Science.gov

Sample records for research centre bombay

  1. Bombay, India

    NASA Technical Reports Server (NTRS)

    2002-01-01

    Formerly known as Bombay, the city of Mumbai is situated on India's west coast, on the Arabian Sea, roughly 500 km (310 miles) south of the Tropic of Cancer. Its large harbor and ideal location facing Africa, Europe, and the Middle East make it an excellent city for trade. Sometimes referred to as the 'Gateway of India,' Mumbai handles more than one third of the country's foreign trade. The city supports a population of more than 12 million people in an area of roughly 619 square km (239 square miles). The port was acquired in 1534 by Portugal, which named it Bom Bahia, meaning 'beautiful bay.' Originally, the city rested upon seven small islands, mostly basaltic bedrock from earlier lava flows. These islands are now connected to one another by reclaimed land, but each island, or neighborhood, still retains a distinct identity within the city. (For more details, visit Welcome to Bombay: The Gateway of India.) The blue-grey pixels in this false-color image are urban areas. The dark green areas are heavily vegetated surfaces while the light brown regions are more sparsely vegetated. This image of Mumbai was acquired by the Enhanced Thematic Mapper plus (ETM+), flying aboard the Landsat 7 satellite. July 23, 2002, marks the 30th anniversary of the Landsat program. (Click to read the press release-Celebrating 30 Years of Imaging the Earth.) The Landsat program has been particularly instrumental in tracking land use and land cover changes-such as increased urban growth-over the last three decades. Image courtesy Ron Beck, USGS EROS Data Center Satellite Systems Branch

  2. Bombay, India

    NASA Technical Reports Server (NTRS)

    2002-01-01

    Formerly known as Bombay, the city of Mumbai is situated on India's west coast, on the Arabian Sea, roughly 500 km (310 miles) south of the Tropic of Cancer. Its large harbor and ideal location facing Africa, Europe, and the Middle East make it an excellent city for trade. Sometimes referred to as the 'Gateway of India,' Mumbai handles more than one third of the country's foreign trade. The city supports a population of more than 12 million people in an area of roughly 619 square km (239 square miles). The port was acquired in 1534 by Portugal, which named it Bom Bahia, meaning 'beautiful bay.' Originally, the city rested upon seven small islands, mostly basaltic bedrock from earlier lava flows. These islands are now connected to one another by reclaimed land, but each island, or neighborhood, still retains a distinct identity within the city. (For more details, visit Welcome to Bombay: The Gateway of India.) The blue-grey pixels in this false-color image are urban areas. The dark green areas are heavily vegetated surfaces while the light brown regions are more sparsely vegetated. This image of Mumbai was acquired by the Enhanced Thematic Mapper plus (ETM+), flying aboard the Landsat 7 satellite. July 23, 2002, marks the 30th anniversary of the Landsat program. (Click to read the press release-Celebrating 30 Years of Imaging the Earth.) The Landsat program has been particularly instrumental in tracking land use and land cover changes-such as increased urban growth-over the last three decades. Image courtesy Ron Beck, USGS EROS Data Center Satellite Systems Branch

  3. The Press Research Centre, 1956-1976.

    ERIC Educational Resources Information Center

    Press Research Centre, Krakow (Poland).

    In 1956, the Press Research Centre was established in Cracow, Poland by a group of journalists and publishers, for the purpose of instituting press research that would have practical applications. The aims of the Centre were to conduct studies on the history of the Polish press, the contemporary press, press readership, and editorial techniques.…

  4. Youth Research Centre Annual Report, 2002.

    ERIC Educational Resources Information Center

    Melbourne Univ. (Australia). Youth Research Centre.

    This report details the activities of the Youth Research Centre (YRC) at the University of Melbourne in 2002 in research project work involving a balance between the completion of projects, the development of new areas, and the continuation of longer-term projects as well as the supervision and teaching of a range of postgraduate health and…

  5. We Love Bombay!

    ERIC Educational Resources Information Center

    Mehta, Shital

    2006-01-01

    The author of this article, an art teacher, describes a lesson in which her elementary school students used acrylics to paint a cityscape of Bombay, India. After seeing huge canvas paintings at an art gallery, the students wanted to paint their own. They performed an exercise in which they closed their eyes, thought about the city, and listed all…

  6. The Charles Perkins Centre's Twins Research Node.

    PubMed

    Ferreira, Lucas C; Craig, Jeffrey M; Hopper, John L; Carrick, Susan E

    2016-08-01

    Twins can help researchers disentangle the roles of genes from those of the environment on human traits, health, and diseases. To realize this potential, the Australian Twin Registry (ATR), University of Melbourne, and the Charles Perkins Centre (CPC), University of Sydney, established a collaboration to form the Twins Research Node, a highly interconnected research facility dedicated specifically to research involving twins. This collaboration aims to foster the adoption of twin designs as important tools for research in a range of health-related domains. The CPC hosted their Twins Research Node's launch seminar entitled 'Double the power of your research with twin studies', in which experienced twin researchers described how twin studies are supporting scientific discoveries and careers. The launch also featured twin pairs who have actively participated in research through the ATR. Researchers at the CPC were surveyed before the event to gauge their level of understanding and interest in utilizing twin research. This article describes the new Twins Research Node, discusses the survey's main results and reports on the launch seminar.

  7. A relational conceptual framework for multidisciplinary health research centre infrastructure

    PubMed Central

    2010-01-01

    Although multidisciplinary and team-based approaches are increasingly acknowledged as necessary to address some of the most pressing contemporary health challenges, many researchers struggle with a lack of infrastructure to facilitate and formalise the requisite collaborations. Specialised research centres have emerged as an important organisational solution, yet centre productivity and sustainability are frequently dictated by the availability and security of infrastructure funds. Despite being widely cited as a core component of research capacity building, infrastructure as a discrete concept has been rather analytically neglected, often treated as an implicit feature of research environments with little specification or relegated to a narrow category of physical or administrative inputs. The terms research infrastructure, capacity, and culture, among others, are deployed in overlapping and inconsistent ways, further obfuscating the crucial functions of infrastructure specifically and its relationships with associated concepts. The case is made for an expanded conceptualisation of research infrastructure, one that moves beyond conventional 'hardware' notions. Drawing on a case analysis of NEXUS, a multidisciplinary health research centre based at the University of British Columbia, Canada, a conceptual framework is proposed that integrates the tangible and intangible structures that interactively underlie research centre functioning. A relational approach holds potential to allow for more comprehensive accounting of the returns on infrastructure investment. For those developing new research centres or seeking to reinvigorate existing ones, this framework may be a useful guide for both centre design and evaluation. PMID:20925953

  8. Research notes from the Onchocerciasis Chemotherapy Research Centre, Ghana.

    PubMed

    Awadzi, K

    1997-10-01

    Brief notes are given on drugs which have been tested at the Onchocerciasis Chemotherapy Research Centre at Tamale and Hohoe and found to have activity against Onchocerca volvulus. Ivermectin in single doses as high as 800 micrograms/kg was found to be no more effective than the standard dose of 150 micrograms/kg. The benzimidazole carbamates, mebendazole and albendazole, differ in their effects on O. volvulus. The former has microfilaricidal effects and is toxic to developing embryos surrounded by an egg shell but not the stretched microfilariae. Albendazole has no microfilaricidal activity but is toxic to all intra-uterine stages. The reasons for these differences are unclear. Early studies with amocarzine are described; the maximum tolerable dose is 20 mg/kg and the predominant activity, against the microfilariae, is marked only at doses greater than 12 mg/kg. None of the drugs tested has macrofilaricidal activity.

  9. Beyond the Beaten Track: Resettlement Initiatives of Pavement Dwellers and Slum Dwellers in Bombay.

    ERIC Educational Resources Information Center

    Patel, Sheela

    1988-01-01

    The Society for Promotion of Adult Resource Centres was created to alleviate the problem of railway settlement families and pavement dwellers in Bombay, India. The area resource center provides information, analysis of available resources, discussion of problems, and sharing of experiences. (JOW)

  10. Beyond the Beaten Track: Resettlement Initiatives of Pavement Dwellers and Slum Dwellers in Bombay.

    ERIC Educational Resources Information Center

    Patel, Sheela

    1988-01-01

    The Society for Promotion of Adult Resource Centres was created to alleviate the problem of railway settlement families and pavement dwellers in Bombay, India. The area resource center provides information, analysis of available resources, discussion of problems, and sharing of experiences. (JOW)

  11. Addiction Research Centres and the Nurturing of Creativity. Substance abuse research in a modern health care centre: the case of the Centre for Addiction and Mental Health.

    PubMed

    Rehm, Jürgen; Giesbrecht, Norman; Gliksman, Louis; Graham, Kathryn; Le, Anh D; Mann, Robert E; Room, Robin; Rush, Brian; Tyndale, Rachel F; Wells, Samantha

    2011-04-01

    The Centre for Addiction and Mental Health is one of the premier centres for research related to substance use and addiction. This research began more than 50 years ago with the Addiction Research Foundation (ARF), an organization that contributed significantly to knowledge about the aetiology, treatment and prevention of substance use, addiction and related harm. After the merger of the ARF with three other institutions in 1998, research on substance use continued, with an additional focus on comorbid substance use and other mental health disorders. In the present paper, we describe the structure of funding and organization and selected current foci of research. We argue for the continuation of this successful model of integrating basic, epidemiological, clinical, health service and prevention research under the roof of a health centre.

  12. Addiction research centres and the nurturing of creativity: the Centre for Addictions Research of British Columbia, Canada.

    PubMed

    Stockwell, Tim; Reist, Dan; Macdonald, Scott; Benoit, Cecilia; Jansson, Mikael

    2010-02-01

    The Centre for Addictions Research of British Columbia (CARBC) was established as a multi-campus and multi-disciplinary research centre administered by the University of Victoria (UVic) in late 2003. Its core funding is provided from interest payments on an endowment of CAD 10.55 million dollars. It is supported by a commitment to seven faculty appointments in various departments at UVic. The Centre has two offices, an administration and research office in Victoria and a knowledge exchange unit in Vancouver. The two offices are collaborating on the implementation of CARBC's first 5-year plan which seeks to build capacity in British Columbia for integrated multi-disciplinary research and knowledge exchange in the areas substance use, addictions and harm reduction. Present challenges include losses to the endowment caused by the 2008/2009 economic crisis and difficulties negotiating faculty positions with the university administration. Despite these hurdles, to date each year has seen increased capacity for the Centre in terms of affiliated scientists, funding and staffing as well as output in terms of published reports, electronic resources and impacts on policy and practice. Areas of special research interest include: drug testing in the work-place, epidemiological monitoring, substance use and injury, pricing and taxation policies, privatization of liquor monopolies, polysubstance use, health determinants of indigenous peoples, street-involved youth and other vulnerable populations at risk of substance use problems. Further information about the Centre and its activities can be found on http://www.carbc.ca.

  13. Scottish Schools Science Equipment Research Centre Bulletin No. 55.

    ERIC Educational Resources Information Center

    1972

    Instructions for the construction of the following apparatus for the secondary school science laboratory are included in this issue of the Scottish Schools Science Equipment Research Centre Bulletin: a cheap water purifier using an expendable deionizer can; a simple amplifier suitable for detecting or displaying D. C. currents of 1 microamp or…

  14. Openness--A Way Forward: Development Education Research Centre

    ERIC Educational Resources Information Center

    Hare-Heremia, Mahora

    2014-01-01

    Education is a vital aspect in the lives of humankind. It contributes and shapes our future as citizens of the world. To understand it is to discover the many hidden talents the world has in store for all. The Development Education Research Centre (DERC) holds many resources that aid in the development of education at a global level. With the…

  15. Openness--A Way Forward: Development Education Research Centre

    ERIC Educational Resources Information Center

    Hare-Heremia, Mahora

    2014-01-01

    Education is a vital aspect in the lives of humankind. It contributes and shapes our future as citizens of the world. To understand it is to discover the many hidden talents the world has in store for all. The Development Education Research Centre (DERC) holds many resources that aid in the development of education at a global level. With the…

  16. National Centre for Vocational Education Research 2009 Strategic Plan

    ERIC Educational Resources Information Center

    National Centre for Vocational Education Research (NCVER), 2009

    2009-01-01

    National Centre for Vocational Education Research (NCVER) was established in 1981 as a not-for-profit company owned by the Commonwealth and state and territory ministers with responsibility for vocational education and training (VET). It is a professional, independent body at arm's length from government. The company initially conducted research…

  17. Scottish Schools Science Equipment Research Centre Bulletin No. 55.

    ERIC Educational Resources Information Center

    1972

    Instructions for the construction of the following apparatus for the secondary school science laboratory are included in this issue of the Scottish Schools Science Equipment Research Centre Bulletin: a cheap water purifier using an expendable deionizer can; a simple amplifier suitable for detecting or displaying D. C. currents of 1 microamp or…

  18. Para Bombay phenotype--a case report.

    PubMed

    Mathai, J; Sulochana, P V; Sathyabhama, S

    1997-10-01

    Bombay phenotype is peculiar in that red cells are not agglutinated by antisera A, B or H; while serum contains anti A, B and H. Existence of modifying genes at independent loci with variable expression of ABO genes is postulated. We report here a case of partial suppression where antigens could be detected by elution tests and unlike classical Bombay type, normal amount of appropriate blood group substances were present in saliva. This case of para Bombay phenotype was detected as a result of discrepancy in cell and serum group ng. This highlights the importance of both forward and reverse grouping in ABO testing.

  19. Addiction research centres and the nurturing of creativity: The Centre for Addictions Research of British Columbia, Canada

    PubMed Central

    Stockwell, Tim; Reist, Dan; Macdonald, Scott; Benoit, Cecilia; Jansson, Mikael

    2015-01-01

    The Centre for Addictions Research of British Columbia (CARBC) was established as a multi-campus and multi-disciplinary research centre administered by the University of Victoria (UVic) in late 2003. Its core funding is provided from interest payments on an endowment of CAD$10.55 million. It is supported by a commitment to seven faculty appointments in various departments at UVic. The Centre has two offices, an administration and research office in Victoria and a knowledge exchange unit in Vancouver. The two offices are collaborating on the implementation of CARBC’s first 5-year plan which seeks to build capacity in British Columbia for integrated multi-disciplinary research and knowledge exchange in the areas substance use, addictions and harm reduction. Present challenges include losses to the endowment caused by the 2008/2009 economic crisis and difficulties negotiating faculty positions with the university administration. Despite these hurdles, to date each year has seen increased capacity for the Centre in terms of affiliated scientists, funding and staffing as well as output in terms of published reports, electronic resources and impacts on policy and practice. Areas of special research interest include: drug testing in the work-place, epidemiological monitoring, substance use and injury, pricing and taxation policies, privatization of liquor monopolies, poly-substance use, health determinants of indigenous peoples, street-involved youth and other vulnerable populations at risk of substance use problems. Further information about the Centre and its activities can be found on http://www.carbc.ca. PMID:20078479

  20. Prevalence of obesity in Bombay.

    PubMed

    Dhurandhar, N V; Kulkarni, P R

    1992-05-01

    Obesity has been reported in developed as well as developing countries. However, data on a large sample of the Indian population are lacking. This study analysed the prevalence of obesity among 1,784 adults in Bombay from various sections of society. Since the prevalence of obesity depends upon the criteria used, prevalence was judged by three criteria viz. percentage excess of body weight, body mass index, and body fat content. The data were classified and analysed according to occupation, age group, income, diet type, and also with respect to family history of obesity. The three methods gave a different prevalence of obesity. In general, the criterion of body mass index under-estimated, and body fat content over-estimated the prevalence as compared to that obtained by percentage excess body weight. An extremely high prevalence of obesity was found in all sub-groups of the sample. As judged by a body mass index of 25 and above, male students had the lowest (10.7%) and male medical doctors had the highest (53.1%) prevalence of obesity. Prevalence was highest for the age group 31-50 years for males and females, and declined on either side of this age range. Prevalence was directly proportional to financial income, and subjects with a family history of obesity had a greater prevalence of obesity compared to those without. This study indicates the gravity of the problem of obesity in Bombay, and provides directions for nutritional planning in the future.

  1. The Copenhagen Muscle Research Centre (CMRC) 1994-2004.

    PubMed

    Joyner, M; Kjaer, M; Larsen, P O

    2015-12-01

    This paper presents an impressionistic summary of the formation, activities, accomplishments, and impact of the Copenhagen Muscle Research Centre (CMRC) from 1994 to 2004. The history of the CMRC is viewed in the context of the goals of the original program, the tradition of excellence in exercise physiology in Copenhagen since the time of August Krogh, and the structure of the center. The key role of Professor Bengt Saltin as a visionary, flexible, and inclusive leader is highlighted. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  2. Six essential roles of health promotion research centres: the Atlantic Canada experience

    PubMed Central

    Langille, Lynn L.; Crowell, Sandra J.; Lyons, Renée F.

    2009-01-01

    SUMMARY Over the past 20 years, the federal government and universities across Canada have directed resources towards the development of university-based health promotion research centres. Researchers at health promotion research centres in Canada have produced peer-reviewed papers and policy documents based on their work, but no publications have emerged that focus on the specific roles of the health promotion research centres themselves. The purpose of this paper is to propose a framework, based on an in-depth examination of one centre, to help identify the unique roles of health promotion research centres and to clarify the value they add to promoting health and advancing university goals. Considering the shifting federal discourse on health promotion over time and the vulnerability of social and health sciences to changes in research funding priorities, health promotion research centres in Canada and elsewhere may need to articulate their unique roles and contributions in order to maintain a critical focus on health promotion research. The authors briefly describe the Atlantic Health Promotion Research Centre (AHPRC), propose a framework that illustrates six essential roles of health promotion research centres and describe the policy contexts and challenges of health promotion research centres. The analysis of research and knowledge translation activities over 15 years at AHPRC sheds light on the roles that health promotion research centres play in applied research. The conclusion raises questions regarding the value of university-based research centres and challenges to their sustainability. PMID:19171668

  3. Space research at the Technical Research Centre of Finland (VTT)

    NASA Astrophysics Data System (ADS)

    Kelhae, Vaeinoe

    The Technical Research Center of Finland (VTT) performs research in satellite communication, remote sensing, and space techniques and instruments. Its objectives are space-related development in industry, promotion of applications, and instruments for space research. Several programs are discussed: TELE-X satellite, Aspera (plasma analyzer on Phobos), solar panel technologies, telecommunications and remote sensing with ESA and USSR, participation in the Finnish Energetic and Relativistic Nuclear Electron (ERNE)-CEPAC energetic particle analyzer, French and Finnish ERNE-SWAN project flying on the Solar and Heliospheric Observatory (SOHO) to measure solar wind anisotropy, GOMOS (Global Ozone Monitor), and the Silicon X-ray Array (SIXA) detector for the Soviet Spectrum-X satellite.

  4. Addiction research centres and the nurturing of creativity. The Centre for Alcohol and Drug Research: social science alcohol and drug research in Denmark.

    PubMed

    Pedersen, Mads U; Elmeland, Karen; Frank, Vibeke A

    2011-12-01

    The purpose of this paper is to introduce the social science alcohol and drug research undertaken by the Centre for Alcohol and Drug Research (CRF) and at the same time offer an insight into the development in Danish alcohol and drug research throughout the past 15-20 years. A review of articles, books and reports published by researcher from CRF from the mid-1990s until today and an analysis of the policy-making in the Danish substance use and misuse area. CRF is a result of the discussions surrounding social, health and allocation policy questions since the mid-1980s. Among other things, these discussions led to the formal establishment of the Centre in 1991 under the Aarhus University, the Faculty of Social Science. Since 2001 the Centre has received a permanent basic allocation, which has made it possible to appoint tenured senior researchers; to work under a more long-term research strategy; to function as a milieu for educating PhD students; and to diversify from commissioned research tasks to initiating projects involving more fundamental research. Research at the Centre is today pivoted around four core areas: consumption, policy, prevention and treatment. The emergence, continuation, financing and character of the research taking place at CRF can be linked closely to the specific Danish drug and alcohol discourse and to the division of the responsibility for alcohol and drug research into separate Ministries. © 2010 The Authors, Addiction © 2010 Society for the Study of Addiction.

  5. Clinical Patterns of Candida Infections in Bombay.

    PubMed

    Dalal, J Pratiba; Kelkar, S S

    1980-01-01

    One hundred consecutive cases of candidiasis in Bombay were studied. In each case the suspicion was confirmed by isolation typing of the Candida species. The clinical was as follows: vulvo-vaginitis 30%; intertrigo 18%; onychia and paronychia 12%; thrush 16%; generalised cutaneous candidasis 8%, enteritis 3%; bronchitis 12% and urinary tract infection 1%. When compared to a study carried out in Bombay in 1966, there was an increase in the frequency of disseminated cutaneous candidiasis and a reduction in the cases of intertrigo and onychia and paronychia.

  6. Research in subsea welding technology at the National Hyperbaric Centre

    SciTech Connect

    Gibson, D.E.; Liddle, D.; Richardson, I.M.

    1993-12-31

    The National Hyperbaric Centre in Aberdeen is a testing facility used by diving contractors, manufacturers and offshore operators for testing of their equipment and procedures. The onshore saturation diving system is used for the qualification of hyperbaric welding procedures and diver welders. Research and development projects are also ongoing at NHC. During the past year, work has focused on the development of synergic MIG and Fluxcored wire welding parameters for the subsea repair of offshore structures. A robot welding system has been installed for operation in the large test chamber. Various aspects of health and safety in hyperbaric welding have also been addressed. These include a survey of current practice by contractors regarding welding fumes and gases and the development of an ozone monitoring system suitable for use in welding habitats.

  7. Genomic analysis of para-Bombay individuals in south-eastern China: the possibility of linkage and disequilibrium between FUT1 and FUT2

    PubMed Central

    Zhang, Ai; Chi, Quan; Ren, Benchun

    2015-01-01

    Background The para-Bombay phenotype results from a variety of mutations in the α-(1,2)-fucosyltransferase gene (FUT1). We investigated samples from seven Chinese probands serologically typed as having the para-Bombay phenotype. Materials and methods The para-Bombay phenotype was identified by standard serological methods. Genetic mutations of FUT1 and FUT2 genes were analysed by DNA sequencing. Heterozygous mutations of FUT1 were identified by TOPO cloning sequencing. Blood samples from 331 randomly-selected Chinese donors were analysed with the SNaPshot system to distinguish five known mutations (Se C357T, A385T, G428A, G716A and FUT1 880delTT) in the FUT1 and FUT2 genes. The genetic characteristics of all para-Bombay probands identified in the Fujian Blood Centre, including those in the present study, were also summarised. Results Three FUT1 genotypes, h1/h1 (5 individuals), h1/h6 (1 individual) and h3/h2 (1 individual), and three FUT2 genotypes, Se357/Se357 (5 individuals), Se357/Se357, 385 (1 individual) and Se357/Se357, 716 (1 individual) were observed in seven para-Bombay probands. Among 331 donors, only one individual carried the G716A and 880delTT mutations in heterozygosity; this subjects FUT1 and FUT2 genotypes were H/h2 and Se357/Se357, 716, respectively. Conclusion The review of all para-Bombay probands identified in the Fujian Blood Centre showed that h1 and h2 are the predominant non-functional FUT1 alleles in Fujian para-Bombay individuals. Our data confirm the hypothesis that the h2 allele is linked to Se357, 716, and the concurrence of unique FUT1 and FUT2 mutations is geographically specific. PMID:25761312

  8. Genomic analysis of para-Bombay individuals in south-eastern China: the possibility of linkage and disequilibrium between FUT1 and FUT2.

    PubMed

    Zhang, Ai; Chi, Quan; Ren, Benchun

    2015-07-01

    The para-Bombay phenotype results from a variety of mutations in the α-(1,2)-fucosyltransferase gene (FUT1). We investigated samples from seven Chinese probands serologically typed as having the para-Bombay phenotype. The para-Bombay phenotype was identified by standard serological methods. Genetic mutations of FUT1 and FUT2 genes were analysed by DNA sequencing. Heterozygous mutations of FUT1 were identified by TOPO cloning sequencing. Blood samples from 331 randomly-selected Chinese donors were analysed with the SNaPshot system to distinguish five known mutations (Se C357T, A385T, G428A, G716A and FUT1 880delTT) in the FUT1 and FUT2 genes. The genetic characteristics of all para-Bombay probands identified in the Fujian Blood Centre, including those in the present study, were also summarised. Three FUT1 genotypes, h1/h1 (5 individuals), h1/h6 (1 individual) and h3/h2 (1 individual), and three FUT2 genotypes, Se(357)/Se(357) (5 individuals), Se(357)/Se(357, 385) (1 individual) and Se(357)/Se(357, 716) (1 individual) were observed in seven para-Bombay probands. Among 331 donors, only one individual carried the G716A and 880delTT mutations in heterozygosity; this subjects FUT1 and FUT2 genotypes were H/h2 and Se(357)/Se(357, 716), respectively. The review of all para-Bombay probands identified in the Fujian Blood Centre showed that h1 and h2 are the predominant non-functional FUT1 alleles in Fujian para-Bombay individuals. Our data confirm the hypothesis that the h2 allele is linked to Se(357, 716), and the concurrence of unique FUT1 and FUT2 mutations is geographically specific.

  9. Research Informed Science Enrichment Programs at the Gravity Discovery Centre

    ERIC Educational Resources Information Center

    Venville, Grady; Blair, David; Coward, David; Deshon, Fred; Gargano, Mark; Gondwe, Mzamose; Heary, Auriol; Longnecker, Nancy; Pitts, Marina; Zadnik, Marjan

    2012-01-01

    Excursions to museums and science centres generally are great fun for students and teachers. The potential educational benefits beyond enjoyment, however, are rarely realised or analysed for their efficacy. The purpose of this paper is to describe four educational enrichment programs delivered at the Gravity Discovery Centre (GDC), near Gingin,…

  10. Research Informed Science Enrichment Programs at the Gravity Discovery Centre

    ERIC Educational Resources Information Center

    Venville, Grady; Blair, David; Coward, David; Deshon, Fred; Gargano, Mark; Gondwe, Mzamose; Heary, Auriol; Longnecker, Nancy; Pitts, Marina; Zadnik, Marjan

    2012-01-01

    Excursions to museums and science centres generally are great fun for students and teachers. The potential educational benefits beyond enjoyment, however, are rarely realised or analysed for their efficacy. The purpose of this paper is to describe four educational enrichment programs delivered at the Gravity Discovery Centre (GDC), near Gingin,…

  11. 2016 INCAM Research Symposium: Expanding Person-Centred Care through Integrative Health Research.

    PubMed

    Boon, Heather; Gaboury, Isabelle; Balneaves, Lynda G; Tsui, Teresa; Ng, Jeremy Y; Bozinovski, Natalie

    2016-12-01

    The following are abstracts of research presentations given at the 9th INCAM Research Symposium. The theme for this year's conference was "Expanding Person-Centred Care through Integrative Health Research", which was held on November 18 and 19, 2016 at the Toronto Marriott Bloor Yorkville Hotel in Ontario, Canada. The abstracts are grouped under the categories of oral or poster presentation based on their presentation at the Symposium. For more information, please visit: http://www.iscmr.org/content/canadian-chapter---public.

  12. Head and Neck Mycetoma: The Mycetoma Research Centre Experience

    PubMed Central

    Fahal, Ahmed; Mahgoub, EL Sheikh; EL Hassan, Ahmed Mohamed; Jacoub, Angom Osman; Hassan, Doaa

    2015-01-01

    Mycetoma is a unique neglected tropical disease which is endemic in what is known as the “mycetoma belt”. The disease has many devastating impacts on patients and communities in endemic area and is characterised by massive deformity, destruction and disability. Mycetoma is commonly seen in the foot and hand and less frequent in other parts of the body. Mycetoma of the head and neck is a rarity and is associated with high morbidity and even mortality if not treated early. In this communication we report on 49 patients with head and neck mycetoma followed up at the Mycetoma Research Centre in Khartoum. Most of the reported patients had actinomycetoma and the majority were young adult males from mycetoma endemic areas in the Sudan. Most of them were students, farmers and workers. Prior to presentation the majority had long disease duration and the cause was multifactorial. Advanced disease with massive lesion, deformity and disability was the common presentation. There was no obvious history of local trauma, familial tendency or other predisposing factor identified in this group of patients. MRI and CT scan were the most accurate diagnostic tools to determine the disease extent. The treatment outcome was rather poor and characterised by low cure rate, poor outcome and high follows-up dropout. Such a gloomy outcome calls for structured and objective health education programs. PMID:25768090

  13. Head and neck mycetoma: the mycetoma research centre experience.

    PubMed

    Fahal, Ahmed; Mahgoub, El Sheikh; El Hassan, Ahmed Mohamed; Jacoub, Angom Osman; Hassan, Doaa

    2015-03-01

    Mycetoma is a unique neglected tropical disease which is endemic in what is known as the "mycetoma belt". The disease has many devastating impacts on patients and communities in endemic area and is characterised by massive deformity, destruction and disability. Mycetoma is commonly seen in the foot and hand and less frequent in other parts of the body. Mycetoma of the head and neck is a rarity and is associated with high morbidity and even mortality if not treated early. In this communication we report on 49 patients with head and neck mycetoma followed up at the Mycetoma Research Centre in Khartoum. Most of the reported patients had actinomycetoma and the majority were young adult males from mycetoma endemic areas in the Sudan. Most of them were students, farmers and workers. Prior to presentation the majority had long disease duration and the cause was multifactorial. Advanced disease with massive lesion, deformity and disability was the common presentation. There was no obvious history of local trauma, familial tendency or other predisposing factor identified in this group of patients. MRI and CT scan were the most accurate diagnostic tools to determine the disease extent. The treatment outcome was rather poor and characterised by low cure rate, poor outcome and high follows-up dropout. Such a gloomy outcome calls for structured and objective health education programs.

  14. Addiction research centres and the nurturing of creativity: National Drug Dependence Treatment Centre, India--a profile.

    PubMed

    Ray, Rajat; Dhawan, Anju; Chopra, Anita

    2013-10-01

    The National Drug Dependence Treatment Centre (NDDTC) is a part of the All India Institute of Medical Sciences, a premier autonomous medical university in India. This article provides an account of its origin and its contribution to the field of substance use disorder at the national and international levels. Since its establishment, the NDDTC has played a major role in the development of various replicable models of care, the training of post-graduate students of psychiatry, research, policy development and planning. An assessment of the magnitude of drug abuse in India began in the early 1990s and this was followed by a National Survey on Extent, Patterns and Trends of Drug Abuse in 2004. Several models of clinical care have been developed for population subgroups in diverse settings. The centre played an important role in producing data and resource material which helped to scale up opioid substitution treatment in India. A nationwide database on the profile of patients seeking treatment (Drug Abuse Monitoring System) at government drug treatment centres has also been created. The centre has provided valuable inputs for the Government of India's programme planning. Besides clinical studies, research has also focused on pre-clinical studies. Capacity-building is an important priority, with training curricula and resource material being developed for doctors and paramedical staff. Many of these training programmes are conducted in collaboration with other institutions in the country. The NDDTC has received funding from several national and international organizations for research and scientific meetings, and, most recently (2012), it has been designated as a World Health Organization Collaborating Centre on Substance Abuse.

  15. Transregional Collaborative Research Centre 32: Patterns in Soil-Vegetation

    NASA Astrophysics Data System (ADS)

    Kollet, S. J.; Simmer, C.; Masbou, M.; Boessenkool, K.; Crewell, S.; Diekkruger, B.; Huber, K.; Klitzsch, N.; Koyama, C. N.; Vereecken, H.

    2011-12-01

    The soil, vegetation and the lower atmosphere (SVA) are key compartments of the Earth, where almost all activities of mankind take place. This region is characterized by extremely complex patterns, structures and processes that act at different temporal and spatial scales. While the exchange of energy, water and carbon is continuous between the different compartments, the pertinent fluxes are strongly heterogeneous and variable in space and time. The overarching TR32 paradigm is that the characterisation of structures and patterns will lead to a deeper qualitative and quantitative understanding of the SVA system, and ultimately to better predictions of the SVA state. The TR32 combines research groups in the field of soil and plant science, remote sensing, hydrology, meteorology and mathematics located at the Universities of Aachen, Bonn, Braunschweig and Cologne and the Research Centre Juelich study the soil-vegetation atmosphere system under the novel holistic paradigm of patterns. To understand the mechanisms leading to spatial and temporal patterns in energy and matter fluxes of the SVA system we link experiments and theory via model-observation integration. Focusing our research on the Rur Catchment (Germany), patterns are monitored since 2006 continuously using existing and novel geophysical and remote sensing techniques from the local to the catchment scale based on ground penetrating radar methods, induced polarization, radiomagnetotellurics, electrical resistivity tomography, boundary layer scintillometry, lidar techniques, microwave radiometry, and precipitation radars with polarization diversity. Modeling approaches involve high resolution numerical weather prediction (NWP; 400m) and hydrological models (few meters). Example work from the first phase includes the transfer of laboratory methods to the field; the measurements of patterns of soil-carbon, evapotranspiration and respiration measured in the field; catchment-scale modeling of exchange processes

  16. Hand Mycetoma: The Mycetoma Research Centre Experience and Literature Review

    PubMed Central

    Omer, Rowa Fathelrahman; Seif EL Din, Nancy; Abdel Rahim, Fadwa Awad; Fahal, Ahmed Hassan

    2016-01-01

    Mycetoma is a devastating, neglected tropical disease characterised by extensive tissue involvement resulting in destruction, deformities and disabilities in the affected patients. The hand is commonly affected by mycetoma thus compromises its functionality and hinder the patient’s daily activities of living. In this communication, we report on 533 patients with hand mycetoma managed over a period of 24 years at the Mycetoma Research Centre, University of Khartoum, Khartoum, Sudan. Eumycetoma was the commonest type of mycetoma (83.3%) encountered. Males were predominately affected (69.2%) with a sex ratio of 2.2:1. The majority of the patients (84%) were young adult below the age of 40 years old at presentation. The generality of patients (86.4%) were from the Sudan mycetoma belt. Children and adolescents (28.1%), farmers (18.2%) and workers (17.4%) were more frequently affected. The majority of patients (67.4%) had disease duration of less than 5 years at presentation. The study, did not document significant history of local trauma, familial tendency, concomitant medical diseases or other predisposing cause for mycetoma in this population. Pain (23.1%) was not a disease feature in this series and 52% of patients had past surgery for mycetoma and recurrence. The right hand was affected most (60.4%), and 64% of them had small lesion at presentation. Conventional x-ray was only helpful in patients with advanced disease and the MRI accurately determined the disease extension. Cytological smears, surgical biopsies histopathological examination and grains culture were the principal diagnostic tools for causative organisms’ identification. In the present series it was difficult to determine the treatment outcome due to high patients follow up dropout. PMID:27483367

  17. Hand Mycetoma: The Mycetoma Research Centre Experience and Literature Review.

    PubMed

    Omer, Rowa Fathelrahman; Seif El Din, Nancy; Abdel Rahim, Fadwa Awad; Fahal, Ahmed Hassan

    2016-08-01

    Mycetoma is a devastating, neglected tropical disease characterised by extensive tissue involvement resulting in destruction, deformities and disabilities in the affected patients. The hand is commonly affected by mycetoma thus compromises its functionality and hinder the patient's daily activities of living. In this communication, we report on 533 patients with hand mycetoma managed over a period of 24 years at the Mycetoma Research Centre, University of Khartoum, Khartoum, Sudan. Eumycetoma was the commonest type of mycetoma (83.3%) encountered. Males were predominately affected (69.2%) with a sex ratio of 2.2:1. The majority of the patients (84%) were young adult below the age of 40 years old at presentation. The generality of patients (86.4%) were from the Sudan mycetoma belt. Children and adolescents (28.1%), farmers (18.2%) and workers (17.4%) were more frequently affected. The majority of patients (67.4%) had disease duration of less than 5 years at presentation. The study, did not document significant history of local trauma, familial tendency, concomitant medical diseases or other predisposing cause for mycetoma in this population. Pain (23.1%) was not a disease feature in this series and 52% of patients had past surgery for mycetoma and recurrence. The right hand was affected most (60.4%), and 64% of them had small lesion at presentation. Conventional x-ray was only helpful in patients with advanced disease and the MRI accurately determined the disease extension. Cytological smears, surgical biopsies histopathological examination and grains culture were the principal diagnostic tools for causative organisms' identification. In the present series it was difficult to determine the treatment outcome due to high patients follow up dropout.

  18. Addiction research centres and the nurturing of creativity: the Kurihama medical and addiction centre-a profile.

    PubMed

    Tohyama, Tomomi; Yokoyama, Akira; Matsushita, Sachio; Higuchi, Susumu

    2014-01-01

    The Kurihama Medical and Addiction Center began to conduct research and to provide medical care for alcohol-related problems in 1963, when special alcoholism treatment wards were established in Japan for the first time. At first, the provision of medical care to patients was prioritized. However, training courses for specialists were initiated in 1975, and the Department of Clinical Research was established in 1984, which led to the formation of the present management structure in which the centre's staff are shared by three departments: Medical Care, Clinical Research and Education and Information. The Department of Medical Care provides specialized treatment for alcohol use disorders and medical services for other conditions, including behavioural addictions such as internet addiction and gambling disorder, as well as dementia and other psychiatric disorders. The Departments of Clinical Research and Education and Information are engaged mainly in specialized activities related to alcohol. The Department of Clinical Research conducts research on the epidemiology of alcohol use, the effects of alcohol on health and the treatment of alcohol use disorders in Japan, in cooperation with universities and other research institutions. The Department of Education and Information fosters the human capacity to achieve the primary, secondary and tertiary prevention of alcohol-related problems and the dissemination of information on alcohol. The centre also performs alcohol-related problem prevention activities, government consultations and international collaborative research and personal exchanges, thereby functioning as a central institution for alcohol policy-based medical services and research in Japan.

  19. Molecular basis for H blood group deficiency in Bombay (Oh) and para-Bombay individuals.

    PubMed Central

    Kelly, R J; Ernst, L K; Larsen, R D; Bryant, J G; Robinson, J S; Lowe, J B

    1994-01-01

    The penultimate step in the biosynthesis of the human ABO blood group oligosaccharide antigens is catalyzed by alpha-(1,2)-fucosyltransferase(s) (GDP-L-fucose: beta-D-galactoside 2-alpha-L-fucosyltransferase, EC 2.4.1.69), whose expression is determined by the H and Secretor (SE) blood group loci (also known as FUT1 and FUT2, respectively). These enzymes construct Fuc alpha 1-->2Gal beta-linkages, known as H determinants, which are essential precursors to the A and B antigens. Erythrocytes from individuals with the rare Bombay and para-Bombay blood group phenotypes are deficient in H determinants, and thus A and B determinants, as a consequence of apparent homozygosity for null alleles at the H locus. We report a molecular analysis of a human alpha-(1,2)-fucosyltransferase gene, thought to correspond to the H blood group locus, in a Bombay pedigree and a para-Bombay pedigree. We find inactivating point mutations in the coding regions of both alleles of this gene in each H-deficient individual. These results define the molecular basis for H blood group antigen deficiency in Bombay and para-Bombay phenotypes, provide compelling evidence that this gene represents the human H blood group locus, and strongly support a hypothesis that the H and SE loci represent distinct alpha-(1,2)-fucosyltransferase genes. Candidate sequences for the human SE locus are identified by low-stringency Southern blot hybridization analyses, using a probe derived from the H alpha-(1,2)-fucosyltransferase gene. Images PMID:7912436

  20. Molecular basis for H blood group deficiency in Bombay (Oh) and para-Bombay individuals.

    PubMed

    Kelly, R J; Ernst, L K; Larsen, R D; Bryant, J G; Robinson, J S; Lowe, J B

    1994-06-21

    The penultimate step in the biosynthesis of the human ABO blood group oligosaccharide antigens is catalyzed by alpha-(1,2)-fucosyltransferase(s) (GDP-L-fucose: beta-D-galactoside 2-alpha-L-fucosyltransferase, EC 2.4.1.69), whose expression is determined by the H and Secretor (SE) blood group loci (also known as FUT1 and FUT2, respectively). These enzymes construct Fuc alpha 1-->2Gal beta-linkages, known as H determinants, which are essential precursors to the A and B antigens. Erythrocytes from individuals with the rare Bombay and para-Bombay blood group phenotypes are deficient in H determinants, and thus A and B determinants, as a consequence of apparent homozygosity for null alleles at the H locus. We report a molecular analysis of a human alpha-(1,2)-fucosyltransferase gene, thought to correspond to the H blood group locus, in a Bombay pedigree and a para-Bombay pedigree. We find inactivating point mutations in the coding regions of both alleles of this gene in each H-deficient individual. These results define the molecular basis for H blood group antigen deficiency in Bombay and para-Bombay phenotypes, provide compelling evidence that this gene represents the human H blood group locus, and strongly support a hypothesis that the H and SE loci represent distinct alpha-(1,2)-fucosyltransferase genes. Candidate sequences for the human SE locus are identified by low-stringency Southern blot hybridization analyses, using a probe derived from the H alpha-(1,2)-fucosyltransferase gene.

  1. The para-Bombay phenotype in Chinese persons.

    PubMed

    Lin-Chu, M; Broadberry, R E; Tsai, S J; Chiou, P W

    1987-01-01

    The para-Bombay phenotype occurs more frequently in Oriental than in white populations. This report describes the immunohematologic findings in 20 cases of the para-Bombay phenotype detected over a period of about 15 months in the Chinese population of Taiwan.

  2. Bioelectromagnetics Research within an Australian Context: The Australian Centre for Electromagnetic Bioeffects Research (ACEBR)

    PubMed Central

    Loughran, Sarah P.; Al Hossain, Md Shahriar; Bentvelzen, Alan; Elwood, Mark; Finnie, John; Horvat, Joseph; Iskra, Steve; Ivanova, Elena P.; Manavis, Jim; Mudiyanselage, Chathuranga Keerawella; Lajevardipour, Alireza; Martinac, Boris; McIntosh, Robert; McKenzie, Raymond; Mustapic, Mislav; Nakayama, Yoshitaka; Pirogova, Elena; Rashid, M. Harunur; Taylor, Nigel A.; Todorova, Nevena; Wiedemann, Peter M.; Vink, Robert; Wood, Andrew; Yarovsky, Irene; Croft, Rodney J.

    2016-01-01

    Mobile phone subscriptions continue to increase across the world, with the electromagnetic fields (EMF) emitted by these devices, as well as by related technologies such as Wi-Fi and smart meters, now ubiquitous. This increase in use and consequent exposure to mobile communication (MC)-related EMF has led to concern about possible health effects that could arise from this exposure. Although much research has been conducted since the introduction of these technologies, uncertainty about the impact on health remains. The Australian Centre for Electromagnetic Bioeffects Research (ACEBR) is a National Health and Medical Research Council Centre of Research Excellence that is undertaking research addressing the most important aspects of the MC-EMF health debate, with a strong focus on mechanisms, neurodegenerative diseases, cancer, and exposure dosimetry. This research takes as its starting point the current scientific status quo, but also addresses the adequacy of the evidence for the status quo. Risk communication research complements the above, and aims to ensure that whatever is found, it is communicated effectively and appropriately. This paper provides a summary of this ACEBR research (both completed and ongoing), and discusses the rationale for conducting it in light of the prevailing science. PMID:27690076

  3. Bioelectromagnetics Research within an Australian Context: The Australian Centre for Electromagnetic Bioeffects Research (ACEBR).

    PubMed

    Loughran, Sarah P; Al Hossain, Md Shahriar; Bentvelzen, Alan; Elwood, Mark; Finnie, John; Horvat, Joseph; Iskra, Steve; Ivanova, Elena P; Manavis, Jim; Mudiyanselage, Chathuranga Keerawella; Lajevardipour, Alireza; Martinac, Boris; McIntosh, Robert; McKenzie, Raymond; Mustapic, Mislav; Nakayama, Yoshitaka; Pirogova, Elena; Rashid, M Harunur; Taylor, Nigel A; Todorova, Nevena; Wiedemann, Peter M; Vink, Robert; Wood, Andrew; Yarovsky, Irene; Croft, Rodney J

    2016-09-29

    Mobile phone subscriptions continue to increase across the world, with the electromagnetic fields (EMF) emitted by these devices, as well as by related technologies such as Wi-Fi and smart meters, now ubiquitous. This increase in use and consequent exposure to mobile communication (MC)-related EMF has led to concern about possible health effects that could arise from this exposure. Although much research has been conducted since the introduction of these technologies, uncertainty about the impact on health remains. The Australian Centre for Electromagnetic Bioeffects Research (ACEBR) is a National Health and Medical Research Council Centre of Research Excellence that is undertaking research addressing the most important aspects of the MC-EMF health debate, with a strong focus on mechanisms, neurodegenerative diseases, cancer, and exposure dosimetry. This research takes as its starting point the current scientific status quo, but also addresses the adequacy of the evidence for the status quo. Risk communication research complements the above, and aims to ensure that whatever is found, it is communicated effectively and appropriately. This paper provides a summary of this ACEBR research (both completed and ongoing), and discusses the rationale for conducting it in light of the prevailing science.

  4. Centre for Educational Research and iInnovation; Purpose, Programmes, Progress.

    ERIC Educational Resources Information Center

    Organisation for Economic Cooperation and Development, Paris (France).

    The Centre for Educational Research and Innovation (CERI) was established so that educational change in Organisation for Economic Co-Operation and Development (OECD) countries could be accomplished through a coherent, continuing process of development and experimentation. The main objectives for the Centre are to promote and support the…

  5. Addiction research centres and the nurturing of creativity: Centre for Social Research on Alcohol and Drugs (SoRAD), Stockholm University, Sweden.

    PubMed

    Stenius, Kerstin; Ramstedt, Mats; Olsson, Börje

    2010-03-01

    The Centre for Social Research on Alcohol and Drugs (SoRAD) was established as a national research centre and department within the Faculty of Social Science at Stockholm University in 1997, following a Government Report and with the aim to strengthen social alcohol and drug research. Initially, core funding came from the Swedish Council for Working Life and Social Research and from the Ministry of Health and Social Affairs for several long-term projects. Today, SoRAD, with 25 senior and junior researchers, has core funding from the university but most of its funding comes from external national and international grants. Research is organized under three themes: consumption, problems and norms, alcohol and drug policy and societal reactions, treatment and recovery processes. SoRADs scientific approach, multi-disciplinarity, a mix of qualitative and quantitative methods and international comparisons was established by the centre's first leader, Robin Room. Regular internal seminars are held and young researchers are encouraged to attend scientific meetings and take part in collaborative projects. SoRAD researchers produce government-funded monthly statistics on alcohol consumption and purchase, and take part in various national government committees, but SoRADs research has no clear political or bureaucratic constraints. One of the future challenges for SoRAD will be the proposed system for university grants allocation, where applied social science will have difficulties competing with basic biomedical research if decisions are based on publication and citation measures.

  6. The Bombay blood group: are we out of risk?

    PubMed

    Dipta, T F; Hossain, A Z

    2011-07-01

    The Bombay blood group is a rare blood group, phenotypes of this group lacking H antigen on the red cell membrane and have anti-H in the serum. It fails to express any A, B or H antigen on their red cells or other tissues. The existence of a human H/h genetic polymorphism was first established by Bhende et al. As first discovery in Bombay (Mumbai), in India in 1952, so the name of this rare blood group is known as Bombay blood group. People having Bombay phenotype are mostly confined to the Southeast Asia. Around 179 persons in India with a frequency of 1 in 10,000 have "Bombay Blood group". A high level of consanguinity present among the parents of the Bombay phenotype. The classic Bombay phenotype has been reported in those of Indian descendent. It is quite rare in Caucasian with an incidence of 1 in 250,000. As because in our country there is routine practice of "only forward or cell type grouping" using finger prick method by voluntary blood donors organization and various blood banks; so there is tremendous chance of misinterpretation or unexploration of this Bombay blood group. When misdiagnosed, this Bombay group can cause fatal haemolytic transfusion reaction. For this reason our suggestion is to incorporate "routine serum typing or reverse grouping confirmation" along with 'O' cell control in reverse grouping procedure in every Transfusion Medicine Department or Blood Bank or Blood Donor Centers and this practice should be mandatory to reduce the risk of fatal haemolytic transfusion reaction. In this view we will highlight the incidence, molecular biology and clinical significance of this rare and fatal blood group.

  7. Is naturalistic driving research possible with highly instrumented cars? Lessons learnt in three research centres.

    PubMed

    Valero-Mora, Pedro M; Tontsch, Anita; Welsh, Ruth; Morris, Andrew; Reed, Steven; Touliou, Katerina; Margaritis, Dimitris

    2013-09-01

    This paper provides an overview of the experiences using Highly Instrumented Cars (HICs) in three research Centres across Europe; Spain, the UK and Greece. The data collection capability of each car is described and an overview presented relating to the relationship between the level of instrumentation and the research possible. A discussion then follows which considers the advantages and disadvantages of using HICs for ND research. This includes the obtrusive nature of the data collection equipment, the cost of equipping the vehicles with sophisticated Data Acquisition Systems (DAS) and the challenges for data storage and analysis particularly with respect to video data. It is concluded that the use of HICs substantially increases the depth of knowledge relating to the driver's behaviour and their interaction with the vehicle and surroundings. With careful study design and integration into larger studies with Low(ly) instrumented Cars (LICs), HICs can contribute significantly and in a relatively naturalistic manner to the driver behaviour research.

  8. BrisSynBio: a BBSRC/EPSRC-funded Synthetic Biology Research Centre.

    PubMed

    Sedgley, Kathleen R; Race, Paul R; Woolfson, Derek N

    2016-06-15

    BrisSynBio is the Bristol-based Biotechnology and Biological Sciences Research Council (BBSRC)/Engineering and Physical Sciences Research Council (EPSRC)-funded Synthetic Biology Research Centre. It is one of six such Centres in the U.K. BrisSynBio's emphasis is on rational and predictive bimolecular modelling, design and engineering in the context of synthetic biology. It trains the next generation of synthetic biologists in these approaches, to facilitate translation of fundamental synthetic biology research to industry and the clinic, and to do this within an innovative and responsible research framework. © 2016 The Author(s).

  9. BrisSynBio: a BBSRC/EPSRC-funded Synthetic Biology Research Centre

    PubMed Central

    Sedgley, Kathleen R.; Race, Paul R.; Woolfson, Derek N.

    2016-01-01

    BrisSynBio is the Bristol-based Biotechnology and Biological Sciences Research Council (BBSRC)/Engineering and Physical Sciences Research Council (EPSRC)-funded Synthetic Biology Research Centre. It is one of six such Centres in the U.K. BrisSynBio's emphasis is on rational and predictive bimolecular modelling, design and engineering in the context of synthetic biology. It trains the next generation of synthetic biologists in these approaches, to facilitate translation of fundamental synthetic biology research to industry and the clinic, and to do this within an innovative and responsible research framework. PMID:27284028

  10. Pockets of Participation: Revisiting Child-Centred Participation Research

    ERIC Educational Resources Information Center

    Franks, Myfanwy

    2011-01-01

    This article revisits the theme of the clash of interests and power relations at work in participatory research which is prescribed from above. It offers a possible route toward solving conflict between adult-led research carried out by young researchers, funding requirements and organisational constraints. The article explores issues of…

  11. Peripheries and Centres: Research Universities in Developing Countries

    ERIC Educational Resources Information Center

    Altbach, Philip G.

    2007-01-01

    The research university is a central institution of the 21st century--providing access to global science, producing basic and applied research, and educating key leaders for academe and society. Worldwide, there are very few research universities--they are expensive to develop and support, and the pressures of massification have placed priorities…

  12. What specifications for a centre or network of excellence in clinical research?

    PubMed

    Diebolt, Vincent; Lang, Marie; Thoby, Frédérique

    2016-02-01

    The Giens 2015 Workshop Round Table entitled "What specifications for a centre or network of excellence in clinical research?" took a viewpoint distinct from earlier work and studies on changes in clinical research activities in France. The purpose of the present work was to identify, starting from concrete examples, the main strengths and advantages of clinical research activity in France related, in part, to the background environment and also to the specific characteristics of the investigation centres considered to be among the most high-performance units in activity. The criteria retained were grouped into a set of specifications that could be used to establish a "label of excellence" upon which the different teams and clinical research centres could model themselves. It was thus considered that belonging to a centre or structured network with at least a national configuration, when this is possible for the medial topic in question, constitutes a real advantage. Four benchmarks were identified: the scientific and clinical expertise of the head investigator, as well as the qualification and operational capacity of the centre's team; definition and measurement of performance using clearly displayed indicators and evaluation procedures; the quality of the overall trial "process" and of each of its component steps; communication, because know-how and promotion go hand in hand, with the main objective of informing the professional and general public about the value of the research centre meeting the above-mentioned criteria, about its networks of competencies, and more generally, about the important assets of the background of clinical research in France. This sector of research is funded by the public authorities via calls for public grants, financial aids for structures supporting clinical research in the University Hospital Centres and other healthcare institutions allowing for a professionalization of the research occupations, and the national public health

  13. Cancer-related psychosocial research: what are the perspectives of cancer care centre users on participation?

    PubMed

    Hepworth, Julie; Robertson, Ann R R; Jhunjhunwala, Anita; Jarvis, Glyn C; McVittie, Chris

    2011-07-01

    To explore the perspectives of cancer care centre users on participation in psychosocial research to inform research design and ethics. The study is based on a qualitative research design. Fourteen semistructured interviews were carried in people diagnosed with cancer and carers. The interview included four main questions about practical barriers to participation, types of research design, motivating factors and the conduct of research in a cancer care support setting. The data were analysed using qualitative content analysis. Interviewees demonstrated a willingness to participate in psychosocial research within certain circumstances. There were no practical barriers identified, although they considered payment for research-related travel important. The most acceptable research design was the face-to-face interview and the least preferred was the randomised control trial. The factors that motivated participation were altruism, valuing research, and making a contribution to the centre. Interviewees supported the conduct of research in cancer care support centres conditional upon delaying recruitment during the initial months of users' visits and its need to be discreet to avoid deterring visitors from accessing the centre. The study concludes that the personal interaction between participants and researchers is the most important feature of decision-making by patients/carers to join studies. Taking into account the perspectives of people affected by cancer during the early stages of research design may enhance recruitment and retention and can contribute to the development of research protocols and ethics.

  14. A Bangladeshi family with three sisters 'Bombay' or Oh phenotype.

    PubMed

    Rahman, M; Abdullah, A Z; Husain, M; Hague, K M; Hossain, M M

    1990-12-01

    Three sisters in a same family (MIAH FAMILY) are of 'Bombay' phenotype. These being the first known female examples of 'Bombay' blood group have been detected in Bangladesh. As predicted by current theory their red cells are Le(a+b-) and their saliva do not contain any of the antigens A, B and H except Lea substance. Family studies showed that individuals with 'Bombay' or Oh phenotype may have A or B gene which are not expressed. This very particular type of blood is one of the rarest in any other parts of world except in India. Due to the presence of anti-H antibody in the plasma of Oh phenotype, when considering such patients for transfusion only blood of identical Bombay type can be safely transfused.

  15. Students' Reflective Essays as Insights into Student Centred-Pedagogies within the Undergraduate Research Methods Curriculum

    ERIC Educational Resources Information Center

    Hosein, Anesa; Rao, Namrata

    2017-01-01

    In higher education, despite the emphasis on student-centred pedagogical approaches, undergraduate research methods pedagogy remains surprisingly teacher-directed. Consequently, it may lead to research methods students assuming that becoming a researcher involves gathering information rather than it being a continuous developmental process. To…

  16. Students' Reflective Essays as Insights into Student Centred-Pedagogies within the Undergraduate Research Methods Curriculum

    ERIC Educational Resources Information Center

    Hosein, Anesa; Rao, Namrata

    2017-01-01

    In higher education, despite the emphasis on student-centred pedagogical approaches, undergraduate research methods pedagogy remains surprisingly teacher-directed. Consequently, it may lead to research methods students assuming that becoming a researcher involves gathering information rather than it being a continuous developmental process. To…

  17. Research priorities of international sporting federations and the IOC research centres

    PubMed Central

    Talpey, Scott; Bradshaw, Ashley; Soligard, Torbjorn; Engebretsen, Lars

    2016-01-01

    Background/aim To be fully effective, the prevention of injury in sport and promotion of athlete's health needs to be both targeted and underpinned by scientific evidence. This study aimed to identify the research priorities of International Sporting Federation (ISFs) compared to the current research focus of the International Olympic Committee Research Centres (IOC-RCs). Methods Online survey of ISF Medical Chairpersons (n=22, 69% response) and IOC-RC Directors (n=7, 78% response). Open-ended responses relating to injury/illness priorities and specific athlete targets were thematically coded. Ratings were given of the need for different research types according to the Translating Research into Injury Prevention Practice (TRIPP) Framework stages. Results are presented as the frequency of ISFs and IOC-RCs separately. Results Both ISFs and IOC-RFs prioritised research into concussion (27%, 72%, respectively), competitive overuse (23%, 43%) and youth (41%, 43%). The ISFs also ranked catastrophic injuries (14%), environmental factors (18%), elite athletes (18%) and Paralympic athletes (14%) as important. The IOC-RCs gave higher priority to preventing respiratory illness (43%), long-term health consequences of injury (43%) and recreational athletes (43%). There was a trend towards ISFs valuing TRIPP stage 5/6 research more highly and for the IOC-RCs to value TRIPP stage 1/2 research. Conclusions There are clear opportunities to better link the priorities and actions of the ISFs and IOC-RCs, to ensure more effective practice-policy-research partnerships for the benefit of all athletes. Setting a mutually-agreed research agenda will require further active engagement between researchers and broader ISF representatives. PMID:27900197

  18. Clinical research centre serves 70,000 patients annually.

    PubMed

    1992-01-01

    The Bangladesh, ICDDR,B's Clinical Research Center (CPR) is described since its inception in 1960 as the former Dhaka Hospital. As 1 of 4 divisions, the CRC has increased admissions for diarrheal diseases, which is associated with the respect earned within the population, and averages 70,000/year. Included in the discussion is consideration of the objectives of the CRC and its predecessor, patient care, research, training, physical facilities, and new and other activities. Early research objectives were to find a better protocol for treatment of diarrheal diseases. Cholera and other diarrheal disease findings contributed to the formulation of an iv fluid for the treatment of severely dehydrated patients. Oral rehydration therapy (ORT) research was also conducted at the center. The cholera death rate with treatment has been reduced to 1%. 70% of patients are children under 15 years old and 65% have some malnutrition. Patients in general come from Dhaka city and suburbs, but they also come from outside the district. Current research focuses on clinical management and basic pathophysiological and nutritional issues; efforts are underway to develop a super oral rehydration solution to improve special diets, and to determine successful implementation strategies. Medical, paramedical, and health workers are trained in establishing diarrheal treatment and training programs in other locations and in research methodologies. The Public Health Institutes has increased capacity to include a 60-bed inpatient ward, an intensive care unit of 12 beds, a 120-bed observation unit, a 30-bed research ward, and a traveler's clinic. The research ward also has an office and laboratory facility and endoscopic facilities with computers, icemakers, centrifuge, deep freezers, and a biological safety hood for sample processing and storage. During epidemics the facilities are still inadequate. Water supply and air cooling and electronic precision weighing scales are available. The Child Health

  19. The joint cardiovascular research profile of the university medical centres in the Netherlands.

    PubMed

    van Welie, S D; van Leeuwen, T N; Bouma, C J; Klaassen, A B M

    2016-05-01

    Biomedical scientific research in the Netherlands has a good reputation worldwide. Quantitatively, the university medical centres (UMCs) deliver about 40 % of the total number of scientific publications of this research. Analysis of the bibliometric output data of the UMCs shows that their research is highly cited. These output-based analyses also indicate the high impact of cardiovascular scientific research in these centres, illustrating the strength of this research in the Netherlands. A set of six joint national cardiovascular research topics selected by the UMCs can be recognised. At the top are heart failure, rhythm disorder research and atherosclerosis. National collaboration of top scientists in consortia in these three areas is successful in acquiring funding of large-scale programs. Our observations suggest that funding national consortia of experts focused on a few selected research topics may increase the international competitiveness of cardiovascular research in the Netherlands.

  20. Trends Shaping Education 2013. Centre for Educational Research and Innovation

    ERIC Educational Resources Information Center

    OECD Publishing (NJ3), 2013

    2013-01-01

    What does it mean for education that our societies are increasingly diverse? How is global economic power shifting towards new countries? In what ways are the skills required in the world of work changing? "Trends Shaping Education 2013" brings together international evidence to give policy makers, researchers, educational leaders, administrators…

  1. Clinical research and service centre: an institutional profile and programmes.

    PubMed

    Salam, M A

    1997-09-01

    The International Center for Diarrheal Disease Research, Bangladesh's (ICDDR,B) Clinical Research and Service Center (CRSC) provides free treatment to diarrheal patients; provides preventive health care to children and mothers; conducts clinical research upon diarrheal diseases and related aspects of nutrition; and provides training to health care providers in managing diarrheal diseases and conducting clinical and operations research. 930,860 patients were treated at CRSC during 1987-96 and more than 110,000 patients are now being treated annually at the facility. While most CRSC patients come from Dhaka city and its suburbs, some also come from remote corners of the country. About 60% of the center's patients are children under age 5 years and most patients are socioeconomically disadvantaged. For example, almost half of patients' mothers have no formal education. The CRSC, commonly known as the Cholera Hospital, is unique in that about 94% of its patients are mainly cared for by trained nurses either in the Oral Rehydration Triage or Short Stay Ward of the hospital. About 40% of patients are discharged within 1-2 hours and 60% within 12 hours. Approximately 80% of the children attending the CRSC are malnourished. Mothers are taught how to improve the nutritional status of their children, simple ways to generate income for the family, and the merits of breast feeding.

  2. Addiction Research Centres and the Nurturing of Creativity

    PubMed Central

    Heilig, Markus; Warren, Kenneth R.; Kunos, George; Silverman, Peter B.; Hewitt, Brenda G.

    2010-01-01

    The aim of this paper is to present a concise account of the history, mission, structure and some recent achievements of the US National Institute on Alcohol Abuse and Alcoholism (NIAAA). Created by the US Congress 40 years ago, the NIAAA has evolved from an entity charged mainly with building a national system of alcoholism treatment services to one with responsibility for developing, nurturing and supporting the biomedical and behavioral science foundation necessary to reduce the significant domestic and global public health impact of alcohol use disorders. The NIAAA is unique in that it functions both as a funding agency, supporting research at universities and other external, or ‘extramural’ research institutions, and is also a research institution itself, where alcohol research is carried out in-house, or ‘intramurally’. Of a $450.2 million 2009 Congressional Appropriation, approximately 90% was devoted toward the former and approximately 10% towards the latter objective. The current NIAAA Strategic Plan builds on a new organizing principle for long-range research planning, based on a life-span perspective that recognizes that human biology and behavior continue to change throughout life and changes occurring throughout the life-span affect individuals’ drinking patterns as well as the decisions they may make to change their drinking habits or to seek help for alcohol use problems. Within this framework, major efforts are currently being devoted to educating practitioners on clinically useful, science-based assessment and treatment methods that exist today, and development of personalized new treatments for tomorrow. PMID:20569230

  3. Intelligent systems installed in building of research centre for research purposes

    NASA Astrophysics Data System (ADS)

    Matusov, Jozef; Mokry, Marian; Kolkova, Zuzana; Sedivy, Stefan

    2016-06-01

    The attractiveness of intelligent buildings is nowadays directly connected with higher level of comfort and also the economic mode of consumption energy for heating, cooling and the total consumption of electricity for electric devices. The technologies of intelligent buildings compared with conventional solutions allow dynamic optimization in real time and make it easy for operational message. The basic division of functionality in horizontal direction is possible divide in to two areas such as Economical sophisticated residential care about the comfort of people in the building and Security features. The paper deals with description of intelligent systems which has a building of Research Centre. The building has installed the latest technology for utilization of renewable energy and also latest systems of controlling and driving all devices which contribute for economy operation by achieving the highest thermal comfort and overall safety.

  4. UBC's Centre for Interactive Research on Sustainability (CIRS) Will Serve as Test Bed for Innovation

    ERIC Educational Resources Information Center

    Neary, Tim

    2012-01-01

    The University of British Columbia (UBC) recently celebrated the opening of its Centre for Interactive Research on Sustainability (CIRS), a living laboratory for researchers to teach, test, and study the long-term impact of sustainable practices and technologies. Featuring advanced building controls, sensing technology, and management software…

  5. Leadership in University-Based Cooperative Research Centres: A Qualitative Investigation of Performance Dimensions

    ERIC Educational Resources Information Center

    Craig, S. Bartholomew; Hess, Clara E.; McGinnis, Jennifer Lindberg; Gray, Denis O.

    2009-01-01

    In spite of the importance often attached to the role played by leadership in university-based cooperative research centres, we know very little about what "leadership" means in this specific context. The research reported here used a qualitative approach to identify fifteen dimensions of leadership performance for directors of university-based…

  6. Infusing Evaluative Thinking as Process Use: The Case of the International Development Research Centre (IDRC)

    ERIC Educational Resources Information Center

    Carden, Fred; Earl, Sarah

    2007-01-01

    Until the recent introduction of a dynamic interview-based process, the International Development Research Centre (IDRC), a Canadian development research funding agency, faced a challenge: project completion reports (PCRs) were not being completed in a timely and quality manner. This is a common problem many organizations face in completing…

  7. The Women's Research Centre at the University of Western Sydney, Nepean: Political and Ethical Considerations.

    ERIC Educational Resources Information Center

    Chambers, Deborah; Wieneke, Christine

    1991-01-01

    This paper raises political and ethical issues related to the 1990 establishment and continuing operation of the Women's Research Centre in Nepean (Australia). Impinging trends in higher education, local factors, and problems and successes of the first year are reviewed. A summary of seven research projects currently being conducted at the center…

  8. The Role of Higher Education Centres in Research and Policy: A Case from a European Periphery

    ERIC Educational Resources Information Center

    Zgaga, Pavel

    2014-01-01

    This article focuses on higher education research and policies in small and/or peripheral countries that usually occupy a marginal position in contemporary international debates. The region discussed here is South-eastern Europe and especially the Western Balkans. First, an outline of emerging research centres and the developments in higher…

  9. Applied Research Centres at South African Universities. The Relationship between 'Base' Internal Structures and Network 'Superstructures'

    ERIC Educational Resources Information Center

    Cooper, David

    2005-01-01

    This article considers the way in which applied research centres and units at South African higher education institutions enhance their networks with industry, government and community organizations. The findings from 12 case studies of research groupings at higher education institutions in Cape Town support the author's argument for a more…

  10. ALERT-India 1981-89: nine years' experience of leprosy control in the slums of Bombay.

    PubMed

    Samy, A A; Mancheril, J; Manek, K P; McDougall, A C

    1991-09-01

    Bombay has a population of about 8 million people, one-half of whom live in slums. In 1981, ALERT-India started its first leprosy control project in N, S and T Wards of Greater Bombay Municipal Corporation covering an area of 122 sq km in the north-eastern suburbs of Vidhyavihar, Ghatkopar, Vikhroli, Kanjurmarg, Bhandup and Mulund, with a total population of 1,100,000 according to the 1981 census. In the 9 years of operation, over 12,000 patients have been registered and treated and of these 7425 have been released from treatment, having satisfactorily completed courses of chemotherapy. However, over 1000 cases are still identified every year by house-to-house or school surveys, or by self-reporting, including a considerable percentage in children. The origin, development, staff structure, operational procedure, administration and recording system of ALERT-India are described in detail, with emphasis on what has been accomplished with purely outpatient facilities, using paramedical workers, all of whom have received inservice training from Government recognized training centres for their specific tasks. The account includes a brief description of an expansion of the organization's work into townships in New Bombay, where preliminary surveys in 1988 confirmed the presence of leprosy cases and the need for treatment facilities. The discussion addresses: 1, the better use of the large volume of statistical information which has been collected by ALERT-India during the past 9 years, with emphasis on its value in assessing the impact on the control programme and modifying future policy; 2, the need to radically examine the present policy of survey, versus an 'education campaign approach' with regard to increasing early case-detection and self-reporting; 3, the establishment of a central coordinating body for leprosy control in Bombay to exchange information, coordinate efforts and formulate a future plan of action, the latter in association with the National Leprosy

  11. Evidence of Public Engagement with Science: Visitor Learning at a Zoo-Housed Primate Research Centre

    PubMed Central

    Waller, Bridget M.; Peirce, Kate; Mitchell, Heidi; Micheletta, Jerome

    2012-01-01

    Primate behavioural and cognitive research is increasingly conducted on direct public view in zoo settings. The potential of such facilities for public engagement with science is often heralded, but evidence of tangible, positive effects on public understanding is rare. Here, the effect of a new zoo-based primate research centre on visitor behaviour, learning and attitudes was assessed using a quasi-experimental design. Zoo visitors approached the primate research centre more often when a scientist was present and working with the primates, and reported greater awareness of primates (including conservation) compared to when the scientist was not present. Visitors also reported greater perceived learning when the scientist was present. Installation of information signage had no main effect on visitor attitudes or learning. Visitors who interacted with the signage, however, demonstrated increased knowledge and understanding when asked about the specific information present on the signs (which was related to the ongoing facial expression research at the research centre). The findings show that primate behaviour research centres on public view can have a demonstrable and beneficial effect on public understanding of science. PMID:23028580

  12. Evidence of public engagement with science: visitor learning at a zoo-housed primate research centre.

    PubMed

    Waller, Bridget M; Peirce, Kate; Mitchell, Heidi; Micheletta, Jerome

    2012-01-01

    Primate behavioural and cognitive research is increasingly conducted on direct public view in zoo settings. The potential of such facilities for public engagement with science is often heralded, but evidence of tangible, positive effects on public understanding is rare. Here, the effect of a new zoo-based primate research centre on visitor behaviour, learning and attitudes was assessed using a quasi-experimental design. Zoo visitors approached the primate research centre more often when a scientist was present and working with the primates, and reported greater awareness of primates (including conservation) compared to when the scientist was not present. Visitors also reported greater perceived learning when the scientist was present. Installation of information signage had no main effect on visitor attitudes or learning. Visitors who interacted with the signage, however, demonstrated increased knowledge and understanding when asked about the specific information present on the signs (which was related to the ongoing facial expression research at the research centre). The findings show that primate behaviour research centres on public view can have a demonstrable and beneficial effect on public understanding of science.

  13. Mycetoma herbal treatment: the Mycetoma Research Centre, Sudan experience.

    PubMed

    Ezaldeen, Eshraga A; Fahal, Ahmed Hassan; Osman, Anjom

    2013-01-01

    It is still challenging and difficult to treat patients with eumycetoma; the current treatment has many side effects and has proven to be expensive and characterized by high recurrence rate, hence the poor patients' treatment compliance. Most of the patients are of low socio-economic status, have many financial constraints and hence, many of them rely on alternative and herbal medicine for the treatment of their disease. With this background, the current study was conducted to determine the prevalence of herbal medicine usage among patients with eumycetoma. This cross-sectional, observational, questionnaire-based study was conducted at the Mycetoma Research Center, University of Khartoum, Khartoum, Sudan. A convenience cohort of 311 patients with confirmed eumycetoma was invited to participate in the study after informed consent. The study showed that 42.4% of the study population used herbal medicine for the treatment of eumycetoma at some stage of their illness. The commonly used herbs were Moringa oleifera, Acacia nilotica, Citrullus colocynthis and Cuminum cyminum. Most of the patients claimed no benefits from the herbal treatment. Ninety one patients (29.3%) had encountered complications with herbal treatment. The high prevalence of herbal treatment encountered in the study can be explained by the patients' dissatisfaction with the current medical therapeutic modalities. To reduce the high prevalence of herbal medicine usage, governmental control and health policies are mandatory; likewise, native healers need to be educated in that. Moringa oleifera was the commonly used herb in this study and many reports claimed medicinal properties of this tree; hence, further in-depth studies to determine the active ingredients in the different parts of the tree and its effect are required.

  14. Mycetoma Herbal Treatment: The Mycetoma Research Centre, Sudan Experience

    PubMed Central

    Ezaldeen, Eshraga A.; Fahal, Ahmed Hassan; Osman, Anjom

    2013-01-01

    It is still challenging and difficult to treat patients with eumycetoma; the current treatment has many side effects and has proven to be expensive and characterized by high recurrence rate, hence the poor patients' treatment compliance. Most of the patients are of low socio-economic status, have many financial constraints and hence, many of them rely on alternative and herbal medicine for the treatment of their disease. With this background, the current study was conducted to determine the prevalence of herbal medicine usage among patients with eumycetoma. This cross-sectional, observational, questionnaire-based study was conducted at the Mycetoma Research Center, University of Khartoum, Khartoum, Sudan. A convenience cohort of 311 patients with confirmed eumycetoma was invited to participate in the study after informed consent. The study showed that 42.4% of the study population used herbal medicine for the treatment of eumycetoma at some stage of their illness. The commonly used herbs were Moringa oleifera, Acacia nilotica, Citrullus colocynthis and Cuminum cyminum. Most of the patients claimed no benefits from the herbal treatment. Ninety one patients (29.3%) had encountered complications with herbal treatment. The high prevalence of herbal treatment encountered in the study can be explained by the patients' dissatisfaction with the current medical therapeutic modalities. To reduce the high prevalence of herbal medicine usage, governmental control and health policies are mandatory; likewise, native healers need to be educated in that. Moringa oleifera was the commonly used herb in this study and many reports claimed medicinal properties of this tree; hence, further in-depth studies to determine the active ingredients in the different parts of the tree and its effect are required. PMID:23991244

  15. Cheminformatics Research at the Unilever Centre for Molecular Science Informatics Cambridge.

    PubMed

    Fuchs, Julian E; Bender, Andreas; Glen, Robert C

    2015-09-01

    The Centre for Molecular Informatics, formerly Unilever Centre for Molecular Science Informatics (UCMSI), at the University of Cambridge is a world-leading driving force in the field of cheminformatics. Since its opening in 2000 more than 300 scientific articles have fundamentally changed the field of molecular informatics. The Centre has been a key player in promoting open chemical data and semantic access. Though mainly focussing on basic research, close collaborations with industrial partners ensured real world feedback and access to high quality molecular data. A variety of tools and standard protocols have been developed and are ubiquitous in the daily practice of cheminformatics. Here, we present a retrospective of cheminformatics research performed at the UCMSI, thereby highlighting historical and recent trends in the field as well as indicating future directions.

  16. VAW Recycling Research Centre: Recycling techniques for post-consumer packaging

    SciTech Connect

    Rossel, H.

    1995-12-31

    VAW aluminium AG has built a Recycling Research Centre to add a new arm to the company`s Corporate Research and Development Department. The Recycling Research Centre, a pilot plant for scientific research, has been in operation since September 1993. These state-of-the-art facilities allow the investigation and optimization of recycling techniques in a global way and in detail. Research is concentrated on the unit operations -- processing, melting and waste-gas purification -- with the available installations making it possible to compare different alternative process combinations on a 100-kg scale. One of the main targets of VAW research is the development of recycling techniques for packaging. The paper presents an approach to recover the aluminium contained in flexible packaging materials using an integrated melting and waste-gas purification system.

  17. Centre for Research Infrastructure of Polish GNSS Data - response and possible contribution to EPOS

    NASA Astrophysics Data System (ADS)

    Araszkiewicz, Andrzej; Rohm, Witold; Bosy, Jaroslaw; Szolucha, Marcin; Kaplon, Jan; Kroszczynski, Krzysztof

    2017-04-01

    In the frame of the first call under Action 4.2: Development of modern research infrastructure of the science sector in the Smart Growth Operational Programme 2014-2020 in the late of 2016 the "EPOS-PL" project has launched. Following institutes are responsible for the implementation of this project: Institute of Geophysics, Polish Academy of Sciences - Project Leader, Academic Computer Centre Cyfronet AGH University of Science and Technology, Central Mining Institute, the Institute of Geodesy and Cartography, Wrocław University of Environmental and Life Sciences, Military University of Technology. In addition, resources constituting entrepreneur's own contribution will come from the Polish Mining Group. Research Infrastructure EPOS-PL will integrate both existing and newly built National Research Infrastructures (Theme Centre for Research Infrastructures), which, under the premise of the program EPOS, are financed exclusively by the national founds. In addition, the e-science platform will be developed. The Centre for Research Infrastructure of GNSS Data (CIBDG - Task 5) will be built based on the experience and facilities of two institutions: Military University of Technology and Wrocław University of Environmental and Life Sciences. The project includes the construction of the National GNNS Repository with data QC procedures and adaptation of two Regional GNNS Analysis Centres for rapid and long-term geodynamical monitoring.

  18. H-deficient blood groups ( Bombay) of Reunion Island.

    PubMed Central

    Gerard, G; Vitrac, D; Le Pendu, J; Muller, A; Oriol, R

    1982-01-01

    Forty-two H-deficient individuals (lacking H antigen on erythrocytes) with anti-H in their sera were found on Reunion Island. A, B, and AB Bombay subjects had small but detectable amounts of A and/or B antigens on erythrocytes. All the H-deficient phenotypes tested were nonsecretors of ABH in their saliva, and one-third were Lewis negative. Fifty-three of the 108 (49%) unaffected members in the 14 Bombay pedigrees analyzed were se/se, showing that the families were selected for the nonsecretor trait, and suggesting that the Bombay probands used to select the families have se/se genotype. In accordance with this concept, all the children from Bombay nonsecretor x unaffected nonsecretor matings were se/se. Segregation of H and Se is compatible with the genetic model proposing that Se and H are closely linked structural genes, and the analysis of the present and previously published Bombay pedigrees strongly supports this model. PMID:7180848

  19. H-deficient blood groups ( Bombay) of Reunion Island.

    PubMed

    Gerard, G; Vitrac, D; Le Pendu, J; Muller, A; Oriol, R

    1982-11-01

    Forty-two H-deficient individuals (lacking H antigen on erythrocytes) with anti-H in their sera were found on Reunion Island. A, B, and AB Bombay subjects had small but detectable amounts of A and/or B antigens on erythrocytes. All the H-deficient phenotypes tested were nonsecretors of ABH in their saliva, and one-third were Lewis negative. Fifty-three of the 108 (49%) unaffected members in the 14 Bombay pedigrees analyzed were se/se, showing that the families were selected for the nonsecretor trait, and suggesting that the Bombay probands used to select the families have se/se genotype. In accordance with this concept, all the children from Bombay nonsecretor x unaffected nonsecretor matings were se/se. Segregation of H and Se is compatible with the genetic model proposing that Se and H are closely linked structural genes, and the analysis of the present and previously published Bombay pedigrees strongly supports this model.

  20. Open Access Centre at the Nature Research Centre: a facility for enhancement of scientific research, education and public outreach in Lithuania

    NASA Astrophysics Data System (ADS)

    Šerpenskienė, Silvija; Skridlaitė, Gražina

    2014-05-01

    Open Access Centre (OAC) was established in Vilnius, Lithuania in 2013 as a subdivision of the Nature Research Centre (NRC) operating on the principle of open access for both internal and external users. The OAC consists of 15 units, i.e. 15 NRC laboratories or their branches. Forty four sets of research equipment were purchased. The OAC cooperates with Lithuanian science and studies institutions, business sector and other governmental and public institutions. Investigations can be carried in the Geosciences, Biotaxonomy, Ecology and Molecular Research, and Ecotoxicology fields. Environmental radioactivity, radioecology, nuclear geophysics, microscopic and chemical composition of natural compounds (minerals, rocks etc.), paleomagnetic, magnetic and environmental investigations, as well as ground and water contamination by oil products and other organic environment polluting compounds, identification of fossils, rocks and minerals can be studied in the Georesearch field. Ecosystems and identification of plants, animals and microorganisms are main subjects of the Biotaxonomy, Ecology and Molecular Research field. The Ecotoxicologal Research deals with toxic and genotoxic effects of toxic substances and other sources of pollution on macro- and microorganisms and cell cultures. Open access is guaranteed by: (1) providing scientific research and experimental development services; (2) implementing joint business and science projects; (3) using facilities for the training of specialists of the highest qualifications; (4) providing properly qualified and technically trained users with opportunities to carry out their scientific research and/or experiments in the OAC laboratories by themselves. Services provided in the Open Access Centre can be received by both internal and external users: persons undertaking innovative economic activities, students of other educational institutions, interns, external teams of researchers engaged in scientific research activities, teachers

  1. Human molecular genetics research at the International Centre for Genetic Engineering and Biotechnology.

    PubMed

    Falaschi, P A

    1997-01-01

    The ICGEB started its activity in 1987 as a special project of UNIDO (United Nations Industrial Development Organization) and operates now as a fully autonomous International Organization, of which 40 countries are members at present. The mandate of ICGEB is to become a Centre of excellence for research and training in modern biology addressed to the needs of the developing world. The ICGEB consists of two main laboratories, one in Trieste (where the direction of the Centre is also located) and one in New Delhi, plus a network of 30 Affiliated Centres. The Centre operates through: 1) specific research programs of hish scientific content at the Trieste and New Delhi laboratories; 2) long term training through post-doctoral and pre-doctoral fellowships; 3) short term training; 4) collaborative research program, through which the Centre finances research projects of major impact to the need of the Member States; 5) scientific services, namely consultation for scientific programs, distribution of reagents and a bioinformatics network particularly geared to the human genome research. The research on human molecular genetics in particularly active in the Trieste Component and concerns the study at the molecular level of several genes important for human health: control of DNA replication, response to infectious diseases, cardiocirculatory diseases, cystic fibrosis and cancer. The methodologies for developing new diagnostic methods and for developing gene therapy protocols are actively pursued. Through these programs, the member countries have access to state-of-the-art technologies anf know-how essential for the development of the molecular approaches to medicine brought forward by the study of the human genome.

  2. Celebration of the Success of Distributed Research with Schools: The CEM Centre, Durham

    ERIC Educational Resources Information Center

    Tymms, Peter; Coe, Robert

    2003-01-01

    The Curriculum, Evaluation and Management (CEM) Centre has grown in just 25 years to become the largest educational research unit in a UK university. It has influenced schools and teachers in unprecedented numbers and has had a considerable impact on policy and practice both directly and indirectly in the UK and beyond. This article summarises…

  3. Scottish Schools Science Equipment Research Centre, Bulletin No. 64, July, 1973.

    ERIC Educational Resources Information Center

    Scottish Schools Science Equipment Research Centre, Edinburgh.

    This bulletin of the Scottish Schools Science Equipment Research Centre provides information to teachers on a variety of topics relating to the use of equipment in science instruction. The introductory remarks deal with an assessment of electronic calculators suitable for use in schools. The section entitled "Physics Notes" lists surplus…

  4. Teaching Research Method Using a Student-Centred Approach? Critical Reflections on Practice

    ERIC Educational Resources Information Center

    Barraket, Jo

    2005-01-01

    This article presents a reflective case study analysis of an attempt to enhance student learning through the introduction of student-centred teaching methods in a masters-level social research methods subject. The introduction of a range of specific techniques, including case study teaching, problem based learning, groupwork, role-play and…

  5. Leadership Challenges of Strategic Research Centres in Relation to Degree of Institutionalisation

    ERIC Educational Resources Information Center

    Blomqvist, Christine; Agrell, Cecilia; Sandahl, Christer

    2016-01-01

    The purpose of this study was to describe and analyse leadership challenges in the organisation of strategic research centres, focusing on the relationship between organisation and the level of institutionalisation. Four main themes of leadership challenges were identified: (1) the "changing university context," including relationships…

  6. Scottish Schools Science Equipment Research Centre, Bulletin No. 58, September 1972.

    ERIC Educational Resources Information Center

    Scottish Schools Science Equipment Research Centre, Edinburgh.

    This issue of the bulletin contains four major topics. The first is a discussion of problems involved in establishing good communication with science teachers concerning the activities of the Scottish Schools Science Equipment Research Centre (SSSERC) via exhibitions throughout Scotland. The second, headed "Biology Notes," presents a…

  7. Scottish Schools Science Equipment Research Centre, Bulletin No. 61, February 1973.

    ERIC Educational Resources Information Center

    Scottish Schools Science Equipment Research Centre, Edinburgh.

    This bulletin of the Scottish Schools Science Equipment Research Centre provides information to teachers regarding the use of newly produced equipment such as an economical soldering iron, nickel cadmium cell, and a desk calculator. Useful information is also included for teachers on the use of electric coils and bicarbonate indicators. A detailed…

  8. Leadership Challenges of Strategic Research Centres in Relation to Degree of Institutionalisation

    ERIC Educational Resources Information Center

    Blomqvist, Christine; Agrell, Cecilia; Sandahl, Christer

    2016-01-01

    The purpose of this study was to describe and analyse leadership challenges in the organisation of strategic research centres, focusing on the relationship between organisation and the level of institutionalisation. Four main themes of leadership challenges were identified: (1) the "changing university context," including relationships…

  9. Pediatric patient with Bombay blood group: A rare case report

    PubMed Central

    Bhar (Kundu), Sudeshna; De, Anisha; Saha, Anindita; Bhattacharyya, Chiranjib

    2015-01-01

    Bombay blood group is a rare blood group in which there is the absence of H antigen and presence of anti-H antibodies. At the time of blood grouping, this blood group mimics O blood group due to the absence of H antigen, but it shows incompatibility with O group blood during cross matching. Serum grouping or reverse grouping are essential for confirmation of the diagnosis. Patients carrying this blood group can receive blood only from a person with this blood group. Reported cases of anesthesia in the pediatric patient with Bombay blood group are relatively rare. Here, we present successful anesthetic management along with intraoperative blood transfusion in a pediatric patient with Bombay blood group posted for ovarian cystectomy. PMID:26240554

  10. Person-centred health care: a critical assessment of current and emerging research approaches.

    PubMed

    Martin, Carmel M; Félix-Bortolotti, Margot

    2014-12-01

    Person-centred health care is prominent in international health care reforms. A shift to understanding and improving personal care at the point of delivery has generated debates about the nature of the person-centred research agenda. This paper purviews research paradigms that influence current person-centred research approaches and traditions that influence knowledge foundations in the field. It presents a synthesis of the emergent approaches and methodologies and highlights gaps between static academic research and the increasing accessibility of evaluation, informatics and big data from health information systems. Paradigms in health services research range from theoretical to atheoretical, including positivist, interpretive, postmodern and pragmatic. Interpretivist (subjective) and positivist (objectivist) paradigms have been historically polarized. Yet, integrative and pragmatic approaches have emerged. Nevertheless, there is a tendency to reductionism, and to reduce personal experiences to metrics in the positivist paradigm. Integrating personalized information into clinical systems is increasingly driven by the pervasive health information technology, which raises many issues about the asymmetry and uncertainty in the flow of information to support personal health journeys. The flux and uncertainty of knowledge between and within paradigmatic or pragmatic approaches highlights the uncertainty and the 'unorder and disorder' in what is known and what it means. Transdisciplinary, complex adaptive systems theory with multi-ontology sense making provides an overarching framework for making sense of the complex dynamics in research progress. A major challenge to current research paradigms is focus on the individualizing of care and enhancing experiences of persons in health settings. There is an urgent need for person-centred research to address this complex process. A transdisciplinary and complex systems approach provides a sense-making framework. © 2014 John

  11. Assessing public engagement with science in a university primate research centre in a national zoo.

    PubMed

    Bowler, Mark T; Buchanan-Smith, Hannah M; Whiten, Andrew

    2012-01-01

    Recent years have seen increasing encouragement by research institutions and funding bodies for scientists to actively engage with the public, who ultimately finance their work. Animal behaviour as a discipline possesses several features, including its inherent accessibility and appeal to the public, that may help it occupy a particularly successful niche within these developments. It has also established a repertoire of quantitative behavioural methodologies that can be used to document the public's responses to engagement initiatives. This kind of assessment is becoming increasingly important considering the enormous effort now being put into public engagement projects, whose effects are more often assumed than demonstrated. Here we report our first attempts to quantify relevant aspects of the behaviour of a sample of the hundreds of thousands of visitors who pass through the 'Living Links to Human Evolution Research Centre' in Edinburgh Zoo. This University research centre actively encourages the public to view ongoing primate research and associated science engagement activities. Focal follows of visitors and scan sampling showed substantial 'dwell times' in the Centre by common zoo standards and the addition of new engagement elements in a second year was accompanied by significantly increased overall dwell times, tripling for the most committed two thirds of visitors. Larger groups of visitors were found to spend more time in the Centre than smaller ones. Viewing live, active science was the most effective activity, shown to be enhanced by novel presentations of carefully constructed explanatory materials. The findings emphasise the importance and potential of zoos as public engagement centres for the biological sciences.

  12. Wide variety of point mutations in the H gene of Bombay and para-Bombay individuals that inactivate H enzyme.

    PubMed

    Kaneko, M; Nishihara, S; Shinya, N; Kudo, T; Iwasaki, H; Seno, T; Okubo, Y; Narimatsu, H

    1997-07-15

    The H genes, encoding an alpha1,2fucosyltransferase, which defines blood groups with the H structure, of four Bombay and 13 para-Bombay Japanese individuals were analyzed for mutations. Four Bombay individuals were homologous for the same null H allele, which is inactivated by a single nonsense mutation at position 695 from G to A (G695A), resulting in termination of H gene translation. The allele inactivated by the G695A was designated h1. The other 13 para-Bombay individuals possessed a trace amount of H antigens on erythrocytes regardless of their secretor status. Sequence analysis of their H genes showed four additional inactivated H gene alleles, h2, h3, h4, and h5. The h2 allele possesed a single base deletion at position 990 G (990-del). The h3 and h4 alleles possessed a single missense mutation, T721C, which changes Tyr 241 to His, and G442T, which changes Asp148 to Tyr, respectively. The h5 allele possessed two missense mutations, T460C (Tyr154to His) and G1042A (Glu348to Lys). The h2, h3, h4, and h5 enzymes directed by these alleles were not fully inactivated by the deletion and the missense mutations expressing some residual enzyme activity resulting in synthesis of H antigen on erythrocytes. Thirteen para-Bombay individuals whose erythrocytes retained a trace amount of H antigen were determined to be heterozygous or homozygous for at least one of h2, h3, h4, or h5 alleles. This clarified that the levels (null to trace amount) of H antigen expression on erythrocytes of Bombay and para-Bombay individuals are determined solely by H enzyme activity. These mutations found in the Japanese H alleles differ from a nonsense mutation found in the Indonesian population. To determine the roles of the H, Se, and Le genes in the expression of H antigen in secretions and Lewis blood group antigen on erythrocytes, the Lewis and secretor genes were also examined in these Bombay and para-Bombay individuals. The Lewis blood group phenotype, Le(alpha- b+), was determined

  13. Putting the evidence into practice: the King Faisal Specialist Hospital and Research Centre experience.

    PubMed

    Robertson-Malt, Suzi; Chapman, Ysanne; Ingram, Gillian

    2006-02-01

    For more than a decade, evidence-based practice has become the desired aim behind organized health care. Although a plethora of reasons exist as to why clinicians are reluctant to adopt research-based findings, the fundamentals relate to management of change and the nature of the individuals involved. Large organizations, with their daily routines and operations, are inherently difficult to change. Hence, one has to use the very structures that drive the organization to effect 'sustained' change. In large tertiary care facilities, such as the King Faisal Specialist Hospital and Research Centre, these structures are policies and procedures. This paper provides details of the process developed by the Nursing Affairs Practice Committee of the King Faisal Specialist Hospital and Research Centre to achieve the committee mandate of: 'Establish and implement an evidence-based process for the systematic review and revision of nursing clinical standards, policies, procedures and protocols'.

  14. Ethical considerations in international nursing research: a report from the International Centre for Nursing Ethics.

    PubMed

    2003-03-01

    Ethical issues in international nursing research are identified and the perspectives o International Centre for Nursing Ethics are offered in an effort to develop an international consensus of ethical behaviour in research. First, theoretical issues are reviewed, then initial conditions for ethical conduct are defined, and protocol design and procedure considerations are examined. A concerted effort is made to identify and avoid a western bias. Broad guiding principles for designing and reviewing research are offered: (1) respect for persons; (2) beneficence; (3) justice; (4) respect for community; and (5) contextual caring. A collaborative model of the researcher-participant relationship is suggested and discussed.

  15. [R]MIT Research Centre at Delft University of Technology: A Bridge between Research, Education, Society and Profession

    ERIC Educational Resources Information Center

    Zijlstra, Hielkje

    2009-01-01

    In 2006, we launched the [R]MIT Research Centre (Modification, Intervention Transformation) at the Faculty of Architecture at Delft University of Technology. [R]MIT was founded to respond to the need for an integrated, multi-disciplinary approach to the transformation of the built environment. [R]MIT aims to bring momentum to the renewal of…

  16. Addiction research centres and the nurturing of creativity. Monitoring the European drug situation: the ongoing challenge for the European Monitoring Centre for Drugs and Drug Addiction (EMCDDA).

    PubMed

    Griffiths, Paul; Mounteney, Jane; Lopez, Dominique; Zobel, Frank; Götz, Wolfgang

    2012-02-01

    The European Monitoring Centre for Drugs and Drug Addiction (EMCDDA) is the designated hub for drug-related information in the European Union. The organization's role is to provide the European Union (EU) and its Member States with a factual overview of European drug problems and a common information framework to support the drugs debate. In order to achieve its mission, the EMCDDA coordinates and relies on a network of 30 national monitoring centres, the Reitox National Focal Points. The Centre publishes on a wide range of drug-related topics, across epidemiology, interventions, laws and policies. Every November, the EMCDDA publishes its Annual Report, providing a yearly update on the European drug situation, translated into 23 EU languages. In line with its founding regulation, the EMCDDA has a role acting as an interface between the worlds of science and policy. While not a research centre in the formal sense, the results the Centre generates serve as catalysts for new research questions and help to identify priorities. Current challenges facing the agency include continuing to increase scientific standards while maintaining a strong institutional role, as well as supporting European efforts to identify, share and codify best practice in the drugs field. © 2011 EMCDDA.

  17. INA-RESPOND: a multi-centre clinical research network in Indonesia.

    PubMed

    Karyana, Muhammad; Kosasih, Herman; Samaan, Gina; Tjitra, Emiliana; Aman, Abu Tholib; Alisjahbana, Bachti; Fatmawati; Gasem, M Hussein; Arif, Mansyur; Sudarmono, Pratiwi; Suharto; Merati, Tuti P; Lane, Clifford; Siswanto; Siddiqui, Sophia

    2015-07-29

    Nationally representative observational and translational research is needed to address the public health challenges in Indonesia due to the geographic disparity, recently decentralized health system, and diverse infectious disease priorities. To accomplish this, the Indonesian Ministry of Health in collaboration with the US National Institute of Health has established INA-RESPOND (Indonesia Research Partnership on Infectious Disease) - a clinical research network comprising 9 referral hospitals, 7 medical faculties, and 2 research centres across Indonesia. The network provides a forum to conduct research at a national scale and to address scientific questions that would be difficult to address in smaller research settings. Further, it is currently conducting multi-centre research on the etiologies of fever, sepsis, and tuberculosis. There are opportunities to leverage existing network resources for other public health research needs. INA-RESPOND is an Indonesian-led network in a country with diverse population groups and public health needs which is poised to collaborate with researchers, universities, donors, and industry worldwide. This paper describes the network and its goals and values, as well as the management structure, process for collaboration, and future vision.

  18. Radiological characterization of the nuclear waste streams of the Belgian nuclear research centre SCK.CEN

    SciTech Connect

    Maris, Patrick; Cornelissen, Rene; Bruggeman, Michel

    2007-07-01

    The radiological characterization of nuclear wastes of a research centre is difficult seen the many different processes that generate waste. Since these wastes may contain radionuclides relevant for the disposal option, the nuclide content and activity have to be known. Considering the fact that some wastes are generated only in minor quantities, complex approaches, involving sampling and successive analysis are not justified. Basic physical models can generally be applied to estimate activity ratios, from which the radionuclide inventory can be determined by non-destructive assay on waste-packages. This article discusses waste streams at the Belgian Nuclear Research Centre SCK.CEN and explains how nuclide inventories and activity are determined. The physical models, used to derive activity ratios, and other simple approaches are discussed. (authors)

  19. Assessing Public Engagement with Science in a University Primate Research Centre in a National Zoo

    PubMed Central

    Bowler, Mark T.; Buchanan-Smith, Hannah M.; Whiten, Andrew

    2012-01-01

    Recent years have seen increasing encouragement by research institutions and funding bodies for scientists to actively engage with the public, who ultimately finance their work. Animal behaviour as a discipline possesses several features, including its inherent accessibility and appeal to the public, that may help it occupy a particularly successful niche within these developments. It has also established a repertoire of quantitative behavioural methodologies that can be used to document the public's responses to engagement initiatives. This kind of assessment is becoming increasingly important considering the enormous effort now being put into public engagement projects, whose effects are more often assumed than demonstrated. Here we report our first attempts to quantify relevant aspects of the behaviour of a sample of the hundreds of thousands of visitors who pass through the ‘Living Links to Human Evolution Research Centre’ in Edinburgh Zoo. This University research centre actively encourages the public to view ongoing primate research and associated science engagement activities. Focal follows of visitors and scan sampling showed substantial ‘dwell times’ in the Centre by common zoo standards and the addition of new engagement elements in a second year was accompanied by significantly increased overall dwell times, tripling for the most committed two thirds of visitors. Larger groups of visitors were found to spend more time in the Centre than smaller ones. Viewing live, active science was the most effective activity, shown to be enhanced by novel presentations of carefully constructed explanatory materials. The findings emphasise the importance and potential of zoos as public engagement centres for the biological sciences. PMID:22496822

  20. Management of a rare blood type: Oh "Bombay" in pregnancy.

    PubMed

    Katz, A R; Ali, V; Ross, P J; Gammon, E

    1981-06-01

    A rare blood type, Oh "Bombay," was observed in a 30-year-old Indian primigravida. The genetic mode of inheritance is discussed. The obstetric management, with anticipation for the need for blood transfusion, is outlined and the use of autotransfusion for patients with rare blood type is emphasized.

  1. Dr John McLennan MD (Aberdeen), FRCP (Lond) (1801-1874) and the Medical School of Bombay that failed.

    PubMed

    Pandya, Sunil K

    2017-01-01

    In 1826, Dr John McLennan was asked by Governor Mounstuart Elphinstone of Bombay to set up the first school to teach modern medicine to Indian citizens. He was expected to create textbooks on a variety of subjects in local languages and teach medicine to poorly educated students in their native tongues. Despite his valiant efforts, the school was deemed a failure and was abolished by the Government in 1832. Sir Robert Grant, appointed Governor of Bombay in 1835, analysed records pertaining to this medical school and concluded that the school failed since Dr McLennan was not provided the assistance he needed and as his suggestions for access to a hospital to teach medicine were not heeded. Dr McLennan provided able support to Dr Charles Morehead on his appointment as Principal and Professor of Medicine at the newly created Grant Medical College in Bombay in 1845. Dr Morehead dedicated his classic 'Clinical researches on diseases in India' to Dr McLennan. Dr McLennan headed the Board of Examiners created to assess the competence of the first batch of medical students emerging from this College. The system of evaluation set up by him remains admirable. Dr McLennan retired from service as Physician-General, full of honours.

  2. Academic collaborative centres for health promotion in the Netherlands: building bridges between research, policy and practice.

    PubMed

    Molleman, Gerard; Fransen, Gerdine

    2012-04-01

    A logical and promising next step for the development of an effective infrastructure for health promotion in the Netherlands are Academic Collaborative Centres (ACCs). Their aims are to bridge the gap between research, policy and practice; make better use of available knowledge and strengthen the evidence base for health promotion practice. To understand their position, they must be seen in light of the strong growth in health promotion in the Netherlands. Since the 1970s, the emphasis in health promotion has shifted from simple unidimensional interventions to much more comprehensive and integrated programmes. Comprehensive research programmes, which explicitly involve actual practice and policy, are also thus called for. These developments are described in this article. There is considerable and widespread enthusiasm about the establishment of ACCs in the Netherlands. Experiences from the first 5 years of collaboration between research, policy and practice within the ACCs, however, shows research to still have the dominant position. The different groups of stakeholders in the public health infrastructure are also shown to perceive and appreciate the current infrastructure rather differently. These findings are similar to results found in the USA. The predominance of research has recently led the Netherlands Organization for Health Research and Development (ZonMw) to impose stricter criteria and guidelines for the funding of such centres. These measures are aimed at eliciting a shift of power from science to practice. They seem to be a promising contribution to bridging the gap between research, policy and practice.

  3. Trauma research in Qatar: a literature review and discussion of progress after establishment of a trauma research centre.

    PubMed

    El-Menyar, A; Asim, M; Zarour, A; Abdelrahman, H; Peralta, R; Parchani, A; Al-Thani, H

    2016-02-01

    A structured research programme is one of the main pillars of a trauma care system. Despite the high rate of injury-related mortalities, especially road traffic accidents, in Qatar, little consideration has been given to research in trauma. This review aimed to analyse research publications on the subject of trauma published from Qatar and to discuss the progress of clinical research in Qatar and the Gulf Cooperation Council countries with special emphasis on trauma research. A literature search using PubMed and Google Scholar search engines located 757 English-language articles within the fields of internal medicine, surgery and trauma originating from Qatar between the years 1993 and 2013. A steep increase in the number of trauma publications since 2010 could be linked to the setting up of a trauma research centre in Qatar in 2011. We believe that establishing a research unit has made a major impact on research productivity, which ultimately benefits health care.

  4. A Canadian model for building university and community partnerships: centre for research & education on violence against women and children.

    PubMed

    Jaffe, Peter G; Berman, Helene; MacQuarrie, Barb

    2011-09-01

    The importance of Canadian research on violence against women became a national focus after the 1989 murder of 14 women at École Polytechnique in Montreal. This tragedy led to several federal government studies that identified a need to develop centers for applied research and community-university alliances on violence against women. One such center is the Centre for Research & Education on Violence against Women and Children. The Centre was founded in London, Canada in 1992 out of a partnership of a university, a community college, and community services. The centre's history and current activities are summarized as a model for the development and sustainability of similar centers.

  5. Transfusion reaction in a case with the rare Bombay blood group.

    PubMed

    Shahshahani, Hayedeh Javadzadeh; Vahidfar, Mohamad Reza; Khodaie, Seyed Ali

    2013-01-01

    Bombay phenotype is extremely rare in Caucasian with an incidence of 1 in 250,000. When individuals with the Bombay phenotype need blood transfusion, they can receive only autologous blood or blood from another Bombay blood group. Transfusing blood group O red cells to them can cause a fatal hemolytic transfusion reaction. In this study, we report a case with the rare Bombay blood group that was misdiagnosed as the O blood group and developed a hemolytic transfusion reaction. This highlights the importance of both forward and reverse typing in ABO blood grouping and standard cross-matching and performing standard pretransfusion laboratory tests in hospital blood banks.

  6. Transfusion reaction in a case with the rare Bombay blood group

    PubMed Central

    Shahshahani, Hayedeh Javadzadeh; Vahidfar, Mohamad Reza; Khodaie, Seyed Ali

    2013-01-01

    Bombay phenotype is extremely rare in Caucasian with an incidence of 1 in 250,000. When individuals with the Bombay phenotype need blood transfusion, they can receive only autologous blood or blood from another Bombay blood group. Transfusing blood group O red cells to them can cause a fatal hemolytic transfusion reaction. In this study, we report a case with the rare Bombay blood group that was misdiagnosed as the O blood group and developed a hemolytic transfusion reaction. This highlights the importance of both forward and reverse typing in ABO blood grouping and standard cross-matching and performing standard pretransfusion laboratory tests in hospital blood banks. PMID:23559776

  7. Mazingira Centre: A state-of-the-art environmental research infrastructure in Eastern Africa

    NASA Astrophysics Data System (ADS)

    Merbold, Lutz; Butterbach-Bahl, Klaus; Goopy, John; Mutuo, Paul; Korir, Daniel; Pelster, David; Wanyama, George

    2017-04-01

    Measurements of greenhouse gases (GHGs), performed in various terrestrial and marine ecosystems have led to a fundamental understanding of the Earth System during the last century. While there are numerous extant long-term measurements of GHGs across the globe, these are mainly located in developed countries of the northern hemisphere, leaving large regions such as Sub-Saharan Africa (SSA) without a consolidated observational network. Moreover, in SSA also infrastructures capable of measuring GHGs following best scientific practice are lacking. The Mazingira Centre - a state-of-the-art environmental laboratory - hosted by the International Livestock Research Institute in Kenya has been established in 2013. The laboratory is equipped with state-of-the-art GHG measurement technology (gas chromatographs, animal respiration chambers, laser absorption spectrometers) and aims at providing fundamental environmental data (e.g. GHGs and auxiliary information) from the most common land-cover types in Eastern Africa and beyond. Thereby a special focus is given to mixed crop-livestock systems managed by smallholders. The first results from the activities of the Mazingira Centre show much lower GHG emissions from manure management and arable systems as commonly assumed using emission factor approaches (EFs). This highlights the need of direct, in-situ measurements from all land-cover types and agricultural systems in Eastern Africa. The Mazingira Centre is furthermore a core training facility for undergraduate and graduate students, technicians as well policy makers that report GHG emissions to the UNFCCC with reliable and accurate emissions factors.

  8. The need for patient-centred clinical research in idiopathic pulmonary fibrosis.

    PubMed

    Russell, Anne-Marie; Sprangers, Mirjam A G; Wibberley, Steven; Snell, Noel; Rose, Daniel M; Swigris, Jeff J

    2015-09-24

    Patient-centredness is an accepted term and is perceived by healthcare professionals to be morally and ethically desirable. We are motivated by the belief that this approach will improve the patient-professional experience of the decision-making process and improve health outcomes. We acknowledge that patients, either as participants or as co-investigators, have positive contributions to make to research. As the idiopathic pulmonary fibrosis (IPF) community enters a new era of clinical research activity we consider that there is greater capacity for patient involvement and partnership.Patient involvement in research can be optimised through collaborations in the research design, study conduct, and dissemination. There is increasing interest in using patient- reported outcomes (PROs), such as health-related quality of life, and symptoms measures to inform decision-making and ensure patient perspectives are taken into account. PROs are an essential component of specialist IPF services, to monitor and improve care delivery and to measure and benchmark performance. In clinical trials, PROs can additionally be used to define entry criteria, evaluate efficacy of an intervention, and evaluate adverse events. We suggest that there is a much wider scope for including patient-centred PROs in clinical research and for creative thought in developing patient co-investigator roles.Participation in research activity requires highly refined decision-making processes, particularly in a condition such as IPF, which has an often unpredictable trajectory. The IPF research landscape has changed and the design and conduct of clinical trials in IPF requires some radical rethinking. It is accepted that involving patients in the role of co-investigators will impact the research questions we ask and result in study designs that are patient-centred. IPF clinical trials have been hindered by the lack of availability of validated, disease-specific questionnaires. A conservative approach

  9. Engaging Consumers with Musculoskeletal Conditions in Health Research: A User-Centred Perspective.

    PubMed

    Pang, Patrick Cheong-Iao; Clavisi, Ornella; Chang, Shanton

    2017-01-01

    Consumers are frequently involved in different kinds of health research, such as clinical trials, focus groups, and surveys. As pointed out by different studies, recruiting and involving consumers to participate in academic research can be challenging. While different research and guidelines are provided to instruct researchers to recruit participants ethically, they seldom consider the needs and expectations of consumers. In this research, we interviewed 23 consumers with musculoskeletal conditions in Australia, to understand their needs and motivations for participating in research from a user-centred perspective. Based on these data, we systematically summarise consumers' feedback into four main themes: (1) Research as Learning Opportunity; (2) The Important Role of Communities and Health Professionals; (3) Research Transparency and Updates; and (4) Special Needs for People with MSK Conditions. As a result, a few recommendations are proposed and researchers should further consider these when designing consumer-based studies. Ultimately, with a better understanding of consumers, we hope that our research can enhance consumer engagement and improve their participation in health research.

  10. Laser remote maneuver of space debris at the Space Environment Research Centre

    NASA Astrophysics Data System (ADS)

    Bold, Matthew M.

    2016-09-01

    Active satellites have the ability to maneuver to avoid collision with other space objects. Unfortunately the majority of objects in space are debris objects that do not have the ability to maneuver. In the future the population of debris objects will grow and the probability of collision will increase. This paper will provide details on plans to use a ground based laser with uplink adaptive optics compensation to apply photon pressure to debris objects and maneuver them out of harm's way. This work is ongoing at the Space Environment Research Centre at Mt. Stromlo Australia with collaborative efforts from Lockheed Martin, Electro-Optics Systems Inc. and the Australian National University.

  11. Maximising value from a United Kingdom Biomedical Research Centre: study protocol.

    PubMed

    Greenhalgh, Trisha; Ovseiko, Pavel V; Fahy, Nick; Shaw, Sara; Kerr, Polly; Rushforth, Alexander D; Channon, Keith M; Kiparoglou, Vasiliki

    2017-08-14

    Biomedical Research Centres (BRCs) are partnerships between healthcare organisations and universities in England. Their mission is to generate novel treatments, technologies, diagnostics and other interventions that increase the country's international competitiveness, to rapidly translate these innovations into benefits for patients, and to improve efficiency and reduce waste in healthcare. As NIHR Oxford BRC (Oxford BRC) enters its third 5-year funding period, we seek to (1) apply the evidence base on how best to support the various partnerships in this large, multi-stakeholder research system and (2) research how these partnerships play out in a new, ambitious programme of translational research. Organisational case study, informed by the principles of action research. A cross-cutting theme, 'Partnerships for Health, Wealth and Innovation' has been established with multiple sub-themes (drug development, device development, business support and commercialisation, research methodology and statistics, health economics, bioethics, patient and public involvement and engagement, knowledge translation, and education and training) to support individual BRC research themes and generate cross-theme learning. The 'Partnerships' theme will support the BRC's goals by facilitating six types of partnership (with patients and citizens, clinical services, industry, across the NIHR infrastructure, across academic disciplines, and with policymakers and payers) through a range of engagement platforms and activities. We will develop a longitudinal progress narrative centred around exemplar case studies, and apply theoretical models from innovation studies (Triple Helix), sociology of science (Mode 2 knowledge production) and business studies (Value Co-creation). Data sources will be the empirical research studies within individual BRC research themes (who will apply separately for NHS ethics approval), plus documentary analysis and interviews and ethnography with research

  12. SFB 754 - Managing a large interdisciplinary collaborative research centre: what matters?

    NASA Astrophysics Data System (ADS)

    Schelten, Christiane; Antia, Avan; Braker, Gesche; Kamm, Ruth; Mehrtens, Hela

    2016-04-01

    The German Research Foundation (DFG) funds Collaborative Research Centres (CRCs - in German: Sonderforschungsbereiche SFBs) that are generally applied for by one university, but may also incorporate neighbouring universities or non-university research institutions. SFBs are crossing the boundaries of disciplines, as well as faculties, departments, institutions and institutes. The funding of an SFB can be up to 12 years (3 x 4 years). Kiel University and GEOMAR Helmholtz Centre for Ocean Research Kiel received funding for the SFB 754 'Climate-biogeochemical interactions in the tropical ocean' in 2008. Currently, the centre is in its third phase comprising 17 scientific subprojects, one outreach project, a central coordination and management subproject and a subproject covering the research expeditions with a total project budget of 12 Mio Euro. Around 100 scientists of interdisciplinary research fields (e.g. physical oceanography, micro-biology, palaeontology, chemistry, modelling) are actively involved. Besides generating high profile research, gender equality, early career support and data management are complementary goals of SFBs requested by the DFG. Within the SFB 754 the scientific coordination office is responsible for developing concepts and strategies to cover these additional requirements and over the past eight years the SFB 754 has been successful in setting up profound programmes and various measures. Some of the SFB 754 practices have been taken up by other projects, and hence allowed the SFB 754 to serve as a role model for 'best practice' within marine sciences in Kiel. A main reason for the success of the SFB 754 to work towards the additional goals set out in the DFGs SFB programme is that the project is well tied into existing structures and builds upon outstanding management expertise available in Kiel. Three examples are highlighted here: • young scientists programme (closely linked to a graduate school (Integrated School of Marine Sciences

  13. The Australian e-Health Research Centre: enabling the health care information and communication technology revolution.

    PubMed

    Hansen, David P; Gurney, Phil; Morgan, Gary; Barraclough, Bruce

    2011-02-21

    The CSIRO (Commonwealth Scientific and Industrial Research Organisation) and the Queensland Government have jointly established the Australian e-Health Research Centre (AEHRC) with the aim of developing innovative information and communication technologies (ICT) for a sustainable health care system. The AEHRC, as part of the CSIRO ICT Centre, has access to new technologies in information processing, wireless and networking technologies, and autonomous systems. The AEHRC's 50 researchers, software engineers and PhD students, in partnership with the CSIRO and clinicians, are developing and applying new technologies for improving patients' experience, building a more rewarding workplace for the health workforce, and improving the efficiency of delivering health care. The capabilities of the AEHRC fall into four broad areas: smart methods for using medical data; advanced medical imaging technologies; new models for clinical and health care interventions; and tools for medical skills development. Since its founding in 2004, new technology from the AEHRC has been adopted within Queensland (eg, a mobile phone-based cardiac rehabilitation program), around Australia (eg, medical imaging technologies) and internationally (eg, our clinical terminology tools).

  14. Forms of interdisciplinarity in four sport science research centres in Europe.

    PubMed

    Camy, Jean; Fargier, Patrick; Perrin, Claire; Belli, Alain

    2017-02-01

    Interdisciplinarity is often presented as a significant element of sport science. We present here the results of an investigation conducted in four European Sport Science Research Centres applying interdisciplinarity. Four main dimensions, that we have called "forms", have been investigated. The "scientific", "organisational", "academic" and "societal" forms cover a wide range of activities run by these Centres. We have compared their situations using indicators. Globally they present quite similar combinations of forms, with dominant roles in the construction of interdisciplinarity played by the organisational and societal forms. The scientific form is never quite supported by an epistemological setting and the academic form, mostly characterised by the position of the university, plays an influential role when it is hostile to that kind of research. Following Klein classification, all of them remain at a multidisciplinary stage, one of them exploring interdisciplinary tracks in some research projects. The development of a common culture and a curiosity regarding disciplines other than its own is a key factor for a sustainable situation, as is the capacity to secure long-term financial resources, often linked to a high academic recognition for the director(s).

  15. The Community-First Land-Centred Theoretical Framework: Bringing a "Good Mind" to Indigenous Education Research?

    ERIC Educational Resources Information Center

    Styres, Sandra D.; Zinga, Dawn M.

    2013-01-01

    This article introduces an emergent research theoretical framework, the community-first Land-centred research framework. Carefully examining the literature within Indigenous educational research, we noted the limited approaches for engaging in culturally aligned and relevant research within Indigenous communities. The community-first Land-centred…

  16. The Community-First Land-Centred Theoretical Framework: Bringing a "Good Mind" to Indigenous Education Research?

    ERIC Educational Resources Information Center

    Styres, Sandra D.; Zinga, Dawn M.

    2013-01-01

    This article introduces an emergent research theoretical framework, the community-first Land-centred research framework. Carefully examining the literature within Indigenous educational research, we noted the limited approaches for engaging in culturally aligned and relevant research within Indigenous communities. The community-first Land-centred…

  17. Optical laboratory facilities at the Finnish Meteorological Institute - Arctic Research Centre

    NASA Astrophysics Data System (ADS)

    Lakkala, Kaisa; Suokanerva, Hanne; Matti Karhu, Juha; Aarva, Antti; Poikonen, Antti; Karppinen, Tomi; Ahponen, Markku; Hannula, Henna-Reetta; Kontu, Anna; Kyrö, Esko

    2016-07-01

    This paper describes the laboratory facilities at the Finnish Meteorological Institute - Arctic Research Centre (FMI-ARC, http://fmiarc.fmi.fi). They comprise an optical laboratory, a facility for biological studies, and an office. A dark room has been built, in which an optical table and a fixed lamp test system are set up, and the electronics allow high-precision adjustment of the current. The Brewer spectroradiometer, NILU-UV multifilter radiometer, and Analytical Spectral Devices (ASD) spectroradiometer of the FMI-ARC are regularly calibrated or checked for stability in the laboratory. The facilities are ideal for responding to the needs of international multidisciplinary research, giving the possibility to calibrate and characterize the research instruments as well as handle and store samples.

  18. The NSW brain tissue resource centre: Banking for alcohol and major neuropsychiatric disorders research.

    PubMed

    Sutherland, G T; Sheedy, D; Stevens, J; McCrossin, T; Smith, C C; van Roijen, M; Kril, J J

    2016-05-01

    The New South Wales Brain Tissue Resource Centre (NSWBTRC) at the University of Sydney (Australia) is an established human brain bank providing tissue to the neuroscience research community for investigations on alcohol-related brain damage and major psychiatric illnesses such as schizophrenia. The NSWBTRC relies on wide community engagement to encourage those with and without neuropsychiatric illness to consent to donation through its allied research programs. The subsequent provision of high-quality samples relies on standardized operational protocols, associated clinical data, quality control measures, integrated information systems, robust infrastructure, and governance. These processes are continually augmented to complement the changes in internal and external governance as well as the complexity and diversity of advanced investigation techniques. This report provides an overview of the dynamic process of brain banking and discusses the challenges of meeting the future needs of researchers, including synchronicity with other disease-focus collections. Copyright © 2016 Elsevier Inc. All rights reserved.

  19. Negotiation of parental roles within family-centred care: a review of the research.

    PubMed

    Corlett, Jo; Twycross, Alison

    2006-10-01

    To review research published in the past 15 years about how children's nurses' negotiate with parents in relation to family-centred care. Family-centred care is a basic tenet of children's nursing and requires a process of negotiation between health professionals and the family, which results in shared decision-making about what the child's care will be and who will provide this. The literature highlights inconsistencies in the degree to which nurses are willing to negotiate with parents and allow them to participate in decisions regarding care of their child. There is need to explore further the extent to which nurses communicate and negotiate shared care with children and their parents. Three themes emerged from this review of the literature relating to whether role negotiation occurred in practice, parental expectations of participation in their child's care and issues relating to power and control. Parents wanted to be involved in their child's care but found that nurses' lack of communication and limited negotiation meant that this did not always occur. Nurses appeared to have clear ideas about what nursing care parents could be involved with and did not routinely negotiate with parents in this context. For family-centred care to be a reality nurses need to negotiate and communicate with children and their families effectively. Parents need to be able to negotiate with health staff what this participation will involve and to negotiate new roles for themselves in sharing care of their sick child. Parents should be involved in the decision-making process. However, research suggests that a lack of effective communication, professional expectations and issues of power and control often inhibit open and mutual negotiation between families and nurses.

  20. The International Development Research Centre: A Guide for the Canadian University Research Community = Le Centre de recherches pour le developpement international: guide a l'intention des scientifiques des universites Canadiennes.

    ERIC Educational Resources Information Center

    Tillman, George; Wasilewski, Ania, Ed.

    Written in both English and French this is a manual for the Canadian research community. It describes the International Development Research Centre (IDRC) and its operations. The main objective of the IDRC is to assist scientists in developing countries to identify and conduct research into long term practical solutions to development problems.…

  1. European Network of Bipolar Research Expert Centre (ENBREC): a network to foster research and promote innovative care.

    PubMed

    Henry, Chantal; Andreassen, Ole A; Barbato, Angelo; Demotes-Mainard, Jacques; Goodwin, Guy; Leboyer, Marion; Vieta, Eduard; Nolen, Willem A; Kessing, Lars Vedel; Scott, Jan; Bauer, Michael

    2013-01-01

    Bipolar disorders rank as one of the most disabling illnesses in working age adults worldwide. Despite this, the quality of care offered to patients with this disorder is suboptimal, largely due to limitations in our understanding of the pathology. Improving this scenario requires the development of a critical mass of expertise and multicentre collaborative projects. Within the framework of the European FP7 programme, we developed a European Network of Bipolar Research Expert Centres (ENBREC) designed specifically to facilitate EU-wide studies. ENBREC provides an integrated support structure facilitating research on disease mechanisms and clinical outcomes across six European countries (France, Germany, Italy, Norway, Spain and the UK). The centres are adopting a standardised clinical assessment that explores multiple aspects of bipolar disorder through a structured evaluation designed to inform clinical decision-making as well as being applicable to research. Reliable, established measures have been prioritised, and instruments have been translated and validated when necessary. An electronic healthcare record and monitoring system (e-ENBREC©) has been developed to collate the data. Protocols to conduct multicentre clinical observational studies and joint studies on cognitive function, biomarkers, genetics, and neuroimaging are in progress; a pilot study has been completed on strategies for routine implementation of psycho-education. The network demonstrates 'proof of principle' that expert centres across Europe can collaborate on a wide range of basic science and clinical programmes using shared protocols. This paper is to describe the network and how it aims to improve the quality and effectiveness of research in a neglected priority area.

  2. Use of human surplus biospecimens in research: a survey from a cancer centre.

    PubMed

    Al-Hussaini, M; Abu-Hmaidan, A

    2014-06-18

    Little is known about the public's views on the use of human biospecimens for research in the Eastern Mediterranean Region. A study at a cancer centre in Amman, Jordan, assessed patients' perceptions about the use of blood and tissue samples obtained during clinical care and the use of these in research. A self-administered questionnaire was distributed to a sample of 205 adult cancer patients. Almost all patients (98.0%) accepted the use of their surplus blood samples and archived tissue in research if they consented, with about one-third requesting a specific opt-in consent. Most patients (82.9%) also agreed to donate a blood sample for research purposes only, 84.9% were interested to know the results of that research, but with a specific opt-in consent, and 81.0% accepted sending their samples to research laboratories abroad, even without specific consent. Patients' views on the potential use of the surplus biospecimens in research were largely concordant with the international literature.

  3. [Genetic analysis of an individual with para-Bombay phenotype].

    PubMed

    Lin, Jia-jin; Huang, Ying; Zhu, Sui-yong

    2013-04-01

    To study genetic characteristics of an individual with para-Bombay phenotype and her family members. ABO and H antigens were detected with routine serological techniques.The entire coding region of FUT1 gene was amplified by polymerase chain reaction (PCR). PCR products was purified with enzymes digestion and directly sequenced. The RBCs of the proband did not agglutinate with H antibody. The proband therefore has a para-Bombay phenotype (Bmh). Direct sequencing indicated the FUT1 sequence of the proband contained a homozygous 547-552 del AG and heterozygous 814A>G mutation, which gave rise to two haplotypes of 547-552delAG, 547-552delAG and 814A>G. The ABO blood type of the proband' s mother and sisters were all B.Sequencing of the FUT1 gene has found heterozygous 547-552 del AG, 814A>G mutations in the mother and elder sister, and heterozygous 547-552 del AG mutation in her younger sister. The FUT1 547-552 del AG and 814 A>G mutations of the proband were inherited from her mother. A complex mutation of the FUT1 gene consisting of 547-55 del AG and 814 A>G has been identified in an individual with para-Bombay phenotype.

  4. Acute Hemolytic Transfusion Reaction in a Patient with Bombay Phenotype: Implications for ABO Grouping.

    PubMed

    Malhotra, Sheetal; Dhawan, Hari Krishan; Jain, Ashish; Sachdev, Suchet; Marwaha, Neelam

    2014-09-01

    Bombay blood group is a rare phenotype that is characterized serologically by absence of H, A and B antigens on red cell surface and presence of corresponding antibodies in the serum. We report a case of 45-year old patient having Bombay blood group phenotype who experienced an acute reaction due to transfusion of mismatched blood unit.

  5. Person centred care and shared decision making: implications for ethics, public health and research.

    PubMed

    Munthe, Christian; Sandman, Lars; Cutas, Daniela

    2012-09-01

    This paper presents a systematic account of ethical issues actualised in different areas, as well as at different levels and stages of health care, by introducing organisational and other procedures that embody a shift towards person centred care and shared decision-making (PCC/SDM). The analysis builds on general ethical theory and earlier work on aspects of PCC/SDM relevant from an ethics perspective. This account leads up to a number of theoretical as well as empirical and practice oriented issues that, in view of broad advancements towards PCC/SDM, need to be considered by health care ethics researchers. Given a PCC/SDM-based reorientation of health care practice, such ethics research is essential from a quality assurance perspective.

  6. The Cyclotron radionuclide program at King Faisal Specialist Hospital and Research Centre

    NASA Astrophysics Data System (ADS)

    Hupf, Homer B.; Tischer, Stephen D.; Al-Watban, Farouk

    1985-05-01

    The King Faisal Specialist Hospital and Research Centre Cyclotron is being used to produce radionuclides for nuclear medicine, short-lived positron emitters for positron emission tomography (PET) studies, neutrons for therapy and biological research. Radiopharmaceuticals for planar imaging at King Faisal Specialist Hospital and other hospitals in Saudi Arabia include thallous-201 chloride, gallium-67 citrate, sodium iodide 123I capsules, 123I orthoiodohippurate and 81mKr generators. Products from short-lived positron emitters such as 18F fluordeoxyglucose, 11C methionine, 15O carbon dioxide and 63Zn hematoporphyrin are prepared and used on site for physiological studies in a PET program. Several patients have been treated with neutron therapy and a program for studying neutron radiation effects on cells is underway. Radiopharmaceutical products under development include 111In-labelled monoclonal antibodies for specific tumor detection, 11C methylglucose for metabolic studies and 11C putrescine for tumor localization.

  7. People-centred science: strengthening the practice of health policy and systems research

    PubMed Central

    2014-01-01

    Health policy and systems research (HPSR) is a transdisciplinary field of global importance, with its own emerging standards for creating, evaluating, and utilizing knowledge, and distinguished by a particular orientation towards influencing policy and wider action to strengthen health systems. In this commentary, we argue that the ability of the HPSR field to influence real world change hinges on its becoming more people-centred. We see people-centredness as recognizing the field of enquiry as one of social construction, requiring those conducting HPSR to locate their own position in the system, and conduct and publish research in a manner that foregrounds human agency attributes and values, and is acutely attentive to policy context. Change occurs at many layers of a health system, shaped by social, political, and economic forces, and brought about by different groups of people who make up the system, including service users and communities. The seeds of transformative practice in HPSR lie in amplifying the breadth and depth of dialogue across health system actors in the conduct of research – recognizing that these actors are all generators, sources, and users of knowledge about the system. While building such a dialogic practice, those conducting HPSR must strive to protect the autonomy and integrity of their ideas and actions, and also clearly explain their own positions and the value-basis of their work. We conclude with a set of questions that health policy and systems researchers may wish to consider in making their practice more people-centred, and hence more oriented toward real-world change. PMID:24739525

  8. People-centred science: strengthening the practice of health policy and systems research.

    PubMed

    Sheikh, Kabir; George, Asha; Gilson, Lucy

    2014-04-17

    Health policy and systems research (HPSR) is a transdisciplinary field of global importance, with its own emerging standards for creating, evaluating, and utilizing knowledge, and distinguished by a particular orientation towards influencing policy and wider action to strengthen health systems. In this commentary, we argue that the ability of the HPSR field to influence real world change hinges on its becoming more people-centred. We see people-centredness as recognizing the field of enquiry as one of social construction, requiring those conducting HPSR to locate their own position in the system, and conduct and publish research in a manner that foregrounds human agency attributes and values, and is acutely attentive to policy context. Change occurs at many layers of a health system, shaped by social, political, and economic forces, and brought about by different groups of people who make up the system, including service users and communities. The seeds of transformative practice in HPSR lie in amplifying the breadth and depth of dialogue across health system actors in the conduct of research - recognizing that these actors are all generators, sources, and users of knowledge about the system. While building such a dialogic practice, those conducting HPSR must strive to protect the autonomy and integrity of their ideas and actions, and also clearly explain their own positions and the value-basis of their work. We conclude with a set of questions that health policy and systems researchers may wish to consider in making their practice more people-centred, and hence more oriented toward real-world change.

  9. [The Coordinating Centres for Clinical Trials Network. Objectives and significance for research sites].

    PubMed

    Bruns, I; Maier-Lenz, H; Wolff, S

    2009-04-01

    In the late 1990s a funding program was set up by the federal German government to help keep stride with developments in the international research arena. Within this programme, Coordinating Centres for Clinical Trials ("Koordinierungszentren für Klinische Studien", KKS) were established at 12 German universities aiming at supporting all processes of academic clinical trials according to international standards. A close network infrastructure was chosen in order to reap maximum benefit from synergy effects and to promote the harmonisation of standards. Continuing to grow, the KKS Network currently has 16 research institutions as members. More than 400 employees within the KKS Network provide scientific services to clinical trials at universities, hospitals and in industry. In cooperation with study clinics, surgeries, study groups and competence networks in medicine within Europe and beyond, the KKS supports many different research projects covering all areas of medicine. The KKS Network contributes expertise to legislative processes within Germany and Europe through its work in professional committees and working groups. A wide range of education and training concepts supports clinical research as a scientific field in its own right. After nearly ten years the KKS Network has established itself as an indispensable partner in the field of clinical research.

  10. Size, Accumulation and Performance for Research Grants: Examining the Role of Size for Centres of Excellence.

    PubMed

    Bloch, Carter; Schneider, Jesper W; Sinkjær, Thomas

    2016-01-01

    The present paper examines the relation between size, accumulation and performance for research grants, where we examine the relation between grant size for Centres of Excellence (CoE) funded by the Danish National Research Foundation (DNRF) and various ex post research performance measures, including impact and shares of highly cited articles. We examine both the relation between size and performance and also how performance for CoEs evolves over the course of grant periods. In terms of dynamics, it appears that performance over the grant period (i.e. 10 years) is falling for the largest CoEs, while it is increasing for those among the smallest half. Overall, multivariate econometric analysis finds evidence that performance is increasing in grant size and over time. In both cases, the relation appears to be non-linear, suggesting that there is a point at which performance peaks. The CoEs have also been very successful in securing additional funding, which can be viewed as a 'cumulative effect' of center grants. In terms of new personnel, the far majority of additional funding is spent on early career researchers, hence, this accumulation would appear to have a 'generational' dimension, allowing for scientific expertise to be passed on to an increasing number of younger researchers.

  11. Size, Accumulation and Performance for Research Grants: Examining the Role of Size for Centres of Excellence

    PubMed Central

    Bloch, Carter; Schneider, Jesper W.; Sinkjær, Thomas

    2016-01-01

    The present paper examines the relation between size, accumulation and performance for research grants, where we examine the relation between grant size for Centres of Excellence (CoE) funded by the Danish National Research Foundation (DNRF) and various ex post research performance measures, including impact and shares of highly cited articles. We examine both the relation between size and performance and also how performance for CoEs evolves over the course of grant periods. In terms of dynamics, it appears that performance over the grant period (i.e. 10 years) is falling for the largest CoEs, while it is increasing for those among the smallest half. Overall, multivariate econometric analysis finds evidence that performance is increasing in grant size and over time. In both cases, the relation appears to be non-linear, suggesting that there is a point at which performance peaks. The CoEs have also been very successful in securing additional funding, which can be viewed as a ‘cumulative effect’ of center grants. In terms of new personnel, the far majority of additional funding is spent on early career researchers, hence, this accumulation would appear to have a ‘generational’ dimension, allowing for scientific expertise to be passed on to an increasing number of younger researchers. PMID:26862907

  12. KLIMA 2050: a research-based innovation centre for risk reduction through climate adaptation of infrastructure and buildings

    NASA Astrophysics Data System (ADS)

    Solheim, Anders; Time, Berit; Kvande, Tore; Sivertsen, Edvard; Cepeda, Jose; Lappegard Hauge, Åshild; Bygballe, Lena; Almås, Anders-Johan

    2016-04-01

    Klima 2050 - Risk reduction through climate adaptation of buildings and infrastructure is a Centre for Research based Innovation (SFI), funded jointly by the Research Council of Norway (RCN) and the partners of the centre. The aim of Klima 2050 is to reduce the societal risks associated with climate changes, including enhanced precipitation and flood water exposure within the built environment. The Centre will strengthen companies' innovation capacity through a focus on long-term research. It is also a clear objective to facilitate close cooperation between Research & Development, performing companies, public entities, and prominent research groups. Emphasis will be placed on development of moisture-resilient buildings, storm-water management, blue-green solutions, mitigation measures for water-triggered landslides, socio-economic incentives and decision-making processes. Both extreme weather and gradual climatic changes will be addressed. The Centre consists of a consortium of 18 partners from three sectors: industry, public entities and research/education organizations. The partners from the industry/private sector include a variety of companies from the building industry. The public entities comprise the most important infrastructure owners in Norway (public roads, railroads, buildings, airports), as well as the directorate for water and energy. The research and education partners are SINTEF Building and Infrastructure, the Norwegian Business School, the Norwegian University of Science and Technology, the Norwegian Meteorological Institute, and the Norwegian Geotechnical Institute. This contribution presents the main research plans and activities of this Centre, which was started in 2015 and will run for 8 years, until 2023. The presentation also includes options for international cooperation in the Centre via PhD and postdoctoral positions, MSc projects and guest-researcher stays with Klima 2050 partners.

  13. At the centre of a science of psychopathology? Characteristics and limitations of cognitive research.

    PubMed

    Bentall, R P

    1996-01-01

    In this brief paper I will suggest that the cognitive approach has four characteristics which must place it at the centre of any complete science of psychopathology: (1) it leads to testable hypotheses about abnormal mental states; (2) it establishes a link between normal psychology and abnormal mental processes, and therefore obviates the need to dichotomise behaviour into the normal and the abnormal; (3) it has the potential to make apparently bizarre and irrational behaviour understandable; and (4) it is neutral with regard to the relative contributions that biology and the environment make to the aetiology of psychiatric disorders. I also identify three limitations of contemporary cognitive models of psychiatric disorders: (1) an over-reliance on conventional methods of psychiatric classification; (2) an underemphasis on social aspects of cognition; and (3) a failure to integrate findings obtained from different models. Once these limitations are overcome, cognitive research is likely to lead to a revolution in our understanding of abnormal behaviour.

  14. Community-based research in action: tales from the Ktunaxa community learning centres project.

    PubMed

    Stacy, Elizabeth; Wisener, Katherine; Liman, Yolanda; Beznosova, Olga; Lauscher, Helen Novak; Ho, Kendall; Jarvis-Selinger, Sandra

    2014-01-01

    Rural communities, particularly Aboriginal communities, often have limited access to health information, a situation that can have significant negative consequences. To address the lack of culturally and geographically relevant health information, a community-university partnership was formed to develop, implement, and evaluate Aboriginal Community Learning Centres (CLCs). The objective of this paper is to evaluate the community-based research process used in the development of the CLCs. It focuses on the process of building relationships among partners and the CLC's value and sustainability. Semistructured interviews were conducted with key stakeholders, including principal investigators, community research leads, and supervisors. The interview transcripts were analyzed using an open-coding process to identify themes. Key challenges included enacting shared project governance, negotiating different working styles, and hiring practices based on commitment to project objectives rather than skill set. Technological access provided by the CLCs increased capacity for learning and collective community initiatives, as well as building community leads' skills, knowledge, and self-efficacy. An important lesson was to meet all partners "where they are" in building trusting relationships and adapting research methods to fit the project's context and strengths. Successful results were dependent upon persistence and patience in working through differences, and breaking the project into achievable goals, which collectively contributed to trust and capacity building. The process of building these partnerships resulted in increased capacity of communities to facilitate learning and change initiatives, and the capacity of the university to engage in successful research partnerships with Aboriginal communities in the future.

  15. Canada's International Development Research Centre's eco-health projects with Latin Americans: origins, development and challenges.

    PubMed

    Cole, Donald C; Crissman, Charles C; Orozco, A Fadya

    2006-01-01

    Since its founding in 1970, Canada's International Development Research Centre (IDRC) has supported research by concerned Latin American researchers on environments and human health relationships. Framing of such relationships has changed through different periods. Participant observation, bibliographic searches, document review, and interviews with key IDRC staff. From the early years of multiple different projects, IDRC developed more focussed interest in tropical diseases, pesticides, agriculture and human health in the 1980s. The United Nations Conference on Sustainable Development in the early 1990s gave impetus to examination of links between ecosystems and human health or "EcoHealth". Projects in Latin America built on earlier work but extended it in methods (transdisciplinarity, community participation, gendered approach) and scope (broader land use and development paradigm issues tackled). A key IDRC-funded activity in Latin America was "EcoSalud", an Ecuadorian effort, which has worked with farming communities, agricultural researchers, health practitioners and local politicians to advance integrated pest management, better recognize and treat poisonings and improve pesticide-related policies. ONGOING CHALLENGES INCLUDE: mobilizing sufficient resources for the primary prevention focus of EcoHealth activities when primary care infrastructure remains stretched, promoting micro-level change in diverse communities and ecosystems, and addressing power structures at the global level that profoundly affect environmental change.

  16. Addiction research centres and the nurturing of creativity; the Research Institute on Addictions, University at Buffalo.

    PubMed

    Connors, Gerard J; Walitzer, Kimberly S

    2012-07-01

    The Research Institute on Addictions (RIA) was established in 1970 as a research component of the New York State Department of Mental Hygiene. After three decades of serving as a research component of New York State agencies concerned with alcohol and substance abuse, RIA was legislatively transferred to the University at Buffalo in 1999. Today, RIA's cadre of senior research scientists are engaged individually and collaboratively on a multitude of addictions-related studies. The majority of the Institute's ongoing research studies relate to one or more of the following seven broad research domains: causes and consequences of alcohol, marijuana and other drug use; biological and neuroscience; gambling behavior; gender-related studies; dissemination and professional training; treatment; and youth, families and relationships. In this paper, an overview of the structure of the Institute is provided, along with a description of the organizational and scientific culture at RIA. Further information about the Institute, its scientists and its activities can be found at http://www.ria.buffalo.edu. © 2011 The Authors, Addiction © 2011 Society for the Study of Addiction.

  17. Does a biomedical research centre affect patient care in local hospitals?

    PubMed

    Lichten, Catherine A; Marsden, Grace; Pollitt, Alexandra; Kiparoglou, Vasiliki; Channon, Keith M; Sussex, Jon

    2017-01-21

    Biomedical research can have impacts on patient care at research-active hospitals. We qualitatively evaluated the impact of the Oxford Biomedical Research Centre (Oxford BRC), a university-hospital partnership, on the effectiveness and efficiency of healthcare in local hospitals. Effectiveness and efficiency are conceptualised in terms of impacts perceived by clinicians on the quality, quantity and costs of patient care they deliver. First, we reviewed documentation from Oxford BRC and literature on the impact of research activity on patient care. Second, we interviewed leaders of the Oxford BRC's research to identify the direct and indirect impacts they expected their activity would have on local hospitals. Third, this information was used to inform interviews with senior clinicians responsible for patient care at Oxford's acute hospitals to discover what impacts they observed from research generally and from Oxford BRC's research work specifically. We compared and contrasted the results from the two sets of interviews using a qualitative approach. Finally, we identified themes emerging from the senior clinicians' responses, and compared them with an existing taxonomy of mechanisms through which quality of healthcare may be affected in research-active settings. We were able to interview 17 research leaders at the Oxford BRC and 19 senior clinicians at Oxford's acute hospitals. The research leaders identified a wide range of beneficial impacts that they expected might be felt at local hospitals as a result of their research activity. They expected the impact of their research activity on patient care to be generally positive. The senior clinicians responsible for patient care at those hospitals presented a more mixed picture, identifying many positive impacts, but also a smaller number of negative impacts, from research activity, including that of the Oxford BRC. We found the existing taxonomy of benefit types to be helpful in organising the findings, and propose

  18. Building a Student-Centred Learning Framework Using Social Software in the Middle Years Classroom: An Action Research Study

    ERIC Educational Resources Information Center

    Casey, Gail

    2013-01-01

    This article discusses the development of the online spaces that were used to create a learning framework: a student-centred framework that combined face-to-face teaching with online social and participatory media. The author, as part of her Doctoral research study, used action research as a mechanism for continual improvement as she redesigned…

  19. Building a Student-Centred Learning Framework Using Social Software in the Middle Years Classroom: An Action Research Study

    ERIC Educational Resources Information Center

    Casey, Gail

    2013-01-01

    This article discusses the development of the online spaces that were used to create a learning framework: a student-centred framework that combined face-to-face teaching with online social and participatory media. The author, as part of her Doctoral research study, used action research as a mechanism for continual improvement as she redesigned…

  20. Marine research in Greece and the additional Greek marine research centres: Progress and present situation

    NASA Astrophysics Data System (ADS)

    Haritonidis, S.

    1995-03-01

    Greece, as is known, has a coastline of 17 000 km, and over 2000 small and large islands. As expected, the quest of humankind for new sources of matter and energy has been focussed on the sea, with fishery being its primary interest. A number of philosophers and scientists have been involved in the study of this vast ecosystem since ancient times (Aristotle). The political, social and geographical upheavals witnessed in the Greek area, have, however resulted in bringing all these activities to a halt. The first contemporary research work commenced at the end of the 18th century/beginning of the 19th — with marine flora and fauna as its starting point. The first investigations had, of course, been limited to random collections of marine material done in the frame of international exploratory expeditions. Studies became more systematic by the end of the 19th and beginning of the 20th century, with priority being given to the animal kingdom (fish, molluscs, etc.). Investigation of the marine phytobenthos (macrophyceae, phytoplankton) was to follow. The past 40 years research has been more extensive, not limited only to biogeographical evaluations, but also having expanded to physiological and ecological levels. The relevant institutes of Greek universities have all the while watched and contributed to this effort. Today, this kind of research is being supported by the N.M.R.C., the Center of Marine Research, University of Crete, and two research boats which sail the Greek seas. In the ever-changing world, the study of marine flora and fauna has certainly made great progress; however, there are still two big problems to be faced. The first deals with increasing pollution of the seas, the second, with the difficulties in finding and affording adequate financial resources that would enable a more detailed and complete execution of this research work.

  1. Evaluating Industry-Based Doctoral Research Programs: Perspectives and Outcomes of Australian Cooperative Research Centre Graduates

    ERIC Educational Resources Information Center

    Manathunga, Catherine; Pitt, Rachael; Cox, Laura; Boreham, Paul; Mellick, George; Lant, Paul

    2012-01-01

    Researchers of the future will need to be able to work across the increasingly porous boundaries between university, industry, government and community sectors. Concerns have been raised internationally for several decades about the content and approaches adopted in doctoral programs. Innovative doctoral programs that facilitate students'…

  2. The Radiopharmaceuticals Production and Research Centre established by the Heavy Ion Laboratory of the University of Warsaw

    NASA Astrophysics Data System (ADS)

    Choiński, J.; Jastrzębskia, J.; Kilian, K.; Mazur, I.; Napiorkowski, P. J.; Pękal, A.; Szczepaniak, D.

    2014-03-01

    The Radiopharmaceuticals Production and Research Centre was recently installed on the premises of the Heavy Ion Laboratory, University of Warsaw. Equipped with a medical PETtrace p/d cyclotron , radiochemistry synthesis and dispensing units and a modern quality control laboratory the Centre is intended to produce regularly for commercial purposes the classic PET radiopharmaceuticals ( such -as e.g. FDG- ). Situated on the largest Warsaw scientific campus OCHOTA, an important part of the Centre's activities will also be devoted to the production of known species for preclinical studies and research into innovative radiopharmaceuticals in collaboration with other scientific units of this Campus as well as with members of the Warsaw Consortium for PET Collaboration. Research into the accelerator production route of 99mTc will also begin shortly.

  3. LeaRN: A Collaborative Learning-Research Network for a WLCG Tier-3 Centre

    NASA Astrophysics Data System (ADS)

    Pérez Calle, Elio

    2011-12-01

    The Department of Modern Physics of the University of Science and Technology of China is hosting a Tier-3 centre for the ATLAS experiment. A interdisciplinary team of researchers, engineers and students are devoted to the task of receiving, storing and analysing the scientific data produced by the LHC. In order to achieve the highest performance and to develop a knowledge base shared by all members of the team, the research activities and their coordination are being supported by an array of computing systems. These systems have been designed to foster communication, collaboration and coordination among the members of the team, both face-to-face and remotely, and both in synchronous and asynchronous ways. The result is a collaborative learning-research network whose main objectives are awareness (to get shared knowledge about other's activities and therefore obtain synergies), articulation (to allow a project to be divided, work units to be assigned and then reintegrated) and adaptation (to adapt information technologies to the needs of the group). The main technologies involved are Communication Tools such as web publishing, revision control and wikis, Conferencing Tools such as forums, instant messaging and video conferencing and Coordination Tools, such as time management, project management and social networks. The software toolkit has been deployed by the members of the team and it has been based on free and open source software.

  4. The biological research programme of the nuclear microprobe at the National Accelerator Centre, Faure

    NASA Astrophysics Data System (ADS)

    Prozesky, V. M.; Pineda, C. A.; Mesjasz-Przybylowicz, J.; Przybylowicz, W. J.; Churms, C. L.; Springhorn, K. A.; Moretto, Ph; Michelet, C.; Chikte, U.; Wenzl, P.

    2000-03-01

    The nuclear microprobe (NMP) unit of the National Accelerator Centre (NAC) has initiated a focused research programme on studies of biological material, ranging from applications in medicine to agriculture and botany. During this period a state-of-the-art cryo-preparation laboratory was also developed. This research programme has resulted in a wide range of projects, and has shown how well suited the NMP is for studies of biological material in general. This paper reports on some of the problems and demands in this field, as well as some of the results obtained using particle induced X-ray spectroscopy (PIXE) and Rutherford backscattering (RBS). True elemental imaging is routinely performed using the dynamic analysis (DA) method, which forms part of the GeoPIXE suite of programmes. A collaborative project, together with the CENBG group of Bordeaux-Gradignan in France, on the development of a facility with the aim of studying effects of single-events of radiation in living cells was recently established and is discussed.

  5. Radioactive waste handling and disposal at King Faisal Specialist Hospital and Research Centre.

    PubMed

    Al-Haj, Abdalla N; Lobriguito, Aida M; Al Anazi, Ibrahim

    2012-08-01

    King Faisal Specialist Hospital & Research Centre (KFSHRC) is the largest specialized medical center in Saudi Arabia. It performs highly specialized diagnostic imaging procedures with the use of various radionuclides required by sophisticated dual imaging systems. As a leading institution in cancer research, KFSHRC uses both long-lived and short-lived radionuclides. KFSHRC established the first cyclotron facility in the Middle East, which solved the in-house high demand for radionuclides and the difficulty in importing them. As both user and producer of high standard radiopharmaceuticals, KFSHRC generates large volumes of low and high level radioactive wastes. An old and small radioactive facility that was used for storage of radioactive waste was replaced with a bigger warehouse provided with facilities that will reduce radiation exposure of the staff, members of the public, and of the environment in the framework of "as low as reasonably achievable." The experiences and the effectiveness of the radiation protection program on handling and storage of radioactive wastes are presented.

  6. Profile: Manhiça Health Research Centre (Manhiça HDSS).

    PubMed

    Sacoor, Charfudin; Nhacolo, Ariel; Nhalungo, Delino; Aponte, John J; Bassat, Quique; Augusto, Orvalho; Mandomando, Inácio; Sacarlal, Jahit; Lauchande, Natu; Sigaúque, Betuel; Alonso, Pedro; Macete, Eusébio; Munguambe, Khátia; Guinovart, Caterina; Aide, Pedro; Menendez, Clara; Acácio, Sozinho; Quelhas, Diana; Sevene, Esperança; Nhampossa, Tacilta

    2013-10-01

    The Manhiça Health Research Centre, established in 1996 in a rural area of southern Mozambique, currently follows around 92 000 individuals living in approximately 20 000 enumerated and geo-positioned households. Its main strength is the possibility of linking demographic data and clinical data to promote and conduct biomedical research in priority health areas. Socio-demographic data are updated twice a year and clinical data are collected on a daily basis. The data collected in Manhiça HDSS comprises household and individual characteristics, household socio-economic assets, vital data, migration, individual health history and cause of death, among others. Studies conducted in this HDSS contributed to guide the health authorities and decision-making bodies to define or adjust health policies such as the introduction of Mozambique's expanded programme of immunization with different vaccines (Haemophilus influenzae type b, Pneumococcus) or the development of the concept of Intermittent Preventive Treatment for Infants (IPTi) that led to the World Health Organization recommendation of this method as best practice for the control of malaria among infants. Manhiça's data can be accessed through a formal request to Diana Quelhas (diana.quelhas@manhica.net) accompanied by a proposal that will be analysed by the Manhiça HDSS internal scientific and ethics committees.

  7. Using Art Installations as Action Research to Engage Children and Communities in Evaluating and Redesigning City Centre Spaces

    ERIC Educational Resources Information Center

    Percy-Smith, Barry; Carney, Clare

    2011-01-01

    This paper discusses learning from a project that set out to explore how the general public perceived the value of public art in the context of urban regeneration of a city centre space. Whilst not set up explicitly as an action research project, the paper discusses the way in which participatory public art projects of this kind can be understood…

  8. Establishing a Community-Controlled Multi-Institutional Centre for Clinical Research Excellence in Aboriginal and Torres Strait Islander Health

    ERIC Educational Resources Information Center

    Pearce, Leilani; Fredericks, Bronwyn

    2007-01-01

    The Queensland Aboriginal and Islander Health Council (QAIHC) lead and govern the Centre for Clinical Research Excellence (CCRE), which has a focus on circulatory and associated conditions in urban Aboriginal and Torres Strait Islander communities. The CCRE is a partnership between QAIHC and Monash University, the Queensland University of…

  9. When Triple Helix Unravels: A Multi-Case Analysis of Failures in Industry-University Cooperative Research Centres

    ERIC Educational Resources Information Center

    Gray, Denis; Sundstrom, Eric; Tornatzky, Louis G.; McGowen, Lindsey

    2011-01-01

    Cooperative research centres (CRCs) increasingly foster Triple Helix (industry-university-government) collaboration and represent significant vehicles for cooperation across sectors, the promotion of knowledge and technology transfer and ultimately the acceleration of innovation. A growing social science literature on CRCs focuses on their…

  10. When Triple Helix Unravels: A Multi-Case Analysis of Failures in Industry-University Cooperative Research Centres

    ERIC Educational Resources Information Center

    Gray, Denis; Sundstrom, Eric; Tornatzky, Louis G.; McGowen, Lindsey

    2011-01-01

    Cooperative research centres (CRCs) increasingly foster Triple Helix (industry-university-government) collaboration and represent significant vehicles for cooperation across sectors, the promotion of knowledge and technology transfer and ultimately the acceleration of innovation. A growing social science literature on CRCs focuses on their…

  11. Using Art Installations as Action Research to Engage Children and Communities in Evaluating and Redesigning City Centre Spaces

    ERIC Educational Resources Information Center

    Percy-Smith, Barry; Carney, Clare

    2011-01-01

    This paper discusses learning from a project that set out to explore how the general public perceived the value of public art in the context of urban regeneration of a city centre space. Whilst not set up explicitly as an action research project, the paper discusses the way in which participatory public art projects of this kind can be understood…

  12. Bombay phenotype in two North Indian brothers: a case report.

    PubMed

    Kaur, Paramjit; Basu, Sabita; Bedi, Ravneet Kaur; Kaur, Gagandeep

    2007-10-01

    Bombay phenotype is unique in the aspect that the red cells are not agglutinated by antisera A, B and H. However the serum of such individuals contains anti A, B and strongly reactive anti H which agglutinates red cells of 'O' group individuals through a wide thermal range. The blood specimen of a 35 year old male donor who donated blood for the first time was subjected to detailed cell and serum grouping. There was a discrepancy between the results. The possibility of Bombay phenotype was considered and the sample was tested with anti H lectin. Further confirmation of blood group and secretor status was done from a reference laboratory. Family studies showed the same blood group in the elder sibling of the propositus. The present case highlights the significance of correlating cell and serum grouping results. Moreover, this blood group is very rare in North India. Family studies revealed the propositus to possess the B gene which was suppressed in the donor but expressed in the offsprings. The use of anti H in discrepant blood grouping results is recommended.

  13. A rare case of haemolytic disease of newborn with Bombay phenotype mother

    PubMed Central

    Shastry, Shamee; Lewis, Leslie E.; Bhat, Sudha S.

    2013-01-01

    We are reporting a rare case of severe hemolytic disease of newborn (HDN) with Bombay phenotype mother. A retrospective study of a case with severe haemolytic disease of newborn with Bombay phenotype mother was done. Blood grouping, antibody screening, and lectin study was done on the blood sample of the baby and mother to confirm the diagnosis. Hematological and biochemical parameters were obtained from the hospital laboratory information system for the analysis. Blood group of the baby was A positive, direct antiglobulin test was negative. Blood group of the mother was confirmed to be Bombay phenotype, Hematological parameters showed all the signs of ongoing hemolysis and the bilirubin level was in the zone of exchange transfusion. Due to the unavailability of this rare phenotype blood unit, baby was managed conservatively. Anticipating the fetal anemia and HDN with mothers having Bombay phenotype and prior notification to the transfusion services will be of great help in optimizing the neonatal care and outcome. PMID:24014949

  14. A rare case of haemolytic disease of newborn with Bombay phenotype mother.

    PubMed

    Shastry, Shamee; Lewis, Leslie E; Bhat, Sudha S

    2013-07-01

    We are reporting a rare case of severe hemolytic disease of newborn (HDN) with Bombay phenotype mother. A retrospective study of a case with severe haemolytic disease of newborn with Bombay phenotype mother was done. Blood grouping, antibody screening, and lectin study was done on the blood sample of the baby and mother to confirm the diagnosis. Hematological and biochemical parameters were obtained from the hospital laboratory information system for the analysis. Blood group of the baby was A positive, direct antiglobulin test was negative. Blood group of the mother was confirmed to be Bombay phenotype, Hematological parameters showed all the signs of ongoing hemolysis and the bilirubin level was in the zone of exchange transfusion. Due to the unavailability of this rare phenotype blood unit, baby was managed conservatively. Anticipating the fetal anemia and HDN with mothers having Bombay phenotype and prior notification to the transfusion services will be of great help in optimizing the neonatal care and outcome.

  15. Emergency dilatation and curettage in a patient with Bombay blood group.

    PubMed

    Ali, Muhammad Asghar; Sohaib, Muhammad

    2014-08-01

    Bombay blood group is a rare autosomal recessive phenotype within the ABO blood group. It represents genetically suppressed A, B and H genes. When considering such patients for transfusion, only blood of identical Bombay type can be safely transfused. We are reporting a patient having Bombay phenotypic blood, underwent emergency dilatation and curettage with active per vaginal bleeding due to retained products of placenta. There are numerous anaesthetic considerations, including emergency surgery with hemodynamic instability due to ongoing blood loss, dilutional coagulopathy as well as presence of Bombay phenotype that severely limit the possibility of red blood cell transfusion. Only four donors were registered with the blood bank of the institution and none was traceable. It becomes a real challenge for the anesthesiologist to manage such type of patients without having units of red packed cell which management is described hereby.

  16. Resurgence of malaria in Bombay (Mumbai) in the 1990s: a historical perspective.

    PubMed

    Kamat, V

    2000-06-01

    Bombay has achieved extraordinary success in controlling its malaria problem for nearly six decades by relying primarily on legislative measures and non-insecticidal methods of mosquito abatement. In 1992, however, malaria reemerged in Bombay with a vengeance. During 1992-1997, the city witnessed a manifold increase in the number of malaria cases diagnosed and treated by the public health system. The large number of malaria patients treated by private practitioners was not recorded by the municipal malaria surveillance system during this period. In 1995, at the peak of the resurgence, public health officials of the Municipal Corporation of Greater Bombay (MCGB) confirmed that 170 persons in the city had died due to malaria. The crisis was unprecedented in Bombay's modern public health history. In response to intense criticism from the media, the city's public health officials attributed the resurgence to the global phenomenon of mosquito-vector resistance to insecticides, and Plasmodium resistance to antimalarial chemoprophylaxis and treatment. Local scientists who investigated the problem offered no support to this explanation. So what might explain the resurgence? What factors led the problem to reach an epidemic level in a matter of two or three years? In addressing the above principal questions, this paper adopts a historical perspective and argues that in the resurgence of malaria in Bombay in the 1990s, there is an element of the 'presence of the past'. In many ways the present public health crisis in Bombay resembles the health scenario that characterized the city at the turn of the 19th century. It is possible to draw parallels between the early public health history of malaria control in Bombay, which was punctuated by events that followed the bubonic plague epidemic of 1896, and the present-day malaria epidemic punctuated by the threat of a plague epidemic in 1994. As such, the paper covers a long period, of almost 100 years. This time-depth is used to

  17. Research and Development Digest--2. A Summary of Published Research by the Centre for the Period 1 July, 1986 - 30 June, 1987.

    ERIC Educational Resources Information Center

    Hall, William C., Ed.

    This digest summarizes the contents of the more than 50 separate items that were published by the Technical and Further Education (TAFE) National Centre for Research and Development in 1986-87. These items include major research reports, video programs, newsletters, clearinghouse reports and textbooks. The first section provides an overview of the…

  18. The strategy of the Belgian nuclear research centre in the area of high-level waste form compatibility research

    SciTech Connect

    Lemmens, Karel; Cachoir, Christelle; Valcke, Elie; Ferrand, Karine; Aertsens, Marc; Mennecart, Thierry

    2007-07-01

    The Belgian Nuclear Research Centre (SCK.CEN) has a long-standing expertise in research concerning the compatibility of waste forms with the final disposal environment. For high level waste, most attention goes to two waste forms that are relevant for Belgium, namely (1) vitrified waste from the reprocessing of spent fuel, and (2) spent fuel as such, referring to the direct disposal scenario. The expertise lies especially in the study of the chemical interactions between the waste forms and the disposal environment. This is done by laboratory experiments, supported by modeling. The experiments vary from traditional leach tests, to more specific tests for the determination of particular parameters, and highly realistic experiments. This results in a description of the phenomena that are expected upon disposal of the waste forms, and in quantitative data that allow a conservative long-term prediction of the in situ life time of the waste form. The predictions are validated by in situ experiments in the underground research laboratory HADES. The final objective of these studies, is to estimate the contribution of the waste form to the overall safety of the disposal system, as part of the Safety and Feasibility Case, planned by the national agency ONDRAF/NIRAS. The recent change of the Belgian disposal concept from an engineered barrier system based on the use of bentonite clay to a system based on a concrete buffer has caused a reorientation of the research programme. The expertise in the area of clay-waste interaction will however be maintained, to develop experimental methodologies in collaboration with other countries, and as a potential support to the decision making in those countries where a clay based near field is still the reference. The paper explains the current R and D approach, and highlights some recent experimental set-ups available at SCK.CEN for this purpose, with some illustrating results. (authors)

  19. International linking of research and development on the model of Laser Centre Hanover

    NASA Astrophysics Data System (ADS)

    Nowitzki, Klaus-Dieter; Boedecker, Olaf

    2005-10-01

    Asia is becoming one of the most important regions in the world from the political, economic and scientific point of view. Germany believes that it is becoming increasingly necessary to cooperate with certain Asian countries especially for scientific and technological reasons. Above and beyond exchanges of scientists, the scientific and technological cooperation will be organized to cover projects with specific targets and to find solutions to important problems. International economic development is characterized by a mixture of competition and cooperation within the context of growing globalization. Germany, being one of the world's largest exporting nation, must therefore combine its active role in cooperation with these countries in the fields of education, research and innovation with economic cooperation. The Laser Centre Hanover pursues the goal of establishing and operating a Chinese German center for training and further education in laser technology and setting up a joint platform for long-term German Chinese cooperation in laser technology. An optimized training infrastructure combined with modern production processes support consequently long-term German businesses in China and secures their market-shares. LZH establishes Laser academies for skilled workers and technical decision makers in Shanghai and Changchun together with local universities and German partners. Due to the economic growth, Russia records since more than two years, the economic conditions are improving the cooperation between Germany and Russia step-by-step. The main goal of Russian science-politics is to stabilize an efficient scientific-technical potential with better chances in the global competition. The German-Russian scientific and technological cooperation plays an important role in this context. It has considerably increased in the last years in terms of width and depth and virtually includes all areas of science and technology at present. The region around Moscow is regarded

  20. Mycetoma in the Sudan: an update from the Mycetoma Research Centre, University of Khartoum, Sudan.

    PubMed

    Fahal, Ahmed; Mahgoub, El Sheikh; El Hassan, Ahmed M; Abdel-Rahman, Manar Elsheikh

    2015-03-01

    This communication reports on the Mycetoma Research Centre of the University of Khartoum, Sudan experience on 6,792 patients seen during the period 1991-2014.The patients were predominately young (64% under 30 years old) males (76%). The majority (68%) were from the Sudan mycetoma belt and 28% were students. Madurella mycetomatis eumycetoma was the most common type (70%). In 66% of the patients the duration of the disease was less than five years, and 81% gave a history of sinuses discharging mostly black grains (78%). History of trauma at the mycetoma site was reported in 20%. Local pain was reported in 27% of the patients, and only 12% had a family history of mycetoma. The study showed that 57% of the patients had previous surgical excisions and recurrence, and only 4% received previous medical treatment for mycetoma. Other concomitant medical diseases were reported in 4% of the patients. The foot (76%) and hand (8%) were the most commonly affected sites. Less frequently affected sites were the leg and knee (7%), thigh (2%), buttock (2%) and arm and forearm (1%). Rare sites included the chest wall, head and neck, back, abdominal wall, perineum, oral cavity, tongue and eye. Multiple sites mycetoma was recorded in 135 (2%) of cases. At presentation, 37% of patients had massive lesions, 79% had sinuses, 8% had local hyper-hydrosis at the mycetoma lesion, 11% had regional lymphadenopathy, while 6% had dilated tortuous veins proximal to the mycetoma lesions. The diagnosis of mycetoma was established by combined imaging techniques and cytological, histopathological, serological tests and grain culture. Patients with actinomycetoma received a combination of antimicrobial agents, while eumycetoma patients received antifungal agents combined with various surgical excisions. Surgical excisions in the form of wide local excision, debridement or amputation were done in 807 patients, and of them 248 patients (30.7%) had postoperative recurrence. Different types of amputations

  1. Transregional Collaborative Research Centre 32: Patterns in Soil-Vegetation-Atmosphere-Systems

    NASA Astrophysics Data System (ADS)

    Simmer, C.; Thiele-Eich, I.

    2015-12-01

    The Collaborative Research Centre TR32 has the goal to perform pattern-based prediction of states and fluxes of water, CO2 and energy in terrestrial systems across scales. For this, the TR32 set up the following three elements during the past nine years: measurement techniques that allow us to characterize and monitor the spatiotemporal dynamics and evolution of system properties across scales, a cross-scale, multi-compartment terrestrial system modeling approach that includes all relevant processes using the terrestrial model platform TerrSysMP and state variable assimilation and parameter estimation methods. We will present examples of how the TR32 utilizes these three elements to improve our understanding of the water cycle. The available soil moisture monitoring network consisting of e.g. cosmic-ray sensors or an in situ NMR slim-line logging tool has been helpful in understanding the interactions of plant growth and soil moisture dynamics. New algorithms derive soil moisture from satellite based SAR systems, which showed potential for the derivation of surface roughness and vegetation information. For surface precipitation, a radar composite using observations from two dual-polarized X-band Doppler radars provides nearly 100% coverage of the Rur catchment. To also be able to include other precipitation observations which occur at different temporal and spatial resolutions, such as rain gauges, a high resolution space-time precipitation model is being developed. Commercial microwave links used for cell phone communication have also been experimented with to improve polarimetric quantitative precipitation estimation. In addition, uncertainty plays a major role with respect to the central goal of the TR32 and is taken into account in various ways. For example, model uncertainty in the Rur catchment results in large parts from anthropogenic activities such as e.g. drainage patterns in fields, the control of the Rur discharge, groundwater pumping, storage lakes

  2. [Descriptive study of cancer incidence in the area around the Ispra Joint Research Centre (JCR)].

    PubMed

    Pisani, Salvatore; Bianchi, Nadia; Gambino, Maria; Prandini, Beatrice; Soma, Renato; Contiero, Paolo; Tagliabue, Giovanna; Marmondi, Elio Giorgio; Banfi, Fabio; Bonarrigo, Domenico

    2009-01-01

    to assess the effects of radioactive emissions from the EU Joint Research Centre (JRC) (nuclear) at Ispra, the Local Health Authority (ASL) of Varese carried out an ecological study to measure any excess incidence of cancer in the surrounding population. after estimation of historical exposure levels in the surrounding population, the incidence rates of leukaemia and other exposure-related tumours were calculated from data in the population based Lombardy Cancer Registry (Varese Province). By indirect standardization, the expected cases (based on incidence rate in the Province) were compared with observed cases in the close-by municipality of Ispra, in municipalities within a 5 km radius of the JRC (5kmArea) and in the area covered by the District of Sesto Calende (DistrictArea). in the period 1982-1998, mean populations were 4,687 (Ispra), 32,120 (5kmArea) and 43,707 (DistrictArea); the population of the Province was 793,752. The numbers of cancers registered were 374, 2,920, 4,099 and 72,246 respectively. Significant excesses of leukaemia were not found in Ispra (SIR 0.33, 95% CI 0.07-0.96) or the 5kmArea (SIR 0.83, 95% CI 0.63-1.08). For all cancers combined and for the commonest cancers (breast, colo-rectal) the numbers of incident cases were lower than expected. consistent with the low levels of exposure detected, and despite the fears of the local people, no incidence excesses of cancers was found in Ispra, the town closest to the JRC, or inforin the surrounding areas. It may be worth searching for excess cancer among exposed workers.

  3. Mycetoma in the Sudan: An Update from the Mycetoma Research Centre, University of Khartoum, Sudan

    PubMed Central

    Fahal, Ahmed; Mahgoub, EL Sheikh; Hassan, Ahmed M. EL; Abdel-Rahman, Manar Elsheikh

    2015-01-01

    This communication reports on the Mycetoma Research Centre of the University of Khartoum, Sudan experience on 6,792 patients seen during the period 1991–2014.The patients were predominately young (64% under 30 years old) males (76%). The majority (68%) were from the Sudan mycetoma belt and 28% were students. Madurella mycetomatis eumycetoma was the most common type (70%). In 66% of the patients the duration of the disease was less than five years, and 81% gave a history of sinuses discharging mostly black grains (78%). History of trauma at the mycetoma site was reported in 20%. Local pain was reported in 27% of the patients, and only 12% had a family history of mycetoma. The study showed that 57% of the patients had previous surgical excisions and recurrence, and only 4% received previous medical treatment for mycetoma. Other concomitant medical diseases were reported in 4% of the patients. The foot (76%) and hand (8%) were the most commonly affected sites. Less frequently affected sites were the leg and knee (7%), thigh (2%), buttock (2%) and arm and forearm (1%). Rare sites included the chest wall, head and neck, back, abdominal wall, perineum, oral cavity, tongue and eye. Multiple sites mycetoma was recorded in 135 (2%) of cases. At presentation, 37% of patients had massive lesions, 79% had sinuses, 8% had local hyper-hydrosis at the mycetoma lesion, 11% had regional lymphadenopathy, while 6% had dilated tortuous veins proximal to the mycetoma lesions. The diagnosis of mycetoma was established by combined imaging techniques and cytological, histopathological, serological tests and grain culture. Patients with actinomycetoma received a combination of antimicrobial agents, while eumycetoma patients received antifungal agents combined with various surgical excisions. Surgical excisions in the form of wide local excision, debridement or amputation were done in 807 patients, and of them 248 patients (30.7%) had postoperative recurrence. Different types of

  4. Building up careers in translational neuroscience and mental health research: Education and training in the Centre for Biomedical Research in Mental Health.

    PubMed

    Rapado-Castro, Marta; Pazos, Ángel; Fañanás, Lourdes; Bernardo, Miquel; Ayuso-Mateos, Jose Luis; Leza, Juan Carlos; Berrocoso, Esther; de Arriba, Jose; Roldán, Laura; Sanjuán, Julio; Pérez, Victor; Haro, Josep M; Palomo, Tomás; Valdizan, Elsa M; Micó, Juan Antonio; Sánchez, Manuel; Arango, Celso

    2015-01-01

    The number of large collaborative research networks in mental health is increasing. Training programs are an essential part of them. We critically review the specific implementation of a research training program in a translational Centre for Biomedical Research in Mental Health in order to inform the strategic integration of basic research into clinical practice to have a positive impact in the mental health system and society. Description of training activities, specific educational programs developed by the research network, and challenges on its implementation are examined. The Centre for Biomedical Research in Mental Health has focused on training through different activities which have led to the development of an interuniversity master's degree postgraduate program in mental health research, certified by the National Spanish Agency for Quality Evaluation and Accreditation. Consolidation of training programs within the Centre for Biomedical Research in Mental Health has considerably advanced the training of researchers to meet competency standards on research. The master's degree constitutes a unique opportunity to accomplish neuroscience and mental health research career-building within the official framework of university programs in Spain.

  5. Royal College of General Practitioners Research and Surveillance Centre (RCGP RSC) sentinel network: a cohort profile

    PubMed Central

    Correa, Ana; Hinton, William; McGovern, Andrew; van Vlymen, Jeremy; Yonova, Ivelina; Jones, Simon; de Lusignan, Simon

    2016-01-01

    Purpose The Royal College of General Practitioners Research and Surveillance Centre (RCGP RSC) is one of the longest established primary care sentinel networks. In 2015, it established a new data and analysis hub at the University of Surrey. This paper evaluates the representativeness of the RCGP RSC network against the English population. Participants and method The cohort includes 1 042 063 patients registered in 107 participating general practitioner (GP) practices. We compared the RCGP RSC data with English national data in the following areas: demographics; geographical distribution; chronic disease prevalence, management and completeness of data recording; and prescribing and vaccine uptake. We also assessed practices within the network participating in a national swabbing programme. Findings to date We found a small over-representation of people in the 25–44 age band, under-representation of white ethnicity, and of less deprived people. Geographical focus is in London, with less practices in the southwest and east of England. We found differences in the prevalence of diabetes (national: 6.4%, RCPG RSC: 5.8%), learning disabilities (national: 0.44%, RCPG RSC: 0.40%), obesity (national: 9.2%, RCPG RSC: 8.0%), pulmonary disease (national: 1.8%, RCPG RSC: 1.6%), and cardiovascular diseases (national: 1.1%, RCPG RSC: 1.2%). Data completeness in risk factors for diabetic population is high (77–99%). We found differences in prescribing rates and costs for infections (national: 5.58%, RCPG RSC: 7.12%), and for nutrition and blood conditions (national: 6.26%, RCPG RSC: 4.50%). Differences in vaccine uptake were seen in patients aged 2 years (national: 38.5%, RCPG RSC: 32.8%). Owing to large numbers, most differences were significant (p<0.00015). Future plans The RCGP RSC is a representative network, having only small differences with the national population, which have now been quantified and can be assessed for clinical relevance for specific studies. This

  6. Royal College of General Practitioners Research and Surveillance Centre (RCGP RSC) sentinel network: a cohort profile.

    PubMed

    Correa, Ana; Hinton, William; McGovern, Andrew; van Vlymen, Jeremy; Yonova, Ivelina; Jones, Simon; de Lusignan, Simon

    2016-04-20

    The Royal College of General Practitioners Research and Surveillance Centre (RCGP RSC) is one of the longest established primary care sentinel networks. In 2015, it established a new data and analysis hub at the University of Surrey. This paper evaluates the representativeness of the RCGP RSC network against the English population. The cohort includes 1 042 063 patients registered in 107 participating general practitioner (GP) practices. We compared the RCGP RSC data with English national data in the following areas: demographics; geographical distribution; chronic disease prevalence, management and completeness of data recording; and prescribing and vaccine uptake. We also assessed practices within the network participating in a national swabbing programme. We found a small over-representation of people in the 25-44 age band, under-representation of white ethnicity, and of less deprived people. Geographical focus is in London, with less practices in the southwest and east of England. We found differences in the prevalence of diabetes (national: 6.4%, RCPG RSC: 5.8%), learning disabilities (national: 0.44%, RCPG RSC: 0.40%), obesity (national: 9.2%, RCPG RSC: 8.0%), pulmonary disease (national: 1.8%, RCPG RSC: 1.6%), and cardiovascular diseases (national: 1.1%, RCPG RSC: 1.2%). Data completeness in risk factors for diabetic population is high (77-99%). We found differences in prescribing rates and costs for infections (national: 5.58%, RCPG RSC: 7.12%), and for nutrition and blood conditions (national: 6.26%, RCPG RSC: 4.50%). Differences in vaccine uptake were seen in patients aged 2 years (national: 38.5%, RCPG RSC: 32.8%). Owing to large numbers, most differences were significant (p<0.00015). The RCGP RSC is a representative network, having only small differences with the national population, which have now been quantified and can be assessed for clinical relevance for specific studies. This network is a rich source for research into routine practice

  7. Process Evaluation of a Teaching and Learning Centre at a Research University

    ERIC Educational Resources Information Center

    Smith, Deborah B.; Gadbury-Amyot, Cynthia C.

    2014-01-01

    This paper describes the evaluation of a teaching and learning centre (TLC) five?years after its inception at a mid-sized, midwestern state university. The mixed methods process evaluation gathered data from 209 attendees and non-attendees of the TLC from the full-time, benefit-eligible teaching faculty. Focus groups noted feelings of…

  8. Process Evaluation of a Teaching and Learning Centre at a Research University

    ERIC Educational Resources Information Center

    Smith, Deborah B.; Gadbury-Amyot, Cynthia C.

    2014-01-01

    This paper describes the evaluation of a teaching and learning centre (TLC) five?years after its inception at a mid-sized, midwestern state university. The mixed methods process evaluation gathered data from 209 attendees and non-attendees of the TLC from the full-time, benefit-eligible teaching faculty. Focus groups noted feelings of…

  9. Acarological diagnostic research at the Diagnostic Centre for Plants during the period 2004-2006.

    PubMed

    Witters, J; De Bondt, G; Desamblanx, J; Casteels, H

    2007-01-01

    During the period 2004-2006, 1691 samples of different origin were examined at the Diagnostic Centre for Plants. We received 1046 samples of imported plant material for detection and identification of quarantine organisms. More than 200 samples were checked on mites and insects to get a phytosanitary certificate for export and 391 samples were investigated for diagnostic reason. The Berlese-funnel and dissecting microscopy technique were used to separate mites from the samples. For identification, the mites were slide mounted in Berlese-Hoyer's medium and examined by using phase-contrast microscopy. In 3% of the samples examined on the presence of quarantine organisms, phytophagous mites belonging to the superfamily Tetranychoidea were found, but none with the quarantine status in accordance with the EPPO A1/A2 list. Besides Tetranychus urticae detected on different crops, the cassava green mite Mononychellus progresivus was found on cassava (import Cameroon) in 2006. Tenuipalpus elegans (Tenuipalpidae) was found on cut foliage (import South Africa) in 2004. In 19.9% of the investigated samples for diagnostic reason mites were found. In 47.7% of the infested samples mites were definitely the reason for the damage; in 15.9% mites were secondary and in 36.4% the occurrence of mites was not relevant for the injury. An overview of the determined mites will be given. During this 3 years diagnostic research a few new pest mites belonging to families Tetranychidae and Eriophyidae can be reported. In 2006 Panonychus citri was found on Prunus laurocerasus and later on Eleaegnus sp. and Skimmia sp.. Aceria silvicola was determined on Rubus idaeus in 2006 and Aculus ulae and Aceria carpini on Carpinus betulus in 2005. Besides new pest mites, never seen problems with the broad mite Polyphagotarsonemus latus (Fam. Tarsonemidae) occurred in tree-nurseries in 2005 and 2006. Also 20 samples coming from private persons were investigated. The main problems indoor were caused by

  10. Transregional Collaborative Research Centre 32: Patterns in Soil-Vegetation-Atmosphere-Systems

    NASA Astrophysics Data System (ADS)

    Simmer, C.

    2014-12-01

    The spatio-temporal dynamics of states, flow and transport within the groundwater-soil-vegetation-atmosphere (GSVA) system lead to complex, scale-dependent patterns, which make predictions of terrestrial systems challenging to both scientists and policymakers. Studying how patterns influence fluxes and state variables across scales is a key goal of the Collaborative Research Centre TR32, which approaches this challenge by monitoring, modelling and data assimilation using the Rur catchment (Germany) as its study area.The evolution of system state variables across scales is monitored using two dual-polarized X-band Doppler radars as well as the atmospheric boundary layer, cloud and precipitation monitoring site JOYCE (Jülich ObservatorY for Cloud Evolution), and measurements from eddy covariance stations, an extensive soil moisture network including cosmic-ray probes. Monitoring is complemented by a suite of geophysical methods such as Nuclear Magnetic Resonance, Spectral Induced Polarization, Electromagnetic Induction, and Ground-Penetrating Radar, as well as a rhizotrone facility set up to monitor root development in conjunction with plant growth.The TR32 employs multi-compartment modelling to upscale the water, CO2 and energy fluxes from the local to the catchment scale. The analysis of the simulations with grids that honor the respective scales reveal the role of patterns on the fluxes and helps to design a general upscaling framework that quantifies information transfer between scales.Model development centers around the coupled model platform TerrSysMP, which considers mutual fluxes from the groundwater to the atmosphere by combining the atmospheric model COSMO, the land surface model CLM, and the hydrological model ParFlow in a scale-consistent way using the OASIS coupler. Processes down to the root scale are modelled at high resolution in order to obtain improved parameterizations for TerrSysMP. State variable assimilation and parameter estimation methods

  11. A National network of schizophrenia expert centres: An innovative tool to bridge the research-practice gap.

    PubMed

    Schürhoff, F; Fond, G; Berna, F; Bulzacka, E; Vilain, J; Capdevielle, D; Misdrahi, D; Leboyer, M; Llorca, P-M

    2015-09-01

    Schizophrenia is probably the most severe psychiatric disorder with much suffering for the patients and huge costs for the society. Efforts to provide optimal care by general practitioners and psychiatrists are undermined by the complexity of the disorder and difficulties in applying clinical practice guidelines and new research findings to the spectrum of cases seen in day-to-day practice. An innovative model of assessment aimed at improving global care of people with schizophrenia provided by the French national network of schizophrenia expert centres is being described. Each centre has established strong links to local health services and provides support to clinicians in delivering personalized care plans. A common set of assessment tools has been adopted by the ten centres spread over the whole French territory. A web application, e-schizo(©) has been created to record data in a common computerized medical file. This network offers systematic, comprehensive, longitudinal, and multi-dimensional assessments of cases including a medical workup and an exhaustive neuropsychological evaluation. This strategy offers an effective way to transfer knowledge and share expertise. This network is a great opportunity to improve the global patient care and is conceived as being an infrastructure for research from observational cohort to translational research.

  12. Detection of rare blood group, Bombay (Oh) phenotype patients and management by acute normovolemic hemodilution

    PubMed Central

    Shrivastava, Manisha; Navaid, Seema; Peethambarakshan, A.; Agrawal, Kalpana; Khan, Athar

    2015-01-01

    Background: Due to lack of correct blood grouping practices, the rare Bombay Oh phenotype may be missed, subjecting patients to the risk of severe hemolytic transfusion reaction. In the absence of blood donor registry, transfusion management of patients needing immediate surgery is a challenge. This study presents detection of rare Bombay Oh phenotype patients and their management by acute peri-operative acute normovolemic hemodilution (ANH) in a hospital from central India. Materials and Methods: Blood grouping of patients and blood donors with a standard tube method was carried out and samples identified as rare Bombay phenotype were confirmed by saliva inhibition test. Surgical management of cases needing transfusion was done by ANH, as per the British Committee for Standards in Hematology guidelines. Results: The incidence of Bombay phenotype was 0.002% or 1 in 51,924 in the study. Amongst three cases (patients) identified as Bombay phenotype, one was Bombay Oh, Rh negative. Two cases were missed in the first instance and one case actually did not require transfusion. In the absence of a blood donor registry for Bombay phenotype, the cases needing transfusion were successfully managed with ANH in the operation theatre. Conclusion: A simple test like blood grouping should be done with serious intention with incorporation of both forward and reverse grouping, so that no patient receives wrong blood leading to fatal hemolysis due to transfusion. ANH is a cost-effective transfusion option for suitable patients. Appropriate clinical decision making, use of strategies to decrease peri-operative blood losses and cost-effective country based planning could be more widely applied to improve clinical transfusion practice. PMID:25722578

  13. Detection of rare blood group, Bombay (Oh) phenotype patients and management by acute normovolemic hemodilution.

    PubMed

    Shrivastava, Manisha; Navaid, Seema; Peethambarakshan, A; Agrawal, Kalpana; Khan, Athar

    2015-01-01

    Due to lack of correct blood grouping practices, the rare Bombay Oh phenotype may be missed, subjecting patients to the risk of severe hemolytic transfusion reaction. In the absence of blood donor registry, transfusion management of patients needing immediate surgery is a challenge. This study presents detection of rare Bombay Oh phenotype patients and their management by acute peri-operative acute normovolemic hemodilution (ANH) in a hospital from central India. Blood grouping of patients and blood donors with a standard tube method was carried out and samples identified as rare Bombay phenotype were confirmed by saliva inhibition test. Surgical management of cases needing transfusion was done by ANH, as per the British Committee for Standards in Hematology guidelines. The incidence of Bombay phenotype was 0.002% or 1 in 51,924 in the study. Amongst three cases (patients) identified as Bombay phenotype, one was Bombay Oh, Rh negative. Two cases were missed in the first instance and one case actually did not require transfusion. In the absence of a blood donor registry for Bombay phenotype, the cases needing transfusion were successfully managed with ANH in the operation theatre. A simple test like blood grouping should be done with serious intention with incorporation of both forward and reverse grouping, so that no patient receives wrong blood leading to fatal hemolysis due to transfusion. ANH is a cost-effective transfusion option for suitable patients. Appropriate clinical decision making, use of strategies to decrease peri-operative blood losses and cost-effective country based planning could be more widely applied to improve clinical transfusion practice.

  14. [Quality management and practice-oriented research in a clinic-network of mother-/father-child rehabilitation centres].

    PubMed

    Otto, F; Arnhold-Kerri, S

    2010-04-01

    The Research Network Prevention and Rehabilitation for Mothers and Children is an association of currently 24 rehabilitation centres for mothers, fathers and their children, and a scientific team at the Hannover Medical School. The Research Network combines practice-oriented research on mother and child health with the further development of treatment programmes and the implementation of internal quality management in mother-/father-child rehabilitation centres in accordance with DIN EN ISO 9001. The present paper describes the concept of the Research Network and the work contents addressed over the last three years. The advantages and disadvantages of this association and the changes initiated in practice were evaluated from the point of view of 19 quality managers of the participating clinics. The data were collected by means of semi-structured interviews, and a qualitative content analysis was performed in order to quantify the responses. The concept of the Research Network has proven successful. In the view of the quality managers of the clinics, implementation of DIN EN ISO 9001 has lead to structuring of the processes, improved internal communication, and increased motivation in the team. The major obstacles were the lack of time and human resources. In all clinics, the participation in practice-related research projects und scientifically monitored concept development has contributed to optimizing everyday practice. The exchange between the quality managers in external quality circle meetings was of central importance. The conjunction of internal quality management, practice-related research and concept development in a network can be recommended also for other associations of clinics, health centres or medical practices.

  15. Patient-centred interprofessional collaboration in primary care: challenges for clinical, educational and health services research. An EGPRN keynote paper.

    PubMed

    Van Royen, Paul; Rees, Charlotte E; Groenewegen, Peter

    2014-12-01

    The theme 'patient-centred interprofessional collaboration' of the EGPRN conference in October 2012, captures in just three words important challenges for European primary care and its research agenda. Challenges for future research are formulated, in three domains: clinical, educational and health services research. Transferability of research, based upon advanced computational infrastructure, will facilitate a rapid learning health care system. In educational research, this includes the use of observational and reflexivity methods. Outcomes should be defined in terms of improvement of functional status and social participation rather than in terms of disease-specific outcomes. Partnership with all stakeholders, patients, GPs and their health care colleagues and students, can help in reducing avoidable waste in the production and reporting of research evidence.

  16. Research on registry centre for geospatial web service based on CSW specification

    NASA Astrophysics Data System (ADS)

    Chen, Yumin; Song, Chunqiao; Shen, Shengyu; Yang, Qing

    2008-12-01

    With the increase of geospatial data and services, how to more efficiently utilize and share the geographic information becomes a crucial problem. To effectively integrate and enhance abundant geographic information anywhere, this paper presents a Registry Centre for Geospatial Web Service (RCGWS) based on the Open Geospatial Consortium (OGC) Catalogue Service for Web and the ebXML Registry Information Model (ebRIM), which provides registration and discovery portals for geospatial metadata for dataset and services. The design ideology and architecture of RCGWS are introduced, and the techniques of appending GIS services classification in extended ebRIM and external interfaces of RCGWS based on OGC CWS are discussed. The implementation of RCGWS platform shows that this Registry Centre can satisfy the requirement of geospatial dataset and services.

  17. The red tape waltz. Where multi-centre ethical and research governance review can step on the toes of good research practice.

    PubMed

    Webster, Susan M; Temple-Smit, Meredith

    2013-03-01

    How could it happen that the very processes intended to assure ethical research in Australia might, themselves, undermine good research practice? This paper describes one PhD candidate's recent experiences of multi-centre review for a Human Research Ethics Committee approved, low/negligible risk, qualitative study, at the crossroad of health services research and organisational research. A retrospective review of international literature about multi-centre review processes revealed that many of these experiences were not unique and might have been expected, notwithstanding Australian efforts at harmonisation of multi-centre review. This paper examines not only the burden of red-tape that was applied to a small doctoral study, but also the way in which the red-tape threatened the anonymity of potential study participants and risked exposing them to undue pressure and distress. These experiences support the view that harmonisation initiatives have not yet developed as the Australian National Health and Medical Research Council may have hoped and that further attention is needed to harmonise research governance processes.

  18. The INGV National Earthquake Centre research infrastructure to study the plate boundary deformation in the Central Mediterranean

    NASA Astrophysics Data System (ADS)

    Selvaggi, Giulio; Mazza, Salvatore; Delladio, Alberto; Cecere, Gianpaolo; Devoti, Roberto

    2010-05-01

    To understand the complex kinematics within the plate boundary zone between Africa and Eurasia in the central Mediterranean, INGV installed a monitoring system based on broad-band seismometers, CGPS and strong motion sensors, most of them co-located in the same site. Established since early '80 with some tens of short period seismometers and analogue transmission, now the monitoring system consists of more than 200 real time broad-band seismometers, 140 CGPS and about 80 strong motions connected to different centres of acquisition. A dedicated disaster recovery guarantees continuity of acquisition and data sharing among centres. Beside essential services connected to Italian Civil Protection agency and basic research, we believe that our network represents an important reality in the framework of the EPOS infrastructure and we strongly support the idea of an European research approach to data sharing among the scientific community. In the presentation we will show the network, from the sites to the acquisition centres, and the level of the seismic and geodetic products and the primary scientific targets addressed when designing the networks.

  19. Research in the Modern Language Centre at the Ontario Institute for Studies in Education of the University of Toronto (OISE/UT)

    ERIC Educational Resources Information Center

    Kim, Youn-Hee; Kohls, Robert; Chun, Christian W.

    2009-01-01

    The Modern Language Centre addresses a broad spectrum of theoretical and practical issues related to second and minority language teaching and learning. Since its foundation in 1968, the quality and range of the Centre's graduate studies programs, research, and development projects and field and dissemination services have brought it both national…

  20. Research in the Modern Language Centre at the Ontario Institute for Studies in Education of the University of Toronto (OISE/UT)

    ERIC Educational Resources Information Center

    Kim, Youn-Hee; Kohls, Robert; Chun, Christian W.

    2009-01-01

    The Modern Language Centre addresses a broad spectrum of theoretical and practical issues related to second and minority language teaching and learning. Since its foundation in 1968, the quality and range of the Centre's graduate studies programs, research, and development projects and field and dissemination services have brought it both national…

  1. Feeding habits and ontogenetic diet shifts of Bombay duck, Harpadon nehereus

    NASA Astrophysics Data System (ADS)

    Zhang, Bo; Jin, Xianshi

    2014-05-01

    Based on two bottom trawl surveys conducted in autumn 2000 and 2001, a total of 1106 stomach samples of Bombay duck Harpadon nehereus between 23-278 mm fork length were collected and analyzed. The results show that Bombay duck prey items consisted of 11 groups or 32 species, of which Apogon lineatus, Leptochela gracilis, Acetes chinensis, and Euphausia pacifi ca were the dominant prey species. Ontogenetic variations were found in feeding habits and feeding activity of Bombay duck. Feeding activity was highest in fish smaller than 50 mm, lowest in fish between 50 and 99 mm, and then increased with increasing size thereafter. As Bombay duck size increased, fish prey increased in importance, whereas euphausiids and decapods decreased in importance. Different trophic guilds were observed in feeding habits across the examined size range. Bombay duck smaller than 50 mm were zooplanktivores, mainly feeding on zooplankton and fish larva; those between 50 and 149 mm were generalist predators, mainly feeding on pelagic shrimps, demersal shrimps and fishes; and those larger than 150 mm were piscivores, mainly feeding on fishes.

  2. Influenza viruses received and tested by the Melbourne WHO Collaborating Centre for Reference and Research on Influenza annual report, 2014.

    PubMed

    Sullivan, Sheena G; Chow, Michelle K; Barr, Ian G; Kelso, Anne

    2015-12-31

    The WHO Collaborating Centre for Reference and Research on Influenza in Melbourne is part of the World Health Organization's (WHO) Global Influenza Surveillance and Response System. In 2014 the Centre received a total of 5,374 influenza samples from laboratories primarily in the Asia-Pacific region. Viruses were characterised by their antigenic, genetic and antiviral drug resistance properties. Of the viruses successfully analysed 52% were A(H1N1)pdm09 viruses. The majority of these were antigenically and genetically similar to the WHO recommended reference strain for the 2014 Southern Hemisphere influenza vaccine. Results for A(H3N2) and B/Yamagata viruses suggested that circulating viruses of this subtype and lineage, respectively, had undergone antigenic and/or genetic changes, consistent with the decision by WHO to change recommended strains for the 2015 Southern Hemisphere vaccine. A small number of A(H1N1)pdm09 and B/Victoria viruses had highly reduced inhibition to the neuraminidase inhibitors oseltamivir and zanamivir. The Centre also undertook primary isolation of vaccine candidate viruses directly into eggs. A total of 38 viruses were successfully isolated in eggs, of which 1 (B/Phuket/3073/2013) was included in the 2015 Southern Hemisphere influenza vaccine.

  3. Centre for Education, Training, & Research in Renewable Energy and Energy Efficiency (CETREE) of Malaysia: Educating the Nation

    NASA Astrophysics Data System (ADS)

    Ibrahim, Kamarulazizi; Hilme, Khairur Rahim Ahmad

    2007-10-01

    Centre for Education, Training, and Research in Renewable Energy and Energy Efficiency (CETREE), was established in the year 2000, in Universiti Sains Malaysia (USM). CETREE is a not-for-profit organization that was part of the Malaysian Government's continuous effort in promoting sustainable development. The centre's main task is to tackle issues and problems that are slowing the potential growth of RE & EE utilizations in Malaysia. CETREE and the Government of Malaysia, with funding and supports from Danish International Development Assistance (DANIDA) and USM, has been working together closely in applying trans-disciplinary educational methods and approaches for the teaching of RE & EE that are compatible with Malaysian. Through association with various entities such as Energy Centre of Malaysia (PTM), Energy Commission of Malaysia (ST), Malaysia Electricity Supply Industry Trust Account (MESITA); CETREE was able to successfully promote sustainable development through education and training. Significant accomplishments made by CETREE include introducing RE and EE as part of Malaysian secondary schools and universities education; conducting energy related courses for professionals; and generating awareness via campaign in the mass media and CETREE's mobile-exhibition-unit road-tour.

  4. Perioperative management of patient with Bombay blood group undergoing mitral valve replacement

    PubMed Central

    Priye, Shio; Sathyanarayan, J; Shivaprakash, S; Reddy, Durgaprasad

    2015-01-01

    Bombay red blood cell phenotype is an extremely rare blood type for which patients can receive only autologous or Bombay phenotype red blood cells. We report a case of stenotic mitral valve with Bombay phenotype who underwent minimal invasive right lateral thoracotomy for the replacement of the mitral valve. A male patient from Bangladesh presented to the hospital with New York Heart Association III symptoms. His medical evaluation revealed severe mitral valve stenosis and mild aortic valve regurgitation. The patient received erythropoietin, intravenous iron succinate and folic acid tablets. Autologous blood transfusion was carried out. The mitral valve was replaced with a prosthetic valve successfully. After weaning off from cardiopulmonary bypass, heparinisation was corrected with protamine. Post-operatively, the patient received autologous red blood cells. The patient recovered after 1-day of inotropic support with adrenaline and milrinone, and diuretics and was discharged on the 5th post-operative day. PMID:26903676

  5. Perioperative management of patient with Bombay blood group undergoing mitral valve replacement.

    PubMed

    Priye, Shio; Sathyanarayan, J; Shivaprakash, S; Reddy, Durgaprasad

    2015-12-01

    Bombay red blood cell phenotype is an extremely rare blood type for which patients can receive only autologous or Bombay phenotype red blood cells. We report a case of stenotic mitral valve with Bombay phenotype who underwent minimal invasive right lateral thoracotomy for the replacement of the mitral valve. A male patient from Bangladesh presented to the hospital with New York Heart Association III symptoms. His medical evaluation revealed severe mitral valve stenosis and mild aortic valve regurgitation. The patient received erythropoietin, intravenous iron succinate and folic acid tablets. Autologous blood transfusion was carried out. The mitral valve was replaced with a prosthetic valve successfully. After weaning off from cardiopulmonary bypass, heparinisation was corrected with protamine. Post-operatively, the patient received autologous red blood cells. The patient recovered after 1-day of inotropic support with adrenaline and milrinone, and diuretics and was discharged on the 5(th) post-operative day.

  6. Quantum structure based infrared detector research and development within Acreo’s centre of excellence IMAGIC

    NASA Astrophysics Data System (ADS)

    Andersson, J. Y.; Höglund, L.; Noharet, B.; Wang, Q.; Ericsson, P.; Wissmar, S.; Asplund, C.; Malm, H.; Martijn, H.; Hammar, M.; Gustafsson, O.; Hellström, S.; Radamson, H.; Holtz, P. O.

    2010-07-01

    Acreo has a long tradition of working with quantum structure based infrared (IR) detectors and arrays. This includes QWIP (quantum well infrared photodetector), QDIP (quantum dot infrared photodetector), and InAs/GaInSb based photon detectors of different structure and composition. It also covers R&D on uncooled microbolometers. The integrated thermistor material of such detectors is advantageously based on quantum structures that are optimised for high temperature coefficient and low noise. Especially the SiGe material system is preferred due to the compatibility with silicon technology. The R&D work on IR detectors is a prominent part of Acreo's centre of excellence "IMAGIC" on imaging detectors and systems for non-visible wavelengths. IMAGIC is a collaboration between Acreo, several industry partners and universities like the Royal Institute of Technology (KTH) and Linköping University.

  7. Negative ion research at the Culham Centre for Fusion Energy (CCFE)

    NASA Astrophysics Data System (ADS)

    McAdams, R.; Holmes, A. J. T.; King, D. B.; Surrey, E.; Turner, I.; Zacks, J.

    2016-12-01

    A summary of negative ion development work being presently undertaken at the Culham Centre for Fusion Energy is given. The small negative ion facility has an RF driven volume ion source with beam extraction at energies up to 30 keV. The extracted beam of H- ions has an associated co-extracted electron beam with an electron to ion ratio of <1 over the whole range of operating parameters. In order to understand this performance spectroscopic investigations have been undertaken using the Balmer series line to determine the electron temperature. In addition a 1D fluid model of an RF driven ion source is also under development. This model is based on a successful model for both arc discharge positive and negative ion sources. Additional system studies of neutral beam injection systems for future fusion machines beyond ITER are being carried out. This is required to understand the limits of various neutralisation and energy recovery systems in order to maximise overall electrical efficiency.

  8. Research and development activities of the Seismology Section

    NASA Astrophysics Data System (ADS)

    Krishnan, C. A.; Murty, G. S.

    The Research and Development (R and D) activities during 1984 to 1985 of the Seismology Section of the Bhabha Atomic Research Centre, Bombay, are reported in the form of individual summaries. The R and D activities of the section are directed towards development of seismological instruments and methods of analysis of the seismic field data with the main objective of detecting underground nuclear explosions and assessing seismicity and seismic risk of sites considered for nuclear power stations. The section has two field stations, one at Gauribidanur in the southern part of the country and another at Delhi i.e., in the northern part of the country. During the report period, a total of 62 events out of the detected ones were identified as underground explosions. The expertise of the section is also made available for outside organizations.

  9. Education, Research and Passive Recreation: An Integrated Programme at the Wetlands Centre, Scotland.

    ERIC Educational Resources Information Center

    Maddock, Max

    1991-01-01

    Describes a center for education, research, and passive recreation in wetland settings operated by a community conservation organization in cooperation with the state and a local university. Discusses the philosophy, on-site programs (formal and nonformal), the outreach program, and community involvement in ornithological research of the center.…

  10. Education, Research and Passive Recreation: An Integrated Programme at the Wetlands Centre, Scotland.

    ERIC Educational Resources Information Center

    Maddock, Max

    1991-01-01

    Describes a center for education, research, and passive recreation in wetland settings operated by a community conservation organization in cooperation with the state and a local university. Discusses the philosophy, on-site programs (formal and nonformal), the outreach program, and community involvement in ornithological research of the center.…

  11. Time Is Precious: Variable- and Event-Centred Approaches to Process Analysis in CSCL Research

    ERIC Educational Resources Information Center

    Reimann, Peter

    2009-01-01

    Although temporality is a key characteristic of the core concepts of CSCL--interaction, communication, learning, knowledge building, technology use--and although CSCL researchers have privileged access to process data, the theoretical constructs and methods employed in research practice frequently neglect to make full use of information relating…

  12. Identification of six new alleles at the FUT1 and FUT2 loci in ethnically diverse individuals with Bombay and Para-Bombay phenotypes.

    PubMed

    Storry, Jill R; Johannesson, Jannica S; Poole, Joyce; Strindberg, Johanna; Rodrigues, Maria J; Yahalom, Vered; Levene, Cyril; Fujita, Claudia; Castilho, Lilian; Hustinx, Hein; Olsson, Martin L

    2006-12-01

    The Bombay and para-Bombay phenotypes arise from mutations of the FUT1 gene that silence the gene or affect the efficiency of the encoded 2-alpha-fucosyltransferase. Samples from seven individuals of different geographic backgrounds whose red blood cells had an apparent Bombay or para-Bombay phenotype were investigated. Among these, novel FUT1 and FUT2 alleles were identified. Standard serologic techniques were used. Genomic DNA was sequenced with primers that amplified the coding sequence of FUT1 and the related secretor gene, FUT2. Routine ABO genotyping analysis was performed. Five new FUT1 alleles were identified that silenced FUT1 or weakened alpha2FucT1 activity. These were 35C>T, 269G>T (Ala11Val, Gly89Val); 421A>G (Trp140Stop); 538C>T, 1089T>G (Gln180Stop, Ala363Ala); 689A>C (Gln230Pro); and 917C>T (Thr305Ile). In addition, both homozygosity and heterozygosity for the previously reported mutation, 826C>T (Gln276Stop), were observed. Four of seven samples were homozygous for the silencing mutation 428A in FUT2. One new FUT2 allele was identified: 278C>T, 357C>T (Ala93Val, Asn119Asn). These results add to the growing database of apparently sporadic and random mutations in the FUT1 gene and confirm previous reports regarding the lack of ethnic bias. In contrast, our data reinforce the apparent maintenance of the common nonsecretor FUT2 alleles in the population.

  13. Challenging conventional practice: placing consumers at the centre of the research enterprise.

    PubMed

    Horsfall, Jan; Cleary, Michelle; Walter, Garry; Malins, Gillian

    2007-11-01

    Without evidence, clinicians may inadvertently be providing treatment that is not necessarily best for some consumers. If consumers, carers, and staff have different views about what type of services are best and which treatments are most effective, it is in all our interests to know more about these differences and find common ground. This article provides an overview of factors that require consideration and action for collaborative research to be successful. Actively involving consumers and carers in mental health research may improve the quality of research and has the potential to enhance clinical outcomes. However, a range of challenges must be overcome, which include insufficient training, extra time requirements, stress and non-representativeness, and the impact on research projects, consumers, and researchers. These factors apply equally to carers and, arguably, staff. With sufficient motivation, commitment, and funds for the requisite time, all of these disadvantages could be overcome or at least minimized.

  14. [Fut1 gene mutation for para-bombay blood type individual in Fujian Province of China].

    PubMed

    Huang, Hao-Bou; Fan, Li-Ping; Wai, Shi-Jin; Zeng, Feng; Lin, Hai-Yan; Zhang, Rong

    2010-10-01

    This study was aimed to investigate the molecular mechanisms for para-Bombay blood type individual in Fujian Province of China. The para-Bombay blood type of this individual was identified by routine serological techniques. The full coding region of alpha (1,2) fucosyltransferase (FUT1) gene of this individual was amplified by polymerase chain reaction (PCR), then the PCR product was cloned into T vector. The mutation in coding region of fut1 gene was identified by TA cloning, so as to explore the molecular mechanisms for para-Bombay blood type individual. The results indicated that the full coding region of fut1 gene was successfully amplified by PCR. AG deletion at position 547-552 on 2 homologous chromosomes was detected by TA cloning method, leading to a reading frame shift and a premature stop codon. It is concluded that genetic mutation of fut1 gene in this para-bombay blood type individual was h1h1 homozygotic type.

  15. The clinical significance of anti-H in an individual with the Oh (Bombay) phenotype.

    PubMed

    Davey, R J; Tourault, M A; Holland, P V

    1978-01-01

    To evaluate the clinical significance of anti-H present in individuals with the Oh (Bombay) phenotype, red blood cell 51chromium survival studies and related serological tests were undertaken in an Oh (Bombay) individual. A small sample of group O donor red blood cells was labeled with 51chromium and infused into the patient. The T 1/2 of the infused cells was six minutes, with two percent of the cells surviving at 24 hours. A similar study using the patient's own labeled red blood cells demonstrated 100 per cent survival at 24 hours. Initial laboratory studies indicated that the anti-H was active in saline at 4, 22 and 37 C and by the indirect antiglobulin test. Analysis of the antibody in both preand posttransfusion specimens showed it to have both IgM and IgG components. The anti-H titer at 37 C rose from 1:4 prior to the infusion of the O cells to 1:32 one week postinfusion, and a partial hemolysin appeared. Saliva inhibition studies demonstrated that the antibody was neutralizable prior to the group O exposure but was not neutralizable one week post exposure. We conclude that the anti-H present in this individual rapidly destroyed infused group O red blood cells. Individuals with the Oh (Bombay) phenotype should be transfused only with Oh (Bombay) blood.

  16. Bombay blood group: Is prevalence decreasing with urbanization and the decreasing rate of consanguineous marriage.

    PubMed

    Mallick, Sujata; Kotasthane, Dhananjay S; Chowdhury, Puskar S; Sarkar, Sonali

    2015-01-01

    Bombay blood group although rare is found to be more prevalent in the Western and Southern states of India, believed to be associated with consanguineous marriage. To estimate the prevalence of the Bombay blood group (Oh) in the urban population of Puducherry. To find the effect of urbanization on consanguineous marriage and to establish whether consanguinity plays a part in the prevalence of Oh group. To compare Oh group prevalence with that of other neighboring states, where population is not predominantly urban. This is a descriptive study in a tertiary care hospital in Puducherry, over a period of 6 years. All blood samples showing 'O' group were tested with anti-H lectin. Specialized tests like Adsorption Elution Technique, inhibition assay for determination of secretor status were performed on Oh positive cases. Any history of consanguineous marriage was recorded. All variables were categorical variable and percentage and proportions were calculated manually. Analysis of the results of 35,497 study subjects showed that the most common group was 'O' group constituting 14,164 (39.90%) of subjects. Only three "Oh" that is, Bombay phenotype (0.008%) were detected. Consanguinity was observed in two cases (66.66%). This study shows the prevalence of Bombay blood group representing the urban population of Puducherry, to be high (0.008%) and associated with consanguineous marriage (66.66%). Thus, consanguinity is still an important risk factor present, even in an urban population in Southern India.

  17. [Heart surgery in a female patient with blood group Oh (Bombay phenotype)].

    PubMed

    Schricker, K T; Neidhardt, B; Hacker, R; Kail, R

    1983-01-14

    A 62-year-old woman with stenosing coronary artery disease had the rare blood group Oh (Bombay phenotype). After prophylactic deep-freeze conservation of autologous blood, direct myocardial revascularization was successfully accomplished under extracorporeal circulation. Three deep-freeze units of erythrocyte concentrates were used. Both operation and postoperative wound healing progressed without complication.

  18. A case of Oh (Bombay) blood found in a Thai-Muslim patient.

    PubMed

    Sringarm, S; Sombatpanich, B; Chandanayingyong, D

    1977-12-01

    This is a report of a case of an inherited Lewis a + b - Oh (Bombay) blood found in a Thai-Muslim patient. The propositus and her brother inherited the suppressant xx (or hh) genes from her parents; the gene frequency could not be surveyed.

  19. Promoting the Success of US Industry/University Research Centres. The Role of Leadership.

    ERIC Educational Resources Information Center

    Tornatzky, Louis; Lovelace, Kay; Gray, Denis O.; Walters, S. George; Geisler, Eliezer

    1999-01-01

    Leadership in industry-university research centers often involves helping constituencies with conflicting priorities deal with challenges, necessitating a participatory leadership style. Other challenges include exercising intrapreneurship, creating a compelling technical vision, and spanning organizational boundaries. (SK)

  20. Two prevalent h alleles in para-Bombay haplotypes among 250,000 Taiwanese.

    PubMed

    Chen, Ding-Ping; Tseng, Ching-Ping; Wang, Wei-Ting; Peng, Chien-Ting; Tsao, Kuo-Chien; Wu, Tsu-Lan; Lin, Kuan-Tsou; Sun, Chien-Feng

    2004-01-01

    Alpha(1,2)-fucosyltransferase catalyzes the transfer of fucose to the C-2 position of galactose on type II precursor substrate Gal beta1-4GlcNAc beta1-R. It plays an important biological role in the formation of H antigen, a precursor oligosaccharide for both A and B antigens on red blood cells. Aberration of alpha(1,2)-fucosyltransferase activity by gene mutations results in decreased synthesis of H antigen, leading to the para-Bombay phenotype. In this study, we collected about 250,000 blood samples in Taiwan during 5 yr and identified the subjects with para-Bombay phenotype. Then we analyzed the sequence of the alpha(1,2)-fucosyltransferase gene by direct sequencing and gene cloning methods, using the blood samples of 30 para-Bombay individuals and 30 control subjects who were randomly selected. The goals of this study were to search for new h alleles, to determine the h allele frequencies, and to test whether the sporadic theory is applicable in Taiwan. Six different h alleles (ha, 547-548 AG-del; hb, 880-881 TT-del; hc, R220C; hd, R220H; he, F174L; and hf, N327T) were observed. Two h alleles, he and hf, were newly discovered in Taiwan. The he allele has a nucleotide 522C>A point mutation, predicting the amino acid 174 substitution of Phe to Leu; the hf allele has missense mutation of nucleotide 980A>C, predicting the amino acid 327 substitution of Asn to Thr. Frequencies of the 6 alleles are ha 46.67%, hb 38.33%, hc 5.00%, hd 1.67%, he 3.33%, and hf 5.00%, respectively. These findings in the Taiwanese population confirm previous observations in other populations that the Bombay and para-Bombay phenotypes are due to diverse, sporadic, nonfunctional alleles, predominantly ha and hb, leading to H deficiency of red blood cells. In contrast to previous reports of non-prevalent associations of h alleles with para-Bombay phenotype, our results suggest a regional allele preference associated with para-Bombay individuals in Taiwan.

  1. Placing ethics in the centre: negotiating new spaces for ethical research in conflict situations.

    PubMed

    Zwi, A B; Grove, N J; MacKenzie, C; Pittaway, E; Zion, D; Silove, D; Tarantola, D

    2006-01-01

    Issues of power and consent, confidentiality, trust, and benefit, risks to researchers, and potential harm to participants, are all contested when working with different cultures and within environments marked by violence and insecurity. Difficulty resolving these dilemmas may paralyse ethics committees, may fail to give the guidance sought by researchers, and will not help populations who are among the world's most vulnerable. Even where efforts are made to respond to ethical guidelines and to improve practice, considerable impediments are present in many developing countries, including lack of formal ethical review structures in unstable settings, lack of required skills, limited political and institutional recognition of ethical issues, competing interests, and limitations in clinical and research practice (Elsayed 2004, Macklin 2004). In conflict settings, these limitations are more marked, and the responsibilities of the researcher for ethical practice are greater, but the mechanisms for oversight are weaker. Moreover, the constant focus on vulnerabilities and problems, and the often almost total lack of recognition of strengths and resilience, can further disempower already exploited groups and individuals. The capacity of refugees and communities in conflict to take an active role in the research process is seldom acknowledged, and undermines the potential for more innovative research which can help generate the evidence for better policy and practice.

  2. Factors influencing increased expertise for a sustainable workforce at a research centre in South Africa.

    PubMed

    Brand, S; Draper, H R; Enarson, D A; Beyers, N; Claassens, M

    2014-12-21

    Contexte : Le Centre Antituberculeux Desmond Tutu (DTTC), à l'Université de Stellenbosch, en Afrique du Sud.Objectifs : 1) Déterminer si l'accès au financement est associé au développement d'une expertise chez les employés, et 2) déterminer quels autres facteurs sont associés au développement de l'expertise des employés.Schéma : Cette étude était rétrospective. La population cible était constituée par les employés du DTTC entre le 1e janvier 2004 et le 31 décembre 2011. L'amélioration de l'expertise pendant la période de fonction était le premier résultat attendu ; le deuxième était une augmentation du niveau de connaissances en relation avec le Cadre National de Certification.Résultats : Il n'a pas été démontré d'association entre l'accès au financement et le développement de l'expertise, mais on a mis en évidence une association entre le nombre de mois de travail et cette amélioration (OR 1.03 ; IC95% 1,02–1.04 ; P< 0,001), en contrôlant l'âge lors de l'entrée en fonction, le sexe, l'accès au financement et le niveau d'instruction.Conclusion : L'étude montre que près d'un tiers du personnel a accru son expertise, plus de 90% ont eu accès au financement et que les personnes employées pendant une durée plus longue avaient davantage de chances d'améliorer leur expertise. Nous encourageons les organismes de recherche des pays à revenu faible et moyen à mettre en œuvre des stratégies visant à retenir leur personnel afin de renforcer leur expertise.

  3. Blood transfusion in the para-Bombay phenotype.

    PubMed

    Lin-Chu, M; Broadberry, R E

    1990-08-01

    The H-deficient phenotypes found in Chinese so far, have all been secretors of soluble blood group substances in saliva. The corresponding isoagglutinin activity (e.g. anti-B in OB(Hm) persons) has been found to be weak in all cases. To determine the clinical significance of these weak isoagglutinins 51Cr red cell survival tests were performed on three OB(Hm) individuals transfused with small volumes (4 ml) of groups B and O RBC. Rapid destruction of most of the RBC occurred whether or not the isoagglutinins of the OB(Hm) individuals were indirect antiglobulin test (IAGT) reactive. When a larger volume (54 ml packed RBC) of group B cells (weakly incompatible by IAGT) was transfused to another OB(Hm) individual with IAGT active anti-HI, the survival of the transfused RBC was 93% at 24 h, with 30% of the RBC remaining in the circulation at 28 d in contrast to 76% as would be expected if the survival was normal. Therefore when whole units of blood of normal ABO blood groups, compatible by IAGT, are transfused, the survival is expected to be almost normal. These weak isoagglutinins may not be very clinically significant and we suggest that when para-Bombay blood is not available, the compatibility testing for OA(Hm) persons should be performed with group A and group O packed RBC; OB(Hm) with group B and group O packed RBC: OAB(Hm) with groups A, B, AB and O packed RBC. For cross matching, the indirect antiglobulin test by a prewarmed technique should be used.

  4. Addiction research centres and the nurturing of creativity: the National Institute on Alcohol Abuse and Alcoholism.

    PubMed

    Heilig, Markus; Warren, Kenneth R; Kunos, George; Silverman, Peter B; Hewitt, Brenda G

    2011-06-01

    The aim of this paper is to present a concise account of the history, mission, structure and some recent achievements of the US National Institute on Alcohol Abuse and Alcoholism (NIAAA). Created by the US Congress 40 years ago, the NIAAA has evolved from an entity charged mainly with building a national system of alcoholism treatment services to one with responsibility for developing, nurturing and supporting the biomedical and behavioral science foundation necessary to reduce the significant domestic and global public health impact of alcohol use disorders. The NIAAA is unique in that it functions both as a funding agency, supporting research at universities and other external, or 'extramural' research institutions, and is also a research institution itself, where alcohol research is carried out in-house, or 'intramurally'. Of a $450.2 million 2009 Congressional Appropriation, approximately 90% was devoted toward the former and approximately 10% towards the latter objective. The current NIAAA Strategic Plan builds on a new organizing principle for long-range research planning, based on a life-span perspective that recognizes that human biology and behavior continue to change throughout life and changes occurring throughout the life-span affect individuals' drinking patterns as well as the decisions they may make to change their drinking habits or to seek help for alcohol use problems. Within this framework, major efforts are currently being devoted to educating practitioners on clinically useful, science-based assessment and treatment methods that exist today, and development of personalized new treatments for tomorrow.

  5. Testing the direct ion storage dosemeter for personal dosimetry in a nuclear research centre and a hospital.

    PubMed

    Vanhavere, F; Covens, P

    2010-03-01

    The direct ion storage (DIS) dosemeter can have some clear advantages in personal dosimetry. Before introducing the DIS into practice in the dosimetry service, a series of tests was performed on the linearity, angular and energy dependence, temperature influences and hard resets. After that, for several months, the DIS dosemeters were worn in parallel with the legal dosemeters (thermoluminescent badge) in a nuclear research centre and in several departments of a university hospital. The conclusions are that the DIS has good characteristics to be used as legal personal dosemeter, and that the comparison with the TLD badge is good. Only in interventional radiology and cardiology fields the DIS gives significant lower values than the TLD badge.

  6. Action of glycosyl transferases upon "Bombay" (Oh) erythrocytes. Conversion to cells showing blood-group H and A specificities.

    PubMed

    Schenkel-Brunner, H; Prohaska, R; Tuppy, H

    1975-08-15

    Individuals of the rare "Bombay" (Oh) blood-group phenotype lacking, due to a genetic defect, the alpha(1-2)fucosyl transferase, which is responsible for converting blood-group H precursor substances to H-specific structures. Treatment with GDP-fucose and alpha(1-2)fucosyl transferase prepared from gastric mucosa of O individuals to transform native or ficin-treated "Bombay" erythrocytes into cells phenotypically resembling O cells. The transformation was achieved, however, after prior incubation of the "Bombay" erythrocytes with neuraminidase, indicating that blood-group H precursor molecules on the surface of these cells are masked by sialyl residues. Blood-group A specificity was conferred upon neuraminidase-treated "Bombay" cells by enzymatic transfer of alpha-N-acetylgalactosamine residues, in addition to alpha-fucose residues.

  7. Innovation in Education. News from the Centre for Educational Research and Innovation OECD Paris. Number 3.

    ERIC Educational Resources Information Center

    Organisation for Economic Cooperation and Development, Paris (France). Centre for Educational Research and Innovation.

    Brief notices of topics arising during the preceding four months from the Center's continuing program of work on behalf of Member countries of the Organisation for Economic Co-operation and Development (OECD) are given in this news-sheet. CERI's interest and activity focus on three areas: 1) Research into the relations between education and…

  8. [Current demographic research projects at the Centre de Recherches Economiques et Demographiques].

    PubMed

    Ngwe, E

    1984-01-01

    The Center for Economic and Demographic Research (CRED), created in 1980 as 1 of 4 research centers of the Institute of Human Sciences, is currently conducting 3 research operations and other projects as well despite its still small staff of only 4 demographers. 1 of 2 research projects concerning internal migration, the survey of demographic processes and rural exodus in the north and west of Cameroon, was a 2-round survey on a sample of about 36,000 persons. Fieldwork took place in April 1982 and April 1983 and analysis of data is currently underway. The survey had several objectives: a study of the concept of population pressure; a comparison of the role of population pressure in the rural exodus in 2 zones with similar densities but different migratory behavior; a study of levels, correlates, and consequences of migration for sending areas and the links between migrants and their places of origin; improvement of data collection techniques for migration research; and provision of data to assist in design of a rural development policy that would increase retention of rural population. The 2nd internal migration study is a survey of migration among secondary school students. Results of a pilot survey among 2408 students in the west and northwest provinces interviewed in March 1984 are being analyzed. The main survey is planned for January 1985 and is intended to measure the volume and duration of migration among students, to study the characteristics of migrants, and to analyze the causes of movements. The sample size is expected to be about 40,000. A pilot study for the survey of infant mortality in rural areas was begun in March 1984 and was intended primarily to determine the feasibility of data gathering techniques for a larger study of the levels and correlates of infant mortality. The methodology calls for the sample of newborns to be visted at 1, 3, 6, 9, and 12 months. Arrondissements with high and low infant mortality are to be studied in 3 different

  9. Scaling-up Sustainable Land Management Practices through the Concept of the Rural Resource Centre: Reconciling Farmers' Interests with Research Agendas

    ERIC Educational Resources Information Center

    Takoutsing, Bertin; Tchoundjeu, Zacharie; Degrande, Ann; Asaah, Ebenezar; Tsobeng, Alain

    2014-01-01

    Purpose: Formal agricultural research has generated vast amount of knowledge and fundamental insights on land management, but their low adoption has been attributed to the use of public extension approach. This research aims to address whether and how full participation of farmers through the concept of Rural Resource Centre (RRC) provides new…

  10. Going Boldly Into the Future: A Series of Case Studies of Co-Operative Research Centres and Their Relationships with the VET Sector.

    ERIC Educational Resources Information Center

    Ferrier, Fran; Trood, Clifford; Whittingham, Karen

    This document presents case studies of 10 cooperative research centers (CRCs) across Australia and their relationships with the vocational education and training (VET) sector. The CRCs profiled in the case studies are as follows: Co-operative Research Centre for Sustainable Rice Production; Cast Alloy and Solidification Technology Co-operative…

  11. Scaling-up Sustainable Land Management Practices through the Concept of the Rural Resource Centre: Reconciling Farmers' Interests with Research Agendas

    ERIC Educational Resources Information Center

    Takoutsing, Bertin; Tchoundjeu, Zacharie; Degrande, Ann; Asaah, Ebenezar; Tsobeng, Alain

    2014-01-01

    Purpose: Formal agricultural research has generated vast amount of knowledge and fundamental insights on land management, but their low adoption has been attributed to the use of public extension approach. This research aims to address whether and how full participation of farmers through the concept of Rural Resource Centre (RRC) provides new…

  12. Going Boldly Into the Future: A Series of Case Studies of Co-Operative Research Centres and Their Relationships with the VET Sector.

    ERIC Educational Resources Information Center

    Ferrier, Fran; Trood, Clifford; Whittingham, Karen

    This document presents case studies of 10 cooperative research centers (CRCs) across Australia and their relationships with the vocational education and training (VET) sector. The CRCs profiled in the case studies are as follows: Co-operative Research Centre for Sustainable Rice Production; Cast Alloy and Solidification Technology Co-operative…

  13. Addiction research centres and the nurturing of creativity. The Korean Institute on Alcohol Problems (KIAP).

    PubMed

    Chun, Sungsoo; Reid, Easton A; Sohn, Aeree; Welch, Michael E; Yun-Welch, Sunmee; Yun, Mieun

    2013-04-01

    The aim of this paper is to provide an account of the history, current status and vision of the Korean Institute on Alcohol Problems (KIAP). In the context of increasing alcohol consumption, rising second-hand effects and industry-friendly government policy, the Korean College Alcohol Study (KCAS) was established in the Republic of Korea in 1999, and changed its name to the Korean Institute on Alcohol Problems (KIAP) in 2005. KIAP's mission is to decrease alcohol consumption and its related harms by promoting research, advocating policy, developing intervention programmes and preparing media communications. Since 1999, KIAP has published scientific papers and books in alcohol research and used the internet and other media for dissemination of specialized information to the general population. In the last decade, KIAP has trained front-line alcohol researchers, and advanced domestic and international networks to promote evidence-based alcohol control policy in Korea. The light of hope shines brightly as KIAP grows and establishes critical linkages to move forward in its mission.

  14. The BonaRes Centre - A virtual institute for soil research in the context of a sustainable bio-economy

    NASA Astrophysics Data System (ADS)

    Wollschläger, Ute; Helming, Katharina; Heinrich, Uwe; Bartke, Stephan; Kögel-Knabner, Ingrid; Russell, David; Eberhardt, Einar; Vogel, Hans-Jörg

    2016-04-01

    Fertile soils are central resources for the production of biomass and provision of food and energy. A growing world population and latest climate targets lead to an increasing demand for both, food and bio-energy, which require preserving and improving the long-term productivity of soils as a bio-economic resource. At the same time, other soil functions and ecosystem services need to be maintained. To render soil management sustainable, we need to establish a scientific knowledge base about complex soil system processes that allows for the development of model tools to quantitatively predict the impact of a multitude of management measures on soil functions. This, finally, will allow for the provision of site-specific options for sustainable soil management. To face this challenge, the German Federal Ministry of Education and Research recently launched the funding program "Soil as a Natural Resource for the Bio-Economy - BonaRes". In a joint effort, ten collaborative projects and the coordinating BonaRes Centre are engaged to close existing knowledge gaps for a profound and systemic understanding of soil functions and their sensitivity to soil management. This presentation provides an overview of the concept of the BonaRes Centre which is responsible for i) setting up a comprehensive data base for soil-related information, ii) the development of model tools aiming to estimate the impact of different management measures on soil functions, and iii) establishing a web-based portal providing decision support tools for a sustainable soil management. A specific focus of the presentation will be laid on the so-called "knowledge-portal" providing the infrastructure for a community effort towards a comprehensive meta-analysis on soil functions as a basis for future model developments.

  15. A Worksite Health Education Workshop as Empowerment Intervention for Health Promotion in the National Research Centre of Egypt.

    PubMed

    Amer, Nagat Mohamed; Monir, Zeinab M; Saleh, Mai Sabry; Mahdy-Abdallah, Heba; Hafez, Salwa Farouk

    2016-09-15

    The study aimed to assess worksite health education workshops as a successful tool for health promotion of employees. A one day workshop was held for individuals engaged in research activities in the National research Centre of Egypt at the worksite. Its main objective was to highlight the nature, causes, symptoms and management of job stress. Participants were asked to fill a personality assessment sheet, a self-reported questionnaire for job satisfaction. Other questionnaires for assessment of falsification of type and some socio-demographic data were filled by the attendants. A concise survey was introduced at the end of the workshop for feedback collection. Attendants of the workshop were 36 subjects mainly females (94.4%). Mean age was 40.5 years with 63.9% of participants at their postdoctoral studies stage. Participants were at midway in the scale of job satisfaction (3.3) and did not suffer from falsification (0.3). The feedback survey score (11.5) showed great acceptance for the intervention. Special interest in the topic of stress was reported by 35.1% of attendants who found it the best item in the workshop and the interactive manipulation came next as declared by 18.9% of the participants. Worksite health education workshops seem to be a successful practice for empowerment in the Egyptian workplace.

  16. A Worksite Health Education Workshop as Empowerment Intervention for Health Promotion in the National Research Centre of Egypt

    PubMed Central

    Amer, Nagat Mohamed; Monir, Zeinab M.; Saleh, Mai Sabry; Mahdy-Abdallah, Heba; Hafez, Salwa Farouk

    2016-01-01

    AIM: The study aimed to assess worksite health education workshops as a successful tool for health promotion of employees. MATERIAL AND METHODS: A one day workshop was held for individuals engaged in research activities in the National research Centre of Egypt at the worksite. Its main objective was to highlight the nature, causes, symptoms and management of job stress. Participants were asked to fill a personality assessment sheet, a self-reported questionnaire for job satisfaction. Other questionnaires for assessment of falsification of type and some socio-demographic data were filled by the attendants. A concise survey was introduced at the end of the workshop for feedback collection. RESULTS: Attendants of the workshop were 36 subjects mainly females (94.4%). Mean age was 40.5 years with 63.9% of participants at their postdoctoral studies stage. Participants were at midway in the scale of job satisfaction (3.3) and did not suffer from falsification (0.3). The feedback survey score (11.5) showed great acceptance for the intervention. Special interest in the topic of stress was reported by 35.1% of attendants who found it the best item in the workshop and the interactive manipulation came next as declared by 18.9% of the participants. CONCLUSION: Worksite health education workshops seem to be a successful practice for empowerment in the Egyptian workplace. PMID:27703583

  17. Benefits and payments for research participants: Experiences and views from a research centre on the Kenyan coast

    PubMed Central

    2012-01-01

    Background There is general consensus internationally that unfair distribution of the benefits of research is exploitative and should be avoided or reduced. However, what constitutes fair benefits, and the exact nature of the benefits and their mode of provision can be strongly contested. Empirical studies have the potential to contribute viewpoints and experiences to debates and guidelines, but few have been conducted. We conducted a study to support the development of guidelines on benefits and payments for studies conducted by the KEMRI-Wellcome Trust programme in Kilifi, Kenya. Methods Following an initial broad based survey of cash, health services and other items being offered during research by all programme studies (n = 38 studies), interviews were held with research managers (n = 9), and with research staff involved in 8 purposively selected case studies (n = 30 interviewees). Interviews explored how these ‘benefits’ were selected and communicated, experiences with their administration, and recommendations for future guidelines. Data fed into a consultative workshop attended by 48 research staff and health managers, which was facilitated by an external ethicist. Findings The most commonly provided benefits were medical care (for example free care, and strengthened quality of care), and lunch or snacks. Most cash given to participants was reimbursement of transport costs (for example to meet appointments or facilitate use of services when unexpectedly sick), but these payments were often described by research participants as benefits. Challenges included: tensions within households and communities resulting from lack of clarity and agreement on who is eligible for benefits; suspicion regarding motivation for their provision; and confusion caused by differences between studies in types and levels of benefits. Conclusions Research staff differed in their views on how benefits should be approached. Echoing elements of international benefit

  18. Benefits and payments for research participants: experiences and views from a research centre on the Kenyan coast.

    PubMed

    Molyneux, Sassy; Mulupi, Stephen; Mbaabu, Lairumbi; Marsh, Vicki

    2012-06-22

    There is general consensus internationally that unfair distribution of the benefits of research is exploitative and should be avoided or reduced. However, what constitutes fair benefits, and the exact nature of the benefits and their mode of provision can be strongly contested. Empirical studies have the potential to contribute viewpoints and experiences to debates and guidelines, but few have been conducted. We conducted a study to support the development of guidelines on benefits and payments for studies conducted by the KEMRI-Wellcome Trust programme in Kilifi, Kenya. Following an initial broad based survey of cash, health services and other items being offered during research by all programme studies (n = 38 studies), interviews were held with research managers (n = 9), and with research staff involved in 8 purposively selected case studies (n = 30 interviewees). Interviews explored how these 'benefits' were selected and communicated, experiences with their administration, and recommendations for future guidelines. Data fed into a consultative workshop attended by 48 research staff and health managers, which was facilitated by an external ethicist. The most commonly provided benefits were medical care (for example free care, and strengthened quality of care), and lunch or snacks. Most cash given to participants was reimbursement of transport costs (for example to meet appointments or facilitate use of services when unexpectedly sick), but these payments were often described by research participants as benefits. Challenges included: tensions within households and communities resulting from lack of clarity and agreement on who is eligible for benefits; suspicion regarding motivation for their provision; and confusion caused by differences between studies in types and levels of benefits. Research staff differed in their views on how benefits should be approached. Echoing elements of international benefit sharing and ancillary care debates, some

  19. Addiction research centres and the nurturing of creativity: University of Michigan Addiction Research Center (UMARC): Development, Evolution, and Direction

    PubMed Central

    Zucker, Robert A.

    2010-01-01

    A historical summary is provided of the evolution of the University of Michigan Addiction Research Center (UMARC) since its origins in 1988. Begun as an NIH research center within a Department of Psychiatry and focused solely on alcohol and aging, early work emphasized treatment efficacy, differential outcome studies, and characterization of the neurophysiological and behavioral manifestations of chronic alcoholism. Over the last fifteen years, UMARC has extended its research focus along a number of dimensions: Its developmental reach has been extended etiologically by studies of risk early in the life span, and by way of work on earlier screening and the development of early, brief treatment interventions. The addiction focus has expanded to include other drugs of abuse. Levels of analysis have also broadened, with work on the molecular genetics and brain neurophysiology underlying addictive processes on the one hand, and examination of the role of the social environment in long term course of disorder on the other. Activities have been facilitated by several research training programs and by collaborative relationships with other universities around the United States and in Poland. Since 2002, a program for research infrastructure development and collaboration has been carried on, initially with Poland and more recently with Ukraine, Latvia, and Slovakia. A blueprint for the future includes expanded characterization of the neurobiology and genetics of addictive processes, the developmental environment, as well as programmatic work to address the public health implications of our ability to identify risk for disorder very early in life. PMID:20331547

  20. Addiction research centres and the nurturing of creativity. University of Michigan Addiction Research Center (UMARC): development, evolution, and direction.

    PubMed

    Zucker, Robert A

    2010-06-01

    A historical summary is provided of the evolution of the University of Michigan Addiction Research Center (UMARC) since its origins in 1988. Begun as an National Institutes of Health (NIH) research center within a Department of Psychiatry and focused solely upon alcohol and aging, early work emphasized treatment efficacy, differential outcome studies and characterization of the neurophysiological and behavioral manifestations of chronic alcoholism. Over the last 15 years, UMARC has extended its research focus along a number of dimensions: its developmental reach has been extended etiologically by studies of risk early in the life span, and by way of work on earlier screening and the development of early, brief treatment interventions. The addiction focus has expanded to include other drugs of abuse. Levels of analysis have also broadened, with work on the molecular genetics and brain neurophysiology underlying addictive processes, on one hand, and examination of the role of the social environment in long-term course of disorder on the other hand. Activities have been facilitated by several research training programs and by collaborative relationships with other universities around the United States and in Poland. Since 2002, a program for research infrastructure development and collaboration has been ongoing, initially with Poland and more recently with Ukraine, Latvia and Slovakia. A blueprint for the future includes expanded characterization of the neurobiology and genetics of addictive processes, the developmental environment, as well as programmatic work to address the public health implications of our ability to identify risk for disorder very early in life.

  1. A three-variable chaotic system for the epidemic of bubonic plague in Bombay by the end of the 19th century and its coupling to the epizootics of the two main species of rats

    NASA Astrophysics Data System (ADS)

    Mangiarotti, Sylvain

    2016-04-01

    any dynamical networks. The possibility to apply the technique to other diseases (such as Ebola) and to detect couplings to climatic conditions will also be evoked. [1] Gatacre W. F., 1897. Report on the bubonic plague in Bombay. [2] Plague Research Commission, 1907. The epidemiological observations made by the commission in Bombay city. J. of Hygiene, 7, 724-798. [3] Mangiarotti S., Coudret R., Drapeau L. & Jarlan L., 2012. Polynomial search and Global modelling: two algorithms for modeling chaos. Physical Review E, 86(4), 046205. [4] Mangiarotti S. 2015. Low dimensional chaotic models for the plague epidemic in Bombay (1896-1911). Chaos Solitons and Fractals, 81, 184-196.

  2. MOSES: a Symbiosis Between the Lagos Ciência Viva Science Centre and a Research Project from the University of the Algarve

    NASA Astrophysics Data System (ADS)

    Leote, Catarina; Moura, Delminda; Azevedo Rodrigues, Luis

    2017-04-01

    Geoscience education is key for the understanding of our home, the planet Earth. The Lagos Ciência Viva Science Centre (CCVL) in Portugal develops various geoscience activities including astronomy sessions, geology, paleontology and oceanography field trips, complementary primary school classes, seminars and numerous workshops for a public ranging from pre-schoolers to seniors . Our experience in geoscience communication and informal education also includes a formal partnership with a research centre from the University of the Algarve, the CIMA - Centre for Marine and Environmental Research, through the project MOSES, which focuses on sand transport along crenulated coasts. Based on the project goals, methods and results, the CCVL team designed a communication and outreach plan including a seminar, a field trip and a workshop, to alert for the subjects of coastal erosion and management, both highly relevant in the Algarve. This partnership was highly beneficial for both parts as it facilitated the communication of a scientific project to the public, while the CCVL had the opportunity to update and expand its educational offer. This type of interaction between universities/research institutes and science centres/museums allows scientists to focus on their research work, reducing their need to invest in communication, and provides good and updated scientific contents to science communicators, ensuring a direct channel between scientific research and the public.

  3. [The contribution of the Russian Research Centre of Medical Rehabilitation and Balneotherapeutics to the development of the health resort business in this country].

    PubMed

    Povazhnaia, E A; Bobrovnitskiĭ, I P

    2013-01-01

    The definition of the notion of health resort business is proposed in the context of the legislation pertinent to the natural therapeutic resources, health and recreational localities, spa and resort facilities currently in force in this country. The main landmark events in the history of the Russian Research Centre of Rehabilitative Medicine and Balneotherapeutics are highlighted, its role in the development of balneotherapeutic science and health resort business is described. The major achievements of the Centre in the investigations of therapeutic properties of natural physical factors (climate, mineral waters, peloids, etc.), their action on the human organism, the possibilities of their application for the treatment and prevention of various pathological conditions in and outside health resort facilities are presented. The contribution of the specialists of the Centre to the search for and discovery of new resort resources is emphasized. Community needs in balneotheraputic treatment are estimated, scientific basis for its organization, principles and normatives of health resort business are discussed along with the problems of sanitary control and protection. The activities of the Centre as an organizer of the unique system of rehabilitative and balneotherapeutic aid to the population are overviewed. Scientifically substantiated indications and contraindications for the spa and resort-based treatment of various diseases are proposed in conjunction with the methods for the application of physiotherapeutic factors. The tasks currently facing the Centre and prospects for its future research activities in the fields of rehabilitative medicine and balneotherapeutics are discussed.

  4. Urgent replacement of a mechanical mitral prosthesis in an anticoagulated patient with Bombay red blood cell phenotype.

    PubMed

    Nairn, Travis K; Giulivi, Antonio; Neurath, Doris; Tokessy, Melanie; Sia, Ying T; Ruel, Marc; Wilkes, Peter R H

    2010-06-01

    Bombay red blood cell phenotype is an extremely rare blood type for which patients can receive only autologous or Bombay phenotype red blood cells. We report a case of urgent repeat sternotomy for replacement of a mechanical mitral prosthesis in a patient with Bombay phenotype anticoagulated with warfarin, to emphasize the transfusion challenges in such patients. A male of Indian descent presented to hospital with New York Heart Association IV symptoms. His medical history revealed previous mitral valve replacement with a mechanical prosthesis in 2005 and Bombay phenotype blood. Preoperative transthoracic echocardiography demonstrated thrombus obstruction of the mitral prosthesis despite anticoagulation with warfarin. Right ventricular systolic pressure was >100 mmHg with 3+ tricuspid regurgitation. The patient's condition was temporized with diuretics, bronchodilators, and bi-level positive airway pressure ventilation while transfusion medicine and cardiac surgery were consulted for urgent surgery. The patient received vitamin K and prothrombin complex concentrate prior to repeat sternotomy and successful mitral prosthesis replacement. After cardiopulmonary bypass, heparinization was corrected with protamine and followed by a second dose of prothrombin complex concentrate and recombinant activated factor VIIa. Postoperatively, the patient received four units of packed red blood cells, two autologous units and two units of Bombay specific red blood cells. Right ventricular pressures stabilized at 40 mmHg following surgery. The patient recovered following several days of inotropic support with milrinone, diuretics, and bronchodilators. Patients with Bombay phenotype red blood cells present as type O, but they are unable to receive red blood cells from any phenotype other than Bombay phenotype. They are able to receive all other blood products, including fresh frozen plasma, cryoprecipitate, platelets, prothrombin complex concentrate, and recombinant activated factor

  5. Student-centred learning in Community Medicine: An experience from Jawaharlal Institute of Postgraduate Medical Education and Research, Puducherry.

    PubMed

    Kar, S S; Premarajan, K C; L, Subitha; Archana, R; Iswarya, S; A, Sujiv

    2014-01-01

    Student-centred learning (SCL) places the student at the centre of policies, practices and decision-making in the teaching-learning process. SCL methodology also advocates active involvement of students in the curriculum planning, selection of teaching-learning methods and assessment process. We planned an education innovation project to assess the perception of fifth semester undergraduate medical students towards implementation of an SCL methodology. The study was done among 87 fifth semester undergraduate medical students (batch of 2010-11) in the noncommunicable disease epidemiology section of Community Medicine at the Jawaharlal Institute of Postgraduate Medical Education and Research (JIPMER), Puducherry. The students divided themselves into seven groups and developed the learning objectives, selected teaching-learning methods and assessment process for each session. The facilitators had 3-5 rounds of interaction with each group before the session. Qualitative analysis of feedback collected from students and external faculty after each session was done. The effect of implementing the SCL methodology was assessed by the reaction level of Kirkpatrick's training evaluation model by using a rating scale Results. Of the 87 eligible students, 73 (83.9%) returned the forms for evaluation. All seven groups were able to formulate the learning objectives. Most of the groups had used PowerPoint slides and videos as a teaching-learning tool. Innovative assessment methods such as crosswords and 'chocopati' were used by some groups. In general, the perception of students was favourable towards SCL compared to conventional methods and they felt that this methodology should be adopted more often. Time management and organization of sessions were the main problems encountered by the students. The mean (SD) score for the items 'sessions were useful', 'sessions were enjoyable' and 'sessions improved my knowledge' were 6.2 (1.8), 7.1 (1.8) and 6.3 (1.9), respectively. The

  6. Complete mitochondrial genome of the Bombay duck Harpodon nehereus (Aulopiformes, Synodontidae).

    PubMed

    Bo, Zhang; Xu, Tianjun; Wang, Rixin; Jin, Xiaoxiao; Sun, Yuena

    2013-12-01

    Bombay duck, Harpodon nehereus (Aulopiformes, Synodontidae), is a commercially important marine fish species in China. In this study, the complete mitochondrial genome of H. nehereus was firstly determined. The mitogenome (16 and 536 bp) comprises 13 protein-coding genes, 22 tRNA genes, 2 rRNA genes, and 1 putative control region. These mitogenome sequence data would play an important role in population genetics and phylogenetic analysis of Aulopiformes.

  7. Identification of a rare blood group, "Bombay (Oh) phenotype," in Bhuyan tribe of Northwestern Orissa, India.

    PubMed

    Balgir, R S

    2007-09-01

    Blood group serology plays a vital role in transfusion medicine. The Bombay (Oh) phenotype is characterized by the absence of A, B, and H antigens on red cells and occurs rarely, especially in tribal populations of India. This is a field-based random population study in the Bhuyan tribal community. The study reports three cases of the rare Bombay (Oh) phenotype for the first time in the Bhuyan tribe of Sundargarh district in North-Western Orissa. Taking informed consent, red blood cells of 836 Bhuyan subjects were tested with three antisera, i.e., anti-A, anti-B, and anti-H (lectin) for forward reaction. Agglutinations of plasma with A, B, and O (H) red cells (reverse reaction) were also tested for the presence or absence of antibodies in the serum. Specialized tests like absorption-elution, titration of naturally occurring antibodies at different temperatures, inhibition of anti-H by O saliva secretor, and determination of secretor status were performed. Three cases of a rare blood group, Bombay (Oh) phenotype, (2 out of 244 Khandayat Bhuyan and 1 out of 379 Paudi Bhuyan from Hemgiri and Lahunipara blocks, respectively) in the Bhuyan tribe of Sundargarh district in North-Western Orissa were detected, giving an incidence of 1 in 122 in Khandayat Bhuyan and 1 in 379 in Paudi Bhuyan, with an average of 1 in 278 among the Bhuyan tribal population. This incidence is high in comparison to earlier studies reported from India. The practice of tribal and territorial endogamy in a smaller effective populations (for example, there are only 3,521 individuals in Paudi Bhuyan) results in smaller marital distance and inbreeding, leading to increased homozygous expression of rare recessive genetic characters like the Bombay (Oh) phenotype. This study further testifies that the incidence is higher in those states of India where the consanguinity is a common practice.

  8. Bombay blood group: Is prevalence decreasing with urbanization and the decreasing rate of consanguineous marriage

    PubMed Central

    Mallick, Sujata; Kotasthane, Dhananjay S.; Chowdhury, Puskar S.; Sarkar, Sonali

    2015-01-01

    Context: Bombay blood group although rare is found to be more prevalent in the Western and Southern states of India, believed to be associated with consanguineous marriage. Aims: To estimate the prevalence of the Bombay blood group (Oh) in the urban population of Puducherry. To find the effect of urbanization on consanguineous marriage and to establish whether consanguinity plays a part in the prevalence of Oh group. To compare Oh group prevalence with that of other neighboring states, where population is not predominantly urban. Settings and Design: This is a descriptive study in a tertiary care hospital in Puducherry, over a period of 6 years. Materials and Methods: All blood samples showing ‘O’ group were tested with anti-H lectin. Specialized tests like Adsorption Elution Technique, inhibition assay for determination of secretor status were performed on Oh positive cases. Any history of consanguineous marriage was recorded. Statistical Analysis Used: All variables were categorical variable and percentage and proportions were calculated manually. Results: Analysis of the results of 35,497 study subjects showed that the most common group was ‘O’ group constituting 14,164 (39.90%) of subjects. Only three “Oh” that is, Bombay phenotype (0.008%) were detected. Consanguinity was observed in two cases (66.66%). Conclusions: This study shows the prevalence of Bombay blood group representing the urban population of Puducherry, to be high (0.008%) and associated with consanguineous marriage (66.66%). Thus, consanguinity is still an important risk factor present, even in an urban population in Southern India. PMID:26420929

  9. The Cooperative Research Centre for Living with Autism (Autism CRC) Conceptual Model to Promote Mental Health for Adolescents with ASD.

    PubMed

    Shochet, Ian M; Saggers, Beth R; Carrington, Suzanne B; Orr, Jayne A; Wurfl, Astrid M; Duncan, Bonnie M; Smith, Coral L

    2016-06-01

    Despite an increased risk of mental health problems in adolescents with autism spectrum disorder (ASD), there is limited research on effective prevention approaches for this population. Funded by the Cooperative Research Centre for Living with Autism, a theoretically and empirically supported school-based preventative model has been developed to alter the negative trajectory and promote wellbeing and positive mental health in adolescents with ASD. This conceptual paper provides the rationale, theoretical, empirical and methodological framework of a multilayered intervention targeting the school, parents and adolescents on the spectrum. Two important interrelated protective factors have been identified in community adolescent samples, namely the sense of belonging (connectedness) to school and the capacity for self and affect regulation in the face of stress (i.e. resilience). We describe how a confluence of theories from social psychology, developmental psychology and family systems theory, along with empirical evidence (including emerging neurobiological evidence), supports the interrelationships between these protective factors and many indices of wellbeing. However, the characteristics of ASD (including social and communication difficulties, and frequently difficulties with changes and transitions, and diminished optimism and self-esteem) impair access to these vital protective factors. The paper describes how evidence-based interventions at the school level for promoting inclusive schools (using the Index for Inclusion) and interventions for adolescents and parents to promote resilience and belonging [using the Resourceful Adolescent Program (RAP)] are adapted and integrated for adolescents with ASD. This multisite proof-of-concept study will confirm whether this multilevel school-based intervention is promising, feasible and sustainable.

  10. Treatment of acute myeloblastic leukaemia in a patient with Bombay blood type: a case report.

    PubMed

    Okamoto, Y; Tsuda, T; Matsunami, M; Hirose, T; Sakaguchi, R; Katayama, N; Ota, K

    2001-01-01

    A 62-year-old female was admitted to our hospital with suspected acute leukaemia and after investigation we diagnosed acute myeloblastic leukaemia (AML-M1). The patient's blood type was found to be the very rare Bombay type and surveillance of her relatives showed the same blood type in her male cousin on her mother's side. Alongside chemotherapy the patient received 4000 ml of frozen Bombay-type red cells, 1400 ml of concentrated red cells in manitol adenine phosphate solutions and 360 units of type O concentrated platelets without marked effects. The anti-H antibody was initially at 128 dilution but for unknown reasons increased to 2048 dilution after remission of AML-M1. About 3 months after hospitalization the patient died of Cryptococcus neoformans pneumonia despite strict precautions against infection. Although AML-M1 is a common adult leukaemia and is chemosensitive to anti-leukaemic drugs, neither AML-M1 in a patient with Bombay-type red cells nor its treatment with chemotherapy and transfusion with type Oh frozen red cells have previously been reported.

  11. [Molecular genetic basis for para-Bombay phenotypes in two cases].

    PubMed

    He, Yang-Ming; Xu, Xian-Guo; Zhu, Fa-Ming; Yan, Li-Xing

    2007-06-01

    This study was purposed to investigate the molecular genetics basis for para-Bombay phenotype. The para-Bombay phenotype of two probands was identified by routine serological techniques. The full coding region of alpha (1, 2) fucosyltransferase gene (FUT1 and FUT2) in the probands was amplified by polymerase chain reaction and the amplified fragments were directly sequenced, meanwhile the mutations of FUT1 were also identified by TOPO TA cloning sequence method. The results indicated that two heterozygous mutations were detected by directly sequencing in two probands: AG deletion at position 547 - 552 and C to T mutation at position 658. Two different mutations were confirmed to be true compound heterozygotes with each mutation on a separate homologous chromosome by TOPO TA cloning sequence method. AG deletion at position 547 - 552 caused a reading frame shift and a premature stop codon. C658T mutation resulted in Arg-->Cys at amino acid position 220. It is suggested that the FUT1 mutation of two probands are compound heterozygous mutation with different chromosomes, which are named h1h3 and may be the genetics basis of para-Bombay phenotype.

  12. [Formation of para-Bombay phenotype caused by homozygous or heterozygous mutation of FUT1 gene].

    PubMed

    Zhang, Jin-Ping; Zheng, Yan; Sun, Dong-Ni

    2014-02-01

    This study was aimed to explore the molecular mechanisms for para-Bombay phenotype formation. The H antigen of these individuals were identified by serological techniques. The full coding region of alpha (1, 2) fucosyltransferase (FUT1) gene of these individuals was amplified by high-fidelity polymerase chain reaction (PCR). PCR product was identified by TOPO cloning sequencing. Analysis and comparison were used to explore the mechanisms of para-bombay phenotype formation in individuals. The results indicated that the full coding region of FUT1 DNA was successfully amplified by PCR and gel electrophoresis. DNA sequencing and analysis found that h1 (547-552delAG) existed in one chromosome and h4 (35C > T) existed in the other chromosome of NO.1 individual. Meantime, h1 (547-552delAG) was found in two chromosomes of NO.2 and NO.3 individual. It also means that FUT1 gene of NO.1 individual was h1h4 heterozygote, FUT1 gene of NO.2 and NO.3 individuals were h1h1 homozygote. It is concluded that homozygous and heterozygous mutation of FUT1 gene can lead to the formation of para-Bombay phenotype.

  13. [Para-Bombay phenotype caused by combined heterozygote of two bases deletion on fut1 alleles].

    PubMed

    Ma, Kan-Rong; Tao, Shu-Dan; Lan, Xiao-Fei; Hong, Xiao-Zhen; Xu, Xian-Guo; Zhu, Fa-Ming; Lü, Hang-Jun; Yan, Li-Xing

    2011-02-01

    This study was purposed to investigate the molecular basis of a para-Bombay phenotype for screening and identification of rare blood group. ABO and H phenotypes of the proband were identified by serological techniques. The exon 6 to exon 7 of ABO gene and full coding region of α-1,2-fucosyltransferase (fut1) gene of the proband were analyzed by polymerase chain reaction and direct sequencing of the amplified fragments. The haplotype of compound heterozygote of fut1 was also identified by cloning sequencing. The results indicated that a rare para-Bombay phenotype was confirmed by serological techniques. Two deletion or insertion variant sites near nucleotide 547 and 880 were detected in fut1 gene. The results of cloning sequence showed that one haplotype of fut1 gene was two bases deletion at 547-552 (AGAGAG→AGAG), and another one was two bases deletion at position 880-882 (TTT→T). Both two variants caused a reading frame shift and a premature stop codon. It is concluded that a rare para-Bombay phenotype is found and confirmed in blood donor population. The molecular basis of this individual is compound heterozygote of two bases deletion on fut1 gene which weaken the activity of α-1, 2-fucosyltransferase.

  14. The Iranian Documentation Centre.

    ERIC Educational Resources Information Center

    Harvey, John F.

    The purpose of the Iranian Documentation Centr (Irandoc) was to collect that portion of the world's literature which was pertinent to Iran's research interests, to organize that material, and to promote its use by Iranian researchers. Stated more succinctly, Irandoc's purpose was to obtain ready access to the world's scientific literature in order…

  15. The Danish Centre for Strategic Research in Type 2 Diabetes (DD2) study: implementation of a nationwide patient enrollment system.

    PubMed

    Nielsen, Jens Steen; Thomsen, Reimar W; Steffensen, Charlotte; Christiansen, Jens S

    2012-01-01

    This paper aims to describe the patient enrollment system and implementation strategy for the new nationwide Danish Centre for Strategic Research in Type 2 Diabetes (DD2) project. The paper will also describe the design, current content, and pilot testing of the DD2 registration form. The challenge of the DD2 project was to construct a registration system functioning in the entire Danish health care system, where new type 2 diabetes patients are initially met, and with the capacity to enroll 200 newly diagnosed diabetes patients per week nationwide. This requires a fast and simple registration that is part of everyday clinical practice in hospital outpatient clinics and general practitioner (GP) clinics. The enrollment system is thus built on a tested, rational design where patients need only one visit and only specific limited data about physical activity, anthropometric measures, and family history of diabetes are collected during a brief patient interview. Later, supplemental data will be extracted by computerized linkage with existing databases. The feasibility of this strategy was verified in a pilot study. For maximum flexibility, three different ways to fill in the DD2 registration form were provided and an interactive webpage was constructed. The DD2 project also involves collection of blood and urine samples from each diabetes patient, to be stored in a biobank. Clinicians may obtain the samples themselves or refer patients to the nearest clinical biochemical department. GPs have the additional option of referring patients to the nearest hospital outpatient diabetes clinic to obtain interview data, clinical data, and samples. At present, the enrollment system is in use at 17 hospital outpatient diabetes clinics and 45 GP clinics nationwide, together enrolling 40 new type 2 diabetes patients per week in the DD2 project. A total of 990 patients have now been enrolled and the DD2 is ready to expand nationwide.

  16. Deliberate and emergent strategies for implementing person-centred care: a qualitative interview study with researchers, professionals and patients.

    PubMed

    Naldemirci, Öncel; Wolf, Axel; Elam, Mark; Lydahl, Doris; Moore, Lucy; Britten, Nicky

    2017-08-04

    The introduction of innovative models of healthcare does not necessarily mean that they become embedded in everyday clinical practice. This study has two aims: first, to analyse deliberate and emergent strategies adopted by healthcare professionals to overcome barriers to normalization of a specific framework of person-centred care (PCC); and secondly, to explore how the recipients of PCC understand these strategies. This paper is based on a qualitative study of the implementation of PCC in a Swedish context. It draws on semi-structured interviews with 18 researchers and 17 practitioners who adopted a model of PCC on four different wards and 20 patients who were cared for in one of these wards. Data from these interviews were first coded inductively and emerging themes are analysed in relation to normalization process theory (NPT). In addition to deliberate strategies, we identify emergent strategies to normalize PCC by (i) creating and sustaining coherence in small but continuously communicating groups (ii) interpreting PCC flexibly when it meets specific local situations and (iii) enforcing teamwork between professional groups. These strategies resulted in patients perceiving PCC as bringing about (i) a sense of ease (ii) appreciation of inter-professional congruity (ii) non-hierarchical communication. NPT is useful to identify and analyse deliberate and emergent strategies relating to mechanisms of normalization. Emergent strategies should be interpreted not as trivial solutions to problems in implementation, but as a possible repertoire of tools, practices and skills developed in situ. As professionals and patients may have different understandings of implementation, it is also crucial to include patients' perceptions to evaluate outcomes.

  17. A Bombay individual lacking H and Le antigens but expressing normal levels of alpha-2- and alpha-4-fucosyltransferases.

    PubMed

    Shechter, Y; Etzioni, A; Levene, C; Greenwell, P

    1995-09-01

    The rare Bombay phenotype is usually due to a primary genetic defect in an alpha-2- or alpha-4-fucosyltransferase. The present study was done to investigate a patient with normal transferases, who exhibits the Bombay phenotype. Red cells of the patient, his parents, and siblings were phenotyped for A, B, and H antigens. The presence of B, H, and Le transferases in serum and saliva was measured. The parents and siblings were all group B, Le(a-b-). The propositus was typed as Oh, Le(a-b-). His serum contained anti-A, anti-B, and anti-H. Normal levels of B, H, and Le transferases were found in all family members including the patient. In an unusual case, a person has the Bombay phenotype, but normal levels of transferases in serum and saliva. A general defect in fucose metabolism seems to be the primary abnormality in this case.

  18. Learning to Use Statistics in Research: A Case Study of Learning in a University-Based Statistical Consulting Centre

    ERIC Educational Resources Information Center

    McGinn, Michelle K.

    2010-01-01

    This paper presents a qualitative case study of statistical practice in a university-based statistical consulting centre. Naturally occurring conversations and activities in the consulting sessions provided opportunities to observe questions, problems, and decisions related to selecting, using, and reporting statistics and statistical techniques…

  19. Getting the Price Right: Costing and Charging Commercial Provision in Centres of Vocational Excellence (CoVEs). Research Report

    ERIC Educational Resources Information Center

    Aitken, Liz; Chadwick, Arthur; Hughes, Maria

    2006-01-01

    Centres of Vocational Excellence (CoVEs) were established in 2001, intended to be a key driver in enhancing the contribution of the further education (FE) sector to meeting skills needs. Current government policy expects employers and individuals to pay a greater share of the costs of training, particularly at Level 3, which is the CoVE priority…

  20. University of Victoria Genome British Columbia Proteomics Centre Partners with CPTAC | Office of Cancer Clinical Proteomics Research

    Cancer.gov

    University of Victoria Genome British Columbia Proteomics Centre, a leader in proteomic technology development, has partnered with the U.S. National Cancer Institute (NCI) to make targeted proteomic assays accessible to the community through NCI’s CPTAC Assay Portal (https://assays.cancer.gov).

  1. An Ecological Footprint for an Early Learning Centre: Identifying Opportunities for Early Childhood Sustainability Education through Interdisciplinary Research

    ERIC Educational Resources Information Center

    McNichol, Heidi; Davis, Julie Margaret; O'Brien, Katherine R.

    2011-01-01

    In this study, engineers and educators worked together to adapt and apply the ecological footprint (EF) methodology to an early learning centre in Brisbane, Australia. Results were analysed to determine how environmental impact can be reduced at the study site and more generally across early childhood settings. It was found that food, transport…

  2. A Research on a Student-Centred Teaching Model in an ICT-Based English Audio-Video Speaking Class

    ERIC Educational Resources Information Center

    Lu, Zhihong; Hou, Leijuan; Huang, Xiaohui

    2010-01-01

    The development and application of Information and Communication Technologies (ICT) in the field of Foreign Language Teaching (FLT) have had a considerable impact on the teaching methodologies in China. With an increasing emphasis on strengthening students' learning initiative and adopting a "student-centred" teaching concept in FLT,…

  3. Learning to Use Statistics in Research: A Case Study of Learning in a University-Based Statistical Consulting Centre

    ERIC Educational Resources Information Center

    McGinn, Michelle K.

    2010-01-01

    This paper presents a qualitative case study of statistical practice in a university-based statistical consulting centre. Naturally occurring conversations and activities in the consulting sessions provided opportunities to observe questions, problems, and decisions related to selecting, using, and reporting statistics and statistical techniques…

  4. University of Victoria Genome British Columbia Proteomics Centre Partners with CPTAC - Office of Cancer Clinical Proteomics Research

    Cancer.gov

    University of Victoria Genome British Columbia Proteomics Centre, a leader in proteomic technology development, has partnered with the U.S. National Cancer Institute (NCI) to make targeted proteomic assays accessible to the community through NCI’s CPTAC Assay Portal.

  5. An Ecological Footprint for an Early Learning Centre: Identifying Opportunities for Early Childhood Sustainability Education through Interdisciplinary Research

    ERIC Educational Resources Information Center

    McNichol, Heidi; Davis, Julie Margaret; O'Brien, Katherine R.

    2011-01-01

    In this study, engineers and educators worked together to adapt and apply the ecological footprint (EF) methodology to an early learning centre in Brisbane, Australia. Results were analysed to determine how environmental impact can be reduced at the study site and more generally across early childhood settings. It was found that food, transport…

  6. Research on teaching and learning processes in Earth Sciences education, particularly centred on the awareness on natural risks and hazards

    NASA Astrophysics Data System (ADS)

    Occhipinti, Susanna

    2013-04-01

    This research, main subject of a PhD now in progress, aims to promote the teaching - learning of Earth Sciences in schools of all levels of educations, with the interesting opportunity to experience innovative and effective practices in our local contest, sharing them between all the teachers as a community of practice and all schools as an open laboratory. Based on experiences already acted in other branches of science, we have made a work notebook freely downloadable from the internet, containing an archive of teaching tools, kits, interactive lessons, easy or complex, common and new, developing contents in a vertical approach, which are now shared and used by nearly all the teachers of our Region. The most important is that each teacher, if request, is initially supported in the practices, then trained and, finally, able to carry out the activity on his own. All the materials and kits necessary for carrying out the various activities are freely available at the regional Science Centre and ready to be used, with clear instructions for the use. Traditional educational scientific instruments, trolleys and trays with all the necessary materials, but mostly models and kits, organised in structured paths, sometime a bit naive but highly effective and able to interest, intrigue and involve, are proposed to students of all ages, sometimes in a peer-to-peer exchange of knowledge. Topics are linked to the curricula of Earth Science, such as minerals and rocks, air and water, plate tectonics, volcanoes and Earthquakes, but a special attention has been paid to the topic of natural hazards and risks: dealing with natural hazard and risks, so common in our Country, requires that local communities, starting from schools, become more and more aware of the natural phenomena, beneficial or catastrophic as they are, but always making a direct impact on the quality of life. For example, students can experience how and why landslides and floods occur, by varying on hands-on models

  7. Winnipeg Centre Project.

    ERIC Educational Resources Information Center

    Manitoba Dept. of Education, Winnipeg.

    The Winnipeg Centre Project is a field-based, work-study program that attempts to create more appropriate education for the inner-city child. Sponsored by the Planning and Research Branch of the Department of Colleges and Universities Affairs and administered by Brandon University in consultation with the Winnipeg School Division, the project is…

  8. An unusual anti-H lectin inhibited by milk from individuals with the Bombay phenotype.

    PubMed

    Joshi, S R; Vasantha, K; Robb, J S

    2005-01-01

    There are several lectins with anti-H specificity but few of them serve as useful reagents. An anti-H lectin, extracted from the seeds of the plant Momordica dioica Roxb. ex willd., was tested for its hemagglutination and inhibition properties, using standard serologic methods and panel RBCs, serum, saliva, milk, and oligosaccharides purified from milk. The extract displayed strongest agglutination with group O RBCs and was weakest with group A1B RBCs in a spectrum of O>A2>B>A2B>A1>A1B; the extract failed to react with the RBCs from 25 individuals with the Bombay (Oh) phenotype and was inhibited by H secretor saliva, hence it was characterized as anti-H. However, its inhibition by milk samples from five mothers with the Bombay phenotype called into question its specificity as anti-H. The lectin reacted as strongly with group O ii (adult) RBCs as with normal OI RBCs, ruling out its specificity as anti-HI. Hemagglutination inhibition was observed with 2'-fucosyllactose (Type 2 H) and lacto-N-fucopentose-I (Type 1 H), suggesting that the binding of the lectin had preference for H structures. However, inhibition by N-acetyllactosamine, lacto-Ntetraose, and lacto-N-neotetraose suggested that the lectin also recognized unsubstituted terminal beta-linked galactose units. The hemagglutinin property in the present lectin showed an unusual anti-H specificity. The lectin was inhibited by milk from Bombay phenotype individuals and certain milk oligosaccharides not specific for the H antigen.

  9. [Analysis on FUT1 and FUT2 gene of 10 para-Bombay individuals in China].

    PubMed

    Guo, Zhong-hui; Xiang, Dong; Zhu, Zi-yan; Wang, Jian-lian; Zhang, Jia-min; Liu, Xi; Shen, Wei; Chen, He-ping

    2004-10-01

    This is a study on the allele composing of ABO, FUT1 and FUT2 gene loci of 10 para-Bombay individuals in China. Ten samples coming from different districts of China were suspected of para-Bombay phenotype by primary serology tests. Routine and absorb-elution tests were conducted to identify their ABO type, and duplex polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) was applied to getting their ABO genotype. Most of them were submitted to a test of their Lewis type as well. Then through direct DNA sequencing with PCR products of FUT1 and FUT2 genes, the genotypes of their H and SE gene loci were analyzed. It can be confirmed that the 10 samples are para-Bombay. All of their ABO genotypes are consistent with the serological absorb-elution results and the substances detected results in saliva. Seven out of 10 have recessive homozygous gene at their H locus. Each phenotype of h1h1 (nt547-552Deltaag), h2h2 (nt880-882Deltatt) and h4h4 (nt35 t-->c) are ascertained in 2 individuals; moreover, h3h3 (nt 658 c-->t) is identified in one individual. The rest are hh heterozygous individuals: one is h3/h(new-1); the other is h2/h(new-2); the last one is h1/h2. The h(new-1) (nt586 c-->t) allele has a point mutation at nt 586 C to T, which leads a nonsense mutation Gln(CAG) to stop (TAG).The second h (new-2) (nt328 g-->a) has an nt328 G to A missense mutation,which leads Ala (GCC),was replaced by Thr (ACC) at 110 amino acid position. All the 10 samples have Se (nt357 c-->t) synonymous mutation. One Bm(h) (B/O) individual with h4h4 phenotype has a Se(w)(nt357 c-->t; nt385 a-->t) allele, whose Lewis type is Le(a+b+). Moreover, the authors detected a (nt716 g-->a) mutation in two samples' Se gene. Four kinds of known h alleles (h1-h4), 2 kinds of novel non-functional FUT1 alleles, a Se(w) allele, and a novel SeG716A polymorphism in Chinese para-Bombay individuals were detected. At the same time, the authors noticed that all the 10 samples have the nt357 c

  10. Biotypes of Gardnerella vaginalis isolated from non-specific vaginitis patients in Bombay.

    PubMed

    Pandit, D V; Barve, S M; Deodhar, L P

    1989-11-01

    The incidence and prevalent biotypes of G. vaginalis in patients with non-specific vaginitis from Bombay, was studied. Of 300 patients screened, 105 were diagnosed to have nonspecific vaginitis (NSV). G. vaginalis was isolated from 71 per cent patients with NSV; 34.6 and 29.3 per cent G. vaginalis were belonging to biotypes 5 and 1 respectively. In 55 per cent patient, G. vaginalis was associated with anaerobes. None of the isolated strains of G. vaginalis was sensitive to 5 micrograms metronidazole disc whereas 93 per cent of the strains were sensitive to 50 micrograms metronidazole disc.

  11. [The 75th anniversary of science research and development testing centre of air medicine and military ergonomics SSRDTI of military medicine of Ministry of Defense of the RF].

    PubMed

    Bukhtiiarov, I V; Khomenko, M N; Zhdan'ko, I M

    2010-01-01

    The article presents main stages of forming Science research and development testing centre of air medicine and military ergonomics, results of researches of three main directions: medical-technical (ergonomic) supply of creation, testing and exploitation of air techniques and armament; participating in organization of combat training activity for the purposes of saving professional health, securing of combativity and professional reliability of aircraft pilots; scientific grounding of improvement of medical supply of aviation (improvement of medical control for dynamics of state of health, physiological and psychological resources of organism in course of combat training, creation of automatized diagnostic complexes and etc.).

  12. Barriers and opportunities for enhancing patient recruitment and retention in clinical research: findings from an interview study in an NHS academic health science centre.

    PubMed

    Adams, Mary; Caffrey, Louise; McKevitt, Christopher

    2015-03-12

    In the UK, the recruitment of patients into clinical research is a national health research and development policy priority. There has been limited investigation of how national level factors operate as barriers or facilitators to recruitment work, particularly from the perspective of staff undertaking patient recruitment work. The aim of this study is to identify and examine staff views of the key organisational barriers and facilitators to patient recruitment work in one clinical research group located in an NHS Academic Health Science Centre. A qualitative study utilizing in-depth, one-to-one semi-structured interviews with 11 purposively selected staff with particular responsibilities to recruit and retain patients as clinical research subjects. Thematic analysis classified interview data by recurring themes, concepts, and emergent categories for the purposes of establishing explanatory accounts. The findings highlight four key factors that staff perceived to be most significant for the successful recruitment and retention of patients in research and identify how staff located these factors within patients, studies, the research centre, the trust, and beyond the trust. Firstly, competition for research participants at an organisational and national level was perceived to undermine recruitment success. Secondly, the tension between clinical and clinical research workloads was seen to interrupt patient recruitment into studies, despite national funding arrangements to manage excess treatment costs. Thirdly, staff perceived an imbalance between personal patient burden and benefit. Ethical committee regulation, designed to protect patients, was perceived by some staff to detract from clarification and systematisation of incentivisation strategies. Finally, the structure and relationships within clinical research teams, in particular the low tacit status of recruitment skills, was seen as influential. The results of this case-study, conducted in an exemplary NHS

  13. Minister unveils new nanotech centres

    NASA Astrophysics Data System (ADS)

    Dumé, Belle

    2009-06-01

    Three new nanotechnology research centres are to be set up in France as part of a €70m government plan to help French companies in the sector. Researchers at the new centres, which will be located in Grenoble, Saclay (near Paris) and Toulouse, will be encouraged to collaborate with industry to develop new nanotech-based products. Dubbed NANO-INNOV, the new plan includes €46m for two new buildings at Saclay, with the rest being used to buy new equipment at the three centres and to fund grant proposals from staff to the French National Research Agency (ANR).

  14. Assessment of potential shale gas resources of the Bombay, Cauvery, and Krishna-Godavari Provinces, India, 2011

    USGS Publications Warehouse

    ,

    2012-01-01

    Using a performance-based geologic assessment methodology, the U.S. Geological Survey estimated a technically recoverable mean volume of 6.1 trillion cubic feet of potential shale gas in the Bombay, Cauvery, and Krishna-Godavari Provinces of India.

  15. Survey of sociodemographic characteristics of tobacco use among 99,598 individuals in Bombay, India using handheld computers

    PubMed Central

    Gupta, P. C.

    1996-01-01

    OBJECTIVES: To study the diversity and sociodemographic characteristics of tobacco use in Bombay, India. DESIGN: Population-based, cross- sectional, house-to-house survey with face-to-face interviews in the city of Bombay during 1992-94. Data was input directly into a programmed, handheld computer (electronic diary). PARTICIPANTS: Permanent residents of the city of Bombay aged 35 years and older. MAIN OUTCOME MEASURES: Tobacco use in various smoking and smokeless forms. RESULTS: 99598 individuals were interviewed (60% women, 40% men). Among women, prevalence of tobacco use was high (57.5%) but almost solely in the smokeless form. Among men, 69.3% reported current tobacco use and 23.6% were smokers. The most common smokeless tobacco practice among women was mishri use (44.5% of smokeless users) and among men betel quid with tobacco (27.1%). About half of smokers used bidi and half smoked cigarettes. Chewing areca nut without tobacco was rare (< 0.5% of smokeless users). Educational level was inversely associated with tobacco use of all kinds except cigarette smoking. CONCLUSIONS: The pattern of tobacco use varies across India and, in Bombay, is very different from other areas. Using handheld computers to collect data in the field was successful. 


 PMID:8910992

  16. The importance of brain banks for molecular neuropathological research: The New South Wales Tissue Resource Centre experience.

    PubMed

    Dedova, Irina; Harding, Antony; Sheedy, Donna; Garrick, Therese; Sundqvist, Nina; Hunt, Clare; Gillies, Juliette; Harper, Clive G

    2009-01-01

    New developments in molecular neuropathology have evoked increased demands for postmortem human brain tissue. The New South Wales Tissue Resource Centre (TRC) at The University of Sydney has grown from a small tissue collection into one of the leading international brain banking facilities, which operates with best practice and quality control protocols. The focus of this tissue collection is on schizophrenia and allied disorders, alcohol use disorders and controls. This review highlights changes in TRC operational procedures dictated by modern neuroscience, and provides examples of applications of modern molecular techniques to study the neuropathogenesis of many different brain disorders.

  17. Exploring multiple sources of climatic information within personal and medical diaries, Bombay 1799-1828

    NASA Astrophysics Data System (ADS)

    Adamson, George

    2016-04-01

    Private diaries are being recognised as an important source of information on past climatic conditions, providing place-specific, often daily records of meteorological information. As many were not intended for publication, or indeed to be read by anyone other than the author, issues of observer bias are lower than some other types of documentary sources. This paper comprises an exploration of the variety of types of climatic information can be mined from a single document or set of documents. The focus of the analysis is three private and one medical diary kept by British colonists in Bombay, western India, during the first decades of the nineteenth century. The paper discusses the potential of the diaries for reconstruction of precipitation, temperature and extreme events. Ad-hoc temperature observations collected by the four observers prove to be particularly fruitful for reconstructing monthly extreme temperatures, with values comparable to more systematic observations collected during the period. This leads to a tentative conclusion that extreme temperatures in Bombay were around 5°C lower during the period than today, a difference likely predominantly attributable to the urban heat island effect.

  18. [Study on the molecular genetics basis for one para-Bombay phenotype].

    PubMed

    Hong, Xiao-Zhen; Shao, Xiao-Chun; Xu, Xian-Guo; Hu, Qing-Fa; Wu, Jun-Jie; Zhu, Fa-Ming; Fu, Qi-Hua; Yan, Li-Xing

    2005-12-01

    To investigate the molecular genetics basis for one para-Bombay phenotype, the red blood cell phenotype of the proband was characterized by standard serological techniques. Exon 6 and 7 of ABO gene, the entire coding region of FUT1 gene and FUT2 gene were amplified by polymerase chain reaction from genomic DNA of the proband respectively. The PCR products were purified by agarose gels and directly sequenced. The PCR-SSP and genescan were performed to confirm the mutations detected by sequencing. The results showed that the proband ABO genotype was A(102)A(102). Two heterozygous mutations of FUT1 gene, an A to G transition at position 682 and AG deletion at position 547-552 were detected in the proband. A682G could cause transition of Met-->Val at amino acid position 228, AG deletion at position 547-552 caused a reading frame shift and a premature stop codon. The FUT2 genotype was heterozygous for a functional allele Se(357) and a weakly functional allele Se(357), 385 (T/T homozygous at position 357 and A/T heterozygous at 385 position). It is concluded that the compound heterozygous mutation--a novel A682G missense mutation and a 547-552 del AG is the molecular mechanism of this para-Bombay phenotype.

  19. Molecular basis of Bombay phenotype in Mashhad, Iran: identification of a novel FUT1 deletion.

    PubMed

    Zanjani, D S; Afzal Aghaee, M; Badiei, Z; Mehrasa, R; Roodsarabi, A; Khayyami, M E; Shahabi, M

    2016-07-01

    Bombay phenotype is characterized by the lack of H substance both on red blood cell (RBC) surface and in body secretions. Mutations of fucosyltransferase 1 (FUT1) and fucosyltransferase 2 (FUT2) genes are resulted in this rare phenotype. Five unrelated patients were tested by hemagglutination and adsorption/elution techniques for the presence of ABH antigens. The saliva specimens were analysed by hemagglutination inhibition method. The exons 6 and 7 of ABO gene were sequenced to determine ABO genotype. The coding fragments of FUT1 and FUT2 were amplified and sequenced by specific primers. Serologic investigation confirmed Bombay phenotype in all individuals. FUT1 molecular analysis revealed a novel large deletion. Also two novel homozygous mutations were detected; one was a missense mutation (392T>C, L131P) and the other a three nucleotide deletion (668_670delACT, Y224del). FUT2 sequencing showed one reported null allele (428G>A, W143X) and one homozygous deletion of FUT2. Although FUT2 deletion has been reported, this is the first report of FUT1 deletion. Finding two FUT1 novel alleles in Iranian people is indicative of mutation diversity in this gene. © 2016 International Society of Blood Transfusion.

  20. Significance of serological monitoring in a Bombay Rh (D) negative phenotype pregnant woman: a case report.

    PubMed

    Jain, Ashish; Kumawat, Vijay; Patil, Sandeep S; Kumar, Praveen; Marwaha, Neelam; Sharma, Ratti Ram

    2012-12-01

    A 32 year old Indian female was referred to our hospital at 32 weeks of gestation because of difficulty in blood group determination and further antenatal care. The results of cell and serum grouping of her blood sample were suggestive of Bombay (O(h)) Rh (D) negative phenotype. An indirect antiglobulin test (IAT) using a pool of red cells from two Bombay Rh (D) positive blood donors gave negative result using the tube as well as the gel technique (LISS-Coombs Card, BioRad, Switzerland), thus ruling out anti-D antibody in her serum. The anti-H titer was 16 (tube technique) and with dithiothreitol (DTT) treated patient's serum the antibody screening was negative suggestive of IgM type of anti-H antibodies. Within the patient's family, only one member (younger sister) was of O(h) phenotype and also was Rh (D) negative. The baby was born vaginally at 38+6 weeks of gestation and was non-hydropic with a packed cell volume (PCV) of 55%. The baby's blood group was AB Rh (D) negative and the cord blood direct antiglobulin test (DAT) was negative. Thus, a careful serological testing of O(h) phenotype antenatal women especially with Rh (D) negative phenotype is of utmost importance in determining the isoimmunization status. Copyright © 2012 Elsevier Ltd. All rights reserved.

  1. Urolithiasis in northeast Bombay: seasonal prevalence and chemical composition of stones.

    PubMed

    Hussain, F; Billimoria, F R; Singh, P P

    1990-01-01

    The seasonal prevalence of urinary calculus disease from the records of L.T. Municipal General Hospital, Sion, Bombay, which primarily caters services to poor people of Northeast Bombay, especially Dharavi slum area, is reported. The qualitative and quantitative compositions of stones collected from the patients of Dharavi slum area are also described. Interestingly, the prevalence of bladder stones (BSF) was lower than that of upper urinary tract stones (UUTSF) which suggests the possibility of involvement of environmental pollution. As regards total number of stone patients, a sharp fall in male BSF in March and increase in male UUTSF in November were evident. In females the number was maximum in April in both BSF and UUTSF. However, no recognizable pattern of seasonal variation was seen in operated stone patients indicating that metabolically active disease is unrelated to season. Prevalence of bladder stones in children was high and male/female ratio was about 5. All stones were of the mixed type. Infection was not a major contributor of stone growth. Calcium oxalate was the major constituent and ammonium acid urate was present in the majority of stones.

  2. Antileprosy measures in Bombay, India: an analysis of 10 years' work*

    PubMed Central

    Koticha, K. K.; Nair, P. R. R.

    1976-01-01

    Leprosy control measures adopted in Bombay consist of health education, case-detection, and treatment, and are carried out mainly by the Acworth Leprosy Hospital and its subsidiary, the Greater Bombay Leprosy Control Scheme. Although the data collected on different aspects of leprosy during the 10-year period 1963-72 are hospital-based and retrospective, their analysis provides a useful indicator of the possible situation in the field. Health education is provided by medical social workers, field staff, and physicians, and the significance of this activity in relation to early detection of leprosy is analysed. It is shown, however, that case-holding is a more urgent priority than case-detection. Trials have confirmed the effectiveness of chemoprophylaxis with dapsone for contacts of infectious index cases in crowded households. Comparison of annual expenditure per outpatient in leprosy clinics with that for inpatients in a leprosy hospital demonstrates greater cost-effectiveness of outpatient treatment. Some practical recommendations are made for leprosy control. PMID:827341

  3. Molecular genetic analysis of para-Bombay phenotypes in Chinese: a novel non-functional FUT1 allele is identified.

    PubMed

    Yip, S P; Chee, K Y; Chan, P Y; Chow, E Y D; Wong, H F

    2002-10-01

    The para-Bombay phenotype (also known as H-deficient secretor) is characterized by a lack of ABH antigens on red cells, but ABH substances are found in saliva. Molecular genetic analysis was performed for five Chinese individuals serologically typed as para-Bombay. ABO genotyping and mutational analysis of both FUT1 (or H) and FUT2 (or Se) loci were performed for these individuals using the polymerase chain reaction, single-strand conformation polymorphism analysis and direct DNA sequencing. The ABO genotypes of these para-Bombay individuals correlated with the types of ABH substances found in the saliva. Their FUT1 genotypes were h1h2 (three individuals), h2h2 (one individual) and h2h6 (one individual). Alleles h1 (547-552delAG) and h2 (880-882delTT) were known frameshift mutations, while h6 (522C > A) was a missense mutation (Phe174Leu) not previously reported. These three mutations were rare sequence variations, each with an allele frequency of less than 0.005. Phe174 might be functionally important because this residue is conserved from mouse to human. Their FUT2 genotypes were Se357se357,385 for the h2h6 individual and Se357Se357) for the others. Both FUT2 alleles were known: one functional (Se357) and one weakly functional (se357,385). That they carried at least one copy of a functional FUT2 allele was consistent with their secretor status. As FUT1 and FUT2 are adjacent on 19q13.3, there are three possible haplotypes in these para-Bombay individuals: h1-Se357; h2-Se357; and h6-se357,385. A novel non-functional FUT1 allele (522C > A, or Phe174Leu) was identified in a para-Bombay individual and on a se357,385 haplotype background.

  4. The imperative of strategic alignment across organizations: the experience of the Canadian Cancer Society's Centre for Behavioural Research and Program Evaluation.

    PubMed

    Cameron, Roy; Riley, Barbara L; Campbell, H Sharon; Manske, Stephen; Lamers-Bellio, Kim

    2009-01-01

    The Canadian Cancer Society's Centre for Behavioural Research and Program Evaluation (CBRPE) is a national asset for building pan-Canadian capacity to support intervention studies that guide population-level policies and programs. This paper briefly describes CBRPE's experience in advancing this work in the field of prevention. The aim is to illuminate issues of central importance for advancing the goals of the Population Health Intervention Research Initiative for Canada. According to our experience, success in building the population intervention field will depend heavily on purposeful alignment across organizations to enable integration of research, evaluation, surveillance, policy and practice. CBRPE's capacity development roles include a) a catalytic role in shaping this aligned inter-organizational milieu and b) investing our resources in building tangible assets (teams, indicators, data systems) that contribute relevant capacities within this emerging milieu. Challenges in building capacity in this field are described.

  5. Public and patient involvement in needs assessment and social innovation: a people-centred approach to care and research for congenital disorders of glycosylation.

    PubMed

    de Freitas, Cláudia; Dos Reis, Vanessa; Silva, Susana; Videira, Paula A; Morava, Eva; Jaeken, Jaak

    2017-09-26

    Public and patient involvement in the design of people-centred care and research is vital for communities whose needs are underserved, as are people with rare diseases. Innovations devised collectively by patients, caregivers, professionals and other members of the public can foster transformative change toward more responsive services and research. However, attempts to involve lay and professional stakeholders in devising community-framed strategies to address the unmet needs of rare diseases are lacking. In this study, we engaged with the community of Congenital Disorders of Glycosylation (CDG) to assess its needs and elicit social innovations to promote people-centred care and research. Drawing on a qualitative study, we conducted three think tanks in France with a total of 48 participants, including patients/family members (n = 18), health care professionals (n = 7), researchers (n = 7) and people combining several of these roles (n = 16). Participants came from 20 countries across five continents. They were selected from the registry of the Second World Conference on CDG through heterogeneity and simple random sampling. Inductive and deductive approaches were employed to conduct interpretational analysis using open, axial and selective coding, and the constant-comparison method to facilitate the emergence of categories and core themes. The CDG community has unmet needs for information, quality health care, psychosocial support and representation in decision-making concerned with care and research. According to participants, these needs can be addressed through a range of social innovations, including peer-support communities, web-based information resources and a CDG expertise platform. This is one of the few studies to engage lay and professional experts in needs assessment and innovation for CDG at a global level. Implementing the innovations proposed by the CDG community is likely to have ethical, legal and social implications associated with the

  6. A Preliminary Analysis of Solar Irradiance Measurements at TNB Solar Research Centre for Optimal Orientation of Fixed Solar Panels installed in Selangor Malaysia

    NASA Astrophysics Data System (ADS)

    Hashim, A. M.; Ali, M. A. M.; Ahmad, B.; Shafie, R. M.; Rusli, R.; Aziz, M. A.; Hassan, J.; Wanik, M. Z. C.

    2013-06-01

    The well established rule for orienting fixed solar devices is to face south for places in the northern hemisphere and northwards for the southern hemisphere. However for regions near the equator such as in Selangor Malaysia, the position of the sun at solar noon is always near zenith both to the north and south depending on location and month of year. This paper reports an analysis of global solar radiation data taken at TNB Solar Research Centre, Malaysia. The solar radiation is measured using both shaded and exposed pyranometers together with a pyrheliometer which is mounted on a sun-tracker. The analysis on the solar measurements show that a near regular solar irradiation pattern had occurred often enough during the year to recommend an optimum azimuth orientation of installing the fixed solar panels tilted facing towards east. Even though all the solar measurements were done at a single location in TNBR Solar Research Centre at Bangi, for locations near the equator with similar weather pattern, the recommended azimuth direction of installing fixed solar panels and collectors tilted eastward will also be generally valid.

  7. "We Are like Dictionaries, Miss, You Can Look Things up in Us": Evaluating Child-Centred Research Methods

    ERIC Educational Resources Information Center

    Elton-Chalcraft, Sally

    2011-01-01

    Research concerning children is often presented with only a brief comment on the research methods adopted. This paper takes a "behind the scenes" view and I discuss my adoption of a non-hierarchical "least adult role" adapted from Mandell's work in 1991 to undertake qualitative research in the sensitive area of children's…

  8. "We Are like Dictionaries, Miss, You Can Look Things up in Us": Evaluating Child-Centred Research Methods

    ERIC Educational Resources Information Center

    Elton-Chalcraft, Sally

    2011-01-01

    Research concerning children is often presented with only a brief comment on the research methods adopted. This paper takes a "behind the scenes" view and I discuss my adoption of a non-hierarchical "least adult role" adapted from Mandell's work in 1991 to undertake qualitative research in the sensitive area of children's…

  9. [Assessing research productivity in Department of Internal Medicine, University of Zagreb, School of Medicine and University Hospital Centre Zagreb].

    PubMed

    Petrak, Jelka; Sember, Marijan; Granić, Davorka

    2012-01-01

    Bibliometric analysis may give an objective information about publishing activity, citation rate and collaboration patterns of individuals, groups and institutions. The publication productivity of the present medical staff (79 with specialist degree and 22 residents) in Department of Internal Medicine, University of Zagreb School of Medicine in University Hospital Centre Zagreb was measured by the number of papers indexed by Medline, their impact was measured by the number of times these papers had subsequently been cited in the medical literature, while the collaboration pattern was estimated by the authors' addresses listed in the papers. PubMed database was a source for verifying the bibliographic data, and the citation data were searched via Thomson Web of Scence (WoS) platform. There were a total of 1182 papers, published from 1974 to date. The number of papers per author ranged from 0 to 252. Sixty of papers were published in English, and 39% in Croatian language. The roughly equal share was published in local and foreign journals. The RCT studies and practice guidelines were among the most cited papers and were at the same time published by the highly ranked journals. The collaboration analysis confirmed the extensive involment in the international multicentric clinical trials as well as in the development of international/local practice guidelines.

  10. The contribution of research results to dramatic improvements in post-abortion care: Centre Hospitalier de Libreville, Gabon.

    PubMed

    Mayi-Tsonga, Sosthène; Assoumou, Pamphile; Olé, Boniface Sima; Ntamack, Jacques Bang; Meyé, Jean François; Souza, Maria Helena; Faúndes, Anibal

    2012-12-01

    In 2009, we published an article in RHM showing a large delay in provision of emergency obstetric care to women who died from unsafe abortion complications at the Centre Hospitalier de Libreville. The paper raised awareness among hospital and government authorities of a serious delay in timely treatment, and they supported the recommendation of the hospital's Maternal Mortality Committee to greatly reduce the delay and also improve the care of women with abortion complications. Training in manual vacuum aspiration (MVA) for uterine evacuation was introduced, for use by midwives as well as obstetrician-gynaecologists, with local anaesthesia. The mean delay in providing care to women with abortion complications in the 2008 findings was compared to data from the five months from 1 November 2011 through 31 March 2012. In 2008, all incomplete abortions were treated by physicians with dilatation & evacuation (D&C) or electric vacuum aspiration (EVA) with general anaesthesia. In 2011-12, two-thirds of women were treated with manual vacuum aspiration with local anaesthesia instead, one half of them by midwives. The mean delay between presentation and treatment was 18.0 hours in 2008 and 1.8 hours in 2011-12. The mean delay did not differ between women treated with MVA or D&C/EVA, nor if treated by midwives or physicians. Copyright © 2012 Reproductive Health Matters. Published by Elsevier Ltd. All rights reserved.

  11. Experiences and Lessons Learnt with Collaborative e-Research Infrastructure and the application of Identity Management and Access Control for the Centre for Environmental Data Analysis

    NASA Astrophysics Data System (ADS)

    Kershaw, P.

    2016-12-01

    CEDA, the Centre for Environmental Data Analysis, hosts a range of services on behalf of NERC (Natural Environment Research Council) for the UK environmental sciences community and its work with international partners. It is host to four data centres covering atmospheric science, earth observation, climate and space data domain areas. It holds this data on behalf of a number of different providers each with their own data policies which has thus required the development of a comprehensive system to manage access. With the advent of CMIP5, CEDA committed to be one of a number of centres to host the climate model outputs and make them available through the Earth System Grid Federation, a globally distributed software infrastructure developed for this purpose. From the outset, a means for restricting access to datasets was required, necessitating the development a federated system for authentication and authorisation so that access to data could be managed across multiple providers around the world. From 2012, CEDA has seen a further evolution with the development of JASMIN, a multi-petabyte data analysis facility. Hosted alongside the CEDA archive, it provides a range of services for users including a batch compute cluster, group workspaces and a community cloud. This has required significant changes and enhancements to the access control system. In common with many other examples in the research community, the experiences of the above underline the difficulties of developing collaborative e-Research infrastructures. Drawing from these there are some recurring themes: Clear requirements need to be established at the outset recognising that implementing strict access policies can incur additional development and administrative overhead. An appropriate balance is needed between ease of access desired by end users and metrics and monitoring required by resource providers. The major technical challenge is not with security technologies themselves but their effective

  12. Pioneering Better Science through the 3Rs: An Introduction to the National Centre for the Replacement, Refinement, and Reduction of Animals in Research (NC3Rs)

    PubMed Central

    Burden, Natalie; Chapman, Kathryn; Sewell, Fiona; Robinson, Vicky

    2015-01-01

    The National Centre for the Replacement, Refinement, and Reduction of Animals in Research (NC3Rs) is an independent scientific organization that is based in the United Kingdom, which was set up by the government to lead the discovery and application of new technologies and approaches that minimize the use of animals in research and improve animal welfare. The NC3Rs uses a range of strategies to improve and advance science through application of the 3Rs. These include funding basic research, open innovation (CRACK IT), and programs run by inhouse scientists. We present several case studies from the NC3Rs portfolio, featuring asthma research, the use of nonhuman primates in monoclonal antibody development, and CRACK IT. Finally, we anticipate the future, as we use our experience to move into new research fields and expand toward international collaboration. Here we highlight how equipping scientists with relevant and emerging 3Rs tools can help overcome the challenges and limitations of the use of animals in research to the benefit of the whole bioscience community. PMID:25836967

  13. Pioneering better science through the 3Rs: an introduction to the national centre for the replacement, refinement, and reduction of animals in research (NC3Rs).

    PubMed

    Burden, Natalie; Chapman, Kathryn; Sewell, Fiona; Robinson, Vicky

    2015-03-01

    The National Centre for the Replacement, Refinement, and Reduction of Animals in Research (NC3Rs) is an independent scientific organization that is based in the United Kingdom, which was set up by the government to lead the discovery and application of new technologies and approaches that minimize the use of animals in research and improve animal welfare. The NC3Rs uses a range of strategies to improve and advance science through application of the 3Rs. These include funding basic research, open innovation (CRACK IT), and programs run by inhouse scientists. We present several case studies from the NC3Rs portfolio, featuring asthma research, the use of nonhuman primates in monoclonal antibody development, and CRACK IT. Finally, we anticipate the future, as we use our experience to move into new research fields and expand toward international collaboration. Here we highlight how equipping scientists with relevant and emerging 3Rs tools can help overcome the challenges and limitations of the use of animals in research to the benefit of the whole bioscience community.

  14. Lichenoid reaction associated with silver amalgam restoration in a Bombay blood group patient: A case report.

    PubMed

    Pawar, Rohini Rangarao; Mattigatti, Sudha S; Mahaparale, Rushikesh R; Kamble, Amit P

    2016-01-01

    The pathogenic relationship between the oral lichenoid reaction (OLR) and dental restorative materials has been confirmed many times. An OLR affecting oral mucosa in direct contact with an amalgam restoration represents a delayed, type IV, cell mediated immune response to mercury or one of the other constituents of the dental amalgam. Bombay blood group patients are more prone to this. A case of bilateral OLR is presented, which is present in relation to amalgam restoration. The lesion healed up after the replacement of restorations with an intermediate restorative material. The clinician should be aware of all the possible pathological etiologies of white lesions. If there is any doubt about the nature or management of a usual oral lesion, a referral to an appropriate specialist is mandatory.

  15. They have not heard of AIDS: HIV/AIDS awareness among married women in Bombay.

    PubMed

    Chatterjee, N

    1999-05-01

    Many married women in India have still not heard of AIDS despite increasing risks, intensive health education campaigns and widespread scientific and media attention. Cross-sectional survey data collected from 350 married women in Bombay, India, revealed that one out of three women had not heard of AIDS. The women who had not heard of AIDS had significantly fewer years of formal education, lower personal and family incomes, less exposure to the mass media and were more likely not to know of condoms in comparison to the women who had heard of AIDS. The results suggest that there are socio-economic barriers to health information. Specific interventions targeted to this group using specific channels of communication are urgently needed.

  16. Rambam-Hasharon syndrome of psychomotor retardation, short stature, defective neutrophil motility, and Bombay phenotype.

    PubMed

    Frydman, M; Etzioni, A; Eidlitz-Markus, T; Avidor, I; Varsano, I; Shechter, Y; Orlin, J B; Gershoni-Baruch, R

    1992-10-01

    We describe 2 Arab patients, both offspring of unrelated consanguineous matings, with unusual facial appearance, severe mental retardation, microcephaly, cortical atrophy, seizures, hypotonia, dwarfism, and recurrent infections with neutrophilia. Neutrophil motility was markedly decreased but the opsonophagocytic activity was normal. Both patients lack the red blood cell (RBC) H antigen and manifest the Bombay (hh) phenotype. Familial endocardial fibroelastosis and familial tetralogy of Fallot segregated independently in one family. The occurrence of the same syndrome in 2 unrelated families suggests that the various aspects of the disorder are the pleiotropic effects of a single mutation. Homozygosity-by-descent for a deletion involving contiguous genes may explain the findings in this syndrome. Alternatively, a mutation which involves an ubiquitous GDP fucose donor rather than the enzyme (alpha 2-L-fucosyltransferase) or its substrate (glcNAc) may account for the pleiotropic manifestations in this syndrome.

  17. Process modelling and simulation of underground coal gasification: A Review of work done at IIT Bombay

    NASA Astrophysics Data System (ADS)

    Sharma, Surabhi; Mahajani, Sanjay M.

    2017-07-01

    This paper presents the summary of the work performed over the last decade, at IIT Bombay by the UCG group. The overall objective is to determine the feasibility of a given coal for underground coal gasification and then determine the capacity of a single pair of well through modelling and simulation. It would help one to design a UCG facility for the desired rate of gas production. The simulator developed in this study seeks inputs on four important aspects: Kinetics of all the reactions under the conditions of interest, heat and mass transfer limitations, if any, the flow patterns inside the cavity and lastly the thermo-mechanical failure of the coal. Each of them requires detailed studies in laboratory. Indian Lignite from one of the reserves was chosen as a case study.

  18. Barriers and facilitators to recruitment of physicians and practices for primary care health services research at one centre

    PubMed Central

    2010-01-01

    Background While some research has been conducted examining recruitment methods to engage physicians and practices in primary care research, further research is needed on recruitment methodology as it remains a recurrent challenge and plays a crucial role in primary care research. This paper reviews recruitment strategies, common challenges, and innovative practices from five recent primary care health services research studies in Ontario, Canada. Methods We used mixed qualitative and quantitative methods to gather data from investigators and/or project staff from five research teams. Team members were interviewed and asked to fill out a brief survey on recruitment methods, results, and challenges encountered during a recent or ongoing project involving primary care practices or physicians. Data analysis included qualitative analysis of interview notes and descriptive statistics generated for each study. Results Recruitment rates varied markedly across the projects despite similar initial strategies. Common challenges and creative solutions were reported by many of the research teams, including building a sampling frame, developing front-office rapport, adapting recruitment strategies, promoting buy-in and interest in the research question, and training a staff recruiter. Conclusions Investigators must continue to find effective ways of reaching and involving diverse and representative samples of primary care providers and practices by building personal connections with, and buy-in from, potential participants. Flexible recruitment strategies and an understanding of the needs and interests of potential participants may also facilitate recruitment. PMID:21144048

  19. Addiction research centres and the nurturing of creativity: IFT Institut für Therapieforschung in Munich, Germany.

    PubMed

    Bühringer, Gerhard

    2014-08-01

    This paper describes the history and current structure of the Institut für Therapieforschung (IFT) [Institute for Therapy Research] in Munich, as well as major research topics and factors which might contribute to a creative structure and atmosphere for innovative research in the addiction field. The institute was founded in 1973 as a non-profit non-governmental organization (NGO) with a focus on applied research. Starting with behaviour therapy-based development and evaluation of programmes for alcohol, illicit drugs and smoking and the evaluation of treatment services, the institute gradually expanded its topics, covering prevention (1985) and epidemiology and policy evaluation (1990), and participated throughout this period in the development of guidelines and screening, diagnostic and clinical instruments. Later, the IFT tried to bridge the gap between basic sciences, applied research, health-care services and health policy, with a network of national and international contacts, including its own university engagements and collaborations with foreign research groups and national and European Union (EU) agencies. Possible creativity-promoting factors on the institutional and individual levels are discussed, e.g. the collaboration of experienced senior researchers with carefully selected innovative doctoral students, considerable in-house and external training of young researchers and the early participation and presentation of their work at international conferences, independence from stakeholders in the field and the refusal of project funds which require external clearance of publications. © 2014 Society for the Study of Addiction.

  20. Developing a WWW Resource Centre for Acquiring and Accessing Open Learning Materials on Research Methods (ReMOTE).

    ERIC Educational Resources Information Center

    Newton, Robert; Marcella, Rita; Middleton, Iain; McConnell, Michael

    This paper reports on ReMOTE (Research Methods Online Teaching Environment), a Robert Gordon University (Scotland) project focusing on the development of a World Wide Web (WWW) site devoted to the teaching of research methods. The aim of ReMOTE is to provide an infrastructure that allows direct links to specialist sources in order to enable the…

  1. A novel FUT1 allele was identified in a Chinese individual with para-Bombay phenotype.

    PubMed

    Xu, X; Tao, S; Ying, Y; Hong, X; He, Y; Zhu, F; Lv, H; Yan, L

    2011-12-01

    The para-Bombay phenotype is characterised by H-deficient or H partially deficient red blood cells (RBCs) in individuals who secrete ABH antigens in their saliva. Samples from an individual whose RBCs had an apparent para-Bombay phenotype and his family members were investigated and a novel FUT1 allele was identified. RBCs' phenotype was characterised by standard serologic technique. Genomic DNA was sequenced with primers that amplified the coding sequence of FUT1 and FUT2, respectively. Routine ABO genotyping analysis was performed. Haplotypes of FUT1 were identified by TOPO cloning sequencing. Recombination expression vectors of FUT1 mutation alleles were constructed and transfected into COS-7 cells. The pα-(1,2)-fucosyltransferase activity of expression protein was determined. B101/O02 genotype of the proband was correlated with ABH substances in saliva. The proband carried a new FUT1 allele which showed 35C/T, 235G/C and 682A/G heterozygote by directly DNA sequencing. Two haplotypes, 235C and 35T+682G, were identified by TOPO cloning sequencing and COS-7 cells transfected with five recombination vectors including wild-type, 35T, 235C, 682G and 35T+682G alleles were established respectively. The α-(1,2)-fucosyltransferase activities of cell lysates which had transfected with 35T, 235C, 682G and 35T+682G recombination vectors showed 79·45, 16·23, 80·32 and 24·59%, respectively, compared with that of the wild-type FUT1-transfected cell lysates. A novel FUT1 allele 235C was identified, which greatly diminished the activity of α-(1,2)-fucosyltransferase. © 2011 The Authors. Transfusion Medicine © 2011 British Blood Transfusion Society.

  2. The research agenda for general practice/family medicine and primary health care in Europe. Part 3. Results: person centred care, comprehensive and holistic approach.

    PubMed

    Van Royen, Paul; Beyer, Martin; Chevallier, Patrick; Eilat-Tsanani, Sophia; Lionis, Christos; Peremans, Lieve; Petek, Davorina; Rurik, Imre; Soler, Jean Karl; Stoffers, Henri E J H; Topsever, Pinar; Ungan, Mehmet; Hummers-Pradier, Eva

    2010-06-01

    The recently published 'Research Agenda for General Practice/Family Medicine and Primary Health Care in Europe' summarizes the evidence relating to the core competencies and characteristics of the Wonca Europe definition of GP/FM, and its implications for general practitioners/family doctors, researchers and policy makers. The European Journal of General Practice publishes a series of articles based on this document. In a first article, background, objectives, and methodology were discussed. In a second article, the results for the two core competencies 'primary care management' and 'community orientation' were presented. This article reflects on the three core competencies, which deal with person related aspects of GP/FM, i.e. 'person centred care', 'comprehensive approach' and 'holistic approach'. Though there is an important body of opinion papers and (non-systematic) reviews, all person related aspects remain poorly defined and researched. Validated instruments to measure these competencies are lacking. Concerning patient-centredness, most research examined patient and doctor preferences and experiences. Studies on comprehensiveness mostly focus on prevention/care of specific diseases. For all domains, there has been limited research conducted on its implications or outcomes.

  3. [Two base deletion of the alpha (1,2) fucosyltransferase gene responsible for para-Bombay phenotype].

    PubMed

    Zhu, Fa-ming; Xu, Xian-guo; Hong, Xiao-zhen; Yan, Li-xing

    2004-06-01

    To probe into the molecular genetics basis for para-Bombay phenotype. Red blood cell phenotype of the proband was characterized by serological techniques. Exons 6 and 7 of ABO gene, the entire coding region of alpha(1,2) fucosyltransferase (FUT1) gene and FUT2 gene were amplified by polymerase chain reaction (PCR) from genomic DNA of the proband respectively. The PCR products were excised and purified from agarose gels and were directly sequenced. AG at 547-552 deletion homozygous allele was found in the proband, which caused a reading frame shift and a premature stop codon. Parents of proband were heterozygous carriers. Two base deletion at position 547-552 of alpha (1,2) fucosyltransferase gene may cause para-Bombay phenotype.

  4. A case of nearly mistaken AB para-Bombay blood group donor transplanted to a group 'O' recipient.

    PubMed

    Townamchai, Natavudh; Watanaboonyongcharoen, Phandee; Chancharoenthana, Wiwat; Avihingsanon, Yingyos

    2014-10-31

    Unintentional ABO mismatch kidney transplantation can cause detrimental hyperacute rejection. We report the first successful ABO incompatible kidney transplantation from an AB para-Bombay donor to O recipient. At the initial evaluation, the donor's ABO type was discordance on the cell typing and serum typing, which typed to be 'O' as cell typing and 'AB' as serum typing. At the second investigation, it was confirmed that the donor had a unique, rare but not uncommon blood type AB para-Bombay which was incompatible with the recipient's blood group. The kidney transplantation was successfully performed by an ABO incompatible preconditioning, double filtration plasmapheresis (DFPP) and rituximab. The serum creatinine at 12 months post-transplantation was 1.3 mg/dL. The pathology of the kidney biopsy showed no signs of rejection.

  5. Two missense mutations of H type alpha(1,2)fucosyltransferase gene (FUT1) responsible for para-Bombay phenotype.

    PubMed

    Wang, B; Koda, Y; Soejima, M; Kimura, H

    1997-01-01

    Rare individuals (Bombay and para-Bombay phenotypes) fail to express the A, B and H antigens on erythrocyte membranes because of a lack in the H gene (FUT1)-encoded alpha(1,2)fucosyltransferase activity. In this study, we have found a para-Bombay individual (Bmh) who expressed B and H antigens in saliva but not on red blood cells. The FUT1 alleles of this person contained two single base changes (T460C and G1042A) in the coding region relative to the wild type allele. These substitutions may result in changes in two amino acid residues (Y154H and E348K). Since the T460C and G1042A mutations destroy endonuclease RsaI and AvaI sites, respectively, we tested for these mutations using PCR-RFLP. Our findings indicated that this para-Bombay person was homozygous for the T460C and G1042A mutations, and that neither of these mutations was found in 136 randomly selected Japanese individuals. The measurement of the alpha(1,2)fucosyltransferase activity after transient expression of the FUT1 alleles in COS-7 cells indicated that the H-deficient allele-encoded enzyme had no detectable activity. Moreover, transfection by chimera FUT1 allele contains only the T460C mutation, or only the G1042A mutation, and yielded 1.0 or 9.3%, respectively, of the activities compared to transfection by the wild type allele. These results suggest that the two mutations in combination are responsible for the inactivation of the FUT1-encoded enzyme activity.

  6. Identification of a rare blood group, “Bombay (Oh) phenotype,” in Bhuyan tribe of Northwestern Orissa, India

    PubMed Central

    Balgir, R. S.

    2007-01-01

    BACKGROUND: Blood group serology plays a vital role in transfusion medicine. The Bombay (Oh) phenotype is characterized by the absence of A, B, and H antigens on red cells and occurs rarely, especially in tribal populations of India. AIMS AND OBJECTIVES: This is a field-based random population study in the Bhuyan tribal community. The study reports three cases of the rare Bombay (Oh) phenotype for the first time in the Bhuyan tribe of Sundargarh district in North-Western Orissa. MATERIALS AND METHODS: Taking informed consent, red blood cells of 836 Bhuyan subjects were tested with three antisera, i.e., anti-A, anti-B, and anti-H (lectin) for forward reaction. Agglutinations of plasma with A, B, and O (H) red cells (reverse reaction) were also tested for the presence or absence of antibodies in the serum. Specialized tests like absorption-elution, titration of naturally occurring antibodies at different temperatures, inhibition of anti-H by O saliva secretor, and determination of secretor status were performed. RESULTS: Three cases of a rare blood group, Bombay (Oh) phenotype, (2 out of 244 Khandayat Bhuyan and 1 out of 379 Paudi Bhuyan from Hemgiri and Lahunipara blocks, respectively) in the Bhuyan tribe of Sundargarh district in North-Western Orissa were detected, giving an incidence of 1 in 122 in Khandayat Bhuyan and 1 in 379 in Paudi Bhuyan, with an average of 1 in 278 among the Bhuyan tribal population. This incidence is high in comparison to earlier studies reported from India. CONCLUSIONS: The practice of tribal and territorial endogamy in a smaller effective populations (for example, there are only 3,521 individuals in Paudi Bhuyan) results in smaller marital distance and inbreeding, leading to increased homozygous expression of rare recessive genetic characters like the Bombay (Oh) phenotype. This study further testifies that the incidence is higher in those states of India where the consanguinity is a common practice. PMID:21957358

  7. Ectoparasite fauna of rodents collected from two wildlife research centres in Saudi Arabia with discussion on the implications for disease transmission.

    PubMed

    Harrison, A; Robb, G N; Alagaili, A N; Hastriter, M W; Apanaskevich, D A; Ueckermann, E A; Bennett, N C

    2015-07-01

    The majority of human pathogens are zoonotic and rodents play an important role as reservoirs of many of these infectious agents. In the case of vector-borne pathogens, rodent reservoirs not only act as a source of infection for vectors but also serve as hosts for the vectors themselves, supporting their populations. Current data on rodent-ectoparasite relationships is limited in Saudi Arabia, however, this is needed to assess disease risk and the relative importance of different hosts for the maintenance of vector-borne pathogen cycles. In order to provide baseline data for the region that could be used to assess zoonotic disease risk, we collected and identified 771 ectoparasite specimens (ticks, fleas and mites) from 161 rodents at two wildlife research centres in Saudi Arabia and discuss our results in the context of possible zoonotic disease risk based on the hosts and vectors present.

  8. Epidemiology of hemoglobinopathies and thalassemias in individuals referred to the haematology research centre, Shiraz University of Medical Sciences, Shiraz, Iran from 2006 to 2011.

    PubMed

    Haghpanah, Sezaneh; Ramzi, Mani; Zakerinia, Maryam; Nourani Khojasteh, Habib; Haghshenas, Mansour; Rezaei, Narges; Moayed, Vida; Rezaei, Alireza; Karimi, Mehran

    2014-01-01

    Hemoglobinopathies and thalassemias are the most frequent genetic hereditary disorders with an increasing global health burden, especially in low- and middle-income countries. We aimed to determine the epidemiologic pattern of hemoglobinopathies and thalassemias in individuals referred to the Haematology Research Centre, Shiraz University of Medical Sciences, Shiraz, Iran, which is the most important referral center in Southern Iran during 2006 to 2011. The most frequent abnormality was β-thalassemia (β-thal) minor (24.0%), followed by α-thalassemia (α-thal) trait (10.0%), hemoglobin (Hb) S trait (4.0%) and Hb D-Punjab trait (4.0%). Because this center is a referral center, we detected a higher prevalence compared to the normal population; however, these data could help policymakers and health service providers to better programming for prevention of births affected with Hb disorders.

  9. [Analysis of alpha-1,2-fucosyltransferase gene mutations in a Chinese family with para-Bombay phenotype].

    PubMed

    Xu, Xian-guo; Hong, Xiao-zhen; Liu, Ying; Ying, Yan-ling; Tao, Su-dan; He, Yan-min; Zhu, Fa-ming; Lv, Hang-jun; Yan, Li-xing

    2010-06-01

    To investigate the molecular genetic basis of para-Bombay phenotype in a Chinese family. ABO and H phenotypes of the proband and his pedigree were characterized by serological techniques. The exons 6 and 7 of the ABO gene and full coding region of alpha-1,2-fucosyltransferase (FUT1) gene of the pedigree were analyzed by polymerase chain reaction and direct sequencing of the amplified fragments. The haplotypes of compound heterozygote of the FUT1 gene were also analyzed by cloning sequencing. Three para-Bombay phenotypes were identified in nine family members by serological technology. Three heterozygous variants (35C/T, 235G/C and 682A/G) were found in FUT1 gene of the proband, and the hapotype of FUT1 gene was h(235C)/h(35T+628G)according to the cloning sequencing. The alleles h(235C)and h(35T+628G) caused G79R, A12V and M228V amino acid substitutions in alpha-1,2-fucosyltransferase, respectively. A novel 235G>C mutation of FUT1 gene which was associated with para-Bombay phenotype was found in the Chinese pedigree.

  10. An Alu-mediated large deletion of the FUT2 gene in individuals with the ABO-Bombay phenotype.

    PubMed

    Koda, Y; Soejima, M; Johnson, P H; Smart, E; Kimura, H

    2000-01-01

    Recently, we have found an allelic deletion of the secretor alpha(1,2)fucosyltransferase (FUT2) gene in individuals with the classical Bombay phenotype of the ABO system. The FUT2 gene consists of two exons separated by an intron that spans approximately 7 kb. The first exon is noncoding, whereas exon 2 contains the complete coding sequence. Since the 5' breakpoint of the deletion has previously been mapped to the single intron of FUT2, we have cloned the junction region of the deletion in a Bombay individual by cassette-mediated polymerase chain reaction. In addition, the region from the 3' untranslated region of FUT2 to the 3' breakpoint sequence has been amplified from a control individual. DNA sequence analysis of this region indicates that the 5' breakpoint is within a free left Alu monomer (FLAM-C) sequence that lies 1.3 kb downstream of exon 1, and that the 3' breakpoint is within a complete Alu element (AluSx) that is positioned 1.5 kb downstream of exon 2. The size of the deletion is estimated to be about 10 kb. There is a 25-bp sequence identity between the reference DNA sequences surrounding the 5' and 3' breakpoints. This demonstrates that an Alu-mediated large gene deletion generated by unequal crossover is responsible for secretor alpha(1,2)fucosyltransferase deficiency in Indian Bombay individuals.

  11. Bombay phenotype is associated with reduced plasma-VWF levels and an increased susceptibility to ADAMTS13 proteolysis.

    PubMed

    O'Donnell, James S; McKinnon, Thomas A J; Crawley, James T B; Lane, David A; Laffan, Michael A

    2005-09-15

    ABO blood group is an important determinant of plasma von Willebrand factor antigen (VWF:Ag) levels, with lower levels in group O. Previous reports have suggested that ABO(H) sugars affect the susceptibility of VWF to ADAMTS13 (a disintegrin and metalloproteinase with thrombospondin type-1 repeats-13) cleavage. To further test this hypothesis, we collected plasma from individuals with the rare Bombay blood group. VWF:Ag levels were significantly lower in Bombay patients (median, 0.69 IU/mL) than in groups AB, A, or B (P < .05) and lower than in group O individuals (median, 0.82 IU/mL). Susceptibility of purified VWF fractions to recombinant ADAMTS13 cleavage, assessed using VWF collagen-binding assay (VWF:CB), was increased in Bombays compared with either group O or AB. Increasing urea concentration (0.5 to 2 M) increased the cleavage rate for each blood group but eliminated the differences between groups. We conclude that reduction in the number of terminal sugars on N-linked glycan increases susceptibility of globular VWF to ADAMTS13 proteolysis and is associated with reduced plasma VWF:Ag and VWF:CB levels.

  12. Point mutations and deletion responsible for the Bombay H null and the Reunion H weak blood groups.

    PubMed

    Fernandez-Mateos, P; Cailleau, A; Henry, S; Costache, M; Elmgren, A; Svensson, L; Larson, G; Samuelsson, B E; Oriol, R; Mollicone, R

    1998-01-01

    Definition of the molecular basis of the Reunion and the Bombay red cell and salivary H-deficient phenotypes. Sequence and expression of FUT1 and FUT2 genes from H-deficient individuals. Family segregation analysis of the mutations responsible for the fucosyltransferase defects of H, secretor and Lewis systems. The Indian red cell H null Bombay phenotype depends on a new mutation of the FUT1 gene. T725-->G changing Leu242-->Arg. Their salivary nonsecretor phenotype is secondary to a complete deletion of the FUT2 gene. The red cell H weak Reunion phenotype depends on another new mutation of FUT1, C349-->T which induces a change of His117-->Tyr. Their salivary nonsecretor phenotype is due to the known Caucasian inactivating mutation G428-->A. Single prevalent FUT1 and FUT2 point mutations and a deletion are responsible for the Indian Bombay H null and the Reunion H weak phenotypes found on Reunion island. This is in contrast with other H-deficient phenotypes where sporadic nonprevalent inactivating mutations are the rule.

  13. Pieces of the Puzzle: Tracking the Chemical Component of the Exposome (Helmholtz Centre for Environmental Research UFZ)

    EPA Science Inventory

    This presentation provides an overview of the risk assessment conducted at the U.S. EPA, as well as some research examples related to the exposome concept. This presentation also provides the recommendation of using two organizational and predictive frameworks for tracking chemi...

  14. Institute for the Study of Sparsely Populated Areas. A Centre for Interdisciplinary Research into Sparsely Populated and Peripheral Regions.

    ERIC Educational Resources Information Center

    Sadler, Peter G.

    The Institute for the Study of Sparsely Populated Areas is a multidisciplinary research unit which acts to coordinate, further, and initiate studies of the economic and social conditions of sparsely populated areas. Short summaries of the eight studies completed in the session of 1977-78 indicate work in such areas as the study of political life…

  15. Institute for the Study of Sparsely Populated Areas. A Centre for Interdisciplinary Research into Sparsely Populated and Peripheral Regions.

    ERIC Educational Resources Information Center

    Sadler, Peter G.

    The Institute for the Study of Sparsely Populated Areas is a multidisciplinary research unit which acts to coordinate, further, and initiate studies of the economic and social conditions of sparsely populated areas. Short summaries of the eight studies completed in the session of 1977-78 indicate work in such areas as the study of political life…

  16. Pieces of the Puzzle: Tracking the Chemical Component of the Exposome (Helmholtz Centre for Environmental Research UFZ)

    EPA Science Inventory

    This presentation provides an overview of the risk assessment conducted at the U.S. EPA, as well as some research examples related to the exposome concept. This presentation also provides the recommendation of using two organizational and predictive frameworks for tracking chemi...

  17. On the Right and Left of the Centre: ABET and ECE Postgraduate Educational Research in South Africa, 1995-2004

    ERIC Educational Resources Information Center

    Rule, P.

    2011-01-01

    Adult Basic Education and Training (ABET) and Early Childhood Education (ECE) are the stepchildren of the South African education system in terms of resource allocation and public attention, and yet vitally inform the enterprise of lifelong learning and the prospects for developing a learning nation. The paucity of research on ECE and ABET, and…

  18. On the Right and Left of the Centre: ABET and ECE Postgraduate Educational Research in South Africa, 1995-2004

    ERIC Educational Resources Information Center

    Rule, P.

    2011-01-01

    Adult Basic Education and Training (ABET) and Early Childhood Education (ECE) are the stepchildren of the South African education system in terms of resource allocation and public attention, and yet vitally inform the enterprise of lifelong learning and the prospects for developing a learning nation. The paucity of research on ECE and ABET, and…

  19. The Terry Fox Research Institute’s Atlantic Dialogue on patient-centred care in a personalized treatment world

    PubMed Central

    Curwin, K.; Johnston, M.; Sutcliffe, S.

    2010-01-01

    The words “personalized medicine” are used daily now in cancer care and research conversations. But what do those words really mean to us as patients, caregivers, physicians, managers of the health system, or researchers? Do we know how personalized medicine will affect us over the next decade? Are we prepared? Those and other questions are part of a continuing conversation that the Terry Fox Research Institute is having with the Canadian public in 2010 as part of its public research and outreach project, The Pan-Canadian Dialogue Series on Cancer: Let’s Get Personal. The first dialogue was held in St. John’s, Newfoundland and Labrador, April 12, to coincide with the 30th anniversary of the Terry Fox Marathon of Hope. It featured speakers and panellists from Newfoundland and Labrador, Nova Scotia, New Brunswick, and Prince Edward Island. Three core issues framed the Atlantic discussion: cancer and population health, cancer and the health system, and the science behind cancer care.

  20. Research and development in haematology. A report on international congresses and visit to academic centres in Europe.

    PubMed

    Wood, L

    1990-01-01

    Haematology is one of the most rapidly expanding disciplines in medicine and nursing. As occurs in other highly specialised areas, optimum care is now largely of a multidisciplinary nature. In this context there are literally unlimited opportunities for the involvement of professional nurses and, as I have attempted to illustrate in this report, integration in all aspects of research and development and active participation in presentation of research data and discussion at international meetings is one direction in which fulfillment of academic aspirations can be achieved. It is my viewpoint, based on more than a decade of direct involvement in all the activities of our department in Cape Town that these are entirely attainable goals. There is currently, in our country, a concerted move afoot to develop an improved career structure for the professional nurse along the lines of the American clinical nurse specialist. Much of this experience overseas would strongly support that commitment. It was my privilege to enjoy the confidence of the department, university and medical school sufficient for me to present research data at international meetings and to be a welcome visitor at some of the world's premier academic and research institutions. That this was possible reflects the uncompromising commitment in Haematology to the position of the professional nurse as an integral and equal part of the multidisciplinary health care team.

  1. Informing Policy and Practice in Australia's Vocational Education and Training Sector: Reflections and Futures. Proceedings of the 25th Anniversary Forum of the National Centre for Vocational Education Research (Adelaide, South Australia, Australia, March 21, 2007)

    ERIC Educational Resources Information Center

    Curtin, Penelope, Ed.; Loveder, Phil, Ed.

    2007-01-01

    To mark the occasion of its 25th anniversary, the National Centre for Vocational Education Research (NCVER) brought together policy, industry and academic leaders to reflect on the role that research and statistics have played in the development of Australia's vocational education and training (VET) sector. This publication includes the original…

  2. The Astronomical Observatory of the Autonomous Region of the Aosta Valley. A professional research centre in the Italian Alps

    NASA Astrophysics Data System (ADS)

    Calcidese, P.; Bernagozzi, A.; Bertolini, E.; Carbognani, A.; Damasso, M.; Pellissier, P.; Recaldini, P.; Soldi, M.; Toso, G.

    The Astronomical Observatory of the Autonomous Region of the Aosta Valley (OAVdA), in the Alps at the border with France and Switzerland, is located in the Saint-Barthélemy Valley at 1675 m a.s.l. and 16 km from the town of Nus (AO). Managed by the Fondazione Clément Fillietroz-ONLUS with funding from local administrations, the OAVdA opened in 2003. For the first years its initiatives were focused on public outreach & education. Since 2006 the main activity has been scientific research thanks to an official agreement of cooperation established with the italian National Institute for Astrophysics (INAF). The OAVdA researchers, with Research Grants from the European Social Fund (EU-ESF), have been authors and/or coauthors of several papers on international journals. Here we present in detail the scientific projects developed at the OAVdA and describe some public outreach & education initiatives proposed at the OAVdA and the Planetarium of Lignan, also managed by the Fondazione Clément Fillietroz-ONLUS since 2009.

  3. Bangalore looks to new interdisciplinary science centre

    NASA Astrophysics Data System (ADS)

    Ramachandran, Ramaseshan

    2008-09-01

    A new centre to boost interdisciplinary research in India is being established in Bangalore - India's IT and software capital. The International Centre for Theoretical Sciences (ICTS) will be led by Spenta Wadia, a theoretical physicist from the Tata Institute of Fundamental Research (TIFR) in Mumbai, which is setting up the new centre. He expects construction of the ICTS, the first of its kind in India, to start by November 2009.

  4. Extraction and Analysis of Mega Cities’ Impervious Surface on Pixel-based and Object-oriented Support Vector Machine Classification Technology: A case of Bombay

    NASA Astrophysics Data System (ADS)

    Yu, S. S.; Sun, Z. C.; Sun, L.; Wu, M. F.

    2017-02-01

    The object of this paper is to study the impervious surface extraction method using remote sensing imagery and monitor the spatiotemporal changing patterns of mega cities. Megacity Bombay was selected as the interesting area. Firstly, the pixel-based and object-oriented support vector machine (SVM) classification methods were used to acquire the land use/land cover (LULC) products of Bombay in 2010. Consequently, the overall accuracy (OA) and overall Kappa (OK) of the pixel-based method were 94.97% and 0.96 with a running time of 78 minutes, the OA and OK of the object-oriented method were 93.72% and 0.94 with a running time of only 17s. Additionally, OA and OK of the object-oriented method after a post-classification were improved up to 95.8% and 0.94. Then, the dynamic impervious surfaces of Bombay in the period 1973-2015 were extracted and the urbanization pattern of Bombay was analysed. Results told that both the two SVM classification methods could accomplish the impervious surface extraction, but the object-oriented method should be a better choice. Urbanization of Bombay experienced a fast extending during the past 42 years, implying a dramatically urban sprawl of mega cities in the developing countries along the One Belt and One Road (OBOR).

  5. Addiction research centres and the nurturing of creativity
department of addictive behaviour and addiction medicine, central institute of Mental Health, Mannheim, University of Heidelberg.

    PubMed

    Mann, Karl

    2010-12-01

    Addictive behaviour is as prevalent in Germany as in other western countries, but in contrast to some European countries and the United States, very little money was given to this research field. Change came in the early 1990s, when the German government started to launch specific grants for addiction research. The first chair in addiction research was created in 1999 (Karl Mann) at the Central Institute of Mental Health Mannheim (CIMH; University of Heidelberg). The recruitment of a pre-clinical alcohol researcher as head of the department of psychopharmacology followed (Rainer Spanagel). This 'addiction research cluster' collaborates with several research groups at the CIMH (such as genetics). We inaugurated a clinical trial network which now comprises up to 20 treatment centres throughout Germany. Like most authors, we found effect sizes of different treatment modalities more in the low to moderate range, perhaps because of the heterogeneity of large patient samples. Therefore, we concentrated upon the biological basis of addiction in order to define more homogeneous 'subtypes' of patients for a better match with existing treatments. Results concerning genetics and neuroimaging (both animal and human) are promising, and could move our field towards a more personalized treatment approach. Our funding has been extended over the years, including involvement in several large European grants. We are studying substance-related problems as well as so-called 'behavioural addictions'. As a natural consequence of this development, we are deeply involved both in informing the general public on addiction issues as well as in counselling policy makers in Germany. © 2010 The Author, Addiction © 2010 Society for the Study of Addiction.

  6. Ergonomics Perspective in Agricultural Research: A User-Centred Approach Using CAD and Digital Human Modeling (DHM) Technologies

    NASA Astrophysics Data System (ADS)

    Patel, Thaneswer; Sanjog, J.; Karmakar, Sougata

    2016-09-01

    Computer-aided Design (CAD) and Digital Human Modeling (DHM) (specialized CAD software for virtual human representation) technologies endow unique opportunities to incorporate human factors pro-actively in design development. Challenges of enhancing agricultural productivity through improvement of agricultural tools/machineries and better human-machine compatibility can be ensured by adoption of these modern technologies. Objectives of present work are to provide the detailed scenario of CAD and DHM applications in agricultural sector; and finding out means for wide adoption of these technologies for design and development of cost-effective, user-friendly, efficient and safe agricultural tools/equipment and operator's workplace. Extensive literature review has been conducted for systematic segregation and representation of available information towards drawing inferences. Although applications of various CAD software have momentum in agricultural research particularly for design and manufacturing of agricultural equipment/machinery, use of DHM is still at its infancy in this sector. Current review discusses about reasons of less adoption of these technologies in agricultural sector and steps to be taken for their wide adoption. It also suggests possible future research directions to come up with better ergonomic design strategies for improvement of agricultural equipment/machines and workstations through application of CAD and DHM.

  7. Geoinformation postgraduate education at Universiti Teknologi Malaysia - towards a centre of high quality postgraduate education and research

    NASA Astrophysics Data System (ADS)

    Peters, S.; Kanniah, K. D.; Rahman, A. A.

    2015-10-01

    Studying at Universiti Teknologi Malaysia (UTM) will ensure academic and technological excellence. The Faculty of Geoinformation and Real Estate (FGHT), established in 1972, focus on education and research for undergraduate as well as postgraduate programs in the related disciplines such as geomatic engineering, geoinformatics, remote sensing, property management and land administration & development. FGHT strives to be a leading academic center in geoinformation and real estate in Southeast Asia. Graduates and alumni form major strong professional societies and work force in the related industries. Many of our graduates end up with good jobs not just in Malaysia but also in other countries (Asian, Middle East, Africa and Europe). The strong team and knowledgeable academic members in this faculty provide excellent ingredients for the success of the programs (i.e. with the relevant and up-to-date curriculum and syllabus). FGHT is continuously working to provide and offer first-class geoinformation and real estate education and research in the country and be at a par with other leading institutions in other parts of the globe. The Department of Geoinformation at FGHT runs a Bachelor of Engineering in Geomatic and a Bachelor of Science in Geoinformatics. At the postgraduate levels, namely M.Sc. and PhD programs, the offered disciplines are Geomatic Engineering, Geoinformatics and Remote Sensing. In the following, the state of the art of FGHT's postgraduate education in Geoinformation is presented, including a comparison with other universities in Malaysia, program content and curriculum information, alumni statistics as well as future strategies.

  8. Getting our house in order: an audit of the registration and publication of clinical trials supported by the National Institute for Health Research Oxford Biomedical Research Centre and the Musculoskeletal Biomedical Research Unit

    PubMed Central

    Tompson, A C; Petit-Zeman, S; Goldacre, B; Heneghan, C J

    2016-01-01

    Objectives To audit the proportion of clinical trials that had been publically registered and, of the completed trials, the proportion published. Setting 2 major research institutions supported by the National Institute of Health Research (NIHR). Primary and secondary outcome measures The proportion of trials reporting results within 12 months, 24 months and ‘ever’. Factors associated with non-publication were analysed using logistic regression. Inclusion criteria Phases 2–4 clinical trials identified from internal documents and publication lists. Results In total, 286 trials were identified. We could not find registration for 4 (1.4%) of these, all of which were completed and published. Of the trials with a registered completion date pre-January 2015, just over half (56%) were published, and half of these were published within 12 months (36/147, 25%). For some trials, information on the public registers was found to be out-of-date and/or inaccurate. No clinical trial characteristics were found to be significantly associated with non-publication. We have produced resources to facilitate similar audits elsewhere. Conclusions It was feasible to conduct an internal audit of registration and publication in 2 major research institutions. Performance was similar to, or better than, comparable cohorts of trials sampled from registries. The major resource input required was manually seeking information: if all registry entries were maintained, then almost the entire process of audit could be automated—and routinely updated—for all research centres and funders. PMID:26936902

  9. Getting our house in order: an audit of the registration and publication of clinical trials supported by the National Institute for Health Research Oxford Biomedical Research Centre and the Musculoskeletal Biomedical Research Unit.

    PubMed

    Tompson, A C; Petit-Zeman, S; Goldacre, B; Heneghan, C J

    2016-03-02

    To audit the proportion of clinical trials that had been publically registered and, of the completed trials, the proportion published. 2 major research institutions supported by the National Institute of Health Research (NIHR). The proportion of trials reporting results within 12 months, 24 months and 'ever'. Factors associated with non-publication were analysed using logistic regression. Phases 2-4 clinical trials identified from internal documents and publication lists. In total, 286 trials were identified. We could not find registration for 4 (1.4%) of these, all of which were completed and published. Of the trials with a registered completion date pre-January 2015, just over half (56%) were published, and half of these were published within 12 months (36/147, 25%). For some trials, information on the public registers was found to be out-of-date and/or inaccurate. No clinical trial characteristics were found to be significantly associated with non-publication. We have produced resources to facilitate similar audits elsewhere. It was feasible to conduct an internal audit of registration and publication in 2 major research institutions. Performance was similar to, or better than, comparable cohorts of trials sampled from registries. The major resource input required was manually seeking information: if all registry entries were maintained, then almost the entire process of audit could be automated--and routinely updated--for all research centres and funders. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/

  10. Mentoring perception, scientific collaboration and research performance: is there a 'gender gap' in academic medicine? An Academic Health Science Centre perspective.

    PubMed

    Athanasiou, Thanos; Patel, Vanash; Garas, George; Ashrafian, Hutan; Hull, Louise; Sevdalis, Nick; Harding, Sian; Darzi, Ara; Paroutis, Sotirios

    2016-10-01

    The 'gender gap' in academic medicine remains significant and predominantly favours males. This study investigates gender disparities in research performance in an Academic Health Science Centre, while considering factors such as mentoring and scientific collaboration. Professorial registry-based electronic survey (n=215) using bibliometric data, a mentoring perception survey and social network analysis. Survey outcomes were aggregated with measures of research performance (publications, citations and h-index) and measures of scientific collaboration (authorship position, centrality and social capital). Univariate and multivariate regression models were constructed to evaluate inter-relationships and identify gender differences. One hundred and four professors responded (48% response rate). Males had a significantly higher number of previous publications than females (mean 131.07 (111.13) vs 79.60 (66.52), p=0.049). The distribution of mentoring survey scores between males and females was similar for the quality and frequency of shared core, mentor-specific and mentee-specific skills. In multivariate analysis including gender as a variable, the quality of managing the relationship, frequency of providing corrective feedback and frequency of building trust had a statistically significant positive influence on number of publications (all p<0.05). This is the first study in healthcare research to investigate the relationship between mentoring perception, scientific collaboration and research performance in the context of gender. It presents a series of initiatives that proved effective in marginalising the gender gap. These include the Athena Scientific Women's Academic Network charter, new recruitment and advertisement strategies, setting up a 'Research and Family Life' forum, establishing mentoring circles for women and projecting female role models. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence

  11. Developing a User-Centred Planning Tool for Young Adults with Development Disorders: A Research-Based Teaching Project.

    PubMed

    Ribu, Kirsten; Patel, Tulpesh

    2016-01-01

    People with development disorders, for instance autism, need structured plans to help create predictability in their daily lives. Digital plans can facilitate enhanced independency, learning, and quality of life, but existing apps are largely general purpose and lack the flexibility required by this specific but heterogeneous user group. Universal design is both a goal and a process and should be based on a holistic approach and user-centered design, interacting with the users in all stages of the development process. At Oslo and Akershus University College (HiOA) we conducted a research-based teaching project in co-operation with the Department of Neuro-habilitation at Oslo University Hospital (OUS) with two employees acting as project managers and students as developers. Three groups of Computer Science bachelor students developed digital prototypes for a planning tool for young adults with pervasive development disorders, who live either with their families or in supervised residences, and do not receive extensive public services. The students conducted the initial planning phase of the software development process, focusing on prototyping the system requirements, whilst a professional software company programmed the end solution. The goal of the project was to develop flexible and adaptive user-oriented and user-specific app solutions for tablets that can aid this diverse user group in structuring daily life, whereby, for example, photos of objects and places known to the individual user replace general pictures or drawings, and checklists can be elaborate or sparse as necessary. The three student groups worked independently of each other and created interactive working prototypes based on tests, observations and short interviews with end users (both administrators and residents) and regular user feedback from the project managers. Three very different solutions were developed that were of high enough quality that an external software company were able to

  12. MEMS sensor technologies for human centred applications in healthcare, physical activities, safety and environmental sensing: a review on research activities in Italy.

    PubMed

    Ciuti, Gastone; Ricotti, Leonardo; Menciassi, Arianna; Dario, Paolo

    2015-03-17

    Over the past few decades the increased level of public awareness concerning healthcare, physical activities, safety and environmental sensing has created an emerging need for smart sensor technologies and monitoring devices able to sense, classify, and provide feedbacks to users' health status and physical activities, as well as to evaluate environmental and safety conditions in a pervasive, accurate and reliable fashion. Monitoring and precisely quantifying users' physical activity with inertial measurement unit-based devices, for instance, has also proven to be important in health management of patients affected by chronic diseases, e.g., Parkinson's disease, many of which are becoming highly prevalent in Italy and in the Western world. This review paper will focus on MEMS sensor technologies developed in Italy in the last three years describing research achievements for healthcare and physical activity, safety and environmental sensing, in addition to smart systems integration. Innovative and smart integrated solutions for sensing devices, pursued and implemented in Italian research centres, will be highlighted, together with specific applications of such technologies. Finally, the paper will depict the future perspective of sensor technologies and corresponding exploitation opportunities, again with a specific focus on Italy.

  13. MEMS Sensor Technologies for Human Centred Applications in Healthcare, Physical Activities, Safety and Environmental Sensing: A Review on Research Activities in Italy

    PubMed Central

    Ciuti, Gastone; Ricotti, Leonardo; Menciassi, Arianna; Dario, Paolo

    2015-01-01

    Over the past few decades the increased level of public awareness concerning healthcare, physical activities, safety and environmental sensing has created an emerging need for smart sensor technologies and monitoring devices able to sense, classify, and provide feedbacks to users’ health status and physical activities, as well as to evaluate environmental and safety conditions in a pervasive, accurate and reliable fashion. Monitoring and precisely quantifying users’ physical activity with inertial measurement unit-based devices, for instance, has also proven to be important in health management of patients affected by chronic diseases, e.g., Parkinson’s disease, many of which are becoming highly prevalent in Italy and in the Western world. This review paper will focus on MEMS sensor technologies developed in Italy in the last three years describing research achievements for healthcare and physical activity, safety and environmental sensing, in addition to smart systems integration. Innovative and smart integrated solutions for sensing devices, pursued and implemented in Italian research centres, will be highlighted, together with specific applications of such technologies. Finally, the paper will depict the future perspective of sensor technologies and corresponding exploitation opportunities, again with a specific focus on Italy. PMID:25808763

  14. [Serological and molecular analysis of a case with para-Bombay phenotype caused by a h(328)(nt328G to A) mutation].

    PubMed

    Geng, Wei; Gao, Huanhuan; Liu, Peiyan; Feng, Zhihui

    2017-06-10

    To explore the serological characteristics and molecular basis for an individual with para-Bombay phenotype. Blood type of the proband was determined with routine serological methods. Exons 6 and 7 of the ABO gene and coding regions of the FUT1 and FUT2 genes were amplified by PCR and sequenced. The para-Bombay phenotype was confirmed to be of Ah-secretion type. The genotype of the individual was determined as A102/O01. Position 328 of the FUT1 gene was mutated from A to G, resulting in replacement of Alanine (Ala) at position 110 by Threonine (Thr). The G to A mutation of nt328 of the FUT1 gene probably underlies the para-Bombay phenotype in this individual.

  15. First radon measurements and occupational exposure assessments in underground geodynamic laboratory the Polish Academy of Sciences Space Research Centre in Książ Castle (SW Poland).

    PubMed

    Fijałkowska-Lichwa, Lidia; Przylibski, Tadeusz A

    2016-12-01

    The article presents the results of the first radon activity concentration measurements conducted continuously between 17(th) May 2014 and 16(th) May 2015 in the underground geodynamic laboratory of the Polish Academy of Sciences Space Research Centre in Książ. The data were registered with the use of three Polish semiconductor SRDN-3 detectors located the closest (SRDN-3 No. 6) to and the furthest (SRDN-3 No. 3) from the facility entrance, and in the fault zone (SRDN-3 No. 4). The study was conducted to characterize the radon behaviour and check it possibility to use with reference to long- and short-term variations of radon activity concentration observed in sedimentary rocks strongly fractured and intersected by systems of multiple faults, for integrated comparative assessments of changes in local orogen kinetics. The values of radon activity concentration in the underground geodynamic laboratory of the Polish Academy of Sciences (PAN) Space Research Centre in Książ undergo changes of a distinctly seasonal character. The highest values of radon activity concentration are recorded from late spring (May/June) to early autumn (October), and the lowest - from November to April. Radon activity concentrations varied depending on the location of measurement points. Between late spring and autumn they ranged from 800 Bq·m(-3) to 1200 Bq·m(-3), and even 3200 Bq·m(-3) in the fault zone. Between November and April, values of radon activity concentration are lower, ranging from 500 Bq·m(-3) to 1000 Bq·m(-3) and 2700 Bq·m(-3) in the fault zone. The values of radon activity concentration recorded in the studied facility did not undergo short-term changes in either the whole annual measuring cycle or any of its months. Effective doses received by people staying in the underground laboratory range from 0.001 mSv/h to 0.012 mSv/h. The mean annual effective dose, depending on the measurement site, equals 1 or is slightly higher than 10 mSv/year, while the maximum

  16. Science Learning Centres Roundup

    ERIC Educational Resources Information Center

    Education in Science, 2010

    2010-01-01

    The national network of Science Learning Centres aims to raise the quality of science teaching from Key Stage 1 through post-16 (ages 5-19). Short courses are provided locally through the regional Science Learning Centres and longer, more intensive programmes are available at the National Science Learning Centre in York. There are a growing number…

  17. PMD2HD--a web tool aligning a PubMed search results page with the local German Cancer Research Centre library collection.

    PubMed

    Bohne-Lang, Andreas; Lang, Elke; Taube, Anke

    2005-06-27

    Web-based searching is the accepted contemporary mode of retrieving relevant literature, and retrieving as many full text articles as possible is a typical prerequisite for research success. In most cases only a proportion of references will be directly accessible as digital reprints through displayed links. A large number of references, however, have to be verified in library catalogues and, depending on their availability, are accessible as print holdings or by interlibrary loan request. The problem of verifying local print holdings from an initial retrieval set of citations can be solved using Z39.50, an ANSI protocol for interactively querying library information systems. Numerous systems include Z39.50 interfaces and therefore can process Z39.50 interactive requests. However, the programmed query interaction command structure is non-intuitive and inaccessible to the average biomedical researcher. For the typical user, it is necessary to implement the protocol within a tool that hides and handles Z39.50 syntax, presenting a comfortable user interface. PMD2HD is a web tool implementing Z39.50 to provide an appropriately functional and usable interface to integrate into the typical workflow that follows an initial PubMed literature search, providing users with an immediate asset to assist in the most tedious step in literature retrieval, checking for subscription holdings against a local online catalogue. PMD2HD can facilitate literature access considerably with respect to the time and cost of manual comparisons of search results with local catalogue holdings. The example presented in this article is related to the library system and collections of the German Cancer Research Centre. However, the PMD2HD software architecture and use of common Z39.50 protocol commands allow for transfer to a broad range of scientific libraries using Z39.50-compatible library information systems.

  18. Documentation Research and Training Centre Annual Seminar 9. Part 1: Papers: Abstracting, Indexing, and Reviewing Periodicals. Pattern of Use of Documents by Specialists. Comparative Study of Schemes for Library Classification.

    ERIC Educational Resources Information Center

    Documentation Research and Training Centre, Bangalore (India).

    Presented are the proceedings of the annual seminar (1971) of the Documentation Research and Training Centre (DRTC), Indian Statistical Institute. The text of 26 reports appears under the following major section headings: (1) Abstracting, indexing and reviewing periodicals; (2) Pattern of use of documents by specialists; (3) Comparative Study of…

  19. [The research on medicine in Greco-Roman Egypt in the Centre de Documentation de Papyrologie Littéraire (CEDOPAL) of the University of Liège].

    PubMed

    Marganne, Marie-Hélène

    2015-01-01

    The paper presents the research on medicine in Greco-Roman Egypt conducted in the last forty years at the Centre de Documentation de Papyrologie Littéraire (CEDOPAL) at the University of Liège. It describes the main results obtained by deciphering, editing, translating and commenting Greek and Latin medical papyri, be they literary, documentary or magical.

  20. Improvement of cooking quality and gel formation capacity of Bombay duck (Harpodon nehereus) fish meat.

    PubMed

    Rupsankar, Chakrabarti

    2010-10-01

    High moisture content (89%) along with high enzymatic and bacteriological activity in Bombay duck (Harpodon nehereus) meat are responsible for short shelf life and disintegration of meat in cooking. Minimum solubility was at pH 5 (iso-electric point) of muscle protein. Citric acid- sodium citrate buffer (pH 5) with 0.2% potassium sorbate was very effective in reducing moisture in dressed fish and in increasing shelf life up to 4 days at ambient temperature (25-28 °C). Reduction in moisture in meat improved its cooking quality and gel formation capacity with increased protein content. Fish meat contained 1.0-1.5% NaCl and produced stronger gel by using 2% NaCl than conventionally prepared gel with 4% NaCl. Washing fish mince with cold water followed by pressing at pH 5, gave fish cake with more salt soluble protein and better gel strength (>500 gcm) than the same operation done at ambient temperature.

  1. Source and distribution of metals in urban soil of Bombay, India, using multivariate statistical techniques

    NASA Astrophysics Data System (ADS)

    Ratha, D. S.; Sahu, B. K.

    1993-11-01

    Simplification of a complex system of geochemical variables obtained from the soils of an industrialized area of Bombay is attempted by means of R-mode factor analysis. Prior to factor analysis, discriminant analysis was carried out taking rock and soil chemical data to establish the anthropogenic contribution of metals in soil. Trace elements (Cd, Co, Cr, Cu, Fe, Mn, Ni, Pb, and Zn) are expressed in terms of three rotated factors. The factors mostly indicate anthropogenic sources of metals such as atmospheric fallout, emission from different industrial chimneys, crushing operations in quarries, and sewage sludges. Major elements (Na, Mg, Al, Si, P, K, Ca, Ti, Mn, and Fe) are also expressed in terms of three rotated factors indicating natural processes such as chemical weathering, presence of clay minerals, and contribution from sewage sludges and municipal refuse. Summary statistics (mean, standard deviation, skewness, and kurtosis) for the particle size distribution were interpreted as moderate dominance of fine particles. Mineralogical studies revealed the presence of montmorillonite, kaolinite, and illite types of clay minerals. Thus the present study provides information about the metal content entering into the soil and their level, sources, and distribution in the area.

  2. Teacher Education Researches in Developing Countries: A Review of Indian Studies

    ERIC Educational Resources Information Center

    Pandey, Saroj

    2004-01-01

    Teacher education research in India is predominantly a post-independence phenomenon, which gained momentum between 1950 and 1960. By the end of the 1960s, 85 doctoral themes had been approved by various Indian universities, out of which 40% of the researches were undertaken by Bombay University, the first university to institute a doctoral…

  3. Generation of human induced pluripotent stem cells from a Bombay individual: Moving towards 'universal-donor' red blood cells

    SciTech Connect

    Seifinejad, Ali; Taei, Adeleh; Totonchi, Mehdi; Vazirinasab, Hamed; Hassani, Seideh Nafiseh; Aghdami, Nasser; Shahbazi, Ebrahim; Yazdi, Reza Salman; Salekdeh, Ghasem Hosseini; Baharvand, Hossein

    2010-01-01

    Bombay phenotype is one of the rare phenotypes in the ABO blood group system that fails to express ABH antigens on red blood cells. Nonsense or missense mutations in fucosyltransfrase1 (FUT1) and fucosyltransfrase2 (FUT2) genes are known to create this phenotype. This blood group is compatible with all other blood groups as a donor, as it does not express the H antigen on the red blood cells. In this study, we describe the establishment of human induced pluripotent stem cells (iPSCs) from the dermal fibroblasts of a Bombay blood-type individual by the ectopic expression of established transcription factors Klf4, Oct4, Sox2, and c-Myc. Sequence analyses of fibroblasts and iPSCs revealed a nonsense mutation 826C to T (276 Gln to Ter) in the FUT1 gene and a missense mutation 739G to A (247 Gly to Ser) in the FUT2 gene in the Bombay phenotype under study. The established iPSCs resemble human embryonic stem cells in morphology, passaging, surface and pluripotency markers, normal karyotype, gene expression, DNA methylation of critical pluripotency genes, and in-vitro differentiation. The directed differentiation of the iPSCs into hematopoietic lineage cells displayed increased expression of the hematopoietic lineage markers such as CD34, CD133, RUNX1, KDR, {alpha}-globulin, and {gamma}-globulin. Such specific stem cells provide an unprecedented opportunity to produce a universal blood group donor, in-vitro, thus enabling cellular replacement therapies, once the safety issue is resolved.

  4. Heterogeneity of the human H blood group alpha(1,2)fucosyltransferase gene among para-Bombay individuals.

    PubMed

    Yu, L C; Yang, Y H; Broadberry, R E; Chen, Y H; Lin, M

    1997-01-01

    The para-Bombay phenotype has a relatively high frequency of about 1 in 8,000 Taiwanese. Studies were carried out on eight healthy and unrelated Taiwanese with the para-Bombay phenotype to cast light on its immunogenetic basis. Blood and saliva samples were tested with standard hemagglutination techniques. Salivary ABH substances were determined by hemagglutination inhibition. PCR techniques were used to amplify the coding region of the H genes. Five different h alleles, designated as h1, h2, h3, h4 and h5, were identified in the Taiwanese with the para-Bombay phenotype. The h1 allele loses one of the three AG repeats located at the nucleotides 547-552 of the H gene, whereas two of the three T repeats located at the nucleotides 880-882 are deleted in the h2 allele. The h3 allele contains a C658 to T missense mutation, whereas two missense mutations, C35 to T and A980 to C were identified in the h4 allele. A T460 to C missense is present in the h5 allele. The h5 allele was identified in an individual whose red blood cells contain blood group A antigen but not H antigen, and thus may be considered a weak variant of the H gene. So far no biologic relevance of the H antigen has been discovered, and its deficiency does not seem to produce any deleterious effects. There may be better understanding of the evolutionary basis for the polymorphisms at these loci after systematic study of different ethnic populations.

  5. Generation of human induced pluripotent stem cells from a Bombay individual: moving towards "universal-donor" red blood cells.

    PubMed

    Seifinejad, Ali; Taei, Adeleh; Totonchi, Mehdi; Vazirinasab, Hamed; Hassani, Seideh Nafiseh; Aghdami, Nasser; Shahbazi, Ebrahim; Yazdi, Reza Salman; Salekdeh, Ghasem Hosseini; Baharvand, Hossein

    2010-01-01

    Bombay phenotype is one of the rare phenotypes in the ABO blood group system that fails to express ABH antigens on red blood cells. Nonsense or missense mutations in fucosyltransfrase1 (FUT1) and fucosyltransfrase2 (FUT2) genes are known to create this phenotype. This blood group is compatible with all other blood groups as a donor, as it does not express the H antigen on the red blood cells. In this study, we describe the establishment of human induced pluripotent stem cells (iPSCs) from the dermal fibroblasts of a Bombay blood-type individual by the ectopic expression of established transcription factors Klf4, Oct4, Sox2, and c-Myc. Sequence analyses of fibroblasts and iPSCs revealed a nonsense mutation 826C to T (276 Gln to Ter) in the FUT1 gene and a missense mutation 739G to A (247 Gly to Ser) in the FUT2 gene in the Bombay phenotype under study. The established iPSCs resemble human embryonic stem cells in morphology, passaging, surface and pluripotency markers, normal karyotype, gene expression, DNA methylation of critical pluripotency genes, and in-vitro differentiation. The directed differentiation of the iPSCs into hematopoietic lineage cells displayed increased expression of the hematopoietic lineage markers such as CD34, CD133, RUNX1, KDR, alpha-globulin, and gamma-globulin. Such specific stem cells provide an unprecedented opportunity to produce a universal blood group donor, in-vitro, thus enabling cellular replacement therapies, once the safety issue is resolved. Copyright 2009 Elsevier Inc. All rights reserved.

  6. Molecular basis for para-Bombay phenotypes in Chinese persons, including a novel nonfunctional FUT1 allele.

    PubMed

    Yan, Lixing; Zhu, Faming; Xu, Xianguo; Hong, Xiaozhen; Lv, Qinfeng

    2005-05-01

    The para-Bombay phenotype is characterized by H-deficient or H-partially deficient red blood cells (RBCs) in persons who secrete ABH antigens in their saliva. The studies that determined the genotypes for two Chinese individuals with the para-Bombay phenotype are described. RBC phenotypes were characterized by conventional serologic methods. Exons 6 and 7 of the ABO gene were amplified, as well as the entire coding region for FUT1 and FUT2, with four independence polymerase chain reactions (PCRs) from genomic DNA. PCR products were excised, purified from agarose gels, and sequenced directly. Mutations of FUT1 were identified by TOPO cloning sequencing. For both individuals, RBC ABO genotypes correlated with ABH substances in their saliva. One individual (a patient) had two heterozygous mutations of FUT1 by direct DNA sequencing, namely, a C-->T heterozygous mutation at position 293(C293T) and AG heterozygous deletion (CAGAGAG-->CAGAG) at position 547 to 552. These two mutations were confirmed to be compound heterozygotes; that is, each mutation was determined to be on a separate homologous chromosome by TOPO cloning sequencing. The FUT2 genotype was Se(357)Se(357). The other individual (a blood donor) had an AG deletion at position 547 to 552 homozygous allele in FUT1. The FUT2 genotype was Se(357)Se(357,385). C293T mutation can cause Thr/Met at amino acid position 98. AG deletion at position 547 to 552 caused a reading frameshift and a premature stop codon. A novel nonfunctional FUT1 allele C293T was identified in a person with the para-Bombay phenotype. This rare H-deficient phenotype may result from different nonfunctional alleles.

  7. Doing challenging research studies in a patient-centred way: a qualitative study to inform a randomised controlled trial in the paediatric emergency care setting

    PubMed Central

    Woolfall, Kerry; Young, Bridget; Frith, Lucy; Appleton, Richard; Iyer, Anand; Messahel, Shrouk; Hickey, Helen; Gamble, Carrol

    2014-01-01

    Objective To inform the design of a randomised controlled trial (called EcLiPSE) to improve the treatment of children with convulsive status epilepticus (CSE). EcLiPSE requires the use of a controversial deferred consent process. Design Qualitative interview and focus group study. Setting 8 UK support groups for parents of children who have chronic or acute health conditions and experience of paediatric emergency care. Participants 17 parents, of whom 11 participated in telephone interviews (10 mothers, 1 father) and 6 in a focus group (5 mothers, 1 father). 6 parents (35%) were bereaved and 7 (41%) had children who had experienced seizures, including CSE. Results Most parents had not heard of deferred consent, yet they supported its use to enable the progress of emergency care research providing a child's safety was not compromised by the research. Parents were reassured by tailored explanation, which focused their attention on aspects of EcLiPSE that addressed their priorities and concerns. These aspects included the safety of the interventions under investigation and how both EcLiPSE interventions are used in routine clinical practice. Parents made recommendations about the appropriate timing of a recruitment discussion, the need to individualise approaches to recruiting bereaved parents and the use of clear written information. Conclusions Our study provided information to help ensure that a challenging trial was patient centred in its design. We will use our findings to help EcLiPSE practitioners to: discuss potentially threatening trial safety information with parents, use open-ended questions and prompts to identify their priorities and concerns and clarify related aspects of written trial information to assist understanding and decision-making. PMID:24833694

  8. Studies on the ABH-Iso-Agglutinins in serum, saliva and milk from mothers with "Bombay" (Oh) phenotype.

    PubMed

    Joshi, S R; Vasantha, K; Iyer, Y S; Kulkarni, S; Jadhav, S

    2009-01-01

    ABO blood group iso-antibodies are naturally occurring antibodies found in serum and other body fluids. Serum, saliva and milk samples from 5 mothers identified as "Bombay" phenotype were tested for ABH-iso-antibodies by routine serological techniques. All the five mothers showed presence of iso-antibodies in the samples tested. Higher titer values in milk than their serum were observed on subjects whose samples were collected in immediate post-partum phase as compared to those whose samples were collected after a lapse of a few months. High titer iso-agglutinins against ABH antigens were detected in milk samples besides their presence in saliva as well as serum.

  9. Report on the 13th symposium on invertebrate neurobiology held 26-30 August 2015 at the Balaton Limnological Institute, MTA Centre for ecological research of the Hungarian Academy of Sciences, Tihany, Hungary.

    PubMed

    Crisford, Anna; Holden-Dye, Lindy; Walker, Robert J

    2016-06-01

    This report summarizes the lectures and posters presented at the International Society for Invertebrate Neurobiology's 13th symposium held 26-30 August 2015, at the Balaton Limnological Institute, MTA Centre for Ecological Research, Tihany, Hungary. The symposium provided an opportunity for scientists working on a range of topics in invertebrate neurobiology to meet and present their research and discuss ways to advance the discipline.

  10. Promotion in Call Centres: Opportunities and Determinants

    ERIC Educational Resources Information Center

    Gorjup, Maria Tatiana; Valverde, Mireia; Ryan, Gerard

    2008-01-01

    Purpose: The purpose of this paper is to examine the quality of jobs in call centres by focusing on the opportunities for promotion in this sector. More specifically, the research questions focus on discovering whether promotion is common practise in the call centre sector and on identifying the factors that affect this.…

  11. Promotion in Call Centres: Opportunities and Determinants

    ERIC Educational Resources Information Center

    Gorjup, Maria Tatiana; Valverde, Mireia; Ryan, Gerard

    2008-01-01

    Purpose: The purpose of this paper is to examine the quality of jobs in call centres by focusing on the opportunities for promotion in this sector. More specifically, the research questions focus on discovering whether promotion is common practise in the call centre sector and on identifying the factors that affect this.…

  12. H-deficient Bombay and para-Bombay red blood cells are most strongly agglutinated by the galactophilic lectins of Aplysia and Pseudomonas aeruginosa that detect I and P1 antigens.

    PubMed

    Gilboa-Garber, N; Sudakevitz, D; Levene, C; Rahimi-Levene, N; Yahalom, V

    2006-01-01

    The galactophilic lectins Aplysia gonad lectin (AGL) and Pseudomonas aeruginosa lectin (PA-IL), which detect human I and P1 RBC antigens, were examined for hemagglutination of H+ (group O and B) and H-deficient (Bombay and para-Bombay phenotype) RBCs. The results were compared with those obtained using two other galactophilic lectins, Maclura pomifera lectin (MPL) and Arachis hypogaea (peanut) agglutinin (PNA), which share T-antigen affinity, and two fucose-binding H-specific lectins, Ulex europaeus (UEA-I) and Pseudomonas aeruginosa lectin (PA-IIL), as well as with those achieved with anti-I serum. The results revealed that, in contrast to UEA-I and PA-IIL, which preferentially agglutinated H+ RBCs, and to MPL and PNA, which similarly agglutinated all examined RBCs, AGL, PA-IL, and the anti-I serum agglutinated the H-deficient RBCs more strongly than did the H+ RBCs. These findings could be attributed to increased levels of I and P1 antigens on those RBCs resulting from the use of the free common H-type 2 precursor for their synthesis. Since both PA-IL and PA-IIL are regarded as potential pathogen adhesins, it would be interesting to statistically compare the sensitivities of individuals of H+ and H-deficient RBC populations to P. aeruginosa infections.

  13. Elevated Seismic Activity Beneath the Slumbering Morne aux Diables Volcano, Northern Dominica and the Monitoring Role of the Seismic Research Centre

    NASA Astrophysics Data System (ADS)

    Watts, R. B.; Robertson, R. E.; Abraham, W.; Cole, P.; de Roche, T.; Edwards, S.; Higgins, M.; Johnson, M.; Joseph, E. P.; Latchman, J.; Lynch, L.; Nath, N.; Ramsingh, C.; Stewart, R. C.

    2012-12-01

    Since June 2009, periods of elevated seismic activity have been experienced around the flanks of Morne Aux Diables Volcano in northern Dominica. This long-dormant volcano is a complex of 7 andesitic lava domes with a central depression where a cold soufrière is evident. Prior to this activity, seismicity was very quiet except for a short period in 2000 and an intense short-lived swarm in April 2003. The most recent earthquake activity has been regularly felt by residents in villages on all flanks of the complex. In Dec 09/Jan10, scientists from the Seismic Research Centre (SRC), based in Trinidad & Tobago, in collaboration with staff of the Office of Disaster Management (ODM) and Dominica Public Seismic Network (DPSN) improved the monitoring capacity around this volcano from 1 to 7 seismic stations. Earthquakes are determined to be volcano-tectonic in nature and located at shallow depths (<4 km) beneath the central depression. Additionally, in Jan/Feb 10 geothermal sampling was undertaken and 2 permanent GPS sites were deployed. Public information leaflets prepared by SRC scientists using a "Question & Answer" format have been distributed to concerned citizens whilst many public meetings were carried out by ODM staff. Field investigations indicate that the previous Late Pleistocene activity of Morne Aux Diables switched from Pelèan dome growth and gravitational collapse to more explosive pumice-falls and associated ignimbrites, both styles forming extensive pyroclastic fans around the central complex. The town of Portsmouth is located on one of these fans ~5 km southwest of the central depression. Sporadic, short bursts of seismic activity continue at the time of writing.

  14. The prospects for using (Q)SARs in a changing political environment--high expectations and a key role for the European Commission's joint research centre.

    PubMed

    Worth, A P; Van Leeuwen, C J; Hartung, T

    2004-01-01

    Recent policy developments in the European union (EU) and within the Organisation for Economic Cooperation and Development (OECD) have placed increased emphasis on the use of structure-activity relationships (SARs) and quantitative structure-activity relationships (QSARs), collectively referred to as (Q)SARs, within various regulatory programmes for the assessment of chemicals and products. The most significant example within the EU is the European commission's proposal (of 29 October 2003) to introduce a new system for managing chemicals (called REACH), which calls for an increased use of (Q)SARs and other non-animal methods, especially for the assessment of low production volume chemicals. Another development within the EU is the Seventh Amendment to the Cosmetics Directive, which foresees the phasing out of animal testing on cosmetics, combined with the imposition of marketing bans on cosmetics that have been tested on animals after certain deadlines. At the same time, the Existing Chemicals programme within the OECD is investigating ways of increasing the use of chemical category approaches, which depend heavily on the use of (Q)SARs, activity-activity relationships and read-across. Such developments are placing an enormous challenge on industry, regulatory bodies, and on the European commission's Joint Research Centre (JRC), which is responsible for providing independent scientific advice to policy makers in the European Commission and the Member States. This paper reviews the different scientific and regulatory purposes for which reliable (Q)SARs could be used, and describes the current work of the JRC in providing scientific support for the development, validation and implementation of (Q)SARs.

  15. [Study of a case with homozygous 35C>T and 658C>T mutations of FUT1 gene leading to a para-Bombay phenotype].

    PubMed

    Lin, Fengqiu; Sun, Changping; Wang, Hui; Zhang, Xu; Li, Jianping

    2015-12-01

    To explore the molecular mechanism for a case with para-Bombay phenotype caused by α-1,2-fucosyltransferase (FUT1) gene mutations. Blood phenotype of the propositus was determined by standard serological testing. Polymerase chain reaction-sequence specific primer (PCR-SSP) and direct sequencing of PCR product were used to analyze its ABO genotype. The PCR product of FUT1 gene was sequenced and analyzed. The phenotype of the propositus was initially detected as para-Bombay A type. Direct sequencing of ABO gene showed that the genotype of the proband was A101/O01 (261G/del), which was consistent with the result of PCR-SSP. Two homo-mutations, 35C>T and 658C>T, were detected in the FUT1 gene by sequencing, and the genotype was determined as h(35T+658T)/h(35T+658T). h(35T+658T)/h(35T+658T) is responsible for the para-Bombay phenotype of the propositus. The genotype is rare even in para-Bombay populations.

  16. Hypertension in the Parsi community of Bombay: a study on prevalence, awareness and compliance to treatment

    PubMed Central

    Bharucha, Nadir E; Kuruvilla, Thomas

    2003-01-01

    Background Uncontrolled hypertension (HT) is an established risk factor for the development of vascular diseases. Prevalence varies in different communities and no such study has been conducted in the Parsi community living in Bombay, India. The objectives of this study were to determine the prevalence, awareness, compliance to medication and control of HT in this community. Method We used a 1 in 4 random selection of subjects who were ≥ 20 years of age. A questionnaire was administered and the blood pressure (BP) was measured by a doctor. HT was defined as diastolic blood pressure (DBP) ≥ 90 mm Hg ± systolic pressure (SBP) ≥ 140 mm Hg. Isolated systolic hypertension (ISH) was defined as SBP ≥ 160 mm Hg with DBP < 90 mm Hg. Subsequently, we reanalysed the data using current definition of ISH as SBP ≥ 140 mm Hg with DBP < 90 mm Hg. Results 2879 subjects ≥ 20 years of age were randomly selected of which 2415 (84%) participated in the study. The overall prevalence of HT in the community was 36.4%, of whom 48.5% were unaware of their hypertensive status. Of those aware of having HT, 36.4% were non-compliant with their anti-hypertensive drugs and only 13.6% had optimally controlled HT. Prevalence of ISH using the present criteria was 19.5% and 73% of hypertensives ≥ 60 years had ISH. Conclusion This study shows that prevalence of HT in the Parsi community is high and nearly half are unaware of their hypertensive status. ISH is the dominant form of HT in the elderly. Compliance to treatment is poor and optimal BP control is achieved in only a small minority. The study highlights the need for regular screening coupled with educational programs to detect and optimally treat HT in the community. PMID:12513697

  17. Biotransformation and detoxification of inorganic arsenic in Bombay oyster Saccostrea cucullata.

    PubMed

    Zhang, Wei; Guo, Zhiqiang; Zhou, Yanyan; Liu, Huaxue; Zhang, Li

    2015-01-01

    Arsenic (As) exists as the toxic inorganic forms in marine water and sediment, while marine oysters usually accumulate high As contents mostly as the less toxic organic forms. It has not yet been clear that how As is biotransformed in marine oysters. This study therefore investigated the biotransformation and detoxification of two inorganic As forms (As(III) and As(V)) in Bombay oyster Saccostrea cucullata after waterborne exposures for 30 days. Seven treatments of dissolved As exposure (clean seawater, 1, 5, 20 mg/L As(III), and 1, 5, 20 mg/L As(V)) were performed. Body As concentration increased significantly after all As exposure treatments except 1mg/L As(V). Total As, As(III), and As(V) concentration were positive correlated with glutathione-S-transferases (GST) activities, suggesting GST might play an important role in the As biotransformation and detoxification process. Organic As species were predominant in control and the low As exposed oysters, whereas a large fraction of As was remained as the inorganic forms in the high As exposed oysters, suggesting As could be biotransformed efficiently in the oysters in clean or light contaminated environment. The results of As speciation demonstrated the As biotransformation in the oysters included As(V) reduction, methylation to monomethylarsonic acid (MMA) and dimethylarsinic acid (DMA), and subsequent conversion to arsenobetaine (AsB). More As was distributed in the subcellular metallothionein-like proteins fraction (MTLP) functioning sequestration and detoxification in the inorganic As exposed oysters, suggesting it was also a strategy for oysters against As stress. In summary, this study elucidated that marine oysters had high ability to accumulate, biotransform, and detoxify inorganic As.

  18. H-deficient blood groups of Reunion island. II. Differences between Indians (Bombay Phenotype) and whites (Reunion phenotype).

    PubMed

    Le Pendu, J; Gerard, G; Vitrac, D; Juszczak, G; Liberge, G; Rouger, P; Salmon, C; Lambert, F; Dalix, A M; Oriol, R

    1983-05-01

    Two variants of recessive, H-deficient nonsecretor individuals (h/h, se/se) were identified on Reunion Island: (1) H-negative individuals corresponding to the classical Bombay phenotypes (OhO, OhA, OhB, OhAB) who lack completely the H antigen on their red cells; all of them were Indian and had strong anti-H antibodies reacting with normal O and Oh red cells from whites; and (2) H-weak individuals (Oh, Ah, Bh, ABh). This phenotype represented the majority (85%) of the H-deficient phenotypes on Reunion Island, and all of them were white. They had only a weak expression of the H antigen and showed small but detectable amounts of ABH antigens on their red cells. Their anti-H antibodies reacted with normal O erythrocytes, but failed to react with Oh red cells, regardless of the ethnic origin of the donor. They were all from the same geographical area on the Island (Cilaos) and showed homogeneous titers of anti-H antibodies in sera. We propose to call this particular variant of weak H phenotype, belonging to the so-called para-Bombay series, Reunion.

  19. H-deficient blood groups of Reunion island. II. Differences between Indians (Bombay Phenotype) and whites (Reunion phenotype).

    PubMed Central

    Le Pendu, J; Gerard, G; Vitrac, D; Juszczak, G; Liberge, G; Rouger, P; Salmon, C; Lambert, F; Dalix, A M; Oriol, R

    1983-01-01

    Two variants of recessive, H-deficient nonsecretor individuals (h/h, se/se) were identified on Reunion Island: (1) H-negative individuals corresponding to the classical Bombay phenotypes (OhO, OhA, OhB, OhAB) who lack completely the H antigen on their red cells; all of them were Indian and had strong anti-H antibodies reacting with normal O and Oh red cells from whites; and (2) H-weak individuals (Oh, Ah, Bh, ABh). This phenotype represented the majority (85%) of the H-deficient phenotypes on Reunion Island, and all of them were white. They had only a weak expression of the H antigen and showed small but detectable amounts of ABH antigens on their red cells. Their anti-H antibodies reacted with normal O erythrocytes, but failed to react with Oh red cells, regardless of the ethnic origin of the donor. They were all from the same geographical area on the Island (Cilaos) and showed homogeneous titers of anti-H antibodies in sera. We propose to call this particular variant of weak H phenotype, belonging to the so-called para-Bombay series, Reunion. PMID:6859043

  20. Identification of a novel FUT1 allele with two mutations in a Chinese para-Bombay individual.

    PubMed

    Wang, Lixin; Huang, Chunyan; Wei, Zengzhen; Tan, Jinzhe; Qin, Li; Tian, Li

    2017-01-01

    The para-Bombay phenotype often results from a silenced β-D-galactoside 2-α-fucosyltransferase 1 (FUT1) gene (h/h) but an active FUT2 (Se/Se or Se/se) gene. We identified a para-Bombay phenotype with two novel mutations in the FUT1 gene and homozygous mutated FUT2 (se(357, 385) /se(357, 385) ) genes. Red blood cell phenotype was detected by using a standard serologic technique. The entire coding regions of the FUT1 and FUT2 genes were amplified and direct sequenced using genomic DNA. No ABH substance was detected on the surface of the proband's red blood cells. Anti-A, anti-B, and anti-H were identified in serum. Genetic studies indicated that the proband's ABO genotyping was A102/O01 and that the FUT2 phenotype was se(357, 385) /se(357,)(385) . The sample was homozygous for two FUT1 mutations: c.958insG and c.961G > A. Two novel FUT1 mutations have been identified in the proband's FUT1 gene. The insertion mutation in the FUT1 that caused a shift of the open reading frame and formed a termination codon early at Amino Acid Position 334 may be the main reason for H deficiency in this case. © 2016 AABB.

  1. Assessment of undiscovered oil and gas resources of the Assam, Bombay, Cauvery, and Krishna-Godavari Provinces, South Asia, 2011

    USGS Publications Warehouse

    Klett, T.R.; Schenk, Christopher J.; Wandrey, Craig J.; Charpentier, Ronald R.; Cook, Troy A.; Brownfield, Michael E.; Pitman, Janet K.; Pollastro, Richard M.

    2012-01-01

    Using a geology-based assessment methodology, the U.S. Geological Survey estimated volumes of undiscovered, technically recoverable, conventional petroleum resources for the Assam, Bombay, Cauvery, and Krishna–Godavari Provinces, South Asia. The estimated mean volumes are as follows: (1) Assam Province, 273 million barrels of crude oil, 1,559 billion cubic feet of natural gas, and 43 million barrels of natural gas liquids; (2) Bombay Province, 1,854 million barrels of crude oil, 15,417 billion cubic feet of natural gas, and 498 million barrels of natural gas liquids; (3) Cauvery Province, 941 million barrels of crude oil, 25,208 billion cubic feet of natural gas, and 654 million barrels of natural gas liquids; and (4) Krishna–Godavari Province, 466 million barrels of crude oil, 37,168 billion cubic feet of natural gas, and 484 million barrels of natural gas liquids. The totals for the four provinces are 3,534 million barrels of crude oil, 79,352 billion cubic feet of natural gas, and 1,679 million barrels of natural gas liquids.

  2. The summary of FUT1 and FUT2 genotyping analysis in Chinese para-Bombay individuals including additional nine probands from Guangzhou in China.

    PubMed

    Luo, Guangping; Wei, Ling; Wang, Zhen; Luo, Hong; Zhao, Yang; Zhang, Runqing; Mo, Chunyan; Ji, Yanli

    2013-12-01

    The para-Bombay phenotype is characterized by the absence or weak expression of ABH antigens on the surface of red blood cells, but normal expression in saliva. The para-Bombay phenotype of the nine Chinese probands was identified by standard serologic techniques. The coding regions of FUT1 and FUT2 genes were amplified by polymerase chain reaction and then directly sequenced. ABO genotyping was performed by polymerase chain reaction with sequence-specific priming method. The FUT1 and FUT2 genotypes and the distribution in all reported Chinese para-Bombay individuals including our study were also summarized. Five FUT1 genotypes, h1h3 (n = 3), h1h2 (n = 3), h1h1 (n = 1), h3h3 (n = 1), and h2h3 (n = 1), and three functional FUT2 genotypes, Se(357) Se(357) (n = 4), Se(357) Se(357, 716) (n = 4), and Se(357) Se(357, 385) (n = 1) described before were identified in nine probands. The review of the literature shows that a total of 17 FUT1 alleles and four FUT2 alleles (Se(357), Se(357,716), Se(357 385), Se) have been identified in Chinese para-Bombay individuals. The four FUT1 alleles, h1 (547delAG), h2 (880delTT), h3 (C658T), and h4 (C35T; A980C) are most prevalent, which account for more than 90% of all allele counts and are essential to be involved when developing para-Bombay genotyping kit for Chinese. © 2013 American Association of Blood Banks.

  3. [Molecular genetic analysis of FUT1 and FUT2 gene in para-Bombay Chinese: a novel FUT1 allele is identified].

    PubMed

    Su, Yu qing; Wei, Tian-li; Yu, Qiong; Liang, Yan-lian; Li, Da-cheng

    2007-10-01

    Molecular genetic analysis of FUT1 and FUT2 gene was performed for seven Chinese Han individuals serologically typed as para-Bombay. Seven DNA samples were studied by polymerase chain reaction and then by direct sequencing. Molecular cloning sequencing was done for an individual with a novel FUT1 allele. Family segregation analysis of the novel FUT1 allele was done to explore whether the allele was responsible for the fucosyltransferase defects of H. The FUT1 genotypes of seven para-Bombay individuals were h1h1 (four individuals), h2h2 (two individuals), h328hnew (one individual), alleles h1 lost one of the three AG repeats located at the nucleotides 547-552 of the FUT1 gene, h2 lost two of the three T repeats located at the nucleotides 880-882, h328 (nt328G>A) was a missense mutation, all of them were known mutations, while allele hnew deleted GGTATTCCGCATCACCCTGCCCGTGCTGGCCCC at nt360-400, total 33 bases, and the frame-shift mutation was not previously reported. The segregation of the hnew allele in his family showed that his father genotype was Hh328, and his mother was Hhnew, while two brother were h328hnew. The FUT2 genotypes of seven para-Bombay individuals were Se357 Se357 (three individuals), Se357 Se357,385 (three individuals), Se357,716Se357,716(one individual), the functional Se357(nt357C>T), Se716(nt716G>A) and the weakly functional Se385(nt385A>T) were known. The seven para-Bombay individuals carried at least one copy of a functional FUT2 allele was consistent with their secretor status. A novel FUT1 allele was identified in a para-Bombay Chinese individual, which was responsible for the inactivation of the FUT1-encoded enzyme activity.

  4. Evaluation of the Forest Valley Outdoor Education Centre regarding Elementary Teacher Development and Attitude Change. Section I: Summary of Results. Research Report.

    ERIC Educational Resources Information Center

    Rowan, M.

    In late February 1977, questionnaires were sent to all special education, kindergarten, third, and fifth grade teachers who visited Forest Valley Outdoor Education Centre during early October 1976, late November 1976, and early February 1977 and to their principals to obtain information concerning their perceptions of the degree to which the…

  5. STS in Engineering: The Teaching and Research Activities of the Centre for Technology and Social Development at the University of Toronto.

    ERIC Educational Resources Information Center

    Vanderburg, W. H.

    1998-01-01

    Describes the conceptual framework and three core courses of the certificate program in Preventive Engineering and Social Development at the Centre for Technology and Social Development at the University of Toronto. Preventive approaches examine how technology fits into, interacts with, and depends on human life, society, and the biosphere to…

  6. STS in Engineering: The Teaching and Research Activities of the Centre for Technology and Social Development at the University of Toronto.

    ERIC Educational Resources Information Center

    Vanderburg, W. H.

    1998-01-01

    Describes the conceptual framework and three core courses of the certificate program in Preventive Engineering and Social Development at the Centre for Technology and Social Development at the University of Toronto. Preventive approaches examine how technology fits into, interacts with, and depends on human life, society, and the biosphere to…

  7. Accuracy of two continuous glucose monitoring systems: a head-to-head comparison under clinical research centre and daily life conditions.

    PubMed

    Kropff, J; Bruttomesso, D; Doll, W; Farret, A; Galasso, S; Luijf, Y M; Mader, J K; Place, J; Boscari, F; Pieber, T R; Renard, E; DeVries, J H

    2015-04-01

    To assess the accuracy and reliability of the two most widely used continuous glucose monitoring (CGM) systems. We studied the Dexcom®G4 Platinum (DG4P; Dexcom, San Diego, CA, USA) and Medtronic Paradigm Veo Enlite system (ENL; Medtronic, Northridge, CA, USA) CGM systems, in 24 patients with type 1 diabetes. The CGM systems were tested during 6-day home use and a nested 6-h clinical research centre (CRC) visit. During the CRC visit, frequent venous blood glucose samples were used as reference while patients received a meal with an increased insulin bolus to induce an aggravated postprandial glucose nadir. At home, patients performed at least six reference capillary blood measurements per day. A Wilcoxon signed-rank test was performed using all data points ≥15 min apart. The overall mean absolute relative difference (MARD) value [standard deviation (s.d.)] measured at the CRC was 13.6 (11.0)% for the DG4P and 16.6 (13.5)% for the ENL [p < 0.0002, confidence interval of difference (CI Δ) 1.7-4.3%, n = 530]. The overall MARD assessed at home was 12.2 (12.0)% for the DG4P and 19.9 (20.5)% for the ENL (p < 0.0001, CI Δ = 5.8-8.7%, n = 839). During the CRC visit, the MARD in the hypoglycaemic range [≤3.9 mmol/l (70 mg/dl)], was 17.6 (12.2)% for the DG4P and 24.6 (18.8)% for the ENL (p = 0.005, CI Δ 3.1-10.7%, n = 117). Both sensors showed higher MARD values during hypoglycaemia than during euglycaemia [3.9-10 mmol/l (70-180 mg/dl)]: for the DG4P 17.6 versus 13.0% and for the ENL 24.6 versus 14.2%. During circumstances of intended use, including both a CRC and home phase, the ENL was noticeably less accurate than the DG4P sensor. Both sensors showed lower accuracy in the hypoglycaemic range. The DG4P was less affected by this negative effect of hypoglycaemia on sensor accuracy than was the ENL. © 2014 The Authors. Diabetes, Obesity and Metabolism published by John Wiley & Sons Ltd.

  8. Accuracy of two continuous glucose monitoring systems: a head-to-head comparison under clinical research centre and daily life conditions

    PubMed Central

    Kropff, J; Bruttomesso, D; Doll, W; Farret, A; Galasso, S; Luijf, Y M; Mader, J K; Place, J; Boscari, F; Pieber, T R; Renard, E; DeVries, J H

    2015-01-01

    Aims To assess the accuracy and reliability of the two most widely used continuous glucose monitoring (CGM) systems. Methods We studied the Dexcom®G4 Platinum (DG4P; Dexcom, San Diego, CA, USA) and Medtronic Paradigm Veo Enlite system (ENL; Medtronic, Northridge, CA, USA) CGM systems, in 24 patients with type 1 diabetes. The CGM systems were tested during 6-day home use and a nested 6-h clinical research centre (CRC) visit. During the CRC visit, frequent venous blood glucose samples were used as reference while patients received a meal with an increased insulin bolus to induce an aggravated postprandial glucose nadir. At home, patients performed at least six reference capillary blood measurements per day. A Wilcoxon signed-rank test was performed using all data points ≥15 min apart. Results The overall mean absolute relative difference (MARD) value [standard deviation (s.d.)] measured at the CRC was 13.6 (11.0)% for the DG4P and 16.6 (13.5)% for the ENL [p < 0.0002, confidence interval of difference (CI Δ) 1.7–4.3%, n = 530]. The overall MARD assessed at home was 12.2 (12.0)% for the DG4P and 19.9 (20.5)% for the ENL (p < 0.0001, CI Δ = 5.8–8.7%, n = 839). During the CRC visit, the MARD in the hypoglycaemic range [≤3.9 mmol/l (70 mg/dl)], was 17.6 (12.2)% for the DG4P and 24.6 (18.8)% for the ENL (p = 0.005, CI Δ 3.1–10.7%, n = 117). Both sensors showed higher MARD values during hypoglycaemia than during euglycaemia [3.9–10 mmol/l (70–180 mg/dl)]: for the DG4P 17.6 versus 13.0% and for the ENL 24.6 versus 14.2%. Conclusions During circumstances of intended use, including both a CRC and home phase, the ENL was noticeably less accurate than the DG4P sensor. Both sensors showed lower accuracy in the hypoglycaemic range. The DG4P was less affected by this negative effect of hypoglycaemia on sensor accuracy than was the ENL. PMID:25132320

  9. The Danish Centre for Strategic Research in Type 2 Diabetes (DD2) study: expected outcome from the DD2 project and two intervention studies

    PubMed Central

    Beck-Nielsen, Henning; Solomon, Thomas PJ; Lauridsen, Jørgen; Karstoft, Kristian; Pedersen, Bente K; Johnsen, Søren P; Nielsen, Jens Steen; Kryger, Tine Bjerregaard; Sortsø, Camilla; Vaag, Allan

    2012-01-01

    The overall aim of the Danish Centre for Strategic Research in Type 2 Diabetes (DD2) is to near-normalize metabolic control in newly diagnosed patients with type 2 diabetes (T2D) using an individualized treatment approach. We hypothesize that this will not only prevent complications and improve quality of life for T2D patients but also result in increased cost efficiency compared with current treatment modalities. This paper provides an overview of the expected outcomes from DD2, focusing on the two main intervention studies. The main data for the DD2 project are collected during patient enrollment and stored using the individual civil registration number. This enables subsequent linking to other national databases where supplemental data can be obtained. All data will be used for designing treatment guidelines and continuously monitoring the development of diabetic complications, thereby obtaining knowledge about predictors for the long-term outcome and identifying targets for new interventions. Further data are being collected from two intervention studies. The aim of the first intervention study is to improve T2D treatment using an individualized treatment modality optimizing medication according to individual metabolic responses and phenotypic characteristics. The aim of the second intervention study is to develop an evidence-based training protocol to be implemented as a treatment modality for T2D and used for initiating lifelong changes in physical activity levels in patients with T2D. An initial pilot study evaluating an interval-based walking protocol is ongoing, and preliminary results indicate that this protocol is an optimal “free-living” training intervention. An initial health-economic analysis will also be performed as a basis for analysis of the data collected during the project. A cost-benefit analysis of the two intervention studies will be conducted. The DD2 project is expected to lead to improved treatment modalities and increased knowledge

  10. The Danish Centre for Strategic Research in Type 2 Diabetes (DD2) study: Collection of baseline data from the first 580 patients

    PubMed Central

    Thomsen, Reimar Wernich; Nielsen, Jens Steen; Ulrichsen, Sinna Pilgaard; Pedersen, Lars; Hansen, Anne-Marie Sigsgaard; Nilsson, Tove

    2012-01-01

    This paper provides an overview of the baseline data collected in the nationwide Danish Centre for Strategic Research in Type 2 Diabetes (DD2) project. The paper presents descriptive data from the first 580 patients enrolled in the DD2. The DD2 database will contain detailed interview data, clinical examination data, and urine and blood samples from up to 10,000 patients newly diagnosed with type 2 diabetes each year, collected from general practitioners and hospital outpatient clinics in all of Denmark. Of the first DD2 patients enrolled, blood and urine samples have been obtained from 97%. The median age of the first 580 patients was 59 years and 322 (56%) were men. Median weight gain from age 20 to maximum lifetime weight was 29 kg for men and 31 kg for women, and 364 patients (63%) did not currently participate in regular sports activities. Two hundred and ninety two patients (50%) had a known family history of diabetes. Two hundred fifty (43%) of the 580 DD2 patients have also been enrolled in the Danish Diabetes Database for Adults from which additional clinical data can be obtained. Among these 250 patients (154 of whom were men, 96 women), 75 (49%) men were currently obese, and 63 (41%) were overweight, whereas 62 (65%) women were obese, and another 21 (22%) were overweight. Twenty-nine patients (12%) received insulin, 164 patients (66%) received oral antidiabetics only, and 57 (23%) received no antidiabetic treatment. Glycemic regulation was modest (the glycosylated hemoglobin A of 46% was ≥7.5%). Two thirds of the patients received antihypertensive and hypolipidemic treatment. Self-reported daily tobacco smoking (23%) and alcohol overuse (6%) seemed comparable to occurrence in the general Danish population. One quarter of the patients with newly diagnosed diabetes had a history of hospital-diagnosed comorbidity at baseline as included in the Charlson comorbidity index, in particular prior myocardial infarction (5%), cerebrovascular disease (5

  11. Design and internal validation of an obstetric early warning score: secondary analysis of the Intensive Care National Audit and Research Centre Case Mix Programme database.

    PubMed

    Carle, C; Alexander, P; Columb, M; Johal, J

    2013-04-01

    We designed and internally validated an aggregate weighted early warning scoring system specific to the obstetric population that has the potential for use in the ward environment. Direct obstetric admissions from the Intensive Care National Audit and Research Centre's Case Mix Programme Database were randomly allocated to model development (n = 2240) or validation (n = 2200) sets. Physiological variables collected during the first 24 h of critical care admission were analysed. Logistic regression analysis for mortality in the model development set was initially used to create a statistically based early warning score. The statistical score was then modified to create a clinically acceptable early warning score. Important features of this clinical obstetric early warning score are that the variables are weighted according to their statistical importance, a surrogate for the FI O2 /Pa O2 relationship is included, conscious level is assessed using a simplified alert/not alert variable, and the score, trigger thresholds and response are consistent with the new non-obstetric National Early Warning Score system. The statistical and clinical early warning scores were internally validated using the validation set. The area under the receiver operating characteristic curve was 0.995 (95% CI 0.992-0.998) for the statistical score and 0.957 (95% CI 0.923-0.991) for the clinical score. Pre-existing empirically designed early warning scores were also validated in the same way for comparison. The area under the receiver operating characteristic curve was 0.955 (95% CI 0.922-0.988) for Swanton et al.'s Modified Early Obstetric Warning System, 0.937 (95% CI 0.884-0.991) for the obstetric early warning score suggested in the 2003-2005 Report on Confidential Enquiries into Maternal Deaths in the UK, and 0.973 (95% CI 0.957-0.989) for the non-obstetric National Early Warning Score. This highlights that the new clinical obstetric early warning score has an excellent ability to

  12. National Centre for Radio Astrophysics

    NASA Astrophysics Data System (ADS)

    Murdin, P.

    2000-11-01

    India's National Centre for Radio Astrophysics (NCRA), located on the Pune University Campus, is part of the TATA INSTITUTE OF FUNDAMENTAL RESEARCH. At Khodad, 80 km from Pune, NCRA has set up the Giant Metrewave Radio Telescope (GMRT), the world's largest telescope operating at meter wavelengths. GMRT consists of 30 fully steerable dishes of 45 m diameter, spread over a 25 km area. Another meter...

  13. Centre of the Cell: Science Comes to Life

    PubMed Central

    Balkwill, Frances; Chambers, Katie

    2015-01-01

    Centre of the Cell is a unique biomedical science education centre, a widening participation and outreach project in London’s East End. This article describes Centre of the Cell’s first five years of operation, the evolution of the project in response to audience demand, and the impact of siting a major public engagement project within a research laboratory. PMID:26340279

  14. Centre of the Cell: Science Comes to Life.

    PubMed

    Balkwill, Frances; Chambers, Katie

    2015-01-01

    Centre of the Cell is a unique biomedical science education centre, a widening participation and outreach project in London's East End. This article describes Centre of the Cell's first five years of operation, the evolution of the project in response to audience demand, and the impact of siting a major public engagement project within a research laboratory.

  15. CMCC Data Distribution Centre

    NASA Astrophysics Data System (ADS)

    Aloisio, Giovanni; Fiore, Sandro; Negro, A.

    2010-05-01

    The CMCC Data Distribution Centre (DDC) is the primary entry point (web gateway) to the CMCC. It is a Data Grid Portal providing a ubiquitous and pervasive way to ease data publishing, climate metadata search, datasets discovery, metadata annotation, data access, data aggregation, sub-setting, etc. The grid portal security model includes the use of HTTPS protocol for secure communication with the client (based on X509v3 certificates that must be loaded into the browser) and secure cookies to establish and maintain user sessions. The CMCC DDC is now in a pre-production phase and it is currently used only by internal users (CMCC researchers and climate scientists). The most important component already available in the CMCC DDC is the Search Engine which allows users to perform, through web interfaces, distributed search and discovery activities by introducing one or more of the following search criteria: horizontal extent (which can be specified by interacting with a geographic map), vertical extent, temporal extent, keywords, topics, creation date, etc. By means of this page the user submits the first step of the query process on the metadata DB, then, she can choose one or more datasets retrieving and displaying the complete XML metadata description (from the browser). This way, the second step of the query process is carried out by accessing to a specific XML document of the metadata DB. Finally, through the web interface, the user can access to and download (partially or totally) the data stored on the storage device accessing to OPeNDAP servers and to other available grid storage interfaces. Requests concerning datasets stored in deep storage will be served asynchronously.

  16. Novel mutations, including a novel G659A missense mutation, of the FUT1 gene are responsible for the para-Bombay phenotype.

    PubMed

    Sun, C F; Lo, M D; Lee, C H; Chu, D C

    2000-10-01

    Para-Bombay phenotype, with an estimated incidence of 1 in 8000 in Taiwanese residents based on serological analysis, is caused by aberrant alpha(1,2)-fucosyltransferase function and hence diminished H-antigen synthesis. In an individual with para-Bombay phenotype, DNA sequencing revealed two missense mutations previously reported C658T mutation and a novel G659A mutation. Haplotype analysis with restriction enzyme digestion showed that the two mutations are located on opposing alleles of the H (FUT1) gene and lead to compound heterozygosity. Since no other known genetic changes were evident, it appears that the new missense mutation, G659A, is deleterious to the alpha(1,2)-fucosyltransferase function encoded by the H (FUT1) gene.

  17. Perspectives on recycling centres and future developments.

    PubMed

    Engkvist, I-L; Eklund, J; Krook, J; Björkman, M; Sundin, E

    2016-11-01

    The overall aim of this paper is to draw combined, all-embracing conclusions based on a long-term multidisciplinary research programme on recycling centres in Sweden, focussing on working conditions, environment and system performance. A second aim is to give recommendations for their development of new and existing recycling centres and to discuss implications for the future design and organisation. Several opportunities for improvement of recycling centres were identified, such as design, layout, ease with which users could sort their waste, the work environment, conflicting needs and goals within the industry, and industrialisation. Combining all results from the research, which consisted of different disciplinary aspects, made it possible to analyse and elucidate their interrelations. Waste sorting quality was recognized as the most prominent improvement field in the recycling centre system. The research identified the importance of involving stakeholders with different perspectives when planning a recycling centre in order to get functionality and high performance. Practical proposals of how to plan and build recycling centres are given in a detailed checklist. Copyright © 2016 Elsevier Ltd. All rights reserved.

  18. Missense mutation of FUT1 and deletion of FUT2 are responsible for Indian Bombay phenotype of ABO blood group system.

    PubMed

    Koda, Y; Soejima, M; Johnson, P H; Smart, E; Kimura, H

    1997-09-08

    The Bombay phenotype fails to express the ABH antigens of ABO blood group system on red blood cells and in secretions because of a lack in activities of the H gene (FUT1)- and Secretor gene (FUT2)-encoded alpha (1,2)fucosyltransferases. In this study, we have examined the FUT1 and the FUT2 from three unrelated Indian individuals with the Bombay phenotype. These three individuals were found to be homozygous for a T725G mutation in the coding region of the FUT1, which inactivated the enzyme activity. In addition, we did not detect any hybridized band corresponding to the FUT2 by Southern blot analysis using the catalytic domain of the FUT2 as a probe, indicating that the three individuals were homozygous for a gene deletion in the FUT2. These results suggest that the T725G mutation of FUT1 and the gene deletion of FUT2 are responsible for the classical Indian Bombay phenotype.

  19. Lidar Calibration Centre

    NASA Astrophysics Data System (ADS)

    Pappalardo, Gelsomina; Freudenthaler, Volker; Nicolae, Doina; Mona, Lucia; Belegante, Livio; D'Amico, Giuseppe

    2016-06-01

    This paper presents the newly established Lidar Calibration Centre, a distributed infrastructure in Europe, whose goal is to offer services for complete characterization and calibration of lidars and ceilometers. Mobile reference lidars, laboratories for testing and characterization of optics and electronics, facilities for inspection and debugging of instruments, as well as for training in good practices are open to users from the scientific community, operational services and private sector. The Lidar Calibration Centre offers support for trans-national access through the EC HORIZON2020 project ACTRIS-2.

  20. Chalcogenide centred gold complexes.

    PubMed

    Gimeno, M Concepción; Laguna, Antonio

    2008-09-01

    Chalcogenide-centred gold complexes are an important class of compounds in which a central chalcogen is surrounded by several gold atoms or gold and other metals. They have special characteristics such as unusual geometries, electron deficiency and properties such as luminescence or non-linear optical properties. The best known species are the trinuclear [E(AuPR3)3]+, 'oxonium' type species, that have high synthetic applicability, not only in other chalcogen-centred species, but in many other organometallic derivatives. The aurophilic interactions play an important role in the stability, preference for a particular geometry and luminescence properties in this type of derivatives (critical review, 117 references).

  1. Learning in interactive science centres

    NASA Astrophysics Data System (ADS)

    Beiers, Robin; McRobbie, Cam

    1992-12-01

    The potential of informal sources of science learning to supplement and interact with formal classroom science is receiving increasing recognition and attention in the research literature. In this study, a phenomenographic approach was used to determine changes in levels of understanding of 27 grade 7 primary school children as a result of a visit to an interactive science centre. The results showed that most students did change their levels of understanding of aspects of the concept “sound”. The study also provides information which will be of assistance to teachers on the levels of understanding displayed by students on this concept.

  2. Complex Modelling Scheme Of An Additive Manufacturing Centre

    NASA Astrophysics Data System (ADS)

    Popescu, Liliana Georgeta

    2015-09-01

    This paper presents a modelling scheme sustaining the development of an additive manufacturing research centre model and its processes. This modelling is performed using IDEF0, the resulting model process representing the basic processes required in developing such a centre in any university. While the activities presented in this study are those recommended in general, changes may occur in specific existing situations in a research centre.

  3. Maple Leaf Outdoor Centre.

    ERIC Educational Resources Information Center

    Maguire, Molly; Gunton, Ric

    2000-01-01

    Maple Leaf Outdoor Centre (Ontario) has added year-round outdoor education facilities and programs to help support its summer camp for disadvantaged children. Schools, youth centers, religious groups, and athletic teams conduct their own programs, collaborate with staff, or use staff-developed programs emphasizing adventure education and personal…

  4. Implementing Responsibility Centre Budgeting

    ERIC Educational Resources Information Center

    Vonasek, Joseph

    2011-01-01

    Recently, institutes of higher education (universities) have shown a renewed interest in organisational structures and operating methodologies that generate productivity and innovation; responsibility centre budgeting (RCB) is one such process. This paper describes the underlying principles constituting RCB, its origin and structural elements, and…

  5. Discovering a Discovery Centre

    ERIC Educational Resources Information Center

    McCullagh, John; Stewart, James; Greenwood, Julian

    2007-01-01

    There has recently been a growth in the popularity of "science centres" and this development provides an excellent opportunity to support the primary science curriculum. Their use is therefore well worth including within initial teacher education courses. Hence, undergraduate student teachers at Stranmillis University College Belfast may…

  6. Discovering a Discovery Centre

    ERIC Educational Resources Information Center

    McCullagh, John; Stewart, James; Greenwood, Julian

    2007-01-01

    There has recently been a growth in the popularity of "science centres" and this development provides an excellent opportunity to support the primary science curriculum. Their use is therefore well worth including within initial teacher education courses. Hence, undergraduate student teachers at Stranmillis University College Belfast may…

  7. Implementing Responsibility Centre Budgeting

    ERIC Educational Resources Information Center

    Vonasek, Joseph

    2011-01-01

    Recently, institutes of higher education (universities) have shown a renewed interest in organisational structures and operating methodologies that generate productivity and innovation; responsibility centre budgeting (RCB) is one such process. This paper describes the underlying principles constituting RCB, its origin and structural elements, and…

  8. Wycheproof Education Centre.

    ERIC Educational Resources Information Center

    Sweetnam and Godfrey, Melbourne (Australia).

    The Wycheproof township in New South Wales (Australia) is the regional center for a grain farming community. The Wycheproof Education Centre was formed by the merger of a separate primary and secondary school (on one site with existing buildings), into a single governing body that is educationally structured into junior, middle, and senior…

  9. Wycheproof Education Centre.

    ERIC Educational Resources Information Center

    Sweetnam and Godfrey, Melbourne (Australia).

    The Wycheproof township in New South Wales (Australia) is the regional center for a grain farming community. The Wycheproof Education Centre was formed by the merger of a separate primary and secondary school (on one site with existing buildings), into a single governing body that is educationally structured into junior, middle, and senior…

  10. Patient-centred care is a way of doing things: How healthcare employees conceptualize patient-centred care.

    PubMed

    Fix, Gemmae M; VanDeusen Lukas, Carol; Bolton, Rendelle E; Hill, Jennifer N; Mueller, Nora; LaVela, Sherri L; Bokhour, Barbara G

    2017-08-25

    Patient-centred care is now ubiquitous in health services research, and healthcare systems are moving ahead with patient-centred care implementation. Yet, little is known about how healthcare employees, charged with implementing patient-centred care, conceptualize what they are implementing. To examine how hospital employees conceptualize patient-centred care. We conducted qualitative interviews about patient-centred care during site four visits, from January to April 2013. We interviewed 107 employees, including leadership, middle managers, front line providers and staff at four US Veteran Health Administration (VHA) medical centres leading VHA's patient-centred care transformation. Data were analysed using grounded thematic analysis. Findings were then mapped to established patient-centred care constructs identified in the literature: taking a biopsychosocial perspective; viewing the patient-as-person; sharing power and responsibility; establishing a therapeutic alliance; and viewing the doctor-as-person. We identified three distinct conceptualizations: (i) those that were well aligned with established patient-centred care constructs surrounding the clinical encounter; (ii) others that extended conceptualizations of patient-centred care into the organizational culture, encompassing the entire patient-experience; and (iii) still others that were poorly aligned with patient-centred care constructs, reflecting more traditional patient care practices. Patient-centred care ideals have permeated into healthcare systems. Additionally, patient-centred care has been expanded to encompass a cultural shift in care delivery, beginning with patients' experiences entering a facility. However, some healthcare employees, namely leadership, see patient-centred care so broadly, it encompasses on-going hospital initiatives, while others consider patient-centred care as inherent to specific positions. These latter conceptualizations risk undermining patient-centred care

  11. Quality of Care and Education Provided by Greek Day-Care Centres: An Approach from Researcher's and Early Childhood Educators' Perspective

    ERIC Educational Resources Information Center

    Rentzou, Konstantina

    2012-01-01

    The present study is aimed at examining the level of quality and care provided by Greek preschool programmes, from the researcher's and early childhood educators' perspectives and verify whether they evaluate with the same way. Research results indicate that according to the researcher's assessment both preschool and infant/toddler classrooms…

  12. The DIY Digital Medical Centre.

    PubMed

    Timmis, James Kenneth; Timmis, Kenneth

    2017-09-01

    Healthcare systems worldwide are confronted with major economic, organizational and logistical challenges. Historic evolution of health care has led to significant healthcare sector fragmentation, resulting in systemic inefficiencies and suboptimal resource exploitation. To attain a sustainable healthcare model, fundamental, system-wide improvements that effectively network, and ensure fulfilment of potential synergies between sectors, and include and facilitate coherent strategic planning and organisation of healthcare infrastructure are needed. Critically, they must be specifically designed to sustainably achieve peak performance within the current policy environment for cost-control, and efficiency and quality improvement for service delivery. We propose creation of a new healthcare cluster, to be embedded in existing healthcare systems. It consists of (i) local 24/7 walk-in virtually autonomous do-it-yourself Digital Medical Centres performing routine diagnosis, monitoring, prevention, treatment and standardized documentation and health outcome assessment/reporting, which are online interfaced with (ii) regional 24/7 eClinician Centres providing on-demand clinical supervision/assistance to Digital Medical Centre patients. Both of these are, in turn, online interfaced with (iii) the National Clinical Informatics Centre, which houses the national patient data centre (cloud) and data analysis units that conduct patient- and population-level, personalized and predictive(-medicine) intervention optimization analyses. The National Clinical Informatics Centre also interfaces with biomedical research and prioritizes and accelerates the translation of new discoveries into clinical practice. The associated Health Policy Innovation and Evaluation Centre rapidly integrates new findings with health policy/regulatory discussions. This new cluster would synergistically link all health system components in a circular format, enable not only access by all arms of the health

  13. Test-retest and interobserver reliability of quantitative sensory testing according to the protocol of the German Research Network on Neuropathic Pain (DFNS): a multi-centre study.

    PubMed

    Geber, Christian; Klein, Thomas; Azad, Shahnaz; Birklein, Frank; Gierthmühlen, Janne; Huge, Volker; Lauchart, Meike; Nitzsche, Dorothee; Stengel, Maike; Valet, Michael; Baron, Ralf; Maier, Christoph; Tölle, Thomas; Treede, Rolf-Detlef

    2011-03-01

    Quantitative sensory testing (QST) is an instrument to assess positive and negative sensory signs, helping to identify mechanisms underlying pathologic pain conditions. In this study, we evaluated the test-retest reliability (TR-R) and the interobserver reliability (IO-R) of QST in patients with sensory disturbances of different etiologies. In 4 centres, 60 patients (37 male and 23 female, 56.4±1.9years) with lesions or diseases of the somatosensory system were included. QST comprised 13 parameters including detection and pain thresholds for thermal and mechanical stimuli. QST was performed in the clinically most affected test area and a less or unaffected control area in a morning and an afternoon session on 2 consecutive days by examiner pairs (4 QSTs/patient). For both, TR-R and IO-R, there were high correlations (r=0.80-0.93) at the affected test area, except for wind-up ratio (TR-R: r=0.67; IO-R: r=0.56) and paradoxical heat sensations (TR-R: r=0.35; IO-R: r=0.44). Mean IO-R (r=0.83, 31% unexplained variance) was slightly lower than TR-R (r=0.86, 26% unexplained variance, P<.05); the difference in variance amounted to 5%. There were no differences between study centres. In a subgroup with an unaffected control area (n=43), reliabilities were significantly better in the test area (TR-R: r=0.86; IO-R: r=0.83) than in the control area (TR-R: r=0.79; IO-R: r=0.71, each P<.01), suggesting that disease-related systematic variance enhances reliability of QST. We conclude that standardized QST performed by trained examiners is a valuable diagnostic instrument with good test-retest and interobserver reliability within 2days. With standardized training, observer bias is much lower than random variance. Quantitative sensory testing performed by trained examiners is a valuable diagnostic instrument with good interobserver and test-retest reliability for use in patients with sensory disturbances of different etiologies to help identify mechanisms of neuropathic and non

  14. Research on Secure Systems and Automatic Programming. Volume II

    DTIC Science & Technology

    1977-10-14

    to robot planning," in 1972 Fall Joint Compat. (’onf, AFIPS Conf. Proc., vol. 41. Montvale, NI: AFIPS Press, 1972, pt. 11, pp. 1181-1187. 141 G. D...D.Eng.Sc. degrees in electrical engineering ing generalized robot plans," J. Artificial Intelligence, vol. 3, pp. A from Columbia University, New York, NY...PLANNER: A language for proving theorems and manipui tute of Fundamental Research, Bombay, lating models in a robot ," Ph.D. dissertation, Dep

  15. SPOT4 Management Centre

    NASA Technical Reports Server (NTRS)

    Labrune, Yves; Labbe, X.; Roussel, A.; Vielcanet, P.

    1994-01-01

    In the context of the CNES SPOT4 program CISI is particularly responsible for the development of the SPOT4 Management Centre, part of the SPOT4 ground control system located at CNES Toulouse (France) designed to provide simultaneous control over two satellites. The main operational activities are timed to synchronize with satellite visibilities (ten usable passes per day). The automatic capability of this system is achieved through agenda services (sequence of operations as defined and planned by operator). Therefore, the SPOT4 Management Centre offers limited, efficient and secure human interventions for supervision and decision making. This paper emphasizes the main system characteristics as degree of automation, level of dependability and system parameterization.

  16. Elderly Care Centre

    NASA Astrophysics Data System (ADS)

    Wagiman, Aliani; Haja Bava Mohidin, Hazrina; Ismail, Alice Sabrina

    2016-02-01

    The demand for elderly centre has increased tremendously abreast with the world demographic change as the number of senior citizens rose in the 21st century. This has become one of the most crucial problems of today's era. As the world progress into modernity, more and more people are occupied with daily work causing the senior citizens to lose the care that they actually need. This paper seeks to elucidate the best possible design of an elderly care centre with new approach in order to provide the best service for them by analysing their needs and suitable activities that could elevate their quality of life. All these findings will then be incorporated into design solutions so as to enhance the living environment for the elderly especially in Malaysian context.

  17. International Seismological Centre

    USGS Publications Warehouse

    Spall, H.; Hughes, A.

    1979-01-01

    The International Seismological Centre had its origins when the British seismologist Professor John Milne returned to England from Japan in 1895 to retire at Shide on the Isle of Eight. In cooperation with the British Association for the Advancement of Science, Milne had set up a number of seismographic stations around the world and, while Tokyo, had published a Catalogue of 8,33 Earthquakes Recorded in Japan, 1885-1892. 

  18. Can Chemistry Teachers' Centres Survive?

    ERIC Educational Resources Information Center

    Garforth, F. M.

    1972-01-01

    The difficulties faced by the Hull Chemistry Teachers' Centre in England are discussed. The lack of finances and time, as well as organizational difficulties in relationship with Science Centres and universities are among the problems. (TS)

  19. Can animal data translate to innovations necessary for a new era of patient-centred and individualised healthcare? Bias in preclinical animal research.

    PubMed

    Green, Susan Bridgwood

    2015-07-28

    The public and healthcare workers have a high expectation of animal research which they perceive as necessary to predict the safety and efficacy of drugs before testing in clinical trials. However, the expectation is not always realised and there is evidence that the research often fails to stand up to scientific scrutiny and its 'predictive value' is either weak or absent. Problems with the use of animals as models of humans arise from a variety of biases and systemic failures including: 1) bias and poor practice in research methodology and data analysis; 2) lack of transparency in scientific assessment and regulation of the research; 3) long-term denial of weaknesses in cross-species translation; 4) profit-driven motives overriding patient interests; 5) lack of accountability of expenditure on animal research; 6) reductionist-materialism in science which tends to dictate scientific inquiry and control the direction of funding in biomedical research. Bias in animal research needs to be addressed before medical research and healthcare decision-making can be more evidence-based. Research funding may be misdirected on studying 'disease mechanisms' in animals that cannot be replicated outside tightly controlled laboratory conditions, and without sufficient critical evaluation animal research may divert attention away from avenues of research that hold promise for human health. The potential for harm to patients and trial volunteers from reliance on biased animal data(1) requires measures to improve its conduct, regulation and analysis. This article draws attention to a few of the many forms of bias in animal research that have come to light in the last decade and offers a strategy incorporating ten recommendations stated at the end of each section on bias. The proposals need development through open debate and subsequent rigorous implementation so that reviewers may determine the value of animal research to human health. The 10Rs + are protected by a Creative Commons

  20. AIDS-related information exposure in the mass media and discussion within social networks among married women in Bombay, India.

    PubMed

    Chatterjee, N

    1999-08-01

    Married women are at high risk of acquiring HIV infection in India and health education remains the most feasible preventive tool in their context. In a survey conducted among 350 married women in Bombay, it was found that a majority had acquired information about AIDS from the mass media, especially television. Although 87% of women who knew of AIDS had been exposed to AIDS-related information in the mass media in the past four weeks, only 57% had discussed it within their social networks. Those with more exposure to AIDS information in the mass media were significantly more likely to discuss AIDS within social networks. The women were most likely to discuss AIDS with their husbands as a general social issue, followed by friends and family members and least likely to talk to husbands about AIDS as a personal issue relating to their sexual relationship. Increased frequency and duration of AIDS messages on television will have a positive influence on AIDS knowledge in this group.

  1. Industry Restructuring: Extracts from Centre Publications.

    ERIC Educational Resources Information Center

    Hall, William C., Ed.

    This document contains excerpts from material previously published by Australia's TAFE (Technical and Further Education) National Centre for Research and Development on the subjects of industry restructuring, the reasons for restructuring, revising curricula, and providing a service to business and industry. Its contents are "Industry…

  2. Emotional intelligence and patient-centred care

    PubMed Central

    Birks, Yvonne F; Watt, Ian S

    2007-01-01

    The principles of patient-centred care are increasingly stressed as part of health care policy and practice. Explanations for why some practitioners seem more successful in achieving patient-centred care vary, but a possible role for individual differences in personality has been postulated. One of these, emotional intelligence (EI), is increasingly referred to in health care literature. This paper reviews the literature on EI in health care and poses a series of questions about the links between EI and patient-centred outcomes. Papers concerning empirical examinations of EI in a variety of settings were identified to determine the evidence base for its increasing popularity. The review suggests that a substantial amount of further research is required before the value of EI as a useful concept can be substantiated. PMID:17682030

  3. The Role of WHO Participating Centres in Continuing Education, Specialty Training and Educational Research. Report on a Seminar (London, England, October 31-November 2, 1983).

    ERIC Educational Resources Information Center

    World Health Organization, Copenhagen (Denmark). Regional Office for Europe.

    This document reports on a seminar to discuss the role that World Health Organization (WHO) participating centers should play in meeting the priority educational needs of the European Region in specialty training, continuing education, and educational research. The three working papers are summarized, and results of discussion on them are noted.…

  4. From the Generalist Courses to Work: An Annotated Bibliography on Generic Skills. Centre for the Study of Higher Education Research Working Papers, 93.5.

    ERIC Educational Resources Information Center

    Marginson, Simon; O'Hanlon, Seamus

    This annotated bibliography of 70 items was developed as part of a larger research project on the possible application of competency-based approaches to generalist courses (arts, humanities, social sciences, and natural sciences) in higher education. The project also looked at other ways, aside from the use of competency-based approaches, of…

  5. Assessment of potential shale oil and tight sandstone gas resources of the Assam, Bombay, Cauvery, and Krishna-Godavari Provinces, India, 2013

    USGS Publications Warehouse

    Klett, Timothy R.; Schenk, Christopher J.; Wandrey, Craig J.; Brownfield, Michael E.; Charpentier, Ronald R.; Tennyson, Marilyn E.; Gautier, Donald L.

    2014-01-01

    Using a well performance-based geologic assessment methodology, the U.S. Geological Survey estimated a technically recoverable mean volume of 62 million barrels of oil in shale oil reservoirs, and more than 3,700 billion cubic feet of gas in tight sandstone gas reservoirs in the Bombay and Krishna-Godavari Provinces of India. The term “provinces” refer to geologically defined units assessed by the USGS for the purposes of this report and carries no political or diplomatic connotation. Shale oil and tight sandstone gas reservoirs were evaluated in the Assam and Cauvery Provinces, but these reservoirs were not quantitatively assessed.

  6. Addiction research centres and the nurturing of creativity: the Department of Alcohol, Drugs and Addiction at the National Institute for Health and Welfare in Finland: diverse problems, diverse perspectives.

    PubMed

    Hakkarainen, Pekka; Kiianmaa, Kalervo; Kuoppasalmi, Kimmo; Tigerstedt, Christoffer

    2012-10-01

    The Department of Alcohol, Drugs and Addiction started operations on 1 January 2009, when the National Institute of Public Health (KTL) and the National Research and Development Centre for Welfare and Health (STAKES) were merged. The newly formed institute, called the National Institute for Health and Welfare (THL), operates under the Finnish Ministry of Social Affairs and Health. The scope of the research and preventive work conducted in the Department covers alcohol, drugs, tobacco and gambling issues. The two main tasks of the Department are (i) to research, produce and disseminate information on alcohol and drugs, substance use, addictions and their social and health-related effects and (ii) to develop prevention and good practices with a view to counteracting the onset and development of alcohol and drug problems and the damaging effects of smoking and other addictions. The number of staff hovers at approximately 60 people. The Department is organized into three units, one specialized in social sciences (the Alcohol and Drug Research Unit), another in laboratory analytics (the Alcohol and Drug Analytics Unit) and the third primarily in preventive work (the Addiction Prevention Unit). These units incorporate a rich variety and long traditions of both research and preventive work. The mixture of different disciplines creates good opportunities for interdisciplinary research projects and collaboration within the Department. Also, the fact that in the same administrative context there are both researchers and people specialized in preventive work opens up interesting possibilities for combining efforts from these two branches. Nationally, the Department is a key player in all its fields of interest. It engages in a great deal of cooperation both nationally and internationally, and among its strengths are the high-quality, regularly collected long-term data sets. © 2011 The Authors, Addiction © 2011 Society for the Study of Addiction.

  7. Mathematics in Student-­Centred Inquiry Learning: Student Engagement

    ERIC Educational Resources Information Center

    Calder, Nigel

    2013-01-01

    This paper examines how mathematical understandings might be facilitated through student-centred inquiry. Data is drawn from a research project on student-centred inquiry learning that situated mathematics within authentic problem-solving contexts and involved students in a collaboratively constructed curriculum. A contemporary interpretive frame…

  8. Mathematics as It Happens: Student-Centred Inquiry Learning

    ERIC Educational Resources Information Center

    Brough, Chris; Calder, Nigel

    2012-01-01

    This paper examines how mathematical understandings might emerge through student-centred inquiry. Data is drawn from a research project on student-centred curriculum integration (CI) that situated mathematics within authentic problem-solving contexts and involved students in collaboratively constructed curriculum. Participatory action research…

  9. Child-Centred Inquiry Learning: How Mathematics Understanding Emerges

    ERIC Educational Resources Information Center

    Calder, Nigel; Brough, Chris

    2013-01-01

    This paper examines how mathematical understandings might emerge through student-centred inquiry. Data is drawn from a research project on student-centred curriculum integration that situated mathematics within authentic problem-solving contexts and involved students in collaboratively constructed curriculum. The project involved case studies in…

  10. Design Considerations for an Intensive Autism Treatment Centre

    ERIC Educational Resources Information Center

    Deochand, Neil; Conway, Alissa A.; Fuqua, R. Wayne

    2015-01-01

    Individuals with autistic spectrum disorder (ASD) who display severe and challenging behaviour sometimes require centre-based intensive applied behaviour analysis (ABA) therapy to meet their health, safety and educational needs. Unfortunately, despite the need for centre-based treatment, there is a paucity of empirical research on building and…

  11. Centre Computer Base for Visually Handicapped Children, Students and Adults.

    ERIC Educational Resources Information Center

    Spencer, S.; And Others

    1987-01-01

    The Centre Computer Base is a list of hardware which can effectively operate the software of the Research Centre for the Education of the Visually Handicapped. Essential hardware contained on the list is described, along with a variety of "add-on" devices such as joysticks, touch-screens, speech synthesizers, braille embossers, etc.…

  12. The pontine micturition centres.

    PubMed

    Griffiths, Derek J

    2002-01-01

    To review recent literature on the function of the two postulated pontine regions (the M- and L-regions) concerned with lower urinary tract control. The work reviewed is based on stimulation and lesion experiments and post-operative follow-up in the cat, supported by acute chemical stimulation and blocking experiments in the rat and PET functional brain scanning in humans. The M-region in the cat, homologous to Barrington's micturition centre and to a similar area in humans, is a small region both specific and necessary to voiding, the origin of the final common pathway to bladder and urethra, and the locus of co-ordination of the bladder and the striated sphincter. The L-region in the cat is part of a larger, less specific area that probably serves sphincter control in various circumstances, not exclusively micturition. The homolog of this region in the human or in the rat has not been adequately established.

  13. [The primary healthcare centres].

    PubMed

    Brambilla, Antonio; Maciocco, Gavino

    2014-04-01

    The central attributes of primary care are: first contact (accessibility), longitudinality (person- focused preventive and curative care overtime), patient-oriented comprehensiveness and coordination (including navigation towards secondary and tertiary care). Besides taking care of the needs of the individuals, primary health care teams are also looking at the community, especially when addressing social determinants of health. The rationale for the benefits for primary care for health has been found in: 1) greater access to needed services; 2) better quality of care; 3) a greater focus on prevention; 4) early management of health problems; 5) organizing and delivering high quality care for chronic non-communicable diseases. This paper describes the role of primary healthcare centres in strengthening community primary services and in reducing health inequalities. Furthemore, the experiences of Regional Health Services from Tuscany and Emilia-Romagna are discussed, with a brief overview of the literature.

  14. A systematic review on the role of vitamins, minerals, proteins, and other supplements for the treatment of cachexia in cancer: a European Palliative Care Research Centre cachexia project

    PubMed Central

    Mochamat; Cuhls, Henning; Marinova, Milka; Kaasa, Stein; Stieber, Christiane; Conrad, Rupert; Radbruch, Lukas

    2016-01-01

    Abstract We provide a systematic review to support the European Palliative Care Research Collaboration development of clinical guidelines for cancer patients suffering from cachexia. CENTRAL, MEDLINE, PsycINFO, ClinicalTrials.gov, and a selection of cancer journals have been searched up until 15 April 2016. The systematic literature research yielded 4214 publications with 21 of these included in the final evaluation. Regarding minerals, our search identified only one study examining the use of magnesium with no effect on weight loss. As far as vitamins are concerned, vitamin E in combination with omega‐3 fatty acids displayed an effect on survival in a single study, vitamin D showed improvement of muscle weakness in prostate cancer patients, and vitamin C supplementation led to an improvement of various quality of life aspects in a sample with a variety of cancer diagnoses. For proteins, a combination therapy of β‐hydroxy‐β‐methylbutyrate (HMB), arginine, and glutamine showed an increase in lean body mass after 4 weeks in a study of advanced solid tumour patients, whereas the same combination did not show a benefit on lean body mass in a large sample of advanced lung and other cancer patients after 8 weeks. L‐carnitine led to an increase of body mass index and an increase in overall survival in advanced pancreatic cancer patients. Adverse effects of food supplementation were rare and showed mild intensity. There is not enough solid evidence for the use of minerals, vitamins, proteins, or other supplements in cancer. No serious adverse effects have been reported with dietary supplementation. PMID:27897391

  15. A systematic review on the role of vitamins, minerals, proteins, and other supplements for the treatment of cachexia in cancer: a European Palliative Care Research Centre cachexia project.

    PubMed

    Mochamat; Cuhls, Henning; Marinova, Milka; Kaasa, Stein; Stieber, Christiane; Conrad, Rupert; Radbruch, Lukas; Mücke, Martin

    2017-02-01

    We provide a systematic review to support the European Palliative Care Research Collaboration development of clinical guidelines for cancer patients suffering from cachexia. CENTRAL, MEDLINE, PsycINFO, ClinicalTrials.gov, and a selection of cancer journals have been searched up until 15 April 2016. The systematic literature research yielded 4214 publications with 21 of these included in the final evaluation. Regarding minerals, our search identified only one study examining the use of magnesium with no effect on weight loss. As far as vitamins are concerned, vitamin E in combination with omega-3 fatty acids displayed an effect on survival in a single study, vitamin D showed improvement of muscle weakness in prostate cancer patients, and vitamin C supplementation led to an improvement of various quality of life aspects in a sample with a variety of cancer diagnoses. For proteins, a combination therapy of β-hydroxy-β-methylbutyrate (HMB), arginine, and glutamine showed an increase in lean body mass after 4 weeks in a study of advanced solid tumour patients, whereas the same combination did not show a benefit on lean body mass in a large sample of advanced lung and other cancer patients after 8 weeks. L-carnitine led to an increase of body mass index and an increase in overall survival in advanced pancreatic cancer patients. Adverse effects of food supplementation were rare and showed mild intensity. There is not enough solid evidence for the use of minerals, vitamins, proteins, or other supplements in cancer. No serious adverse effects have been reported with dietary supplementation.

  16. A chaotic model for the plague epidemic that has occurred in Bombay at the end of the 19th century

    NASA Astrophysics Data System (ADS)

    Mangiarotti, Sylvain

    2015-04-01

    The plague epidemic that has occurred in Bombay at the end of the 19th century was detected in 1896. One year before, an Advisory Committee had been appointed by the Secretary of State for India, the Royal Society, and the Lister Institute. This Committee made numerous investigations and gathered a large panel of data including the number of people attacked and died from the plague, records of rat and flea populations, as well as meteorological records of temperature and humidity [1]. The global modeling technique [2] aims to obtain low dimensional models able to simulate the observed cycles from time series. As far as we know, this technique has been tried only to one case of epidemiological analysis (the whooping cough infection) based on a discrete formulation [3]. In the present work, the continuous time formulation of this technique is used to analyze the time evolution of the plague epidemic from this data set. One low dimensional model (three variables) is obtained exhibiting a limit cycle of period-5. A chaotic behavior could be derived from this model by tuning the model parameters. It provides a strong argument for a dynamical behavior that can be approximated by low dimensional deterministic equations. This model also provides an empirical argument for chaos in epidemics. [1] Verjbitski D. T., Bannerman W. B. & Kápadiâ R. T., 1908. Reports on Plague Investigations in India (May,1908), The Journal of Hygiene, 8(2), 161 -308. [2] Mangiarotti S., Coudret R., Drapeau L. & Jarlan L., 2012. Polynomial search and Global modelling: two algorithms for modeling chaos. Physical Review E, 86(4), 046205. [3] Boudjema G. & Cazelles B., 2003. Extraction of nonlinear dynamics from short and noisy time series. Chaos, Solitons and Fractals, 12, 2051-2069.

  17. A possible K-T boundary bolide impact site offshore near Bombay and triggering of rapid Deccan volcanism

    NASA Astrophysics Data System (ADS)

    Negi, J. G.; Agrawal, P. K.; Pandey, O. P.; Singh, A. P.

    1993-03-01

    The temporal coincidence of a major biological mass extinction (including dinosaurs), the well-known iridium excess anomaly at the Cretaceous-Tertiary (K-T) boundary and the eruption of Deccan flood basalts at about 65 Ma has aroused global interest among geologists and biologists. It is widely debated whether the mass extinction and iridium anomaly are due to an asteroid impact or the massive outpouring of extensive Deccan volcanism. An oval shaped unusual positive gravity anomaly (10 000 km 2 in area) near Bombay has attracted our attention during a search for an impact site near Deccan basalts. A detailed gravity interpretation indicates the presence of a fossil conduit structure of 12 km height extending from a shallow crust-mantle boundary (at 18 km) to an approximate depth of 6 km from the surface. The conduit structure, with a maximum diameter of about 35 km at its base, may originate from cracking of a weak pre-Deccan trap shallow upwarped mantle. The structure may have been caused by a bolide impact which triggered the eruption of massive flood basalts (Deccan traps) on the western margin of the fast-moving Indian plate. An impact in this locality can explain the sudden detachment of the arcuate Seychelles block from India as well as the large-scale reorganisation of plate boundaries in the Indian Ocean. Our hypothesis of impact-triggered volcanism at 65 Ma advocates a bimodal cause for the mass extinction at the K-T boundary. Extraordinary geothermal and structural conditions of the nearby region are also discussed as circumstantial evidence to support the twin-cause mechanism by weakened features and the presence of partial melt at subcrustal depth.

  18. Should "Teacher Centred Teaching" Replace "Student Centred Learning"?

    ERIC Educational Resources Information Center

    Bailey, Patrick D.

    2008-01-01

    Mission statements of most HEIs across the UK support "student centred learning". In this paper, it is suggested that "teacher centred teaching" should also have a major role to play, improving the quality of the learning experience in higher education. Students are extremely diverse in their skills, weaknesses, and learning…

  19. Should "Teacher Centred Teaching" Replace "Student Centred Learning"?

    ERIC Educational Resources Information Center

    Bailey, Patrick D.

    2008-01-01

    Mission statements of most HEIs across the UK support "student centred learning". In this paper, it is suggested that "teacher centred teaching" should also have a major role to play, improving the quality of the learning experience in higher education. Students are extremely diverse in their skills, weaknesses, and learning…

  20. Mortality of people with chronic fatigue syndrome: a retrospective cohort study in England and Wales from the South London and Maudsley NHS Foundation Trust Biomedical Research Centre (SLaM BRC) Clinical Record Interactive Search (CRIS) Register.

    PubMed

    Roberts, Emmert; Wessely, Simon; Chalder, Trudie; Chang, Chin-Kuo; Hotopf, Matthew

    2016-04-16

    Mortality associated with chronic fatigue syndrome is uncertain. We investigated mortality in individuals diagnosed with chronic fatigue syndrome in secondary and tertiary care using data from the South London and Maudsley NHS Foundation Trust Biomedical Research Centre (SLaM BRC) Clinical Record Interactive Search (CRIS) register. We calculated standardised mortality ratios (SMRs) for all-cause, suicide-specific, and cancer-specific mortality for a 7-year observation period using the number of deaths observed in SLaM records compared with age-specific and sex-specific mortality statistics for England and Wales. Study participants were included if they had had contact with the chronic fatigue service (referral, discharge, or case note entry) and received a diagnosis of chronic fatigue syndrome. We identified 2147 cases of chronic fatigue syndrome from CRIS and 17 deaths from Jan 1, 2007, to Dec 31, 2013. 1533 patients were women of whom 11 died, and 614 were men of whom six died. There was no significant difference in age-standardised and sex-standardised mortality ratios (SMRs) for all-cause mortality (SMR 1·14, 95% CI 0·65-1·85; p=0·67) or cancer-specific mortality (1·39, 0·60-2·73; p=0·45) in patients with chronic fatigue syndrome when compared with the general population in England and Wales. This remained the case when deaths from suicide were removed from the analysis. There was a significant increase in suicide-specific mortality (SMR 6·85, 95% CI 2·22-15·98; p=0·002). We did not note increased all-cause mortality in people with chronic fatigue syndrome, but our findings show a substantial increase in mortality from suicide. This highlights the need for clinicians to be aware of the increased risk of completed suicide and to assess suicidality adequately in patients with chronic fatigue syndrome. National Institute for Health Research (NIHR) Biomedical Research Centre at South London and Maudsley NHS Foundation Trust and King's College London

  1. Cohort profile of the South London and Maudsley NHS Foundation Trust Biomedical Research Centre (SLaM BRC) Case Register: current status and recent enhancement of an Electronic Mental Health Record-derived data resource

    PubMed Central

    Perera, Gayan; Broadbent, Matthew; Callard, Felicity; Chang, Chin-Kuo; Downs, Johnny; Dutta, Rina; Fernandes, Andrea; Hayes, Richard D; Henderson, Max; Jackson, Richard; Jewell, Amelia; Kadra, Giouliana; Little, Ryan; Pritchard, Megan; Shetty, Hitesh; Tulloch, Alex; Stewart, Robert

    2016-01-01

    Purpose The South London and Maudsley National Health Service (NHS) Foundation Trust Biomedical Research Centre (SLaM BRC) Case Register and its Clinical Record Interactive Search (CRIS) application were developed in 2008, generating a research repository of real-time, anonymised, structured and open-text data derived from the electronic health record system used by SLaM, a large mental healthcare provider in southeast London. In this paper, we update this register's descriptive data, and describe the substantial expansion and extension of the data resource since its original development. Participants Descriptive data were generated from the SLaM BRC Case Register on 31 December 2014. Currently, there are over 250 000 patient records accessed through CRIS. Findings to date Since 2008, the most significant developments in the SLaM BRC Case Register have been the introduction of natural language processing to extract structured data from open-text fields, linkages to external sources of data, and the addition of a parallel relational database (Structured Query Language) output. Natural language processing applications to date have brought in new and hitherto inaccessible data on cognitive function, education, social care receipt, smoking, diagnostic statements and pharmacotherapy. In addition, through external data linkages, large volumes of supplementary information have been accessed on mortality, hospital attendances and cancer registrations. Future plans Coupled with robust data security and governance structures, electronic health records provide potentially transformative information on mental disorders and outcomes in routine clinical care. The SLaM BRC Case Register continues to grow as a database, with approximately 20 000 new cases added each year, in addition to extension of follow-up for existing cases. Data linkages and natural language processing present important opportunities to enhance this type of research resource further, achieving both volume

  2. The English Teaching Information Centre

    ERIC Educational Resources Information Center

    Roe, Peter

    1977-01-01

    Describes the function of the British Council's English Teaching Information Centre, which serves foreign students, teachers, teacher trainers, scientists, textbook writers, etc. Emphasizes the Centre's work in English for Special Purposes, including an ample library and many services. Address: ETIC, British Council, 10 Spring Gardens, London SW…

  3. Systematic Assessment of Game-Centred Approach Practices--The Game-Centred Approach Assessment Scaffold

    ERIC Educational Resources Information Center

    Forrest, Gregory

    2015-01-01

    Background: Game-centred approaches (GCA) have been promoted as a more meaningful way to teach games and sports due to their connections with constructivist learning principles. However, the implementation is dependant on the teacher implementing it rather than just the model. There has been little research into what it means to use a GCA well and…

  4. RTEMS CENTRE - Support and Maintenance CENTRE to RTEMS Operating System

    NASA Astrophysics Data System (ADS)

    Silva, H.; Constantino, A.; Mota, M.; Freitas, D.; Zulianello, M.

    2007-08-01

    Real Time Operating System for Multiprocessor Systems (RTEMS) CENTRE is a project under the ESA-Portugal Task Force aiming to develop a support and maintenance centre to RTEMS operating system. The project can be summarized in two main streams, first one related to design, development, maintenance and integration of tools to augment and sustain RTEMS operating system and second stream linked to the creation of technical competences with a support site to RTEMS operating system in Europe. RTEMS CENTRE intends to minimize the cost of the incorporation/integration of airborne and space applications in this Real Time Operating System. The centre started officially in the 15th of November 2006 and is currently in the study definition and system engineering phase.

  5. Scottish Schools Science Equipment Research Centre.

    ERIC Educational Resources Information Center

    1972

    This newsletter is composed of brief notes in the various areas of science. Biology Notes include hazards of tasting Phenylthiocarbamide in laboratory experiments, the use of Albustic and Clinistix test papers for protein and glucose determinations, the measurement of the respiratory quotient, and the construction of a simple respirometer. Physics…

  6. Scottish Schools Science Equipment Research Centre.

    ERIC Educational Resources Information Center

    1972

    This newsletter is composed of brief notes in the various areas of science. Biology Notes include hazards of tasting Phenylthiocarbamide in laboratory experiments, the use of Albustic and Clinistix test papers for protein and glucose determinations, the measurement of the respiratory quotient, and the construction of a simple respirometer. Physics…

  7. The Human Communication Research Centre dialogue database.

    PubMed

    Anderson, A H; Garrod, S C; Clark, A; Boyle, E; Mullin, J

    1992-10-01

    The HCRC dialogue database consists of over 700 transcribed and coded dialogues from pairs of speakers aged from seven to fourteen. The speakers are recorded while tackling co-operative problem-solving tasks and the same pairs of speakers are recorded over two years tackling 10 different versions of our two tasks. In addition there are over 200 dialogues recorded between pairs of undergraduate speakers engaged on versions of the same tasks. Access to the database, and to its accompanying custom-built search software, is available electronically over the JANET system by contacting liz@psy.glasgow.ac.uk, from whom further information about the database and a user's guide to the database can be obtained.

  8. The European NEO Coordination Centre

    NASA Astrophysics Data System (ADS)

    Perozzi, E.; Borgia, B.; Micheli, M.

    An operational approach to NEO (Near-Earth Object) hazard monitoring has been developed at European level within the framework of the Space Situational Awareness Program (SSA) of the European Space Agency (ESA). Through federating European assets and profiting of the expertise developed in European Universities and Research Centers, it has been possible to start the deployment of the so-called SSA NEO Segment. This initiative aims to provide a significant contribution to the worldwide effort to the discovery, follow-up and characterization of the near-Earth object population. A major achievement has been the inauguration in May 2013 of the ESA NEO Coordination Centre located at ESRIN (Frascati, Italy). The goal of the NEOCC Precursor Service operations is twofold: to make available updated information on the NEO population and the associated hazard and to contribute to optimize the NEO observational efforts. This is done by maintaining and improving a Web Portal publicly available at http://neo.ssa.esa.int and by performing follow-up observations through a network of collaborating telescopes and facilities. An overview of the SSA-NEO System and a summary of the first two years of NEOCC operations is presented.

  9. The Danish Centre for Strategic Research in Type 2 Diabetes (DD2): organization of diabetes care in Denmark and supplementary data sources for data collection among DD2 study participants.

    PubMed

    Thomsen, Reimar Wernich; Friborg, Søren; Nielsen, Jens Steen; Schroll, Henrik; Johnsen, Søren Paaske

    2012-01-01

    This paper provides a short overview of the Danish health care system and the organization of care for type 2 diabetes patients in Denmark. It also describes the supplementary data sources that are used for collection of baseline data in the nationwide Danish Centre for Strategic Research in Type 2 Diabetes (DD2) Project. The Danish National Health Service provides tax-funded medical care for all 5.6 million Danish residents. The health care system is characterized by extensive individual-level registration of data used for planning, administration, quality improvement, and research. It is estimated that there are currently at least 250,000 individuals with known diabetes in Denmark (approximately 4.5% of the Danish population), of which an estimated 80% are followed and treated by their general practitioners and approximately 20% are followed at hospital specialist outpatient clinics. These health care providers form the basis for recruiting diabetes patients in the DD2 project, and the data sources that these providers use in clinical practice give access to important supplementary patient data. The DD2's patient-enrollment system is designed to be fast and simple, and thus only collects primary interview data that cannot be extracted from already existing data sources. Thus, in addition to an online DD2 questionnaire filled out by general practitioners and hospital physicians at the time of patient enrollment, supplementary data are obtained from the Danish Diabetes Database for Adults, a nationwide clinical quality improvement registry. Both hospital physicians and a growing number of general practitioners routinely report data to this database. For general practitioners, the Danish General Practice Database acts as an important feeder database for the Danish Diabetes Database for Adults and thereby also for the DD2 project.

  10. The Canadian Astronomy Data Centre

    NASA Astrophysics Data System (ADS)

    Ball, Nicholas M.; Schade, D.; Astronomy Data Centre, Canadian

    2011-01-01

    The Canadian Astronomy Data Centre (CADC) is the world's largest astronomical data center, holding over 0.5 Petabytes of information, and serving nearly 3000 astronomers worldwide. Its current data collections include BLAST, CFHT, CGPS, FUSE, Gemini, HST, JCMT, MACHO, MOST, and numerous other archives and services. It provides extensive data archiving, curation, and processing expertise, via projects such as MegaPipe, and enables substantial day-to-day collaboration between resident astronomers and computer specialists. It is a stable, powerful, persistent, and properly supported environment for the storage and processing of large volumes of data, a condition that is now absolutely vital for their science potential to be exploited by the community. Through initiatives such as the Common Archive Observation Model (CAOM), the Canadian Virtual Observatory (CVO), and the Canadian Advanced Network for Astronomical Research (CANFAR), the CADC is at the global forefront of advancing astronomical research through improved data services. The CAOM aims to provide homogeneous data access, and hence viable interoperability between a potentially unlimited number of different data collections, at many wavelengths. It is active in the definition of numerous emerging standards within the International Virtual Observatory, and several datasets are already available. The CANFAR project is an initiative to make cloud computing for storage and data-intensive processing available to the community. It does this via a Virtual Machine environment that is equivalent to managing a local desktop. Several groups are already processing science data. CADC is also at the forefront of advanced astronomical data analysis, driven by the science requirements of astronomers both locally and further afield. The emergence of 'Astroinformatics' promises to provide not only utility items like object classifications, but to directly enable new science by accessing previously undiscovered or intractable

  11. International Centre for Reproductive Health (ICRH)

    PubMed Central

    Van Braeckel, D.; Luchters, S.; Degomme, O.; Temmerman, M.

    2011-01-01

    The International Centre for Reproductive Health (ICRH) was established by Prof. dr. Marleen Temmerman in the aftermath of the UN Conference on Population and Development in Cairo in 1994. This conference called for world-wide action to improve the sexual and reproductive health situation of the global population in general and for vulnerable groups in particular, and this is exactly what ICRH is striving for and has been working on for the last 15 years. ICRH is a multidisciplinary centre of excellence, in research, capacity building and fieldwork in sexual and reproductive health and HIV prevention, and an advocate for sexual and reproductive health and rights. Right from the start, ICRH has opted for a global approach, which has resulted in a broad geographical spread of activities, with projects in Africa, Latin America, Asia and Europe. Since its inception, ICRH has participated in more than 120 projects, often as the coordinator, and through this work it has contributed considerably not only to scientific knowledge, improvement of health systems and increased accessibility of health services for vulnerable groups, but also to the quality of live of numerous individuals. Since 2004, ICRH has been recognized as a WHO Collaborating Centre for Research on Sexual and Reproductive Health.

  12. Cohort profile of the South London and Maudsley NHS Foundation Trust Biomedical Research Centre (SLaM BRC) Case Register: current status and recent enhancement of an Electronic Mental Health Record-derived data resource.

    PubMed

    Perera, Gayan; Broadbent, Matthew; Callard, Felicity; Chang, Chin-Kuo; Downs, Johnny; Dutta, Rina; Fernandes, Andrea; Hayes, Richard D; Henderson, Max; Jackson, Richard; Jewell, Amelia; Kadra, Giouliana; Little, Ryan; Pritchard, Megan; Shetty, Hitesh; Tulloch, Alex; Stewart, Robert

    2016-03-01

    The South London and Maudsley National Health Service (NHS) Foundation Trust Biomedical Research Centre (SLaM BRC) Case Register and its Clinical Record Interactive Search (CRIS) application were developed in 2008, generating a research repository of real-time, anonymised, structured and open-text data derived from the electronic health record system used by SLaM, a large mental healthcare provider in southeast London. In this paper, we update this register's descriptive data, and describe the substantial expansion and extension of the data resource since its original development. Descriptive data were generated from the SLaM BRC Case Register on 31 December 2014. Currently, there are over 250,000 patient records accessed through CRIS. Since 2008, the most significant developments in the SLaM BRC Case Register have been the introduction of natural language processing to extract structured data from open-text fields, linkages to external sources of data, and the addition of a parallel relational database (Structured Query Language) output. Natural language processing applications to date have brought in new and hitherto inaccessible data on cognitive function, education, social care receipt, smoking, diagnostic statements and pharmacotherapy. In addition, through external data linkages, large volumes of supplementary information have been accessed on mortality, hospital attendances and cancer registrations. Coupled with robust data security and governance structures, electronic health records provide potentially transformative information on mental disorders and outcomes in routine clinical care. The SLaM BRC Case Register continues to grow as a database, with approximately 20,000 new cases added each year, in addition to extension of follow-up for existing cases. Data linkages and natural language processing present important opportunities to enhance this type of research resource further, achieving both volume and depth of data. However, research projects still

  13. Green house emissions, inventories and evaluation of marine environment visa vis offshore oil field development activities Bombay high (west coast) upstream petroleum sector, India

    SciTech Connect

    Sharma, J.S.; Ahmed, S.; Negi, C.V.S.; Nainwal, D.R.

    1996-12-31

    Wide use of petroleum products contributes significant amount of emission to the global environment and hence maintaining emission inventories are of great importance while assessing the global green house emissions. The present paper describes a brief account of green house emission and inventories for CO{sub 2}, CO, NO{sub x}, HC particulate and SO{sub 2} emissions generated due to upstream petroleum sector activities viz. discharges of gaseous emission, combustion of Natural Gas anti HSD from production and drilling facilities of Bombay offshore area located in Exclusive Economic Zone (EEZ) west coast of India. Besides, authors have also given an account on west coast marine base line status including impact of oil field activities on marine ecosystem.

  14. Development of a disease-specific quality of life questionnaire for adult patients with hereditary angioedema due to C1 inhibitor deficiency (HAE-QoL): Spanish multi-centre research project

    PubMed Central

    2012-01-01

    Background There is a need for a disease-specific instrument for assessing health-related quality of life in adults with hereditary angioedema due to C1 inhibitor deficiency, a rare, disabling and life-threatening disease. In this paper we report the protocol for the development and validation of a specific questionnaire, with details on the results of the process of item generation, domain selection, and the expert and patient rating phase. Methods/Design Semi-structured interviews were completed by 45 patients with hereditary angioedema and 8 experts from 8 regions in Spain. A qualitative content analysis of the responses was carried out. Issues raised by respondents were grouped into categories. Content analysis identified 240 different responses, which were grouped into 10 conceptual domains. Sixty- four items were generated. A total of 8 experts and 16 patients assessed the items for clarity, relevance to the disease, and correct dimension assignment. The preliminary version of the specific health-related quality of life questionnaire for hereditary angioedema (HAE-QoL v 1.1) contained 44 items grouped into 9 domains. Discussion To the best of our knowledge, this is the first multi-centre research project that aims to develop a specific health-related quality of life questionnaire for adult patients with hereditary angioedema due to C1 inhibitor deficiency. A preliminary version of the specific HAE-QoL questionnaire was obtained. The qualitative analysis of interviews together with the expert and patient rating phase helped to ensure content validity. A pilot study will be performed to assess the psychometric properties of the questionnaire and to decide on the final version. PMID:22817696

  15. Age influences the predictive value of Acute Physiology and Chronic Health Evaluation II and Intensive Care National Audit and Research Centre scoring models in patients admitted to Intensive Care Units after in-hospital cardiac arrest.

    PubMed

    Senaratne, D N S; Veenith, T

    2015-03-01

    Outcomes following in-hospital cardiac arrest (IHCA) are generally poor though different patient populations may benefit to different degrees from admission to Intensive Care Units (ICUs). Risk stratification algorithms may be useful in identifying patients who are most likely to benefit from ICU admission and so may aid allocation of this scarce resource. We aimed to compare the performance of the Acute Physiology and Chronic Health Evaluation II (APACHE II) and Intensive Care National Audit and Research Centre (ICNARC) scoring systems in predicting outcome following ICU admission after IHCA in younger (≤69 years) and older (≥70 years) patients. We performed a retrospective observational study in two adult ICUs from January 2006 to February 2010 inclusive. Patients were divided into younger (≤69 years) and older (≥70 years) patients. The primary outcome measures were acute hospital mortality and area under the curve (AUC) calculation for receiver operating characteristic (ROC) analysis. Two hundred and sixty-one adult consecutive adult patients admitted following IHCA. Hospital mortality was 58.6%. ROC analysis demonstrated that ICNARC was more accurate than APACHE II in predicting acute hospital outcomes in the adult population (AUC 0.734 vs. 0.706). Both scoring systems performed weaker when predicting outcomes in younger patients compared to older patients (ICNARC AUC 0.655 vs. 0.810; APACHE II AUC 0.660 vs. 0.759). Both APACHE II and ICNARC predict outcome well in older patients. In younger patients, their value is less clear, and so they must be used with caution.

  16. Case mix, outcome and length of stay for admissions to adult, general critical care units in England, Wales and Northern Ireland: the Intensive Care National Audit & Research Centre Case Mix Programme Database

    PubMed Central

    Harrison, David A; Brady, Anthony R; Rowan, Kathy

    2004-01-01

    Introduction The present paper describes the methods of data collection and validation employed in the Intensive Care National Audit & Research Centre Case Mix Programme (CMP), a national comparative audit of outcome for adult, critical care admissions. The paper also describes the case mix, outcome and activity of the admissions in the Case Mix Programme Database (CMPD). Methods The CMP collects data on consecutive admissions to adult, general critical care units in England, Wales and Northern Ireland. Explicit steps are taken to ensure the accuracy of the data, including use of a dataset specification, of initial and refresher training courses, and of local and central validation of submitted data for incomplete, illogical and inconsistent values. Criteria for evaluating clinical databases developed by the Directory of Clinical Databases were applied to the CMPD. The case mix, outcome and activity for all admissions were briefly summarised. Results The mean quality level achieved by the CMPD for the 10 Directory of Clinical Databases criteria was 3.4 (on a scale of 1 = worst to 4 = best). The CMPD contained validated data on 129,647 admissions to 128 units. The median age was 63 years, and 59% were male. The mean Acute Physiology and Chronic Health Evaluation II score was 16.5. Mortality was 20.3% in the CMP unit and was 30.8% at ultimate discharge from hospital. Nonsurvivors stayed longer in intensive care than did survivors (median 2.0 days versus 1.7 days in the CMP unit) but had a shorter total hospital length of stay (9 days versus 16 days). Results for the CMPD were comparable with results from other published reports of UK critical care admissions. Conclusions The CMP uses rigorous methods to ensure data are complete, valid and reliable. The CMP scores well against published criteria for high-quality clinical databases. PMID:15025784

  17. Case mix, outcome and length of stay for admissions to adult, general critical care units in England, Wales and Northern Ireland: the Intensive Care National Audit & Research Centre Case Mix Programme Database

    PubMed Central

    2005-01-01

    Introduction The present paper describes the methods of data collection and validation employed in the Intensive Care National Audit & Research Centre Case Mix Programme (CMP), a national comparative audit of outcome for adult, critical care admissions. The paper also describes the case mix, outcome and activity of the admissions in the Case Mix Programme Database (CMPD). Methods The CMP collects data on consecutive admissions to adult, general critical care units in England, Wales and Northern Ireland. Explicit steps are taken to ensure the accuracy of the data, including use of a dataset specification, of initial and refresher training courses, and of local and central validation of submitted data for incomplete, illogical and inconsistent values. Criteria for evaluating clinical databases developed by the Directory of Clinical Databases were applied to the CMPD. The case mix, outcome and activity for all admissions were briefly summarised. Results The mean quality level achieved by the CMPD for the 10 Directory of Clinical Databases criteria was 3.4 (on a scale of 1 = worst to 4 = best). The CMPD contained validated data on 129,647 admissions to 128 units. The median age was 63 years, and 59% were male. The mean Acute Physiology and Chronic Health Evaluation II score was 16.5. Mortality was 20.3% in the CMP unit and was 30.8% at ultimate discharge from hospital. Nonsurvivors stayed longer in intensive care than did survivors (median 2.0 days versus 1.7 days in the CMP unit) but had a shorter total hospital length of stay (9 days versus 16 days). Results for the CMPD were comparable with results from other published reports of UK critical care admissions. Conclusions The CMP uses rigorous methods to ensure data are complete, valid and reliable. The CMP scores well against published criteria for high-quality clinical databases.

  18. [Interdisciplinary centres in hospitals? A review of the literature].

    PubMed

    Erbsen, Astrid; Rüdiger-Stürchler, Marjam; Heberer, Michael

    2010-01-01

    The treatment of complex disease patterns demands knowledge, and hence the collaboration of many medical disciplines. Interdisciplinary approaches to treatment are thus superior to multidisciplinary ones in terms of quality and costs. To make use of those benefits, interdisciplinary centres have emerged at many hospitals. Our review of the literature has sought to answer two questions: 1) Is there any evidence for the relationship 'creation of a centre = creation of interdisciplinarity'? 2) How can interdisciplinarity be fostered in centres? Medical and economic publications were identified via key terms in PubMed, Web of Knowledge and WISO. Using their references, further publications were researched. Contributions that complied with predefined criteria were included. For 75 of the 78 publications interdisciplinarity is the means to achieve a centre's objectives in quality and cost. Almost all the positive results achieved in centres, e.g., an increase in number of cases, are attributed to the seemingly established interdisciplinarity, without any evidence to substantiate this interrelation (question 1). The recommendations for creating the requested lively interdisciplinarity are insufficient, since technical arrangements dominate and the importance of social and therewith behavioural aspects is often forgotten--the findings of the respective literature remain unappreciated (question 2). Moreover, pertinent research as well as qualitative longitudinal research designs activating the knowledge of physicians, social scientists and economists should be used to investigate the interdisciplinarity sought for in centres.

  19. The digital eczema centre utrecht.

    PubMed

    van Os-Medendorp, Harmieke; van Veelen, Carien; Hover, Maaike; Eland-de Kok, Petra; Bruijnzeel-Koomen, Carla; Sonnevelt, Gert-Jan; Mensing, Geert; Pasmans, Suzanne

    2010-01-01

    The University Medical Centre Utrecht (UMC Utrecht) has developed an eczema portal that combines e-consulting, monitoring and self-management training by a dermatology nurse online for patients and parents of young children with atopic dermatitis (AD). Patient satisfaction with the portal was high. It could be extended to become a Digital Eczema Centre for multidisciplinary collaboration between health-care providers from different locations and the patient. Before starting the construction of the Digital Eczema Centre, the feasibility was examined by carrying out a business case analysis. The purposes, strength and weaknesses showed that the Digital Eczema Centre offered opportunities to improve care for patients with AD. The financial analysis resulted in a medium/best case scenario with a positive result of euro50-240,000 over a period of five years. We expect that the Digital Eczema Centre will increase the accessibility and quality of care. The web-based patient record and the digital chain-of-care promote the involvement of patients, parents and multidisciplinary teams as well as the continuity and coordination of care.

  20. WISB: Warwick Integrative Synthetic Biology Centre

    PubMed Central

    McCarthy, John

    2016-01-01

    Synthetic biology promises to create high-impact solutions to challenges in the areas of biotechnology, human/animal health, the environment, energy, materials and food security. Equally, synthetic biologists create tools and strategies that have the potential to help us answer important fundamental questions in biology. Warwick Integrative Synthetic Biology (WISB) pursues both of these mutually complementary ‘build to apply’ and ‘build to understand’ approaches. This is reflected in our research structure, in which a core theme on predictive biosystems engineering develops underpinning understanding as well as next-generation experimental/theoretical tools, and these are then incorporated into three applied themes in which we engineer biosynthetic pathways, microbial communities and microbial effector systems in plants. WISB takes a comprehensive approach to training, education and outreach. For example, WISB is a partner in the EPSRC/BBSRC-funded U.K. Doctoral Training Centre in synthetic biology, we have developed a new undergraduate module in the subject, and we have established five WISB Research Career Development Fellowships to support young group leaders. Research in Ethical, Legal and Societal Aspects (ELSA) of synthetic biology is embedded in our centre activities. WISB has been highly proactive in building an international research and training network that includes partners in Barcelona, Boston, Copenhagen, Madrid, Marburg, São Paulo, Tartu and Valencia. PMID:27284024

  1. WISB: Warwick Integrative Synthetic Biology Centre.

    PubMed

    McCarthy, John

    2016-06-15

    Synthetic biology promises to create high-impact solutions to challenges in the areas of biotechnology, human/animal health, the environment, energy, materials and food security. Equally, synthetic biologists create tools and strategies that have the potential to help us answer important fundamental questions in biology. Warwick Integrative Synthetic Biology (WISB) pursues both of these mutually complementary 'build to apply' and 'build to understand' approaches. This is reflected in our research structure, in which a core theme on predictive biosystems engineering develops underpinning understanding as well as next-generation experimental/theoretical tools, and these are then incorporated into three applied themes in which we engineer biosynthetic pathways, microbial communities and microbial effector systems in plants. WISB takes a comprehensive approach to training, education and outreach. For example, WISB is a partner in the EPSRC/BBSRC-funded U.K. Doctoral Training Centre in synthetic biology, we have developed a new undergraduate module in the subject, and we have established five WISB Research Career Development Fellowships to support young group leaders. Research in Ethical, Legal and Societal Aspects (ELSA) of synthetic biology is embedded in our centre activities. WISB has been highly proactive in building an international research and training network that includes partners in Barcelona, Boston, Copenhagen, Madrid, Marburg, São Paulo, Tartu and Valencia. © 2016 The Author(s).

  2. New roles for poison control centres in the developing countries.

    PubMed

    Laborde, Amalia

    2004-05-20

    The primary mission of poison control centres has always been an improvement in the poisoned patients' care and poison prevention. The need to reach this mission implies that many functions and roles must be accomplished. Many centres, even in developing countries, are multifunctional and provide a broad toxicological information service. However, the main challenges of poison centres in developing countries are still treatment information, formal training, laboratory services accessibility and availability of antidotes. At the same time poison centres from developing countries need to accomplish their public health mission through strengthening and expansion of some well-defined roles like toxico-surveillance and environmental health monitoring according to the prevailing and future toxicological problems. Poison control centres from developing countries continue to face old challenges but cannot ignore the new ones that appear in the globalised world. Poison centres have a vital role for environmental exposure surveillance systems for sentinel event detection. Poison centres offer real-time and continuous data needed for preparation and response during such events and also offer a means to report health concerns. Centres from South America were involved in some of the most important environmental health problems of the region e.g., lead contamination (children), children 'occupational' poisoning, and flour contamination with fusarium toxins. Furthermore, poison centres can be the markers of risk factors or identifiers of vulnerable population e.g., changes in drugs prescription patterns, unusual patterns of addiction, unexpected product uses, children abuse scenarios or undetected sources of environmental contamination. In an era of evidence-based medicine and research, toxico-vigilance based on the millions of cases registered by poison centres everyday acquires more and more importance. A new approach of the toxico-vigilance and preventive roles of poison

  3. Person-centred reflective practice.

    PubMed

    Devenny, Bob; Duffy, Kathleen

    Person-centred health and person-centred care have gained prominence across the UK following the publication of reports on public inquiries exploring failings in care. Self-awareness and participation in reflective practice are recognised as vital to supporting the person-centred agenda. This article presents an education framework for reflective practice, developed and used in one NHS board in Scotland, and based on the tenets of the clinical pastoral education movement. Providing an insight into the usefulness of a spiritual component in the reflective process, the framework provides an opportunity for nurses and other healthcare professionals to examine the spiritual dimensions of patient encounters, their own values and beliefs, and the effect these may have on their practice.

  4. Human-centred approaches in slipperiness measurement

    PubMed Central

    Grönqvist, Raoul; Abeysekera, John; Gard, Gunvor; Hsiang, Simon M.; Leamon, Tom B.; Newman, Dava J.; Gielo-Perczak, Krystyna; Lockhart, Thurmon E.; Pai, Clive Y.-C.

    2010-01-01

    A number of human-centred methodologies—subjective, objective, and combined—are used for slipperiness measurement. They comprise a variety of approaches from biomechanically-oriented experiments to psychophysical tests and subjective evaluations. The objective of this paper is to review some of the research done in the field, including such topics as awareness and perception of slipperiness, postural and balance control, rating scales for balance, adaptation to slippery conditions, measurement of unexpected movements, kinematics of slipping, and protective movements during falling. The role of human factors in slips and falls will be discussed. Strengths and weaknesses of human-centred approaches in relation to mechanical slip test methodologies are considered. Current friction-based criteria and thresholds for walking without slipping are reviewed for a number of work tasks. These include activities such as walking on a level or an inclined surface, running, stopping and jumping, as well as stair ascent and descent, manual exertion (pushing and pulling, load carrying, lifting) and particular concerns of the elderly and mobility disabled persons. Some future directions for slipperiness measurement and research in the field of slips and falls are outlined. Human-centred approaches for slipperiness measurement do have many applications. First, they are utilized to develop research hypotheses and models to predict workplace risks caused by slipping. Second, they are important alternatives to apparatus-based friction measurements and are used to validate such methodologies. Third, they are used as practical tools for evaluating and monitoring slip resistance properties of foot wear, anti-skid devices and floor surfaces. PMID:11794763

  5. The IOC Centres of Excellence bring prevention to sports medicine.

    PubMed

    Engebretsen, Lars; Bahr, Roald; Cook, Jill L; Derman, Wayne; Emery, Carolyn A; Finch, Caroline F; Meeuwisse, Willem H; Schwellnus, Martin; Steffen, Kathrin

    2014-09-01

    The protection of an athlete's health and preventing injuries and illnesses in sport are top priorities for the IOC and its Medical Commission. The IOC therefore partners with selected research centres around the world and supports research in the field of sports medicine. This has enabled the IOC to develop an international network of expert scientists and clinicians in sports injury and disease prevention research. The IOC wants to promote injury and disease prevention and the improvement of physical health of the athlete by: (1) establishing long-term research programmes on injury and disease prevention (including studies on basic epidemiology, risk factors, injury mechanisms and intervention), (2) fostering collaborative relationships with individuals, institutions and organisations to improve athletes' health, (3) implementing and collaborating with applied, ongoing and novel research and development within the framework and long-term strategy of the IOC and (4) setting up knowledge translation mechanisms to share scientific research results with the field throughout the Olympic Movement and sports community and converting these results into concrete actions to protect the health of the athletes. In 2009, the IOC also identified four research centres that had an established track record in research, educational and clinical activities to achieve these ambitions: (1) the Australian Centre for Research into Injury in Sport and its Prevention (ACRISP), Australia; (2) the Sport Injury Prevention Research Centre (SIPRC), Canada; (3) the Clinical Sport and Exercise Medicine Research (CSEM), South Africa and (4) the Oslo Sports Trauma Research Center (OSTRC), Norway. This paper highlights the work carried out by these four IOC Centres of Excellence over the past 6 years and their contribution to the world of sports medicine. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.

  6. How the "Understanding Research Evidence" Web-Based Video Series From the National Collaborating Centre for Methods and Tools Contributes to Public Health Capacity to Practice Evidence-Informed Decision Making: Mixed-Methods Evaluation.

    PubMed

    Chan, Linda; Mackintosh, Jeannie; Dobbins, Maureen

    2017-09-28

    The National Collaborating Centre for Methods and Tools (NCCMT) offers workshops and webinars to build public health capacity for evidence-informed decision-making. Despite positive feedback for NCCMT workshops and resources, NCCMT users found key terms used in research papers difficult to understand. The Understanding Research Evidence (URE) videos use plain language, cartoon visuals, and public health examples to explain complex research concepts. The videos are posted on the NCCMT website and YouTube channel. The first four videos in the URE web-based video series, which explained odds ratios (ORs), confidence intervals (CIs), clinical significance, and forest plots, were evaluated. The evaluation examined how the videos affected public health professionals' practice. A mixed-methods approach was used to examine the delivery mode and the content of the videos. Specifically, the evaluation explored (1) whether the videos were effective at increasing knowledge on the four video topics, (2) whether public health professionals were satisfied with the videos, and (3) how public health professionals applied the knowledge gained from the videos in their work. A three-part evaluation was conducted to determine the effectiveness of the first four URE videos. The evaluation included a Web-based survey, telephone interviews, and pretest and posttests, which evaluated public health professionals' experience with the videos and how the videos affected their public health work. Participants were invited to participate in this evaluation through various open access, public health email lists, through informational flyers and posters at the Canadian Public Health Association (CPHA) conference, and through targeted recruitment to NCCMT's network. In the Web-based surveys (n=46), participants achieved higher scores on the knowledge assessment questions from watching the OR (P=.04), CI (P=.04), and clinical significance (P=.05) videos but not the forest plot (P=.12) video, as

  7. The Makana Regional Centre of Expertise: Experiments in Social Learning

    ERIC Educational Resources Information Center

    Lotz-Sisitka, Heila; O'Donoghue, Rob; Wilmot, Di

    2010-01-01

    This article deliberates the possibilities for Regional Centres of Expertise (RCEs) to become "experiments" in social learning. The purpose of the article is to advance the broader research agenda of RCEs through reflection on the empirical research agenda of one RCE, Makana RCE in South Africa. As such it opens questions on how we might…

  8. Centre for Applied Language Studies, University of Limerick, Ireland

    ERIC Educational Resources Information Center

    Chambers, Angela; Atkinson, David; Farr, Fiona

    2015-01-01

    The Centre for Applied Language Studies (CALS), founded in 1997, brings together researchers and postgraduate students from several disciplines in language studies, and is structured in three research clusters: New learning environments; Discourse, society and identity; and Plurilingualism and language policy. There is a certain amount of…

  9. The Makana Regional Centre of Expertise: Experiments in Social Learning

    ERIC Educational Resources Information Center

    Lotz-Sisitka, Heila; O'Donoghue, Rob; Wilmot, Di

    2010-01-01

    This article deliberates the possibilities for Regional Centres of Expertise (RCEs) to become "experiments" in social learning. The purpose of the article is to advance the broader research agenda of RCEs through reflection on the empirical research agenda of one RCE, Makana RCE in South Africa. As such it opens questions on how we might…

  10. Centre for Applied Language Studies, University of Limerick, Ireland

    ERIC Educational Resources Information Center

    Chambers, Angela; Atkinson, David; Farr, Fiona

    2015-01-01

    The Centre for Applied Language Studies (CALS), founded in 1997, brings together researchers and postgraduate students from several disciplines in language studies, and is structured in three research clusters: New learning environments; Discourse, society and identity; and Plurilingualism and language policy. There is a certain amount of…

  11. Lively Bureaucracy? The ESRC's Doctoral Training Centres and UK Universities

    ERIC Educational Resources Information Center

    Lunt, Ingrid; McAlpine, Lynn; Mills, David

    2014-01-01

    This paper explores the changing relationships between the UK government, its research councils and universities, focusing on the governing, funding and organisation of doctoral training. We use the Doctoral Training Centres (DTCs) funded by the Economic and Social Research Council (ESRC) as a prism through which to study the shifting nature of…

  12. Lively Bureaucracy? The ESRC's Doctoral Training Centres and UK Universities

    ERIC Educational Resources Information Center

    Lunt, Ingrid; McAlpine, Lynn; Mills, David

    2014-01-01

    This paper explores the changing relationships between the UK government, its research councils and universities, focusing on the governing, funding and organisation of doctoral training. We use the Doctoral Training Centres (DTCs) funded by the Economic and Social Research Council (ESRC) as a prism through which to study the shifting nature of…

  13. Statistics Canada's Definition and Classification of Postsecondary and Adult Education Providers in Canada. Culture, Tourism and the Centre for Education Statistics. Research Paper. Catalogue no. 81-595-M No. 071

    ERIC Educational Resources Information Center

    Orton, Larry

    2009-01-01

    This document outlines the definitions and the typology now used by Statistics Canada's Centre for Education Statistics to identify, classify and delineate the universities, colleges and other providers of postsecondary and adult education in Canada for which basic enrollments, graduates, professors and finance statistics are produced. These new…

  14. Doctorate Education in Canada: Findings from the Survey of Earned Doctorates, 2005/2006. Culture, Tourism and the Centre for Education Statistics. Research Paper. Catalogue no. 81-595-M No. 069

    ERIC Educational Resources Information Center

    King, Darren; Eisl-Culkin, Judy; Desjardins, Louise

    2008-01-01

    "Doctorate Education in Canada: Findings from the Survey of Earned Doctorates, 2005/2006" is the third paper in a series of reports written by the Learning Policy Directorate of Human Resources and Social Development Canada (HRSDC) and the Centre for Education Statistics of Statistics Canada. Each report presents an overview of doctoral…

  15. Statistics Canada's Definition and Classification of Postsecondary and Adult Education Providers in Canada. Culture, Tourism and the Centre for Education Statistics. Research Paper. Catalogue no. 81-595-M No. 071

    ERIC Educational Resources Information Center

    Orton, Larry

    2009-01-01

    This document outlines the definitions and the typology now used by Statistics Canada's Centre for Education Statistics to identify, classify and delineate the universities, colleges and other providers of postsecondary and adult education in Canada for which basic enrollments, graduates, professors and finance statistics are produced. These new…

  16. Questioning Centre-Periphery Platforms

    ERIC Educational Resources Information Center

    Postiglione, Gerard A.

    2005-01-01

    How much is hegemony and how much is self-determination in the higher education systems in Southeast Asia? This paper argues that while the question of centre and periphery is still relevant to the analysis of international university systems, the analytical frameworks from which it has arisen may lose viability in the long term. Southeast Asian…

  17. The Tehran Book Processing Centre.

    ERIC Educational Resources Information Center

    Harvey, John F.

    Establishment of the Tehran Book Processing Centre (Tebroc) was proposed in the Spring of 1968. This document is a descriptive and historical account of the center, and a description of its contributions to Iranian processing development. The center was modeled, to a certain extent, after Bro-Dart's Alanar in Williamsport, Pennsylvania. Tebroc was…

  18. Reliability-centred approach evaluated.

    PubMed

    Steele, William R

    2005-02-01

    Reliability-centred maintenance is the process used to determine the most effective maintenance approach. RCM takes a system approach when evaluating the consequences of failure. Run-to-fail is sometimes an acceptable maintenance approach. Condition monitoring is often the most effective maintenance approach.

  19. Changing the paradigm for marine data production, dissemination and validation with Collaborative Platforms. The GlobColour webservice, a prime example which leads to the integration of CWE technologies to build-up virtual research centres.

    NASA Astrophysics Data System (ADS)

    Fanton d'Andon, Odile; Martin-Lauzer, François-Regis; Mangin, Antoine; Barrot, Gilbert; Clouaire, Stephane; Sardou, Olivier; Demaria, Julien; Serra, Romain

    2015-04-01

    data for their particular applications. • Match-ups using real-time EO data and data collected from bio-Argo floats are processed automatically on-the-fly. • This is possible because quality control of the bio-Argo float data is also automated. A dedicated interface has been set-up to monitor the whole fleet of Bio-Argo floats, and access detailed information from each acquired profile. Finally, a Collaborative Platform has been developed to support R&D activities in parallel to the standard production chain, enabling users to work remotely within a dedicated production environment in order to develop new algorithms and methods. The Collaborative Platform is based on a Collaborative Working Environment, a secured IT environment mixing hardware and software elements. It provides access to raw data, to processing and storage facilities, to specific applicative software (e.g. visualisation and post-processing tools). In addition, collaborative tools to exchange data, information and ideas between participants (through forums, web-conferencing…) contribute to create a "Virtual Research Centre" preparing future evolutions of the service. Acknowledgements: This research received funding from the following projects: • MCGS project funded by the Fonds Unique Interministériel, French regional funds PACA and Bretagne, the Fonds Européen de Développement Régional • FP7 Copernicus projects OSS2015 (grant n° 282723) and E-AIMS (grant n° 312642). • The French EQUIPEX project NAOS

  20. Towards Human-Centred Design

    NASA Astrophysics Data System (ADS)

    Bannon, Liam J.

    The field of HCI has evolved and expanded dramatically since its origin in the early 1980’s. The HCI community embraces a large community of researchers and practitioners around the world, from a variety of disciplinary backgrounds in the human and social sciences, engineering and informatics, and more recently, the arts and design disciplines. This kaleidoscope of cultures and disciplines as seen at INTERACT Conferences provides a rich pool of resources for examining our field. Applications are increasingly exploring our full range of sensory modalities, and merging the digital and physical worlds. WiFi has opened up a huge design space for mobile applications. A focus on usability of products and services has been complemented by an emphasis on engagement, enjoyment and experience. With the advent of ubiquitous computing, and the emergence of “The Internet of Things”, new kinds of more open infrastructures make possible radically new kinds of applications. The sources of innovation have also broadened, to include human and social actors outside of the computing and design organizations. The question is to what extent is our mainstream thinking in the HCI field ready for the challenges of this Brave New World? Do the technological and social innovations that we see emerging require us to re-shape, or even, re-create, our field, or is it a case of a more gradual evolution and development of that which we already know? In this closing Keynote, I will provide a perspective on the evolution and development of the HCI field, looking backwards as well as forwards, in order to determine what are some of the changes of significance in the field. This “broad-brush” approach to what I term “ human-centred design” will be complemented by the examination of specific projects and applications, to help anchor some of the discussion. Areas such as user-centred design, participatory design, computer-supported cooperative work and learning, and interaction design, in

  1. Fungal genetic resource centres and the genomic challenge.

    PubMed

    Ryan, Matthew J; Smith, David

    2004-12-01

    Fungal research and education has for many years been supported by public service genetic resource centres, whose roles have been to maintain, preserve and supply living cultures to the research community. In the genomic era, genetic resource centres are perhaps more important than ever before. The cultures held, many of which are described and validated by expert biosystematists, are valuable resources for the future. There is a need to supply genomic and proteomic research programmes with fully characterised organisms, as usage of organisms from unreliable sources can prove disastrous, not least in economical terms. However, mycologists often require more than just the organisms, for example, their associated information is vital for bioinformatic applications and some researchers may only require genomic DNA from the organism rather than the organism per se. Genetic resource centres are continually adapting to meet the needs of their users and the wider mycological research community, this associated with OECD international initiatives should ensure they exist to support research for many years to come. This review considers the impact of such initiatives, the current roles of fungal genetic resource centres, the mechanisms used to preserve organisms in a stable manner and the range of resources that are offered for genomic research.

  2. Business Models of High Performance Computing Centres in Higher Education in Europe

    ERIC Educational Resources Information Center

    Eurich, Markus; Calleja, Paul; Boutellier, Roman

    2013-01-01

    High performance computing (HPC) service centres are a vital part of the academic infrastructure of higher education organisations. However, despite their importance for research and the necessary high capital expenditures, business research on HPC service centres is mostly missing. From a business perspective, it is important to find an answer to…

  3. Business Models of High Performance Computing Centres in Higher Education in Europe

    ERIC Educational Resources Information Center

    Eurich, Markus; Calleja, Paul; Boutellier, Roman

    2013-01-01

    High performance computing (HPC) service centres are a vital part of the academic infrastructure of higher education organisations. However, despite their importance for research and the necessary high capital expenditures, business research on HPC service centres is mostly missing. From a business perspective, it is important to find an answer to…

  4. KNMI Data Centre: Easy access for all

    NASA Astrophysics Data System (ADS)

    van de Vegte, John; Som de Cerff, Wim; Plieger, Maarten; de Vreede, Ernst; Sluiter, Raymond; Willem Noteboom, Jan; van der Neut, Ian; Verhoef, Hans; van Versendaal, Robert; van Binnendijk, Martin; Kalle, Henk; Knopper, Arthur; Spit, Jasper; Mastop, Joeri; Klos, Olaf; Calis, Gijs; Ha, Siu-Siu; van Moosel, Wim; Klein Ikkink, Henk-Jan; Tosun, Tuncay

    2013-04-01

    KNMI is the Dutch institute for weather, climate research and seismology. It disseminates weather information to the public at large, the government, aviation and the shipping industry in the interest of safety, the economy and a sustainable environment. To gain insight into long-term developments KNMI conducts research on climate change. Making the knowledge, data and information on hand at KNMI accessible is one core activity. A huge part of the KNMI information is from numerical models, insitu sensor networks and remote sensing satellites. This digital collection is mostly internal only available and is a collection of non searchable , non standardized file formats, lacking documentation and has no references to scientific publications. With the KNMI Data Centre (KDC) project these issues are tackled. In the project a user driven development approach with SCRUM was chosen to get maximum user involvement in a relative short development timeframe. Building on open standards and proven open source technology (which includes in-house developed software like ADAGUC WMS and Portal) resulted in a first release in December 2012 This presentation will focus on the aspects of KDC relating to its technical challenges, the development strategy and the initial usage results of the data centre.

  5. International Workshop on Glasses and Ceramics, Hybrids and Nanocomposites from Gels (9th); Sol-Gel 󈨥 Held in Centre for Glass Research, The University of Sheffield, UK on 31 August-5 September 1997

    DTIC Science & Technology

    1998-01-01

    5581), Universite Montpellier II, F-34095 Montpellier Cedex 5 lionel@gdpc.univ-montp2.fr T. GULIK-KRZYWICKI Centre de Genetique Moleculaire-CNRS...hydrolysis and gelation can be manipulated separately. Compared with aqueous sys- tems, borosiloxanes formed in this anhydrous system References 1. H...molecular weight of the organic polymers, as well as temperature; a precise control of viscosity can usually be attained by manipulating these

  6. Worldwide Report, Telecommunications Policy, Research, and Development

    DTIC Science & Technology

    2007-11-02

    STATESMAN, 11 Sep 85) 20 All- India Radio To Gear Up External Services (M. Shamim; Bombay THE TIMES OF INDIA , 9 Sep 85) 22 More Details on Indigenous... Union Ministry has decided to set up two separate public sector enterprises for the telecom network In Bombay and Delhi. Once these corporations...during the Seventh Plan. CSO: 5550/0006 21 ALL- INDIA RADIO TO GEAR UP EXTERNAL SERVICES JPRS-TTP-85-025 21 October 1985 INDIA Bombay THE TIMES OF

  7. Client-centred empowering partnering in nursing.

    PubMed

    Brown, Darlene; McWilliam, Carol; Ward-Griffin, Catherine

    2006-01-01

    This paper explores nurses' experiences 1 year after an organization's commitment to providing a client-centred and client-empowering partnering approach to care. Historically, nurses' approach to providing care in all nursing contexts has been one of doing for clients, and previous studies have focused more on in-hospital care than on home care. However, the isolation inherent in in-home nursing and nurses' limited professional autonomy and power associated with physician control over patients in home care have been reported, as has their difficulty in finding the meaning and satisfaction of human connectedness and mutuality in nurse-client relationships. Overall, research to date does not inform us about how nurses might make a change toward a more client-centred and client-empowering approach to nursing. An interpretive phenomenological design was used to elicit in-depth understanding about Registered Nurses' experiences of providing care using this innovative empowerment model. A purposefully selected sample of eight Registered Nurses participated in in-depth interviews. Data were generated during 2002. Hermeneutic analysis was used to elicit themes and patterns emerging from the data. Caring, client-centredness and the context of in-home care were important in implementing the new partnering approach. Barriers encountered at system, organizational and personal levels distracted nurses from fully comprehending and enacting the approach. After a year, they had begun to contemplate potential strategies for partnering with clients, but had not yet explored the power of their professional autonomy. Nurses are inclined to practise within the expert model of service delivery. They need to work through issues of professional autonomy and rise to the challenge of exercising their autonomy within the current healthcare context if they are to attend more consistently to client-centred empowering partnering. The home care setting offers an excellent environment for

  8. Home as a hybrid centre of medication practice.

    PubMed

    Dew, Kevin; Chamberlain, Kerry; Hodgetts, Darrin; Norris, Pauline; Radley, Alan; Gabe, Jonathan

    2014-01-01

    This article presents research that explores how medications are understood and used by people in everyday life. An intensive process of data collection from 55 households was used in this research, which included photo-elicitation and diary-elicitation interviews. It is argued that households are at the very centre of complex networks of therapeutic advice and practice and can usefully be seen as hybrid centres of medication practice, where a plethora of available medications is assimilated and different forms of knowledge and expertise are made sense of. Dominant therapeutic frameworks are tactically manipulated in households in order for medication practices to align with the understandings, resources and practicalities of households. Understanding the home as a centre of medication practice decentralises the role of health advisors (whether mainstream or alternative) in wellness practices. © 2013 The Authors. Sociology of Health & Illness © 2013 Foundation for the Sociology of Health & Illness/John Wiley & Sons Ltd.

  9. European Centre for Disease Prevention and Control.

    PubMed

    Evans, Roger

    2014-11-04

    The European Centre for Disease Prevention and Control was set up in 2005 to strengthen Europe's defences against infectious diseases. The centre is an independent agency of the European Union and is based in Stockholm, Sweden.

  10. Communicating astronomy by the Unizul Science Centre

    NASA Astrophysics Data System (ADS)

    Beesham, A.; Beesham, N.

    2015-03-01

    The University of Zululand, situated along the east coast of KwaZulu-Natal, has a thriving Science Centre (USC) situated in the developing port city of Richards Bay. Over 30 000 learners visit the centre annually, and it consists of an exhibition area, an auditorium, lecture areas and offices. The shows consist of interactive games, science shows, competitions, quizzes and matriculation workshops. Outreach activities take place through a mobile science centre for schools and communities that cannot visit the centre.

  11. The cost for construction and operation of a simulation centre.

    PubMed

    Kurrek, M M; Devitt, J H

    1997-11-01

    Lack of financial information results in planning difficulties and may delay the introduction of simulator based education. We collected data from an existing simulation centre and describe a construction and operating budget to facilitate planning and construction for interested institutions. After obtaining approval from the managing board, the plans and financial statements of the Canadian Simulation Centre, Sunnybrook Health Science Centre, University of Toronto were reviewed from the period from July 1994 through June 1996. Costs were calculated from the financial reports and separated into construction and operation phases. A list of the ongoing educational and research activities was compiled. All dollar figures are expressed in 1996 Canadian Dollars. The planning and construction took place from July 1994 through June 1995. Construction costs for the simulation centre totalled $665,000, of which 85% was related to capital equipment purchases and 15% for salary support. The net costs of ongoing education and research activities (3.35 days/week) were $167,250 from July 1995 through June 1996. About 65% of this consisted of salary support and was absorbed by the existing educational resources of the University of Toronto Department of Anaesthesia. Substantial resources are required for the construction of a simulation centre ($665,000) primarily use of capital equipment purchases. However, there is also a considerable operating cost per year ($167,250) which consists mostly of salary support.

  12. Teaching and Learning Centres: Towards Maturation

    ERIC Educational Resources Information Center

    Challis, Di; Holt, Dale; Palmer, Stuart

    2009-01-01

    Approximately 70% of Australian Teaching and Learning Centres have been restructured and/or have undergone leadership changes in the last three years. The volatility of this environment reflects the number of significant challenges faced by Teaching and Learning Centres. In determining what makes Centres successful, the issues that are likely to…

  13. Small Steps towards Student-Centred Learning

    ERIC Educational Resources Information Center

    Jacobs, George M.; Toh-Heng, Hwee Leng

    2013-01-01

    Student centred learning classroom practices are contrasted with those in teacher centred learning classrooms. The discussion focuses on the theoretical underpinnings of the former, and provides nine steps and tips on how to implement student centred learning strategies, with the aim of developing the 21st century skills of self-directed and…

  14. Sofia University GNSS Analysis Centre (SUGAC)

    NASA Astrophysics Data System (ADS)

    Simeonov, Tzvetan; Sidorov, Dmitry; Teferle, Norman; Guerova, Guergana; Egova, Evgenia; Vassileva, Keranka; Milev, Ivo; Milev, Georgi

    2015-04-01

    The Sofia University GNSS Analysis Centre (SUGAC, suada.phys.uni-sofia.bg) is a new analysis centre established via collaboration between the Department of Meteorology and Geophysics of Sofia University, the IPOS - BuliPOS GNSS network in Bulgaria and the University of Luxembourg. In April 2014, the first processing campaign took place. One year GNSS data from 7 stations of the BuliPOS network are processed in collaboration with the University of Luxembourg. Tropospheric products (Zenith Total Delay and gradients) with 5 min temporal resolution are obtained using the NAPEOS software, developed by ESA. The tropospheric products from this campaign will be used for validation of the Weather Research and Forecasting (WRF) model as well as for case studies during intense precipitation events and fog. In this work the WRF model validation for Bulgaria will be presented. Future work will be the establishment of autonomous near real-time processing of the regional ground-based GNSS network in Southeast Europe in support of the EUMETNET E-GVAP and COST ES1206 "Advanced Global Navigation Satellite Systems for Severe Weather Events and Climate" projects.

  15. Differentiation Potential of O Bombay Human-Induced Pluripotent Stem Cells and Human Embryonic Stem Cells into Fetal Erythroid-Like Cells

    PubMed Central

    Ganji, Fatemeh; Abroun, Saeid; Baharvand, Hossein; Aghdami, Nasser; Ebrahimi, Marzieh

    2015-01-01

    Objective There is constant difficulty in obtaining adequate supplies of blood components, as well as disappointing performance of "universal" red blood cells. Advances in somatic cell reprogramming of human-induced pluripotent stem cells (hiPSCs) have provided a valuable alternative source to differentiate into any desired cell type as a therapeutic promise to cure many human disease. Materials and Methods In this experimental study, we examined the erythroid differentiation potential of normal Bombay hiPSCs (B-hiPSCs) and compared results to human embryonic stem cell (hESC) lines. Because of lacking ABO blood group expression in B-hiPSCs, it has been highlighted as a valuable source to produce any cell type in vitro. Results Similar to hESC lines, hemangioblasts derived from B-hiPSCs expressed approximately 9% KDR+CD31+ and approximately 5% CD31+CD34+. In semisolid media, iPSC and hESC-derived hemangioblast formed mixed type of hematopoietic colony. In mixed colonies, erythroid progenitors were capable to express CD71+GPA+HbF+ and accompanied by endothelial cells differentiation. Conclusion Finally, iPS and ES cells have been directly induced to erythropoiesis without hemangioblast formation that produced CD71+HbF+ erythroid cells. Although we observed some variations in the efficiency of hematopoietic differentiation between iPSC and ES cells, the pattern of differentiation was similar among all three tested lines. PMID:25685733

  16. Maintaining health: proactive client-oriented community day treatment centres for the chronic mentally ill.

    PubMed

    Yurkovich, E; Smyer, T; Dean, L

    1999-02-01

    This grounded theory study compared the definition of health by clients of two rural mental health day treatment centres, Big Sky Centre and Montana Centre. Based on an original grounded theory study of seven chronic mentally ill/disabled clients in Big Sky Centre (Yurkovich et al. 1997), the core variable, 'preventing loss of control' and related properties, were validated with nine residents of Montana Centre. While establishing a 'fit' with previous research findings, differences emerged between these two centres. These differences related to the staffs' philosophical approaches in providing treatment to the chronic mentally ill. Big Sky Centre care providers empowered their clients to learn new behaviours from their peers and assume new roles such as newcomer, member and leader. They also encouraged a prosocial attitude, and created a sense of belonging through valued involvement in their treatment. Montana Centre clients were not empowered to try out new behaviours in the treatment environment, or seek social support networks among their peers at the centre, which would foster a sense of belonging. The result was that clients from Montana Centre relied on the formal healthcare system more often than clients from the Big Sky Centre. The competing forces in healthcare today--family members, mental health providers, and insurance or managed care providers--make it easy to lose sight of or fail to gain the client's perspective about their health status and maintenance, particularly as it concerns day treatment centres. The importance of the day treatment centre as a therapeutic community which requires educational processes, innovative nursing practice, and client-centred interventions will be discussed.

  17. Learner Centred Design for a Hybrid Interaction Application

    ERIC Educational Resources Information Center

    Wood, Simon; Romero, Pablo

    2010-01-01

    Learner centred design methods highlight the importance of involving the stakeholders of the learning process (learners, teachers, educational researchers) at all stages of the design of educational applications and of refining the design through an iterative prototyping process. These methods have been used successfully when designing systems…

  18. Learner Centred Design for a Hybrid Interaction Application

    ERIC Educational Resources Information Center

    Wood, Simon; Romero, Pablo

    2010-01-01

    Learner centred design methods highlight the importance of involving the stakeholders of the learning process (learners, teachers, educational researchers) at all stages of the design of educational applications and of refining the design through an iterative prototyping process. These methods have been used successfully when designing systems…

  19. Centres for People with Intellectual Disabilities: Attendees' Perceptions of Benefit

    ERIC Educational Resources Information Center

    Gajewska, Urszula; Trigg, Richard

    2016-01-01

    Background: Day and community learning centres aim to provide intellectually disabled (ID) people with social support, life skills and greater control over their lives. However, there is little research exploring the benefits of attendance from the perspective of attendees and whether these goals are met. Materials and methods: Unstructured…

  20. An Emerging Person Centred Model for Problem-Based Learning

    ERIC Educational Resources Information Center

    Clouston, Teena J.; Whitcombe, Steven W.

    2005-01-01

    This article sets out to offer the reader an opportunity to engage with our emerging ideas about a reflective, person centred model for students and facilitators using problem-based learning (PBL). The model developed initially through several strands of qualitative inquiry including research with students, immersion in the existing literature and…

  1. Centres for People with Intellectual Disabilities: Attendees' Perceptions of Benefit

    ERIC Educational Resources Information Center

    Gajewska, Urszula; Trigg, Richard

    2016-01-01

    Background: Day and community learning centres aim to provide intellectually disabled (ID) people with social support, life skills and greater control over their lives. However, there is little research exploring the benefits of attendance from the perspective of attendees and whether these goals are met. Materials and methods: Unstructured…

  2. The Vision Education Centre: A Multi-Level Educational Tool.

    ERIC Educational Resources Information Center

    Junghans, Barbara M.; Crewther, Sheila G.

    1992-01-01

    The University of New South Wales (Australia) has established the Vision Education Centre, a clinic designed to attract more pediatric patients for care by senior optometry students. The center uses interactive learning principles to teach elementary school children about optics, provides screening, and offers research opportunities. (MSE)

  3. Development of the National Documentation Centre. Hashemite Kingdom of Jordan.

    ERIC Educational Resources Information Center

    de Grolier, Eric

    The development of a National Documentation Centre in the Hashemite kingdom of Jordan's East Bank is described in five major sections including basic data (geographical background, historical background, population, natural resources, services, finance, research and development, and planning); the information situation (user studies, media, data…

  4. Student-Centred and Teacher-Centred Learning Environments: What Students Think

    ERIC Educational Resources Information Center

    Elen, Jan; Clarebout, Geraldine; Leonard, Rebecca; Lowyck, Joost

    2007-01-01

    This contribution explores the relationship between teacher-centred and student-centred learning environments from a student's perspective. Three different views with respect to this relationship can be retrieved. The "balance" view suggests that the more teacher-centred a learning environment is, the less student-centred it is and vice versa. The…

  5. The DEMETER Science Mission Centre

    NASA Astrophysics Data System (ADS)

    Lagoutte, D.; Brochot, J. Y.; de Carvalho, D.; Elie, F.; Harivelo, F.; Hobara, Y.; Madrias, L.; Parrot, M.; Pinçon, J. L.; Berthelier, J. J.; Peschard, D.; Seran, E.; Gangloff, M.; Sauvaud, J. A.; Lebreton, J. P.; Stverak, S.; Travnicek, P.; Grygorczuk, J.; Slominski, J.; Wronowski, R.; Barbier, S.; Bernard, P.; Gaboriaud, A.; Wallut, J. M.

    2006-04-01

    The DEMETER Scientific Mission Centre (SMC) has been developed and is operated by the Laboratoire de Physique et Chimie de l'Environnement (LPCE). The SMC commands the instruments of the scientific payload, collects and distributes DEMETER data and associated products to the DEMETER international community. The SMC has been designed to maximize scientific return and to reduce development and exploitation costs for the DEMETER project. This paper describes the SMC's data processing system, data server and methods of payload operation, and presents associated hardware and software architectures.

  6. European hospital managers' perceptions of patient-centred care.

    PubMed

    Taylor, Angelina; Groene, Oliver

    2015-01-01

    The spotlight has recently been placed on managers' responsibility for patient-centred care as a result of Mid Staffordshire NHS Foundation Trust failings. In previous research, clinicians reported that managers do not have an adequate structured plan for implementing patient-centred care. The purpose of this paper is to assess the perceptions of European hospital management with respect to factors affecting the implementation of a patient-centred approach. In total, 15 semi-structured interviews were conducted with hospital managers (n=10), expert country informants (n=2), patient organisations (n=2) and a user representative (n=1) from around Europe. Participants were purposively and snowball sampled. Interviews were analysed using framework analysis. Most participants felt that current levels of patient-centred care are inadequate, but accounted that there were a number of macro, meso and micro challenges they faced in implementing this approach. These included budget constraints, political and historical factors, the resistance of clinicians and other frontline staff. Organisational culture emerged as a central theme, shaped by these multi-level factors and influencing the way in which patient-centred care was borne out in the hospital. Participants proposed that the needs of patients might be better met through increasing advocacy by patient organisations and greater staff contact with patients. This study is the first of its kind to obtain management views from around Europe. It offers an insight into different models of how patient-centred care is realised by management. It indicates that managers see the value of a patient-centred approach but that they feel restricted by a number of factors at multiple levels.

  7. Perceptual centres in speech - an acoustic analysis

    NASA Astrophysics Data System (ADS)

    Scott, Sophie Kerttu

    Perceptual centres, or P-centres, represent the perceptual moments of occurrence of acoustic signals - the 'beat' of a sound. P-centres underlie the perception and production of rhythm in perceptually regular speech sequences. P-centres have been modelled both in speech and non speech (music) domains. The three aims of this thesis were toatest out current P-centre models to determine which best accounted for the experimental data bto identify a candidate parameter to map P-centres onto (a local approach) as opposed to the previous global models which rely upon the whole signal to determine the P-centre the final aim was to develop a model of P-centre location which could be applied to speech and non speech signals. The first aim was investigated by a series of experiments in which a) speech from different speakers was investigated to determine whether different models could account for variation between speakers b) whether rendering the amplitude time plot of a speech signal affects the P-centre of the signal c) whether increasing the amplitude at the offset of a speech signal alters P-centres in the production and perception of speech. The second aim was carried out by a) manipulating the rise time of different speech signals to determine whether the P-centre was affected, and whether the type of speech sound ramped affected the P-centre shift b) manipulating the rise time and decay time of a synthetic vowel to determine whether the onset alteration was had more affect on P-centre than the offset manipulation c) and whether the duration of a vowel affected the P-centre, if other attributes (amplitude, spectral contents) were held constant. The third aim - modelling P-centres - was based on these results. The Frequency dependent Amplitude Increase Model of P-centre location (FAIM) was developed using a modelling protocol, the APU GammaTone Filterbank and the speech from different speakers. The P-centres of the stimuli corpus were highly predicted by attributes of

  8. Launch of the London Centre for Nanotechnology.

    PubMed

    Aeppli, Gabriel; Pankhurst, Quentin

    2006-12-01

    Is nanomedicine an area with the promise that its proponents claim? Professors Gabriel Aeppli and Quentin Pankhurst explore the issues in light of the new London Centre for Nanotechnology (LCN)--a joint enterprise between Imperial College and University College London--opened on November 7, 2006. The center is a multidisciplinary research initiative that aims to bridge the physical, engineering and biomedical sciences. In this interview, Professor Gabriel Aeppli, LCN co-Director, and Deputy Director Professor Quentin Pankhurst discuss the advent and future role of the LCN with Nanomedicine's Morag Robertson. Professor Aeppli was formerly with NEC, Bell Laboratories and MIT and has more than 15 years' experience in the computer and telecommunications industry. Professor Pankhurst is a physicist with more than 20 years' experience of working with magnetic materials and nanoparticles, who now works closely with clinicians and medics on innovative healthcare applications. He also recently formed the new start-up company Endomagnetics Inc.

  9. Centre of Excellence For Simulation Education and Innovation (CESEI).

    PubMed

    Qayumi, A Karim

    2010-01-01

    Simulation is becoming an integral part of medical education. The American College of Surgeons (ACS) was the first organization to recognize the value of simulation-based learning, and to award accreditation for educational institutions that aim to provide simulation as part of the experiential learning opportunity. Centre of Excellence for Simulation Education and Innovation (CESEI) is a multidisciplinary and interprofessional educational facility that is based at the University of British Columbia (UBC) and Vancouver Costal Health Authority (VCH). Centre of Excellence for Simulation Education and Innovation's goal is to provide excellence in education, research, and healthcare delivery by providing a technologically advanced environment and learning opportunity using simulation for various groups of learners including undergraduate, postgraduate, nursing, and allied health professionals. This article is an attempt to describe the infrastructure, services, and uniqueness of the Centre of Excellence for Simulation Education and Innovation.

  10. Patient-centred measurement in ophthalmology – a paradigm shift

    PubMed Central

    Pesudovs, Konrad

    2006-01-01

    Ophthalmologists and researchers in ophthalmology understand what a rapidly evolving field ophthalmology is, and that to conduct good research it is essential to use the latest and best methods. In outcomes research, one modern initiative has been to conduct holistic measurement of outcomes inclusive of the patient's point of view; patient-centred outcome. This, of course, means including a questionnaire. However, the irony of trying to improve outcomes research by being inclusive of many measures is that the researcher may not be expert in all measures used. Certainly, few people conducting outcomes research in ophthalmology would claim to be questionnaire experts. Most tend to be experts in their ophthalmic subspecialty and probably simply choose a popular questionnaire that appears to fit their needs and think little more about it. Perhaps, unlike our own field, we assume that the field of questionnaire research is relatively stable. This is far from the case. The measurement of patient-centred outcomes with questionnaires is a rapidly evolving field. Indeed, over the last few years a paradigm shift has occurred in patient-centred measurement. PMID:16774690

  11. An Assessment of Nutritional Patterns in Early Childhood Centres in Zimbabwe: A Quest for Dietary Quality

    ERIC Educational Resources Information Center

    Runyowa, Julius; Podzo, Barbara Zvisinei; Kanyume, Patience

    2014-01-01

    The study explored the experiences of ECD centres in Masvingo district in terms of the quality of meals with regards to diversity and size of portions and WASH provisions. One school was purposively sampled. The research adopted a qualitative paradigm and used one ECD centre in Masvingo district as a case study. Data were gathered through…

  12. Cognitive Tools and Student-Centred Learning: Rethinking Tools, Functions and Applications

    ERIC Educational Resources Information Center

    Iiyoshi, Toru; Hannafin, Michael J.; Wang, Feng

    2005-01-01

    Although student-centred learning environments have recently attracted attention, such systems often place an unusual cognitive burden on the learner. Recent research suggests that cognitive tools can scaffold student-centred learning in these types of environments. This paper introduces and analyses problems and issues in the design and use of…

  13. Evaluation of the Behaviour Management Program at the Melbourne Juvenile Justice Centre. Working Paper 20.

    ERIC Educational Resources Information Center

    Semmens, Bob; Cook, Sandy; Grimwade, Cherry

    In 1998, researchers were requested to undertake an evaluation of a proposed new behavior program at the Melbourne Juvenile Justice Centre. The behavior management program at the Centre attempts to intervene constructively in the lives of young offenders. The project aims to increase the range of skills for management of clients' behaviors in a…

  14. Australian Teaching and Learning Centres through the Eyes of Their Directors: Characteristics, Capacities and Constraints

    ERIC Educational Resources Information Center

    Palmer, Stuart; Holt, Dale; Challis, Di

    2010-01-01

    This paper is based on research to identify common factors that contribute to the effective strategic leadership of teaching and learning centres. The second of three phases of data collection involved a survey of Directors of Australian teaching and learning centres. The data collected were quantitatively analysed using a range of descriptive,…

  15. Clarifying the Subject Centred Approach to Vocational Learning Theory: Negotiated Participation

    ERIC Educational Resources Information Center

    Smith, Raymond

    2012-01-01

    Workplace learning research has taken what could be termed a turn to the subjective. This brings the person and agency of workers to the centre of work learning theory. Within sociocultural perspectives that emphasise participative practice as the basis of vocational learning, a key concept that emerges from this subject centred approach is…

  16. Being Subject-Centred: A Philosophy of Teaching and Implications for Higher Education

    ERIC Educational Resources Information Center

    Morrison-Saunders, Angus; Hobson, Julia

    2013-01-01

    Being subject-centred as a higher education teacher offers a rich and illuminating philosophical and practical understanding of learning. Building upon previous research on subject-centred learning, we draw on reflection, literature review and a phenomenological approach to show how our ways of being infuse the teaching and learning environment.…

  17. Children's Preferences for Group Musical Activities in Child Care Centres: A Cross-Cultural Study

    ERIC Educational Resources Information Center

    Yim, Hoi Yin Bonnie; Ebbeck, Marjory

    2009-01-01

    This paper reports on a cross-cultural research study of children's preferences for group musical activities in child care centres. A total of 228 young children aged 4-5 years in seven child care centres in Hong Kong and in the Adelaide City of South Australia participated in the study. Both qualitative and quantitative data were collected via a…

  18. The Reconceptualisation of Learner-Centred Approaches: A Namibian Case Study

    ERIC Educational Resources Information Center

    O'Sullivan, Margo

    2004-01-01

    The case study, which explored the implementation of learner-centred approaches, emerged from an action research study of a three-year INSET (In-service Education and Training) programme for 145 unqualified primary teachers in Namibia. A learner-centred curriculum was introduced in Namibia soon after her Independence from South Africa in 1990. It…

  19. Nuclear Science Centre, New Delhi

    SciTech Connect

    Mehta, G.; Potukuchi, P.; Roy, A.

    1995-08-01

    Argonne is collaborating with the Nuclear Science Centre (NSC), New Delhi, to develop a new type of superconducting accelerating structure for low-velocity heavy ions. A copper model has been evaluated and tests on the niobium prototype are currently in progress. Some technical details of this project are described in the Superconducting Linac Development section of this report. All funding for the prototype has come from the NSC, and they have also stationed two staff members at ATLAS for the past two years to gain experience and work on this project. Additional NSC personnel visited ATLAS for extended periods during 1994 for electronics and cryogenics experience and training. Two NSC staff members are scheduled to spend several months at ANL during 1995 to continue tests and developments of the prototype resonators and to initiate fabrication of the production models for their linac project.

  20. Distant Operational Care Centre: Design Project Report

    NASA Technical Reports Server (NTRS)

    1996-01-01

    The goal of this project is to outline the design of the Distant Operational Care Centre (DOCC), a modular medical facility to maintain human health and performance in space, that is adaptable to a range of remote human habitats. The purpose of this project is to outline a design, not to go into a complete technical specification of a medical facility for space. This project involves a process to produce a concise set of requirements, addressing the fundamental problems and issues regarding all aspects of a space medical facility for the future. The ideas presented here are at a high level, based on existing, researched, and hypothetical technologies. Given the long development times for space exploration, the outlined concepts from this project embodies a collection of identified problems, and corresponding proposed solutions and ideas, ready to contribute to future space exploration efforts. In order to provide a solid extrapolation and speculation in the context of the future of space medicine, the extent of this project's vision is roughly within the next two decades. The Distant Operational Care Centre (DOCC) is a modular medical facility for space. That is, its function is to maintain human health and performance in space environments, through prevention, diagnosis, and treatment. Furthermore, the DOCC must be adaptable to meet the environmental requirements of different remote human habitats, and support a high quality of human performance. To meet a diverse range of remote human habitats, the DOCC concentrates on a core medical capability that can then be adapted. Adaptation would make use of the DOCC's functional modularity, providing the ability to replace, add, and modify core functions of the DOCC by updating hardware, operations, and procedures. Some of the challenges to be addressed by this project include what constitutes the core medical capability in terms of hardware, operations, and procedures, and how DOCC can be adapted to different remote

  1. The International Centre for Theoretical Physics

    NASA Astrophysics Data System (ADS)

    Hussain, Faheem

    2008-07-01

    This talk traces in brief the genesis of the Abdus Salam International Centre for Theoretical Physics, Trieste, as one of Prof. Abdus Salam's major achievements. It outlines why Salam felt the necessity for establishing such a centre to help physicists in the developing world. It situates the founding of the Centre within Salam's broader vision of the causes of underdevelopment and of science as an engine for scientific, technological, economic and social development. The talk reviews the successes and failures of the ICTP and gives a brief overall view of the current status of the Centre.

  2. Safe motherhood partners -- the International Children's Centre.

    PubMed

    1994-01-01

    The International Children's Centre (ICC) works worldwide to improve child health in the least developed countries. In its training and research projects the agency contributes to the Safe Motherhood Initiative to improve the health of mothers and infants. ICC is based in Paris, it was established in 1949, and the agency has cooperated with governments, nongovernmental organizations and international bodies like the World Health Organization (WHO) in child care. ICC's activities reflect concern for the health of women before and during pregnancy and the rest of their lives. The center's work comprises training, research, local projects, and information and documentation. Following the 1987 Nairobi conference on safe motherhood, ICC organized a seminar in Paris on maternal mortality in Sub-Saharan francophone Africa, which led to participation in the Safe Motherhood Initiative with a variety of training and research programs. ICC training is integrated, community-based, and multidisciplinary. Anthropology, psychology, economics and management have played a role in ICC training courses. The center runs an international course on maternal and child health from January to April each year and also organizes distance training courses on problem solving in health care. ICC training programs have taken place in Laos, Senegal, and Vietnam to strengthen the work of maternal and child health training centers there. A 4-week course on economic evaluation of health programs is held in Paris each July. In 1989 and 1990, ICC organized in collaboration with WHO safe motherhood workshops on research methodology in Benin and in Burkina Faso with participants from 6 francophone African countries. One research project in Benin is on risk factors for maternal and perinatal mortality and morbidity, and the other in Cameroon on improving surveillance of pregnancy, delivery, and the postnatal period. ICC focuses on long-term planning and action for the benefit of mothers and children.

  3. Walk-in centres in primary care: a review of the international literature.

    PubMed Central

    Salisbury, Chris; Munro, James

    2003-01-01

    Nurse-led walk-in centres were first announced in April 1999. They represent a new development in unscheduled care provision in the United Kingdom (UK) National Health Service (NHS). By the end of 2000, 40 NHS walk-in centres had been opened, with further centres recently announced. This paper aims to review international experience with walk-in centres in primary and emergency care and identify relevant lessons for the UK. This study is a systematic review, with qualitative synthesis of relevant findings. Studies were identified from seven major bibliographic databases using a sensitive search strategy, and 244 relevant documents relating to walk-in or 'ambulatory care' centres were identified. Users of walk-in centres in other countries tend to be a relatively affluent population of working age, and a different population from those using conventional general practice services. Walk-in centres are used particularly when other health services are closed. The problems presented are mainly minor illnesses and minor injuries. People choose this form of care mainly for reasons of convenience, and satisfaction with the service is generally high. The very limited evidence available suggests that walk-in centres provide care of reasonable quality, but there is insufficient evidence to draw firm conclusions about the impact of walk-in centres on other healthcare services or the costs of such care. Although a number of countries have had a long experience of walk-in centres, the lack of reliable evidence on many of the most important issues is notable. In the NHS, walk-in centres represent a radically innovative attempt to improve access to health care, but the limited research available does little to inform their development. Important questions that need to be addressed include whether walk-in centres do improve access to care, for whom, and at what overall cost. PMID:12564280

  4. Environmental Studies at the Guiana Space Centre

    NASA Astrophysics Data System (ADS)

    Richard, Sandrine

    2013-09-01

    The Environmental Commitment of the French Space Agency at the Guiana Space Centre (CNES / CSG) specifies that the environmental protection is a major stake. Consequently, CNES participates in numerous space programs that contribute significantly to a better knowledge, management and protection of our environment at a global scale.The studies and researches that are done at CNES / CSG meet several objectives:* Assessment of safety and environmental effects and risk related to the effects overflowing due to a pollution caused by ground and flight activities* Improvement of the studies related to the knowledge of the environment (flora and fauna monitoring).* Risk assessment and management which may affect the safety of people , property, and protection of public health and environment * Verification of the compliance of the results of impact studies of launch vehicle in flight phase provided by the launch operator (Technical Regulation) with the French Safety Operational Acts.In this note, study and research programs are presented. They allow a better knowledge of the surrounding environment and of impacts caused by the industrial activities done in Guiana Space Center.

  5. Energy efficiency in U.K. shopping centres

    NASA Astrophysics Data System (ADS)

    Mangiarotti, Michela

    Energy efficiency in shopping centres means providing comfortable internal environment and services to the occupants with minimum energy use in a cost-effective and environmentally sensitive manner. This research considers the interaction of three factors affecting the energy efficiency of shopping centres: i) performance of the building fabric and services ii) management of the building in terms of operation, control, maintenance and replacement of the building fabric and services, and company's energy policy iii) occupants' expectation for comfort and awareness of energy efficiency. The aim of the investigation is to determine the role of the above factors in the energy consumption and carbon emissions of shopping centres and the scope for reducing this energy usage by changing one or all the three factors. The study also attempts to prioritize the changes in the above factors that are more cost-effective at reducing that energy consumption and identify the benefits and main economic and legal drivers for energy efficiency in shopping centres. To achieve these targets, three case studies have been analysed. Using energy data from bills, the performance of the selected case studies has been assessed to establish trends and current energy consumption and carbon emissions of shopping centres and their related causes. A regression analysis has attempted to break down the energy consumption of the landlords' area by end-use to identify the main sources of energy usage and consequently introduce cost-effective measures for saving energy. A monitoring and occupants' survey in both landlords' and tenants' areas have been carried out at the same time to compare the objective data of the environmental conditions with the subjective impressions of shoppers and shopkeepers. In particular, the monitoring aimed at assessing the internal environment to identify possible causes of discomfort and opportunities for introducing energy saving measures. The survey looked at

  6. Capturing Reality at Centre Block

    NASA Astrophysics Data System (ADS)

    Boulanger, C.; Ouimet, C.; Yeomans, N.

    2017-08-01

    The Centre Block of Canada's Parliament buildings, National Historic Site of Canada is set to undergo a major rehabilitation project that will take approximately 10 years to complete. In preparation for this work, Heritage Conservation Services (HCS) of Public Services and Procurement Canada has been completing heritage documentation of the entire site which includes laser scanning of all interior rooms and accessible confined spaces such as attics and other similar areas. Other documentation completed includes detailed photogrammetric documentation of rooms and areas of high heritage value. Some of these high heritage value spaces present certain challenges such as accessibility due to the height and the size of the spaces. Another challenge is the poor lighting conditions, requiring the use of flash or strobe lighting to either compliment or completely eliminate the available ambient lighting. All the spaces captured at this higher level of detail were also captured with laser scanning. This allowed the team to validate the information and conduct a quality review of the photogrammetric data. As a result of this exercise, the team realized that in most, if not all cases, the photogrammetric data was more detailed and at a higher quality then the terrestrial laser scanning data. The purpose and motivation of this paper is to present these findings, as well provide the advantages and disadvantages of the two methods and data sets.

  7. A comparative concept analysis of centring vs. opening meditation processes in health care.

    PubMed

    Birx, Ellen

    2013-08-01

    To report an analysis and comparison of the concepts centring and opening meditation processes in health care. Centring and opening meditation processes are included in nursing theories and frequently recommended in health care for stress management. These meditation processes are integrated into emerging psychotherapy approaches and there is a rapidly expanding body of neuroscience research distinguishing brain activity associated with different types of meditation. Currently, there is a lack of theoretical and conceptual clarity needed to guide meditation research in health care. A search of healthcare literature between 2006-2011 was conducted using Alt HealthWatch, CINAHL, PsychNET and PubMed databases using the keywords 'centring' and 'opening' alone and in combination with the term 'meditation.' For the concept centring, 10 articles and 11 books and for the concept opening 13 articles and 10 books were included as data sources. Rodgers' evolutionary method of concept analysis was used. Centring and opening are similar in that they both involve awareness in the present moment; both use a gentle, effortless approach; and both have a calming effect. Key differences include centring's focus on the individual's inner experience compared with the non-dual, spacious awareness of opening. Centring and opening are overlapping, yet distinct meditation processes. The term meditation cannot be used in a generic way in health care. The differences between centring and opening have important implications for the further development of unitary-transformative nursing theories. © 2012 Blackwell Publishing Ltd.

  8. The Irish Centre for Talented Youth

    ERIC Educational Resources Information Center

    Gilheany, Sheila

    2005-01-01

    Conducting potency tests on penicillin, discussing rocket technology with a NASA astronaut, analysing animal bone fragments from medieval times, these are just some of the activities which occupy the time of students at The Irish Centre for Talented Youth. The Centre identifies young students with exceptional academic ability and then provides…

  9. Student-Centred Learning (SCL): Roles Changed?

    ERIC Educational Resources Information Center

    Onurkan Aliusta, Gülen; Özer, Bekir

    2017-01-01

    This paper addresses the espoused and enacted practices of high school teachers with regard to student-centred learning (SCL). Explanatory mixed-method design, where quantitative strand is followed by qualitative one, is employed. While the quantitative strand aims to explore teachers' perceptions regarding the extent student-centred teacher and…

  10. [The Adamant, an unusual care centre].

    PubMed

    Khidichian, Frédéric

    2011-01-01

    The day care centre of the central Paris area has established itself in an unusual location--a 650 m2 floating building moored on the right bank of the Seine. Patients and caregivers were involved in the design of this original and ecological care centre, which places the emphasis on comfort and safety.

  11. Student Centred Approaches: Teachers' Learning and Practice

    ERIC Educational Resources Information Center

    Vale, Colleen; Davies, Anne; Weaven, Mary; Hooley, Neil

    2010-01-01

    Student centred approaches to teaching and learning in mathematics is one of the reforms currently being advocated and implemented to improve mathematics outcomes for students from low socio-economic status (SES) backgrounds. The models, meanings and practices of student centred approaches explored in this paper reveal that a constructivist model…

  12. The European standards of Haemophilia Centres

    PubMed Central

    Giangrande, Paul; Calizzani, Gabriele; Menichini, Ivana; Candura, Fabio; Mannucci, Pier Mannuccio; Makris, Michael

    2014-01-01

    Introduction The European haemophilia community of professionals and patients has agreed on the principles of haemophilia care to address comprehensive optimal delivery of care which is nowadays scattered throughout Europe. Many of the health facilities call themselves Haemophilia Centres despite their variation in size, expertise and services provided. Only a small number of countries have Haemophilia Centre accreditation systems in place. Methods In the framework of the European Haemophilia Network project, following an inclusive process of stakeholder involvement, the European Guidelines for the certification of haemophilia centres have been developed in order to set quality standards for European Haemophilia Centres and criteria for their certification. Results The Guidelines define the standards and criteria for the designation of two levels of care delivery: European Haemophilia Treatment Centres, providing local routine care, and European Haemophilia Comprehensive Care Centres, providing specialised and multi-disciplinary care and functioning as tertiary referral centres. Additionally, they define standards about general requirements, patient care, provision of an advisory service and establishment of network of clinical and specialised services. Conclusions The implementation of the European Guidelines for the certification of Haemophilia Centres will contribute to the reduction of health inequalities through the standardisation of quality of care in European Union Member States and could represent a model to be taken into consideration for other rare disease groups. PMID:24922293

  13. The Irish Centre for Talented Youth

    ERIC Educational Resources Information Center

    Gilheany, Sheila

    2005-01-01

    Conducting potency tests on penicillin, discussing rocket technology with a NASA astronaut, analysing animal bone fragments from medieval times, these are just some of the activities which occupy the time of students at The Irish Centre for Talented Youth. The Centre identifies young students with exceptional academic ability and then provides…

  14. The Manitoba Centre for Health Policy: A Case Study

    PubMed Central

    Marchessault, Gail

    2011-01-01

    Context: The Manitoba Centre for Health Policy (MCHP) is a university research centre with a long-standing contractual arrangement with government. Objective: The purpose of this project was to examine the facilitators and challenges in the development, establishment and continuation of MCHP. Methods: In-depth, semi-structured interviews with 28 participants selected purposefully and a document review were conducted and analyzed using qualitative methods. Results: Although a unique confluence of factors facilitated MCHP's establishment, participants viewed safeguards to credibility (arm's-length from government; guaranteed academic freedom) along with powerful advocates as key to longevity. Other factors that participants discussed as important to sustainability included excellence in scholarship; thorough protection of privacy; stable funding; incremental growth; teamwork; leadership; nurturing of relationships; and authentic partnerships. Conclusions: MCHP has demonstrated that using local administrative data to address policy-related research questions is of enduring value to local and provincial communities, and also has national and international relevance. PMID:24933371

  15. Redesigning digital dictation for physicians: a user-centred approach.

    PubMed

    Viitanen, Johanna

    2009-09-01

    The user-centred approach has proven its success in software and product development. However, in the healthcare domain, user-centred research methodology has been applied less widely. This article reports a study that employs a contextual inquiry method to study the prevailing dictation procedures and solutions in a hospital from the physician's perspective. The goal was to empirically evaluate digital dictation and the other three currently used methods for making dictations, thereby eliciting information for supporting the hospital administration in their decisions concerning the further development of a dictation solution. The research indicated a number of user requirements for a dictation solution. The main conclusions were: (1) the currently used information systems need extensive improvements and redesign; (2) the observed process of digital dictation does not seem applicable for its intended context of use; (3) for future solutions, it is important to understand that the dictation user interface cannot be standardized.

  16. Evaluation of telemedicine centres in Madhya Pradesh, Central India.

    PubMed

    Bali, Surya; Gupta, Arti; Khan, Asif; Pakhare, Abhijit

    2016-04-01

    In a developing country such as India, there is substantial inequality in health care distribution. Telemedicine facilities were established in Madhya Pradesh in 2007-2008. The purpose of this study was to evaluate the infrastructure, equipment, manpower, and functional status of Indian Space and Research Organisation (ISRO) telemedicine nodes in Madhya Pradesh. All district hospitals and medical colleges with nodes were visited by a team of three members. The study was conducted from December 2013-January 2014. The team recorded the structural facility situation and physical conditions on a predesigned pro forma. The team also conducted interviews with the nodal officers, data entry operator and other relevant people at these centres. Of the six specialist nodes, four were functional and two were non-functional. Of 10 patient nodes, two nodes were functional, four were semi-functional and four were non-functional. Most of the centres were not working due to a problem with their satellite modem. The overall condition of ISRO run telemedicine centres in Madhya Pradesh was found to be poor. Most of these centres failed to provide telemedicine consultations. We recommend replacing this system with another cost effective system available in the state wide area network (SWAN). We suggest the concept of the virtual out-patient department.

  17. Comparative Vocational Education and Training Research in Europe: Balance and Perspectives. Contributions, Recommendations and Follow-Up of the CEDEFOP/DIPF Conference from January 1998 at the Science Centre in Bonn.

    ERIC Educational Resources Information Center

    Lauterbach, Uwe, Ed.; Sellin, Burkart, Ed.

    This document contains 32 papers from a conference on balance and perspectives in comparative vocational education and training (VET) research in Europe. Selected papers are as follows: "On the Path to Vocational Training Research with a European Dimension" (Oliver Lubke, Klaus Schedler, Alphonse de Vadder); "The Val Duchesse Social…

  18. The Palliative Care Centre of Hôtel-Dieu Hospital.

    PubMed

    Lassaunière, J M; Zittoun, R

    1995-01-01

    In 1989, two affiliations of Centre de Soins Palliatifs were created by the Assistance Publique-Hôpitaux de Paris, the largest medical complex in Europe. At Hôtel-Dieu de Paris, a mobile team from Soins Palliatifs was formed. The members were recruited from hospital services in order to help the team in the care and support of patients with advanced diseases. A description of the service, team activities (care, formation, teaching and research) is proposed.

  19. Big Surveys, Big Data Centres

    NASA Astrophysics Data System (ADS)

    Schade, D.

    2016-06-01

    Well-designed astronomical surveys are powerful and have consistently been keystones of scientific progress. The Byurakan Surveys using a Schmidt telescope with an objective prism produced a list of about 3000 UV-excess Markarian galaxies but these objects have stimulated an enormous amount of further study and appear in over 16,000 publications. The CFHT Legacy Surveys used a wide-field imager to cover thousands of square degrees and those surveys are mentioned in over 1100 publications since 2002. Both ground and space-based astronomy have been increasing their investments in survey work. Survey instrumentation strives toward fair samples and large sky coverage and therefore strives to produce massive datasets. Thus we are faced with the "big data" problem in astronomy. Survey datasets require specialized approaches to data management. Big data places additional challenging requirements for data management. If the term "big data" is defined as data collections that are too large to move then there are profound implications for the infrastructure that supports big data science. The current model of data centres is obsolete. In the era of big data the central problem is how to create architectures that effectively manage the relationship between data collections, networks, processing capabilities, and software, given the science requirements of the projects that need to be executed. A stand alone data silo cannot support big data science. I'll describe the current efforts of the Canadian community to deal with this situation and our successes and failures. I'll talk about how we are planning in the next decade to try to create a workable and adaptable solution to support big data science.

  20. ACTRIS Data Centre: An atmospheric data portal

    NASA Astrophysics Data System (ADS)

    Myhre, C. Lund; Fahre Vik, A.; Logna, R.; Torseth, K.; Linné, H.; O'Connor, E.

    2012-04-01

    ACTRIS (Aerosols, Clouds, and Trace gases Research InfraStructure Network) is a European Project aiming at integrating European ground-based stations equipped with advanced instrumentation for studying aerosols, clouds, and short-lived gas-phase species. The ACTRIS activities result in improved atmospheric measurements data made at more than 60 European sites, from numerous instruments and includes variables measured by ground based in situ and remote sensing technologies. Core variables are in situ aerosol optical, physical and chemical properties, short-lived trace gases (volatile organic carbon and nitrogen oxides), aerosol scattering and extinction profiles, and cloud properties. The ACTRIS data centre (ACTRIS DC) is giving free and open access to all data resulting from the activities of the infrastructure network, complemented with data from other relevant networks and data bases. The overall goal is to facilitate scientists and other user groups access to atmospheric observational data, and to provide mature products for analysis and interpretation of atmospheric composition change. The ACTRIS DC aims at substantially increasing the number of high-quality data by providing long-term observational data relevant to climate and air quality research produced with standardized or comparable procedures throughout the network. The backbone of the ACTRIS DC is the three core data bases: - EARLINET Data Base hosting aerosol lidar data from more than 30 European sites - EBAS hosting ground based atmospheric in situ data from more than 1000 sites globally - Cloudnet hosting remote sensing cloud data and products from 5 European sites Furthermore, a joint portal is developed combining information from various data sources to gain new information not presently available from standalone databases or networks. The data centre will provide tools and services to facilitate the use of measurements for broad user communities. Higher level and integrated products will be