggest an alternative possibility: that the recruitment of condensin is the primary function of monopolin. Here we test these models using the yeast Candida albicans. C. albicans cells lacking monopolin exhibit defects in chromosome segregation, increased distance between centromeres, and decreased stability of several types of repeat DNA. Of note, changing kinetochore–microtubule copy number from one to more than one kinetochore–microtubule/centromere does not alter the requirement for monopolin. Furthermore, monopolin recruits condensin to C. albicans centromeres, and overexpression of condensin suppresses chromosome segregation defects in strains lacking monopolin. We propose that the key function of monopolin is to recruit condensin in order to promote the assembly of higher-order structure at centromere and repetitive DNA. PMID:23885115

  4. The history of mutation pattern in human: A statistical analysis of repetitive sequences

    NASA Astrophysics Data System (ADS)

    Arndt, Peter

    2003-03-01

    Different regions of the human genome show large variation in GC-content (from 30% to 60%) at scales exceeding hundreds of kilobases. The origin, timing and implications of this so called ``human isochore structure'' is still controversial, primarily due to a number of technical issues that have made it difficult to reconstruct the history of the substitutional process. To gain more insight into these questions, we utilize the vast amount of repetitive elements in the human genome to estimate substitution patterns at different evolutionary times going back approximately 250 Myr. We demonstrate that the large-scale variation in GC-content in the human genome has been generated through substitutional biases prior to the radiation of eutherian mammals. While the eutherian substitution pattern allows the formation and maintenance of isochores, the substitution patterns changed abruptly at approximately the time of the mammalian radiation. The newly evolved mammalian pattern of substitution is expected to largely homogenize GC content across the human genome over time. Eutherian mammals are also predicted to share a newly evolved high rate of methylation-induced cytosine transition in CpG pairs, with a 4- to 8-fold increase in rate compared to that of the reptilian ancestor.

  5. Pitfalls of mapping high throughput sequencing data to repetitive sequences: Piwi’s genomic targets still not identified

    PubMed Central

    Marinov, Georgi K.; Wang, Jie; Handler, Dominik; Wold, Barbara J.; Weng, Zhiping; Hannon, Gregory J.; Aravin, Alexei A.; Zamore, Phillip D.; Brennecke, Julius; Toth, Katalin Fejes

    2015-01-01

    Huang et al. (2013) recently reported that chromatin immuno-precipitation followed by sequencing (ChIP-seq) reveals the genome-wide sites of occupancy by Piwi - a piRNA-guided Argonaute protein central to transposon silencing in Drosophila. Their study also reported that loss of Piwi causes widespread rewiring of transcriptional patterns as evidenced by changes in RNA polymerase II occupancy across the genome. Here we reanalyze their underlying deep sequencing data and report that the data do not support the author’s central conclusions. PMID:25805138

  6. DNA Cloning of Plasmodium falciparum Circumsporozoite Gene: Amino Acid Sequence of Repetitive Epitope

    NASA Astrophysics Data System (ADS)

    Enea, Vincenzo; Ellis, Joan; Zavala, Fidel; Arnot, David E.; Asavanich, Achara; Masuda, Aoi; Quakyi, Isabella; Nussenzweig, Ruth S.

    1984-08-01

    A clone of complementary DNA encoding the circumsporozoite (CS) protein of the human malaria parasite Plasmodium falciparum has been isolated by screening an Escherichia coli complementary DNA library with a monoclonal antibody to the CS protein. The DNA sequence of the complementary DNA insert encodes a four-amino acid sequence: proline-asparagine-alanine-asparagine, tandemly repeated 23 times. The CS β -lactamase fusion protein specifically binds monoclonal antibodies to the CS protein and inhibits the binding of these antibodies to native Plasmodium falciparum CS protein. These findings provide a basis for the development of a vaccine against Plasmodium falciparum malaria.

  7. Structural Analysis of a Repetitive Protein Sequence Motif in Strepsirrhine Primate Amelogenin

    PubMed Central

    Bromley, Keith M.; Hacia, Joseph G.; Bromage, Timothy G.; Snead, Malcolm L.; Moradian-Oldak, Janet; Paine, Michael L.

    2011-01-01

    Strepsirrhines are members of a primate suborder that has a distinctive set of features associated with the development of the dentition. Amelogenin (AMEL), the better known of the enamel matrix proteins, forms 90% of the secreted organic matrix during amelogenesis. Although AMEL has been sequenced in numerous mammalian lineages, the only reported strepsirrhine AMEL sequences are those of the ring-tailed lemur and galago, which contain a set of additional proline-rich tandem repeats absent in all other primates species analyzed to date, but present in some non-primate mammals. Here, we first determined that these repeats are present in AMEL from three additional lemur species and thus are likely to be widespread throughout this group. To evaluate the functional relevance of these repeats in strepsirrhines, we engineered a mutated murine amelogenin sequence containing a similar proline-rich sequence to that of Lemur catta. In the monomeric form, the MQP insertions had no influence on the secondary structure or refolding properties, whereas in the assembled form, the insertions increased the hydrodynamic radii. We speculate that increased AMEL nanosphere size may influence enamel formation in strepsirrhine primates. PMID:21437261

  8. Distribution of genes and repetitive elements in the Diabrotica virgifera virgifera genome estimated using BAC sequencing

    USDA-ARS?s Scientific Manuscript database

    Feeding damage caused by the corn rootworm, Diabrotica virgifera virgifera, is destructive to corn plants in North America and Europe where control remains challenging due to evolution of resistance traits that allow survival when exposed to chemical and transgenic toxins. Genome sequencing of an i...

  9. Repetitive sequence variation and dynamics in the ribosomal DNA array of Saccharomyces cerevisiae as revealed by whole-genome resequencing

    PubMed Central

    James, Stephen A.; O'Kelly, Michael J.T.; Carter, David M.; Davey, Robert P.; van Oudenaarden, Alexander; Roberts, Ian N.

    2009-01-01

    Ribosomal DNA (rDNA) plays a key role in ribosome biogenesis, encoding genes for the structural RNA components of this important cellular organelle. These genes are vital for efficient functioning of the cellular protein synthesis machinery and as such are highly conserved and normally present in high copy numbers. In the baker's yeast Saccharomyces cerevisiae, there are more than 100 rDNA repeats located at a single locus on chromosome XII. Stability and sequence homogeneity of the rDNA array is essential for function, and this is achieved primarily by the mechanism of gene conversion. Detecting variation within these arrays is extremely problematic due to their large size and repetitive structure. In an attempt to address this, we have analyzed over 35 Mbp of rDNA sequence obtained from whole-genome shotgun sequencing (WGSS) of 34 strains of S. cerevisiae. Contrary to expectation, we find significant rDNA sequence variation exists within individual genomes. Many of the detected polymorphisms are not fully resolved. For this type of sequence variation, we introduce the term partial single nucleotide polymorphism, or pSNP. Comparative analysis of the complete data set reveals that different S. cerevisiae genomes possess different patterns of rDNA polymorphism, with much of the variation located within the rapidly evolving nontranscribed intergenic spacer (IGS) region. Furthermore, we find that strains known to have either structured or mosaic/hybrid genomes can be distinguished from one another based on rDNA pSNP number, indicating that pSNP dynamics may provide a reliable new measure of genome origin and stability. PMID:19141593

  10. Fold homology detection using sequence fragment composition profiles of proteins.

    PubMed

    Solis, Armando D; Rackovsky, Shalom R

    2010-10-01

    The effectiveness of sequence alignment in detecting structural homology among protein sequences decreases markedly when pairwise sequence identity is low (the so-called "twilight zone" problem of sequence alignment). Alternative sequence comparison strategies able to detect structural kinship among highly divergent sequences are necessary to address this need. Among them are alignment-free methods, which use global sequence properties (such as amino acid composition) to identify structural homology in a rapid and straightforward way. We explore the viability of using tetramer sequence fragment composition profiles in finding structural relationships that lie undetected by traditional alignment. We establish a strategy to recast any given protein sequence into a tetramer sequence fragment composition profile, using a series of amino acid clustering steps that have been optimized for mutual information. Our method has the effect of compressing the set of 160,000 unique tetramers (if using the 20-letter amino acid alphabet) into a more tractable number of reduced tetramers (approximately 15-30), so that a meaningful tetramer composition profile can be constructed. We test remote homology detection at the topology and fold superfamily levels using a comprehensive set of fold homologs, culled from the CATH database that share low pairwise sequence similarity. Using the receiver-operating characteristic measure, we demonstrate potentially significant improvement in using information-optimized reduced tetramer composition, over methods relying only on the raw amino acid composition or on traditional sequence alignment, in homology detection at or below the "twilight zone". 2010 Wiley-Liss, Inc.

  11. Fold Homology Detection Using Sequence Fragment Composition Profiles of Proteins

    PubMed Central

    Solis, Armando D.; Rackovsky, Shalom R.

    2010-01-01

    The effectiveness of sequence alignment in detecting structural homology among protein sequences decreases markedly when pairwise sequence identity is low (the so-called “twilight zone” problem of sequence alignment). Alternative sequence comparison strategies able to detect structural kinship among highly divergent sequences are necessary to address this need. Among them are alignment-free methods, which use global sequence properties (such as amino acid composition) to identify structural homology in a rapid and straightforward way. We explore the viability of using tetramer sequence fragment composition profiles in finding structural relationships that lie undetected by traditional alignment. We establish a strategy to recast any given protein sequence into a tetramer sequence fragment composition profile, using a series of amino acid clustering steps that have been optimized for mutual information. Our method has the effect of compressing the set of 160,000 unique tetramers (if using the 20-letter amino acid alphabet) into a more tractable number of reduced tetramers (around 15 to 30), so that a meaningful tetramer composition profile can be constructed. We test remote homology detection at the topology and fold superfamily levels using a comprehensive set of fold homologs, culled from the CATH database, that share low pairwise sequence similarity. Using the receiver operating characteristic (ROC) measure, we demonstrate potentially significant improvement in using information-optimized reduced tetramer composition, over methods relying only on the raw amino acid composition or on traditional sequence alignment, in homology detection at or below the “twilight zone”. PMID:20635424

  12. Multiple site-selective insertions of non-canonical amino acids into sequence-repetitive polypeptides

    PubMed Central

    Wu, I-Lin; Patterson, Melissa A.; Carpenter Desai, Holly E.; Mehl, Ryan A.; Giorgi, Gianluca

    2013-01-01

    A simple and efficient method is described for introduction of non-canonical amino acids at multiple, structurally defined sites within recombinant polypeptide sequences. E. coli MRA30, a bacterial host strain with attenuated activity for release factor 1 (RF1), is assessed for its ability to support the incorporation of a diverse range of non-canonical amino acids in response to multiple encoded amber (TAG) codons within genetic templates derived from superfolder GFP and an elastin-mimetic protein polymer. Suppression efficiency and isolated protein yield were observed to depend on the identity of the orthogonal aminoacyl-tRNA synthetase/tRNACUA pair and the non-canonical amino acid substrate. This approach afforded elastin-mimetic protein polymers containing non-canonical amino acid derivatives at up to twenty-two positions within the repeat sequence with high levels of substitution. The identity and position of the variant residues was confirmed by mass spectrometric analysis of the full-length polypeptides and proteolytic cleavage fragments resulting from thermolysin digestion. The accumulated data suggest that this multi-site suppression approach permits the preparation of protein-based materials in which novel chemical functionality can be introduced at precisely defined positions within the polypeptide sequence. PMID:23625817

  13. Visualization of specific repetitive genomic sequences with fluorescent TALEs in Arabidopsis thaliana.

    PubMed

    Fujimoto, Satoru; Sugano, Shigeo S; Kuwata, Keiko; Osakabe, Keishi; Matsunaga, Sachihiro

    2016-11-01

    Live imaging of the dynamics of nuclear organization provides the opportunity to uncover the mechanisms responsible for four-dimensional genome architecture. Here, we describe the use of fluorescent protein (FP) fusions of transcription activator-like effectors (TALEs) to visualize endogenous genomic sequences in Arabidopsis thaliana. The ability to engineer sequence-specific TALEs permits the investigation of precise genomic sequences. We could detect TALE-FP signals associated with centromeric, telomeric, and rDNA repeats and the signal distribution was consistent with that observed by fluorescent in situ hybridization. TALE-FPs are advantageous because they permit the observation of intact tissues. We used our TALE-FP method to investigate the nuclei of several multicellular plant tissues including roots, hypocotyls, leaves, and flowers. Because TALE-FPs permit live-cell imaging, we successfully observed the temporal dynamics of centromeres and telomeres in plant organs. Fusing TALEs to multimeric FPs enhanced the signal intensity when observing telomeres. We found that the mobility of telomeres was different in sub-nuclear regions. Transgenic plants stably expressing TALE-FPs will provide new insights into chromatin organization and dynamics in multicellular organisms.

  14. Visualization of specific repetitive genomic sequences with fluorescent TALEs in Arabidopsis thaliana

    PubMed Central

    Fujimoto, Satoru; Sugano, Shigeo S.; Kuwata, Keiko; Osakabe, Keishi; Matsunaga, Sachihiro

    2016-01-01

    Live imaging of the dynamics of nuclear organization provides the opportunity to uncover the mechanisms responsible for four-dimensional genome architecture. Here, we describe the use of fluorescent protein (FP) fusions of transcription activator-like effectors (TALEs) to visualize endogenous genomic sequences in Arabidopsis thaliana. The ability to engineer sequence-specific TALEs permits the investigation of precise genomic sequences. We could detect TALE-FP signals associated with centromeric, telomeric, and rDNA repeats and the signal distribution was consistent with that observed by fluorescent in situ hybridization. TALE-FPs are advantageous because they permit the observation of intact tissues. We used our TALE-FP method to investigate the nuclei of several multicellular plant tissues including roots, hypocotyls, leaves, and flowers. Because TALE-FPs permit live-cell imaging, we successfully observed the temporal dynamics of centromeres and telomeres in plant organs. Fusing TALEs to multimeric FPs enhanced the signal intensity when observing telomeres. We found that the mobility of telomeres was different in sub-nuclear regions. Transgenic plants stably expressing TALE-FPs will provide new insights into chromatin organization and dynamics in multicellular organisms. PMID:27811079

  15. Paleogenomics: Investigation of an ancient family of repetitive sequences present in great numbers in human genome

    SciTech Connect

    Zietkiewicz, E.; Labuda, D.; Jurka, J.

    1994-09-01

    Paleogenomics is the research activity aiming to reconstruct ancient genetic events and/or structures from the {open_quotes}fossil{close_quotes} genomic record. With about 120,000 copies, mammalian interspersed repeats, MIRs, represent the second most abundant family of short interspersed repeats in human DNA, only outnumbered by Alu elements. MIR consensus sequence of 100 nucleotides was reconstructed from 455 mutated copies preserved in contemporary genome (GenBank release 69). As no division into subfamilies was observed, we assume that this consensus represents an ancestral MIR sequence. To find out how far MIRs can be traced down the phylogenetic tree, we examined their distribution in a variety of mammalian and non-mammalian DNAs. Oligonucleotide primers based on the MIR consensus were used, one at a time, for PCR amplification of the genomic fragments flanked by MIR repeats (inter-MIR-PCR). Significant amplification in DNA samples from a variety of placental orders as well as marsupials and monotremes indicates that MIRs originated in early mammals. Sequence analysis is consistent with their proliferation during the Mesozoic era. Electrophoretic profiles of inter-MIR-PCR products are distinct among different species. Intra-species comparison of multiple human samples reveals polymorphic bands segregating as Mendelian traits which can be used as genetic markers in both mapping and fingerprinting.

  16. Molecular characterization and chromosomal distribution of species-specific repetitive DNA sequences from Beta corolliflora, a wild relative of sugar beet.

    PubMed

    Gao, D; Schmidt, T; Jung, C

    2000-12-01

    Repetitive DNA sequences have been isolated from a Sau3AI plasmid library of tetraploid Beta corolliflora (2n = 4x = 36), a wild relative of sugar beet (B. vulgaris). The library was screened by differential hybridization with genomic DNA of B. corolliflora and B. vulgaris. When used as probes for Southern hybridization of genomic DNA, six clones were determined to represent highly repetitive DNA families present only in the B. corolliflora genome. Five other sequences were highly repetitive in B. corolliflora and low or single copy in B. vulgaris. The insert size varied between 43 bp and 448 bp. Two sequences pBC1279 and pBC1944 displayed strong homology to a previously cloned satellite DNA from B. nana. With one exception, sequences are tandemly arranged as revealed by a typical ladder pattern after genomic Southern hybridization. The chromosomal distribution of five probes was determined by fluorescence in situ hybridization (FISH) of mitotic metaphases from B. corolliflora and a triploid hybrid between B. vulgaris and B. corolliflora. Three sequences were spread along all chromosome arms of B. corolliflora while one sequence was present on only six chromosomes. The chromosome-specific sequence pBC216 was found in close vicinity to the 5S rDNA located on B. corolliflora chromosome IV. This set of species-specific sequences has the potential to be used as probes for the identification of monosomic alien addition lines and for marker-assisted gene transfer from wild beet to cultivated beet.

  17. A dispersed family of repetitive DNA sequences exhibits characteristics of a transposable element in the genus Lycopersicon.

    PubMed

    Young, R J; Francis, D M; St Clair, D A; Taylor, B H

    1994-06-01

    A segment of DNA 5' to the transcribed region of an auxin-regulated gene, ARPI, from Lycopersicon esculentum Mill. cv. VFN8 contains a sequence with the structural characteristics of a transposable element. The putative element (Lyt1) is 1340 bp long, has terminal inverted repeats of approximately 235 bp and is flanked by 9-bp direct repeats. Lyt1 has a structure similar to the Robertson's Mutator (Mu) family from maize. The terminal inverted repeats are 80% AT-rich, are 96.6% identical, and define a larger family of repetitive elements. Southern analysis and genomic dot-blot reconstructions detected at least 41 copies of Lyt1-hybridizing sequences in red-fruited Lycopersicon spp. (L. esculentum, L. pimpinellifolium and L. cheesmanii), and 2-8 copies in the green-fruited species (L. hirsutum, L. pennellii, L. peruvianum, L. chilense and L. chmielewskii). There were two to four copies in the Solanum spp. closely allied with the genus Lycopersicon (S. lycopersicoides, S. ochranthum and S. juglandifolium), while the more distantly related Solanum spp. showed little (one to two copies in S. tuberosum) to no (S. quitoense) detectable hybridization under stringent conditions. Linkage analysis in the F2 progeny of a cross between L. esculentum and L. cheesmanii indicated that at least six loci that hybridize to the Lyt1 sequence are dispersed in the genome. Polymerase chain reaction and Southern analyses revealed that some red-fruited accessions and L. chmielewskii lacked Lyt1 5' to the transcribed region of ARPI. Subsequent sequence analysis indicated that only one copy of the 9-bp direct repeat (target site) was present, suggesting that transposition of the element into the ARPI gene occurred after the divergence of the red-fruited and green-fruited Lycopersicon species.

  18. Characterization of RFRS9, a second member of the Rhizobium fredii repetitive sequence family from the nitrogen-fixing symbiont R. fredii USDA257.

    PubMed Central

    Krishnan, H B; Pueppke, S G

    1993-01-01

    The genome of the nitrogen-fixing symbiont, Rhizobium fredii USDA257, contains nine copies of repetitive sequences known as the R. fredii repetitive sequence (RFRS) family. We previously sequenced RFRS3, which is linked to symbiosis plasmid-borne nodulation genes of this organism and has substantial homology to the T-DNA of Agrobacterium rhizogenes and lesser homology to reiterated sequences of Bradyrhizobium japonicum. Here we characterize a second family member, RFRS9. The EcoRI fragment containing RFRS9 is 1,248 bp in length and contains a single 666-bp open reading frame that is flanked by perfect 8-bp inverted repeats. Nucleic and amino acid sequences corresponding to the C terminus of the putative RFRS9 protein are nearly identical to those of RFRS3, and they retain homology to DNA from A. rhizogenes. The central portion of the RFRS9 protein also appears to be related to the S locus-specific glycoprotein family of pollen stigma incompatibility glycoproteins from Brassica oleracea, which are involved in signal perception. Sequences that define the RFRS family are restricted to the open reading frame of RFRS9 and associated upstream sequences. These regions also contain a second group of repetitive sequences, which is present in four copies within the genome of USDA257. Both families of repetitive sequences are ubiquitous in R. fredii, and they are preferentially localized on symbiosis plasmids. Southern hybridization confirms that sequences homologous to RFRS9 are present in broad-host-range Rhizobium sp. strain NGR234, in A. rhizogenes, and in two biotype 3 strains of Agrobacterium tumefaciens. Images PMID:8382462

  19. Next-Generation Sequencing Reveals the Repetitive Structure of the Mammoth Genome

    PubMed Central

    Zhao, F.

    2010-01-01

    RP-18 Woolly mammoths were a species of elephant that populated much of Eurasia and North America until about 10,000 years ago. Using the next-generation sequencing technologies, we generated nearly one-fold nuclear genomic sequences, and investigated their transposable element amplification dynamics. We found that the mammoth genome contains a larger proportion of interspersed repeats than any other mammalian genome reported so far, in which the proliferation of the RTE family of retrotransposons (covering 12% of the genome) may be the main reason for an increased genome size. Phylogenetic analysis showed that RTEs in mammoth are closely related to the family BovB/RTE. The incongruence of the reconstructed RTE phylogeny indicates that RTEs in mammoth may be acquired through an ancient lateral gene transfer event. A recent proliferation of SINEs was also found in the probocidean lineage, whereas the Afrotherian-wide SINEs in mammoth have undergone a rather flat and stepwise expansion. Comparisons of the transposable elements (TEs) between mammoth and other mammals may shed light on the evolutionary history of TEs in various mammalian lineages.

  20. Physical localisation of repetitive DNA sequences in Alstroemeria: karyotyping of two species with species-specific and ribosomal DNA.

    PubMed

    Kamstra, S A; Kuipers, A G; De Jeu, M J; Ramanna, M S; Jacobsen, E

    1997-10-01

    Fluorescence in situ hybridization (FISH) was used to localise two species-specific repetitive DNA sequences, A001-I and D32-13, and two highly conserved 25S and 5S rDNA sequences on the metaphase chromosomes of two species of Alstroemeria. The Chilean species, Alstroemeria aurea (2n = 16), has abundant constitutive heterochromatin, whereas the Brazilian species, Alstroemeria inodora, has hardly any heterochromatin. The A. aurea specific A001-I probe hybridized specifically to the C-band regions on all chromosomes. The FISH patterns on A. inodora chromosomes using species-specific probe D32-13 resembled the C-banding pattern and the A001-I pattern on A. aurea chromosomes. There were notable differences in number and distribution of rDNA sites between the two species. The 25S rDNA probe revealed 16 sites in A. aurea that closely colocalised with A001-I sites and 12 in A. inodora that were predominantly detected in the centromeric regions. FISH karyotypes of the two Alstroemeria species were constructed accordingly, enabling full identification of all individual chromosomes. These FISH karyotypes will be useful for monitoring the chromosomes of both Alstroemeria species in hybrids and backcross derivatives.

  1. Characterization of the Pseudomonas putida Mobile Genetic Element ISPpu10: an Occupant of Repetitive Extragenic Palindromic Sequences

    PubMed Central

    Ramos-González, María Isabel; Campos, María Jesús; Ramos, Juan Luis; Espinosa-Urgel, Manuel

    2006-01-01

    We have characterized the Pseudomonas putida KT2440 insertion element ISPpu10. This insertion sequence encodes a transposase which exhibits homology to the transposases and specific recombinases of the Piv/Moov family, and no inverted repeats are present at the borders of its left and right ends, thus constituting a new member of the atypical IS110/IS492 family. ISPpu10 was found in at least seven identical loci in the KT2440 genome, and variants were identified having an extra insertion at distinct loci. ISPpu10 always appeared within the core of specific repetitive extragenic palindromic (REP) sequences TCGCGGGTAAACCCGCTCCTAC, exhibiting high target stringency. One intragenic target was found associated with the truncation of a GGDEF/EAL domain protein. After active in vitro transposition to a plasmid-borne target, a duplication of the CT (underlined above) at the junction as a consequence of the ISPpu10 insertion was experimentally demonstrated for the first time in the IS110/IS492 family. The same duplication was observed after transposition of ISPpu10 from a plasmid to the chromosome of P. putida DOT-T1E, an ISPpu10-free strain with REPs similar to those of strain KT2440. Plasmid ISPpu10-mediated rearrangements were observed in vivo under laboratory conditions and in the plant rhizosphere. PMID:16352819

  2. Specific genomic fingerprints of phytopathogenic Xanthomonas and Pseudomonas pathovars and strains generated with repetitive sequences and PCR

    SciTech Connect

    Louws, F.J.; Stephens, C.T.; Fulbright, D.W.

    1994-07-01

    DNA primers corresponding to conserved motifs in bacterial repetitive (REP, ERIC, and BOX) elements and PCR were used to show that REP-, ERIC-, and BOX-like DNA sequences are widely distributed in phytopathogenic Xanthomonas and Pseudomonas strains. REP-, ERIC-, and BOX-PCR (collectively known as rep-PCR) were used to generate genomic fingerprints of a variety of Xanthomonas and Pseudomonas isolates and to to identify pathovars and strains that were previously not distinguishable by other classification methods. Analogous rep-PCR-derived genomic fingerprints were generated from purified genomic DNA, colonies on agar plates, liquid cultures, and directly from lesions on infected plants. REP-, ERIC-, and BOX-PCR-generated fingerprints of specific Xanthomonas and Pseudomonas strains were found to yield similar conclusions with regard to the identity of and relationship between these strains. This suggests that the distribution of REP-, ERIC-, and BOX-like sequences in these strains is a reflection of their genomic structure. Thus, the rep-PCR technique appears to be a rapid, simple, and reproducible method to identify and classify Xanthomonas and Pseudomonas strains, and it may be a useful diagnostic tool for these important plant pathogens. 70 refs., 5 figs., 1 tab.

  3. Specific genomic fingerprints of phytopathogenic Xanthomonas and Pseudomonas pathovars and strains generated with repetitive sequences and PCR.

    PubMed Central

    Louws, F J; Fulbright, D W; Stephens, C T; de Bruijn, F J

    1994-01-01

    DNA primers corresponding to conserved motifs in bacterial repetitive (REP, ERIC, and BOX) elements and PCR were used to show that REP-, ERIC-, and BOX-like DNA sequences are widely distributed in phytopathogenic Xanthomonas and Pseudomonas strains. REP-, ERIC, and BOX-PCR (collectively known as rep-PCR) were used to generate genomic fingerprints of a variety of Xanthomonas and Pseudomonas isolates and to identify pathovars and strains that were previously not distinguishable by other classification methods. Analogous rep-PCR-derived genomic fingerprints were generated from purified genomic DNA, colonies on agar plates, liquid cultures, and directly from lesions on infected plants. REP, ERIC, and BOX-PCR-generated fingerprints of specific Xanthomonas and Pseudomonas strains were found to yield similar conclusions wtih regard to the identity of and relationship between these strains. This suggests that the distribution of REP-, ERIC, and BOX-like sequences in these strains is a reflection of their genomic structure. Thus, the rep-PCR technique appears to be a rapid, simple, and reproducible method to identify and classify Xanthomonas and Pseudomonas strains, and it may be a useful diagnostic tool for these important plant pathogens. Images PMID:8074510

  4. Methylation levels of the "long interspersed nucleotide element-1" repetitive sequences predict survival of melanoma patients.

    PubMed

    Sigalotti, Luca; Fratta, Elisabetta; Bidoli, Ettore; Covre, Alessia; Parisi, Giulia; Colizzi, Francesca; Coral, Sandra; Massarut, Samuele; Kirkwood, John M; Maio, Michele

    2011-05-26

    The prognosis of cutaneous melanoma (CM) differs for patients with identical clinico-pathological stage, and no molecular markers discriminating the prognosis of stage III individuals have been established. Genome-wide alterations in DNA methylation are a common event in cancer. This study aimed to define the prognostic value of genomic DNA methylation levels in stage III CM patients. Overall level of genomic DNA methylation was measured using bisulfite pyrosequencing at three CpG sites (CpG1, CpG2, CpG3) of the Long Interspersed Nucleotide Element-1 (LINE-1) sequences in short-term CM cultures from 42 stage IIIC patients. The impact of LINE-1 methylation on overall survival (OS) was assessed using Cox regression and Kaplan-Meier analysis. Hypomethylation (i.e., methylation below median) at CpG2 and CpG3 sites significantly associated with improved prognosis of CM, CpG3 showing the strongest association. Patients with hypomethylated CpG3 had increased OS (P = 0.01, log-rank = 6.39) by Kaplan-Meyer analysis. Median OS of patients with hypomethylated or hypermethylated CpG3 were 31.9 and 11.5 months, respectively. The 5 year OS for patients with hypomethylated CpG3 was 48% compared to 7% for patients with hypermethylated sequences. Among the variables examined by Cox regression analysis, LINE-1 methylation at CpG2 and CpG3 was the only predictor of OS (Hazard Ratio = 2.63, for hypermethylated CpG3; 95% Confidence Interval: 1.21-5.69; P = 0.01). LINE-1 methylation is identified as a molecular marker of prognosis for CM patients in stage IIIC. Evaluation of LINE-1 promises to represent a key tool for driving the most appropriate clinical management of stage III CM patients.

  5. Methylation levels of the "long interspersed nucleotide element-1" repetitive sequences predict survival of melanoma patients

    PubMed Central

    2011-01-01

    Background The prognosis of cutaneous melanoma (CM) differs for patients with identical clinico-pathological stage, and no molecular markers discriminating the prognosis of stage III individuals have been established. Genome-wide alterations in DNA methylation are a common event in cancer. This study aimed to define the prognostic value of genomic DNA methylation levels in stage III CM patients. Methods Overall level of genomic DNA methylation was measured using bisulfite pyrosequencing at three CpG sites (CpG1, CpG2, CpG3) of the Long Interspersed Nucleotide Element-1 (LINE-1) sequences in short-term CM cultures from 42 stage IIIC patients. The impact of LINE-1 methylation on overall survival (OS) was assessed using Cox regression and Kaplan-Meier analysis. Results Hypomethylation (i.e., methylation below median) at CpG2 and CpG3 sites significantly associated with improved prognosis of CM, CpG3 showing the strongest association. Patients with hypomethylated CpG3 had increased OS (P = 0.01, log-rank = 6.39) by Kaplan-Meyer analysis. Median OS of patients with hypomethylated or hypermethylated CpG3 were 31.9 and 11.5 months, respectively. The 5 year OS for patients with hypomethylated CpG3 was 48% compared to 7% for patients with hypermethylated sequences. Among the variables examined by Cox regression analysis, LINE-1 methylation at CpG2 and CpG3 was the only predictor of OS (Hazard Ratio = 2.63, for hypermethylated CpG3; 95% Confidence Interval: 1.21-5.69; P = 0.01). Conclusion LINE-1 methylation is identified as a molecular marker of prognosis for CM patients in stage IIIC. Evaluation of LINE-1 promises to represent a key tool for driving the most appropriate clinical management of stage III CM patients. PMID:21615918

  6. Role of repetitive nine-residue sequence motifs in secretion, enzymatic activity, and protein conformation of a family I.3 lipase.

    PubMed

    Kwon, Hyun-Ju; Haruki, Mitsuru; Morikawa, Masaaki; Omori, Kenji; Kanaya, Shigenori

    2002-01-01

    A family I.3 lipase from Pseudomonas sp. MIS38 (PML) contains 12 repeats of a nine-residue sequence motif in the C-terminal region. To elucidate the role of these repetitive sequences, mutant proteins PML5, PML4, PML1, and PML0, in which 7, 8, 11, and all 12 of the repetitive sequences are deleted, and PMLdelta19, in which 19 C-terminal residues are truncated, were constructed. Escherichia coli DH5 cells carrying the Serratia marcescens Lip system permitted the secretion of the wild-type and all of the mutant proteins except for PMLdelta19, although they were partially accumulated in the cells in an insoluble form as well. Both the secretion level and cellular content of the proteins decreased in the order PML > PML5 > PML4 > PML1 > PML0, indicating that repetitive sequences are not required for secretion of PML but are important for its stability in the cells. All the mutant proteins were purified in a refolded form and their biochemical properties were characterized. CD spectra, the Ca2+ contents, and susceptibility to chymotryptic digestion strongly suggested that the five repetitive sequences remaining in PML5 are sufficient to form a beta-roll structure, whereas the four in PML4 are not. PML5 and PMLdelta19 showed both lipase and esterase activities, whereas PML4, PML1, and PML0 were inactive. These results suggest that the enzymatic activity of PML is not seriously affected by a deletion or truncation at the C-terminal region as long as a succession of repetitive sequences can build a beta-roll structure.

  7. 1 Hz repetitive transcranial magnetic stimulation over dorsal premotor cortex enhances offline motor memory consolidation for sequence-specific implicit learning

    PubMed Central

    Meehan, S.K.; Zabukovec, J.R.; Dao, E.; Cheung, K.L.; Linsdell, M.A.; Boyd, L.A.

    2016-01-01

    Consolidation of motor memories associated with skilled practice can occur both online, concurrent with practice, and offline, after practice has ended. The current study investigated the role of dorsal premotor cortex (PMd) in early offline motor memory consolidation of implicit sequence specific learning. Thirty-three participants were assigned to one of three groups of repetitive TMS over left PMd (5 Hz, 1 Hz or control) immediately following practice of a novel continuous tracking task. There was no additional practice following repetitive TMS. This procedure was repeated for 4 days. The continuous tracking task contained a repeated sequence that could be learned implicitly and random sequences that could not. On a separate fifth day, a retention test was performed to assess implicit sequence-specific motor learning of the task. Tracking error was decreased for the group who received 1 Hz repetitive TMS over the PMd during the early consolidation period immediately following practice compared to control or 5 Hz repetitive TMS. Enhanced sequence specific learning with 1 Hz repetitive TMS following practice was due to greater offline consolidation, not differences in online learning between the groups within practice days. A follow-up experiment revealed that stimulation of PMd following practice did not differentially change motor cortical excitability, suggesting that changes in offline consolidation can be largely attributed to stimulation induced changes in PMd. These findings support a differential role for the PMd in support of online and offline sequence specific learning of a visuomotor task and offer converging evidence for competing memory systems. PMID:23834742

  8. Karyotypic Evolution and Chromosomal Organization of Repetitive DNA Sequences in Species of Panaque, Panaqolus, and Scobinancistrus (Siluriformes and Loricariidae) from the Amazon Basin.

    PubMed

    Ayres-Alves, Thayana; Cardoso, Adauto Lima; Nagamachi, Cleusa Yoshiko; Sousa, Leandro Melo de; Pieczarka, Julio Cesar; Noronha, Renata Coelho Rodrigues

    2017-06-01

    Loricariidae family comprises the greatest variability of Neotropical catfish species, with more than 800 valid species. This family shows significant chromosomal diversity. Mapping of repetitive DNA sequences can be very useful in exploring such diversity, especially among groups that appear to share a preserved karyotypic macrostructure. We describe the karyotypes of Panaque armbrusteri and Panaqolus sp., as assessed using classical cytogenetic methods. Moreover, we offer a map of their repetitive sequences, including 18S and 5S ribosomal DNAs, the Rex1 and Rex3 retrotransposons, and the Tc1-mariner transposon in P. armbrusteri, Panaqolus sp., Scobinancistrus aureatus, and Scobinancistrus pariolispos. Those species share chromosome numbers of 2n = 52, but are divergent in their chromosome structures and the distributions of their repetitive DNA sequences. In situ hybridization with 18S and 5S rDNA probes confirms chromosome location in different pairs; in Panaqolus sp. these sites are in synteny. This multigene family organization can be explained by the occurrence of chromosome rearrangements, and possible events, such as transposition and unequal crossing-over. Rex1 and Rex3 retrotransposons and the Tc1-mariner transposon appeared predominantly dispersed and in small clusters in some chromosome regions. These data emphasize the importance of repetitive sequences in promoting the karyotypic evolution of these species.

  9. Long-Term Rasamsonia argillacea Complex Species Colonization Revealed by PCR Amplification of Repetitive DNA Sequences in Cystic Fibrosis Patients.

    PubMed

    Mouhajir, Abdelmounaim; Matray, Olivier; Giraud, Sandrine; Mély, Laurent; Marguet, Christophe; Sermet-Gaudelus, Isabelle; Le Gal, Solène; Labbé, Franck; Person, Christine; Troussier, Françoise; Ballet, Jean-Jacques; Gargala, Gilles; Zouhair, Rachid; Bougnoux, Marie-Elisabeth; Bouchara, Jean-Philippe; Favennec, Loïc

    2016-11-01

    The aim of this work was to document molecular epidemiology of Rasamsonia argillacea species complex isolates from cystic fibrosis (CF) patients. In this work, 116 isolates belonging to this species complex and collected from 26 CF patients and one patient with chronic granulomatous disease were characterized using PCR amplification assays of repetitive DNA sequences and electrophoretic separation of amplicons (rep-PCR). Data revealed a clustering consistent with molecular species identification. A single species was recovered from most patients. Rasamsonia aegroticola was the most common species, followed by R. argillacea sensu stricto and R. piperina, while R. eburnea was not identified. Of 29 genotypes, 7 were shared by distinct patients while 22 were patient specific. In each clinical sample, most isolates exhibited an identical genotype. Genotyping of isolates recovered from sequential samples from the same patient confirmed the capability of R. aegroticola and R. argillacea isolates to chronically colonize the airways. A unique genotype was recovered from two siblings during a 6-month period. In the other cases, a largely dominant genotype was detected. Present results which support the use of rep-PCR for both identification and genotyping for the R. argillacea species complex provide the first molecular evidence of chronic airway colonization by these fungi in CF patients. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  10. Long-Term Rasamsonia argillacea Complex Species Colonization Revealed by PCR Amplification of Repetitive DNA Sequences in Cystic Fibrosis Patients

    PubMed Central

    Mouhajir, Abdelmounaim; Matray, Olivier; Giraud, Sandrine; Mély, Laurent; Marguet, Christophe; Sermet-Gaudelus, Isabelle; Le Gal, Solène; Labbé, Franck; Person, Christine; Troussier, Françoise; Ballet, Jean-Jacques; Gargala, Gilles; Zouhair, Rachid; Bougnoux, Marie-Elisabeth; Bouchara, Jean-Philippe

    2016-01-01

    The aim of this work was to document molecular epidemiology of Rasamsonia argillacea species complex isolates from cystic fibrosis (CF) patients. In this work, 116 isolates belonging to this species complex and collected from 26 CF patients and one patient with chronic granulomatous disease were characterized using PCR amplification assays of repetitive DNA sequences and electrophoretic separation of amplicons (rep-PCR). Data revealed a clustering consistent with molecular species identification. A single species was recovered from most patients. Rasamsonia aegroticola was the most common species, followed by R. argillacea sensu stricto and R. piperina, while R. eburnea was not identified. Of 29 genotypes, 7 were shared by distinct patients while 22 were patient specific. In each clinical sample, most isolates exhibited an identical genotype. Genotyping of isolates recovered from sequential samples from the same patient confirmed the capability of R. aegroticola and R. argillacea isolates to chronically colonize the airways. A unique genotype was recovered from two siblings during a 6-month period. In the other cases, a largely dominant genotype was detected. Present results which support the use of rep-PCR for both identification and genotyping for the R. argillacea species complex provide the first molecular evidence of chronic airway colonization by these fungi in CF patients. PMID:27605712

  11. CONTRAILS: A tool for rapid identification of transgene integration sites in complex, repetitive genomes using low-coverage paired-end sequencing

    PubMed Central

    Lambirth, Kevin C.; Whaley, Adam M.; Schlueter, Jessica A.; Bost, Kenneth L.; Piller, Kenneth J.

    2015-01-01

    Transgenic crops have become a staple in modern agriculture, and are typically characterized using a variety of molecular techniques involving proteomics and metabolomics. Characterization of the transgene insertion site is of great interest, as disruptions, deletions, and genomic location can affect product selection and fitness, and identification of these regions and their integrity is required for regulatory agencies. Here, we present CONTRAILS (Characterization of Transgene Insertion Locations with Sequencing), a straightforward, rapid and reproducible method for the identification of transgene insertion sites in highly complex and repetitive genomes using low coverage paired-end Illumina sequencing and traditional PCR. This pipeline requires little to no troubleshooting and is not restricted to any genome type, allowing use for many molecular applications. Using whole genome sequencing of in-house transgenic Glycine max, a legume with a highly repetitive and complex genome, we used CONTRAILS to successfully identify the location of a single T-DNA insertion to single base resolution. PMID:26697366

  12. Sequence composition and genome organization of maize

    PubMed Central

    Messing, Joachim; Bharti, Arvind K.; Karlowski, Wojciech M.; Gundlach, Heidrun; Kim, Hye Ran; Yu, Yeisoo; Wei, Fusheng; Fuks, Galina; Soderlund, Carol A.; Mayer, Klaus F. X.; Wing, Rod A.

    2004-01-01

    Zea mays L. ssp. mays, or corn, one of the most important crops and a model for plant genetics, has a genome ≈80% the size of the human genome. To gain global insight into the organization of its genome, we have sequenced the ends of large insert clones, yielding a cumulative length of one-eighth of the genome with a DNA sequence read every 6.2 kb, thereby describing a large percentage of the genes and transposable elements of maize in an unbiased approach. Based on the accumulative 307 Mb of sequence, repeat sequences occupy 58% and genic regions occupy 7.5%. A conservative estimate predicts ≈59,000 genes, which is higher than in any other organism sequenced so far. Because the sequences are derived from bacterial artificial chromosome clones, which are ordered in overlapping bins, tagged genes are also ordered along continuous chromosomal segments. Based on this positional information, roughly one-third of the genes appear to consist of tandemly arrayed gene families. Although the ancestor of maize arose by tetraploidization, fewer than half of the genes appear to be present in two orthologous copies, indicating that the maize genome has undergone significant gene loss since the duplication event. PMID:15388850

  13. CA88, a nuclear repetitive DNA sequence identified in Schistosoma mansoni, aids in the genotyping of nine Schistosoma species of medical and veterinary importance.

    PubMed

    Bahia, Diana; Rodrigues, Nilton B; Araújo, Flávio Marcos G; Romanha, Alvaro José; Ruiz, Jerônimo C; Johnston, David A; Oliveira, Guilherme

    2010-07-01

    CA88 is the first long nuclear repetitive DNA sequence identified in the blood fluke, Schistosoma mansoni. The assembled S. mansoni sequence, which contains the CA88 repeat, has 8,887 nucleotides and at least three repeat units of approximately 360 bp. In addition, CA88 also possesses an internal CA microsatellite, identified as SmBr18. Both PCR and BLAST analysis have been used to analyse and confirm the CA88 sequence in other S. mansoni sequences in the public database. PCR-acquired nuclear repetitive DNA sequence profiles from nine Schistosoma species were used to classify this organism into four genotypes. Included among the nine species analysed were five sequences of both African and Asian lineages that are known to infect humans. Within these genotypes, three of them refer to recognised species groups. A panel of four microsatellite loci, including SmBr18 and three previously published loci, has been used to characterise the nine Schistosoma species. Each species has been identified and classified based on its CA88 DNA fingerprint profile. Furthermore, microsatellite sequences and intra-specific variation have also been observed within the nine Schistosoma species sequences. Taken together, these results support the use of these markers in studying the population dynamics of Schistosoma isolates from endemic areas and also provide new methods for investigating the relationships between different populations of parasites. In addition, these data also indicate that Schistosoma magrebowiei is not a sister taxon to Schistosoma mattheei, prompting a new designation to a basal clade.

  14. The repetitive component of the A genome of peanut (Arachis hypogaea) and its role in remodelling intergenic sequence space since its evolutionary divergence from the B genome

    PubMed Central

    Bertioli, David J.; Vidigal, Bruna; Nielen, Stephan; Ratnaparkhe, Milind B.; Lee, Tae-Ho; Leal-Bertioli, Soraya C. M.; Kim, Changsoo; Guimarães, Patricia M.; Seijo, Guillermo; Schwarzacher, Trude; Paterson, Andrew H.; Heslop-Harrison, Pat; Araujo, Ana C. G.

    2013-01-01

    Background and Aims Peanut (Arachis hypogaea) is an allotetraploid (AABB-type genome) of recent origin, with a genome of about 2·8 Gb and a high repetitive content. This study reports an analysis of the repetitive component of the peanut A genome using bacterial artificial chromosome (BAC) clones from A. duranensis, the most probable A genome donor, and the probable consequences of the activity of these elements since the divergence of the peanut A and B genomes. Methods The repetitive content of the A genome was analysed by using A. duranensis BAC clones as probes for fluorescence in situ hybridization (BAC-FISH), and by sequencing and characterization of 12 genomic regions. For the analysis of the evolutionary dynamics, two A genome regions are compared with their B genome homeologues. Key Results BAC-FISH using 27 A. duranensis BAC clones as probes gave dispersed and repetitive DNA characteristic signals, predominantly in interstitial regions of the peanut A chromosomes. The sequences of 14 BAC clones showed complete and truncated copies of ten abundant long terminal repeat (LTR) retrotransposons, characterized here. Almost all dateable transposition events occurred <3·5 million years ago, the estimated date of the divergence of A and B genomes. The most abundant retrotransposon is Feral, apparently parasitic on the retrotransposon FIDEL, followed by Pipa, also non-autonomous and probably parasitic on a retrotransposon we named Pipoka. The comparison of the A and B genome homeologous regions showed conserved segments of high sequence identity, punctuated by predominantly indel regions without significant similarity. Conclusions A substantial proportion of the highly repetitive component of the peanut A genome appears to be accounted for by relatively few LTR retrotransposons and their truncated copies or solo LTRs. The most abundant of the retrotransposons are non-autonomous. The activity of these retrotransposons has been a very significant driver of genome

  15. The repetitive component of the A genome of peanut (Arachis hypogaea) and its role in remodelling intergenic sequence space since its evolutionary divergence from the B genome.

    PubMed

    Bertioli, David J; Vidigal, Bruna; Nielen, Stephan; Ratnaparkhe, Milind B; Lee, Tae-Ho; Leal-Bertioli, Soraya C M; Kim, Changsoo; Guimarães, Patricia M; Seijo, Guillermo; Schwarzacher, Trude; Paterson, Andrew H; Heslop-Harrison, Pat; Araujo, Ana C G

    2013-08-01

    Peanut (Arachis hypogaea) is an allotetraploid (AABB-type genome) of recent origin, with a genome of about 2·8 Gb and a high repetitive content. This study reports an analysis of the repetitive component of the peanut A genome using bacterial artificial chromosome (BAC) clones from A. duranensis, the most probable A genome donor, and the probable consequences of the activity of these elements since the divergence of the peanut A and B genomes. The repetitive content of the A genome was analysed by using A. duranensis BAC clones as probes for fluorescence in situ hybridization (BAC-FISH), and by sequencing and characterization of 12 genomic regions. For the analysis of the evolutionary dynamics, two A genome regions are compared with their B genome homeologues. BAC-FISH using 27 A. duranensis BAC clones as probes gave dispersed and repetitive DNA characteristic signals, predominantly in interstitial regions of the peanut A chromosomes. The sequences of 14 BAC clones showed complete and truncated copies of ten abundant long terminal repeat (LTR) retrotransposons, characterized here. Almost all dateable transposition events occurred <3·5 million years ago, the estimated date of the divergence of A and B genomes. The most abundant retrotransposon is Feral, apparently parasitic on the retrotransposon FIDEL, followed by Pipa, also non-autonomous and probably parasitic on a retrotransposon we named Pipoka. The comparison of the A and B genome homeologous regions showed conserved segments of high sequence identity, punctuated by predominantly indel regions without significant similarity. A substantial proportion of the highly repetitive component of the peanut A genome appears to be accounted for by relatively few LTR retrotransposons and their truncated copies or solo LTRs. The most abundant of the retrotransposons are non-autonomous. The activity of these retrotransposons has been a very significant driver of genome evolution since the evolutionary divergence of the A

  16. Monosomy 1p36 breakpoints indicate repetitive DNA sequence elements may be involved in generating and/or stabilizing some terminal deletions.

    PubMed

    Ballif, Blake C; Gajecka, Marzena; Shaffer, Lisa G

    2004-01-01

    Monosomy 1p36 is the most commonly observed terminal deletion syndrome in humans. Our previous molecular studies on a large cohort of subjects suggest that monosomy 1p36 can result from a variety of chromosomal rearrangements including terminal truncations, interstitial deletions, derivative chromosomes, inverted duplications, and complex rearrangements. However, the mechanism(s) by which rearrangements of 1p36 are generated and/or stabilized is not understood. Sequence analysis of breakpoint junctions may provide valuable clues to the underlying mechanisms of many chromosomal aberrations. In this report, we analyze the breakpoints at the DNA-sequence level in four subjects with variable-sized deletions of 1p36. All four breakpoints fall within repetitive DNA-sequence elements (LINEs, SINEs, etc). This suggests that repetitive DNA-sequence elements may play an important role in generating and/or stabilizing terminal deletions of 1p36. Mechanisms by which repetitive elements may be involved in the process of terminal deletion formation and stabilization are discussed.

  17. Spoligotyping and polymorphic GC-rich repetitive sequence fingerprinting of mycobacterium tuberculosis strains having few copies of IS6110.

    PubMed

    Yang, Z H; Ijaz, K; Bates, J H; Eisenach, K D; Cave, M D

    2000-10-01

    Several genetic loci have been utilized to genotype isolates of Mycobacterium tuberculosis. A shortcoming of the most commonly used method, IS6110 fingerprinting, is that it does not adequately discriminate between isolates having few copies of IS6110. This study was undertaken to compare pTBN12 fingerprinting of polymorphic GC-rich repetitive sequence genes and spoligotyping of the direct repeat locus as secondary typing procedures for M. tuberculosis isolates having fewer than six copies of IS6110. A total of 88 isolates (100% of the isolates with fewer than six copies of IS6110 isolated in Arkansas during 1996 and 1997) were included in this study. Among the 88 isolates, 34 different IS6110 patterns were observed, 10 of which were shared by more than 1 isolate, involving a total of 64 isolates. The 64 isolates were subdivided into 13 clusters (containing 37 isolates) and 27 unique isolates based on a combination of IS6110 and pTBN12 fingerprinting and into 11 clusters (containing 51 isolates) and 13 unique isolates based on a combination of IS6110 fingerprinting and spoligotyping. Identical spoligotypes were found among isolates having different IS6110 patterns, as well as among isolates showing different pTBN12 patterns. In contrast, all isolates that had different IS6110 patterns were found to be unique by pTBN12 typing. The clustering rate was 73, 58, and 42%, respectively, for IS6110 fingerprinting alone, IS6110 fingerprinting and spoligotyping combined, and IS6110 and pTBN12 combined fingerprinting. The data indicate that the pTBN12 method has greater discriminating power among low-copy-number isolates than does spoligotyping.

  18. Neonatal Pasteurella multocida subsp. septica Meningitis Traced to Household Cats: Molecular Linkage Analysis Using Repetitive-Sequence-Based PCR

    PubMed Central

    Freij, Bishara J.; Robinson-Dunn, Barbara; Makin, Jacob; Runge, Jessica K.; Luna, Ruth Ann

    2015-01-01

    Pasteurella multocida is a rare cause of neonatal bacterial meningitis. We describe such a case and verify two household cats as the source of infection using repetitive-element PCR (rep-PCR) molecular fingering. PMID:26491173

  19. Nucleotide sequence composition and method for detection of neisseria gonorrhoeae

    SciTech Connect

    Lo, A.; Yang, H.L.

    1990-02-13

    This patent describes a composition of matter that is specific for {ital Neisseria gonorrhoeae}. It comprises: at least one nucleotide sequence for which the ratio of the amount of the sequence which hybridizes to chromosomal DNA of {ital Neisseria gonorrhoeae} to the amount of the sequence which hybridizes to chromosomal DNA of {ital Neisseria meningitidis} is greater than about five. The ratio being obtained by a method described.

  20. Optimal arbitrarily accurate composite pulse sequences

    NASA Astrophysics Data System (ADS)

    Low, Guang Hao; Yoder, Theodore J.; Chuang, Isaac L.

    2014-02-01

    Implementing a single-qubit unitary is often hampered by imperfect control. Systematic amplitude errors ɛ, caused by incorrect duration or strength of a pulse, are an especially common problem. But a sequence of imperfect pulses can provide a better implementation of a desired operation, as compared to a single primitive pulse. We find optimal pulse sequences consisting of L primitive π or 2π rotations that suppress such errors to arbitrary order O (ɛn) on arbitrary initial states. Optimality is demonstrated by proving an L =O(n) lower bound and saturating it with L =2n solutions. Closed-form solutions for arbitrary rotation angles are given for n =1,2,3,4. Perturbative solutions for any n are proven for small angles, while arbitrary angle solutions are obtained by analytic continuation up to n =12. The derivation proceeds by a novel algebraic and nonrecursive approach, in which finding amplitude error correcting sequences can be reduced to solving polynomial equations.

  1. Optimal arbitrarily accurate composite pulse sequences

    NASA Astrophysics Data System (ADS)

    Low, Guang Hao; Yoder, Theodore

    2014-03-01

    Implementing a single qubit unitary is often hampered by imperfect control. Systematic amplitude errors ɛ, caused by incorrect duration or strength of a pulse, are an especially common problem. But a sequence of imperfect pulses can provide a better implementation of a desired operation, as compared to a single primitive pulse. We find optimal pulse sequences consisting of L primitive π or 2 π rotations that suppress such errors to arbitrary order (ɛn) on arbitrary initial states. Optimality is demonstrated by proving an L = (n) lower bound and saturating it with L = 2 n solutions. Closed-form solutions for arbitrary rotation angles are given for n = 1 , 2 , 3 , 4 . Perturbative solutions for any n are proven for small angles, while arbitrary angle solutions are obtained by analytic continuation up to n = 12 . The derivation proceeds by a novel algebraic and non-recursive approach, in which finding amplitude error correcting sequences can be reduced to solving polynomial equations.

  2. Comparison of automated repetitive-sequence-based polymerase chain reaction and spa typing versus pulsed-field gel electrophoresis for molecular typing of methicillin-resistant Staphylococcus aureus.

    PubMed

    Church, Deirdre L; Chow, Barbara L; Lloyd, Tracie; Gregson, Daniel B

    2011-01-01

    Automated repetitive polymerase chain reaction (PCR) (DiversiLab, bioMérieux, St. Laurent, Quebec, Canada) and single locus sequence typing of the Staphylococcus protein A (spa) gene with spa-type assignment by StaphType RIDOM software were compared to pulsed-field gel electrophoresis (PFGE) as the "gold standard" method for methicillin-resistant Staphylococcus aureus (MRSA) typing. Fifty-four MRSA isolates were typed by all methods: 10 of known PFGE CMRSA type and 44 clinical isolates. Correct assignment of CMRSA type or cluster occurred for 47 of 54 (87%) of the isolates when using a rep-PCR similarity index (SI) of ≥95%. Rep-PCR gave 7 discordant results [CMRSA1 (3), CMRSA2 (1), CMRSA4 (1), and CMRSA10 (2)], and some CMRSA clusters were not distinguished (CMRSA10/5/9, CMRSA 7/8, and CMRSA3/6). Several spa types occurred within a single PFGE or repetitive PCR types among the 19 different spa types found. spa type t037 was shared by CMRSA3 and CMRSA6 strains, and CMRSA9 and most CMRSA10 strains shared spa type t008. Time to results for PFGE, repetitive PCR, and spa typing was 3-4 days, 24 h, and 48 h, respectively. The annual costs of using spa or repetitive PCR were 2.4× and 1.9× higher, respectively, than PFGE but routine use of spa typing would lower annual labor costs by 0.10 full-time equivalents compared to PFGE. Repetitive PCR is a good method for rapid outbreak screening, but MRSA isolates that share the same repetitive PCR or PFGE patterns can be distinguished by spa typing. Copyright © 2011 Elsevier Inc. All rights reserved.

  3. Chromosomal organization of repetitive DNA sequences in Astyanax bockmanni (Teleostei, Characiformes): dispersive location, association and co-localization in the genome.

    PubMed

    Silva, Duílio M Z A; Pansonato-Alves, José Carlos; Utsunomia, Ricardo; Daniel, Sandro Natal; Hashimoto, Diogo Teruo; Oliveira, Claudio; Porto-Foresti, Fabio; Foresti, Fausto

    2013-09-01

    Repetitive DNA sequences constitute a great portion of the genome of eukaryotes and are considered key components to comprehend evolutionary mechanisms and karyotypic differentiation. Aiming to contribute to the knowledge of chromosome structure and organization of some repetitive DNA classes in the fish genome, chromosomes of two allopatric populations of Astyanax bockmanni were analyzed using classic cytogenetics techniques and fluorescent in situ hybridization, with probes for ribosomal DNA sequences, histone DNA and transposable elements. These Astyanax populations showed the same diploid number (2n = 50), however with differences in chromosome morphology, distribution of constitutive heterochromatin, and location of 18S rDNA and retroelement Rex3 sites. In contrast, sites for 5S rDNA and H1, H3 and H4 histones showed to be co-located and highly conserved. Our results indicate that dispersion and variability of 18S rDNA and heterochromatin sites are not associated with macro rearrangements in the chromosome structure of these populations. Similarly, distinct evolutionary mechanisms would act upon histone genes and 5S rDNA, contributing to chromosomal association and co-location of these sequences. Data obtained indicate that distinct mechanisms drive the spreading of repetitive DNAs in the genome of A. bockmanni. Also, mobile elements may account for the polymorphism of the major rDNA sites and heterochromatin in this genus.

  4. Effects of creatine supplementation on repetitive sprint performance and body composition in competitive swimmers.

    PubMed

    Grindstaff, P D; Kreider, R; Bishop, R; Wilson, M; Wood, L; Alexander, C; Almada, A

    1997-12-01

    In a double-blind and randomized manner, 18 male and female junior competitive swimmers supplemented their diets with 21 g.day-1 of creatine monohydrate (Cr) or a maltodextrin placebo (P) for 9 days during training. Prior to and following supplementation, subjects performed three 100-m freestyle sprint swims (long course) with 60 s rest/recovery between heats. In addition, subjects performed three 20-s arm ergometer maximal-effort sprint tests in the prone position with 60 s rest/recovery between sprint tests. Significant differences were observed among swim times, with Cr subjects swimming significantly faster than P subjects following supplementation in Heat 1 and significantly decreasing swim time in the second 100-m sprint. There was also some evidence that cumulative time to perform the three 100-m swims was decreased in the Cr group. Results indicate that 9 days of Cr supplementation during swim training may provide some ergogenic value to competitive junior swimmers during repetitive sprint performance.

  5. Methods and compositions for efficient nucleic acid sequencing

    DOEpatents

    Drmanac, Radoje

    2002-01-01

    Disclosed are novel methods and compositions for rapid and highly efficient nucleic acid sequencing based upon hybridization with two sets of small oligonucleotide probes of known sequences. Extremely large nucleic acid molecules, including chromosomes and non-amplified RNA, may be sequenced without prior cloning or subcloning steps. The methods of the invention also solve various current problems associated with sequencing technology such as, for example, high noise to signal ratios and difficult discrimination, attaching many nucleic acid fragments to a surface, preparing many, longer or more complex probes and labelling more species.

  6. Methods and compositions for efficient nucleic acid sequencing

    DOEpatents

    Drmanac, Radoje

    2006-07-04

    Disclosed are novel methods and compositions for rapid and highly efficient nucleic acid sequencing based upon hybridization with two sets of small oligonucleotide probes of known sequences. Extremely large nucleic acid molecules, including chromosomes and non-amplified RNA, may be sequenced without prior cloning or subcloning steps. The methods of the invention also solve various current problems associated with sequencing technology such as, for example, high noise to signal ratios and difficult discrimination, attaching many nucleic acid fragments to a surface, preparing many, longer or more complex probes and labelling more species.

  7. Construction of validated, non-redundant composite protein sequence databases.

    PubMed

    Bleasby, A J; Wootton, J C

    1990-01-01

    A strategy has been developed for the construction of a validated, comprehensive composite protein sequence database. Entries are amalgamated from primary source data bases by a largely automated set of processes in which redundant and trivially different entries are eliminated. A modular approach has been adopted to allow scientific judgement to be used at each stage of database processing and amalgamation. Source databases are assigned a priority depending on the quality of sequence validation and commenting. Rejection of entries from the lower priority database, in each pairwise comparison of databases, is carried out according to optionally defined redundancy criteria based on sequence segment mismatches. Efficient algorithms for this methodology are embodied in the COMPO software system. COMPO has been applied for over 2 years in construction and regular updating of the OWL composite protein sequence database from the source databases NBRF-PIR, SWISS-PROT, a GenBank translation retrieved from the feature tables, NBRF-NEW, NEWAT86, PSD-KYOTO and the sequences contained in the Brookhaven protein structure databank. OWL is part of the ISIS integrated data resource of protein sequence and structure [Akrigg et al. (1988) Nature, 335, 745-746]. The modular nature of the integration process greatly facilitates the frequent updating of OWL following releases of the source databases. The extent of redundancy in these sources is revealed by the comparison process. The advantages of a robust composite database for sequence similarity searching and information retrieval are discussed.

  8. Dynamic chromosome reorganization in the osprey ( Pandion haliaetus , Pandionidae, Falconiformes): relationship between chromosome size and the chromosomal distribution of centromeric repetitive DNA sequences.

    PubMed

    Nishida, C; Ishishita, S; Yamada, K; Griffin, D K; Matsuda, Y

    2014-01-01

    The osprey (Pandion haliaetus) has a diploid number of 74 chromosomes, consisting of a large number of medium-sized macrochromosomes and relatively few microchromosomes; this differs greatly from the typical avian karyotype. Chromosome painting with chicken DNA probes revealed that the karyotype of P. haliaetus differs from the chicken karyotype by at least 14 fission events involving macrochromosomes (chicken chromosomes 1-9 and Z) and at most 15 fusions of microchromosomes, suggesting that considerable karyotype reorganization occurred in P. haliaetus in a similar manner previously reported for Accipitridae. A distinct difference was observed, however, between Accipitridae and Pandionidae with respect to the pattern of chromosome rearrangements that occurred after fissions of macrochromosomes. Metacentric or submetacentric chromosomes 1-5 in P. haliaetus appear to have been formed by centric fusion of chromosome segments derived from macrochromosomal fissions. By contrast, many pairs of bi-armed chromosomes in Accipitridae species seem to result from pericentric inversions that occurred in the fission-derived chromosomes. Two families of repetitive sequences were isolated; the 173-bp PHA-HaeIII sequence occurred on all chromosomes, whereas intense signals from the 742-bp PHA-NsiI sequence were localized to all acrocentric chromosomes, with weak signals on most of the bi-armed chromosomes. Two repetitive sequences cohybridized in the centromeric heterochromatin; however, the sequences differed in unit size, nucleotide sequence and GC content. The results suggest that the 2 sequence families originated from different ancestral sequences and were homogenized independently in centromeres, and that a chromosome size-dependent compartmentalization may have been lost in P. haliaetus. © 2014 S. Karger AG, Basel.

  9. Soil amino acid composition across a boreal forest successional sequence

    Treesearch

    Nancy R. Werdin-Pfisterer; Knut Kielland; Richard D. Boone

    2009-01-01

    Soil amino acids are important sources of organic nitrogen for plant nutrition, yet few studies have examined which amino acids are most prevalent in the soil. In this study, we examined the composition, concentration, and seasonal patterns of soil amino acids across a primary successional sequence encompassing a natural gradient of plant productivity and soil...

  10. Optimized control of multistate quantum systems by composite pulse sequences

    SciTech Connect

    Genov, G. T.; Vitanov, N. V.; Torosov, B. T.

    2011-12-15

    We introduce a technique for derivation of high-fidelity composite pulse sequences for two types of multistate quantum systems: systems with the SU(2) and Morris-Shore dynamic symmetries. For the former type, we use the Majorana decomposition to reduce the dynamics to an effective two-state system, which allows us to find the propagator analytically and use the pool of available composite pulses for two-state systems. For the latter type of multistate systems, we use the Morris-Shore decomposition, which reduces the multistate dynamics to a set of two-state systems. We present examples which demonstrate that the multistate composite sequences open a variety of possibilities for coherent control of quantum systems with multiple states.

  11. Phylogenetic Heatmaps Highlight Composition Biases in Sequenced Reads

    PubMed Central

    Choudhari, Sulbha; Grigoriev, Andrey

    2017-01-01

    Due to advancements in sequencing technology, sequence data production is no longer a constraint in the field of microbiology and has made it possible to study uncultured microbes or whole environments using metagenomics. However, these new technologies introduce different biases in metagenomic sequencing, affecting the nucleotide distribution of resulting sequence reads. Here, we illustrate such biases using two methods. One is based on phylogenetic heatmaps (PGHMs), a novel approach for compact visualization of sequence composition differences between two groups of sequences containing the same phylogenetic groups. This method is well suited for finding noise and biases when comparing metagenomics samples. We apply PGHMs to detect noise and bias in the data produced with different DNA extraction protocols, different sequencing platforms and different experimental frameworks. In parallel, we use principal component analysis displaying different clustering of sequences from each sample to support our findings and illustrate the utility of PGHMs. We considered contributions of the read length and GC-content variation and observed that in most cases biases were generally due to the GC-content of the reads. PMID:28125031

  12. High repetition rate dual-rod acousto-optics Q-switched composite Nd:YVO4 laser.

    PubMed

    Yan, Xingpeng; Liu, Qiang; Fu, Xing; Chen, Hailong; Gong, Mali; Wang, Dongsheng

    2009-11-23

    We demonstrate the high-repetition rate acousto-optic Q-switching of a dual-rod Nd:YVO4 laser. Two thermally bonded composite YVO4-Nd:YVO4-YVO4 rod crystals were used as the gain medium to reduce the serious thermal effect. The pump mode and its influence on the laser mode were analyzed, and the effective pump radius was controlled by tuning the spectrum of laser diodes with adjustment on the temperature of laser diodes. Three different configurations of cavity optics were designed and the output performance using these cavities was investigated. In Q-switching operation, 73.2 W TEM00 mode average power at 650 kHz was obtained. The stable Q-switching range was from 80 kHz to 650 kHz with the pulse duration increasing from 17.5 ns to 80 ns. In CW operation, 78 W TEM00 mode and 93 W multi-mode output power was achieved with different cavity designs, corresponding to the optical-optical efficiency of 46.5% and 52.2% respectively.

  13. A BR 1 gene in Chironomus tentans has a composite structure: a large repetitive core block is separated from a short unrelated 3'-terminal domain by a small intron.

    PubMed Central

    Höög, C; Engberg, C; Wieslander, L

    1986-01-01

    The large Balbiani ring (BR) genes in the dipteran genus Chironomus have been considered to be homogeneous repetitive structures. Analysis of a genomic DNA segment now reveals that a BR 1 gene in C. tentans is a composite gene, consisting of two different types of sequences. A 15-20 kb core block of tandemly arranged repeat units extends close to the 3' end of the BR 1 gene and ends in repetitive structures partly different from the repeat units in the core block. A 55 bp long intron separates the core block, which probably constitutes a single exon, from a non-related 3'-exon, comprising the final 332 bp of the translated part of the gene. According to hydrophobicity and secondary structure predictions, the 3'-exon encoded peptide is distinctly different from the repetitive core block domain and attains a globular structure. The carboxyl-terminal peptide domain is likely to be a general feature of BR encoded proteins and may have important functions in the excretion and polymerisation of the secretory proteins. Images PMID:3003693

  14. 100 Repetitions

    ERIC Educational Resources Information Center

    Benson, Jeffrey

    2012-01-01

    One hundred repetitions--100 "useful" repetitions. This notion has guided the author's work in alternative education programs for almost 20 years, dealing with the most challenging students, from addicts to conduct-disordered adolescents to traumatized 5th graders. There are no magic tricks. The role of educators is to align with the healthy…

  15. 100 Repetitions

    ERIC Educational Resources Information Center

    Benson, Jeffrey

    2012-01-01

    One hundred repetitions--100 "useful" repetitions. This notion has guided the author's work in alternative education programs for almost 20 years, dealing with the most challenging students, from addicts to conduct-disordered adolescents to traumatized 5th graders. There are no magic tricks. The role of educators is to align with the healthy…

  16. Expectancy and Repetition in Task Preparation

    NASA Technical Reports Server (NTRS)

    Ruthruff, E.; Remington, R. W.; Johnston, James C.; Null, Cynthia H. (Technical Monitor)

    1996-01-01

    We studied the mechanisms of task preparation using a design that pitted task expectancy against task repetition. In one experiment, two simple cognitive tasks were presented in a predictable sequence containing both repetitions and non-repetitions. The typical task sequence was AABBAABB. Occasional violations of this sequence allowed us to measure the effects of valid versus invalid expectancy. With this design, we were able to study the effects of task expectancy, task repetition, and interaction.

  17. Highly species-specific centromeric repetitive DNA sequences in lizards: molecular cytogenetic characterization of a novel family of satellite DNA sequences isolated from the water monitor lizard (Varanus salvator macromaculatus, Platynota).

    PubMed

    Chaiprasertsri, Nampech; Uno, Yoshinobu; Peyachoknagul, Surin; Prakhongcheep, Ornjira; Baicharoen, Sudarath; Charernsuk, Saranon; Nishida, Chizuko; Matsuda, Yoichi; Koga, Akihiko; Srikulnath, Kornsorn

    2013-01-01

    Two novel repetitive DNA sequences, VSAREP1 and VSAREP2, were isolated from the water monitor lizard (Varanus salvator macromaculatus, Platynota) and characterized using molecular cytogenetics. The respective lengths and guanine-cytosine (GC) contents of the sequences were 190 bp and 57.5% for VSAREP1 and 185 bp and 59.7% for VSAREP2, and both elements were tandemly arrayed as satellite DNA in the genome. VSAREP1 and VSAREP2 were each located at the C-positive heterochromatin in the pericentromeric region of chromosome 2q, the centromeric region of chromosome 5, and 3 pairs of microchromosomes. This suggests that genomic compartmentalization between macro- and microchromosomes might not have occurred in the centromeric repetitive sequences of V. salvator macromaculatus. These 2 sequences did only hybridize to genomic DNA of V. salvator macromaculatus, but no signal was observed even for other squamate reptiles, including Varanus exanthematicus, which is a closely related species of V. salvator macromaculatus. These results suggest that these sequences were differentiated rapidly or were specifically amplified in the V. salvator macromaculatus genome.

  18. Differentiation of the XY sex chromosomes in the fish Hoplias malabaricus (Characiformes, Erythrinidae): unusual accumulation of repetitive sequences on the X chromosome.

    PubMed

    Cioffi, M B; Martins, C; Vicari, M R; Rebordinos, L; Bertollo, L A C

    2010-01-01

    The wolf fish Hoplias malabaricus (Erythrinidae) presents a high karyotypic diversity, with 7 karyomorphs identified. Karyomorph A is characterized by 2n = 42 chromosomes, without morphologically differentiated sex chromosomes. Karyomorph B also has 2n = 42 chromosomes for both sexes, but differs by a distinct heteromorphic XX/XY sex chromosome system. The cytogenetic mapping of 5 classes of repetitive DNA indicated similarities between both karyomorphs and the probable derivation of the XY chromosomes from pair No. 21 of karyomorph A. These chromosomes appear to be homeologous since the distribution of (GATA)(n) sequences, 18S rDNA and 5SHindIII-DNA sites supports their potential relatedness. Our data indicate that the differentiation of the long arms of the X chromosome occurred by accumulation of heterochromatin and 18S rDNA cistrons from the ancestral homomorphic pair No. 21 present in karyomorph A. These findings are further supported by the distribution of the Cot-1 DNA fraction. In addition, while the 18S rDNA cistrons were maintained and amplified on the X chromosomes, they were lost in the Y chromosome. The X chromosome was a clearly preferred site for the accumulation of DNA repeats, representing an unusual example of an X clustering more repetitive sequences than the Y during sex chromosome differentiation in fish. Copyright 2010 S. Karger AG, Basel.

  19. Variation in extragenic repetitive DNA sequences in Pseudomonas syringae and potential use of modified REP primers in the identification of closely related isolates

    PubMed Central

    Çepni, Elif; Gürel, Filiz

    2012-01-01

    In this study, Pseudomonas syringe pathovars isolated from olive, tomato and bean were identified by species-specific PCR and their genetic diversity was assessed by repetitive extragenic palindromic (REP)-PCR. Reverse universal primers for REP-PCR were designed by using the bases of A, T, G or C at the positions of 1, 4 and 11 to identify additional polymorphism in the banding patterns. Binding of the primers to different annealing sites in the genome revealed additional fingerprint patterns in eight isolates of P. savastanoi pv. savastanoi and two isolates of P. syringae pv. tomato. The use of four different bases in the primer sequences did not affect the PCR reproducibility and was very efficient in revealing intra-pathovar diversity, particularly in P. savastanoi pv. savastanoi. At the pathovar level, the primer BOX1AR yielded shared fragments, in addition to five bands that discriminated among the pathovars P. syringae pv. phaseolicola, P. savastanoi pv. savastanoi and P. syringae pv. tomato. REP-PCR with a modified primer containing C produced identical bands among the isolates in a pathovar but separated three pathovars more distinctly than four other primers. Although REP- and BOX-PCRs have been successfully used in the molecular identification of Pseudomonas isolates from Turkish flora, a PCR based on inter-enterobacterial repetitive intergenic concensus (ERIC) sequences failed to produce clear banding patterns in this study. PMID:23055805

  20. Structure of a D-protein gene and amino-acid sequences of the highly repetitive D-proteins secreted by the accessory glands of the mealworm beetle.

    PubMed

    Paesen, G C; Feng, X; Happ, G M

    1996-04-16

    The D-group proteins form the major component of the proteinaceous secretion of the tubular accessory glands of the yellow mealworm beetle, Tenebrio molitor. In a previous paper, we reported the sequence of two D-protein cDNAs and their inferred translation products. Both proteins contain three highly repetitive domains (A, A' and B). In this paper, we present the cDNA-inferred sequences of 8 more D-proteins, none of which contains an A' domain. We also present the structure of a D-protein gene. Southern analysis suggests that genes coding for an A' domain are relatively rare. Genes with a total of 7 or 8 (A + B domain) repeats seem most common.

  1. Sex determination of porcine embryos using a new developed duplex polymerase chain reaction procedure based on the amplification of repetitive sequences.

    PubMed

    Torner, Eva; Bussalleu, Eva; Briz, M Dolors; Gutiérrez-Adán, Alfonso; Bonet, Sergi

    2013-01-01

    Polymerase chain reaction (PCR)-based assays have become increasingly prevalent for sexing embryos. The aim of the present study was to develop a suitable duplex PCR procedure based on the amplification of porcine repetitive sequences for sexing porcine tissues, embryos and single cells. Primers were designed targeting the X12696 Y chromosome-specific repeat sequence (SUSYa and SUSYb; sex-related primer sets), the multicopy porcine-specific mitochondrial 12S rRNA gene (SUS12S; control primer set) and the X51555 1 chromosome repeat sequence (SUS1; control primer set). The specificity of the primer sets was established and the technique was optimised by testing combinations of two specific primer sets (SUSYa/SUS12S; SUSYb/SUS12S), different primer concentrations, two sources of DNA polymerase, different melting temperatures and different numbers of amplification cycles using genomic DNA from porcine ovarian and testicular tissue. The optimised SUSYa/SUS12S- and SUSYb/SUS12S-based duplex PCR procedures were applied to porcine in vitro-produced (IVP) blastocysts, cell-stage embryos and oocytes. The SUSYb/SUS12S primer-based procedure successfully sexed porcine single cells and IVP cell-stage embryos (100% efficiency), as well as blastocysts (96.6% accuracy; 96.7% efficiency). This is the first report to demonstrate the applicability of these repetitive sequences for this purpose. In conclusion, the SUSYb/SUS12S primer-based duplex PCR procedure is highly reliable and sensitive for sexing porcine IVP embryos.

  2. The RNase P RNA from cyanobacteria: short tandemly repeated repetitive (STRR) sequences are present within the RNase P RNA gene in heterocyst-forming cyanobacteria.

    PubMed Central

    Vioque, A

    1997-01-01

    The RNase P RNA gene (rnpB) from 10 cyanobacteria has been characterized. These new RNAs, together with the previously available ones, provide a comprehensive data set of RNase P RNA from diverse cyanobacterial lineages. All heterocystous cyanobacteria, but none of the non-heterocystous strains analyzed, contain short tandemly repeated repetitive (STRR) sequences that increase the length of helix P12. Site-directed mutagenesis experiments indicate that the STRR sequences are not required for catalytic activity in vitro. STRR sequences seem to have recently and independently invaded the RNase P RNA genes in heterocyst-forming cyanobacteria because closely related strains contain unrelated STRR sequences. Most cyanobacteria RNase P RNAs lack the sequence GGU in the loop connecting helices P15 and P16 that has been established to interact with the 3'-end CCA in precursor tRNA substrates in other bacteria. This character is shared with plastid RNase P RNA. Helix P6 is longer than usual in most cyanobacteria as well as in plastid RNase P RNA. PMID:9254706

  3. Whole-genome in-silico subtractive hybridization (WISH)--using massive sequencing for the identification of unique and repetitive sex-specific sequences: the example of Schistosoma mansoni.

    PubMed

    Portela, Julien; Grunau, Christoph; Cosseau, Céline; Beltran, Sophie; Dantec, Christelle; Parrinello, Hugues; Boissier, Jérôme

    2010-06-21

    Emerging methods of massive sequencing that allow for rapid re-sequencing of entire genomes at comparably low cost are changing the way biological questions are addressed in many domains. Here we propose a novel method to compare two genomes (genome-to-genome comparison). We used this method to identify sex-specific sequences of the human blood fluke Schistosoma mansoni. Genomic DNA was extracted from male and female (heterogametic) S. mansoni adults and sequenced with a Genome Analyzer (Illumina). Sequences are available at the NCBI sequence read archive http://www.ncbi.nlm.nih.gov/Traces/sra/ under study accession number SRA012151.6. Sequencing reads were aligned to the genome, and a pseudogenome composed of known repeats. Straightforward comparative bioinformatics analysis was performed to compare male and female schistosome genomes and identify female-specific sequences. We found that the S. mansoni female W chromosome contains only few specific unique sequences (950 Kb i.e. about 0.2% of the genome). The majority of W-specific sequences are repeats (10.5 Mb i.e. about 2.5% of the genome). Arbitrarily selected W-specific sequences were confirmed by PCR. Primers designed for unique and repetitive sequences allowed to reliably identify the sex of both larval and adult stages of the parasite. Our genome-to-genome comparison method that we call "whole-genome in-silico subtractive hybridization" (WISH) allows for rapid identification of sequences that are specific for a certain genotype (e.g. the heterogametic sex). It can in principle be used for the detection of any sequence differences between isolates (e.g. strains, pathovars) or even closely related species.

  4. One hertz repetitive transcranial magnetic stimulation over dorsal premotor cortex enhances offline motor memory consolidation for sequence-specific implicit learning.

    PubMed

    Meehan, S K; Zabukovec, J R; Dao, E; Cheung, K L; Linsdell, M A; Boyd, L A

    2013-10-01

    Consolidation of motor memories associated with skilled practice can occur both online, concurrent with practice, and offline, after practice has ended. The current study investigated the role of dorsal premotor cortex (PMd) in early offline motor memory consolidation of implicit sequence-specific learning. Thirty-three participants were assigned to one of three groups of repetitive transcranial magnetic stimulation (rTMS) over left PMd (5 Hz, 1 Hz or control) immediately following practice of a novel continuous tracking task. There was no additional practice following rTMS. This procedure was repeated for 4 days. The continuous tracking task contained a repeated sequence that could be learned implicitly and random sequences that could not. On a separate fifth day, a retention test was performed to assess implicit sequence-specific motor learning of the task. Tracking error was decreased for the group who received 1 Hz rTMS over the PMd during the early consolidation period immediately following practice compared with control or 5 Hz rTMS. Enhanced sequence-specific learning with 1 Hz rTMS following practice was due to greater offline consolidation, not differences in online learning between the groups within practice days. A follow-up experiment revealed that stimulation of PMd following practice did not differentially change motor cortical excitability, suggesting that changes in offline consolidation can be largely attributed to stimulation-induced changes in PMd. These findings support a differential role for the PMd in support of online and offline sequence-specific learning of a visuomotor task and offer converging evidence for competing memory systems. © 2013 Federation of European Neuroscience Societies and John Wiley & Sons Ltd.

  5. Patterns of rDNA and telomeric sequences diversification: contribution to repetitive DNA organization in Phyllostomidae bats.

    PubMed

    Calixto, Merilane da Silva; de Andrade, Izaquiel Santos; Cabral-de-Mello, Diogo Cavalcanti; Santos, Neide; Martins, Cesar; Loreto, Vilma; de Souza, Maria José

    2014-02-01

    Chromosomal organization and the evolution of genome architecture can be investigated by physical mapping of the genes for 45S and 5S ribosomal DNAs (rDNAs) and by the analysis of telomeric sequences. We studied 12 species of bats belonging to four subfamilies of the family Phyllostomidae in order to correlate patterns of distribution of heterochromatin and the multigene families for rDNA. The number of clusters for 45S gene ranged from one to three pairs, with exclusively location in autosomes, except for Carollia perspicillata that had in X chromosome. The 5S gene all the species studied had only one site located on an autosomal pair. In no species the 45S and 5S genes collocated. The fluorescence in situ hybridization (FISH) probe for telomeric sequences revealed fluorescence on all telomeres in all species, except in Carollia perspicillata. Non-telomeric sites in the pericentromeric region of the chromosomes were observed in most species, ranged from one to 12 pairs. Most interstitial telomeric sequences were coincident with heterochromatic regions. The results obtained in the present work indicate that different evolutionary mechanisms are acting in Phyllostomidae genome architecture, as well as the occurrence of Robertsonian fusion during the chromosomal evolution of bats without a loss of telomeric sequences. These data contribute to understanding the organization of multigene families and telomeric sequences on bat genome as well as the chromosomal evolutionary history of Phyllostomidae bats.

  6. Nuclear RNAi contributes to the silencing of off-target genes and repetitive sequences in Caenorhabditis elegans.

    PubMed

    Zhou, Xufei; Xu, Fei; Mao, Hui; Ji, Jiaojiao; Yin, Meng; Feng, Xuezhu; Guang, Shouhong

    2014-05-01

    Small RNAs recognize, bind, and regulate other complementary cellular RNAs. The introduction of small RNAs to eukaryotic cells frequently results in unintended silencing of related, but not identical, RNAs: a process termed off-target gene silencing. Off-target gene silencing is one of the major concerns during the application of small RNA-based technologies for gene discovery and the treatment of human disease. Off-target gene silencing is commonly thought to be due to inherent biochemical limitations of the RNAi machinery. Here we show that following the introduction of exogenous sources of double-stranded RNA, the nuclear RNAi pathway, but not its cytoplasmic counterparts, is the primary source of off-target silencing in Caenorhabditis elegans. In addition, we show that during the normal course of growth and development the nuclear RNAi pathway regulates repetitive gene families. Therefore, we speculate that RNAi off-target effects might not be "mistakes" but rather an intentional and genetically programmed aspect of small RNA-mediated gene silencing, which might allow small RNAs to silence rapidly evolving parasitic nucleic acids. Finally, reducing off-target effects by manipulating the nuclear RNAi pathway in vivo might improve the efficacy of small RNA-based technologies.

  7. Heterogeneity of clinical and environmental isolates of Mycobacterium fortuitum using repetitive element sequence-based PCR: municipal water an unlikely source of community-acquired infections.

    PubMed

    Thomson, R M; Tolson, C E; Carter, R; Huygens, F; Hargreaves, M

    2014-10-01

    M. fortuitum is a rapidly growing mycobacterium associated with community-acquired and nosocomial wound, soft tissue, and pulmonary infections. It has been postulated that water has been the source of infection especially in the hospital setting. The aim of this study was to determine if municipal water may be the source of community-acquired or nosocomial infections in the Brisbane area. Between 2007 and 2009, 20 strains of M. fortuitum were recovered from municipal water and 53 patients' isolates were submitted to the reference laboratory. A wide variation in strain types was identified using repetitive element sequence-based PCR, with 13 clusters of ⩾2 indistinguishable isolates, and 28 patterns consisting of individual isolates. The clusters could be grouped into seven similar groups (>95% similarity). Municipal water and clinical isolates collected during the same time period and from the same geographical area consisted of different strain types, making municipal water an unlikely source of sporadic human infection.

  8. Robustness of composite pulse sequences to time-dependent noise

    NASA Astrophysics Data System (ADS)

    Kabytayev, Chingiz; Green, Todd J.; Khodjasteh, Kaveh; Viola, Lorenza; Biercuk, Michael J.; Brown, Kenneth R.

    2014-03-01

    Quantum control protocols can minimize the effect of noise sources that reduce the quality of quantum operations. Originally developed for NMR, composite pulse sequences correct for unknown static control errors . We study these compensating pulses in the general case of time-varying Gaussian control noise using a filter-function approach and detailed numerics. Three different noise models were considered in this work: amplitude noise, detuning noise and simultaneous presence of both noises. Pulse sequences are shown to be robust to noise up to frequencies as high as ~10% of the Rabi frequency. Robustness of pulses designed for amplitude noise is explained using a geometric picture that naturally follows from filter function. We also discuss future directions including new pulses correcting for noise of certain frequency. True J. Merrill and Kenneth R. Brown. arXiv:1203.6392v1. In press Adv. Chem. Phys. (2013)

  9. Evaluation of a high-throughput repetitive-sequence-based PCR system for DNA fingerprinting of Mycobacterium tuberculosis and Mycobacterium avium complex strains.

    PubMed

    Cangelosi, Gerard A; Freeman, Robert J; Lewis, Kaeryn N; Livingston-Rosanoff, Devon; Shah, Ketan S; Milan, Sparrow Joy; Goldberg, Stefan V

    2004-06-01

    Repetitive-sequence-based PCR (rep-PCR) is useful for generating DNA fingerprints of diverse bacterial and fungal species. Rep-PCR amplicon fingerprints represent genomic segments lying between repetitive sequences. A commercial system that electrophoretically separates rep-PCR amplicons on microfluidic chips, and provides computer-generated readouts of results has been adapted for use with Mycobacterium species. The ability of this system to type M. tuberculosis and M. avium complex (MAC) isolates was evaluated. M. tuberculosis strains (n = 56) were typed by spoligotyping with rep-PCR as a high-resolution adjunct. Results were compared with those generated by a standard approach of spoligotyping with IS6110-targeted restriction fragment length polymorphism (IS6110-RFLP) as the high-resolution adjunct. The sample included 11 epidemiologically and genotypically linked outbreak isolates and a population-based sample of 45 isolates from recent immigrants to Seattle, Wash., from the African Horn countries of Somalia, Eritrea, and Ethiopia. Twenty isolates exhibited unique spoligotypes and were not analyzed further. Of the 36 outbreak and African Horn isolates with nonunique spoligotypes, 23 fell into four clusters identified by IS6110-RFLP and rep-PCR, with 97% concordance observed between the two methods. Both approaches revealed extensive strain heterogeneity within the African Horn sample, consistent with a predominant pattern of reactivation of latent infections in this immigrant population. Rep-PCR exhibited 89% concordance with IS1245-RFLP typing of 28 M. avium subspecies avium strains. For M. tuberculosis as well as M. avium subspecies avium, the discriminative power of rep-PCR equaled or exceeded that of RFLP. Rep-PCR also generated DNA fingerprints from M. intracellulare (n = 8) and MAC(x) (n = 2) strains. It shows promise as a fast, unified method for high-throughput genotypic fingerprinting of multiple Mycobacterium species.

  10. Repetitive sequences originating from the centromere constitute large-scale heterochromatin in the telomere region in the siamang, a small ape

    PubMed Central

    Koga, A; Hirai, Y; Hara, T; Hirai, H

    2012-01-01

    Chromosomes of the siamang Symphalangus syndactylus (a small ape) carry large-scale heterochromatic structures at their ends. These structures look similar, by chromosome C-banding, to chromosome-end heterochromatin found in chimpanzee, bonobo and gorilla (African great apes), of which a major component is tandem repeats of 32-bp-long, AT-rich units. In the present study, we identified repetitive sequences that are a major component of the siamang heterochromatin. Their repeat units are 171 bp in length, and exhibit sequence similarity to alpha satellite DNA, a major component of the centromeres in primates. Thus, the large-scale heterochromatic structures have different origins between the great apes and the small ape. The presence of alpha satellite DNA in the telomere region has previously been reported in the white-cheeked gibbon Nomascus leucogenys, another small ape species. There is, however, a difference in the size of the telomere-region alpha satellite DNA, which is far larger in the siamang. It is not known whether the sequences of these two species (of different genera) have a common origin because the phylogenetic relationship of genera within the small ape family is still not clear. Possible evolutionary scenarios are discussed. PMID:22669075

  11. Comparison of pulsed-field gel electrophoresis & repetitive sequence-based PCR methods for molecular epidemiological studies of Escherichia coli clinical isolates

    PubMed Central

    Bae, Il Kwon; Kim, Juwon; Sun, Je Young Hannah; Jeong, Seok Hoon; Kim, Yong-Rok; Wang, Kang-Kyun; Lee, Kyungwon

    2014-01-01

    Background & objectives: PFGE, rep-PCR, and MLST are widely used to identify related bacterial isolates and determine epidemiologic associations during outbreaks. This study was performed to compare the ability of repetitive sequence-based PCR (rep-PCR) and pulsed-field gel electrophoresis (PFGE) to determine the genetic relationships among Escherichia coli isolates assigned to various sequence types (STs) by two multilocus sequence typing (MLST) schemes. Methods: A total of 41 extended-spectrum β-lactamase- (ESBL-) and/or AmpC β-lactamase-producing E. coli clinical isolates were included in this study. MLST experiments were performed following the Achtman's MLST scheme and the Whittam's MLST scheme, respectively. Rep-PCR experiments were performed using the DiversiLab system. PFGE experiments were also performed. Results: A comparison of the two MLST methods demonstrated that these two schemes yielded compatible results. PFGE correctly segregated E. coli isolates belonging to different STs as different types, but did not group E. coli isolates belonging to the same ST in the same group. Rep-PCR accurately grouped E. coli isolates belonging to the same ST together, but this method demonstrated limited ability to discriminate between E. coli isolates belonging to different STs. Interpretation & conclusions: These results suggest that PFGE would be more effective when investigating outbreaks in a limited space, such as a specialty hospital or an intensive care unit, whereas rep-PCR should be used for nationwide or worldwide epidemiology studies. PMID:25579152

  12. The DNA deletion in an Indian delta beta-thalassaemia begins one kilobase from the A gamma globin gene and ends in an L1 repetitive sequence.

    PubMed

    Mishima, N; Landman, H; Huisman, T H; Gilman, J G

    1989-11-01

    High fetal haemoglobin levels of 5-15% are present in adult heterozygotes for delta beta-thalassaemia as the result of large deletions of DNA. We have cloned DNA spanning the deletion breakpoint for a new Indian delta beta-thalassaemia associated with mild anaemia. The 5' breakpoint is at 42151 of GenBank file HUMHBB, which is about 1 kb 3' of the A gamma globin gene poly A site at 41003. On the 3' side of the breakpoint, the sequence is homologous to L1 (KpnI) repetitive DNA located 3.6-10 kb 3' of the beta-globin gene: Indian delta beta-thalassaemia DNA is 74% homologous to the inverted complement of HUMHBB from 69849 to 70020, followed by a region 78% homologous to the direct sequence of HUMHBB from 70534 to 71010. The precise location of the 3' endpoint of this deletion has not been determined, but it is within L1 sequences located more than 10 kb 3' of the beta-globin gene.

  13. Repetitive sequences originating from the centromere constitute large-scale heterochromatin in the telomere region in the siamang, a small ape.

    PubMed

    Koga, A; Hirai, Y; Hara, T; Hirai, H

    2012-09-01

    Chromosomes of the siamang Symphalangus syndactylus (a small ape) carry large-scale heterochromatic structures at their ends. These structures look similar, by chromosome C-banding, to chromosome-end heterochromatin found in chimpanzee, bonobo and gorilla (African great apes), of which a major component is tandem repeats of 32-bp-long, AT-rich units. In the present study, we identified repetitive sequences that are a major component of the siamang heterochromatin. Their repeat units are 171 bp in length, and exhibit sequence similarity to alpha satellite DNA, a major component of the centromeres in primates. Thus, the large-scale heterochromatic structures have different origins between the great apes and the small ape. The presence of alpha satellite DNA in the telomere region has previously been reported in the white-cheeked gibbon Nomascus leucogenys, another small ape species. There is, however, a difference in the size of the telomere-region alpha satellite DNA, which is far larger in the siamang. It is not known whether the sequences of these two species (of different genera) have a common origin because the phylogenetic relationship of genera within the small ape family is still not clear. Possible evolutionary scenarios are discussed.

  14. Transcription blockage by homopurine DNA sequences: role of sequence composition and single-strand breaks

    PubMed Central

    Belotserkovskii, Boris P.; Neil, Alexander J.; Saleh, Syed Shayon; Shin, Jane Hae Soo; Mirkin, Sergei M.; Hanawalt, Philip C.

    2013-01-01

    The ability of DNA to adopt non-canonical structures can affect transcription and has broad implications for genome functioning. We have recently reported that guanine-rich (G-rich) homopurine-homopyrimidine sequences cause significant blockage of transcription in vitro in a strictly orientation-dependent manner: when the G-rich strand serves as the non-template strand [Belotserkovskii et al. (2010) Mechanisms and implications of transcription blockage by guanine-rich DNA sequences., Proc. Natl Acad. Sci. USA, 107, 12816–12821]. We have now systematically studied the effect of the sequence composition and single-stranded breaks on this blockage. Although substitution of guanine by any other base reduced the blockage, cytosine and thymine reduced the blockage more significantly than adenine substitutions, affirming the importance of both G-richness and the homopurine-homopyrimidine character of the sequence for this effect. A single-strand break in the non-template strand adjacent to the G-rich stretch dramatically increased the blockage. Breaks in the non-template strand result in much weaker blockage signals extending downstream from the break even in the absence of the G-rich stretch. Our combined data support the notion that transcription blockage at homopurine-homopyrimidine sequences is caused by R-loop formation. PMID:23275544

  15. Transcription blockage by homopurine DNA sequences: role of sequence composition and single-strand breaks.

    PubMed

    Belotserkovskii, Boris P; Neil, Alexander J; Saleh, Syed Shayon; Shin, Jane Hae Soo; Mirkin, Sergei M; Hanawalt, Philip C

    2013-02-01

    The ability of DNA to adopt non-canonical structures can affect transcription and has broad implications for genome functioning. We have recently reported that guanine-rich (G-rich) homopurine-homopyrimidine sequences cause significant blockage of transcription in vitro in a strictly orientation-dependent manner: when the G-rich strand serves as the non-template strand [Belotserkovskii et al. (2010) Mechanisms and implications of transcription blockage by guanine-rich DNA sequences., Proc. Natl Acad. Sci. USA, 107, 12816-12821]. We have now systematically studied the effect of the sequence composition and single-stranded breaks on this blockage. Although substitution of guanine by any other base reduced the blockage, cytosine and thymine reduced the blockage more significantly than adenine substitutions, affirming the importance of both G-richness and the homopurine-homopyrimidine character of the sequence for this effect. A single-strand break in the non-template strand adjacent to the G-rich stretch dramatically increased the blockage. Breaks in the non-template strand result in much weaker blockage signals extending downstream from the break even in the absence of the G-rich stretch. Our combined data support the notion that transcription blockage at homopurine-homopyrimidine sequences is caused by R-loop formation.

  16. Structural biology of disease-associated repetitive DNA sequences and protein-DNA complexes involved in DNA damage and repair

    SciTech Connect

    Gupta, G.; Santhana Mariappan, S.V.; Chen, X.; Catasti, P.; Silks, L.A. III; Moyzis, R.K.; Bradbury, E.M.; Garcia, A.E.

    1997-07-01

    This project is aimed at formulating the sequence-structure-function correlations of various microsatellites in the human (and other eukaryotic) genomes. Here the authors have been able to develop and apply structure biology tools to understand the following: the molecular mechanism of length polymorphism microsatellites; the molecular mechanism by which the microsatellites in the noncoding regions alter the regulation of the associated gene; and finally, the molecular mechanism by which the expansion of these microsatellites impairs gene expression and causes the disease. Their multidisciplinary structural biology approach is quantitative and can be applied to all coding and noncoding DNA sequences associated with any gene. Both NIH and DOE are interested in developing quantitative tools for understanding the function of various human genes for prevention against diseases caused by genetic and environmental effects.

  17. Complete mitochondrial genome of Ptychobarbus kaznakovi (Teleostei: Cypriniformes: Cyprinidae), and repetitive sequences in the D-loop.

    PubMed

    Ma, Qingzhan; Wu, Bo; Li, Jiuxuan; Song, Zhaobin

    2016-05-01

    The complete mitochondrial DNA genome of Ptychobarbus kaznakovi was sequenced and characterized. The genome is 16,842 bp in length. Similar with most teleosts, it has two ribosomal RNA (rRNA) genes, 13 protein-coding genes, 22 transfer RNA (tRNA) genes, and one displacement loop (D-loop) region. Conserved sequence blocks, including ETAS, CSB-B, D, E, F, and CSB1-3, were identified in the D-loop, which is similar to other species in Cypriniformes. Nevertheless, a 55 bp tandem repeat array was also identified at 3' end of the D-loop, which is the first finding in Schizothoracinae. Phylogenetic analysis showed that the species of Ptychobarbus (P. dipogon and P. kaznakovi) formed a monophyletic group and represented close relationship to the species without scales in Schizothoracinae.

  18. A non-radioactive DNA diagnostic procedure for the detection of malarial infection: general application to genome with repetitive sequences.

    PubMed

    Ayyanathan, K; Datta, S

    1995-04-01

    A novel non-radioactive DNA diagnostic method has been developed to detect Plasmodium falciparum infection in whole blood. In this method a drop of blood from a finger prick is added to a lysing solution containing a biotinylated oligonucleotide whose sequence design is based on the repeated sequence of the parasite genome. The mixture is heated in a boiling water bath and then added to a microtitre plate where the 'target-bioprobe hybrids' are captured by the immobilized oligonucleotides. The plate is then washed to remove the coloured material and the biotinylated oligonucleotide retained on the plate is assayed by streptavidin-alkaline phosphatase conjugate. This method has also been tested in field trials by double-blind studies to detect P.falciparum infection in blood samples. Results indicate that this method is superior to the classical blood smear examination for its speed and its ease in large epidemiological surveys and is especially useful in identifying clinical malaria in endemic areas where the semi-immune population predominates. The method described can be of general application for the detection of any foreign pathogen in blood, other body fluids and tissue samples, provided the DNA probe employed constitutes a part of the repeated sequence of the genome and is unique.

  19. The Repetitive Oligopeptide Sequences Modulate Cytopathic Potency but Are Not Crucial for Cellular Uptake of Clostridium difficile Toxin A

    PubMed Central

    Olling, Alexandra; Goy, Sebastian; Hoffmann, Florian; Tatge, Helma; Just, Ingo; Gerhard, Ralf

    2011-01-01

    The pathogenicity of Clostridium difficile is primarily linked to secretion of the intracellular acting toxins A (TcdA) and B (TcdB) which monoglucosylate and thereby inactivate Rho GTPases of host cells. Although the molecular mode of action of TcdA and TcdB is well understood, far less is known about toxin binding and uptake. It is acknowledged that the C-terminally combined repetitive oligopeptides (CROPs) of the toxins function as receptor binding domain. The current study evaluates the role of the CROP domain with respect to functionality of TcdA and TcdB. Therefore, we generated truncated TcdA devoid of the CROPs (TcdA1–1874) and found that this mutant was still cytopathic. However, TcdA1–1874 possesses about 5 to 10-fold less potency towards 3T3 and HT29 cells compared to the full length toxin. Interestingly, CHO-C6 cells even showed almost identical susceptibility towards truncated and full length TcdA concerning Rac1 glucosylation or cell rounding, respectively. FACS and Western blot analyses elucidated these differences and revealed a correlation between CROP-binding to the cell surface and toxin potency. These findings refute the accepted opinion of solely CROP- mediated toxin internalization. Competition experiments demonstrated that presence neither of TcdA CROPs nor of full length TcdA reduced binding of truncated TcdA1–1874 to HT29 cells. We assume that toxin uptake might additionally occur through alternative receptor structures and/or other associated endocytotic pathways. The second assumption was substantiated by TER measurements showing that basolaterally applied TcdA1–1874 exhibits considerably higher cytotoxic potency than apically applied mutant or even full length TcdA, the latter being almost independent of the side of application. Thus, different routes for cellular uptake might enable the toxins to enter a broader repertoire of cell types leading to the observed multifarious pathogenesis of C. difficile. PMID:21445253

  20. Repetitive transpositions of mitochondrial DNA sequences to the nucleus during the radiation of horseshoe bats (Rhinolophus, Chiroptera).

    PubMed

    Shi, Huizhen; Dong, Ji; Irwin, David M; Zhang, Shuyi; Mao, Xiuguang

    2016-05-01

    Transposition of mitochondrial DNA into the nucleus, which gives rise to nuclear mitochondrial DNAs (NUMTs), has been well documented in eukaryotes. However, very few studies have assessed the frequency of these transpositions during the evolutionary history of a specific taxonomic group. Here we used the horseshoe bats (Rhinolophus) as a case study to determine the frequency and relative timing of nuclear transfers of mitochondrial control region sequences. For this, phylogenetic and coalescent analyzes were performed on NUMTs and authentic mtDNA sequences generated from eight horseshoe bat species. Our results suggest at least three independent transpositions, including two ancient and one more recent, during the evolutionary history of Rhinolophus. The two ancient transpositions are represented by the NUMT-1 and -2 clades, with each clade consisting of NUMTs from almost all studied species but originating from different portions of the mtDNA genome. Furthermore, estimates of the most recent common ancestor for each clade corresponded to the time of the initial diversification of this genus. The recent transposition is represented by NUMT-3, which was discovered only in a specific subgroup of Rhinolophus and exhibited a close relationship to its mitochondrial counterpart. Our similarity searches of mtDNA in the R. ferrumequinum genome confirmed the presence of NUMT-1 and NUMT-2 clade sequences and, for the first time, assessed the extent of NUMTs in a bat genome. To our knowledge, this is the first study to report on the frequency of transpositions of mtDNA occurring before the common ancestry of a genus.

  1. Study of quasistationary and stationary states in the short-repetition-time sequences in the NQR of nitrogen.

    PubMed

    Mikhaltsevitch, V T; Rudakov, T N

    2004-01-01

    Experimental and theoretical study of quasistationary and stationary states that are established in the quadrupolar spin system subjected to the steady-state sequences which consist of a chain of identical pulses and can be preceded by a preparatory pulse. We have obtained theoretical expressions for the magnetisation of the spin system that take into account off-resonance conditions during the effect of the pulses. Frequency dependencies of the NQR signal in the quasistationary and stationary states are shown for C3H6N6O6 (RDX) and NaNO2, and compared with theoretical results.

  2. Differential chromosomal organization between Saguinus midas and Saguinus bicolor with accumulation of differences the repetitive sequence DNA.

    PubMed

    Serfaty, Dayane Martins Barbosa; Carvalho, Natália Dayane Moura; Gross, Maria Claudia; Gordo, Marcelo; Schneider, Carlos Henrique

    2017-06-20

    Saguinus is the largest and most complex genus of the subfamily Callitrichinae, with 23 species distributed from the south of Central America to the north of South America with Saguinus midas having the largest geographical distribution while Saguinus bicolor has a very restricted one, affected by the population expansion in the state of Amazonas. Considering the phylogenetic proximity of the two species along with evidence on the existence of hybrids between them, as well as cytogenetic studies on Saguinus describing a conserved karyotypic macrostructure, we carried out a physical mapping of DNA repeated sequences in the mitotic chromosome of both species, since these sequences are less susceptible to evolutionary pressure and possibly perform an important function in speciation. Both species presented 2n = 46 chromosomes; in S. midas, chromosome Y is the smallest. Multiple ribosomal sites occur in both species, but chromosome pairs three and four may be regarded as markers that differ the species when subjected to G banding and distribution of retroelement LINE 1, suggesting that it may be cytogenetic marker in which it can contribute to identification of first generation hybrids in contact zone. Saguinus bicolor also presented differences in the LINE 1 distribution pattern for sexual chromosome X in individuals from different urban fragments, probably due to geographical isolation. In this context, cytogenetic analyses reveal a differential genomic organization pattern between species S. midas and S. bicolor, in addition to indicating that individuals from different urban fragments have been accumulating differences because of the isolation between them.

  3. Microhomology-mediated DNA strand annealing and elongation by human DNA polymerases λ and β on normal and repetitive DNA sequences

    PubMed Central

    Crespan, Emmanuele; Czabany, Tibor; Maga, Giovanni; Hübscher, Ulrich

    2012-01-01

    ‘Classical’ non-homologous end joining (NHEJ), dependent on the Ku70/80 and the DNA ligase IV/XRCC4 complexes, is essential for the repair of DNA double-strand breaks. Eukaryotic cells possess also an alternative microhomology-mediated end-joining (MMEJ) mechanism, which is independent from Ku and DNA ligase 4/XRCC4. The components of the MMEJ machinery are still largely unknown. Family X DNA polymerases (pols) are involved in the classical NHEJ pathway. We have compared in this work, the ability of human family X DNA pols β, λ and μ, to promote the MMEJ of different model templates with terminal microhomology regions. Our results reveal that DNA pol λ and DNA ligase I are sufficient to promote efficient MMEJ repair of broken DNA ends in vitro, and this in the absence of auxiliary factors. However, DNA pol β, not λ, was more efficient in promoting MMEJ of DNA ends containing the (CAG)n triplet repeat sequence of the human Huntingtin gene, leading to triplet expansion. The checkpoint complex Rad9/Hus1/Rad1 promoted end joining by DNA pol λ on non-repetitive sequences, while it limited triplet expansion by DNA pol β. We propose a possible novel role of DNA pol β in MMEJ, promoting (CAG)n triplet repeats instability. PMID:22373917

  4. Large-scale cloning of human chromosome 2-specific yeast artificial chromosomes (YACs) using an interspersed repetitive sequences (IRS)-PCR approach.

    PubMed

    Liu, J; Stanton, V P; Fujiwara, T M; Wang, J X; Rezonzew, R; Crumley, M J; Morgan, K; Gros, P; Housman, D; Schurr, E

    1995-03-20

    We report here an efficient approach to the establishment of extended YAC contigs on human chromosome 2 by using an interspersed repetitive sequences (IRS)-PCR-based screening strategy for YAC DNA pools. Genomic DNA was extracted from 1152 YAC pools comprised of 55,296 YACs mostly derived from the CEPH Mark I library. Alu-element-mediated PCR was performed for each pool, and amplification products were spotted on hybridization membranes (IRS filters). IRS probes for the screening of the IRS filters were obtained by Alu-element-mediated PCR. Of 708 distinct probes obtained from chromosome 2-specific somatic cell hybrids, 85% were successfully used for library screening. Similarly, 80% of 80 YAC walking probes were successfully used for library screening. Each probe detected an average of 6.6 YACs, which is in good agreement with the 7- to 7.5-fold genome coverage provided by the library. In a preliminary analysis, we have identified 188 YAC groups that are the basis for building contigs for chromosome 2. The coverage of the telomeric half of chromosome 2q was considered to be good since 31 of 34 microsatellites and 22 of 23 expressed sequence tags that were chosen from chromosome region 2q13-q37 were contained in a chromosome 2 YAC sublibrary generated by our experiments. We have identified a minimum of 1610 distinct chromosome 2-specific YACs, which will be a valuable asset for the physical mapping of the second largest human chromosome.

  5. Characterization of Erwinia amylovora strains from different host plants using repetitive-sequences PCR analysis, and restriction fragment length polymorphism and short-sequence DNA repeats of plasmid pEA29.

    PubMed

    Barionovi, D; Giorgi, S; Stoeger, A R; Ruppitsch, W; Scortichini, M

    2006-05-01

    The three main aims of the study were the assessment of the genetic relationship between a deviating Erwinia amylovora strain isolated from Amelanchier sp. (Maloideae) grown in Canada and other strains from Maloideae and Rosoideae, the investigation of the variability of the PstI fragment of the pEA29 plasmid using restriction fragment length polymorphism (RFLP) analysis and the determination of the number of short-sequence DNA repeats (SSR) by DNA sequence analysis in representative strains. Ninety-three strains obtained from 12 plant genera and different geographical locations were examined by repetitive-sequences PCR using Enterobacterial Repetitive Intergenic Consensus, BOX and Repetitive Extragenic Palindromic primer sets. Upon the unweighted pair group method with arithmetic mean analysis, a deviating strain from Amelanchier sp. was analysed using amplified ribosomal DNA restriction analysis (ARDRA) analysis and the sequencing of the 16S rDNA gene. This strain showed 99% similarity to other E. amylovora strains in the 16S gene and the same banding pattern with ARDRA. The RFLP analysis of pEA29 plasmid using MspI and Sau3A restriction enzymes showed a higher variability than that previously observed and no clear-cut grouping of the strains was possible. The number of SSR units reiterated two to 12 times. The strains obtained from pear orchards showing for the first time symptoms of fire blight had a low number of SSR units. The strains from Maloideae exhibit a wider genetic variability than previously thought. The RFLP analysis of a fragment of the pEA29 plasmid would not seem a reliable method for typing E. amylovora strains. A low number of SSR units was observed with first epidemics of fire blight. The current detection techniques are mainly based on the genetic similarities observed within the strains from the cultivated tree-fruit crops. For a more reliable detection of the fire blight pathogen also in wild and ornamentals Rosaceous plants the genetic

  6. A genome-wide BAC-end sequence survey provides first insights into sweetpotato (Ipomoea batatas (L.) Lam.) genome composition.

    PubMed

    Si, Zengzhi; Du, Bing; Huo, Jinxi; He, Shaozhen; Liu, Qingchang; Zhai, Hong

    2016-11-21

    Sweetpotato, Ipomoea batatas (L.) Lam., is an important food crop widely grown in the world. However, little is known about the genome of this species because it is a highly heterozygous hexaploid. Gaining a more in-depth knowledge of sweetpotato genome is therefore necessary and imperative. In this study, the first bacterial artificial chromosome (BAC) library of sweetpotato was constructed. Clones from the BAC library were end-sequenced and analyzed to provide genome-wide information about this species. The BAC library contained 240,384 clones with an average insert size of 101 kb and had a 7.93-10.82 × coverage of the genome, and the probability of isolating any single-copy DNA sequence from the library was more than 99%. Both ends of 8310 BAC clones randomly selected from the library were sequenced to generate 11,542 high-quality BAC-end sequences (BESs), with an accumulative length of 7,595,261 bp and an average length of 658 bp. Analysis of the BESs revealed that 12.17% of the sweetpotato genome were known repetitive DNA, including 7.37% long terminal repeat (LTR) retrotransposons, 1.15% Non-LTR retrotransposons and 1.42% Class II DNA transposons etc., 18.31% of the genome were identified as sweetpotato-unique repetitive DNA and 10.00% of the genome were predicted to be coding regions. In total, 3,846 simple sequences repeats (SSRs) were identified, with a density of one SSR per 1.93 kb, from which 288 SSRs primers were designed and tested for length polymorphism using 20 sweetpotato accessions, 173 (60.07%) of them produced polymorphic bands. Sweetpotato BESs had significant hits to the genome sequences of I. trifida and more matches to the whole-genome sequences of Solanum lycopersicum than those of Vitis vinifera, Theobroma cacao and Arabidopsis thaliana. The first BAC library for sweetpotato has been successfully constructed. The high quality BESs provide first insights into sweetpotato genome composition, and have significant hits to the genome

  7. Molecular and cytogenetic analysis of the telomeric (TTAGGG)n repetitive sequences in the Nile tilapia, Oreochromis niloticus (Teleostei: Cichlidae).

    PubMed

    Chew, Joyce S K; Oliveira, Claudio; Wright, Jonathan M; Dobson, Melanie J

    2002-03-01

    The majority of chromosomes in Oreochromis niloticus, as with most fish karyotyped to date, cannot be individually identified owing to their small size. As a first step in establishing a physical map for this important aquaculture species of tilapia we have analyzed the location of the vertebrate telomeric repeat sequence, (TTAGGG)n, in O. niloticus. Southern blot hybridization analysis and a Bal31 sensitivity assay confirm that the vertebrate telomeric repeat is indeed present at O. niloticus chromosomal ends with repeat tracts extending for 4-10 kb on chromosomal ends in erythrocytes. Fluorescent in situ hybridization revealed that (TTAGGG)n is found not only at telomeres, but also at two interstitial loci on chromosome 1. These data support the hypothesis that chromosome 1, which is significantly larger than all the other chromosomes in the karyotype, was produced by the fusion of three chromosomes and explain the overall reduction of chromosomal number from the ancestral teleost karyotype of 2n=48 to 2n=44 observed in tilapia.

  8. Chromosome Mapping of Repetitive Sequences in Rachycentron canadum (Perciformes: Rachycentridae): Implications for Karyotypic Evolution and Perspectives for Biotechnological Uses

    PubMed Central

    Jacobina, Uedson Pereira; Cioffi, Marcelo de Bello; Souza, Luiz Gustavo Rodrigues; Calado, Leonardo Luiz; Tavares, Manoel; Manzella, João; Bertollo, Luiz Antonio Carlos; Molina, Wagner Franco

    2011-01-01

    The cobia, Rachycentron canadum, a species of marine fish, has been increasingly used in aquaculture worldwide. It is the only member of the family Rachycentridae (Perciformes) showing wide geographic distribution and phylogenetic patterns still not fully understood. In this study, the species was cytogenetically analyzed by different methodologies, including Ag-NOR and chromomycin A3 (CMA3)/DAPI staining, C-banding, early replication banding (RGB), and in situ fluorescent hybridization with probes for 18S and 5S ribosomal genes and for telomeric sequences (TTAGGG)n. The results obtained allow a detailed chromosomal characterization of the Atlantic population. The chromosome diversification found in the karyotype of the cobia is apparently related to pericentric inversions, the main mechanism associated to the karyotypic evolution of Perciformes. The differential heterochromatin replication patterns found were in part associated to functional genes. Despite maintaining conservative chromosomal characteristics in relation to the basal pattern established for Perciformes, some chromosome pairs in the analyzed population exhibit markers that may be important for cytotaxonomic, population, and biodiversity studies as well as for monitoring the species in question. PMID:21541243

  9. Diversity of Enterococcus faecalis Genotypes from Multiple Oral Sites Associated with Endodontic Failure Using Repetitive Sequence-based Polymerase Chain Reaction and Arbitrarily Primed Polymerase Chain Reaction.

    PubMed

    Delboni, Maraísa G; Gomes, Brenda P F A; Francisco, Priscila A; Teixeira, Fabrício B; Drake, David

    2017-03-01

    The aim of this study was to evaluate the diversity and similarity of Enterococcus faecalis genotype isolates from multiple oral sites using repetitive sequence-based polymerase chain reaction and arbitrarily primed polymerase chain reaction (AP-PCR). Forty-two endodontically treated teeth with apical periodontitis were selected. A total of 126 microbial samples were collected from 3 different sites (saliva, pulp chamber, and root canals, all n = 42) during the nonsurgical retreatment procedures. After growth on m-Enterococcus agar, the colonies were isolated, characterized as gram-positive catalase negative cocci, and identified using an API 20 Strep kit (bioMérieux, Marcy-l'Etoile, France). Seventy-four colonies from 10 patients were confirmed as E. faecalis by polymerase chain reaction (16S ribosomal RNA). Repetitive sequence-based polymerase chain reactions using ERIC and AP-PCR using RW3A primers were performed in all 74 colonies. Fingerprints were analyzed and separated into genotypic groups based on the Dice coefficient percentage of similarity (82% or greater) as determined by ERIC reproducibility assays involving E. faecalis controls. Seven different E. faecalis genotypes (GTs) (GT1 = 27%, GT2 = 17.6%, GT3 = 1.3%, GT4 = 18.9%, GT5 = 9.5%, GT6 = 14.9%, and GT7 = 10.8%) were observed in different subjects and oral sites associated with endodontic failure. Remarkably, in 4 of 5 patients, the same GTs present in the infected root canals were also isolated from either the pulp chamber or the saliva samples. In particular, GT6 was detected in all 3 oral sites of patient 37. E. faecalis GTs isolated from saliva, the pulp chamber, and the root canal were similar using the Rep-PCR and AP-PCR methods. These findings suggest that coronal microleakage is a conceivable cause of endodontic failure. Copyright © 2016 American Association of Endodontists. Published by Elsevier Inc. All rights reserved.

  10. Identification and molecular epidemiology of dermatophyte isolates by repetitive-sequence-PCR-based DNA fingerprinting using the DiversiLab system in Turkey.

    PubMed

    Koc, A Nedret; Atalay, Mustafa A; Inci, Melek; Sariguzel, Fatma M; Sav, Hafize

    2017-05-01

    Dermatophyte species, isolation and identification in clinical samples are still difficult and take a long time. The identification and molecular epidemiology of dermatophytes commonly isolated in a clinical laboratory in Turkey by repetitive sequence-based PCR (rep-PCR) were assessed by comparing the results with those of reference identification. A total of 44 dermatophytes isolated from various clinical specimens of 20 patients with superficial mycoses in Kayseri and 24 patients in Hatay were studied. The identification of dermatophyte isolates was based on the reference identification and rep-PCR using the DiversiLab System (BioMerieux). The genotyping of dermatophyte isolates from different patients was determined by rep-PCR. In the identification of dermatophyte isolates, agreement between rep-PCR and conventional methods was 87.8 % ( 36 of 41). The dermatophyte strains belonged to four clones (A -D) which were determined by the use of rep-PCR. The dermatophyte strains in Clone B, D showed identical patterns with respect to the region. In conclusion, rep-PCR appears to be useful for evaluation of the identification and clonal relationships between Trichophyton rubrum species complex and Trichophyton mentagrophytes species complex isolates. The similarity and diversity of these isolates may be assessed according to different regions by rep-PCR. © 2017 Blackwell Verlag GmbH.

  11. Occurrence and genotyping using automated repetitive-sequence-based PCR of methicillin-resistant Staphylococcus aureus ST398 in Southeast Austria.

    PubMed

    Grisold, Andrea J; Zarfel, Gernot; Hoenigl, Martin; Krziwanek, Karina; Feierl, Gebhard; Masoud, Lilian; Leitner, Eva; Wagner-Eibel, Ute; Badura, Alexandra; Marth, Egon

    2010-02-01

    In this retrospective study, the occurrence and genetic relatedness of methicillin-resistant Staphylococcus aureus (MRSA) ST398 in Austrian MRSA patients was investigated. From 2002 to 2008, 14 MRSA ST398 were detected. First occurrence of MRSA ST398 was already found in 2004. Spa ribotyping assigned 12 isolates to spa type t011 and 1 each to spa type t034 and spa type t1451. Isolated MRSA ST398 was nontypeable by pulsed-field gel electrophoresis (NT-MRSA) using restriction enzyme SmaI; therefore, genotyping was performed using automated repetitive-sequence-based PCR (rep-PCR) on the DiversiLab system. Rep-PCR results assigned 10 (71%) of the 14 MRSA ST398 into 1 cluster with a similarity >95%; there was 1 cluster consisting of 2 isolates with a similarity >99% and 2 unique MRSA ST398 isolates. In conclusion, MRSA ST398 was continuously detected in Southeast Austria; first in 2004 with up to 5 MRSA ST398 isolates in 2008. Automated rep-PCR proved as a reliable technique in determining genetic relatedness of NT-MRSA ST398 and demonstrates clonal spread of MRSA ST398 in the investigated region.

  12. Indole acetic acid production by fluorescent Pseudomonas spp. from the rhizosphere of Plectranthus amboinicus (Lour.) Spreng. and their variation in extragenic repetitive DNA sequences.

    PubMed

    Sethia, Bedhya; Mustafa, Mariam; Manohar, Sneha; Patil, Savita V; Jayamohan, Nellickal Subramanian; Kumudini, Belur Satyan

    2015-06-01

    Fluorescent Pseudomonas (FP) is a heterogenous group of growth promoting rhizobacteria that regulate plant growth by releasing secondary metabolic compounds viz., indole acetic acid (IAA), siderophores, ammonia and hydrogen cyanide. In the present study, IAA producing FPs from the rhizosphere of Plectranthus amboinicus were characterized morphologically, biochemically and at the molecular level. Molecular identification of the isolates were carried out using Pseudomonas specific primers. The effect of varying time (24, 48, 72 and 96 h), Trp concentrations (100, 200, 300, 400 and 500 μg x ml(-1)), temperature (10, 26, 37 and 50 ± 2 degrees C) and pH (6, 7 and 8) on IAA production by 10 best isolates were studied. Results showed higher IAA production at 72 h incubation, at 300 μg x ml(-1) Trp concentration, temperature 26 ± 2 degrees C and pH 7. TLC with acidified ethyl acetate extract showed that the IAA produced has a similar Rf value to that of the standard IAA. Results of TLC were confirmed by HPLC analysis. Genetic diversity of the isolates was also studied using 40 RAPD and 4 Rep primers. Genetic diversity parameters such as dominance, Shannon index and Simpson index were calculated. Out of 40 RAPD primers tested, 9 (2 OP-D series and 7 OP-E series) were shortlisted for further analysis. Studies using RAPD, ERIC, BOX, REP and GTG5 primers revealed that isolates exhibit significant diversity in repetitive DNA sequences irrespective of the rhizosphere.

  13. Polymerase chain reaction for the amplification of the 121-bp repetitive sequence of Schistosoma mansoni: a highly sensitive potential diagnostic tool for areas of low endemicity.

    PubMed

    Ferrer, E; Pérez, F; Bello, I; Bolívar, A; Lares, M; Osorio, A; León, L; Amarista, M; Incani, R N

    2015-11-01

    Schistosomiasis is a disease caused by parasitic flatworms of the genus Schistosoma, whose diagnosis has limitations, such as the low sensitivity and specificity of parasitological and immunological methods, respectively. In the present study an alternative molecular technique requiring previous standardization was carried out using the polymerase chain reaction (PCR) for the amplification of a 121-bp highly repetitive sequence for Schistosoma mansoni. DNA was extracted from eggs of S. mansoni by salting out. Different conditions were standardized for the PCR technique, including the concentration of reagents and the DNA template, annealing temperature and number of cycles, followed by the determination of the analytical sensitivity and specificity of the technique. Furthermore, the standardized PCR technique was employed in DNA extracted, using Chelex®100, from samples of sera of patients with an immunodiagnosis of schistosomiasis. The optimal conditions for the PCR were 2.5 mm MgCl2, 150 mm deoxynucleoside triphosphates (dNTPs), 0.4 μm primers, 0.75 U DNA polymerase, using 35 cycles and an annealing temperature of 63°C. The analytical sensitivity of the PCR was 10 attograms of DNA and the specificity was 100%. The DNA sequence was successfully detected in the sera of two patients, demonstrating schistosomiasis transmission, although low, in the community studied. The standardized PCR technique, using smaller amounts of reagents than in the original protocol, is highly sensitive and specific for the detection of DNA from S. mansoni and could be an important tool for diagnosis in areas of low endemicity.

  14. Clonal Relationship and Differentiation among Mycobacterium abscessus Isolates as Determined Using the Semiautomated Repetitive Extragenic Palindromic Sequence PCR-Based DiversiLab System

    PubMed Central

    Mougari, Faiza; Raskine, Laurent; Ferroni, Agnes; Marcon, Estelle; Sermet-Gaudelus, Isabelle; Veziris, Nicolas; Heym, Beate; Gaillard, Jean-Louis; Nassif, Xavier

    2014-01-01

    Mycobacterium abscessus is a rapidly growing mycobacterium that causes respiratory tract infections in predisposed patients, such as those with cystic fibrosis and nosocomial skin and soft tissue infections. In order to investigate the clonal relationships between the strains causing epidemic episodes, we evaluated the discriminatory power of the semiautomated DiversiLab (DL) repetitive extragenic palindromic sequence PCR (REP-PCR) test for M. abscessus genotyping. Since M. abscessus was shown to be composed of subspecies (M. abscessus subsp. massiliense, M. abscessus subsp. bolletii, and M. abscessus subsp. abscessus), we also evaluated the ability of this technique to differentiate subspecies. The technique was applied to two collections of clinical isolates, (i) 83 M. abscessus original isolates (43 M. abscessus subsp. abscessus, 12 M. abscessus subsp. bolletii, and 28 M. abscessus subsp. massiliense) from infected patients and (ii) 35 repeated isolates obtained over 1 year from four cystic fibrosis patients. The DL REP-PCR test was standardized for DNA extraction, DNA amplification, and electrophoresis pattern comparisons. Among the isolates from distinct patients, 53/83 (62%) isolates showed a specific pattern, and 30 were distributed in 11 clusters and 6 patterns, with 2 to 4 isolates per pattern. The clusters and patterns did not fully correlate with multilocus sequence typing (MLST) analysis results. This revealed a high genomic diversity between patients, with a discriminatory power of 98% (Simpson's diversity index). However, since some isolates shared identical patterns, this raises the question of whether it is due to transmission between patients or a common reservoir. Multiple isolates from the same patient showed identical patterns, except for one patient infected by two strains. Between the M. abscessus subspecies, the indexes were <70%, indicating that the DL REP-PCR test is not an accurate tool for identifying organisms to the subspecies level

  15. Repetitive experiments of one or two-pulse sequences in NQR of spins I=3/2: Liouville space, steady-state, Ernst angle and optimum signal.

    PubMed

    Odin, Christophe

    2017-09-01

    In NMR, the repetition of pulse sequences with a recycle time that does not allow the spin system to completely relax back to equilibrium is a well known and often used method to increase the signal to noise ratio at given total measuring time. For isolated spins I=1/2, the steady-state of a train of strictly identical pulse sequences separated by free evolution periods of same duration is described by the well known Ernst-Anderson model, and the optimum pulse angle is given by the Ernst angle. We showed recently that equivalent formula, but with super-operators in the Liouville space, can be obtained for general spins I. In this article, this formalism is generalized to pure NQR of spins I=3/2, and applied to calculate the signal resulting from single and solid-echo sequences, in the limit when the recycle time T>5T2q, where T2q is the transverse (coherence) quadrupolar relaxation time. In particular, we show that powder samples have a behaviour that is very close to NMR of spins I=1/2. For instance, the generalized Ernst angle βM that maximizes the signal amplitude for a single pulse train is well described by the simple formula cos(1.52βM)≈exp(-T/T1q), whatever the quadrupolar asymmetry parameter η, T1q being the longitudinal (population) quadrupolar relaxation time. Moreover, a simplified NMR-like formula that describes the overall behaviour of nutation curves is proposed, and it is shown that the signal to noise ratio (SNR) at given experimental time is exactly the same as in NMR of spins I=1/2 as a function of recycle time, when properly normalized. Some theoretical predictions for the single pulse and solid-echo sequence were compared to experiments, and validated, by performing (35)Cl pure NQR experiment on chloranil (C6Cl4O2 tetrachloro-1,4-benzoquinone) powder. Copyright © 2017 Elsevier Inc. All rights reserved.

  16. Repetition reduction: Lexical repetition in the absence of referent repetition

    PubMed Central

    Lam, Tuan Q.; Watson, Duane G.

    2014-01-01

    Repeated words are produced with reduced acoustic prominence compared to words that are new to a discourse. Although these effects are often attributed to priming in the production system, the locus of the effect within the production system remains unresolved because in natural speech, repetition often involves repetition of referents and lexical items simultaneously. Therefore, repetition reduction could be due to repeated mention of a referent, or repetition of a word or referring expression. In our study, we test whether repetition reduction is due to repetition of lexical items or repeated mention of referents using an event description task. The results show that repeated lexical items lead to reduced duration and intensity even in the absence of referent repetition whereas repeated referents lead to reduced intensity alone. The general pattern suggests that repetition reduction is due most strongly to repetition of the lexical item, rather than repeated mention of the referent. PMID:24548320

  17. SAG-QC: quality control of single amplified genome information by subtracting non-target sequences based on sequence compositions.

    PubMed

    Maruyama, Toru; Mori, Tetsushi; Yamagishi, Keisuke; Takeyama, Haruko

    2017-03-04

    Whole genome amplification techniques have enabled the analysis of unexplored genomic information by sequencing of single-amplified genomes (SAGs). Whole genome amplification of single bacteria is currently challenging because contamination often occurs in experimental processes. Thus, to increase the confidence in the analyses of sequenced SAGs, bioinformatics approaches that identify and exclude non-target sequences from SAGs are required. Since currently reported approaches utilize sequence information in public databases, they have limitations when new strains are the targets of interest. Here, we developed a software SAG-QC that identify and exclude non-target sequences independent of database. In our method, "no template control" sequences acquired during WGA were used. We calculated the probability that a sequence was derived from contaminants by comparing k-mer compositions with the no template control sequences. Based on the results of tests using simulated SAG datasets, the accuracy of our method for predicting non-target sequences was higher than that of currently reported techniques. Subsequently, we applied our tool to actual SAG datasets and evaluated the accuracy of the predictions. Our method works independently of public sequence information for distinguishing SAGs from non-target sequences. This method will be effective when employed against SAG sequences of unexplored strains and we anticipate that it will contribute to the correct interpretation of SAGs.

  18. Hyperactive antifreeze protein from an Antarctic sea ice bacterium Colwellia sp. has a compound ice-binding site without repetitive sequences.

    PubMed

    Hanada, Yuichi; Nishimiya, Yoshiyuki; Miura, Ai; Tsuda, Sakae; Kondo, Hidemasa

    2014-08-01

    Antifreeze proteins (AFPs) are structurally diverse macromolecules that bind to ice crystals and inhibit their growth to protect the organism from injuries caused by freezing. An AFP identified from the Antarctic bacterium Colwellia sp. strain SLW05 (ColAFP) is homologous to AFPs from a wide variety of psychrophilic microorganisms. To understand the antifreeze function of ColAFP, we have characterized its antifreeze activity and determined the crystal structure of this protein. The recombinant ColAFP exhibited thermal hysteresis activity of approximately 4 °C at a concentration of 0.14 mm, and induced rapid growth of ice crystals in the hexagonal direction. Fluorescence-based ice plane affinity analysis showed that ColAFP binds to multiple planes of ice, including the basal plane. These observations show that ColAFP is a hyperactive AFP. The crystal structure of ColAFP determined at 1.6 Å resolution revealed an irregular β-helical structure, similar to known homologs. Mutational and molecular docking studies showed that ColAFP binds to ice through a compound ice-binding site (IBS) located at a flat surface of the β-helix and the adjoining loop region. The IBS of ColAFP lacks the repetitive sequences that are characteristic of hyperactive AFPs. These results suggest that ColAFP exerts antifreeze activity through a compound IBS that differs from the characteristic IBSs shared by other hyperactive AFPs. This study demonstrates a novel method for protection from freezing by AFPs in psychrophilic microorganisms. Structural data for ColAFP have been submitted to the Protein Data Bank (PDB) under accession number 3WP9. © 2014 FEBS.

  19. Investigation of the Self-Healing Behaviors of Microcapsules/Bitumen Composites by a Repetitive Direct Tension Test

    PubMed Central

    Su, Jun-Feng; Yang, Peng; Wang, Ying-Yuan; Han, Shan; Han, Ning-Xu; Li, Wei

    2016-01-01

    The aim of this work was to evaluate the self-healing behaviors of bitumen using microcapsules containing rejuvenator by a modified fracture healing–refracture method through a repetitive tension test. Microcapsules had mean size values of 10, 20 and 30 μm with a same core/shell ratio of 1/1. Various microcapsules/bitumen samples were fabricated with microcapsule contents of 1.0, 3.0 and 5.0 wt. %, respectively. Tension strength values of microcapsules/bitumen samples were measured by a reparative fracture-healing process under different temperatures. It was found that these samples had tensile strength values larger than the data of pure bitumen samples under the same conditions after the four tensile fracture-healing cycles. Fracture morphology investigation and mechanism analysis indicated that the self-healing process was a process consisting of microcapsules being broken, penetrated and diffused. Moreover, the crack healing of bitumen can be considered as a viscosity driven process. The self-healing ability partly repaired the damage of bitumen during service life by comparing the properties of virgin and rejuvenated bitumen. PMID:28773722

  20. The Organization of Repetitive DNA in the Genomes of Amazonian Lizard Species in the Family Teiidae.

    PubMed

    Carvalho, Natalia D M; Pinheiro, Vanessa S S; Carmo, Edson J; Goll, Leonardo G; Schneider, Carlos H; Gross, Maria C

    2015-01-01

    Repetitive DNA is the largest fraction of the eukaryote genome and comprises tandem and dispersed sequences. It presents variations in relation to its composition, number of copies, distribution, dynamics, and genome organization, and participates in the evolutionary diversification of different vertebrate species. Repetitive sequences are usually located in the heterochromatin of centromeric and telomeric regions of chromosomes, contributing to chromosomal structures. Therefore, the aim of this study was to physically map repetitive DNA sequences (5S rDNA, telomeric sequences, tropomyosin gene 1, and retroelements Rex1 and SINE) of mitotic chromosomes of Amazonian species of teiids (Ameiva ameiva, Cnemidophorus sp. 1, Kentropyx calcarata, Kentropyx pelviceps, and Tupinambis teguixin) to understand their genome organization and karyotype evolution. The mapping of repetitive sequences revealed a distinct pattern in Cnemidophorus sp. 1, whereas the other species showed all sequences interspersed in the heterochromatic region. Physical mapping of the tropomyosin 1 gene was performed for the first time in lizards and showed that in addition to being functional, this gene has a structural function similar to the mapped repetitive elements as it is located preferentially in centromeric regions and termini of chromosomes.

  1. Composition and organization of active centromere sequences in complex genomes

    PubMed Central

    2012-01-01

    Background Centromeres are sites of chromosomal spindle attachment during mitosis and meiosis. While the sequence basis for centromere identity remains a subject of considerable debate, one approach is to examine the genomic organization at these active sites that are correlated with epigenetic marks of centromere function. Results We have developed an approach to characterize both satellite and non-satellite centromeric sequences that are missing from current assemblies in complex genomes, using the dog genome as an example. Combining this genomic reference with an epigenetic dataset corresponding to sequences associated with the histone H3 variant centromere protein A (CENP-A), we identify active satellite sequence domains that appear to be both functionally and spatially distinct within the overall definition of satellite families. Conclusions These findings establish a genomic and epigenetic foundation for exploring the functional role of centromeric sequences in the previously sequenced dog genome and provide a model for similar studies within the context of less-characterized genomes. PMID:22817545

  2. Diverse nucleotide compositions and sequence fluctuation in Rubisco protein genes

    NASA Astrophysics Data System (ADS)

    Holden, Todd; Dehipawala, S.; Cheung, E.; Bienaime, R.; Ye, J.; Tremberger, G., Jr.; Schneider, P.; Lieberman, D.; Cheung, T.

    2011-10-01

    The Rubisco protein-enzyme is arguably the most abundance protein on Earth. The biology dogma of transcription and translation necessitates the study of the Rubisco genes and Rubisco-like genes in various species. Stronger correlation of fractal dimension of the atomic number fluctuation along a DNA sequence with Shannon entropy has been observed in the studied Rubisco-like gene sequences, suggesting a more diverse evolutionary pressure and constraints in the Rubisco sequences. The strategy of using metal for structural stabilization appears to be an ancient mechanism, with data from the porphobilinogen deaminase gene in Capsaspora owczarzaki and Monosiga brevicollis. Using the chi-square distance probability, our analysis supports the conjecture that the more ancient Rubisco-like sequence in Microcystis aeruginosa would have experienced very different evolutionary pressure and bio-chemical constraint as compared to Bordetella bronchiseptica, the two microbes occupying either end of the correlation graph. Our exploratory study would indicate that high fractal dimension Rubisco sequence would support high carbon dioxide rate via the Michaelis- Menten coefficient; with implication for the control of the whooping cough pathogen Bordetella bronchiseptica, a microbe containing a high fractal dimension Rubisco-like sequence (2.07). Using the internal comparison of chi-square distance probability for 16S rRNA (~ E-22) versus radiation repair Rec-A gene (~ E-05) in high GC content Deinococcus radiodurans, our analysis supports the conjecture that high GC content microbes containing Rubisco-like sequence are likely to include an extra-terrestrial origin, relative to Deinococcus radiodurans. Similar photosynthesis process that could utilize host star radiation would not compete with radiation resistant process from the biology dogma perspective in environments such as Mars and exoplanets.

  3. Repetition Reduction: Lexical Repetition in the Absence of Referent Repetition

    ERIC Educational Resources Information Center

    Lam, Tuan Q.; Watson, Duane G.

    2014-01-01

    Compared to words that are new to a discourse, repeated words are produced with reduced acoustic prominence. Although these effects are often attributed to priming in the production system, the locus of the effect within the production system remains unresolved because, in natural speech, repetition often involves repetition of referents and…

  4. Repetition Reduction: Lexical Repetition in the Absence of Referent Repetition

    ERIC Educational Resources Information Center

    Lam, Tuan Q.; Watson, Duane G.

    2014-01-01

    Compared to words that are new to a discourse, repeated words are produced with reduced acoustic prominence. Although these effects are often attributed to priming in the production system, the locus of the effect within the production system remains unresolved because, in natural speech, repetition often involves repetition of referents and…

  5. Retrieval accuracy, statistical significance and compositional similarity in protein sequence database searches.

    PubMed

    Yu, Yi-Kuo; Gertz, E Michael; Agarwala, Richa; Schäffer, Alejandro A; Altschul, Stephen F

    2006-01-01

    Protein sequence database search programs may be evaluated both for their retrieval accuracy--the ability to separate meaningful from chance similarities--and for the accuracy of their statistical assessments of reported alignments. However, methods for improving statistical accuracy can degrade retrieval accuracy by discarding compositional evidence of sequence relatedness. This evidence may be preserved by combining essentially independent measures of alignment and compositional similarity into a unified measure of sequence similarity. A version of the BLAST protein database search program, modified to employ this new measure, outperforms the baseline program in both retrieval and statistical accuracy on ASTRAL, a SCOP-based test set.

  6. Influence of Stacking Sequence and Notch Angle on the Charpy Impact Behavior of Hybrid Composites

    NASA Astrophysics Data System (ADS)

    Behnia, S.; Daghigh, V.; Nikbin, K.; Fereidoon, A.; Ghorbani, J.

    2016-09-01

    The low-velocity impact behavior of hybrid composite laminates was investigated. The epoxy matrix was reinforced with aramid, glass, basalt, and carbon fabrics using the hand lay-up technique. Different stacking sequences and notch angles were and notch angles considered and tested using a Charpy impact testing machine to study the hybridization and notch angle effects on the impact response of the hybrid composites. The energy absorption capability of specimens with different stacking sequences and notch angles is compared and discussed. It is shown that the hybridization can enhance the mechanical performance of composite materials.

  7. A base composition analysis of natural patterns for the preprocessing of metagenome sequences

    PubMed Central

    2013-01-01

    Background On the pretext that sequence reads and contigs often exhibit the same kinds of base usage that is also observed in the sequences from which they are derived, we offer a base composition analysis tool. Our tool uses these natural patterns to determine relatedness across sequence data. We introduce spectrum sets (sets of motifs) which are permutations of bacterial restriction sites and the base composition analysis framework to measure their proportional content in sequence data. We suggest that this framework will increase the efficiency during the pre-processing stages of metagenome sequencing and assembly projects. Results Our method is able to differentiate organisms and their reads or contigs. The framework shows how to successfully determine the relatedness between these reads or contigs by comparison of base composition. In particular, we show that two types of organismal-sequence data are fundamentally different by analyzing their spectrum set motif proportions (coverage). By the application of one of the four possible spectrum sets, encompassing all known restriction sites, we provide the evidence to claim that each set has a different ability to differentiate sequence data. Furthermore, we show that the spectrum set selection having relevance to one organism, but not to the others of the data set, will greatly improve performance of sequence differentiation even if the fragment size of the read, contig or sequence is not lengthy. Conclusions We show the proof of concept of our method by its application to ten trials of two or three freshly selected sequence fragments (reads and contigs) for each experiment across the six organisms of our set. Here we describe a novel and computationally effective pre-processing step for metagenome sequencing and assembly tasks. Furthermore, our base composition method has applications in phylogeny where it can be used to infer evolutionary distances between organisms based on the notion that related organisms

  8. De novo construction of a "Gene-space" for diploid plant genome rich in repetitive sequences by an iterative Process of Extraction and Assembly of NGS reads (iPEA protocol) with limited computing resources.

    PubMed

    Aluome, Christelle; Aubert, Grégoire; Alves Carvalho, Susete; Le Paslier, Marie-Christine; Burstin, Judith; Brunel, Dominique

    2016-02-11

    The continuing increase in size and quality of the "short reads" raw data is a significant help for the quality of the assembly obtained through various bioinformatics tools. However, building a reference genome sequence for most plant species remains a significant challenge due to the large number of repeated sequences which are problematic for a whole-genome quality de novo assembly. Furthermore, for most SNP identification approaches in plant genetics and breeding, only the "Gene-space" regions including the promoter, exon and intron sequences are considered. We developed the iPea protocol to produce a de novo Gene-space assembly by reconstructing, in an iterative way, the non-coding sequence flanking the Unigene cDNA sequence through addition of next-generation DNA-seq data. The approach was elaborated with the large diploid genome of pea (Pisum sativum L.), rich in repetitive sequences. The final Gene-space assembly included 35,400 contigs (97 Mb), covering 88 % of the 40,227 contigs (53.1 Mb) of the PsCam_low-copy Unigen set. Its accuracy was validated by the results of the built GenoPea 13.2 K SNP Array. The iPEA protocol allows the reconstruction of a Gene-space based from RNA-Seq and DNA-seq data with limited computing resources.

  9. Factoring local sequence composition in motif significance analysis.

    PubMed

    Ng, Patrick; Keich, Uri

    2008-01-01

    We recently introduced a biologically realistic and reliable significance analysis of the output of a popular class of motif finders. In this paper we further improve our significance analysis by incorporating local base composition information. Relying on realistic biological data simulation, as well as on FDR analysis applied to real data, we show that our method is significantly better than the increasingly popular practice of using the normal approximation to estimate the significance of a finder's output. Finally we turn to leveraging our reliable significance analysis to improve the actual motif finding task. Specifically, endowing a variant of the Gibbs Sampler with our improved significance analysis we demonstrate that de novo finders can perform better than has been perceived. Significantly, our new variant outperforms all the finders reviewed in a recently published comprehensive analysis of the Harbison genome-wide binding location data. Interestingly, many of these finders incorporate additional information such as nucleosome positioning and the significance of binding data.

  10. Chromosomal Mapping of Repetitive DNA Sequences in Five Species of Astyanax (Characiformes, Characidae) Reveals Independent Location of U1 and U2 snRNA Sites and Association of U1 snRNA and 5S rDNA.

    PubMed

    Silva, Duilio M Z A; Utsunomia, Ricardo; Pansonato-Alves, José C; Oliveira, Cláudio; Foresti, Fausto

    2015-01-01

    Astyanax is a genus of Characidae fishes currently composed of 155 valid species. Previous cytogenetic studies revealed high chromosomal diversification among them, and several studies have been performed using traditional cytogenetic techniques to investigate karyotypes and chromosomal locations of 18S and 5S rDNA genes. However, only a few studies are currently available about other repetitive sequences. Here, the chromosomal location of small nuclear RNA genes, identified as U1 and U2 snRNA clusters, was established and compared to the distribution of 5S rDNA and histone clusters in 5 Astyanax species (A. paranae, A. fasciatus, A. bockmanni, A. altiparanae, and A. jordani) using FISH. The cytogenetic mapping of U1 and U2 snRNA demonstrated a conserved pattern in the number of sites per genome independent of the location in Astyanax species. The location of the U1 snRNA gene was frequently associated with 5S rDNA sequences, indicating a possible interaction between the distinct repetitive DNA families. Finally, comparisons involving the location of U1 and U2 snRNA clusters in the chromosomes of Astyanax species revealed a very diverse pattern, suggesting that many rearrangements have occurred during the diversification process of this group. © 2015 S. Karger AG, Basel.

  11. Molecular Typing of Mycobacterium intracellulare Using Pulsed-Field Gel Electrophoresis, Variable-Number Tandem-Repeat Analysis, Mycobacteria Interspersed Repetitive-Unit-Variable-Number Tandem Repeat Typing, and Multilocus Sequence Typing: Molecular Characterization and Comparison of Each Typing Methods

    PubMed Central

    Jeon, Semi; Lim, Nara; Kwon, Seungjik; Shim, Taesun; Park, Misun; Kim, Bum-Joon; Kim, Seonghan

    2014-01-01

    Objectives Mycobacterium intracellulare is the major causative agent of nontuberculous mycobacteria-related pulmonary infections. The strain typing of M. intracellulare is important for the treatment and control of its infections. We compared the discrimination capacity and effective value of four different molecular typing methods. Methods Antibiotic susceptibility testing, hsp65 and rpoB sequencing, pulsed-field gel electrophoresis (PFGE), multilocus sequence typing (MLST), mycobacteria interspersed repetitive-unit-variable-number tandem-repeat analysis (MIRU-VNTR), and VNTR assay targeting 44 M. intracellulare isolates obtained from patients with pulmonary infections were performed. Results All the antibiotic susceptibility patterns had no association with the molecular and sequence types tested in this study; however, the molecular and sequence types were related with each other. PFGE gave best results for discriminatory capacity, followed by VNTR, MLST, and MIRU-VNTR. Conclusion The high discriminatory power of PFGE, VNTR, and MLST is enough for differentiating between reinfection and relapse, as well as for other molecular epidemiological usages. The MLST could be regarded as a representative classification method, because it showed the clearest relation with the sequence types. PMID:25180144

  12. A novel sensitive method for the detection of user-defined compositional bias in biological sequences.

    PubMed

    Kuznetsov, Igor B; Hwang, Seungwoo

    2006-05-01

    Most biological sequences contain compositionally biased segments in which one or more residue types are significantly overrepresented. The function and evolution of these segments are poorly understood. Usually, all types of compositionally biased segments are masked and ignored during sequence analysis. However, it has been shown for a number of proteins that biased segments that contain amino acids with similar chemical properties are involved in a variety of molecular functions and human diseases. A detailed large-scale analysis of the functional implications and evolutionary conservation of different compositionally biased segments requires a sensitive method capable of detecting user-specified types of compositional bias. We present BIAS, a novel sensitive method for the detection of compositionally biased segments composed of a user-specified set of residue types. BIAS uses the discrete scan statistics that provides a highly accurate correction for multiple tests to compute analytical estimates of the significance of each compositionally biased segment. The method can take into account global compositional bias when computing analytical estimates of the significance of local clusters. BIAS is benchmarked against SEG, SAPS and CAST programs. We also use BIAS to show that groups of proteins with the same biological function are significantly associated with particular types of compositionally biased segments.

  13. Targeted Capture Sequencing in Whitebark Pine Reveals Range-Wide Demographic and Adaptive Patterns Despite Challenges of a Large, Repetitive Genome

    PubMed Central

    Syring, John V.; Tennessen, Jacob A.; Jennings, Tara N.; Wegrzyn, Jill; Scelfo-Dalbey, Camille; Cronn, Richard

    2016-01-01

    Whitebark pine (Pinus albicaulis) inhabits an expansive range in western North America, and it is a keystone species of subalpine environments. Whitebark is susceptible to multiple threats – climate change, white pine blister rust, mountain pine beetle, and fire exclusion – and it is suffering significant mortality range-wide, prompting the tree to be listed as ‘globally endangered’ by the International Union for Conservation of Nature and ‘endangered’ by the Canadian government. Conservation collections (in situ and ex situ) are being initiated to preserve the genetic legacy of the species. Reliable, transferrable, and highly variable genetic markers are essential for quantifying the genetic profiles of seed collections relative to natural stands, and ensuring the completeness of conservation collections. We evaluated the use of hybridization-based target capture to enrich specific genomic regions from the 27 GB genome of whitebark pine, and to evaluate genetic variation across loci, trees, and geography. Probes were designed to capture 7,849 distinct genes, and screening was performed on 48 trees. Despite the inclusion of repetitive elements in the probe pool, the resulting dataset provided information on 4,452 genes and 32% of targeted positions (528,873 bp), and we were able to identify 12,390 segregating sites from 47 trees. Variations reveal strong geographic trends in heterozygosity and allelic richness, with trees from the southern Cascade and Sierra Range showing the greatest distinctiveness and differentiation. Our results show that even under non-optimal conditions (low enrichment efficiency; inclusion of repetitive elements in baits), targeted enrichment produces high quality, codominant genotypes from large genomes. The resulting data can be readily integrated into management and gene conservation activities for whitebark pine, and have the potential to be applied to other members of 5-needle pine group (Pinus subsect. Quinquefolia) due to

  14. Targeted Capture Sequencing in Whitebark Pine Reveals Range-Wide Demographic and Adaptive Patterns Despite Challenges of a Large, Repetitive Genome.

    PubMed

    Syring, John V; Tennessen, Jacob A; Jennings, Tara N; Wegrzyn, Jill; Scelfo-Dalbey, Camille; Cronn, Richard

    2016-01-01

    Whitebark pine (Pinus albicaulis) inhabits an expansive range in western North America, and it is a keystone species of subalpine environments. Whitebark is susceptible to multiple threats - climate change, white pine blister rust, mountain pine beetle, and fire exclusion - and it is suffering significant mortality range-wide, prompting the tree to be listed as 'globally endangered' by the International Union for Conservation of Nature and 'endangered' by the Canadian government. Conservation collections (in situ and ex situ) are being initiated to preserve the genetic legacy of the species. Reliable, transferrable, and highly variable genetic markers are essential for quantifying the genetic profiles of seed collections relative to natural stands, and ensuring the completeness of conservation collections. We evaluated the use of hybridization-based target capture to enrich specific genomic regions from the 27 GB genome of whitebark pine, and to evaluate genetic variation across loci, trees, and geography. Probes were designed to capture 7,849 distinct genes, and screening was performed on 48 trees. Despite the inclusion of repetitive elements in the probe pool, the resulting dataset provided information on 4,452 genes and 32% of targeted positions (528,873 bp), and we were able to identify 12,390 segregating sites from 47 trees. Variations reveal strong geographic trends in heterozygosity and allelic richness, with trees from the southern Cascade and Sierra Range showing the greatest distinctiveness and differentiation. Our results show that even under non-optimal conditions (low enrichment efficiency; inclusion of repetitive elements in baits), targeted enrichment produces high quality, codominant genotypes from large genomes. The resulting data can be readily integrated into management and gene conservation activities for whitebark pine, and have the potential to be applied to other members of 5-needle pine group (Pinus subsect. Quinquefolia) due to their

  15. Pseudo nucleotide composition or PseKNC: an effective formulation for analyzing genomic sequences.

    PubMed

    Chen, Wei; Lin, Hao; Chou, Kuo-Chen

    2015-10-01

    With the avalanche of DNA/RNA sequences generated in the post-genomic age, it is urgent to develop automated methods for analyzing the relationship between the sequences and their functions. Towards this goal, a series of sequence-based methods have been proposed and applied to analyze various character-unknown DNA/RNA sequences in order for in-depth understanding their action mechanisms and processes. Compared with the classical sequence-based methods, the pseudo nucleotide composition or PseKNC approach developed very recently has the following advantages: (1) it can convert length-different DNA/RNA sequences into dimension-fixed digital vectors that can be directly handled by all the existing machine-learning algorithms or operation engines; (2) it can contain the desired features and properties according to the selection or definition of users; (3) it can cover considerable sequence pattern information, both local and global. This minireview is focused on the concept of pseudo nucleotide composition, its development and applications.

  16. Enzymes/non-enzymes classification model complexity based on composition, sequence, 3D and topological indices.

    PubMed

    Munteanu, Cristian Robert; González-Díaz, Humberto; Magalhães, Alexandre L

    2008-09-21

    The huge amount of new proteins that need a fast enzymatic activity characterization creates demands of protein QSAR theoretical models. The protein parameters that can be used for an enzyme/non-enzyme classification includes the simpler indices such as composition, sequence and connectivity, also called topological indices (TIs) and the computationally expensive 3D descriptors. A comparison of the 3D versus lower dimension indices has not been reported with respect to the power of discrimination of proteins according to enzyme action. A set of 966 proteins (enzymes and non-enzymes) whose structural characteristics are provided by PDB/DSSP files was analyzed with Python/Biopython scripts, STATISTICA and Weka. The list of indices includes, but it is not restricted to pure composition indices (residue fractions), DSSP secondary structure protein composition and 3D indices (surface and access). We also used mixed indices such as composition-sequence indices (Chou's pseudo-amino acid compositions or coupling numbers), 3D-composition (surface fractions) and DSSP secondary structure amino acid composition/propensities (obtained with our Prot-2S Web tool). In addition, we extend and test for the first time several classic TIs for the Randic's protein sequence Star graphs using our Sequence to Star Graph (S2SG) Python application. All the indices were processed with general discriminant analysis models (GDA), neural networks (NN) and machine learning (ML) methods and the results are presented versus complexity, average of Shannon's information entropy (Sh) and data/method type. This study compares for the first time all these classes of indices to assess the ratios between model accuracy and indices/model complexity in enzyme/non-enzyme discrimination. The use of different methods and complexity of data shows that one cannot establish a direct relation between the complexity and the accuracy of the model.

  17. Mitochondrial genomes and divergence times of crocodile newts: inter-islands distribution of Echinotriton andersoni and the origin of a unique repetitive sequence found in Tylototriton mt genomes.

    PubMed

    Kurabayashi, Atsushi; Nishitani, Takuma; Katsuren, Seiki; Oumi, Shohei; Sumida, Masayuki

    2012-01-01

    Crocodile newts, which constitute the genera Echinotriton and Tylototriton, are known as living fossils, and these genera comprise many endangered species. To identify mitochondrial (mt) genes suitable for future population genetic analyses for endangered taxa, we determined the complete nucleotide sequences of the mt genomes of the Japanese crocodile newt Echinotriton andersoni and Himalayan crocodile newt Tylototriton verrucosus. Although the control region (CR) is known as the most variable mtDNA region in many animal taxa, the CRs of crocodile newts are highly conservative. Rather, the genes of NADH dehydrogenase subunits and ATPase subunit 6 were found to have high sequence divergences and to be usable for population genetics studies. To estimate the inter-population divergence ages of E. andersoni endemic to the Ryukyu Islands, we performed molecular dating analysis using whole and partial mt genomic data. The estimated divergence ages of the inter-island individuals are older than the paleogeographic segmentation ages of the islands, suggesting that the lineage splits of E. andersoni populations were not caused by vicariant events. Our phylogenetic analysis with partial mt sequence data also suggests the existence of at least two more undescribed species in the genus Tylototriton. We also found unusual repeat sequences containing the 3' region of cytochrome apoenzyme b gene, whole tRNA-Thr gene, and a noncoding region (the T-P noncoding region characteristic in caudate mtDNAs) from T. verrucosus mtDNA. Similar repeat sequences were found in two other Tylototriton species. The Tylototriton taxa with the repeats become a monophyletic group, indicating a single origin of the repeat sequences. The intra-and inter-specific comparisons of the repeat sequences suggest the occurrences of homologous recombination-based concerted evolution among the repeat sequences.

  18. A novel repetitive sequence, termed the JNK repeat family, located on an extra heterochromatic region of chromosome 2R of Japanese rye.

    PubMed

    Nagaki, K; Tsujimoto, H; Sasakuma, T

    1999-01-01

    Among cultivated rye, Seccale cereale L., collected in Japan, we found an extra heterochromatin on the long-arm interstitial region of chromosome 2R. This extra heterochromatin was polymorphic in the population. The plants with the extra heterochromatin showed a specific DNA fragment of 1.2 kb in digests prepared with the restriction enzyme Dral. The fragment was cloned and used as a probe for fluorescent in-situ hybridization (FISH). The clone, pScJNK1, showed a hybridization signal at the extra heterochromatic region. The segregation of the number of signals corresponded to the number of the extra heterochromatin of the 2R chromosome, indicating that the sequence might construct the heterochromatin. Southern hybridization using the clone as a probe showed a ladder pattern, suggesting that the sequence was a tandem repeat. Three sequences homologous to pScJNK1 were isolated; these were 1192 1232 bp, 44.7-45.9% in GC content, highly homologous (> 93%) with each other, and did not show any significant homology to other sequences in a DNA database. Slot blot hybridization using pScJNK1 as a probe indicated that there were about 4000 copies of the sequence in the haploid genome carrying the extra heterochromatin, whereas less than 20 copies existed in the genome without the heterochromatin. Southern hybridization using MspI and HapII indicated that all of the second cytosine nucleotides in CCGG sites in the sequence were methylated in the extra heterochromatin.

  19. Draft Genome Sequence of Cyanobacterium sp. Strain IPPAS B-1200 with a Unique Fatty Acid Composition

    PubMed Central

    Starikov, Alexander Y.; Usserbaeva, Aizhan A.; Sinetova, Maria A.; Sarsekeyeva, Fariza K.; Zayadan, Bolatkhan K.; Ustinova, Vera V.; Kupriyanova, Elena V.; Los, Dmitry A.

    2016-01-01

    Here, we report the draft genome of Cyanobacterium sp. IPPAS strain B-1200, isolated from Lake Balkhash, Kazakhstan, and characterized by the unique fatty acid composition of its membrane lipids, which are enriched with myristic and myristoleic acids. The approximate genome size is 3.4 Mb, and the predicted number of coding sequences is 3,119. PMID:27856596

  20. Precipitation Sequence of a SiC Particle Reinforced Al-Mg-Si Alloy Composite

    NASA Astrophysics Data System (ADS)

    Shen, Rujuan; Wang, Yihan; Guo, Baisong; Song, Min

    2016-11-01

    In this study, the precipitation sequence of a 5 vol.% SiC particles reinforced Al-1.12 wt.%Mg-0.77 wt.%Si alloy composite fabricated by traditional powder metallurgy method was investigated by transmission electron microscopy and hardness measurements. The results indicated that the addition of SiC reinforcements not only suppresses the initial aging stage but also influences the subsequent precipitates. The precipitation sequence of the composite aged at 175 °C can be described as: Guinier-Preston (G.P.) zone → β″ → β' → B', which was confirmed by high-resolution transmission electron microscopy. This work might provide the guidance for the design and fabrication of hardenable automobile body sheet by Al-based composites with enhanced mechanical properties.

  1. Influence of processing sequence on the tribological properties of VGCF-X/PA6/SEBS composites

    NASA Astrophysics Data System (ADS)

    Osada, Yu; Nishitani, Yosuke; Kitano, Takeshi

    2016-03-01

    In order to develop the new tribomaterials for mechanical sliding parts with sufficient balance of mechanical and tribological properties, we investigated the influence of processing sequence on the tribological properties of the ternary nanocomposites: the polymer blends of polyamide 6 (PA6) and styrene-ethylene/butylene-styrene copolymer (SEBS) filled with vapor grown carbon fiber (VGCF-X), which is one of carbon nanofiber (CNF) and has 15nm diameter and 3μm length. Five different processing sequences: (1) VGCF-X, PA6 and SEBS were mixed simultaneously (Process A), (2) Re-mixing (Second compounding) of the materials prepared by Process A (Process AR),(3) SEBS was blended with PA6 (PA6/SEBS blends) and then these blends were mixed with VGCF-X (Process B), (4) VGCF-X was mixed with PA6 (VGCF-X/PA6 composites) and then these composites were blended with SEBS (Process C), and (5) VGCF-X were mixed with SEBS (VGCF-X/SEBS composites) and then these composites were blended with PA6 (Process D) were attempted for preparing of the ternary nanocomposites (VGCF-X/PA6/SEBS composites). These ternary polymer nanocomposites were extruded by a twin screw extruder and injection-molded. Their tribological properties were evaluated by using a ring-on-plate type sliding wear tester under dry condition. The tribological properties such as the frictional coefficient and the specific wear rate were influenced by the processing sequence. These results may be attributed to the change of internal structure formation, which is a dispersibility of SEBS particle and VGCF-X in ternary nanocomposites (VGCF-X/PA6/SEBS) by different processing sequences. In particular, the processing sequences of AR, B and D, which are those of re-mixing of VGCF-X, have a good dispersibility of VGCF-X for the improvement of tribological properties.

  2. Effect of stacking sequence on the coefficients of mutual influence of composite laminates

    NASA Astrophysics Data System (ADS)

    Dupir (Hudișteanu, I.; Țăranu, N.; Axinte, A.

    2016-11-01

    Fiber reinforced polymeric (FRP) composites are nowadays widely used in engineering applications due to their outstanding features, such as high specific strength and specific stiffness as well as good corrosion resistance. A major advantage of fibrous polymeric composites is that their anisotropy can be controlled through suitable choice of the influencing parameters. The unidirectional fiber reinforced composites provide much higher longitudinal mechanical properties compared to the transverse ones. Therefore, composite laminates are formed by stacking two or more laminas, with different fiber orientations, as to respond to complex states of stresses. These laminates experience the effect of axial-shear coupling, which is caused by applying normal or shear stresses, implying shear or normal strains, respectively. The normal-shear coupling is expressed by the coefficients of mutual influence. They are engineering constants of primary interest for composite laminates, since the mismatch of the material properties between adjacent layers can produce interlaminar stresses and/or plies delamination. The paper presents the variation of the in-plane and flexural coefficients of mutual influence for three types of multi-layered composites, with different stacking sequences. The results are obtained using the Classical Lamination Theory (CLT) and are illustrated graphically in terms of fiber orientations, for asymmetric, antisymmetric and symmetric laminates. Conclusions are formulated on the variation of these coefficients, caused by the stacking sequence.

  3. Comparison of a Repetitive Extragenic Palindromic Sequence-Based PCR Method and Clinical and Microbiological Methods for Determining Strain Sources in Cases of Nosocomial Acinetobacter baumannii Bacteremia

    PubMed Central

    Martín-Lozano, David; Cisneros, José Miguel; Becerril, Berta; Cuberos, Lucila; Prados, Trinidad; Ortíz-Leyba, Carlos; Cañas, Elías; Pachón, Jerónimo

    2002-01-01

    Using a repetitive extragenic palindromic PCR (REP-PCR), we genotypically characterized strains causing nosocomial Acinetobacter baumannii infections and analyzed the source of bacteremia in 67 patients from an institution in which infections by this bacterium were endemic. Six different genotypes were found, including 21, 27, 3, 9, 3, and 4 strains. The probable source of bacteremia, according to clinical and/or microbiological criteria, was known in 42 patients (63%): respiratory tract (n = 19), surgical sites (n = 12), intravascular catheters (n = 5), burns (n = 3), and urinary tract (n = 3). The definite source of bacteremia, according to REP-PCR, could be established in 30 (71%) out of the 42 patients with strains from blood and other sites; in these cases clinical and microbiological criteria for the source of bacteremia were thus confirmed. In the remaining 12 patients (29%) the probable source was refuted by the REP-PCR method. The definite sources of bacteremia according to genotype were as follows: respiratory tract in 13 patients (31%), surgical sites in 8 (19%), intravascular catheters in 4 (9%), burns in 3 (7%), and urinary tract in 2 (5%). A comparison of strains from blood cultures and other sites with regard to their REP-PCR and antimicrobial resistance profiles was also made. Taking the REP-PCR as the “gold standard,” the positive predictive value of antibiotype was 77% and the negative predictive value was 42%. In summary, the utility of the diagnosis of the source of nosocomial A. baumannii bacteremia using clinical and/or microbiological criteria, including antibiotyping, is limited, as demonstrated by REP-PCR. PMID:12454154

  4. Stacking Sequence Optimizations Using Fractal Branch and Bound Method for Laminated Composites

    NASA Astrophysics Data System (ADS)

    Terada, Yuichiro; Todoroki, Akira; Shimamura, Yoshinobu

    The present study shows a mechanism of fractal branches of stacking sequences of laminated composites and proposes a novel approach for stacking sequence optimizations named the fractal branch and bound method. Applications of the method are limited to the stacking sequence optimizations that can be computed only by out-of-planes lamination parameters. First, values of the objective function are approximated by response surfaces as a function of the out-of-plane lamination parameters using design of experiments and the least-square-error method, and an optimal set of lamination parameters is obtained. Next, a set of candidates of optimal stacking sequences is collected using a branch-and-bound method near the optimal point of the set of lamination parameters. All of the candidates are examined thoroughly and the actual optimal stacking sequence is obtained. The fractal branch and bound method is applied to the stacking sequence optimization problems for a maximization of buckling load of a simply supported rectangular plate, and the method obtained the exact optimal stacking sequence with very low computational cost.

  5. Repetitively pulsed vacuum insulator flashover

    SciTech Connect

    Ginn, J.W.; Buttram, M.T.

    1987-01-01

    Experiments were performed to determine the flashover strength of various vacuum insulators under conditions of repetitive pulsing. The pulse duration was 30 ns, and the thickness of a typical insulator sample was 1.8 cm. Data were taken for 45 insulators from five different materials. An insulator was subjected to an extended series of pulses at a given repetition rate and field. If flashover was not detected, the field level was increased and the sequence repeated. At rates up to 50 pulses per second, there was no apparent dependence of flashover field on rate. In addition, some ''single shot'' data were taken, including various modifications of the geometries and surface textures of the insulators. Only two to the modifications increased the flashover strength significantly over that of a 45 sample: (1) annealing some plastics (roughly a 35% increase), and (2) extending the insulator to cover the surfaces of both electrodes (an increase of nearly a factor of two).

  6. Determination of load sequence effects on the degradation and failure of composite materials. [Graphite-epoxy composites

    NASA Technical Reports Server (NTRS)

    Yang, J. N.; Jones, D. L.

    1981-01-01

    A theoretical model was established to predict the fatigue behavior of composite materials, with emphasis placed on predictions of the degradation of residual strength and residual stiffness during fatigue cycling. The model parameters were evaluated from three test series including static strength fatigue life and residual strength tests. The tests were applied to two graphite/epoxy laminates. Load sequence effects were emphasized for both laminates and the predicted results agreed quite well with subsequent verification tests. Dynamic as well as static stiffness reduction data were collected by use of a PDP11-03 computer, which performed quite satisfactorily and permitted the recording of a substantial amount of dynamic stiffness reduction data.

  7. The Negative Repetition Effect

    ERIC Educational Resources Information Center

    Mulligan, Neil W.; Peterson, Daniel J.

    2013-01-01

    A fundamental property of human memory is that repetition enhances memory. Peterson and Mulligan (2012) recently documented a surprising "negative repetition effect," in which participants who studied a list of cue-target pairs twice recalled fewer targets than a group who studied the pairs only once. Words within a pair rhymed, and…

  8. The Negative Repetition Effect

    ERIC Educational Resources Information Center

    Mulligan, Neil W.; Peterson, Daniel J.

    2013-01-01

    A fundamental property of human memory is that repetition enhances memory. Peterson and Mulligan (2012) recently documented a surprising "negative repetition effect," in which participants who studied a list of cue-target pairs twice recalled fewer targets than a group who studied the pairs only once. Words within a pair rhymed, and…

  9. Sequence-Based Analysis of Structural Organization and Composition of the Cultivated Sunflower (Helianthus annuus L.) Genome.

    PubMed

    Gill, Navdeep; Buti, Matteo; Kane, Nolan; Bellec, Arnaud; Helmstetter, Nicolas; Berges, Hélène; Rieseberg, Loren H

    2014-04-16

    Sunflower is an important oilseed crop, as well as a model system for evolutionary studies, but its 3.6 gigabase genome has proven difficult to assemble, in part because of the high repeat content of its genome. Here we report on the sequencing, assembly, and analyses of 96 randomly chosen BACs from sunflower to provide additional information on the repeat content of the sunflower genome, assess how repetitive elements in the sunflower genome are organized relative to genes, and compare the genomic distribution of these repeats to that found in other food crops and model species. We also examine the expression of transposable element-related transcripts in EST databases for sunflower to determine the representation of repeats in the transcriptome and to measure their transcriptional activity. Our data confirm previous reports in suggesting that the sunflower genome is >78% repetitive. Sunflower repeats share very little similarity to other plant repeats such as those of Arabidopsis, rice, maize and wheat; overall 28% of repeats are "novel" to sunflower. The repetitive sequences appear to be randomly distributed within the sequenced BACs. Assuming the 96 BACs are representative of the genome as a whole, then approximately 5.2% of the sunflower genome comprises non TE-related genic sequence, with an average gene density of 18kbp/gene. Expression levels of these transposable elements indicate tissue specificity and differential expression in vegetative and reproductive tissues, suggesting that expressed TEs might contribute to sunflower development. The assembled BACs will also be useful for assessing the quality of several different draft assemblies of the sunflower genome and for annotating the reference sequence.

  10. Community and gene composition of a human dental plaque microbiota obtained by metagenomic sequencing

    PubMed Central

    Xie, G.; Chain, P.S.G.; Lo, C.; Liu, K-L.; Gans, J.; Merritt, J.; Qi, F.

    2010-01-01

    SUMMARY Human dental plaque is a complex microbial community containing an estimated 700 to 19,000 species/phylotypes. Despite numerous studies analysing species richness in healthy and diseased human subjects, the true genomic composition of the human dental plaque microbiota remains unknown. Here we report a metagenomic analysis of a healthy human plaque sample using a combination of second-generation sequencing platforms. A total of 860 million base pairs of non-human sequences were generated. Various analysis tools revealed the presence of 12 well-characterized phyla, members of the TM-7 and BRC1 clade, and sequences that could not be classified. Both pathogens and opportunistic pathogens were identified, supporting the ecological plaque hypothesis for oral diseases. Mapping the metagenomic reads to sequenced reference genomes demonstrated that 4% of the reads could be assigned to the sequenced species. Preliminary annotation identified genes belonging to all known functional categories. Interestingly, although 73% of the total assembled contig sequences were predicted to code for proteins, only 51% of them could be assigned a functional role. Furthermore, ~ 2.8% of the total predicted genes coded for proteins involved in resistance to antibiotics and toxic compounds, suggesting that the oral cavity is an important reservoir for antimicrobial resistance. PMID:21040513

  11. Community and gene composition of a human dental plaque microbiota obtained by metagenomic sequencing.

    PubMed

    Xie, G; Chain, P S G; Lo, C-C; Liu, K-L; Gans, J; Merritt, J; Qi, F

    2010-12-01

    Human dental plaque is a complex microbial community containing an estimated 700 to 19,000 species/phylotypes. Despite numerous studies analysing species richness in healthy and diseased human subjects, the true genomic composition of the human dental plaque microbiota remains unknown. Here we report a metagenomic analysis of a healthy human plaque sample using a combination of second-generation sequencing platforms. A total of 860 million base pairs of non-human sequences were generated. Various analysis tools revealed the presence of 12 well-characterized phyla, members of the TM-7 and BRC1 clade, and sequences that could not be classified. Both pathogens and opportunistic pathogens were identified, supporting the ecological plaque hypothesis for oral diseases. Mapping the metagenomic reads to sequenced reference genomes demonstrated that 4% of the reads could be assigned to the sequenced species. Preliminary annotation identified genes belonging to all known functional categories. Interestingly, although 73% of the total assembled contig sequences were predicted to code for proteins, only 51% of them could be assigned a functional role. Furthermore, ~2.8% of the total predicted genes coded for proteins involved in resistance to antibiotics and toxic compounds, suggesting that the oral cavity is an important reservoir for antimicrobial resistance.

  12. Nucleotide composition of CO1 sequences in Chelicerata (Arthropoda): detecting new mitogenomic rearrangements.

    PubMed

    Arabi, Juliette; Judson, Mark L I; Deharveng, Louis; Lourenço, Wilson R; Cruaud, Corinne; Hassanin, Alexandre

    2012-02-01

    Here we study the evolution of nucleotide composition in third codon-positions of CO1 sequences of Chelicerata, using a phylogenetic framework, based on 180 taxa and three markers (CO1, 18S, and 28S rRNA; 5,218 nt). The analyses of nucleotide composition were also extended to all CO1 sequences of Chelicerata found in GenBank (1,701 taxa). The results show that most species of Chelicerata have a positive strand bias in CO1, i.e., in favor of C nucleotides, including all Amblypygi, Palpigradi, Ricinulei, Solifugae, Uropygi, and Xiphosura. However, several taxa show a negative strand bias, i.e., in favor of G nucleotides: all Scorpiones, Opisthothelae spiders and several taxa within Acari, Opiliones, Pseudoscorpiones, and Pycnogonida. Several reversals of strand-specific bias can be attributed to either a rearrangement of the control region or an inversion of a fragment containing the CO1 gene. Key taxa for which sequencing of complete mitochondrial genomes will be necessary to determine the origin and nature of mtDNA rearrangements involved in the reversals are identified. Acari, Opiliones, Pseudoscorpiones, and Pycnogonida were found to show a strong variability in nucleotide composition. In addition, both mitochondrial and nuclear genomes have been affected by higher substitution rates in Acari and Pseudoscorpiones. The results therefore indicate that these two orders are more liable to fix mutations of all types, including base substitutions, indels, and genomic rearrangements.

  13. Composite Sequences for Triple-dot Qubits that Compensate for Miscalibration and Hyperfine Gradients

    NASA Astrophysics Data System (ADS)

    Ladd, Thaddeus

    2014-03-01

    Exchange-only qubits defined in triple quantum dots form a promising means for all-electrical semiconductor quantum control, but they suffer from both charge noise and random magnetic field gradients. Low-frequency noise sources can be compensated using composite sequences, but the development of such sequences is constrained by the fact that exchange energies are always positive and the control axes are non-orthogonal. Here, we present the results of both analytical approaches and computational searches for composite pulse sequences, which compensate for simultaneous low-frequency miscalibration (due to fixed random electric fields) and hyperfine effects (due to nuclear magnetic fields) in a single triple-dot qubit. We also present compensation sequences for multi-qubit gates. These results can substantially improve the working fidelity of quantum operations in semiconductor quantum dot devices. Sponsored by United States Department of Defense. The views and conclusions contained in this document are those of the authors and should not be interpreted as representing the official policies, either expressly or implied, of the United States Department of Defense or the U.S. Government.

  14. Compositional analysis: a valid approach to analyze microbiome high-throughput sequencing data.

    PubMed

    Gloor, Gregory B; Reid, Gregor

    2016-08-01

    A workshop held at the 2015 annual meeting of the Canadian Society of Microbiologists highlighted compositional data analysis methods and the importance of exploratory data analysis for the analysis of microbiome data sets generated by high-throughput DNA sequencing. A summary of the content of that workshop, a review of new methods of analysis, and information on the importance of careful analyses are presented herein. The workshop focussed on explaining the rationale behind the use of compositional data analysis, and a demonstration of these methods for the examination of 2 microbiome data sets. A clear understanding of bioinformatics methodologies and the type of data being analyzed is essential, given the growing number of studies uncovering the critical role of the microbiome in health and disease and the need to understand alterations to its composition and function following intervention with fecal transplant, probiotics, diet, and pharmaceutical agents.

  15. Influence of Stacking Sequence on the Impact and Postimpact Bending Behavior of Hybrid Sandwich Composites

    NASA Astrophysics Data System (ADS)

    Özen, M.

    2017-01-01

    A new hybrid sandwich structure was developed by using carbon, e-glass, and s-glass fabrics as reinforcement materials, an epoxy resin as the matrix material for face sheets, and a PVC foam as the core material. Six different configurations were prepared. Sandwich composites plates with different stacking sequences were subjected to low-speed impacts will energies of 7.5, 15, and 22.5 J. Their impact response is analyzed and reported in terms of the peak load as a function of impact energy. After impact tests, 3-point bending tests were conducted to determine the bending behavior of the sandwich composites after impacts in terms of their flexural strength. The results obtained showed that the use of carbon fabrics in the face sheets increased the peak loads for all the impact energies considered. The presence of carbon fibers in skin regions increased the flexural strength of the composites, but e-glass fibers decreased this strength.

  16. Replication in the amplified dihydrofolate reductase domain in CHO cells may initiate at two distinct sites, one of which is a repetitive sequence element.

    PubMed

    Anachkova, B; Hamlin, J L

    1989-02-01

    To study initiation of DNA replication in mammalian chromosomes, we have established a methotrexate-resistant Chinese hamster ovary cell line (CHOC 400) that contains approximately 1,000 copies of the early replicating dihydrofolate reductase (DHFR) domain. We have previously shown that DNA replication in the prevalent 243-kilobase (kb) amplicon type in this cell line initiates somewhere within a 28-kb region located downstream from the DHFR gene. In an attempt to localize the origin of replication with more precision, we blocked the progress of replication forks emanating from origins at the beginning of the S phase by the introduction of trioxsalen cross-links at 1- to 5-kb intervals in the parental double-stranded DNA. The small DNA fragments synthesized under these conditions (which should be centered around replication origins) were then used as hybridization probes on digests of cosmids and plasmids from the DHFR domain. These studies suggested that in cells synchronized by this regimen, DNA replication initiates at two separate sites within the previously defined 28-kb replication initiation locus, in general agreement with results described in the accompanying paper (T.-H. Leu and J. L. Hamlin, Mol. Cell. Biol. 9:523-531, 1989). One of these sites contains a repeated DNA sequence element that is found at or near many other initiation sites in the genome, since it was also highly enriched in the early replicating DNA isolated from cross-linked CHO cells that contain only two copies of the DHFR domain.

  17. Chromosomal distribution patterns of the (AC)10 microsatellite and other repetitive sequences, and their use in chromosome rearrangement analysis of species of the genus Avena.

    PubMed

    Fominaya, Araceli; Loarce, Yolanda; Montes, Alexander; Ferrer, Esther

    2017-03-01

    Fluorescence in situ hybridization (FISH) was used to determine the physical location of the (AC)10 microsatellite in metaphase chromosomes of six diploid species (AA or CC genomes), two tetraploid species (AACC genome), and five cultivars of two hexaploid species (AACCDD genome) of the genus Avena, a genus in which genomic relationships remain obscure. A preferential distribution of the (AC)10 microsatellite in the pericentromeric and interstitial regions was seen in both the A- and D-genome chromosomes, while in C-genome chromosomes the majority of signals were located in the pericentromeric heterochromatic regions. New large chromosome rearrangements were detected in two polyploid species: an intergenomic translocation involving chromosomes 17AL and 21DS in Avena sativa 'Araceli' and another involving chromosomes 4CL and 21DS in the analyzed cultivars of Avena byzantina. The latter 4CL-21DS intergenomic translocation differentiates clearly between A. sativa and A. byzantina. Searches for common hybridization patterns on the chromosomes of different species revealed chromosome 10A of Avena magna and 21D of hexaploid oats to be very similar in terms of the distribution of 45S and Am1 sequences. This suggests a common origin for these chromosomes and supports a CCDD rather than an AACC genomic designation for this species.

  18. First Survey of the Wheat Chromosome 5A Composition through a Next Generation Sequencing Approach

    PubMed Central

    Vitulo, Nicola; Albiero, Alessandro; Forcato, Claudio; Campagna, Davide; Dal Pero, Francesca; Bagnaresi, Paolo; Colaiacovo, Moreno; Faccioli, Primetta; Lamontanara, Antonella; Šimková, Hana; Kubaláková, Marie; Perrotta, Gaetano; Facella, Paolo; Lopez, Loredana; Pietrella, Marco; Gianese, Giulio; Doležel, Jaroslav; Giuliano, Giovanni; Cattivelli, Luigi; Valle, Giorgio; Stanca, A. Michele

    2011-01-01

    Wheat is one of the world's most important crops and is characterized by a large polyploid genome. One way to reduce genome complexity is to isolate single chromosomes using flow cytometry. Low coverage DNA sequencing can provide a snapshot of individual chromosomes, allowing a fast characterization of their main features and comparison with other genomes. We used massively parallel 454 pyrosequencing to obtain a 2x coverage of wheat chromosome 5A. The resulting sequence assembly was used to identify TEs, genes and miRNAs, as well as to infer a virtual gene order based on the synteny with other grass genomes. Repetitive elements account for more than 75% of the genome. Gene content was estimated considering non-redundant reads showing at least one match to ESTs or proteins. The results indicate that the coding fraction represents 1.08% and 1.3% of the short and long arm respectively, projecting the number of genes of the whole chromosome to approximately 5,000. 195 candidate miRNA precursors belonging to 16 miRNA families were identified. The 5A genes were used to search for syntenic relationships between grass genomes. The short arm is closely related to Brachypodium chromosome 4, sorghum chromosome 8 and rice chromosome 12; the long arm to regions of Brachypodium chromosomes 4 and 1, sorghum chromosomes 1 and 2 and rice chromosomes 9 and 3. From these similarities it was possible to infer the virtual gene order of 392 (5AS) and 1,480 (5AL) genes of chromosome 5A, which was compared to, and found to be largely congruent with the available physical map of this chromosome. PMID:22028874

  19. Repetitive Sequence Variations in the Promoter Region of the Adhesin-Encoding Gene sabA of Helicobacter pylori Affect Transcription

    PubMed Central

    Harvey, Vivian C.; Acio, Catherine R.; Bredehoft, Amy K.; Zhu, Laurence; Hallinger, Daniel R.; Quinlivan-Repasi, Vanessa; Harvey, Samuel E.

    2014-01-01

    The pathogenesis of diseases elicited by the gastric pathogen Helicobacter pylori is partially determined by the effectiveness of adaptation to the variably acidic environment of the host stomach. Adaptation includes appropriate adherence to the gastric epithelium via outer membrane protein adhesins such as SabA. The expression of sabA is subject to regulation via phase variation in the promoter and coding regions as well as repression by the two-component system ArsRS. In this study, we investigated the role of a homopolymeric thymine [poly(T)] tract −50 to −33 relative to the sabA transcriptional start site in H. pylori strain J99. We quantified sabA expression in H. pylori J99 by quantitative reverse transcription-PCR (RT-PCR), demonstrating significant changes in sabA expression associated with experimental manipulations of poly(T) tract length. Mimicking the length increase of this tract by adding adenines instead of thymines had similar effects, while the addition of other nucleotides failed to affect sabA expression in the same manner. We hypothesize that modification of the poly(T) tract changes DNA topology, affecting regulatory protein interaction(s) or RNA polymerase binding efficiency. Additionally, we characterized the interaction between the sabA promoter region and ArsR, a response regulator affecting sabA expression. Using recombinant ArsR in electrophoretic mobility shift assays (EMSA), we localized binding to a sequence with partial dyad symmetry −20 and +38 relative to the sabA +1 site. The control of sabA expression by both ArsRS and phase variation at two distinct repeat regions suggests the control of sabA expression is both complex and vital to H. pylori infection. PMID:25022855

  20. Trialogue: Preparation, Repetition and...

    ERIC Educational Resources Information Center

    Oberg, Antoinette; And Others

    1996-01-01

    This paper interrogates both curriculum theory and the limits and potentials of textual forms. A set of overlapping discourses (a trialogue) focuses on inquiring into the roles of obsession and repetition in creating deeply interpretive locations for understanding. (SM)

  1. Repetition priming in music.

    PubMed

    Hutchins, Sean; Palmer, Caroline

    2008-06-01

    The authors explore priming effects of pitch repetition in music in 3 experiments. Musically untrained participants heard a short melody and sang the last pitch of the melody as quickly as possible. Each experiment manipulated (a) whether or not the tone to be sung (target) was heard earlier in the melody (primed) and (b) the prime-target distance (measured in events). Experiment 1 used variable-length melodies, whereas Experiments 2 and 3 used fixed-length melodies. Experiment 3 changed the timbre of the target tone. In all experiments, fast-responding participants produced repeated tones faster than nonrepeated tones, and this repetition benefit decreased as prime-target distances increased. All participants produced expected tonic endings faster than less expected nontonic endings. Repetition and tonal priming effects are compared with harmonic priming effects in music and with repetition priming effects in language.

  2. Characterizing temporal repetition

    SciTech Connect

    Cukierman, D.; Delgrande, J.

    1996-12-31

    We are investigating the representation and reasoning about schedulable, repeated activities, specified using calendars. Examples of such activities include meeting every Tuesday and Thursday during a semester and attending a seminar every first day of a month. This research provides for a valuable framework for scheduling systems, financial systems and, in general, date-based systems. Very recently work has been done related to reasoning about repetition in the Artificial Intelligence community and others. A partial reference list is provided here. However, to our knowledge no extensive taxonomy of repetition has been proposed in the literature. We believe that reasoning about repeated activities calls for a study and precise definition of the topological characteristics in a repetitive series. In this abstract we summarize a proposal to classify types of repetition according to parameters. The combination of all possible values of these parameters provides a complete taxonomy of repetitive classes with respect to the proposed parameters. Several notions of repetition are considered, some are extremely general, some are very specific.

  3. Indirect decentralized repetitive control

    NASA Technical Reports Server (NTRS)

    Lee, Soo Cheol; Longman, Richard W.

    1993-01-01

    Learning control refers to controllers that learn to improve their performance at executing a given task, based on experience performing this specific task. In a previous work, the authors presented a theory of indirect decentralized learning control based on use of indirect adaptive control concepts employing simultaneous identification and control. This paper extends these results to apply to the indirect repetitive control problem in which a periodic (i.e., repetitive) command is given to a control system. Decentralized indirect repetitive control algorithms are presented that have guaranteed convergence to zero tracking error under very general conditions. The original motivation of the repetitive control and learning control fields was learning in robots doing repetitive tasks such as on an assembly line. This paper starts with decentralized discrete time systems, and progresses to the robot application, modeling the robot as a time varying linear system in the neighborhood of the desired trajectory. Decentralized repetitive control is natural for this application because the feedback control for link rotations is normally implemented in a decentralized manner, treating each link as if it is independent of the other links.

  4. Repetitive DNAs in the slug Milax nigricans: association of ribosomal (18S-28S and 5S rDNA) and (TTAGGG)n telomeric sequences in the slug M. nigricans (Mollusca: Gastropoda: Pulmonata).

    PubMed

    Vitturi, R; Sineo, L; Volpe, N; Lannino, A; Colomba, M

    2004-01-01

    Spermatocyte chromosomes of the slug Milax nigricans (Mollusca: Gastropoda: Pulmonata) were studied using silver staining (Ag-NOR) and fluorescent in situ hybridization (FISH) with four repetitive DNA probes [18S rDNA, 5S rDNA, (TTAGGG)n and (GATA)n]. Silver impregnation was inadequate to localize the chromosome sites of nucleolus organizer regions (NORs) since no silver dots occurred on the chromosomes at spermatogonial metaphase and a diffuse silver stainability could be observed on the bivalents at metaphase-I. Unlike silver staining, single-colour rDNA FISH consistently mapped major ribosomal sites (18S-28S rDNA) on two small-sized chromosomes in spermatogonial cells and on the correspondent metaphase-I bivalent in spermatocytes. While telomeric (TTAGGG)n sequence hybridized to all chromosomes, (GATA)n probe localized abundant hybridization sites, dispersed throughout the genome. Simultaneous double-colour FISH demonstrated a close chromosomal association of 18S-28S rDNA, 5S rDNA and (TTAGGG)n.

  5. Base composition, size and sequence similarities of genoma deoxyribonucleic acids from clinical isolates of Pseudomonas putrefaciens.

    PubMed

    Owen, R J; Legors, R M; Lapage, S P

    1978-01-01

    The mean base compositions of DNA from 27 strains of Pseudomonas putrefaciens, P. rubescens and P. piscicida ranged from 43-4 to 53-2 mol% GC with genome sizes from 3.04 X 10(9) to 4.23 X 10(9) daltons. On the basis of in vitro DNA-DNA binding, estimated spectrophotometrically from initial renaturation rates, P. putrefaciens strains were heterogenous in the extent to which they shared similar nucleotide sequences, and were divided into four DNA homology groups. The DNA characteristics of strains in these groups correlated with several biochemical characteristics that facilitated identification of clinical isolates of P. putrefaciens. The two species P. putrefaciens and P. rubescens appear to be synonymous and none of the four groups of P. putrefaciens was related in DNA sequences to P. pisicida. Pseudomonas putrefaciens should theretofore be retained as a single species and characteristics for identifying the various groups within the species are listed.

  6. Simple Sequence Repeats in Escherichia coli: Abundance, Distribution, Composition, and Polymorphism

    PubMed Central

    Gur-Arie, Riva; Cohen, Cyril J.; Eitan, Yuval; Shelef, Leora; Hallerman, Eric M.; Kashi, Yechezkel

    2000-01-01

    Computer-based genome-wide screening of the DNA sequence of Escherichia coli strain K12 revealed tens of thousands of tandem simple sequence repeat (SSR) tracts, with motifs ranging from 1 to 6 nucleotides. SSRs were well distributed throughout the genome. Mononucleotide SSRs were over-represented in noncoding regions and under-represented in open reading frames (ORFs). Nucleotide composition of mono- and dinucleotide SSRs, both in ORFs and in noncoding regions, differed from that of the genomic region in which they occurred, with 93% of all mononucleotide SSRs proving to be of A or T. Computer-based analysis of the fine position of every SSR locus in the noncoding portion of the genome relative to downstream ORFs showed SSRs located in areas that could affect gene regulation. DNA sequences at 14 arbitrarily chosen SSR tracts were compared among E. coli strains. Polymorphisms of SSR copy number were observed at four of seven mononucleotide SSR tracts screened, with all polymorphisms occurring in noncoding regions. SSR polymorphism could prove important as a genome-wide source of variation, both for practical applications (including rapid detection, strain identification, and detection of loci affecting key phenotypes) and for evolutionary adaptation of microbes.[The sequence data described in this paper have been submitted to the GenBank data library under accession numbers AF209020–209030 and AF209508–209518.] PMID:10645951

  7. High-fidelity local addressing of trapped ions and atoms by composite sequences of laser pulses.

    PubMed

    Ivanov, Svetoslav S; Vitanov, Nikolay V

    2011-04-01

    A vital requirement for a quantum computer is the ability to locally address, with high fidelity, any of its qubits without affecting their neighbors. We propose an addressing method using composite sequences of laser pulses that dramatically reduces the addressing error in a lattice of closely spaced atoms or ions and at the same time significantly enhances the robustness of qubit manipulations. To this end, we design novel (to our knowledge) high-fidelity composite pulses for the most important single-qubit operations. In principle, this method allows one to beat the diffraction limit, for only atoms situated in a small spatial region around the center of the laser beam are excited, well within the laser beam waist.

  8. Delineation of 7q11.2 deletions associated with Williams-Beuren syndrome and mapping of a repetitive sequence to within and to either side of the common deletion

    SciTech Connect

    Robinson, W.P.; Waslynka, J.; Wang, M.; Clark, S. |

    1996-05-15

    The majority of Williams-Beuren syndrome (WBS) patients have been shown to have a microdeletion within 7q11.2 including the elastin gene locus. The extent of these deletions has, however, not been well characterized. Thirty-five deletion patients were tested for all polymorphic markers in the 7q11.2 region bounding ELN to define the extent of deletions associated with WBS. With only one exception, ELN, D7S1870, and one copy of the D7S489 locus (D7S489U) were always included in the deletions. One patient showed lack of maternal inheritance at D7S1870 and not at ELN or D7S489U. A product corresponding to D7S489U was amplified form YAC 743G6 and from the P1 clone RMC07P008, thereby localizing both to within the common deletion. The boundary of the deleted region on the proximal (centromeric) side is D7S653 and on the distal side is D7S675, neither of which were ever included in the deletion. One locus, D7S489L, was variably deleted in patients, indicating a minimum of two common breakpoints on the proximal side. At least one additional repeat amplified by D7S489 (D7S489M) was localized to a YAC contig mapping distal to the mologous to several cDNA clones in the GenBank database and contains an Alu sequence. It is possible that this and/or other repetitive sequences in this region could play a role in the mechanism of deletion. 26 refs., 5 figs., 2 tabs.

  9. Fine mapping and DNA fiber FISH analysis locates the tobamovirus resistance gene L3 of Capsicum chinense in a 400-kb region of R-like genes cluster embedded in highly repetitive sequences.

    PubMed

    Tomita, R; Murai, J; Miura, Y; Ishihara, H; Liu, S; Kubotera, Y; Honda, A; Hatta, R; Kuroda, T; Hamada, H; Sakamoto, M; Munemura, I; Nunomura, O; Ishikawa, K; Genda, Y; Kawasaki, S; Suzuki, K; Meksem, K; Kobayashi, K

    2008-11-01

    The tobamovirus resistance gene L(3) of Capsicum chinense was mapped using an intra-specific F2 population (2,016 individuals) of Capsicum annuum cultivars, into one of which had been introduced the C. chinense L(3) gene, and an inter-specific F2 population (3,391 individuals) between C. chinense and Capsicum frutescence. Analysis of a BAC library with an AFLP marker closely linked to L(3)-resistance revealed the presence of homologs of the tomato disease resistance gene I2. Partial or full-length coding sequences were cloned by degenerate PCR from 35 different pepper I2 homologs and 17 genetic markers were generated in the inter-specific combination. The L(3) gene was mapped between I2 homolog marker IH1-04 and BAC-end marker 189D23M, and located within a region encompassing two different BAC contigs consisting of four and one clones, respectively. DNA fiber FISH analysis revealed that these two contigs are separated from each other by about 30 kb. DNA fiber FISH results and Southern blotting of the BAC clones suggested that the L(3) locus-containing region is rich in highly repetitive sequences. Southern blot analysis indicated that the two BAC contigs contain more than ten copies of the I2 homologs. In contrast to the inter-specific F2 population, no recombinant progeny were identified to have a crossover point within two BAC contigs consisting of seven and two clones in the intra-specific F2 population. Moreover, distribution of the crossover points differed between the two populations, suggesting linkage disequilibrium in the region containing the L locus.

  10. Selective confinement of vibrations in composite systems with alternate quasi-regular sequences

    NASA Astrophysics Data System (ADS)

    Montalbán, A.; Velasco, V. R.; Tutor, J.; Fernández-Velicia, F. J.

    2007-01-01

    We have studied the atom displacements and the vibrational frequencies of 1D systems formed by combinations of Fibonacci, Thue-Morse and Rudin-Shapiro quasi-regular stacks and their alternate ones. The materials are described by nearest-neighbor force constants and the corresponding atom masses, particularized to the Al, Ag systems. These structures exhibit differences in the frequency spectrum as compared to the original simple quasi-regular generations but the most important feature is the presence of separate confinement of the atom displacements in one of the sequences forming the total composite structure for different frequency ranges.

  11. A comparison of sequencing platforms and bioinformatics pipelines for compositional analysis of the gut microbiome.

    PubMed

    Allali, Imane; Arnold, Jason W; Roach, Jeffrey; Cadenas, Maria Belen; Butz, Natasha; Hassan, Hosni M; Koci, Matthew; Ballou, Anne; Mendoza, Mary; Ali, Rizwana; Azcarate-Peril, M Andrea

    2017-09-13

    Advancements in Next Generation Sequencing (NGS) technologies regarding throughput, read length and accuracy had a major impact on microbiome research by significantly improving 16S rRNA amplicon sequencing. As rapid improvements in sequencing platforms and new data analysis pipelines are introduced, it is essential to evaluate their capabilities in specific applications. The aim of this study was to assess whether the same project-specific biological conclusions regarding microbiome composition could be reached using different sequencing platforms and bioinformatics pipelines. Chicken cecum microbiome was analyzed by 16S rRNA amplicon sequencing using Illumina MiSeq, Ion Torrent PGM, and Roche 454 GS FLX Titanium platforms, with standard and modified protocols for library preparation. We labeled the bioinformatics pipelines included in our analysis QIIME1 and QIIME2 (de novo OTU picking [not to be confused with QIIME version 2 commonly referred to as QIIME2]), QIIME3 and QIIME4 (open reference OTU picking), UPARSE1 and UPARSE2 (each pair differs only in the use of chimera depletion methods), and DADA2 (for Illumina data only). GS FLX+ yielded the longest reads and highest quality scores, while MiSeq generated the largest number of reads after quality filtering. Declines in quality scores were observed starting at bases 150-199 for GS FLX+ and bases 90-99 for MiSeq. Scores were stable for PGM-generated data. Overall microbiome compositional profiles were comparable between platforms; however, average relative abundance of specific taxa varied depending on sequencing platform, library preparation method, and bioinformatics analysis. Specifically, QIIME with de novo OTU picking yielded the highest number of unique species and alpha diversity was reduced with UPARSE and DADA2 compared to QIIME. The three platforms compared in this study were capable of discriminating samples by treatment, despite differences in diversity and abundance, leading to similar biological

  12. Postglacial climate-change record in biomarker lipid compositions of the Hani peat sequence, Northeastern China

    NASA Astrophysics Data System (ADS)

    Zhou, Weijian; Zheng, Yanhong; Meyers, Philip A.; Jull, A. J. Timothy; Xie, Shucheng

    2010-05-01

    The peat sequence at Hani in northeastern China accumulated over the past 16 cal kyr in a percolation mire in which rain water and ground water seeped through the peat system. The molecular compositions of n-alkanes, n-alkanols, and n-alkanoic acids extracted from the Hani peat sequence reveal different responses to the progressive evolution of climate and changes in the nature of the peat-forming vegetation. Long chain length components that originate from the waxy coatings of subaerial vascular plants dominate the n-alkane distributions throughout the Hani peat sequence. The paleoclimate integrity of these biomarker molecules appears to be well preserved. Most of the n-alkanol distributions are similarly dominated by long chain components that indicate their origins from subaerial plants. In contrast, n-alkanoic acid distributions are dominated by secondary components that record the importance of post-depositional microbial activity in this peat sequence, which evidently can be extensive in a percolation mire. Elevated n-alkane Paq values and C 23/C 29 ratios, which are both molecular proxies for water-loving plants, record an especially moist local climate in the Bølling-Allerød (14.5 to 12.9 ka), Younger Dryas (12.9 to 11.5 ka), and Pre-Boreal (11.5 to 10.5 ka) portions of the Hani peat sequence. Depressed Paq values and C 23/C 29 ratios and larger n-alkane average chain length values indicate that the Holocene Climatic Optimum (10.5 to 6 ka) was a period of warmer climate with lower effective precipitation, which contrasts with evidence of wetter climates in most of East Asia.

  13. A lowest-order composite finite element exact sequence on pyramids

    NASA Astrophysics Data System (ADS)

    Ainsworth, Mark; Fu, Guosheng

    2017-09-01

    Composite basis functions for pyramidal elements on the spaces $H^1(\\Omega)$, $H(\\mathrm{curl},\\Omega)$, $H(\\mathrm{div},\\Omega)$ and $L^2(\\Omega)$ are presented. In particular, we construct the lowest-order composite pyramidal elements and show that they respect the de Rham diagram, i.e. we have an exact sequence and satisfy the commuting property. Moreover, the finite elements are fully compatible with the standard finite elements for the lowest-order Raviart-Thomas-N\\'ed\\'elec sequence on tetrahedral and hexahedral elements. That is to say, the new elements have the same degrees of freedom on the shared interface with the neighbouring hexahedral or tetrahedra elements, and the basis functions are conforming in the sense that they maintain the required level of continuity (full, tangential component, normal component, ...) across the interface. Furthermore, we study the approximation properties of the spaces as an initial partition consisting of tetrahedra, hexahedra and pyramid elements is successively subdivided and show that the spaces result in the same (optimal) order of approximation in terms of the mesh size $h$ as one would obtain using purely hexahedral or purely tetrahedral partitions.

  14. The correlation of protein hydropathy with the base composition of coding sequences.

    PubMed

    D'Onofrio, G; Jabbari, K; Musto, H; Bernardi, G

    1999-09-30

    The "universal correlation" (D'Onofrio, G., Bernardi, G., 1992. A universal compositional correlation among codon positions. Gene 110, 81-88.) that holds between and or ( values are the average values of the coding sequences of each genome analyzed) at both the inter- and intra-genomic level, was re-analyzed on a vastly larger dataset. The results showed a slight, but significant, difference in the vs. correlations exhibited by prokaryotes and eukaryotes. This finding prompted an analysis of the correlation between and the amino acid frequencies in the encoded proteins, which has shown that positive correlations exist between values of coding sequences and the hydropathy of the corresponding proteins. These correlations are due to the fact that hydrophobic and amphypathic amino acids increase, whereas hydrophilic amino acids decrease with increasing values. Hydropathy values of prokaryotic proteins are systematically higher than those of eukaryotes, but the slopes of the regression lines are identical. The lower hydrophobicity of eukaryotic proteins is due to differences in the amino acid composition. In particular, the twofold higher cysteine (and disulfide bond) level of eukaryotic proteins compared to prokaryotic proteins most probably compensates for their lower hydrophobicity. This supports the viewpoint that hydrophobicity plays a structural and functional role as far as protein stability is concerned.

  15. A portable system for rapid bacterial composition analysis using a nanopore-based sequencer and laptop computer.

    PubMed

    Mitsuhashi, Satomi; Kryukov, Kirill; Nakagawa, So; Takeuchi, Junko S; Shiraishi, Yoshiki; Asano, Koichiro; Imanishi, Tadashi

    2017-07-18

    We developed a portable system for 16S rDNA analyses consisting of a nanopore technology-based sequencer, the MinION, and laptop computers, and assessed its potential ability to determine bacterial compositions rapidly. We tested our protocols using a mock bacterial community that contained equimolar 16S rDNA and a pleural effusion from a patient with empyema, for time effectiveness and accuracy. MinION sequencing targeting 16S rDNA detected all 20 of the bacterial species present in the mock bacterial community. Time course analysis indicated that the sequence data obtained during the first 5 minutes of sequencing (1,379 bacterial reads) were enough to detect all 20 bacteria in the mock sample and to determine species composition, consistent with results of those obtained from 4 hours of sequencing (24,202 reads). Additionally, using a clinical sample extracted from the empyema patient's pleural effusion, we could identify major bacterial pathogens in that effusion using our rapid sequencing and analysis protocol. All results are comparable to conventional 16S rDNA sequencing results using an IonPGM sequencer. Our results suggest that rapid sequencing and bacterial composition determination are possible within 2 hours after obtaining a DNA sample.

  16. Model for repetitive cycles of large earthquakes

    SciTech Connect

    Newman, W.I.; Knopoff, L.

    1983-04-01

    The theory of the fusion of small cracks into large ones reproduces certain features also observed in the clustering of earthquake sequences. By modifying our earlier model to take into account the stress release associated with the occurrence of large earthquakes, we obtain repetitive periodic cycles of large earthquakes. A preliminary conclusion is that a combination of the stress release or elastic rebound mechanism plus time delays in the fusion process are sufficient to destabilize the crack populations and, ultimately, give rise to repetitive episodes of seismicity.

  17. Stacking sequence and shape optimization of laminated composite plates via a level-set method

    NASA Astrophysics Data System (ADS)

    Allaire, G.; Delgado, G.

    2016-12-01

    We consider the optimal design of composite laminates by allowing a variable stacking sequence and in-plane shape of each ply. In order to optimize both variables we rely on a decomposition technique which aggregates the constraints into one unique constraint margin function. Thanks to this approach, an exactly equivalent bi-level optimization problem is established. This problem is made up of an inner level represented by the combinatorial optimization of the stacking sequence and an outer level represented by the topology and geometry optimization of each ply. We propose for the stacking sequence optimization an outer approximation method which iteratively solves a set of mixed integer linear problems associated to the evaluation of the constraint margin function. For the topology optimization of each ply, we lean on the level set method for the description of the interfaces and the Hadamard method for boundary variations by means of the computation of the shape gradient. Numerical experiments are performed on an aeronautic test case where the weight is minimized subject to different mechanical constraints, namely compliance, reserve factor and buckling load.

  18. Epigenomic k-mer dictionaries: shedding light on how sequence composition influences in vivo nucleosome positioning.

    PubMed

    Giancarlo, Raffaele; Rombo, Simona E; Utro, Filippo

    2015-09-15

    Information-theoretic and compositional analysis of biological sequences, in terms of k-mer dictionaries, has a well established role in genomic and proteomic studies. Much less so in epigenomics, although the role of k-mers in chromatin organization and nucleosome positioning is particularly relevant. Fundamental questions concerning the informational content and compositional structure of nucleosome favouring and disfavoring sequences with respect to their basic building blocks still remain open. We present the first analysis on the role of k-mers in the composition of nucleosome enriched and depleted genomic regions (NER and NDR for short) that is: (i) exhaustive and within the bounds dictated by the information-theoretic content of the sample sets we use and (ii) informative for comparative epigenomics. We analize four different organisms and we propose a paradigmatic formalization of k-mer dictionaries, providing two different and complementary views of the k-mers involved in NER and NDR. The first extends well known studies in this area, its comparative nature being its major merit. The second, very novel, brings to light the rich variety of k-mers involved in influencing nucleosome positioning, for which an initial classification in terms of clusters is also provided. Although such a classification offers many insights, the following deserves to be singled-out: short poly(dA:dT) tracts are reported in the literature as fundamental for nucleosome depletion, however a global quantitative look reveals that their role is much less prominent than one would expect based on previous studies. Dictionaries, clusters and Supplementary Material are available online at http://math.unipa.it/rombo/epigenomics/. simona.rombo@unipa.it Supplementary data are available at Bioinformatics online. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  19. Targeted Sequencing Reveals Large-Scale Sequence Polymorphism in Maize Candidate Genes for Biomass Production and Composition

    PubMed Central

    Ulpinnis, Chris; Scholz, Uwe; Altmann, Thomas

    2015-01-01

    A major goal of maize genomic research is to identify sequence polymorphisms responsible for phenotypic variation in traits of economic importance. Large-scale detection of sequence variation is critical for linking genes, or genomic regions, to phenotypes. However, due to its size and complexity, it remains expensive to generate whole genome sequences of sufficient coverage for divergent maize lines, even with access to next generation sequencing (NGS) technology. Because methods involving reduction of genome complexity, such as genotyping-by-sequencing (GBS), assess only a limited fraction of sequence variation, targeted sequencing of selected genomic loci offers an attractive alternative. We therefore designed a sequence capture assay to target 29 Mb genomic regions and surveyed a total of 4,648 genes possibly affecting biomass production in 21 diverse inbred maize lines (7 flints, 14 dents). Captured and enriched genomic DNA was sequenced using the 454 NGS platform to 19.6-fold average depth coverage, and a broad evaluation of read alignment and variant calling methods was performed to select optimal procedures for variant discovery. Sequence alignment with the B73 reference and de novo assembly identified 383,145 putative single nucleotide polymorphisms (SNPs), of which 42,685 were non-synonymous alterations and 7,139 caused frameshifts. Presence/absence variation (PAV) of genes was also detected. We found that substantial sequence variation exists among genomic regions targeted in this study, which was particularly evident within coding regions. This diversification has the potential to broaden functional diversity and generate phenotypic variation that may lead to new adaptations and the modification of important agronomic traits. Further, annotated SNPs identified here will serve as useful genetic tools and as candidates in searches for phenotype-altering DNA variation. In summary, we demonstrated that sequencing of captured DNA is a powerful approach for

  20. Targeted Sequencing Reveals Large-Scale Sequence Polymorphism in Maize Candidate Genes for Biomass Production and Composition.

    PubMed

    Muraya, Moses M; Schmutzer, Thomas; Ulpinnis, Chris; Scholz, Uwe; Altmann, Thomas

    2015-01-01

    A major goal of maize genomic research is to identify sequence polymorphisms responsible for phenotypic variation in traits of economic importance. Large-scale detection of sequence variation is critical for linking genes, or genomic regions, to phenotypes. However, due to its size and complexity, it remains expensive to generate whole genome sequences of sufficient coverage for divergent maize lines, even with access to next generation sequencing (NGS) technology. Because methods involving reduction of genome complexity, such as genotyping-by-sequencing (GBS), assess only a limited fraction of sequence variation, targeted sequencing of selected genomic loci offers an attractive alternative. We therefore designed a sequence capture assay to target 29 Mb genomic regions and surveyed a total of 4,648 genes possibly affecting biomass production in 21 diverse inbred maize lines (7 flints, 14 dents). Captured and enriched genomic DNA was sequenced using the 454 NGS platform to 19.6-fold average depth coverage, and a broad evaluation of read alignment and variant calling methods was performed to select optimal procedures for variant discovery. Sequence alignment with the B73 reference and de novo assembly identified 383,145 putative single nucleotide polymorphisms (SNPs), of which 42,685 were non-synonymous alterations and 7,139 caused frameshifts. Presence/absence variation (PAV) of genes was also detected. We found that substantial sequence variation exists among genomic regions targeted in this study, which was particularly evident within coding regions. This diversification has the potential to broaden functional diversity and generate phenotypic variation that may lead to new adaptations and the modification of important agronomic traits. Further, annotated SNPs identified here will serve as useful genetic tools and as candidates in searches for phenotype-altering DNA variation. In summary, we demonstrated that sequencing of captured DNA is a powerful approach for

  1. Process of labeling specific chromosomes using recombinant repetitive DNA

    DOEpatents

    Moyzis, R.K.; Meyne, J.

    1988-02-12

    Chromosome preferential nucleotide sequences are first determined from a library of recombinant DNA clones having families of repetitive sequences. Library clones are identified with a low homology with a sequence of repetitive DNA families to which the first clones respectively belong and variant sequences are then identified by selecting clones having a pattern of hybridization with genomic DNA dissimilar to the hybridization pattern shown by the respective families. In another embodiment, variant sequences are selected from a sequence of a known repetitive DNA family. The selected variant sequence is classified as chromosome specific, chromosome preferential, or chromosome nonspecific. Sequences which are classified as chromosome preferential are further sequenced and regions are identified having a low homology with other regions of the chromosome preferential sequence or with known sequences of other family members and consensus sequences of the repetitive DNA families for the chromosome preferential sequences. The selected low homology regions are then hybridized with chromosomes to determine those low homology regions hybridized with a specific chromosome under normal stringency conditions.

  2. Multiplexed Metagenomic Deep Sequencing To Analyze the Composition of High-Priority Pathogen Reagents

    PubMed Central

    Wilson, Michael R.; Stenglein, Mark D.; Olejnik, Judith; Rennick, Linda J.; Nambulli, Sham; Feldmann, Friederike; Duprex, W. Paul

    2016-01-01

    ABSTRACT Laboratories studying high-priority pathogens need comprehensive methods to confirm microbial species and strains while also detecting contamination. Metagenomic deep sequencing (MDS) inventories nucleic acids present in laboratory stocks, providing an unbiased assessment of pathogen identity, the extent of genomic variation, and the presence of contaminants. Double-stranded cDNA MDS libraries were constructed from RNA extracted from in vitro-passaged stocks of six viruses (La Crosse virus, Ebola virus, canine distemper virus, measles virus, human respiratory syncytial virus, and vesicular stomatitis virus). Each library was dual indexed and pooled for sequencing. A custom bioinformatics pipeline determined the organisms present in each sample in a blinded fashion. Single nucleotide variant (SNV) analysis identified viral isolates. We confirmed that (i) each sample contained the expected microbe, (ii) dual indexing of the samples minimized false assignments of individual sequences, (iii) multiple viral and bacterial contaminants were present, and (iv) SNV analysis of the viral genomes allowed precise identification of the viral isolates. MDS can be multiplexed to allow simultaneous and unbiased interrogation of mixed microbial cultures and (i) confirm pathogen identity, (ii) characterize the extent of genomic variation, (iii) confirm the cell line used for virus propagation, and (iv) assess for contaminating microbes. These assessments ensure the true composition of these high-priority reagents and generate a comprehensive database of microbial genomes studied in each facility. MDS can serve as an integral part of a pathogen-tracking program which in turn will enhance sample security and increase experimental rigor and precision. IMPORTANCE Both the integrity and reproducibility of experiments using select agents depend in large part on unbiased validation to ensure the correct identity and purity of the species in question. Metagenomic deep sequencing

  3. Types of DNA methylation status of the interspersed repetitive sequences for LINE-1, Alu, HERV-E and HERV-K in the neutrophils from systemic lupus erythematosus patients and healthy controls.

    PubMed

    Sukapan, Patadon; Promnarate, Paramate; Avihingsanon, Yingyos; Mutirangura, Apiwat; Hirankarn, Nattiya

    2014-04-01

    Changes of the DNA methylation at the interspersed repetitive sequences can occur in various conditions including cancer as well as autoimmune diseases. We previously reported the hypomethylation of LINE-1 and HERV-E in the lymphocytes of systemic lupus erythematosus (SLE) patients. As neutrophils are another important cell type contributing to SLE pathogenesis, in this study, we evaluated the methylation levels and patterns for LINE-1, ALU, HERV-E and HERV-K in the neutrophils from SLE patients compared with the healthy controls. We observed that the methylation levels, especially for LINE-1, in the neutrophils from SLE patients were significantly lower than the healthy controls (P-value < 0.0001). Interestingly, this hypomethylation was not correlated with the activity of the disease. Furthermore, the methylation levels and patterns for Alu, HERV-E and HERV-K in the neutrophils from the SLE patients were not significantly different from the healthy controls. In addition, we further investigated whether there were any correlations between the intragenic LINE-1 and differential expressions of the neutrophils from the SLE patients using public arrays data. The upregulated genes in the neutrophils from the SLE patients were significantly associated with the genes containing LINE-1s compared with the healthy controls (P-value GSE27427 = 7.74 × 10(-3); odds ratio (OR) = 1.28). Interestingly, this association was mainly found among genes with antisense LINE-1s (P-value GSE27427 = 6.22 × 10(-3); OR = 1.38). Bioinformatics data suggest that LINE-1 hypomethylation may affect expression of the genes that may contribute to the pathogenesis of SLE. However, additional functional studies of these proposed genes are warranted to prove this hypothesis.

  4. Repetition through Successive Approximations.

    ERIC Educational Resources Information Center

    Littell, Katherine M.

    This study was conducted in an attempt to provide an alternative to the long-established method of tape listening and repetition drills, a method that has had disappointing results. It is suggested that the rate of speed of phonic presentation is not commensurate with the rate of comprehension. The proposed method seeks to prevent cognitive…

  5. Repetitive strain injury.

    PubMed

    Al-Otaibi, S T

    2001-05-01

    Repetitive strain injury is a group of musculoskeletal disorders affecting muscles, tendons, nerves and blood vessels. These disorders could be attributed to occupational causes; however non-occupational causes should be excluded. The management of these cases required a multidisciplinary team approach.

  6. Repetition Priming in Music

    ERIC Educational Resources Information Center

    Hutchins, Sean; Palmer, Caroline

    2008-01-01

    The authors explore priming effects of pitch repetition in music in 3 experiments. Musically untrained participants heard a short melody and sang the last pitch of the melody as quickly as possible. Each experiment manipulated (a) whether or not the tone to be sung (target) was heard earlier in the melody (primed) and (b) the prime-target distance…

  7. Analysis of repetitive DNA in chromosomes by flow cytometry.

    PubMed

    Brind'Amour, Julie; Lansdorp, Peter M

    2011-06-01

    We developed a flow cytometry method, chromosome flow fluorescence in situ hybridization (FISH), called CFF, to analyze repetitive DNA in chromosomes using FISH with directly labeled peptide nucleic acid (PNA) probes. We used CFF to measure the abundance of interstitial telomeric sequences in Chinese hamster chromosomes and major satellite sequences in mouse chromosomes. Using CFF we also identified parental homologs of human chromosome 18 with different amounts of repetitive DNA.

  8. The role of short-term memory impairment in nonword repetition, real word repetition, and nonword decoding: A case study.

    PubMed

    Peter, Beate

    2017-09-21

    In a companion study, adults with dyslexia and adults with a probable history of childhood apraxia of speech showed evidence of difficulty with processing sequential information during nonword repetition, multisyllabic real word repetition and nonword decoding. Results suggested that some errors arose in visual encoding during nonword reading, all levels of processing but especially short-term memory storage/retrieval during nonword repetition, and motor planning and programming during complex real word repetition. To further investigate the role of short-term memory, a participant with short-term memory impairment (MI) was recruited. MI was confirmed with poor performance during a sentence repetition and three nonword repetition tasks, all of which have a high short-term memory load, whereas typical performance was observed during tests of reading, spelling, and static verbal knowledge, all with low short-term memory loads. Experimental results show error-free performance during multisyllabic real word repetition but high counts of sequence errors, especially migrations and assimilations, during nonword repetition, supporting short-term memory as a locus of sequential processing deficit during nonword repetition. Results are also consistent with the hypothesis that during complex real word repetition, short-term memory is bypassed as the word is recognized and retrieved from long-term memory prior to producing the word.

  9. The repetitive landscape of the chicken genome.

    PubMed

    Wicker, Thomas; Robertson, Jon S; Schulze, Stefan R; Feltus, F Alex; Magrini, Vincent; Morrison, Jason A; Mardis, Elaine R; Wilson, Richard K; Peterson, Daniel G; Paterson, Andrew H; Ivarie, Robert

    2005-01-01

    Cot-based cloning and sequencing (CBCS) is a powerful tool for isolating and characterizing the various repetitive components of any genome, combining the established principles of DNA reassociation kinetics with high-throughput sequencing. CBCS was used to generate sequence libraries representing the high, middle, and low-copy fractions of the chicken genome. Sequencing high-copy DNA of chicken to about 2.7 x coverage of its estimated sequence complexity led to the initial identification of several new repeat families, which were then used for a survey of the newly released first draft of the complete chicken genome. The analysis provided insight into the diversity and biology of known repeat structures such as CR1 and CNM, for which only limited sequence data had previously been available. Cot sequence data also resulted in the identification of four novel repeats (Birddawg, Hitchcock, Kronos, and Soprano), two new subfamilies of CR1 repeats, and many elements absent from the chicken genome assembly. Multiple autonomous elements were found for a novel Mariner-like transposon, Galluhop, in addition to nonautonomous deletion derivatives. Phylogenetic analysis of the high-copy repeats CR1, Galluhop, and Birddawg provided insight into two distinct genome dispersion strategies. This study also exemplifies the power of the CBCS method to create representative databases for the repetitive fractions of genomes for which only limited sequence data is available.

  10. Use of Composite Protein Database including Search Result Sequences for Mass Spectrometric Analysis of Cell Secretome

    PubMed Central

    Shin, Jihye; Kim, Gamin; Kabir, Mohammad Humayun; Park, Seong Jun; Lee, Seoung Taek; Lee, Cheolju

    2015-01-01

    Mass spectrometric (MS) data of human cell secretomes are usually run through the conventional human database for identification. However, the search may result in false identifications due to contamination of the secretome with fetal bovine serum (FBS) proteins. To overcome this challenge, here we provide a composite protein database including human as well as 199 FBS protein sequences for MS data search of human cell secretomes. Searching against the human-FBS database returned more reliable results with fewer false-positive and false-negative identifications compared to using either a human only database or a human-bovine database. Furthermore, the improved results validated our strategy without complex experiments like SILAC. We expect our strategy to improve the accuracy of human secreted protein identification and to also add value for general use. PMID:25822838

  11. Repetition blindness is orientation blind.

    PubMed

    Corballis, Michael C; Armstrong, Cole

    2007-03-01

    In identifying rapid sequences of three letters, subjects were worse at identifying the first and third letters when they were the same than when they were different, indicating repetition blindness (RB). This effect occurred regardless of the angular orientations of the letters, but was more pronounced when the orientations of the repeated letters were different than when they were the same. In a second experiment, RB was also evident when the first and third letters were lowercase bs or ds, presented upright or inverted, even though they are differently named when inverted (q and p, respectively). Conversely, a third experiment showed that RB occurred when the letters had the same names but were repeated in different case. These results suggest that the early extraction of letter shape is independent of its orientation and left-right sense, and that RB can occur at the levels of both shape and name.

  12. A view of an elemental naturalist at the DNA world (base composition, sequences, methylation).

    PubMed

    Vanyushin, B F

    2007-12-01

    The pioneering data on base composition and pyrimidine sequences in DNA of pro- and eukaryotes are considered, and their significance for the origin of genosystematics is discussed. The modern views on specificity and functional role of enzymatic DNA methylation in eukaryotes are described. DNA methylation controls all genetic functions and is a mechanism of cellular differentiation and gene silencing. A model of regulation of DNA replication by methylation is suggested. Adenine DNA methylation in higher eukaryotes (higher plants) was first observed, and it was established that one and the same gene can be methylated at both cytosine and adenine moieties. Thus, there are at least two different and seemingly interdependent DNA methylation systems present in eukaryotic cells. The first eukaryotic adenine DNA-methyltransferase is isolated from wheat seedlings and described: the enzyme methylates DNA with formation of N6-methyladenine in the sequence TGATCA-->TGm6ATCA. It is found that higher plants have endonucleases that are dependent on S-adenosyl-L-methionine (SAM) and sensitive to DNA methylation status. Therefore, as in bacteria, plants seem to have a restriction-modification (R-M) system. A system of conjugated up- and down-regulation of SAM-dependent endonucleases by SAM modulations is found in plants. Revelation of an essential role of DNA methylation in regulation of genetic processes is a fundament of materialization of epigenetics and epigenomics.

  13. Analysing Microbial Community Composition through Amplicon Sequencing: From Sampling to Hypothesis Testing.

    PubMed

    Hugerth, Luisa W; Andersson, Anders F

    2017-01-01

    Microbial ecology as a scientific field is fundamentally driven by technological advance. The past decade's revolution in DNA sequencing cost and throughput has made it possible for most research groups to map microbial community composition in environments of interest. However, the computational and statistical methodology required to analyse this kind of data is often not part of the biologist training. In this review, we give a historical perspective on the use of sequencing data in microbial ecology and restate the current need for this method; but also highlight the major caveats with standard practices for handling these data, from sample collection and library preparation to statistical analysis. Further, we outline the main new analytical tools that have been developed in the past few years to bypass these caveats, as well as highlight the major requirements of common statistical practices and the extent to which they are applicable to microbial data. Besides delving into the meaning of select alpha- and beta-diversity measures, we give special consideration to techniques for finding the main drivers of community dissimilarity and for interaction network construction. While every project design has specific needs, this review should serve as a starting point for considering what options are available.

  14. Analysing Microbial Community Composition through Amplicon Sequencing: From Sampling to Hypothesis Testing

    PubMed Central

    Hugerth, Luisa W.; Andersson, Anders F.

    2017-01-01

    Microbial ecology as a scientific field is fundamentally driven by technological advance. The past decade's revolution in DNA sequencing cost and throughput has made it possible for most research groups to map microbial community composition in environments of interest. However, the computational and statistical methodology required to analyse this kind of data is often not part of the biologist training. In this review, we give a historical perspective on the use of sequencing data in microbial ecology and restate the current need for this method; but also highlight the major caveats with standard practices for handling these data, from sample collection and library preparation to statistical analysis. Further, we outline the main new analytical tools that have been developed in the past few years to bypass these caveats, as well as highlight the major requirements of common statistical practices and the extent to which they are applicable to microbial data. Besides delving into the meaning of select alpha- and beta-diversity measures, we give special consideration to techniques for finding the main drivers of community dissimilarity and for interaction network construction. While every project design has specific needs, this review should serve as a starting point for considering what options are available. PMID:28928718

  15. Metagenomic sequencing reveals the relationship between microbiota composition and quality of Chinese Rice Wine

    PubMed Central

    Hong, Xutao; Chen, Jing; Liu, Lin; Wu, Huan; Tan, Haiqin; Xie, Guangfa; Xu, Qian; Zou, Huijun; Yu, Wenjing; Wang, Lan; Qin, Nan

    2016-01-01

    Chinese Rice Wine (CRW) is a common alcoholic beverage in China. To investigate the influence of microbial composition on the quality of CRW, high throughput sequencing was performed for 110 wine samples on bacterial 16S rRNA gene and fungal Internal Transcribed Spacer II (ITS2). Bioinformatic analyses demonstrated that the quality of yeast starter and final wine correlated with microbial taxonomic composition, which was exemplified by our finding that wine spoilage resulted from a high proportion of genus Lactobacillus. Subsequently, based on Lactobacillus abundance of an early stage, a model was constructed to predict final wine quality. In addition, three batches of 20 representative wine samples selected from a pool of 110 samples were further analyzed in metagenomics. The results revealed that wine spoilage was due to rapid growth of Lactobacillus brevis at the early stage of fermentation. Gene functional analysis indicated the importance of some pathways such as synthesis of biotin, malolactic fermentation and production of short-chain fatty acid. These results led to a conclusion that metabolisms of microbes influence the wine quality. Thus, nurturing of beneficial microbes and inhibition of undesired ones are both important for the mechanized brewery. PMID:27241862

  16. Repetitive Elements in Mycoplasma hyopneumoniae Transcriptional Regulation.

    PubMed

    Cattani, Amanda Malvessi; Siqueira, Franciele Maboni; Guedes, Rafael Lucas Muniz; Schrank, Irene Silveira

    2016-01-01

    Transcriptional regulation, a multiple-step process, is still poorly understood in the important pig pathogen Mycoplasma hyopneumoniae. Basic motifs like promoters and terminators have already been described, but no other cis-regulatory elements have been found. DNA repeat sequences have been shown to be an interesting potential source of cis-regulatory elements. In this work, a genome-wide search for tandem and palindromic repetitive elements was performed in the intergenic regions of all coding sequences from M. hyopneumoniae strain 7448. Computational analysis demonstrated the presence of 144 tandem repeats and 1,171 palindromic elements. The DNA repeat sequences were distributed within the 5' upstream regions of 86% of transcriptional units of M. hyopneumoniae strain 7448. Comparative analysis between distinct repetitive sequences found in related mycoplasma genomes demonstrated different percentages of conservation among pathogenic and nonpathogenic strains. qPCR assays revealed differential expression among genes showing variable numbers of repetitive elements. In addition, repeats found in 206 genes already described to be differentially regulated under different culture conditions of M. hyopneumoniae strain 232 showed almost 80% conservation in relation to M. hyopneumoniae strain 7448 repeats. Altogether, these findings suggest a potential regulatory role of tandem and palindromic DNA repeats in the M. hyopneumoniae transcriptional profile.

  17. Repetitive Elements in Mycoplasma hyopneumoniae Transcriptional Regulation

    PubMed Central

    Cattani, Amanda Malvessi; Siqueira, Franciele Maboni; Guedes, Rafael Lucas Muniz; Schrank, Irene Silveira

    2016-01-01

    Transcriptional regulation, a multiple-step process, is still poorly understood in the important pig pathogen Mycoplasma hyopneumoniae. Basic motifs like promoters and terminators have already been described, but no other cis-regulatory elements have been found. DNA repeat sequences have been shown to be an interesting potential source of cis-regulatory elements. In this work, a genome-wide search for tandem and palindromic repetitive elements was performed in the intergenic regions of all coding sequences from M. hyopneumoniae strain 7448. Computational analysis demonstrated the presence of 144 tandem repeats and 1,171 palindromic elements. The DNA repeat sequences were distributed within the 5’ upstream regions of 86% of transcriptional units of M. hyopneumoniae strain 7448. Comparative analysis between distinct repetitive sequences found in related mycoplasma genomes demonstrated different percentages of conservation among pathogenic and nonpathogenic strains. qPCR assays revealed differential expression among genes showing variable numbers of repetitive elements. In addition, repeats found in 206 genes already described to be differentially regulated under different culture conditions of M. hyopneumoniae strain 232 showed almost 80% conservation in relation to M. hyopneumoniae strain 7448 repeats. Altogether, these findings suggest a potential regulatory role of tandem and palindromic DNA repeats in the M. hyopneumoniae transcriptional profile. PMID:28005945

  18. Treatment of composite chemical wastewater by aerobic GAC-biofilm sequencing batch reactor (SBGR).

    PubMed

    Rao, N Chandrasekhara; Mohan, S Venkata; Muralikrishna, P; Sarma, P N

    2005-09-30

    The performance of granular activated carbon (GAC)-biofilm configured sequencing batch reactor (SBGR) in aerobic environment was investigated for the treatment of composite chemical wastewater [low BOD/COD ratio ( approximately 0.3), high sulfate content (1.75 g/l) and high TDS concentration (11 g/l)]. Composite wastewater was a combined mixture of effluents from about 100 chemical based industries. Reactor was operated under anoxic-aerobic-anoxic microenvironment conditions with a total cycle period of 24 h (fill: 15 min; reaction (aeration with recirculation): 23 h; settle: 30 min; decant: 15 min) and the performance of the system was studied at organic loading rates (OLR) of 1.7 kg COD/cum-day, 3.5 kg COD/cum-day and 5.5 kg COD/cum-day. The reactor showed efficient performance with respect to substrate degradation rate and sustained its performance at higher operating OLR (5.5 kg COD/cum-day) and at low BOD/COD ratio. Substrate utilization was found to increase with increase in the operating OLR. Maximum non-cumulative substrate utilization of 1.837 kg COD/cum-h, 2.99 kg COD/cum-h and 3.821 kg COD/cum-h was observed after 15 h of the cycle operation for operating OLRs of 1.7 kg COD/cum-day, 3.5 kg COD/cum-day and 5.5 kg COD/cum-day, respectively. Sulfate removal efficiency of 11+/-2% was recorded in the SBGR due to the induced anoxic conditions prevailing during the sequence phase operation of the reactor and the existing internal anoxic zones in the biofilm. Effective performance of the reactor may be attributed to sorption capacity of GAC as carrier material facilitating low toxicant concentration in the mixed liquor. The existing high flow rates around the GAC particle results in good mass transfer of the substrate from the bulk liquid. The long retention of biofilm on GAC increases the potential for the treatment of recalcitrant industrial wastewater. GAC configured biofilm configuration coupled with sequencing batch mode operation appears to be promising

  19. An Adapting Auditory-motor Feedback Loop Can Contribute to Generating Vocal Repetition

    PubMed Central

    Brainard, Michael S.; Jin, Dezhe Z.

    2015-01-01

    Consecutive repetition of actions is common in behavioral sequences. Although integration of sensory feedback with internal motor programs is important for sequence generation, if and how feedback contributes to repetitive actions is poorly understood. Here we study how auditory feedback contributes to generating repetitive syllable sequences in songbirds. We propose that auditory signals provide positive feedback to ongoing motor commands, but this influence decays as feedback weakens from response adaptation during syllable repetitions. Computational models show that this mechanism explains repeat distributions observed in Bengalese finch song. We experimentally confirmed two predictions of this mechanism in Bengalese finches: removal of auditory feedback by deafening reduces syllable repetitions; and neural responses to auditory playback of repeated syllable sequences gradually adapt in sensory-motor nucleus HVC. Together, our results implicate a positive auditory-feedback loop with adaptation in generating repetitive vocalizations, and suggest sensory adaptation is important for feedback control of motor sequences. PMID:26448054

  20. Influence of fiber lay-up sequence on mechanical properties of SiC(f)/SiC composites

    SciTech Connect

    Singh, D.; Singh, J.P.; Sutaria, M.

    1996-03-01

    Mechanical properties of Nicalon-fiber-reinforced silicon carbide matrix composites with two different fiber lay-up sequences (0{degree}/40{degree}/60{degree} and 0{degree}/45{degree}) were evaluated at various temperatures ranging from ambient to 1300{degree}C. Composites with 0{degree}/40{degree}/60{degree} fiber lay-up sequence showed a higher average first matrix cracking stress than that of 0{degree}/45{degree} composites. The measured room-temperature ultimate strength of the 0{degree}/40{degree}/60{degree} composites was 300 MPa compared to 180 MPa for the 0{degree}/45{degree} composites. These measured ultimate strengths were correlated to the predictions made with an analytical model and to in-situ fiber strength characteristics. The large difference in room-temperature ultimate strengths between the two sets of composites is attributed to the relative contributions of the off-axis fibers to the load-bearing capacity of each composite. Up to 1200{degree}C, ultimate strength and work-of-fracture in each set of composites increased, but then declined above 1300{degree}C. The decreases were correlated to in-situ Nicalon fiber strength and fiber/matrix interface degradation.

  1. Computer-Related Repetitive Stress Injuries

    MedlinePlus

    ... Games, and the Internet Computer-Related Repetitive Stress Injuries KidsHealth > For Parents > Computer-Related Repetitive Stress Injuries ... and how to prevent them. About Repetitive Stress Injuries Repetitive stress injuries (RSIs) are conditions caused by ...

  2. Aspects of speech motor control: programing of repetitive versus non-repetitive speech.

    PubMed

    Schönle, P W; Hong, G; Benecke, R; Conrad, B

    1986-01-16

    The aim of the present study was to investigate whether time to program repetitive speech movements (RS) would be distinct from time to program non-repetitive speech movements (NRS) when the length of sequences is kept constant. Using an oral reading task, latencies for the initiation of RS and NRS were measured under two conditions which allowed delineation of the time necessary for perceptual processing separated from actual motor programing. The results show that latencies for NRS were significantly longer than for RS, indicating that the nature of an utterance, not simply its length, is a determinant of program complexity.

  3. Influence of laminate sequence and fabric type on the inherent acoustic nonlinearity in carbon fiber reinforced composites.

    PubMed

    Chakrapani, Sunil Kishore; Barnard, Daniel J; Dayal, Vinay

    2016-05-01

    This paper presents the study of influence of laminate sequence and fabric type on the baseline acoustic nonlinearity of fiber-reinforced composites. Nonlinear elastic wave techniques are increasingly becoming popular in detecting damage in composite materials. It was earlier observed by the authors that the non-classical nonlinear response of fiber-reinforced composite is influenced by the fiber orientation [Chakrapani, Barnard, and Dayal, J. Acoust. Soc. Am. 137(2), 617-624 (2015)]. The current study expands this effort to investigate the effect of laminate sequence and fabric type on the non-classical nonlinear response. Two hypotheses were developed using the previous results, and the theory of interlaminar stresses to investigate the influence of laminate sequence and fabric type. Each hypothesis was tested by capturing the nonlinear response by performing nonlinear resonance spectroscopy and measuring frequency shifts, loss factors, and higher harmonics. It was observed that the laminate sequence can either increase or decrease the nonlinear response based on the stacking sequence. Similarly, tests were performed to compare unidirectional fabric and woven fabric and it was observed that woven fabric exhibited a lower nonlinear response compared to the unidirectional fabric. Conjectures based on the matrix properties and interlaminar stresses were used in an attempt to explain the observed nonlinear responses for different configurations.

  4. Comparison of base composition analysis and Sanger sequencing of mitochondrial DNA for four U.S. population groups.

    PubMed

    Kiesler, Kevin M; Coble, Michael D; Hall, Thomas A; Vallone, Peter M

    2014-01-01

    A set of 711 samples from four U.S. population groups was analyzed using a novel mass spectrometry based method for mitochondrial DNA (mtDNA) base composition profiling. Comparison of the mass spectrometry results with Sanger sequencing derived data yielded a concordance rate of 99.97%. Length heteroplasmy was identified in 46% of samples and point heteroplasmy was observed in 6.6% of samples in the combined mass spectral and Sanger data set. Using discrimination capacity as a metric, Sanger sequencing of the full control region had the highest discriminatory power, followed by the mass spectrometry base composition method, which was more discriminating than Sanger sequencing of just the hypervariable regions. This trend is in agreement with the number of nucleotides covered by each of the three assays.

  5. Genome-Wide Prediction of DNA Methylation Using DNA Composition and Sequence Complexity in Human

    PubMed Central

    Wu, Chengchao; Yao, Shixin; Li, Xinghao; Chen, Chujia; Hu, Xuehai

    2017-01-01

    DNA methylation plays a significant role in transcriptional regulation by repressing activity. Change of the DNA methylation level is an important factor affecting the expression of target genes and downstream phenotypes. Because current experimental technologies can only assay a small proportion of CpG sites in the human genome, it is urgent to develop reliable computational models for predicting genome-wide DNA methylation. Here, we proposed a novel algorithm that accurately extracted sequence complexity features (seven features) and developed a support-vector-machine-based prediction model with integration of the reported DNA composition features (trinucleotide frequency and GC content, 65 features) by utilizing the methylation profiles of embryonic stem cells in human. The prediction results from 22 human chromosomes with size-varied windows showed that the 600-bp window achieved the best average accuracy of 94.7%. Moreover, comparisons with two existing methods further showed the superiority of our model, and cross-species predictions on mouse data also demonstrated that our model has certain generalization ability. Finally, a statistical test of the experimental data and the predicted data on functional regions annotated by ChromHMM found that six out of 10 regions were consistent, which implies reliable prediction of unassayed CpG sites. Accordingly, we believe that our novel model will be useful and reliable in predicting DNA methylation. PMID:28212312

  6. Database of repetitive elements in complete genomes and data mining using transcription factor binding sites.

    PubMed

    Horng, Jorng-Tzong; Lin, F M; Lin, J H; Huang, H D; Liu, B J

    2003-06-01

    Approximately 43% of the human genome is occupied by repetitive elements. Even more, around 51% of the rice genome is occupied by repetitive elements. The analysis presented here indicates that repetitive elements in complete genomes may have been very important in the evolutionary genomics. In this study, a database, called the Repeat Sequence Database, is first designed and implemented to store complete and comprehensive repetitive sequences. See http://rsdb.csie.ncu.edu.tw for more information. The database contains direct, inverted and palindromic repetitive sequences, and each repetitive sequence has a variable length ranging from seven to many hundred nucleotides. The repetitive sequences in the database are explored using a mathematical algorithm to mine rules on how combinations of individual binding sites are distributed among repetitive sequences in the database. Combinations of transcription factor binding sites in the repetitive sequences are obtained and then data mining techniques are applied to mine association rules from these combinations. The discovered associations are further pruned to remove insignificant associations and obtain a set of associations. The mined association rules facilitate efforts to identify gene classes regulated by similar mechanisms and accurately predict regulatory elements. Experiments are performed on several genomes including C. elegans, human chromosome 22, and yeast.

  7. Repetitive strain injury.

    PubMed

    van Tulder, Maurits; Malmivaara, Antti; Koes, Bart

    2007-05-26

    Repetitive strain injury remains a controversial topic. The term repetitive strain injury includes specific disorders such as carpal tunnel syndrome, cubital tunnel syndrome, Guyon canal syndrome, lateral epicondylitis, and tendonitis of the wrist or hand. The diagnosis is usually made on the basis of history and clinical examination. Large high-quality studies using newer imaging techniques, such as MRI and ultrasonography are few. Consequently, the role of such imaging in diagnosis of upper limb disorders remains unclear. In many cases, no specific diagnosis can be established and complaints are labelled as non-specific. Little is known about the effectiveness of treatment options for upper limb disorders. Strong evidence for any intervention is scarce and the effect, if any, is mainly short-term pain relief. Exercise is beneficial for non-specific upper limb disorders. Immobilising hand braces and open carpal tunnel surgery release are beneficial for carpal tunnel syndrome, and topical and oral non-steroidal anti-inflammatory drugs, and corticosteroid injections are helpful for lateral epicondylitis. Exercise is probably beneficial for neck pain, as are corticosteroid injections and exercise for shoulder pain. Although upper limb disorders occur frequently in the working population, most trials have not exclusively included a working population or assessed effects on work-related outcomes. Further high-quality trials should aim to include sufficient sample sizes, working populations, and work-related outcomes.

  8. Agrobacterium T-DNA integration in Arabidopsis is correlated with DNA sequence compositions that occur frequently in gene promoter regions.

    PubMed

    Schneeberger, Richard G; Zhang, Ke; Tatarinova, Tatiana; Troukhan, Max; Kwok, Shing F; Drais, Josh; Klinger, Kevin; Orejudos, Francis; Macy, Kimberly; Bhakta, Amit; Burns, James; Subramanian, Gopal; Donson, Jonathan; Flavell, Richard; Feldmann, Kenneth A

    2005-10-01

    Mobile insertion elements such as transposons and T-DNA generate useful genetic variation and are important tools for functional genomics studies in plants and animals. The spectrum of mutations obtained in different systems can be highly influenced by target site preferences inherent in the mechanism of DNA integration. We investigated the target site preferences of Agrobacterium T-DNA insertions in the chromosomes of the model plant Arabidopsis thaliana. The relative frequencies of insertions in genic and intergenic regions of the genome were calculated and DNA composition features associated with the insertion site flanking sequences were identified. Insertion frequencies across the genome indicate that T-strand integration is suppressed near centromeres and rDNA loci, progressively increases towards telomeres, and is highly correlated with gene density. At the gene level, T-DNA integration events show a statistically significant preference for insertion in the 5' and 3' flanking regions of protein coding sequences as well as the promoter region of RNA polymerase I transcribed rRNA gene repeats. The increased insertion frequencies in 5' upstream regions compared to coding sequences are positively correlated with gene expression activity and DNA sequence composition. Analysis of the relationship between DNA sequence composition and gene activity further demonstrates that DNA sequences with high CG-skew ratios are consistently correlated with T-DNA insertion site preference and high gene expression. The results demonstrate genomic and gene-specific preferences for T-strand integration and suggest that DNA sequences with a pronounced transition in CG- and AT-skew ratios are preferred targets for T-DNA integration.

  9. The Perceptual Determinants of Repetition Learning in Auditory Space

    ERIC Educational Resources Information Center

    Parmentier, Fabrice B. R.; Maybery, Murray T.; Huitson, Matthew; Jones, Dylan M.

    2008-01-01

    The present study includes seven experiments examining the effect of repetition learning (Hebb effect) on auditory spatial serial recall. Participants were asked to remember sequences of spatial locations marked by auditory stimuli, where one sequence was repeated across trials. Consistent with the proposition that the spatial scattering of…

  10. Species-specific shifts in centromere sequence composition are coincident with breakpoint reuse in karyotypically divergent lineages

    PubMed Central

    Bulazel, Kira V; Ferreri, Gianni C; Eldridge, Mark DB; O'Neill, Rachel J

    2007-01-01

    Background It has been hypothesized that rapid divergence in centromere sequences accompanies rapid karyotypic change during speciation. However, the reuse of breakpoints coincident with centromeres in the evolution of divergent karyotypes poses a potential paradox. In distantly related species where the same centromere breakpoints are used in the independent derivation of karyotypes, centromere-specific sequences may undergo convergent evolution rather than rapid sequence divergence. To determine whether centromere sequence composition follows the phylogenetic history of species evolution or patterns of convergent breakpoint reuse through chromosome evolution, we examined the phylogenetic trajectory of centromere sequences within a group of karyotypically diverse mammals, macropodine marsupials (wallabies, wallaroos and kangaroos). Results The evolution of three classes of centromere sequences across nine species within the genus Macropus (including Wallabia) were compared with the phylogenetic history of a mitochondrial gene, Cytochrome b (Cyt b), a nuclear gene, selenocysteine tRNA (TRSP), and the chromosomal histories of the syntenic blocks that define the different karyotype arrangements. Convergent contraction or expansion of predominant satellites is found to accompany specific karyotype rearrangements. The phylogenetic history of these centromere sequences includes the convergence of centromere composition in divergent species through convergent breakpoint reuse between syntenic blocks. Conclusion These data support the 'library hypothesis' of centromere evolution within this genus as each species possesses all three satellites yet each species has experienced differential expansion and contraction of individual classes. Thus, we have identified a correlation between the evolution of centromere satellite sequences, the reuse of syntenic breakpoints, and karyotype convergence in the context of a gene-based phylogeny. PMID:17708770

  11. Functionalized gold nanoparticles as additive to form polymer/metal composite matrix for improved DNA sequencing by capillary electrophoresis.

    PubMed

    Zhou, Dan; Yang, Liping; Yang, Runmiao; Song, Weihua; Peng, Shuhua; Wang, Yanmei

    2009-11-15

    A new matrix additive, poly (N,N-dimethylacrylamide)-functionalized gold nanoparticle (GNP-PDMA), was prepared by "grafting-to" approach, and then incorporated into quasi-interpenetrating network (quasi-IPN) composed of linear polyacrylamide (LPA, 3.3 MDa) and PDMA to form novel polymer/metal composite sieving matrix (quasi-IPN/GNP-PDMA) for DNA sequencing by capillary electrophoresis. Without complete optimization, quasi-IPN/GNP-PDMA yielded a readlength of 801 bases at 98% accuracy in about 64 min by using the ABI 310 Genetic Analyzer at 50 degrees C and 150 V/cm. Compared with previous quasi-IPN/GNPs, quasi-IPN/GNP-PDMA can further improve DNA sequencing performances. This is because the presence of GNP-PDMA can improve the compatibility of GNPs with the whole sequencing system, enhance the entanglement degree of networks, and increase the GNP concentration in system, which consequently lead to higher restriction and stability, higher apparent molecular weight (MW), and smaller pore size of the total sieving networks. Furthermore, the composite matrix was also compared with quasi-IPN containing higher-MW LPA and commercial POP-6. The results indicate that the composite matrix is a promising one for DNA sequencing to achieve full automation due to the separation provided with high resolution, speediness, excellent reproducibility, and easy loading in the presence of GNP-PDMA.

  12. Modeling repetitive motions using structured light.

    PubMed

    Xu, Yi; Aliaga, Daniel G

    2010-01-01

    Obtaining models of dynamic 3D objects is an important part of content generation for computer graphics. Numerous methods have been extended from static scenarios to model dynamic scenes. If the states or poses of the dynamic object repeat often during a sequence (but not necessarily periodically), we call such a repetitive motion. There are many objects, such as toys, machines, and humans, undergoing repetitive motions. Our key observation is that when a motion-state repeats, we can sample the scene under the same motion state again but using a different set of parameters; thus, providing more information of each motion state. This enables robustly acquiring dense 3D information difficult for objects with repetitive motions using only simple hardware. After the motion sequence, we group temporally disjoint observations of the same motion state together and produce a smooth space-time reconstruction of the scene. Effectively, the dynamic scene modeling problem is converted to a series of static scene reconstructions, which are easier to tackle. The varying sampling parameters can be, for example, structured-light patterns, illumination directions, and viewpoints resulting in different modeling techniques. Based on this observation, we present an image-based motion-state framework and demonstrate our paradigm using either a synchronized or an unsynchronized structured-light acquisition method.

  13. Chromosomal Mapping of Repetitive DNAs in the Grasshopper Abracris flavolineata Reveal Possible Ancestry of the B Chromosome and H3 Histone Spreading

    PubMed Central

    Bueno, Danilo; Palacios-Gimenez, Octavio Manuel; Cabral-de-Mello, Diogo Cavalcanti

    2013-01-01

    Supernumerary chromosomes (B chromosomes) occur in approximately 15% of eukaryote species. Although these chromosomes have been extensively studied, knowledge concerning their specific molecular composition is lacking in most cases. The accumulation of repetitive DNAs is one remarkable characteristic of B chromosomes, and the occurrence of distinct types of multigene families, satellite DNAs and some transposable elements have been reported. Here, we describe the organization of repetitive DNAs in the A complement and B chromosome system in the grasshopper species Abracris flavolineata using classical cytogenetic techniques and FISH analysis using probes for five multigene families, telomeric repeats and repetitive C0t-1 DNA fractions. The 18S rRNA and H3 histone multigene families are highly variable and well distributed in A. flavolineata chromosomes, which contrasts with the conservation of U snRNA genes and less variable distribution of 5S rDNA sequences. The H3 histone gene was an extensively distributed with clusters occurring in all chromosomes. Repetitive DNAs were concentrated in C-positive regions, including the pericentromeric region and small chromosomal arms, with some occurrence in C-negative regions, but abundance was low in the B chromosome. Finally, the first demonstration of the U2 snRNA gene in B chromosomes in A. flavolineata may shed light on its possible origin. These results provide new information regarding chromosomal variability for repetitive DNAs in grasshoppers and the specific molecular composition of B chromosomes. PMID:23826099

  14. Repetitive resonant railgun power supply

    DOEpatents

    Honig, E.M.; Nunnally, W.C.

    1985-06-19

    A repetitive resonant railgun power supply provides energy for repetitively propelling projectiles from a pair of parallel rails. The supply comprises an energy storage capacitor, a storage inductor to form a resonant circuit with the energy storage capacitor and a magnetic switch to transfer energy between the resonant circuit and the pair of parallel rails for the propelling of projectiles.

  15. Repetitive resonant railgun power supply

    SciTech Connect

    Honig, Emanuel M.; Nunnally, William C.

    1988-01-01

    A repetitive resonant railgun power supply provides energy for repetitively propelling projectiles from a pair of parallel rails. The supply comprises an energy storage capacitor, a storage inductor to form a resonant circuit with the energy storage capacitor and a magnetic switch to transfer energy between the resonant circuit and the pair of parallel rails for the propelling of projectiles.

  16. Repetition Blindness for Rotated Objects

    ERIC Educational Resources Information Center

    Hayward, William G.; Zhou, Guomei; Man, Wai-Fung; Harris, Irina M.

    2010-01-01

    Repetition blindness (RB) is the finding that observers often miss the repetition of an item within a rapid stream of words or objects. Recent studies have shown that RB for objects is largely unaffected by variations in viewpoint between the repeated items. In 5 experiments, we tested RB under different axes of rotation, with different types of…

  17. Variation, Repetition, And Choice

    PubMed Central

    Abreu-Rodrigues, Josele; Lattal, Kennon A; dos Santos, Cristiano V; Matos, Ricardo A

    2005-01-01

    Experiment 1 investigated the controlling properties of variability contingencies on choice between repeated and variable responding. Pigeons were exposed to concurrent-chains schedules with two alternatives. In the REPEAT alternative, reinforcers in the terminal link depended on a single sequence of four responses. In the VARY alternative, a response sequence in the terminal link was reinforced only if it differed from the n previous sequences (lag criterion). The REPEAT contingency generated low, constant levels of sequence variation whereas the VARY contingency produced levels of sequence variation that increased with the lag criterion. Preference for the REPEAT alternative tended to increase directly with the degree of variation required for reinforcement. Experiment 2 examined the potential confounding effects in Experiment 1 of immediacy of reinforcement by yoking the interreinforcer intervals in the REPEAT alternative to those in the VARY alternative. Again, preference for REPEAT was a function of the lag criterion. Choice between varying and repeating behavior is discussed with respect to obtained behavioral variability, probability of reinforcement, delay of reinforcement, and switching within a sequence. PMID:15828592

  18. Repetition priming: Is music special?

    PubMed

    Bigand, E; Tillmann, B; Poulin-Charronnat, B; Manderlier, D

    2005-11-01

    Using short and long contexts, the present study investigated musical priming effects that are based on chord repetition and harmonic relatedness. A musical target (a chord) was preceded by either an identical prime or a different but harmonically related prime. In contrast to words, pictures, and environmental sounds, chord processing was not facilitated by repetition. Experiments 1 and 2 using single-chord primes showed either no significant difference between chord repetition and harmonic relatedness or facilitated processing for harmonically related targets. Experiment 3 using longer prime contexts showed that musical priming depended more on the musical function of the target in the preceding context than on target repetition. The effect of musical function was decreased, but not qualitatively changed, by chord repetition. The outcome of this study challenges predictions of sensory approaches and supports a cognitive approach of musical priming.

  19. Symmetry and repetition in perspective.

    PubMed

    van der Vloed, Gert; Csathó, Arpád; van der Helm, Peter A

    2005-09-01

    Although ecologically relevant, perspective views of symmetries and repetitions have hardly been investigated. Any symmetry or repetition that is not oriented orthogonally to the line of sight yields perspective distortions on the retina. In this study, these distortions are analyzed in terms of first-order structures (i.e., virtual lines between corresponding points) and second-order structures (i.e., correlation quadrangles formed by two virtual lines). In the literature, these structures have been proposed to guide the detection of fron to parallel symmetry and repetition. But what about perspective views? First, the analysis in this study shows that perspective distorts the retinal first-order and second-order structures of symmetry and repetition differently. Second, the results of two experiments on this distortion difference suggest that, in perspective views, symmetry and repetition detection is not preceded by normalization but occurs directly on the basis of the retinal first-order and second-order structures.

  20. Perceptual Repetition Blindness Effects

    NASA Technical Reports Server (NTRS)

    Hochhaus, Larry; Johnston, James C.; Null, Cynthia H. (Technical Monitor)

    1994-01-01

    The phenomenon of repetition blindness (RB) may reveal a new limitation on human perceptual processing. Recently, however, researchers have attributed RB to post-perceptual processes such as memory retrieval and/or reporting biases. The standard rapid serial visual presentation (RSVP) paradigm used in most RB studies is, indeed, open to such objections. Here we investigate RB using a "single-frame" paradigm introduced by Johnston and Hale (1984) in which memory demands are minimal. Subjects made only a single judgement about whether one masked target word was the same or different than a post-target probe. Confidence ratings permitted use of signal detection methods to assess sensitivity and bias effects. In the critical condition for RB a precue of the post-target word was provided prior to the target stimulus (identity precue), so that the required judgement amounted to whether the target did or did not repeat the precue word. In control treatments, the precue was either an unrelated word or a dummy.

  1. Orthographic repetition blindness.

    PubMed

    Harris, C L; Morris, A L

    2000-11-01

    Repetition blindness (RB) is the failure to report the second occurrence of a repeated word, when words are sequentially and briefly displayed (Kanwisher, 1987). RB is also observed for non-identical words, such as home, dome. Explanations for non-identity RB assume that similarity at the level of the whole word causes the second word to be suppressed ("similarity inhibition"). Three experiments demonstrate that RB is robust for diverse types of orthographic relatedness, including critical words that share only their first initial letter, their last two letters, first three letters, middle three letters, beginning and final letters, three alternating letters, and three non-aligned letters (as in chance hand). The theoretical construct of similarity inhibition may be able to account for these data, although one mechanism previously proposed in the literature, neighbourhood inhibition, is probably not a useful way to explain the data on RB for words sharing only one or two letters. We introduce an alternative explanation for orthographic RB: Only the repeated letters are suppressed, and amount of RB depends on how easily the perceiver can reconstruct the target word from the non-suppressed letters.

  2. Repetitive strain injury.

    PubMed

    Helliwell, P S; Taylor, W J

    2004-08-01

    Pain in the forearm is relatively common in the community. In the workplace forearm pain is associated with work involving frequent repetition, high forces, and prolonged abnormal postures. Nevertheless, other factors are involved in the presentation and the continuation of the pain. Notable among these factors are psychosocial issues and the workplace environment-the attitude to workers and their welfare, the physical conditions, and design of the job. Primary prevention may be effective but active surveillance is important with early intervention and an active management approach. Physical treatments have not been extensively evaluated. In the established case, management should be multidisciplinary, addressing physical aspects of the job but also addressing the "yellow, blue, and black flags" which should be viewed as obstacles to recovery. For the worker "on sick" a dialogue should be established between the worker, the primary care physician, and the workplace. Return to work should be encouraged and facilitated by medical interventions and light duty options. Rehabilitation programmes may be of use in chronic cases.

  3. Perceptual repetition blindness effects.

    PubMed

    Hochhaus, L; Johnston, J C

    1996-04-01

    Repetition blindness (RB) may reveal a new limitation on human perceptual processing. Recently, however, researchers have attributed RB to postperceptual processes. The standard rapid serial visual presentation (RSVP) paradigm used in most RB studies is open to such objections. The "single-frame" paradigm introduced by J. C. Johnston and B. L. Hale (1984) allowed investigation of RB with minimal memory demands. Participants made a judgment about whether 1 masked target word was the same or different than a posttarget probe. Confidence ratings permitted use of signal detection methods. In the critical condition for RB, a precue of the posttarget word was provided prior to the target stimulus so that the required judgment amounted to whether the target did or did not repeat the precue word. In control treatments, the precue was an unrelated word or a dummy. Results showed that perceptual sensitivity was significantly reduced in the RB condition relative to baseline control conditions. The data showed that RB can be obtained under conditions in which memory problems are minimal and perceptual sensitivity is assessed independently of biases. RB therefore can be a perceptual phenomenon.

  4. Is conflict adaptation triggered by feature repetitions? An unexpected finding

    PubMed Central

    Lierde, Elke Van; Desender, Kobe; den Bussche, Eva Van

    2015-01-01

    For decades, cognitive adaptation to response conflict has been considered to be the hallmark of cognitive control. Notwithstanding a vast amount of evidence ruling out low-level interpretations of these findings, disbelief still exists with regard to the underlying cause of the observed effects. Especially when considering cognitive adaptation to unconscious conflict, it is still a matter of debate whether repetitions of features between trials might explain this intriguing finding rather than the involvement of unconscious control. To this purpose, we conducted two masked priming experiments in which four different responses to four different stimuli were required. This allowed us to completely eliminate repetitions of prime and target over consecutive trials. Independent of whether conflicting information was presented clearly visible or almost imperceptible, the results showed an unexpected pattern. Contrary to the regular congruency sequence effect (CSE; i.e., classic Gratton effect), in both experiments the congruency effect increased following incongruent trials. Interestingly, this reversed effect completely disappeared when we eliminated all trials with feature repetitions from the analysis. A third experiment, in which feature repetitions were excluded a priori, showed a small but regular CSE in the error rates only. Given that feature repetitions are theoretically thought to create a regular CSE, our results are not in line with an interpretation in terms of feature repetitions nor with an interpretation in terms of cognitive control. We conclude that examining cognitive adaptation with or without feature repetitions might be more difficult to conceive than is often suggested in the literature. PMID:25698982

  5. A mapping of an ensemble of mitochondrial sequences for various organisms into 3D space based on the word composition.

    PubMed

    Aita, Takuyo; Nishigaki, Koichi

    2012-11-01

    To visualize a bird's-eye view of an ensemble of mitochondrial genome sequences for various species, we recently developed a novel method of mapping a biological sequence ensemble into Three-Dimensional (3D) vector space. First, we represented a biological sequence of a species s by a word-composition vector x(s), where its length [absolute value]x(s)[absolute value] represents the sequence length, and its unit vector x(s)/[absolute value]x(s)[absolute value] represents the relative composition of the K-tuple words through the sequence and the size of the dimension, N=4(K), is the number of all possible words with the length of K. Second, we mapped the vector x(s) to the 3D position vector y(s), based on the two following simple principles: (1) [absolute value]y(s)[absolute value]=[absolute value]x(s)[absolute value] and (2) the angle between y(s) and y(t) maximally correlates with the angle between x(s) and x(t). The mitochondrial genome sequences for 311 species, including 177 Animalia, 85 Fungi and 49 Green plants, were mapped into 3D space by using K=7. The mapping was successful because the angles between vectors before and after the mapping highly correlated with each other (correlation coefficients were 0.92-0.97). Interestingly, the Animalia kingdom is distributed along a single arc belt (just like the Milky Way on a Celestial Globe), and the Fungi and Green plant kingdoms are distributed in a similar arc belt. These two arc belts intersect at their respective middle regions and form a cross structure just like a jet aircraft fuselage and its wings. This new mapping method will allow researchers to intuitively interpret the visual information presented in the maps in a highly effective manner.

  6. Neural Basis of Repetition Priming during Mathematical Cognition: Repetition Suppression or Repetition Enhancement?

    ERIC Educational Resources Information Center

    Salimpoor, Valorie N.; Chang, Catie; Menon, Vinod

    2010-01-01

    We investigated the neural basis of repetition priming (RP) during mathematical cognition. Previous studies of RP have focused on repetition suppression as the basis of behavioral facilitation, primarily using word and object identification and classification tasks. More recently, researchers have suggested associative stimulus-response learning…

  7. Neural Basis of Repetition Priming during Mathematical Cognition: Repetition Suppression or Repetition Enhancement?

    ERIC Educational Resources Information Center

    Salimpoor, Valorie N.; Chang, Catie; Menon, Vinod

    2010-01-01

    We investigated the neural basis of repetition priming (RP) during mathematical cognition. Previous studies of RP have focused on repetition suppression as the basis of behavioral facilitation, primarily using word and object identification and classification tasks. More recently, researchers have suggested associative stimulus-response learning…

  8. Variation, Repetition, and Choice

    ERIC Educational Resources Information Center

    Abreu-Rodrigues, Josele; Lattal, Kennon A.; dos Santos, Cristiano V.; Matos, Ricardo A.

    2005-01-01

    Experiment 1 investigated the controlling properties of variability contingencies on choice between repeated and variable responding. Pigeons were exposed to concurrent-chains schedules with two alternatives. In the REPEAT alternative, reinforcers in the terminal link depended on a single sequence of four responses. In the VARY alternative, a…

  9. [Repetitive monomorphic ventricular tachycardia].

    PubMed

    Maia, I G; Cruz Filho, F; Costa, A M; Boghossian, S H; Fagundes, M; Ribeiro, J C; Sá, R; Alves, P A

    1994-01-01

    To evaluate retrospectively clinical features of repetitive monomorphic ventricular tachycardia (RMVT). Files of 11 patients with RMVT were analyzed (9 females, mean-age 37 +/- 17 years). All patients were submitted to clinical evaluation, ECG, Holter monitoring stress test, high-resolution ECG and echocardiogram; they were treated with antiarrhythmic drugs. Patients were in NYHA class I or II, 9 asymptomatics and 2 with palpitations. The ECG was normal in all of them. Cardiac memory was observed in 3. A left bundle branch block with inferior axis deviation in the frontal plane was present during RMVT in all patients (right ventricular outflow tract focus). Holter monitoring revealed mean of 12031 +/- 8345 isolated PVC/24h; 2892 +/- 234 ventricular couplets/24h and 1367 +/- 890 VTs/24h (mainly nonsustained). In 6 patients RMVT was suppressed during maximal exercise treadmill. High-resolution ECG was negative in all group. Five patients had a normal echocardiogram while 5 showed mitral valve prolapse. One patient developed tachycardiomyopathy. The arrhythmia was controlled with 320mg of oral sotalol in 3 of 4 that used this drug and with 120mg oral propranolol in one of 6 that used this drug. Drug resistance was present in the others. The mean follow-up period was 38 +/- 16 months. The results demonstrate that RMVT is a benign form of VT with no detectable anatomic substract by the currently used methods. It is probably induced by nonreentrant mechanism and frequently drug resistance is observed. Among the antiarrhythmic drugs commonly used, sotalol showed to be the most effective.

  10. [Repetitive work and psychosomatic complaints].

    PubMed

    Liebrich, J; Geiger, L; Rupp, M

    1978-08-01

    200 workers of the Swiss watch industry were examined in an interdisciplinary study on the effect of repetitive work on the wellbeing of the worker. Women doing repetitive work with little autonomy complained more often about psychosomatic problems than the male workers doing non-repetitive work. This difference is interpreted as a difference of sexe rather than one of the work situation. However, there is a significant difference in the complaint about nervosity between women being paid monthly and women who were paid by piece or by hour with a premium.

  11. Recombinant human MDM2 oncoprotein shows sequence composition selectivity for binding to both RNA and DNA.

    PubMed

    Challen, Christine; Anderson, John J; Chrzanowska-Lightowlers, Zofia M A; Lightowlers, Robert N; Lunec, John

    2012-03-01

    MDM2 is a 90 kDa nucleo-phosphoprotein that binds p53 and other proteins contributing to its oncogenic properties. Its structure includes an amino proximal p53 binding site, a central acidic domain and a carboxy region which incorporates Zinc and Ring Finger domains suggestive of nucleic acid binding or transcription factor function. It has previously been reported that a bacculovirus expressed MDM2 protein binds RNA in a sequence-specific manner through the Ring Finger domain, however, its ability to bind DNA has yet to be examined. We report here that a bacterially expressed human MDM2 protein binds both DNA as well as the previously defined RNA consensus sequence. DNA binding appears selective and involves the carboxy-terminal domain of the molecule. RNA binding is inhibited by an MDM2 specific antibody, which recognises an epitope within the carboxy region of the protein. Selection cloning and sequence analysis of MDM2 DNA binding sequences, unlike RNA binding sequences, revealed no obvious DNA binding consensus sequence, but preferential binding to oligopurine:pyrimidine-rich stretches. Our results suggest that the observed preferential DNA binding may occur through the Zinc Finger or in a charge-charge interaction through the Ring Finger, thereby implying potentially different mechanisms for DNA and RNA MDM2 binding.

  12. Sequence-based Association Analysis Reveals an MGST1 eQTL with Pleiotropic Effects on Bovine Milk Composition

    PubMed Central

    Littlejohn, Mathew D.; Tiplady, Kathryn; Fink, Tania A.; Lehnert, Klaus; Lopdell, Thomas; Johnson, Thomas; Couldrey, Christine; Keehan, Mike; Sherlock, Richard G.; Harland, Chad; Scott, Andrew; Snell, Russell G.; Davis, Stephen R.; Spelman, Richard J.

    2016-01-01

    The mammary gland is a prolific lipogenic organ, synthesising copious amounts of triglycerides for secretion into milk. The fat content of milk varies widely both between and within species, and recent independent genome-wide association studies have highlighted a milk fat percentage quantitative trait locus (QTL) of large effect on bovine chromosome 5. Although both EPS8 and MGST1 have been proposed to underlie these signals, the causative status of these genes has not been functionally confirmed. To investigate this QTL in detail, we report genome sequence-based imputation and association mapping in a population of 64,244 taurine cattle. This analysis reveals a cluster of 17 non-coding variants spanning MGST1 that are highly associated with milk fat percentage, and a range of other milk composition traits. Further, we exploit a high-depth mammary RNA sequence dataset to conduct expression QTL (eQTL) mapping in 375 lactating cows, revealing a strong MGST1 eQTL underpinning these effects. These data demonstrate the utility of DNA and RNA sequence-based association mapping, and implicate MGST1, a gene with no obvious mechanistic relationship to milk composition regulation, as causally involved in these processes. PMID:27146958

  13. Emotional response to musical repetition.

    PubMed

    Livingstone, Steven R; Palmer, Caroline; Schubert, Emery

    2012-06-01

    Two experiments examined the effects of repetition on listeners' emotional response to music. Listeners heard recordings of orchestral music that contained a large section repeated twice. The music had a symmetric phrase structure (same-length phrases) in Experiment 1 and an asymmetric phrase structure (different-length phrases) in Experiment 2, hypothesized to alter the predictability of sensitivity to musical repetition. Continuous measures of arousal and valence were compared across music that contained identical repetition, variation (related), or contrasting (unrelated) structure. Listeners' emotional arousal ratings differed most for contrasting music, moderately for variations, and least for repeating musical segments. A computational model for the detection of repeated musical segments was applied to the listeners' emotional responses. The model detected the locations of phrase boundaries from the emotional responses better than from performed tempo or physical intensity in both experiments. These findings indicate the importance of repetition in listeners' emotional response to music and in the perceptual segmentation of musical structure.

  14. Repetitively pumped electron beam device

    DOEpatents

    Schlitt, L.G.

    1979-07-24

    Disclosed is an apparatus for producing fast, repetitive pulses of controllable length of an electron beam by phased energy storage in a transmission line of length matched to the number of pulses and specific pulse lengths desired. 12 figs.

  15. Apollo 17 petrology and experimental determination of differentiation sequences in model moon compositions

    NASA Technical Reports Server (NTRS)

    Hodges, F. N.; Kushiro, I.

    1974-01-01

    Experimental studies of model moon compositions are discussed, taking into account questions related to the differentiation of the outer layer of the moon. Phase relations for a series of proposed lunar compositions have been determined and a petrographic and electron microprobe study was conducted on four Apollo 17 samples. Two of the samples consist of high-titanium mare basalts, one includes crushed anorthosite and gabbro, and another contains blue-gray breccia.

  16. A Perceptual Repetition Blindness Effect

    NASA Technical Reports Server (NTRS)

    Hochhaus, Larry; Johnston, James C.; Null, Cynthia H. (Technical Monitor)

    1994-01-01

    Before concluding Repetition Blindness is a perceptual phenomenon, alternative explanations based on memory retrieval problems and report bias must be rejected. Memory problems were minimized by requiring a judgment about only a single briefly displayed field. Bias and sensitivity effects were empirically measured with an ROC-curve analysis method based on confidence ratings. Results from five experiments support the hypothesis that Repetition Blindness can be a perceptual phenomenon.

  17. Sequence stratigraphy and composition of late quaternary shelf-margin deltas, Northern Gulf of Mexico

    SciTech Connect

    Morton, R.A.; Suter, J.R.

    1996-04-01

    High-resolution seismic profiles and foundation borings from the northwestern Gulf of Mexico record the physical attributes and depositional histories of several late Quaternary sequences that were deposited by wave-modified, river-dominated shelf-margin deltas during successive periods of lowered sea level. Each progressively younger deltaic sequence is thinner and exhibits a systematic decrease in the abundance and concentration of sand, which is attributed to a shift in the axes of trunk streams and greater structural influence through time. Our study shows that (1) contemporaneous structural deformation controlled the thickness of each sequence, the oblique directions of delta progradation, the axes of major fluvial channels, and the geometries of delta lobes at the shelf margin; (2) sedimentation was rapid in response to rapid eustatic fluctuations and structural influence; (3) boundaries of these high-frequency sequences are the correlative conformities of updip fluvial incision and coincide with downlap surfaces at the shelf margin; (4) the downlap surfaces are not true surfaces, but zones of parallel reflections that become progressively higher and younger in the direction of progradation; (5) the downlap zones are composed of marine muds that do not contain the high concentrations of shell debris expected in condensed sections; (6) possible paleosols capping the two oldest sequences are regressive surfaces of subaerial exposure that were preserved during transgressions; and (7) no incised valleys or submarine canyons breach the paleoshelf margin, even though incised drainages were present updip and sea level curves indicate several periods of rapid fall.

  18. Sentence repetition: what does the task measure?

    PubMed

    Polišenská, Kamila; Chiat, Shula; Roy, Penny

    2015-01-01

    Sentence repetition is gaining increasing attention as a source of information about children's sentence-level abilities in clinical assessment, and as a clinical marker of specific language impairment. However, it is widely debated what the task is testing and therefore how informative it is. (1) To evaluate the effects of different types of long-term linguistic knowledge on immediate recall, (2) to assess age sensitivity of repetition tasks designed to evaluate these effects, and (3) to establish if the effects are similar across typologically different languages. The study also considers the implications of the findings for the use of sentence repetition as a research and clinical assessment tool. Participants were 50 English-speaking and 50 Czech-speaking typically developing 4-5-year-olds. Children's ability to recall sequences of items was compared in seven linguistic conditions ranging from fully well-formed sentences to sequences of non-words. In each condition, children repeated blocks of successively longer stimuli to establish their span. Results showed significant but differential effects of all linguistic factors in both languages. While syntactic violations and presence of non-words dramatically reduced children's span, semantic implausibility and the removal of sentence prosody played a significant but much smaller role. Familiarity of function words was more important than familiarity of content words. The effects of different linguistic factors on spans were the same for both languages and did not change between 4 and 5 years, although average spans increased over this age range. Children's ability to repeat sentences is more dependent on their familiarity with morphosyntax and lexical phonology than semantics or prosody, with function words of particular importance. Findings have implications for the use of recall in clinical assessment and as a research tool. © 2014 Royal College of Speech and Language Therapists.

  19. Synthetic long read sequencing reveals the composition and intraspecies diversity of the human microbiome

    PubMed Central

    Kuleshov, Volodymyr; Jiang, Chao; Zhou, Wenyu; Jahanbani, Fereshteh; Batzoglou, Serafim; Snyder, Michael

    2016-01-01

    Identifying bacterial strains in metagenome and microbiome samples using computational analyses of short-read sequence remains a difficult problem. Here, we present an analysis of a human gut microbiome using on Tru-seq synthetic long reads combined with new computational tools for metagenomic long-read assembly, variant-calling and haplotyping (Nanoscope and Lens). Our analysis identifies 178 bacterial species of which 51 were not found using short sequence reads alone. We recover bacterial contigs that comprise multiple operons, including 22 contigs of >1Mbp. Extensive intraspecies variation among microbial strains in the form of haplotypes that span up to hundreds of Kbp can be observed using our approach. Our method incorporates synthetic long-read sequencing technology with standard shotgun approaches to move towards rapid, precise and comprehensive analyses of metagenome and microbiome samples. PMID:26655498

  20. Microbial Community Composition in the Marine Sediments of Jeju Island: Next-Generation Sequencing Surveys.

    PubMed

    Choi, Heebok; Koh, Hyeon-Woo; Kim, Hongik; Chae, Jong-Chan; Park, Soo-Je

    2016-05-28

    Marine sediments are a microbial biosphere with an unknown physiology, and the sediments harbor numerous distinct phylogenetic lineages of Bacteria and Archaea that are at present uncultured. In this study, the structure of the archaeal and bacterial communities was investigated in the surface and subsurface sediments of Jeju Island using a next-generation sequencing method. The microbial communities in the surface sediments were distinct from those in the subsurface sediments; the relative abundance of sequences for Thaumarchaeota, Actinobacteria, Bacteroides, Alphaproteobacteria, and Gammaproteobacteria were higher in the surface than subsurface sediments, whereas the sequences for Euryarchaeota, Acidobacteria, Firmicutes, and Deltaproteobacteria were relatively more abundant in the subsurface than surface sediments. This study presents detailed characterization of the spatial distribution of benthic microbial communities of Jeju Island and provides fundamental information on the potential interactions mediated by microorganisms with the different biogeochemical cycles in coastal sediments.

  1. The venom composition of the parasitic wasp Chelonus inanitus resolved by combined expressed sequence tags analysis and proteomic approach

    PubMed Central

    2010-01-01

    Background Parasitic wasps constitute one of the largest group of venomous animals. Although some physiological effects of their venoms are well documented, relatively little is known at the molecular level on the protein composition of these secretions. To identify the majority of the venom proteins of the endoparasitoid wasp Chelonus inanitus (Hymenoptera: Braconidae), we have randomly sequenced 2111 expressed sequence tags (ESTs) from a cDNA library of venom gland. In parallel, proteins from pure venom were separated by gel electrophoresis and individually submitted to a nano-LC-MS/MS analysis allowing comparison of peptides and ESTs sequences. Results About 60% of sequenced ESTs encoded proteins whose presence in venom was attested by mass spectrometry. Most of the remaining ESTs corresponded to gene products likely involved in the transcriptional and translational machinery of venom gland cells. In addition, a small number of transcripts were found to encode proteins that share sequence similarity with well-known venom constituents of social hymenopteran species, such as hyaluronidase-like proteins and an Allergen-5 protein. An overall number of 29 venom proteins could be identified through the combination of ESTs sequencing and proteomic analyses. The most highly redundant set of ESTs encoded a protein that shared sequence similarity with a venom protein of unknown function potentially specific of the Chelonus lineage. Venom components specific to C. inanitus included a C-type lectin domain containing protein, a chemosensory protein-like protein, a protein related to yellow-e3 and ten new proteins which shared no significant sequence similarity with known sequences. In addition, several venom proteins potentially able to interact with chitin were also identified including a chitinase, an imaginal disc growth factor-like protein and two putative mucin-like peritrophins. Conclusions The use of the combined approaches has allowed to discriminate between cellular

  2. Using DGGE and 16S rRNA Gene Sequence Analysis to Evaluate Changes in Oral Bacterial Composition

    PubMed Central

    CHEN, Zhou; TRIVEDI, Harsh M.; CHHUN, Nok; BARNES, Virginia M.; SAXENA, Deepak; XU, Tao; LI, Yihong

    2015-01-01

    Objective To investigate whether a standard dental prophylaxis followed by tooth brushing with an antibacterial dentifrice will affect the oral bacterial community, as determined by denaturing gradient gel electrophoresis (DGGE) combined with 16S rRNA gene sequence analysis. Methods Twenty-four healthy adults were instructed to brush their teeth using commercial dentifrice for 1 week during a washout period. An initial set of pooled supragingival plaque samples was collected from each participant at baseline (0 h) before prophylaxis treatment. The subjects were given a clinical examination and dental prophylaxis and asked to brush for 1 min with a dentifrice containing 0.3% triclosan/2.0% PVM/MA copolymer/0.243% sodium fluoride (Colgate Total). On the following day, a second set of pooled supragingival plaque samples (24 h) was collected. Total bacterial genomic DNA was isolated from the samples. Differences in the microbial composition before and after the prophylactic procedure and tooth brushing were assessed by comparing the DGGE profiles of PCR-amplified and 16S rRNA gene segments sequence analysis. Results Two distinct clusters of DGGE profiles were found, suggesting that a shift in the microbial composition had occurred 24 h after the prophylaxis and brushing. A detailed sequencing analysis of 16S rRNA gene segments further identified six phyla and 29 genera, including known and unknown bacterial species. Importantly, an increase in bacterial diversity was observed after 24 h, including members of the Streptococcaceae family, Prevotella, Corynebacterium, TM7 and other commensal bacteria. Conclusion The results suggest that the use of a standard prophylaxis followed by the use of the dentifrice containing 0.3% triclosan/2.0% PVM/MA copolymer/0.243% sodium fluoride may promote a healthier composition within the oral bacterial community. PMID:22319750

  3. Using DGGE and 16S rRNA gene sequence analysis to evaluate changes in oral bacterial composition.

    PubMed

    Chen, Zhou; Trivedi, Harsh M; Chhun, Nok; Barnes, Virginia M; Saxena, Deepak; Xu, Tao; Li, Yihong

    2011-01-01

    To investigate whether a standard dental prophylaxis followed by tooth brushing with an antibacterial dentifrice will affect the oral bacterial community, as determined by denaturing gradient gel electrophoresis (DGGE) combined with 16S rRNA gene sequence analysis. Twenty-four healthy adults were instructed to brush their teeth using commercial dentifrice for 1 week during a washout period. An initial set of pooled supragingival plaque samples was collected from each participant at baseline (0 h) before prophylaxis treatment. The subjects were given a clinical examination and dental prophylaxis and asked to brush for 1 min with a dentifrice containing 0.3% triclosan, 2.0% PVM/MA copolymer and 0.243% sodium fluoride (Colgate Total). On the following day, a second set of pooled supragingival plaque samples (24 h) was collected. Total bacterial genomic DNA was isolated from the samples. Differences in the microbial composition before and after the prophylactic procedure and tooth brushing were assessed by comparing the DGGE profiles and 16S rRNA gene segments sequence analysis. Two distinct clusters of DGGE profiles were found, suggesting that a shift in the microbial composition had occurred 24 h after the prophylaxis and brushing. A detailed sequencing analysis of 16S rRNA gene segments further identified 6 phyla and 29 genera, including known and unknown bacterial species. Importantly, an increase in bacterial diversity was observed after 24 h, including members of the Streptococcaceae family, Prevotella, Corynebacterium, TM7 and other commensal bacteria. The results suggest that the use of a standard prophylaxis followed by the use of the dentifrice containing 0.3% triclosan, 2.0% PVM/MA copolymer and 0.243% sodium fluoride may promote a healthier composition within the oral bacterial community.

  4. Palynological composition of a Lower Cretaceous South American tropical sequence: Climatic implications and diversity comparisons with other latitudes.

    USGS Publications Warehouse

    Mejia-Velasquez, Paula J.; Dilcher, David L.; Jaramillo, Carlos A.; Fortini, Lucas B.; Manchester, Steven R.

    2012-01-01

    Premise of the study: Reconstruction of floristic patterns during the early diversification of angiosperms is impeded by the scarce fossil record, especially in tropical latitudes. Here we collected quantitative palynological data from a stratigraphic sequence in tropical South America to provide floristic and climatic insights into such tropical environments during the Early Cretaceous. Methods: We reconstructed the floristic composition of an Aptian-Albian tropical sequence from central Colombia using quantitative palynology (rarefied species richness and abundance) and used it to infer its predominant climatic conditions. Additionally, we compared our results with available quantitative data from three other sequences encompassing 70 floristic assemblages to determine latitudinal diversity patterns. Key results: Abundance of humidity indicators was higher than that of aridity indicators (61% vs. 10%). Additionally, we found an angiosperm latitudinal diversity gradient (LDG) for the Aptian, but not for the Albian, and an inverted LDG of the overall diversity for the Albian. Angiosperm species turnover during the Albian, however, was higher in humid tropics. Conclusions: There were humid climates in northwestern South America during the Aptian-Albian interval contrary to the widespread aridity expected for the tropical belt. The Albian inverted overall LDG is produced by a faster increase in per-sample angiosperm and pteridophyte diversity in temperate latitudes. However, humid tropical sequences had higher rates of floristic turnover suggesting a higher degree of morphological variation than in temperate regions.

  5. Limits on movement integration in children: The concatenation of trained subsequences into composite sequences as a specific experience-triggered skill.

    PubMed

    Ashtamker, Lilach; Karni, Avi

    2015-09-01

    Complex movement sequences may be easier to acquire in sub-segments. Nevertheless, the neuro-behavioral constraints on assembling short multi-element movement segments, acquired piecemeal and serially, into larger, composite units of action, are not clear. Here we examined the ability of children to combine movement subsequences into longer, composite, sequences. Eleven-year-olds were trained in the performance of two, 3-elements, finger-to-thumb opposition movement sequences and were tested, overnight, in the performance of composite, 6-elements, sequences. Two experiments were compared, differing only in whether or not a brief test for integration into a composite sequence was afforded immediately post-training. This composite sequence (Full) was a direct forward integration of the two subsequences, maintaining the order in which the two subsequences were trained. In both experiments, overnight performance of movement elements within the composite sequences was better than naive performance, but slower and less accurate compared to the performance of the identical movement elements in the context of the trained subsequences. Integration was as effective in the Full sequence as when the order between subsequences was switched (Reversed). However, the early test for subsequence integration was critical in inducing clear between-session ('offline') gains, as expressed in overnight performance, in both the Full and Reversed sequences. Without this brief experience in integration, no overnight gains were expressed in any of the 6-elements sequences. Moreover, the immediate post-training test resulted in a relative advantage of the Full and Reversed sequences over a 6-element sequence in which the order of the elements was mirror-reversed within each subsequence. Thus, training on subsequences may not spontaneously lead to an advantage in the performance of composite sequences, in children. However, an early brief experience with a composite sequence can suffice to

  6. Elevated nutrients change bacterial community composition and connectivity: high throughput sequencing of young marine biofilms.

    PubMed

    Lawes, Jasmin C; Neilan, Brett A; Brown, Mark V; Clark, Graeme F; Johnston, Emma L

    2016-01-01

    Biofilms are integral to many marine processes but their formation and function may be affected by anthropogenic inputs that alter environmental conditions, including fertilisers that increase nutrients. Density composition and connectivity of biofilms developed in situ (under ambient and elevated nutrients) were compared using 454-pyrosequencing of the 16S gene. Elevated nutrients shifted community composition from bacteria involved in higher processes (eg Pseudoalteromonas spp. invertebrate recruitment) towards more nutrient-tolerant bacterial species (eg Terendinibacter sp.). This may enable the persistence of biofilm communities by increasing resistance to nutrient inputs. A core biofilm microbiome was identified (predominantly Alteromonadales and Oceanospirillales) and revealed shifts in abundances of core microbes that could indicate enrichment by fertilisers. Fertiliser decreased density and connectivity within biofilms indicating that associations were disrupted perhaps via changes to energetic allocations within the core microbiome. Density composition and connectivity changes suggest nutrients can affect the stability and function of these important marine communities.

  7. Composition-based classification of short metagenomic sequences elucidates the landscapes of taxonomic and functional enrichment of microorganisms.

    PubMed

    Liu, Jiemeng; Wang, Haifeng; Yang, Hongxing; Zhang, Yizhe; Wang, Jinfeng; Zhao, Fangqing; Qi, Ji

    2013-01-07

    Compared with traditional algorithms for long metagenomic sequence classification, characterizing microorganisms' taxonomic and functional abundance based on tens of millions of very short reads are much more challenging. We describe an efficient composition and phylogeny-based algorithm [Metagenome Composition Vector (MetaCV)] to classify very short metagenomic reads (75-100 bp) into specific taxonomic and functional groups. We applied MetaCV to the Meta-HIT data (371-Gb 75-bp reads of 109 human gut metagenomes), and this single-read-based, instead of assembly-based, classification has a high resolution to characterize the composition and structure of human gut microbiota, especially for low abundance species. Most strikingly, it only took MetaCV 10 days to do all the computation work on a server with five 24-core nodes. To our knowledge, MetaCV, benefited from the strategy of composition comparison, is the first algorithm that can classify millions of very short reads within affordable time.

  8. Composition-based classification of short metagenomic sequences elucidates the landscapes of taxonomic and functional enrichment of microorganisms

    PubMed Central

    Liu, Jiemeng; Wang, Haifeng; Yang, Hongxing; Zhang, Yizhe; Wang, Jinfeng; Zhao, Fangqing; Qi, Ji

    2013-01-01

    Compared with traditional algorithms for long metagenomic sequence classification, characterizing microorganisms’ taxonomic and functional abundance based on tens of millions of very short reads are much more challenging. We describe an efficient composition and phylogeny-based algorithm [Metagenome Composition Vector (MetaCV)] to classify very short metagenomic reads (75–100 bp) into specific taxonomic and functional groups. We applied MetaCV to the Meta-HIT data (371-Gb 75-bp reads of 109 human gut metagenomes), and this single-read-based, instead of assembly-based, classification has a high resolution to characterize the composition and structure of human gut microbiota, especially for low abundance species. Most strikingly, it only took MetaCV 10 days to do all the computation work on a server with five 24-core nodes. To our knowledge, MetaCV, benefited from the strategy of composition comparison, is the first algorithm that can classify millions of very short reads within affordable time. PMID:22941634

  9. Nonword Repetition in Children and Adults: Effects on Movement Coordination

    ERIC Educational Resources Information Center

    Sasisekaran, Jayanthi; Smith, Anne; Sadagopan, Neeraja; Weber-Fox, Christine

    2010-01-01

    Hearing and repeating novel phonetic sequences, or novel nonwords, is a task that taps many levels of processing, including auditory decoding, phonological processing, working memory, speech motor planning and execution. Investigations of nonword repetition abilities have been framed within models of psycholinguistic processing, while the motor…

  10. Chronic occupational repetitive strain injury.

    PubMed

    O'Neil, B A; Forsythe, M E; Stanish, W D

    2001-02-01

    To review common repetitive strain injuries (RSIs) that occur in the workplace, emphasizing diagnosis, treatment, and etiology of these conditions. A MEDLINE search from January 1966 to June 1999 focused on articles published since 1990 because RSIs are relatively new diagnoses. MeSH headings that were explored using the thesaurus included "cumulative trauma disorder," "overuse injury," and "repetitive strain injury." The search was limited to English articles only, and preference was given to randomized controlled trials. Repetitive strain injuries result from repeated stress to the body's soft tissue structures including muscles, tendons, and nerves. They often occur in patients who perform repetitive movements either in their jobs or in extracurricular activities. Common RSIs include tendon-related disorders, such as rotator cuff tendonitis, and peripheral nerve entrapment disorders, such as carpal tunnel syndrome. A careful history and physical examination often lead to the diagnosis, but newer imaging techniques, such as magnetic resonance imaging and ultrasound, can help in refractory cases. Conservative management with medication, physiotherapy, or bracing is the mainstay of treatment. Surgery is reserved for cases that do not respond to treatment. Repetitive strain injury is common; primary care physicians must establish a diagnosis and, more importantly, its relationship to occupation. Treatment can be offered by family physicians who refer to specialists for cases refractory to conservative management.

  11. Chronic occupational repetitive strain injury.

    PubMed Central

    O'Neil, B. A.; Forsythe, M. E.; Stanish, W. D.

    2001-01-01

    OBJECTIVE: To review common repetitive strain injuries (RSIs) that occur in the workplace, emphasizing diagnosis, treatment, and etiology of these conditions. QUALITY OF EVIDENCE: A MEDLINE search from January 1966 to June 1999 focused on articles published since 1990 because RSIs are relatively new diagnoses. MeSH headings that were explored using the thesaurus included "cumulative trauma disorder," "overuse injury," and "repetitive strain injury." The search was limited to English articles only, and preference was given to randomized controlled trials. MAIN MESSAGE: Repetitive strain injuries result from repeated stress to the body's soft tissue structures including muscles, tendons, and nerves. They often occur in patients who perform repetitive movements either in their jobs or in extracurricular activities. Common RSIs include tendon-related disorders, such as rotator cuff tendonitis, and peripheral nerve entrapment disorders, such as carpal tunnel syndrome. A careful history and physical examination often lead to the diagnosis, but newer imaging techniques, such as magnetic resonance imaging and ultrasound, can help in refractory cases. Conservative management with medication, physiotherapy, or bracing is the mainstay of treatment. Surgery is reserved for cases that do not respond to treatment. CONCLUSION: Repetitive strain injury is common; primary care physicians must establish a diagnosis and, more importantly, its relationship to occupation. Treatment can be offered by family physicians who refer to specialists for cases refractory to conservative management. PMID:11228032

  12. Domain of the composition of some triangles in the space of p-summable sequences

    NASA Astrophysics Data System (ADS)

    Başar, Feyzi

    2014-08-01

    Let 1 ≤ p < ∞. In the present paper, we introduce the space ˜ℓp of Euler-Cesáro p-summable difference sequences. Furthermore, we give an inclusion relation concerning the space ˜ℓp and compute the alpha-, beta- and gamma-duals of the space ˜ℓp and construct its basis. We characterize the classes (˜ℓp: ℓ∞), (˜ℓp: c) and (˜ℓp: c0) of infinite matrices, and give the characterization of some other classes of matrix transformations from the space ˜ℓp to the Euler, Riesz, difference, etc., sequence spaces, by means of a basic lemma.

  13. Composition and phylogenetic analysis of vitellogenin coding sequences in the Indonesian coelacanth Latimeria menadoensis.

    PubMed

    Canapa, Adriana; Olmo, Ettore; Forconi, Mariko; Pallavicini, Alberto; Makapedua, Monica Daisy; Biscotti, Maria Assunta; Barucca, Marco

    2012-07-01

    The coelacanth Latimeria menadoensis, a living fossil, occupies a key phylogenetic position to explore the changes that have affected the genomes of the aquatic vertebrates that colonized dry land. This is the first study to isolate and analyze L. menadoensis mRNA. Three different vitellogenin transcripts were identified and their inferred amino acid sequences compared to those of other known vertebrates. The phylogenetic data suggest that the evolutionary history of this gene family in coelacanths was characterized by a different duplication event than those which occurred in teleosts, amniotes, and amphibia. Comparison of the three sequences highlighted differences in functional sites. Moreover, despite the presence of conserved sites compared with the other oviparous vertebrates, some sites were seen to have changed, others to be similar only to those of teleosts, and others still to resemble only to those of tetrapods.

  14. Fragmentation Characteristics of Deprotonated N-linked Glycopeptides: Influences of Amino Acid Composition and Sequence

    NASA Astrophysics Data System (ADS)

    Nishikaze, Takashi; Kawabata, Shin-ichirou; Tanaka, Koichi

    2014-06-01

    Glycopeptide structural analysis using tandem mass spectrometry is becoming a common approach for elucidating site-specific N-glycosylation. The analysis is generally performed in positive-ion mode. Therefore, fragmentation of protonated glycopeptides has been extensively investigated; however, few studies are available on deprotonated glycopeptides, despite the usefulness of negative-ion mode analysis in detecting glycopeptide signals. Here, large sets of glycopeptides derived from well-characterized glycoproteins were investigated to understand the fragmentation behavior of deprotonated N-linked glycopeptides under low-energy collision-induced dissociation (CID) conditions. The fragment ion species were found to be significantly variable depending on their amino acid sequence and could be classified into three types: (i) glycan fragment ions, (ii) glycan-lost fragment ions and their secondary cleavage products, and (iii) fragment ions with intact glycan moiety. The CID spectra of glycopeptides having a short peptide sequence were dominated by type (i) glycan fragments (e.g., 2,4AR, 2,4AR-1, D, and E ions). These fragments define detailed structural features of the glycan moiety such as branching. For glycopeptides with medium or long peptide sequences, the major fragments were type (ii) ions (e.g., [peptide + 0,2X0-H]- and [peptide-NH3-H]-). The appearance of type (iii) ions strongly depended on the peptide sequence, and especially on the presence of Asp, Asn, and Glu. When a glycosylated Asn is located on the C-terminus, an interesting fragment having an Asn residue with intact glycan moiety, [glycan + Asn-36]-, was abundantly formed. Observed fragments are reasonably explained by a combination of existing fragmentation rules suggested for N-glycans and peptides.

  15. Scan patterns when viewing natural scenes: emotion, complexity, and repetition.

    PubMed

    Bradley, Margaret M; Houbova, Petra; Miccoli, Laura; Costa, Vincent D; Lang, Peter J

    2011-11-01

    Eye movements were monitored during picture viewing, and effects of hedonic content, perceptual composition, and repetition on scanning assessed. In Experiment 1, emotional and neutral pictures that were figure-ground compositions or more complex scenes were presented for a 6-s free viewing period. Viewing emotional pictures or complex scenes prompted more fixations and broader scanning of the visual array, compared to neutral pictures or simple figure-ground compositions. Effects of emotion and composition were independent, supporting the hypothesis that these oculomotor indices reflect enhanced information seeking. Experiment 2 tested an orienting hypothesis by repeatedly presenting the same pictures. Although repetition altered specific scan patterns, emotional, compared to neutral, picture viewing continued to prompt oculomotor differences, suggesting that motivationally relevant cues enhance information seeking in appetitive and defensive contexts. Copyright © 2011 Society for Psychophysiological Research.

  16. Scan patterns when viewing natural scenes: Emotion, complexity, and repetition

    PubMed Central

    Bradley, Margaret M.; Houbova, Petra; Miccoli, Laura; Costa, Vincent D.; Lang, Peter J.

    2011-01-01

    Eye movements were monitored during picture viewing and effects of hedonic content, perceptual composition, and repetition on scanning assessed. In Experiment 1, emotional and neutral pictures that were figure-ground compositions or more complex scenes were presented for a 6 s free viewing period. Viewing emotional pictures or complex scenes prompted more fixations and broader scanning of the visual array, compared to neutral pictures or simple figure-ground compositions. Effects of emotion and composition were independent, supporting the hypothesis that these oculomotor indices reflect enhanced information seeking. Experiment 2 tested an orienting hypothesis by repeatedly presenting the same pictures. Although repetition altered specific scan patterns, emotional, compared to neutral, picture viewing continued to prompt oculomotor differences, suggesting that motivationally relevant cues enhance information seeking in appetitive and defensive contexts. PMID:21649664

  17. Tongue Motion Averaging from Contour Sequences

    ERIC Educational Resources Information Center

    Li, Min; Kambhamettu, Chandra; Stone, Maureen

    2005-01-01

    In this paper, a method to get the best representation of a speech motion from several repetitions is presented. Each repetition is a representation of the same speech captured at different times by sequence of ultrasound images and is composed of a set of 2D spatio-temporal contours. These 2D contours in different repetitions are time aligned…

  18. Tongue Motion Averaging from Contour Sequences

    ERIC Educational Resources Information Center

    Li, Min; Kambhamettu, Chandra; Stone, Maureen

    2005-01-01

    In this paper, a method to get the best representation of a speech motion from several repetitions is presented. Each repetition is a representation of the same speech captured at different times by sequence of ultrasound images and is composed of a set of 2D spatio-temporal contours. These 2D contours in different repetitions are time aligned…

  19. Complete sequence of heterogenous-composition mitochondrial genome (Brassica napus) and its exogenous source

    PubMed Central

    2012-01-01

    Background Unlike maternal inheritance of mitochondria in sexual reproduction, somatic hybrids follow no obvious pattern. The introgressed segment orf138 from the mitochondrial genome of radish (Raphanus sativus) to its counterpart in rapeseed (Brassica napus) demonstrates that this inheritance mode derives from the cytoplasm of both parents. Sequencing of the complete mitochondrial genome of five species from Brassica family allowed the prediction of other extraneous sources of the cybrids from the radish parent, and the determination of their mitochondrial rearrangement. Results We obtained the complete mitochondrial genome of Ogura-cms-cybrid (oguC) rapeseed. To date, this is the first time that a heterogeneously composed mitochondrial genome was sequenced. The 258,473 bp master circle constituted of 33 protein-coding genes, 3 rRNA sequences, and 23 tRNA sequences. This mitotype noticeably holds two copies of atp9 and is devoid of cox2-2. Relative to nap mitochondrial genome, 40 point mutations were scattered in the 23 protein-coding genes. atp6 even has an abnormal start locus whereas tatC has an abnormal end locus. The rearrangement of the 22 syntenic regions that comprised 80.11% of the genome was influenced by short repeats. A pair of large repeats (9731 bp) was responsible for the multipartite structure. Nine unique regions were detected when compared with other published Brassica mitochondrial genome sequences. We also found six homologous chloroplast segments (Brassica napus). Conclusions The mitochondrial genome of oguC is quite divergent from nap and pol, which are more similar with each other. We analyzed the unique regions of every genome of the Brassica family, and found that very few segments were specific for these six mitotypes, especially cam, jun, and ole, which have no specific segments at all. Therefore, we conclude that the most specific regions of oguC possibly came from radish. Compared with the chloroplast genome, six identical regions

  20. Between memory and destiny: repetition.

    PubMed

    Marucco, Norberto Carlos

    2007-04-01

    This essay focuses mainly on the topic of repetition (agieren)-on its metapsychological, clinical, and technical conceptions. It contains a core problem, that is, the question of the represented, the nonrepresented, and the unrepresentable in the psyche. This problem, in turn, brings to light the dialectical relation between drive and object and its specific articulation with the traumatic. The author attributes special significance to its clinical expression as 'destiny.' He points out a shift in the theory of the cure from recollection and the unveiling of unconscious desire, to the possibility of understanding 'pure' repetition, which would constitute the very essence of the drive. The author highlights three types of repetition, namely, 'representative' (oedipal) repetition, the repetition of the 'nonrepresented' (narcissistic), which may gain representation, and that of the 'unrepresentable' (sensory impressions, 'lived experiences from primal times,' 'prelinguistic signifiers,' 'ungovernable mnemic traces'). The concept-the metaphor-drive embryo brings the author close to the question of the archaic in psychoanalysis, where the repetition in the act would express itself. 'Another unconscious' would zealously conceal the entombed (verschüttet) that we are not yet able to describe-the 'innermost' rather than the 'buried' (untergegangen) or the 'annihilated' (zugrunde gegangen)-through a mechanism whose way of expression is repetition in the act. With 'Constructions in analysis' as its starting point, this paper suggests a different technical implementation from that of the Freudian construction; its main material is what emerges in the present of the transference as the repetition of 'something' lacking as history. The memory of the analytic process offers a historical diachrony whereby a temporality freed from repetition and utterly unique might unfold in the analysis. This diachrony would no longer be the historical reconstruction of material truth, but the

  1. Prediction of protein structural class for low-similarity sequences using Chou's pseudo amino acid composition and wavelet denoising.

    PubMed

    Yu, Bin; Lou, Lifeng; Li, Shan; Zhang, Yusen; Qiu, Wenying; Wu, Xue; Wang, Minghui; Tian, Baoguang

    2017-09-01

    Prediction of protein structural class plays an important role in protein structure and function analysis, drug design and many other biological applications. Prediction of protein structural class for low-similarity sequences is still a challenging task. Based on the theory of wavelet denoising, this paper presents a novel method of prediction of protein structural class for the first time. Firstly, the features of the protein sequence are extracted by using Chou's pseudo amino acid composition (PseAAC). Then the extracted feature information is denoised by two-dimensional (2D) wavelet. Finally, the optimal feature vectors are input to support vector machine (SVM) classifier to predict protein structural classes. We obtained significant predictive results using jackknife test on three low-similarity protein structural class datasets 25PDB, 1189 and 640, and compared our method with previous methods The results indicate that the method proposed in this paper can effectively improve the prediction accuracy of protein structural class, which will be a reliable tool for prediction of protein structural class, especially for low-similarity sequences. Copyright © 2017 Elsevier Inc. All rights reserved.

  2. A close relationship between primary nucleotides sequence structure and the composition of functional genes in the genome of prokaryotes.

    PubMed

    Garcia, Juan A L; Fernández-Guerra, Antoni; Casamayor, Emilio O

    2011-12-01

    Comparative genomics is an essential tool to unravel how genomes change over evolutionary time and to gain clues on the links between functional genomics and evolution. In prokaryotes, the large, good quality, genome sequences available in public databases and the recently developed large-scale computational methods, offer an unprecedent view on the ecology and evolution of microorganisms through comparative genomics. In this work, we examined the links among genome structure (i.e., the sequential distribution of nucleotides itself by detrended fluctuation analysis, DFA) and genomic diversity (i.e., gene functionality by Clusters of Orthologous Genes, COGs) in 828 full sequenced prokaryotic genomes from 548 different bacteria and archaea species. DFA scaling exponent α indicated persistent long-range correlations (fractality) in each genome analyzed. Higher resolution power was found when considering the sequential succession of purine (AG) vs. pyrimidine (CT) bases than either keto (GT) to amino (AC) forms or strongly (GC) vs. weakly (AT) bonded nucleotides. Interestingly, the phyla Aquificae, Fusobacteria, Dictyoglomi, Nitrospirae, and Thermotogae were closer to archaea than to their bacterial counterparts. A strong significant correlation was found between scaling exponent α and COGs distribution, and we consistently observed that the larger α the more heterogeneous was the gene distribution within each functional category, suggesting a close relationship between primary nucleotides sequence structure and functional genes composition.

  3. Understanding microalgal species composition and contributions in Antarctic glacial melt water through rbcL high throughput sequencing

    NASA Astrophysics Data System (ADS)

    Barretto, K. M.; Kalmbach, A. J.; de la Torre, J. R.; Falcón, L. I.; Carpenter, E. J.

    2016-02-01

    The McMurdo Dry Valleys (MDV) in Antarctica present unique research opportunities, both because of the understudied biogeochemical impact of their microbial communities, and their sensitivity to climate change. Despite harsh desiccation, pH, and salinity stress, summer glacial melt water supports life in the MDV in the form of algal mats. These mat communities are complex in structure, with a network of dominant cyanobacteria interspersed with heterotrophic diazotrophs, smaller photoautotrophs, and thick extracellular polymeric substances. Due to their complexity, standard microscopy yields a limited understanding of community assemblages. Our previous high throughput sequencing (HTS) approaches focusing on 16S rRNA have profiled communities with understudied photosynthetic phyla such as Acidobacteria, Gemmatimonadetes, and Chloroflexi. To characterize these phototrophic communities, we are interested in (1) understanding their temporal dynamics and how the dominant cyanobacterial species influence community composition, (2) modeling how pH, nutrients, soil wetness, and temperature act as multivariate drivers of community composition, and (3) establishing a pipeline for HTS of the rbcL gene - which encodes the large subunit of the ubiquitous photosynthetic protein RuBisCO. Our initial screening of community DNA from MDV algal mats has shown the presence of Form IA, IB, and IC cbbL (an rbcL ortholog), and Form ID rbcL - indicating a relatively high degree of photoautotrophic diversity. Soil wetness drives anoxic conditions and we see that it shifts overall microbial composition - we expect photoautotrophs to respond similarly. We also expect photoautotrophic assemblages to shift with pH and soil nutrients. Our deep sequencing efforts suggest an inconsistency between indexing primers and algal DNA that could underestimate cyanobacterial and overestimate eukaryotic abundance. Resolving these issues with new approaches will allow us to more fully understand the

  4. Validation of use of whole-cell repetitive extragenic palindromic sequence-based PCR (REP-PCR) for typing strains belonging to the Acinetobacter calcoaceticus-Acinetobacter baumannii complex and application of the method to the investigation of a hospital outbreak.

    PubMed Central

    Snelling, A M; Gerner-Smidt, P; Hawkey, P M; Heritage, J; Parnell, P; Porter, C; Bodenham, A R; Inglis, T

    1996-01-01

    Acinetobacter spp. are being reported with increasing frequency as causes of nosocomial infection. In order to identify reservoirs of infection as quickly as possible, a rapid typing method that can differentiate epidemic strains from environmental and nonepidemic strains is needed. In 1993, a cluster of Acinetobacter baumannii isolates from five patients in the adult intensive therapy unit of our tertiary-care teaching hospital led us to develop and optimize a rapid repetitive extragenic palindromic sequence-based PCR (REP-PCR) typing protocol for members of the Acinetobacter calcoaceticus-A. baumannii complex that uses boiled colonies and consensus primers aimed at repetitive extragenic palindromic sequences. Four of the five patient isolates gave the same REP-PCR typing pattern as isolates of A. baumannii obtained from the temperature probe of a Bennett humidifier; the fifth isolate had a unique profile. Disinfection of the probe with 70% ethanol, as recommended by the manufacturer, proved ineffective, as A. baumannii with the same REP-PCR pattern was isolated from it 10 days after cleaning, necessitating a change in our decontamination procedure. Results obtained with REP-PCR were subsequently confirmed by ribotyping. To evaluate the discriminatory power (D) of REP-PCR for typing members of the A. calcoaceticus-A. baumannii complex, compared with that of ribotyping, we have applied both methods to a collection of 85 strains that included representatives of six DNA groups within the complex. Ribotyping using EcoRI digests yielded 53 patterns (D = 0.98), whereas 68 different REP-PCR patterns were observed (D = 0.99). By computer-assisted analysis of gel images, 74 patterns were observed with REP-PCR (D = 1.0). Overall, REP-PCR typing proved to be slightly more discriminatory than ribotyping. Our results indicate that REP-PCR typing used boiled colonies is a simple, rapid, and effective means of typing members of the A. calcoaceticus-A. baumannii complex. PMID

  5. Phylogeny of prokaryotes and chloroplasts revealed by a simple composition approach on all protein sequences from complete genomes without sequence alignment.

    PubMed

    Yu, Z G; Zhou, L Q; Anh, V V; Chu, K H; Long, S C; Deng, J Q

    2005-04-01

    The complete genomes of living organisms have provided much information on their phylogenetic relationships. Similarly, the complete genomes of chloroplasts have helped to resolve the evolution of this organelle in photosynthetic eukaryotes. In this paper we propose an alternative method of phylogenetic analysis using compositional statistics for all protein sequences from complete genomes. This new method is conceptually simpler than and computationally as fast as the one proposed by Qi et al. (2004b) and Chu et al. (2004). The same data sets used in Qi et al. (2004b) and Chu et al. (2004) are analyzed using the new method. Our distance-based phylogenic tree of the 109 prokaryotes and eukaryotes agrees with the biologists "tree of life" based on 16S rRNA comparison in a predominant majority of basic branching and most lower taxa. Our phylogenetic analysis also shows that the chloroplast genomes are separated to two major clades corresponding to chlorophytes s.l. and rhodophytes s.l. The interrelationships among the chloroplasts are largely in agreement with the current understanding on chloroplast evolution.

  6. Sequence-based analysis of the microbial composition of water kefir from multiple sources.

    PubMed

    Marsh, Alan J; O'Sullivan, Orla; Hill, Colin; Ross, R Paul; Cotter, Paul D

    2013-11-01

    Water kefir is a water-sucrose-based beverage, fermented by a symbiosis of bacteria and yeast to produce a final product that is lightly carbonated, acidic and that has a low alcohol percentage. The microorganisms present in water kefir are introduced via water kefir grains, which consist of a polysaccharide matrix in which the microorganisms are embedded. We aimed to provide a comprehensive sequencing-based analysis of the bacterial population of water kefir beverages and grains, while providing an initial insight into the corresponding fungal population. To facilitate this objective, four water kefirs were sourced from the UK, Canada and the United States. Culture-independent, high-throughput, sequencing-based analyses revealed that the bacterial fraction of each water kefir and grain was dominated by Zymomonas, an ethanol-producing bacterium, which has not previously been detected at such a scale. The other genera detected were representatives of the lactic acid bacteria and acetic acid bacteria. Our analysis of the fungal component established that it was comprised of the genera Dekkera, Hanseniaspora, Saccharomyces, Zygosaccharomyces, Torulaspora and Lachancea. This information will assist in the ultimate identification of the microorganisms responsible for the potentially health-promoting attributes of these beverages. © 2013 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.

  7. Genotyping by PCR and High-Throughput Sequencing of Commercial Probiotic Products Reveals Composition Biases

    PubMed Central

    Morovic, Wesley; Hibberd, Ashley A.; Zabel, Bryan; Barrangou, Rodolphe; Stahl, Buffy

    2016-01-01

    Recent advances in microbiome research have brought renewed focus on beneficial bacteria, many of which are available in food and dietary supplements. Although probiotics have historically been defined as microorganisms that convey health benefits when ingested in sufficient viable amounts, this description now includes the stipulation “well defined strains,” encompassing definitive taxonomy for consumer consideration and regulatory oversight. Here, we evaluated 52 commercial dietary supplements covering a range of labeled species using plate counting and targeted genotyping. Strain identities were assessed using methods recently published by the United States Pharmacopeial Convention. We also determined the relative abundance of individual bacteria by high-throughput sequencing (HTS) of the 16S rRNA sequence using paired-end 2 × 250 bp Illumina MiSeq technology. Using these methods, we tested the hypothesis that products do contain the quantitative and qualitative list of labeled microbial species. We found that 17 samples (33%) were below label claim for CFU prior to their expiration dates. A multiplexed-PCR scheme showed that only 30/52 (58%) of the products contained a correctly labeled classification, with issues encompassing incorrect taxonomy, missing species, and un-labeled species. The HTS revealed that many blended products consisted predominantly of Lactobacillus acidophilus and Bifidobacterium animalis subsp. lactis. These results highlight the need for reliable methods to determine the correct taxonomy and quantify the relative amounts of mixed microbial populations in commercial probiotic products. PMID:27857709

  8. A chenopod extensin lacks repetitive tetrahydroxyproline blocks

    SciTech Connect

    Li, Xiongbiao; Kieliszewski, M.; Lamport, D.T.A. )

    1990-02-01

    An extensin isolated from sugar beet (Beta vulgaris) cell suspension cultures fulfills all criteria for membership of the extensin family save one, notably, lack of the diagnostic pentamer Ser-Hyp-Hyp-Hyp-Hyp. However, sequence analysis of the major tryptic peptides shows that sugar beet extensin shares a motif in common with tomato extensin P1 but differs by the position of an insertion sequence (X) or (Y) which, in sugar beet, splits the tetrahydroxyproline block: Ser-Hyp-Hyp-(X)-Hyp-Hyp-Thr-Hyp-Val-Tyr-Lys, where (X) is (Val-His-Glu/Lys-Tyr-Pro), while in tomato the insertion sequence (Y) = (Val-Lys-Pro-Tyr-His-Pro) and, when it occurs, immediately follows the tetrahydroxyproline block: Ser-Hyp-Hyp-Hyp-Hyp-(Y)-Thr-Hyp-Val-Tyr-Lys. Based on these data were reinterpret three highly repetitive cDNA sequences, including nodulin N75 from soybean and wound-induced P33 of carrot, as extensins with split tetra(hydroxy)proline blocks.

  9. Bioinformatical parsing of folding-on-binding proteins reveals their compositional and evolutionary sequence design.

    PubMed

    Narasumani, Mohanalakshmi; Harrison, Paul M

    2015-12-18

    Intrinsic disorder occurs when (part of) a protein remains unfolded during normal functioning. Intrinsically-disordered regions can contain segments that 'fold on binding' to another molecule. Here, we perform bioinformatical parsing of human 'folding-on-binding' (FB) proteins, into four subsets: Ordered regions, FB regions, Disordered regions that surround FB regions ('Disordered-around-FB'), and Other-Disordered regions. We examined the composition and evolutionary behaviour (across vertebrate orthologs) of these subsets. From a convergence of three separate analyses, we find that for hydrophobicity, Ordered regions segregate from the other subsets, but the Ordered and FB regions group together as highly conserved, and the Disordered-around-FB and Other-Disordered regions as less conserved (with a lesser significant difference between Ordered and FB regions). FB regions are highly-conserved with net positive charge, whereas Disordered-around-FB have net negative charge and are relatively less hydrophobic than FB regions. Indeed, these Disordered-around-FB regions are excessively hydrophilic compared to other disordered regions generally. We describe how our results point towards a possible compositionally-based steering mechanism of folding-on-binding.

  10. Precautions regarding Nonword Repetition Tasks

    ERIC Educational Resources Information Center

    Smith, Bruce

    2006-01-01

    Using nonword repetition tasks as an experimental approach with both adults and children has become quite common in the past 10 to 15 years for studying lexical learning and phonological processing (e.g., Bailey & Hahn, 2001; Gathercole, Frankish, Pickering & Peaker, 1998; Munson, Edwards, & Beckman, 2005; Storkel, 2001; Vitevich & Luce, 2005). In…

  11. Constructive and Unconstructive Repetitive Thought

    ERIC Educational Resources Information Center

    Watkins, Edward R.

    2008-01-01

    The author reviews research showing that repetitive thought (RT) can have constructive or unconstructive consequences. The main unconstructive consequences of RT are (a) depression, (b) anxiety, and (c) difficulties in physical health. The main constructive consequences of RT are (a) recovery from upsetting and traumatic events, (b) adaptive…

  12. Repetition Blindness Occurs in Nonwords

    ERIC Educational Resources Information Center

    Harris, Catherine L.; Morris, Alison L.

    2004-01-01

    Theorists have predicted that repetition blindness (RB) should be absent for nonwords because they do not activate preexisting mental types. The authors hypothesized that RB would be observed for nonwords because RB can occur at a sublexical level. Four experiments showed that RB is observed for word-nonword pairs (noon noof), orthographically…

  13. Constructive and Unconstructive Repetitive Thought

    ERIC Educational Resources Information Center

    Watkins, Edward R.

    2008-01-01

    The author reviews research showing that repetitive thought (RT) can have constructive or unconstructive consequences. The main unconstructive consequences of RT are (a) depression, (b) anxiety, and (c) difficulties in physical health. The main constructive consequences of RT are (a) recovery from upsetting and traumatic events, (b) adaptive…

  14. Exploring the Gastrointestinal “Nemabiome”: Deep Amplicon Sequencing to Quantify the Species Composition of Parasitic Nematode Communities

    PubMed Central

    Avramenko, Russell W.; Redman, Elizabeth M.; Lewis, Roy; Yazwinski, Thomas A.; Wasmuth, James D.; Gilleard, John S.

    2015-01-01

    Parasitic helminth infections have a considerable impact on global human health as well as animal welfare and production. Although co-infection with multiple parasite species within a host is common, there is a dearth of tools with which to study the composition of these complex parasite communities. Helminth species vary in their pathogenicity, epidemiology and drug sensitivity and the interactions that occur between co-infecting species and their hosts are poorly understood. We describe the first application of deep amplicon sequencing to study parasitic nematode communities as well as introduce the concept of the gastro-intestinal “nemabiome”. The approach is analogous to 16S rDNA deep sequencing used to explore microbial communities, but utilizes the nematode ITS-2 rDNA locus instead. Gastro-intestinal parasites of cattle were used to develop the concept, as this host has many well-defined gastro-intestinal nematode species that commonly occur as complex co-infections. Further, the availability of pure mono-parasite populations from experimentally infected cattle allowed us to prepare mock parasite communities to determine, and correct for, species representation biases in the sequence data. We demonstrate that, once these biases have been corrected, accurate relative quantitation of gastro-intestinal parasitic nematode communities in cattle fecal samples can be achieved. We have validated the accuracy of the method applied to field-samples by comparing the results of detailed morphological examination of L3 larvae populations with those of the sequencing assay. The results illustrate the insights that can be gained into the species composition of parasite communities, using grazing cattle in the mid-west USA as an example. However, both the technical approach and the concept of the ‘nemabiome’ have a wide range of potential applications in human and veterinary medicine. These include investigations of host-parasite and parasite-parasite interactions

  15. Domain of the composition of some triangles in the space of p-summable sequences for 0 < p ≤ 1

    NASA Astrophysics Data System (ADS)

    Başar, Feyzi

    2016-08-01

    Let 0

    composition of E1, C1 and Δ of the Euler, Cesàro means of order one and the backward difference matrix. Furthermore, we give an inclusion relation concerning the space ℓ˜ p and compute the alpha-, beta- and gamma-duals of the space ℓ˜ p and construct its basis. We characterize the classes (ℓ˜ p:ℓ∞ ), (ℓ˜ p:c ) and (ℓ˜ p:c0 ) of infinite matrices, and give the characterization of some other classes of matrix transformations from the space ℓ˜ p to the Euler, Riesz, difference, etc., sequence spaces, by means of a basic lemma.

  16. Visual identity and uncertainty in repetition blindness.

    PubMed

    Brill, Gary A; Glass, Arnold L; Rashid, Hanin; Hussey, Erika

    2008-01-01

    Repetition blindness (RB) was investigated in 6 experiments. In the first 3 experiments participants detected vowel targets in 11-letter sequences. When all letters were uppercase, detection was poorer for same (e.g., AA) than for different (e.g., AO) targets. However, when one target was uppercase and the other lowercase, RB was found only for targets visually identical except for size (e.g., Oo), not for visually different pairs (e.g., Aa). Experiment 4 found RB for visually identical versus different consonant-vowel-consonant words. Experiments 5 and 6 replicated Kanwisher's (1987) experiment in which RB was insensitive to word case but revealed these effects to be artifacts of poor recognition of 5-letter words coupled with a biased guessing strategy. Overall, these experiments found RB only at a low level of visual information processing.

  17. Sequence composition and context effects on the generation and repair of frameshift intermediates in mononucleotide runs in Saccharomyces cerevisiae.

    PubMed Central

    Harfe, B D; Jinks-Robertson, S

    2000-01-01

    DNA polymerase slippage occurs frequently in tracts of a tandemly repeated nucleotide, and such slippage events can be genetically detected as frameshift mutations. In long mononucleotide runs, most frameshift intermediates are repaired by the postreplicative mismatch repair (MMR) machinery, rather than by the exonucleolytic proofreading activity of DNA polymerase. Although mononucleotide runs are hotspots for polymerase slippage events, it is not known whether the composition of a run and the surrounding context affect the frequency of slippage or the efficiency of MMR. To address these issues, 10-nucleotide (10N) runs were inserted into the yeast LYS2 gene to create +1 frameshift alleles. Slippage events within these runs were detected as Lys(+) revertants. 10G or 10C runs were found to be more unstable than 10A or 10T runs, but neither the frequency of polymerase slippage nor the overall efficiency of MMR was greatly influenced by sequence context. Although complete elimination of MMR activity (msh2 mutants) affected all runs similarly, analyses of reversion rates in msh3 and msh6 mutants revealed distinct specificities of the yeast Msh2p-Msh3p and Msh2p-Msh6p mismatch binding complexes in the repair of frameshift intermediates in different sequence contexts. PMID:11014807

  18. DNA sequence analysis of the composite plasmid pTC conferring virulence and antimicrobial resistance for porcine enterotoxigenic Escherichia coli.

    PubMed

    Fekete, Péter Z; Brzuszkiewicz, Elzbieta; Blum-Oehler, Gabriele; Olasz, Ferenc; Szabó, Mónika; Gottschalk, Gerhard; Hacker, Jörg; Nagy, Béla

    2012-01-01

    In this study the plasmid pTC, a 90 kb self-conjugative virulence plasmid of the porcine enterotoxigenic Escherichia coli (ETEC) strain EC2173 encoding the STa and STb heat-stable enterotoxins and tetracycline resistance, has been sequenced in two steps. As a result we identified five main distinct regions of pTC: (i) the maintenance region responsible for the extreme stability of the plasmid, (ii) the TSL (toxin-specific locus comprising the estA and estB genes) which is unique and characteristic for pTC, (iii) a Tn10 transposon, encoding tetracycline resistance, (iv) the tra (plasmid transfer) region, and (v) the colE1-like origin of replication. It is concluded that pTC is a self-transmissible composite plasmid harbouring antibiotic resistance and virulence genes. pTC belongs to a group of large conjugative E. coli plasmids represented by NR1 with a widespread tra backbone which might have evolved from a common ancestor. This is the first report of a completely sequenced animal ETEC virulence plasmid containing an antimicrobial resistance locus, thereby representing a selection advantage for spread of pathogenicity in the presence of antimicrobials leading to increased disease potential. Copyright © 2011. Published by Elsevier GmbH.

  19. Bacterial community compositions of coking wastewater treatment plants in steel industry revealed by Illumina high-throughput sequencing.

    PubMed

    Ma, Qiao; Qu, Yuanyuan; Shen, Wenli; Zhang, Zhaojing; Wang, Jingwei; Liu, Ziyan; Li, Duanxing; Li, Huijie; Zhou, Jiti

    2015-03-01

    In this study, Illumina high-throughput sequencing was used to reveal the community structures of nine coking wastewater treatment plants (CWWTPs) in China for the first time. The sludge systems exhibited a similar community composition at each taxonomic level. Compared to previous studies, some of the core genera in municipal wastewater treatment plants such as Zoogloea, Prosthecobacter and Gp6 were detected as minor species. Thiobacillus (20.83%), Comamonas (6.58%), Thauera (4.02%), Azoarcus (7.78%) and Rhodoplanes (1.42%) were the dominant genera shared by at least six CWWTPs. The percentages of autotrophic ammonia-oxidizing bacteria and nitrite-oxidizing bacteria were unexpectedly low, which were verified by both real-time PCR and fluorescence in situ hybridization analyses. Hierarchical clustering and canonical correspondence analysis indicated that operation mode, flow rate and temperature might be the key factors in community formation. This study provides new insights into our understanding of microbial community compositions and structures of CWWTPs.

  20. Hemicyanine LB film—Silver nanoparticle composite: contrasting fluorescence responses sensitive to the ultrathin film assembly sequence

    NASA Astrophysics Data System (ADS)

    Maganti, Lasya; Dwivedi, Itisha; Jose, Anju; Radhakrishnan, T. P.

    2017-07-01

    Fluorescence emission of molecules is strongly influenced by the plasmonic field of metal nanoparticles, with significant enhancement induced under optimal conditions. Nanocomposite ultrathin films fabricated with citrate-stabilized Ag nanoparticles and LB film of a cationic hemicyanine amphiphile, are shown to produce opposing fluorescence emission trends upon subtle variation in the assembly sequence. Monolayer LB films of the pure amphiphile show aggregation-induced quenching with increasing deposition pressure. Composite films formed by adsorption of Ag nanoparticles on the Langmuir film (self-assembly together with steered assembly) followed by LB transfer, show further quenching. However, adsorption of Ag nanoparticles on the pre-formed amphiphile LB film (self-assembly following steered assembly), causes the fluorescence to increase with the extent of adsorption. Spectroscopy and microscopy provide insight into the contrasting, tunable emission. Formation of Ag nanoparticle chains on the Langmuir film and their direct contact with the monolayer cause the fluorescence quenching; adsorption of isolated Ag nanoparticles on the LB film along with multilayer formation leads to the enhancement. The study illustrates the versatility of LB film—metal nanoparticle composites in producing distinct materials responses through subtle changes in the mode of assembly.

  1. Identification of protein N-termini in Cyanophora paradoxa cyanelles: transit peptide composition and sequence determinants for precursor maturation

    PubMed Central

    Köhler, Daniel; Dobritzsch, Dirk; Hoehenwarter, Wolfgang; Helm, Stefan; Steiner, Jürgen M.; Baginsky, Sacha

    2015-01-01

    Glaucophyta, rhodophyta, and chloroplastida represent the three main evolutionary lineages that diverged from a common ancestor after primary endosymbiosis. Comparative analyses between members of these three lineages are a rich source of information on ancestral plastid features. We analyzed the composition and the cleavage site of cyanelle transit peptides from the glaucophyte Cyanophora paradoxa by terminal amine labeling of substrates (TAILS), and compared their characteristics to those of representatives of the chloroplastida. Our data show that transit peptide architecture is similar between members of these two lineages. This entails a comparable modular structure, an overrepresentation of serine or alanine and similarities in the amino acid composition around the processing peptidase cleavage site. The most distinctive difference is the overrepresentation of phenylalanine in the N-terminal 1–10 amino acids of cyanelle transit peptides. A quantitative proteome analysis with periplasm-free cyanelles identified 42 out of 262 proteins without the N-terminal phenylalanine, suggesting that the requirement for phenylalanine in the N-terminal region is not absolute. Proteins in this set are on average of low abundance, suggesting that either alternative import pathways are operating specifically for low abundance proteins or that the gene model annotation is incorrect for proteins with fewer EST sequences. We discuss these two possibilities and provide examples for both interpretations. PMID:26257763

  2. Modelling the Strength and Fatigue Life of a Unidirectional Fibrous Composite by Using Daniels' Sequence and Markov Chains

    NASA Astrophysics Data System (ADS)

    Paramonov, Yu.; Cimanis, V.; Varickis, S.; Kleinhofs, M.

    2013-11-01

    A review of the previous works of the authors dedicated to the use of Daniels' sequence (DS) for analyzing the relation between the distribution of the static strength of components of a unidirectional fibrous composite (UFC) and the distribution of its fatigue life is presented. A generalization of the DS which can be used to analyze the association of distribution of the static strength of composite components with distribution of the static strength of the UFC itself is given. In analyzing the fatigue life of a UFC, unlike in Daniels' model, the loading rate and randomness of the number of still workable components in the weak microvolume in which the destruction process takes place are taken into account. By analyzing the fatigue life, it is possible to explain the existence of the random fatigue strength and to calculate the maximum load at which the probability of absence of fatigue failure is great enough when the number of cycles of fatigue loading tends to infinity. Numerical examples of processing of experimental data are presented, and estimates for parameters of the corresponding nonlinear regression model, which can be interpreted as the strength parameters of UFC, are obtained.

  3. Subcellular location prediction of proteins using support vector machines with alignment of block sequences utilizing amino acid composition.

    PubMed

    Tamura, Takeyuki; Akutsu, Tatsuya

    2007-11-30

    Subcellular location prediction of proteins is an important and well-studied problem in bioinformatics. This is a problem of predicting which part in a cell a given protein is transported to, where an amino acid sequence of the protein is given as an input. This problem is becoming more important since information on subcellular location is helpful for annotation of proteins and genes and the number of complete genomes is rapidly increasing. Since existing predictors are based on various heuristics, it is important to develop a simple method with high prediction accuracies. In this paper, we propose a novel and general predicting method by combining techniques for sequence alignment and feature vectors based on amino acid composition. We implemented this method with support vector machines on plant data sets extracted from the TargetP database. Through fivefold cross validation tests, the obtained overall accuracies and average MCC were 0.9096 and 0.8655 respectively. We also applied our method to other datasets including that of WoLF PSORT. Although there is a predictor which uses the information of gene ontology and yields higher accuracy than ours, our accuracies are higher than existing predictors which use only sequence information. Since such information as gene ontology can be obtained only for known proteins, our predictor is considered to be useful for subcellular location prediction of newly-discovered proteins. Furthermore, the idea of combination of alignment and amino acid frequency is novel and general so that it may be applied to other problems in bioinformatics. Our method for plant is also implemented as a web-system and available on http://sunflower.kuicr.kyoto-u.ac.jp/~tamura/slpfa.html.

  4. Sequence-based analysis of the bacterial and fungal compositions of multiple kombucha (tea fungus) samples.

    PubMed

    Marsh, Alan J; O'Sullivan, Orla; Hill, Colin; Ross, R Paul; Cotter, Paul D

    2014-04-01

    Kombucha is a sweetened tea beverage that, as a consequence of fermentation, contains ethanol, carbon dioxide, a high concentration of acid (gluconic, acetic and lactic) as well as a number of other metabolites and is thought to contain a number of health-promoting components. The sucrose-tea solution is fermented by a symbiosis of bacteria and yeast embedded within a cellulosic pellicle, which forms a floating mat in the tea, and generates a new layer with each successful fermentation. The specific identity of the microbial populations present has been the focus of attention but, to date, the majority of studies have relied on culture-based analyses. To gain a more comprehensive insight into the kombucha microbiota we have carried out the first culture-independent, high-throughput sequencing analysis of the bacterial and fungal populations of 5 distinct pellicles as well as the resultant fermented kombucha at two time points. Following the analysis it was established that the major bacterial genus present was Gluconacetobacter, present at >85% in most samples, with only trace populations of Acetobacter detected (<2%). A prominent Lactobacillus population was also identified (up to 30%), with a number of sub-dominant genera, not previously associated with kombucha, also being revealed. The yeast populations were found to be dominated by Zygosaccharomyces at >95% in the fermented beverage, with a greater fungal diversity present in the cellulosic pellicle, including numerous species not identified in kombucha previously. Ultimately, this study represents the most accurate description of the microbiology of kombucha to date. Copyright © 2013 Elsevier Ltd. All rights reserved.

  5. DNA sequence mapping by fluorescence in situ hybridization

    SciTech Connect

    Brandriff, B.F.; Gordon, L.A.; Trask, B.J. )

    1991-01-01

    Various types of DNA probes, such as total genomic DNA, repetitive sequences, unique sequences, and composites of chromosome-specific DNA probes, can be used with fluorescence in situ hybridization (FISH) techniques to address research questions having to do with localization, mapping, and distribution of DNA in situ. FISH involves the formation of a heteroduplex between such DNA probes and chromatin targets on a microscope slide, which can be visualized with fluorescent reporter molecules. Three chromatin targets - metaphase chromosomes, somatic interphases, and zygote interphases - offer increasingly extended states of chromatin which can be strategically selected, individually or in combination, to address specific research questions of interest.

  6. Biosynthesis and characterization of a non-repetitive polypeptide derived from silk fibroin heavy chain.

    PubMed

    Yang, Gaoqiang; Wu, Mingyang; Yi, Honggen; Wang, Jiannan

    2016-02-01

    Silk fibroin heavy chain is the major protein component of Bombyx mori silk fibroin and is composed of 12 repetitive and 11 non-repetitive regions, with the non-repetitive domain consisting of a hydrophilic polypeptide chain. In order to determine the biomedical function of the non-repetitive domain or potentially use it to modify hydrophobic biomaterials, high-purity isolation is necessary. Previously, we cloned and extended a gene motif (f(1)) encoding the non-repetitive domain. Here, this motif and its multimers are inserted into a glutathione S-transferase (GST)-tagged fusion-protein expression vector. Motif f(1) and multimers f(4) and f(8) were expressed in Escherichia coli BL21 cells following isopropyl β-D-1-thiogalactopyranoside induction, purified by GST-affinity chromatography, and single bands of purified fusion proteins GST-F(1), GST-F(4), and GST-F(8), were visualized by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. Target polypeptides F(1), F(4), and F(8), were cleaved clearly from the GST-fusion tag following thrombin digestion. Mass spectrometry results indicate that the molecular weights associated with fusion proteins GST-F(1), GST-F(4), and GST-F(8) are 31.5, 43.8, and 59.0kDa, respectively, and with the cleaved polypeptides F(1), F(4), and F(8) are 4.8, 16.8, and 32.8kDa, respectively. The F(1), F(4), and F(8) polypeptide chains are negatively charged with isoelectric points (pI) of 3.3, 3.2, and 3.0, respectively. The molecular weight and pI values of the polypeptide chains are consistent with the predicted values and the amino acid compositions similar to predicted sequences. FTIR and CD results show the molecular conformation of F(1) was mainly random coil, and more stable α-helix structure formed in longer molecular chain.

  7. Hemispheric Asymmetries in Repetition Enhancement and Suppression Effects in the Newborn Brain

    PubMed Central

    Bouchon, Camillia; Nazzi, Thierry; Gervain, Judit

    2015-01-01

    Background The repeated presentation of stimuli typically attenuates neural responses (repetition suppression) or, less commonly, increases them (repetition enhancement) when stimuli are highly complex, degraded or presented under noisy conditions. In adult functional neuroimaging research, these repetition effects are considered as neural correlates of habituation. The development and respective functional significance of these effects in infancy remain largely unknown. Objective This study investigates repetition effects in newborns using functional near-infrared spectroscopy, and specifically the role of stimulus complexity in evoking a repetition enhancement vs. a repetition suppression response, following up on Gervain et al. (2008). In that study, abstract rule-learning was found at birth in cortical areas specific to speech processing, as evidenced by a left-lateralized repetition enhancement of the hemodynamic response to highly variable speech sequences conforming to a repetition-based ABB artificial grammar, but not to a random ABC grammar. Methods Here, the same paradigm was used to investigate how simpler stimuli (12 different sequences per condition as opposed to 140), and simpler presentation conditions (blocked rather than interleaved) would influence repetition effects at birth. Results Results revealed that the two grammars elicited different dynamics in the two hemispheres. In left fronto-temporal areas, we reproduce the early perceptual discrimination of the two grammars, with ABB giving rise to a greater response at the beginning of the experiment than ABC. In addition, the ABC grammar evoked a repetition enhancement effect over time, whereas a stable response was found for the ABB grammar. Right fronto-temporal areas showed neither initial discrimination, nor change over time to either pattern. Conclusion Taken together with Gervain et al. (2008), this is the first evidence that manipulating methodological factors influences the presence or

  8. Full-Length Venom Protein cDNA Sequences from Venom-Derived mRNA: Exploring Compositional Variation and Adaptive Multigene Evolution.

    PubMed

    Modahl, Cassandra M; Mackessy, Stephen P

    2016-06-01

    Envenomation of humans by snakes is a complex and continuously evolving medical emergency, and treatment is made that much more difficult by the diverse biochemical composition of many venoms. Venomous snakes and their venoms also provide models for the study of molecular evolutionary processes leading to adaptation and genotype-phenotype relationships. To compare venom complexity and protein sequences, venom gland transcriptomes are assembled, which usually requires the sacrifice of snakes for tissue. However, toxin transcripts are also present in venoms, offering the possibility of obtaining cDNA sequences directly from venom. This study provides evidence that unknown full-length venom protein transcripts can be obtained from the venoms of multiple species from all major venomous snake families. These unknown venom protein cDNAs are obtained by the use of primers designed from conserved signal peptide sequences within each venom protein superfamily. This technique was used to assemble a partial venom gland transcriptome for the Middle American Rattlesnake (Crotalus simus tzabcan) by amplifying sequences for phospholipases A2, serine proteases, C-lectins, and metalloproteinases from within venom. Phospholipase A2 sequences were also recovered from the venoms of several rattlesnakes and an elapid snake (Pseudechis porphyriacus), and three-finger toxin sequences were recovered from multiple rear-fanged snake species, demonstrating that the three major clades of advanced snakes (Elapidae, Viperidae, Colubridae) have stable mRNA present in their venoms. These cDNA sequences from venom were then used to explore potential activities derived from protein sequence similarities and evolutionary histories within these large multigene superfamilies. Venom-derived sequences can also be used to aid in characterizing venoms that lack proteomic profiles and identify sequence characteristics indicating specific envenomation profiles. This approach, requiring only venom, provides

  9. Full-Length Venom Protein cDNA Sequences from Venom-Derived mRNA: Exploring Compositional Variation and Adaptive Multigene Evolution

    PubMed Central

    Modahl, Cassandra M.; Mackessy, Stephen P.

    2016-01-01

    Envenomation of humans by snakes is a complex and continuously evolving medical emergency, and treatment is made that much more difficult by the diverse biochemical composition of many venoms. Venomous snakes and their venoms also provide models for the study of molecular evolutionary processes leading to adaptation and genotype-phenotype relationships. To compare venom complexity and protein sequences, venom gland transcriptomes are assembled, which usually requires the sacrifice of snakes for tissue. However, toxin transcripts are also present in venoms, offering the possibility of obtaining cDNA sequences directly from venom. This study provides evidence that unknown full-length venom protein transcripts can be obtained from the venoms of multiple species from all major venomous snake families. These unknown venom protein cDNAs are obtained by the use of primers designed from conserved signal peptide sequences within each venom protein superfamily. This technique was used to assemble a partial venom gland transcriptome for the Middle American Rattlesnake (Crotalus simus tzabcan) by amplifying sequences for phospholipases A2, serine proteases, C-lectins, and metalloproteinases from within venom. Phospholipase A2 sequences were also recovered from the venoms of several rattlesnakes and an elapid snake (Pseudechis porphyriacus), and three-finger toxin sequences were recovered from multiple rear-fanged snake species, demonstrating that the three major clades of advanced snakes (Elapidae, Viperidae, Colubridae) have stable mRNA present in their venoms. These cDNA sequences from venom were then used to explore potential activities derived from protein sequence similarities and evolutionary histories within these large multigene superfamilies. Venom-derived sequences can also be used to aid in characterizing venoms that lack proteomic profiles and identify sequence characteristics indicating specific envenomation profiles. This approach, requiring only venom, provides

  10. Species composition of the genus Saprolegnia in fin fish aquaculture environments, as determined by nucleotide sequence analysis of the nuclear rDNA ITS regions.

    PubMed

    de la Bastide, Paul Y; Leung, Wai Lam; Hintz, William E

    2015-01-01

    The ITS region of the rDNA gene was compared for Saprolegnia spp. in order to improve our understanding of nucleotide sequence variability within and between species of this genus, determine species composition in Canadian fin fish aquaculture facilities, and to assess the utility of ITS sequence variability in genetic marker development. From a collection of more than 400 field isolates, ITS region nucleotide sequences were studied and it was determined that there was sufficient consistent inter-specific variation to support the designation of species identity based on ITS sequence data. This non-subjective approach to species identification does not rely upon transient morphological features. Phylogenetic analyses comparing our ITS sequences and species designations with data from previous studies generally supported the clade scheme of Diéguez-Uribeondo et al. (2007) and found agreement with the molecular taxonomic cluster system of Sandoval-Sierra et al. (2014). Our Canadian ITS sequence collection will thus contribute to the public database and assist the clarification of Saprolegnia spp. taxonomy. The analysis of ITS region sequence variability facilitated genus- and species-level identification of unknown samples from aquaculture facilities and provided useful information on species composition. A unique ITS-RFLP for the identification of S. parasitica was also described.

  11. The Role of Memory Processes in Repetition Blindness

    NASA Technical Reports Server (NTRS)

    Johnston, James C.; Hochhaus, Larry; Null, Cynthia H. (Technical Monitor)

    1995-01-01

    We investigated whether Repetition Blindness (RB) in processing RSVP strings depends critically on memory demands. When all items in the sequence had to be reported, strong RB was found. When only the 2 critical items (cued by color) had to be reported, no RB was found. Preliminary results show that imposing a separate memory load, while reporting only the critical items, also produces little RB. Implications for the processing locus of RB will be discussed.

  12. The Role of Memory Processes in Repetition Blindness

    NASA Technical Reports Server (NTRS)

    Johnston, James C.; Hochhaus, Larry; Null, Cynthia H. (Technical Monitor)

    1995-01-01

    We investigated whether Repetition Blindness (RB) in processing RSVP strings depends critically on memory demands. When all items in the sequence had to be reported, strong RB was found. When only the 2 critical items (cued by color) had to be reported, no RB was found. Preliminary results show that imposing a separate memory load, while reporting only the critical items, also produces little RB. Implications for the processing locus of RB will be discussed.

  13. High-throughput sequencing technology to reveal the composition and function of cecal microbiota in Dagu chicken.

    PubMed

    Xu, Yunhe; Yang, Huixin; Zhang, Lili; Su, Yuhong; Shi, Donghui; Xiao, Haidi; Tian, Yumin

    2016-11-04

    The chicken gut microbiota is an important and complicated ecosystem for the host. They play an important role in converting food into nutrient and energy. The coding capacity of microbiome vastly surpasses that of the host's genome, encoding biochemical pathways that the host has not developed. An optimal gut microbiota can increase agricultural productivity. This study aims to explore the composition and function of cecal microbiota in Dagu chicken under two feeding modes, free-range (outdoor, OD) and cage (indoor, ID) raising. Cecal samples were collected from 24 chickens across 4 groups (12-w OD, 12-w ID, 18-w OD, and 18-w ID). We performed high-throughput sequencing of the 16S rRNA genes V4 hypervariable regions to characterize the cecal microbiota of Dagu chicken and compare the difference of cecal microbiota between free-range and cage raising chickens. It was found that 34 special operational taxonomic units (OTUs) in OD groups and 4 special OTUs in ID groups. 24 phyla were shared by the 24 samples. Bacteroidetes was the most abundant phylum with the largest proportion, followed by Firmicutes and Proteobacteria. The OD groups showed a higher proportion of Bacteroidetes (>50 %) in cecum, but a lower Firmicutes/Bacteroidetes ratio in both 12-w old (0.42, 0.62) and 18-w old groups (0.37, 0.49) compared with the ID groups. Cecal microbiota in the OD groups have higher abundance of functions involved in amino acids and glycan metabolic pathway. The composition and function of cecal microbiota in Dagu chicken under two feeding modes, free-range and cage raising are different. The cage raising mode showed a lower proportion of Bacteroidetes in cecum, but a higher Firmicutes/Bacteroidetes ratio compared with free-range mode. Cecal microbiota in free-range mode have higher abundance of functions involved in amino acids and glycan metabolic pathway.

  14. A computational tool for the genomic identification of regions of unusual compositional properties and its utilization in the detection of horizontally transferred sequences.

    PubMed

    Putonti, Catherine; Luo, Yi; Katili, Charles; Chumakov, Sergey; Fox, George E; Graur, Dan; Fofanov, Yuriy

    2006-10-01

    Similarity Plot (S-plot) is a Windows-based application for large-scale comparisons and 2-dimensional visualization of compositional similarities between genomic sequences. This application combines 2 approaches widely used in genomics: window analysis of statistical characteristics along genomes and dot-plot visual representation. S-plot is effective in identifying highly similar regions between genomes as well as regions with unusual compositional properties (RUCPs) within a single genome, which may be indicative of horizontal gene transfer or of locus-specific selective forces. We use S-plot to identify regions that may have originated through horizontal gene transfer through a 2-step approach, by first comparing a genomic sequence to itself and, subsequently, comparing it to the genomic sequence of a closely related taxon. Moreover, by comparing these suspect sequences to one another, we can estimate a minimum number of sources for these putative xenologous sequences. We illustrate the uses of S-plot in a comparison involving Escherichia coli K12 and E. coli O157:H7. In O157:H7, we found 145 regions that have most probably originated through horizontal gene transfer. By using S-plot to compare each of these regions with 277 completely sequenced prokaryotic genomes, 1 sequence was found to have similar compositional properties to the Yersinia pseudotuberculosis genome, indicating a transfer from a Yersinia or Yersinia relative. Based upon our analysis of RUCPs in O157:H7, we infer that there were at least 53 sources of horizontally transferred sequences.

  15. Circuit considerations for repetitive railguns

    SciTech Connect

    Honih, E.M.

    1986-01-01

    Railgun electromagnetic launchers have significant military and scientific potential. They provide direct conversion of electrical energy to projectile kinetic energy, and they offer the hope of achieving projectile velocities greatly exceeding the limits of conventional guns. With over 10 km/sec already demonstrated, railguns are attracting attention for tactical and strategic weapons systems and for scientific equation-of-state research. The full utilization of railguns will require significant improvements in every aspect of system design - projectile, barrel, and power source - to achieve operation on a large scale. This paper will review fundamental aspects of railguns, with emphasis on circuit considerations and repetitive operation.

  16. Evolution of the structure and composition of house mouse satellite DNA sequences in the subgenus Mus (Rodentia: Muridea): a cytogenomic approach.

    PubMed

    Cazaux, B; Catalan, J; Justy, F; Escudé, C; Desmarais, E; Britton-Davidian, J

    2013-06-01

    The composition and orientation of the house mouse satellite DNA sequences (minor, major, TLC) were investigated by a FISH and CO-FISH approach in 11 taxa belonging to three clades of the subgenus Mus. Using a phylogenetic framework, our results highlighted two distribution patterns. The TLC satellite, the most recently discovered satellite, was present in all clades but varied quantitatively among species. This distribution supported its appearance in the ancestor of the subgenus followed by independent evolution in species of each clade. In contrast, the minor and major satellites occurred in only two clades of the subgenus indicating the simultaneous and recent amplification of these sequences. In addition, although qualitative differences in the composition and orientation of the satellite sequences were observed among the taxa, none of the features studied were unique to the house mouse and could account for the extensive chromosomal plasticity evidenced in Mus musculus domesticus.

  17. Influence of recirculation on the performance of anaerobic sequencing batch biofilm reactor (AnSBBR) treating hypersaline composite chemical wastewater.

    PubMed

    Mohan, S Venkata; Lalit Babu, V; Vijaya Bhaskar, Y; Sarma, P N

    2007-05-01

    Influence of recirculation on the performance of anaerobic sequencing batch biofilm reactor (AnSBBR) was studied in the process of treating hypersaline (total dissolved inorganic solids (TDIS) approximately 26 g/l) and low biodegradable (BOD/COD approximately 0.3) composite chemical wastewater. Significant enhancement in the substrate removal efficiency and biogas yield was observed after introducing the recirculation to the system. Maximum efficiency (COD removal efficiency - 51%; SDR - 3.14 kg COD/cum-day) was observed at recirculation to feed (R/F) ratio of 2 (OLR - 6.15 kg C OD/cum-day; HLR - 2.30 cum (liquid)/cum day; UFV(A) - 0.023 m/h). Subsequent increase of R/F to 3 (OLR - 6.15 kg COD/cum-day; HLR - 3.07cum (liquid)/cum-day; UFV(A) - 0.035 m/h) resulted in reduction in COD removal efficiency (32%; SDR - 1.97 kg COD/cum-day). The enhanced performance of the system due to the introduction of recirculation was attributed to the improvement in the mass transfer between the substrate present in the bulk liquid and the attached biofilm. The hydrodynamic behavior due to recirculation mode of operation reduced the concentration gradient (substrate inhibition) of substrate and reaction by-products (VFA) resulting in mixed flow conditions.

  18. Lncident: A Tool for Rapid Identification of Long Noncoding RNAs Utilizing Sequence Intrinsic Composition and Open Reading Frame Information

    PubMed Central

    Liang, Yanchun

    2016-01-01

    More and more studies have demonstrated that long noncoding RNAs (lncRNAs) play critical roles in diversity of biological process and are also associated with various types of disease. How to rapidly identify lncRNAs and messenger RNA is the fundamental step to uncover the function of lncRNAs identification. Here, we present a novel method for rapid identification of lncRNAs utilizing sequence intrinsic composition features and open reading frame information based on support vector machine model, named as Lncident (LncRNAs identification). The 10-fold cross-validation and ROC curve are used to evaluate the performance of Lncident. The main advantage of Lncident is high speed without the loss of accuracy. Compared with the exiting popular tools, Lncident outperforms Coding-Potential Calculator, Coding-Potential Assessment Tool, Coding-Noncoding Index, and PLEK. Lncident is also much faster than Coding-Potential Calculator and Coding-Noncoding Index. Lncident presents an outstanding performance on microorganism, which offers a great application prospect to the analysis of microorganism. In addition, Lncident can be trained by users' own collected data. Furthermore, R package and web server are simultaneously developed in order to maximize the convenience for the users. The R package “Lncident” can be easily installed on multiple operating system platforms, as long as R is supported. PMID:28116287

  19. The mitochondrial genomes of sponges provide evidence for multiple invasions by Repetitive Hairpin-forming Elements (RHE)

    PubMed Central

    2009-01-01

    Background The mitochondrial (mt) genomes of sponges possess a variety of features, which appear to be intermediate between those of Eumetazoa and non-metazoan opisthokonts. Among these features is the presence of long intergenic regions, which are common in other eukaryotes, but generally absent in Eumetazoa. Here we analyse poriferan mitochondrial intergenic regions, paying particular attention to repetitive sequences within them. In this context we introduce the mitochondrial genome of Ircinia strobilina (Lamarck, 1816; Demospongiae: Dictyoceratida) and compare it with mtDNA of other sponges. Results Mt genomes of dictyoceratid sponges are identical in gene order and content but display major differences in size and organization of intergenic regions. An even higher degree of diversity in the structure of intergenic regions was found among different orders of demosponges. One interesting observation made from such comparisons was of what appears to be recurrent invasions of sponge mitochondrial genomes by repetitive hairpin-forming elements, which cause large genome size differences even among closely related taxa. These repetitive hairpin-forming elements are structurally and compositionally divergent and display a scattered distribution throughout various groups of demosponges. Conclusion Large intergenic regions of poriferan mt genomes are targets for insertions of repetitive hairpin- forming elements, similar to the ones found in non-metazoan opisthokonts. Such elements were likely present in some lineages early in animal mitochondrial genome evolution but were subsequently lost during the reduction of intergenic regions, which occurred in the Eumetazoa lineage after the split of Porifera. Porifera acquired their elements in several independent events. Patterns of their intra-genomic dispersal can be seen in the mt genome of Vaceletia sp. PMID:20003196

  20. Neuroimaging in repetitive brain trauma.

    PubMed

    Ng, Thomas Sc; Lin, Alexander P; Koerte, Inga K; Pasternak, Ofer; Liao, Huijun; Merugumala, Sai; Bouix, Sylvain; Shenton, Martha E

    2014-01-01

    Sports-related concussions are one of the major causes of mild traumatic brain injury. Although most patients recover completely within days to weeks, those who experience repetitive brain trauma (RBT) may be at risk for developing a condition known as chronic traumatic encephalopathy (CTE). While this condition is most commonly observed in athletes who experience repetitive concussive and/or subconcussive blows to the head, such as boxers, football players, or hockey players, CTE may also affect soldiers on active duty. Currently, the only means by which to diagnose CTE is by the presence of phosphorylated tau aggregations post-mortem. Non-invasive neuroimaging, however, may allow early diagnosis as well as improve our understanding of the underlying pathophysiology of RBT. The purpose of this article is to review advanced neuroimaging methods used to investigate RBT, including diffusion tensor imaging, magnetic resonance spectroscopy, functional magnetic resonance imaging, susceptibility weighted imaging, and positron emission tomography. While there is a considerable literature using these methods in brain injury in general, the focus of this review is on RBT and those subject populations currently known to be susceptible to RBT, namely athletes and soldiers. Further, while direct detection of CTE in vivo has not yet been achieved, all of the methods described in this review provide insight into RBT and will likely lead to a better characterization (diagnosis), in vivo, of CTE than measures of self-report.

  1. Neuroimaging in repetitive brain trauma

    PubMed Central

    2014-01-01

    Sports-related concussions are one of the major causes of mild traumatic brain injury. Although most patients recover completely within days to weeks, those who experience repetitive brain trauma (RBT) may be at risk for developing a condition known as chronic traumatic encephalopathy (CTE). While this condition is most commonly observed in athletes who experience repetitive concussive and/or subconcussive blows to the head, such as boxers, football players, or hockey players, CTE may also affect soldiers on active duty. Currently, the only means by which to diagnose CTE is by the presence of phosphorylated tau aggregations post-mortem. Non-invasive neuroimaging, however, may allow early diagnosis as well as improve our understanding of the underlying pathophysiology of RBT. The purpose of this article is to review advanced neuroimaging methods used to investigate RBT, including diffusion tensor imaging, magnetic resonance spectroscopy, functional magnetic resonance imaging, susceptibility weighted imaging, and positron emission tomography. While there is a considerable literature using these methods in brain injury in general, the focus of this review is on RBT and those subject populations currently known to be susceptible to RBT, namely athletes and soldiers. Further, while direct detection of CTE in vivo has not yet been achieved, all of the methods described in this review provide insight into RBT and will likely lead to a better characterization (diagnosis), in vivo, of CTE than measures of self-report. PMID:25031630

  2. Rearrangement of repeated DNA sequences during development of macronucleus in Tetrahymena thermophila.

    PubMed Central

    Iwamura, Y; Sakai, M; Muramatsu, M

    1982-01-01

    Three clones of non-repetitive sequences and six clones containing repetitive sequences were obtained from micronuclear DNA of Tetrahymena thermophila. All the non-repetitive and three repetitive sequences had the same organization in micro- and macronuclear DNAs as revealed by blot hybridization. On the other hand, the remaining three clones with repetitive sequences had apparently different organization in the two nuclear DNAs. All these repetitive sequences showed a smear on the blot in addition to a number of discrete bands when micronuclear DNA was digested with EcoR I. In macronuclear DNAs, these sequences invariably became one or two bands and the smear disappeared. We conclude that, when a macronucleus develops from a micronucleus, the non-repetitive sequences amplify by more than 20 times with relatively few rearrangement, whereas some selected portions of repeated and/or repeat-contiguous sequences are amplified with rather extensive reorganization. Images PMID:6289270

  3. Use of Repetitive Element Palindromic-PCR (rep-PCR) for the Epidemiologic Discrimination of Food-Borne Pathogens

    USDA-ARS?s Scientific Manuscript database

    The use of defined primers for polymerase chain reactions (PCR) amplicifcations of interspersed repetitive DNA elements present at distinct locations in prokaryotic genomes is referred to as Repetitive Element Palindromic Sequences Based-Polymerase Chain Reactions, rep-PCR. The initial discovery of...

  4. The Development of Long-Term Lexical Representations through Hebb Repetition Learning

    ERIC Educational Resources Information Center

    Szmalec, Arnaud; Page, Mike P. A.; Duyck, Wouter

    2012-01-01

    This study clarifies the involvement of short- and long-term memory in novel word-form learning, using the Hebb repetition paradigm. In Experiment 1, participants recalled sequences of visually presented syllables (e.g., "la"-"va"-"bu"-"sa"-"fa"-"ra"-"re"-"si"-"di"), with one particular (Hebb) sequence repeated on every third trial. Crucially,…

  5. The Effect of N-3 on N-2 Repetition Costs in Task Switching

    ERIC Educational Resources Information Center

    Schuch, Stefanie; Grange, James A.

    2015-01-01

    N-2 task repetition cost is a response time and error cost returning to a task recently performed after one intervening trial (i.e., an ABA task sequence) compared with returning to a task not recently performed (i.e., a CBA task sequence). This cost is considered a robust measure of inhibitory control during task switching. The present article…

  6. Stimulus-Category and Response-Repetition Effects in Task Switching: An Evaluation of Four Explanations

    ERIC Educational Resources Information Center

    Druey, Michel D.

    2014-01-01

    In many task-switch studies, task sequence and response sequence interact: Response repetitions produce benefits when the task repeats but produce costs when the task switches. Four different theoretical frameworks have been proposed to explain these effects: a reconfiguration-based account, association-learning models, an episodic-retrieval…

  7. Stimulus-Category and Response-Repetition Effects in Task Switching: An Evaluation of Four Explanations

    ERIC Educational Resources Information Center

    Druey, Michel D.

    2014-01-01

    In many task-switch studies, task sequence and response sequence interact: Response repetitions produce benefits when the task repeats but produce costs when the task switches. Four different theoretical frameworks have been proposed to explain these effects: a reconfiguration-based account, association-learning models, an episodic-retrieval…

  8. The Development of Long-Term Lexical Representations through Hebb Repetition Learning

    ERIC Educational Resources Information Center

    Szmalec, Arnaud; Page, Mike P. A.; Duyck, Wouter

    2012-01-01

    This study clarifies the involvement of short- and long-term memory in novel word-form learning, using the Hebb repetition paradigm. In Experiment 1, participants recalled sequences of visually presented syllables (e.g., "la"-"va"-"bu"-"sa"-"fa"-"ra"-"re"-"si"-"di"), with one particular (Hebb) sequence repeated on every third trial. Crucially,…

  9. The Effect of N-3 on N-2 Repetition Costs in Task Switching

    ERIC Educational Resources Information Center

    Schuch, Stefanie; Grange, James A.

    2015-01-01

    N-2 task repetition cost is a response time and error cost returning to a task recently performed after one intervening trial (i.e., an ABA task sequence) compared with returning to a task not recently performed (i.e., a CBA task sequence). This cost is considered a robust measure of inhibitory control during task switching. The present article…

  10. Palindromic repetitive DNA elements with coding potential in Methanocaldococcus jannaschii.

    PubMed

    Suyama, Mikita; Lathe, Warren C; Bork, Peer

    2005-10-10

    We have identified 141 novel palindromic repetitive elements in the genome of euryarchaeon Methanocaldococcus jannaschii. The total length of these elements is 14.3kb, which corresponds to 0.9% of the total genomic sequence and 6.3% of all extragenic regions. The elements can be divided into three groups (MJRE1-3) based on the sequence similarity. The low sequence identity within each of the groups suggests rather old origin of these elements in M. jannaschii. Three MJRE2 elements were located within the protein coding regions without disrupting the coding potential of the host genes, indicating that insertion of repeats might be a widespread mechanism to enhance sequence diversity in coding regions.

  11. Sequencing-based analysis of the bacterial and fungal composition of kefir grains and milks from multiple sources.

    PubMed

    Marsh, Alan J; O'Sullivan, Orla; Hill, Colin; Ross, R Paul; Cotter, Paul D

    2013-01-01

    Kefir is a fermented milk-based beverage to which a number of health-promoting properties have been attributed. The microbes responsible for the fermentation of milk to produce kefir consist of a complex association of bacteria and yeasts, bound within a polysaccharide matrix, known as the kefir grain. The consistency of this microbial population, and that present in the resultant beverage, has been the subject of a number of previous, almost exclusively culture-based, studies which have indicated differences depending on geographical location and culture conditions. However, culture-based identification studies are limited by virtue of only detecting species with the ability to grow on the specific medium used and thus culture-independent, molecular-based techniques offer the potential for a more comprehensive analysis of such communities. Here we describe a detailed investigation of the microbial population, both bacterial and fungal, of kefir, using high-throughput sequencing to analyse 25 kefir milks and associated grains sourced from 8 geographically distinct regions. This is the first occasion that this technology has been employed to investigate the fungal component of these populations or to reveal the microbial composition of such an extensive number of kefir grains or milks. As a result several genera and species not previously identified in kefir were revealed. Our analysis shows that the bacterial populations in kefir are dominated by 2 phyla, the Firmicutes and the Proteobacteria. It was also established that the fungal populations of kefir were dominated by the genera Kazachstania, Kluyveromyces and Naumovozyma, but that a variable sub-dominant population also exists.

  12. Comparison of the bacterial community composition in the granular and the suspended phase of sequencing batch reactors.

    PubMed

    Szabó, Enikö; Liébana, Raquel; Hermansson, Malte; Modin, Oskar; Persson, Frank; Wilén, Britt-Marie

    2017-09-05

    Granulation of activated sludge is an increasingly important area within the field of wastewater treatment. Granulation is usually achieved by high hydraulic selection pressure, which results in the wash-out of slow settling particles. The effect of the harsh wash-out conditions on the granular sludge ecosystem is not yet fully understood, but different bacterial groups may be affected to varying degrees. In this study, we used high-throughput amplicon sequencing to follow the community composition in granular sludge reactors for 12 weeks, both in the granular phase and the suspended phase (effluent). The microbiome of the washed out biomass was similar but not identical to the microbiome of the granular biomass. Certain taxa (e.g. Flavobacterium spp. and Bdellovibrio spp.) had significantly (p < 0.05) higher relative abundance in the granules compared to the effluent. Fluorescence in situ hybridization images indicated that these taxa were mainly located in the interior of granules and therefore protected from erosion. Other taxa (e.g. Meganema sp. and Zooglea sp.) had significantly lower relative abundance in the granules compared to the effluent, and appeared to be mainly located on the surface of granules and therefore subject to erosion. Despite being washed out, these taxa were among the most abundant members of the granular sludge communities and were likely growing fast in the reactors. The ratio between relative abundance in the granular biomass and in the effluent did not predict temporal variation of the taxa in the reactors, but it did appear to predict the spatial location of the taxa in the granules.

  13. Sequencing-Based Analysis of the Bacterial and Fungal Composition of Kefir Grains and Milks from Multiple Sources

    PubMed Central

    Marsh, Alan J.; O’Sullivan, Orla; Hill, Colin; Ross, R. Paul; Cotter, Paul D.

    2013-01-01

    Kefir is a fermented milk-based beverage to which a number of health-promoting properties have been attributed. The microbes responsible for the fermentation of milk to produce kefir consist of a complex association of bacteria and yeasts, bound within a polysaccharide matrix, known as the kefir grain. The consistency of this microbial population, and that present in the resultant beverage, has been the subject of a number of previous, almost exclusively culture-based, studies which have indicated differences depending on geographical location and culture conditions. However, culture-based identification studies are limited by virtue of only detecting species with the ability to grow on the specific medium used and thus culture-independent, molecular-based techniques offer the potential for a more comprehensive analysis of such communities. Here we describe a detailed investigation of the microbial population, both bacterial and fungal, of kefir, using high-throughput sequencing to analyse 25 kefir milks and associated grains sourced from 8 geographically distinct regions. This is the first occasion that this technology has been employed to investigate the fungal component of these populations or to reveal the microbial composition of such an extensive number of kefir grains or milks. As a result several genera and species not previously identified in kefir were revealed. Our analysis shows that the bacterial populations in kefir are dominated by 2 phyla, the Firmicutes and the Proteobacteria. It was also established that the fungal populations of kefir were dominated by the genera Kazachstania, Kluyveromyces and Naumovozyma, but that a variable sub-dominant population also exists. PMID:23894461

  14. [Repetition and fear of dying].

    PubMed

    Lerner, B D

    1995-03-01

    In this paper a revision is made of the qualifications of Repetition (R) in Freuds work, i.e. its being at the service of the Pleasure Principle and, beyond it, the binding of free energy due to trauma. Freud intends to explain with this last concept the "fort-da" and the traumatic dreams (obsessively reiterated self-reproaches may be added to them). The main thesis of this work is that R. is not only a defense against the recollection of the ominous past (as in the metaphorical deaths of abandonment and desertion) but also a way of maintaining life and identify fighting against the inescapable omninous future (known but yet experienced), i.e. our own death. Some forms of R. like habits, identificatory behaviors and sometimes even magic, are geared to serve the life instinct. A literary illustration shows this desperate fight.

  15. Pressure rig for repetitive casting

    NASA Technical Reports Server (NTRS)

    Vasquez, Peter (Inventor); Hutto, William R. (Inventor); Philips, Albert R. (Inventor)

    1989-01-01

    The invention is a pressure rig for repetitive casting of metal. The pressure rig performs like a piston for feeding molten metal into a mold. Pressure is applied to an expandable rubber diaphragm which expands like a balloon to force the metal into the mold. A ceramic cavity which holds molten metal is lined with blanket-type insulating material, necessitating only a relining for subsequent use and eliminating the lengthy cavity preparation inherent in previous rigs. In addition, the expandable rubber diaphragm is protected by the insulating material thereby decreasing its vulnerability to heat damage. As a result of the improved design the life expectancy of the pressure rig contemplated by the present invention is more than doubled. Moreover, the improved heat protection has allowed the casting of brass and other alloys with higher melting temperatures than possible in the conventional pressure rigs.

  16. Constructive and Unconstructive Repetitive Thought

    PubMed Central

    Watkins, Edward R.

    2008-01-01

    The author reviews research showing that repetitive thought (RT) can have constructive or unconstructive consequences. The main unconstructive consequences of RT are (a) depression, (b) anxiety, and (c) difficulties in physical health. The main constructive consequences of RT are (a) recovery from upsetting and traumatic events, (b) adaptive preparation and anticipatory planning, (c) recovery from depression, and (d) uptake of health-promoting behaviors. Several potential principles accounting for these distinct consequences of RT are identified within this review: (a) the valence of thought content, (b) the intrapersonal and situational context in which RT occurs, and (c) the level of construal (abstract vs. concrete processing) adopted during RT. Of the existing models of RT, it is proposed that an elaborated version of the control theory account provides the best theoretical framework to account for its distinct consequences. PMID:18298268

  17. Characterization and distribution of repetitive elements in association with genes in the human genome.

    PubMed

    Liang, Kai-Chiang; Tseng, Joseph T; Tsai, Shaw-Jenq; Sun, H Sunny

    2015-08-01

    Repetitive elements constitute more than 50% of the human genome. Recent studies implied that the complexity of living organisms is not just a direct outcome of a number of coding sequences; the repetitive elements, which do not encode proteins, may also play a significant role. Though scattered studies showed that repetitive elements in the regulatory regions of a gene control gene expression, no systematic survey has been done to report the characterization and distribution of various types of these repetitive elements in the human genome. Sequences from 5' and 3' untranslated regions and upstream and downstream of a gene were downloaded from the Ensembl database. The repetitive elements in the neighboring of each gene were identified and classified using cross-matching implemented in the RepeatMasker. The annotation and distribution of distinct classes of repetitive elements associated with individual gene were collected to characterize genes in association with different types of repetitive elements using systems biology program. We identified a total of 1,068,400 repetitive elements which belong to 37-class families and 1235 subclasses that are associated with 33,761 genes and 57,365 transcripts. In addition, we found that the tandem repeats preferentially locate proximal to the transcription start site (TSS) of genes and the major function of these genes are involved in developmental processes. On the other hand, interspersed repetitive elements showed a tendency to be accumulated at distal region from the TSS and the function of interspersed repeat-containing genes took part in the catabolic/metabolic processes. Results from the distribution analysis were collected and used to construct a gene-based repetitive element database (GBRED; http://www.binfo.ncku.edu.tw/GBRED/index.html). A user-friendly web interface was designed to provide the information of repetitive elements associated with any particular gene(s). This is the first study focusing on the gene

  18. Development of a repetitive compact torus injector

    NASA Astrophysics Data System (ADS)

    Onchi, Takumi; McColl, David; Dreval, Mykola; Rohollahi, Akbar; Xiao, Chijin; Hirose, Akira; Zushi, Hideki

    2013-10-01

    A system for Repetitive Compact Torus Injection (RCTI) has been developed at the University of Saskatchewan. CTI is a promising fuelling technology to directly fuel the core region of tokamak reactors. In addition to fuelling, CTI has also the potential for (a) optimization of density profile and thus bootstrap current and (b) momentum injection. For steady-state reactor operation, RCTI is necessary. The approach to RCTI is to charge a storage capacitor bank with a large capacitance and quickly charge the CT capacitor bank through a stack of integrated-gate bipolar transistors (IGBTs). When the CT bank is fully charged, the IGBT stack will be turned off to isolate banks, and CT formation/acceleration sequence will start. After formation of each CT, the fast bank will be replenished and a new CT will be formed and accelerated. Circuits for the formation and the acceleration in University of Saskatchewan CT Injector (USCTI) have been modified. Three CT shots at 10 Hz or eight shots at 1.7 Hz have been achieved. This work has been sponsored by the CRC and NSERC, Canada.

  19. Understanding communicative actions: a repetitive TMS study.

    PubMed

    Stolk, Arjen; Noordzij, Matthijs L; Volman, Inge; Verhagen, Lennart; Overeem, Sebastiaan; van Elswijk, Gijs; Bloem, Bas; Hagoort, Peter; Toni, Ivan

    2014-02-01

    Despite the ambiguity inherent in human communication, people are remarkably efficient in establishing mutual understanding. Studying how people communicate in novel settings provides a window into the mechanisms supporting the human competence to rapidly generate and understand novel shared symbols, a fundamental property of human communication. Previous work indicates that the right posterior superior temporal sulcus (pSTS) is involved when people understand the intended meaning of novel communicative actions. Here, we set out to test whether normal functioning of this cerebral structure is required for understanding novel communicative actions using inhibitory low-frequency repetitive transcranial magnetic stimulation (rTMS). A factorial experimental design contrasted two tightly matched stimulation sites (right pSTS vs left MT+, i.e., a contiguous homotopic task-relevant region) and tasks (a communicative task vs a visual tracking task that used the same sequences of stimuli). Overall task performance was not affected by rTMS, whereas changes in task performance over time were disrupted according to TMS site and task combinations. Namely, rTMS over pSTS led to a diminished ability to improve action understanding on the basis of recent communicative history, while rTMS over MT+ perturbed improvement in visual tracking over trials. These findings qualify the contributions of the right pSTS to human communicative abilities, showing that this region might be necessary for incorporating previous knowledge, accumulated during interactions with a communicative partner, to constrain the inferential process that leads to action understanding.

  20. Resistance to change of operant variation and repetition.

    PubMed Central

    Doughty, A H; Lattal, K A

    2001-01-01

    A multiple chained schedule was used to compare the relative resistance to change of variable and fixed four-peck response sequences in pigeons. In one terminal link, a response sequence produced food only if it occurred infrequently relative to 15 other response sequences (vary). In the other terminal link, a single response sequence produced food (repeat). Identical variable-interval schedules operated in the initial links. During baseline, lower response rates generally occurred in the vary initial link, and similar response and reinforcement rates occurred in each terminal link. Resistance of responding to prefeeding and three rates of response-independent food delivered during the intercomponent intervals then was compared between components. During each disruption condition, initial- and terminal-link response rates generally were more resistant in the vary component than in the repeat component. During the response-independent food conditions, terminal-link response rates were more resistant than initial-link response rates in each component, but this did not occur during prefeeding. Variation (in vary) and repetition (in repeat) both decreased during the response-independent food conditions in the respective components, but with relatively greater disruption in repeat. These results extend earlier findings demonstrating that operant variation is more resistant to disruption than is operant repetition and suggest that theories of response strength, such as behavioral momentum theory, must consider factors other than reinforcement rate. The implications of the results for understanding operant response classes are discussed. PMID:11599639

  1. Resistance to change of operant variation and repetition.

    PubMed

    Doughty, A H; Lattal, K A

    2001-09-01

    A multiple chained schedule was used to compare the relative resistance to change of variable and fixed four-peck response sequences in pigeons. In one terminal link, a response sequence produced food only if it occurred infrequently relative to 15 other response sequences (vary). In the other terminal link, a single response sequence produced food (repeat). Identical variable-interval schedules operated in the initial links. During baseline, lower response rates generally occurred in the vary initial link, and similar response and reinforcement rates occurred in each terminal link. Resistance of responding to prefeeding and three rates of response-independent food delivered during the intercomponent intervals then was compared between components. During each disruption condition, initial- and terminal-link response rates generally were more resistant in the vary component than in the repeat component. During the response-independent food conditions, terminal-link response rates were more resistant than initial-link response rates in each component, but this did not occur during prefeeding. Variation (in vary) and repetition (in repeat) both decreased during the response-independent food conditions in the respective components, but with relatively greater disruption in repeat. These results extend earlier findings demonstrating that operant variation is more resistant to disruption than is operant repetition and suggest that theories of response strength, such as behavioral momentum theory, must consider factors other than reinforcement rate. The implications of the results for understanding operant response classes are discussed.

  2. Socio-Economic Status Affects Sentence Repetition, but Not Non-Word Repetition, in Chilean Preschoolers

    ERIC Educational Resources Information Center

    Balladares, Jaime; Marshall, Chloë; Griffiths, Yvonne

    2016-01-01

    Sentence repetition and non-word repetition tests are widely used measures of language processing which are sensitive to language ability. Surprisingly little previous work has investigated whether children's socio-economic status (SES) affects their sentence and non-word repetition accuracy. This study investigates sentence and non-word…

  3. A Nonword Repetition Task for Speakers with Misarticulations: The Syllable Repetition Task (SRT)

    ERIC Educational Resources Information Center

    Shriberg, Lawrence D.; Lohmeier, Heather L.; Campbell, Thomas F.; Dollaghan, Christine A.; Green, Jordan R.; Moore, Christopher A.

    2009-01-01

    Purpose: Conceptual and methodological confounds occur when non(sense) word repetition tasks are administered to speakers who do not have the target speech sounds in their phonetic inventories or who habitually misarticulate targeted speech sounds. In this article, the authors (a) describe a nonword repetition task, the Syllable Repetition Task…

  4. Serial Position Effects in Nonword Repetition

    ERIC Educational Resources Information Center

    Gupta, P.; Lipinski, J.; Abbs, B.; Lin, P.H.

    2005-01-01

    A growing body of research has emphasized the linkage between performance in immediate serial recall of lists, nonword repetition, and word learning. Recently, it has been reported that primacy and recency effects are obtained in repetition of individual syllables within nonwords (Gupta, in press). Five experiments examined whether such…

  5. Repetitions: A Cross-Cultural Study.

    ERIC Educational Resources Information Center

    Murata, Kumiko

    1995-01-01

    This study investigated how repetition is used in conversation among native speakers of British English, native speakers of Japanese, and Japanese speakers of English. Five interactional functions of repetition (interruption-orientated, solidarity, silence-avoidance, hesitation, and reformulation) were identified, as well as the cultural factors…

  6. Grade Repetition in Queensland State Prep Classes

    ERIC Educational Resources Information Center

    Anderson, Robyn

    2012-01-01

    The current study considers grade repetition rates in the early years of schooling in Queensland state schools with specific focus on the pre-schooling year, Prep. In particular, it provides empirical evidence of grade repetition in Queensland state schools along with groups of students who are more often repeated. At the same time, much of the…

  7. Task Repetition and Second Language Speech Processing

    ERIC Educational Resources Information Center

    Lambert, Craig; Kormos, Judit; Minn, Danny

    2017-01-01

    This study examines the relationship between the repetition of oral monologue tasks and immediate gains in L2 fluency. It considers the effect of aural-oral task repetition on speech rate, frequency of clause-final and midclause filled pauses, and overt self-repairs across different task types and proficiency levels and relates these findings to…

  8. MinION nanopore sequencing identifies the position and structure of a bacterial antibiotic resistance island.

    PubMed

    Ashton, Philip M; Nair, Satheesh; Dallman, Tim; Rubino, Salvatore; Rabsch, Wolfgang; Mwaigwisya, Solomon; Wain, John; O'Grady, Justin

    2015-03-01

    Short-read, high-throughput sequencing technology cannot identify the chromosomal position of repetitive insertion sequences that typically flank horizontally acquired genes such as bacterial virulence genes and antibiotic resistance genes. The MinION nanopore sequencer can produce long sequencing reads on a device similar in size to a USB memory stick. Here we apply a MinION sequencer to resolve the structure and chromosomal insertion site of a composite antibiotic resistance island in Salmonella Typhi Haplotype 58. Nanopore sequencing data from a single 18-h run was used to create a scaffold for an assembly generated from short-read Illumina data. Our results demonstrate the potential of the MinION device in clinical laboratories to fully characterize the epidemic spread of bacterial pathogens.

  9. Temporal and spatial variations in the composition of freshwater photosynthetic picoeukaryotes revealed by MiSeq sequencing from flow cytometry sorted samples.

    PubMed

    Li, Shengnan; Bronner, Gisèle; Lepère, Cécile; Kong, Fanxiang; Shi, Xiaoli

    2017-03-09

    The diversity and composition of photosynthetic picoeukaryotes (PPEs) in two large shallow lakes in China (Lake Taihu and Lake Chaohu) were investigated from flow cytometry sorted samples using Miseq high-throughput sequencing. We collected 65 samples covering different regions of the two lakes over four seasons to unveil spatial and temporal patterns of PPEs community composition. The use of flow cytometry sorting largely improved the efficiency of detecting PPEs sequences and over 70% of the retrieved reads belonged to PPEs. Chlorophyta and Bacillariophyta dominated PPEs in most of the samples. A distinct but complex seasonality of PPEs composition emerged at the OTUs level. NGS-based Miseq sequencing facilitates an in-depth view of numerous rare OTUs. Nearly 80% of the PPEs OTUs were rare and lots of them were detected only in one season, whereas most of the abundant OTUs were frequently detected in all seasons but only changed in relative abundances. Besides, a close relative of the marine PPEs species Ostreococcus sp. (OTU_1144, 99% identity) was discovered in freshwater systems for the first time and was abundant especially in winter. The diversity and community composition of PPEs were more dependent on season rather than sampling sites. Temperature, phycocyanin and NO3 N concentrations in Lake Taihu explained the PPE composition variations, whereas in Lake Chaohu TN/TP ratios, temperature, pH and nephelometric turbidity units (NTU) seemed to be the most important factors. In addition, a great number of OTUs belong to nonpigmented picoeukaryotes, especially Chytridiomycota, Perkinsozoa, Ciliophora and Cercozoa, which are known to include algae parasites as well as predators. The results of mantel test also showed that the community of photosynthetic and nonpigmented picoeukaryotes were significantly correlated in both lakes.

  10. Repetition priming results in sensitivity attenuation

    PubMed Central

    Allenmark, Fredrik; Hsu, Yi-Fang; Roussel, Cedric; Waszak, Florian

    2015-01-01

    Repetition priming refers to the change in the ability to perform a task on a stimulus as a consequence of a former encounter with that very same item. Usually, repetition results in faster and more accurate performance. In the present study, we used a contrast discrimination protocol to assess perceptual sensitivity and response bias of Gabor gratings that are either repeated (same orientation) or alternated (different orientation). We observed that contrast discrimination performance is worse, not better, for repeated than for alternated stimuli. In a second experiment, we varied the probability of stimulus repetition, thus testing whether the repetition effect is due to bottom-up or top-down factors. We found that it is top-down expectation that determines the effect. We discuss the implication of these findings for repetition priming and related phenomena as sensory attenuation. This article is part of a Special Issue entitled SI: Prediction and Attention. PMID:25819554

  11. Deep nirS amplicon sequencing of San Francisco Bay sediments enables prediction of geography and environmental conditions from denitrifying community composition.

    PubMed

    Lee, Jessica A; Francis, Christopher A

    2017-09-11

    Denitrification is a dominant nitrogen loss process in the sediments of San Francisco Bay. In this study, we sought to understand the ecology of denitrifying bacteria by using next-generation sequencing (NGS) to survey the diversity of a denitrification functional gene, nirS (encoding cytchrome-cd1 nitrite reductase), along the salinity gradient of San Francisco Bay over the course of a year. We compared our dataset to a library of nirS sequences obtained previously from the same samples by standard PCR cloning and Sanger sequencing, and showed that both methods similarly demonstrated geography, salinity and, to a lesser extent, nitrogen, to be strong determinants of community composition. Furthermore, the depth afforded by NGS enabled novel techniques for measuring the association between environment and community composition. We used Random Forests modelling to demonstrate that the site and salinity of a sample could be predicted from its nirS sequences, and to identify indicator taxa associated with those environmental characteristics. This work contributes significantly to our understanding of the distribution and dynamics of denitrifying communities in San Francisco Bay, and provides valuable tools for the further study of this key N-cycling guild in all estuarine systems. © 2017 Society for Applied Microbiology and John Wiley & Sons Ltd.

  12. Strategies for Using Repetition as a Powerful Teaching Tool

    ERIC Educational Resources Information Center

    Saville, Kirt

    2011-01-01

    Brain research indicates that repetition is of vital importance in the learning process. Repetition is an especially useful tool in the area of music education. The success of repetition can be enhanced by accurate and timely feedback. From "simple repetition" to "repetition with the addition or subtraction of degrees of freedom," there are many…

  13. Strategies for Using Repetition as a Powerful Teaching Tool

    ERIC Educational Resources Information Center

    Saville, Kirt

    2011-01-01

    Brain research indicates that repetition is of vital importance in the learning process. Repetition is an especially useful tool in the area of music education. The success of repetition can be enhanced by accurate and timely feedback. From "simple repetition" to "repetition with the addition or subtraction of degrees of freedom," there are many…

  14. Fast repetition rate (FRR) flasher

    DOEpatents

    Kolber, Zbigniew; Falkowski, Paul

    1997-02-11

    A fast repetition rate (FRR) flasher suitable for high flash photolysis including kinetic chemical and biological analysis. The flasher includes a power supply, a discharge capacitor operably connected to be charged by the power supply, and a flash lamp for producing a series of flashes in response to discharge of the discharge capacitor. A triggering circuit operably connected to the flash lamp initially ionizes the flash lamp. A current switch is operably connected between the flash lamp and the discharge capacitor. The current switch has at least one insulated gate bipolar transistor for switching current that is operable to initiate a controllable discharge of the discharge capacitor through the flash lamp. Control means connected to the current switch for controlling the rate of discharge of the discharge capacitor thereby to effectively keep the flash lamp in an ionized state between Successive discharges of the discharge capacitor. Advantageously, the control means is operable to discharge the discharge capacitor at a rate greater than 10,000 Hz and even up to a rate greater than about 250,000 Hz.

  15. Fast repetition rate (FRR) flasher

    DOEpatents

    Kolber, Z.; Falkowski, P.

    1997-02-11

    A fast repetition rate (FRR) flasher is described suitable for high flash photolysis including kinetic chemical and biological analysis. The flasher includes a power supply, a discharge capacitor operably connected to be charged by the power supply, and a flash lamp for producing a series of flashes in response to discharge of the discharge capacitor. A triggering circuit operably connected to the flash lamp initially ionizes the flash lamp. A current switch is operably connected between the flash lamp and the discharge capacitor. The current switch has at least one insulated gate bipolar transistor for switching current that is operable to initiate a controllable discharge of the discharge capacitor through the flash lamp. Control means connected to the current switch for controlling the rate of discharge of the discharge capacitor thereby to effectively keep the flash lamp in an ionized state between successive discharges of the discharge capacitor. Advantageously, the control means is operable to discharge the discharge capacitor at a rate greater than 10,000 Hz and even up to a rate greater than about 250,000 Hz. 14 figs.

  16. Analysis of repetitive DNA distribution patterns in the Tribolium castaneum genome

    PubMed Central

    Wang, Suzhi; Lorenzen, Marcé D; Beeman, Richard W; Brown, Susan J

    2008-01-01

    Background Insect genomes vary widely in size, a large fraction of which is often devoted to repetitive DNA. Re-association kinetics indicate that up to 42% of the genome of the red flour beetle, Tribolium castaneum, is repetitive. Analysis of the abundance and distribution of repetitive DNA in the recently sequenced genome of T. castaneum is important for understanding the structure and function of its genome. Results Using TRF, TEpipe and RepeatScout we found that approximately 30% of the T. castaneum assembled genome is composed of repetitive DNA. Of this, 17% is found in tandem arrays and the remaining 83% is dispersed, including transposable elements, which in themselves constitute 5-6% of the genome. RepeatScout identified 31 highly repetitive DNA elements with repeat units longer than 100 bp, which constitute 7% of the genome; 65% of these highly repetitive elements and 74% of transposable elements accumulate in regions representing 40% of the assembled genome that is anchored to chromosomes. These regions tend to occur near one end of each chromosome, similar to previously described blocks of pericentric heterochromatin. They contain fewer genes with longer introns, and often correspond with regions of low recombination in the genetic map. Conclusion Our study found that transposable elements and other repetitive DNA accumulate in certain regions in the assembled T. castaneum genome. Several lines of evidence suggest these regions are derived from the large blocks of pericentric heterochromatin in T. castaneum chromosomes. PMID:18366801

  17. Particle swarm-based structural optimization of laminated composite hydrokinetic turbine blades

    NASA Astrophysics Data System (ADS)

    Li, H.; Chandrashekhara, K.

    2015-09-01

    Composite blade manufacturing for hydrokinetic turbine application is quite complex and requires extensive optimization studies in terms of material selection, number of layers, stacking sequence, ply thickness and orientation. To avoid a repetitive trial-and-error method process, hydrokinetic turbine blade structural optimization using particle swarm optimization was proposed to perform detailed composite lay-up optimization. Layer numbers, ply thickness and ply orientations were optimized using standard particle swarm optimization to minimize the weight of the composite blade while satisfying failure evaluation. To address the discrete combinatorial optimization problem of blade stacking sequence, a novel permutation discrete particle swarm optimization model was also developed to maximize the out-of-plane load-carrying capability of the composite blade. A composite blade design with significant material saving and satisfactory performance was presented. The proposed methodology offers an alternative and efficient design solution to composite structural optimization which involves complex loading and multiple discrete and combinatorial design parameters.

  18. Combinatorial codon scrambling enables scalable gene synthesis and amplification of repetitive proteins

    NASA Astrophysics Data System (ADS)

    Tang, Nicholas C.; Chilkoti, Ashutosh

    2016-04-01

    Most genes are synthesized using seamless assembly methods that rely on the polymerase chain reaction (PCR). However, PCR of genes encoding repetitive proteins either fails or generates nonspecific products. Motivated by the need to efficiently generate new protein polymers through high-throughput gene synthesis, here we report a codon-scrambling algorithm that enables the PCR-based gene synthesis of repetitive proteins by exploiting the codon redundancy of amino acids and finding the least-repetitive synonymous gene sequence. We also show that the codon-scrambling problem is analogous to the well-known travelling salesman problem, and obtain an exact solution to it by using De Bruijn graphs and a modern mixed integer linear programme solver. As experimental proof of the utility of this approach, we use it to optimize the synthetic genes for 19 repetitive proteins, and show that the gene fragments are amenable to PCR-based gene assembly and recombinant expression.

  19. MetaGaAP: A Novel Pipeline to Estimate Community Composition and Abundance from Non-Model Sequence Data

    PubMed Central

    Noune, Christopher; Hauxwell, Caroline

    2017-01-01

    Next generation sequencing and bioinformatic approaches are increasingly used to quantify microorganisms within populations by analysis of ‘meta-barcode’ data. This approach relies on comparison of amplicon sequences of ‘barcode’ regions from a population with public-domain databases of reference sequences. However, for many organisms relevant ‘barcode’ regions may not have been identified and large databases of reference sequences may not be available. A workflow and software pipeline, ‘MetaGaAP,’ was developed to identify and quantify genotypes through four steps: shotgun sequencing and identification of polymorphisms in a metapopulation to identify custom ‘barcode’ regions of less than 30 polymorphisms within the span of a single ‘read’, amplification and sequencing of the ‘barcode’, generation of a custom database of polymorphisms, and quantitation of the relative abundance of genotypes. The pipeline and workflow were validated in a ‘wild type’ Alphabaculovirus isolate, Helicoverpa armigera single nucleopolyhedrovirus (HaSNPV-AC53) and a tissue-culture derived strain (HaSNPV-AC53-T2). The approach was validated by comparison of polymorphisms in amplicons and shotgun data, and by comparison of predicted dominant and co-dominant genotypes with Sanger sequences. The computational power required to generate and search the database effectively limits the number of polymorphisms that can be included in a barcode to 30 or less. The approach can be used in quantitative analysis of the ecology and pathology of non-model organisms. PMID:28218638

  20. Precision markedly attenuates repetitive lift capacity.

    PubMed

    Collier, Brooke R; Holland, Laura; McGhee, Deirdre; Sampson, John A; Bell, Alison; Stapley, Paul J; Groeller, Herbert

    2014-01-01

    This study investigated the effect of precision on time to task failure in a repetitive whole-body manual handling task. Twelve participants were required to repetitively lift a box weighing 65% of their single repetition maximum to shoulder height using either precise or unconstrained box placement. Muscle activity, forces exerted at the ground, 2D body kinematics, box acceleration and psychophysical measures of performance were recorded until task failure was reached. With precision, time to task failure for repetitive lifting was reduced by 72%, whereas the duration taken to complete a single lift and anterior deltoid muscle activation increased by 39% and 25%, respectively. Yet, no significant difference was observed in ratings of perceived exertion or heart rate at task failure. In conclusion, our results suggest that when accuracy is a characteristic of a repetitive manual handling task, physical work capacity will decline markedly. The capacity to lift repetitively to shoulder height was reduced by 72% when increased accuracy was required to place a box upon a shelf. Lifting strategy and muscle activity were also modified, confirming practitioners should take into consideration movement precision when evaluating the demands of repetitive manual handling tasks.

  1. Identification of repeats in DNA sequences using nucleotide distribution uniformity.

    PubMed

    Yin, Changchuan

    2017-01-07

    Repetitive elements are important in genomic structures, functions and regulations, yet effective methods in precisely identifying repetitive elements in DNA sequences are not fully accessible, and the relationship between repetitive elements and periodicities of genomes is not clearly understood. We present an ab initio method to quantitatively detect repetitive elements and infer the consensus repeat pattern in repetitive elements. The method uses the measure of the distribution uniformity of nucleotides at periodic positions in DNA sequences or genomes. It can identify periodicities, consensus repeat patterns, copy numbers and perfect levels of repetitive elements. The results of using the method on different DNA sequences and genomes demonstrate efficacy and accuracy in identifying repeat patterns and periodicities. The complexity of the method is linear with respect to the lengths of the analyzed sequences. The Python programs in this study are freely available to the public upon request or at https://github.com/cyinbox/DNADU. Copyright © 2016 Elsevier Ltd. All rights reserved.

  2. Bacterial Community Composition in Central European Running Waters Examined by Temperature Gradient Gel Electrophoresis and Sequence Analysis of 16S rRNA Genes▿ †

    PubMed Central

    Beier, Sara; Witzel, Karl-Paul; Marxsen, Jürgen

    2008-01-01

    The bacterial community composition in small streams and a river in central Germany was examined by temperature gradient gel electrophoresis (TGGE) with PCR products of 16S rRNA gene fragments and sequence analysis. Complex TGGE band patterns suggested high levels of diversity of bacterial species in all habitats of these environments. Cluster analyses demonstrated distinct differences among the communities in stream and spring water, sandy sediments, biofilms on stones, degrading leaves, and soil. The differences between stream water and sediment were more significant than those between sites within the same habitat along the stretch from the stream source to the mouth. TGGE data from an entire stream course suggest that, in the upper reach of the stream, a special suspended bacterial community is already established and changes only slightly downstream. The bacterial communities in water and sediment in an acidic headwater with a pH below 5 were highly similar to each other but deviated distinctly from the communities at the other sites. As ascertained by nucleotide sequence analysis, stream water communities were dominated by Betaproteobacteria (one-third of the total bacteria), whereas sediment communities were composed mainly of Betaproteobacteria and members of the Fibrobacteres/Acidobacteria group (each accounting for about 25% of bacteria). Sequences obtained from bacteria from water samples indicated the presence of typical cosmopolitan freshwater organisms. TGGE bands shared between stream and soil samples, as well as sequences found in bacteria from stream samples that were related to those of soil bacteria, demonstrated the occurrence of some species in both stream and soil habitats. Changes in bacterial community composition were correlated with geographic distance along a stream, but in comparisons of different streams and rivers, community composition was correlated only with environmental conditions. PMID:18024682

  3. Unusual structure of a human middle repetitive DNA

    SciTech Connect

    Ratnasinghe, D.D.

    1993-01-01

    The L2Hs sequences are a polymorphic, interspersed, middle repetitive DNA family unique to human genomes. Genomic fingerprinting indicates that these DNAs vary from one individual to another and between tissues of the same individual. Sequence analysis reveals that they are AT-rich (76%) and contain many unusual sequence arrangements (palindromes, inverted and direct repeats). These sequence properties confer on the L2Hs elements the potential to fold into non-B-form structures, a characteristic of recombination hot spots. To test this hypothesis carbodiimide, osmium tetroxide and S[sub 1] nuclease were used as single-strand specific probes to study a recombinant plasmid, pN6.4.39, containing a single L2Hs segment. Different forms of the plasmid substrate were analyzed, including linear molecules and circular forms of DNA in growing E. coli cells were analyzed. Modified plasmid DNA was analyzed by primer extension in a sequencing-type reaction format. These studies demonstrate that the L2Hs sequences: (1) assume non-B-form structures both in vitro and in vivo, (2) map to predicted cruciform structures, (3) behave as C-type extrusion sequences, and (4) that these unusual DNA structures are dependent on plasmid superhelicity.

  4. Impact of repetitive DNA on sex chromosome evolution in plants.

    PubMed

    Hobza, Roman; Kubat, Zdenek; Cegan, Radim; Jesionek, Wojciech; Vyskot, Boris; Kejnovsky, Eduard

    2015-09-01

    Structurally and functionally diverged sex chromosomes have evolved in many animals as well as in some plants. Sex chromosomes represent a specific genomic region(s) with locally suppressed recombination. As a consequence, repetitive sequences involving transposable elements, tandem repeats (satellites and microsatellites), and organellar DNA accumulate on the Y (W) chromosomes. In this paper, we review the main types of repetitive elements, their gathering on the Y chromosome, and discuss new findings showing that not only accumulation of various repeats in non-recombining regions but also opposite processes form Y chromosome. The aim of this review is also to discuss the mechanisms of repetitive DNA spread involving (retro) transposition, DNA polymerase slippage or unequal crossing-over, as well as modes of repeat removal by ectopic recombination. The intensity of these processes differs in non-recombining region(s) of sex chromosomes when compared to the recombining parts of genome. We also speculate about the relationship between heterochromatinization and the formation of heteromorphic sex chromosomes.

  5. Repetition Pitch glide from the step pyramid at Chichen Itza.

    PubMed

    Bilsen, Frans A

    2006-08-01

    Standing at the foot of the Mayan step pyramid at Chichen Itza in Mexico, one can produce a pitchy "chirp" echo by handclapping. As exposed by Declercq et al. [J. Acoust. Soc. Am. 116, 3328-3335 (2004)], an acoustic model based on optical Bragg diffraction at a periodic structure cannot explain satisfactorily the chirp-echo sonogram. Alternatively, considering the echo as a sequence of reflections, and given the dimensions of the pyramid and source-receiver position, the chirp is predicted correctly as a Repetition Pitch glide of which the pitch height is continuously decreasing within 177 ms from 796 to 471 Hz-equivalent.

  6. Item repetition in short-term memory: Ranschburg repeated.

    PubMed

    Henson, R N

    1998-09-01

    In serial recall from short-term memory, repeated items are recalled well when close together (repetition facilitation), but not when far apart (repetition inhibition; the Ranschburg effect). These effects were re-examined with a new scoring scheme that addresses the possibility that repetitions are distinct tokens in memory. Repetition facilitation and repetition inhibition proved robust, and were shown to interact with the temporal grouping of items (Experiment 1), which affected the probability of detecting repetition (Experiments 2A and 2B). It is argued that detection of a repetition is necessary for repetition facilitation, attributable to the tagging of immediate repetition, whereas the failure to detect or remember a repetition results in repetition inhibition, attributable to an automatic suppression of previous responses and a bias against guessing repeated items (Experiment 3). The findings are discussed in relation to models of short-term memory and the phenomenon of repetition blindness.

  7. Fungal ITS1 Deep-Sequencing Strategies to Reconstruct the Composition of a 26-Species Community and Evaluation of the Gut Mycobiota of Healthy Japanese Individuals.

    PubMed

    Motooka, Daisuke; Fujimoto, Kosuke; Tanaka, Reiko; Yaguchi, Takashi; Gotoh, Kazuyoshi; Maeda, Yuichi; Furuta, Yoki; Kurakawa, Takashi; Goto, Naohisa; Yasunaga, Teruo; Narazaki, Masashi; Kumanogoh, Atsushi; Horii, Toshihiro; Iida, Tetsuya; Takeda, Kiyoshi; Nakamura, Shota

    2017-01-01

    The study of mycobiota remains relatively unexplored due to the lack of sufficient available reference strains and databases compared to those of bacterial microbiome studies. Deep sequencing of Internal Transcribed Spacer (ITS) regions is the de facto standard for fungal diversity analysis. However, results are often biased because of the wide variety of sequence lengths in the ITS regions and the complexity of high-throughput sequencing (HTS) technologies. In this study, a curated ITS database, ntF-ITS1, was constructed. This database can be utilized for the taxonomic assignment of fungal community members. We evaluated the efficacy of strategies for mycobiome analysis by using this database and characterizing a mock fungal community consisting of 26 species representing 15 genera using ITS1 sequencing with three HTS platforms: Illumina MiSeq (MiSeq), Ion Torrent Personal Genome Machine (IonPGM), and Pacific Biosciences (PacBio). Our evaluation demonstrated that PacBio's circular consensus sequencing with greater than 8 full-passes most accurately reconstructed the composition of the mock community. Using this strategy for deep-sequencing analysis of the gut mycobiota in healthy Japanese individuals revealed two major mycobiota types: a single-species type composed of Candida albicans or Saccharomyces cerevisiae and a multi-species type. In this study, we proposed the best possible processing strategies for the three sequencing platforms, of which, the PacBio platform allowed for the most accurate estimation of the fungal community. The database and methodology described here provide critical tools for the emerging field of mycobiome studies.

  8. Fungal ITS1 Deep-Sequencing Strategies to Reconstruct the Composition of a 26-Species Community and Evaluation of the Gut Mycobiota of Healthy Japanese Individuals

    PubMed Central

    Motooka, Daisuke; Fujimoto, Kosuke; Tanaka, Reiko; Yaguchi, Takashi; Gotoh, Kazuyoshi; Maeda, Yuichi; Furuta, Yoki; Kurakawa, Takashi; Goto, Naohisa; Yasunaga, Teruo; Narazaki, Masashi; Kumanogoh, Atsushi; Horii, Toshihiro; Iida, Tetsuya; Takeda, Kiyoshi; Nakamura, Shota

    2017-01-01

    The study of mycobiota remains relatively unexplored due to the lack of sufficient available reference strains and databases compared to those of bacterial microbiome studies. Deep sequencing of Internal Transcribed Spacer (ITS) regions is the de facto standard for fungal diversity analysis. However, results are often biased because of the wide variety of sequence lengths in the ITS regions and the complexity of high-throughput sequencing (HTS) technologies. In this study, a curated ITS database, ntF-ITS1, was constructed. This database can be utilized for the taxonomic assignment of fungal community members. We evaluated the efficacy of strategies for mycobiome analysis by using this database and characterizing a mock fungal community consisting of 26 species representing 15 genera using ITS1 sequencing with three HTS platforms: Illumina MiSeq (MiSeq), Ion Torrent Personal Genome Machine (IonPGM), and Pacific Biosciences (PacBio). Our evaluation demonstrated that PacBio’s circular consensus sequencing with greater than 8 full-passes most accurately reconstructed the composition of the mock community. Using this strategy for deep-sequencing analysis of the gut mycobiota in healthy Japanese individuals revealed two major mycobiota types: a single-species type composed of Candida albicans or Saccharomyces cerevisiae and a multi-species type. In this study, we proposed the best possible processing strategies for the three sequencing platforms, of which, the PacBio platform allowed for the most accurate estimation of the fungal community. The database and methodology described here provide critical tools for the emerging field of mycobiome studies. PMID:28261190

  9. Within-breed and multi-breed GWAS on imputed whole-genome sequence variants reveal candidate mutations affecting milk protein composition in dairy cattle.

    PubMed

    Sanchez, Marie-Pierre; Govignon-Gion, Armelle; Croiseau, Pascal; Fritz, Sébastien; Hozé, Chris; Miranda, Guy; Martin, Patrice; Barbat-Leterrier, Anne; Letaïef, Rabia; Rocha, Dominique; Brochard, Mickaël; Boussaha, Mekki; Boichard, Didier

    2017-09-18

    Genome-wide association studies (GWAS) were performed at the sequence level to identify candidate mutations that affect the expression of six major milk proteins in Montbéliarde (MON), Normande (NOR), and Holstein (HOL) dairy cattle. Whey protein (α-lactalbumin and β-lactoglobulin) and casein (αs1, αs2, β, and κ) contents were estimated by mid-infrared (MIR) spectrometry, with medium to high accuracy (0.59 ≤ R(2) ≤ 0.92), for 848,068 test-day milk samples from 156,660 cows in the first three lactations. Milk composition was evaluated as average test-day measurements adjusted for environmental effects. Next, we genotyped a subset of 8080 cows (2967 MON, 2737 NOR, and 2306 HOL) with the BovineSNP50 Beadchip. For each breed, genotypes were first imputed to high-density (HD) using HD single nucleotide polymorphisms (SNPs) genotypes of 522 MON, 546 NOR, and 776 HOL bulls. The resulting HD SNP genotypes were subsequently imputed to the sequence level using 27 million high-quality sequence variants selected from Run4 of the 1000 Bull Genomes consortium (1147 bulls). Within-breed, multi-breed, and conditional GWAS were performed. Thirty-four distinct genomic regions were identified. Three regions on chromosomes 6, 11, and 20 had very significant effects on milk composition and were shared across the three breeds. Other significant effects, which partially overlapped across breeds, were found on almost all the autosomes. Multi-breed analyses provided a larger number of significant genomic regions with smaller confidence intervals than within-breed analyses. Combinations of within-breed, multi-breed, and conditional analyses led to the identification of putative causative variants in several candidate genes that presented significant protein-protein interactions enrichment, including those with previously described effects on milk composition (SLC37A1, MGST1, ABCG2, CSN1S1, CSN2, CSN1S2, CSN3, PAEP, DGAT1, AGPAT6) and those with effects reported for the first

  10. Epithelial topography for repetitive tooth formation

    PubMed Central

    Gaete, Marcia; Fons, Juan Manuel; Popa, Elena Mădălina; Chatzeli, Lemonia; Tucker, Abigail S.

    2015-01-01

    ABSTRACT During the formation of repetitive ectodermally derived organs such as mammary glands, lateral line and teeth, the tissue primordium iteratively initiates new structures. In the case of successional molar development, new teeth appear sequentially in the posterior region of the jaw from Sox2+ cells in association with the posterior aspect of a pre-existing tooth. The sequence of molar development is well known, however, the epithelial topography involved in the formation of a new tooth is unclear. Here, we have examined the morphology of the molar dental epithelium and its development at different stages in the mouse in vivo and in molar explants. Using regional lineage tracing we show that within the posterior tail of the first molar the primordium for the second and third molar are organized in a row, with the tail remaining in connection with the surface, where a furrow is observed. The morphology and Sox2 expression of the tail retains characteristics reminiscent of the earlier stages of tooth development, such that position along the A-P axes of the tail correlates with different temporal stages. Sox9, a stem/progenitor cell marker in other organs, is expressed mainly in the suprabasal epithelium complementary with Sox2 expression. This Sox2 and Sox9 expressing molar tail contains actively proliferating cells with mitosis following an apico-basal direction. Snail2, a transcription factor implicated in cell migration, is expressed at high levels in the tip of the molar tail while E-cadherin and laminin are decreased. In conclusion, our studies propose a model in which the epithelium of the molar tail can grow by posterior movement of epithelial cells followed by infolding and stratification involving a population of Sox2+/Sox9+ cells. PMID:26538639

  11. Repetition enhancement and memory effects for duration.

    PubMed

    Wiener, Martin; Thompson, James C

    2015-06-01

    A remarkable aspect of conscious perception is that moments carryover from one to the next, also known as temporal continuity. This ability is thus crucial for detecting regularities, such as in speech and music, and may rely on an accurate perception of time. Investigations of human time perception have detailed two electroencephalographic (EEG) components associated with timing, the contingent negative variation (CNV) and late positive component of timing (LPCt); however, the precise roles of these components in timing remain elusive. Recently, we demonstrated that the perception of duration is influenced by durations presented on prior trials, which we explained by the creation of an implicit memory standard that adapts to local changes in sequence presentation. Here, we turn to the neural basis of this effect. Human participants performed a temporal bisection task in which they were required to classify the duration of auditory stimuli into short and long duration categories; crucially, the presentation order was first-order counterbalanced, allowing us to measure the effect of each presented duration on the next. EEG recordings revealed that the CNV and LPCt signals both covaried with the duration presented on the current trial, with CNV predicting reaction time and LPCt predicting choice. Additionally, both signals covaried with the duration presented in the prior trial but in different ways, with the CNV amplitude reflecting the change in the memory standard and the LPCt reflecting decision uncertainty. Furthermore, we observed a repetition enhancement effect of duration only for the CNV, suggesting that this signal additionally indexes the similarity of successive durations. These findings demonstrate dissociable roles for the CNV and LPCt, and demonstrate that both signals are continuously updated on a trial-by-trial basis that reflects shifts in temporal decisions. Copyright © 2015 Elsevier Inc. All rights reserved.

  12. Retention of nucleic acids in ion-pair reversed-phase high-performance liquid chromatography depends not only on base composition but also on base sequence.

    PubMed

    Qiao, Jun-Qin; Liang, Chao; Wei, Lan-Chun; Cao, Zhao-Ming; Lian, Hong-Zhen

    2016-12-01

    The study on nucleic acid retention in ion-pair reversed-phase high-performance liquid chromatography mainly focuses on size-dependence, however, other factors influencing retention behaviors have not been comprehensively clarified up to date. In this present work, the retention behaviors of oligonucleotides and double-stranded DNAs were investigated on silica-based C18 stationary phase by ion-pair reversed-phase high-performance liquid chromatography. It is found that the retention of oligonucleotides was influenced by base composition and base sequence as well as size, and oligonucleotides prone to self-dimerization have weaker retention than those not prone to self-dimerization but with the same base composition. However, homo-oligonucleotides are suitable for the size-dependent separation as a special case of oligonucleotides. For double-stranded DNAs, the retention is also influenced by base composition and base sequence, as well as size. This may be attributed to the interaction of exposed bases in major or minor grooves with the hydrophobic alky chains of stationary phase. In addition, no specific influence of guanine and cytosine content was confirmed on retention of double-stranded DNAs. Notably, the space effect resulted from the stereostructure of nucleic acids also influences the retention behavior in ion-pair reversed-phase high-performance liquid chromatography.

  13. A composite foraminiferal biostratigraphic sequence for the Lower Miocene deposits in the type area of the Qom Formation, central Iran, developed by constrained optimization (CONOP)

    NASA Astrophysics Data System (ADS)

    Daneshian, Jahanbakhsh; Ramezani Dana, Leila; Sadler, Peter

    2017-01-01

    Benthic foraminifera species commonly outnumber planktic species in the type area of the Lower Miocene Qom Formation, in north central Iran, where it records the Tethyan link between the eastern Mediterranean and Indo- Pacific provinces. Because measured sections preserve very different sequences of first and last occurrences of these species, no single section provides a completely suitable baseline for correlation. To resolve this problem, we combined bioevents from three stratigraphic sections into a single composite sequence by constrained optimization (CONOP). The composite section arranges the first and last appearance events (FAD and LAD) of 242 foraminifera in an optimal order that minimizes the implied diachronism between sections. The composite stratigraphic ranges of the planktic foraminifera support a practical biozonation which reveals substantial local changes of accumulation rate during Aquitanian to Burdigalian times. Traditional biozone boundaries emerge little changed but an order of magnitude more correlations can be interpolated. The top of the section at Dobaradar is younger than previously thought and younger than sections at Dochah and Tigheh Reza-Abad. The latter two sections probably extend older into the Aquitanian than the Dobaradar section, but likely include a hiatus near the base of the Burdigalian. The bounding contacts with the Upper Red and Lower Red Formations are shown to be diachronous.

  14. Composites

    NASA Astrophysics Data System (ADS)

    Taylor, John G.

    The Composites market is arguably the most challenging and profitable market for phenolic resins aside from electronics. The variety of products and processes encountered creates the challenges, and the demand for high performance in critical operations brings value. Phenolic composite materials are rendered into a wide range of components to supply a diverse and fragmented commercial base that includes customers in aerospace (Space Shuttle), aircraft (interiors and brakes), mass transit (interiors), defense (blast protection), marine, mine ducting, off-shore (ducts and grating) and infrastructure (architectural) to name a few. For example, phenolic resin is a critical adhesive in the manufacture of honeycomb sandwich panels. Various solvent and water based resins are