Binding and thermodynamics of REV peptide-ctDNA interaction.

PubMed

Upadhyay, Santosh Kumar

2017-03-01

The thermodynamics of DNA-ligand binding is important as it provides useful information to understand the details of binding processes. HIV-1 REV response element (RRE) located in the env coding region of the viral genome is reported to be well conserved across different HIV-1 isolates. In this study, the binding characteristics of Calf thymus DNA (ctDNA) and REV peptide from HIV-1 were investigated using spectroscopic (UV-visible, fluorescence, and circular dichroism (CD)) and isothermal titration calorimetric (ITC) techniques. Thermal stability and ligand binding properties of the ctDNA revealed that native ctDNA had a T m of 75.5 °C, whereas the ctDNA-REV peptide complex exhibited an incremental shift in the T m by 8 °C, indicating thermal stability of the complex. CD data indicated increased ellipticity due to large conformational changes in ctDNA molecule upon binding with REV peptide and two binding stoichiometric modes are apparent. The ctDNA experienced condensation due to large conformational changes in the presence of REV peptide and positive B→Ψ transition was observed at higher molar charge ratios. Fluorescence studies performed at several ligand concentrations revealed a gradual decrease in the fluorescence intensity of EtBr-bound ctDNA in response to increasing ligand concentrations. The fluorescence data further confirmed two stoichiometric modes of binding for ctDNA-REV peptide complex as previously observed with CD studies. The binding enthalpies were determined using ITC in the temperature range of 293 K-308 K. The ITC binding isotherm was exothermic at all temperatures examined, with low ΔH values indicating that the ctDNA-REV peptide interaction is driven largely by entropy. The heat capacity change (ΔC p ) was insignificant, an unusual finding in the area of DNA-peptide interaction studies. The variation in the values obtained for ΔH, ΔS, and ΔG with temperature further suggests that ctDNA-REV peptide interaction is entropically driven. ITC based analysis of salt dependence of binding constant gave a charge value (Z) = +4.01, as determined for the δlnK/δln[Na + ] parameter, suggesting the participation of only 3-4 Arg out of 11 Arg charge from REV peptide. The stoichiometry observed for the complex was three molar charge of REV peptide binding per molar charge of ctDNA. ITC based analysis further confirmed that the binding between ctDNA and REV peptide is governed by electrostatic interaction. Molecular interactions including H-bonding, van der Waals forces, and solvent molecules rearrangement, underlie the binding of REV peptide to ctDNA. © 2016 Wiley Periodicals, Inc.

Structure of the Response Regulator PhoP from Mycobacterium tuberculosis Reveals a Dimer Through the Receiver Domain

DOE Office of Scientific and Technical Information (OSTI.GOV)

S Menon; S Wang

The PhoP protein from Mycobacterium tuberculosis is a response regulator of the OmpR/PhoB subfamily, whose structure consists of an N-terminal receiver domain and a C-terminal DNA-binding domain. How the DNA-binding activities are regulated by phosphorylation of the receiver domain remains unclear due to a lack of structural information on the full-length proteins. Here we report the crystal structure of the full-length PhoP of M. tuberculosis. Unlike other known structures of full-length proteins of the same subfamily, PhoP forms a dimer through its receiver domain with the dimer interface involving {alpha}4-{beta}5-{alpha}5, a common interface for activated receiver domain dimers. However, themore » switch residues, Thr99 and Tyr118, are in a conformation resembling those of nonactivated receiver domains. The Tyr118 side chain is involved in the dimer interface interactions. The receiver domain is tethered to the DNA-binding domain through a flexible linker and does not impose structural constraints on the DNA-binding domain. This structure suggests that phosphorylation likely facilitates/stabilizes receiver domain dimerization, bringing the DNA-binding domains to close proximity, thereby increasing their binding affinity for direct repeat DNA sequences.« less

Cryptic MCAT enhancer regulation in fibroblasts and smooth muscle cells. Suppression of TEF-1 mediated activation by the single-stranded DNA-binding proteins, Pur alpha, Pur beta, and MSY1.

PubMed

Carlini, Leslie E; Getz, Michael J; Strauch, Arthur R; Kelm, Robert J

2002-03-08

An asymmetric polypurine-polypyrimidine cis-element located in the 5' region of the mouse vascular smooth muscle alpha-actin gene serves as a binding site for multiple proteins with specific affinity for either single- or double-stranded DNA. Here, we test the hypothesis that single-stranded DNA-binding proteins are responsible for preventing a cryptic MCAT enhancer centered within this element from cooperating with a nearby serum response factor-interacting CArG motif to trans-activate the minimal promoter in fibroblasts and smooth muscle cells. DNA binding studies revealed that the core MCAT sequence mediates binding of transcription enhancer factor-1 to the double-stranded polypurine-polypyrimidine element while flanking nucleotides account for interaction of Pur alpha and Pur beta with the purine-rich strand and MSY1 with the complementary pyrimidine-rich strand. Mutations that selectively impaired high affinity single-stranded DNA binding by fibroblast or smooth muscle cell-derived Pur alpha, Pur beta, and MSY1 in vitro, released the cryptic MCAT enhancer from repression in transfected cells. Additional experiments indicated that Pur alpha, Pur beta, and MSY1 also interact specifically, albeit weakly, with double-stranded DNA and with transcription enhancer factor-1. These results are consistent with two plausible models of cryptic MCAT enhancer regulation by Pur alpha, Pur beta, and MSY1 involving either competitive single-stranded DNA binding or masking of MCAT-bound transcription enhancer factor-1.

Structure of p73 DNA-binding domain tetramer modulates p73 transactivation

PubMed Central

Ethayathulla, Abdul S.; Tse, Pui-Wah; Monti, Paola; Nguyen, Sonha; Inga, Alberto; Fronza, Gilberto; Viadiu, Hector

2012-01-01

The transcription factor p73 triggers developmental pathways and overlaps stress-induced p53 transcriptional pathways. How p53-family response elements determine and regulate transcriptional specificity remains an unsolved problem. In this work, we have determined the first crystal structures of p73 DNA-binding domain tetramer bound to response elements with spacers of different length. The structure and function of the adaptable tetramer are determined by the distance between two half-sites. The structures with zero and one base-pair spacers show compact p73 DNA-binding domain tetramers with large tetramerization interfaces; a two base-pair spacer results in DNA unwinding and a smaller tetramerization interface, whereas a four base-pair spacer hinders tetramerization. Functionally, p73 is more sensitive to spacer length than p53, with one base-pair spacer reducing 90% of transactivation activity and longer spacers reducing transactivation to basal levels. Our results establish the quaternary structure of the p73 DNA-binding domain required as a scaffold to promote transactivation. PMID:22474346

The electrostatic role of the Zn-Cys2His2 complex in binding of operator DNA with transcription factors: mouse EGR-1 from the Cys2His2 family.

PubMed

Chirgadze, Y N; Boshkova, E A; Polozov, R V; Sivozhelezov, V S; Dzyabchenko, A V; Kuzminsky, M B; Stepanenko, V A; Ivanov, V V

2018-01-07

The mouse factor Zif268, known also as early growth response protein EGR-1, is a classical representative for the Cys2His2 transcription factor family. It is required for binding the RNA polymerase with operator dsDNA to initialize the transcription process. We have shown that only in this family of total six Zn-finger protein families the Zn complex plays a significant role in the protein-DNA binding. Electrostatic feature of this complex in the binding of factor Zif268 from Mus musculus with operator DNA has been considered. The factor consists of three similar Zn-finger units which bind with triplets of coding DNA. Essential contacts of the factor with the DNA phosphates are formed by three conservative His residues, one in each finger. We describe here the results of calculations of the electrostatic potentials for the Zn-Cys2His2 complex, Zn-finger unit 1, and the whole transcription factor. The potential of Zif268 has a positive area on the factor surface, and it corresponds exactly to the binding sites of each of Zn-finger units. The main part of these areas is determined by conservative His residues, which form contacts with the DNA phosphate groups. Our result shows that the electrostatic positive potential of this histidine residue is enhanced due to the Zn complex. The other contacts of the Zn-finger with DNA are related to nucleotide bases, and they are responsible for the sequence-specific binding with DNA. This result may be extended to all other members of the Cys2His2 transcription factor family.

Discrimination against RNA Backbones by a ssDNA Binding Protein.

PubMed

Lloyd, Neil R; Wuttke, Deborah S

2018-05-01

Pot1 is the shelterin component responsible for the protection of the single-stranded DNA (ssDNA) overhang at telomeres in nearly all eukaryotic organisms. The C-terminal domain of the DNA-binding domain, Pot1pC, exhibits non-specific ssDNA recognition, achieved through thermodynamically equivalent alternative binding conformations. Given this flexibility, it is unclear how specificity for ssDNA over RNA, an activity required for biological function, is achieved. Examination of the ribose-position specificity of Pot1pC shows that ssDNA specificity is additive but not uniformly distributed across the ligand. High-resolution structures of several Pot1pC complexes with RNA-DNA chimeric ligands reveal Pot1pC discriminates against RNA by utilizing non-compensatory binding modes that feature significant rearrangement of the binding interface. These alternative conformations, accessed through both ligand and protein flexibility, recover much, but not all, of the binding energy, leading to the observed reduction in affinities. These findings suggest that intermolecular interfaces are remarkably sophisticated in their tuning of specificity toward flexible ligands. Copyright © 2018 Elsevier Ltd. All rights reserved.

The high mobility group protein 1 enhances binding of the estrogen receptor DNA binding domain to the estrogen response element.

PubMed

Romine, L E; Wood, J R; Lamia, L A; Prendergast, P; Edwards, D P; Nardulli, A M

1998-05-01

We have examined the ability of the high-mobility group protein 1 (HMG1) to alter binding of the estrogen receptor DNA-binding domain (DBD) to the estrogen response element (ERE). HMG1 dramatically enhanced binding of purified, bacterially expressed DBD to the consensus vitellogenin A2 ERE in a dose-dependent manner. The ability of HMG1 to stabilize the DBD-ERE complex resulted in part from a decrease in the dissociation rate of the DBD from the ERE. Antibody supershift experiments demonstrated that HMG1 was also capable of forming a ternary complex with the ERE-bound DBD in the presence of HMG1-specific antibody. HMG1 did not substantially affect DBD-ERE contacts as assessed by methylation interference assays, nor did it alter the ability of the DBD to induce distortion in ERE-containing DNA fragments. Because HMG1 dramatically enhanced estrogen receptor DBD binding to the ERE, and the DBD is the most highly conserved region among the nuclear receptor superfamily members, HMG1 may function to enhance binding of other nuclear receptors to their respective response elements and act in concert with coactivator proteins to regulate expression of hormone-responsive genes.

The Electronic Behavior of Zinc-Finger Protein Binding Sites in the Context of the DNA Extended Ladder Model

NASA Astrophysics Data System (ADS)

Oiwa, Nestor; Cordeiro, Claudette; Heermann, Dieter

2016-05-01

Instead of ATCG letter alignments, typically used in bioinformatics, we propose a new alignment method using the probability distribution function of the bottom of the occupied molecular orbital (BOMO), highest occupied molecular orbital (HOMO) and lowest unoccupied orbital (LUMO). We apply the technique to transcription factors with Cys2His2 zinc fingers. These transcription factors search for binding sites, probing for the electronic patterns at the minor and major DNA groves. The eukaryotic Cys2His2 zinc finger proteins bind to DNA ubiquitously at highly conserved domains. They are responsible for gene regulation and the spatial organization of DNA. To study and understand these zinc finger DNA-protein interactions, we use the extended ladder in the DNA model proposed by Zhu, Rasmussen, Balatsky & Bishop (2007) te{Zhu-2007}. Considering one single spinless electron in each nucleotide π-orbital along a double DNA chain (dDNA), we find a typical pattern for the bottom of BOMO, HOMO and LUMO along the binding sites. We specifically looked at two members of zinc finger protein family: specificity protein 1 (SP1) and early grown response 1 transcription factors (EGR1). When the valence band is filled, we find electrons in the purines along the nucleotide sequence, compatible with the electric charges of the binding amino acids in SP1 and EGR1 zinc finger.

Intercalation of XR5944 with the estrogen response element is modulated by the tri-nucleotide spacer sequence between half-sites

PubMed Central

Sidell, Neil; Mathad, Raveendra I.; Shu, Feng-jue; Zhang, Zhenjiang; Kallen, Caleb B.; Yang, Danzhou

2011-01-01

DNA-intercalating molecules can impair DNA replication, DNA repair, and gene transcription. We previously demonstrated that XR5944, a DNA bis-intercalator, specifically blocks binding of estrogen receptor-α (ERα) to the consensus estrogen response element (ERE). The consensus ERE sequence is AGGTCAnnnTGACCT, where nnn is known as the tri-nucleotide spacer. Recent work has shown that the tri-nucleotide spacer can modulate ERα-ERE binding affinity and ligand-mediated transcriptional responses. To further understand the mechanism by which XR5944 inhibits ERα-ERE binding, we tested its ability to interact with consensus EREs with variable tri-nucleotide spacer sequences and with natural but non-consensus ERE sequences using one dimensional nuclear magnetic resonance (1D 1H NMR) titration studies. We found that the tri-nucleotide spacer sequence significantly modulates the binding of XR5944 to EREs. Of the sequences that were tested, EREs with CGG and AGG spacers showed the best binding specificity with XR5944, while those spaced with TTT demonstrated the least specific binding. The binding stoichiometry of XR5944 with EREs was 2:1, which can explain why the spacer influences the drug-DNA interaction; each XR5944 spans four nucleotides (including portions of the spacer) when intercalating with DNA. To validate our NMR results, we conducted functional studies using reporter constructs containing consensus EREs with tri-nucleotide spacers CGG, CTG, and TTT. Results of reporter assays in MCF-7 cells indicated that XR5944 was significantly more potent in inhibiting the activity of CGG- than TTT-spaced EREs, consistent with our NMR results. Taken together, these findings predict that the anti-estrogenic effects of XR5944 will depend not only on ERE half-site composition but also on the tri-nucleotide spacer sequence of EREs located in the promoters of estrogen-responsive genes. PMID:21333738

DOE Office of Scientific and Technical Information (OSTI.GOV)

Akabayov, B.; Akabayov, S; Lee , S

Gene 5 of bacteriophage T7 encodes a DNA polymerase (gp5) responsible for the replication of the phage DNA. Gp5 polymerizes nucleotides with low processivity, dissociating after the incorporation of 1 to 50 nucleotides. Thioredoxin (trx) of Escherichia coli binds tightly (Kd = 5 nM) to a unique segment in the thumb subdomain of gp5 and increases processivity. We have probed the molecular basis for the increase in processivity. A single-molecule experiment reveals differences in rates of enzymatic activity and processivity between gp5 and gp5/trx. Small angle X-ray scattering studies combined with nuclease footprinting reveal two conformations of gp5, one inmore » the free state and one upon binding to trx. Comparative analysis of the DNA binding clefts of DNA polymerases and DNA binding proteins show that the binding surface contains more hydrophobic residues than other DNA binding proteins. The balanced composition between hydrophobic and charged residues of the binding site allows for efficient sliding of gp5/trx on the DNA. We propose a model for trx-induced conformational changes in gp5 that enhance the processivity by increasing the interaction of gp5 with DNA.« less

Promoter selection in human mitochondria involves binding of a transcription factor to orientation-independent upstream regulatory elements.

PubMed

Fisher, R P; Topper, J N; Clayton, D A

1987-07-17

Selective transcription of human mitochondrial DNA requires a transcription factor (mtTF) in addition to an essentially nonselective RNA polymerase. Partially purified mtTF is able to sequester promoter-containing DNA in preinitiation complexes in the absence of mitochondrial RNA polymerase, suggesting a DNA-binding mechanism for factor activity. Functional domains, required for positive transcriptional regulation by mtTF, are identified within both major promoters of human mtDNA through transcription of mutant promoter templates in a reconstituted in vitro system. These domains are essentially coextensive with DNA sequences protected from nuclease digestion by mtTF-binding. Comparison of the sequences of the two mtTF-responsive elements reveals significant homology only when one sequence is inverted; the binding sites are in opposite orientations with respect to the predominant direction of transcription. Thus mtTF may function bidirectionally, requiring additional protein-DNA interactions to dictate transcriptional polarity. The mtTF-responsive elements are arrayed as direct repeats, separated by approximately 80 bp within the displacement-loop region of human mitochondrial DNA; this arrangement may reflect duplication of an ancestral bidirectional promoter, giving rise to separate, unidirectional promoters for each strand.

A calmodulin-binding/CGCG box DNA-binding protein family involved in multiple signaling pathways in plants

NASA Technical Reports Server (NTRS)

Yang, Tianbao; Poovaiah, B. W.

2002-01-01

We reported earlier that the tobacco early ethylene-responsive gene NtER1 encodes a calmodulin-binding protein (Yang, T., and Poovaiah, B. W. (2000) J. Biol. Chem. 275, 38467-38473). Here we demonstrate that there is one NtER1 homolog as well as five related genes in Arabidopsis. These six genes are rapidly and differentially induced by environmental signals such as temperature extremes, UVB, salt, and wounding; hormones such as ethylene and abscisic acid; and signal molecules such as methyl jasmonate, H(2)O(2), and salicylic acid. Hence, they were designated as AtSR1-6 (Arabidopsis thaliana signal-responsive genes). Ca(2+)/calmodulin binds to all AtSRs, and their calmodulin-binding regions are located on a conserved basic amphiphilic alpha-helical motif in the C terminus. AtSR1 targets the nucleus and specifically recognizes a novel 6-bp CGCG box (A/C/G)CGCG(G/T/C). The multiple CGCG cis-elements are found in promoters of genes such as those involved in ethylene signaling, abscisic acid signaling, and light signal perception. The DNA-binding domain in AtSR1 is located on the N-terminal 146 bp where all AtSR1-related proteins share high similarity but have no similarity to other known DNA-binding proteins. The calmodulin-binding nuclear proteins isolated from wounded leaves exhibit specific CGCG box DNA binding activities. These results suggest that the AtSR gene family encodes a family of calmodulin-binding/DNA-binding proteins involved in multiple signal transduction pathways in plants.

Effect of DNA type on response of DNA biosensor for carcinogens

NASA Astrophysics Data System (ADS)

Sani, Nor Diyana bt. Md.; Heng, Lee Yook; Surif, Salmijah; Lazim, Azwani Mat

2013-11-01

Carcinogens are cancer causing chemicals that can bind to DNA and cause damage to the DNA. These chemicals are available everywhere including in water, air, soil and food. Therefore, a sensor that can detect the presence of these chemicals will be a very useful tool. Since carcinogens bind to DNA, DNA can be used as the biological element in a biosensor. This study has utilized different types of DNA in a biosensor for carcinogen detection. The DNAs include double stranded calf thymus DNA, single stranded calf thymus DNA and guanine rich single stranded DNA. The modified SPE was exposed to a carcinogen followed by interaction with methylene blue which acts as the electroactive indicator. The SPE was then analysed using differential pulse voltammetry (DPV). Optimization studies were conducted for MB concentration and accumulation time, DNA concentration, as well as effect of buffer concentration, buffer pH and ionic strength. The performance of the biosensor was tested on a group 1 carcinogen, formaldehyde. The results indicated that the usage of guanine rich single stranded DNA also gives higher response as carcinogens prefer to bind with guanine compared to other bases.

RING finger and WD repeat domain 3 (RFWD3) associates with replication protein A (RPA) and facilitates RPA-mediated DNA damage response.

PubMed

Liu, Shangfeng; Chu, Jessica; Yucer, Nur; Leng, Mei; Wang, Shih-Ya; Chen, Benjamin P C; Hittelman, Walter N; Wang, Yi

2011-06-24

DNA damage response is crucial for maintaining genomic integrity and preventing cancer by coordinating the activation of checkpoints and the repair of damaged DNA. Central to DNA damage response are the two checkpoint kinases ATM and ATR that phosphorylate a wide range of substrates. RING finger and WD repeat domain 3 (RFWD3) was initially identified as a substrate of ATM/ATR from a proteomic screen. Subsequent studies showed that RFWD3 is an E3 ubiquitin ligase that ubiquitinates p53 in vitro and positively regulates p53 levels in response to DNA damage. We report here that RFWD3 associates with replication protein A (RPA), a single-stranded DNA-binding protein that plays essential roles in DNA replication, recombination, and repair. Binding of RPA to single-stranded DNA (ssDNA), which is generated by DNA damage and repair, is essential for the recruitment of DNA repair factors to damaged sites and the activation of checkpoint signaling. We show that RFWD3 is physically associated with RPA and rapidly localizes to sites of DNA damage in a RPA-dependent manner. In vitro experiments suggest that the C terminus of RFWD3, which encompass the coiled-coil domain and the WD40 domain, is necessary for binding to RPA. Furthermore, DNA damage-induced phosphorylation of RPA and RFWD3 is dependent upon each other. Consequently, loss of RFWD3 results in the persistent foci of DNA damage marker γH2AX and the repair protein Rad51 in damaged cells. These findings suggest that RFWD3 is recruited to sites of DNA damage and facilitates RPA-mediated DNA damage signaling and repair.

Physical interaction between replication protein A (RPA) and MRN: involvement of RPA2 phosphorylation and the N-terminus of RPA1.

PubMed

Oakley, Greg G; Tillison, Kristin; Opiyo, Stephen A; Glanzer, Jason G; Horn, Jeffrey M; Patrick, Steve M

2009-08-11

Replication protein A (RPA) is a heterotrimeric protein consisting of RPA1, RPA2, and RPA3 subunits that binds to single-stranded DNA (ssDNA) with high affinity. The response to replication stress requires the recruitment of RPA and the MRE11-RAD50-NBS1 (MRN) complex. RPA bound to ssDNA stabilizes stalled replication forks by recruiting checkpoint proteins involved in fork stabilization. MRN can bind DNA structures encountered at stalled or collapsed replication forks, such as ssDNA-double-stranded DNA (dsDNA) junctions or breaks, and promote the restart of DNA replication. Here, we demonstrate that RPA2 phosphorylation regulates the assembly of DNA damage-induced RPA and MRN foci. Using purified proteins, we observe a direct interaction between RPA with both NBS1 and MRE11. By utilizing RPA bound to ssDNA, we demonstrate that substituting RPA with phosphorylated RPA or a phosphomimetic weakens the interaction with the MRN complex. Also, the N-terminus of RPA1 is a critical component of the RPA-MRN protein-protein interaction. Deletion of the N-terminal oligonucleotide-oligosaccharide binding fold (OB-fold) of RPA1 abrogates interactions of RPA with MRN and individual proteins of the MRN complex. Further identification of residues critical for MRN binding in the N-terminus of RPA1 shows that substitution of Arg31 and Arg41 with alanines disrupts the RPA-MRN interaction and alters cell cycle progression in response to DNA damage. Thus, the N-terminus of RPA1 and phosphorylation of RPA2 regulate RPA-MRN interactions and are important in the response to DNA damage.

Role of the DNA Damage Response in Human Papillomavirus RNA Splicing and Polyadenylation.

PubMed

Nilsson, Kersti; Wu, Chengjun; Schwartz, Stefan

2018-06-12

Human papillomaviruses (HPVs) have evolved to use the DNA repair machinery to replicate its DNA genome in differentiated cells. HPV activates the DNA damage response (DDR) in infected cells. Cellular DDR factors are recruited to the HPV DNA genome and position the cellular DNA polymerase on the HPV DNA and progeny genomes are synthesized. Following HPV DNA replication, HPV late gene expression is activated. Recent research has shown that the DDR factors also interact with RNA binding proteins and affects RNA processing. DDR factors activated by DNA damage and that associate with HPV DNA can recruit splicing factors and RNA binding proteins to the HPV DNA and induce HPV late gene expression. This induction is the result of altered alternative polyadenylation and splicing of HPV messenger RNA (mRNA). HPV uses the DDR machinery to replicate its DNA genome and to activate HPV late gene expression at the level of RNA processing.

Determining the folding and binding free energy of DNA-based nanodevices and nanoswitches using urea titration curves

PubMed Central

Idili, Andrea

2017-01-01

Abstract DNA nanotechnology takes advantage of the predictability of DNA interactions to build complex DNA-based functional nanoscale structures. However, when DNA functional and responsive units that are based on non-canonical DNA interactions are employed it becomes quite challenging to predict, understand and control their thermodynamics. In response to this limitation, here we demonstrate the use of isothermal urea titration experiments to estimate the free energy involved in a set of DNA-based systems ranging from unimolecular DNA-based nanoswitches to more complex DNA folds (e.g. aptamers) and nanodevices. We propose here a set of fitting equations that allow to analyze the urea titration curves of these DNA responsive units based on Watson–Crick and non-canonical interactions (stem-loop, G-quadruplex, triplex structures) and to correctly estimate their relative folding and binding free energy values under different experimental conditions. The results described herein will pave the way toward the use of urea titration experiments in the field of DNA nanotechnology to achieve easier and more reliable thermodynamic characterization of DNA-based functional responsive units. More generally, our results will be of general utility to characterize other complex supramolecular systems based on different biopolymers. PMID:28605461

The evaluation of anoxia responsive E2F DNA binding activity in the red eared slider turtle, Trachemys scripta elegans.

PubMed

Biggar, Kyle K; Storey, Kenneth B

2018-01-01

In many cases, the DNA-binding activity of a transcription factor does not change, while its transcriptional activity is greatly influenced by the make-up of bound proteins. In this study, we assessed the protein composition and DNA-binding ability of the E2F transcription factor complex to provide insight into cell cycle control in an anoxia tolerant turtle through the use of a modified ELISA protocol. This modification also permits the use of custom DNA probes that are tailored to a specific DNA binding region, introducing the ability to design capture probes for non-model organisms. Through the use of EMSA and ELISA DNA binding assays, we have successfully determined the in vitro DNA binding activity and complex dynamics of the Rb/E2F cell cycle regulatory mechanisms in an anoxic turtle, Trachemys scripta elegans . Repressive cell cycle proteins (E2F4, Rb, HDAC4 and Suv39H1) were found to significantly increase at E2F DNA-binding sites upon anoxic exposure in anoxic turtle liver. The lack of p130 involvement in the E2F DNA-bound complex indicates that anoxic turtle liver may maintain G 1 arrest for the duration of stress survival.

The evaluation of anoxia responsive E2F DNA binding activity in the red eared slider turtle, Trachemys scripta elegans

PubMed Central

Biggar, Kyle K.

2018-01-01

In many cases, the DNA-binding activity of a transcription factor does not change, while its transcriptional activity is greatly influenced by the make-up of bound proteins. In this study, we assessed the protein composition and DNA-binding ability of the E2F transcription factor complex to provide insight into cell cycle control in an anoxia tolerant turtle through the use of a modified ELISA protocol. This modification also permits the use of custom DNA probes that are tailored to a specific DNA binding region, introducing the ability to design capture probes for non-model organisms. Through the use of EMSA and ELISA DNA binding assays, we have successfully determined the in vitro DNA binding activity and complex dynamics of the Rb/E2F cell cycle regulatory mechanisms in an anoxic turtle, Trachemys scripta elegans. Repressive cell cycle proteins (E2F4, Rb, HDAC4 and Suv39H1) were found to significantly increase at E2F DNA-binding sites upon anoxic exposure in anoxic turtle liver. The lack of p130 involvement in the E2F DNA-bound complex indicates that anoxic turtle liver may maintain G1 arrest for the duration of stress survival. PMID:29770276

Novel structural features drive DNA binding properties of Cmr, a CRP family protein in TB complex mycobacteria.

PubMed

Ranganathan, Sridevi; Cheung, Jonah; Cassidy, Michael; Ginter, Christopher; Pata, Janice D; McDonough, Kathleen A

2018-01-09

Mycobacterium tuberculosis (Mtb) encodes two CRP/FNR family transcription factors (TF) that contribute to virulence, Cmr (Rv1675c) and CRPMt (Rv3676). Prior studies identified distinct chromosomal binding profiles for each TF despite their recognizing overlapping DNA motifs. The present study shows that Cmr binding specificity is determined by discriminator nucleotides at motif positions 4 and 13. X-ray crystallography and targeted mutational analyses identified an arginine-rich loop that expands Cmr's DNA interactions beyond the classical helix-turn-helix contacts common to all CRP/FNR family members and facilitates binding to imperfect DNA sequences. Cmr binding to DNA results in a pronounced asymmetric bending of the DNA and its high level of cooperativity is consistent with DNA-facilitated dimerization. A unique N-terminal extension inserts between the DNA binding and dimerization domains, partially occluding the site where the canonical cAMP binding pocket is found. However, an unstructured region of this N-terminus may help modulate Cmr activity in response to cellular signals. Cmr's multiple levels of DNA interaction likely enhance its ability to integrate diverse gene regulatory signals, while its novel structural features establish Cmr as an atypical CRP/FNR family member. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

Structures of apo IRF-3 and IRF-7 DNA binding domains: effect of loop L1 on DNA binding

DOE Office of Scientific and Technical Information (OSTI.GOV)

De Ioannes, Pablo; Escalante, Carlos R.; Aggarwal, Aneel K.

2013-11-20

Interferon regulatory factors IRF-3 and IRF-7 are transcription factors essential in the activation of interferon-{beta} (IFN-{beta}) gene in response to viral infections. Although, both proteins recognize the same consensus IRF binding site AANNGAAA, they have distinct DNA binding preferences for sites in vivo. The X-ray structures of IRF-3 and IRF-7 DNA binding domains (DBDs) bound to IFN-{beta} promoter elements revealed flexibility in the loops (L1-L3) and the residues that make contacts with the target sequence. To characterize the conformational changes that occur on DNA binding and how they differ between IRF family members, we have solved the X-ray structures ofmore » IRF-3 and IRF-7 DBDs in the absence of DNA. We found that loop L1, carrying the conserved histidine that interacts with the DNA minor groove, is disordered in apo IRF-3 but is ordered in apo IRF-7. This is reflected in differences in DNA binding affinities when the conserved histidine in loop L1 is mutated to alanine in the two proteins. The stability of loop L1 in IRF-7 derives from a unique combination of hydrophobic residues that pack against the protein core. Together, our data show that differences in flexibility of loop L1 are an important determinant of differential IRF-DNA binding.« less

The Verrucomicrobia LexA-Binding Motif: Insights into the Evolutionary Dynamics of the SOS Response.

PubMed

Erill, Ivan; Campoy, Susana; Kılıç, Sefa; Barbé, Jordi

2016-01-01

The SOS response is the primary bacterial mechanism to address DNA damage, coordinating multiple cellular processes that include DNA repair, cell division, and translesion synthesis. In contrast to other regulatory systems, the composition of the SOS genetic network and the binding motif of its transcriptional repressor, LexA, have been shown to vary greatly across bacterial clades, making it an ideal system to study the co-evolution of transcription factors and their regulons. Leveraging comparative genomics approaches and prior knowledge on the core SOS regulon, here we define the binding motif of the Verrucomicrobia, a recently described phylum of emerging interest due to its association with eukaryotic hosts. Site directed mutagenesis of the Verrucomicrobium spinosum recA promoter confirms that LexA binds a 14 bp palindromic motif with consensus sequence TGTTC-N4-GAACA. Computational analyses suggest that recognition of this novel motif is determined primarily by changes in base-contacting residues of the third alpha helix of the LexA helix-turn-helix DNA binding motif. In conjunction with comparative genomics analysis of the LexA regulon in the Verrucomicrobia phylum, electrophoretic shift assays reveal that LexA binds to operators in the promoter region of DNA repair genes and a mutagenesis cassette in this organism, and identify previously unreported components of the SOS response. The identification of tandem LexA-binding sites generating instances of other LexA-binding motifs in the lexA gene promoter of Verrucomicrobia species leads us to postulate a novel mechanism for LexA-binding motif evolution. This model, based on gene duplication, successfully addresses outstanding questions in the intricate co-evolution of the LexA protein, its binding motif and the regulatory network it controls.

The human haptoglobin gene promoter: interleukin-6-responsive elements interact with a DNA-binding protein induced by interleukin-6.

PubMed Central

Oliviero, S; Cortese, R

1989-01-01

Transcription of the human haptoglobin (Hp) gene is induced by interleukin-6 (IL-6) in the human hepatoma cell line Hep3B. Cis-acting elements responsible for this response are localized within the first 186 bp of the 5'-flanking region. Site-specific mutants of the Hp promoter fused to the chloramphenicol acetyl transferase (CAT) gene were analysed by transient transfection into uninduced and IL-6-treated Hep3B cells. We identified three regions, A, B and C, defined by mutation, which are important for the IL-6 response. Band shift experiments using nuclear extracts from untreated or IL-6-treated cells revealed the presence of IL-6-inducible DNA binding activities when DNA fragments containing the A or the C sequences were used. Competition experiments showed that both sequences bind to the same nuclear factors. Polymers of oligonucleotides containing either the A or the C regions confer IL-6 responsiveness to a truncated SV40 promoter. The B region forms several complexes with specific DNA-binding proteins different from those which bind to the A and C region. The B region complexes are identical in nuclear extracts from IL-6-treated and untreated cells. While important for IL-6 induction in the context of the haptoglobin promoter, the B site does not confer IL-6 inducibility to the SV40 promoter. Our results indicate that the IL-6 response of the haptoglobin promoter is dependent on the presence of multiple, partly redundant, cis-acting elements. Images PMID:2787245

Replication of damaged DNA in vitro is blocked by p53

PubMed Central

Zhou, Jianmin; Prives, Carol

2003-01-01

The tumor suppressor protein p53 may have other roles and functions in addition to its well-documented ability to serve as a sequence-specific transcriptional activator in response to DNA damage. We showed previously that p53 can block the replication of polyomavirus origin-containing DNA (Py ori-DNA) in vitro when p53 binding sites are present on the late side of the Py ori. Here we have both further extended these observations and have also examined whether p53 might be able to bind directly to and inhibit the replication of damaged DNA. We found that p53 strongly inhibits replication of γ-irradiated Py ori-DNA and such inhibition requires both the central DNA binding domain and the extreme C-terminus of the p53 protein. An endogenous p53 binding site lies within the Py origin and is required for the ability of p53 to block initiation of replication from γ-irradiated Py ori-DNA, suggesting the possibility of DNA looping caused by p53 binding both non-specifically to sites of DNA damage and specifically to the endogenous site in the polyomavirus origin. Our results thus suggest the possibility that under some circumstances p53 might serve as a direct regulator of DNA replication and suggest as well an additional function for cooperation between its two autonomous DNA binding domains. PMID:12853603

Identification of a Hydrophobic Cleft in the LytTR Domain of AgrA as a Locus for Small Molecule Interactions that Inhibit DNA Binding

PubMed Central

Leonard, Paul G.; Bezar, Ian F.; Sidote, David J.; Stock, Ann M.

2012-01-01

The AgrA transcription factor regulates the quorum-sensing response in Staphylococcus aureus, controlling the production of hemolysins and other virulence factors. AgrA binds to DNA via its C-terminal LytTR domain, a domain not found in humans but common in many pathogenic bacteria, making it a potential target for antimicrobial development. We have determined the crystal structure of the apo AgrA LytTR domain and screened a library of 500 fragment compounds to find inhibitors of AgrA DNA-binding activity. Using NMR, the binding site for five compounds has been mapped to a common locus at the C-terminal end of the LytTR domain, a site known to be important for DNA-binding activity. Three of these compounds inhibit AgrA DNA binding. These results provide the first evidence that LytTR domains can be targeted by small organic compounds. PMID:23181972

Trigger Factor and DnaK possess overlapping substrate pools and binding specificities.

PubMed

Deuerling, Elke; Patzelt, Holger; Vorderwülbecke, Sonja; Rauch, Thomas; Kramer, Günter; Schaffitzel, Elke; Mogk, Axel; Schulze-Specking, Agnes; Langen, Hanno; Bukau, Bernd

2003-03-01

Ribosome-associated Trigger Factor (TF) and the DnaK chaperone system assist the folding of newly synthesized proteins in Escherichia coli. Here, we show that DnaK and TF share a common substrate pool in vivo. In TF-deficient cells, deltatig, depleted for DnaK and DnaJ the amount of aggregated proteins increases with increasing temperature, amounting to 10% of total soluble protein (approximately 340 protein species) at 37 degrees C. A similar population of proteins aggregated in DnaK depleted tig+ cells, albeit to a much lower extent. Ninety-four aggregated proteins isolated from DnaK- and DnaJ-depleted deltatig cells were identified by mass spectrometry and found to include essential cytosolic proteins. Four potential in vivo substrates were screened for chaperone binding sites using peptide libraries. Although TF and DnaK recognize different binding motifs, 77% of TF binding peptides also associated with DnaK. In the case of the nascent polypeptides TF and DnaK competed for binding, however, with competitive advantage for TF. In vivo, the loss of TF is compensated by the induction of the heat shock response and thus enhanced levels of DnaK. In summary, our results demonstrate that the co-operation of the two mechanistically distinct chaperones in protein folding is based on their overlap in substrate specificities.

HTLV-1 Tax Oncoprotein Subverts the Cellular DNA Damage Response via Binding to DNA-dependent Protein Kinase*S⃞

PubMed Central

Durkin, Sarah S.; Guo, Xin; Fryrear, Kimberly A.; Mihaylova, Valia T.; Gupta, Saurabh K.; Belgnaoui, S. Mehdi; Haoudi, Abdelali; Kupfer, Gary M.; Semmes, O. John

2008-01-01

Human T-cell leukemia virus type-1 is the causative agent for adult T-cell leukemia. Previous research has established that the viral oncoprotein Tax mediates the transformation process by impairing cell cycle control and cellular response to DNA damage. We showed previously that Tax sequesters huChk2 within chromatin and impairs the response to ionizing radiation. Here we demonstrate that DNA-dependent protein kinase (DNA-PK) is a member of the Tax·Chk2 nuclear complex. The catalytic subunit, DNA-PKcs, and the regulatory subunit, Ku70, were present. Tax-containing nuclear extracts showed increased DNA-PK activity, and specific inhibition of DNA-PK prevented Tax-induced activation of Chk2 kinase activity. Expression of Tax induced foci formation and phosphorylation of H2AX. However, Tax-induced constitutive signaling of the DNA-PK pathway impaired cellular response to new damage, as reflected in suppression of ionizing radiation-induced DNA-PK phosphorylation and γH2AX stabilization. Tax co-localized with phospho-DNA-PK into nuclear speckles and a nuclear excluded Tax mutant sequestered endogenous phospho-DNA-PK into the cytoplasm, suggesting that Tax interaction with DNA-PK is an initiating event. We also describe a novel interaction between DNA-PK and Chk2 that requires Tax. We propose that Tax binds to and stabilizes a protein complex with DNA-PK and Chk2, resulting in a saturation of DNA-PK-mediated damage repair response. PMID:18957425

Insights into the nature of DNA binding of AbrB-like transcription factors

PubMed Central

Sullivan, Daniel M.; Bobay, Benjamin G.; Kojetin, Douglas J.; Thompson, Richele J.; Rance, Mark; Strauch, Mark A.; Cavanagh, John

2008-01-01

Summary Understanding the DNA recognition and binding by the AbrB-like family of transcriptional regulators is of significant interest since these proteins enable bacteria to elicit the appropriate response to diverse environmental stimuli. Although these ‘transition-state regulator’ proteins have been well characterized at the genetic level, the general and specific mechanisms of DNA binding remain elusive. We present RDC-refined NMR solution structures and dynamic properties of the DNA-binding domains of three Bacillus subtilis transition-state regulators AbrB, Abh, and SpoVT. We combined previously investigated DNase I footprinting, DNA methylation, gel shift assays, mutagenic and NMR studies to generate a structural model of the complex between AbrBN55 and its cognate promoter, abrB8. These investigations have enabled us to generate the first model for the specific nature of the transition-state regulator-DNA interaction. PMID:19000822

Expression, purification, and DNA-binding activity of the Herbaspirillum seropedicae RecX protein.

PubMed

Galvão, Carolina W; Pedrosa, Fábio O; Souza, Emanuel M; Yates, M Geoffrey; Chubatsu, Leda S; Steffens, Maria Berenice R

2004-06-01

The Herbaspirillum seropedicae RecX protein participates in the SOS response: a process in which the RecA protein plays a central role. The RecX protein of the H. seropedicae, fused to a His-tag sequence (RecX His-tagged), was over-expressed in Escherichia coli and purified by metal-affinity chromatography to yield a highly purified and active protein. DNA band-shift assays showed that the RecX His-tagged protein bound to both circular and linear double-stranded DNA and also to circular single-stranded DNA. The apparent affinity of RecX for DNA decreased in the presence of Mg(2+) ions. The ability of RecX to bind DNA may be relevant to its function in the SOS response.

Optimization of Polyplex Formation between DNA Oligonucleotide and Poly(ʟ-Lysine): Experimental Study and Modeling Approach.

PubMed

Vasiliu, Tudor; Cojocaru, Corneliu; Rotaru, Alexandru; Pricope, Gabriela; Pinteala, Mariana; Clima, Lilia

2017-06-17

The polyplexes formed by nucleic acids and polycations have received a great attention owing to their potential application in gene therapy. In our study, we report experimental results and modeling outcomes regarding the optimization of polyplex formation between the double-stranded DNA (dsDNA) and poly(ʟ-Lysine) (PLL). The quantification of the binding efficiency during polyplex formation was performed by processing of the images captured from the gel electrophoresis assays. The design of experiments (DoE) and response surface methodology (RSM) were employed to investigate the coupling effect of key factors (pH and N/P ratio) affecting the binding efficiency. According to the experimental observations and response surface analysis, the N/P ratio showed a major influence on binding efficiency compared to pH. Model-based optimization calculations along with the experimental confirmation runs unveiled the maximal binding efficiency (99.4%) achieved at pH 5.4 and N/P ratio 125. To support the experimental data and reveal insights of molecular mechanism responsible for the polyplex formation between dsDNA and PLL, molecular dynamics simulations were performed at pH 5.4 and 7.4.

Optimization of Polyplex Formation between DNA Oligonucleotide and Poly(l-Lysine): Experimental Study and Modeling Approach

PubMed Central

Vasiliu, Tudor; Cojocaru, Corneliu; Rotaru, Alexandru; Pricope, Gabriela; Pinteala, Mariana; Clima, Lilia

2017-01-01

The polyplexes formed by nucleic acids and polycations have received a great attention owing to their potential application in gene therapy. In our study, we report experimental results and modeling outcomes regarding the optimization of polyplex formation between the double-stranded DNA (dsDNA) and poly(l-Lysine) (PLL). The quantification of the binding efficiency during polyplex formation was performed by processing of the images captured from the gel electrophoresis assays. The design of experiments (DoE) and response surface methodology (RSM) were employed to investigate the coupling effect of key factors (pH and N/P ratio) affecting the binding efficiency. According to the experimental observations and response surface analysis, the N/P ratio showed a major influence on binding efficiency compared to pH. Model-based optimization calculations along with the experimental confirmation runs unveiled the maximal binding efficiency (99.4%) achieved at pH 5.4 and N/P ratio 125. To support the experimental data and reveal insights of molecular mechanism responsible for the polyplex formation between dsDNA and PLL, molecular dynamics simulations were performed at pH 5.4 and 7.4. PMID:28629130

Generation of mice deficient in RNA-binding motif protein 3 (RBM3) and characterization of its role in innate immune responses and cell growth

DOE Office of Scientific and Technical Information (OSTI.GOV)

Matsuda, Atsushi; Core Research for Evolution Science and Technology, Japan Science and Technology Agency, Chiyoda-ku, Tokyo 102-0075; Ogawa, Masahiro

Highlights: {yields} We identified RNA-binding motif protein 3 (RBM3) as CpG-B DNA-binding protein. {yields} RBM3 translocates from the nucleus to the cytoplasm and co-localized with CpG-B DNA. {yields} We newly generated Rbm3-deficient (Rbm3{sup -/-}) mice. {yields} DNA-mediated cytokine gene induction was normally occured in Rbm3{sup -/-} cells. {yields}Rbm3{sup -/-} MEFs showed poorer proliferation rate and increased number of G2-phase cells. -- Abstract: The activation of innate immune responses is critical to host defense against microbial infections, wherein nucleic acid-sensing pattern recognition receptors recognize DNA or RNA from viruses or bacteria and activate downstream signaling pathways. In a search for newmore » DNA-sensing molecules that regulate innate immune responses, we identified RNA-binding motif protein 3 (RBM3), whose role has been implicated in the regulation of cell growth. In this study, we generated Rbm3-deficient (Rbm3{sup -/-}) mice to study the role of RBM3 in immune responses and cell growth. Despite evidence for its interaction with immunogenic DNA in a cell, no overt phenotypic abnormalities were found in cells from Rbm3{sup -/-} mice for the DNA-mediated induction of cytokine genes. Interestingly, however, Rbm3{sup -/-} mouse embryonic fibroblasts (MEFs) showed poorer proliferation rates as compared to control MEFs. Further cell cycle analysis revealed that Rbm3{sup -/-} MEFs have markedly increased number of G2-phase cells, suggesting a hitherto unknown role of RBM3 in the G2-phase control. Thus, these mutant mice and cells may provide new tools with which to study the mechanisms underlying the regulation of cell cycle and oncogenesis.« less

Structural and Functional Analysis of DDX41: a bispecific immune receptor for DNA and cyclic dinucleotide

PubMed Central

Omura, Hiroki; Oikawa, Daisuke; Nakane, Takanori; Kato, Megumi; Ishii, Ryohei; Ishitani, Ryuichiro; Tokunaga, Fuminori; Nureki, Osamu

2016-01-01

In the innate immune system, pattern recognition receptors (PRRs) specifically recognize ligands derived from bacteria or viruses, to trigger the responsible downstream pathways. DEAD box protein 41 (DDX41) is an intracellular PRR that triggers the downstream pathway involving the adapter STING, the kinase TBK1, and the transcription factor IRF3, to activate the type I interferon response. DDX41 is unique in that it recognizes two different ligands; i.e., double-stranded DNA (dsDNA) and cyclic dinucleotides (CDN), via its DEAD domain. However, the structural basis for the ligand recognition by the DDX41 DEAD domain has remained elusive. Here, we report two crystal structures of the DDX41 DEAD domain in apo forms, at 1.5 and 2.2 Å resolutions. A comparison of the two crystal structures revealed the flexibility in the ATP binding site, suggesting its formation upon ATP binding. Structure-guided functional analyses in vitro and in vivo demonstrated the overlapped binding surface for dsDNA and CDN, which is distinct from the ATP-binding site. We propose that the structural rearrangement of the ATP binding site is crucial for the release of ADP, enabling the fast turnover of DDX41 for the dsDNA/CDN-induced STING activation pathway. PMID:27721487

Reduced DNA repair in mouse satellite DNA after treatment with methylmethanesulfonate, and N-methyl-N-nitrosourea.

PubMed Central

Bodell, W J; Banerjee, M R

1976-01-01

We have measured DNA repair in mouse satellite and main band DNA as resolved by Ag+-Cs2SO4 centrifugation in response to treatment with the alkylating agents, methyl methanesulfonate, and N-methyl-N-nitrosourea. We find that there is a statistically significant lower incorporation of 3H-Tdr into the satellite DNA as compared to the main band at varying periods after treatment with the alkylating agents. This suggests a reduced repair activity in the satellite DNA. We have measured the extent of binding of 14C-methyl methanesulfonate to the satellite, and main band DNA, and no difference in binding was observed, indicating that the reduced repair activity of satellite DNA is not due to a difference in binding of alkylating agents. We believe that the reduced incorporation of 3H-Tdr into satellite DNA may be due to its location in the condensed chromatin fraction. PMID:184436

Specificity determinants for the abscisic acid response element.

PubMed

Sarkar, Aditya Kumar; Lahiri, Ansuman

2013-01-01

Abscisic acid (ABA) response elements (ABREs) are a group of cis-acting DNA elements that have been identified from promoter analysis of many ABA-regulated genes in plants. We are interested in understanding the mechanism of binding specificity between ABREs and a class of bZIP transcription factors known as ABRE binding factors (ABFs). In this work, we have modeled the homodimeric structure of the bZIP domain of ABRE binding factor 1 from Arabidopsis thaliana (AtABF1) and studied its interaction with ACGT core motif-containing ABRE sequences. We have also examined the variation in the stability of the protein-DNA complex upon mutating ABRE sequences using the protein design algorithm FoldX. The high throughput free energy calculations successfully predicted the ability of ABF1 to bind to alternative core motifs like GCGT or AAGT and also rationalized the role of the flanking sequences in determining the specificity of the protein-DNA interaction.

Distinct structural features of the peroxide response regulator from group A Streptococcus drive DNA binding.

PubMed

Lin, Chang Sheng-Huei; Chao, Shi-Yu; Hammel, Michal; Nix, Jay C; Tseng, Hsiao-Ling; Tsou, Chih-Cheng; Fei, Chun-Hsien; Chiou, Huo-Sheng; Jeng, U-Ser; Lin, Yee-Shin; Chuang, Woei-Jer; Wu, Jiunn-Jong; Wang, Shuying

2014-01-01

Group A streptococcus (GAS, Streptococcus pyogenes) is a strict human pathogen that causes severe, invasive diseases. GAS does not produce catalase, but has an ability to resist killing by reactive oxygen species (ROS) through novel mechanisms. The peroxide response regulator (PerR), a member of ferric uptake regulator (Fur) family, plays a key role for GAS to cope with oxidative stress by regulating the expression of multiple genes. Our previous studies have found that expression of an iron-binding protein, Dpr, is under the direct control of PerR. To elucidate the molecular interactions of PerR with its cognate promoter, we have carried out structural studies on PerR and PerR-DNA complex. By combining crystallography and small-angle X-ray scattering (SAXS), we confirmed that the determined PerR crystal structure reflects its conformation in solution. Through mutagenesis and biochemical analysis, we have identified DNA-binding residues suggesting that PerR binds to the dpr promoter at the per box through a winged-helix motif. Furthermore, we have performed SAXS analysis and resolved the molecular architecture of PerR-DNA complex, in which two 30 bp DNA fragments wrap around two PerR homodimers by interacting with the adjacent positively-charged winged-helix motifs. Overall, we provide structural insights into molecular recognition of DNA by PerR and define the hollow structural arrangement of PerR-30bpDNA complex, which displays a unique topology distinct from currently proposed DNA-binding models for Fur family regulators.

Mechanism of the CO-sensing heme protein CooA: new insights from the truncated heme domain and UVRR spectroscopy

PubMed Central

Ibrahim, Mohammed; Kuchinskas, Michael; Youn, Hwan; Kerby, Robert L.; Roberts, Gary P.; Poulos, Thomas L.; Spiro, Thomas G.

2007-01-01

The bacterial CO-sensing heme protein CooA activates expression of genes whose products perform CO-metabolism by binding its target DNA in response to CO binding. The required conformational change has been proposed to result from CO-induced displacement of the heme and of the adjacent C-helix, which connects the sensory and DNA-binding domains. Support for this proposal comes from UV Resonance Raman (UVRR) spectroscopy, which reveals a more hydrophobic environment for the C-helix residue Trp110 when CO binds. In addition, we find a tyrosine UVRR response, which is attributable to weakening of a Tyr55-Glu83 H-bond that anchors the proximal side of the heme. Both Trp and Tyr responses are augmented in the heme domain when the DNA-binding domain has been removed, apparently reflecting loss of the inter-domain restraint. This augmentation is abolished by a Glu83Gln substitution, which weakens the anchoring H-bond. The CO recombination rate following photolysis of the CO adduct is similar for truncated and full-length protein, though truncation does increase the rate of CO association in the absence of photolysis; together these data indicate that truncation causes a faster dissociation of the endogenous Pro2 ligand. These findings are discussed in the light of structural evidence that the N-terminal tail, once released from the heme, selects the proper orientation of the DNA-binding domain, via docking interactions. PMID:17720248

Identification of a p53-response element in the promoter of the proline oxidase gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Maxwell, Steve A.; Kochevar, Gerald J.

2008-05-02

Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less

A novel class of plant-specific zinc-dependent DNA-binding protein that binds to A/T-rich DNA sequences

PubMed Central

Nagano, Yukio; Furuhashi, Hirofumi; Inaba, Takehito; Sasaki, Yukiko

2001-01-01

Complementary DNA encoding a DNA-binding protein, designated PLATZ1 (plant AT-rich sequence- and zinc-binding protein 1), was isolated from peas. The amino acid sequence of the protein is similar to those of other uncharacterized proteins predicted from the genome sequences of higher plants. However, no paralogous sequences have been found outside the plant kingdom. Multiple alignments among these paralogous proteins show that several cysteine and histidine residues are invariant, suggesting that these proteins are a novel class of zinc-dependent DNA-binding proteins with two distantly located regions, C-x2-H-x11-C-x2-C-x(4–5)-C-x2-C-x(3–7)-H-x2-H and C-x2-C-x(10–11)-C-x3-C. In an electrophoretic mobility shift assay, the zinc chelator 1,10-o-phenanthroline inhibited DNA binding, and two distant zinc-binding regions were required for DNA binding. A protein blot with 65ZnCl2 showed that both regions are required for zinc-binding activity. The PLATZ1 protein non-specifically binds to A/T-rich sequences, including the upstream region of the pea GTPase pra2 and plastocyanin petE genes. Expression of the PLATZ1 repressed those of the reporter constructs containing the coding sequence of luciferase gene driven by the cauliflower mosaic virus (CaMV) 35S90 promoter fused to the tandem repeat of the A/T-rich sequences. These results indicate that PLATZ1 is a novel class of plant-specific zinc-dependent DNA-binding protein responsible for A/T-rich sequence-mediated transcriptional repression. PMID:11600698

Cold-inducible RNA-binding protein through TLR4 signaling induces mitochondrial DNA fragmentation and regulates macrophage cell death after trauma.

PubMed

Li, Zhigang; Fan, Erica K; Liu, Jinghua; Scott, Melanie J; Li, Yuehua; Li, Song; Xie, Wen; Billiar, Timothy R; Wilson, Mark A; Jiang, Yong; Wang, Ping; Fan, Jie

2017-05-11

Trauma is a major cause of systemic inflammatory response syndrome and multiple organ dysfunction syndrome. Macrophages (Mφ) direct trauma-induced inflammation, and Mφ death critically influences the progression of the inflammatory response. In the current study, we explored an important role of trauma in inducing mitochondrial DNA (mtDNA) damage in Mφ and the subsequent regulation of Mφ death. Using an animal pseudo-fracture trauma model, we demonstrated that tissue damage induced NADPH oxidase activation and increased the release of reactive oxygen species via cold-inducible RNA-binding protein (CIRP)-TLR4-MyD88 signaling. This in turn, activates endonuclease G, which serves as an executor for the fragmentation of mtDNA in Mφ. We further showed that fragmented mtDNA triggered both p62-related autophagy and necroptosis in Mφ. However, autophagy activation also suppressed Mφ necroptosis and pro-inflammatory responses. This study demonstrates a previously unidentified intracellular regulation of Mφ homeostasis in response to trauma.

Cold-inducible RNA-binding protein through TLR4 signaling induces mitochondrial DNA fragmentation and regulates macrophage cell death after trauma

PubMed Central

Li, Zhigang; Fan, Erica K; Liu, Jinghua; Scott, Melanie J; Li, Yuehua; Li, Song; Xie, Wen; Billiar, Timothy R; Wilson, Mark A; Jiang, Yong; Wang, Ping; Fan, Jie

2017-01-01

Trauma is a major cause of systemic inflammatory response syndrome and multiple organ dysfunction syndrome. Macrophages (Mϕ) direct trauma-induced inflammation, and Mϕ death critically influences the progression of the inflammatory response. In the current study, we explored an important role of trauma in inducing mitochondrial DNA (mtDNA) damage in Mϕ and the subsequent regulation of Mϕ death. Using an animal pseudo-fracture trauma model, we demonstrated that tissue damage induced NADPH oxidase activation and increased the release of reactive oxygen species via cold-inducible RNA-binding protein (CIRP)–TLR4–MyD88 signaling. This in turn, activates endonuclease G, which serves as an executor for the fragmentation of mtDNA in Mϕ. We further showed that fragmented mtDNA triggered both p62-related autophagy and necroptosis in Mϕ. However, autophagy activation also suppressed Mϕ necroptosis and pro-inflammatory responses. This study demonstrates a previously unidentified intracellular regulation of Mϕ homeostasis in response to trauma. PMID:28492546

The amplification effect of functionalized gold nanoparticles on the binding of anticancer drug dacarbazine to DNA and DNA bases

NASA Astrophysics Data System (ADS)

Shen, Qin; Wang, Xuemei; Fu, Degang

2008-11-01

The promising application of functionalized gold nanoparticles to amplify the performance of biosensors and relevant biomolecular recognition processes has been explored in this paper. Our observations illustrate the apparent enhancement effect of the gold nanoparticles on the electrochemical response of the anticancer drug dacarbazine (DTIC) binding to DNA and DNA bases, indicating that these functionalized gold nanoparticles could readily facilitate the specific interactions between DTIC and DNA/DNA bases. This raises the potential valuable applications of these biocompatible nanoparticles in the promising biosensors and biomedical engineering.

Solution structure of the DNA-binding domain of RPA from Saccharomyces cerevisiae and its interaction with single-stranded DNA and SV40 T antigen

PubMed Central

Park, Chin-Ju; Lee, Joon-Hwa; Choi, Byong-Seok

2005-01-01

Replication protein A (RPA) is a three-subunit complex with multiple roles in DNA metabolism. DNA-binding domain A in the large subunit of human RPA (hRPA70A) binds to single-stranded DNA (ssDNA) and is responsible for the species-specific RPA–T antigen (T-ag) interaction required for Simian virus 40 replication. Although Saccharomyces cerevisiae RPA70A (scRPA70A) shares high sequence homology with hRPA70A, the two are not functionally equivalent. To elucidate the similarities and differences between these two homologous proteins, we determined the solution structure of scRPA70A, which closely resembled the structure of hRPA70A. The structure of ssDNA-bound scRPA70A, as simulated by residual dipolar coupling-based homology modeling, suggested that the positioning of the ssDNA is the same for scRPA70A and hRPA70A, although the conformational changes that occur in the two proteins upon ssDNA binding are not identical. NMR titrations of hRPA70A with T-ag showed that the T-ag binding surface is separate from the ssDNA-binding region and is more neutral than the corresponding part of scRPA70A. These differences might account for the species-specific nature of the hRPA70A–T-ag interaction. Our results provide insight into how these two homologous RPA proteins can exhibit functional differences, but still both retain their ability to bind ssDNA. PMID:16043636

Solution structure of CEH-37 homeodomain of the nematode Caenorhabditis elegans

DOE Office of Scientific and Technical Information (OSTI.GOV)

Moon, Sunjin; Lee, Yong Woo; Kim, Woo Taek

Highlights: •We have determined solution structures of CEH-37 homedomain. •CEH-37 HD has a compact α-helical structure with HTH DNA binding motif. •Solution structure of CEH-37 HD shares its molecular topology with that of the homeodomain proteins. •Residues in the N-terminal region and HTH motif are important in binding to Caenorhabditis elegans telomeric DNA. •CEH-37 could play an important role in telomere function via DNA binding. -- Abstract: The nematode Caenorhabditis elegans protein CEH-37 belongs to the paired OTD/OTX family of homeobox-containing homeodomain proteins. CEH-37 shares sequence similarity with homeodomain proteins, although it specifically binds to double-stranded C. elegans telomeric DNA,more » which is unusual to homeodomain proteins. Here, we report the solution structure of CEH-37 homeodomain and molecular interaction with double-stranded C. elegans telomeric DNA using nuclear magnetic resonance (NMR) spectroscopy. NMR structure shows that CEH-37 homeodomain is composed of a flexible N-terminal region and three α-helices with a helix-turn-helix (HTH) DNA binding motif. Data from size-exclusion chromatography and fluorescence spectroscopy reveal that CEH-37 homeodomain interacts strongly with double-stranded C. elegans telomeric DNA. NMR titration experiments identified residues responsible for specific binding to nematode double-stranded telomeric DNA. These results suggest that C. elegans homeodomain protein, CEH-37 could play an important role in telomere function via DNA binding.« less

Zinc-binding Domain of the Bacteriophage T7 DNA Primase Modulates Binding to the DNA Template*

PubMed Central

Lee, Seung-Joo; Zhu, Bin; Akabayov, Barak; Richardson, Charles C.

2012-01-01

The zinc-binding domain (ZBD) of prokaryotic DNA primases has been postulated to be crucial for recognition of specific sequences in the single-stranded DNA template. To determine the molecular basis for this role in recognition, we carried out homolog-scanning mutagenesis of the zinc-binding domain of DNA primase of bacteriophage T7 using a bacterial homolog from Geobacillus stearothermophilus. The ability of T7 DNA primase to catalyze template-directed oligoribonucleotide synthesis is eliminated by substitution of any five-amino acid residue-long segment within the ZBD. The most significant defect occurs upon substitution of a region (Pro-16 to Cys-20) spanning two cysteines that coordinate the zinc ion. The role of this region in primase function was further investigated by generating a protein library composed of multiple amino acid substitutions for Pro-16, Asp-18, and Asn-19 followed by genetic screening for functional proteins. Examination of proteins selected from the screening reveals no change in sequence-specific recognition. However, the more positively charged residues in the region facilitate DNA binding, leading to more efficient oligoribonucleotide synthesis on short templates. The results suggest that the zinc-binding mode alone is not responsible for sequence recognition, but rather its interaction with the RNA polymerase domain is critical for DNA binding and for sequence recognition. Consequently, any alteration in the ZBD that disturbs its conformation leads to loss of DNA-dependent oligoribonucleotide synthesis. PMID:23024359

Surface reengineering of RPA70N enables cocrystallization with an inhibitor of the replication protein A interaction motif of ATR interacting protein.

PubMed

Feldkamp, Michael D; Frank, Andreas O; Kennedy, J Phillip; Patrone, James D; Vangamudi, Bhavatarini; Waterson, Alex G; Fesik, Stephen W; Chazin, Walter J

2013-09-17

Replication protein A (RPA) is the primary single-stranded DNA (ssDNA) binding protein in eukaryotes. The N-terminal domain of the RPA70 subunit (RPA70N) interacts via a basic cleft with a wide range of DNA processing proteins, including several that regulate DNA damage response and repair. Small molecule inhibitors that disrupt these protein-protein interactions are therefore of interest as chemical probes of these critical DNA processing pathways and as inhibitors to counter the upregulation of DNA damage response and repair associated with treatment of cancer patients with radiation or DNA-damaging agents. Determination of three-dimensional structures of protein-ligand complexes is an important step for elaboration of small molecule inhibitors. However, although crystal structures of free RPA70N and an RPA70N-peptide fusion construct have been reported, RPA70N-inhibitor complexes have been recalcitrant to crystallization. Analysis of the P61 lattice of RPA70N crystals led us to hypothesize that the ligand-binding surface was occluded. Surface reengineering to alter key crystal lattice contacts led to the design of RPA70N E7R, E100R, and E7R/E100R mutants. These mutants crystallized in a P212121 lattice that clearly had significant solvent channels open to the critical basic cleft. Analysis of X-ray crystal structures, target peptide binding affinities, and (15)N-(1)H heteronuclear single-quantum coherence nuclear magnetic resonance spectra showed that the mutations do not result in perturbations of the RPA70N ligand-binding surface. The success of the design was demonstrated by determining the structure of RPA70N E7R soaked with a ligand discovered in a previously reported molecular fragment screen. A fluorescence anisotropy competition binding assay revealed this compound can inhibit the interaction of RPA70N with the peptide binding motif from the DNA damage response protein ATRIP. The implications of the results are discussed in the context of ongoing efforts to design RPA70N inhibitors.

Aptamer-Binding Directed DNA Origami Pattern for Logic Gates.

PubMed

Yang, Jing; Jiang, Shuoxing; Liu, Xiangrong; Pan, Linqiang; Zhang, Cheng

2016-12-14

In this study, an aptamer-substrate strategy is introduced to control programmable DNA origami pattern. Combined with DNA aptamer-substrate binding and DNAzyme-cutting, small DNA tiles were specifically controlled to fill into the predesigned DNA origami frame. Here, a set of DNA logic gates (OR, YES, and AND) are performed in response to the stimuli of adenosine triphosphate (ATP) and cocaine. The experimental results are confirmed by AFM imaging and time-dependent fluorescence changes, demonstrating that the geometric patterns are regulated in a controllable and programmable manner. Our approach provides a new platform for engineering programmable origami nanopatterns and constructing complex DNA nanodevices.

High-Mobility Group Chromatin Proteins 1 and 2 Functionally Interact with Steroid Hormone Receptors To Enhance Their DNA Binding In Vitro and Transcriptional Activity in Mammalian Cells

PubMed Central

Boonyaratanakornkit, Viroj; Melvin, Vida; Prendergast, Paul; Altmann, Magda; Ronfani, Lorenza; Bianchi, Marco E.; Taraseviciene, Laima; Nordeen, Steven K.; Allegretto, Elizabeth A.; Edwards, Dean P.

1998-01-01

We previously reported that the chromatin high-mobility group protein 1 (HMG-1) enhances the sequence-specific DNA binding activity of progesterone receptor (PR) in vitro, thus providing the first evidence that HMG-1 may have a coregulatory role in steroid receptor-mediated gene transcription. Here we show that HMG-1 and the highly related HMG-2 stimulate DNA binding by other steroid receptors, including estrogen, androgen, and glucocorticoid receptors, but have no effect on DNA binding by several nonsteroid nuclear receptors, including retinoid acid receptor (RAR), retinoic X receptor (RXR), and vitamin D receptor (VDR). As highly purified recombinant full-length proteins, all steroid receptors tested exhibited weak binding affinity for their optimal palindromic hormone response elements (HREs), and the addition of purified HMG-1 or -2 substantially increased their affinity for HREs. Purified RAR, RXR, and VDR also exhibited little to no detectable binding to their cognate direct repeat HREs but, in contrast to results with steroid receptors, the addition of HMG-1 or HMG-2 had no stimulatory effect. Instead, the addition of purified RXR enhanced RAR and VDR DNA binding through a heterodimerization mechanism and HMG-1 or HMG-2 had no further effect on DNA binding by RXR-RAR or RXR-VDR heterodimers. HMG-1 and HMG-2 (HMG-1/-2) themselves do not bind to progesterone response elements, but in the presence of PR they were detected as part of an HMG-PR-DNA ternary complex. HMG-1/-2 can also interact transiently in vitro with PR in the absence of DNA; however, no direct protein interaction was detected with VDR. These results, taken together with the fact that PR can bend its target DNA and that HMG-1/-2 are non-sequence-specific DNA binding proteins that recognize DNA structure, suggest that HMG-1/-2 are recruited to the PR-DNA complex by the combined effect of transient protein interaction and DNA bending. In transient-transfection assays, coexpression of HMG-1 or HMG-2 increased PR-mediated transcription in mammalian cells by as much as 7- to 10-fold without altering the basal promoter activity of target reporter genes. This increase in PR-mediated gene activation by coexpression of HMG-1/-2 was observed in different cell types and with different target promoters, suggesting a generality to the functional interaction between HMG-1/-2 and PR in vivo. Cotransfection of HMG-1 also increased reporter gene activation mediated by other steroid receptors, including glucocorticoid and androgen receptors, but it had a minimal influence on VDR-dependent transcription in vivo. These results support the conclusion that HMG-1/-2 are coregulatory proteins that increase the DNA binding and transcriptional activity of the steroid hormone class of receptors but that do not functionally interact with certain nonsteroid classes of nuclear receptors. PMID:9671457

Specialized nucleoprotein structures at the origin of replication of bacteriophage lambda: localized unwinding of duplex DNA by a six-protein reaction.

PubMed Central

Dodson, M; Echols, H; Wickner, S; Alfano, C; Mensa-Wilmot, K; Gomes, B; LeBowitz, J; Roberts, J D; McMacken, R

1986-01-01

The O protein of bacteriophage lambda localizes the initiation of DNA replication to a unique site on the lambda genome, ori lambda. By means of electron microscopy, we infer that the binding of O to ori lambda initiates a series of protein addition and transfer reactions that culminate in localized unwinding of the origin DNA, generating a prepriming structure for the initiation of DNA replication. We can define three stages of this prepriming reaction, the first two of which we have characterized previously. First, dimeric O protein binds to multiple DNA binding sites and self-associates to form a nucleoprotein structure, the O-some. Second, lambda P and host DnaB proteins interact with the O-some to generate a larger complex that includes additional DNA from an A + T-rich region adjacent to the O binding sites. Third, the addition of the DnaJ, DnaK, and Ssb proteins and ATP results in an origin-specific unwinding reaction, probably catalyzed by the helicase activity of DnaB. The unwinding reaction is unidirectional, proceeding "rightward" from the origin. The minimal DNA sequence competent for unwinding consists of two O binding sites and the adjacent A + T-rich region to the right of the binding sites. We conclude that the lambda O protein localizes and initiates a six-protein sequential reaction responsible for but preceding the precise initiation of DNA replication. Specialized nucleoprotein structures similar to the O-some may be a general feature of DNA transactions requiring extraordinary precision in localization and control. Images PMID:3020552

Genome-wide DNA methylation reprogramming in response to inorganic arsenic links inhibition of CTCF binding, DNMT expression and cellular transformation

NASA Astrophysics Data System (ADS)

Rea, Matthew; Eckstein, Meredith; Eleazer, Rebekah; Smith, Caroline; Fondufe-Mittendorf, Yvonne N.

2017-02-01

Chronic low dose inorganic arsenic (iAs) exposure leads to changes in gene expression and epithelial-to-mesenchymal transformation. During this transformation, cells adopt a fibroblast-like phenotype accompanied by profound gene expression changes. While many mechanisms have been implicated in this transformation, studies that focus on the role of epigenetic alterations in this process are just emerging. DNA methylation controls gene expression in physiologic and pathologic states. Several studies show alterations in DNA methylation patterns in iAs-mediated pathogenesis, but these studies focused on single genes. We present a comprehensive genome-wide DNA methylation analysis using methyl-sequencing to measure changes between normal and iAs-transformed cells. Additionally, these differential methylation changes correlated positively with changes in gene expression and alternative splicing. Interestingly, most of these differentially methylated genes function in cell adhesion and communication pathways. To gain insight into how genomic DNA methylation patterns are regulated during iAs-mediated carcinogenesis, we show that iAs probably targets CTCF binding at the promoter of DNA methyltransferases, regulating their expression. These findings reveal how CTCF binding regulates DNA methyltransferase to reprogram the methylome in response to an environmental toxin.

Genome-wide DNA methylation reprogramming in response to inorganic arsenic links inhibition of CTCF binding, DNMT expression and cellular transformation

PubMed Central

Rea, Matthew; Eckstein, Meredith; Eleazer, Rebekah; Smith, Caroline; Fondufe-Mittendorf , Yvonne N.

2017-01-01

Chronic low dose inorganic arsenic (iAs) exposure leads to changes in gene expression and epithelial-to-mesenchymal transformation. During this transformation, cells adopt a fibroblast-like phenotype accompanied by profound gene expression changes. While many mechanisms have been implicated in this transformation, studies that focus on the role of epigenetic alterations in this process are just emerging. DNA methylation controls gene expression in physiologic and pathologic states. Several studies show alterations in DNA methylation patterns in iAs-mediated pathogenesis, but these studies focused on single genes. We present a comprehensive genome-wide DNA methylation analysis using methyl-sequencing to measure changes between normal and iAs-transformed cells. Additionally, these differential methylation changes correlated positively with changes in gene expression and alternative splicing. Interestingly, most of these differentially methylated genes function in cell adhesion and communication pathways. To gain insight into how genomic DNA methylation patterns are regulated during iAs-mediated carcinogenesis, we show that iAs probably targets CTCF binding at the promoter of DNA methyltransferases, regulating their expression. These findings reveal how CTCF binding regulates DNA methyltransferase to reprogram the methylome in response to an environmental toxin. PMID:28150704

Cytosolic sensing of immuno-stimulatory DNA, the enemy within.

PubMed

Dhanwani, Rekha; Takahashi, Mariko; Sharma, Sonia

2018-02-01

In the cytoplasm, DNA is sensed as a universal danger signal by the innate immune system. Cyclic GMP-AMP synthase (cGAS) is a cytosolic DNA sensor/enzyme that catalyzes formation of 2'-5'-cGAMP, an atypical cyclic di-nucleotide second messenger that binds and activates the Stimulator of Interferon Genes (STING), resulting in recruitment of Tank Binding Kinase 1 (TBK1), activation of the transcription factor Interferon Regulatory Factor 3 (IRF3), and trans-activation of innate immune response genes, including type I Interferon cytokines (IFN-I). Activation of the pro-inflammatory cGAS-STING-IRF3 response is triggered by direct recognition of the DNA genomes of bacteria and viruses, but also during RNA virus infection, neoplastic transformation, tumor immunotherapy and systemic auto-inflammatory diseases. In these circumstances, the source of immuno-stimulatory DNA has often represented a fundamental yet poorly understood aspect of the response. This review focuses on recent findings related to cGAS activation by an array of self-derived DNA substrates, including endogenous retroviral elements, mitochondrial DNA (mtDNA) and micronuclei generated as a result of genotoxic stress and DNA damage. These findings emphasize the role of the cGAS axis as a cell-intrinsic innate immune response to a wide variety of genomic insults. Copyright © 2017. Published by Elsevier Ltd.

The DNA-recognition mode shared by archaeal feast/famine-regulatory proteins revealed by the DNA-binding specificities of TvFL3, FL10, FL11 and Ss-LrpB

PubMed Central

Yokoyama, Katsushi; Nogami, Hideki; Kabasawa, Mamiko; Ebihara, Sonomi; Shimowasa, Ai; Hashimoto, Keiko; Kawashima, Tsuyoshi; Ishijima, Sanae A.; Suzuki, Masashi

2009-01-01

The DNA-binding mode of archaeal feast/famine-regulatory proteins (FFRPs), i.e. paralogs of the Esherichia coli leucine-responsive regulatory protein (Lrp), was studied. Using the method of systematic evolution of ligands by exponential enrichment (SELEX), optimal DNA duplexes for interacting with TvFL3, FL10, FL11 and Ss-LrpB were identified as TACGA[AAT/ATT]TCGTA, GTTCGA[AAT/ATT]TCGAAC, CCGAAA[AAT/ATT]TTTCGG and TTGCAA[AAT/ATT]TTGCAA, respectively, all fitting into the form abcdeWWWedcba. Here W is A or T, and e.g. a and a are bases complementary to each other. Apparent equilibrium binding constants of the FFRPs and various DNA duplexes were determined, thereby confirming the DNA-binding specificities of the FFRPs. It is likely that these FFRPs recognize DNA in essentially the same way, since their DNA-binding specificities were all explained by the same pattern of relationship between amino-acid positions and base positions to form chemical interactions. As predicted from this relationship, when Gly36 of TvFL3 was replaced by Thr, the b base in the optimal DNA duplex changed from A to T, and, when Thr36 of FL10 was replaced by Ser, the b base changed from T to G/A. DNA-binding characteristics of other archaeal FFRPs, Ptr1, Ptr2, Ss-Lrp and LysM, are also consistent with the relationship. PMID:19468044

The Replication Focus Targeting Sequence (RFTS) Domain Is a DNA-competitive Inhibitor of Dnmt1

DOE Office of Scientific and Technical Information (OSTI.GOV)

Syeda, Farisa; Fagan, Rebecca L.; Wean, Matthew

Dnmt1 (DNA methyltransferase 1) is the principal enzyme responsible for maintenance of cytosine methylation at CpG dinucleotides in the mammalian genome. The N-terminal replication focus targeting sequence (RFTS) domain of Dnmt1 has been implicated in subcellular localization, protein association, and catalytic function. However, progress in understanding its function has been limited by the lack of assays for and a structure of this domain. Here, we show that the naked DNA- and polynucleosome-binding activities of Dnmt1 are inhibited by the RFTS domain, which functions by virtue of binding the catalytic domain to the exclusion of DNA. Kinetic analysis with a fluorogenicmore » DNA substrate established the RFTS domain as a 600-fold inhibitor of Dnmt1 enzymatic activity. The crystal structure of the RFTS domain reveals a novel fold and supports a mechanism in which an RFTS-targeted Dnmt1-binding protein, such as Uhrf1, may activate Dnmt1 for DNA binding.« less

Function and horizontal transfer of the small terminase subunit of the tailed bacteriophage Sf6 DNA packaging nanomotor

PubMed Central

Leavitt, Justin C.; Gilcrease, Eddie B.; Wilson, Kassandra; Casjens, Sherwood R.

2013-01-01

Bacteriophage Sf6 DNA packaging series initiate at many locations across a 2 kbp region. Our in vivo studies that show that Sf6 small terminase subunit (TerS) protein recognizes a specific packaging (pac) site near the center of this region, that this site lies within the portion of the Sf6 gene that encodes the DNA-binding domain of TerS protein, that this domain of the TerS protein is responsible for the imprecision in Sf6 packaging initiation, and that the DNA-binding domain of TerS must be covalently attached to the domain that interacts with the rest of the packaging motor. The TerS DNA-binding domain is self-contained in that it apparently does not interact closely with the rest of the motor and it binds to a recognition site that lies within the DNA that encodes the domain. This arrangement has allowed the horizontal exchange of terS genes among phages to be very successful. PMID:23562538

Enhancing the response rate of strand displacement-based electrochemical aptamer sensors using bivalent binding aptamer-cDNA probes.

PubMed

Zhang, Ziping; Tao, Cancan; Yin, Jungang; Wang, Yunhui; Li, Yanshen

2018-04-30

Electrochemical aptamer (EA) sensors based on aptamer-cDNA duplex probes (cDNA: complementary DNA) and target induced strand displacement (TISD) recognition are sensitive, selective and capable of detecting a wide variety of target analytes. While substantial research efforts have focused on engineering of new signaling mechanisms for the improvement of sensor sensitivity, little attention was paid to the enhancement of sensor response rate. Typically, the previous TISD based EA sensors exhibited relatively long response times larger than 30min, which mainly resulted from the suboptimal aptamer-cDNA probe structure in which most of aptamer bases were paired to the cDNA bases. In an effort to improve the response rate of this type of sensors, we report here the rational engineering of a quickly responsive and sensitive aptamer-cDNA probe by employing the conception of bivalent interaction in supramolecular chemistry. We design a bivalent cDNA strand through linking two short monovalent cDNA sequences, and it is simultaneously hybridized to two electrode-immobilized aptamer probes to form a bivalent binding (BB) aptamer-cDNA probe. This class of BB probe possesses the advantages of less aptamer bases paired to the cDNA bases for quick response rate and good structural stability for high sensor sensitivity. By use of the rationally designed BB aptamer-cDNA probe, a TISD based EA sensor against ATP with significantly enhanced response rate (with a displacement equilibrium time of 4min) and high sensitivity was successfully constructed. We believe that our BB probe conception will help guide future designs and applications of TISD based EA sensors. Copyright © 2017 Elsevier B.V. All rights reserved.

NMR and computational methods applied to the 3- dimensional structure determination of DNA and ligand-DNA complexes in solution

NASA Astrophysics Data System (ADS)

Smith, Jarrod Anson

2D homonuclear 1H NMR methods and restrained molecular dynamics (rMD) calculations have been applied to determining the three-dimensional structures of DNA and minor groove-binding ligand-DNA complexes in solution. The structure of the DNA decamer sequence d(GCGTTAACGC)2 has been solved both with a distance-based rMD protocol and an NOE relaxation matrix backcalculation-based protocol in order to probe the relative merits of the different refinement methods. In addition, three minor groove binding ligand-DNA complexes have been examined. The solution structure of the oligosaccharide moiety of the antitumor DNA scission agent calicheamicin γ1I has been determined in complex with a decamer duplex containing its high affinity 5'-TCCT- 3' binding sequence. The structure of the complex reinforces the belief that the oligosaccharide moiety is responsible for the sequence selective minor-groove binding activity of the agent, and critical intermolecular contacts are revealed. The solution structures of both the (+) and (-) enantiomers of the minor groove binding DNA alkylating agent duocarmycin SA have been determined in covalent complex with the undecamer DNA duplex d(GACTAATTGTC).d(GAC AATTAGTC). The results support the proposal that the alkylation activity of the duocarmycin antitumor antibiotics is catalyzed by a binding-induced conformational change in the ligand which activates the cyclopropyl group for reaction with the DNA. Comparisons between the structures of the two enantiomers covalently bound to the same DNA sequence at the same 5'-AATTA-3 ' site have provided insight into the binding orientation and site selectivity, as well as the relative rates of reactivity of these two agents.

Analytical methods to determine the comparative DNA binding studies of curcumin-Cu(II) complexes

NASA Astrophysics Data System (ADS)

Rajesh, Jegathalaprathaban; Rajasekaran, Marichamy; Rajagopal, Gurusamy; Athappan, Periakaruppan

2012-11-01

DNA interaction studies of two mononuclear [1:1(1); 1:2(2)] copper(II) complexes of curcumin have been studied. The interaction of these complexes with CT-DNA has been explored by physical methods to propose modes of DNA binding of the complexes. Absorption spectral titrations of complex 1 with CT-DNA shows a red-shift of 3 nm with the DNA binding affinity of Kb, 5.21 × 104 M-1 that are higher than that obtained for 2 (red-shift, 2 nm; Kb, 1.73 × 104 M-1) reveal that the binding occurs in grooves as a result of the interaction is via exterior phosphates. The CD spectra of these Cu(II) complexes show a red shift of 3-10 nm in the positive band with increase in intensities. This spectral change of induced CD due to the hydrophobic interaction of copper complexes with DNA is the characteristic of B to A conformational change. The EB displacement assay also reveals the same trend as observed in UV-Vis spectral titration. The addition of complexes 1 and 2 to the DNA bound ethidium bromide (EB) solutions causes an obvious reduction in emission intensities indicating that these complexes competitively bind to DNA with EB. The positive shift of both the Epc and E0' accompanied by reduction of peak currents in differential pulse voltammogram (DPV), upon adding different concentrations of DNA to the metal complexes, are obviously in favor of strong binding to DNA. The super coiled plasmid pUC18 DNA cleavage ability of Cu(II) complexes in the presence of reducing agent reveals the single strand DNA cleavage (ssDNA) is observed. The hydroxyl radical (HOrad ) and the singlet oxygen are believed to be the reactive species responsible for the cleavage.

Two CGTCA motifs and a GHF1/Pit1 binding site mediate cAMP-dependent protein kinase A regulation of human growth hormone gene expression in rat anterior pituitary GC cells.

PubMed

Shepard, A R; Zhang, W; Eberhardt, N L

1994-01-21

We established the cis-acting elements which mediate cAMP responsiveness of the human growth hormone (hGH) gene in transiently transfected rat anterior pituitary tumor GC cells. Analysis of the intact hGH gene or hGH 5'-flanking DNA (5'-FR) coupled to the hGh cDNA or chloramphenicol acetyltransferase or luciferase genes, indicated that cAMP primarily stimulated hGH promoter activity. Cotransfection of a protein kinase A inhibitory protein cDNA demonstrated that the cAMP response was mediated by protein kinase A. Mutational analysis of the hGH promoter identified two core cAMP response element motifs (CGTCA) located at nucleotides -187/-183 (distal cAMP response element; dCRE) and -99/-95 (proximal cAMP response element; pCRE) and a pituitary-specific transcription factor (GHF1/Pit1) binding site at nucleotides -123/-112 (dGHF1) which were required for cAMP responsiveness. GHF1 was not a limiting factor, since overexpression of GHF1 in cotransfections increased basal but not forskolin induction levels. Gel shift analyses indicated that similar, ubiquitous, thermostable protein(s) specifically bound the pCRE and dCRE motifs. The CGTCA motif-binding factors were cAMP response element binding protein (CREB)/activating transcription factor-1 (ATF-1)-related, since the DNA-protein complex was competed by unlabeled CREB consensus oligonucleotide, specifically supershifted by antisera to CREB and ATF-1 but not ATF-2, and was bound by purified CREB with the same relative binding affinity (pCRE < dCRE < CREB) and mobility as the GC nuclear extract. UV cross-linking and Southwestern blot analyses revealed multiple DNA-protein interactions of which approximately 100- and approximately 45-kDa proteins were predominant; the approximately 45-kDa protein may represent CREB. These results indicate that CREB/ATF-1-related factors act coordinately with the cell-specific factor GHF1 to mediate cAMP-dependent regulation of hGH-1 gene transcription in anterior pituitary somatotrophs.

PRP19 Transforms into a Sensor of RPA-ssDNA after DNA Damage and Drives ATR Activation via a Ubiquitin-Mediated Circuitry

PubMed Central

Maréchal, Alexandre; Wu, Ching-Shyi; Yazinski, Stephanie A.; Nguyen, Hai Dang; Liu, Shizhou; Jiménez, Amanda E.; Jin, Jianping; Zou, Lee

2014-01-01

Summary PRP19 is a ubiquitin ligase involved in pre-mRNA splicing and the DNA damage response (DDR). While the role for PRP19 in splicing is well characterized, its role in the DDR remains elusive. Through a proteomic screen for proteins that interact with RPA-coated single-stranded DNA (RPA-ssDNA), we identified PRP19 as a sensor of DNA damage. PRP19 binds RPA directly and localizes to DNA damage sites via RPA, promoting RPA ubiquitylation in a DNA damage-induced manner. PRP19 facilitates the accumulation of ATRIP, the regulatory partner of the ATR kinase, at DNA damage sites. Depletion of PRP19 compromised the phosphorylation of ATR substrates, the recovery of stalled replication forks, and the progression of replication forks on damaged DNA. Importantly, PRP19 mutants that cannot bind RPA or function as an E3 ligase failed to support the ATR response, revealing that PRP19 drives ATR activation by acting as an RPA-ssDNA-sensing ubiquitin ligase during the DDR. PMID:24332808

The Drosophila telomere-capping protein Verrocchio binds single-stranded DNA and protects telomeres from DNA damage response

PubMed Central

Cicconi, Alessandro; Micheli, Emanuela; Vernì, Fiammetta; Jackson, Alison; Gradilla, Ana Citlali; Cipressa, Francesca; Raimondo, Domenico; Bosso, Giuseppe; Wakefield, James G.; Ciapponi, Laura; Cenci, Giovanni; Gatti, Maurizio

2017-01-01

Abstract Drosophila telomeres are sequence-independent structures maintained by transposition to chromosome ends of three specialized retroelements rather than by telomerase activity. Fly telomeres are protected by the terminin complex that includes the HOAP, HipHop, Moi and Ver proteins. These are fast evolving, non-conserved proteins that localize and function exclusively at telomeres, protecting them from fusion events. We have previously suggested that terminin is the functional analogue of shelterin, the multi-protein complex that protects human telomeres. Here, we use electrophoretic mobility shift assay (EMSA) and atomic force microscopy (AFM) to show that Ver preferentially binds single-stranded DNA (ssDNA) with no sequence specificity. We also show that Moi and Ver form a complex in vivo. Although these two proteins are mutually dependent for their localization at telomeres, Moi neither binds ssDNA nor facilitates Ver binding to ssDNA. Consistent with these results, we found that Ver-depleted telomeres form RPA and γH2AX foci, like the human telomeres lacking the ssDNA-binding POT1 protein. Collectively, our findings suggest that Drosophila telomeres possess a ssDNA overhang like the other eukaryotes, and that the terminin complex is architecturally and functionally similar to shelterin. PMID:27940556

DNA interactions with a Methylene Blue redox indicator depend on the DNA length and are sequence specific.

PubMed

Farjami, Elaheh; Clima, Lilia; Gothelf, Kurt V; Ferapontova, Elena E

2010-06-01

A DNA molecular beacon approach was used for the analysis of interactions between DNA and Methylene Blue (MB) as a redox indicator of a hybridization event. DNA hairpin structures of different length and guanine (G) content were immobilized onto gold electrodes in their folded states through the alkanethiol linker at the 5'-end. Binding of MB to the folded hairpin DNA was electrochemically studied and compared with binding to the duplex structure formed by hybridization of the hairpin DNA to a complementary DNA strand. Variation of the electrochemical signal from the DNA-MB complex was shown to depend primarily on the DNA length and sequence used: the G-C base pairs were the preferential sites of MB binding in the duplex. For short 20 nts long DNA sequences, the increased electrochemical response from MB bound to the duplex structure was consistent with the increased amount of bound and electrochemically readable MB molecules (i.e. MB molecules that are available for the electron transfer (ET) reaction with the electrode). With longer DNA sequences, the balance between the amounts of the electrochemically readable MB molecules bound to the hairpin DNA and to the hybrid was opposite: a part of the MB molecules bound to the long-sequence DNA duplex seem to be electrochemically mute due to long ET distance. The increasing electrochemical response from MB bound to the short-length DNA hybrid contrasts with the decreasing signal from MB bound to the long-length DNA hybrid and allows an "off"-"on" genosensor development.

pH modulates the binding of early growth response protein 1 transcription factor to DNA.

PubMed

Mikles, David C; Bhat, Vikas; Schuchardt, Brett J; Deegan, Brian J; Seldeen, Kenneth L; McDonald, Caleb B; Farooq, Amjad

2013-08-01

The transcription factor early growth response protein (EGR)1 orchestrates a plethora of signaling cascades involved in cellular homeostasis, and its downregulation has been implicated in the development of prostate cancer. Herein, using a battery of biophysical tools, we show that the binding of EGR1 to DNA is tightly regulated by solution pH. Importantly, the binding affinity undergoes an enhancement of more than an order of magnitude with an increase in pH from 5 to 8, implying that the deprotonation of an ionizable residue accounts for such behavior. This ionizable residue is identified as His382 by virtue of the fact that its replacement by nonionizable residues abolishes the pH dependence of the binding of EGR1 to DNA. Notably, His382 inserts into the major groove of DNA, and stabilizes the EGR1-DNA interaction via both hydrogen bonding and van der Waals contacts. Remarkably, His382 is mainly conserved across other members of the EGR family, implying that histidine protonation-deprotonation may serve as a molecular switch for modulating the protein-DNA interactions that are central to this family of transcription factors. Collectively, our findings reveal an unexpected but a key step in the molecular recognition of the EGR family of transcription factors, and suggest that they may act as sensors of pH within the intracellular environment. © 2013 FEBS.

Elucidating the evolutionary conserved DNA-binding specificities of WRKY transcription factors by molecular dynamics and in vitro binding assays

PubMed Central

Brand, Luise H.; Fischer, Nina M.; Harter, Klaus; Kohlbacher, Oliver; Wanke, Dierk

2013-01-01

WRKY transcription factors constitute a large protein family in plants that is involved in the regulation of developmental processes and responses to biotic or abiotic stimuli. The question arises how stimulus-specific responses are mediated given that the highly conserved WRKY DNA-binding domain (DBD) exclusively recognizes the ‘TTGACY’ W-box consensus. We speculated that the W-box consensus might be more degenerate and yet undetected differences in the W-box consensus of WRKYs of different evolutionary descent exist. The phylogenetic analysis of WRKY DBDs suggests that they evolved from an ancestral group IIc-like WRKY early in the eukaryote lineage. A direct descent of group IIc WRKYs supports a monophyletic origin of all other group II and III WRKYs from group I by loss of an N-terminal DBD. Group I WRKYs are of paraphyletic descent and evolved multiple times independently. By homology modeling, molecular dynamics simulations and in vitro DNA–protein interaction-enzyme-linked immunosorbent assay with AtWRKY50 (IIc), AtWRKY33 (I) and AtWRKY11 (IId) DBDs, we revealed differences in DNA-binding specificities. Our data imply that other components are essentially required besides the W-box-specific binding to DNA to facilitate a stimulus-specific WRKY function. PMID:23975197

DNA sequences, recombinant DNA molecules and processes for producing the A and B subunits of cholera toxin and preparations containing so-obtained subunit or subunits

DOE Office of Scientific and Technical Information (OSTI.GOV)

Harford, N.; De Wilde, M.

1987-05-19

A recombinant DNA molecule is described comprising at least a portion coding for subunits A and B of cholera toxin, or a fragment or derivative of the portion wherein the fragment or derivative codes for a polypeptide have an activity which can induce an immune response to subunit A; can induce an immune response to subunit A and cause epithelial cell penetration and the enzymatic effect leading to net loss of fluid into the gut lumen; can bind to the membrane receptor for the B subunit of cholera toxin; can induce an immune response to subunit B; can induce anmore » immune response to subunit B and bind to the membrane receptor; or has a combination of the activities.« less

RPA-coated single-stranded DNA as a platform for post-translational modifications in the DNA damage response

PubMed Central

Maréchal, Alexandre; Zou, Lee

2015-01-01

The Replication Protein A (RPA) complex is an essential regulator of eukaryotic DNA metabolism. RPA avidly binds to single-stranded DNA (ssDNA) through multiple oligonucleotide/oligosaccharide-binding folds and coordinates the recruitment and exchange of genome maintenance factors to regulate DNA replication, recombination and repair. The RPA-ssDNA platform also constitutes a key physiological signal which activates the master ATR kinase to protect and repair stalled or collapsed replication forks during replication stress. In recent years, the RPA complex has emerged as a key target and an important regulator of post-translational modifications in response to DNA damage, which is critical for its genome guardian functions. Phosphorylation and SUMOylation of the RPA complex, and more recently RPA-regulated ubiquitination, have all been shown to control specific aspects of DNA damage signaling and repair by modulating the interactions between RPA and its partners. Here, we review our current understanding of the critical functions of the RPA-ssDNA platform in the maintenance of genome stability and its regulation through an elaborate network of covalent modifications. PMID:25403473

RPA-coated single-stranded DNA as a platform for post-translational modifications in the DNA damage response.

PubMed

Maréchal, Alexandre; Zou, Lee

2015-01-01

The Replication Protein A (RPA) complex is an essential regulator of eukaryotic DNA metabolism. RPA avidly binds to single-stranded DNA (ssDNA) through multiple oligonucleotide/oligosaccharide-binding folds and coordinates the recruitment and exchange of genome maintenance factors to regulate DNA replication, recombination and repair. The RPA-ssDNA platform also constitutes a key physiological signal which activates the master ATR kinase to protect and repair stalled or collapsed replication forks during replication stress. In recent years, the RPA complex has emerged as a key target and an important regulator of post-translational modifications in response to DNA damage, which is critical for its genome guardian functions. Phosphorylation and SUMOylation of the RPA complex, and more recently RPA-regulated ubiquitination, have all been shown to control specific aspects of DNA damage signaling and repair by modulating the interactions between RPA and its partners. Here, we review our current understanding of the critical functions of the RPA-ssDNA platform in the maintenance of genome stability and its regulation through an elaborate network of covalent modifications.

A variable DNA recognition site organization establishes the LiaR-mediated cell envelope stress response of enterococci to daptomycin

DOE PAGES

Davlieva, Milya; Shi, Yiwen; Leonard, Paul G.; ...

2015-04-19

LiaR is a ‘master regulator’ of the cell envelope stress response in enterococci and many other Gram-positive organisms. Mutations to liaR can lead to antibiotic resistance to a variety of antibiotics including the cyclic lipopeptide daptomycin. LiaR is phosphorylated in response to membrane stress to regulate downstream target operons. Using DNA footprinting of the regions upstream of the liaXYZ and liaFSR operons we show that LiaR binds an extended stretch of DNA that extends beyond the proposed canonical consensus sequence suggesting a more complex level of regulatory control of target operons. We go on to determine the biochemical and structuralmore » basis for increased resistance to daptomycin by the adaptive mutation to LiaR (D191N) first identified from the pathogen Enterococcus faecalis S613. LiaR D191N increases oligomerization of LiaR to form a constitutively activated tetramer that has high affinity for DNA even in the absence of phosphorylation leading to increased resistance. The crystal structures of the LiaR DNA binding domain complexed to the putative consensus sequence as well as an adjoining secondary sequence show that upon binding, LiaR induces DNA bending that is consistent with increased recruitment of RNA polymerase to the transcription start site and upregulation of target operons.« less

Solution structure of telomere binding domain of AtTRB2 derived from Arabidopsis thaliana

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yun, Ji-Hye; Lee, Won Kyung; Kim, Heeyoun

Highlights: • We have determined solution structure of Myb domain of AtTRB2. • The Myb domain of AtTRB2 is located in the N-terminal region. • The Myb domain of AtTRB2 binds to plant telomeric DNA without fourth helix. • Helix 2 and 3 of the Myb domain of AtTRB2 are involved in DNA recognition. • AtTRB2 is a novel protein distinguished from other known plant TBP. - Abstract: Telomere homeostasis is regulated by telomere-associated proteins, and the Myb domain is well conserved for telomere binding. AtTRB2 is a member of the SMH (Single-Myb-Histone)-like family in Arabidopsis thaliana, having an N-terminalmore » Myb domain, which is responsible for DNA binding. The Myb domain of AtTRB2 contains three α-helices and loops for DNA binding, which is unusual given that other plant telomere-binding proteins have an additional fourth helix that is essential for DNA binding. To understand the structural role for telomeric DNA binding of AtTRB2, we determined the solution structure of the Myb domain of AtTRB2 (AtTRB2{sub 1–64}) using nuclear magnetic resonance (NMR) spectroscopy. In addition, the inter-molecular interaction between AtTRB2{sub 1–64} and telomeric DNA has been characterized by the electrophoretic mobility shift assay (EMSA) and NMR titration analyses for both plant (TTTAGGG)n and human (TTAGGG)n telomere sequences. Data revealed that Trp28, Arg29, and Val47 residues located in Helix 2 and Helix 3 are crucial for DNA binding, which are well conserved among other plant telomere binding proteins. We concluded that although AtTRB2 is devoid of the additional fourth helix in the Myb-extension domain, it is able to bind to plant telomeric repeat sequences as well as human telomeric repeat sequences.« less

SELMAP - SELEX affinity landscape MAPping of transcription factor binding sites using integrated microfluidics

PubMed Central

Chen, Dana; Orenstein, Yaron; Golodnitsky, Rada; Pellach, Michal; Avrahami, Dorit; Wachtel, Chaim; Ovadia-Shochat, Avital; Shir-Shapira, Hila; Kedmi, Adi; Juven-Gershon, Tamar; Shamir, Ron; Gerber, Doron

2016-01-01

Transcription factors (TFs) alter gene expression in response to changes in the environment through sequence-specific interactions with the DNA. These interactions are best portrayed as a landscape of TF binding affinities. Current methods to study sequence-specific binding preferences suffer from limited dynamic range, sequence bias, lack of specificity and limited throughput. We have developed a microfluidic-based device for SELEX Affinity Landscape MAPping (SELMAP) of TF binding, which allows high-throughput measurement of 16 proteins in parallel. We used it to measure the relative affinities of Pho4, AtERF2 and Btd full-length proteins to millions of different DNA binding sites, and detected both high and low-affinity interactions in equilibrium conditions, generating a comprehensive landscape of the relative TF affinities to all possible DNA 6-mers, and even DNA10-mers with increased sequencing depth. Low quantities of both the TFs and DNA oligomers were sufficient for obtaining high-quality results, significantly reducing experimental costs. SELMAP allows in-depth screening of hundreds of TFs, and provides a means for better understanding of the regulatory processes that govern gene expression. PMID:27628341

Light-up fluorescent probes utilizing binding behavior of perylenediimide derivatives to a hydrophobic pocket within DNA.

PubMed

Takada, Tadao; Yamaguchi, Kosato; Tsukamoto, Suguru; Nakamura, Mitsunobu; Yamana, Kazushige

2014-08-21

Here we study the binding behavior of perylenediimide () derivatives to a hydrophobic pocket created inside DNA and their photochemical properties capable of designing a light-up fluorescent sensor for short single-stranded DNA or RNA. The perylenediimide derivative with alkoxy groups () suppressing electron transfer quenching was examined. The bound randomly to DNA showed negligible fluorescence due to the aggregation-induced quenching, whereas the bound to the pocket as a monomeric form showed more than 100-fold fluorescence enhancement. Switching the binding states of the corresponded to a change in the fluorescence response for the hybridization event, which allowed us to design a fluorescent sensor of nucleic acids with a nanomolar detection limit.

Differential sensitivities of cellular XPA and PARP-1 to arsenite inhibition and zinc rescue.

PubMed

Ding, Xiaofeng; Zhou, Xixi; Cooper, Karen L; Huestis, Juliana; Hudson, Laurie G; Liu, Ke Jian

2017-09-15

Arsenite directly binds to the zinc finger domains of the DNA repair protein poly (ADP ribose) polymerase (PARP)-1, and inhibits PARP-1 activity in the base excision repair (BER) pathway. PARP inhibition by arsenite enhances ultraviolet radiation (UVR)-induced DNA damage in keratinocytes, and the increase in DNA damage is reduced by zinc supplementation. However, little is known about the effects of arsenite and zinc on the zinc finger nucleotide excision repair (NER) protein xeroderma pigmentosum group A (XPA). In this study, we investigated the difference in response to arsenite exposure between XPA and PARP-1, and the differential effectiveness of zinc supplementation in restoring protein DNA binding and DNA damage repair. Arsenite targeted both XPA and PARP-1 in human keratinocytes, resulting in zinc loss from each protein and a pronounced decrease in XPA and PARP-1 binding to chromatin as demonstrated by Chip-on-Western assays. Zinc effectively restored DNA binding of PARP-1 and XPA to chromatin when zinc concentrations were equal to those of arsenite. In contrast, zinc was more effective in rescuing arsenite-augmented direct UVR-induced DNA damage than oxidative DNA damage. Taken together, our findings indicate that arsenite interferes with PARP-1 and XPA binding to chromatin, and that zinc supplementation fully restores DNA binding activity to both proteins in the cellular context. Interestingly, rescue of arsenite-inhibited DNA damage repair by supplemental zinc was more sensitive for DNA damage repaired by the XPA-associated NER pathway than for the PARP-1-dependent BER pathway. This study expands our understanding of arsenite's role in DNA repair inhibition and co-carcinogenesis. Copyright © 2017 Elsevier Inc. All rights reserved.

Identification of transactivation-responsive DNA-binding protein 43 (TARDBP43; TDP-43) as a novel factor for TNF-α expression upon lipopolysaccharide stimulation in human monocytes.

PubMed

Murata, H; Hattori, T; Maeda, H; Takashiba, S; Takigawa, M; Kido, J; Nagata, T

2015-08-01

Tumor necrosis factor alpha (TNF-α) is a major cytokine implicated in various inflammatory diseases. The nature of the nuclear factors associated with human TNF-α gene regulation is not well elucidated. We previously identified a novel region located from -550 to -487 in human TNF-α promoter that did not contain the reported binding sites for nuclear factor kappa B (NF-κB) but showed lipopolysaccharide (LPS)-induced transcriptional activity. The purpose of this study is to identify novel factors that bind to the promoter region and regulate TNF-α expression. To identify DNA-binding proteins that bound to the target region of TNF-α promoter, a cDNA library from LPS-stimulated human monocytic cell line THP-1 was screened using a yeast one-hybrid system. Cellular localizations of the DNA-binding protein in the cells were examined by subcellular immunocytochemistry. Nuclear amounts of the protein in LPS-stimulated THP-1 cells were identified by western blot analysis. Expression of mRNA of the protein in the cells was quantified by real-time polymerase chain reaction. Electrophoretic mobility shift assays were performed to confirm the DNA-binding profile. Overexpression of the protein and knockdown of the gene were also performed to investigate the role for TNF-α expression. Several candidates were identified from the cDNA library and transactivation-responsive DNA-binding protein 43 (TARDBP43; TDP-43) was focused on. Western blot analysis revealed that nuclear TDP-43 protein was increased in the LPS-stimulated THP-1 cells. Expression of TDP-43 mRNA was already enhanced before TNF-α induction by LPS. Electrophoretic mobility shift assay analysis showed that nuclear extracts obtained by overexpressing FLAG-tagged TDP-43 bound to the -550 to -487 TNF-α promoter fragments. Overexpression of TDP-43 in THP-1 cells resulted in an increase of TNF-α expression. Knockdown of TDP-43 in THP-1 cells downregulated TNF-α expression. We identified TDP-43 as one of the novel TNF-α factors and found that it bound to the LPS-responsive element in the TNF-α promoter to increase TNF-α expression. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Structure of the E2 DNA-binding domain from human papillomavirus serotype 31 at 2.4 A.

PubMed

Bussiere, D E; Kong, X; Egan, D A; Walter, K; Holzman, T F; Lindh, F; Robins, T; Giranda, V L

1998-11-01

The papillomaviruses are a family of small double-stranded DNA viruses which exclusively infect epithelial cells and stimulate the proliferation of those cells. A key protein within the papillomavirus life-cycle is known as the E2 (Early 2) protein and is responsible for regulating viral transcription from all viral promoters as well as for replication of the papillomavirus genome in tandem with another protein known as E1. The E2 protein itself consists of three functional domains: an N-terminal trans-activation domain, a proline-rich linker, and a C-terminal DNA-binding domain. The first crystal structure of the human papillomavirus, serotype 31 (HPV-31), E2 DNA-binding domain has been determined at 2.4 A resolution. The HPV DNA-binding domain monomer consists of two beta-alpha-beta repeats of approximately equal length and is arranged as to have an anti-parallel beta-sheet flanked by the two alpha-helices. The monomers form the functional in vivo dimer by association of the beta-sheets of each monomer so as to form an eight-stranded anti-parallel beta-barrel at the center of the dimer, with the alpha-helices lining the outside of the barrel. The overall structure of HVP-31 E2 DNA-binding domain is similar to both the bovine papillomavirus E2-binding domain and the Epstein-Barr nuclear antigen-1 DNA-binding domain.

Mapping the Structural and Dynamical Features of Multiple p53 DNA Binding Domains: Insights into Loop 1 Intrinsic Dynamics

PubMed Central

Lukman, Suryani; Lane, David P.; Verma, Chandra S.

2013-01-01

The transcription factor p53 regulates cellular integrity in response to stress. p53 is mutated in more than half of cancerous cells, with a majority of the mutations localized to the DNA binding domain (DBD). In order to map the structural and dynamical features of the DBD, we carried out multiple copy molecular dynamics simulations (totaling 0.8 μs). Simulations show the loop 1 to be the most dynamic element among the DNA-contacting loops (loops 1-3). Loop 1 occupies two major conformational states: extended and recessed; the former but not the latter displays correlations in atomic fluctuations with those of loop 2 (~24 Å apart). Since loop 1 binds to the major groove whereas loop 2 binds to the minor groove of DNA, our results begin to provide some insight into the possible mechanism underpinning the cooperative nature of DBD binding to DNA. We propose (1) a novel mechanism underlying the dynamics of loop 1 and the possible tread-milling of p53 on DNA and (2) possible mutations on loop 1 residues to restore the transcriptional activity of an oncogenic mutation at a distant site. PMID:24324553

Impact of cadmium, cobalt and nickel on sequence-specific DNA binding of p63 and p73 in vitro and in cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Adámik, Matej; Bažantová, Pavla; Department of Biology and Ecology, Faculty of Science, University of Ostrava, Chittussiho 10, 701 03 Ostrava

Highlights: • DNA binding of p53 family core domains is inhibited by cadmium, cobalt and nickel. • Binding to DNA protects p53 family core domains from metal induced inhibition. • Cadmium, cobalt and nickel induced inhibition was reverted by EDTA in vitro. - Abstract: Site-specific DNA recognition and binding activity belong to common attributes of all three members of tumor suppressor p53 family proteins: p53, p63 and p73. It was previously shown that heavy metals can affect p53 conformation, sequence-specific binding and suppress p53 response to DNA damage. Here we report for the first time that cadmium, nickel and cobalt,more » which have already been shown to disturb various DNA repair mechanisms, can also influence p63 and p73 sequence-specific DNA binding activity and transactivation of p53 family target genes. Based on results of electrophoretic mobility shift assay and luciferase reporter assay, we conclude that cadmium inhibits sequence-specific binding of all three core domains to p53 consensus sequences and abolishes transactivation of several promoters (e.g. BAX and MDM2) by 50 μM concentrations. In the presence of specific DNA, all p53 family core domains were partially protected against loss of DNA binding activity due to cadmium treatment. Effective cadmium concentration to abolish DNA–protein interactions was about two times higher for p63 and p73 proteins than for p53. Furthermore, we detected partial reversibility of cadmium inhibition for all p53 family members by EDTA. DTT was able to reverse cadmium inhibition only for p53 and p73. Nickel and cobalt abolished DNA–p53 interaction at sub-millimolar concentrations while inhibition of p63 and p73 DNA binding was observed at millimolar concentrations. In summary, cadmium strongly inhibits p53, p63 and p73 DNA binding in vitro and in cells in comparison to nickel and cobalt. The role of cadmium inhibition of p53 tumor suppressor family in carcinogenesis is discussed.« less

Development of novel metabolite-responsive transcription factors via transposon-mediated protein fusion.

PubMed

Younger, Andrew K D; Su, Peter Y; Shepard, Andrea J; Udani, Shreya V; Cybulski, Thaddeus R; Tyo, Keith E J; Leonard, Joshua N

2018-02-01

Naturally evolved metabolite-responsive biosensors enable applications in metabolic engineering, ranging from screening large genetic libraries to dynamically regulating biosynthetic pathways. However, there are many metabolites for which a natural biosensor does not exist. To address this need, we developed a general method for converting metabolite-binding proteins into metabolite-responsive transcription factors-Biosensor Engineering by Random Domain Insertion (BERDI). This approach takes advantage of an in vitro transposon insertion reaction to generate all possible insertions of a DNA-binding domain into a metabolite-binding protein, followed by fluorescence activated cell sorting to isolate functional biosensors. To develop and evaluate the BERDI method, we generated a library of candidate biosensors in which a zinc finger DNA-binding domain was inserted into maltose binding protein, which served as a model well-studied metabolite-binding protein. Library diversity was characterized by several methods, a selection scheme was deployed, and ultimately several distinct and functional maltose-responsive transcriptional biosensors were identified. We hypothesize that the BERDI method comprises a generalizable strategy that may ultimately be applied to convert a wide range of metabolite-binding proteins into novel biosensors for applications in metabolic engineering and synthetic biology. © The Author(s) 2018. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

The prokaryotic enhancer binding protein NTRC has an ATPase activity which is phosphorylation and DNA dependent.

PubMed Central

Austin, S; Dixon, R

1992-01-01

The prokaryotic activator protein NTRC binds to enhancer-like elements and activates transcription in response to nitrogen limitation by catalysing open complex formation by sigma 54 RNA polymerase holoenzyme. Formation of open complexes requires the phosphorylated form of NTRC and the reaction is ATP dependent. We find that NTRC has an ATPase activity which is activated by phosphorylation and is strongly stimulated by the presence of DNA containing specific NTRC binding sites. Images PMID:1534752

Trimeric association of Hox and TALE homeodomain proteins mediates Hoxb2 hindbrain enhancer activity.

PubMed

Jacobs, Y; Schnabel, C A; Cleary, M L

1999-07-01

Pbx/exd proteins modulate the DNA binding affinities and specificities of Hox proteins and contribute to the execution of Hox-dependent developmental programs in arthropods and vertebrates. Pbx proteins also stably heterodimerize and bind DNA with Meis and Pknox1-Prep1, additional members of the TALE (three-amino-acid loop extension) superclass of homeodomain proteins that function on common genetic pathways with a subset of Hox proteins. In this study, we demonstrated that Pbx and Meis bind DNA as heterotrimeric complexes with Hoxb1 on a genetically defined Hoxb2 enhancer, r4, that mediates the cross-regulatory transcriptional effects of Hoxb1 in vivo. The DNA binding specificity of the heterotrimeric complex for r4 is mediated by a Pbx-Hox site in conjunction with a distal Meis site, which we showed to be required for ternary complex formation and Meis-enhanced transcription. Formation of heterotrimeric complexes in which all three homeodomains bind their cognate DNA sites is topologically facilitated by the ability of Pbx and Meis to interact through their amino termini and bind DNA without stringent half-site orientation and spacing requirements. Furthermore, Meis site mutation in the Hoxb2 enhancer phenocopies Pbx-Hox site mutation to abrogate enhancer-directed expression of a reporter transgene in the murine embryonic hindbrain, demonstrating that DNA binding by all three proteins is required for trimer function in vivo. Our data provide in vitro and in vivo evidence for the combinatorial regulation of Hox and TALE protein functions that are mediated, in part, by their interdependent DNA binding activities as ternary complexes. As a consequence, Hoxb1 employs Pbx and Meis-related proteins, as a pair of essential cofactors in a higher-order molecular complex, to mediate its transcriptional effects on an endogenous Hox response element.

An electrochemical sensing platform based on local repression of electrolyte diffusion for single-step, reagentless, sensitive detection of a sequence-specific DNA-binding protein.

PubMed

Zhang, Yun; Liu, Fang; Nie, Jinfang; Jiang, Fuyang; Zhou, Caibin; Yang, Jiani; Fan, Jinlong; Li, Jianping

2014-05-07

In this paper, we report for the first time an electrochemical biosensor for single-step, reagentless, and picomolar detection of a sequence-specific DNA-binding protein using a double-stranded, electrode-bound DNA probe terminally modified with a redox active label close to the electrode surface. This new methodology is based upon local repression of electrolyte diffusion associated with protein-DNA binding that leads to reduction of the electrochemical response of the label. In the proof-of-concept study, the resulting electrochemical biosensor was quantitatively sensitive to the concentrations of the TATA binding protein (TBP, a model analyte) ranging from 40 pM to 25.4 nM with an estimated detection limit of ∼10.6 pM (∼80 to 400-fold improvement on the detection limit over previous electrochemical analytical systems).

SOS response in bacteria: Inhibitory activity of lichen secondary metabolites against Escherichia coli RecA protein.

PubMed

Bellio, Pierangelo; Di Pietro, Letizia; Mancini, Alisia; Piovano, Marisa; Nicoletti, Marcello; Brisdelli, Fabrizia; Tondi, Donatella; Cendron, Laura; Franceschini, Nicola; Amicosante, Gianfranco; Perilli, Mariagrazia; Celenza, Giuseppe

2017-06-15

RecA is a bacterial multifunctional protein essential to genetic recombination, error-prone replicative bypass of DNA damages and regulation of SOS response. The activation of bacterial SOS response is directly related to the development of intrinsic and/or acquired resistance to antimicrobials. Although recent studies directed towards RecA inactivation via ATP binding inhibition described a variety of micromolar affinity ligands, inhibitors of the DNA binding site are still unknown. Twenty-seven secondary metabolites classified as anthraquinones, depsides, depsidones, dibenzofurans, diphenyl-butenolides, paraconic acids, pseudo-depsidones, triterpenes and xanthones, were investigated for their ability to inhibit RecA from Escherichia coli. They were isolated in various Chilean regions from 14 families and 19 genera of lichens. The ATP hydrolytic activity of RecA was quantified detecting the generation of free phosphate in solution. The percentage of inhibition was calculated fixing at 100µM the concentration of the compounds. Deeper investigations were reserved to those compounds showing an inhibition higher than 80%. To clarify the mechanism of inhibition, the semi-log plot of the percentage of inhibition vs. ATP and vs. ssDNA, was evaluated. Only nine compounds showed a percentage of RecA inhibition higher than 80% (divaricatic, perlatolic, alpha-collatolic, lobaric, lichesterinic, protolichesterinic, epiphorellic acids, sphaerophorin and tumidulin). The half-inhibitory concentrations (IC 50 ) calculated for these compounds were ranging from 14.2µM for protolichesterinic acid to 42.6µM for sphaerophorin. Investigations on the mechanism of inhibition showed that all compounds behaved as uncompetitive inhibitors for ATP binding site, with the exception of epiphorellic acid which clearly acted as non-competitive inhibitor of the ATP site. Further investigations demonstrated that epiphorellic acid competitively binds the ssDNA binding site. Kinetic data were confirmed by molecular modelling binding predictions which shows that epiphorellic acid is expected to bind the ssDNA site into the L2 loop of RecA protein. In this paper the first RecA ssDNA binding site ligand is described. Our study sets epiphorellic acid as a promising hit for the development of more effective RecA inhibitors. In our drug discovery approach, natural products in general and lichen in particular, represent a successful source of active ligands and structural diversity. Copyright © 2017 Elsevier GmbH. All rights reserved.

Xenopus origin recognition complex (ORC) initiates DNA replication preferentially at sequences targeted by Schizosaccharomyces pombe ORC

PubMed Central

Kong, Daochun; Coleman, Thomas R.; DePamphilis, Melvin L.

2003-01-01

Budding yeast (Saccharomyces cerevisiae) origin recognition complex (ORC) requires ATP to bind specific DNA sequences, whereas fission yeast (Schizosaccharomyces pombe) ORC binds to specific, asymmetric A:T-rich sites within replication origins, independently of ATP, and frog (Xenopus laevis) ORC seems to bind DNA non-specifically. Here we show that despite these differences, ORCs are functionally conserved. Firstly, SpOrc1, SpOrc4 and SpOrc5, like those from other eukaryotes, bound ATP and exhibited ATPase activity, suggesting that ATP is required for pre-replication complex (pre-RC) assembly rather than origin specificity. Secondly, SpOrc4, which is solely responsible for binding SpORC to DNA, inhibited up to 70% of XlORC-dependent DNA replication in Xenopus egg extract by preventing XlORC from binding to chromatin and assembling pre-RCs. Chromatin-bound SpOrc4 was located at AT-rich sequences. XlORC in egg extract bound preferentially to asymmetric A:T-sequences in either bare DNA or in sperm chromatin, and it recruited XlCdc6 and XlMcm proteins to these sequences. These results reveal that XlORC initiates DNA replication preferentially at the same or similar sites to those targeted in S.pombe. PMID:12840006

Downstream promoter interactions of TFIID TAFs facilitate transcription reinitiation

PubMed Central

Joo, Yoo Jin; Ficarro, Scott B.; Soares, Luis M.; Chun, Yujin; Marto, Jarrod A.; Buratowski, Stephen

2017-01-01

TFIID binds promoter DNA to recruit RNA polymerase II and other basal factors for transcription. Although the TATA-binding protein (TBP) subunit of TFIID is necessary and sufficient for in vitro transcription, the TBP-associated factor (TAF) subunits recognize downstream promoter elements, act as coactivators, and interact with nucleosomes. In yeast nuclear extracts, transcription induces stable TAF binding to downstream promoter DNA, promoting subsequent activator-independent transcription reinitiation. In vivo, promoter responses to TAF mutations correlate with the level of downstream, rather than overall, Taf1 cross-linking. We propose a new model in which TAFs function as reinitiation factors, accounting for the differential responses of promoters to various transcription factor mutations. PMID:29203645

Crystal structure of the DNA-binding domain of the LysR-type transcriptional regulator CbnR in complex with a DNA fragment of the recognition-binding site in the promoter region.

PubMed

Koentjoro, Maharani Pertiwi; Adachi, Naruhiko; Senda, Miki; Ogawa, Naoto; Senda, Toshiya

2018-03-01

LysR-type transcriptional regulators (LTTRs) are among the most abundant transcriptional regulators in bacteria. CbnR is an LTTR derived from Cupriavidus necator (formerly Alcaligenes eutrophus or Ralstonia eutropha) NH9 and is involved in transcriptional activation of the cbnABCD genes encoding chlorocatechol degradative enzymes. CbnR interacts with a cbnA promoter region of approximately 60 bp in length that contains the recognition-binding site (RBS) and activation-binding site (ABS). Upon inducer binding, CbnR seems to undergo conformational changes, leading to the activation of the transcription. Since the interaction of an LTTR with RBS is considered to be the first step of the transcriptional activation, the CbnR-RBS interaction is responsible for the selectivity of the promoter to be activated. To understand the sequence selectivity of CbnR, we determined the crystal structure of the DNA-binding domain of CbnR in complex with RBS of the cbnA promoter at 2.55 Å resolution. The crystal structure revealed details of the interactions between the DNA-binding domain and the promoter DNA. A comparison with the previously reported crystal structure of the DNA-binding domain of BenM in complex with its cognate RBS showed several differences in the DNA interactions, despite the structural similarity between CbnR and BenM. These differences explain the observed promoter sequence selectivity between CbnR and BenM. Particularly, the difference between Thr33 in CbnR and Ser33 in BenM appears to affect the conformations of neighboring residues, leading to the selective interactions with DNA. Atomic coordinates and structure factors for the DNA-binding domain of Cupriavidus necatorNH9 CbnR in complex with RBS are available in the Protein Data Bank under the accession code 5XXP. © 2018 Federation of European Biochemical Societies.

pH-Dependent DNA Distortion and Repression of Gene Expression by Pectobacterium atrosepticum PecS.

PubMed

Deochand, Dinesh K; Meariman, Jacob K; Grove, Anne

2016-07-15

Transcriptional activity is exquisitely sensitive to changes in promoter DNA topology. Transcription factors may therefore control gene activity by modulating the relative positioning of -10 and -35 promoter elements. The plant pathogen Pectobacterium atrosepticum, which causes soft rot in potatoes, must alter gene expression patterns to ensure growth in planta. In the related soft-rot enterobacterium Dickeya dadantii, PecS functions as a master regulator of virulence gene expression. Here, we report that P. atrosepticum PecS controls gene activity by altering promoter DNA topology in response to pH. While PecS binds the pecS promoter with high affinity regardless of pH, it induces significant DNA distortion only at neutral pH, the pH at which the pecS promoter is repressed in vivo. At pH ∼8, DNA distortions are attenuated, and PecS no longer represses the pecS promoter. A specific histidine (H142) located in a crevice between the dimerization- and DNA-binding regions is required for pH-dependent changes in DNA distortion and repression of gene activity, and mutation of this histidine renders the mutant protein incapable of repressing the pecS promoter. We propose that protonated PecS induces a DNA conformation at neutral pH in which -10 and -35 promoter elements are suboptimally positioned for RNA polymerase binding; on deprotonation of PecS, binding is no longer associated with significant changes in DNA conformation, allowing gene expression. We suggest that this mode of gene regulation leads to differential expression of the PecS regulon in response to alkalinization of the plant apoplast.

Human T-cell leukemia virus type 1 Tax requires direct access to DNA for recruitment of CREB binding protein to the viral promoter.

PubMed

Lenzmeier, B A; Giebler, H A; Nyborg, J K

1998-02-01

Efficient human T-cell leukemia virus type 1 (HTLV-1) replication and viral gene expression are dependent upon the virally encoded oncoprotein Tax. To activate HTLV-1 transcription, Tax interacts with the cellular DNA binding protein cyclic AMP-responsive element binding protein (CREB) and recruits the coactivator CREB binding protein (CBP), forming a nucleoprotein complex on the three viral cyclic AMP-responsive elements (CREs) in the HTLV-1 promoter. Short stretches of dG-dC-rich (GC-rich) DNA, immediately flanking each of the viral CREs, are essential for Tax recruitment of CBP in vitro and Tax transactivation in vivo. Although the importance of the viral CRE-flanking sequences is well established, several studies have failed to identify an interaction between Tax and the DNA. The mechanistic role of the viral CRE-flanking sequences has therefore remained enigmatic. In this study, we used high resolution methidiumpropyl-EDTA iron(II) footprinting to show that Tax extended the CREB footprint into the GC-rich DNA flanking sequences of the viral CRE. The Tax-CREB footprint was enhanced but not extended by the KIX domain of CBP, suggesting that the coactivator increased the stability of the nucleoprotein complex. Conversely, the footprint pattern of CREB on a cellular CRE lacking GC-rich flanking sequences did not change in the presence of Tax or Tax plus KIX. The minor-groove DNA binding drug chromomycin A3 bound to the GC-rich flanking sequences and inhibited the association of Tax and the Tax-CBP complex without affecting CREB binding. Tax specifically cross-linked to the viral CRE in the 5'-flanking sequence, and this cross-link was blocked by chromomycin A3. Together, these data support a model where Tax interacts directly with both CREB and the minor-groove viral CRE-flanking sequences to form a high-affinity binding site for the recruitment of CBP to the HTLV-1 promoter.

Structural and Mechanistic Basis of Zinc Regulation Across the E. coli Zur Regulon

PubMed Central

Gilston, Benjamin A.; Wang, Suning; Marcus, Mason D.; Canalizo-Hernández, Mónica A.; Swindell, Elden P.; Xue, Yi; Mondragón, Alfonso; O'Halloran, Thomas V.

2014-01-01

Commensal microbes, whether they are beneficial or pathogenic, are sensitive to host processes that starve or swamp the prokaryote with large fluctuations in local zinc concentration. To understand how microorganisms coordinate a dynamic response to changes in zinc availability at the molecular level, we evaluated the molecular mechanism of the zinc-sensing zinc uptake regulator (Zur) protein at each of the known Zur-regulated genes in Escherichia coli. We solved the structure of zinc-loaded Zur bound to the PznuABC promoter and show that this metalloregulatory protein represses gene expression by a highly cooperative binding of two adjacent dimers to essentially encircle the core element of each of the Zur-regulated promoters. Cooperativity in these protein-DNA interactions requires a pair of asymmetric salt bridges between Arg52 and Asp49′ that connect otherwise independent dimers. Analysis of the protein-DNA interface led to the discovery of a new member of the Zur-regulon: pliG. We demonstrate this gene is directly regulated by Zur in a zinc responsive manner. The pliG promoter forms stable complexes with either one or two Zur dimers with significantly less protein-DNA cooperativity than observed at other Zur regulon promoters. Comparison of the in vitro Zur-DNA binding affinity at each of four Zur-regulon promoters reveals ca. 10,000-fold variation Zur-DNA binding constants. The degree of Zur repression observed in vivo by comparison of transcript copy number in wild-type and Δzur strains parallels this trend spanning a 100-fold difference. We conclude that the number of ferric uptake regulator (Fur)-family dimers that bind within any given promoter varies significantly and that the thermodynamic profile of the Zur-DNA interactions directly correlates with the physiological response at different promoters. PMID:25369000

DNA Replication Arrest and DNA Damage Responses Induced by Alkylating Minor Groove Binders

DTIC Science & Technology

2001-05-01

We are interested in the molecular mechanisms involved in DNA replication arrest by the S phase DNA damage checkpoints. Using in vitro simian virus...40 DNA replication assays, we have found three factors that directly contribute to DNA damage-induced DNA replication arrest: Replication Protein A...trans-acting inhibitors. RPA is the major eukaryotic single-stranded DNA binding protein required for DNA replication , repair and recombination. Upon DNA

PRP19 transforms into a sensor of RPA-ssDNA after DNA damage and drives ATR activation via a ubiquitin-mediated circuitry.

PubMed

Maréchal, Alexandre; Li, Ju-Mei; Ji, Xiao Ye; Wu, Ching-Shyi; Yazinski, Stephanie A; Nguyen, Hai Dang; Liu, Shizhou; Jiménez, Amanda E; Jin, Jianping; Zou, Lee

2014-01-23

PRP19 is a ubiquitin ligase involved in pre-mRNA splicing and the DNA damage response (DDR). Although the role for PRP19 in splicing is well characterized, its role in the DDR remains elusive. Through a proteomic screen for proteins that interact with RPA-coated single-stranded DNA (RPA-ssDNA), we identified PRP19 as a sensor of DNA damage. PRP19 directly binds RPA and localizes to DNA damage sites via RPA, promoting RPA ubiquitylation in a DNA-damage-induced manner. PRP19 facilitates the accumulation of ATRIP, the regulatory partner of the ataxia telangiectasia mutated and Rad3-related (ATR) kinase, at DNA damage sites. Depletion of PRP19 compromised the phosphorylation of ATR substrates, recovery of stalled replication forks, and progression of replication forks on damaged DNA. Importantly, PRP19 mutants that cannot bind RPA or function as an E3 ligase failed to support the ATR response, revealing that PRP19 drives ATR activation by acting as an RPA-ssDNA-sensing ubiquitin ligase during the DDR. Copyright © 2014 Elsevier Inc. All rights reserved.

C/EBPα Expression is Partially Regulated by C/EBPβ in Response to DNA Damage and C/EBPα Deficient Fibroblasts Display an Impaired G1 Checkpoint

PubMed Central

Ranjan, Rakesh; Thompson, Elizabeth A.; Yoon, Kyungsil; Smart, Robert C.

2009-01-01

We observed that C/EBPα is highly inducible in primary fibroblasts by DNA damaging agents that induce strand breaks, alkylate and crosslink DNA as well as those that produce bulky DNA lesions. Fibroblasts deficient in C/EBPα (C/EBPα-/-) display an impaired G1 checkpoint as evidenced by inappropriate entry into S-phase in response to DNA damage and these cells also display an enhanced G1 to S transition in response to mitogens. The induction of C/EBPα by DNA damage in fibroblasts does not require p53. EMSA analysis of nuclear extracts prepared from UVB- and MNNG-treated fibroblasts revealed increased binding of C/EBPβ to a C/EBP consensus sequence and ChIP analysis revealed increased C/EBPβ binding to the C/EBPα promoter. To determine whether C/EBPβ has a role in the regulation of C/EBPα we treated C/EBPβ-/- fibroblasts with UVB or MNNG. We observed C/EBPα induction was impaired in both UVB- and MNNG- treated C/EBPβ-/- fibroblasts. Our study reveals a novel role for C/EBPβ in the regulation of C/EBPα in response to DNA damage and provides definitive genetic evidence that C/EBPα has a critical role in the DNA damage G1 checkpoint. PMID:19581927

Chk1 Promotes DNA Damage Response Bypass following Oxidative Stress in a Model of Hydrogen Peroxide-Associated Ulcerative Colitis through JNK Inactivation and Chromatin Binding.

PubMed

Reissig, Kathrin; Silver, Andrew; Hartig, Roland; Schinlauer, Antje; Walluscheck, Diana; Guenther, Thomas; Siedentopf, Sandra; Ross, Jochen; Vo, Diep-Khanh; Roessner, Albert; Poehlmann-Nitsche, Angela

2017-01-01

Dysregulation of c-Jun N -terminal kinase (JNK) activation promoted DNA damage response bypass and tumorigenesis in our model of hydrogen peroxide-associated ulcerative colitis (UC) and in patients with quiescent UC (QUC), UC-related dysplasia, and UC-related carcinoma (UC-CRC), thereby adapting to oxidative stress. In the UC model, we have observed features of oncogenic transformation: increased proliferation, undetected DNA damage, and apoptosis resistance. Here, we show that Chk1 was downregulated but activated in the acute and quiescent chronic phases. In both phases, Chk1 was linked to DNA damage response bypass by suppressing JNK activation following oxidative stress, promoting cell cycle progression despite DNA damage. Simultaneously, activated Chk1 was bound to chromatin. This triggered histone acetylation and the binding of histone acetyltransferases and transcription factors to chromatin. Thus, chromatin-immobilized activated Chk1 executed a dual function by suppressing DNA damage response and simultaneously inducing chromatin modulation. This caused undetected DNA damage and increased cellular proliferation through failure to transmit the appropriate DNA damage signal. Findings in vitro were corroborated by chromatin accumulation of activated Chk1, Ac-H3, Ac-H4, and c-Jun in active UC (AUC) in vivo. Targeting chromatin-bound Chk1, GCN5, PCAF, and p300/CBP could be a novel therapeutic strategy to prevent UC-related tumor progression.

Allosteric analysis of glucocorticoid receptor-DNA interface induced by cyclic Py-Im polyamide: a molecular dynamics simulation study.

PubMed

Wang, Yaru; Ma, Na; Wang, Yan; Chen, Guangju

2012-01-01

It has been extensively developed in recent years that cell-permeable small molecules, such as polyamide, can be programmed to disrupt transcription factor-DNA interfaces and can silence aberrant gene expression. For example, cyclic pyrrole-imidazole polyamide that competes with glucocorticoid receptor (GR) for binding to glucocorticoid response elements could be expected to affect the DNA dependent binding by interfering with the protein-DNA interface. However, how such small molecules affect the transcription factor-DNA interfaces and gene regulatory pathways through DNA structure distortion is not fully understood so far. In the present work, we have constructed some models, especially the ternary model of polyamides+DNA+GR DNA-binding domain (GRDBD) dimer, and carried out molecular dynamics simulations and free energy calculations for them to address how polyamide molecules disrupt the GRDBD and DNA interface when polyamide and protein bind at the same sites on opposite grooves of DNA. We found that the cyclic polyamide binding in minor groove of DNA can induce a large structural perturbation of DNA, i.e. a >4 Å widening of the DNA minor groove and a compression of the major groove by more than 4 Å as compared with the DNA molecule in the GRDBD dimer+DNA complex. Further investigations for the ternary system of polyamides+DNA+GRDBD dimer and the binary system of allosteric DNA+GRDBD dimer revealed that the compression of DNA major groove surface causes GRDBD to move away from the DNA major groove with the initial average distance of ∼4 Å to the final average distance of ∼10 Å during 40 ns simulation course. Therefore, this study straightforward explores how small molecule targeting specific sites in the DNA minor groove disrupts the transcription factor-DNA interface in DNA major groove, and consequently modulates gene expression.

p53 Specifically Binds Triplex DNA In Vitro and in Cells

PubMed Central

Brázdová, Marie; Tichý, Vlastimil; Helma, Robert; Bažantová, Pavla; Polášková, Alena; Krejčí, Aneta; Petr, Marek; Navrátilová, Lucie; Tichá, Olga; Nejedlý, Karel; Bennink, Martin L.; Subramaniam, Vinod; Bábková, Zuzana; Martínek, Tomáš; Lexa, Matej; Adámik, Matej

2016-01-01

Triplex DNA is implicated in a wide range of biological activities, including regulation of gene expression and genomic instability leading to cancer. The tumor suppressor p53 is a central regulator of cell fate in response to different type of insults. Sequence and structure specific modes of DNA recognition are core attributes of the p53 protein. The focus of this work is the structure-specific binding of p53 to DNA containing triplex-forming sequences in vitro and in cells and the effect on p53-driven transcription. This is the first DNA binding study of full-length p53 and its deletion variants to both intermolecular and intramolecular T.A.T triplexes. We demonstrate that the interaction of p53 with intermolecular T.A.T triplex is comparable to the recognition of CTG-hairpin non-B DNA structure. Using deletion mutants we determined the C-terminal DNA binding domain of p53 to be crucial for triplex recognition. Furthermore, strong p53 recognition of intramolecular T.A.T triplexes (H-DNA), stabilized by negative superhelicity in plasmid DNA, was detected by competition and immunoprecipitation experiments, and visualized by AFM. Moreover, chromatin immunoprecipitation revealed p53 binding T.A.T forming sequence in vivo. Enhanced reporter transactivation by p53 on insertion of triplex forming sequence into plasmid with p53 consensus sequence was observed by luciferase reporter assays. In-silico scan of human regulatory regions for the simultaneous presence of both consensus sequence and T.A.T motifs identified a set of candidate p53 target genes and p53-dependent activation of several of them (ABCG5, ENOX1, INSR, MCC, NFAT5) was confirmed by RT-qPCR. Our results show that T.A.T triplex comprises a new class of p53 binding sites targeted by p53 in a DNA structure-dependent mode in vitro and in cells. The contribution of p53 DNA structure-dependent binding to the regulation of transcription is discussed. PMID:27907175

Molecular Insights into the Impact of Oxidative Stress on the Quorum-Sensing Regulator Protein LasR*

PubMed Central

Kafle, Prapti; Amoh, Amanda N.; Reaves, Jocelyn M.; Suneby, Emma G.; Tutunjian, Kathryn A.; Tyson, Reed L.; Schneider, Tanya L.

2016-01-01

The LasR regulator protein functions at the top of the Pseudomonas aeruginosa quorum-sensing hierarchy and is implicated in promoting bacterial virulence. Of note is recent evidence that this transcription factor may also respond to oxidative stress. Here, all cysteines in LasR were inspected to deduce their redox sensitivity and to probe the connection between stress response and LasR activity using purified LasR and individual LasR domains. Cys79 in the ligand binding domain of LasR appears to be important for ligand recognition and folding of this domain to potentiate DNA binding but does not seem to be sensitive to oxidative stress when bound to its native ligand. Two cysteines in the DNA binding domain of LasR do form a disulfide bond when treated with hydrogen peroxide, and formation of this Cys201-Cys203 disulfide bond appears to disrupt the DNA binding activity of the transcription factor. Mutagenesis of either of these cysteines leads to expression of a protein that no longer binds DNA. A cell-based reporter assay linking LasR function with β-galactosidase activity gave results consistent with those obtained with purified LasR. This work provides a possible mechanism for oxidative stress response by LasR and indicates that multiple cysteines within the protein may prove to be useful targets for disabling its activity. PMID:27053110

NOTCH1 Inhibits Activation of ATM by Impairing the Formation of an ATM-FOXO3a-KAT5/Tip60 Complex.

PubMed

Adamowicz, Marek; Vermezovic, Jelena; d'Adda di Fagagna, Fabrizio

2016-08-23

The DNA damage response (DDR) signal transduction pathway is responsible for sensing DNA damage and further relaying this signal into the cell. ATM is an apical DDR kinase that orchestrates the activation and the recruitment of downstream DDR factors to induce cell-cycle arrest and repair. We have previously shown that NOTCH1 inhibits ATM activation upon DNA damage, but the underlying mechanism remains unclear. Here, we show that NOTCH1 does not impair ATM recruitment to DNA double-strand breaks (DSBs). Rather, NOTCH1 prevents binding of FOXO3a and KAT5/Tip60 to ATM through a mechanism in which NOTCH1 competes with FOXO3a for ATM binding. Lack of FOXO3a binding to ATM leads to the loss of KAT5/Tip60 association with ATM. Moreover, expression of NOTCH1 or depletion of ATM impairs the formation of the FOXO3a-KAT5/Tip60 protein complex. Finally, we show that pharmacological induction of FOXO3a nuclear localization sensitizes NOTCH1-driven cancers to DNA-damage-induced cell death. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

Structural and Thermodynamic Consequences of the Replacement of Zinc with Environmental Metals on ERα-DNA Interactions

PubMed Central

Deegan, Brian J.; Bona, Anna M.; Bhat, Vikas; Mikles, David C.; McDonald, Caleb B.; Seldeen, Kenneth L.; Farooq, Amjad

2011-01-01

Estrogen receptor α (ERα) acts as a transcription factor by virtue of the ability of its DNA-binding (DB) domain, comprised of a tandem pair of zinc fingers, to recognize the estrogen response element (ERE) within the promoters of target genes. Herein, using an array of biophysical methods, we probe structural consequences of the replacement of zinc within the DB domain of ERα with various environmental metals and their effects on the thermodynamics of binding to DNA. Our data reveal that while the DB domain reconstituted with divalent ions of zinc, cadmium, mercury and cobalt binds to DNA with affinities in the nanomolar range, divalent ions of barium, copper, iron, lead, manganese, nickel and tin are unable to regenerate DB domain with DNA-binding potential though they can compete with zinc for coordinating the cysteine ligands within the zinc fingers. We also show that the metal-free DB domain is a homodimer in solution and that the binding of various metals only results in subtle secondary and tertiary structural changes, implying that metal-coordination may only be essential for DNA-binding. Collectively, our findings provide mechanistic insights into how environmental metals may modulate the physiological function of a key nuclear receptor involved in mediating a plethora of cellular functions central to human health and disease. PMID:22038807

Non-equilibrium repressor binding kinetics link DNA damage dose to transcriptional timing within the SOS gene network.

PubMed

Culyba, Matthew J; Kubiak, Jeffrey M; Mo, Charlie Y; Goulian, Mark; Kohli, Rahul M

2018-06-01

Biochemical pathways are often genetically encoded as simple transcription regulation networks, where one transcription factor regulates the expression of multiple genes in a pathway. The relative timing of each promoter's activation and shut-off within the network can impact physiology. In the DNA damage repair pathway (known as the SOS response) of Escherichia coli, approximately 40 genes are regulated by the LexA repressor. After a DNA damaging event, LexA degradation triggers SOS gene transcription, which is temporally separated into subsets of 'early', 'middle', and 'late' genes. Although this feature plays an important role in regulating the SOS response, both the range of this separation and its underlying mechanism are not experimentally defined. Here we show that, at low doses of DNA damage, the timing of promoter activities is not separated. Instead, timing differences only emerge at higher levels of DNA damage and increase as a function of DNA damage dose. To understand mechanism, we derived a series of synthetic SOS gene promoters which vary in LexA-operator binding kinetics, but are otherwise identical, and then studied their activity over a large dose-range of DNA damage. In distinction to established models based on rapid equilibrium assumptions, the data best fit a kinetic model of repressor occupancy at promoters, where the drop in cellular LexA levels associated with higher doses of DNA damage leads to non-equilibrium binding kinetics of LexA at operators. Operators with slow LexA binding kinetics achieve their minimal occupancy state at later times than operators with fast binding kinetics, resulting in a time separation of peak promoter activity between genes. These data provide insight into this remarkable feature of the SOS pathway by demonstrating how a single transcription factor can be employed to control the relative timing of each gene's transcription as a function of stimulus dose.

Alternative Use of DNA Binding Domains by the Neurospora White Collar Complex Dictates Circadian Regulation and Light Responses

PubMed Central

Wang, Bin; Zhou, Xiaoying; Loros, Jennifer J.

2015-01-01

In the Neurospora circadian system, the White Collar complex (WCC) of WC-1 and WC-2 drives transcription of the circadian pacemaker gene frequency (frq), whose gene product, FRQ, as a part of the FRQ-FRH complex (FFC), inhibits its own expression. The WCC is also the principal Neurospora photoreceptor; WCC-mediated light induction of frq resets the clock, and all acute light induction is triggered by WCC binding to promoters of light-induced genes. However, not all acutely light-induced genes are also clock regulated, and conversely, not all clock-regulated direct targets of WCC are light induced; the structural determinants governing the shift from WCC's dark circadian role to its light activation role are poorly described. We report that the DBD region (named for being defective in binding DNA), a basic region in WC-1 proximal to the DNA-binding zinc finger (ZnF) whose function was previously ascribed to nuclear localization, instead plays multiple essential roles assisting in DNA binding and mediating interactions with the FFC. DNA binding for light induction by the WCC requires only WC-2, whereas DNA binding for circadian functions requires WC-2 as well as the ZnF and DBD motif of WC-1. The data suggest a means by which alterations in the tertiary and quaternary structures of the WCC can lead to its distinct functions in the dark and in the light. PMID:26711258

Cross-talk between the ligand- and DNA-binding domains of estrogen receptor.

PubMed

Huang, Wei; Greene, Geoffrey L; Ravikumar, Krishnakumar M; Yang, Sichun

2013-11-01

Estrogen receptor alpha (ERα) is a hormone-responsive transcription factor that contains several discrete functional domains, including a ligand-binding domain (LBD) and a DNA-binding domain (DBD). Despite a wealth of knowledge about the behaviors of individual domains, the molecular mechanisms of cross-talk between LBD and DBD during signal transduction from hormone to DNA-binding of ERα remain elusive. Here, we apply a multiscale approach combining coarse-grained (CG) and atomistically detailed simulations to characterize this cross-talk mechanism via an investigation of the ERα conformational landscape. First, a CG model of ERα is built based on crystal structures of individual LBDs and DBDs, with more emphasis on their interdomain interactions. Second, molecular dynamics simulations are implemented and enhanced sampling is achieved via the "push-pull-release" strategy in the search for different LBD-DBD orientations. Third, multiple energetically stable ERα conformations are identified on the landscape. A key finding is that estradiol-bound LBDs utilize the well-described activation helix H12 to pack and stabilize LBD-DBD interactions. Our results suggest that the estradiol-bound LBDs can serve as a scaffold to position and stabilize the DBD-DNA complex, consistent with experimental observations of enhanced DNA binding with the LBD. Final assessment using atomic-level simulations shows that these CG-predicted models are significantly stable within a 15-ns simulation window and that specific pairs of lysine residues in close proximity at the domain interfaces could serve as candidate sites for chemical cross-linking studies. Together, these simulation results provide a molecular view of the role of ERα domain interactions in response to hormone binding. Copyright © 2013 Wiley Periodicals, Inc.

Effect of DNA Binding on Geminate CO Recombination Kinetics in CO-sensing Transcription Factor CooA*

PubMed Central

Benabbas, Abdelkrim; Karunakaran, Venugopal; Youn, Hwan; Poulos, Thomas L.; Champion, Paul M.

2012-01-01

Carbon monoxide oxidation activator (CooA) proteins are heme-based CO-sensing transcription factors. Here we study the ultrafast dynamics of geminate CO rebinding in two CooA homologues, Rhodospirillum rubrum (RrCooA) and Carboxydothermus hydrogenoformans (ChCooA). The effects of DNA binding and the truncation of the DNA-binding domain on the CO geminate recombination kinetics were specifically investigated. The CO rebinding kinetics in these CooA complexes take place on ultrafast time scales but remain non-exponential over many decades in time. We show that this non-exponential kinetic response is due to a quenched enthalpic barrier distribution resulting from a distribution of heme geometries that is frozen or slowly evolving on the time scale of CO rebinding. We also show that, upon CO binding, the distal pocket of the heme in the CooA proteins relaxes to form a very efficient hydrophobic trap for CO. DNA binding further tightens the narrow distal pocket and slightly weakens the iron-proximal histidine bond. Comparison of the CO rebinding kinetics of RrCooA, truncated RrCooA, and DNA-bound RrCooA proteins reveals that the uncomplexed and inherently flexible DNA-binding domain adds additional structural heterogeneity to the heme doming coordinate. When CooA forms a complex with DNA, the flexibility of the DNA-binding domain decreases, and the distribution of the conformations available in the heme domain becomes restricted. The kinetic studies also offer insights into how the architecture of the heme environment can tune entropic barriers in order to control the geminate recombination of CO in heme proteins, whereas spin selection rules play a minor or non-existent role. PMID:22544803

Effect of DNA binding on geminate CO recombination kinetics in CO-sensing transcription factor CooA.

PubMed

Benabbas, Abdelkrim; Karunakaran, Venugopal; Youn, Hwan; Poulos, Thomas L; Champion, Paul M

2012-06-22

Carbon monoxide oxidation activator (CooA) proteins are heme-based CO-sensing transcription factors. Here we study the ultrafast dynamics of geminate CO rebinding in two CooA homologues, Rhodospirillum rubrum (RrCooA) and Carboxydothermus hydrogenoformans (ChCooA). The effects of DNA binding and the truncation of the DNA-binding domain on the CO geminate recombination kinetics were specifically investigated. The CO rebinding kinetics in these CooA complexes take place on ultrafast time scales but remain non-exponential over many decades in time. We show that this non-exponential kinetic response is due to a quenched enthalpic barrier distribution resulting from a distribution of heme geometries that is frozen or slowly evolving on the time scale of CO rebinding. We also show that, upon CO binding, the distal pocket of the heme in the CooA proteins relaxes to form a very efficient hydrophobic trap for CO. DNA binding further tightens the narrow distal pocket and slightly weakens the iron-proximal histidine bond. Comparison of the CO rebinding kinetics of RrCooA, truncated RrCooA, and DNA-bound RrCooA proteins reveals that the uncomplexed and inherently flexible DNA-binding domain adds additional structural heterogeneity to the heme doming coordinate. When CooA forms a complex with DNA, the flexibility of the DNA-binding domain decreases, and the distribution of the conformations available in the heme domain becomes restricted. The kinetic studies also offer insights into how the architecture of the heme environment can tune entropic barriers in order to control the geminate recombination of CO in heme proteins, whereas spin selection rules play a minor or non-existent role.

Concentration-Dependent Exchange of Replication Protein A on Single-Stranded DNA Revealed by Single-Molecule Imaging

PubMed Central

Gibb, Bryan; Ye, Ling F.; Gergoudis, Stephanie C.; Kwon, YoungHo; Niu, Hengyao; Sung, Patrick; Greene, Eric C.

2014-01-01

Replication protein A (RPA) is a ubiquitous eukaryotic single-stranded DNA (ssDNA) binding protein necessary for all aspects of DNA metabolism involving an ssDNA intermediate, including DNA replication, repair, recombination, DNA damage response and checkpoint activation, and telomere maintenance [1], [2], [3]. The role of RPA in most of these reactions is to protect the ssDNA until it can be delivered to downstream enzymes. Therefore a crucial feature of RPA is that it must bind very tightly to ssDNA, but must also be easily displaced from ssDNA to allow other proteins to gain access to the substrate. Here we use total internal reflection fluorescence microscopy and nanofabricated DNA curtains to visualize the behavior of Saccharomyces cerevisiae RPA on individual strands of ssDNA in real-time. Our results show that RPA remains bound to ssDNA for long periods of time when free protein is absent from solution. In contrast, RPA rapidly dissociates from ssDNA when free RPA is present in solution allowing rapid exchange between the free and bound states. In addition, the S. cerevisiae DNA recombinase Rad51 and E. coli single-stranded binding protein (SSB) also promote removal of RPA from ssDNA. These results reveal an unanticipated exchange between bound and free RPA suggesting a binding mechanism that can confer exceptionally slow off rates, yet also enables rapid displacement through a direct exchange mechanism that is reliant upon the presence of free ssDNA-binding proteins in solution. Our results indicate that RPA undergoes constant microscopic dissociation under all conditions, but this is only manifested as macroscopic dissociation (i.e. exchange) when free proteins are present in solution, and this effect is due to mass action. We propose that the dissociation of RPA from ssDNA involves a partially dissociated intermediate, which exposes a small section of ssDNA allowing other proteins to access to the DNA. PMID:24498402

In vitro selection of shape-changing DNA nanostructures capable of binding-induced cargo release.

PubMed

Oh, Seung Soo; Plakos, Kory; Xiao, Yi; Eisenstein, Michael; Soh, H Tom

2013-11-26

Many biological systems employ allosteric regulatory mechanisms, which offer a powerful means of directly linking a specific binding event to a wide spectrum of molecular functionalities. There is considerable interest in generating synthetic allosteric regulators that can perform useful molecular functions for applications in diagnostics, imaging and targeted therapies, but generating such molecules through either rational design or directed evolution has proven exceptionally challenging. To address this need, we present an in vitro selection strategy for generating conformation-switching DNA nanostructures that selectively release a small-molecule payload in response to binding of a specific trigger molecule. As an exemplar, we have generated a DNA nanostructure that hybridizes with a separate 'cargo strand' containing an abasic site. This abasic site stably sequesters a fluorescent cargo molecule in an inactive state until the DNA nanostructure encounters an ATP trigger molecule. This ATP trigger causes the nanostructure to release the cargo strand, thereby liberating the fluorescent payload and generating a detectable fluorescent readout. Our DNA nanostructure is highly sensitive, with an EC50 of 30 μM, and highly specific, releasing its payload in response to ATP but not to other chemically similar nucleotide triphosphates. We believe that this selection approach could be generalized to generate synthetic nanostructures capable of selective and controlled release of other small-molecule cargos in response to a variety of triggers, for both research and clinical applications.

Characterization of two mosquito STATs, AaSTAT and CtSTAT. Differential regulation of tyrosine phosphorylation and DNA binding activity by lipopolysaccharide treatment and by Japanese encephalitis virus infection.

PubMed

Lin, Chang-Chi; Chou, Chih-Ming; Hsu, Ya-Li; Lien, Jih-Ching; Wang, Yu-Ming; Chen, Shui-Tsung; Tsai, Shu-Chuan; Hsiao, Pei-Wen; Huang, Chang-Jen

2004-01-30

Two mosquito STATs, AaSTAT and CtSTAT, have been cloned from Aedes albopictus and Culex tritaeniorhynchus mosquitoes, respectively. These two STATs are more similar to those of Drosophila, Anopheles, and mammalian STAT5 in the DNA binding and Src homology 2 domains. The mRNA transcripts are expressed at all developmental stages, and the proteins are present predominantly at the pupal and adult stages in both mosquitoes. Stimulation with lipopolysaccharide resulted in an increase of tyrosine phosphorylation and DNA binding activity of AaSTAT and CtSTAT as well as an increase of luciferase activity of a reporter gene containing Drosophila STAT binding motif in mosquito C6/36 cells. After being infected with Japanese encephalitis virus, nuclear extracts of C6/36 cells revealed a decrease of tyrosine phosphorylation and DNA binding activity of AaSTAT which could be restored by sodium orthovanadate treatment. Taking all of the data together, this is the first report to clone and characterize two mosquito STATs with 81% identity and to demonstrate a different response of tyrosine phosphorylation and DNA binding of these two STATs by lipopolysaccharide treatment and by Japanese encephalitis virus infection.

The structures of non-CG-repeat Z-DNAs co-crystallized with the Z-DNA-binding domain, hZ alpha(ADAR1).

PubMed

Ha, Sung Chul; Choi, Jongkeun; Hwang, Hye-Yeon; Rich, Alexander; Kim, Yang-Gyun; Kim, Kyeong Kyu

2009-02-01

The Z-DNA conformation preferentially occurs at alternating purine-pyrimidine repeats, and is specifically recognized by Z alpha domains identified in several Z-DNA-binding proteins. The binding of Z alpha to foreign or chromosomal DNA in various sequence contexts is known to influence various biological functions, including the DNA-mediated innate immune response and transcriptional modulation of gene expression. For these reasons, understanding its binding mode and the conformational diversity of Z alpha bound Z-DNAs is of considerable importance. However, structural studies of Z alpha bound Z-DNA have been mostly limited to standard CG-repeat DNAs. Here, we have solved the crystal structures of three representative non-CG repeat DNAs, d(CACGTG)(2), d(CGTACG)(2) and d(CGGCCG)(2) complexed to hZ alpha(ADAR1) and compared those structures with that of hZ alpha(ADAR1)/d(CGCGCG)(2) and the Z alpha-free Z-DNAs. hZ alpha(ADAR1) bound to each of the three Z-DNAs showed a well conserved binding mode with very limited structural deviation irrespective of the DNA sequence, although varying numbers of residues were in contact with Z-DNA. Z-DNAs display less structural alterations in the Z alpha-bound state than in their free form, thereby suggesting that conformational diversities of Z-DNAs are restrained by the binding pocket of Z alpha. These data suggest that Z-DNAs are recognized by Z alpha through common conformational features regardless of the sequence and structural alterations.

Reactivation of mutant p53: Constraints on mechanism highlighted by principal component analysis of the DNA binding domain.

PubMed

Ouaray, Zahra; ElSawy, Karim M; Lane, David P; Essex, Jonathan W; Verma, Chandra

2016-10-01

Most p53 mutations associated with cancer are located in its DNA binding domain (DBD). Many structures (X-ray and NMR) of this domain are available in the protein data bank (PDB) and a vast conformational heterogeneity characterizes the various free and complexed states. The major difference between the apo and the holo-complexed states appears to lie in the L1 loop. In particular, the conformations of this loop appear to depend intimately on the sequence of DNA to which it binds. This conclusion builds upon recent observations that implicate the tetramerization and the C-terminal domains (respectively TD and Cter) in DNA binding specificity. Detailed PCA analysis of the most recent collection of DBD structures from the PDB have been carried out. In contrast to recommendations that small molecules/drugs stabilize the flexible L1 loop to rescue mutant p53, our study highlights a need to retain the flexibility of the p53 DNA binding surface (DBS). It is the adaptability of this region that enables p53 to engage in the diverse interactions responsible for its functionality. Proteins 2016; 84:1443-1461. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

Nanopore sensing of individual transcription factors bound to DNA

PubMed Central

Squires, Allison; Atas, Evrim; Meller, Amit

2015-01-01

Transcription factor (TF)-DNA interactions are the primary control point in regulation of gene expression. Characterization of these interactions is essential for understanding genetic regulation of biological systems and developing novel therapies to treat cellular malfunctions. Solid-state nanopores are a highly versatile class of single-molecule sensors that can provide rich information about local properties of long charged biopolymers using the current blockage patterns generated during analyte translocation, and provide a novel platform for characterization of TF-DNA interactions. The DNA-binding domain of the TF Early Growth Response Protein 1 (EGR1), a prototypical zinc finger protein known as zif268, is used as a model system for this study. zif268 adopts two distinct bound conformations corresponding to specific and nonspecific binding, according to the local DNA sequence. Here we implement a solid-state nanopore platform for direct, label- and tether-free single-molecule detection of zif268 bound to DNA. We demonstrate detection of single zif268 TFs bound to DNA according to current blockage sublevels and duration of translocation through the nanopore. We further show that the nanopore can detect and discriminate both specific and nonspecific binding conformations of zif268 on DNA via the distinct current blockage patterns corresponding to each of these two known binding modes. PMID:26109509

Nanopore sensing of individual transcription factors bound to DNA

NASA Astrophysics Data System (ADS)

Squires, Allison; Atas, Evrim; Meller, Amit

2015-06-01

Transcription factor (TF)-DNA interactions are the primary control point in regulation of gene expression. Characterization of these interactions is essential for understanding genetic regulation of biological systems and developing novel therapies to treat cellular malfunctions. Solid-state nanopores are a highly versatile class of single-molecule sensors that can provide rich information about local properties of long charged biopolymers using the current blockage patterns generated during analyte translocation, and provide a novel platform for characterization of TF-DNA interactions. The DNA-binding domain of the TF Early Growth Response Protein 1 (EGR1), a prototypical zinc finger protein known as zif268, is used as a model system for this study. zif268 adopts two distinct bound conformations corresponding to specific and nonspecific binding, according to the local DNA sequence. Here we implement a solid-state nanopore platform for direct, label- and tether-free single-molecule detection of zif268 bound to DNA. We demonstrate detection of single zif268 TFs bound to DNA according to current blockage sublevels and duration of translocation through the nanopore. We further show that the nanopore can detect and discriminate both specific and nonspecific binding conformations of zif268 on DNA via the distinct current blockage patterns corresponding to each of these two known binding modes.

Optical tweezers reveal how proteins alter replication

NASA Astrophysics Data System (ADS)

Chaurasiya, Kathy

Single molecule force spectroscopy is a powerful method that explores the DNA interaction properties of proteins involved in a wide range of fundamental biological processes such as DNA replication, transcription, and repair. We use optical tweezers to capture and stretch a single DNA molecule in the presence of proteins that bind DNA and alter its mechanical properties. We quantitatively characterize the DNA binding mechanisms of proteins in order to provide a detailed understanding of their function. In this work, we focus on proteins involved in replication of Escherichia coli (E. coli ), endogenous eukaryotic retrotransposons Ty3 and LINE-1, and human immunodeficiency virus (HIV). DNA polymerases replicate the entire genome of the cell, and bind both double-stranded DNA (dsDNA) and single-stranded DNA (ssDNA) during DNA replication. The replicative DNA polymerase in the widely-studied model system E. coli is the DNA polymerase III subunit alpha (DNA pol III alpha). We use optical tweezers to determine that UmuD, a protein that regulates bacterial mutagenesis through its interactions with DNA polymerases, specifically disrupts alpha binding to ssDNA. This suggests that UmuD removes alpha from its ssDNA template to allow DNA repair proteins access to the damaged DNA, and to facilitate exchange of the replicative polymerase for an error-prone translesion synthesis (TLS) polymerase that inserts nucleotides opposite the lesions, so that bacterial DNA replication may proceed. This work demonstrates a biophysical mechanism by which E. coli cells tolerate DNA damage. Retroviruses and retrotransposons reproduce by copying their RNA genome into the nuclear DNA of their eukaryotic hosts. Retroelements encode proteins called nucleic acid chaperones, which rearrange nucleic acid secondary structure and are therefore required for successful replication. The chaperone activity of these proteins requires strong binding affinity for both single- and double-stranded nucleic acids. We use single molecule DNA stretching to show that the nucleocapsid protein (NC) of the yeast retrotransposon Ty3, which is likely to be an ancestor of HIV NC, has optimal nucleic acid chaperone activity with only a single zinc finger. We also show that the chaperone activity of the ORF1 protein is responsible for successful replication of the mouse LINE-1 retrotransposon. LINE-1 is also 17% of the human genome, where it generates insertion mutations and alters gene expression. Retrotransposons such as LINE-1 and Ty3 are likely to be ancestors of retroviruses such as HIV. Human APOBEC3G (A3G) inhibits HIV-1 replication via cytidine deamination of the viral ssDNA genome, as well as via a distinct deamination-independent mechanism. Efficient deamination requires rapid on-off binding kinetics, but a slow dissociation rate is required for the proposed deaminase-independent mechanism. We resolve this apparent contradiction with a new quantitative single molecule method, which shows that A3G initially binds ssDNA with fast on-off rates and subsequently converts to a slow binding mode. This suggests that oligomerization transforms A3G from a fast enzyme to a slow binding protein, which is the biophysical mechanism that allows A3G to inhibit HIV replication. A complete understanding of the mechanism of A3G-mediated antiviral activity is required to design drugs that disrupt the viral response to A3G, enhance A3G packaging inside the viral core, and other potential strategies for long-term treatment of HIV infection. We use single molecule biophysics to explore the function of proteins involved in bacterial DNA replication, endogenous retrotransposition of retroelements in eukaryotic hosts such yeast and mice, and HIV replication in human cells. Our quantitative results provide insight into protein function in a range of complex biological systems and have wide-ranging implications for human health.

Selective DNA demethylation by fusion of TDG with a sequence-specific DNA-binding domain

PubMed Central

Gregory, David J.; Mikhaylova, Lyudmila; Fedulov, Alexey V.

2012-01-01

Our ability to selectively manipulate gene expression by epigenetic means is limited, as there is no approach for targeted reactivation of epigenetically silenced genes, in contrast to what is available for selective gene silencing. We aimed to develop a tool for selective transcriptional activation by DNA demethylation. Here we present evidence that direct targeting of thymine-DNA-glycosylase (TDG) to specific sequences in the DNA can result in local DNA demethylation at potential regulatory sequences and lead to enhanced gene induction. When TDG was fused to a well-characterized DNA-binding domain [the Rel-homology domain (RHD) of NFκB], we observed decreased DNA methylation and increased transcriptional response to unrelated stimulus of inducible nitric oxide synthase (NOS2). The effect was not seen for control genes lacking either RHD-binding sites or high levels of methylation, nor in control mock-transduced cells. Specific reactivation of epigenetically silenced genes may thus be achievable by this approach, which provides a broadly useful strategy to further our exploration of biological mechanisms and to improve control over the epigenome. PMID:22419066

Regulation of chromatin organization and inducible gene expression by a Drosophila insulator

PubMed Central

Wood, Ashley M.; Van Bortle, Kevin; Ramos, Edward; Takenaka, Naomi; Rohrbaugh, Margaret; Jones, Brian C.; Jones, Keith C.; Corces, Victor G.

2011-01-01

SUMMARY Insulators are multi-protein-DNA complexes thought to affect gene expression by mediating inter- and intra-chromosomal interactions. Drosophila insulators contain specific DNA binding proteins plus common components, such as CP190, that facilitate these interactions. Here we examine changes in the distribution of Drosophila insulator proteins during the heat-shock and ecdysone responses. We find that CP190 recruitment to insulator sites is the main regulatable step in controlling insulator function during heat shock. In contrast, both CP190 and DNA binding protein recruitment are regulated during the ecdysone response. CP190 is necessary to stabilize specific chromatin loops and for proper activation of transcription of genes regulated by this hormone. These findings suggest that cells may regulate recruitment of insulator proteins to the DNA in order to activate insulator activity at specific sites and create distinct patterns of nuclear organization that are necessary to achieve proper gene expression in response to different stimuli. PMID:21981916

Regulation of chromatin organization and inducible gene expression by a Drosophila insulator.

PubMed

Wood, Ashley M; Van Bortle, Kevin; Ramos, Edward; Takenaka, Naomi; Rohrbaugh, Margaret; Jones, Brian C; Jones, Keith C; Corces, Victor G

2011-10-07

Insulators are multiprotein-DNA complexes thought to affect gene expression by mediating inter- and intrachromosomal interactions. Drosophila insulators contain specific DNA-binding proteins plus common components, such as CP190, that facilitate these interactions. Here, we examine changes in the distribution of Drosophila insulator proteins during the heat-shock and ecdysone responses. We find that CP190 recruitment to insulator sites is the main regulatable step in controlling insulator function during heat shock. In contrast, both CP190 and DNA-binding protein recruitment are regulated during the ecdysone response. CP190 is necessary to stabilize specific chromatin loops and for proper activation of transcription of genes regulated by this hormone. These findings suggest that cells may regulate recruitment of insulator proteins to DNA to activate insulator activity at specific sites and create distinct patterns of nuclear organization that are necessary to achieve proper gene expression in response to different stimuli. Copyright © 2011 Elsevier Inc. All rights reserved.

A novel bifunctional histone protein in Streptomyces: a candidate for structural coupling between DNA conformation and transcription during development and stress?

PubMed Central

Aldridge, Matthew; Facey, Paul; Francis, Lewis; Bayliss, Sion; Del Sol, Ricardo; Dyson, Paul

2013-01-01

Antibiotic-producing Streptomyces are complex bacteria that remodel global transcription patterns and their nucleoids during development. Here, we describe a novel developmentally regulated nucleoid-associated protein, DdbA, of the genus that consists of an N-terminal DNA-binding histone H1-like domain and a C-terminal DksA-like domain that can potentially modulate RNA polymerase activity in conjunction with ppGpp. Owing to its N-terminal domain, the protein can efficiently bind and condense DNA in vitro. Loss of function of this DNA-binding protein results in changes in both DNA condensation during development and the ability to adjust DNA supercoiling in response to osmotic stress. Initial analysis of the DksA-like activity of DdbA indicates that overexpression of the protein suppresses a conditional deficiency in antibiotic production of relA mutants that are unable to synthesise ppGpp, just as DksA overexpression in Escherichia coli can suppress ppGpp0 phenotypes. The null mutant is also sensitive to oxidative stress owing to impaired upregulation of transcription of sigR, encoding an alternative sigma factor. Consequently, we propose this bifunctional histone-like protein as a candidate that could structurally couple changes in DNA conformation and transcription during the streptomycete life-cycle and in response to stress. PMID:23525459

Two phenylalanines in the C-terminus of Epstein-Barr virus Rta protein reciprocally modulate its DNA binding and transactivation function

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chen, L.-W.; Department of Molecular Biophysics and Biochemistry, Yale University School of Medicine, New Haven, CT 06520; Raghavan, Vineetha

The Rta (R transactivator) protein plays an essential role in the Epstein-Barr viral (EBV) lytic cascade. Rta activates viral gene expression by several mechanisms including direct and indirect binding to target viral promoters, synergy with EBV ZEBRA protein, and stimulation of cellular signaling pathways. We previously found that Rta proteins with C-terminal truncations of 30 aa were markedly enhanced in their capacity to bind DNA (Chen, L.W., Chang, P.J., Delecluse, H.J., and Miller, G., (2005). Marked variation in response of consensus binding elements for the Rta protein of Epstein-Barr virus. J. Virol. 79(15), 9635-9650.). Here we show that two phenylalaninesmore » (F600 and F605) in the C-terminus of Rta play a crucial role in mediating this DNA binding inhibitory function. Amino acids 555 to 605 of Rta constitute a functional DNA binding inhibitory sequence (DBIS) that markedly decreased DNA binding when transferred to a minimal DNA binding domain of Rta (aa 1-350). Alanine substitution mutants, F600A/F605A, abolished activity of the DBIS. F600 and F605 are located in the transcriptional activation domain of Rta. Alanine substitutions, F600A/F605A, decreased transcriptional activation by Rta protein, whereas aromatic substitutions, such as F600Y/F605Y or F600W/F605W, partially restored transcriptional activation. Full-length Rta protein with F600A/F605A mutations were enhanced in DNA binding compared to wild-type, whereas Rta proteins with F600Y/F605Y or F600W/F605W substitutions were, like wild-type Rta, relatively poor DNA binders. GAL4 (1-147)/Rta (416-605) fusion proteins with F600A/F605A mutations were diminished in transcriptional activation, relative to GAL4/Rta chimeras without such mutations. The results suggest that, in the context of a larger DBIS, F600 and F605 play a role in the reciprocal regulation of DNA binding and transcriptional activation by Rta. Regulation of DNA binding by Rta is likely to be important in controlling its different modes of action.« less

The DNA Maturation Domain of gpA, the DNA Packaging Motor Protein of Bacteriophage Lambda, Contains an ATPase Site Associated with Endonuclease Activity

PubMed Central

Ortega, Marcos E.; Gaussier, Helene; Catalano, Carlos E.

2007-01-01

Summary Terminase enzymes are common to double-stranded DNA (dsDNA) viruses and are responsible for packaging viral DNA into the confines of an empty capsid shell. In bacteriophage lambda the catalytic terminase subunit is gpA, which is responsible for maturation of the genome end prior to packaging and subsequent translocation of the matured DNA into the capsid. DNA packaging requires an ATPase catalytic site situated in the N-terminus of the protein. A second ATPase catalytic site associated with the DNA maturation activities of the protein has been proposed; however, direct demonstration of this putative second site is lacking. Here we describe biochemical studies that define protease-resistant peptides of gpA and expression of these putative domains in E. coli. Biochemical characterization of gpA-ΔN179, a construct in which the N-terminal 179 residues of gpA have been deleted, indicates that this protein encompasses the DNA maturation domain of gpA. The construct is folded, soluble and possesses an ATP-dependent nuclease activity. Moreover, the construct binds and hydrolyzes ATP despite the fact that the DNA packaging ATPase site in the N-terminus of gpA has been deleted. Mutation of lysine 497, which alters the conserved lysine in a predicted Walker A “P-loop” sequence, does not affect ATP binding but severely impairs ATP hydrolysis. Further, this mutation abrogates the ATP-dependent nuclease activity of the protein. These studies provide direct evidence for the elusive nucleotide-binding site in gpA that is directly associated with the DNA maturation activity of the protein. The implications of these results with respect to the two roles of the terminase holoenzyme – DNA maturation and DNA packaging – are discussed. PMID:17870092

Cerium chloride stimulated controlled conversion of B-to-Z DNA in self-assembled nanostructures

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bhanjadeo, Madhabi M.; Academy of Scientific & Innovative Research; Nayak, Ashok K.

DNA adopts different conformation not only because of novel base pairs but also while interacting with inorganic or organic compounds. Self-assembled branched DNA (bDNA) structures or DNA origami that change conformation in response to environmental cues hold great promises in sensing and actuation at the nanoscale. Recently, the B-Z transition in DNA is being explored to design various nanomechanical devices. In this communication we have demonstrated that Cerium chloride binds to the phosphate backbone of self-assembled bDNA structure and induce B-to-Z transition at physiological concentration. The mechanism of controlled conversion from right-handed to left-handed has been assayed by various dyemore » binding studies using CD and fluorescence spectroscopy. Three different bDNA structures have been identified to display B-Z transition. This approach provides a rapid and reversible means to change bDNA conformation, which can be used for dynamic and progressive control at the nanoscale. - Highlights: • Cerium-induced B-to-Z DNA transition in self-assembled nanostructures. • Lower melting temperature of Z-DNA than B-DNA confirmed by CD spectroscopy. • Binding mechanism of cerium chloride is explained using fluorescence spectroscopy. • Right-handed to left-handed DNA conformation is also noticed in modified bDNA structure.« less

Functionalization of DNA Nanostructures for Cell Signaling Applications

NASA Astrophysics Data System (ADS)

Pedersen, Ronnie O.

Transforming growth factor beta (TGF-beta) is an important cytokine responsible for a wide range of different cellular functions including extracellular matrix formation, angiogenesis and epithelial-mesenchymal transition. We have sought to use self-assembling DNA nanostructures to influence TGF-beta signaling. The predictable Watson Crick base pairing allows for designing self-assembling nanoscale structures using oligonucleotides. We have used the method of DNA origami to assemble structures functionalized with multiple peptides that bind TGF-beta receptors outside the ligand binding domain. This allows the nanostructures to cluster TGF-beta receptors and lower the energy barrier of ligand binding thus sensitizing the cells to TGF-beta stimulation. To prove efficacy of our nanostructures we have utilized immunofluorescent staining of Smad2/4 in order to monitor TGF-beta mediated translocation of Smad2/4 to the cell nucleus. We have also utilized Smad2/4 responsive luminescence constructs that allows us to quantify TGF-beta stimulation with and without nanostructures. To functionalize our nanostructures we relied on biotin-streptavidin linkages. This introduces a multivalency that is not necessarily desirable in all designs. Therefore we have investigated alternative means of functionalization. The first approach is based on targeting DNA nanostructure by using zinc finger binding proteins. Efficacy of zinc finger binding proteins was assayed by the use of enzyme-linked immunosorbent (ELISA) assay and atomic force microscopy (AFM). While ELISA indicated a relative specificity of zinc finger proteins for target DNA sequences AFM showed a high degree of non-specific binding and insufficient affinity. The second approach is based on using peptide nucleic acid (PNA) incorporated in the nanostructure through base pairing. PNA is a synthetic DNA analog consisting of a backbone of repeating N-(2-aminoethyl)-glycine units to which purine and pyrimidine bases are linked by amide bonds. The solid phase synthesis of PNA allows for convenient extension of the backbone into a peptide segment enabling peptide functionalization of DNA nanostructures. We have investigated how the neutral character of PNA alters the incorporation in DNA based nanostructures compared to a DNA control using biotinylation and AFM. Results indicate that PNA can successfully be used as a way of functionalizing DNA nanostructures. Additionally we have shown that functionalized nanostructures are capable of sensitizing cells to TGF-beta stimulation.

Toehold-Mediated Displacement of an Adenosine-Binding Aptamer from a DNA Duplex by its Ligand.

PubMed

Monserud, Jon H; Macri, Katherine M; Schwartz, Daniel K

2016-10-24

DNA is increasingly used to engineer dynamic nanoscale circuits, structures, and motors, many of which rely on DNA strand-displacement reactions. The use of functional DNA sequences (e.g., aptamers, which bind to a wide range of ligands) in these reactions would potentially confer responsiveness on such devices, and integrate DNA computation with highly varied molecular stimuli. By using high-throughput single-molecule FRET methods, we compared the kinetics of a putative aptamer-ligand and aptamer-complement strand-displacement reaction. We found that the ligands actively disrupted the DNA duplex in the presence of a DNA toehold in a similar manner to complementary DNA, with kinetic details specific to the aptamer structure, thus suggesting that the DNA strand-displacement concept can be extended to functional DNA-ligand systems. © 2016 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Set2 Methyltransferase Facilitates DNA Replication and Promotes Genotoxic Stress Responses through MBF-Dependent Transcription.

PubMed

Pai, Chen-Chun; Kishkevich, Anastasiya; Deegan, Rachel S; Keszthelyi, Andrea; Folkes, Lisa; Kearsey, Stephen E; De León, Nagore; Soriano, Ignacio; de Bruin, Robertus Antonius Maria; Carr, Antony M; Humphrey, Timothy C

2017-09-12

Chromatin modification through histone H3 lysine 36 methylation by the SETD2 tumor suppressor plays a key role in maintaining genome stability. Here, we describe a role for Set2-dependent H3K36 methylation in facilitating DNA replication and the transcriptional responses to both replication stress and DNA damage through promoting MluI cell-cycle box (MCB) binding factor (MBF)-complex-dependent transcription in fission yeast. Set2 loss leads to reduced MBF-dependent ribonucleotide reductase (RNR) expression, reduced deoxyribonucleoside triphosphate (dNTP) synthesis, altered replication origin firing, and a checkpoint-dependent S-phase delay. Accordingly, prolonged S phase in the absence of Set2 is suppressed by increasing dNTP synthesis. Furthermore, H3K36 is di- and tri-methylated at these MBF gene promoters, and Set2 loss leads to reduced MBF binding and transcription in response to genotoxic stress. Together, these findings provide new insights into how H3K36 methylation facilitates DNA replication and promotes genotoxic stress responses in fission yeast. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

DNA Binding Hydroxyl Radical Probes.

PubMed

Tang, Vicky J; Konigsfeld, Katie M; Aguilera, Joe A; Milligan, Jamie R

2012-01-01

The hydroxyl radical is the primary mediator of DNA damage by the indirect effect of ionizing radiation. It is a powerful oxidizing agent produced by the radiolysis of water and is responsible for a significant fraction of the DNA damage associated with ionizing radiation. There is therefore an interest in the development of sensitive assays for its detection. The hydroxylation of aromatic groups to produce fluorescent products has been used for this purpose. We have examined four different chromophores which produce fluorescent products when hydroxylated. Of these, the coumarin system suffers from the fewest disadvantages. We have therefore examined its behavior when linked to a cationic peptide ligand designed to bind strongly to DNA.

Oligomerization transforms human APOBEC3G from an efficient enzyme to a slowly dissociating nucleic acid-binding protein

NASA Astrophysics Data System (ADS)

Chaurasiya, Kathy R.; McCauley, Micah J.; Wang, Wei; Qualley, Dominic F.; Wu, Tiyun; Kitamura, Shingo; Geertsema, Hylkje; Chan, Denise S. B.; Hertz, Amber; Iwatani, Yasumasa; Levin, Judith G.; Musier-Forsyth, Karin; Rouzina, Ioulia; Williams, Mark C.

2014-01-01

The human APOBEC3 proteins are a family of DNA-editing enzymes that play an important role in the innate immune response against retroviruses and retrotransposons. APOBEC3G is a member of this family that inhibits HIV-1 replication in the absence of the viral infectivity factor Vif. Inhibition of HIV replication occurs by both deamination of viral single-stranded DNA and a deamination-independent mechanism. Efficient deamination requires rapid binding to and dissociation from ssDNA. However, a relatively slow dissociation rate is required for the proposed deaminase-independent roadblock mechanism in which APOBEC3G binds the viral template strand and blocks reverse transcriptase-catalysed DNA elongation. Here, we show that APOBEC3G initially binds ssDNA with rapid on-off rates and subsequently converts to a slowly dissociating mode. In contrast, an oligomerization-deficient APOBEC3G mutant did not exhibit a slow off rate. We propose that catalytically active monomers or dimers slowly oligomerize on the viral genome and inhibit reverse transcription.

Glutathionylation of the Bacterial Hsp70 Chaperone DnaK Provides a Link between Oxidative Stress and the Heat Shock Response.

PubMed

Zhang, Hong; Yang, Jie; Wu, Si; Gong, Weibin; Chen, Chang; Perrett, Sarah

2016-03-25

DnaK is the major bacterial Hsp70, participating in DNA replication, protein folding, and the stress response. DnaK cooperates with the Hsp40 co-chaperone DnaJ and the nucleotide exchange factor GrpE. Under non-stress conditions, DnaK binds to the heat shock transcription factor σ(32)and facilitates its degradation. Oxidative stress results in temporary inactivation of DnaK due to depletion of cellular ATP and thiol modifications such as glutathionylation until normal cellular ATP levels and a reducing environment are restored. However, the biological significance of DnaK glutathionylation remains unknown, and the mechanisms by which glutathionylation may regulate the activity of DnaK are also unclear. We investigated the conditions under which Escherichia coli DnaK undergoesS-glutathionylation. We observed glutathionylation of DnaK in lysates of E. coli cells that had been subjected to oxidative stress. We also obtained homogeneously glutathionylated DnaK using purified DnaK in the apo state. We found that glutathionylation of DnaK reversibly changes the secondary structure and tertiary conformation, leading to reduced nucleotide and peptide binding ability. The chaperone activity of DnaK was reversibly down-regulated by glutathionylation, accompanying the structural changes. We found that interaction of DnaK with DnaJ, GrpE, or σ(32)becomes weaker when DnaK is glutathionylated, and the interaction is restored upon deglutathionylation. This study confirms that glutathionylation down-regulates the functions of DnaK under oxidizing conditions, and this down-regulation may facilitate release of σ(32)from its interaction with DnaK, thus triggering the heat shock response. Such a mechanism provides a link between oxidative stress and the heat shock response in bacteria. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

Trimeric Association of Hox and TALE Homeodomain Proteins Mediates Hoxb2 Hindbrain Enhancer Activity

PubMed Central

Jacobs, Yakop; Schnabel, Catherine A.; Cleary, Michael L.

1999-01-01

Pbx/exd proteins modulate the DNA binding affinities and specificities of Hox proteins and contribute to the execution of Hox-dependent developmental programs in arthropods and vertebrates. Pbx proteins also stably heterodimerize and bind DNA with Meis and Pknox1-Prep1, additional members of the TALE (three-amino-acid loop extension) superclass of homeodomain proteins that function on common genetic pathways with a subset of Hox proteins. In this study, we demonstrated that Pbx and Meis bind DNA as heterotrimeric complexes with Hoxb1 on a genetically defined Hoxb2 enhancer, r4, that mediates the cross-regulatory transcriptional effects of Hoxb1 in vivo. The DNA binding specificity of the heterotrimeric complex for r4 is mediated by a Pbx-Hox site in conjunction with a distal Meis site, which we showed to be required for ternary complex formation and Meis-enhanced transcription. Formation of heterotrimeric complexes in which all three homeodomains bind their cognate DNA sites is topologically facilitated by the ability of Pbx and Meis to interact through their amino termini and bind DNA without stringent half-site orientation and spacing requirements. Furthermore, Meis site mutation in the Hoxb2 enhancer phenocopies Pbx-Hox site mutation to abrogate enhancer-directed expression of a reporter transgene in the murine embryonic hindbrain, demonstrating that DNA binding by all three proteins is required for trimer function in vivo. Our data provide in vitro and in vivo evidence for the combinatorial regulation of Hox and TALE protein functions that are mediated, in part, by their interdependent DNA binding activities as ternary complexes. As a consequence, Hoxb1 employs Pbx and Meis-related proteins, as a pair of essential cofactors in a higher-order molecular complex, to mediate its transcriptional effects on an endogenous Hox response element. PMID:10373562

Formononetin, a phyto-oestrogen, and its metabolites up-regulate interleukin-4 production in activated T cells via increased AP-1 DNA binding activity

PubMed Central

Park, Jin; Kim, Seung H; Cho, Daeho; Kim, Tae S

2005-01-01

Phyto-oestrogens are polyphenolic non-steroidal plant compounds with oestrogen-like biological activity. Phyto-oestrogens have many biological effects including oestrogen agonist/antagonist properties. However, the effect of phyto-oestrogens on allergic responses remains unclear. In this study we investigated whether formononetin, a phyto-oestrogen, and its metabolites, daidzein and equol, affect production of interleukin-4 (IL-4), a pro-inflammatory cytokine closely associated with allergic immune response, in primary CD4+ T cells and EL4 T lymphoma cells. Formononetin, daidzein and equol significantly enhanced IL-4 production from both CD4+ T cells and EL4 cells in a dose-dependent manner. Formononetin, daidzein and equol also enhanced IL-4 gene promoter activity in EL4 cells transiently transfected with IL-4 gene promoter constructs, but this effect was impaired in EL4 cells transfected with an IL-4 promoter construct deleted of P4 site carrying nuclear factor of activated T cells (NF-AT) and activator protein-1 (AP-1) binding sites. In addition, formononetin, daidzein and equol increased AP-1 DNA binding activities while did not affect NF-AT DNA binding activities. The enhancing effects on IL-4 production and AP-1 DNA binding activities were abrogated by specific inhibitors for phosphatidylinositol-3-kinase (PI3K), protein kinase C (PKC) and p38 mitogen-activated protein kinase (MAPK), indicating that formononetin, daidzein and equol might enhance IL-4 production by increased activation of AP-1 through the PI3-K/PKC/p38 MAPK signalling pathway. These results suggest that phyto-oestrogens and some of their metabolites may increase allergic responses via the enhancement of IL-4 production in T cells. PMID:16108819

Chk1 Promotes DNA Damage Response Bypass following Oxidative Stress in a Model of Hydrogen Peroxide-Associated Ulcerative Colitis through JNK Inactivation and Chromatin Binding

PubMed Central

Silver, Andrew; Guenther, Thomas; Siedentopf, Sandra; Ross, Jochen; Vo, Diep-Khanh; Roessner, Albert

2017-01-01

Dysregulation of c-Jun N-terminal kinase (JNK) activation promoted DNA damage response bypass and tumorigenesis in our model of hydrogen peroxide-associated ulcerative colitis (UC) and in patients with quiescent UC (QUC), UC-related dysplasia, and UC-related carcinoma (UC-CRC), thereby adapting to oxidative stress. In the UC model, we have observed features of oncogenic transformation: increased proliferation, undetected DNA damage, and apoptosis resistance. Here, we show that Chk1 was downregulated but activated in the acute and quiescent chronic phases. In both phases, Chk1 was linked to DNA damage response bypass by suppressing JNK activation following oxidative stress, promoting cell cycle progression despite DNA damage. Simultaneously, activated Chk1 was bound to chromatin. This triggered histone acetylation and the binding of histone acetyltransferases and transcription factors to chromatin. Thus, chromatin-immobilized activated Chk1 executed a dual function by suppressing DNA damage response and simultaneously inducing chromatin modulation. This caused undetected DNA damage and increased cellular proliferation through failure to transmit the appropriate DNA damage signal. Findings in vitro were corroborated by chromatin accumulation of activated Chk1, Ac-H3, Ac-H4, and c-Jun in active UC (AUC) in vivo. Targeting chromatin-bound Chk1, GCN5, PCAF, and p300/CBP could be a novel therapeutic strategy to prevent UC-related tumor progression. PMID:28751935

Asymmetric binding of histone H1 stabilizes MMTV nucleosomes and the interaction of progesterone receptor with the exposed HRE.

PubMed

Vicent, Guillermo P; Meliá, María J; Beato, Miguel

2002-11-29

Packaging of mouse mammary tumor virus (MMTV) promoter sequences in nucleosomes modulates access of DNA binding proteins and influences the interaction among DNA bound transcription factors. Here we analyze the binding of histone H1 to MMTV mononucleosomes assembled with recombinant histones and study its influence on nucleosome structure and stability as well as on progesterone receptor (PR) binding to the hormone responsive elements (HREs). The MMTV nucleosomes can be separated into three main populations, two of which exhibited precise translational positioning. Histone H1 bound preferentially to the 5' distal nucleosomal DNA protecting additional 27-28 nt from digestion by micrococcal nuclease. Binding of histone H1 was unaffected by prior crosslinking of protein and DNA in nucleosomes with formaldehyde. Neither the translational nor the rotational nucleosome positioning was altered by histone H1 binding, but the nucleosomes were stabilized as judged by the kinetics of nuclease cleavage. Unexpectedly, binding of recombinant PR to the exposed distal HRE-I in nucleosomes was enhanced in the presence of histone H1, as demonstrated by band shift and footprinting experiments. This enhanced PR affinity may contribute to the reported positive effect of histone H1 on the hormonal activation of MMTV reporter genes.

ATM activation and its recruitment to damaged DNA require binding to the C terminus of Nbs1.

PubMed

You, Zhongsheng; Chahwan, Charly; Bailis, Julie; Hunter, Tony; Russell, Paul

2005-07-01

ATM has a central role in controlling the cellular responses to DNA damage. It and other phosphoinositide 3-kinase-related kinases (PIKKs) have giant helical HEAT repeat domains in their amino-terminal regions. The functions of these domains in PIKKs are not well understood. ATM activation in response to DNA damage appears to be regulated by the Mre11-Rad50-Nbs1 (MRN) complex, although the exact functional relationship between the MRN complex and ATM is uncertain. Here we show that two pairs of HEAT repeats in fission yeast ATM (Tel1) interact with an FXF/Y motif at the C terminus of Nbs1. This interaction resembles nucleoporin FXFG motif binding to HEAT repeats in importin-beta. Budding yeast Nbs1 (Xrs2) appears to have two FXF/Y motifs that interact with Tel1 (ATM). In Xenopus egg extracts, the C terminus of Nbs1 recruits ATM to damaged DNA, where it is subsequently autophosphorylated. This interaction is essential for ATM activation. A C-terminal 147-amino-acid fragment of Nbs1 that has the Mre11- and ATM-binding domains can restore ATM activation in an Nbs1-depleted extract. We conclude that an interaction between specific HEAT repeats in ATM and the C-terminal FXF/Y domain of Nbs1 is essential for ATM activation. We propose that conformational changes in the MRN complex that occur upon binding to damaged DNA are transmitted through the FXF/Y-HEAT interface to activate ATM. This interaction also retains active ATM at sites of DNA damage.

Electrostatic field of the large fragment of Escherichia coli DNA polymerase I.

PubMed

Warwicker, J; Ollis, D; Richards, F M; Steitz, T A

1985-12-05

The electrostatic field of the large fragment of Escherichia coli DNA polymerase I (Klenow fragment) has been calculated by the finite difference procedure on a 2 A grid. The potential field is substantially negative at physiological pH (reflecting the net negative charge at this pH). The largest regions of positive potential are in the deep crevice of the C-terminal domain, which is the proposed binding site for the DNA substrate. Within the crevice, the electrostatic potential has a partly helical form. If the DNA is positioned to fulfil stereochemical requirements, then the positive potential generally follows the major groove and (to a lesser extent) the negative potential is in the minor groove. Such an arrangement could stabilize DNA configurations related by screw symmetry. The histidine residues of the Klenow fragment give the positive field of the groove a sensitivity to relatively small pH changes around neutrality. We suggest that the histidine residues could change their ionization states in response to DNA binding, and that this effect could contribute to the protein-DNA binding energy.

RPA and POT1: friends or foes at telomeres?

PubMed

Flynn, Rachel Litman; Chang, Sandy; Zou, Lee

2012-02-15

Telomere maintenance in cycling cells relies on both DNA replication and capping by the protein complex shelterin. Two single-stranded DNA (ssDNA)-binding proteins, replication protein A (RPA) and protection of telomere 1 (POT1) play critical roles in DNA replication and telomere capping, respectively. While RPA binds to ssDNA in a non-sequence-specific manner, POT1 specifically recognizes singlestranded TTAGGG telomeric repeats. Loss of POT1 leads to aberrant accumulation of RPA at telomeres and activation of the ataxia telangiectasia and Rad3-related kinase (ATR)-mediated checkpoint response, suggesting that POT1 antagonizes RPA binding to telomeric ssDNA. The requirement for both POT1 and RPA in telomere maintenance and the antagonism between the two proteins raises the important question of how they function in concert on telomeric ssDNA. Two interesting models were proposed by recent studies to explain the regulation of POT1 and RPA at telomeres. Here, we discuss how these models help unravel the coordination, and also the antagonism, between POT1 and RPA during the cell cycle.

Novel mechanism of gene regulation: the protein Rv1222 of Mycobacterium tuberculosis inhibits transcription by anchoring the RNA polymerase onto DNA.

PubMed

Rudra, Paulami; Prajapati, Ranjit Kumar; Banerjee, Rajdeep; Sengupta, Shreya; Mukhopadhyay, Jayanta

2015-07-13

We propose a novel mechanism of gene regulation in Mycobacterium tuberculosis where the protein Rv1222 inhibits transcription by anchoring RNA polymerase (RNAP) onto DNA. In contrast to our existing knowledge that transcriptional repressors function either by binding to DNA at specific sequences or by binding to RNAP, we show that Rv1222-mediated transcription inhibition requires simultaneous binding of the protein to both RNAP and DNA. We demonstrate that the positively charged C-terminus tail of Rv1222 is responsible for anchoring RNAP on DNA, hence the protein slows down the movement of RNAP along the DNA during transcription elongation. The interaction between Rv1222 and DNA is electrostatic, thus the protein could inhibit transcription from any gene. As Rv1222 slows down the RNA synthesis, upon expression of the protein in Mycobacterium smegmatis or Escherichia coli, the growth rate of the bacteria is severely impaired. The protein does not possess any significant affinity for DNA polymerase, thus, is unable to inhibit DNA synthesis. The proposed mechanism by which Rv1222 inhibits transcription reveals a new repertoire of prokaryotic gene regulation. © Crown copyright 2015.

AmrZ Beta-Sheet Residues Are Essential for DNA Binding and Transcriptional Control of Pseudomonas aeruginosa Virulence Genes ▿ †

PubMed Central

Waligora, Elizabeth A.; Ramsey, Deborah M.; Pryor, Edward E.; Lu, Haiping; Hollis, Thomas; Sloan, Gina P.; Deora, Rajendar; Wozniak, Daniel J.

2010-01-01

AmrZ is a putative ribbon-helix-helix (RHH) transcriptional regulator. RHH proteins utilize residues within the β-sheet for DNA binding, while the α-helices promote oligomerization. AmrZ is of interest due to its dual roles as a transcriptional activator and as a repressor, regulating genes encoding virulence factors associated with both chronic and acute Pseudomonas aeruginosa infection. In this study, cross-linking revealed that AmrZ forms oligomers in solution but that the amino terminus, containing an unordered region and a β-sheet, were not required for oligomerization. The first 12 unordered residues (extended amino terminus) contributed minimally to DNA binding. Mutagenesis of the AmrZ β-sheet demonstrated that residues 18, 20, and 22 were essential for DNA binding at both activation and repressor sites, suggesting that AmrZ utilizes a similar mechanism for binding to these sites. Mice infected with amrZ mutants exhibited reduced bacterial burden, morbidity, and mortality. Direct in vivo competition assays showed a 5-fold competitive advantage for the wild type over an isogenic amrZ mutant. Finally, the reduced infection phenotype of the amrZ-null strain was similar to that of a strain expressing a DNA-binding-deficient AmrZ variant, indicating that DNA binding and transcriptional regulation by AmrZ is responsible for the in vivo virulence defect. These recent infection data, along with previously identified AmrZ-regulated virulence factors, suggest the necessity of AmrZ transcriptional regulation for optimal virulence during acute infection. PMID:20709902

Genomic Heat Shock Element Sequences Drive Cooperative Human Heat Shock Factor 1 DNA Binding and Selectivity*

PubMed Central

Jaeger, Alex M.; Makley, Leah N.; Gestwicki, Jason E.; Thiele, Dennis J.

2014-01-01

The heat shock transcription factor 1 (HSF1) activates expression of a variety of genes involved in cell survival, including protein chaperones, the protein degradation machinery, anti-apoptotic proteins, and transcription factors. Although HSF1 activation has been linked to amelioration of neurodegenerative disease, cancer cells exhibit a dependence on HSF1 for survival. Indeed, HSF1 drives a program of gene expression in cancer cells that is distinct from that activated in response to proteotoxic stress, and HSF1 DNA binding activity is elevated in cycling cells as compared with arrested cells. Active HSF1 homotrimerizes and binds to a DNA sequence consisting of inverted repeats of the pentameric sequence nGAAn, known as heat shock elements (HSEs). Recent comprehensive ChIP-seq experiments demonstrated that the architecture of HSEs is very diverse in the human genome, with deviations from the consensus sequence in the spacing, orientation, and extent of HSE repeats that could influence HSF1 DNA binding efficacy and the kinetics and magnitude of target gene expression. To understand the mechanisms that dictate binding specificity, HSF1 was purified as either a monomer or trimer and used to evaluate DNA-binding site preferences in vitro using fluorescence polarization and thermal denaturation profiling. These results were compared with quantitative chromatin immunoprecipitation assays in vivo. We demonstrate a role for specific orientations of extended HSE sequences in driving preferential HSF1 DNA binding to target loci in vivo. These studies provide a biochemical basis for understanding differential HSF1 target gene recognition and transcription in neurodegenerative disease and in cancer. PMID:25204655

Azadirachtin interacts with retinoic acid receptors and inhibits retinoic acid-mediated biological responses.

PubMed

Thoh, Maikho; Babajan, Banaganapalli; Raghavendra, Pongali B; Sureshkumar, Chitta; Manna, Sunil K

2011-02-11

Considering the role of retinoids in regulation of more than 500 genes involved in cell cycle and growth arrest, a detailed understanding of the mechanism and its regulation is useful for therapy. The extract of the medicinal plant Neem (Azadirachta indica) is used against several ailments especially for anti-inflammatory, anti-itching, spermicidal, anticancer, and insecticidal activities. In this report we prove the detailed mechanism on the regulation of retinoic acid-mediated cell signaling by azadirachtin, active components of neem extract. Azadirachtin repressed all trans-retinoic acid (ATRA)-mediated nuclear transcription factor κB (NF-κB) activation, not the DNA binding but the NF-κB-dependent gene expression. It did not inhibit IκBα degradation, IκBα kinase activity, or p65 phosphorylation and its nuclear translocation but inhibited NF-κB-dependent reporter gene expression. Azadirachtin inhibited TRAF6-mediated, but not TRAF2-mediated NF-κB activation. It inhibited ATRA-induced Sp1 and CREB (cAMP-response element-binding protein) DNA binding. Azadirachtin inhibited ATRA binding with retinoid receptors, which is supported by biochemical and in silico evidences. Azadirachtin showed strong interaction with retinoid receptors. It suppressed ATRA-mediated removal of retinoid receptors, bound with DNA by inhibiting ATRA binding to its receptors. Overall, our data suggest that azadirachtin interacts with retinoic acid receptors and suppresses ATRA binding, inhibits falling off the receptors, and activates transcription factors like CREB, Sp1, NF-κB, etc. Thus, azadirachtin exerts anti-inflammatory and anti-metastatic responses by a novel pathway that would be beneficial for further anti-inflammatory and anti-cancer therapies.

Thermodynamic and structural insights into CSL-DNA complexes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Friedmann, David R.; Kovall, Rhett A.

The Notch pathway is an intercellular signaling mechanism that plays important roles in cell fates decisions throughout the developing and adult organism. Extracellular complexation of Notch receptors with ligands ultimately results in changes in gene expression, which is regulated by the nuclear effector of the pathway, CSL (C-promoter binding factor 1 (CBF-1), suppressor of hairless (Su(H)), lin-12 and glp-1 (Lag-1)). CSL is a DNA binding protein that is involved in both repression and activation of transcription from genes that are responsive to Notch signaling. One well-characterized Notch target gene is hairy and enhancer of split-1 (HES-1), which is regulated bymore » a promoter element consisting of two CSL binding sites oriented in a head-to-head arrangement. Although previous studies have identified in vivo and consensus binding sites for CSL, and crystal structures of these complexes have been determined, to date, a quantitative description of the energetics that underlie CSL-DNA binding is unknown. Here, we provide a thermodynamic and structural analysis of the interaction between CSL and the two individual sites that comprise the HES-1 promoter element. Our comprehensive studies that analyze binding as a function of temperature, salt, and pH reveal moderate, but distinct, differences in the affinities of CSL for the two HES-1 binding sites. Similarly, our structural results indicate that overall CSL binds both DNA sites in a similar manner; however, minor changes are observed in both the conformation of CSL and DNA. Taken together, our results provide a quantitative and biophysical basis for understanding how CSL interacts with DNA sites in vivo.« less

DNA Replication Arrest and DNA Damage Responses Induced by Alkylating Minor Groove Binders

DTIC Science & Technology

2003-05-01

Alkylating minor groove DNA binder adozelesin is capable of inhibiting DNA replication in treated cells through a trans-acting mechanism. The trans... replication in vitro. Using purified proteins in DNA replication initiation assays, we found that RPA purified from cells treated with adozelesin in not...adozelesin has the same single-stranded DNA binding activity and support nucleotide excision repair as normal RPA, but is not able to support SV40 DNA

Urate is a ligand for the transcriptional regulator PecS.

PubMed

Perera, Inoka C; Grove, Anne

2010-09-24

PecS is a member of the MarR (multiple antibiotic resistance regulator) family, which has been shown in Erwinia to regulate the expression of virulence genes. MarR homologs typically bind a small molecule ligand, resulting in attenuated DNA binding. For PecS, the natural ligand has not been identified. We have previously shown that urate is a ligand for the Deinococcus radiodurans-encoded MarR homolog HucR (hypothetical uricase regulator) and identified residues responsible for ligand binding. We show here that all four residues involved in urate binding and propagation of conformational changes to DNA recognition helices are conserved in PecS homologs, suggesting that urate is the ligand for PecS. Consistent with this prediction, Agrobacterium tumefaciens PecS specifically binds urate, and urate attenuates DNA binding in vitro. PecS binds two operator sites in the intergenic region between the divergent pecS gene and pecM genes, one of which features two partially overlapping repeats to which PecS binds as a dimer on opposite faces of the duplex. Notably, urate dissociates PecS from cognate DNA, allowing transcription of both genes in vivo. Taken together, our data show that urate is a ligand for PecS and suggest that urate serves a novel function in signaling the colonization of a host plant. Copyright © 2010 Elsevier Ltd. All rights reserved.

Differences in the Mechanism of the Allosteric L-Rhamnose Responses of the AraC/XylS Family Transcription Activators RhaS and RhaR

PubMed Central

Kolin, Ana; Balasubramaniam, Vinitha; Skredenske, Jeff; Wickstrum, Jason; Egan, Susan M.

2008-01-01

SUMMARY Proteins in the largest subset of AraC/XylS family transcription activators, including RhaS and RhaR, have C-terminal domains (CTDs) that mediate DNA-binding and transcription activation, and N-terminal domains (NTDs) that mediate dimerization and effector binding. The mechanism of the allosteric effector response in this family has been identified only for AraC. Here, we investigated the mechanism by which RhaS and RhaR respond to their effector, L-rhamnose. Unlike AraC, N-terminal truncations suggested that RhaS and RhaR don’t use an N-terminal arm to inhibit activity in the absence of effector. We used random mutagenesis to isolate RhaS and RhaR variants with enhanced activation in the absence of L-rhamnose. NTD substitutions largely clustered around the predicted L-rhamnose-binding pockets, suggesting that they mimic the structural outcome of effector binding to the wild-type proteins. RhaS-CTD substitutions clustered in the first HTH motif, and suggested that L-rhamnose induces improved DNA binding. In contrast, RhaR-CTD substitutions clustered at a single residue in the second HTH motif, at a position consistent with improved RNAP contacts. We propose separate allosteric mechanisms for the two proteins: Without L-rhamnose, RhaS doesn’t effectively bind DNA while RhaR doesn’t effectively contact RNAP. Upon L-rhamnose binding, both proteins undergo structural changes that enable transcription activation. PMID:18366439

The natural absence of RPA1N domain did not impair Leishmania amazonensis RPA-1 participation in DNA damage response and telomere protection.

PubMed

Da Silveira, Rita De Cássia Viveiros; Da Silva, Marcelo Santos; Nunes, Vinícius Santana; Perez, Arina Marina; Cano, Maria Isabel Nogueira

2013-04-01

We have previously shown that the subunit 1 of Leishmania amazonensis RPA (LaRPA-1) alone binds the G-rich telomeric strand and is structurally different from other RPA-1. It is analogous to telomere end-binding proteins described in model eukaryotes whose homologues were not identified in the protozoan´s genome. Here we show that LaRPA-1 is involved with damage response and telomere protection although it lacks the RPA1N domain involved with the binding with multiple checkpoint proteins. We induced DNA double-strand breaks (DSBs) in Leishmania using phleomycin. Damage was confirmed by TUNEL-positive nuclei and triggered a G1/S cell cycle arrest that was accompanied by nuclear accumulation of LaRPA-1 and RAD51 in the S phase of hydroxyurea-synchronized parasites. DSBs also increased the levels of RAD51 in non-synchronized parasites and of LaRPA-1 and RAD51 in the S phase of synchronized cells. More LaRPA-1 appeared immunoprecipitating telomeres in vivo and associated in a complex containing RAD51, although this interaction needs more investigation. RAD51 apparently co-localized with few telomeric clusters but it did not immunoprecipitate telomeric DNA. These findings suggest that LaRPA-1 and RAD51 work together in response to DNA DSBs and at telomeres, upon damage, LaRPA-1 works probably to prevent loss of single-stranded DNA and to assume a capping function.

NLRC3, a member of the NLR family of proteins, is a negative regulator of innate immune signaling induced by the DNA sensor STING

PubMed Central

Zhang, Lu; Mo, Jinyao; Swanson, Karen V.; Wen, Haitao; Petrucelli, Alex; Gregory, Sean M.; Zhang, Zhigang; Schneider, Monika; Jiang, Yan; Fitzgerald, Katherine A.; Ouyang, Songying; Liu, Zhi-Jie; Damania, Blossom A; Shu, Hong-Bing; Duncan, Joseph A.; Ting, Jenny P-Y.

2014-01-01

SUMMARY Stimulator of interferon genes (STING, also named MITA, MYPS or ERIS) is an intracellular DNA sensor that induces type I interferon through its interaction with TANK-binding kinase 1 (TBK1). Here we found that the nucleotide-binding, leucine-rich repeat containing protein, NLRC3, reduced STING-dependent innate immune activation in response to cytosolic DNA, cyclic di-GMP (c-di-GMP) and DNA viruses. NLRC3 associated with both STING and TBK1, and impeded STING-TBK1 interaction and downstream type I interferon production. Using purified recombinant proteins NLRC3 was found to interact directly with STING. Furthermore, NLRC3 prevented proper trafficking of STING to perinuclear and punctated region, known to be important for its activation. In animals, herpes simplex virus 1 (HSV-1)-infected Nlrc3−/− mice exhibited enhanced innate immunity, reduced morbidity and viral load. This demonstrates the intersection of two key pathways of innate immune regulation, NLR and STING, to fine tune host response to intracellular DNA, DNA virus and c-di-GMP PMID:24560620

Experimental design, modeling and optimization of polyplex formation between DNA oligonucleotides and branched polyethylenimine.

PubMed

Clima, Lilia; Ursu, Elena L; Cojocaru, Corneliu; Rotaru, Alexandru; Barboiu, Mihail; Pinteala, Mariana

2015-09-28

The complexes formed by DNA and polycations have received great attention owing to their potential application in gene therapy. In this study, the binding efficiency between double-stranded oligonucleotides (dsDNA) and branched polyethylenimine (B-PEI) has been quantified by processing of the images captured from the gel electrophoresis assays. The central composite experimental design has been employed to investigate the effects of controllable factors on the binding efficiency. On the basis of experimental data and the response surface methodology, a multivariate regression model has been constructed and statistically validated. The model has enabled us to predict the binding efficiency depending on experimental factors, such as concentrations of dsDNA and B-PEI as well as the initial pH of solution. The optimization of the binding process has been performed using simplex and gradient methods. The optimal conditions determined for polyplex formation have yielded a maximal binding efficiency close to 100%. In order to reveal the mechanism of complex formation at the atomic-scale, a molecular dynamic simulation has been carried out. According to the computation results, B-PEI amine hydrogen atoms have interacted with oxygen atoms from dsDNA phosphate groups. These interactions have led to the formation of hydrogen bonds between macromolecules, stabilizing the polyplex structure.

The increasing diversity of functions attributed to the SAFB family of RNA-/DNA-binding proteins.

PubMed

Norman, Michael; Rivers, Caroline; Lee, Youn-Bok; Idris, Jalilah; Uney, James

2016-12-01

RNA-binding proteins play a central role in cellular metabolism by orchestrating the complex interactions of coding, structural and regulatory RNA species. The SAFB (scaffold attachment factor B) proteins (SAFB1, SAFB2 and SAFB-like transcriptional modulator, SLTM), which are highly conserved evolutionarily, were first identified on the basis of their ability to bind scaffold attachment region DNA elements, but attention has subsequently shifted to their RNA-binding and protein-protein interactions. Initial studies identified the involvement of these proteins in the cellular stress response and other aspects of gene regulation. More recently, the multifunctional capabilities of SAFB proteins have shown that they play crucial roles in DNA repair, processing of mRNA and regulatory RNA, as well as in interaction with chromatin-modifying complexes. With the advent of new techniques for identifying RNA-binding sites, enumeration of individual RNA targets has now begun. This review aims to summarise what is currently known about the functions of SAFB proteins. © 2016 The Author(s).

Estrogen receptor accessory proteins augment receptor-DNA interaction and DNA bending.

PubMed

Landel, C C; Potthoff, S J; Nardulli, A M; Kushner, P J; Greene, G L

1997-01-01

Increasing evidence suggests that accessory proteins play an important role in the ability of the estrogen receptor (ER) and other nuclear hormone receptors to modulate transcription when bound to cis-acting hormone response elements in target genes. We have previously shown that four proteins, hsp70, protein disulfide isomerase (PDI) and two unknown proteins (p48 and p45), copurify with ER that has been isolated by site-specific DNA chromatography (BERE) and influence the interaction of ER with DNA in vitro. To better define the nature of these effects, we used filter binding and electrophoretic mobility shift assays to study the ability of these proteins to alter the kinetics of ER-DNA interaction and to influence the ability of ER to bend DNA when bound to an estrogen response element (ERE). The results of both assays indicate that ERE-purified ER, with its four associated proteins (hsp70, PDI, p48, p45), has a greater ability to bind to the vitellogenin A2 ERE than ER purified by estradiol-Sepharose chromatography in the absence (ESeph) or presence (EATP) of ATP, in which p48, p45 (ESeph) and hsp70 (EATP) are removed. Surprisingly, the rates of association and dissociation of ER and ERE were essentially the same for all three mixtures, suggesting that one or more ER-associated proteins, especially p45 and p48, may be required for ER to attain maximum DNA binding activity. In addition, circular permutation and phasing analyses demonstrated that the same ER-associated proteins produced higher order ER-DNA complexes that significantly increased the magnitude of DNA distortion, but did not alter the direction of the ER-induced bend of ERE-containing DNA fragments, which was toward the major groove of the DNA helix. These results suggest that p45 and/or p48 and possibly hsp70, play an important role both in the specific DNA binding and bending activities of ER and thus contribute to the overall stimulation of transcription in target genes that contain cis-acting EREs.

Chemical Screens Against A Reconstituted Multi-Protein Complex: Myricetin Blocks DnaJ Regulation of DnaK through an Allosteric Mechanism

PubMed Central

Chang, Lyra; Miyata, Yoshinari; Ung, Peter M. U.; Bertelsen, Eric B.; McQuade, Thomas J.; Carlson, Heather A.; Zuiderweg, Erik R. P.; Gestwicki, Jason E.

2011-01-01

SUMMARY DnaK is a molecular chaperone responsible for multiple aspects of proteostasis. The intrinsically slow ATPase activity of DnaK is stimulated by its co-chaperone, DnaJ, and these proteins often work in concert. To identify inhibitors, we screened plant-derived extracts against a re-constituted mixture of DnaK and DnaJ. This approach resulted in the identification of flavonoids, including myricetin, which inhibited activity by up to 75%. Interestingly, myricetin prevented DnaJ-mediated stimulation of ATPase activity, with minimal impact on either DnaK’s intrinsic turnover rate or its stimulation by another co-chaperone, GrpE. Using NMR, we found that myricetin binds DnaK at an unanticipated site between the IB and IIB subdomains and that it allosterically blocked binding of DnaJ. Together, these results highlight a “gray box” screening approach, which approximates a limited amount of the complexity expected in physiological, multi-protein systems. PMID:21338918

Transcription and DNA Damage: Holding Hands or Crossing Swords?

PubMed

D'Alessandro, Giuseppina; d'Adda di Fagagna, Fabrizio

2017-10-27

Transcription has classically been considered a potential threat to genome integrity. Collision between transcription and DNA replication machinery, and retention of DNA:RNA hybrids, may result in genome instability. On the other hand, it has been proposed that active genes repair faster and preferentially via homologous recombination. Moreover, while canonical transcription is inhibited in the proximity of DNA double-strand breaks, a growing body of evidence supports active non-canonical transcription at DNA damage sites. Small non-coding RNAs accumulate at DNA double-strand break sites in mammals and other organisms, and are involved in DNA damage signaling and repair. Furthermore, RNA binding proteins are recruited to DNA damage sites and participate in the DNA damage response. Here, we discuss the impact of transcription on genome stability, the role of RNA binding proteins at DNA damage sites, and the function of small non-coding RNAs generated upon damage in the signaling and repair of DNA lesions. Copyright © 2016 Elsevier Ltd. All rights reserved.

A systematic analysis of factors localized to damaged chromatin reveals PARP-dependent recruitment of transcription factors

PubMed Central

Izhar, Lior; Adamson, Britt; Ciccia, Alberto; Lewis, Jedd; Pontano-Vaites, Laura; Leng, Yumei; Liang, Anthony C.; Westbrook, Thomas F.; Harper, J. Wade; Elledge, Stephen J.

2015-01-01

Localization to sites of DNA damage is a hallmark of DNA damage response (DDR) proteins. To identify new DDR factors, we screened epitope-tagged proteins for localization to sites of chromatin damaged by UV laser microirradiation and found >120 proteins that localize to damaged chromatin. These include the BAF tumor suppressor complex and the ALS candidate protein TAF15. TAF15 contains multiple domains that bind damaged chromatin in a PARP-dependent manner, suggesting a possible role as glue that tethers multiple PAR chains together. Many positives were transcription factors and >70% of randomly tested transcription factors localized to sites of DNA damage and approximately 90% were PARP-dependent for localization. Mutational analyses showed that localization to damaged chromatin is DNA-binding domain-dependent. By examining Hoechst staining patterns at damage sites, we see evidence of chromatin decompaction that is PARP-dependent. We propose that PARP-regulated chromatin remodeling at sites of damage allows transient accessibility of DNA-binding proteins. PMID:26004182

Strip biosensor for amplified detection of nerve growth factor-beta based on a molecular translator and catalytic DNA circuit.

PubMed

Liu, Jun; Lai, Ting; Mu, Kejie; Zhou, Zheng

2014-10-07

We have demonstrated a new visual detection approach based on a molecular translator and a catalytic DNA circuit for the detection of nerve growth factor-beta (NGF-β). In this assay, a molecular translator based on the binding-induced DNA strand-displacement reaction was employed to convert the input protein to an output DNA signal. The molecular translator is composed of a target recognition element and a signal output element. Target recognition is achieved by the binding of the anti-NGF-β antibody to the target protein. Polyclonal anti-NGF-β antibody is conjugated to DNA1 and DNA2. The antibody conjugated DNA1 is initially hybridized to DNA3 to form a stable DNA1/DNA3 duplex. In the presence of NGF-β, the binding of the same target protein brings DNA1 and DNA2 into close proximity, resulting in an increase in their local effective concentration. This process triggers the strand-displacement reaction between DNA2 and DNA3 and releases the output DNA3. The released DNA3 is further amplified by a catalytic DNA circuit. The product of the catalytic DNA circuit is detected by a strip biosensor. This proposed assay has high sensitivity and selectivity with a dynamic response ranging from 10 fM to 10 pM, and its detection limit is 10 fM of NGF-β. This work provides a sensitive, enzyme-free, and universal strategy for the detection of other proteins.

ATM Protein Physically and Functionally Interacts with Proliferating Cell Nuclear Antigen to Regulate DNA Synthesis*

PubMed Central

Gamper, Armin M.; Choi, Serah; Matsumoto, Yoshihiro; Banerjee, Dibyendu; Tomkinson, Alan E.; Bakkenist, Christopher J.

2012-01-01

Ataxia telangiectasia (A-T) is a pleiotropic disease, with a characteristic hypersensitivity to ionizing radiation that is caused by biallelic mutations in A-T mutated (ATM), a gene encoding a protein kinase critical for the induction of cellular responses to DNA damage, particularly to DNA double strand breaks. A long known characteristic of A-T cells is their ability to synthesize DNA even in the presence of ionizing radiation-induced DNA damage, a phenomenon termed radioresistant DNA synthesis. We previously reported that ATM kinase inhibition, but not ATM protein disruption, blocks sister chromatid exchange following DNA damage. We now show that ATM kinase inhibition, but not ATM protein disruption, also inhibits DNA synthesis. Investigating a potential physical interaction of ATM with the DNA replication machinery, we found that ATM co-precipitates with proliferating cell nuclear antigen (PCNA) from cellular extracts. Using bacterially purified ATM truncation mutants and in vitro translated PCNA, we showed that the interaction is direct and mediated by the C terminus of ATM. Indeed, a 20-amino acid region close to the kinase domain is sufficient for strong binding to PCNA. This binding is specific to ATM, because the homologous regions of other PIKK members, including the closely related kinase A-T and Rad3-related (ATR), did not bind PCNA. ATM was found to bind two regions in PCNA. To examine the functional significance of the interaction between ATM and PCNA, we tested the ability of ATM to stimulate DNA synthesis by DNA polymerase δ, which is implicated in both DNA replication and DNA repair processes. ATM was observed to stimulate DNA polymerase activity in a PCNA-dependent manner. PMID:22362778

Controlling the response to DNA damage by the APC/C-Cdh1.

PubMed

de Boer, H Rudolf; Guerrero Llobet, S; van Vugt, Marcel A T M

2016-03-01

Proper cell cycle progression is safeguarded by the oscillating activities of cyclin/cyclin-dependent kinase complexes. An important player in the regulation of mitotic cyclins is the anaphase-promoting complex/cyclosome (APC/C), a multi-subunit E3 ubiquitin ligase. Prior to entry into mitosis, the APC/C remains inactive, which allows the accumulation of mitotic regulators. APC/C activation requires binding to either the Cdc20 or Cdh1 adaptor protein, which sequentially bind the APC/C and facilitate targeting of multiple mitotic regulators for proteasomal destruction, including Securin and Cyclin B, to ensure proper chromosome segregation and mitotic exit. Emerging data have indicated that the APC/C, particularly in association with Cdh1, also functions prior to mitotic entry. Specifically, the APC/C-Cdh1 is activated in response to DNA damage in G2 phase cells. These observations are in line with in vitro and in vivo genetic studies, in which cells lacking Cdh1 expression display various defects, including impaired DNA repair and aberrant cell cycle checkpoints. In this review, we summarize the current literature on APC/C regulation in response to DNA damage, the functions of APC/C-Cdh1 activation upon DNA damage, and speculate how APC/C-Cdh1 can control cell fate in the context of persistent DNA damage.

The RNA-binding proteins Zfp36l1 and Zfp36l2 enforce the thymic β-selection checkpoint by limiting DNA damage response signaling and cell cycle progression

PubMed Central

Galloway, Alison; Ahlfors, Helena; Turner, Martin

2016-01-01

The RNA binding proteins Zfp36l1 and Zfp36l2 act redundantly to enforce the β-selection checkpoint during thymopoiesis, yet their molecular targets remain largely unknown. Here, we identify these targets on a genome wide scale in primary mouse thymocytes and show that Zfp36l1/l2 regulate DNA damage response and cell cycle transcripts to ensure proper β-selection. DN3 thymocytes lacking Zfp36l1/l2 share a gene expression profile with post-selected DN3b cells despite the absence of intracellular TCRβ and reduced IL-7 signaling. Our findings show that in addition to controlling the timing of proliferation at β-selection post-transcriptional control by Zfp36l1/l2 limits DNA damage responses which are known to promote thymocyte differentiation. Zfp36l1/l2 therefore act as post-transcriptional safeguards against chromosomal instability and replication stress by integrating pre-TCR and IL-7 signaling with DNA damage and cell cycle control. PMID:27566829

Rhodium metalloinsertor binding generates a lesion with selective cytotoxicity for mismatch repair-deficient cells.

PubMed

Bailis, Julie M; Weidmann, Alyson G; Mariano, Natalie F; Barton, Jacqueline K

2017-07-03

The DNA mismatch repair (MMR) pathway recognizes and repairs errors in base pairing and acts to maintain genome stability. Cancers that have lost MMR function are common and comprise an important clinical subtype that is resistant to many standard of care chemotherapeutics such as cisplatin. We have identified a family of rhodium metalloinsertors that bind DNA mismatches with high specificity and are preferentially cytotoxic to MMR-deficient cells. Here, we characterize the cellular mechanism of action of the most potent and selective complex in this family, [Rh(chrysi)(phen)(PPO)] 2+ (Rh-PPO). We find that Rh-PPO binding induces a lesion that triggers the DNA damage response (DDR). DDR activation results in cell-cycle blockade and inhibition of DNA replication and transcription. Significantly, the lesion induced by Rh-PPO is not repaired in MMR-deficient cells, resulting in selective cytotoxicity. The Rh-PPO mechanism is reminiscent of DNA repair enzymes that displace mismatched bases, and is differentiated from other DNA-targeted chemotherapeutics such as cisplatin by its potency, cellular mechanism, and selectivity for MMR-deficient cells.

SOX9 is targeted for proteasomal degradation by the E3 ligase FBW7 in response to DNA damage

PubMed Central

Hong, Xuehui; Liu, Wenyu; Song, Ruipeng; Shah, Jamie J.; Feng, Xing; Tsang, Chi Kwan; Morgan, Katherine M.; Bunting, Samuel F.; Inuzuka, Hiroyuki; Zheng, X. F. Steven; Shen, Zhiyuan; Sabaawy, Hatem E.; Liu, LianXin; Pine, Sharon R.

2016-01-01

SOX9 encodes a transcription factor that governs cell fate specification throughout development and tissue homeostasis. Elevated SOX9 is implicated in the genesis and progression of human tumors by increasing cell proliferation and epithelial-mesenchymal transition. We found that in response to UV irradiation or genotoxic chemotherapeutics, SOX9 is actively degraded in various cancer types and in normal epithelial cells, through a pathway independent of p53, ATM, ATR and DNA-PK. SOX9 is phosphorylated by GSK3β, facilitating the binding of SOX9 to the F-box protein FBW7α, an E3 ligase that functions in the DNA damage response pathway. The binding of FBW7α to the SOX9 K2 domain at T236-T240 targets SOX9 for subsequent ubiquitination and proteasomal destruction. Exogenous overexpression of SOX9 after genotoxic stress increases cell survival. Our findings reveal a novel regulatory mechanism for SOX9 stability and uncover a unique function of SOX9 in the cellular response to DNA damage. This new mechanism underlying a FBW7-SOX9 axis in cancer could have implications in therapy resistance. PMID:27566146

Specific DNA binding of a potential transcriptional regulator, inosine 5'-monophosphate dehydrogenase-related protein VII, to the promoter region of a methyl coenzyme m reductase I-encoding operon retrieved from Methanothermobacter thermautotrophicus strain DeltaH.

PubMed

Shinzato, Naoya; Enoki, Miho; Sato, Hiroaki; Nakamura, Kohei; Matsui, Toru; Kamagata, Yoichi

2008-10-01

Two methyl coenzyme M reductases (MCRs) encoded by the mcr and mrt operons of the hydrogenotrophic methanogen Methanothermobacter thermautotrophicus DeltaH are expressed in response to H(2) availability. In the present study, cis elements and trans-acting factors responsible for the gene expression of MCRs were investigated by using electrophoretic mobility shift assay (EMSA) and affinity particle purification. A survey of their operator regions by EMSA with protein extracts from mrt-expressing cultures restricted them to 46- and 41-bp-long mcr and mrt upstream regions, respectively. Affinity particle purification of DNA-binding proteins conjugated with putative operator regions resulted in the retrieval of a protein attributed to IMP dehydrogenase-related protein VII (IMPDH VII). IMPDH VII is predicted to have a winged helix-turn-helix DNA-binding motif and two cystathionine beta-synthase domains, and it has been suspected to be an energy-sensing module. EMSA with oligonucleotide probes with unusual sequences showed that the binding site of IMPDH VII mostly overlaps the factor B-responsible element-TATA box of the mcr operon. The results presented here suggest that IMPDH VII encoded by MTH126 is a plausible candidate for the transcriptional regulator of the mcr operon in this methanogen.

Investigations of vibrational spectra and bioactivity of novel anticancer drug N-(6-ferrocenyl-2-naphthoyl)-gamma-amino butyric acid ethyl ester

NASA Astrophysics Data System (ADS)

Sudhi, Geethu; Rajina, S. R.; Praveen, S. G.; Xavier, T. S.; Kenny, Peter T. M.; Jaiswal-Nagar, D.; Binoy, J.

2017-10-01

The bioactivity of compounds is mainly dependent on molecular structure and the present work aims to explore the bonding features responsible for biological activity of novel anticancer drug N-(6-ferrocenyl-2-naphthoyl)-gamma-amino butyric acid ethyl ester (FNGABEE). In the present study, we investigate the molecular structural properties of newly synthesized title compound through experimental and quantum chemical studies. The detailed vibrational analysis has been performed using FT IR and FT Raman spectrum, aided by DFT computed geometry, vibrational spectrum, Eigen vector distribution and PED, at B3LYP/6-311 ++G(d,p) level. The resonance structure of naphthalene, different from that of benzene, revealed by molecular structure has been investigated using Csbnd C and Cdbnd C stretching modes. The proton transfer in amide has been analyzed to obtain spectral distinction between different carbonyl and Csbnd N groups which point to the reactive sites responsible for binding with DNA and bovine serum albumin (BSA). The spectral distinction between eclipsed and staggered form of ferrocene has been analyzed. The molecular docking of FNGABEE with BSA and DNA has been performed to find the strength of binding and the moieties responsible for the interactions. The experimental binding studies of FNGABEE with BSA and DNA has been performed using UV absorption spectroscopy and fluorometric assay, to find the nature and strength of binding.

Investigating DNA Binding and Conformational Variation in Temperature Sensitive p53 Cancer Mutants Using QM-MM Simulations

PubMed Central

Koulgi, Shruti; Achalere, Archana; Sonavane, Uddhavesh; Joshi, Rajendra

2015-01-01

The tp53 gene is found to be mutated in 50% of all the cancers. The p53 protein, a product of tp53 gene, is a multi-domain protein. It consists of a core DNA binding domain (DBD) which is responsible for its binding and transcription of downstream target genes. The mutations in p53 protein are responsible for creating cancerous conditions and are found to be occurring at a high frequency in the DBD region of p53. Some of these mutations are also known to be temperature sensitive (ts) in nature. They are known to exhibit partial or strong binding with DNA in the temperature range (298–306 K). Whereas, at 310 K and above they show complete loss in binding. We have analyzed the changes in binding and conformational behavior at 300 K and 310 K for three of the ts-mutants viz., V143A, R249S and R175H. QM-MM simulations have been performed on the wild type and the above mentioned ts-mutants for 30 ns each. The optimal estimate of free energy of binding for a particular number of interface hydrogen bonds was calculated using the maximum likelihood method as described by Chodera et. al (2007). This parameter has been observed to be able to mimic the binding affinity of the p53 ts-mutants at 300 K and 310 K. Thus the correlation between MM-GBSA free energy of binding and hydrogen bonds formed by the interface residues between p53 and DNA has revealed the temperature dependent nature of these mutants. The role of main chain dihedrals was obtained by performing dihedral principal component analysis (PCA). This analysis, suggests that the conformational variations in the main chain dihedrals (ϕ and ψ) of the p53 ts-mutants may have caused reduction in the overall stability of the protein. The solvent exposure of the side chains of the interface residues were found to hamper the binding of the p53 to the DNA. Solvent Accessible Surface Area (SASA) also proved to be a crucial property in distinguishing the conformers obtained at 300 K and 310 K for the three ts-mutants from the wild type at 300 K. PMID:26579714

Xeroderma pigmentosum complementation group E and UV-damaged DNA-binding protein

PubMed Central

Tang, Jean; Chu, Gilbert

2010-01-01

UV-damaged DNA-binding protein (UV-DDB) is composed of two subunits, DDB1 (p127) and DDB2 (p48). Mutations in the DDB2 gene inactivate UV-DDB in individuals from complementation group E of xeroderma pigmentosum (XP-E), an autosomal recessive disease characterized by sun sensitivity, severe risk for skin cancer and defective nucleotide excision repair. UV-DDB is also deficient in many rodent tissues, exposing a shortcoming in rodent models for cancer. In vitro, UV-DDB binds to cyclobutane pyrimidine dimers (CPDs), 6–4 photoproducts and other DNA lesions, stimulating the excision of CPDs, and to a lesser extent, of 6–4 photoproducts. In vivo, UV-DDB plays an important role in the p53-dependent response of mammalian cells to DNA damage. When cells are exposed to UV, the resulting accumulation of p53 activates DDB2 transcription, which leads to increased levels of UV-DDB. Binding of UV-DDB to CPDs targets these lesions for global genomic repair, suppressing mutations without affecting UV survival. Apparently, cells are able to survive with unrepaired CPDs because of the activity of bypass DNA polymerases. Finally, there is evidence that UV-DDB may have roles in the cell that are distinct from DNA repair. PMID:12509284

DIRECT BINDING OF GLYCERALDEHYDE 3-PHOSPHATE DEHYDROGENASE TO TELOMERIC DNA PROTECTS TELOMERES AGAINST CHEMOTHERAPY-INDUCED RAPID DEGRADATION

PubMed Central

Demarse, Neil A.; Ponnusamy, Suriyan; Spicer, Eleanor K.; Apohan, Elif; Baatz, John E.; Ogretmen, Besim; Davies, Christopher

2009-01-01

GAPDH (glyceraldehyde 3-phosphate dehydrogenase) is a glycolytic enzyme that displays several non-glycolytic activities, including the maintenance and/or protection of telomeres. In this study, we determined the molecular mechanism and biological role of the interaction between GAPDH and human telomeric DNA. Using gel shift assays, we show that recombinant GAPDH binds directly with high affinity (Kd = 45 nM) to a single-stranded oligonucleotide comprising three telomeric DNA repeats and that nucleotides T1, G5 and G6 of the TTAGGG repeat are essential for binding. The stoichiometry of the interaction is 2:1 (DNA: GAPDH), and GAPDH appears to form a high-molecular weight complex when bound to the oligonucleotide. Mutation of Asp32 and Cys149, which are localized to the NAD-binding site and the active site center of GAPDH, respectively, produced mutants that almost completely lost their telomere-binding functions both in vitro and in situ (in A549 human lung cancer cells). Treatment of A549 cells with the chemotherapeutic agents gemcitabine and doxorubicin resulted in increased nuclear localization of expressed wild-type GAPDH, where it protected telomeres against rapid degradation, concomitant with increased resistance to the growth inhibitory effects of these drugs. The non-DNA-binding mutants of GAPDH also localized to the nucleus when expressed in A549 cells, but did not confer any significant protection of telomeres against chemotherapy-induced degradation or growth inhibition, and this occurred without the involvement of caspase activation or apoptosis regulation. Overall, these data demonstrate that GAPDH binds telomeric DNA directly in vitro and may have a biological role in the protection of telomeres against rapid degradation in response to chemotherapeutic agents in A549 human lung cancer cells. PMID:19800890

Flexibility and adaptability in binding of E. coli cytidine repressor to different operators suggests a role in differential gene regulation.

PubMed

Tretyachenko-Ladokhina, Vira; Cocco, Melanie J; Senear, Donald F

2006-09-15

Interactions between DNA-bound transcription factors CytR and CRP regulate the promoters of the Escherichia coli CytR regulon. A distinctive feature of the palindromic CytR operators is highly variable length central spacers (0-9 bp). Previously we demonstrated distinct modes of CytR binding to operators that differ in spacer length. These different modes are characterized by opposite enthalpic and entropic contributions at 25 degrees C. Of particular note were radically different negative DeltaCp values suggesting variable contribution from coupled protein folding and/or DNA structural transitions. We proposed that the CytR DNA binding-domain adopts either a more rigid or flexible DNA-bound conformation in response to the different spacer lengths. More recently, similar effects were shown to contribute to discrimination between operator and non-specific DNA binding by LacR, a CytR homolog. Here we have extended the thermodynamic analysis to the remaining natural CytR operators plus a set of synthetic operators designed to isolate spacing as the single variable. The thermodynamic results show a broad and monotonic range of effects that are primarily dependent on spacer length. The magnitude of effects suggests participation by more than the DNA-binding domain. 15N HSQC NMR and CD spectral analyses were employed to characterize the structural basis for these effects. The results indicate that while CytR forms a well-ordered structure in solution, it is highly dynamic. We propose a model in which a large ensemble of native state conformations narrows upon binding, to an extent governed by operator spacing. This in turn is expected to constrain intermolecular interactions in the CytR-CRP-DNA complex, thus generating operator-specific effects on repression and induction of transcription.

Replication Protein A Presents Canonical Functions and Is Also Involved in the Differentiation Capacity of Trypanosoma cruzi.

PubMed

Pavani, Raphael Souza; da Silva, Marcelo Santos; Fernandes, Carlos Alexandre Henrique; Morini, Flavia Souza; Araujo, Christiane Bezerra; Fontes, Marcos Roberto de Mattos; Sant'Anna, Osvaldo Augusto; Machado, Carlos Renato; Cano, Maria Isabel; Fragoso, Stenio Perdigão; Elias, Maria Carolina

2016-12-01

Replication Protein A (RPA), the major single stranded DNA binding protein in eukaryotes, is composed of three subunits and is a fundamental player in DNA metabolism, participating in replication, transcription, repair, and the DNA damage response. In human pathogenic trypanosomatids, only limited studies have been performed on RPA-1 from Leishmania. Here, we performed in silico, in vitro and in vivo analysis of Trypanosoma cruzi RPA-1 and RPA-2 subunits. Although computational analysis suggests similarities in DNA binding and Ob-fold structures of RPA from T. cruzi compared with mammalian and fungi RPA, the predicted tridimensional structures of T. cruzi RPA-1 and RPA-2 indicated that these molecules present a more flexible tertiary structure, suggesting that T. cruzi RPA could be involved in additional responses. Here, we demonstrate experimentally that the T. cruzi RPA complex interacts with DNA via RPA-1 and is directly related to canonical functions, such as DNA replication and DNA damage response. Accordingly, a reduction of TcRPA-2 expression by generating heterozygous knockout cells impaired cell growth, slowing down S-phase progression. Moreover, heterozygous knockout cells presented a better efficiency in differentiation from epimastigote to metacyclic trypomastigote forms and metacyclic trypomastigote infection. Taken together, these findings indicate the involvement of TcRPA in the metacyclogenesis process and suggest that a delay in cell cycle progression could be linked with differentiation in T. cruzi.

Evidence for hSNM1B/Apollo functioning in the HSP70 mediated DNA damage response.

PubMed

Anders, Marco; Mattow, Jens; Digweed, Martin; Demuth, Ilja

2009-06-01

The hSNM1B/Apollo protein is involved in the cellular response to DNA-damage as well as in the maintenance of telomeres during S-phase. TRF2 has been shown to interact physically with hSNM1B. As a core component of shelterin, TRF2 functions in organization and protection of telomeres. However, TRF2 was also shown to have a role in the early DNA-damage response, suggesting that hSNM1B and TRF2 cooperate in this dual function. Here we have used Tandem-Affinity-Purification in combination with mass spectrometry to identify additional binding partners of hSNM1B. This revealed HSC70, HSP72, HSP60 and beta-Tubulin to be hSNM1B-interactors. We have confirmed the interaction of hSNM1B and HSP70 in co-immunoprecipitation assays and found that hSNM1B binds to a C-terminal fragment of HSP72, known to contain the substrate binding domain. Depletion of HSP72 in human fibroblasts resulted in a significant reduction of nuclear hSNM1B foci. We also found the phosphorylation of CHK1 at serine 317 to be attenuated in response to UVC irradiation as a consequence of hSNM1B depletion, a result which extends our previous findings on the DNA-damage response function of hSNM1B. HSP70 chaperones have been implicated in the maintenance of genome stability and their expression is often aberrant in cancer. Our results presented here, suggest that the role in genome stability might not be specific to HSP70 but rather can be attributed, at least in part, to hSNM1B. This, together with its stimulating effect on ATM and ATR substrate phosphorylation in response to DNA-damage qualify hSNM1B as a putative target in cancer therapy.

Azadirachtin Interacts with Retinoic Acid Receptors and Inhibits Retinoic Acid-mediated Biological Responses*

PubMed Central

Thoh, Maikho; Babajan, Banaganapalli; Raghavendra, Pongali B.; Sureshkumar, Chitta; Manna, Sunil K.

2011-01-01

Considering the role of retinoids in regulation of more than 500 genes involved in cell cycle and growth arrest, a detailed understanding of the mechanism and its regulation is useful for therapy. The extract of the medicinal plant Neem (Azadirachta indica) is used against several ailments especially for anti-inflammatory, anti-itching, spermicidal, anticancer, and insecticidal activities. In this report we prove the detailed mechanism on the regulation of retinoic acid-mediated cell signaling by azadirachtin, active components of neem extract. Azadirachtin repressed all trans-retinoic acid (ATRA)-mediated nuclear transcription factor κB (NF-κB) activation, not the DNA binding but the NF-κB-dependent gene expression. It did not inhibit IκBα degradation, IκBα kinase activity, or p65 phosphorylation and its nuclear translocation but inhibited NF-κB-dependent reporter gene expression. Azadirachtin inhibited TRAF6-mediated, but not TRAF2-mediated NF-κB activation. It inhibited ATRA-induced Sp1 and CREB (cAMP-response element-binding protein) DNA binding. Azadirachtin inhibited ATRA binding with retinoid receptors, which is supported by biochemical and in silico evidences. Azadirachtin showed strong interaction with retinoid receptors. It suppressed ATRA-mediated removal of retinoid receptors, bound with DNA by inhibiting ATRA binding to its receptors. Overall, our data suggest that azadirachtin interacts with retinoic acid receptors and suppresses ATRA binding, inhibits falling off the receptors, and activates transcription factors like CREB, Sp1, NF-κB, etc. Thus, azadirachtin exerts anti-inflammatory and anti-metastatic responses by a novel pathway that would be beneficial for further anti-inflammatory and anti-cancer therapies. PMID:21127062

An immunoassay for the study of DNA-binding activities of herpes simplex virus protein ICP8.

PubMed

Lee, C K; Knipe, D M

1985-06-01

An immunoassay was used to examine the interaction between a herpes simplex virus protein, ICP8, and various types of DNA. The advantage of this assay is that the protein is not subjected to harsh purification procedures. We characterized the binding of ICP8 to both single-stranded (ss) and double-stranded (ds) DNA. ICP8 bound ss DNA fivefold more efficiently than ds DNA, and both binding activities were most efficient in 150 mM NaCl. Two lines of evidence indicate that the binding activities were not identical: (i) ds DNA failed to complete with ss DNA binding even with a large excess of ds DNA; (ii) Scatchard plots of DNA binding with various amounts of DNA were fundamentally different for ss DNA and ds DNA. However, the two activities were related in that ss DNA efficiently competed with the binding of ds DNA. We conclude that the ds DNA-binding activity of ICP8 is probably distinct from the ss DNA-binding activity. No evidence for sequence-specific ds DNA binding was obtained for either the entire herpes simplex virus genome or cloned viral sequences.

The H3-H4 N-Terminal Tail Domains Are the Primary Mediators of Transcription Factor IIIA Access to 5S DNA within a Nucleosome

PubMed Central

Vitolo, Joseph M.; Thiriet, Christophe; Hayes, Jeffrey J.

2000-01-01

Reconstitution of a DNA fragment containing a Xenopus borealis somatic type 5S rRNA gene into a nucleosome greatly restricts the binding of transcription factor IIIA (TFIIIA) to its cognate DNA sequence within the internal promoter of the gene. Removal of all core histone tail domains by limited trypsin proteolysis or acetylation of the core histone tails significantly relieves this inhibition and allows TFIIIA to exhibit high-affinity binding to nucleosomal DNA. Since only a single tail or a subset of tails may be primarily responsible for this effect, we determined whether removal of the individual tail domains of the H2A-H2B dimer or the H3-H4 tetramer affects TFIIIA binding to its cognate DNA site within the 5S nucleosome in vitro. The results show that the tail domains of H3 and H4, but not those of H2A and/or H2B, directly modulate the ability of TFIIIA to bind nucleosomal DNA. In vitro transcription assays carried out with nucleosomal templates lacking individual tail domains show that transcription efficiency parallels the binding of TFIIIA. In addition, we show that the stoichiometry of core histones within the 5S DNA-core histone-TFIIIA triple complex is not changed upon TFIIIA association. Thus, TFIIIA binding occurs by displacement of H2A-H2B–DNA contacts but without complete loss of the dimer from the nucleoprotein complex. These data, coupled with previous reports (M. Vettese-Dadey, P. A. Grant, T. R. Hebbes, C. Crane-Robinson, C. D. Allis, and J. L. Workman, EMBO J. 15:2508–2518, 1996; L. Howe, T. A. Ranalli, C. D. Allis, and J. Ausio, J. Biol. Chem. 273:20693–20696, 1998), suggest that the H3/H4 tails are the primary arbiters of transcription factor access to intranucleosomal DNA. PMID:10688663

Thermodynamics of complex structures formed between single-stranded DNA oligomers and the KH domains of the far upstream element binding protein

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chakraborty, Kaushik; Sinha, Sudipta Kumar; Bandyopadhyay, Sanjoy, E-mail: sanjoy@chem.iitkgp.ernet.in

The noncovalent interaction between protein and DNA is responsible for regulating the genetic activities in living organisms. The most critical issue in this problem is to understand the underlying driving force for the formation and stability of the complex. To address this issue, we have performed atomistic molecular dynamics simulations of two DNA binding K homology (KH) domains (KH3 and KH4) of the far upstream element binding protein (FBP) complexed with two single-stranded DNA (ss-DNA) oligomers in aqueous media. Attempts have been made to calculate the individual components of the net entropy change for the complexation process by adopting suitablemore » statistical mechanical approaches. Our calculations reveal that translational, rotational, and configurational entropy changes of the protein and the DNA components have unfavourable contributions for this protein-DNA association process and such entropy lost is compensated by the entropy gained due to the release of hydration layer water molecules. The free energy change corresponding to the association process has also been calculated using the Free Energy Perturbation (FEP) method. The free energy gain associated with the KH4–DNA complex formation has been found to be noticeably higher than that involving the formation of the KH3–DNA complex.« less

Binding of anticancer drug daunomycin to a TGGGGT G-quadruplex DNA probed by all-atom molecular dynamics simulations: additional pure groove binding mode and implications on designing more selective G-quadruplex ligands.

PubMed

Shen, Zhanhang; Mulholland, Kelly A; Zheng, Yujun; Wu, Chun

2017-09-01

DNA G-quadruplex structures are emerging cancer-specific targets for chemotherapeutics. Ligands that bind to and stabilize DNA G-quadruplexes have the potential to be anti-cancer drugs. Lack of binding selectivity to DNA G-quadruplex over DNA duplex remains a major challenge when attempting to develop G-quadruplex ligands into successful anti-cancer drugs. Thorough understanding of the binding nature of existing non-selective ligands that bind to both DNA quadruplex and DNA duplex will help to address this challenge. Daunomycin and doxorubicin, two commonly used anticancer drugs, are examples of non-selective DNA ligands. In this study, we extended our early all-atom binding simulation studies between doxorubicin and a DNA duplex (d(CGATCG) 2 ) to probe the binding between daunomycin and a parallel DNA quadruplex (d(TGGGGT) 4 ) and DNA duplex. In addition to the end stacking mode, which mimics the mode in the crystal structure, a pure groove binding mode was observed in our free binding simulations. The dynamic and energetic properties of these two binding modes are thoroughly examined, and a detailed comparison is made between DNA quadruplex binding modes and DNA duplex binding modes. Implications on the design of more selective DNA quadruplex ligands are also discussed. Graphical abstract Top stacking and groov binding modes from the MD simulations.

In vitro selection of DNA elements highly responsive to the human T-cell lymphotropic virus type I transcriptional activator, Tax.

PubMed

Paca-Uccaralertkun, S; Zhao, L J; Adya, N; Cross, J V; Cullen, B R; Boros, I M; Giam, C Z

1994-01-01

The human T-cell lymphotropic virus type I (HTLV-I) transactivator, Tax, the ubiquitous transcriptional factor cyclic AMP (cAMP) response element-binding protein (CREB protein), and the 21-bp repeats in the HTLV-I transcriptional enhancer form a ternary nucleoprotein complex (L. J. Zhao and C. Z. Giam, Proc. Natl. Acad. Sci. USA 89:7070-7074, 1992). Using an antibody directed against the COOH-terminal region of Tax along with purified Tax and CREB proteins, we selected DNA elements bound specifically by the Tax-CREB complex in vitro. Two distinct but related groups of sequences containing the cAMP response element (CRE) flanked by long runs of G and C residues in the 5' and 3' regions, respectively, were preferentially recognized by Tax-CREB. In contrast, CREB alone binds only to CRE motifs (GNTGACG[T/C]) without neighboring G- or C-rich sequences. The Tax-CREB-selected sequences bear a striking resemblance to the 5' or 3' two-thirds of the HTLV-I 21-bp repeats and are highly inducible by Tax. Gel electrophoretic mobility shift assays, DNA transfection, and DNase I footprinting analyses indicated that the G- and C-rich sequences flanking the CRE motif are crucial for Tax-CREB-DNA ternary complex assembly and Tax transactivation but are not in direct contact with the Tax-CREB complex. These data show that Tax recruits CREB to form a multiprotein complex that specifically recognizes the viral 21-bp repeats. The expanded DNA binding specificity of Tax-CREB and the obligatory role the ternary Tax-CREB-DNA complex plays in transactivation reveal a novel mechanism for regulating the transcriptional activity of leucine zipper proteins like CREB.

Cerium chloride stimulated controlled conversion of B-to-Z DNA in self-assembled nanostructures.

PubMed

Bhanjadeo, Madhabi M; Nayak, Ashok K; Subudhi, Umakanta

2017-01-22

DNA adopts different conformation not only because of novel base pairs but also while interacting with inorganic or organic compounds. Self-assembled branched DNA (bDNA) structures or DNA origami that change conformation in response to environmental cues hold great promises in sensing and actuation at the nanoscale. Recently, the B-Z transition in DNA is being explored to design various nanomechanical devices. In this communication we have demonstrated that Cerium chloride binds to the phosphate backbone of self-assembled bDNA structure and induce B-to-Z transition at physiological concentration. The mechanism of controlled conversion from right-handed to left-handed has been assayed by various dye binding studies using CD and fluorescence spectroscopy. Three different bDNA structures have been identified to display B-Z transition. This approach provides a rapid and reversible means to change bDNA conformation, which can be used for dynamic and progressive control at the nanoscale. Copyright © 2016 Elsevier Inc. All rights reserved.

A core hSSB1–INTS complex participates in the DNA damage response

PubMed Central

Zhang, Feng; Ma, Teng; Yu, Xiaochun

2013-01-01

Summary Human single-stranded DNA-binding protein 1 (hSSB1) plays an important role in the DNA damage response and the maintenance of genomic stability. It has been shown that the core hSSB1 complex contains hSSB1, INTS3 and C9orf80. Using protein affinity purification, we have identified integrator complex subunit 6 (INTS6) as a major subunit of the core hSSB1 complex. INTS6 forms a stable complex with INTS3 and hSSB1 both in vitro and in vivo. In this complex, INTS6 directly interacts with INTS3. In response to the DNA damage response, along with INTS3 and hSSB1, INTS6 relocates to the DNA damage sites. Moreover, the hSSB1–INTS complex regulates the accumulation of RAD51 and BRCA1 at DNA damage sites and the correlated homologous recombination. PMID:23986477

The FHA domain determines Drosophila Chk2/Mnk localization to key mitotic structures and is essential for early embryonic DNA damage responses.

PubMed

Takada, Saeko; Collins, Eric R; Kurahashi, Kayo

2015-05-15

DNA damage responses, including mitotic centrosome inactivation, cell-cycle delay in mitosis, and nuclear dropping from embryo cortex, maintain genome integrity in syncytial Drosophila embryos. A conserved signaling kinase, Chk2, known as Mnk/Loki, is essential for the responses. Here we demonstrate that functional EGFP-Mnk expressed from a transgene localizes to the nucleus, centrosomes, interkinetochore/centromere region, midbody, and pseudocleavage furrows without DNA damage and in addition forms numerous foci/aggregates on mitotic chromosomes upon DNA damage. We expressed EGFP-tagged Mnk deletion or point mutation variants and investigated domain functions of Mnk in vivo. A triple mutation in the phosphopeptide-binding site of the forkhead-associated (FHA) domain disrupted normal Mnk localization except to the nucleus. The mutation also disrupted Mnk foci formation on chromosomes upon DNA damage. FHA mutations and deletion of the SQ/TQ-cluster domain (SCD) abolished Mnk transphosphorylations and autophosphorylations, indicative of kinase activation after DNA damage. A potent NLS was found at the C-terminus, which is required for normal Mnk function. We propose that the FHA domain in Mnk plays essential dual functions in mediating embryonic DNA damage responses by means of its phosphopeptide-binding ability: activating Mnk in the nucleus upon DNA damage and recruiting Mnk to multiple subcellular structures independently of DNA damage. © 2015 Takada et al. This article is distributed by The American Society for Cell Biology under license from the author(s). Two months after publication it is available to the public under an Attribution–Noncommercial–Share Alike 3.0 Unported Creative Commons License (http://creativecommons.org/licenses/by-nc-sa/3.0).

Time-Resolved Fluorescence Resonance Energy Transfer Assay for Discovery of Small-Molecule Inhibitors of Methyl-CpG Binding Domain Protein 2.

PubMed

Wyhs, Nicolas; Walker, David; Giovinazzo, Hugh; Yegnasubramanian, Srinivasan; Nelson, William G

2014-08-01

Methylated DNA binding proteins such as Methyl-CpG Binding Domain Protein 2 (MBD2) can transduce DNA methylation alterations into a repressive signal by recruiting transcriptional co-repressor complexes. Interfering with MBD2 could lead to reactivation of tumor suppressor genes and therefore represents an attractive strategy for epigenetic therapy. We developed and compared fluorescence polarization (FP) and time-resolved fluorescence resonance energy transfer (TR-FRET)-based high-throughput screening (HTS) assays to identify small-molecule inhibitors of the interaction between the methyl binding domain of MBD2 (MBD2-MBD) and methylated DNA. Although both assays performed well in 96-well format, the TR-FRET assay (Z' factor = 0.58) emerged as a superior screening strategy compared with FP (Z' factor = 0.08) when evaluated in an HTS 384-well plate format. Using TR-FRET, we screened the Sigma LOPAC library for MBD2-MBD inhibitors and identified four compounds that also validated in a dose-response series. This included two known DNA intercalators (mitoxantrone and idarubicin) among two other inhibitory compounds (NF449 and aurintricarboxylic acid). All four compounds also inhibited the binding of SP-1, a transcription factor with a GC-rich binding sequence, to a methylated oligonucleotide, demonstrating that the activity was nonspecific. Our results provide proof of principle for using TR-FRET-based HTS to identify small-molecule inhibitors of MBD2 and other DNA-protein interactions. © 2014 Society for Laboratory Automation and Screening.

Alteration of Cyclic-AMP Response Element Binding Protein in the Postmortem Brain of Subjects with Bipolar Disorder and Schizophrenia

PubMed Central

Ren, Xinguo; Rizavi, Hooriyah S.; Khan, Mansoor A.; Bhaumik, Runa; Dwivedi, Yogesh; Pandey, Ghanshyam N.

2013-01-01

Background Abnormalities of cyclic-AMP (cAMP) response element binding protein (CREB) function has been suggested in bipolar (BP) illness and schizophrenia (SZ), based on both indirect and direct evidence. To further elucidate the role of CREB in these disorders, we studied CREB expression and function in two brain areas implicated in these disorders, i.e., dorsolateral prefrontal cortex (DLPFC) and cingulate gyrus (CG). Methods We determined CREB protein expression using Western blot technique, CRE-DNA binding using gel shift assay, and mRNA expression using real-time RT-polymerase chain reaction (qPCR) in DLPFC and CG of the postmortem brain of BP (n = 19), SZ (n = 20), and normal control (NC, n = 20) subjects. Results We observed that CREB protein and mRNA expression and CRE-DNA binding activity were significantly decreased in the nuclear fraction of DLPFC and CG obtained from BP subjects compared with NC subjects. However, the protein and mRNA expression and CRE-DNA binding in SZ subjects was significantly decreased in CG, but not in DLPFC, compared with NC. Conclusion These studies thus indicate region-specific abnormalities of CREB expression and function in both BP and SZ. They suggest that abnormalities of CREB in CG may be associated with both BP and SZ, but its abnormality in DLPFC is specific to BP illness. PMID:24148789

Identification and functional characterization of BTas transactivator as a DNA-binding protein.

PubMed

Tan, Juan; Hao, Peng; Jia, Rui; Yang, Wei; Liu, Ruichang; Wang, Jinzhong; Xi, Zhen; Geng, Yunqi; Qiao, Wentao

2010-09-30

The genome of bovine foamy virus (BFV) encodes a transcriptional transactivator, namely BTas, that remarkably enhances gene expression by binding to the viral long-terminal repeat promoter (LTR) and internal promoter (IP). In this report, we characterized the functional domains of BFV BTas. BTas contains two major functional domains: the N-terminal DNA-binding domain (residues 1-133) and the C-terminal activation domain (residues 198-249). The complete BTas responsive regions were mapped to the positions -380/-140 of LTR and 9205/9276 of IP. Four BTas responsive elements were identified at the positions -368/-346, -327/-307, -306/-285 and -186/-165 of the BFV LTR, and one element was identified at the position 9243/9264 of the BFV IP. Unlike other foamy viruses, the five BTas responsive elements in BFV shared obvious sequence homology. These data suggest that among the complex retroviruses, BFV appears to have a unique transactivation mechanism. Crown Copyright 2010. Published by Elsevier Inc. All rights reserved.

Factor H Binds to Extracellular DNA Traps Released from Human Blood Monocytes in Response to Candida albicans

PubMed Central

Halder, Luke D.; Abdelfatah, Mahmoud A.; Jo, Emeraldo A. H.; Jacobsen, Ilse D.; Westermann, Martin; Beyersdorf, Niklas; Lorkowski, Stefan; Zipfel, Peter F.; Skerka, Christine

2017-01-01

Upon systemic infection with human pathogenic yeast Candida albicans (C. albicans), human monocytes and polymorph nuclear neutrophilic granulocytes are the first immune cells to respond and come into contact with C. albicans. Monocytes exert immediate candidacidal activity and inhibit germination, mediate phagocytosis, and kill fungal cells. Here, we show that human monocytes spontaneously respond to C. albicans cells via phagocytosis, decondensation of nuclear DNA, and release of this decondensed DNA in the form of extracellular traps (called monocytic extracellular traps: MoETs). Both subtypes of monocytes (CD14++CD16−/CD14+CD16+) formed MoETs within the first hours upon contact with C. albicans. MoETs were characterized by the presence of citrullinated histone, myeloperoxidase, lactoferrin, and elastase. MoETs were also formed in response to Staphylococcus aureus and Escherichia coli, indicating a general reaction of monocytes to infectious microbes. MoET induction differs from extracellular trap formation in macrophages as MoETs are not triggered by simvastatin, an inhibitor of cholesterol synthesis and inducer of extracellular traps in macrophages. Extracellular traps from both monocytes and neutrophils activate complement and C3b is deposited. However, factor H (FH) binds via C3b to the extracellular DNA, mediates cofactor activity, and inhibits the induction of the inflammatory cytokine interleukin-1 beta in monocytes. Altogether, the results show that human monocytes release extracellular DNA traps in response to C. albicans and that these traps finally bind FH via C3b to presumably support clearance without further inflammation. PMID:28133459

AtSPX1 affects the AtPHR1-DNA-binding equilibrium by binding monomeric AtPHR1 in solution.

PubMed

Qi, Wanjun; Manfield, Iain W; Muench, Stephen P; Baker, Alison

2017-10-23

Phosphorus is an essential macronutrient for plant growth and is deficient in ∼50% of agricultural soils. The transcription factor phosphate starvation response 1 (PHR1) plays a central role in regulating the expression of a subset of phosphate starvation-induced (PSI) genes through binding to a cis -acting DNA element termed P1BS (PHR1-binding sequences). In Arabidopsis and rice, activity of AtPHR1/OsPHR2 is regulated in part by their downstream target SPX ( S yg1, P ho81, X pr1) proteins through protein-protein interaction. Here, we provide kinetic and affinity data for interaction between AtPHR1 and P1BS sites. Using surface plasmon resonance, a tandem P1BS sequence showed ∼50-fold higher affinity for MBPAtdPHR1 (a fusion protein comprising the DNA-binding domain and coiled-coil domain of AtPHR1 fused to maltose-binding protein) than a single site. The affinity difference was largely reflected in a much slower dissociation rate from the 2× P1BS-binding site, suggesting an important role for protein co-operativity. Injection of AtSPX1 in the presence of phosphate or inositol hexakisphosphate (InsP6) failed to alter the MBPAtdPHR1-P1BS dissociation rate, while pre-mixing of these two proteins in the presence of either 5 mM Pi or 500 µM InsP6 resulted in a much lower DNA-binding signal from MBPAtdPHR1. These data suggest that, in the Pi-restored condition, AtSPX1 can bind to monomeric AtPHR1 in solution and therefore regulate PSI gene expression by tuning the AtPHR1-DNA-binding equilibrium. This Pi-dependent regulation of AtPHR1-DNA-binding equilibrium also generates a negative feedback loop on the expression of AtSPX1 itself, providing a tight control of PSI gene expression. © 2017 The Author(s).

A high-fat diet and the threonine-encoding allele (Thr54) polymorphism of fatty acid–binding protein 2 reduce plasma triglyceride–rich lipoproteins

USDA-ARS?s Scientific Manuscript database

The Thr54 allele of the fatty acid binding protein 2 (FABP2) DNA polymorphism is associated with increased triglyceride-rich lipoproteins and insulin resistance. We investigated whether the triglyceride-rich lipoprotein response to diets of varied fat content is affected by the fatty acid binding pr...

APE2 Zf-GRF facilitates 3'-5' resection of DNA damage following oxidative stress

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wallace, Bret D.; Berman, Zachary; Mueller, Geoffrey A.

The Xenopus laevis APE2 (apurinic/apyrimidinic endonuclease 2) nuclease participates in 3'-5' nucleolytic resection of oxidative DNA damage and activation of the ATR-Chk1 DNA damage response (DDR) pathway via ill-defined mechanisms. Here we report that APE2 resection activity is regulated by DNA interactions in its Zf-GRF domain, a region sharing high homology with DDR proteins Topoisomerase 3α (TOP3α) and NEIL3 (Nei-like DNA glycosylase 3), as well as transcription and RNA regulatory proteins, such as TTF2 (transcription termination factor 2), TFIIS, and RPB9. Biochemical and NMR results establish the nucleic acid-binding activity of the Zf-GRF domain. Moreover, an APE2 Zf-GRF X-ray structuremore » and small-angle X-ray scattering analyses show that the Zf-GRF fold is typified by a crescent-shaped ssDNA binding claw that is flexibly appended to an APE2 endonuclease/exonuclease/phosphatase (EEP) catalytic core. Structure-guided Zf-GRF mutations impact APE2 DNA binding and 3'-5' exonuclease processing, and also prevent efficient APE2-dependent RPA recruitment to damaged chromatin and activation of the ATR-Chk1 DDR pathway in response to oxidative stress in Xenopus egg extracts. Collectively, our data unveil the APE2 Zf-GRF domain as a nucleic acid interaction module in the regulation of a key single-strand break resection function of APE2, and also reveal topologic similarity of the Zf-GRF to the zinc ribbon domains of TFIIS and RPB9.« less

Assessment of amsacrine binding with DNA using UV-visible, circular dichroism and Raman spectroscopic techniques.

PubMed

Jangir, Deepak Kumar; Dey, Sanjay Kumar; Kundu, Suman; Mehrotra, Ranjana

2012-09-03

Proper understanding of the mechanism of binding of drugs to their targets in cell is a fundamental requirement to develop new drug therapy regimen. Amsacrine is a rationally designed anticancer drug, used to treat leukemia and lymphoma. Binding with cellular DNA is a crucial step in its mechanism of cytotoxicity. Despite numerous studies, DNA binding properties of amsacrine are poorly understood. Its reversible binding with DNA does not permit X-ray crystallography or NMR spectroscopic evaluation of amsacrine-DNA complexes. In the present work, interaction of amsacrine with calf thymus DNA is investigated at physiological conditions. UV-visible, FT-Raman and circular dichroism spectroscopic techniques were employed to determine the binding mode, binding constant, sequence specificity and conformational effects of amsacrine binding to native calf thymus DNA. Our results illustrate that amsacrine interacts with DNA by and large through intercalation between base pairs. Binding constant of the amsacrine-DNA complex was found to be K=1.2±0.1×10(4) M(-1) which is indicative of moderate type of binding of amsacrine to DNA. Raman spectroscopic results suggest that amsacrine has a binding preference of intercalation between AT base pairs of DNA. Minor groove binding is also observed in amsacrine-DNA complexes. These results are in good agreement with in silico investigation of amsacrine binding to DNA and thus provide detailed insight into DNA binding properties of amsacrine, which could ultimately, renders its cytotoxic efficacy. Copyright © 2012 Elsevier B.V. All rights reserved.

A core viral protein binds host nucleosomes to sequester immune danger signals

PubMed Central

Avgousti, Daphne C.; Herrmann, Christin; Kulej, Katarzyna; Pancholi, Neha J.; Sekulic, Nikolina; Petrescu, Joana; Molden, Rosalynn C.; Blumenthal, Daniel; Paris, Andrew J.; Reyes, Emigdio D.; Ostapchuk, Philomena; Hearing, Patrick; Seeholzer, Steven H.; Worthen, G. Scott; Black, Ben E.; Garcia, Benjamin A.; Weitzman, Matthew D.

2016-01-01

Viral proteins mimic host protein structure and function to redirect cellular processes and subvert innate defenses1. Small basic proteins compact and regulate both viral and cellular DNA genomes. Nucleosomes are the repeating units of cellular chromatin and play an important role in innate immune responses2. Viral encoded core basic proteins compact viral genomes but their impact on host chromatin structure and function remains unexplored. Adenoviruses encode a highly basic protein called protein VII that resembles cellular histones3. Although protein VII binds viral DNA and is incorporated with viral genomes into virus particles4,5, it is unknown whether protein VII impacts cellular chromatin. Our observation that protein VII alters cellular chromatin led us to hypothesize that this impacts antiviral responses during adenovirus infection. We found that protein VII forms complexes with nucleosomes and limits DNA accessibility. We identified post-translational modifications on protein VII that are responsible for chromatin localization. Furthermore, proteomic analysis demonstrated that protein VII is sufficient to alter protein composition of host chromatin. We found that protein VII is necessary and sufficient for retention in chromatin of members of the high-mobility group protein B family (HMGB1, HMGB2, and HMGB3). HMGB1 is actively released in response to inflammatory stimuli and functions as a danger signal to activate immune responses6,7. We showed that protein VII can directly bind HMGB1 in vitro and further demonstrated that protein VII expression in mouse lungs is sufficient to decrease inflammation-induced HMGB1 content and neutrophil recruitment in the bronchoalveolar lavage fluid. Together our in vitro and in vivo results show that protein VII sequesters HMGB1 and can prevent its release. This study uncovers a viral strategy in which nucleosome binding is exploited to control extracellular immune signaling. PMID:27362237

NLRC3, a member of the NLR family of proteins, is a negative regulator of innate immune signaling induced by the DNA sensor STING.

PubMed

Zhang, Lu; Mo, Jinyao; Swanson, Karen V; Wen, Haitao; Petrucelli, Alex; Gregory, Sean M; Zhang, Zhigang; Schneider, Monika; Jiang, Yan; Fitzgerald, Katherine A; Ouyang, Songying; Liu, Zhi-Jie; Damania, Blossom; Shu, Hong-Bing; Duncan, Joseph A; Ting, Jenny P-Y

2014-03-20

Stimulator of interferon genes (STING, also named MITA, MYPS, or ERIS) is an intracellular DNA sensor that induces type I interferon through its interaction with TANK-binding kinase 1 (TBK1). Here we found that the nucleotide-binding, leucine-rich-repeat-containing protein, NLRC3, reduced STING-dependent innate immune activation in response to cytosolic DNA, cyclic di-GMP (c-di-GMP), and DNA viruses. NLRC3 associated with both STING and TBK1 and impeded STING-TBK1 interaction and downstream type I interferon production. By using purified recombinant proteins, we found NLRC3 to interact directly with STING. Furthermore, NLRC3 prevented proper trafficking of STING to perinuclear and punctated region, known to be important for its activation. In animals, herpes simplex virus 1 (HSV-1)-infected Nlrc3(-/-) mice exhibited enhanced innate immunity and reduced morbidity and viral load. This demonstrates the intersection of two key pathways of innate immune regulation, NLR and STING, to fine tune host response to intracellular DNA, DNA virus, and c-di-GMP. Copyright © 2014 Elsevier Inc. All rights reserved.

Structural and Functional Analysis of the Signal-Transducing Linker in the pH-Responsive One-Component System CadC of Escherichia coli.

PubMed

Buchner, Sophie; Schlundt, Andreas; Lassak, Jürgen; Sattler, Michael; Jung, Kirsten

2015-07-31

The pH-responsive one-component signaling system CadC in Escherichia coli belongs to the family of ToxR-like proteins, whose members share a conserved modular structure, with an N-terminal cytoplasmic winged helix-turn-helix DNA-binding domain being followed by a single transmembrane helix and a C-terminal periplasmic pH-sensing domain. In E. coli CadC, a cytoplasmic linker comprising approximately 50 amino acids is essential for transmission of the signal from the sensor to the DNA-binding domain. However, the mechanism of transduction is poorly understood. Using NMR spectroscopy, we demonstrate here that the linker region is intrinsically disordered in solution. Furthermore, mutational analyses showed that it tolerates a range of amino acid substitutions (altering polarity, rigidity and α-helix-forming propensity), is robust to extension but is sensitive to truncation. Indeed, truncations either reversed the expression profile of the target operon cadBA or decoupled expression from external pH altogether. CadC dimerizes via its periplasmic domain, but light-scattering analysis provided no evidence for dimerization of the isolated DNA-binding domain, with or without the linker region. However, bacterial two-hybrid analysis revealed that CadC forms stable dimers in a stimulus- and linker-dependent manner, interacting only at pH<6.8. Strikingly, a variant with inversed cadBA expression profile, which lacks most of the linker, dimerizes preferentially at higher pH. Thus, we propose that the disordered CadC linker is required for transducing the pH-dependent response of the periplasmic sensor into a structural rearrangement that facilitates dimerization of the cytoplasmic CadC DNA-binding domain. Copyright © 2015 Elsevier Ltd. All rights reserved.

Single-stranded DNA Binding by the Helix-Hairpin-Helix Domain of XPF Protein Contributes to the Substrate Specificity of the ERCC1-XPF Protein Complex*

PubMed Central

Das, Devashish; Faridounnia, Maryam; Kovacic, Lidija; Kaptein, Robert; Boelens, Rolf; Folkers, Gert E.

2017-01-01

The nucleotide excision repair protein complex ERCC1-XPF is required for incision of DNA upstream of DNA damage. Functional studies have provided insights into the binding of ERCC1-XPF to various DNA substrates. However, because no structure for the ERCC1-XPF-DNA complex has been determined, the mechanism of substrate recognition remains elusive. Here we biochemically characterize the substrate preferences of the helix-hairpin-helix (HhH) domains of XPF and ERCC-XPF and show that the binding to single-stranded DNA (ssDNA)/dsDNA junctions is dependent on joint binding to the DNA binding domain of ERCC1 and XPF. We reveal that the homodimeric XPF is able to bind various ssDNA sequences but with a clear preference for guanine-containing substrates. NMR titration experiments and in vitro DNA binding assays also show that, within the heterodimeric ERCC1-XPF complex, XPF specifically recognizes ssDNA. On the other hand, the HhH domain of ERCC1 preferentially binds dsDNA through the hairpin region. The two separate non-overlapping DNA binding domains in the ERCC1-XPF heterodimer jointly bind to an ssDNA/dsDNA substrate and, thereby, at least partially dictate the incision position during damage removal. Based on structural models, NMR titrations, DNA-binding studies, site-directed mutagenesis, charge distribution, and sequence conservation, we propose that the HhH domain of ERCC1 binds to dsDNA upstream of the damage, and XPF binds to the non-damaged strand within a repair bubble. PMID:28028171

Spectroscopic studies on the interaction of sodium benzoate, a food preservative, with calf thymus DNA.

PubMed

Zhang, Guowen; Ma, Yadi

2013-11-01

The interaction between sodium benzoate (SB) and calf thymus DNA in simulated physiological buffer (pH 7.4) using acridine orange (AO) dye as a fluorescence probe, was investigated by UV-Vis absorption, fluorescence and circular dichroism (CD) spectroscopy along with DNA melting studies and viscosity measurements. An expanded UV-Vis spectral data matrix was resolved by multivariate curve resolution-alternating least squares (MCR-ALS) approach. The equilibrium concentration profiles and the pure spectra for SB, DNA and DNA-SB complex from the high overlapping composite response were simultaneously obtained. The results indicated that SB could bind to DNA, and hydrophobic interactions and hydrogen bonds played a vital role in the binding process. Moreover, SB was able to quench the fluorescence of DNA-AO complex through a static procedure. The quenching observed was indicative of an intercalative mode of interaction between SB and DNA, which was supported by melting studies, viscosity measurements and CD analysis. Copyright © 2013 Elsevier Ltd. All rights reserved.

Leptospira interrogans serovar copenhageni harbors two lexA genes involved in SOS response.

PubMed

Fonseca, Luciane S; da Silva, Josefa B; Milanez, Juliana S; Monteiro-Vitorello, Claudia B; Momo, Leonardo; de Morais, Zenaide M; Vasconcellos, Silvio A; Marques, Marilis V; Ho, Paulo L; da Costa, Renata M A

2013-01-01

Bacteria activate a regulatory network in response to the challenges imposed by DNA damage to genetic material, known as the SOS response. This system is regulated by the RecA recombinase and by the transcriptional repressor lexA. Leptospira interrogans is a pathogen capable of surviving in the environment for weeks, being exposed to a great variety of stress agents and yet retaining its ability to infect the host. This study aims to investigate the behavior of L. interrogans serovar Copenhageni after the stress induced by DNA damage. We show that L. interrogans serovar Copenhageni genome contains two genes encoding putative LexA proteins (lexA1 and lexA2) one of them being potentially acquired by lateral gene transfer. Both genes are induced after DNA damage, but the steady state levels of both LexA proteins drop, probably due to auto-proteolytic activity triggered in this condition. In addition, seven other genes were up-regulated following UV-C irradiation, recA, recN, dinP, and four genes encoding hypothetical proteins. This set of genes is potentially regulated by LexA1, as it showed binding to their promoter regions. All these regions contain degenerated sequences in relation to the previously described SOS box, TTTGN 5CAAA. On the other hand, LexA2 was able to bind to the palindrome TTGTAN10TACAA, found in its own promoter region, but not in the others. Therefore, the L. interrogans serovar Copenhageni SOS regulon may be even more complex, as a result of LexA1 and LexA2 binding to divergent motifs. New possibilities for DNA damage response in Leptospira are expected, with potential influence in other biological responses such as virulence.

Leptospira interrogans serovar Copenhageni Harbors Two lexA Genes Involved in SOS Response

PubMed Central

Fonseca, Luciane S.; da Silva, Josefa B.; Milanez, Juliana S.; Monteiro-Vitorello, Claudia B.; Momo, Leonardo; de Morais, Zenaide M.; Vasconcellos, Silvio A.; Marques, Marilis V.; Ho, Paulo L.; da Costa, Renata M. A.

2013-01-01

Bacteria activate a regulatory network in response to the challenges imposed by DNA damage to genetic material, known as the SOS response. This system is regulated by the RecA recombinase and by the transcriptional repressor lexA. Leptospira interrogans is a pathogen capable of surviving in the environment for weeks, being exposed to a great variety of stress agents and yet retaining its ability to infect the host. This study aims to investigate the behavior of L. interrogans serovar Copenhageni after the stress induced by DNA damage. We show that L. interrogans serovar Copenhageni genome contains two genes encoding putative LexA proteins (lexA1 and lexA2) one of them being potentially acquired by lateral gene transfer. Both genes are induced after DNA damage, but the steady state levels of both LexA proteins drop, probably due to auto-proteolytic activity triggered in this condition. In addition, seven other genes were up-regulated following UV-C irradiation, recA, recN, dinP, and four genes encoding hypothetical proteins. This set of genes is potentially regulated by LexA1, as it showed binding to their promoter regions. All these regions contain degenerated sequences in relation to the previously described SOS box, TTTGN 5CAAA. On the other hand, LexA2 was able to bind to the palindrome TTGTAN 10TACAA, found in its own promoter region, but not in the others. Therefore, the L. interrogans serovar Copenhageni SOS regulon may be even more complex, as a result of LexA1 and LexA2 binding to divergent motifs. New possibilities for DNA damage response in Leptospira are expected, with potential influence in other biological responses such as virulence. PMID:24098496

BuD, a helix–loop–helix DNA-binding domain for genome modification

PubMed Central

Stella, Stefano; Molina, Rafael; López-Méndez, Blanca; Juillerat, Alexandre; Bertonati, Claudia; Daboussi, Fayza; Campos-Olivas, Ramon; Duchateau, Phillippe; Montoya, Guillermo

2014-01-01

DNA editing offers new possibilities in synthetic biology and biomedicine for modulation or modification of cellular functions to organisms. However, inaccuracy in this process may lead to genome damage. To address this important problem, a strategy allowing specific gene modification has been achieved through the addition, removal or exchange of DNA sequences using customized proteins and the endogenous DNA-repair machinery. Therefore, the engineering of specific protein–DNA interactions in protein scaffolds is key to providing ‘toolkits’ for precise genome modification or regulation of gene expression. In a search for putative DNA-binding domains, BurrH, a protein that recognizes a 19 bp DNA target, was identified. Here, its apo and DNA-bound crystal structures are reported, revealing a central region containing 19 repeats of a helix–loop–helix modular domain (BurrH domain; BuD), which identifies the DNA target by a single residue-to-nucleotide code, thus facilitating its redesign for gene targeting. New DNA-binding specificities have been engineered in this template, showing that BuD-derived nucleases (BuDNs) induce high levels of gene targeting in a locus of the human haemoglobin β (HBB) gene close to mutations responsible for sickle-cell anaemia. Hence, the unique combination of high efficiency and specificity of the BuD arrays can push forward diverse genome-modification approaches for cell or organism redesign, opening new avenues for gene editing. PMID:25004980

Abnormal expression and functional characteristics of cyclic adenosine monophosphate response element binding protein in postmortem brain of suicide subjects.

PubMed

Dwivedi, Yogesh; Rao, Jagadeesh Sridhara; Rizavi, Hooriyah S; Kotowski, Jacek; Conley, Robert R; Roberts, Rosalinda C; Tamminga, Carol A; Pandey, Ghanshyam N

2003-03-01

Cyclic adenosine monophosphate response element binding protein (CREB) is a transcription factor that, on phosphorylation by protein kinases, is activated, and in response, regulates the transcription of many neuronally expressed genes. In view of the recent observations that catalytic properties and/or expression of many kinases that mediate their physiological responses through the activation of CREB are altered in the postmortem brain of subjects who commit suicide (hereafter referred to as suicide subjects), we examined the status of CREB in suicidal behavior. These studies were performed in Brodmann area (BA) 9 and hippocampus obtained from 26 suicide subjects and 20 nonpsychiatric healthy control subjects. Messenger RNA levels of CREB and neuron-specific enolase were determined in total RNA by means of quantitative reverse transcriptase-polymerase chain reaction. Protein levels and the functional characteristics of CREB were determined in nuclear fractions by means of Western blot and cyclic adenosine monophosphate response element (CRE)-DNA binding activity, respectively. In the same nuclear fraction, we determined the catalytic activity of cyclic adenosine monophosphate-stimulated protein kinase A by means of enzymatic assay. We observed a significant reduction in messenger RNA and protein levels of CREB, CRE-DNA binding activity, and basal and cyclic adenosine monophosphate-stimulated protein kinase A activity in BA 9 and hippocampus of suicide subjects, without any change in messenger RNA levels of neuron-specific enolase in BA 9. Except for protein kinase A activity, changes in CREB expression and CRE-DNA binding activity were present in all suicide subjects, irrespective of diagnosis. These changes were unrelated to postmortem intervals, age, sex, or antidepressant treatment. Given the significance of CREB in mediating various physiological functions through gene transcription, our results of decreased expression and functional characteristics of CREB in postmortem brain of suicide subjects suggest that CREB may play an important role in suicidal behavior.

Transcriptional activation of the Escherichia coli adaptive response gene aidB is mediated by binding of methylated Ada protein. Evidence for a new consensus sequence for Ada-binding sites.

PubMed

Landini, P; Volkert, M R

1995-04-07

The Escherichia coli aidB gene is part of the adaptive response to DNA methylation damage. Genes belonging to the adaptive response are positively regulated by the ada gene; the Ada protein acts as a transcriptional activator when methylated in one of its cysteine residues at position 69. Through DNaseI protection assays, we show that methylated Ada (meAda) is able to bind a DNA sequence between 40 and 60 base pairs upstream of the aidB transcriptional startpoint. Binding of meAda is necessary to activate transcription of the adaptive response genes; accordingly, in vitro transcription of aidB is dependent on the presence of meAda. Unmethylated Ada protein shows no protection against DNaseI digestion in the aidB promoter region nor does it promote aidB in vitro transcription. The aidB Ada-binding site shows only weak homology to the proposed consensus sequences for Ada-binding sites in E. coli (AAANNAA and AAAGCGCA) but shares a higher degree of similarity with the Ada-binding regions from other bacterial species, such as Salmonella typhimurium and Bacillus subtilis. Based on the comparison of five different Ada-dependent promoter regions, we suggest that a possible recognition sequence for meAda might be AATnnnnnnG-CAA. Higher concentrations of Ada are required for the binding of aidB than for the ada promoter, suggesting lower affinity of the protein for the aidB Ada-binding site. Common features in the Ada-binding regions of ada and aidB are a high A/T content, the presence of an inverted repeat structure, and their position relative to the transcriptional start site. We propose that these elements, in addition to the proposed recognition sequence, are important for binding of the Ada protein.

BPF-1, a pathogen-induced DNA-binding protein involved in the plant defense response.

PubMed

da Costa e Silva, O; Klein, L; Schmelzer, E; Trezzini, G F; Hahlbrock, K

1993-07-01

The mechanisms by which plants restrict the growth of pathogens include transient activation of numerous defense-related genes. Box P is a putative cis-acting element of a distinct group of such genes, including those encoding the enzyme phenylalanine ammonialyase (PAL). A DNA-binding activity to Box P was identified in nuclear extracts from cultured parsley cells and a cDNA encoding the protein BPF-1 (Box P-binding Factor) partially characterized. BPF-1 binds to this element with specificity similar to that of the binding activity in nuclear extracts. BPF-1 mRNA accumulates rapidly in elicitor-treated parsley cells and around fungal infection sites on parsley leaves. This accumulation is, at least partly, due to a rapid and transient increase in the transcription rate of BPF-1. Moreover, tight correlation between the relative amounts of BPF-1 and PAL mRNAs was observed in different organs of a parsley plant. These results are consistent with the hypothesis that BPF-1 is involved in disease resistance by modulating plant defense gene expression.

Role of promoter DNA sequence variations on the binding of EGR1 transcription factor.

PubMed

Mikles, David C; Schuchardt, Brett J; Bhat, Vikas; McDonald, Caleb B; Farooq, Amjad

2014-05-01

In response to a wide variety of stimuli such as growth factors and hormones, EGR1 transcription factor is rapidly induced and immediately exerts downstream effects central to the maintenance of cellular homeostasis. Herein, our biophysical analysis reveals that DNA sequence variations within the target gene promoters tightly modulate the energetics of binding of EGR1 and that nucleotide substitutions at certain positions are much more detrimental to EGR1-DNA interaction than others. Importantly, the reduction in binding affinity poorly correlates with the loss of enthalpy and gain of entropy-a trend indicative of a complex interplay between underlying thermodynamic factors due to the differential role of water solvent upon nucleotide substitution. We also provide a rationale for the physical basis of the effect of nucleotide substitutions on the EGR1-DNA interaction at atomic level. Taken together, our study bears important implications on understanding the molecular determinants of a key protein-DNA interaction at the cross-roads of human health and disease. Copyright © 2014 Elsevier Inc. All rights reserved.

A Systematic Analysis of Factors Localized to Damaged Chromatin Reveals PARP-Dependent Recruitment of Transcription Factors.

PubMed

Izhar, Lior; Adamson, Britt; Ciccia, Alberto; Lewis, Jedd; Pontano-Vaites, Laura; Leng, Yumei; Liang, Anthony C; Westbrook, Thomas F; Harper, J Wade; Elledge, Stephen J

2015-06-09

Localization to sites of DNA damage is a hallmark of DNA damage response (DDR) proteins. To identify DDR factors, we screened epitope-tagged proteins for localization to sites of chromatin damaged by UV laser microirradiation and found >120 proteins that localize to damaged chromatin. These include the BAF tumor suppressor complex and the amyotrophic lateral sclerosis (ALS) candidate protein TAF15. TAF15 contains multiple domains that bind damaged chromatin in a poly-(ADP-ribose) polymerase (PARP)-dependent manner, suggesting a possible role as glue that tethers multiple PAR chains together. Many positives were transcription factors; > 70% of randomly tested transcription factors localized to sites of DNA damage, and of these, ∼90% were PARP dependent for localization. Mutational analyses showed that localization to damaged chromatin is DNA-binding-domain dependent. By examining Hoechst staining patterns at damage sites, we see evidence of chromatin decompaction that is PARP dependent. We propose that PARP-regulated chromatin remodeling at sites of damage allows transient accessibility of DNA-binding proteins. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

Recovery from DNA damage-induced G2 arrest requires actin-binding protein filamin-A/actin-binding protein 280.

PubMed

Meng, Xiangbing; Yuan, Yuan; Maestas, Adrian; Shen, Zhiyuan

2004-02-13

Filamin-A (filamin-1) is an actin-binding protein involved in the organization of actin networks. Our previous study shows that filamin-A interacts with BRCA2, and lack of filamin-A expression results in increased cellular sensitivity to several DNA damaging agents in melanoma cells (Yuan, Y., and Shen, Z. (2001) J. Biol. Chem. 276, 48318-48324), suggesting a role of filamin-A in DNA damage response. In this report, we demonstrated that deficiency of filamin-A results in an 8-h delay in the recovery from G2 arrest in response to ionizing radiation. However, filamin-A deficiency does not affect the initial activation of the G2/M checkpoint. We also found that filamin-A deficiency results in sustained activation of Chk1 and Chk2 after irradiation. This in turn causes a delay in the dephosphorylation of phospho-Cdc2, which is inhibitory to the G2/M transition. In addition, filamin-A-deficient M2 cells undergo mitotic catastrophe-related nuclear fragmentation after they are released from the G2 arrest. Together, these data suggest a functional role of filamin-A in the recovery from G2 arrest and subsequent mitotic cell death after DNA damage.

RPA-Binding Protein ETAA1 Is an ATR Activator Involved in DNA Replication Stress Response.

PubMed

Lee, Yuan-Cho; Zhou, Qing; Chen, Junjie; Yuan, Jingsong

2016-12-19

ETAA1 (Ewing tumor-associated antigen 1), also known as ETAA16, was identified as a tumor-specific antigen in the Ewing family of tumors. However, the biological function of this protein remains unknown. Here, we report the identification of ETAA1 as a DNA replication stress response protein. ETAA1 specifically interacts with RPA (Replication protein A) via two conserved RPA-binding domains and is therefore recruited to stalled replication forks. Interestingly, further analysis of ETAA1 function revealed that ETAA1 participates in the activation of ATR signaling pathway via a conserved ATR-activating domain (AAD) located near its N terminus. Importantly, we demonstrate that both RPA binding and ATR activation are required for ETAA1 function at stalled replication forks to maintain genome stability. Therefore, our data suggest that ETAA1 is a new ATR activator involved in replication checkpoint control. Copyright © 2016 Elsevier Ltd. All rights reserved.

Cyclic Peptidic Mimetics of Apollo Peptides Targeting Telomeric Repeat Binding Factor 2 (TRF2) and Apollo Interaction.

PubMed

Chen, Xia; Liu, Liu; Chen, Yong; Yang, Yuting; Yang, Chao-Yie; Guo, Tianyue; Lei, Ming; Sun, Haiying; Wang, Shaomeng

2018-05-10

Telomeric repeat binding factor 2 (TRF2) is a telomere-associated protein that plays an important role in the formation of the 3' single strand DNA overhang and the "T loop", two structures critical for the stability of the telomeres. Apollo is a 5'-exonuclease recruited by TRF2 to the telomere and contributes to the formation of the 3' single strand DNA overhang. Knocking down of Apollo can induce DNA damage response similar to that caused by the knocking down of TRF2. In this Letter, we report the design and synthesis of a class of cyclic peptidic mimetics of the TRFH binding motif of Apollo (Apollo TBM ). We found conformational control of the C terminal residues of Apollo TBM can effectively improve the binding affinity. We have obtained a crystal structure of a cyclic peptidic Apollo peptide mimetic ( 34 ) complexed with TRF2, which provides valuable guidance to the future design of TRF2 inhibitors.

Mutations on the DNA Binding Surface of TBP Discriminate between Yeast TATA and TATA-Less Gene Transcription

PubMed Central

Kamenova, Ivanka; Warfield, Linda

2014-01-01

Most RNA polymerase (Pol) II promoters lack a TATA element, yet nearly all Pol II transcription requires TATA binding protein (TBP). While the TBP-TATA interaction is critical for transcription at TATA-containing promoters, it has been unclear whether TBP sequence-specific DNA contacts are required for transcription at TATA-less genes. Transcription factor IID (TFIID), the TBP-containing coactivator that functions at most TATA-less genes, recognizes short sequence-specific promoter elements in metazoans, but analogous promoter elements have not been identified in Saccharomyces cerevisiae. We generated a set of mutations in the yeast TBP DNA binding surface and found that most support growth of yeast. Both in vivo and in vitro, many of these mutations are specifically defective for transcription of two TATA-containing genes with only minor defects in transcription of two TATA-less, TFIID-dependent genes. TBP binds several TATA-less promoters with apparent high affinity, but our results suggest that this binding is not important for transcription activity. Our results are consistent with the model that sequence-specific TBP-DNA contacts are not important at yeast TATA-less genes and suggest that other general transcription factors or coactivator subunits are responsible for recognition of TATA-less promoters. Our results also explain why yeast TBP derivatives defective for TATA binding appear defective in activated transcription. PMID:24865972

Mutations on the DNA binding surface of TBP discriminate between yeast TATA and TATA-less gene transcription.

PubMed

Kamenova, Ivanka; Warfield, Linda; Hahn, Steven

2014-08-01

Most RNA polymerase (Pol) II promoters lack a TATA element, yet nearly all Pol II transcription requires TATA binding protein (TBP). While the TBP-TATA interaction is critical for transcription at TATA-containing promoters, it has been unclear whether TBP sequence-specific DNA contacts are required for transcription at TATA-less genes. Transcription factor IID (TFIID), the TBP-containing coactivator that functions at most TATA-less genes, recognizes short sequence-specific promoter elements in metazoans, but analogous promoter elements have not been identified in Saccharomyces cerevisiae. We generated a set of mutations in the yeast TBP DNA binding surface and found that most support growth of yeast. Both in vivo and in vitro, many of these mutations are specifically defective for transcription of two TATA-containing genes with only minor defects in transcription of two TATA-less, TFIID-dependent genes. TBP binds several TATA-less promoters with apparent high affinity, but our results suggest that this binding is not important for transcription activity. Our results are consistent with the model that sequence-specific TBP-DNA contacts are not important at yeast TATA-less genes and suggest that other general transcription factors or coactivator subunits are responsible for recognition of TATA-less promoters. Our results also explain why yeast TBP derivatives defective for TATA binding appear defective in activated transcription. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

Crystal Structure of the Chromodomain Helicase DNA-binding Protein 1 (Chd1) DNA-binding Domain in Complex with DNA*

PubMed Central

Sharma, Amit; Jenkins, Katherine R.; Héroux, Annie; Bowman, Gregory D.

2011-01-01

Chromatin remodelers are ATP-dependent machines that dynamically alter the chromatin packaging of eukaryotic genomes by assembling, sliding, and displacing nucleosomes. The Chd1 chromatin remodeler possesses a C-terminal DNA-binding domain that is required for efficient nucleosome sliding and believed to be essential for sensing the length of DNA flanking the nucleosome core. The structure of the Chd1 DNA-binding domain was recently shown to consist of a SANT and SLIDE domain, analogous to the DNA-binding domain of the ISWI family, yet the details of how Chd1 recognized DNA were not known. Here we present the crystal structure of the Saccharomyces cerevisiae Chd1 DNA-binding domain in complex with a DNA duplex. The bound DNA duplex is straight, consistent with the preference exhibited by the Chd1 DNA-binding domain for extranucleosomal DNA. Comparison of this structure with the recently solved ISW1a DNA-binding domain bound to DNA reveals that DNA lays across each protein at a distinct angle, yet contacts similar surfaces on the SANT and SLIDE domains. In contrast to the minor groove binding seen for Isw1 and predicted for Chd1, the SLIDE domain of the Chd1 DNA-binding domain contacts the DNA major groove. The majority of direct contacts with the phosphate backbone occur only on one DNA strand, suggesting that Chd1 may not strongly discriminate between major and minor grooves. PMID:22033927

Characterization of protein--DNA interactions using surface plasmon resonance spectroscopy with various assay schemes.

PubMed

Teh, Huey Fang; Peh, Wendy Y X; Su, Xiaodi; Thomsen, Jane S

2007-02-27

Specific protein-DNA interactions play a central role in transcription and other biological processes. A comprehensive characterization of protein-DNA interactions should include information about binding affinity, kinetics, sequence specificity, and binding stoichiometry. In this study, we have used surface plasmon resonance spectroscopy (SPR) to study the interactions between human estrogen receptors (ER, alpha and beta subtypes) and estrogen response elements (ERE), with four assay schemes. First, we determined the sequence-dependent receptors' binding capacity by monitoring the binding of ER to various ERE sequences immobilized on a sensor surface (assay format denoted as the direct assay). Second, we screened the relative affinity of ER for various ERE sequences using a competition assay, in which the receptors bind to an ERE-immobilized surface in the presence of competitor ERE sequences. Third, we monitored the assembly of ER-ERE complexes on a SPR surface and thereafter the removal and/or dissociation of the ER (assay scheme denoted as the dissociation assay) to determine the binding stoichiometry. Last, a sandwich assay (ER binding to ERE followed by anti-ER recognition of a specific ER subtype) was performed in an effort to understand how ERalpha and ERbeta may associate and compete when binding to the DNA. With these assay schemes, we reaffirmed that (1) ERalpha is more sensitive than ERbeta to base pair change(s) in the consensus ERE, (2) ERalpha and ERbeta form a heterodimer when they bind to the consensus ERE, and (3) the binding stoichiometry of both ERalpha- and ERbeta-ERE complexes is dependent on salt concentration. With this study, we demonstrate the versatility of the SPR analysis. With the involvement of various assay arrangements, the SPR analysis can be further extended to more than kinetics and affinity study.

Characterization of the DNA binding properties of polyomavirus capsid protein

NASA Technical Reports Server (NTRS)

Chang, D.; Cai, X.; Consigli, R. A.; Spooner, B. S. (Principal Investigator)

1993-01-01

The DNA binding properties of the polyomavirus structural proteins VP1, VP2, and VP3 were studied by Southwestern analysis. The major viral structural protein VP1 and host-contributed histone proteins of polyomavirus virions were shown to exhibit DNA binding activity, but the minor capsid proteins VP2 and VP3 failed to bind DNA. The N-terminal first five amino acids (Ala-1 to Lys-5) were identified as the VP1 DNA binding domain by genetic and biochemical approaches. Wild-type VP1 expressed in Escherichia coli (RK1448) exhibited DNA binding activity, but the N-terminal truncated VP1 mutants (lacking Ala-1 to Lys-5 and Ala-1 to Cys-11) failed to bind DNA. The synthetic peptide (Ala-1 to Cys-11) was also shown to have an affinity for DNA binding. Site-directed mutagenesis of the VP1 gene showed that the point mutations at Pro-2, Lys-3, and Arg-4 on the VP1 molecule did not affect DNA binding properties but that the point mutation at Lys-5 drastically reduced DNA binding affinity. The N-terminal (Ala-1 to Lys-5) region of VP1 was found to be essential and specific for DNA binding, while the DNA appears to be non-sequence specific. The DNA binding domain and the nuclear localization signal are located in the same N-terminal region.

Destabilization of the MutSα's protein-protein interface due to binding to the DNA adduct induced by anticancer agent carboplatin via molecular dynamics simulations.

PubMed

Negureanu, Lacramioara; Salsbury, Freddie R

2013-11-01

DNA mismatch repair (MMR) proteins maintain genetic integrity in all organisms by recognizing and repairing DNA errors. Such alteration of hereditary information can lead to various diseases, including cancer. Besides their role in DNA repair, MMR proteins detect and initiate cellular responses to certain type of DNA damage. Its response to the damaged DNA has made the human MMR pathway a useful target for anticancer agents such as carboplatin. This study indicates that strong, specific interactions at the interface of MutSα in response to the mismatched DNA recognition are replaced by weak, non-specific interactions in response to the damaged DNA recognition. Data suggest a severe impairment of the dimerization of MutSα in response to the damaged DNA recognition. While the core of MutSα is preserved in response to the damaged DNA recognition, the loss of contact surface and the rearrangement of contacts at the protein interface suggest a different packing in response to the damaged DNA recognition. Coupled in response to the mismatched DNA recognition, interaction energies, hydrogen bonds, salt bridges, and solvent accessible surface areas at the interface of MutSα and within the subunits are uncoupled or asynchronously coupled in response to the damaged DNA recognition. These pieces of evidence suggest that the loss of a synchronous mode of response in the MutSα's surveillance for DNA errors would possibly be one of the mechanism(s) of signaling the MMR-dependent programed cell death much wanted in anticancer therapies. The analysis was drawn from dynamics simulations.

Quantitative characterization of conformational-specific protein-DNA binding using a dual-spectral interferometric imaging biosensor

NASA Astrophysics Data System (ADS)

Zhang, Xirui; Daaboul, George G.; Spuhler, Philipp S.; Dröge, Peter; Ünlü, M. Selim

2016-03-01

DNA-binding proteins play crucial roles in the maintenance and functions of the genome and yet, their specific binding mechanisms are not fully understood. Recently, it was discovered that DNA-binding proteins recognize specific binding sites to carry out their functions through an indirect readout mechanism by recognizing and capturing DNA conformational flexibility and deformation. High-throughput DNA microarray-based methods that provide large-scale protein-DNA binding information have shown effective and comprehensive analysis of protein-DNA binding affinities, but do not provide information of DNA conformational changes in specific protein-DNA complexes. Building on the high-throughput capability of DNA microarrays, we demonstrate a quantitative approach that simultaneously measures the amount of protein binding to DNA and nanometer-scale DNA conformational change induced by protein binding in a microarray format. Both measurements rely on spectral interferometry on a layered substrate using a single optical instrument in two distinct modalities. In the first modality, we quantitate the amount of binding of protein to surface-immobilized DNA in each DNA spot using a label-free spectral reflectivity technique that accurately measures the surface densities of protein and DNA accumulated on the substrate. In the second modality, for each DNA spot, we simultaneously measure DNA conformational change using a fluorescence vertical sectioning technique that determines average axial height of fluorophores tagged to specific nucleotides of the surface-immobilized DNA. The approach presented in this paper, when combined with current high-throughput DNA microarray-based technologies, has the potential to serve as a rapid and simple method for quantitative and large-scale characterization of conformational specific protein-DNA interactions.DNA-binding proteins play crucial roles in the maintenance and functions of the genome and yet, their specific binding mechanisms are not fully understood. Recently, it was discovered that DNA-binding proteins recognize specific binding sites to carry out their functions through an indirect readout mechanism by recognizing and capturing DNA conformational flexibility and deformation. High-throughput DNA microarray-based methods that provide large-scale protein-DNA binding information have shown effective and comprehensive analysis of protein-DNA binding affinities, but do not provide information of DNA conformational changes in specific protein-DNA complexes. Building on the high-throughput capability of DNA microarrays, we demonstrate a quantitative approach that simultaneously measures the amount of protein binding to DNA and nanometer-scale DNA conformational change induced by protein binding in a microarray format. Both measurements rely on spectral interferometry on a layered substrate using a single optical instrument in two distinct modalities. In the first modality, we quantitate the amount of binding of protein to surface-immobilized DNA in each DNA spot using a label-free spectral reflectivity technique that accurately measures the surface densities of protein and DNA accumulated on the substrate. In the second modality, for each DNA spot, we simultaneously measure DNA conformational change using a fluorescence vertical sectioning technique that determines average axial height of fluorophores tagged to specific nucleotides of the surface-immobilized DNA. The approach presented in this paper, when combined with current high-throughput DNA microarray-based technologies, has the potential to serve as a rapid and simple method for quantitative and large-scale characterization of conformational specific protein-DNA interactions. Electronic supplementary information (ESI) available: DNA sequences and nomenclature (Table 1S); SDS-PAGE assay of IHF stock solution (Fig. 1S); determination of the concentration of IHF stock solution by Bradford assay (Fig. 2S); equilibrium binding isotherm fitting results of other DNA sequences (Table 2S); calculation of dissociation constants (Fig. 3S, 4S; Table 2S); geometric model for quantitation of DNA bending angle induced by specific IHF binding (Fig. 4S); customized flow cell assembly (Fig. 5S); real-time measurement of average fluorophore height change by SSFM (Fig. 6S); summary of binding parameters obtained from additive isotherm model fitting (Table 3S); average surface densities of 10 dsDNA spots and bound IHF at equilibrium (Table 4S); effects of surface densities on the binding and bending of dsDNA (Tables 5S, 6S and Fig. 7S-10S). See DOI: 10.1039/c5nr06785e

DNA binding of a proflavine derivative bearing a platinum hanging residue.

PubMed

Biagini, Silvia; Bianchi, Antonio; Biver, Tarita; Boggioni, Alessia; Nikolayenko, Igor V; Secco, Fernando; Venturini, Marcella

2011-04-01

New platinum(II) complex of 3,6-diamine-9-[6,6-bis(2-aminohethyl)-1,6-diaminohexyl]acridine, AzaPt, has been synthesised and characterised. Behaviour of AzaPt in solution (protonation and possible self-aggregation phenomena) has been investigated by spectral methods (absorbance and fluorescence) at I=0.1M and 25°C, and the equilibrium parameters of binding to calf thymus DNA have been established. Two different modes of DNA binding by the complex were detected, which depend on the polymer to dye molar ratio (P/D). At relatively low P/D values the mode was interpreted as binding by the polyamine residue external to the base pairs, while at high P/D values the binding corresponds to intercalation of the proflavine residue. Such interpretation is supported by the observed salt effect on binding and the temperature variation of the binding constants, which allowed estimating the ΔH and ΔS values contributions. Spectrophotometric analysis of the long time range binding revealed that AzaPt is involved in a slow reaction, interpreted as an attack by the platinum ion on the nucleobases. The time constant for such interaction was calculated and found to be the same order of magnitude as for processes responsible for the action of anti-tumour drugs that do covalently bind to polynucleotides. Copyright © 2010 Elsevier Inc. All rights reserved.

Replication Protein A Presents Canonical Functions and Is Also Involved in the Differentiation Capacity of Trypanosoma cruzi

PubMed Central

Pavani, Raphael Souza; da Silva, Marcelo Santos; Fernandes, Carlos Alexandre Henrique; Morini, Flavia Souza; Araujo, Christiane Bezerra; Fontes, Marcos Roberto de Mattos; Sant’Anna, Osvaldo Augusto; Machado, Carlos Renato; Cano, Maria Isabel; Fragoso, Stenio Perdigão; Elias, Maria Carolina

2016-01-01

Replication Protein A (RPA), the major single stranded DNA binding protein in eukaryotes, is composed of three subunits and is a fundamental player in DNA metabolism, participating in replication, transcription, repair, and the DNA damage response. In human pathogenic trypanosomatids, only limited studies have been performed on RPA-1 from Leishmania. Here, we performed in silico, in vitro and in vivo analysis of Trypanosoma cruzi RPA-1 and RPA-2 subunits. Although computational analysis suggests similarities in DNA binding and Ob-fold structures of RPA from T. cruzi compared with mammalian and fungi RPA, the predicted tridimensional structures of T. cruzi RPA-1 and RPA-2 indicated that these molecules present a more flexible tertiary structure, suggesting that T. cruzi RPA could be involved in additional responses. Here, we demonstrate experimentally that the T. cruzi RPA complex interacts with DNA via RPA-1 and is directly related to canonical functions, such as DNA replication and DNA damage response. Accordingly, a reduction of TcRPA-2 expression by generating heterozygous knockout cells impaired cell growth, slowing down S-phase progression. Moreover, heterozygous knockout cells presented a better efficiency in differentiation from epimastigote to metacyclic trypomastigote forms and metacyclic trypomastigote infection. Taken together, these findings indicate the involvement of TcRPA in the metacyclogenesis process and suggest that a delay in cell cycle progression could be linked with differentiation in T. cruzi. PMID:27984589

Biomimetic glass nanopores employing aptamer gates responsive to a small molecule†

PubMed Central

Abelow, Alexis E.; Schepelina, Olga; White, Ryan J.; Vallée-Bélisle, Alexis

2011-01-01

We report the preparation of 20 and 65 nm radii glass nanopores whose surface is modified with DNA aptamers controlling the molecular transport through the nanopores in response to small molecule binding. PMID:20865192

Dynamic binding of replication protein a is required for DNA repair

PubMed Central

Chen, Ran; Subramanyam, Shyamal; Elcock, Adrian H.; Spies, Maria; Wold, Marc S.

2016-01-01

Replication protein A (RPA), the major eukaryotic single-stranded DNA (ssDNA) binding protein, is essential for replication, repair and recombination. High-affinity ssDNA-binding by RPA depends on two DNA binding domains in the large subunit of RPA. Mutation of the evolutionarily conserved aromatic residues in these two domains results in a separation-of-function phenotype: aromatic residue mutants support DNA replication but are defective in DNA repair. We used biochemical and single-molecule analyses, and Brownian Dynamics simulations to determine the molecular basis of this phenotype. Our studies demonstrated that RPA binds to ssDNA in at least two modes characterized by different dissociation kinetics. We also showed that the aromatic residues contribute to the formation of the longer-lived state, are required for stable binding to short ssDNA regions and are needed for RPA melting of partially duplex DNA structures. We conclude that stable binding and/or the melting of secondary DNA structures by RPA is required for DNA repair, including RAD51 mediated DNA strand exchange, but is dispensable for DNA replication. It is likely that the binding modes are in equilibrium and reflect dynamics in the RPA–DNA complex. This suggests that dynamic binding of RPA to DNA is necessary for different cellular functions. PMID:27131385

The substrate binding interface of alkylpurine DNA glycosylase AlkD.

PubMed

Mullins, Elwood A; Rubinson, Emily H; Eichman, Brandt F

2014-01-01

Tandem helical repeats have emerged as an important DNA binding architecture. DNA glycosylase AlkD, which excises N3- and N7-alkylated nucleobases, uses repeating helical motifs to bind duplex DNA and to selectively pause at non-Watson-Crick base pairs. Remodeling of the DNA backbone promotes nucleotide flipping of the lesion and the complementary base into the solvent and toward the protein surface, respectively. The important features of this new DNA binding architecture that allow AlkD to distinguish between damaged and normal DNA without contacting the lesion are poorly understood. Here, we show through extensive mutational analysis that DNA binding and N3-methyladenine (3mA) and N7-methylguanine (7mG) excision are dependent upon each residue lining the DNA binding interface. Disrupting electrostatic or hydrophobic interactions with the DNA backbone substantially reduced binding affinity and catalytic activity. These results demonstrate that residues seemingly only involved in general DNA binding are important for catalytic activity and imply that base excision is driven by binding energy provided by the entire substrate interface of this novel DNA binding architecture. Copyright © 2013 Elsevier B.V. All rights reserved.

Stoichiometry of DNA binding by the bacteriophage SP01-encoded type II DNA-binding protein TF1.

PubMed

Schneider, G J; Geiduschek, E P

1990-06-25

The stoichiometry of DNA binding by the bacteriophage SP01-encoded type II DNA-binding protein TF1 has been determined. 3H-Labeled TF1 was allowed to bind to a 32P-labeled DNA fragment containing a TF1 binding site. Multiple TF1-DNA complexes were resolved from each other and from unbound DNA by native gel electrophoresis. DNA-protein complexes were cut from polyacrylamide gels, and the amounts of 3H and 32P contained in each slice were measured. A ratio of 1.12 +/- 0.06 TF1 dimer/DNA molecule was calculated for the fastest-migrating TF1-DNA complex. We conclude that TF1 has a DNA-binding unit of one dimer. More slowly migrating complexes are apparently formed by serial addition of single TF1 dimers.

Mapping the interactions of the single-stranded DNA binding protein of bacteriophage T4 (gp32) with DNA lattices at single nucleotide resolution: polynucleotide binding and cooperativity

PubMed Central

Jose, Davis; Weitzel, Steven E.; Baase, Walter A.; Michael, Miya M.; von Hippel, Peter H.

2015-01-01

We here use our site-specific base analog mapping approach to study the interactions and binding equilibria of cooperatively-bound clusters of the single-stranded DNA binding protein (gp32) of the T4 DNA replication complex with longer ssDNA (and dsDNA) lattices. We show that in cooperatively bound clusters the binding free energy appears to be equi-partitioned between the gp32 monomers of the cluster, so that all bind to the ssDNA lattice with comparable affinity, but also that the outer domains of the gp32 monomers at the ends of the cluster can fluctuate on and off the lattice and that the clusters of gp32 monomers can slide along the ssDNA. We also show that at very low binding densities gp32 monomers bind to the ssDNA lattice at random, but that cooperatively bound gp32 clusters bind preferentially at the 5′-end of the ssDNA lattice. We use these results and the gp32 monomer-binding results of the companion paper to propose a detailed model for how gp32 might bind to and interact with ssDNA lattices in its various binding modes, and also consider how these clusters might interact with other components of the T4 DNA replication complex. PMID:26275774

Comparison between TRF2 and TRF1 of their telomeric DNA-bound structures and DNA-binding activities

PubMed Central

Hanaoka, Shingo; Nagadoi, Aritaka; Nishimura, Yoshifumi

2005-01-01

Mammalian telomeres consist of long tandem arrays of double-stranded telomeric TTAGGG repeats packaged by the telomeric DNA-binding proteins TRF1 and TRF2. Both contain a similar C-terminal Myb domain that mediates sequence-specific binding to telomeric DNA. In a DNA complex of TRF1, only the single Myb-like domain consisting of three helices can bind specifically to double-stranded telomeric DNA. TRF2 also binds to double-stranded telomeric DNA. Although the DNA binding mode of TRF2 is likely identical to that of TRF1, TRF2 plays an important role in the t-loop formation that protects the ends of telomeres. Here, to clarify the details of the double-stranded telomeric DNA-binding modes of TRF1 and TRF2, we determined the solution structure of the DNA-binding domain of human TRF2 bound to telomeric DNA; it consists of three helices, and like TRF1, the third helix recognizes TAGGG sequence in the major groove of DNA with the N-terminal arm locating in the minor groove. However, small but significant differences are observed; in contrast to the minor groove recognition of TRF1, in which an arginine residue recognizes the TT sequence, a lysine residue of TRF2 interacts with the TT part. We examined the telomeric DNA-binding activities of both DNA-binding domains of TRF1 and TRF2 and found that TRF1 binds more strongly than TRF2. Based on the structural differences of both domains, we created several mutants of the DNA-binding domain of TRF2 with stronger binding activities compared to the wild-type TRF2. PMID:15608118

ETS target genes: Identification of Egr1 as a target by RNA differential display and whole genome PCR techniques

PubMed Central

Robinson, Lois; Panayiotakis, Alexandra; Papas, Takis S.; Kola, Ismail; Seth, Arun

1997-01-01

ETS transcription factors play important roles in hematopoiesis, angiogenesis, and organogenesis during murine development. The ETS genes also have a role in neoplasia, for example in Ewing’s sarcomas and retrovirally induced cancers. The ETS genes encode transcription factors that bind to specific DNA sequences and activate transcription of various cellular and viral genes. To isolate novel ETS target genes, we used two approaches. In the first approach, we isolated genes by the RNA differential display technique. Previously, we have shown that the overexpression of ETS1 and ETS2 genes effects transformation of NIH 3T3 cells and specific transformants produce high levels of the ETS proteins. To isolate ETS1 and ETS2 responsive genes in these transformed cells, we prepared RNA from ETS1, ETS2 transformants, and normal NIH 3T3 cell lines and converted it into cDNA. This cDNA was amplified by PCR and displayed on sequencing gels. The differentially displayed bands were subcloned into plasmid vectors. By Northern blot analysis, several clones showed differential patterns of mRNA expression in the NIH 3T3-, ETS1-, and ETS2-expressing cell lines. Sixteen clones were analyzed by DNA sequence analysis, and 13 of them appeared to be unique because their DNA sequences did not match with any of the known genes present in the gene bank. Three known genes were found to be identical to the CArG box binding factor, phospholipase A2-activating protein, and early growth response 1 (Egr1) genes. In the second approach, to isolate ETS target promoters directly, we performed ETS1 binding with MboI-cleaved genomic DNA in the presence of a specific mAb followed by whole genome PCR. The immune complex-bound ETS binding sites containing DNA fragments were amplified and subcloned into pBluescript and subjected to DNA sequence and computer analysis. We found that, of a large number of clones isolated, 43 represented unique sequences not previously identified. Three clones turned out to contain regulatory sequences derived from human serglycin, preproapolipoprotein C II, and Egr1 genes. The ETS binding sites derived from these three regulatory sequences showed specific binding with recombinant ETS proteins. Of interest, Egr1 was identified by both of these techniques, suggesting strongly that it is indeed an ETS target gene. PMID:9207063

Cryptic glucocorticoid receptor-binding sites pervade genomic NF-κB response elements.

PubMed

Hudson, William H; Vera, Ian Mitchelle S de; Nwachukwu, Jerome C; Weikum, Emily R; Herbst, Austin G; Yang, Qin; Bain, David L; Nettles, Kendall W; Kojetin, Douglas J; Ortlund, Eric A

2018-04-06

Glucocorticoids (GCs) are potent repressors of NF-κB activity, making them a preferred choice for treatment of inflammation-driven conditions. Despite the widespread use of GCs in the clinic, current models are inadequate to explain the role of the glucocorticoid receptor (GR) within this critical signaling pathway. GR binding directly to NF-κB itself-tethering in a DNA binding-independent manner-represents the standing model of how GCs inhibit NF-κB-driven transcription. We demonstrate that direct binding of GR to genomic NF-κB response elements (κBREs) mediates GR-driven repression of inflammatory gene expression. We report five crystal structures and solution NMR data of GR DBD-κBRE complexes, which reveal that GR recognizes a cryptic response element between the binding footprints of NF-κB subunits within κBREs. These cryptic sequences exhibit high sequence and functional conservation, suggesting that GR binding to κBREs is an evolutionarily conserved mechanism of controlling the inflammatory response.

Bacillus subtilis glutamine synthetase regulates its own synthesis by acting as a chaperone to stabilize GlnR-DNA complexes.

PubMed

Fisher, Susan H; Wray, Lewis V

2008-01-22

The Bacillus subtilis GlnR repressor controls gene expression in response to nitrogen availability. Because all GlnR-regulated genes are expressed constitutively in mutants lacking glutamine synthetase (GS), GS is required for repression by GlnR. Feedback-inhibited GS (FBI-GS) was shown to activate GlnR DNA binding with an in vitro electophoretic mobility shift assay (EMSA). The activation of GlnR DNA binding by GS in these experiments depended on the feedback inhibitor glutamine and did not occur with mutant GS proteins defective in regulating GlnR activity in vivo. Although stable GS-GlnR-DNA ternary complexes were not observed in the EMSA experiments, cross-linking experiments showed that a protein-protein interaction occurs between GlnR and FBI-GS. This interaction was reduced in the absence of the feedback inhibitor glutamine and with mutant GS proteins. Because FBI-GS significantly reduced the dissociation rate of the GlnR-DNA complexes, the stability of these complexes is enhanced by FBI-GS. These results argue that FBI-GS acts as a chaperone that activates GlnR DNA binding through a transient protein-protein interaction that stabilizes GlnR-DNA complexes. GS was shown to control the activity of the B. subtilis nitrogen transcription factor TnrA by forming a stable complex between FBI-GS and TnrA that inhibits TnrA DNA binding. Thus, B. subtilis GS is an enzyme with dual catalytic and regulatory functions that uses distinct mechanisms to control the activity of two different transcription factors.

DNA cytosine methylation in the bovine leukemia virus promoter is associated with latency in a lymphoma-derived B-cell line: potential involvement of direct inhibition of cAMP-responsive element (CRE)-binding protein/CRE modulator/activation transcription factor binding.

PubMed

Pierard, Valérie; Guiguen, Allan; Colin, Laurence; Wijmeersch, Gaëlle; Vanhulle, Caroline; Van Driessche, Benoît; Dekoninck, Ann; Blazkova, Jana; Cardona, Christelle; Merimi, Makram; Vierendeel, Valérie; Calomme, Claire; Nguyên, Thi Liên-Anh; Nuttinck, Michèle; Twizere, Jean-Claude; Kettmann, Richard; Portetelle, Daniel; Burny, Arsène; Hirsch, Ivan; Rohr, Olivier; Van Lint, Carine

2010-06-18

Bovine leukemia virus (BLV) proviral latency represents a viral strategy to escape the host immune system and allow tumor development. Besides the previously demonstrated role of histone deacetylation in the epigenetic repression of BLV expression, we showed here that BLV promoter activity was induced by several DNA methylation inhibitors (such as 5-aza-2'-deoxycytidine) and that overexpressed DNMT1 and DNMT3A, but not DNMT3B, down-regulated BLV promoter activity. Importantly, cytosine hypermethylation in the 5'-long terminal repeat (LTR) U3 and R regions was associated with true latency in the lymphoma-derived B-cell line L267 but not with defective latency in YR2 cells. Moreover, the virus-encoded transactivator Tax(BLV) decreased DNA methyltransferase expression levels, which could explain the lower level of cytosine methylation observed in the L267(LTaxSN) 5'-LTR compared with the L267 5'-LTR. Interestingly, DNA methylation inhibitors and Tax(BLV) synergistically activated BLV promoter transcriptional activity in a cAMP-responsive element (CRE)-dependent manner. Mechanistically, methylation at the -154 or -129 CpG position (relative to the transcription start site) impaired in vitro binding of CRE-binding protein (CREB) transcription factors to their respective CRE sites. Methylation at -129 CpG alone was sufficient to decrease BLV promoter-driven reporter gene expression by 2-fold. We demonstrated in vivo the recruitment of CREB/CRE modulator (CREM) and to a lesser extent activating transcription factor-1 (ATF-1) to the hypomethylated CRE region of the YR2 5'-LTR, whereas we detected no CREB/CREM/ATF recruitment to the hypermethylated corresponding region in the L267 cells. Altogether, these findings suggest that site-specific DNA methylation of the BLV promoter represses viral transcription by directly inhibiting transcription factor binding, thereby contributing to true proviral latency.

EBP1 is a novel E2F target gene regulated by transforming growth factor-β.

PubMed

Judah, David; Chang, Wing Y; Dagnino, Lina

2010-11-10

Regulation of gene expression requires transcription factor binding to specific DNA elements, and a large body of work has focused on the identification of such sequences. However, it is becoming increasingly clear that eukaryotic transcription factors can exhibit widespread, nonfunctional binding to genomic DNA sites. Conversely, some of these proteins, such as E2F, can also modulate gene expression by binding to non-consensus elements. E2F comprises a family of transcription factors that play key roles in a wide variety of cellular functions, including survival, differentiation, activation during tissue regeneration, metabolism, and proliferation. E2F factors bind to the Erb3-binding protein 1 (EBP1) promoter in live cells. We now show that E2F binding to the EBP1 promoter occurs through two tandem DNA elements that do not conform to typical consensus E2F motifs. Exogenously expressed E2F1 activates EBP1 reporters lacking one, but not both sites, suggesting a degree of redundancy under certain conditions. E2F1 increases the levels of endogenous EBP1 mRNA in breast carcinoma and other transformed cell lines. In contrast, in non-transformed primary epidermal keratinocytes, E2F, together with the retinoblastoma family of proteins, appears to be involved in decreasing EBP1 mRNA abundance in response to growth inhibition by transforming growth factor-β1. Thus, E2F is likely a central coordinator of multiple responses that culminate in regulation of EBP1 gene expression, and which may vary depending on cell type and context.

Deciphering the Binding between Nupr1 and MSL1 and Their DNA-Repairing Activity

PubMed Central

Doménech, Rosa; Pantoja-Uceda, David; Gironella, Meritxell; Santoro, Jorge; Velázquez-Campoy, Adrián; Neira, José L.; Iovanna, Juan L.

2013-01-01

The stress protein Nupr1 is a highly basic, multifunctional, intrinsically disordered protein (IDP). MSL1 is a histone acetyl transferase-associated protein, known to intervene in the dosage compensation complex (DCC). In this work, we show that both Nupr1 and MSL1 proteins were recruited and formed a complex into the nucleus in response to DNA-damage, which was essential for cell survival in reply to cisplatin damage. We studied the interaction of Nupr1 and MSL1, and their binding affinities to DNA by spectroscopic and biophysical methods. The MSL1 bound to Nupr1, with a moderate affinity (2.8 µM) in an entropically-driven process. MSL1 did not bind to non-damaged DNA, but it bound to chemically-damaged-DNA with a moderate affinity (1.2 µM) also in an entropically-driven process. The Nupr1 protein bound to chemically-damaged-DNA with a slightly larger affinity (0.4 µM), but in an enthalpically-driven process. Nupr1 showed different interacting regions in the formed complexes with Nupr1 or DNA; however, they were always disordered (“fuzzy”), as shown by NMR. These results underline a stochastic description of the functionality of the Nupr1 and its other interacting partners. PMID:24205110

Anoxia-responsive regulation of the FoxO transcription factors in freshwater turtles, Trachemys scripta elegans.

PubMed

Krivoruchko, Anastasia; Storey, Kenneth B

2013-11-01

The forkhead class O (FoxO) transcription factors are important regulators of multiple aspects of cellular metabolism. We hypothesized that activation of these transcription factors could play crucial roles in low oxygen survival in the anoxia-tolerant turtle, Trachemys scripta elegans. Two FoxOs, FoxO1 and FoxO3, were examined in turtle tissues in response to 5 and 20h of anoxic submergence using techniques of RT-PCR, western immunoblotting and DNA-binding assays to assess activation. Transcript levels of FoxO-responsive genes were also quantified using RT-PCR. FoxO1 was anoxia-responsive in the liver, with increases in transcript levels, protein levels, nuclear levels and DNA-binding of 1.7-4.8fold in response to anoxia. Levels of phosphorylated FoxO1 also decreased to 57% of control values in response to 5h of anoxia, indicating activation. FoxO3 was activated in the heart, kidney and liver in response to anoxia, with nuclear levels increasing by 1.5-3.7fold and DNA-binding activity increasing by 1.3-2.9fold. Transcript levels of two FoxO-target genes, p27kip1 and catalase, also rose by 2.4-2.5fold in the turtle liver under anoxia. The results suggest that the FoxO transcription factors are activated in response to anoxia in T. scripta elegans, potentially contributing to the regulation of stress resistance and metabolic depression. This study provides the first demonstration of activation of FoxOs in a natural model for vertebrate anoxia tolerance, further improving understanding of how tissues can survive without oxygen. © 2013.

A Brownian motor mechanism of translocation and strand separation by hepatitis C virus helicase.

PubMed

Levin, Mikhail K; Gurjar, Madhura; Patel, Smita S

2005-05-01

Helicases translocate along their nucleic acid substrates using the energy of ATP hydrolysis and by changing conformations of their nucleic acid-binding sites. Our goal is to characterize the conformational changes of hepatitis C virus (HCV) helicase at different stages of ATPase cycle and to determine how they lead to translocation. We have reported that ATP binding reduces HCV helicase affinity for nucleic acid. Now we identify the stage of the ATPase cycle responsible for translocation and unwinding. We show that a rapid directional movement occurs upon helicase binding to DNA in the absence of ATP, resulting in opening of several base pairs. We propose that HCV helicase translocates as a Brownian motor with a simple two-stroke cycle. The directional movement step is fueled by single-stranded DNA binding energy while ATP binding allows for a brief period of random movement that prepares the helicase for the next cycle.

Effects of nucleoside analog incorporation on DNA binding to the DNA binding domain of the GATA-1 erythroid transcription factor.

PubMed

Foti, M; Omichinski, J G; Stahl, S; Maloney, D; West, J; Schweitzer, B I

1999-02-05

We investigate here the effects of the incorporation of the nucleoside analogs araC (1-beta-D-arabinofuranosylcytosine) and ganciclovir (9-[(1,3-dihydroxy-2-propoxy)methyl] guanine) into the DNA binding recognition sequence for the GATA-1 erythroid transcription factor. A 10-fold decrease in binding affinity was observed for the ganciclovir-substituted DNA complex in comparison to an unmodified DNA of the same sequence composition. AraC substitution did not result in any changes in binding affinity. 1H-15N HSQC and NOESY NMR experiments revealed a number of chemical shift changes in both DNA and protein in the ganciclovir-modified DNA-protein complex when compared to the unmodified DNA-protein complex. These changes in chemical shift and binding affinity suggest a change in the binding mode of the complex when ganciclovir is incorporated into the GATA DNA binding site.

Analysis of DNA binding by human factor xeroderma pigmentosum complementation group A (XPA) provides insight into its interactions with nucleotide excision repair substrates.

PubMed

Sugitani, Norie; Voehler, Markus W; Roh, Michelle S; Topolska-Woś, Agnieszka M; Chazin, Walter J

2017-10-13

Xeroderma pigmentosum (XP) complementation group A (XPA) is an essential scaffolding protein in the multiprotein nucleotide excision repair (NER) machinery. The interaction of XPA with DNA is a core function of this protein; a number of mutations in the DNA-binding domain (DBD) are associated with XP disease. Although structures of the central globular domain of human XPA and data on binding of DNA substrates have been reported, the structural basis for XPA's DNA-binding activity remains unknown. X-ray crystal structures of the central globular domain of yeast XPA (Rad14) with lesion-containing DNA duplexes have provided valuable insights, but the DNA substrates used for this study do not correspond to the substrates of XPA as it functions within the NER machinery. To better understand the DNA-binding activity of human XPA in NER, we used NMR to investigate the interaction of its DBD with a range of DNA substrates. We found that XPA binds different single-stranded/double-stranded junction DNA substrates with a common surface. Comparisons of our NMR-based mapping of binding residues with the previously reported Rad14-DNA crystal structures revealed similarities and differences in substrate binding between XPA and Rad14. This includes direct evidence for DNA contacts to the residues extending C-terminally from the globular core, which are lacking in the Rad14 construct. Moreover, mutation of the XPA residue corresponding to Phe-262 in Rad14, previously reported as being critical for DNA binding, had only a moderate effect on the DNA-binding activity of XPA. The DNA-binding properties of several disease-associated mutations in the DBD were investigated. These results suggest that for XPA mutants exhibiting altered DNA-binding properties, a correlation exists between the extent of reduction in DNA-binding affinity and the severity of symptoms in XP patients. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

Activation of the carbohydrate response element binding protein (ChREBP) in response to anoxia in the turtle Trachemys scripta elegans.

PubMed

Krivoruchko, Anastasia; Storey, Kenneth B

2014-10-01

ChREBP (carbohydrate response element binding protein) is a glucose-responsive transcription factor that is known to be an important regulator of glycolytic and lipogenic genes in response to glucose. We hypothesized that activation of ChREBP could be relevant to anoxia survival by the anoxia-tolerant turtle, Trachemys scripta elegans. Expression of ChREBP in response to 5 and 20h of anoxia was examined using RT-PCR and Western immunoblotting. In addition, subcellular localization and DNA-binding activity of ChREBP protein were assessed and transcript levels of liver pyruvate kinase (LPK), a downstream gene under ChREBP control were quantified using RT-PCR. ChREBP was anoxia-responsive in kidney and liver, with transcript levels increasing by 1.2-1.8 fold in response to anoxia and protein levels increasing by 1.8-1.9 fold. Enhanced nuclear presence under anoxia was also observed in both tissues by 2.2-2.8 fold. A 4.2 fold increase in DNA binding activity of ChREBP was also observed in liver in response to 5h of anoxia. In addition, transcript levels of LPK increased by 2.1 fold in response to 5h of anoxia in the liver. The results suggest that activation of ChREBP in response to anoxia might be a crucial factor for anoxia survival in turtle liver by contributing to elevated glycolytic flux in the initial phases of oxygen limitation. This study provides the first demonstration of activation of ChREBP in response to anoxia in a natural model of anoxia tolerance, further improving our understanding of the molecular nature of anoxia tolerance. Copyright © 2014 Elsevier B.V. All rights reserved.

Re-visiting protein-centric two-tier classification of existing DNA-protein complexes

PubMed Central

2012-01-01

Background Precise DNA-protein interactions play most important and vital role in maintaining the normal physiological functioning of the cell, as it controls many high fidelity cellular processes. Detailed study of the nature of these interactions has paved the way for understanding the mechanisms behind the biological processes in which they are involved. Earlier in 2000, a systematic classification of DNA-protein complexes based on the structural analysis of the proteins was proposed at two tiers, namely groups and families. With the advancement in the number and resolution of structures of DNA-protein complexes deposited in the Protein Data Bank, it is important to revisit the existing classification. Results On the basis of the sequence analysis of DNA binding proteins, we have built upon the protein centric, two-tier classification of DNA-protein complexes by adding new members to existing families and making new families and groups. While classifying the new complexes, we also realised the emergence of new groups and families. The new group observed was where β-propeller was seen to interact with DNA. There were 34 SCOP folds which were observed to be present in the complexes of both old and new classifications, whereas 28 folds are present exclusively in the new complexes. Some new families noticed were NarL transcription factor, Z-α DNA binding proteins, Forkhead transcription factor, AP2 protein, Methyl CpG binding protein etc. Conclusions Our results suggest that with the increasing number of availability of DNA-protein complexes in Protein Data Bank, the number of families in the classification increased by approximately three fold. The folds present exclusively in newly classified complexes is suggestive of inclusion of proteins with new function in new classification, the most populated of which are the folds responsible for DNA damage repair. The proposed re-visited classification can be used to perform genome-wide surveys in the genomes of interest for the presence of DNA-binding proteins. Further analysis of these complexes can aid in developing algorithms for identifying DNA-binding proteins and their family members from mere sequence information. PMID:22800292

Re-visiting protein-centric two-tier classification of existing DNA-protein complexes.

PubMed

Malhotra, Sony; Sowdhamini, Ramanathan

2012-07-16

Precise DNA-protein interactions play most important and vital role in maintaining the normal physiological functioning of the cell, as it controls many high fidelity cellular processes. Detailed study of the nature of these interactions has paved the way for understanding the mechanisms behind the biological processes in which they are involved. Earlier in 2000, a systematic classification of DNA-protein complexes based on the structural analysis of the proteins was proposed at two tiers, namely groups and families. With the advancement in the number and resolution of structures of DNA-protein complexes deposited in the Protein Data Bank, it is important to revisit the existing classification. On the basis of the sequence analysis of DNA binding proteins, we have built upon the protein centric, two-tier classification of DNA-protein complexes by adding new members to existing families and making new families and groups. While classifying the new complexes, we also realised the emergence of new groups and families. The new group observed was where β-propeller was seen to interact with DNA. There were 34 SCOP folds which were observed to be present in the complexes of both old and new classifications, whereas 28 folds are present exclusively in the new complexes. Some new families noticed were NarL transcription factor, Z-α DNA binding proteins, Forkhead transcription factor, AP2 protein, Methyl CpG binding protein etc. Our results suggest that with the increasing number of availability of DNA-protein complexes in Protein Data Bank, the number of families in the classification increased by approximately three fold. The folds present exclusively in newly classified complexes is suggestive of inclusion of proteins with new function in new classification, the most populated of which are the folds responsible for DNA damage repair. The proposed re-visited classification can be used to perform genome-wide surveys in the genomes of interest for the presence of DNA-binding proteins. Further analysis of these complexes can aid in developing algorithms for identifying DNA-binding proteins and their family members from mere sequence information.

Quantitative characterization of conformational-specific protein-DNA binding using a dual-spectral interferometric imaging biosensor.

PubMed

Zhang, Xirui; Daaboul, George G; Spuhler, Philipp S; Dröge, Peter; Ünlü, M Selim

2016-03-14

DNA-binding proteins play crucial roles in the maintenance and functions of the genome and yet, their specific binding mechanisms are not fully understood. Recently, it was discovered that DNA-binding proteins recognize specific binding sites to carry out their functions through an indirect readout mechanism by recognizing and capturing DNA conformational flexibility and deformation. High-throughput DNA microarray-based methods that provide large-scale protein-DNA binding information have shown effective and comprehensive analysis of protein-DNA binding affinities, but do not provide information of DNA conformational changes in specific protein-DNA complexes. Building on the high-throughput capability of DNA microarrays, we demonstrate a quantitative approach that simultaneously measures the amount of protein binding to DNA and nanometer-scale DNA conformational change induced by protein binding in a microarray format. Both measurements rely on spectral interferometry on a layered substrate using a single optical instrument in two distinct modalities. In the first modality, we quantitate the amount of binding of protein to surface-immobilized DNA in each DNA spot using a label-free spectral reflectivity technique that accurately measures the surface densities of protein and DNA accumulated on the substrate. In the second modality, for each DNA spot, we simultaneously measure DNA conformational change using a fluorescence vertical sectioning technique that determines average axial height of fluorophores tagged to specific nucleotides of the surface-immobilized DNA. The approach presented in this paper, when combined with current high-throughput DNA microarray-based technologies, has the potential to serve as a rapid and simple method for quantitative and large-scale characterization of conformational specific protein-DNA interactions.

The Structure of the Transcriptional Repressor KstR in Complex with CoA Thioester Cholesterol Metabolites Sheds Light on the Regulation of Cholesterol Catabolism in Mycobacterium tuberculosis*

PubMed Central

Ho, Ngoc Anh Thu; Dawes, Stephanie S.; Crowe, Adam M.; Casabon, Israël; Gao, Chen; Kendall, Sharon L.; Baker, Edward N.; Eltis, Lindsay D.; Lott, J. Shaun

2016-01-01

Cholesterol can be a major carbon source for Mycobacterium tuberculosis during infection, both at an early stage in the macrophage phagosome and later within the necrotic granuloma. KstR is a highly conserved TetR family transcriptional repressor that regulates a large set of genes responsible for cholesterol catabolism. Many genes in this regulon, including kstR, are either induced during infection or are essential for survival of M. tuberculosis in vivo. In this study, we identified two ligands for KstR, both of which are CoA thioester cholesterol metabolites with four intact steroid rings. A metabolite in which one of the rings was cleaved was not a ligand. We confirmed the ligand-protein interactions using intrinsic tryptophan fluorescence and showed that ligand binding strongly inhibited KstR-DNA binding using surface plasmon resonance (IC50 for ligand = 25 nm). Crystal structures of the ligand-free form of KstR show variability in the position of the DNA-binding domain. In contrast, structures of KstR·ligand complexes are highly similar to each other and demonstrate a position of the DNA-binding domain that is unfavorable for DNA binding. Comparison of ligand-bound and ligand-free structures identifies residues involved in ligand specificity and reveals a distinctive mechanism by which the ligand-induced conformational change mediates DNA release. PMID:26858250

Inhibition mechanisms of hemoglobin, immunoglobulin G, and whole blood in digital and real-time PCR.

PubMed

Sidstedt, Maja; Hedman, Johannes; Romsos, Erica L; Waitara, Leticia; Wadsö, Lars; Steffen, Carolyn R; Vallone, Peter M; Rådström, Peter

2018-04-01

Blood samples are widely used for PCR-based DNA analysis in fields such as diagnosis of infectious diseases, cancer diagnostics, and forensic genetics. In this study, the mechanisms behind blood-induced PCR inhibition were evaluated by use of whole blood as well as known PCR-inhibitory molecules in both digital PCR and real-time PCR. Also, electrophoretic mobility shift assay was applied to investigate interactions between inhibitory proteins and DNA, and isothermal titration calorimetry was used to directly measure effects on DNA polymerase activity. Whole blood caused a decrease in the number of positive digital PCR reactions, lowered amplification efficiency, and caused severe quenching of the fluorescence of the passive reference dye 6-carboxy-X-rhodamine as well as the double-stranded DNA binding dye EvaGreen. Immunoglobulin G was found to bind to single-stranded genomic DNA, leading to increased quantification cycle values. Hemoglobin affected the DNA polymerase activity and thus lowered the amplification efficiency. Hemoglobin and hematin were shown to be the molecules in blood responsible for the fluorescence quenching. In conclusion, hemoglobin and immunoglobulin G are the two major PCR inhibitors in blood, where the first affects amplification through a direct effect on the DNA polymerase activity and quenches the fluorescence of free dye molecules, and the latter binds to single-stranded genomic DNA, hindering DNA polymerization in the first few PCR cycles. Graphical abstract PCR inhibition mechanisms of hemoglobin and immunoglobulin G (IgG). Cq quantification cycle, dsDNA double-stranded DNA, ssDNA single-stranded DNA.

The Cac2 subunit is essential for productive histone binding and nucleosome assembly in CAF-1

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mattiroli, Francesca; Gu, Yajie; Balsbaugh, Jeremy L.

Nucleosome assembly following DNA replication controls epigenome maintenance and genome integrity. Chromatin assembly factor 1 (CAF-1) is the histone chaperone responsible for histone (H3-H4)2 deposition following DNA synthesis. Structural and functional details for this chaperone complex and its interaction with histones are slowly emerging. Using hydrogen-deuterium exchange coupled to mass spectrometry, combined with in vitro and in vivo mutagenesis studies, we identified the regions involved in the direct interaction between the yeast CAF-1 subunits, and mapped the CAF-1 domains responsible for H3-H4 binding. The large subunit, Cac1 organizes the assembly of CAF-1. Strikingly, H3-H4 binding is mediated by a compositemore » interface, shaped by Cac1-bound Cac2 and the Cac1 acidic region. Cac2 is indispensable for productive histone binding, while deletion of Cac3 has only moderate effects on H3-H4 binding and nucleosome assembly. These results define direct structural roles for yeast CAF-1 subunits and uncover a previously unknown critical function of the middle subunit in CAF-1.« less

DNA and protein co-immunization improves the magnitude and longevity of humoral immune responses in macaques.

PubMed

Jalah, Rashmi; Kulkarni, Viraj; Patel, Vainav; Rosati, Margherita; Alicea, Candido; Bear, Jenifer; Yu, Lei; Guan, Yongjun; Shen, Xiaoying; Tomaras, Georgia D; LaBranche, Celia; Montefiori, David C; Prattipati, Rajasekhar; Pinter, Abraham; Bess, Julian; Lifson, Jeffrey D; Reed, Steven G; Sardesai, Niranjan Y; Venzon, David J; Valentin, Antonio; Pavlakis, George N; Felber, Barbara K

2014-01-01

We tested the concept of combining DNA with protein to improve anti-HIV Env systemic and mucosal humoral immune responses. Rhesus macaques were vaccinated with DNA, DNA&protein co-immunization or DNA prime followed by protein boost, and the magnitude and mucosal dissemination of the antibody responses were monitored in both plasma and mucosal secretions. We achieved induction of robust humoral responses by optimized DNA vaccination delivered by in vivo electroporation. These responses were greatly increased upon administration of a protein boost. Importantly, a co-immunization regimen of DNA&protein injected in the same muscle at the same time induced the highest systemic binding and neutralizing antibodies to homologous or heterologous Env as well as the highest Env-specific IgG in saliva. Inclusion of protein in the vaccine resulted in more immunized animals with Env-specific IgG in rectal fluids. Inclusion of DNA in the vaccine significantly increased the longevity of systemic humoral immune responses, whereas protein immunization, either as the only vaccine component or as boost after DNA prime, was followed by a great decline of humoral immune responses overtime. We conclude that DNA&protein co-delivery in a simple vaccine regimen combines the strength of each vaccine component, resulting in improved magnitude, extended longevity and increased mucosal dissemination of the induced antibodies in immunized rhesus macaques.

Isolation from genomic DNA of sequences binding specific regulatory proteins by the acceleration of protein electrophoretic mobility upon DNA binding.

PubMed

Subrahmanyam, S; Cronan, J E

1999-01-21

We report an efficient and flexible in vitro method for the isolation of genomic DNA sequences that are the binding targets of a given DNA binding protein. This method takes advantage of the fact that binding of a protein to a DNA molecule generally increases the rate of migration of the protein in nondenaturing gel electrophoresis. By the use of a radioactively labeled DNA-binding protein and nonradioactive DNA coupled with PCR amplification from gel slices, we show that specific binding sites can be isolated from Escherichia coli genomic DNA. We have applied this method to isolate a binding site for FadR, a global regulator of fatty acid metabolism in E. coli. We have also isolated a second binding site for BirA, the biotin operon repressor/biotin ligase, from the E. coli genome that has a very low binding efficiency compared with the bio operator region.

The helical structure of DNA facilitates binding

NASA Astrophysics Data System (ADS)

Berg, Otto G.; Mahmutovic, Anel; Marklund, Emil; Elf, Johan

2016-09-01

The helical structure of DNA imposes constraints on the rate of diffusion-limited protein binding. Here we solve the reaction-diffusion equations for DNA-like geometries and extend with simulations when necessary. We find that the helical structure can make binding to the DNA more than twice as fast compared to a case where DNA would be reactive only along one side. We also find that this rate advantage remains when the contributions from steric constraints and rotational diffusion of the DNA-binding protein are included. Furthermore, we find that the association rate is insensitive to changes in the steric constraints on the DNA in the helix geometry, while it is much more dependent on the steric constraints on the DNA-binding protein. We conclude that the helical structure of DNA facilitates the nonspecific binding of transcription factors and structural DNA-binding proteins in general.

Destabilization of the MutSα’s protein-protein interface due to binding to the DNA adduct induced by anticancer agent Carboplatin via molecular dynamics simulations

PubMed Central

Negureanu, Lacramioara; Salsbury, Freddie R

2013-01-01

DNA mismatch repair (MMR) proteins maintain genetic integrity in all organisms by recognizing and repairing DNA errors. Such alteration of hereditary information can lead to various diseases, including cancer. Besides their role in DNA repair, MMR proteins detect and initiate cellular responses to certain type of DNA damage. Its response to the damaged DNA has made the human MMR pathway a useful target for anticancer agents such as carboplatin. This study indicates that strong, specific interactions at the interface of MutSα in response to the mismatched DNA recognition are replaced by weak, non-specific interactions in response to the damaged DNA recognition. Data suggest a severe impairment of the dimerization of MutSα in response to the damaged DNA recognition. While the core of MutSα is preserved in response to the damaged DNA recognition, the loss of contact surface and the rearrangement of contacts at the protein interface suggest a different packing in response to the damaged DNA recognition. Coupled in response to the mismatched DNA recognition, interaction energies, hydrogen bonds, salt bridges, and solvent accessible surface areas at the interface of MutSα and within the subunits are uncoupled or asynchronously coupled in response to the damaged DNA recognition. These pieces of evidence suggest that the loss of a synchronous mode of response in the MutSα’s surveillance for DNA errors would possible be one of the mechanism(s) of signaling the MMR-dependent programed cell death much wanted in anticancer therapies. The analysis was drawn from dynamics simulations. PMID:24061854

Label-free detection of kanamycin based on a G-quadruplex DNA aptamer-based fluorescent intercalator displacement assay

NASA Astrophysics Data System (ADS)

Xing, Yun-Peng; Liu, Chun; Zhou, Xiao-Hong; Shi, Han-Chang

2015-01-01

This work was the first to report that the kanamycin-binding DNA aptamer (5'-TGG GGG TTG AGG CTA AGC CGA-3') can form stable parallel G-quadruplex DNA (G4-DNA) structures by themselves and that this phenomenon can be verified by nondenaturing polyacrylamide gel electrophoresis and circular dichroism spectroscopy. Based on these findings, we developed a novel label-free strategy for kanamycin detection based on the G4-DNA aptamer-based fluorescent intercalator displacement assay with thiazole orange (TO) as the fluorescence probe. In the proposed strategy, TO became strongly fluorescent upon binding to kanamycin-binding G4-DNA. However, the addition of kanamycin caused the displacement of TO from the G4-DNA-TO conjugate, thereby resulting in decreased fluorescent signal, which was inversely related to the kanamycin concentration. The detection limit of the proposed assay decreased to 59 nM with a linear working range of 0.1 μM to 20 μM for kanamycin. The cross-reactivity against six other antibiotics was negligible compared with the response to kanamycin. A satisfactory recovery of kanamycin in milk samples ranged from 80.1% to 98.0%, confirming the potential of this bioassay in the measurement of kanamycin in various applications. Our results also served as a good reference for developing similar fluorescent G4-DNA-based bioassays in the future.

Regulation of the Myxococcus xanthus C-Signal-Dependent Ω4400 Promoter by the Essential Developmental Protein FruA

PubMed Central

Yoder-Himes, Deborah R.; Kroos, Lee

2006-01-01

The bacterium Myxococcus xanthus employs extracellular signals to coordinate aggregation and sporulation during multicellular development. Extracellular, contact-dependent signaling that involves the CsgA protein (called C-signaling) activates FruA, a putative response regulator that governs a branched signaling pathway inside cells. One branch regulates cell movement, leading to aggregation. The other branch regulates gene expression, leading to sporulation. C-signaling is required for full expression of most genes induced after 6 h into development, including the gene identified by Tn5 lac insertion Ω4400. To determine if FruA is a direct regulator of Ω4400 transcription, a combination of in vivo and in vitro experiments was performed. Ω4400 expression was abolished in a fruA mutant. The DNA-binding domain of FruA bound specifically to DNA upstream of the promoter −35 region in vitro. Mutations between bp −86 and −77 greatly reduced binding. One of these mutations had been shown previously to reduce Ω4400 expression in vivo and make it independent of C-signaling. For the first time, chromatin immunoprecipitation (ChIP) experiments were performed on M. xanthus. The ChIP experiments demonstrated that FruA is associated with the Ω4400 promoter region late in development, even in the absence of C-signaling. Based on these results, we propose that FruA directly activates Ω4400 transcription to a moderate level prior to C-signaling and, in response to C-signaling, binds near bp −80 and activates transcription to a higher level. Also, the highly localized effects of mutations between bp −86 and −77 on DNA binding in vitro, together with recently published footprints, allow us to predict a consensus binding site of GTCG/CGA/G for the FruA DNA-binding domain. PMID:16816188

Coupled binding-bending-folding: The complex conformational dynamics of protein-DNA binding studied by atomistic molecular dynamics simulations.

PubMed

van der Vaart, Arjan

2015-05-01

Protein-DNA binding often involves dramatic conformational changes such as protein folding and DNA bending. While thermodynamic aspects of this behavior are understood, and its biological function is often known, the mechanism by which the conformational changes occur is generally unclear. By providing detailed structural and energetic data, molecular dynamics simulations have been helpful in elucidating and rationalizing protein-DNA binding. This review will summarize recent atomistic molecular dynamics simulations of the conformational dynamics of DNA and protein-DNA binding. A brief overview of recent developments in DNA force fields is given as well. Simulations have been crucial in rationalizing the intrinsic flexibility of DNA, and have been instrumental in identifying the sequence of binding events, the triggers for the conformational motion, and the mechanism of binding for a number of important DNA-binding proteins. Molecular dynamics simulations are an important tool for understanding the complex binding behavior of DNA-binding proteins. With recent advances in force fields and rapid increases in simulation time scales, simulations will become even more important for future studies. This article is part of a Special Issue entitled Recent developments of molecular dynamics. Copyright © 2014. Published by Elsevier B.V.

Diversification, phylogeny and evolution of auxin response factor (ARF) family: insights gained from analyzing maize ARF genes.

PubMed

Wang, Yijun; Deng, Dexiang; Shi, Yating; Miao, Nan; Bian, Yunlong; Yin, Zhitong

2012-03-01

Auxin response factors (ARFs), member of the plant-specific B3 DNA binding superfamily, target specifically to auxin response elements (AuxREs) in promoters of primary auxin-responsive genes and heterodimerize with Aux/IAA proteins in auxin signaling transduction cascade. In previous research, we have isolated and characterized maize Aux/IAA genes in whole-genome scale. Here, we report the comprehensive analysis of ARF genes in maize. A total of 36 ARF genes were identified and validated from the B73 maize genome through an iterative strategy. Thirty-six maize ARF genes are distributed in all maize chromosomes except chromosome 7. Maize ARF genes expansion is mainly due to recent segmental duplications. Maize ARF proteins share one B3 DNA binding domain which consists of seven-stranded β sheets and two short α helixes. Twelve maize ARFs with glutamine-rich middle regions could be as activators in modulating expression of auxin-responsive genes. Eleven maize ARF proteins are lack of homo- and heterodimerization domains. Putative cis-elements involved in phytohormones and light signaling responses, biotic and abiotic stress adaption locate in promoters of maize ARF genes. Expression patterns vary greatly between clades and sister pairs of maize ARF genes. The B3 DNA binding and auxin response factor domains of maize ARF proteins are primarily subjected to negative selection during selective sweep. The mixed selective forces drive the diversification and evolution of genomic regions outside of B3 and ARF domains. Additionally, the dicot-specific proliferation of ARF genes was detected. Comparative genomics analysis indicated that maize, sorghum and rice duplicate chromosomal blocks containing ARF homologs are highly syntenic. This study provides insights into the distribution, phylogeny and evolution of ARF gene family.

Activation of both acfA and acfD transcription by Vibrio cholerae ToxT requires binding to two centrally located DNA sites in an inverted repeat conformation.

PubMed

Withey, Jeffrey H; DiRita, Victor J

2005-05-01

The Gram-negative bacterium Vibrio cholerae is the infectious agent responsible for the disease Asiatic cholera. The genes required for V. cholerae virulence, such as those encoding the cholera toxin (CT) and toxin-coregulated pilus (TCP), are controlled by a cascade of transcriptional activators. Ultimately, the direct transcriptional activator of the majority of V. cholerae virulence genes is the AraC/XylS family member ToxT protein, the expression of which is activated by the ToxR and TcpP proteins. Previous studies have identified the DNA sites to which ToxT binds upstream of the ctx operon, encoding CT, and the tcpA operon, encoding, among other products, the major subunit of the TCP. These known ToxT binding sites are seemingly dissimilar in sequence other than being A/T rich. Further results suggested that ctx and tcpA each has a pair of ToxT binding sites arranged in a direct repeat orientation upstream of the core promoter elements. In this work, using both transcriptional lacZ fusions and in vitro copper-phenanthroline footprinting experiments, we have identified the ToxT binding sites between the divergently transcribed acfA and acfD genes, which encode components of the accessory colonization factor required for efficient intestinal colonization by V. cholerae. Our results indicate that ToxT binds to a pair of DNA sites between acfA and acfD in an inverted repeat orientation. Moreover, a mutational analysis of the ToxT binding sites indicates that both binding sites are required by ToxT for transcriptional activation of both acfA and acfD. Using copper-phenanthroline footprinting to assess the occupancy of ToxT on DNA having mutations in one of these binding sites, we found that protection by ToxT of the unaltered binding site was not affected, whereas protection by ToxT of the mutant binding site was significantly reduced in the region of the mutations. The results of further footprinting experiments using DNA templates having +5 bp and +10 bp insertions between the two ToxT binding sites indicate that both binding sites are occupied by ToxT regardless of their positions relative to each other. Based on these results, we propose that ToxT binds independently to two DNA sites between acfA and acfD to activate transcription of both genes.

DNA sequence determinants controlling affinity, stability and shape of DNA complexes bound by the nucleoid protein Fis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hancock, Stephen P.; Stella, Stefano; Cascio, Duilio

The abundant Fis nucleoid protein selectively binds poorly related DNA sequences with high affinities to regulate diverse DNA reactions. Fis binds DNA primarily through DNA backbone contacts and selects target sites by reading conformational properties of DNA sequences, most prominently intrinsic minor groove widths. High-affinity binding requires Fis-stabilized DNA conformational changes that vary depending on DNA sequence. In order to better understand the molecular basis for high affinity site recognition, we analyzed the effects of DNA sequence within and flanking the core Fis binding site on binding affinity and DNA structure. X-ray crystal structures of Fis-DNA complexes containing variable sequencesmore » in the noncontacted center of the binding site or variations within the major groove interfaces show that the DNA can adapt to the Fis dimer surface asymmetrically. We show that the presence and position of pyrimidine-purine base steps within the major groove interfaces affect both local DNA bending and minor groove compression to modulate affinities and lifetimes of Fis-DNA complexes. Sequences flanking the core binding site also modulate complex affinities, lifetimes, and the degree of local and global Fis-induced DNA bending. In particular, a G immediately upstream of the 15 bp core sequence inhibits binding and bending, and A-tracts within the flanking base pairs increase both complex lifetimes and global DNA curvatures. Taken together, our observations support a revised DNA motif specifying high-affinity Fis binding and highlight the range of conformations that Fis-bound DNA can adopt. Lastly, the affinities and DNA conformations of individual Fis-DNA complexes are likely to be tailored to their context-specific biological functions.« less

DNA sequence determinants controlling affinity, stability and shape of DNA complexes bound by the nucleoid protein Fis

DOE PAGES

Hancock, Stephen P.; Stella, Stefano; Cascio, Duilio; ...

2016-03-09

The abundant Fis nucleoid protein selectively binds poorly related DNA sequences with high affinities to regulate diverse DNA reactions. Fis binds DNA primarily through DNA backbone contacts and selects target sites by reading conformational properties of DNA sequences, most prominently intrinsic minor groove widths. High-affinity binding requires Fis-stabilized DNA conformational changes that vary depending on DNA sequence. In order to better understand the molecular basis for high affinity site recognition, we analyzed the effects of DNA sequence within and flanking the core Fis binding site on binding affinity and DNA structure. X-ray crystal structures of Fis-DNA complexes containing variable sequencesmore » in the noncontacted center of the binding site or variations within the major groove interfaces show that the DNA can adapt to the Fis dimer surface asymmetrically. We show that the presence and position of pyrimidine-purine base steps within the major groove interfaces affect both local DNA bending and minor groove compression to modulate affinities and lifetimes of Fis-DNA complexes. Sequences flanking the core binding site also modulate complex affinities, lifetimes, and the degree of local and global Fis-induced DNA bending. In particular, a G immediately upstream of the 15 bp core sequence inhibits binding and bending, and A-tracts within the flanking base pairs increase both complex lifetimes and global DNA curvatures. Taken together, our observations support a revised DNA motif specifying high-affinity Fis binding and highlight the range of conformations that Fis-bound DNA can adopt. Lastly, the affinities and DNA conformations of individual Fis-DNA complexes are likely to be tailored to their context-specific biological functions.« less

Identification of DNA-dependent protein kinase catalytic subunit (DNA-PKcs) as a novel target of bisphenol A.

PubMed

Ito, Yuki; Ito, Takumi; Karasawa, Satoki; Enomoto, Teruya; Nashimoto, Akihiro; Hase, Yasuyoshi; Sakamoto, Satoshi; Mimori, Tsuneyo; Matsumoto, Yoshihisa; Yamaguchi, Yuki; Handa, Hiroshi

2012-01-01

Bisphenol A (BPA) forms the backbone of plastics and epoxy resins used to produce packaging for various foods and beverages. BPA is also an estrogenic disruptor, interacting with human estrogen receptors (ER) and other related nuclear receptors. Nevertheless, the effects of BPA on human health remain unclear. The present study identified DNA-dependent protein kinase catalytic subunit (DNA-PKcs) as a novel BPA-binding protein. DNA-PKcs, in association with the Ku heterodimer (Ku70/80), is a critical enzyme involved in the repair of DNA double-strand breaks. Low levels of DNA-PK activity are previously reported to be associated with an increased risk of certain types of cancer. Although the Kd for the interaction between BPA and a drug-binding mutant of DNA-PKcs was comparatively low (137 nM), high doses of BPA were required before cellular effects were observed (100-300 μM). The results of an in vitro kinase assay showed that BPA inhibited DNA-PK kinase activity in a concentration-dependent manner. In M059K cells, BPA inhibited the phosphorylation of DNA-PKcs at Ser2056 and H2AX at Ser139 in response to ionizing radiation (IR)-irradiation. BPA also disrupted DNA-PKcs binding to Ku70/80 and increased the radiosensitivity of M059K cells, but not M059J cells (which are DNA-PKcs-deficient). Taken together, these results provide new evidence of the effects of BPA on DNA repair in mammalian cells, which are mediated via inhibition of DNA-PK activity. This study may warrant the consideration of the possible carcinogenic effects of high doses of BPA, which are mediated through its action on DNA-PK.

Identification of DNA-Dependent Protein Kinase Catalytic Subunit (DNA-PKcs) as a Novel Target of Bisphenol A

PubMed Central

Nashimoto, Akihiro; Hase, Yasuyoshi; Sakamoto, Satoshi; Mimori, Tsuneyo; Matsumoto, Yoshihisa; Yamaguchi, Yuki; Handa, Hiroshi

2012-01-01

Bisphenol A (BPA) forms the backbone of plastics and epoxy resins used to produce packaging for various foods and beverages. BPA is also an estrogenic disruptor, interacting with human estrogen receptors (ER) and other related nuclear receptors. Nevertheless, the effects of BPA on human health remain unclear. The present study identified DNA-dependent protein kinase catalytic subunit (DNA-PKcs) as a novel BPA-binding protein. DNA-PKcs, in association with the Ku heterodimer (Ku70/80), is a critical enzyme involved in the repair of DNA double-strand breaks. Low levels of DNA-PK activity are previously reported to be associated with an increased risk of certain types of cancer. Although the Kd for the interaction between BPA and a drug-binding mutant of DNA-PKcs was comparatively low (137 nM), high doses of BPA were required before cellular effects were observed (100–300 μM). The results of an in vitro kinase assay showed that BPA inhibited DNA-PK kinase activity in a concentration-dependent manner. In M059K cells, BPA inhibited the phosphorylation of DNA-PKcs at Ser2056 and H2AX at Ser139 in response to ionizing radiation (IR)-irradiation. BPA also disrupted DNA-PKcs binding to Ku70/80 and increased the radiosensitivity of M059K cells, but not M059J cells (which are DNA-PKcs-deficient). Taken together, these results provide new evidence of the effects of BPA on DNA repair in mammalian cells, which are mediated via inhibition of DNA-PK activity. This study may warrant the consideration of the possible carcinogenic effects of high doses of BPA, which are mediated through its action on DNA-PK. PMID:23227178

Monitoring ssDNA Binding to the DnaB Helicase from Helicobacter pylori by Solid-State NMR Spectroscopy.

PubMed

Wiegand, Thomas; Cadalbert, Riccardo; Gardiennet, Carole; Timmins, Joanna; Terradot, Laurent; Böckmann, Anja; Meier, Beat H

2016-11-02

DnaB helicases are bacterial, ATP-driven enzymes that unwind double-stranded DNA during DNA replication. Herein, we study the sequential binding of the "non-hydrolysable" ATP analogue AMP-PNP and of single-stranded (ss) DNA to the dodecameric DnaB helicase from Helicobacter pylori using solid-state NMR. Phosphorus cross-polarization experiments monitor the binding of AMP-PNP and DNA to the helicase. 13 C chemical-shift perturbations (CSPs) are used to detect conformational changes in the protein upon binding. The helicase switches upon AMP-PNP addition into a conformation apt for ssDNA binding, and AMP-PNP is hydrolyzed and released upon binding of ssDNA. Our study sheds light on the conformational changes which are triggered by the interaction with AMP-PNP and are needed for ssDNA binding of H. pylori DnaB in vitro. They also demonstrate the level of detail solid-state NMR can provide for the characterization of protein-DNA interactions and the interplay with ATP or its analogues. © 2016 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Electrostatics, structure prediction, and the energy landscapes for protein folding and binding.

PubMed

Tsai, Min-Yeh; Zheng, Weihua; Balamurugan, D; Schafer, Nicholas P; Kim, Bobby L; Cheung, Margaret S; Wolynes, Peter G

2016-01-01

While being long in range and therefore weakly specific, electrostatic interactions are able to modulate the stability and folding landscapes of some proteins. The relevance of electrostatic forces for steering the docking of proteins to each other is widely acknowledged, however, the role of electrostatics in establishing specifically funneled landscapes and their relevance for protein structure prediction are still not clear. By introducing Debye-Hückel potentials that mimic long-range electrostatic forces into the Associative memory, Water mediated, Structure, and Energy Model (AWSEM), a transferable protein model capable of predicting tertiary structures, we assess the effects of electrostatics on the landscapes of thirteen monomeric proteins and four dimers. For the monomers, we find that adding electrostatic interactions does not improve structure prediction. Simulations of ribosomal protein S6 show, however, that folding stability depends monotonically on electrostatic strength. The trend in predicted melting temperatures of the S6 variants agrees with experimental observations. Electrostatic effects can play a range of roles in binding. The binding of the protein complex KIX-pKID is largely assisted by electrostatic interactions, which provide direct charge-charge stabilization of the native state and contribute to the funneling of the binding landscape. In contrast, for several other proteins, including the DNA-binding protein FIS, electrostatics causes frustration in the DNA-binding region, which favors its binding with DNA but not with its protein partner. This study highlights the importance of long-range electrostatics in functional responses to problems where proteins interact with their charged partners, such as DNA, RNA, as well as membranes. © 2015 The Protein Society.

The Crystal Structures of Apo and cAMP-Bound GlxR from Corynebacterium glutamicum Reveal Structural and Dynamic Changes upon cAMP Binding in CRP/FNR Family Transcription Factors

PubMed Central

Townsend, Philip D.; Jungwirth, Britta; Pojer, Florence; Bußmann, Michael; Money, Victoria A.; Cole, Stewart T.; Pühler, Alfred; Tauch, Andreas; Bott, Michael; Cann, Martin J.; Pohl, Ehmke

2014-01-01

The cyclic AMP-dependent transcriptional regulator GlxR from Corynebacterium glutamicum is a member of the super-family of CRP/FNR (cyclic AMP receptor protein/fumarate and nitrate reduction regulator) transcriptional regulators that play central roles in bacterial metabolic regulatory networks. In C. glutamicum, which is widely used for the industrial production of amino acids and serves as a non-pathogenic model organism for members of the Corynebacteriales including Mycobacterium tuberculosis, the GlxR homodimer controls the transcription of a large number of genes involved in carbon metabolism. GlxR therefore represents a key target for understanding the regulation and coordination of C. glutamicum metabolism. Here we investigate cylic AMP and DNA binding of GlxR from C. glutamicum and describe the crystal structures of apo GlxR determined at a resolution of 2.5 Å, and two crystal forms of holo GlxR at resolutions of 2.38 and 1.82 Å, respectively. The detailed structural analysis and comparison of GlxR with CRP reveals that the protein undergoes a distinctive conformational change upon cyclic AMP binding leading to a dimer structure more compatible to DNA-binding. As the two binding sites in the GlxR homodimer are structurally identical dynamic changes upon binding of the first ligand are responsible for the allosteric behavior. The results presented here show how dynamic and structural changes in GlxR lead to optimization of orientation and distance of its two DNA-binding helices for optimal DNA recognition. PMID:25469635

Dynamic and Progressive Control of DNA Origami Conformation by Modulating DNA Helicity with Chemical Adducts.

PubMed

Chen, Haorong; Zhang, Hanyu; Pan, Jing; Cha, Tae-Gon; Li, Shiming; Andréasson, Joakim; Choi, Jong Hyun

2016-05-24

DNA origami has received enormous attention for its ability to program complex nanostructures with a few nanometer precision. Dynamic origami structures that change conformation in response to environmental cues or external signals hold great promises in sensing and actuation at the nanoscale. The reconfiguration mechanism of existing dynamic origami structures is mostly limited to single-stranded hinges and relies almost exclusively on DNA hybridization or strand displacement. Here, we show an alternative approach by demonstrating on-demand conformation changes with DNA-binding molecules, which intercalate between base pairs and unwind DNA double helices. The unwinding effect modulates the helicity mismatch in DNA origami, which significantly influences the internal stress and the global conformation of the origami structure. We demonstrate the switching of a polymerized origami nanoribbon between different twisting states and a well-constrained torsional deformation in a monomeric origami shaft. The structural transformation is shown to be reversible, and binding isotherms confirm the reconfiguration mechanism. This approach provides a rapid and reversible means to change DNA origami conformation, which can be used for dynamic and progressive control at the nanoscale.

Fe65 is required for Tip60-directed histone H4 acetylation at DNA strand breaks

PubMed Central

Stante, Maria; Minopoli, Giuseppina; Passaro, Fabiana; Raia, Maddalena; Vecchio, Luigi Del; Russo, Tommaso

2009-01-01

Fe65 is a binding partner of the Alzheimer's β-amyloid precursor protein APP. The possible involvement of this protein in the cellular response to DNA damage was suggested by the observation that Fe65 null mice are more sensitive to genotoxic stress than WT counterpart. Fe65 associated with chromatin under basal conditions and its involvement in DNA damage repair requires this association. A known partner of Fe65 is the histone acetyltransferase Tip60. Considering the crucial role of Tip60 in DNA repair, we explored the hypothesis that the phenotype of Fe65 null cells depended on its interaction with Tip60. We demonstrated that Fe65 knockdown impaired recruitment of Tip60-TRRAP complex to DNA double strand breaks and decreased histone H4 acetylation. Accordingly, the efficiency of DNA repair was decreased upon Fe65 suppression. To explore whether APP has a role in this mechanism, we analyzed a Fe65 mutant unable to bind to APP. This mutant failed to rescue the phenotypes of Fe65 null cells; furthermore, APP/APLP2 suppression results in the impairment of recruitment of Tip60-TRRAP complex to DNA double strand breaks, decreased histone H4 acetylation and repair efficiency. On these bases, we propose that Fe65 and its interaction with APP play an important role in the response to DNA damage by assisting the recruitment of Tip60-TRRAP to DNA damage sites. PMID:19282473

Interactions of the SAP Domain of Human Ku70 with DNA Substrate: A Molecular Dynamics Study

NASA Technical Reports Server (NTRS)

Hu, Shaowen; Carra, Claudio; Huff, Janice; Pluth, Janice M.; Cucinotta, Francis A.

2007-01-01

NASA is developing a systems biology approach to improve the assessment of health risks associated with space radiation. The primary toxic and mutagenic lesion following radiation exposure is the DNA double strand break (DSB), thus a model incorporating proteins and pathways important in response and repair of this lesion is critical. One key protein heterodimer for systems models of radiation effects is the Ku70/80 complex. The Ku70/80 complex is important in the initial binding of DSB ends following DNA damage, and is a component of nonhomologous end joining repair, the primary pathway for DSB repair in mammalian cells. The SAP domain of Ku70 (residues 556-609), contains an a helix-extended strand-helix motif and similar motifs have been found in other nucleic acid-binding proteins critical for DNA repair. However, the exact mechanism of damage recognition and substrate specificity for the Ku heterodimer remains unclear in part due to the absence of a high-resolution structure of the SAP/DNA complex. We performed a series of molecular dynamics (MD) simulations on a system with the SAP domain of Ku70 and a 10 base pairs DNA duplex. Large-scale conformational changes were observed and some putative binding modes were suggested based on energetic analysis. These modes are consistent with previous experimental investigations. In addition, the results indicate that cooperation of SAP with other domains of Ku70/80 is necessary to explain the high affinity of binding as observed in experiments.

Phosphopeptide binding by Sld3 links Dbf4-dependent kinase to MCM replicative helicase activation.

PubMed

Deegan, Tom D; Yeeles, Joseph Tp; Diffley, John Fx

2016-05-02

The initiation of eukaryotic DNA replication requires the assembly of active CMG (Cdc45-MCM-GINS) helicases at replication origins by a set of conserved and essential firing factors. This process is controlled during the cell cycle by cyclin-dependent kinase (CDK) and Dbf4-dependent kinase (DDK), and in response to DNA damage by the checkpoint kinase Rad53/Chk1. Here we show that Sld3, previously shown to be an essential CDK and Rad53 substrate, is recruited to the inactive MCM double hexamer in a DDK-dependent manner. Sld3 binds specifically to DDK-phosphorylated peptides from two MCM subunits (Mcm4, 6) and then recruits Cdc45. MCM mutants that cannot bind Sld3 or Sld3 mutants that cannot bind phospho-MCM or Cdc45 do not support replication. Moreover, phosphomimicking mutants in Mcm4 and Mcm6 bind Sld3 without DDK and facilitate DDK-independent replication. Thus, Sld3 is an essential "reader" of DDK phosphorylation, integrating signals from three distinct protein kinase pathways to coordinate DNA replication during S phase. © 2016 The Authors. Published under the terms of the CC BY 4.0 license.

PARP-1 dependent recruitment of the amyotrophic lateral sclerosis-associated protein FUS/TLS to sites of oxidative DNA damage

PubMed Central

Rulten, Stuart L.; Rotheray, Amy; Green, Ryan L.; Grundy, Gabrielle J.; Moore, Duncan A. Q.; Gómez-Herreros, Fernando; Hafezparast, Majid; Caldecott, Keith W

2014-01-01

Amyotrophic lateral sclerosis (ALS) is associated with progressive degeneration of motor neurons. Several of the genes associated with this disease encode proteins involved in RNA processing, including fused-in-sarcoma/translocated-in-sarcoma (FUS/TLS). FUS is a member of the heterogeneous nuclear ribonucleoprotein (hnRNP) family of proteins that bind thousands of pre-mRNAs and can regulate their splicing. Here, we have examined the possibility that FUS is also a component of the cellular response to DNA damage. We show that both GFP-tagged and endogenous FUS re-localize to sites of oxidative DNA damage induced by UVA laser, and that FUS recruitment is greatly reduced or ablated by an inhibitor of poly (ADP-ribose) polymerase activity. Consistent with this, we show that recombinant FUS binds directly to poly (ADP-ribose) in vitro, and that both GFP-tagged and endogenous FUS fail to accumulate at sites of UVA laser induced damage in cells lacking poly (ADP-ribose) polymerase-1. Finally, we show that GFP-FUSR521G, harbouring a mutation that is associated with ALS, exhibits reduced ability to accumulate at sites of UVA laser-induced DNA damage. Together, these data suggest that FUS is a component of the cellular response to DNA damage, and that defects in this response may contribute to ALS. PMID:24049082

Binding of undamaged double stranded DNA to vaccinia virus uracil-DNA glycosylase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Schormann, Norbert; Banerjee, Surajit; Ricciardi, Robert

Background: Uracil-DNA glycosylases are evolutionarily conserved DNA repair enzymes. However, vaccinia virus uracil-DNA glycosylase (known as D4), also serves as an intrinsic and essential component of the processive DNA polymerase complex during DNA replication. In this complex D4 binds to a unique poxvirus specific protein A20 which tethers it to the DNA polymerase. At the replication fork the DNA scanning and repair function of D4 is coupled with DNA replication. So far, DNA-binding to D4 has not been structurally characterized. Results: This manuscript describes the first structure of a DNA-complex of a uracil-DNA glycosylase from the poxvirus family. This alsomore » represents the first structure of a uracil DNA glycosylase in complex with an undamaged DNA. In the asymmetric unit two D4 subunits bind simultaneously to complementary strands of the DNA double helix. Each D4 subunit interacts mainly with the central region of one strand. DNA binds to the opposite side of the A20-binding surface on D4. In comparison of the present structure with the structure of uracil-containing DNA-bound human uracil-DNA glycosylase suggests that for DNA binding and uracil removal D4 employs a unique set of residues and motifs that are highly conserved within the poxvirus family but different in other organisms. Conclusion: The first structure of D4 bound to a truly non-specific undamaged double-stranded DNA suggests that initial binding of DNA may involve multiple non-specific interactions between the protein and the phosphate backbone.« less

Binding of undamaged double stranded DNA to vaccinia virus uracil-DNA glycosylase

DOE PAGES

Schormann, Norbert; Banerjee, Surajit; Ricciardi, Robert; ...

2015-06-02

Background: Uracil-DNA glycosylases are evolutionarily conserved DNA repair enzymes. However, vaccinia virus uracil-DNA glycosylase (known as D4), also serves as an intrinsic and essential component of the processive DNA polymerase complex during DNA replication. In this complex D4 binds to a unique poxvirus specific protein A20 which tethers it to the DNA polymerase. At the replication fork the DNA scanning and repair function of D4 is coupled with DNA replication. So far, DNA-binding to D4 has not been structurally characterized. Results: This manuscript describes the first structure of a DNA-complex of a uracil-DNA glycosylase from the poxvirus family. This alsomore » represents the first structure of a uracil DNA glycosylase in complex with an undamaged DNA. In the asymmetric unit two D4 subunits bind simultaneously to complementary strands of the DNA double helix. Each D4 subunit interacts mainly with the central region of one strand. DNA binds to the opposite side of the A20-binding surface on D4. In comparison of the present structure with the structure of uracil-containing DNA-bound human uracil-DNA glycosylase suggests that for DNA binding and uracil removal D4 employs a unique set of residues and motifs that are highly conserved within the poxvirus family but different in other organisms. Conclusion: The first structure of D4 bound to a truly non-specific undamaged double-stranded DNA suggests that initial binding of DNA may involve multiple non-specific interactions between the protein and the phosphate backbone.« less

NF-κB DNA-binding activity in embryos responding to a teratogen, cyclophosphamide

PubMed Central

Torchinsky, Arkady; Lishanski, Lucy; Wolstein, Orit; Shepshelovich, Jeanne; Orenstein, Hasida; Savion, Shoshana; Zaslavsky, Zeev; Carp, Howard; Brill, Alexander; Dikstein, Rivka; Toder, Vladimir; Fein, Amos

2002-01-01

Background The Rel/NF-κB transcription factors have been shown to regulate apoptosis in different cell types, acting as inducers or blockers in a stimuli- and cell type-dependent fashion. One of the Rel/NF-κB subunits, RelA, has been shown to be crucial for normal embryonic development, in which it functions in the embryonic liver as a protector against TNFα-induced physiological apoptosis. This study assesses whether NF-κB may be involved in the embryo's response to teratogens. Fot this, we evaluated how NF-KappaB DNA binding activity in embryonic organs demonstraiting differential sensitivity to a reference teratogen, cyclophosphamide, correlates with dysmorphic events induced by the teratogen at the cellular level (excessive apoptosis) and at the organ level (structural anomalies). Results The embryonic brain and liver were used as target organs. We observed that the Cyclophosphamide-induced excessive apoptosis in the brain, followed by the formation of severe craniofacial structural anomalies, was accompanied by suppression of NF-κB DNA-binding activity as well as by a significant and lasting increase in the activity of caspases 3 and 8. However, in the liver, in which cyclophosphamide induced transient apoptosis was not followed by dysmorphogenesis, no suppression of NF-κB DNA-binding activity was registered and the level of active caspases 3 and 8 was significantly lower than in the brain. It has also been observed that both the brain and liver became much more sensitive to the CP-induced teratogenic insult if the embryos were exposed to a combined treatment with the teratogen and sodium salicylate that suppressed NF-κB DNA-binding activity in these organs. Conclusion The results of this study demonstrate that suppression of NF-κB DNA-binding activity in embryos responding to the teratogenic insult may be associated with their decreased resistance to this insult. They also suggest that teratogens may suppress NF-κB DNA-binding activity in the embryonic tissues in an organ type- and dose-dependent fashion. PMID:11893254

A complex mechanism determines polarity of DNA replication fork arrest by the replication terminator complex of Bacillus subtilis.

PubMed

Duggin, Iain G; Matthews, Jacqueline M; Dixon, Nicholas E; Wake, R Gerry; Mackay, Joel P

2005-04-01

Two dimers of the replication terminator protein (RTP) of Bacillus subtilis bind to a chromosomal DNA terminator site to effect polar replication fork arrest. Cooperative binding of the dimers to overlapping half-sites within the terminator is essential for arrest. It was suggested previously that polarity of fork arrest is the result of the RTP dimer at the blocking (proximal) side within the complex binding very tightly and the permissive-side RTP dimer binding relatively weakly. In order to investigate this "differential binding affinity" model, we have constructed a series of mutant terminators that contain half-sites of widely different RTP binding affinities in various combinations. Although there appeared to be a correlation between binding affinity at the proximal half-site and fork arrest efficiency in vivo for some terminators, several deviated significantly from this correlation. Some terminators exhibited greatly reduced binding cooperativity (and therefore have reduced affinity at each half-site) but were highly efficient in fork arrest, whereas one terminator had normal affinity over the proximal half-site, yet had low fork arrest efficiency. The results show clearly that there is no direct correlation between the RTP binding affinity (either within the full complex or at the proximal half-site within the full complex) and the efficiency of replication fork arrest in vivo. Thus, the differential binding affinity over the proximal and distal half-sites cannot be solely responsible for functional polarity of fork arrest. Furthermore, efficient fork arrest relies on features in addition to the tight binding of RTP to terminator DNA.

Drosophila Uri, a PP1α binding protein, is essential for viability, maintenance of DNA integrity and normal transcriptional activity

PubMed Central

Kirchner, Jasmin; Vissi, Emese; Gross, Sascha; Szoor, Balazs; Rudenko, Andrey; Alphey, Luke; White-Cooper, Helen

2008-01-01

Background Protein phosphatase 1 (PP1) is involved in diverse cellular processes, and is targeted to substrates via interaction with many different protein binding partners. PP1 catalytic subunits (PP1c) fall into PP1α and PP1β subfamilies based on sequence analysis, however very few PP1c binding proteins have been demonstrated to discriminate between PP1α and PP1β. Results URI (unconventional prefoldin RPB5 interactor) is a conserved molecular chaperone implicated in a variety of cellular processes, including the transcriptional response to nutrient signalling and maintenance of DNA integrity. We show that Drosophila Uri binds PP1α with much higher affinity than PP1β, and that this ability to discriminate between PP1c forms is conserved to humans. Most Uri is cytoplasmic, however we found some protein associated with active RNAPII on chromatin. We generated a uri loss of function allele, and show that uri is essential for viability in Drosophila. uri mutants have transcriptional defects, reduced cell viability and differentiation in the germline, and accumulate DNA damage in their nuclei. Conclusion Uri is the first PP1α specific binding protein to be described in Drosophila. Uri protein plays a role in transcriptional regulation. Activity of uri is required to maintain DNA integrity and cell survival in normal development. PMID:18412953

Curated collection of yeast transcription factor DNA binding specificity data reveals novel structural and gene regulatory insights

PubMed Central

2011-01-01

Background Transcription factors (TFs) play a central role in regulating gene expression by interacting with cis-regulatory DNA elements associated with their target genes. Recent surveys have examined the DNA binding specificities of most Saccharomyces cerevisiae TFs, but a comprehensive evaluation of their data has been lacking. Results We analyzed in vitro and in vivo TF-DNA binding data reported in previous large-scale studies to generate a comprehensive, curated resource of DNA binding specificity data for all characterized S. cerevisiae TFs. Our collection comprises DNA binding site motifs and comprehensive in vitro DNA binding specificity data for all possible 8-bp sequences. Investigation of the DNA binding specificities within the basic leucine zipper (bZIP) and VHT1 regulator (VHR) TF families revealed unexpected plasticity in TF-DNA recognition: intriguingly, the VHR TFs, newly characterized by protein binding microarrays in this study, recognize bZIP-like DNA motifs, while the bZIP TF Hac1 recognizes a motif highly similar to the canonical E-box motif of basic helix-loop-helix (bHLH) TFs. We identified several TFs with distinct primary and secondary motifs, which might be associated with different regulatory functions. Finally, integrated analysis of in vivo TF binding data with protein binding microarray data lends further support for indirect DNA binding in vivo by sequence-specific TFs. Conclusions The comprehensive data in this curated collection allow for more accurate analyses of regulatory TF-DNA interactions, in-depth structural studies of TF-DNA specificity determinants, and future experimental investigations of the TFs' predicted target genes and regulatory roles. PMID:22189060

Specificity of the weak binding between the phage SPO1 transcription-inhibitory protein, TF1, and SPO1 DNA.

PubMed

Johnson, G G; Geiduschek, E P

1977-04-05

The interaction of the phage SPO1 protein transcription factor 1 (TF1), with DNA has been analyzed by membrane filter binding and by sedimentation methods. Substantially specific binding of TF1 to helical SPO1 DNA can be demonstrated by nitrocellulose filter-binding assays at relatively low ionic strength (0.08). However, TF1-DNA complexes dissociate and reequilibrate relatively rapidly and this makes filter-binding assays unsuitable for quantitative measurements of binding equilibra. Accordingly, the sedimentation properties of TF1-DNA complexes have been explored and a short-column centrifugation assay has been elaborated for quantitative measurements. Preferential binding of TF1 to the hydroxymethyluracil-containing SPO1 DNA has also been demonstrated by short-column centrifugation. TF1 binds relatively weakly and somewhat cooperatively to SPO1 DNA at many sites; TF1-DNA complexes dissociate and reequilibrate rapidly. At 20 degrees C in 0.01 M phosphate, pH 7.5, 0.15 KC1, one molecule of TF1 can bind to approximately every 60 nucleotide pairs of SPO1 DNA.

Structural basis of DNA sequence recognition by the response regulator PhoP in Mycobacterium tuberculosis.

PubMed

He, Xiaoyuan; Wang, Liqin; Wang, Shuishu

2016-04-15

The transcriptional regulator PhoP is an essential virulence factor in Mycobacterium tuberculosis, and it presents a target for the development of new anti-tuberculosis drugs and attenuated tuberculosis vaccine strains. PhoP binds to DNA as a highly cooperative dimer by recognizing direct repeats of 7-bp motifs with a 4-bp spacer. To elucidate the PhoP-DNA binding mechanism, we determined the crystal structure of the PhoP-DNA complex. The structure revealed a tandem PhoP dimer that bound to the direct repeat. The surprising tandem arrangement of the receiver domains allowed the four domains of the PhoP dimer to form a compact structure, accounting for the strict requirement of a 4-bp spacer and the highly cooperative binding of the dimer. The PhoP-DNA interactions exclusively involved the effector domain. The sequence-recognition helix made contact with the bases of the 7-bp motif in the major groove, and the wing interacted with the adjacent minor groove. The structure provides a starting point for the elucidation of the mechanism by which PhoP regulates the virulence of M. tuberculosis and guides the design of screening platforms for PhoP inhibitors.

Interaction of DNA with Simple and Mixed Ligand Copper(II) Complexes of 1,10-Phenanthrolines as Studied by DNA-Fiber EPR Spectroscopy

PubMed Central

Chikira, Makoto; Ng, Chew Hee; Palaniandavar, Mallayan

2015-01-01

The interaction of simple and ternary Cu(II) complexes of 1,10-phenanthrolines with DNA has been studied extensively because of their various interesting and important functions such as DNA cleavage activity, cytotoxicity towards cancer cells, and DNA based asymmetric catalysis. Such functions are closely related to the DNA binding modes of the complexes such as intercalation, groove binding, and electrostatic surface binding. A variety of spectroscopic methods have been used to study the DNA binding mode of the Cu(II) complexes. Of all these methods, DNA-fiber electron paramagnetic resonance (EPR) spectroscopy affords unique information on the DNA binding structures of the complexes. In this review we summarize the results of our DNA-fiber EPR studies on the DNA binding structure of the complexes and discuss them together with the data accumulated by using other measurements. PMID:26402668

Cell-extracellular matrix interactions can regulate the switch between growth and differentiation in rat hepatocytes: reciprocal expression of C/EBP alpha and immediate-early growth response transcription factors.

PubMed Central

Rana, B; Mischoulon, D; Xie, Y; Bucher, N L; Farmer, S R

1994-01-01

Previous investigations have shown that culture of freshly isolated hepatocytes under conventional conditions, i.e., on dried rat tail collagen in the presence of growth factors, facilitates cell growth but also causes an extensive down-regulation of most liver-specific functions. This dedifferentiation process can be prevented if the cells are cultured on a reconstituted basement membrane gel matrix derived from the Englebreth-Holm-Swarm mouse sarcoma tumor (EHS gel). To gain insight into the mechanisms regulating this response to extracellular matrix, we are analyzing the activities of two families of transcription factors, C/EBP and AP-1, which control the transcription of hepatic and growth-responsive genes, respectively. We demonstrate that isolation of hepatocytes from the normal quiescent rat liver by collagenase perfusion activates the immediate-early growth response program, as indicated by increased expression of c-jun, junB, c-fos, and c-myc mRNAs. Adhesion of these activated cells to dried rat tail collagen augments the elevated levels of these mRNAs for the initial 1 to 2 h postplating; junB and c-myc mRNA levels then drop steeply, with junB returning to normal quiescence and the c-myc level remaining slightly elevated during the 3-day culture period. Levels of c-jun mRNA and AP-1 DNA binding activity, however, remain elevated from the outset, while C/EBP alpha mRNA expression is down-regulated, resulting in a decrease in the steady-state levels of the 42- and 30-kDa C/EBP alpha polypeptides and C/EBP alpha DNA binding activity. In contrast, C/EBP beta mRNA production remains at near-normal hepatic levels for 5 to 8 days of culture, although its DNA binding activity decreases severalfold during this time. Adhesion of hepatocytes to the EHS gel for the same period of time dramatically alters this program: it arrests growth and inhibits AP-1 DNA binding activity and the expression of c-jun, junB, and c-myc mRNAs, but, in addition, it restores C/EBP alpha mRNA and protein as well as C/EBP alpha and C/EBP beta DNA binding activities to the abundant levels present in freshly isolated hepatocytes. These changes are not due merely to growth inhibition, because suppression of hepatocyte proliferation on collagen by epidermal growth factor starvation or addition of transforming growth factor beta does not inhibit AP-1 activity or restore C/EBP alpha DNA binding activity to normal hepatic levels. These data suggest that expression of the normal hepatic phenotype requires that hepatocytes exist in a G0 state of growth arrest, facilitated here by adhesion of cells to the EHS gel, in order to express high levels of hepatic transcription factors such as C/EBP alpha. Images PMID:8065319

Characterization of differential ripening pattern in association with ethylene biosynthesis in the fruits of five naturally occurring banana cultivars and detection of a GCC-box-specific DNA-binding protein.

PubMed

Choudhury, Swarup Roy; Roy, Sujit; Saha, Progya Paramita; Singh, Sanjay Kumar; Sengupta, Dibyendu N

2008-07-01

MA-ACS1 and MA-ACO1 are the two major ripening genes in banana and play crucial role in the regulation of ethylene production during ripening. Here, we report a comparative ripening pattern in five different naturally occurring banana cultivars namely Cavendish (AAA), Rasthali (AAB), Kanthali (AB), Poovan (AAB) and Monthan (ABB), which have distinct genome composition. We found a distinct variation in the climacteric ethylene production and in-vivo ACC oxidase activity level during the ripening stages in the five cultivars. We identified the cDNAs for MA-ACS1 and MA-ACO1 from the five cultivars and studied the transcript accumulation patterns of the two genes, which correlated well with the differential timing in the expression of these two genes during ripening. The GCC-box is one of the ethylene-responsive elements (EREs) found in the promoters of many ethylene-inducible genes. We have identified a GCC-box motif (putative ERE) in the promoters of MA-ACS1 and MA-ACO1 in banana cultivars. DNA-protein interaction studies revealed the presence of a GCC-box-specific DNA-binding activity in the fruit nuclear extract and such DNA-binding activity was enhanced following ethylene treatment. South-Western blotting revealed a 25-kDa nuclear protein that binds specifically to GCC-box DNA in the climacteric banana fruit. Together, these results indicate the probable involvement of the GCC-box motif as the cis-acting ERE in the regulation of MA-ACS1 and MA-ACO1 during ripening in banana fruits via binding of specific ERE-binding protein.

Salmonella typhimurium PtsJ is a novel MocR-like transcriptional repressor involved in regulating the vitamin B6 salvage pathway.

PubMed

Tramonti, Angela; Milano, Teresa; Nardella, Caterina; di Salvo, Martino L; Pascarella, Stefano; Contestabile, Roberto

2017-02-01

The vitamin B 6 salvage pathway, involving pyridoxine 5'-phosphate oxidase (PNPOx) and pyridoxal kinase (PLK), recycles B 6 vitamers from nutrients and protein turnover to produce pyridoxal 5'-phosphate (PLP), the catalytically active form of the vitamin. Regulation of this pathway, widespread in living organisms including humans and many bacteria, is very important to vitamin B 6 homeostasis but poorly understood. Although some information is available on the enzymatic regulation of PNPOx and PLK, little is known on their regulation at the transcriptional level. In the present work, we identified a new MocR-like regulator, PtsJ from Salmonella typhimurium, which controls the expression of the pdxK gene encoding one of the two PLKs expressed in this organism (PLK1). Analysis of pdxK expression in a ptsJ knockout strain demonstrated that PtsJ acts as a transcriptional repressor. This is the first case of a MocR-like regulator acting as repressor of its target gene. Expression and purification of PtsJ allowed a detailed characterisation of its effector and DNA-binding properties. PLP is the only B 6 vitamer acting as effector molecule for PtsJ. A DNA-binding region composed of four repeated nucleotide sequences is responsible for binding of PtsJ to its target promoter. Analysis of binding stoichiometry revealed that protein subunits/DNA molar ratio varies from 4 : 1 to 2 : 1, depending on the presence or absence of PLP. Structural characteristics of DNA transcriptional factor-binding sites suggest that PtsJ binds DNA according to a different model with respect to other characterised members of the MocR subgroup. © 2016 Federation of European Biochemical Societies.

Max-E47, a Designed Minimalist Protein that Targets the E-Box DNA Site In Vivo and In Vitro

PubMed Central

Xu, Jing; Chen, Gang; De Jong, Antonia T.; Shahravan, S. Hesam; Shin, Jumi A.

2009-01-01

Max-E47 is a designed hybrid protein comprising the Max DNA-binding basic region and E47 HLH dimerization subdomain. In the yeast one-hybrid system (Y1H), Max-E47 shows strong transcriptional activation from the E-box site, 5'-CACGTG, targeted by the Myc/Max/Mad network of transcription factors; two mutants, Max-E47Y and Max-E47YF, activate more weakly from the E-box in the Y1H. Quantitative fluorescence anisotropy titrations to gain free energies of protein:DNA binding gave low nM Kd values for the native MaxbHLHZ, Max-E47, and the Y and YF mutants binding to the E-box site (14 nM, 15 nM, 9 nM, and 6 nM, respectively), with no detectable binding to a nonspecific control duplex. Because these minimalist, E-box-binding hybrids have no activation domain and no interactions with the c-MycbHLHZ, as shown by the yeast two-hybrid assay, they can potentially serve as dominant-negative inhibitors that suppress activation of E-box-responsive genes targeted by transcription factors including the c-Myc/Max complex. As proof-of-principle, we used our modified Y1H, which allows direct competition between two proteins vying for a DNA target, to show that Max-E47 effectively outcompetes the native MaxbHLHZ for the E-box; weaker competition is observed from the two mutants, consistent with Y1H results. These hybrids provide a minimalist scaffold for further exploration of the relationship between protein structure and DNA-binding function and may have applications as protein therapeutics or biochemical probes capable of targeting the E-box site. PMID:19449889

Acetaminophen-induced hepatotoxicity is associated with early changes in NF-kB and NF-IL6 DNA binding activity.

PubMed

Blazka, M E; Germolec, D R; Simeonova, P; Bruccoleri, A; Pennypacker, K R; Luster, M I

Nuclear transcription factors, such as NF-kB and NF-IL6, are believed to play an important role in regulating the expression of genes that encode for products involved in tissue damage and inflammation and, thus, may represent early biomarkers for chemical toxicities. In the present study changes in DNA binding activity of these factors were examined in livers of mice administered hepatotoxic doses of acetaminophen (APAP). NF-kB and NF-IL6 DNA binding occurred constitutively in control mouse liver. However, within 4 hr following administration of hepatotoxic doses of APAP, their binding activities were transiently lost and is in contrast to AP-1 transcription factor where activation occurs under similar conditions. These changes corresponded with increased release of inflammatory mediators (IL-6, serum amyloid A) and increased levels of enzymatic markers of hepatocyte damage. Similarly, treatment of mice with gadolinium chloride, an inhibitor of Kupffer cell activation and known to protect against APAP-induced hepatotoxicity, reduced the observed pathophysiological response in the liver while altering the APAP-associated changes in NF-kB DNA binding activity. NF-kB was found predominantly in parenchymal and endothelial cells and was composed primarily of relatively inactive p50 homodimer subunits in control liver. Taken together, these studies suggest that hepatotoxicity is associated with early and complex changes in DNA binding activities of specific transcription factors. In particular, NF-kB and NF-IL6 may serve as negative regulators of hepatocyte-derived inflammatory mediators and is analogous to that previously observed in certain other cell systems such as B lymphocytes.

Aptamer-based electrochemical sensors with aptamer-complementary DNA oligonucleotides as probe.

PubMed

Lu, Ying; Li, Xianchan; Zhang, Limin; Yu, Ping; Su, Lei; Mao, Lanqun

2008-03-15

This study describes a facile and general strategy for the development of aptamer-based electrochemical sensors with a high specificity toward the targets and a ready regeneration feature. Very different from the existing strategies for the development of electrochemical aptasensors with the aptamers as the probes, the strategy proposed here is essentially based on the utilization of the aptamer-complementary DNA (cDNA) oligonucleotides as the probes for electrochemical sensing. In this context, the sequences at both ends of the cDNA are tailor-made to be complementary and both the redox moiety (i.e., ferrocene in this study) and thiol group are labeled onto the cDNA. The labeled cDNA are hybridized with their respective aptamers (i.e., ATP- and thrombin-binding aptamers in this study) to form double-stranded DNA (ds-DNA) and the electrochemical aptasensors are prepared by self-assembling the labeled ds-DNA onto Au electrodes. Upon target binding, the aptamers confined onto electrode surface dissociate from their respective cDNA oligonucleotides into the solution and the single-stranded cDNA could thus tend to form a hairpin structure through the hybridization of the complementary sequences at both its ends. Such a conformational change of the cDNA resulting from the target binding-induced dissociation of the aptamers essentially leads to the change in the voltammetric signal of the redox moiety labeled onto the cDNA and thus constitutes the mechanism for the electrochemical aptasensors for specific target sensing. The aptasensors demonstrated here with the cDNA as the probe are readily regenerated and show good responses toward the targets. This study may offer a new and relatively general approach to electrochemical aptasensors with good analytical properties and potential applications.

Inhibition of nuclear factor kappaB proteins-platinated DNA interactions correlates with cytotoxic effectiveness of the platinum complexes

PubMed Central

Brabec, Viktor; Kasparkova, Jana; Kostrhunova, Hana; Farrell, Nicholas P.

2016-01-01

Nuclear DNA is the target responsible for anticancer activity of platinum anticancer drugs. Their activity is mediated by altered signals related to programmed cell death and the activation of various signaling pathways. An example is activation of nuclear factor kappaB (NF-κB). Binding of NF-κB proteins to their consensus sequences in DNA (κB sites) is the key biochemical activity responsible for the biological functions of NF-κB. Using gel-mobility-shift assays and surface plasmon resonance spectroscopy we examined the interactions of NF-κB proteins with oligodeoxyribonucleotide duplexes containing κB site damaged by DNA adducts of three platinum complexes. These complexes markedly differed in their toxic effects in tumor cells and comprised highly cytotoxic trinuclear platinum(II) complex BBR3464, less cytotoxic conventional cisplatin and ineffective transplatin. The results indicate that structurally different DNA adducts of these platinum complexes exhibit a different efficiency to affect the affinity of the platinated DNA (κB sites) to NF-κB proteins. Our results support the hypothesis that structural perturbations induced in DNA by platinum(II) complexes correlate with their higher efficiency to inhibit binding of NF-κB proteins to their κB sites and cytotoxicity as well. However, the full generalization of this hypothesis will require to evaluate a larger series of platinum(II) complexes. PMID:27574114

Inhibition of nuclear factor kappaB proteins-platinated DNA interactions correlates with cytotoxic effectiveness of the platinum complexes.

PubMed

Brabec, Viktor; Kasparkova, Jana; Kostrhunova, Hana; Farrell, Nicholas P

2016-08-30

Nuclear DNA is the target responsible for anticancer activity of platinum anticancer drugs. Their activity is mediated by altered signals related to programmed cell death and the activation of various signaling pathways. An example is activation of nuclear factor kappaB (NF-κB). Binding of NF-κB proteins to their consensus sequences in DNA (κB sites) is the key biochemical activity responsible for the biological functions of NF-κB. Using gel-mobility-shift assays and surface plasmon resonance spectroscopy we examined the interactions of NF-κB proteins with oligodeoxyribonucleotide duplexes containing κB site damaged by DNA adducts of three platinum complexes. These complexes markedly differed in their toxic effects in tumor cells and comprised highly cytotoxic trinuclear platinum(II) complex BBR3464, less cytotoxic conventional cisplatin and ineffective transplatin. The results indicate that structurally different DNA adducts of these platinum complexes exhibit a different efficiency to affect the affinity of the platinated DNA (κB sites) to NF-κB proteins. Our results support the hypothesis that structural perturbations induced in DNA by platinum(II) complexes correlate with their higher efficiency to inhibit binding of NF-κB proteins to their κB sites and cytotoxicity as well. However, the full generalization of this hypothesis will require to evaluate a larger series of platinum(II) complexes.

Molecular Basis for Impaired DNA Damage Response Function Associated with the RAP80 ΔE81 Defect*

PubMed Central

Anamika; Markin, Craig J.; Rout, Manoj K.; Spyracopoulos, Leo

2014-01-01

Signal transduction within the DNA damage response is driven by the flux of protein-protein interaction cascades that ultimately recruit repair complexes to sites of damage. The protein RAP80 plays a central role in the damage response by targeting BRCA1/BRCA2 tumor suppressors to DNA damage foci through multivalent binding of Lys-63-linked polyubiquitin chains. Mutations within the high penetrance BRCA1/BRCA2 genes account for ∼20% of familial breast cancers. The genetic basis for the remaining cancers remains unknown, but may involve defects in binding partners for BRCA1 and BRCA2 that lead to impaired targeting to foci and a concomitant role in the pathogenesis of cancer. Recently, an in-frame deletion mutation (ΔE81) in a conserved region from the first ubiquitin interaction motif of RAP80 has been linked to an increase in chromosomal abnormalities. Using NMR spectroscopy, we demonstrate that the N-cap motif within the α-helix of the first ubiquitin interaction motif from ΔE81 undergoes a structural frameshift that leads to abolishment of multivalent binding of polyubiquitin chains. Loss of this single glutamate residue disrupts favorable electrostatic interactions between RAP80 and ubiquitin, establishing a plausible molecular basis for a potential predisposition to cancer unrelated to mutations within BRCA1/BRCA2 genes. PMID:24627472

ΔN-P63α and TA-P63α exhibit intrinsic differences in transactivation specificities that depend on distinct features of DNA target sites

PubMed Central

Foggetti, Giorgia; Raimondi, Ivan; Campomenosi, Paola; Menichini, Paola

2014-01-01

TP63 is a member of the TP53 gene family that encodes for up to ten different TA and ΔN isoforms through alternative promoter usage and alternative splicing. Besides being a master regulator of gene expression for squamous epithelial proliferation, differentiation and maintenance, P63, through differential expression of its isoforms, plays important roles in tumorigenesis. All P63 isoforms share an immunoglobulin-like folded DNA binding domain responsible for binding to sequence-specific response elements (REs), whose overall consensus sequence is similar to that of the canonical p53 RE. Using a defined assay in yeast, where P63 isoforms and RE sequences are the only variables, and gene expression assays in human cell lines, we demonstrated that human TA- and ΔN-P63α proteins exhibited differences in transactivation specificity not observed with the corresponding P73 or P53 protein isoforms. These differences 1) were dependent on specific features of the RE sequence, 2) could be related to intrinsic differences in their oligomeric state and cooperative DNA binding, and 3) appeared to be conserved in evolution. Since genotoxic stress can change relative ratio of TA- and ΔN-P63α protein levels, the different transactivation specificity of each P63 isoform could potentially influence cellular responses to specific stresses. PMID:24926492

Genome-wide characterization reveals complex interplay between TP53 and TP63 in response to genotoxic stress

PubMed Central

McDade, Simon S.; Patel, Daksha; Moran, Michael; Campbell, James; Fenwick, Kerry; Kozarewa, Iwanka; Orr, Nicholas J.; Lord, Christopher J.; Ashworth, Alan A.; McCance, Dennis J.

2014-01-01

In response to genotoxic stress the TP53 tumour suppressor activates target gene expression to induce cell cycle arrest or apoptosis depending on the extent of DNA damage. These canonical activities can be repressed by TP63 in normal stratifying epithelia to maintain proliferative capacity or drive proliferation of squamous cell carcinomas, where TP63 is frequently overexpressed/amplified. Here we use ChIP-sequencing, integrated with microarray analysis, to define the genome-wide interplay between TP53 and TP63 in response to genotoxic stress in normal cells. We reveal that TP53 and TP63 bind to overlapping, but distinct cistromes of sites through utilization of distinctive consensus motifs and that TP53 is constitutively bound to a number of sites. We demonstrate that cisplatin and adriamycin elicit distinct effects on TP53 and TP63 binding events, through which TP53 can induce or repress transcription of an extensive network of genes by direct binding and/or modulation of TP63 activity. Collectively, this results in a global TP53-dependent repression of cell cycle progression, mitosis and DNA damage repair concomitant with activation of anti-proliferative and pro-apoptotic canonical target genes. Further analyses reveal that in the absence of genotoxic stress TP63 plays an important role in maintaining expression of DNA repair genes, loss of which results in defective repair. PMID:24823795

Heat Shock Response of Archaeoglobus fulgidus†

PubMed Central

Rohlin, Lars; Trent, Jonathan D.; Salmon, Kirsty; Kim, Unmi; Gunsalus, Robert P.; Liao, James C.

2005-01-01

The heat shock response of the hyperthermophilic archaeon Archaeoglobus fulgidus strain VC-16 was studied using whole-genome microarrays. On the basis of the resulting expression profiles, approximately 350 of the 2,410 open reading frames (ORFs) (ca. 14%) exhibited increased or decreased transcript abundance. These span a range of cell functions, including energy production, amino acid metabolism, and signal transduction, where the majority are uncharacterized. One ORF called AF1298 was identified that contains a putative helix-turn-helix DNA binding motif. The gene product, HSR1, was expressed and purified from Escherichia coli and was used to characterize specific DNA recognition regions upstream of two A. fulgidus genes, AF1298 and AF1971. The results indicate that AF1298 is autoregulated and is part of an operon with two downstream genes that encode a small heat shock protein, Hsp20, and cdc48, an AAA+ ATPase. The DNase I footprints using HSR1 suggest the presence of a cis-binding motif upstream of AF1298 consisting of CTAAC-N5-GTTAG. Since AF1298 is negatively regulated in response to heat shock and encodes a protein only distantly related to the N-terminal DNA binding domain of Phr of Pyrococcus furiosus, these results suggest that HSR1 and Phr may belong to an evolutionarily diverse protein family involved in heat shock regulation in hyperthermophilic and mesophilic Archaea organisms. PMID:16109946

Novel TDP2-ubiquitin interactions and their importance for the repair of topoisomerase II-mediated DNA damage

PubMed Central

Rao, Timsi; Gao, Rui; Takada, Saeko; Al Abo, Muthana; Chen, Xiang; Walters, Kylie J.; Pommier, Yves; Aihara, Hideki

2016-01-01

Tyrosyl DNA phosphodiesterase 2 (TDP2) is a multifunctional protein implicated in DNA repair, signal transduction and transcriptional regulation. In its DNA repair role, TDP2 safeguards genome integrity by hydrolyzing 5′-tyrosyl DNA adducts formed by abortive topoisomerase II (Top2) cleavage complexes to allow error-free repair of DNA double-strand breaks, thereby conferring cellular resistance against Top2 poisons. TDP2 consists of a C-terminal catalytic domain responsible for its phosphodiesterase activity, and a functionally uncharacterized N-terminal region. Here, we demonstrate that this N-terminal region contains a ubiquitin (Ub)-associated (UBA) domain capable of binding multiple forms of Ub with distinct modes of interactions and preference for either K48- or K63-linked polyUbs over monoUb. The structure of TDP2 UBA bound to monoUb shows a canonical mode of UBA-Ub interaction. However, the absence of the highly conserved MGF motif and the presence of a fourth α-helix make TDP2 UBA distinct from other known UBAs. Mutations in the TDP2 UBA-Ub binding interface do not affect nuclear import of TDP2, but severely compromise its ability to repair Top2-mediated DNA damage, thus establishing the importance of the TDP2 UBA–Ub interaction in DNA repair. The differential binding to multiple Ub forms could be important for responding to DNA damage signals under different contexts or to support the multi-functionality of TDP2. PMID:27543075

MCM ring hexamerization is a prerequisite for DNA-binding

DOE PAGES

Froelich, Clifford A.; Nourse, Amanda; Enemark, Eric J.

2015-09-13

The hexameric Minichromosome Maintenance (MCM) protein complex forms a ring that unwinds DNA at the replication fork in eukaryotes and archaea. Our recent crystal structure of an archaeal MCM N-terminal domain bound to single-stranded DNA (ssDNA) revealed ssDNA associating across tight subunit interfaces but not at the loose interfaces, indicating that DNA-binding is governed not only by the DNA-binding residues of the subunits (MCM ssDNA-binding motif, MSSB) but also by the relative orientation of the subunits. We now extend these findings to show that DNA-binding by the MCM N-terminal domain of the archaeal organism Pyrococcus furiosus occurs specifically in themore » hexameric oligomeric form. We show that mutants defective for hexamerization are defective in binding ssDNA despite retaining all the residues observed to interact with ssDNA in the crystal structure. One mutation that exhibits severely defective hexamerization and ssDNA-binding is at a conserved phenylalanine that aligns with the mouse Mcm4(Chaos3) mutation associated with chromosomal instability, cancer, and decreased intersubunit association.« less

Investigations on the Interactions of 5-Fluorouracil with Herring Sperm DNA: Steady State/Time Resolved and Molecular Modeling Studies

NASA Astrophysics Data System (ADS)

Chinnathambi, Shanmugavel; Karthikeyan, Subramani; Velmurugan, Devadasan; Hanagata, Nobutaka; Aruna, Prakasarao; Ganesan, Singaravelu

2015-04-01

In the present study, the interaction of 5-Fluorouracil with herring sperm DNA is reported using spectroscopic and molecular modeling techniques. This binding study of 5-FU with hs-DNA is of paramount importance in understanding chemico-biological interactions for drug design, pharmacy and biochemistry without altering the original structure. The challenge of the study was to find the exact binding mode of the drug 5-Fluorouracil with hs-DNA. From the absorption studies, a hyperchromic effect was observed for the herring sperm DNA in the presence of 5-Fluorouracil and a binding constant of 6.153 × 103 M-1 for 5-Fluorouracil reveals the existence of weak interaction between the 5-Fluorouracil and herring sperm DNA. Ethidium bromide loaded herring sperm DNA showed a quenching in the fluorescence intensity after the addition of 5-Fluorouracil. The binding constants for 5-Fluorouracil stranded DNA and competitive bindings of 5-FU interacting with DNA-EB systems were examined by fluorescence spectra. The Stern-Volmer plots and fluorescence lifetime results confirm the static quenching nature of the drug-DNA complex. The binding constant Kb was 2.5 × 104 L mol-1 and the number of binding sites are 1.17. The 5-FU on DNA system was calculated using double logarithmic plot. From the Forster nonradiative energy transfer study it has been found that the distance of 5-FU from DNA was 4.24 nm. In addition to the spectroscopic results, the molecular modeling studies also revealed the major groove binding as well as the partial intercalation mode of binding between the 5-Fluorouracil and herring sperm DNA. The binding energy and major groove binding as -6.04 kcal mol-1 and -6.31 kcal mol-1 were calculated from the modeling studies. All the testimonies manifested that binding modes between 5-Fluorouracil and DNA were evidenced to be groove binding and in partial intercalative mode.

Structural determinants of HIV-1 nucleocapsid protein for cTAR DNA binding and destabilization, and correlation with inhibition of self-primed DNA synthesis.

PubMed

Beltz, Hervé; Clauss, Céline; Piémont, Etienne; Ficheux, Damien; Gorelick, Robert J; Roques, Bernard; Gabus, Caroline; Darlix, Jean-Luc; de Rocquigny, Hugues; Mély, Yves

2005-05-20

The nucleocapsid protein (NC) of human immunodeficiency virus type 1 (HIV-1) is formed of two highly conserved CCHC zinc fingers flanked by small basic domains. NC is required for the two obligatory strand transfers in viral DNA synthesis through its nucleic acid chaperoning properties. The first DNA strand transfer relies on NC's ability to bind and destabilize the secondary structure of complementary transactivation response region (cTAR) DNA, to inhibit self-priming, and to promote the annealing of cTAR to TAR RNA. To further investigate NC chaperone properties, our aim was to identify by fluorescence spectroscopy and gel electrophoresis, the NC structural determinants for cTAR binding and destabilization, and for the inhibition of self-primed DNA synthesis on a model system using a series of NC mutants and HIV-1 reverse transcriptase. NC destabilization and self-priming inhibition properties were found to be supported by the two fingers in their proper context and the basic (29)RAPRKKG(35) linker. The strict requirement of the native proximal finger suggests that its hydrophobic platform (Val13, Phe16, Thr24 and Ala25) is crucial for binding, destabilization and inhibition of self-priming. In contrast, only partial folding of the distal finger is required, probably for presenting the Trp37 residue in an appropriate orientation. Also, Trp37 and the hydrophobic residues of the proximal finger appear to be essential for the propagation of the melting from the cTAR ends up to the middle of the stem. Finally, both N-terminal and C-terminal basic domains contribute to cTAR binding but not to its destabilization.

A PARP1-ERK2 synergism is required for the induction of LTP

PubMed Central

Visochek, L.; Grigoryan, G.; Kalal, A.; Milshtein-Parush, H.; Gazit, N.; Slutsky, I.; Yeheskel, A.; Shainberg, A.; Castiel, A.; Seger, R.; Langelier, M. F.; Dantzer, F.; Pascal, J. M.; Segal, M.; Cohen-Armon, M.

2016-01-01

Unexpectedly, a post-translational modification of DNA-binding proteins, initiating the cell response to single-strand DNA damage, was also required for long-term memory acquisition in a variety of learning paradigms. Our findings disclose a molecular mechanism based on PARP1-Erk synergism, which may underlie this phenomenon. A stimulation induced PARP1 binding to phosphorylated Erk2 in the chromatin of cerebral neurons caused Erk-induced PARP1 activation, rendering transcription factors and promoters of immediate early genes (IEG) accessible to PARP1-bound phosphorylated Erk2. Thus, Erk-induced PARP1 activation mediated IEG expression implicated in long-term memory. PARP1 inhibition, silencing, or genetic deletion abrogated stimulation-induced Erk-recruitment to IEG promoters, gene expression and LTP generation in hippocampal CA3-CA1-connections. Moreover, a predominant binding of PARP1 to single-strand DNA breaks, occluding its Erk binding sites, suppressed IEG expression and prevented the generation of LTP. These findings outline a PARP1-dependent mechanism required for LTP generation, which may be implicated in long-term memory acquisition and in its deterioration in senescence. PMID:27121568

A PARP1-ERK2 synergism is required for the induction of LTP.

PubMed

Visochek, L; Grigoryan, G; Kalal, A; Milshtein-Parush, H; Gazit, N; Slutsky, I; Yeheskel, A; Shainberg, A; Castiel, A; Seger, R; Langelier, M F; Dantzer, F; Pascal, J M; Segal, M; Cohen-Armon, M

2016-04-28

Unexpectedly, a post-translational modification of DNA-binding proteins, initiating the cell response to single-strand DNA damage, was also required for long-term memory acquisition in a variety of learning paradigms. Our findings disclose a molecular mechanism based on PARP1-Erk synergism, which may underlie this phenomenon. A stimulation induced PARP1 binding to phosphorylated Erk2 in the chromatin of cerebral neurons caused Erk-induced PARP1 activation, rendering transcription factors and promoters of immediate early genes (IEG) accessible to PARP1-bound phosphorylated Erk2. Thus, Erk-induced PARP1 activation mediated IEG expression implicated in long-term memory. PARP1 inhibition, silencing, or genetic deletion abrogated stimulation-induced Erk-recruitment to IEG promoters, gene expression and LTP generation in hippocampal CA3-CA1-connections. Moreover, a predominant binding of PARP1 to single-strand DNA breaks, occluding its Erk binding sites, suppressed IEG expression and prevented the generation of LTP. These findings outline a PARP1-dependent mechanism required for LTP generation, which may be implicated in long-term memory acquisition and in its deterioration in senescence.

Mechanistic Insights on the Inhibition of C5 DNA Methyltransferases by Zebularine

PubMed Central

Champion, Christine; Guianvarc'h, Dominique; Sénamaud-Beaufort, Catherine; Jurkowska, Renata Z.; Jeltsch, Albert; Ponger, Loïc; Arimondo, Paola B.; Guieysse-Peugeot, Anne-Laure

2010-01-01

In mammals DNA methylation occurs at position 5 of cytosine in a CpG context and regulates gene expression. It plays an important role in diseases and inhibitors of DNA methyltransferases (DNMTs)—the enzymes responsible for DNA methylation—are used in clinics for cancer therapy. The most potent inhibitors are 5-azacytidine and 5-azadeoxycytidine. Zebularine (1-(β-D-ribofuranosyl)-2(1H)- pyrimidinone) is another cytidine analog described as a potent inhibitor that acts by forming a covalent complex with DNMT when incorporated into DNA. Here we bring additional experiments to explain its mechanism of action. First, we observe an increase in the DNA binding when zebularine is incorporated into the DNA, compared to deoxycytidine and 5-fluorodeoxycytidine, together with a strong decrease in the dissociation rate. Second, we show by denaturing gel analysis that the intermediate covalent complex between the enzyme and the DNA is reversible, differing thus from 5-fluorodeoxycytidine. Third, no methylation reaction occurs when zebularine is present in the DNA. We confirm that zebularine exerts its demethylation activity by stabilizing the binding of DNMTs to DNA, hindering the methylation and decreasing the dissociation, thereby trapping the enzyme and preventing turnover even at other sites. PMID:20808780

Krüppel-like factors are effectors of nuclear receptor signaling

PubMed Central

Knoedler, Joseph R.; Denver, Robert J.

2015-01-01

Binding of steroid and thyroid hormones to their cognate nuclear receptors (NRs) impacts virtually every aspect of postembryonic development, physiology and behavior, and inappropriate signaling by NRs may contribute to disease. While NRs regulate genes by direct binding to hormone response elements in the genome, their actions may depend on the activity of other transcription factors (TFs) that may or may not bind DNA. The Krüppel-like family of transcription factors (KLF) is an evolutionarily conserved class of DNA-binding proteins that influence many aspects of development and physiology. Several members of this family have been shown to play diverse roles in NR signaling. For example, KLFs 1) act as accessory transcription factors for NR actions, 2) regulate expression of NR genes, and 3) as gene products of primary NR response genes function as key players in NR-dependent transcriptional networks. In mouse models, deletion of different KLFs leads to aberrant transcriptional and physiological responses to hormones, underscoring the importance of these proteins in the regulation of hormonal signaling. Understanding the functional relationships between NRs and KLFs will yield important insights into mechanisms of NR signaling. In this review we present a conceptual framework for understanding how KLFs participate in NR signaling, and we provide examples of how these proteins function to effect hormone action. PMID:24642391

Multiple conformational states of DnaA protein regulate its interaction with DnaA boxes in the initiation of DNA replication.

PubMed

Patel, Meera J; Bhatia, Lavesh; Yilmaz, Gulden; Biswas-Fiss, Esther E; Biswas, Subhasis B

2017-09-01

DnaA protein is the initiator of genomic DNA replication in prokaryotes. It binds to specific DNA sequences in the origin of DNA replication and unwinds small AT-rich sequences downstream for the assembly of the replisome. The mechanism of activation of DnaA that enables it to bind and organize the origin DNA and leads to replication initiation remains unclear. In this study, we have developed double-labeled fluorescent DnaA probes to analyze conformational states of DnaA protein upon binding DNA, nucleotide, and Soj sporulation protein using Fluorescence Resonance Energy Transfer (FRET). Our studies demonstrate that DnaA protein undergoes large conformational changes upon binding to substrates and there are multiple distinct conformational states that enable it to initiate DNA replication. DnaA protein adopted a relaxed conformation by expanding ~15Å upon binding ATP and DNA to form the ATP·DnaA·DNA complex. Hydrolysis of bound ATP to ADP led to a contraction of DnaA within the complex. The relaxed conformation of DnaA is likely required for the formation of the multi-protein ATP·DnaA·DNA complex. In the initiation of sporulation, Soj binding to DnaA prevented relaxation of its conformation. Soj·ADP appeared to block the activation of DnaA, suggesting a mechanism for Soj·ADP in switching initiation of DNA replication to sporulation. Our studies demonstrate that multiple conformational states of DnaA protein regulate its binding to DNA in the initiation of DNA replication. Copyright © 2017 Elsevier B.V. All rights reserved.

Differences in DNA Binding Specificity of Floral Homeotic Protein Complexes Predict Organ-Specific Target Genes.

PubMed

Smaczniak, Cezary; Muiño, Jose M; Chen, Dijun; Angenent, Gerco C; Kaufmann, Kerstin

2017-08-01

Floral organ identities in plants are specified by the combinatorial action of homeotic master regulatory transcription factors. However, how these factors achieve their regulatory specificities is still largely unclear. Genome-wide in vivo DNA binding data show that homeotic MADS domain proteins recognize partly distinct genomic regions, suggesting that DNA binding specificity contributes to functional differences of homeotic protein complexes. We used in vitro systematic evolution of ligands by exponential enrichment followed by high-throughput DNA sequencing (SELEX-seq) on several floral MADS domain protein homo- and heterodimers to measure their DNA binding specificities. We show that specification of reproductive organs is associated with distinct binding preferences of a complex formed by SEPALLATA3 and AGAMOUS. Binding specificity is further modulated by different binding site spacing preferences. Combination of SELEX-seq and genome-wide DNA binding data allows differentiation between targets in specification of reproductive versus perianth organs in the flower. We validate the importance of DNA binding specificity for organ-specific gene regulation by modulating promoter activity through targeted mutagenesis. Our study shows that intrafamily protein interactions affect DNA binding specificity of floral MADS domain proteins. Differential DNA binding of MADS domain protein complexes plays a role in the specificity of target gene regulation. © 2017 American Society of Plant Biologists. All rights reserved.

Investigation of arc repressor DNA-binding specificity by comparative molecular dynamics simulations.

PubMed

Song, Wei; Guo, Jun-Tao

2015-01-01

Transcription factors regulate gene expression through binding to specific DNA sequences. How transcription factors achieve high binding specificity is still not well understood. In this paper, we investigated the role of protein flexibility in protein-DNA-binding specificity by comparative molecular dynamics (MD) simulations. Protein flexibility has been considered as a key factor in molecular recognition, which is intrinsically a dynamic process involving fine structural fitting between binding components. In this study, we performed comparative MD simulations on wild-type and F10V mutant P22 Arc repressor in both free and complex conformations. The F10V mutant has lower DNA-binding specificity though both the bound and unbound main-chain structures between the wild-type and F10V mutant Arc are highly similar. We found that the DNA-binding motif of wild-type Arc is structurally more flexible than the F10V mutant in the unbound state, especially for the six DNA base-contacting residues in each dimer. We demonstrated that the flexible side chains of wild-type Arc lead to a higher DNA-binding specificity through forming more hydrogen bonds with DNA bases upon binding. Our simulations also showed a possible conformational selection mechanism for Arc-DNA binding. These results indicate the important roles of protein flexibility and dynamic properties in protein-DNA-binding specificity.

Mitochondrial DNA maintenance is regulated in human hepatoma cells by glycogen synthase kinase 3β and p53 in response to tumor necrosis factor α.

PubMed

Vadrot, Nathalie; Ghanem, Sarita; Braut, Françoise; Gavrilescu, Laura; Pilard, Nathalie; Mansouri, Abdellah; Moreau, Richard; Reyl-Desmars, Florence

2012-01-01

During chronic liver inflammation, up-regulated Tumor Necrosis Factor alpha (TNF-α) targets hepatocytes and induces abnormal reactive oxygen species (ROS) production responsible for mitochondrial DNA (mtDNA) alterations. The serine/threonine Glycogen Synthase Kinase 3 beta (GSK3β) plays a pivotal role during inflammation but its involvement in the maintenance of mtDNA remains unknown. The aim of this study was to investigate its involvement in TNF-α induced mtDNA depletion and its interrelationship with p53 a protein known to maintain mtDNA copy numbers. Using quantitative polymerase chain reaction (qPCR) we found that at 30 min in human hepatoma HepG2 cells TNF-α induced 0.55±0.10 mtDNA lesions per 10 Kb and a 52.4±2.8% decrease in mtDNA content dependent on TNF-R1 receptor and ROS production. Both lesions and depletion returned to baseline from 1 to 6 h after TNF-α exposure. Luminol-amplified chemiluminescence (LAC) was used to measure the rapid (10 min) and transient TNF-α induced increase in ROS production (168±15%). A transient 8-oxo-dG level of 1.4±0.3 ng/mg DNA and repair of abasic sites were also measured by ELISA assays. Translocation of p53 to mitochondria was observed by Western Blot and co-immunoprecipitations showed that TNF-α induced p53 binding to GSK3β and mitochondrial transcription factor A (TFAM). In addition, mitochondrial D-loop immunoprecipitation (mtDIP) revealed that TNF-α induced p53 binding to the regulatory D-loop region of mtDNA. The knockdown of p53 by siRNAs, inhibition by the phosphoSer(15)p53 antibody or transfection of human mutant active GSK3βS9A pcDNA3 plasmid inhibited recovery of mtDNA content while blockade of GSK3β activity by SB216763 inhibitor or knockdown by siRNAs suppressed mtDNA depletion. This study is the first to report the involvement of GSK3β in TNF-α induced mtDNA depletion. We suggest that p53 binding to GSK3β, TFAM and D-loop could induce recovery of mtDNA content through mtDNA repair.

Single-molecule FRET studies of the cooperative and non-cooperative binding kinetics of the bacteriophage T4 single-stranded DNA binding protein (gp32) to ssDNA lattices at replication fork junctions

PubMed Central

Lee, Wonbae; Gillies, John P.; Jose, Davis; Israels, Brett A.; von Hippel, Peter H.; Marcus, Andrew H.

2016-01-01

Gene 32 protein (gp32) is the single-stranded (ss) DNA binding protein of the bacteriophage T4. It binds transiently and cooperatively to ssDNA sequences exposed during the DNA replication process and regulates the interactions of the other sub-assemblies of the replication complex during the replication cycle. We here use single-molecule FRET techniques to build on previous thermodynamic studies of gp32 binding to initiate studies of the dynamics of the isolated and cooperative binding of gp32 molecules within the replication complex. DNA primer/template (p/t) constructs are used as models to determine the effects of ssDNA lattice length, gp32 concentration, salt concentration, binding cooperativity and binding polarity at p/t junctions. Hidden Markov models (HMMs) and transition density plots (TDPs) are used to characterize the dynamics of the multi-step assembly pathway of gp32 at p/t junctions of differing polarity, and show that isolated gp32 molecules bind to their ssDNA targets weakly and dissociate quickly, while cooperatively bound dimeric or trimeric clusters of gp32 bind much more tightly, can ‘slide’ on ssDNA sequences, and exhibit binding dynamics that depend on p/t junction polarities. The potential relationships of these binding dynamics to interactions with other components of the T4 DNA replication complex are discussed. PMID:27694621

STAT1:DNA sequence-dependent binding modulation by phosphorylation, protein:protein interactions and small-molecule inhibition

PubMed Central

Bonham, Andrew J.; Wenta, Nikola; Osslund, Leah M.; Prussin, Aaron J.; Vinkemeier, Uwe; Reich, Norbert O.

2013-01-01

The DNA-binding specificity and affinity of the dimeric human transcription factor (TF) STAT1, were assessed by total internal reflectance fluorescence protein-binding microarrays (TIRF-PBM) to evaluate the effects of protein phosphorylation, higher-order polymerization and small-molecule inhibition. Active, phosphorylated STAT1 showed binding preferences consistent with prior characterization, whereas unphosphorylated STAT1 showed a weak-binding preference for one-half of the GAS consensus site, consistent with recent models of STAT1 structure and function in response to phosphorylation. This altered-binding preference was further tested by use of the inhibitor LLL3, which we show to disrupt STAT1 binding in a sequence-dependent fashion. To determine if this sequence-dependence is specific to STAT1 and not a general feature of human TF biology, the TF Myc/Max was analysed and tested with the inhibitor Mycro3. Myc/Max inhibition by Mycro3 is sequence independent, suggesting that the sequence-dependent inhibition of STAT1 may be specific to this system and a useful target for future inhibitor design. PMID:23180800

Specificity and 6-Month Durability of Immune Responses Induced by DNA and Recombinant Modified Vaccinia Ankara Vaccines Expressing HIV-1 Virus-Like Particles

PubMed Central

Goepfert, Paul A.; Elizaga, Marnie L.; Seaton, Kelly; Tomaras, Georgia D.; Montefiori, David C.; Sato, Alicia; Hural, John; DeRosa, Stephen C.; Kalams, Spyros A.; McElrath, M. Juliana; Keefer, Michael C.; Baden, Lindsey R.; Lama, Javier R.; Sanchez, Jorge; Mulligan, Mark J.; Buchbinder, Susan P.; Hammer, Scott M.; Koblin, Beryl A.; Pensiero, Michael; Butler, Chris; Moss, Bernard; Robinson, Harriet L.; Donastorg, Yeycy; Qin, Li; Lawrence, Dale; Cardinali, Massimo; Bae, Jin; Holt, Renée; Redinger, Huguette; Johannessen, Jan; Broder, Gail; Moody-White, Jerri; McKay, Butch; Calazans, Gabriela; Bentley, Carter; Kakinami, Lisa; Skibinski, Katie; Estep, Scharla; Tseng, Jenny; Swenson, Molly; Madenwald, Tamra; Overton, Edgar Turner; Edupuganti, Srilatha; Rouphael, Nadine; Whitaker, Jennifer; Hay, C Mhorag; Bunce, Catherine A; Gonzales, Pedro; Hurtado, Juan Carlos; Dolin, Raphael; Mayer, Ken; Walsh, Steven; Johnson, Jennifer

2014-01-01

Background. Clade B DNA and recombinant modified vaccinia Ankara (MVA) vaccines producing virus-like particles displaying trimeric membrane-bound envelope glycoprotein (Env) were tested in a phase 2a trial in human immunodeficiency virus (HIV)–uninfected adults for safety, immunogenicity, and 6-month durability of immune responses. Methods. A total of 299 individuals received 2 doses of JS7 DNA vaccine and 2 doses of MVA/HIV62B at 0, 2, 4, and 6 months, respectively (the DDMM regimen); 3 doses of MVA/HIV62B at 0, 2, and 6 months (the MMM regimen); or placebo injections. Results. At peak response, 93.2% of the DDMM group and 98.4% of the MMM group had binding antibodies for Env. These binding antibodies were more frequent and of higher magnitude for the transmembrane subunit (gp41) than the receptor-binding subunit (gp120) of Env. For both regimens, response rates were higher for CD4+ T cells (66.4% in the DDMM group and 43.1% in the MMM group) than for CD8+ T cells (21.8% in the DDMM group and 14.9% in the MMM group). Responding CD4+ and CD8+ T cells were biased toward Gag, and >70% produced 2 or 3 of the 4 cytokines evaluated (ie, interferon γ, interleukin 2, tumor necrosis factor α, and granzyme B). Six months after vaccination, the magnitudes of antibodies and T-cell responses had decreased by <3-fold. Conclusions. DDMM and MMM vaccinations with virus-like particle–expressing immunogens elicited durable antibody and T-cell responses. PMID:24403557

The FANCJ/MutLα interaction is required for correction of the cross-link response in FA-J cells

PubMed Central

Peng, Min; Litman, Rachel; Xie, Jenny; Sharma, Sudha; Brosh, Robert M; Cantor, Sharon B

2007-01-01

FANCJ also called BACH1/BRIP1 was first linked to hereditary breast cancer through its direct interaction with BRCA1. FANCJ was also recently identified as a Fanconi anemia (FA) gene product, establishing FANCJ as an essential tumor suppressor. Similar to other FA cells, FANCJ-null (FA-J) cells accumulate 4N DNA content in response to DNA interstrand crosslinks (ICLs). This accumulation is corrected by reintroduction of wild-type FANCJ. Here, we show that FANCJ interacts with the mismatch repair complex MutLα, composed of PMS2 and MLH1. Specifically, FANCJ directly interacts with MLH1 independent of BRCA1, through its helicase domain. Genetic studies reveal that FANCJ helicase activity and MLH1 binding, but not BRCA1 binding, are essential to correct the FA-J cells' ICL-induced 4N DNA accumulation and sensitivity to ICLs. These results suggest that the FANCJ/MutLα interaction, but not FANCJ/BRCA1 interaction, is essential for establishment of a normal ICL-induced response. The functional role of the FANCJ/MutLα complex demonstrates a novel link between FA and MMR, and predicts a broader role for FANCJ in DNA damage signaling independent of BRCA1. PMID:17581638

Molecular dynamics simulations revealed structural differences among WRKY domain-DNA interaction in barley (Hordeum vulgare).

PubMed

Pandey, Bharati; Grover, Abhinav; Sharma, Pradeep

2018-02-12

The WRKY transcription factors are a class of DNA-binding proteins involved in diverse plant processes play critical roles in response to abiotic and biotic stresses. Genome-wide divergence analysis of WRKY gene family in Hordeum vulgare provided a framework for molecular evolution and functional roles. So far, the crystal structure of WRKY from barley has not been resolved; moreover, knowledge of the three-dimensional structure of WRKY domain is pre-requisites for exploring the protein-DNA recognition mechanisms. Homology modelling based approach was used to generate structures for WRKY DNA binding domain (DBD) and its variants using AtWRKY1 as a template. Finally, the stability and conformational changes of the generated model in unbound and bound form was examined through atomistic molecular dynamics (MD) simulations for 100 ns time period. In this study, we investigated the comparative binding pattern of WRKY domain and its variants with W-box cis-regulatory element using molecular docking and dynamics (MD) simulations assays. The atomic insight into WRKY domain exhibited significant variation in the intermolecular hydrogen bonding pattern, leading to the structural anomalies in the variant type and differences in the DNA-binding specificities. Based on the MD analysis, residual contribution and interaction contour, wild-type WRKY (HvWRKY46) were found to interact with DNA through highly conserved heptapeptide in the pre- and post-MD simulated complexes, whereas heptapeptide interaction with DNA was missing in variants (I and II) in post-MD complexes. Consequently, through principal component analysis, wild-type WRKY was also found to be more stable by obscuring a reduced conformational space than the variant I (HvWRKY34). Lastly, high binding free energy for wild-type and variant II allowed us to conclude that wild-type WRKY-DNA complex was more stable relative to variants I. The results of our study revealed complete dynamic and structural information about WRKY domain-DNA interactions. However, no structure base information reported to date for WRKY variants and their mechanism of interaction with DNA. Our findings highlighted the importance of selecting a sequence to generate newer transgenic plants that would be increasingly tolerance to stress conditions.

Regulation of yeast DNA polymerase δ-mediated strand displacement synthesis by 5′-flaps

PubMed Central

Koc, Katrina N.; Stodola, Joseph L.; Burgers, Peter M.; Galletto, Roberto

2015-01-01

The strand displacement activity of DNA polymerase δ is strongly stimulated by its interaction with proliferating cell nuclear antigen (PCNA). However, inactivation of the 3′–5′ exonuclease activity is sufficient to allow the polymerase to carry out strand displacement even in the absence of PCNA. We have examined in vitro the basic biochemical properties that allow Pol δ-exo− to carry out strand displacement synthesis and discovered that it is regulated by the 5′-flaps in the DNA strand to be displaced. Under conditions where Pol δ carries out strand displacement synthesis, the presence of long 5′-flaps or addition in trans of ssDNA suppress this activity. This suggests the presence of a secondary DNA binding site on the enzyme that is responsible for modulation of strand displacement activity. The inhibitory effect of a long 5′-flap can be suppressed by its interaction with single-stranded DNA binding proteins. However, this relief of flap-inhibition does not simply originate from binding of Replication Protein A to the flap and sequestering it. Interaction of Pol δ with PCNA eliminates flap-mediated inhibition of strand displacement synthesis by masking the secondary DNA site on the polymerase. These data suggest that in addition to enhancing the processivity of the polymerase PCNA is an allosteric modulator of other Pol δ activities. PMID:25813050

Herpes simplex virus DNA packaging sequences adopt novel structures that are specifically recognized by a component of the cleavage and packaging machinery.

PubMed

Adelman, K; Salmon, B; Baines, J D

2001-03-13

The product of the herpes simplex virus type 1 U(L)28 gene is essential for cleavage of concatemeric viral DNA into genome-length units and packaging of this DNA into viral procapsids. To address the role of U(L)28 in this process, purified U(L)28 protein was assayed for the ability to recognize conserved herpesvirus DNA packaging sequences. We report that DNA fragments containing the pac1 DNA packaging motif can be induced by heat treatment to adopt novel DNA conformations that migrate faster than the corresponding duplex in nondenaturing gels. Surprisingly, these novel DNA structures are high-affinity substrates for U(L)28 protein binding, whereas double-stranded DNA of identical sequence composition is not recognized by U(L)28 protein. We demonstrate that only one strand of the pac1 motif is responsible for the formation of novel DNA structures that are bound tightly and specifically by U(L)28 protein. To determine the relevance of the observed U(L)28 protein-pac1 interaction to the cleavage and packaging process, we have analyzed the binding affinity of U(L)28 protein for pac1 mutants previously shown to be deficient in cleavage and packaging in vivo. Each of the pac1 mutants exhibited a decrease in DNA binding by U(L)28 protein that correlated directly with the reported reduction in cleavage and packaging efficiency, thereby supporting a role for the U(L)28 protein-pac1 interaction in vivo. These data therefore suggest that the formation of novel DNA structures by the pac1 motif confers added specificity on recognition of DNA packaging sequences by the U(L)28-encoded component of the herpesvirus cleavage and packaging machinery.

Context influences on TALE–DNA binding revealed by quantitative profiling

PubMed Central

Rogers, Julia M.; Barrera, Luis A.; Reyon, Deepak; Sander, Jeffry D.; Kellis, Manolis; Joung, J Keith; Bulyk, Martha L.

2015-01-01

Transcription activator-like effector (TALE) proteins recognize DNA using a seemingly simple DNA-binding code, which makes them attractive for use in genome engineering technologies that require precise targeting. Although this code is used successfully to design TALEs to target specific sequences, off-target binding has been observed and is difficult to predict. Here we explore TALE–DNA interactions comprehensively by quantitatively assaying the DNA-binding specificities of 21 representative TALEs to ∼5,000–20,000 unique DNA sequences per protein using custom-designed protein-binding microarrays (PBMs). We find that protein context features exert significant influences on binding. Thus, the canonical recognition code does not fully capture the complexity of TALE–DNA binding. We used the PBM data to develop a computational model, Specificity Inference For TAL-Effector Design (SIFTED), to predict the DNA-binding specificity of any TALE. We provide SIFTED as a publicly available web tool that predicts potential genomic off-target sites for improved TALE design. PMID:26067805

Context influences on TALE-DNA binding revealed by quantitative profiling.

PubMed

Rogers, Julia M; Barrera, Luis A; Reyon, Deepak; Sander, Jeffry D; Kellis, Manolis; Joung, J Keith; Bulyk, Martha L

2015-06-11

Transcription activator-like effector (TALE) proteins recognize DNA using a seemingly simple DNA-binding code, which makes them attractive for use in genome engineering technologies that require precise targeting. Although this code is used successfully to design TALEs to target specific sequences, off-target binding has been observed and is difficult to predict. Here we explore TALE-DNA interactions comprehensively by quantitatively assaying the DNA-binding specificities of 21 representative TALEs to ∼5,000-20,000 unique DNA sequences per protein using custom-designed protein-binding microarrays (PBMs). We find that protein context features exert significant influences on binding. Thus, the canonical recognition code does not fully capture the complexity of TALE-DNA binding. We used the PBM data to develop a computational model, Specificity Inference For TAL-Effector Design (SIFTED), to predict the DNA-binding specificity of any TALE. We provide SIFTED as a publicly available web tool that predicts potential genomic off-target sites for improved TALE design.

TFBSshape: a motif database for DNA shape features of transcription factor binding sites.

PubMed

Yang, Lin; Zhou, Tianyin; Dror, Iris; Mathelier, Anthony; Wasserman, Wyeth W; Gordân, Raluca; Rohs, Remo

2014-01-01

Transcription factor binding sites (TFBSs) are most commonly characterized by the nucleotide preferences at each position of the DNA target. Whereas these sequence motifs are quite accurate descriptions of DNA binding specificities of transcription factors (TFs), proteins recognize DNA as a three-dimensional object. DNA structural features refine the description of TF binding specificities and provide mechanistic insights into protein-DNA recognition. Existing motif databases contain extensive nucleotide sequences identified in binding experiments based on their selection by a TF. To utilize DNA shape information when analysing the DNA binding specificities of TFs, we developed a new tool, the TFBSshape database (available at http://rohslab.cmb.usc.edu/TFBSshape/), for calculating DNA structural features from nucleotide sequences provided by motif databases. The TFBSshape database can be used to generate heat maps and quantitative data for DNA structural features (i.e., minor groove width, roll, propeller twist and helix twist) for 739 TF datasets from 23 different species derived from the motif databases JASPAR and UniPROBE. As demonstrated for the basic helix-loop-helix and homeodomain TF families, our TFBSshape database can be used to compare, qualitatively and quantitatively, the DNA binding specificities of closely related TFs and, thus, uncover differential DNA binding specificities that are not apparent from nucleotide sequence alone.

TFBSshape: a motif database for DNA shape features of transcription factor binding sites

PubMed Central

Yang, Lin; Zhou, Tianyin; Dror, Iris; Mathelier, Anthony; Wasserman, Wyeth W.; Gordân, Raluca; Rohs, Remo

2014-01-01

Transcription factor binding sites (TFBSs) are most commonly characterized by the nucleotide preferences at each position of the DNA target. Whereas these sequence motifs are quite accurate descriptions of DNA binding specificities of transcription factors (TFs), proteins recognize DNA as a three-dimensional object. DNA structural features refine the description of TF binding specificities and provide mechanistic insights into protein–DNA recognition. Existing motif databases contain extensive nucleotide sequences identified in binding experiments based on their selection by a TF. To utilize DNA shape information when analysing the DNA binding specificities of TFs, we developed a new tool, the TFBSshape database (available at http://rohslab.cmb.usc.edu/TFBSshape/), for calculating DNA structural features from nucleotide sequences provided by motif databases. The TFBSshape database can be used to generate heat maps and quantitative data for DNA structural features (i.e., minor groove width, roll, propeller twist and helix twist) for 739 TF datasets from 23 different species derived from the motif databases JASPAR and UniPROBE. As demonstrated for the basic helix-loop-helix and homeodomain TF families, our TFBSshape database can be used to compare, qualitatively and quantitatively, the DNA binding specificities of closely related TFs and, thus, uncover differential DNA binding specificities that are not apparent from nucleotide sequence alone. PMID:24214955

Impact of low-frequency hotspot mutation R282Q on the structure of p53 DNA-binding domain as revealed by crystallography at 1.54 Å resolution

PubMed Central

Tu, Chao; Tan, Yu-Hong; Shaw, Gary; Zhou, Zheng; Bai, Yawen; Luo, Ray; Ji, Xinhua

2008-01-01

Tumor suppressor p53 is a sequence-specific DNA-binding protein and its central DNA-binding domain (DBD) harbors six hotspots (Arg175, Gly245, Arg248, Arg249, Arg273 and Arg282) for human cancers. Here, the crystal structure of a low-frequency hotspot mutant, p53DBD(R282Q), is reported at 1.54 Å resolution together with the results of molecular-dynamics simulations on the basis of the structure. In addition to eliminating a salt bridge, the R282Q mutation has a significant impact on the properties of two DNA-binding loops (L1 and L3). The L1 loop is flexible in the wild type, but it is not flexible in the mutant. The L3 loop of the wild type is not flexible, whereas it assumes two conformations in the mutant. Molecular-dynamics simulations indicated that both conformations of the L3 loop are accessible under biological conditions. It is predicted that the elimination of the salt bridge and the inversion of the flexibility of L1 and L3 are directly or indirectly responsible for deactivating the tumor suppressor p53. PMID:18453682

Mammalian transcription factor LSF is a target of ERK signaling

PubMed Central

Pagon, Zrinka; Volker, Janet; Cooper, Geoffrey M.; Hansen, Ulla

2012-01-01

LSF is a mammalian transcription factor that is rapidly and quantitatively phosphorylated upon growth induction of resting, peripheral human T cells, as assayed by a reduction in its electrophoretic mobility. The DNA-binding activity of LSF in primary T cells is greatly increased after this phosphorylation event [Volker et al., 1997]. We demonstrate here that LSF is also rapidly and quantitatively phosphorylated upon growth induction in NIH 3T3 cells, although its DNA-binding activity is not significantly altered. Three lines of experimentation established that ERK is responsible for phosphorylating LSF upon growth induction in both cell types. First, phosphorylation of LSF by ERK is sufficient to cause the reduced electrophoretic mobility of LSF. Second, the amount of ERK activity correlates with the extent of LSF phosphorylation in both primary human T cells and NIH 3T3 cells. Finally, specific inhibitors of the Ras/Raf/MEK/ERK pathway inhibit LSF modification in vivo. This phosphorylation by ERK is not sufficient for activation of LSF DNA-binding activity, as evidenced both in vitro and in mouse fibroblasts. Nonetheless, activation of ERK is a prerequisite for the substantial increase in LSF DNA-binding activity upon activation of resting T cells, indicating that ERK phosphorylation is necessary but not sufficient for activation of LSF in this cell type. PMID:12858339

Lithium promotes DNA stability and survival of ischemic retinal neurocytes by upregulating DNA ligase IV.

PubMed

Yang, Ying; Wu, Nandan; Tian, Sijia; Li, Fan; Hu, Huan; Chen, Pei; Cai, Xiaoxiao; Xu, Lijun; Zhang, Jing; Chen, Zhao; Ge, Jian; Yu, Keming; Zhuang, Jing

2016-11-17

Neurons display genomic fragility and show fragmented DNA in pathological degeneration. A failure to repair DNA breaks may result in cell death or apoptosis. Lithium protects retinal neurocytes following nutrient deprivation or partial nerve crush, but the underlying mechanisms are not well defined. Here we demonstrate that pretreatment with lithium protects retinal neurocytes from ischemia-induced damage and enhances light response in rat retina following ischemia-reperfusion injury. Moreover, we found that DNA nonhomologous end-joining (NHEJ) repair is implicated in this process because in ischemic retinal neurocytes, lithium significantly reduces the number of γ-H2AX foci (well-characterized markers of DNA double-strand breaks in situ) and increases the DNA ligase IV expression level. Furthermore, we also demonstrate that nuclear respiratory factor 1 (Nrf-1) and phosphorylated cyclic AMP-response element binding protein-1 (P-CREB1) bind to ligase IV promoter to cause upregulation of ligase IV in neurocytes. The ischemic upregulation of Nrf-1 and lithium-induced increase of P-CREB1 cooperate to promote transcription of ligase IV. Short hairpin RNAs against Nrf-1 and CREB1 could significantly inhibit the increase in promoter activity and expression of ligase IV observed in the control oligos following lithium treatment in retinal neurocytes. More importantly, ischemic stimulation triggers the expression of ligase IV. Taken together, our results thus reveal a novel mechanism that lithium offers neuroprotection from ischemia-induced damage by enhancing DNA NHEJ repair.

Lithium promotes DNA stability and survival of ischemic retinal neurocytes by upregulating DNA ligase IV

PubMed Central

Yang, Ying; Wu, Nandan; Tian, Sijia; Li, Fan; Hu, Huan; Chen, Pei; Cai, Xiaoxiao; Xu, Lijun; Zhang, Jing; Chen, Zhao; Ge, Jian; Yu, Keming; Zhuang, Jing

2016-01-01

Neurons display genomic fragility and show fragmented DNA in pathological degeneration. A failure to repair DNA breaks may result in cell death or apoptosis. Lithium protects retinal neurocytes following nutrient deprivation or partial nerve crush, but the underlying mechanisms are not well defined. Here we demonstrate that pretreatment with lithium protects retinal neurocytes from ischemia-induced damage and enhances light response in rat retina following ischemia–reperfusion injury. Moreover, we found that DNA nonhomologous end-joining (NHEJ) repair is implicated in this process because in ischemic retinal neurocytes, lithium significantly reduces the number of γ-H2AX foci (well-characterized markers of DNA double-strand breaks in situ) and increases the DNA ligase IV expression level. Furthermore, we also demonstrate that nuclear respiratory factor 1 (Nrf-1) and phosphorylated cyclic AMP-response element binding protein-1 (P-CREB1) bind to ligase IV promoter to cause upregulation of ligase IV in neurocytes. The ischemic upregulation of Nrf-1 and lithium-induced increase of P-CREB1 cooperate to promote transcription of ligase IV. Short hairpin RNAs against Nrf-1 and CREB1 could significantly inhibit the increase in promoter activity and expression of ligase IV observed in the control oligos following lithium treatment in retinal neurocytes. More importantly, ischemic stimulation triggers the expression of ligase IV. Taken together, our results thus reveal a novel mechanism that lithium offers neuroprotection from ischemia-induced damage by enhancing DNA NHEJ repair. PMID:27853172

The mCpG-binding domain of human MBD3 does not bind to mCpG but interacts with NuRD/Mi2 components HDAC1 and MTA2.

PubMed

Saito, Motoki; Ishikawa, Fuyuki

2002-09-20

Although mammalian MBD3 contains the mCpG-binding domain (MBD) and is highly homologous with the authentic mCpG-binding protein MBD2, it was reported that the protein does not bind to mCpG specifically. Using recombinant human wild type and mutant MBD3 proteins, we demonstrated that atypical amino acids found in MBD3 MBD, namely, His-30 and Phe-34, are responsible for the inability of MBD3 to bind to mCpG. Interestingly, although H30K/F34Y MBD3 mutant protein binds to mCpG efficiently in vitro, it was not localized at the mCpG-rich pericentromeric regions in mouse cells. We also showed that Y34F MBD2b MBD, which possesses not the mCpG-specific DNA-binding activity but the nonspecific DNA-binding activity, was localized at the pericentromeric regions. These results suggested that the mCpG-specific DNA-binding activity is largely dispensable, and another factor(s) is required for the localization of MBD proteins in vivo. MBD3 was identified as a component of the NuRD/Mi2 complex that shows chromatin remodeling and histone deacetylase activities. We demonstrated that MBD3 MBD is necessary and sufficient for binding to HDAC1 and MTA2, two components of the NuRD/Mi2 complex. It was therefore suggested that mCpG-binding-defective MBD3 has evolutionarily conserved its MBD because of the secondary role played by the MBD in protein-protein interactions.

Activation of p53 Transcriptional Activity by SMRT: a Histone Deacetylase 3-Independent Function of a Transcriptional Corepressor

PubMed Central

Adikesavan, Anbu Karani; Karmakar, Sudipan; Pardo, Patricia; Wang, Liguo; Liu, Shuang; Li, Wei

2014-01-01

The silencing mediator of retinoic acid and thyroid hormone receptors (SMRT) is an established histone deacetylase 3 (HDAC3)-dependent transcriptional corepressor. Microarray analyses of MCF-7 cells transfected with control or SMRT small interfering RNA revealed SMRT regulation of genes involved in DNA damage responses, and the levels of the DNA damage marker γH2AX as well as poly(ADP-ribose) polymerase cleavage were elevated in SMRT-depleted cells treated with doxorubicin. A number of these genes are established p53 targets. SMRT knockdown decreased the activity of two p53-dependent reporter genes as well as the expression of p53 target genes, such as CDKN1A (which encodes p21). SMRT bound directly to p53 and was recruited to p53 binding sites within the p21 promoter. Depletion of GPS2 and TBL1, components of the SMRT corepressor complex, but not histone deacetylase 3 (HDAC3) decreased p21-luciferase activity. p53 bound to the SMRT deacetylase activation domain (DAD), which mediates HDAC3 binding and activation, and HDAC3 could attenuate p53 binding to the DAD region of SMRT. Moreover, an HDAC3 binding-deficient SMRT DAD mutant coactivated p53 transcriptional activity. Collectively, these data highlight a biological role for SMRT in mediating DNA damage responses and suggest a model where p53 binding to the DAD limits HDAC3 interaction with this coregulator, thereby facilitating SMRT coactivation of p53-dependent gene expression. PMID:24449765

Identification of the DNA-Binding Domains of Human Replication Protein A That Recognize G-Quadruplex DNA

PubMed Central

Prakash, Aishwarya; Natarajan, Amarnath; Marky, Luis A.; Ouellette, Michel M.; Borgstahl, Gloria E. O.

2011-01-01

Replication protein A (RPA), a key player in DNA metabolism, has 6 single-stranded DNA-(ssDNA-) binding domains (DBDs) A-F. SELEX experiments with the DBDs-C, -D, and -E retrieve a 20-nt G-quadruplex forming sequence. Binding studies show that RPA-DE binds preferentially to the G-quadruplex DNA, a unique preference not observed with other RPA constructs. Circular dichroism experiments show that RPA-CDE-core can unfold the G-quadruplex while RPA-DE stabilizes it. Binding studies show that RPA-C binds pyrimidine- and purine-rich sequences similarly. This difference between RPA-C and RPA-DE binding was also indicated by the inability of RPA-CDE-core to unfold an oligonucleotide containing a TC-region 5′ to the G-quadruplex. Molecular modeling studies of RPA-DE and telomere-binding proteins Pot1 and Stn1 reveal structural similarities between the proteins and illuminate potential DNA-binding sites for RPA-DE and Stn1. These data indicate that DBDs of RPA have different ssDNA recognition properties. PMID:21772997

Screening for Protein-DNA Interactions by Automatable DNA-Protein Interaction ELISA

PubMed Central

Schüssler, Axel; Kolukisaoglu, H. Üner; Koch, Grit; Wallmeroth, Niklas; Hecker, Andreas; Thurow, Kerstin; Zell, Andreas; Harter, Klaus; Wanke, Dierk

2013-01-01

DNA-binding proteins (DBPs), such as transcription factors, constitute about 10% of the protein-coding genes in eukaryotic genomes and play pivotal roles in the regulation of chromatin structure and gene expression by binding to short stretches of DNA. Despite their number and importance, only for a minor portion of DBPs the binding sequence had been disclosed. Methods that allow the de novo identification of DNA-binding motifs of known DBPs, such as protein binding microarray technology or SELEX, are not yet suited for high-throughput and automation. To close this gap, we report an automatable DNA-protein-interaction (DPI)-ELISA screen of an optimized double-stranded DNA (dsDNA) probe library that allows the high-throughput identification of hexanucleotide DNA-binding motifs. In contrast to other methods, this DPI-ELISA screen can be performed manually or with standard laboratory automation. Furthermore, output evaluation does not require extensive computational analysis to derive a binding consensus. We could show that the DPI-ELISA screen disclosed the full spectrum of binding preferences for a given DBP. As an example, AtWRKY11 was used to demonstrate that the automated DPI-ELISA screen revealed the entire range of in vitro binding preferences. In addition, protein extracts of AtbZIP63 and the DNA-binding domain of AtWRKY33 were analyzed, which led to a refinement of their known DNA-binding consensi. Finally, we performed a DPI-ELISA screen to disclose the DNA-binding consensus of a yet uncharacterized putative DBP, AtTIFY1. A palindromic TGATCA-consensus was uncovered and we could show that the GATC-core is compulsory for AtTIFY1 binding. This specific interaction between AtTIFY1 and its DNA-binding motif was confirmed by in vivo plant one-hybrid assays in protoplasts. Thus, the value and applicability of the DPI-ELISA screen for de novo binding site identification of DBPs, also under automatized conditions, is a promising approach for a deeper understanding of gene regulation in any organism of choice. PMID:24146751

Site-directed mutagenesis study on DNA binding regions of the mouse homologue of Suppressor of Hairless, RBP-J kappa.

PubMed Central

Chung, C N; Hamaguchi, Y; Honjo, T; Kawaichi, M

1994-01-01

To map regions important for DNA binding of the mouse homologue of Suppressor of Hairless or RBP-J kappa protein, mutated mouse RBP-J kappa cDNAs were made by insertion of oligonucleotide linkers or base replacement. DNA binding assays using the mutated proteins expressed in COS cells showed that various mutations between 218 Arg and 227 Arg decreased the DNA binding activity drastically. The DNA binding activity was not affected by amino acid replacements within the integrase motif of the RBP-J kappa protein (230His-269His). Replacements between 291Arg and 323Tyr affected the DNA binding activity slightly but reproducibly. These results indicate that the region encompassing 218Arg-227Arg is critical for the DNA binding activity of RBP-J kappa. This region did not show any significant homology to motifs or domains of the previously described DNA binding proteins. Using a truncation mutant protein RBP-J kappa was shown to associate with DNA as a monomer. Images PMID:8065905

Determinants of affinity and mode of DNA binding at the carboxy terminus of the bacteriophage SPO1-encoded type II DNA-binding protein, TF1.

PubMed

Andera, L; Geiduschek, E P

1994-03-01

The role of the carboxy-terminal amino acids of the bacteriophage SPO1-encoded type II DNA-binding protein, TF1, in DNA binding was analyzed. Chain-terminating mutations truncating the normally 99-amino-acid TF1 at amino acids 96, 97, and 98 were constructed, as were missense mutations substituting cysteine, arginine, and serine for phenylalanine at amino acid 97 and tryptophan for lysine at amino acid 99. The binding of the resulting proteins to a synthetic 44-bp binding site in 5-(hydroxymethyl)uracil DNA, to binding sites in larger SPO1 [5-(hydroxymethyl)uracil-containing] DNA fragments, and to thymine-containing homologous DNA was analyzed by gel retardation and also by DNase I and hydroxy radical footprinting. We conclude that the C tail up to and including phenylalanine at amino acid 97 is essential for DNA binding and that the two C-terminal amino acids, 98 and 99, are involved in protein-protein interactions between TF1 dimers bound to DNA.

Functional interaction of the DNA-binding transcription factor Sp1 through its DNA-binding domain with the histone chaperone TAF-I.

PubMed

Suzuki, Toru; Muto, Shinsuke; Miyamoto, Saku; Aizawa, Kenichi; Horikoshi, Masami; Nagai, Ryozo

2003-08-01

Transcription involves molecular interactions between general and regulatory transcription factors with further regulation by protein-protein interactions (e.g. transcriptional cofactors). Here we describe functional interaction between DNA-binding transcription factor and histone chaperone. Affinity purification of factors interacting with the DNA-binding domain of the transcription factor Sp1 showed Sp1 to interact with the histone chaperone TAF-I, both alpha and beta isoforms. This interaction was specific as Sp1 did not interact with another histone chaperone CIA nor did other tested DNA-binding regulatory factors (MyoD, NFkappaB, p53) interact with TAF-I. Interaction of Sp1 and TAF-I occurs both in vitro and in vivo. Interaction with TAF-I results in inhibition of DNA-binding, and also likely as a result of such, inhibition of promoter activation by Sp1. Collectively, we describe interaction between DNA-binding transcription factor and histone chaperone which results in negative regulation of the former. This novel regulatory interaction advances our understanding of the mechanisms of eukaryotic transcription through DNA-binding regulatory transcription factors by protein-protein interactions, and also shows the DNA-binding domain to mediate important regulatory interactions.

Chromatin-Specific Regulation of Mammalian rDNA Transcription by Clustered TTF-I Binding Sites

PubMed Central

Diermeier, Sarah D.; Németh, Attila; Rehli, Michael; Grummt, Ingrid; Längst, Gernot

2013-01-01

Enhancers and promoters often contain multiple binding sites for the same transcription factor, suggesting that homotypic clustering of binding sites may serve a role in transcription regulation. Here we show that clustering of binding sites for the transcription termination factor TTF-I downstream of the pre-rRNA coding region specifies transcription termination, increases the efficiency of transcription initiation and affects the three-dimensional structure of rRNA genes. On chromatin templates, but not on free rDNA, clustered binding sites promote cooperative binding of TTF-I, loading TTF-I to the downstream terminators before it binds to the rDNA promoter. Interaction of TTF-I with target sites upstream and downstream of the rDNA transcription unit connects these distal DNA elements by forming a chromatin loop between the rDNA promoter and the terminators. The results imply that clustered binding sites increase the binding affinity of transcription factors in chromatin, thus influencing the timing and strength of DNA-dependent processes. PMID:24068958

DNA breathing dynamics distinguish binding from nonbinding consensus sites for transcription factor YY1 in cells.

PubMed

Alexandrov, Boian S; Fukuyo, Yayoi; Lange, Martin; Horikoshi, Nobuo; Gelev, Vladimir; Rasmussen, Kim Ø; Bishop, Alan R; Usheva, Anny

2012-11-01

The genome-wide mapping of the major gene expression regulators, the transcription factors (TFs) and their DNA binding sites, is of great importance for describing cellular behavior and phenotypic diversity. Presently, the methods for prediction of genomic TF binding produce a large number of false positives, most likely due to insufficient description of the physiochemical mechanisms of protein-DNA binding. Growing evidence suggests that, in the cell, the double-stranded DNA (dsDNA) is subject to local transient strands separations (breathing) that contribute to genomic functions. By using site-specific chromatin immunopecipitations, gel shifts, BIOBASE data, and our model that accurately describes the melting behavior and breathing dynamics of dsDNA we report a specific DNA breathing profile found at YY1 binding sites in cells. We find that the genomic flanking sequence variations and SNPs, may exert long-range effects on DNA dynamics and predetermine YY1 binding. The ubiquitous TF YY1 has a fundamental role in essential biological processes by activating, initiating or repressing transcription depending upon the sequence context it binds. We anticipate that consensus binding sequences together with the related DNA dynamics profile may significantly improve the accuracy of genomic TF binding sites and TF binding-related functional SNPs.

Overexpression of Transcription Factor Sp1 Leads to Gene Expression Perturbations and Cell Cycle Inhibition

PubMed Central

Deniaud, Emmanuelle; Baguet, Joël; Chalard, Roxane; Blanquier, Bariza; Brinza, Lilia; Meunier, Julien; Michallet, Marie-Cécile; Laugraud, Aurélie; Ah-Soon, Claudette; Wierinckx, Anne; Castellazzi, Marc; Lachuer, Joël; Gautier, Christian

2009-01-01

Background The ubiquitous transcription factor Sp1 regulates the expression of a vast number of genes involved in many cellular functions ranging from differentiation to proliferation and apoptosis. Sp1 expression levels show a dramatic increase during transformation and this could play a critical role for tumour development or maintenance. Although Sp1 deregulation might be beneficial for tumour cells, its overexpression induces apoptosis of untransformed cells. Here we further characterised the functional and transcriptional responses of untransformed cells following Sp1 overexpression. Methodology and Principal Findings We made use of wild-type and DNA-binding-deficient Sp1 to demonstrate that the induction of apoptosis by Sp1 is dependent on its capacity to bind DNA. Genome-wide expression profiling identified genes involved in cancer, cell death and cell cycle as being enriched among differentially expressed genes following Sp1 overexpression. In silico search to determine the presence of Sp1 binding sites in the promoter region of modulated genes was conducted. Genes that contained Sp1 binding sites in their promoters were enriched among down-regulated genes. The endogenous sp1 gene is one of the most down-regulated suggesting a negative feedback loop induced by overexpressed Sp1. In contrast, genes containing Sp1 binding sites in their promoters were not enriched among up-regulated genes. These results suggest that the transcriptional response involves both direct Sp1-driven transcription and indirect mechanisms. Finally, we show that Sp1 overexpression led to a modified expression of G1/S transition regulatory genes such as the down-regulation of cyclin D2 and the up-regulation of cyclin G2 and cdkn2c/p18 expression. The biological significance of these modifications was confirmed by showing that the cells accumulated in the G1 phase of the cell cycle before the onset of apoptosis. Conclusion This study shows that the binding to DNA of overexpressed Sp1 induces an inhibition of cell cycle progression that precedes apoptosis and a transcriptional response targeting genes containing Sp1 binding sites in their promoter or not suggesting both direct Sp1-driven transcription and indirect mechanisms. PMID:19753117

Nuclear magnetic resonance-based model of a TF1/HmU-DNA complex.

PubMed

Silva, M V; Pasternack, L B; Kearns, D R

1997-12-15

Transcription factor 1 (TF1), a type II DNA-binding protein encoded by the Bacillus subtilis bacteriophage SPO1, has the capacity for sequence-selective DNA binding and a preference for 5-hydroxymethyl-2'-deoxyuridine (HmU)-containing DNA. In NMR studies of the TF1/HmU-DNA complex, intermolecular NOEs indicate that the flexible beta-ribbon and C-terminal alpha-helix are involved in the DNA-binding site of TF1, placing it in the beta-sheet category of DNA-binding proteins proposed to bind by wrapping two beta-ribbon "arms" around the DNA. Intermolecular and intramolecular NOEs were used to generate an energy-minimized model of the protein-DNA complex in which both DNA bending and protein structure changes are evident.

On the connection between inherent DNA flexure and preferred binding of hydroxymethyluracil-containing DNA by the type II DNA-binding protein TF1.

PubMed

Grove, A; Galeone, A; Mayol, L; Geiduschek, E P

1996-07-12

TF1 is a member of the family of type II DNA-binding proteins, which also includes the bacterial HU proteins and the Escherichia coli integration host factor (IHF). Distinctive to TF1, which is encoded by the Bacillus subtilis bacteriophage SPO1, is its preferential binding to DNA in which thymine is replaced by 5-hydroxymethyluracil (hmU), as it is in the phage genome. TF1 binds to preferred sites within the phage genome and generates pronounced DNA bending. The extent to which DNA flexibility contributes to the sequence-specific binding of TF1, and the connection between hmU preference and DNA flexibility has been examined. Model flexible sites, consisting of consecutive mismatches, increase the affinity of thymine-containing DNA for TF1. In particular, tandem mismatches separated by nine base-pairs generate an increase, by orders of magnitude, in the affinity of TF1 for T-containing DNA with the sequence of a preferred TF1 binding site, and fully match the affinity of TF1 for this cognate site in hmU-containing DNA (Kd approximately 3 nM). Other placements of loops generate suboptimal binding. This is consistent with a significant contribution of site-specific DNA flexibility to complex formation. Analysis of complexes with hmU-DNA of decreasing length shows that a major part of the binding affinity is generated within a central 19 bp segment (delta G0 = 41.7 kJ mol-1) with more-distal DNA contributing modestly to the affinity (delta delta G = -0.42 kJ mol-1 bp-1 on increasing duplex length to 37 bp). However, a previously characterised thermostable and more tightly binding mutant TF1, TF1(E15G/T32I), derives most of its extra affinity from interaction with flanking DNA. We propose that inherent but sequence-dependent deformability of hmU-containing DNA underlies the preferential binding of TF1 and that TF1-induced DNA bendings is a result of distortions at two distinct sites separated by 9 bp of duplex DNA.

A Novel DNA Binding Mechanism for maf Basic Region-Leucine Zipper Factors Inferred from a MafA-DNA Complex Structure and Binding Specificities

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lu, Xun; Guanga, Gerald P; Wan, Cheng

2012-11-13

MafA is a proto-oncoprotein and is critical for insulin gene expression in pancreatic β-cells. Maf proteins belong to the AP1 superfamily of basic region-leucine zipper (bZIP) transcription factors. Residues in the basic helix and an ancillary N-terminal domain, the Extended Homology Region (EHR), endow maf proteins with unique DNA binding properties: binding a 13 bp consensus site consisting of a core AP1 site (TGACTCA) flanked by TGC sequences and binding DNA stably as monomers. To further characterize maf DNA binding, we determined the structure of a MafA–DNA complex. MafA forms base-specific hydrogen bonds with the flanking G –5C –4 andmore » central C 0/G 0 bases, but not with the core-TGA bases. However, in vitro binding studies utilizing a pulse–chase electrophoretic mobility shift assay protocol revealed that mutating either the core-TGA or flanking-TGC bases dramatically increases the binding off rate. Comparing the known maf structures, we propose that DNA binding specificity results from positioning the basic helix through unique phosphate contacts. The EHR does not contact DNA directly but stabilizes DNA binding by contacting the basic helix. Collectively, these results suggest a novel multistep DNA binding process involving a conformational change from contacting the core-TGA to contacting the flanking-TGC bases.« less

Study on the binding of procaine hydrochloride to DNA/DNA bases and the effect of CdS nanoparticles on the binding behavior.

PubMed

Ping, Gang; Lv, Gang; Gutmann, Sebastian; Chen, Chen; Zhang, Renyun; Wang, Xuemei

2006-01-01

The interaction between procaine hydrochloride and DNA/DNA bases in the absence and presence of cadmium sulfide (CdS) nanoparticles has been explored in this study by using differential pulse voltammetry, atomic force microscopy (AFM) and so on, which illustrates the different binding behaviors of procaine hydrochloride with different DNA bases. The results clearly indicate that the binding of purines to procaine hydrochloride is stronger than that of pyrimidines and the binding affinity is in the order of G > A > T > C. In addition, it was observed that the presence of CdS nanoparticles could remarkably enhance the probing sensitivity for the interaction between procaine hydrochloride and DNA/DNA bases. Furthermore, AFM study illustrates that procaine hydrochloride can bind to some specific sites of DNA chains, which indicates that procaine hydrochloride may interact with some special sequences of DNA.

Non-intercalative, deoxyribose binding of boric acid to calf thymus DNA.

PubMed

Ozdemir, Ayse; Gursaclı, Refiye Tekiner; Tekinay, Turgay

2014-05-01

The present study characterizes the effects of the boric acid binding on calf thymus DNA (ct-DNA) by spectroscopic and calorimetric methods. UV-Vis absorbance spectroscopy, circular dichroism (CD) spectroscopy, transmission electron microscopy (TEM), isothermal titration calorimetry (ITC), and Fourier transform infrared (FT-IR) spectroscopy were employed to characterize binding properties. Changes in the secondary structure of ct-DNA were determined by CD spectroscopy. Sizes and morphologies of boric acid-DNA complexes were determined by transmission electron microscopy (TEM). The kinetics of boric acid binding to calf thymus DNA (ct-DNA) was investigated by isothermal titration calorimetry (ITC). ITC results revealed that boric acid exhibits a moderate affinity to ct-DNA with a binding constant (K a) of 9.54 × 10(4) M(-1). FT-IR results revealed that boric acid binds to the deoxyribose sugar of DNA without disrupting the B-conformation at tested concentrations.

A new structural framework for integrating replication protein A into DNA processing machinery

PubMed Central

Brosey, Chris A.; Yan, Chunli; Tsutakawa, Susan E.; Heller, William T.; Rambo, Robert P.; Tainer, John A.; Ivanov, Ivaylo; Chazin, Walter J.

2013-01-01

By coupling the protection and organization of single-stranded DNA (ssDNA) with recruitment and alignment of DNA processing factors, replication protein A (RPA) lies at the heart of dynamic multi-protein DNA processing machinery. Nevertheless, how RPA coordinates biochemical functions of its eight domains remains unknown. We examined the structural biochemistry of RPA’s DNA-binding activity, combining small-angle X-ray and neutron scattering with all-atom molecular dynamics simulations to investigate the architecture of RPA’s DNA-binding core. The scattering data reveal compaction promoted by DNA binding; DNA-free RPA exists in an ensemble of states with inter-domain mobility and becomes progressively more condensed and less dynamic on binding ssDNA. Our results contrast with previous models proposing RPA initially binds ssDNA in a condensed state and becomes more extended as it fully engages the substrate. Moreover, the consensus view that RPA engages ssDNA in initial, intermediate and final stages conflicts with our data revealing that RPA undergoes two (not three) transitions as it binds ssDNA with no evidence for a discrete intermediate state. These results form a framework for understanding how RPA integrates the ssDNA substrate into DNA processing machinery, provides substrate access to its binding partners and promotes the progression and selection of DNA processing pathways. PMID:23303776

A new structural framework for integrating replication protein A into DNA processing machinery

DOE Office of Scientific and Technical Information (OSTI.GOV)

Brosey, Chris; Yan, Chunli; Tsutakawa, Susan

2013-01-17

By coupling the protection and organization of single-stranded DNA (ssDNA) with recruitment and alignment of DNA processing factors, replication protein A (RPA) lies at the heart of dynamic multi-protein DNA processing machinery. Nevertheless, how RPA coordinates biochemical functions of its eight domains remains unknown. We examined the structural biochemistry of RPA's DNA-binding activity, combining small-angle X-ray and neutron scattering with all-atom molecular dynamics simulations to investigate the architecture of RPA's DNA-binding core. The scattering data reveal compaction promoted by DNA binding; DNA-free RPA exists in an ensemble of states with inter-domain mobility and becomes progressively more condensed and less dynamicmore » on binding ssDNA. Our results contrast with previous models proposing RPA initially binds ssDNA in a condensed state and becomes more extended as it fully engages the substrate. Moreover, the consensus view that RPA engages ssDNA in initial, intermediate and final stages conflicts with our data revealing that RPA undergoes two (not three) transitions as it binds ssDNA with no evidence for a discrete intermediate state. These results form a framework for understanding how RPA integrates the ssDNA substrate into DNA processing machinery, provides substrate access to its binding partners and promotes the progression and selection of DNA processing pathways.« less

Role of Su(Hw) zinc finger 10 and interaction with CP190 and Mod(mdg4) proteins in recruiting the Su(Hw) complex to chromatin sites in Drosophila.

PubMed

Melnikova, Larisa; Kostyuchenko, Margarita; Parshikov, Alexander; Georgiev, Pavel; Golovnin, Anton

2018-01-01

Su(Hw) belongs to the class of proteins that organize chromosome architecture and boundaries/insulators between regulatory domains. This protein contains a cluster of 12 zinc finger domains most of which are responsible for binding to three different modules in the consensus site. Su(Hw) forms a complex with CP190 and Mod(mdg4)-67.2 proteins that binds to well-known Drosophila insulators. To understand how Su(Hw) performs its activities and binds to specific sites in chromatin, we have examined the previously described su(Hw)f mutation that disrupts the 10th zinc finger (ZF10) responsible for Su(Hw) binding to the upstream module. The results have shown that Su(Hw)f loses the ability to interact with CP190 in the absence of DNA. In contrast, complete deletion of ZF10 does not prevent the interaction between Su(Hw)Δ10 and CP190. Having studied insulator complex formation in different mutant backgrounds, we conclude that both association with CP190 and Mod(mdg4)-67.2 partners and proper organization of DNA binding site are essential for the efficient recruitment of the Su(Hw) complex to chromatin insulators.

The coactivator CBP stimulates human T-cell lymphotrophic virus type I Tax transactivation in vitro.

PubMed

Kashanchi, F; Duvall, J F; Kwok, R P; Lundblad, J R; Goodman, R H; Brady, J N

1998-12-18

Tax interacts with the cellular cyclic AMP-responsive element binding protein (CREB) and facilitates the binding of the coactivator CREB binding protein (CBP), forming a multimeric complex on the cyclic AMP-responsive element (CRE)-like sites in the human T-cell lymphotrophic virus type I (HTLV-I) promoter. The trimeric complex is believed to recruit additional regulatory proteins to the HTLV-I long terminal repeat, but there has been no direct evidence that CBP is required for Tax-mediated transactivation. We present evidence that Tax and CBP activate transcription from the HTLV-I 21 base pair repeats on naked DNA templates. Transcriptional activation of the HTLV-I sequences required both Tax and CBP and could be mediated by either the N-terminal activation domain of CBP or the full-length protein. Fluorescence polarization binding assays indicated that CBP does not markedly enhance the affinity of Tax for the trimeric complex. Transcription analyses suggest that CBP activates Tax-dependent transcription by promoting transcriptional initiation and reinitiation. The ability of CBP to activate the HTLV-I promoter does not involve the stabilization of Tax binding, but rather depends upon gene activation properties of the co-activator that function in the context of a naked DNA template.

Dampening DNA binding: a common mechanism of transcriptional repression for both ncRNAs and protein domains.

PubMed

Goodrich, James A; Kugel, Jennifer F

2010-01-01

With eukaryotic non-coding RNAs (ncRNAs) now established as critical regulators of cellular transcription, the true diversity with which they can elicit biological effects is beginning to be appreciated. Two ncRNAs, mouse B2 RNA and human Alu RNA, have been found to repress mRNA transcription in response to heat shock. They do so by binding directly to RNA polymerase II, assembling into complexes on promoter DNA, and disrupting contacts between the polymerase and the DNA. Such a mechanism of repression had not previously been observed for a eukaryotic ncRNA; however, there are examples of eukaryotic protein domains that repress transcription by blocking essential protein-DNA interactions. Comparing the mechanism of transcriptional repression utilized by these protein domains to that used by B2 and Alu RNAs raises intriguing questions regarding transcriptional control, and how B2 and Alu RNAs might themselves be regulated.

Allosteric Pathways in the PPARγ-RXRα nuclear receptor complex

NASA Astrophysics Data System (ADS)

Ricci, Clarisse G.; Silveira, Rodrigo L.; Rivalta, Ivan; Batista, Victor S.; Skaf, Munir S.

2016-01-01

Understanding the nature of allostery in DNA-nuclear receptor (NR) complexes is of fundamental importance for drug development since NRs regulate the transcription of a myriad of genes in humans and other metazoans. Here, we investigate allostery in the peroxisome proliferator-activated/retinoid X receptor heterodimer. This important NR complex is a target for antidiabetic drugs since it binds to DNA and functions as a transcription factor essential for insulin sensitization and lipid metabolism. We find evidence of interdependent motions of Ω-loops and PPARγ-DNA binding domain with contacts susceptible to conformational changes and mutations, critical for regulating transcriptional functions in response to sequence-dependent DNA dynamics. Statistical network analysis of the correlated motions, observed in molecular dynamics simulations, shows preferential allosteric pathways with convergence centers comprised of polar amino acid residues. These findings are particularly relevant for the design of allosteric modulators of ligand-dependent transcription factors.

Actinomycin D binding mode reveals the basis for its potent HIV-1 and cancer activity

NASA Astrophysics Data System (ADS)

Paramanathan, Thayaparan; Vladescu, Ioana D.; McCauley, Micah J.; Rouzina, Ioulia; Williams, Mark C.

2011-03-01

Actinomycin D (ActD) is one of the most studied antibiotics, which has been used as an anti-cancer agent and also shown to inhibit HIV reverse transcription. Initial studies with ActD established that it intercalates double stranded DNA (dsDNA). However, recent studies have shown that ActD binds with even higher affinity to single stranded DNA (ssDNA). In our studies we use optical tweezers to stretch and hold single dsDNA molecule at constant force in the presence of varying ActD concentrations until the binding reaches equilibrium. The change in dsDNA length upon ActD binding measured as a function of time yields the rate of binding in addition to the equilibrium lengthening of DNA. The results suggest extremely slow kinetics, on the order of several minutes and 0.52 +/- 0.06 μ M binding affinity. Holding DNA at constant force while stretching and relaxing suggests that ActD binds to two single strands that are close to each other rather than to pure dsDNA or ssDNA. This suggests that biological activity of ActD that contributes towards the inhibition of cellular replication is due to its ability to bind at DNA bubbles during RNA transcription, thereby stalling the transcription process.

Experimental and computational studies on the effects of valganciclovir as an antiviral drug on calf thymus DNA.

PubMed

Shahabadi, Nahid; Pourfoulad, Mehdi; Moghadam, Neda Hosseinpour

2017-01-02

DNA-binding properties of an antiviral drug, valganciclovir (valcyte) was studied by using emission, absorption, circular dichroism, viscosity, differential pulse voltammetry, fluorescence techniques, and computational studies. The drug bound to calf thymus DNA (ct-DNA) in a groove-binding mode. The calculated binding constant of UV-vis, K a , is comparable to groove-binding drugs. Competitive fluorimetric studies with Hoechst 33258 showed that valcyte could displace the DNA-bound Hoechst 33258. The drug could not displace intercalated methylene blue from DNA double helix. Furthermore, the induced detectable changes in the CD spectrum of ct-DNA as well as changes in its viscosity confirm the groove-binding mode. In addition, an integrated molecular docking was employed to further investigate the binding interactions between valcyte and calf thymus DNA.

MOCCS: Clarifying DNA-binding motif ambiguity using ChIP-Seq data.

PubMed

Ozaki, Haruka; Iwasaki, Wataru

2016-08-01

As a key mechanism of gene regulation, transcription factors (TFs) bind to DNA by recognizing specific short sequence patterns that are called DNA-binding motifs. A single TF can accept ambiguity within its DNA-binding motifs, which comprise both canonical (typical) and non-canonical motifs. Clarification of such DNA-binding motif ambiguity is crucial for revealing gene regulatory networks and evaluating mutations in cis-regulatory elements. Although chromatin immunoprecipitation sequencing (ChIP-seq) now provides abundant data on the genomic sequences to which a given TF binds, existing motif discovery methods are unable to directly answer whether a given TF can bind to a specific DNA-binding motif. Here, we report a method for clarifying the DNA-binding motif ambiguity, MOCCS. Given ChIP-Seq data of any TF, MOCCS comprehensively analyzes and describes every k-mer to which that TF binds. Analysis of simulated datasets revealed that MOCCS is applicable to various ChIP-Seq datasets, requiring only a few minutes per dataset. Application to the ENCODE ChIP-Seq datasets proved that MOCCS directly evaluates whether a given TF binds to each DNA-binding motif, even if known position weight matrix models do not provide sufficient information on DNA-binding motif ambiguity. Furthermore, users are not required to provide numerous parameters or background genomic sequence models that are typically unavailable. MOCCS is implemented in Perl and R and is freely available via https://github.com/yuifu/moccs. By complementing existing motif-discovery software, MOCCS will contribute to the basic understanding of how the genome controls diverse cellular processes via DNA-protein interactions. Copyright © 2016 Elsevier Ltd. All rights reserved.

STAT3 and importins are novel mediators of early molecular and cellular responses in experimental duodenal ulceration.

PubMed

Khomenko, Tetyana; Deng, Xiaoming; Ahluwalia, Amrita; Tarnawski, Andrzej; Patel, Khushin N; Sandor, Zsuzsanna; Szabo, Sandor

2014-02-01

Signal transducer and activator of transcription 3 (STAT3) is a transcription factor that directly upregulates VEGF, Ref-1, p21, and anti-apoptotic genes such as Bcl-xL. In this study, we hypothesized that STAT3 signaling is activated and provides a critical protective role that is required for enterocyte survival during the early phases of cysteamine-induced duodenal ulcers. We studied the effect of inhibition of STAT3 activity on cysteamine-induced duodenal ulcers in rats and egr-1 knockout mice using STAT3/DNA binding assay, immunohistochemistry, immunoblot, and quantitative reverse transcriptase PCR analyses. We found that G-quartet oligodeoxynucleotides T40214, a specific inhibitor of STAT3/DNA binding, aggravated cysteamine-induced duodenal ulcers in rats 2.8-fold (p < 0.05). In the pre-ulcerogenic stage, cysteamine induced STAT3 tyrosine phosphorylation, its translocation to nuclei, an increased expression and nuclear translocation of importin α and β in the rat duodenal mucosa. Cysteamine enhanced the binding of STAT3 to its DNA consensus sequences at 6, 12, and 24 h after cysteamine by 1.5-, 1.8-, and 3.5-fold, respectively, and activated the expression of STAT3 target genes such as VEGF, Bcl-xL, Ref-1, and STAT3-induced feedback inhibitor, a suppressor of cytokine signaling 3. We also demonstrated that egr-1 knockout mice, which are more susceptible to cysteamine-induced duodenal ulcers, had lower levels of STAT3 expression, its phosphorylation, expression of importin α or β, and STAT3/DNA binding than wild-type mice in response to cysteamine. Thus, STAT3 represents an important new molecular mechanism in experimental duodenal ulceration.

Protein Cofactors Are Essential for High-Affinity DNA Binding by the Nuclear Factor κB RelA Subunit.

PubMed

Mulero, Maria Carmen; Shahabi, Shandy; Ko, Myung Soo; Schiffer, Jamie M; Huang, De-Bin; Wang, Vivien Ya-Fan; Amaro, Rommie E; Huxford, Tom; Ghosh, Gourisankar

2018-05-22

Transcription activator proteins typically contain two functional domains: a DNA binding domain (DBD) that binds to DNA with sequence specificity and an activation domain (AD) whose established function is to recruit RNA polymerase. In this report, we show that purified recombinant nuclear factor κB (NF-κB) RelA dimers bind specific κB DNA sites with an affinity significantly lower than that of the same dimers from nuclear extracts of activated cells, suggesting that additional nuclear cofactors might facilitate DNA binding by the RelA dimers. Additionally, recombinant RelA binds DNA with relatively low affinity at a physiological salt concentration in vitro. The addition of p53 or RPS3 (ribosomal protein S3) increases RelA:DNA binding affinity 2- to >50-fold depending on the protein and ionic conditions. These cofactor proteins do not form stable ternary complexes, suggesting that they stabilize the RelA:DNA complex through dynamic interactions. Surprisingly, the RelA-DBD alone fails to bind DNA under the same solution conditions even in the presence of cofactors, suggesting an important role of the RelA-AD in DNA binding. Reduced RelA:DNA binding at a physiological ionic strength suggests that multiple cofactors might be acting simultaneously to mitigate the electrolyte effect and stabilize the RelA:DNA complex in vivo. Overall, our observations suggest that the RelA-AD and multiple cofactor proteins function cooperatively to prime the RelA-DBD and stabilize the RelA:DNA complex in cells. Our study provides a mechanism for nuclear cofactor proteins in NF-κB-dependent gene regulation.

Structures of BmrR-Drug Complexes Reveal a Rigid Multidrug Binding Pocket And Transcription Activation Through Tyrosine Expulsion

DOE Office of Scientific and Technical Information (OSTI.GOV)

Newberry, K.J.; Huffman, J.L.; Miller, M.C.

2009-05-22

BmrR is a member of the MerR family and a multidrug binding transcription factor that up-regulates the expression of the bmr multidrug efflux transporter gene in response to myriad lipophilic cationic compounds. The structural mechanism by which BmrR binds these chemically and structurally different drugs and subsequently activates transcription is poorly understood. Here, we describe the crystal structures of BmrR bound to rhodamine 6G (R6G) or berberine (Ber) and cognate DNA. These structures reveal each drug stacks against multiple aromatic residues with their positive charges most proximal to the carboxylate group of Glu-253 and that, unlike other multidrug binding pockets,more » that of BmrR is rigid. Substitution of Glu-253 with either alanine (E253A) or glutamine (E253Q) results in unpredictable binding affinities for R6G, Ber, and tetraphenylphosphonium. Moreover, these drug binding studies reveal that the negative charge of Glu-253 is not important for high affinity binding to Ber and tetraphenylphosphonium but plays a more significant, but unpredictable, role in R6G binding. In vitro transcription data show that E253A and E253Q are constitutively active, and structures of the drug-free E253A-DNA and E253Q-DNA complexes support a transcription activation mechanism requiring the expulsion of Tyr-152 from the multidrug binding pocket. In sum, these data delineate the mechanism by which BmrR binds lipophilic, monovalent cationic compounds and suggest the importance of the redundant negative electrostatic nature of this rigid drug binding pocket that can be used to discriminate against molecules that are not substrates of the Bmr multidrug efflux pump.« less

Genome-Wide Motif Statistics are Shaped by DNA Binding Proteins over Evolutionary Time Scales

NASA Astrophysics Data System (ADS)

Qian, Long; Kussell, Edo

The composition of genomes with respect to short DNA motifs impacts the ability of DNA binding proteins to locate and bind their target sites. Since nonfunctional DNA binding can be detrimental to cellular functions and ultimately to organismal fitness, organisms could benefit from reducing the number of nonfunctional binding sites genome wide. Using in vitro measurements of binding affinities for a large collection of DNA binding proteins, in multiple species, we detect a significant global avoidance of weak binding sites in genomes. The underlying evolutionary process leaves a distinct genomic hallmark in that similar words have correlated frequencies, which we detect in all species across domains of life. We hypothesize that natural selection against weak binding sites contributes to this process, and using an evolutionary model we show that the strength of selection needed to maintain global word compositions is on the order of point mutation rates. Alternative contributions may come from interference of protein-DNA binding with replication and mutational repair processes, which operates with similar rates. We conclude that genome-wide word compositions have been molded by DNA binding proteins through tiny evolutionary steps over timescales spanning millions of generations.

Interactions of the C-terminal Domain of Human Ku70 with DNA Substrate: A Molecular Dynamics Study

NASA Technical Reports Server (NTRS)

Hu, Shaowen; Huff, Janice; Pluth, Janice M.; Cucinotta, Francis A.

2007-01-01

NASA is developing a systems biology approach to improve the assessment of health risks associated with space radiation. The primary toxic and mutagenic lesion following radiation exposure is the DNA double strand break (DSB), thus a model incorporating proteins and pathways important in response and repair of this lesion is critical. One key protein heterodimer for systems models of radiation effects is the Ku(sub 70/80) complex. The Ku70/80 complex is important in the initial binding of DSB ends following DNA damage, and is a component of nonhomologous end joining repair, the primary pathway for DSB repair in mammalian cells. The C-terminal domain of Ku70 (Ku70c, residues 559-609), contains an helix-extended strand-helix motif and similar motifs have been found in other nucleic acid-binding proteins critical for DNA repair. However, the exact mechanism of damage recognition and substrate specificity for the Ku heterodimer remains unclear in part due to the absence of a high-resolution structure of the Ku70c/DNA complex. We performed a series of molecular dynamics (MD) simulations on a system with the subunit Ku70c and a 14 base pairs DNA duplex, whose starting structures are designed to be variable so as to mimic their different binding modes. By analyzing conformational changes and energetic properties of the complex during MD simulations, we found that interactions are preferred at DNA ends, and within the major groove, which is consistent with previous experimental investigations. In addition, the results indicate that cooperation of Ku70c with other subunits of Ku(sub 70/80) is necessary to explain the high affinity of binding as observed in experiments.

Evidence for the role of Mycobacterium tuberculosis RecG helicase in DNA repair and recombination.

PubMed

Thakur, Roshan S; Basavaraju, Shivakumar; Somyajit, Kumar; Jain, Akshatha; Subramanya, Shreelakshmi; Muniyappa, Kalappa; Nagaraju, Ganesh

2013-04-01

In order to survive and replicate in a variety of stressful conditions during its life cycle, Mycobacterium tuberculosis must possess mechanisms to safeguard the integrity of the genome. Although DNA repair and recombination related genes are thought to play key roles in the repair of damaged DNA in all organisms, so far only a few of them have been functionally characterized in the tubercle bacillus. In this study, we show that M. tuberculosis RecG (MtRecG) expression was induced in response to different genotoxic agents. Strikingly, expression of MtRecG in Escherichia coli ∆recG mutant strain provided protection against mitomycin C, methyl methane sulfonate and UV induced cell death. Purified MtRecG exhibited higher binding affinity for the Holliday junction (HJ) compared with a number of canonical recombinational DNA repair intermediates. Notably, although MtRecG binds at the core of the mobile and immobile HJs, and with higher binding affinity for the immobile HJ, branch migration was evident only in the case of the mobile HJ. Furthermore, immobile HJs stimulate MtRecG ATPase activity less efficiently than mobile HJs. In addition to HJ substrates, MtRecG exhibited binding affinity for a variety of branched DNA structures including three-way junctions, replication forks, flap structures, forked duplex and a D-loop structure, but demonstrated strong unwinding activity on replication fork and flap DNA structures. Together, these results support that MtRecG plays an important role in processes related to DNA metabolism under normal as well as stress conditions. © 2013 The Authors Journal compilation © 2013 FEBS.

Real-time reliable determination of binding kinetics of DNA hybridization using a multi-channel graphene biosensor

NASA Astrophysics Data System (ADS)

Xu, Shicai; Zhan, Jian; Man, Baoyuan; Jiang, Shouzhen; Yue, Weiwei; Gao, Shoubao; Guo, Chengang; Liu, Hanping; Li, Zhenhua; Wang, Jihua; Zhou, Yaoqi

2017-03-01

Reliable determination of binding kinetics and affinity of DNA hybridization and single-base mismatches plays an essential role in systems biology, personalized and precision medicine. The standard tools are optical-based sensors that are difficult to operate in low cost and to miniaturize for high-throughput measurement. Biosensors based on nanowire field-effect transistors have been developed, but reliable and cost-effective fabrication remains a challenge. Here, we demonstrate that a graphene single-crystal domain patterned into multiple channels can measure time- and concentration-dependent DNA hybridization kinetics and affinity reliably and sensitively, with a detection limit of 10 pM for DNA. It can distinguish single-base mutations quantitatively in real time. An analytical model is developed to estimate probe density, efficiency of hybridization and the maximum sensor response. The results suggest a promising future for cost-effective, high-throughput screening of drug candidates, genetic variations and disease biomarkers by using an integrated, miniaturized, all-electrical multiplexed, graphene-based DNA array.

DNA-Binding Interaction Studies of Microwave Assisted Synthesized Sulfonamide Substituted 8-Hydroxyquinoline Derivatives.

PubMed

Dixit, Ritu B; Patel, Tarosh S; Vanparia, Satish F; Kunjadiya, Anju P; Keharia, Harish R; Dixit, Bharat C

2011-01-01

Sulfonamide substituted 8-hydroxyquinoline derivatives were prepared using a microwave synthesizer. The interaction of sulfonamide substituted 8-hydroxyquinoline derivatives and their transition metal complexes with Plasmid (pUC 19) DNA and Calf Thymus DNA were investigated by UV spectroscopic studies and gel electrophoresis measurements. The interaction between ligand/metal complexes and DNA was carried out by increasing the concentration of DNA from 0 to 12 μl in UV spectroscopic study, while the concentration of DNA in gel electrophoresis remained constant at 10 μl. These studies supported the fact that, the complex binds to DNA by intercalation via ligand into the base pairs of DNA. The relative binding efficacy of the complexes to DNA was much higher than the binding efficacy of ligands, especially the complex of Cu-AHQMBSH had the highest binding ability to DNA. The mobility of the bands decreased as the concentration of the complex was increased, indicating that there was increase in the interaction between the metal ion and DNA. Complexes of AHQMBSH were excellent for DNA binding as compared to HQMABS.

Unique structural modulation of a non-native substrate by cochaperone DnaJ.

PubMed

Tiwari, Satyam; Kumar, Vignesh; Jayaraj, Gopal Gunanathan; Maiti, Souvik; Mapa, Koyeli

2013-02-12

The role of bacterial DnaJ protein as a cochaperone of DnaK is strongly appreciated. Although DnaJ unaccompanied by DnaK can bind unfolded as well as native substrate proteins, its role as an individual chaperone remains elusive. In this study, we demonstrate that DnaJ binds a model non-native substrate with a low nanomolar dissociation constant and, more importantly, modulates the structure of its non-native state. The structural modulation achieved by DnaJ is different compared to that achieved by the DnaK-DnaJ complex. The nature of structural modulation exerted by DnaJ is suggestive of a unique unfolding activity on the non-native substrate by the chaperone. Furthermore, we demonstrate that the zinc binding motif along with the C-terminal substrate binding domain of DnaJ is necessary and sufficient for binding and the subsequent binding-induced structural alterations of the non-native substrate. We hypothesize that this hitherto unknown structural alteration of non-native states by DnaJ might be important for its chaperoning activity by removing kinetic traps of the folding intermediates.

Mechanism of repression of the inhibin alpha-subunit gene by inducible 3',5'-cyclic adenosine monophosphate early repressor.

PubMed

Burkart, Anna D; Mukherjee, Abir; Mayo, Kelly E

2006-03-01

The rodent ovary is regulated throughout the reproductive cycle to maintain normal cyclicity. Ovarian follicular development is controlled by changes in gene expression in response to the gonadotropins FSH and LH. The inhibin alpha-subunit gene belongs to a group of genes that is positively regulated by FSH and negatively regulated by LH. Previous studies established an important role for inducible cAMP early repressor (ICER) in repression of alpha-inhibin. These current studies investigate the mechanisms of repression by ICER. It is not clear whether all four ICER isoforms expressed in the ovary can act as repressors of the inhibin alpha-subunit gene. EMSAs demonstrate binding of all isoforms to the inhibin alpha-subunit CRE (cAMP response element), and transfection studies demonstrate that all isoforms can repress the inhibin alpha-subunit gene. Repression by ICER is dependent on its binding to DNA as demonstrated by mutations to ICER's DNA-binding domain. These mutational studies also demonstrate that repression by ICER is not dependent on heterodimerization with CREB (CRE-binding protein). Competitive EMSAs show that ICER effectively competes with CREB for binding to the inhibin alpha CRE in vitro. Chromatin immunoprecipitation assays demonstrate a replacement of CREB dimers bound to the inhibin alpha CRE by ICER dimers in ovarian granulosa cells in response to LH signaling. Thus, there is a temporal association of transcription factors bound to the inhibin alpha-CRE controlling inhibin alpha-subunit gene expression.

Oxidized Guanine Base Lesions Function in 8-Oxoguanine DNA Glycosylase-1-mediated Epigenetic Regulation of Nuclear Factor κB-driven Gene Expression*

PubMed Central

Pan, Lang; Hao, Wenjing; Ba, Xueqing

2016-01-01

A large percentage of redox-responsive gene promoters contain evolutionarily conserved guanine-rich clusters; guanines are the bases most susceptible to oxidative modification(s). Consequently, 7,8-dihydro-8-oxoguanine (8-oxoG) is one of the most abundant base lesions in promoters and is primarily repaired via the 8-oxoguanine DNA glycosylase-1 (OOG1)-initiated base excision repair pathway. In view of a prompt cellular response to oxidative challenge, we hypothesized that the 8-oxoG lesion and the cognate repair protein OGG1 are utilized in transcriptional gene activation. Here, we document TNFα-induced enrichment of both 8-oxoG and OGG1 in promoters of pro-inflammatory genes, which precedes interaction of NF-κB with its DNA-binding motif. OGG1 bound to 8-oxoG upstream from the NF-κB motif increased its DNA occupancy by promoting an on-rate of both homodimeric and heterodimeric forms of NF-κB. OGG1 depletion decreased both NF-κB binding and gene expression, whereas Nei-like glycosylase-1 and -2 had a marginal effect. These results are the first to document a novel paradigm wherein the DNA repair protein OGG1 bound to its substrate is coupled to DNA occupancy of NF-κB and functions in epigenetic regulation of gene expression. PMID:27756845

Synergistic regulation of competence development in Bacillus subtilis by two Rap-Phr systems.

PubMed

Bongiorni, Cristina; Ishikawa, Shu; Stephenson, Sophie; Ogasawara, Naotake; Perego, Marta

2005-07-01

The 11 Rap proteins of Bacillus subtilis comprise a conserved family of tetratricopeptide (TPR)-containing regulatory proteins. Their activity is inhibited by specific Phr pentapeptides produced from the product of phr genes through an export-import maturation process. We found that one of the proteins, namely RapF, is involved in the regulation of competence to DNA transformation. The ComA response regulator and transcription factor for initiation of competence development is the target of RapF. Specific binding of RapF to the carboxy-terminal DNA-binding domain of ComA inhibits the response regulator's ability to bind its target DNA promoters. The PhrF C-terminal pentapeptide, QRGMI, inhibits RapF activity. The activity of RapF and PhrF in regulating competence development is analogous to the previously described activity of RapC and PhrC (L. J. Core and M. Perego, Mol. Microbiol. 49:1509-1522, 2003). In fact, the RapF and PhrF pair of proteins acts synergistically with RapC and PhrC in the overall regulation of the ComA transcription factor. Since the transcription of the RapC- and RapF-encoding genes is positively regulated by their own target ComA, an autoregulatory circuit must exist for the competence transcription factor in order to modulate its activity.

A novel cold-inducible zinc finger protein from soybean, SCOF-1, enhances cold tolerance in transgenic plants.

PubMed

Kim, J C; Lee, S H; Cheong, Y H; Yoo, C M; Lee, S I; Chun, H J; Yun, D J; Hong, J C; Lee, S Y; Lim, C O; Cho, M J

2001-02-01

Cold stress on plants induces changes in the transcription of cold response genes. A cDNA clone encoding C2H2-type zinc finger protein, SCOF-1, was isolated from soybean. The transcription of SCOF-1 is specifically induced by low temperature and abscisic acid (ABA) but not by dehydration or high salinity. Constitutive overexpression of SCOF-1 induced cold-regulated (COR) gene expression and enhanced cold tolerance of non-acclimated transgenic Arabidopsis and tobacco plants. SCOF-1 localized to the nucleus but did not bind directly to either C-repeat/dehydration (CRT/DRE) or ABA responsive element (ABRE), cis-acting DNA regulatory elements present in COR gene promoters. However, SCOF-1 greatly enhanced the DNA binding activity of SGBF-1, a soybean G-box binding bZIP transcription factor, to ABRE in vitro. SCOF-1 also interacted with SGBF-1 in a yeast two-hybrid system. The SGBF-1 transactivated the beta-glucuronidase reporter gene driven by the ABRE element in Arabidopsis leaf protoplasts. Furthermore, the SCOF-1 enhanced ABRE-dependent gene expression mediated by SGBF-1. These results suggest that SCOF-1 may function as a positive regulator of COR gene expression mediated by ABRE via protein-protein interaction, which in turn enhances cold tolerance of plants.

The RNF168 paralog RNF169 defines a new class of ubiquitylated histone reader involved in the response to DNA damage

PubMed Central

Kitevski-LeBlanc, Julianne; Fradet-Turcotte, Amélie; Portella, Guillem; Yuwen, Tairan; Panier, Stephanie; Duan, Shili; Canny, Marella D; van Ingen, Hugo; Arrowsmith, Cheryl H; Rubinstein, John L; Vendruscolo, Michele; Durocher, Daniel; Kay, Lewis E

2017-01-01

Site-specific histone ubiquitylation plays a central role in orchestrating the response to DNA double-strand breaks (DSBs). DSBs elicit a cascade of events controlled by the ubiquitin ligase RNF168, which promotes the accumulation of repair factors such as 53BP1 and BRCA1 on the chromatin flanking the break site. RNF168 also promotes its own accumulation, and that of its paralog RNF169, but how they recognize ubiquitylated chromatin is unknown. Using methyl-TROSY solution NMR spectroscopy and molecular dynamics simulations, we present an atomic resolution model of human RNF169 binding to a ubiquitylated nucleosome, and validate it by electron cryomicroscopy. We establish that RNF169 binds to ubiquitylated H2A-Lys13/Lys15 in a manner that involves its canonical ubiquitin-binding helix and a pair of arginine-rich motifs that interact with the nucleosome acidic patch. This three-pronged interaction mechanism is distinct from that by which 53BP1 binds to ubiquitylated H2A-Lys15 highlighting the diversity in site-specific recognition of ubiquitylated nucleosomes. DOI: http://dx.doi.org/10.7554/eLife.23872.001 PMID:28406400

Mutations to essential orphan response regulator HP1043 of Helicobacter pylori result in growth-stage regulatory defects.

PubMed

Olekhnovich, Igor N; Vitko, Serhiy; Chertihin, Olga; Hontecillas, Raquel; Viladomiu, Monica; Bassaganya-Riera, Josep; Hoffman, Paul S

2013-05-01

Helicobacter pylori establishes lifelong infections of the gastric mucosa, a niche considered hostile to most microbes. While responses to gastric acidity and local inflammation are understood, little is known as to how they are integrated into homeostatic control of cell division and growth-stage gene expression. Here we investigate the essential orphan response regulator HP1043, a member of the OmpR/PhoB subfamily of transcriptional regulators that is unique to the Epsilonproteobacteria and that lacks phosphorylation domains. To test the hypothesis that conformational changes in the homodimer might lead to defects in gene expression, we sought mutations that might alter DNA-binding efficiency. Two introduced mutations (C215S, C221S) C terminal to the DNA-binding domain of HP1043 (HP1043CC11) resulted in a 2-fold higher affinity for its own promoter by footprinting. Modeling studies with the crystal structure of HP1043 suggested that C215S might affect the helix-turn-helix domain. Genomic replacement of the hp1043 allele with the hp1043CC11 mutant allele resulted in a 2-fold decrease in protein levels, despite a dramatic increase in mRNA. The mutations did not affect in vitro growth rates or colonization efficiency in a mouse model. Proteomic profiling (CC11 mutant strain versus wild type) identified many expression differences, and quantitative PCR further revealed that 11 out of 12 examined genes had lost growth-stage regulation and that 6 of the genes contained HP1043 binding consensus sequences within the promoter regions (fur, cagA, cag23, flhA, flip, and napA). Our studies show that mutations that affect DNA-binding affinity can be used to identify new members of the HP1043 regulon.

Deciphering the mechanism of interaction of edifenphos with calf thymus DNA

NASA Astrophysics Data System (ADS)

Ahmad, Ajaz; Ahmad, Masood

2018-01-01

Edifenphos is an important organophosphate pesticide with many antifungal and anti-insecticidal properties but it may cause potential hazards to human health. In this work, we have tried to explore the binding mode of action and mechanism of edifenphos to calf thymus DNA (CT-DNA). Several experiments such as ultraviolet-visible absorption spectra and emission spectroscopy showed complex formation between edifenphos and CT-DNA and low binding constant values supporting groove binding mode. These results were further confirmed by circular dichroism (CD), CT-DNA melting studies, viscosity measurements, density functional theory and molecular docking. CD study suggests that edifenphos does not alter native structure of CT-DNA. Isothermal calorimetry reveals that binding of edifenphos with CT-DNA is enthalpy driven process. Competitive binding assay and effect of ionic strength showed that edifenphos binds to CT-DNA via groove binding manner. Hence, edifenphos is a minor groove binder preferably interacting with A-T regions with docking score - 6.84 kJ/mol.

Identification of Specific DNA Binding Residues in the TCP Family of Transcription Factors in Arabidopsis[W

PubMed Central

Aggarwal, Pooja; Das Gupta, Mainak; Joseph, Agnel Praveen; Chatterjee, Nirmalya; Srinivasan, N.; Nath, Utpal

2010-01-01

The TCP transcription factors control multiple developmental traits in diverse plant species. Members of this family share an ∼60-residue-long TCP domain that binds to DNA. The TCP domain is predicted to form a basic helix-loop-helix (bHLH) structure but shares little sequence similarity with canonical bHLH domain. This classifies the TCP domain as a novel class of DNA binding domain specific to the plant kingdom. Little is known about how the TCP domain interacts with its target DNA. We report biochemical characterization and DNA binding properties of a TCP member in Arabidopsis thaliana, TCP4. We have shown that the 58-residue domain of TCP4 is essential and sufficient for binding to DNA and possesses DNA binding parameters comparable to canonical bHLH proteins. Using a yeast-based random mutagenesis screen and site-directed mutants, we identified the residues important for DNA binding and dimer formation. Mutants defective in binding and dimerization failed to rescue the phenotype of an Arabidopsis line lacking the endogenous TCP4 activity. By combining structure prediction, functional characterization of the mutants, and molecular modeling, we suggest a possible DNA binding mechanism for this class of transcription factors. PMID:20363772

5-Hydroxymethylcytosine in E-box motifs ACAT|GTG and ACAC|GTG increases DNA-binding of the B-HLH transcription factor TCF4.

PubMed

Khund-Sayeed, Syed; He, Ximiao; Holzberg, Timothy; Wang, Jun; Rajagopal, Divya; Upadhyay, Shriyash; Durell, Stewart R; Mukherjee, Sanjit; Weirauch, Matthew T; Rose, Robert; Vinson, Charles

2016-09-12

We evaluated DNA binding of the B-HLH family members TCF4 and USF1 using protein binding microarrays (PBMs) containing double-stranded DNA probes with cytosine on both strands or 5-methylcytosine (5mC) or 5-hydroxymethylcytosine (5hmC) on one DNA strand and cytosine on the second strand. TCF4 preferentially bound the E-box motif (CAN|NTG) with strongest binding to the 8-mer CAG|GTGGT. 5mC uniformly decreases DNA binding of both TCF4 and USF1. The bulkier 5hmC also inhibited USF1 binding to DNA. In contrast, 5hmC dramatically enhanced TCF4 binding to E-box motifs ACAT|GTG and ACAC|GTG, being better bound than any 8-mer containing cytosine. Examination of X-ray structures of the closely related TCF3 and USF1 bound to DNA suggests TCF3 can undergo a conformational shift to preferentially bind to 5hmC while the USF1 basic region is bulkier and rigid precluding a conformation shift to bind 5hmC. These results greatly expand the regulatory DNA sequence landscape bound by TCF4.

[Features of binding of proflavine to DNA at different DNA-ligand concentration ratios].

PubMed

Berezniak, E G; gladkovskaia, N A; Khrebtova, A S; Dukhopel'nikov, E V; Zinchenko, A V

2009-01-01

The binding of proflavine to calf thymus DNA has been studied using the methods of differential scanning calorimetry and spectrophotometry. It was shown that proflavine can interact with DNA by at least 3 binding modes. At high DNA-ligand concentration ratios (P/D), proflavine intercalates into both GC- and AT-sites, with a preference to GC-rich sequences. At low P/D ratios proflavine interacts with DNA by the external binding mode. From spectrophotometric concentration dependences, the parameters of complexing of proflavine with DNA were calculated. Thermodynamic parameters of DNA melting were calculated from differential scanning calorimetry data.

A Novel Rrm3 Function in Restricting DNA Replication via an Orc5-Binding Domain Is Genetically Separable from Rrm3 Function as an ATPase/Helicase in Facilitating Fork Progression.

PubMed

Syed, Salahuddin; Desler, Claus; Rasmussen, Lene J; Schmidt, Kristina H

2016-12-01

In response to replication stress cells activate the intra-S checkpoint, induce DNA repair pathways, increase nucleotide levels, and inhibit origin firing. Here, we report that Rrm3 associates with a subset of replication origins and controls DNA synthesis during replication stress. The N-terminal domain required for control of DNA synthesis maps to residues 186-212 that are also critical for binding Orc5 of the origin recognition complex. Deletion of this domain is lethal to cells lacking the replication checkpoint mediator Mrc1 and leads to mutations upon exposure to the replication stressor hydroxyurea. This novel Rrm3 function is independent of its established role as an ATPase/helicase in facilitating replication fork progression through polymerase blocking obstacles. Using quantitative mass spectrometry and genetic analyses, we find that the homologous recombination factor Rdh54 and Rad5-dependent error-free DNA damage bypass act as independent mechanisms on DNA lesions that arise when Rrm3 catalytic activity is disrupted whereas these mechanisms are dispensable for DNA damage tolerance when the replication function is disrupted, indicating that the DNA lesions generated by the loss of each Rrm3 function are distinct. Although both lesion types activate the DNA-damage checkpoint, we find that the resultant increase in nucleotide levels is not sufficient for continued DNA synthesis under replication stress. Together, our findings suggest a role of Rrm3, via its Orc5-binding domain, in restricting DNA synthesis that is genetically and physically separable from its established catalytic role in facilitating fork progression through replication blocks.

A Novel Rrm3 Function in Restricting DNA Replication via an Orc5-Binding Domain Is Genetically Separable from Rrm3 Function as an ATPase/Helicase in Facilitating Fork Progression

PubMed Central

Syed, Salahuddin; Desler, Claus; Rasmussen, Lene J.; Schmidt, Kristina H.

2016-01-01

In response to replication stress cells activate the intra-S checkpoint, induce DNA repair pathways, increase nucleotide levels, and inhibit origin firing. Here, we report that Rrm3 associates with a subset of replication origins and controls DNA synthesis during replication stress. The N-terminal domain required for control of DNA synthesis maps to residues 186–212 that are also critical for binding Orc5 of the origin recognition complex. Deletion of this domain is lethal to cells lacking the replication checkpoint mediator Mrc1 and leads to mutations upon exposure to the replication stressor hydroxyurea. This novel Rrm3 function is independent of its established role as an ATPase/helicase in facilitating replication fork progression through polymerase blocking obstacles. Using quantitative mass spectrometry and genetic analyses, we find that the homologous recombination factor Rdh54 and Rad5-dependent error-free DNA damage bypass act as independent mechanisms on DNA lesions that arise when Rrm3 catalytic activity is disrupted whereas these mechanisms are dispensable for DNA damage tolerance when the replication function is disrupted, indicating that the DNA lesions generated by the loss of each Rrm3 function are distinct. Although both lesion types activate the DNA-damage checkpoint, we find that the resultant increase in nucleotide levels is not sufficient for continued DNA synthesis under replication stress. Together, our findings suggest a role of Rrm3, via its Orc5-binding domain, in restricting DNA synthesis that is genetically and physically separable from its established catalytic role in facilitating fork progression through replication blocks. PMID:27923055

Definition of an HPV18/45 cross-reactive human T-cell epitope after DNA immunisation of HLA-A2/KB transgenic mice.

PubMed

McCarthy, Corinna; Youde, Sarah J; Man, Stephen

2006-05-15

Although human papillomavirus (HPV) types 16 and 18 are the most common types associated with cervical cancer worldwide, other related HPV types such as HPV 35, 45 and 58 have significant prevalence in geographically distinct populations. For development of global prophylactic and therapeutic vaccine strategies, it is important to study immune responses against these viruses and to define the degree of cross-reactivity between related HPV types. To investigate the potential for T cell cross-reactivity after vaccination, HLA-A2/Kb transgenic mice were immunised with DNA plasmid constructs containing HPV18 and 45 E6 and E7. Splenocytes from immunised mice were tested in direct ELIspot assays against overlapping pools of HPV 18 peptides. Immunisation with either HPV18 or HPV45 E6 DNA produced dominant T cell responses against an epitope (KCIDFYSRI) that was shared between HPV18 and HPV45. This peptide was shown to bind to HLA-A*0201 but not Db or Kb molecules on the cell surface. Furthermore this peptide was shown to be immunogenic in vitro to human T cells from 2 out of 3 HLA-A2+ healthy donors. Collectively, these results demonstrate that HPV 18 and 45 E6 DNA vaccines are immunogenic in mice and demonstrate that cross-reactive T cell responses against closely related HPV types can be induced in vivo. The use of the HLA-A2/Kb transgenic mice allowed definition of an HLA-A*0201 binding peptide epitope that would have been rejected on the basis of predicted major histocompatibility complex binding affinity. Copyright (c) 2005 Wiley-Liss, Inc.

Redox-dependent regulation of hepatocyte AIM2 inflammasome activation in sterile liver injury in mice

PubMed Central

Sun, Qian; Loughran, Patricia; Shapiro, Richard; Shrivastava, Indira H.; Antoine, Daniel J.; Li, Tunliang; Yan, Zhengzheng; Fan, Jie; Billiar, Timothy R.; Scott, Melanie J.

2016-01-01

Sterile liver inflammation, such as liver ischemia reperfusion, hemorrhagic shock after trauma and drug-induced liver injury is initiated and regulated by endogenous mediators including DNA and reactive oxygen species. Here we identify a novel mechanism for redox-mediated regulation of AIM2-inflammasome activation in hepatocytes after redox stress in mice, which occurs via interaction with cytosolic HMGB1. We show that in liver during hemorrhagic shock in mice, and in hepatocytes after hypoxia with reoxygenation, cytosolic HMGB1 associates with AIM2 and is required for activation of caspase-1 in response to cytosolic DNA. Activation of caspase-1 via AIM2 leads to subsequent hepatoprotective responses such as autophagy. HMGB1 binds to AIM2 at a non-DNA-binding site on the HIN-domain of AIM2 to facilitate inflammasome and caspase-1 activation in hepatocytes. Furthermore, binding of HMGB1 to AIM2 is stronger with fully-reduced all-thiol HMGB1 than with partially oxidized disulfide-HMGB1, and binding strength corresponds to caspase-1 activation. These data suggest HMGB1 redox status regulates AIM2 inflammasome activation. Conclusion Our findings suggest a novel and important mechanism for regulation of AIM2 inflammasome activation in hepatocytes during redox stress. Our study may suggest broader implications for how this and other inflammasomes are activated and how their activation is regulated during cell stress, as well as the mechanisms of inflammasome regulation in non-immune cell types. PMID:27774630

The cellular transcription factor CREB corresponds to activating transcription factor 47 (ATF-47) and forms complexes with a group of polypeptides related to ATF-43.

PubMed

Hurst, H C; Masson, N; Jones, N C; Lee, K A

1990-12-01

Promoter elements containing the sequence motif CGTCA are important for a variety of inducible responses at the transcriptional level. Multiple cellular factors specifically bind to these elements and are encoded by a multigene family. Among these factors, polypeptides termed activating transcription factor 43 (ATF-43) and ATF-47 have been purified from HeLa cells and a factor referred to as cyclic AMP response element-binding protein (CREB) has been isolated from PC12 cells and rat brain. We demonstrated that CREB and ATF-47 are identical and that CREB and ATF-43 form protein-protein complexes. We also found that the cis requirements for stable DNA binding by ATF-43 and CREB are different. Using antibodies to ATF-43 we have identified a group of polypeptides (ATF-43) in the size range from 40 to 43 kDa. ATF-43 polypeptides are related by their reactivity with anti-ATF-43, DNA-binding specificity, complex formation with CREB, heat stability, and phosphorylation by protein kinase A. Certain cell types vary in their ATF-43 complement, suggesting that CREB activity is modulated in a cell-type-specific manner through interaction with ATF-43. ATF-43 polypeptides do not appear simply to correspond to the gene products of the ATF multigene family, suggesting that the size of the ATF family at the protein level is even larger than predicted from cDNA-cloning studies.

New inhibitor targeting human transcription factor HSF1: effects on the heat shock response and tumor cell survival

PubMed Central

Vilaboa, Nuria; Boré, Alba; Martin-Saavedra, Francisco; Bayford, Melanie; Winfield, Natalie; Firth-Clark, Stuart; Kirton, Stewart B.

2017-01-01

Abstract Comparative modeling of the DNA-binding domain of human HSF1 facilitated the prediction of possible binding pockets for small molecules and definition of corresponding pharmacophores. In silico screening of a large library of lead-like compounds identified a set of compounds that satisfied the pharmacophoric criteria, a selection of which compounds was purchased to populate a biased sublibrary. A discriminating cell-based screening assay identified compound 001, which was subjected to systematic analysis of structure–activity relationships, resulting in the development of compound 115 (IHSF115). IHSF115 bound to an isolated HSF1 DNA-binding domain fragment. The compound did not affect heat-induced oligomerization, nuclear localization and specific DNA binding but inhibited the transcriptional activity of human HSF1, interfering with the assembly of ATF1-containing transcription complexes. IHSF115 was employed to probe the human heat shock response at the transcriptome level. In contrast to earlier studies of differential regulation in HSF1-naïve and -depleted cells, our results suggest that a large majority of heat-induced genes is positively regulated by HSF1. That IHSF115 effectively countermanded repression in a significant fraction of heat-repressed genes suggests that repression of these genes is mediated by transcriptionally active HSF1. IHSF115 is cytotoxic for a variety of human cancer cell lines, multiple myeloma lines consistently exhibiting high sensitivity. PMID:28369544

Loss of p21{sup Sdi1} expression in senescent cells after DNA damage accompanied with increase of miR-93 expression and reduced p53 interaction with p21{sup Sdi1} gene promoter

DOE Office of Scientific and Technical Information (OSTI.GOV)

Choi, Ok Ran; Lim, In Kyoung, E-mail: iklim@ajou.ac.kr

2011-04-08

Highlights: {yields} Reduced p21 expression in senescent cells treated with DNA damaging agents. {yields} Increase of [{sup 3}H]thymidine and BrdU incorporations in DNA damaged-senescent cells. {yields} Upregulation of miR-93 expression in senescent cells in response to DSB. {yields} Failure of p53 binding to p21 promoter in senescent cells in response to DSB. {yields} Molecular mechanism of increased cancer development in aged than young individuals. -- Abstract: To answer what is a critical event for higher incidence of tumor development in old than young individuals, primary culture of human diploid fibroblasts were employed and DNA damage was induced by doxorubicin ormore » X-ray irradiation. Response to the damage was different between young and old cells; loss of p21{sup sdi1} expression in spite of p53{sup S15} activation in old cells along with [{sup 3}H]thymidine and BrdU incorporation, but not in young cells. The phenomenon was confirmed by other tissue fibroblasts obtained from different donor ages. Induction of miR-93 expression and reduced p53 binding to p21 gene promoter account for loss of p21{sup sdi1} expression in senescent cells after DNA damage, suggesting a mechanism of in vivo carcinogenesis in aged tissue without repair arrest.« less

Dpb11 may function with RPA and DNA to initiate DNA replication.

PubMed

Bruck, Irina; Dhingra, Nalini; Martinez, Matthew P; Kaplan, Daniel L

2017-01-01

Dpb11 is required for the initiation of DNA replication in budding yeast. We found that Dpb11 binds tightly to single-stranded DNA (ssDNA) or branched DNA structures, while its human homolog, TopBP1, binds tightly to branched-DNA structures. We also found that Dpb11 binds stably to CDK-phosphorylated RPA, the eukaryotic ssDNA binding protein, in the presence of branched DNA. A Dpb11 mutant specifically defective for DNA binding did not exhibit tight binding to RPA in the presence of DNA, suggesting that Dpb11-interaction with DNA may promote the recruitment of RPA to melted DNA. We then characterized a mutant of Dpb11 that is specifically defective in DNA binding in budding yeast cells. Expression of dpb11-m1,2,3,5,ΔC results in a substantial decrease in RPA recruitment to origins, suggesting that Dpb11 interaction with DNA may be required for RPA recruitment to origins. Expression of dpb11-m1,2,3,5,ΔC also results in diminished GINS interaction with Mcm2-7 during S phase, while Cdc45 interaction with Mcm2-7 is like wild-type. The reduced GINS interaction with Mcm2-7 may be an indirect consequence of diminished origin melting. We propose that the tight interaction between Dpb11, CDK-phosphorylated RPA, and branched-DNA may be required for the essential function of stabilizing melted origin DNA in vivo. We also propose an alternative model, wherein Dpb11-DNA interaction is required for some other function in DNA replication initiation, such as helicase activation.

Francisella DnaK Inhibits Tissue-nonspecific Alkaline Phosphatase*

PubMed Central

Arulanandam, Bernard P.; Chetty, Senthilnath Lakshmana; Yu, Jieh-Juen; Leonard, Sean; Klose, Karl; Seshu, Janakiram; Cap, Andrew; Valdes, James J.; Chambers, James P.

2012-01-01

Following pulmonary infection with Francisella tularensis, we observed an unexpected but significant reduction of alkaline phosphatase, an enzyme normally up-regulated following inflammation. However, no reduction was observed in mice infected with a closely related Gram-negative pneumonic organism (Klebsiella pneumoniae) suggesting the inhibition may be Francisella-specific. In similar fashion to in vivo observations, addition of Francisella lysate to exogenous alkaline phosphatase (tissue-nonspecific isozyme) was inhibitory. Partial purification and subsequent proteomic analysis indicated the inhibitory factor to be the heat shock protein DnaK. Incubation with increasing amounts of anti-DnaK antibody reduced the inhibitory effect in a dose-dependent manner. Furthermore, DnaK contains an adenosine triphosphate binding domain at its N terminus, and addition of adenosine triphosphate enhances dissociation of DnaK with its target protein, e.g. alkaline phosphatase. Addition of adenosine triphosphate resulted in decreased DnaK co-immunoprecipitated with alkaline phosphatase as well as reduction of Francisella-mediated alkaline phosphatase inhibition further supporting the binding of Francisella DnaK to alkaline phosphatase. Release of DnaK via secretion and/or bacterial cell lysis into the extracellular milieu and inhibition of plasma alkaline phosphatase could promote an orchestrated, inflammatory response advantageous to Francisella. PMID:22923614

Francisella DnaK inhibits tissue-nonspecific alkaline phosphatase.

PubMed

Arulanandam, Bernard P; Chetty, Senthilnath Lakshmana; Yu, Jieh-Juen; Leonard, Sean; Klose, Karl; Seshu, Janakiram; Cap, Andrew; Valdes, James J; Chambers, James P

2012-10-26

Following pulmonary infection with Francisella tularensis, we observed an unexpected but significant reduction of alkaline phosphatase, an enzyme normally up-regulated following inflammation. However, no reduction was observed in mice infected with a closely related gram-negative pneumonic organism (Klebsiella pneumoniae) suggesting the inhibition may be Francisella-specific. In similar fashion to in vivo observations, addition of Francisella lysate to exogenous alkaline phosphatase (tissue-nonspecific isozyme) was inhibitory. Partial purification and subsequent proteomic analysis indicated the inhibitory factor to be the heat shock protein DnaK. Incubation with increasing amounts of anti-DnaK antibody reduced the inhibitory effect in a dose-dependent manner. Furthermore, DnaK contains an adenosine triphosphate binding domain at its N terminus, and addition of adenosine triphosphate enhances dissociation of DnaK with its target protein, e.g. alkaline phosphatase. Addition of adenosine triphosphate resulted in decreased DnaK co-immunoprecipitated with alkaline phosphatase as well as reduction of Francisella-mediated alkaline phosphatase inhibition further supporting the binding of Francisella DnaK to alkaline phosphatase. Release of DnaK via secretion and/or bacterial cell lysis into the extracellular milieu and inhibition of plasma alkaline phosphatase could promote an orchestrated, inflammatory response advantageous to Francisella.

Redox control of protein-DNA interactions: from molecular mechanisms to significance in signal transduction, gene expression, and DNA replication.

PubMed

Shlomai, Joseph

2010-11-01

Protein-DNA interactions play a key role in the regulation of major cellular metabolic pathways, including gene expression, genome replication, and genomic stability. They are mediated through the interactions of regulatory proteins with their specific DNA-binding sites at promoters, enhancers, and replication origins in the genome. Redox signaling regulates these protein-DNA interactions using reactive oxygen species and reactive nitrogen species that interact with cysteine residues at target proteins and their regulators. This review describes the redox-mediated regulation of several master regulators of gene expression that control the induction and suppression of hundreds of genes in the genome, regulating multiple metabolic pathways, which are involved in cell growth, development, differentiation, and survival, as well as in the function of the immune system and cellular response to intracellular and extracellular stimuli. It also discusses the role of redox signaling in protein-DNA interactions that regulate DNA replication. Specificity of redox regulation is discussed, as well as the mechanisms providing several levels of redox-mediated regulation, from direct control of DNA-binding domains through the indirect control, mediated by release of negative regulators, regulation of redox-sensitive protein kinases, intracellular trafficking, and chromatin remodeling.

Concerted formation of macromolecular Suppressor–mutator transposition complexes

PubMed Central

Raina, Ramesh; Schläppi, Michael; Karunanandaa, Balasulojini; Elhofy, Adam; Fedoroff, Nina

1998-01-01

Transposition of the maize Suppressor–mutator (Spm) transposon requires two element-encoded proteins, TnpA and TnpD. Although there are multiple TnpA binding sites near each element end, binding of TnpA to DNA is not cooperative, and the binding affinity is not markedly affected by the number of binding sites per DNA fragment. However, intermolecular complexes form cooperatively between DNA fragments with three or more TnpA binding sites. TnpD, itself not a sequence-specific DNA-binding protein, binds to TnpA and stabilizes the TnpA–DNA complex. The high redundancy of TnpA binding sites at both element ends and the protein–protein interactions between DNA-bound TnpA complexes and between these and TnpD imply a concerted transition of the element from a linear to a protein crosslinked transposition complex within a very narrow protein concentration range. PMID:9671711

DNA Binding of Centromere Protein C (CENPC) Is Stabilized by Single-Stranded RNA

PubMed Central

Du, Yaqing; Topp, Christopher N.; Dawe, R. Kelly

2010-01-01

Centromeres are the attachment points between the genome and the cytoskeleton: centromeres bind to kinetochores, which in turn bind to spindles and move chromosomes. Paradoxically, the DNA sequence of centromeres has little or no role in perpetuating kinetochores. As such they are striking examples of genetic information being transmitted in a manner that is independent of DNA sequence (epigenetically). It has been found that RNA transcribed from centromeres remains bound within the kinetochore region, and this local population of RNA is thought to be part of the epigenetic marking system. Here we carried out a genetic and biochemical study of maize CENPC, a key inner kinetochore protein. We show that DNA binding is conferred by a localized region 122 amino acids long, and that the DNA-binding reaction is exquisitely sensitive to single-stranded RNA. Long, single-stranded nucleic acids strongly promote the binding of CENPC to DNA, and the types of RNAs that stabilize DNA binding match in size and character the RNAs present on kinetochores in vivo. Removal or replacement of the binding module with HIV integrase binding domain causes a partial delocalization of CENPC in vivo. The data suggest that centromeric RNA helps to recruit CENPC to the inner kinetochore by altering its DNA binding characteristics. PMID:20140237

The influence of repressor DNA binding site architecture on transcriptional control.

PubMed

Park, Dan M; Kiley, Patricia J

2014-08-26

How the architecture of DNA binding sites dictates the extent of repression of promoters is not well understood. Here, we addressed the importance of the number and information content of the three direct repeats (DRs) in the binding and repression of the icdA promoter by the phosphorylated form of the global Escherichia coli repressor ArcA (ArcA-P). We show that decreasing the information content of the two sites with the highest information (DR1 and DR2) eliminated ArcA binding to all three DRs and ArcA repression of icdA. Unexpectedly, we also found that DR3 occupancy functions principally in repression, since mutation of this low-information-content site both eliminated DNA binding to DR3 and significantly weakened icdA repression, despite the fact that binding to DR1 and DR2 was intact. In addition, increasing the information content of any one of the three DRs or addition of a fourth DR increased ArcA-dependent repression but perturbed signal-dependent regulation of repression. Thus, our data show that the information content and number of DR elements are critical architectural features for maintaining a balance between high-affinity binding and signal-dependent regulation of icdA promoter function in response to changes in ArcA-P levels. Optimization of such architectural features may be a common strategy to either dampen or enhance the sensitivity of DNA binding among the members of the large OmpR/PhoB family of regulators as well as other transcription factors. In Escherichia coli, the response regulator ArcA maintains homeostasis of redox carriers under O2-limiting conditions through a comprehensive repression of carbon oxidation pathways that require aerobic respiration to recycle redox carriers. Although a binding site architecture comprised of a variable number of sequence recognition elements has been identified within the promoter regions of ArcA-repressed operons, it is unclear how this variable architecture dictates transcriptional regulation. By dissecting the role of multiple sequence elements within the icdA promoter, we provide insight into the design principles that allow ArcA to repress transcription within diverse promoter contexts. Our data suggest that the arrangement of recognition elements is tailored to achieve sufficient repression of a given promoter while maintaining appropriate signal-dependent regulation of repression, providing insight into how diverse binding site architectures link changes in O2 with the fine-tuning of carbon oxidation pathway levels. Copyright © 2014 Park and Kiley.

A fractal analysis of protein to DNA binding kinetics using biosensors.

PubMed

Sadana, Ajit

2003-08-01

A fractal analysis of a confirmative nature only is presented for the binding of estrogen receptor (ER) in solution to its corresponding DNA (estrogen response element, ERE) immobilized on a sensor chip surface [J. Biol. Chem. 272 (1997) 11384], and for the cooperative binding of human 1,25-dihydroxyvitamin D(3) receptor (VDR) to DNA with the 9-cis-retinoic acid receptor (RXR) [Biochemistry 35 (1996) 3309]. Ligands were also used to modulate the first reaction. Data taken from the literature may be modeled by using a single- or a dual-fractal analysis. Relationships are presented for the binding rate coefficient as a function of either the analyte concentration in solution or the fractal dimension that exists on the biosensor surface. The binding rate expressions developed exhibit a wide range of dependence on the degree of heterogeneity that exists on the surface, ranging from sensitive (order of dependence equal to 1.202) to very sensitive (order of dependence equal to 12.239). In general, the binding rate coefficient increases as the degree of heterogeneity or the fractal dimension of the surface increases. The predictive relationships presented provide further physical insights into the reactions occurring on the biosensor surface. Even though these reactions are occurring on the biosensor surface, the relationships presented should assist in understanding and in possibly manipulating the reactions occurring on cellular surfaces.

Dynamic Changes in Nucleosome Occupancy Are Not Predictive of Gene Expression Dynamics but Are Linked to Transcription and Chromatin Regulators

PubMed Central

Huebert, Dana J.; Kuan, Pei-Fen; Keleş, Sündüz

2012-01-01

The response to stressful stimuli requires rapid, precise, and dynamic gene expression changes that must be coordinated across the genome. To gain insight into the temporal ordering of genome reorganization, we investigated dynamic relationships between changing nucleosome occupancy, transcription factor binding, and gene expression in Saccharomyces cerevisiae yeast responding to oxidative stress. We applied deep sequencing to nucleosomal DNA at six time points before and after hydrogen peroxide treatment and revealed many distinct dynamic patterns of nucleosome gain and loss. The timing of nucleosome repositioning was not predictive of the dynamics of downstream gene expression change but instead was linked to nucleosome position relative to transcription start sites and specific cis-regulatory elements. We measured genome-wide binding of the stress-activated transcription factor Msn2p over time and found that Msn2p binds different loci with different dynamics. Nucleosome eviction from Msn2p binding sites was common across the genome; however, we show that, contrary to expectation, nucleosome loss occurred after Msn2p binding and in fact required Msn2p. This negates the prevailing model that nucleosomes obscuring Msn2p sites regulate DNA access and must be lost before Msn2p can bind DNA. Together, these results highlight the complexities of stress-dependent chromatin changes and their effects on gene expression. PMID:22354995

A Key Evolutionary Mutation Enhances DNA Binding of the FOXP2 Forkhead Domain.

PubMed

Morris, Gavin; Fanucchi, Sylvia

2016-04-05

Forkhead box (FOX) transcription factors share a conserved forkhead DNA binding domain (FHD) and are key role players in the development of many eukaryotic species. Their involvement in various congenital disorders and cancers makes them clinically relevant targets for novel therapeutic strategies. Among them, the FOXP subfamily of multidomain transcriptional repressors is unique in its ability to form DNA binding homo and heterodimers. The truncated FOXP2 FHD, in the absence of the leucine zipper, exists in equilibrium between monomeric and domain-swapped dimeric states in vitro. As a consequence, determining the DNA binding properties of the FOXP2 FHD becomes inherently difficult. In this work, two FOXP2 FHD hinge loop mutants have been generated to successfully prevent both the formation (A539P) and the dissociation (F541C) of the homodimers. This allows for the separation of the two species for downstream DNA binding studies. Comparison of DNA binding of the different species using electrophoretic mobility shift assay, fluorescence anisotropy and isothermal titration calorimetry indicates that the wild-type FOXP2 FHD binds DNA as a monomer. However, comparison of the DNA-binding energetics of the monomer and wild-type FHD, reveals that there is a difference in the mechanism of binding between the two species. We conclude that the naturally occurring reverse mutation (P539A) seen in the FOXP subfamily increases DNA binding affinity and may increase the potential for nonspecific binding compared to other FOX family members.

Probing the Characterization of the Interaction of Aflatoxins B1 and G1 with Calf Thymus DNA In Vitro

PubMed Central

Ma, Liang; Wang, Jiaman; Zhang, Yuhao

2017-01-01

The binding characterization of aflatoxins with calf thymus DNA (ctDNA) under physiological conditions was investigated. Multispectroscopic techniques, ctDNA melting, viscosity measurements, and molecular docking techniques were employed to elucidate the binding mechanism of the aflatoxins with DNA. The fluorescence results indicated that both aflatoxin B1 (AFB1) and aflatoxin G1 (AFG1) bound to the ctDNA, forming complexes through hydrogen bonding. The binding constants of AFB1 and AFG1 with ctDNA reached up to 103 L·mol−1 and 104 L·mol−1, respectively, and AFG1 exhibited a higher binding propensity than that of AFB1. Furthermore, both AFB1 and AFG1 bound to the ctDNA through groove binding, as evidenced by the results of the spectroscopic, iodide quenching effect, viscosity, and ctDNA melting measurements. Changes in the circular dichroism signal manifested that both AFB1 and AFG1 induced an increase in the right-handed helicity, but only minimally influenced the base stacking of the DNA. A molecular docking study of the aflatoxin’s binding with the DNA revealed a groove binding mode, which was driven mainly by hydrogen bonding. This study of aflatoxin–ctDNA interaction may provide novel insights into the toxicological effect of the mycotoxins. PMID:28671585

DNA-binding by Haemophilus influenzae and Escherichia coli YbaB, members of a widely-distributed bacterial protein family.

PubMed

Cooley, Anne E; Riley, Sean P; Kral, Keith; Miller, M Clarke; DeMoll, Edward; Fried, Michael G; Stevenson, Brian

2009-07-13

Genes orthologous to the ybaB loci of Escherichia coli and Haemophilus influenzae are widely distributed among eubacteria. Several years ago, the three-dimensional structures of the YbaB orthologs of both E. coli and H. influenzae were determined, revealing a novel "tweezer"-like structure. However, a function for YbaB had remained elusive, with an early study of the H. influenzae ortholog failing to detect DNA-binding activity. Our group recently determined that the Borrelia burgdorferi YbaB ortholog, EbfC, is a DNA-binding protein. To reconcile those results, we assessed the abilities of both the H. influenzae and E. coli YbaB proteins to bind DNA to which B. burgdorferi EbfC can bind. Both the H. influenzae and the E. coli YbaB proteins bound to tested DNAs. DNA-binding was not well competed with poly-dI-dC, indicating some sequence preferences for those two proteins. Analyses of binding characteristics determined that both YbaB orthologs bind as homodimers. Different DNA sequence preferences were observed between H. influenzae YbaB, E. coli YbaB and B. burgdorferi EbfC, consistent with amino acid differences in the putative DNA-binding domains of these proteins. Three distinct members of the YbaB/EbfC bacterial protein family have now been demonstrated to bind DNA. Members of this protein family are encoded by a broad range of bacteria, including many pathogenic species, and results of our studies suggest that all such proteins have DNA-binding activities. The functions of YbaB/EbfC family members in each bacterial species are as-yet unknown, but given the ubiquity of these DNA-binding proteins among Eubacteria, further investigations are warranted.

Correlation of Local Effects of DNA Sequence and Position of Beta-Alanine Inserts with Polyamide-DNA Complex Binding Affinities and Kinetics

PubMed Central

Wang, Shuo; Nanjunda, Rupesh; Aston, Karl; Bashkin, James K.; Wilson, W. David

2012-01-01

In order to better understand the effects of β-alanine (β) substitution and the number of heterocycles on DNA binding affinity and selectivity, the interactions of an eight-ring hairpin polyamide (PA) and two β derivatives as well as a six-heterocycle analog have been investigated with their cognate DNA sequence, 5′-TGGCTT-3′. Binding selectivity and the effects of β have been investigated with the cognate and five mutant DNAs. A set of powerful and complementary methods have been employed for both energetic and structural evaluations: UV-melting, biosensor-surface plasmon resonance, isothermal titration calorimetry, circular dichroism and a DNA ligation ladder global structure assay. The reduced number of heterocycles in the six-ring PA weakens the binding affinity; however, the smaller PA aggregates significantly less than the larger PAs, and allows us to obtain the binding thermodynamics. The PA-DNA binding enthalpy is large and negative with a large negative ΔCp, and is the primary driving component of the Gibbs free energy. The complete SPR binding results clearly show that β substitutions can substantially weaken the binding affinity of hairpin PAs in a position-dependent manner. More importantly, the changes in PA binding to the mutant DNAs further confirm the position-dependent effects on PA-DNA interaction affinity. Comparison of mutant DNA sequences also shows a different effect in recognition of T•A versus A•T base pairs. The effects of DNA mutations on binding of a single PA as well as the effects of the position of β substitution on binding tell a clear and very important story about sequence dependent binding of PAs to DNA. PMID:23167504

Probing the electrostatics and pharmacologic modulation of sequence-specific binding by the DNA-binding domain of the ETS-family transcription factor PU.1: a binding affinity and kinetics investigation

PubMed Central

Munde, Manoj; Poon, Gregory M. K.; Wilson, W. David

2013-01-01

Members of the ETS family of transcription factors regulate a functionally diverse array of genes. All ETS proteins share a structurally-conserved but sequence-divergent DNA-binding domain, known as the ETS domain. Although the structure and thermodynamics of the ETS-DNA complexes are well known, little is known about the kinetics of sequence recognition, a facet that offers potential insight into its molecular mechanism. We have characterized DNA binding by the ETS domain of PU.1 by biosensor-surface plasmon resonance (SPR). SPR analysis revealed a striking kinetic profile for DNA binding by the PU.1 ETS domain. At low salt concentrations, it binds high-affinity cognate DNA with a very slow association rate constant (≤105 M−1 s−1), compensated by a correspondingly small dissociation rate constant. The kinetics are strongly salt-dependent but mutually balance to produce a relatively weak dependence in the equilibrium constant. This profile contrasts sharply with reported data for other ETS domains (e.g., Ets-1, TEL) for which high-affinity binding is driven by rapid association (>107 M−1 s−1). We interpret this difference in terms of the hydration properties of ETS-DNA binding and propose that at least two mechanisms of sequence recognition are employed by this family of DNA-binding domain. Additionally, we use SPR to demonstrate the potential for pharmacological inhibition of sequence-specific ETS-DNA binding, using the minor groove-binding distamycin as a model compound. Our work establishes SPR as a valuable technique for extending our understanding of the molecular mechanisms of ETS-DNA interactions as well as developing potential small-molecule agents for biotechnological and therapeutic purposes. PMID:23416556

Two high-mobility group box domains act together to underwind and kink DNA

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sánchez-Giraldo, R.; Acosta-Reyes, F. J.; Malarkey, C. S.

The crystal structure of HMGB1 box A bound to an unmodified AT-rich DNA fragment is reported at a resolution of 2 Å. A new mode of DNA recognition for HMG box proteins is found in which two box A domains bind in an unusual configuration generating a highly kinked DNA structure. High-mobility group protein 1 (HMGB1) is an essential and ubiquitous DNA architectural factor that influences a myriad of cellular processes. HMGB1 contains two DNA-binding domains, box A and box B, which have little sequence specificity but have remarkable abilities to underwind and bend DNA. Although HMGB1 box A ismore » thought to be responsible for the majority of HMGB1–DNA interactions with pre-bent or kinked DNA, little is known about how it recognizes unmodified DNA. Here, the crystal structure of HMGB1 box A bound to an AT-rich DNA fragment is reported at a resolution of 2 Å. Two box A domains of HMGB1 collaborate in an unusual configuration in which the Phe37 residues of both domains stack together and intercalate the same CG base pair, generating highly kinked DNA. This represents a novel mode of DNA recognition for HMGB proteins and reveals a mechanism by which structure-specific HMG boxes kink linear DNA.« less

p67SRF is a constitutive nuclear protein implicated in the modulation of genes required throughout the G1 period.

PubMed Central

Gauthier-Rouvière, C; Cavadore, J C; Blanchard, J M; Lamb, N J; Fernandez, A

1991-01-01

Indirect immunofluorescence analysis, using antibodies directed against peptide sequences outside the DNA-binding domain of the 67-kDa serum response factor (p67SRF), revealed a punctuated nuclear staining, constant throughout the cell cycle and in all different cell lines tested. p67SRF was also tightly associated with chromatin through all stages of mitosis. Inhibition of p67SRF activity in vivo, through microinjection of anti-p67SRF antibodies, specifically suppressed DNA synthesis induced after serum addition or ras microinjection, suggesting that these antibodies were effective in preventing expression of serum response element (SRE)-regulated genes. A similar inhibition was also obtained in cells injected with oligonucleotides corresponding to the DNA binding sequence for p67SRF protein, SRE. Moreover, this inhibition of DNA synthesis by anti-p67SRF or SRE injection was still observed in cells injected during late G1, well after c-fos induction. These data imply that genes regulated by p67SRF are continuously involved in the proliferation pathway throughout G1 and that p67SRF forms an integral component of mammalian cell transcriptional control. Images PMID:1782216

Molecular simulations of polycation-DNA binding exploring the effect of peptide chemistry and sequence in nuclear localization sequence based polycations.

PubMed

Elder, Robert M; Jayaraman, Arthi

2013-10-10

Gene therapy relies on the delivery of DNA into cells, and polycations are one class of vectors enabling efficient DNA delivery. Nuclear localization sequences (NLS), cationic oligopeptides that target molecules for nuclear entry, can be incorporated into polycations to improve their gene delivery efficiency. We use simulations to study the effect of peptide chemistry and sequence on the DNA-binding behavior of NLS-grafted polycations by systematically mutating the residues in the grafts, which are based on the SV40 NLS (peptide sequence PKKKRKV). Replacing arginine (R) with lysine (K) reduces binding strength by eliminating arginine-DNA interactions, but placing R in a less hindered location (e.g., farther from the grafting point to the polycation backbone) has surprisingly little effect on polycation-DNA binding strength. Changing the positions of the hydrophobic proline (P) and valine (V) residues relative to the polycation backbone changes hydrophobic aggregation within the polycation and, consequently, changes the conformational entropy loss that occurs upon polycation-DNA binding. Since conformational entropy loss affects the free energy of binding, the positions of P and V in the grafts affect DNA binding affinity. The insight from this work guides synthesis of polycations with tailored DNA binding affinity and, in turn, efficient DNA delivery.

In vitro DNA binding studies of Aspartame, an artificial sweetener.

PubMed

Kashanian, Soheila; Khodaei, Mohammad Mehdi; Kheirdoosh, Fahimeh

2013-03-05

A number of small molecules bind directly and selectively to DNA, by inhibiting replication, transcription or topoisomerase activity. In this work the interaction of native calf thymus DNA (CT-DNA) with Aspartame (APM), an artificial sweeteners was studied at physiological pH. DNA binding study of APM is useful to understand APM-DNA interaction mechanism and to provide guidance for the application and design of new and safer artificial sweeteners. The interaction was investigated using spectrophotometric, spectrofluorometric competition experiment and circular dichroism (CD). Hypochromism and red shift are shown in UV absorption band of APM. A strong fluorescence quenching reaction of DNA to APM was observed and the binding constants (Kf) of DNA with APM and corresponding number of binding sites (n) were calculated at different temperatures. Thermodynamic parameters, enthalpy changes (ΔH) and entropy changes (ΔS) were calculated to be +181kJmol(-1) and +681Jmol(-1)K(-1) according to Van't Hoff equation, which indicated that reaction is predominantly entropically driven. Moreover, spectrofluorometric competition experiment and circular dichroism (CD) results are indicative of non-intercalative DNA binding nature of APM. We suggest that APM interacts with calf thymus DNA via groove binding mode with an intrinsic binding constant of 5×10(+4)M(-1). Copyright © 2013 Elsevier B.V. All rights reserved.

Detection of DNA damage in individual cells by flow cytometric analysis using anti-DNA monoclonal antibody

DOE Office of Scientific and Technical Information (OSTI.GOV)

Frankfurt, O.S.

A new method for the measurement of DNA damage in individual cells treated with alkylating agents is described. The method is based on the binding of anti-DNA monoclonal antibody to DNA in situ. Binding of antibody was evaluated by flow cytometry with indirect immunofluorescence. No binding of antibody to DNA in non-treated HeLa S3 cells was detected. Treatment of cells with HN2 or L-phenylalanine mustard induced binding of antibody to DNA in situ. Binding of antibody was observed after treating cells with doses of drugs which reduced the surviving fraction below 20%. Intensity of binding increased in proportion to themore » drug dose. In HN2-treated cells a cell subset with the lowest antibody binding was observed among cells in G1 phase. Binding of antibody to DNA in HN2-treated cells was eliminated by single-strand (ss) specific S1 nuclease. In competition assay, antibody was inhibited by thermally denatured DNA, but not by native double-stranded (ds) DNA, RNA, nucleosides and deoxyribohomopolymers. Immunoreactivity of cells with the monoclonal antibody F7-26 may be a useful probe for the assessment of cell damage induced by alkylating agents, especially in heterogeneous cell populations.« less

Structural basis for autoantibody recognition of phosphatidylserine-β2 glycoprotein I and apoptotic cells

PubMed Central

Cocca, Brian A.; Seal, Samarendra N.; D'Agnillo, Paolo; Mueller, Yvonne M.; Katsikis, Peter D.; Rauch, Joyce; Weigert, Martin; Radic, Marko Z.

2001-01-01

Apoptotic cells contain nuclear autoantigens that may initiate a systemic autoimmune response. To explore the mechanism of antibody binding to apoptotic cells, 3H9, a murine autoantibody with dual specificity for phospholipids and DNA, was used. H chain mutants of 3H9 were constructed, expressed as single-chain Fv (scFv) in Escherichia coli, and assessed for binding to phosphatidylserine, an antigen expressed on apoptotic cells. Both 3H9 and its germline revertant bound to dioleoyl phosphatidylserine in ELISA, and binding was enhanced by β2 glycoprotein I (β2GPI), a plasma protein that selectively binds to apoptotic cells. Higher relative affinity for DOPS-β2GPI was achieved by the introduction of Arg residues into the 3H9 H chain variable region at positions previously shown to mediate DNA binding. Specificity of the two structurally most diverse scFv for apoptotic cells was shown by flow cytometry, and two populations of scFv-bound cells were identified by differences in propidium iodide staining. The results suggest that, in autoimmunity, B cells with Ig receptors for apoptotic cells and DNA are positively selected, and that the antibodies they produce have the potential to affect the clearance and processing of apoptotic cells. PMID:11717440

Role of conserved cysteine residues in Herbaspirillum seropedicae NifA activity.

PubMed

Oliveira, Marco A S; Baura, Valter A; Aquino, Bruno; Huergo, Luciano F; Kadowaki, Marco A S; Chubatsu, Leda S; Souza, Emanuel M; Dixon, Ray; Pedrosa, Fábio O; Wassem, Roseli; Monteiro, Rose A

2009-01-01

Herbaspirillum seropedicae is an endophytic diazotrophic bacterium that associates with economically important crops. NifA protein, the transcriptional activator of nif genes in H. seropedicae, binds to nif promoters and, together with RNA polymerase-sigma(54) holoenzyme, catalyzes the formation of open complexes to allow transcription initiation. The activity of H. seropedicae NifA is controlled by ammonium and oxygen levels, but the mechanisms of such control are unknown. Oxygen sensitivity is attributed to a conserved motif of cysteine residues in NifA that spans the central AAA+ domain and the interdomain linker that connects the AAA+ domain to the C-terminal DNA binding domain. Here we mutagenized this conserved motif of cysteines and assayed the activity of mutant proteins in vivo. We also purified the mutant variants of NifA and tested their capacity to bind to the nifB promoter region. Chimeric proteins between H. seropedicae NifA, an oxygen-sensitive protein, and Azotobacter vinelandii NifA, an oxygen-tolerant protein, were constructed and showed that the oxygen response is conferred by the central AAA+ and C-terminal DNA binding domains of H. seropedicae NifA. We conclude that the conserved cysteine motif is essential for NifA activity, although single cysteine-to-serine mutants are still competent at binding DNA.

The human mitochondrial single-stranded DNA-binding protein displays distinct kinetics and thermodynamics of DNA binding and exchange

PubMed Central

Qian, Yufeng; Johnson, Kenneth A.

2017-01-01

The human mitochondrial ssDNA-binding protein (mtSSB) is a homotetrameric protein, involved in mtDNA replication and maintenance. Although mtSSB is structurally similar to SSB from Escherichia coli (EcoSSB), it lacks the C-terminal disordered domain, and little is known about the biophysics of mtSSB–ssDNA interactions. Here, we characterized the kinetics and thermodynamics of mtSSB binding to ssDNA by equilibrium titrations and stopped-flow kinetic measurements. We show that the mtSSB tetramer can bind to ssDNA in two distinct binding modes: (SSB)30 and (SSB)60, defined by DNA binding site sizes of 30 and 60 nucleotides, respectively. We found that the binding mode is modulated by magnesium ion and NaCl concentration, but unlike EcoSSB, the mtSSB does not show negative intersubunit cooperativity. Global fitting of both the equilibrium and kinetic data afforded estimates for the rate and equilibrium constants governing the formation of (SSB)60 and (SSB)30 complexes and for the transitions between the two binding modes. We found that the mtSSB tetramer binds to ssDNA with a rate constant near the diffusion limit (2 × 109 m−1 s−1) and that longer DNA (≥60 nucleotides) rapidly wraps around all four monomers, as revealed by FRET assays. We also show that the mtSSB tetramer can directly transfer from one ssDNA molecule to another via an intermediate with two DNA molecules bound to the mtSSB. In conclusion, our results indicate that human mtSSB shares many physicochemical properties with EcoSSB and that the differences may be explained by the lack of an acidic, disordered C-terminal tail in human mtSSB protein. PMID:28615444

Sliding of proteins non-specifically bound to DNA: Brownian dynamics studies with coarse-grained protein and DNA models.

PubMed

Ando, Tadashi; Skolnick, Jeffrey

2014-12-01

DNA binding proteins efficiently search for their cognitive sites on long genomic DNA by combining 3D diffusion and 1D diffusion (sliding) along the DNA. Recent experimental results and theoretical analyses revealed that the proteins show a rotation-coupled sliding along DNA helical pitch. Here, we performed Brownian dynamics simulations using newly developed coarse-grained protein and DNA models for evaluating how hydrodynamic interactions between the protein and DNA molecules, binding affinity of the protein to DNA, and DNA fluctuations affect the one dimensional diffusion of the protein on the DNA. Our results indicate that intermolecular hydrodynamic interactions reduce 1D diffusivity by 30%. On the other hand, structural fluctuations of DNA give rise to steric collisions between the CG-proteins and DNA, resulting in faster 1D sliding of the protein. Proteins with low binding affinities consistent with experimental estimates of non-specific DNA binding show hopping along the CG-DNA. This hopping significantly increases sliding speed. These simulation studies provide additional insights into the mechanism of how DNA binding proteins find their target sites on the genome.

Detection of Z DNA binding proteins in tissue culture cells.

PubMed Central

Leith, I R; Hay, R T; Russell, W C

1988-01-01

A gel electrophoresis DNA binding assay to detect Z DNA binding proteins has been developed utilising [32P] labelled poly [d(G-C)] which was converted to the Z form by incubation in 100 microM Co(NH3)6Cl3. The parameters of the assay were established using a Z DNA antibody as a model system and then applied to extracts of Hela and BHK21 cells. Using an anti-Z DNA antibody conditions were established which allowed resolution of antibody-DNA complexes and free DNA in the presence of 100 microM Co(NH3)6Cl3. The inclusion of unlabelled complementary homopolymers eliminated non-specific binding to the labelled Z-DNA probe. Competition experiments demonstrated that the assay was highly specific for double stranded non-B DNA. Application of the technique to extracts of mammalian cells demonstrated that human and hamster cells contain Z-DNA binding proteins; further characterisation by a blotting technique indicated that a 56,000 molecular weight cell protein preferentially binds Z-DNA. Images PMID:3419919

HEXIM1 and NEAT1 Long Non-coding RNA Form a Multi-subunit Complex that Regulates DNA-Mediated Innate Immune Response.

PubMed

Morchikh, Mehdi; Cribier, Alexandra; Raffel, Raoul; Amraoui, Sonia; Cau, Julien; Severac, Dany; Dubois, Emeric; Schwartz, Olivier; Bennasser, Yamina; Benkirane, Monsef

2017-08-03

The DNA-mediated innate immune response underpins anti-microbial defenses and certain autoimmune diseases. Here we used immunoprecipitation, mass spectrometry, and RNA sequencing to identify a ribonuclear complex built around HEXIM1 and the long non-coding RNA NEAT1 that we dubbed the HEXIM1-DNA-PK-paraspeckle components-ribonucleoprotein complex (HDP-RNP). The HDP-RNP contains DNA-PK subunits (DNAPKc, Ku70, and Ku80) and paraspeckle proteins (SFPQ, NONO, PSPC1, RBM14, and MATRIN3). We show that binding of HEXIM1 to NEAT1 is required for its assembly. We further demonstrate that the HDP-RNP is required for the innate immune response to foreign DNA, through the cGAS-STING-IRF3 pathway. The HDP-RNP interacts with cGAS and its partner PQBP1, and their interaction is remodeled by foreign DNA. Remodeling leads to the release of paraspeckle proteins, recruitment of STING, and activation of DNAPKc and IRF3. Our study establishes the HDP-RNP as a key nuclear regulator of DNA-mediated activation of innate immune response through the cGAS-STING pathway. Copyright © 2017 Elsevier Inc. All rights reserved.

Genome-Wide Motif Statistics are Shaped by DNA Binding Proteins over Evolutionary Time Scales

NASA Astrophysics Data System (ADS)

Qian, Long; Kussell, Edo

2016-10-01

The composition of a genome with respect to all possible short DNA motifs impacts the ability of DNA binding proteins to locate and bind their target sites. Since nonfunctional DNA binding can be detrimental to cellular functions and ultimately to organismal fitness, organisms could benefit from reducing the number of nonfunctional DNA binding sites genome wide. Using in vitro measurements of binding affinities for a large collection of DNA binding proteins, in multiple species, we detect a significant global avoidance of weak binding sites in genomes. We demonstrate that the underlying evolutionary process leaves a distinct genomic hallmark in that similar words have correlated frequencies, a signal that we detect in all species across domains of life. We consider the possibility that natural selection against weak binding sites contributes to this process, and using an evolutionary model we show that the strength of selection needed to maintain global word compositions is on the order of point mutation rates. Likewise, we show that evolutionary mechanisms based on interference of protein-DNA binding with replication and mutational repair processes could yield similar results and operate with similar rates. On the basis of these modeling and bioinformatic results, we conclude that genome-wide word compositions have been molded by DNA binding proteins acting through tiny evolutionary steps over time scales spanning millions of generations.

DNA Recognition by the DNA Primase of Bacteriophage T7: A Structure Function Study of the Zinc-Binding Domain

DOE Office of Scientific and Technical Information (OSTI.GOV)

Akabayov, B.; Lee, S; Akabayov, S

2009-01-01

Synthesis of oligoribonucleotide primers for lagging-strand DNA synthesis in the DNA replication system of bacteriophage T7 is catalyzed by the primase domain of the gene 4 helicase-primase. The primase consists of a zinc-binding domain (ZBD) and an RNA polymerase (RPD) domain. The ZBD is responsible for recognition of a specific sequence in the ssDNA template whereas catalytic activity resides in the RPD. The ZBD contains a zinc ion coordinated with four cysteine residues. We have examined the ligation state of the zinc ion by X-ray absorption spectroscopy and biochemical analysis of genetically altered primases. The ZBD of primase engaged inmore » catalysis exhibits considerable asymmetry in coordination to zinc, as evidenced by a gradual increase in electron density of the zinc together with elongation of the zinc-sulfur bonds. Both wild-type primase and primase reconstituted from purified ZBD and RPD have a similar electronic change in the level of the zinc ion as well as the configuration of the ZBD. Single amino acid replacements in the ZBD (H33A and C36S) result in the loss of both zinc binding and its structural integrity. Thus the zinc in the ZBD may act as a charge modulation indicator for the surrounding sulfur atoms necessary for recognition of specific DNA sequences.« less

DNA-binding mechanism of the Escherichia coli Ada O6-alkylguanine–DNA alkyltransferase

PubMed Central

Verdemato, Philip E.; Brannigan, James A.; Damblon, Christian; Zuccotto, Fabio; Moody, Peter C. E.; Lian, Lu-Yun

2000-01-01

The C-terminal domain of the Escherichia coli Ada protein (Ada-C) aids in the maintenance of genomic integrity by efficiently repairing pre-mutagenic O6-alkylguanine lesions in DNA. Structural and thermodynamic studies were carried out to obtain a model of the DNA-binding process. Nuclear magnetic resonance (NMR) studies map the DNA-binding site to helix 5, and a loop region (residues 151–160) which form the recognition helix and the ‘wing’ of a helix–turn–wing motif, respectively. The NMR data also suggest the absence of a large conformational change in the protein upon binding to DNA. Hence, an O6-methylguanine (O6meG) lesion would be inaccessible to active site nucleophile Cys146 if the modified base remained stacked within the DNA duplex. The experimentally determined DNA-binding face of Ada-C was used in combination with homology modelling, based on the catabolite activator protein, and the accepted base-flipping mechanism, to construct a model of how Ada-C binds to DNA in a productive manner. To complement the structural studies, thermodynamic data were obtained which demonstrate that binding to unmethylated DNA was entropically driven, whilst the demethylation reaction provoked an exothermic heat change. Methylation of Cys146 leads to a loss of structural integrity of the DNA-binding subdomain. PMID:11000262

DNA Adducts from Anticancer Drugs as Candidate Predictive Markers for Precision Medicine

PubMed Central

2016-01-01

Biomarker-driven drug selection plays a central role in cancer drug discovery and development, and in diagnostic strategies to improve the use of traditional chemotherapeutic drugs. DNA-modifying anticancer drugs are still used as first line medication, but drawbacks such as resistance and side effects remain an issue. Monitoring the formation and level of DNA modifications induced by anticancer drugs is a potential strategy for stratifying patients and predicting drug efficacy. In this perspective, preclinical and clinical data concerning the relationship between drug-induced DNA adducts and biological response for platinum drugs and combination therapies, nitrogen mustards and half-mustards, hypoxia-activated drugs, reductase-activated drugs, and minor groove binding agents are presented and discussed. Aspects including measurement strategies, identification of adducts, and biological factors that influence the predictive relationship between DNA modification and biological response are addressed. A positive correlation between DNA adduct levels and response was observed for the majority of the studies, demonstrating the high potential of using DNA adducts from anticancer drugs as mechanism-based biomarkers of susceptibility, especially as bioanalysis approaches with higher sensitivity and throughput emerge. PMID:27936622

Modulation of DNA binding by gene-specific transcription factors.

PubMed

Schleif, Robert F

2013-10-01

The transcription of many genes, particularly in prokaryotes, is controlled by transcription factors whose activity can be modulated by controlling their DNA binding affinity. Understanding the molecular mechanisms by which DNA binding affinity is regulated is important, but because forming definitive conclusions usually requires detailed structural information in combination with data from extensive biophysical, biochemical, and sometimes genetic experiments, little is truly understood about this topic. This review describes the biological requirements placed upon DNA binding transcription factors and their consequent properties, particularly the ways that DNA binding affinity can be modulated and methods for its study. What is known and not known about the mechanisms modulating the DNA binding affinity of a number of prokaryotic transcription factors, including CAP and lac repressor, is provided.

Tankyrases Promote Homologous Recombination and Check Point Activation in Response to DSBs

PubMed Central

Furst, Audrey; Koch, Marc; Fischer, Benoit; Soutoglou, Evi

2016-01-01

DNA lesions are sensed by a network of proteins that trigger the DNA damage response (DDR), a signaling cascade that acts to delay cell cycle progression and initiate DNA repair. The Mediator of DNA damage Checkpoint protein 1 (MDC1) is essential for spreading of the DDR signaling on chromatin surrounding Double Strand Breaks (DSBs) by acting as a scaffold for PI3K kinases and for ubiquitin ligases. MDC1 also plays a role both in Non-Homologous End Joining (NHEJ) and Homologous Recombination (HR) repair pathways. Here we identify two novel binding partners of MDC1, the poly (ADP-ribose) Polymerases (PARPs) TNKS1 and 2. We find that TNKSs are recruited to DNA lesions by MDC1 and regulate DNA end resection and BRCA1A complex stabilization at lesions leading to efficient DSB repair by HR and proper checkpoint activation. PMID:26845027

The RNA Splicing Response to DNA Damage.

PubMed

Shkreta, Lulzim; Chabot, Benoit

2015-10-29

The number of factors known to participate in the DNA damage response (DDR) has expanded considerably in recent years to include splicing and alternative splicing factors. While the binding of splicing proteins and ribonucleoprotein complexes to nascent transcripts prevents genomic instability by deterring the formation of RNA/DNA duplexes, splicing factors are also recruited to, or removed from, sites of DNA damage. The first steps of the DDR promote the post-translational modification of splicing factors to affect their localization and activity, while more downstream DDR events alter their expression. Although descriptions of molecular mechanisms remain limited, an emerging trend is that DNA damage disrupts the coupling of constitutive and alternative splicing with the transcription of genes involved in DNA repair, cell-cycle control and apoptosis. A better understanding of how changes in splice site selection are integrated into the DDR may provide new avenues to combat cancer and delay aging.

The RNA Splicing Response to DNA Damage

PubMed Central

Shkreta, Lulzim; Chabot, Benoit

2015-01-01

The number of factors known to participate in the DNA damage response (DDR) has expanded considerably in recent years to include splicing and alternative splicing factors. While the binding of splicing proteins and ribonucleoprotein complexes to nascent transcripts prevents genomic instability by deterring the formation of RNA/DNA duplexes, splicing factors are also recruited to, or removed from, sites of DNA damage. The first steps of the DDR promote the post-translational modification of splicing factors to affect their localization and activity, while more downstream DDR events alter their expression. Although descriptions of molecular mechanisms remain limited, an emerging trend is that DNA damage disrupts the coupling of constitutive and alternative splicing with the transcription of genes involved in DNA repair, cell-cycle control and apoptosis. A better understanding of how changes in splice site selection are integrated into the DDR may provide new avenues to combat cancer and delay aging. PMID:26529031

Surface shapes and surrounding environment analysis of single- and double-stranded DNA-binding proteins in protein-DNA interface.

PubMed

Wang, Wei; Liu, Juan; Sun, Lin

2016-07-01

Protein-DNA bindings are critical to many biological processes. However, the structural mechanisms underlying these interactions are not fully understood. Here, we analyzed the residues shape (peak, flat, or valley) and the surrounding environment of double-stranded DNA-binding proteins (DSBs) and single-stranded DNA-binding proteins (SSBs) in protein-DNA interfaces. In the results, we found that the interface shapes, hydrogen bonds, and the surrounding environment present significant differences between the two kinds of proteins. Built on the investigation results, we constructed a random forest (RF) classifier to distinguish DSBs and SSBs with satisfying performance. In conclusion, we present a novel methodology to characterize protein interfaces, which will deepen our understanding of the specificity of proteins binding to ssDNA (single-stranded DNA) or dsDNA (double-stranded DNA). Proteins 2016; 84:979-989. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

Binding mechanism of PicoGreen to DNA characterized by magnetic tweezers and fluorescence spectroscopy.

PubMed

Wang, Ying; Schellenberg, Helene; Walhorn, Volker; Toensing, Katja; Anselmetti, Dario

2017-09-01

Fluorescent dyes are broadly used in many biotechnological applications to detect and visualize DNA molecules. However, their binding to DNA alters the structural and nanomechanical properties of DNA and, thus, interferes with associated biological processes. In this work we employed magnetic tweezers and fluorescence spectroscopy to investigate the binding of PicoGreen to DNA at room temperature in a concentration-dependent manner. PicoGreen is an ultrasensitive quinolinium nucleic acid stain exhibiting hardly any background signal from unbound dye molecules. By means of stretching and overwinding single, torsionally constrained, nick-free double-stranded DNA molecules, we acquired force-extension and supercoiling curves which allow quantifying DNA contour length, persistence length and other thermodynamical binding parameters, respectively. The results of our magnetic tweezers single-molecule binding study were well supported through analyzing the fluorescent spectra of stained DNA. On the basis of our work, we could identify a concentration-dependent bimodal binding behavior, where, apparently, PicoGreen associates to DNA as an intercalator and minor-groove binder simultaneously.

Nonspecific DNA Binding and Bending by HUαβ: Interfaces of the Three Binding Modes Characterized by Salt Dependent Thermodynamics

PubMed Central

Koh, Junseock; Shkel, Irina; Saecker, Ruth M.; Record, M. Thomas

2011-01-01

Previous ITC and FRET studies demonstrated that Escherichia coli HUαβ binds nonspecifically to duplex DNA in three different binding modes: a tighter-binding 34 bp mode which interacts with DNA in large (>34 bp) gaps between bound proteins, reversibly bending it 140° and thereby increasing its flexibility, and two weaker, modestly cooperative small-site-size modes (10 bp, 6 bp) useful for filling gaps between bound proteins shorter than 34 bp. Here we use ITC to determine the thermodynamics of these binding modes as a function of salt concentration, and deduce that DNA in the 34 bp mode is bent around but not wrapped on the body of HU, in contrast to specific binding of IHF. Analyses of binding isotherms (8, 15, 34 bp DNA) and initial binding heats (34, 38, 160 bp DNA) reveal that all three modes have similar log-log salt concentration derivatives of the binding constants (Ski) even though their binding site sizes differ greatly; most probable values of Ski on 34 bp or larger DNA are − 7.5 ± 0.5. From the similarity of Ski values, we conclude that binding interfaces of all three modes involve the same region of the arms and saddle of HU. All modes are entropy-driven, as expected for nonspecific binding driven by the polyelectrolyte effect. The bent-DNA 34 bp mode is most endothermic, presumably because of the cost of HU-induced DNA bending, while the 6 bp mode is modestly exothermic at all salt concentrations examined. Structural models consistent with the observed Ski values are proposed. PMID:21513716

Mechanisms underlying radiosensitivity : iIvestigations in xrs-5, an X-ray sensitive hamster cell line

NASA Astrophysics Data System (ADS)

Johnston, Peter James

The damage caused to cells by ionising radiation is believed to center on damage to the DNA. In particular, the induction of DNA double strand breaks (DSB) have been implicated in biological end-points such as cell killing and the formation of chromosomal aberrations. The xrs-5 cell line is a mutant Chinese hamster ovary fibroblast (CHO-K1) mutant which exhibits sensitivity to ionising radiation and a number of other DNA damaging agents. This mutation, postulated to involve the hamster homologue of the human XRCC5 gene, is believed to be involved in the repair of the DSB. In addition, there are constitutive differences between the wild type and xrs cells involving the structure and function of the nucleus and higher order chromatin structures. The aims of this thesis were to study further the xrs-5 cell line and its response to DNA damage and to investigate the possible link between chromatin structure and DSB repair. By the examination of the response of xrs-5 cells to a number of DNA damaging agents and potential modulators of this response using the cytokinesis block micronucleus assay [Fenech and Morley, 1985] a possible cell cycle defect was identified in addition to elevated levels of chromosomal damage. Xrs-5 cells appeared to be partially defective in the cell cycle checkpoints involving the passage from G2 phase to mitosis. By the use of a modified neutral filter elution procedure variations in the repair of DSB were observed between xrs-5 and CHO. Conventional neutral filter elution requires harsh lysis conditions to remove higher order chromatin structures which interfere with the elution of DNA containing DSB. By lysing cells with non-ionic detergent in the presence of 2 M NaC1, histone depleted structures which retain the higher order nuclear matrix organisation, including chromatin loops, can be produced. Elution from these structures will only occur if two or more DSB lie within a single looped domain delineated by points of attachment to the nuclear matrix. Repair experiments indicate that in CHO cells repair of DSB in loops containing multiple DSB are repaired with "slow" kinetics (t1/2 = 5 hrs) whilst DSB occurring in loops containing single DSB are repaired with "fast" kinetics (t1/2 " 10 min). Xrs- 5 cells are incapable of repairing these multiply damaged loops. This work indicates that the spatial orientation of DSB in higher order structures of chromatin are a possible factor in the repair of these lesions. By construction of a mathematical model of the process of elution from chromatin loops it was possible to postulate the size of the loops to approximate to 2.5-3 Mbp. Further evidence of a potential structural defect in the chromatin of xrs-5 cells was provided by examination of the polypeptide composition and DNA binding activity of nuclear extracts. The affinity of extracted proteins for double-stranded calf-thymus DNA was measured in nuclear extracts of xrs-5 and CHO cells. There was an alteration in the DNA binding activity of salt extractable proteins from xrs-5 as measured by a filter binding assay. By the use of SDS-PAGE and the technique of South-Western blotting, it was possible to identify the approximate molecular weights of these DNA binding proteins. Differences were found in DNA binding between proteins from CHO and xrs-5 extracts of both non-irradiated and irradiated cells. Two proteins with apparent molecular weights of 32.2 and 31.8 kDa exhibited a lower DNA binding activity in xrs-5 than proteins of similar extracts from CHO. The amount of the 32.2 kDa protein was less in the xrs-5 extracts than in CHO extracts, as measured by Coomassie blue staining. The two proteins have not yet been identified but comprise a major DNA binding activity in CHO extracts obtained by detergent-free extraction procedures. This work provides circumstantial evidence that suggests these two polypeptides may form part of the histone H1 family.

The Fanconi anemia associated protein FAAP24 uses two substrate specific binding surfaces for DNA recognition

PubMed Central

Wienk, Hans; Slootweg, Jack C.; Speerstra, Sietske; Kaptein, Robert; Boelens, Rolf; Folkers, Gert E.

2013-01-01

To maintain the integrity of the genome, multiple DNA repair systems exist to repair damaged DNA. Recognition of altered DNA, including bulky adducts, pyrimidine dimers and interstrand crosslinks (ICL), partially depends on proteins containing helix-hairpin-helix (HhH) domains. To understand how ICL is specifically recognized by the Fanconi anemia proteins FANCM and FAAP24, we determined the structure of the HhH domain of FAAP24. Although it resembles other HhH domains, the FAAP24 domain contains a canonical hairpin motif followed by distorted motif. The HhH domain can bind various DNA substrates; using nuclear magnetic resonance titration experiments, we demonstrate that the canonical HhH motif is required for double-stranded DNA (dsDNA) binding, whereas the unstructured N-terminus can interact with single-stranded DNA. Both DNA binding surfaces are used for binding to ICL-like single/double-strand junction-containing DNA substrates. A structural model for FAAP24 bound to dsDNA has been made based on homology with the translesion polymerase iota. Site-directed mutagenesis, sequence conservation and charge distribution support the dsDNA-binding model. Analogous to other HhH domain-containing proteins, we suggest that multiple FAAP24 regions together contribute to binding to single/double-strand junction, which could contribute to specificity in ICL DNA recognition. PMID:23661679

DNABP: Identification of DNA-Binding Proteins Based on Feature Selection Using a Random Forest and Predicting Binding Residues.

PubMed

Ma, Xin; Guo, Jing; Sun, Xiao

2016-01-01

DNA-binding proteins are fundamentally important in cellular processes. Several computational-based methods have been developed to improve the prediction of DNA-binding proteins in previous years. However, insufficient work has been done on the prediction of DNA-binding proteins from protein sequence information. In this paper, a novel predictor, DNABP (DNA-binding proteins), was designed to predict DNA-binding proteins using the random forest (RF) classifier with a hybrid feature. The hybrid feature contains two types of novel sequence features, which reflect information about the conservation of physicochemical properties of the amino acids, and the binding propensity of DNA-binding residues and non-binding propensities of non-binding residues. The comparisons with each feature demonstrated that these two novel features contributed most to the improvement in predictive ability. Furthermore, to improve the prediction performance of the DNABP model, feature selection using the minimum redundancy maximum relevance (mRMR) method combined with incremental feature selection (IFS) was carried out during the model construction. The results showed that the DNABP model could achieve 86.90% accuracy, 83.76% sensitivity, 90.03% specificity and a Matthews correlation coefficient of 0.727. High prediction accuracy and performance comparisons with previous research suggested that DNABP could be a useful approach to identify DNA-binding proteins from sequence information. The DNABP web server system is freely available at http://www.cbi.seu.edu.cn/DNABP/.

Multiple Intrinsically Disordered Sequences Alter DNA Binding by the Homeodomain of the Drosophila Hox Protein Ultrabithorax*S⃞

PubMed Central

Liu, Ying; Matthews, Kathleen S.; Bondos, Sarah E.

2008-01-01

During animal development, distinct tissues, organs, and appendages are specified through differential gene transcription by Hox transcription factors. However, the conserved Hox homeodomains bind DNA with high affinity yet low specificity. We have therefore explored the structure of the Drosophila melanogaster Hox protein Ultrabithorax and the impact of its nonhomeodomain regions on DNA binding properties. Computational and experimental approaches identified several conserved, intrinsically disordered regions outside the homeodomain of Ultrabithorax that impact DNA binding by the homeodomain. Full-length Ultrabithorax bound to target DNA 2.5-fold weaker than its isolated homeodomain. Using N-terminal and C-terminal deletion mutants, we demonstrate that the YPWM region and the disordered microexons (termed the I1 region) inhibit DNA binding ∼2-fold, whereas the disordered I2 region inhibits homeodomain-DNA interaction a further ∼40-fold. Binding is restored almost to homeodomain affinity by the mostly disordered N-terminal 174 amino acids (R region) in a length-dependent manner. Both the I2 and R regions contain portions of the activation domain, functionally linking DNA binding and transcription regulation. Given that (i) the I1 region and a portion of the R region alter homeodomain-DNA binding as a function of pH and (ii) an internal deletion within I1 increases Ultrabithorax-DNA affinity, I1 must directly impact homeodomain-DNA interaction energetics. However, I2 appears to indirectly affect DNA binding in a manner countered by the N terminus. The amino acid sequences of I2 and much of the I1 and R regions vary significantly among Ultrabithorax orthologues, potentially diversifying Hox-DNA interactions. PMID:18508761

UV-induced DNA damage is an intermediate step in UV-induced expression of human immunodeficiency virus type 1, collagenase, c-fos, and metallothionein.

PubMed Central

Stein, B; Rahmsdorf, H J; Steffen, A; Litfin, M; Herrlich, P

1989-01-01

UV irradiation of human and murine cells enhances the transcription of several genes. Here we report on the primary target of relevant UV absorption, on pathways leading to gene activation, and on the elements receiving the UV-induced signal in the human immunodeficiency virus type 1 (HIV-1) long terminal repeat, in the gene coding for collagenase, and in the cellular oncogene fos. In order to induce the expression of genes. UV radiation needs to be absorbed by DNA and to cause DNA damage of the kind that cannot be repaired by cells from patients with xeroderma pigmentosum group A. UV-induced activation of the three genes is mediated by the major enhancer elements (located between nucleotide positions -105 and -79 of HIV-1, between positions -72 and -65 of the collagenase gene, and between positions -320 and -299 of fos). These elements share no apparent sequence motif and bind different trans-acting proteins; a member of the NF kappa B family binds to the HIV-1 enhancer, the heterodimer of Jun and Fos (AP-1) binds to the collagenase enhancer, and the serum response factors p67 and p62 bind to fos. DNA-binding activities of the factors recognizing the HIV-1 and collagenase enhancers are augmented in extracts from UV-treated cells. The increase in activity is due to posttranslational modification. While AP-1 resides in the nucleus and must be modulated there, NF kappa B is activated in the cytoplasm, indicating the existence of a cytoplasmic signal transduction pathway triggered by UV-induced DNA damage. In addition to activation, new synthesis of AP-1 is induced by UV radiation. Images PMID:2557547

Preferential epigenetic programming of estrogen response after in utero xenoestrogen (bisphenol-A) exposure

PubMed Central

Jorgensen, Elisa M.; Alderman, Myles H.; Taylor, Hugh S.

2016-01-01

Bisphenol-A (BPA) is an environmentally ubiquitous estrogen-like endocrine-disrupting compound. Exposure to BPA in utero has been linked to female reproductive disorders, including endometrial hyperplasia and breast cancer. Estrogens are an etiological factor in many of these conditions. We sought to determine whether in utero exposure to BPA altered the global CpG methylation pattern of the uterine genome, subsequent gene expression, and estrogen response. Pregnant mice were exposed to an environmentally relevant dose of BPA or DMSO control. Uterine DNA and RNA were examined by using methylated DNA immunoprecipitation methylation microarray, expression microarray, and quantitative PCR. In utero BPA exposure altered the global CpG methylation profile of the uterine genome and subsequent gene expression. The effect on gene expression was not apparent until sexual maturation, which suggested that estrogen response was the primary alteration. Indeed, prenatal BPA exposure preferentially altered adult estrogen-responsive gene expression. Changes in estrogen response were accompanied by altered methylation that preferentially affected estrogen receptor-α (ERα)–binding genes. The majority of genes that demonstrated both altered expression and ERα binding had decreased methylation. BPA selectively altered the normal developmental programming of estrogen-responsive genes via modification of the genes that bind ERα. Gene–environment interactions driven by early life xenoestrogen exposure likely contributes to increased risk of estrogen-related disease in adults.—Jorgensen, E. M., Alderman, M. H., III, Taylor, H. S. Preferential epigenetic programming of estrogen response after in utero xenoestrogen (bisphenol-A) exposure. PMID:27312807

Genome-wide inference of transcription factor-DNA binding specificity in cell regeneration using a combination strategy.

PubMed

Wang, Xiaofeng; Zhang, Aiqun; Ren, Weizheng; Chen, Caiyu; Dong, Jiahong

2012-11-01

The cell growth, development, and regeneration of tissue and organ are associated with a large number of gene regulation events, which are mediated in part by transcription factors (TFs) binding to cis-regulatory elements involved in the genome. Predicting the binding affinity and inferring the binding specificity of TF-DNA interactions at the genomic level would be fundamentally helpful for our understanding of the molecular mechanism and biological implication underlying sequence-specific TF-DNA recognition. In this study, we report the development of a combination method to characterize the interaction behavior of a 11-mer oligonucleotide segment and its mutations with the Gcn4p protein, a homodimeric, basic leucine zipper TF, and to predict the binding affinity and specificity of potential Gcn4p binders in the genome-wide scale. In this procedure, a position-mutated energy matrix is created based on molecular modeling analysis of native and mutated Gcn4p-DNA complex structures to describe the position-independent interaction energy profile of Gcn4p with different nucleotide types at each position of the oligonucleotide, and the energy terms extracted from the matrix and their interactives are then correlated with experimentally measured affinities of 19268 distinct oligonucleotides using statistical modeling methodology. Subsequently, the best one of built regression models is successfully applied to screen those of potential high-affinity Gcn4p binders from the complete genome. The findings arising from this study are briefly listed below: (i) The 11 positions of oligonucleotides are highly interactive and non-additive in contribution to Gcn4p-DNA binding affinity; (ii) Indirect conformational effects upon nucleotide mutations as well as associated subtle changes in interfacial atomic contacts, but not the direct nonbonded interactions, are primarily responsible for the sequence-specific recognition; (iii) The intrinsic synergistic effects among the sequence positions of oligonucleotides determine Gcn4p-DNA binding affinity and specificity; (iv) Linear regression models in conjunction with variable selection seem to perform fairly well in capturing the internal dependences hidden in the Gcn4p-DNA system, albeit ignoring nonlinear factors may lead the models to systematically underestimate and overestimate high- and low-affinity samples, respectively. © 2012 John Wiley & Sons A/S.

An Enhanced Synthetic Multiclade DNA Prime Induces Improved Cross-Clade-Reactive Functional Antibodies when Combined with an Adjuvanted Protein Boost in Nonhuman Primates

PubMed Central

Wise, Megan C.; Hutnick, Natalie A.; Pollara, Justin; Myles, Devin J. F.; Williams, Constance; Yan, Jian; LaBranche, Celia C.; Khan, Amir S.; Sardesai, Niranjan Y.; Montefiori, David; Barnett, Susan W.; Zolla-Pazner, Susan; Ferrari, Guido

2015-01-01

ABSTRACT The search for an efficacious human immunodeficiency virus type 1 (HIV-1) vaccine remains a pressing need. The moderate success of the RV144 Thai clinical vaccine trial suggested that vaccine-induced HIV-1-specific antibodies can reduce the risk of HIV-1 infection. We have made several improvements to the DNA platform and have previously shown that improved DNA vaccines alone are capable of inducing both binding and neutralizing antibodies in small-animal models. In this study, we explored how an improved DNA prime and recombinant protein boost would impact HIV-specific vaccine immunogenicity in rhesus macaques (RhM). After DNA immunization with either a single HIV Env consensus sequence or multiple constructs expressing HIV subtype-specific Env consensus sequences, we detected both CD4+ and CD8+ T-cell responses to all vaccine immunogens. These T-cell responses were further increased after protein boosting to levels exceeding those of DNA-only or protein-only immunization. In addition, we observed antibodies that exhibited robust cross-clade binding and neutralizing and antibody-dependent cellular cytotoxicity (ADCC) activity after immunization with the DNA prime-protein boost regimen, with the multiple-Env formulation inducing a more robust and broader response than the single-Env formulation. The magnitude and functionality of these responses emphasize the strong priming effect improved DNA immunogens can induce, which are further expanded upon protein boost. These results support further study of an improved synthetic DNA prime together with a protein boost for enhancing anti-HIV immune responses. IMPORTANCE Even with effective antiretroviral drugs, HIV remains an enormous global health burden. Vaccine development has been problematic in part due to the high degree of diversity and poor immunogenicity of the HIV Env protein. Studies suggest that a relevant HIV vaccine will likely need to induce broad cellular and humoral responses from a simple vaccine regimen due to the resource-limited setting in which the HIV pandemic is most rampant. DNA vaccination lends itself well to increasing the amount of diversity included in a vaccine due to the ease of manufacturing multiple plasmids and formulating them as a single immunization. By increasing the number of Envs within a formulation, we were able to show an increased breadth of responses as well as improved functionality induced in a nonhuman primate model. This increased breadth could be built upon, leading to better coverage against circulating strains with broader vaccine-induced protection. PMID:26085155

Alchemical Free Energy Calculations for Nucleotide Mutations in Protein-DNA Complexes.

PubMed

Gapsys, Vytautas; de Groot, Bert L

2017-12-12

Nucleotide-sequence-dependent interactions between proteins and DNA are responsible for a wide range of gene regulatory functions. Accurate and generalizable methods to evaluate the strength of protein-DNA binding have long been sought. While numerous computational approaches have been developed, most of them require fitting parameters to experimental data to a certain degree, e.g., machine learning algorithms or knowledge-based statistical potentials. Molecular-dynamics-based free energy calculations offer a robust, system-independent, first-principles-based method to calculate free energy differences upon nucleotide mutation. We present an automated procedure to set up alchemical MD-based calculations to evaluate free energy changes occurring as the result of a nucleotide mutation in DNA. We used these methods to perform a large-scale mutation scan comprising 397 nucleotide mutation cases in 16 protein-DNA complexes. The obtained prediction accuracy reaches 5.6 kJ/mol average unsigned deviation from experiment with a correlation coefficient of 0.57 with respect to the experimentally measured free energies. Overall, the first-principles-based approach performed on par with the molecular modeling approaches Rosetta and FoldX. Subsequently, we utilized the MD-based free energy calculations to construct protein-DNA binding profiles for the zinc finger protein Zif268. The calculation results compare remarkably well with the experimentally determined binding profiles. The software automating the structure and topology setup for alchemical calculations is a part of the pmx package; the utilities have also been made available online at http://pmx.mpibpc.mpg.de/dna_webserver.html .

Studies on the mechanism of functional cooperativity between progesterone and estrogen receptors.

PubMed

Bradshaw, M S; Tsai, S Y; Leng, X H; Dobson, A D; Conneely, O M; O'Malley, B W; Tsai, M J

1991-09-05

Steroid response elements (SREs) cooperate with many different cis-acting elements including NF-1 sites, CACCC boxes, and other SREs to induce target gene expression (Schule, R., Muller, M., Otsuka-Murakami, H., and Renkawitz, R. (1988) Nature 332, 87-90; Strahle, U., Schmid, W., and Schutz, G. (1988) EMBO J. 7, 3389-3395). Induction of gene expression can be additive or synergistic with respect to the level of activation by either transactivators. Two mechanisms have been proposed for how synergism occurs: 1) cooperative binding of transcriptional activators to DNA or 2) simultaneous interaction of individually bound activators with a common target protein. We have shown previously that cooperative binding of receptors is important for synergism between two progesterone response elements (PREs). Here we showed that an estrogen response element (ERE) and a PRE can also functionally cooperate and this synergism between an ERE and a PRE is not contributed by cooperative DNA binding. Furthermore, we have demonstrated that the activation domains of the progesterone receptor (PR) (C1Act) are required for synergism between two PREs and sufficient for confirming cooperative binding. However these two activation domains of PR are not sufficient for synergism between an ERE and a PRE. Additional regions within the NH2-terminal and COOH-terminal domains are also required for synergistic interaction between two heterologous SREs.

DNA prime–protein boost increased the titer, avidity and persistence of anti-Aβ antibodies in wild-type mice

PubMed Central

Davtyan, H; Mkrtichyan, M; Movsesyan, N; Petrushina, I; Mamikonyan, G; Cribbs, DH; Agadjanyan, MG; Ghochikyan, A

2010-01-01

Recently, we reported that a DNA vaccine, composed of three copies of a self B cell epitope of amyloid-β (Aβ42) and the foreign T-cell epitope, Pan DR epitope (PADRE), generated strong anti-Aβ immune responses in wild-type and amyloid precursor protein transgenic animals. Although DNA vaccines have several advantages over peptide–protein vaccines, they induce lower immune responses in large animals and humans compared with those in mice. The focus of this study was to further enhance anti-Aβ11 immune responses by developing an improved DNA vaccination protocol of the prime–boost regimen, in which the priming step would use DNA and the boosting step would use recombinant protein. Accordingly, we generated DNA and recombinant protein-based epitope vaccines and showed that priming with DNA followed by boosting with a homologous recombinant protein vaccine significantly increases the anti-Aβ antibody responses and do not change the immunoglobulin G1 (IgG1) profile of humoral immune responses. Furthermore, the antibodies generated by this prime–boost regimen were long-lasting and possessed a higher avidity for binding with an Aβ42 peptide. Thus, we showed that a heterologous prime–boost regimen could be an effective protocol for developing a potent Alzheimer’s disease (AD) vaccine. PMID:19865176

Mechanisms of small molecule–DNA interactions probed by single-molecule force spectroscopy

PubMed Central

Almaqwashi, Ali A.; Paramanathan, Thayaparan; Rouzina, Ioulia; Williams, Mark C.

2016-01-01

There is a wide range of applications for non-covalent DNA binding ligands, and optimization of such interactions requires detailed understanding of the binding mechanisms. One important class of these ligands is that of intercalators, which bind DNA by inserting aromatic moieties between adjacent DNA base pairs. Characterizing the dynamic and equilibrium aspects of DNA-intercalator complex assembly may allow optimization of DNA binding for specific functions. Single-molecule force spectroscopy studies have recently revealed new details about the molecular mechanisms governing DNA intercalation. These studies can provide the binding kinetics and affinity as well as determining the magnitude of the double helix structural deformations during the dynamic assembly of DNA–ligand complexes. These results may in turn guide the rational design of intercalators synthesized for DNA-targeted drugs, optical probes, or integrated biological self-assembly processes. Herein, we survey the progress in experimental methods as well as the corresponding analysis framework for understanding single molecule DNA binding mechanisms. We discuss briefly minor and major groove binding ligands, and then focus on intercalators, which have been probed extensively with these methods. Conventional mono-intercalators and bis-intercalators are discussed, followed by unconventional DNA intercalation. We then consider the prospects for using these methods in optimizing conventional and unconventional DNA-intercalating small molecules. PMID:27085806

A Zn(II)2Cys6 DNA binding protein regulates the sirodesmin PL biosynthetic gene cluster in Leptosphaeria maculans

PubMed Central

Fox, Ellen M.; Gardiner, Donald M.; Keller, Nancy P.; Howlett, Barbara J.

2008-01-01

A gene, sirZ, encoding a Zn(II)2Cys6 DNA binding protein is present in a cluster of genes responsible for the biosynthesis of the epipolythiodioxopiperazine (ETP) toxin, sirodesmin PL in the ascomycete plant pathogen, Leptosphaeria maculans. RNA-mediated silencing of sirZ gives rise to transformants that produce only residual amounts of sirodesmin PL and display a decrease in the transcription of several sirodesmin PL biosynthetic genes. This indicates that SirZ is a major regulator of this gene cluster. Proteins similar to SirZ are encoded in the gliotoxin biosynthetic gene cluster of Aspergillus fumigatus (gliZ) and in an ETP-like cluster in Penicillium lilacinoechinulatum (PlgliZ). Despite its high level of sequence similarity to gliZ, PlgliZ is unable to complement the gliotoxin-deficiency of a mutant of gliZ in A. fumigatus. Putative binding sites for these regulatory proteins in the promoters of genes in these clusters were predicted using bioinformatic analysis. These sites are similar to those commonly bound by other proteins with Zn(II)2Cys6 DNA binding domains. PMID:18023597

Alpha-crystallins are involved in specific interactions with the murine gamma D/E/F-crystallin-encoding gene.

PubMed

Pietrowski, D; Durante, M J; Liebstein, A; Schmitt-John, T; Werner, T; Graw, J

1994-07-08

The promoter of the murine gamma E-crystallin (gamma E-Cry) encoding gene (gamma E-cry) was analyzed for specific interactions with lenticular proteins in a gel-retardation assay. A 21-bp fragment immediately downstream of the transcription initiation site (DOTIS) is demonstrated to be responsible for specific interactions with lens extracts. The DOTIS-binding protein(s) accept only the sense DNA strand as target; anti-sense or double-stranded DNA do not interact with these proteins. The DOTIS sequence element is highly conserved among the murine gamma D-, gamma E- and gamma F-cry and is present at comparable positions in the orthologous rat genes. Only a weak or even no protein-binding activity is observed if a few particular bases are changed, as in the rat gamma A-, gamma C- and gamma E-cry elements. DOTIS-binding proteins were found in commercially available bovine alpha-Cry preparations. The essential participation of alpha-Cry in the DNA-binding protein complex was confirmed using alpha-Cry-specific monoclonal antibody. The results reported here point to a novel function of alpha-Cry besides the structural properties in the lens.

A Comparative Phase I Study of Combination, Homologous Subtype-C DNA, MVA, and Env gp140 Protein/Adjuvant HIV Vaccines in Two Immunization Regimes

PubMed Central

Joseph, Sarah; Quinn, Killian; Greenwood, Aldona; Cope, Alethea V.; McKay, Paul F.; Hayes, Peter J.; Kopycinski, Jakub T.; Gilmour, Jill; Miller, Aleisha N.; Geldmacher, Christof; Nadai, Yuka; Ahmed, Mohamed I. M.; Montefiori, David C.; Dally, Len; Bouliotis, George; Lewis, David J. M.; Tatoud, Roger; Wagner, Ralf; Esteban, Mariano; Shattock, Robin J.; McCormack, Sheena; Weber, Jonathan

2017-01-01

There remains an urgent need for a prophylactic HIV vaccine. We compared combined MVA and adjuvanted gp140 to sequential MVA/gp140 after DNA priming. We expected Env-specific CD4+ T-cells after DNA and MVA priming, and Env-binding antibodies in 100% individuals after boosting with gp140 and that combined vaccines would not compromise safety and might augment immunogenicity. Forty volunteers were primed three times with DNA plasmids encoding (CN54) env and (ZM96) gag-pol-nef at 0, 4 and 8 weeks then boosted with MVA-C (CN54 env and gag-pol-nef) and glucopyranosyl lipid adjuvant—aqueous formulation (GLA-AF) adjuvanted CN54gp140. They were randomised to receive them in combination at the same visit at 16 and 20 weeks (accelerated) or sequentially with MVA-C at 16, 20, and GLA-AF/gp140 at 24 and 28 weeks (standard). All vaccinations were intramuscular. Primary outcomes included ≥grade 3 safety events and the titer of CN54gp140-specific binding IgG. Other outcomes included neutralization, binding antibody specificity and T-cell responses. Two participants experienced asymptomatic ≥grade 3 transaminitis leading to discontinuation of vaccinations, and three had grade 3 solicited local or systemic reactions. A total of 100% made anti-CN54gp140 IgG and combining vaccines did not significantly alter the response; geometric mean titer 6424 (accelerated) and 6578 (standard); neutralization of MW965.2 Tier 1 pseudovirus was superior in the standard group (82 versus 45% responders, p = 0.04). T-cell ELISpot responses were CD4+ and Env-dominant; 85 and 82% responding in the accelerated and standard groups, respectively. Vaccine-induced IgG responses targeted multiple regions within gp120 with the V3 region most immunodominant and no differences between groups detected. Combining MVA and gp140 vaccines did not result in increased adverse events and did not significantly impact upon the titer of Env-specific binding antibodies, which were seen in 100% individuals. The approach did however affect other immune responses; neutralizing antibody responses, seen only to Tier 1 pseudoviruses, were poorer when the vaccines were combined and while T-cell responses were seen in >80% individuals in both groups and similarly CD4 and Env dominant, their breadth/polyfunctionality tended to be lower when the vaccines were combined, suggesting attenuation of immunogenicity and cautioning against this accelerated regimen. PMID:28275375

Footprinting of Chlorella virus DNA ligase bound at a nick in duplex DNA.

PubMed

Odell, M; Shuman, S

1999-05-14

The 298-amino acid ATP-dependent DNA ligase of Chlorella virus PBCV-1 is the smallest eukaryotic DNA ligase known. The enzyme has intrinsic specificity for binding to nicked duplex DNA. To delineate the ligase-DNA interface, we have footprinted the enzyme binding site on DNA and the DNA binding site on ligase. The size of the exonuclease III footprint of ligase bound a single nick in duplex DNA is 19-21 nucleotides. The footprint is asymmetric, extending 8-9 nucleotides on the 3'-OH side of the nick and 11-12 nucleotides on the 5'-phosphate side. The 5'-phosphate moiety is essential for the binding of Chlorella virus ligase to nicked DNA. Here we show that the 3'-OH moiety is not required for nick recognition. The Chlorella virus ligase binds to a nicked ligand containing 2',3'-dideoxy and 5'-phosphate termini, but cannot catalyze adenylation of the 5'-end. Hence, the 3'-OH is important for step 2 chemistry even though it is not itself chemically transformed during DNA-adenylate formation. A 2'-OH cannot substitute for the essential 3'-OH in adenylation at a nick or even in strand closure at a preadenylated nick. The protein side of the ligase-DNA interface was probed by limited proteolysis of ligase with trypsin and chymotrypsin in the presence and absence of nicked DNA. Protease accessible sites are clustered within a short segment from amino acids 210-225 located distal to conserved motif V. The ligase is protected from proteolysis by nicked DNA. Protease cleavage of the native enzyme prior to DNA addition results in loss of DNA binding. These results suggest a bipartite domain structure in which the interdomain segment either comprises part of the DNA binding site or undergoes a conformational change upon DNA binding. The domain structure of Chlorella virus ligase inferred from the solution experiments is consistent with the structure of T7 DNA ligase determined by x-ray crystallography.

Reshaping the Energy Landscape Transforms the Mechanism and Binding Kinetics of DNA Threading Intercalation.

PubMed

Clark, Andrew G; Naufer, M Nabuan; Westerlund, Fredrik; Lincoln, Per; Rouzina, Ioulia; Paramanathan, Thayaparan; Williams, Mark C

2018-02-06

Molecules that bind DNA via threading intercalation show high binding affinity as well as slow dissociation kinetics, properties ideal for the development of anticancer drugs. To this end, it is critical to identify the specific molecular characteristics of threading intercalators that result in optimal DNA interactions. Using single-molecule techniques, we quantify the binding of a small metal-organic ruthenium threading intercalator (Δ,Δ-B) and compare its binding characteristics to a similar molecule with significantly larger threading moieties (Δ,Δ-P). The binding affinities of the two molecules are the same, while comparison of the binding kinetics reveals significantly faster kinetics for Δ,Δ-B. However, the kinetics is still much slower than that observed for conventional intercalators. Comparison of the two threading intercalators shows that the binding affinity is modulated independently by the intercalating section and the binding kinetics is modulated by the threading moiety. In order to thread DNA, Δ,Δ-P requires a "lock mechanism", in which a large length increase of the DNA duplex is required for both association and dissociation. In contrast, measurements of the force-dependent binding kinetics show that Δ,Δ-B requires a large DNA length increase for association but no length increase for dissociation from DNA. This contrasts strongly with conventional intercalators, for which almost no DNA length change is required for association but a large DNA length change must occur for dissociation. This result illustrates the fundamentally different mechanism of threading intercalation compared with conventional intercalation and will pave the way for the rational design of therapeutic drugs based on DNA threading intercalation.

Dpb11 may function with RPA and DNA to initiate DNA replication

PubMed Central

Bruck, Irina; Dhingra, Nalini; Martinez, Matthew P.

2017-01-01

Dpb11 is required for the initiation of DNA replication in budding yeast. We found that Dpb11 binds tightly to single-stranded DNA (ssDNA) or branched DNA structures, while its human homolog, TopBP1, binds tightly to branched-DNA structures. We also found that Dpb11 binds stably to CDK-phosphorylated RPA, the eukaryotic ssDNA binding protein, in the presence of branched DNA. A Dpb11 mutant specifically defective for DNA binding did not exhibit tight binding to RPA in the presence of DNA, suggesting that Dpb11-interaction with DNA may promote the recruitment of RPA to melted DNA. We then characterized a mutant of Dpb11 that is specifically defective in DNA binding in budding yeast cells. Expression of dpb11-m1,2,3,5,ΔC results in a substantial decrease in RPA recruitment to origins, suggesting that Dpb11 interaction with DNA may be required for RPA recruitment to origins. Expression of dpb11-m1,2,3,5,ΔC also results in diminished GINS interaction with Mcm2-7 during S phase, while Cdc45 interaction with Mcm2-7 is like wild-type. The reduced GINS interaction with Mcm2-7 may be an indirect consequence of diminished origin melting. We propose that the tight interaction between Dpb11, CDK-phosphorylated RPA, and branched-DNA may be required for the essential function of stabilizing melted origin DNA in vivo. We also propose an alternative model, wherein Dpb11-DNA interaction is required for some other function in DNA replication initiation, such as helicase activation. PMID:28467467

Studies on the interaction of a synthetic nitro-flavone derivative with DNA: A multi-spectroscopic and molecular docking approach.

PubMed

Mitra, A; Saikh, F; Das, J; Ghosh, S; Ghosh, R

2018-05-22

Interaction of a ligand with DNA is often the basis of drug action of many molecules. Flavones are important in this regard as their structural features confer them the ability to bind to DNA. 2-(4-Nitrophenyl)-4H-chromen-4-one (4NCO) is an important biologically active synthetic flavone derivative. We are therefore interested in studying its interaction with DNA. Absorption spectroscopy studies included standard and reverse titration, effect of ionic strength on titration, determination of stoichiometry of binding and thermal denaturation. Spectrofluorimetry techniques included fluorimetric titration, quenching studies and fluorescence displacement assay. Assessment of relative viscosity and estimation of thermodynamic parameters from CD spectral studies were also undertaken. Furthermore, molecular docking analyses were also done with different short DNA sequences. The fluorescent flavone 4NCO reversibly interacted with DNA through partial intercalation as well as minor-groove binding. The binding constant and the number of binding sites were of the order 10 4  M -1 and 1 respectively. The binding stoichiometry with DNA was found to be 1:1. The nature of the interaction of 4NCO with DNA was hydrophobic in nature and the process of binding was spontaneous, endothermic and entropy-driven. The flavone also showed a preference for binding to GC rich sequences. The study presents a profile for structural and thermodynamic parameters, for the binding of 4NCO with DNA. DNA is an important target for ligands that are effective against cell proliferative disorders. In this regard, the molecule 4NCO is important since it can exert its biological activity through its DNA binding ability and can be a potential drug candidate. Copyright © 2018 Elsevier B.V. All rights reserved.

Chemotherapeutic Drug-Conjugated Microbeads Demonstrate Preferential Binding to Methylated Plasmid DNA.

PubMed

Lin, Kevin N; Grandhi, Taraka Sai Pavan; Goklany, Sheba; Rege, Kaushal

2018-04-10

Plasmid DNA (pDNA) is an attractive therapeutic biomolecule in several diseases including cancer, AIDS, cystic fibrosis, Parkinson's disease, and Alzheimer's disease. Increasing demand for plasmid DNA as a therapeutic biomolecule for transgene expression or vaccine applications necessitate novel approaches to bioprocessing. The synthesis, characterization and evaluation of aminoglycoside-derived hydrogel microbeads (Amikabeads) for pDNA binding is described previously. Here, the generation and evaluation of novel chemotherapeutic drug-conjugated microbeads for application in pDNA binding and recovery is described. Chemotherapeutic drug-conjugated Amikabeads demonstrate higher binding of methylated pDNA compared to unmethylated pDNA in presence of high salt concentrations. Desorption of plasmids from drug-conjugated microbeads is facilitated by the use of organic modifiers. The observed differences in binding methylated versus unmethylated DNA can make drug-conjugated microbeads useful in diagnostic as well as therapeutic applications. These results demonstrate that anti-cancer drugs represent a diverse set of ligands that may be exploited for molecular engineering of novel DNA binding materials for applications in delivery, diagnostics, and biomanufacturing. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Ethylene Receptor 1 (ETR1) Is Sufficient and Has the Predominant Role in Mediating Inhibition of Ethylene Responses by Silver in Arabidopsis thaliana*

PubMed Central

McDaniel, Brittany K.; Binder, Brad M.

2012-01-01

Ethylene influences many processes in Arabidopsis thaliana through the action of five receptor isoforms. All five isoforms use copper as a cofactor for binding ethylene. Previous research showed that silver can substitute for copper as a cofactor for ethylene binding activity in the ETR1 ethylene receptor yet also inhibit ethylene responses in plants. End-point and rapid kinetic analyses of dark-grown seedling growth revealed that the effects of silver are mostly dependent upon ETR1, and ETR1 alone is sufficient for the effects of silver. Ethylene responses in etr1-6 etr2-3 ein4-4 triple mutants were not blocked by silver. Transformation of these triple mutants with cDNA for each receptor isoform under the promoter control of ETR1 revealed that the cETR1 transgene completely rescued responses to silver while the cETR2 transgene failed to rescue these responses. The other three isoforms partially rescued responses to silver. Ethylene binding assays on the binding domains of the five receptor isoforms expressed in yeast showed that silver supports ethylene binding to ETR1 and ERS1 but not the other isoforms. Thus, silver may have an effect on ethylene signaling outside of the ethylene binding pocket of the receptors. Ethylene binding to ETR1 with silver was ∼30% of binding with copper. However, alterations in the Kd for ethylene binding to ETR1 and the half-time of ethylene dissociation from ETR1 do not underlie this lower binding. Thus, it is likely that the lower ethylene binding activity of ETR1 with silver is due to fewer ethylene binding sites generated with silver versus copper. PMID:22692214

DNA binding by the ribosomal DNA transcription factor rrn3 is essential for ribosomal DNA transcription.

PubMed

Stepanchick, Ann; Zhi, Huijun; Cavanaugh, Alice H; Rothblum, Katrina; Schneider, David A; Rothblum, Lawrence I

2013-03-29

The human homologue of yeast Rrn3 is an RNA polymerase I-associated transcription factor that is essential for ribosomal DNA (rDNA) transcription. The generally accepted model is that Rrn3 functions as a bridge between RNA polymerase I and the transcription factors bound to the committed template. In this model Rrn3 would mediate an interaction between the mammalian Rrn3-polymerase I complex and SL1, the rDNA transcription factor that binds to the core promoter element of the rDNA. In the course of studying the role of Rrn3 in recruitment, we found that Rrn3 was in fact a DNA-binding protein. Analysis of the sequence of Rrn3 identified a domain with sequence similarity to the DNA binding domain of heat shock transcription factor 2. Randomization, or deletion, of the amino acids in this region in Rrn3, amino acids 382-400, abrogated its ability to bind DNA, indicating that this domain was an important contributor to DNA binding by Rrn3. Control experiments demonstrated that these mutant Rrn3 constructs were capable of interacting with both rpa43 and SL1, two other activities demonstrated to be essential for Rrn3 function. However, neither of these Rrn3 mutants was capable of functioning in transcription in vitro. Moreover, although wild-type human Rrn3 complemented a yeast rrn3-ts mutant, the DNA-binding site mutant did not. These results demonstrate that DNA binding by Rrn3 is essential for transcription by RNA polymerase I.

DNA Binding by the Ribosomal DNA Transcription Factor Rrn3 Is Essential for Ribosomal DNA Transcription*

PubMed Central

Stepanchick, Ann; Zhi, Huijun; Cavanaugh, Alice H.; Rothblum, Katrina; Schneider, David A.; Rothblum, Lawrence I.

2013-01-01

The human homologue of yeast Rrn3 is an RNA polymerase I-associated transcription factor that is essential for ribosomal DNA (rDNA) transcription. The generally accepted model is that Rrn3 functions as a bridge between RNA polymerase I and the transcription factors bound to the committed template. In this model Rrn3 would mediate an interaction between the mammalian Rrn3-polymerase I complex and SL1, the rDNA transcription factor that binds to the core promoter element of the rDNA. In the course of studying the role of Rrn3 in recruitment, we found that Rrn3 was in fact a DNA-binding protein. Analysis of the sequence of Rrn3 identified a domain with sequence similarity to the DNA binding domain of heat shock transcription factor 2. Randomization, or deletion, of the amino acids in this region in Rrn3, amino acids 382–400, abrogated its ability to bind DNA, indicating that this domain was an important contributor to DNA binding by Rrn3. Control experiments demonstrated that these mutant Rrn3 constructs were capable of interacting with both rpa43 and SL1, two other activities demonstrated to be essential for Rrn3 function. However, neither of these Rrn3 mutants was capable of functioning in transcription in vitro. Moreover, although wild-type human Rrn3 complemented a yeast rrn3-ts mutant, the DNA-binding site mutant did not. These results demonstrate that DNA binding by Rrn3 is essential for transcription by RNA polymerase I. PMID:23393135

DNA-aptamers binding aminoglycoside antibiotics.

PubMed

Nikolaus, Nadia; Strehlitz, Beate

2014-02-21

Aptamers are short, single stranded DNA or RNA oligonucleotides that are able to bind specifically and with high affinity to their non-nucleic acid target molecules. This binding reaction enables their application as biorecognition elements in biosensors and assays. As antibiotic residues pose a problem contributing to the emergence of antibiotic-resistant pathogens and thereby reducing the effectiveness of the drug to fight human infections, we selected aptamers targeted against the aminoglycoside antibiotic kanamycin A with the aim of constructing a robust and functional assay that can be used for water analysis. With this work we show that aptamers that were derived from a Capture-SELEX procedure targeting against kanamycin A also display binding to related aminoglycoside antibiotics. The binding patterns differ among all tested aptamers so that there are highly substance specific aptamers and more group specific aptamers binding to a different variety of aminoglycoside antibiotics. Also the region of the aminoglycoside antibiotics responsible for aptamer binding can be estimated. Affinities of the different aptamers for their target substance, kanamycin A, are measured with different approaches and are in the micromolar range. Finally, the proof of principle of an assay for detection of kanamycin A in a real water sample is given.

Cytotoxicity and DNA cleavage with core-shell nanocomposites functionalized by a KH domain DNA binding peptide

NASA Astrophysics Data System (ADS)

Bazak, Remon; Ressl, Jan; Raha, Sumita; Doty, Caroline; Liu, William; Wanzer, Beau; Salam, Seddik Abdel; Elwany, Samy; Paunesku, Tatjana; Woloschak, Gayle E.

2013-11-01

A nanoconjugate was composed of metal oxide nanoparticles decorated with peptides and fluorescent dye and tested for DNA cleavage following UV light activation. The peptide design was based on a DNA binding domain, the so called KH domain of the hnRNPK protein. This ``KH peptide'' enabled cellular uptake of nanoconjugates and their entry into cell nuclei. The control nanoconjugate carried no peptide; it consisted only of the metal oxide nanoparticle prepared as Fe3O4@TiO2 nanocomposite and the fluorescent dye alizarin red S. These components of either construct are responsible for nanoconjugate activation by UV light and the resultant production of reactive oxygen species (ROS). Production of ROS at different subcellular locations causes damage to different components of cells: only nanoconjugates inside cell nuclei can be expected to cause DNA cleavage. Degradation of cellular DNA with KH peptide decorated nanoconjugates exceeded the DNA damage obtained from control, no-peptide nanoconjugate counterparts. Moreover, caspase activation and cell death were more extensive in the same cells.A nanoconjugate was composed of metal oxide nanoparticles decorated with peptides and fluorescent dye and tested for DNA cleavage following UV light activation. The peptide design was based on a DNA binding domain, the so called KH domain of the hnRNPK protein. This ``KH peptide'' enabled cellular uptake of nanoconjugates and their entry into cell nuclei. The control nanoconjugate carried no peptide; it consisted only of the metal oxide nanoparticle prepared as Fe3O4@TiO2 nanocomposite and the fluorescent dye alizarin red S. These components of either construct are responsible for nanoconjugate activation by UV light and the resultant production of reactive oxygen species (ROS). Production of ROS at different subcellular locations causes damage to different components of cells: only nanoconjugates inside cell nuclei can be expected to cause DNA cleavage. Degradation of cellular DNA with KH peptide decorated nanoconjugates exceeded the DNA damage obtained from control, no-peptide nanoconjugate counterparts. Moreover, caspase activation and cell death were more extensive in the same cells. Electronic supplementary information (ESI) available: http://janus.northwestern.edu/wololab/auxiliary/supplementary_data_2013.docx. See DOI: 10.1039/c3nr02203j

DNA Recognition by a σ 54 Transcriptional Activator from Aquifex aeolicus

DOE PAGES

Vidangos, Natasha K.; Heideker, Johanna; Lyubimov, Artem; ...

2014-08-23

Transcription initiation by bacterial σ 54-polymerase requires the action of a transcriptional activator protein. Activators bind sequence-specifically upstream of the transcription initiation site via a DNA-binding domain. The structurally characterized DNA-binding domains from activators all belong to the Factor for Inversion Stimulation (Fis) family of helix-turn-helix DNA-binding proteins. We report here structures of the free and DNA-bound forms of the DNA-binding domain of NtrC4 (4DBD) from Aquifex aeolicus, a member of the NtrC family of σ 54 activators. Two NtrC4 binding sites were identified upstream (-145 and -85 base pairs) from the start of the lpxC gene, which is responsiblemore » for the first committed step in Lipid A biosynthesis. This is the first experimental evidence for σ 54 regulation in lpxC expression. 4DBD was crystallized both without DNA and in complex with the -145 binding site. The structures, together with biochemical data, indicate that NtrC4 binds to DNA in a manner that is similar to that of its close homologue, Fis. Ultimately, the greater sequence specificity for the binding of 4DBD relative to Fis seems to arise from a larger number of base specific contacts contributing to affinity than for Fis.« less

A Colorimetric Microplate Assay for DNA-Binding Activity of His-Tagged MutS Protein.

PubMed

Banasik, Michał; Sachadyn, Paweł

2016-09-01

A simple microplate method was designed for rapid testing DNA-binding activity of proteins. The principle of the assay involves binding of tested DNA by his-tagged protein immobilized on a nickel-coated ELISA plate, following colorimetric detection of biotinylated DNA with avidin conjugated to horseradish peroxidase. The method was used to compare DNA mismatch binding activities of MutS proteins from three bacterial species. The assay required relatively low amounts of tested protein (approximately 0.5-10 pmol) and DNA (0.1-10 pmol) and a relatively short time of analysis (up to 60 min). The method is very simple to apply and convenient to test different buffer conditions of DNA-protein binding. Sensitive colorimetric detection enables naked eye observations and quantitation with an ELISA reader. The performance of the assay, which we believe is a distinguishing trait of the method, is based on two strong and specific molecular interactions: binding of a his-tagged protein to a nickel-coated microplate and binding of biotinylated DNA to avidin. In the reported experiments, the solution was used to optimize the conditions for DNA mismatch binding by MutS protein; however, the approach could be implemented to test nucleic acids interactions with any protein of interest.

Structure and Function of Lipopolysaccharide Binding Protein

NASA Astrophysics Data System (ADS)

Schumann, Ralf R.; Leong, Steven R.; Flaggs, Gail W.; Gray, Patrick W.; Wright, Samuel D.; Mathison, John C.; Tobias, Peter S.; Ulevitch, Richard J.

1990-09-01

The primary structure of lipopolysaccharide binding protein (LBP), a trace plasma protein that binds to the lipid A moiety of bacterial lipopolysaccharides (LPSs), was deduced by sequencing cloned complementary DNA. LBP shares sequence identity with another LPS binding protein found in granulocytes, bactericidal/permeability-increasing protein, and with cholesterol ester transport protein of the plasma. LBP may control the response to LPS under physiologic conditions by forming high-affinity complexes with LPS that bind to monocytes and macrophages, which then secrete tumor necrosis factor. The identification of this pathway for LPS-induced monocyte stimulation may aid in the development of treatments for diseases in which Gram-negative sepsis or endotoxemia are involved.

Structural Determinants of DNA Binding by a P. falciparum ApiAP2 Transcriptional Regulator

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lindner, Scott E.; De Silva, Erandi K.; Keck, James L.

2010-11-05

Putative transcription factors have only recently been identified in the Plasmodium spp., with the major family of regulators comprising the Apicomplexan Apetala2 (AP2) proteins. To better understand the DNA-binding mechanisms of these transcriptional regulators, we characterized the structure and in vitro function of an AP2 DNA-binding domain from a prototypical Apicomplexan AP2 protein, PF14{_}0633 from Plasmodium falciparum. The X-ray crystal structure of the PF14{_}0633 AP2 domain bound to DNA reveals a {beta}-sheet fold that binds the DNA major groove through base-specific and backbone contacts; a prominent {alpha}-helix supports the {beta}-sheet structure. Substitution of predicted DNA-binding residues with alanine weakened ormore » eliminated DNA binding in solution. In contrast to plant AP2 domains, the PF14{_}0633 AP2 domain dimerizes upon binding to DNA through a domain-swapping mechanism in which the {alpha}-helices of the AP2 domains pack against the {beta}-sheets of the dimer mates. DNA-induced dimerization of PF14{_}0633 may be important for tethering two distal DNA loci together in the nucleus and/or for inducing functional rearrangements of its domains to facilitate transcriptional regulation. Consistent with a multisite binding mode, at least two copies of the consensus sequence recognized by PF14{_}0633 are present upstream of a previously identified group of sporozoite-stage genes. Taken together, these findings illustrate how Plasmodium has adapted the AP2 DNA-binding domain for genome-wide transcriptional regulation.« less

Structure and Biochemical Activities of Escherichia coli MgsA

DOE Office of Scientific and Technical Information (OSTI.GOV)

Page, Asher N.; George, Nicholas P.; Marceau, Aimee H.

2012-02-27

Bacterial 'maintenance of genome stability protein A' (MgsA) and related eukaryotic enzymes play important roles in cellular responses to stalled DNA replication processes. Sequence information identifies MgsA enzymes as members of the clamp loader clade of AAA{sup +} proteins, but structural information defining the family has been limited. Here, the x-ray crystal structure of Escherichia coli MgsA is described, revealing a homotetrameric arrangement for the protein that distinguishes it from other clamp loader clade AAA{sup +} proteins. Each MgsA protomer is composed of three elements as follows: ATP-binding and helical lid domains (conserved among AAA{sup +} proteins) and a tetramerizationmore » domain. Although the tetramerization domains bury the greatest amount of surface area in the MgsA oligomer, each of the domains participates in oligomerization to form a highly intertwined quaternary structure. Phosphate is bound at each AAA{sup +} ATP-binding site, but the active sites do not appear to be in a catalytically competent conformation due to displacement of Arg finger residues. E. coli MgsA is also shown to form a complex with the single-stranded DNA-binding protein through co-purification and biochemical studies. MgsA DNA-dependent ATPase activity is inhibited by single-stranded DNA-binding protein. Together, these structural and biochemical observations provide insights into the mechanisms of MgsA family AAA{sup +} proteins.« less

Isolation and Characterization of a Sex-Specific Lectin in a Marine Red Alga, Aglaothamnion oosumiense Itono

PubMed Central

Han, Jong Won; Klochkova, Tatyana A.; Shim, Jun Bo; Yoon, Kangsup

2012-01-01

In red algae, spermatial binding to female trichogynes is mediated by a lectin-carbohydrate complementary system. Aglaothamnion oosumiense is a microscopic filamentous red alga. The gamete recognition and binding occur at the surface of the hairlike trichogyne on the female carpogonium. Male spermatia are nonmotile. Previous studies suggested the presence of a lectin responsible for gamete recognition on the surface of female trychogynes. A novel N-acetyl-d-galactosamine-specific protein was isolated from female plants of A. oosumiense by affinity chromatography and named AOL1. The lectin was monomeric and did not agglutinate horse blood or human erythrocytes. The N-terminal amino acid sequence of the protein was analyzed, and degenerate primers were designed. A full-length cDNA encoding the lectin was obtained using rapid amplification of cDNA ends-PCR (RACE-PCR). The cDNA was 1,095 bp in length and coded for a protein of 259 amino acids with a deduced molecular mass of 21.4 kDa, which agreed well with the protein data. PCR analysis using genomic DNA showed that both male and female plants have this gene. However, Northern blotting and two-dimensional electrophoresis showed that this protein was expressed 12 to 15 times more in female plants. The lectin inhibited spermatial binding to the trichogynes when preincubated with spermatia, suggesting its involvement in gamete binding. PMID:22865077

Structural insights into the cTAR DNA recognition by the HIV-1 nucleocapsid protein: role of sugar deoxyriboses in the binding polarity of NC

PubMed Central

Bazzi, Ali; Zargarian, Loussiné; Chaminade, Françoise; Boudier, Christian; De Rocquigny, Hughes; René, Brigitte; Mély, Yves; Fossé, Philippe; Mauffret, Olivier

2011-01-01

An essential step of the reverse transcription of the HIV-1 genome is the first strand transfer that requires the annealing of the TAR RNA hairpin to the cTAR DNA hairpin. HIV-1 nucleocapsid protein (NC) plays a crucial role by facilitating annealing of the complementary hairpins. Using nuclear magnetic resonance and gel retardation assays, we investigated the interaction between NC and the top half of the cTAR DNA (mini-cTAR). We show that NC(11-55) binds the TGG sequence in the lower stem that is destabilized by the adjacent internal loop. The 5′ thymine interacts with residues of the N-terminal zinc knuckle and the 3′ guanine is inserted in the hydrophobic plateau of the C-terminal zinc knuckle. The TGG sequence is preferred relative to the apical and internal loops containing unpaired guanines. Investigation of the DNA–protein contacts shows the major role of hydrophobic interactions involving nucleobases and deoxyribose sugars. A similar network of hydrophobic contacts is observed in the published NC:DNA complexes, whereas NC contacts ribose differently in NC:RNA complexes. We propose that the binding polarity of NC is related to these contacts that could be responsible for the preferential binding to single-stranded nucleic acids. PMID:21227929

Structure and Biochemical Activities of Escherichia coli MgsA*♦

PubMed Central

Page, Asher N.; George, Nicholas P.; Marceau, Aimee H.; Cox, Michael M.; Keck, James L.

2011-01-01

Bacterial “maintenance of genome stability protein A” (MgsA) and related eukaryotic enzymes play important roles in cellular responses to stalled DNA replication processes. Sequence information identifies MgsA enzymes as members of the clamp loader clade of AAA+ proteins, but structural information defining the family has been limited. Here, the x-ray crystal structure of Escherichia coli MgsA is described, revealing a homotetrameric arrangement for the protein that distinguishes it from other clamp loader clade AAA+ proteins. Each MgsA protomer is composed of three elements as follows: ATP-binding and helical lid domains (conserved among AAA+ proteins) and a tetramerization domain. Although the tetramerization domains bury the greatest amount of surface area in the MgsA oligomer, each of the domains participates in oligomerization to form a highly intertwined quaternary structure. Phosphate is bound at each AAA+ ATP-binding site, but the active sites do not appear to be in a catalytically competent conformation due to displacement of Arg finger residues. E. coli MgsA is also shown to form a complex with the single-stranded DNA-binding protein through co-purification and biochemical studies. MgsA DNA-dependent ATPase activity is inhibited by single-stranded DNA-binding protein. Together, these structural and biochemical observations provide insights into the mechanisms of MgsA family AAA+ proteins. PMID:21297161

Cr(3+) Binding to DNA Backbone Phosphate and Bases: Slow Ligand Exchange Rates and Metal Hydrolysis.

PubMed

Zhou, Wenhu; Yu, Tianmeng; Vazin, Mahsa; Ding, Jinsong; Liu, Juewen

2016-08-15

The interaction between chromium ions and DNA is of great interest in inorganic chemistry, toxicology, and analytical chemistry. Most previous studies focused on in situ reduction of Cr(VI), producing Cr(3+) for DNA binding. Recently, Cr(3+) was reported to activate the Ce13d DNAzyme for RNA cleavage. Herein, the Ce13d is used to study two types of Cr(3+) and DNA interactions. First, Cr(3+) binds to the DNA phosphate backbone weakly through reversible electrostatic interactions, which is weakened by adding competing inorganic phosphate. However, Cr(3+) coordinates with DNA nucleobases forming stable cross-links that can survive denaturing gel electrophoresis condition. The binding of Cr(3+) to different nucleobases was further studied in terms of binding kinetics and affinity by exploiting carboxyfluorescein-labeled DNA homopolymers. Once binding takes place, the stable Cr(3+)/DNA complex cannot be dissociated by EDTA, attributable to the ultraslow ligand exchange rate of Cr(3+). The binding rate follows the order of G > C > T ≈ A. Finally, Cr(3+) gradually loses its DNA binding ability after being stored at neutral or high pH, attributable to hydrolysis. This hydrolysis can be reversed by lowering the pH. This work provides a deeper insight into the bioinorganic chemistry of Cr(3+) coordination with DNA, clarifies some inconsistency in the previous literature, and offers practically useful information for generating reproducible results.

A mammary cell-specific enhancer in mouse mammary tumor virus DNA is composed of multiple regulatory elements including binding sites for CTF/NFI and a novel transcription factor, mammary cell-activating factor.

PubMed Central

Mink, S; Härtig, E; Jennewein, P; Doppler, W; Cato, A C

1992-01-01

Mouse mammary tumor virus (MMTV) is a milk-transmitted retrovirus involved in the neoplastic transformation of mouse mammary gland cells. The expression of this virus is regulated by mammary cell type-specific factors, steroid hormones, and polypeptide growth factors. Sequences for mammary cell-specific expression are located in an enhancer element in the extreme 5' end of the long terminal repeat region of this virus. This enhancer, when cloned in front of the herpes simplex thymidine kinase promoter, endows the promoter with mammary cell-specific response. Using functional and DNA-protein-binding studies with constructs mutated in the MMTV long terminal repeat enhancer, we have identified two main regulatory elements necessary for the mammary cell-specific response. These elements consist of binding sites for a transcription factor in the family of CTF/NFI proteins and the transcription factor mammary cell-activating factor (MAF) that recognizes the sequence G Pu Pu G C/G A A G G/T. Combinations of CTF/NFI- and MAF-binding sites or multiple copies of either one of these binding sites but not solitary binding sites mediate mammary cell-specific expression. The functional activities of these two regulatory elements are enhanced by another factor that binds to the core sequence ACAAAG. Interdigitated binding sites for CTF/NFI, MAF, and/or the ACAAAG factor are also found in the 5' upstream regions of genes encoding whey milk proteins from different species. These findings suggest that mammary cell-specific regulation is achieved by a concerted action of factors binding to multiple regulatory sites. Images PMID:1328867

Anti-nucleosome antibodies complexed to nucleosomal antigens show anti-DNA reactivity and bind to rat glomerular basement membrane in vivo.

PubMed Central

Kramers, C; Hylkema, M N; van Bruggen, M C; van de Lagemaat, R; Dijkman, H B; Assmann, K J; Smeenk, R J; Berden, J H

1994-01-01

Histones can mediate the binding of DNA and anti-DNA to the glomerular basement membrane (GBM). In ELISA histone/DNA/anti-DNA complexes are able to bind to heparan sulfate (HS), an intrinsic constituent of the GBM. We questioned whether histone containing immune complexes are able to bind to the GBM, and if so, whether the ligand in the GBM is HS. Monoclonal antibodies (mAbs) complexed to nucleosomal antigens and noncomplexed mAbs were isolated from culture supernatants of four IgG anti-nuclear mAbs. All noncomplexed mAbs showed strong anti-nucleosome reactivity in ELISA. One of them showed in addition anti-DNA reactivity in noncomplexed form. The other three mAbs only showed anti-DNA reactivity when they were complexed to nucleosomal antigens. After renal perfusion a fine granular binding of complexed mAbs to the glomerular capillary wall and activation of complement was observed in immunofluorescence, whereas noncomplexed mAbs did not bind. Immuno-electron microscopy showed binding of complexes to the whole width of the GBM. When HS in the GBM was removed by renal heparinase perfusion the binding of complexed mAb decreased, but did not disappear completely. We conclude that anti-nucleosome mAbs, which do not bind DNA, become DNA reactive once complexed to nucleosomal antigens. These complexed mAbs can bind to the GBM. The binding ligand in the GBM is partly, but not solely, HS. Binding to the GBM of immune complexes containing nucleosomal material might be an important event in the pathogenesis of lupus nephritis. Images PMID:8040312

Non-B-DNA structures on the interferon-beta promoter?

PubMed

Robbe, K; Bonnefoy, E

1998-01-01

The high mobility group (HMG) I protein intervenes as an essential factor during the virus induced expression of the interferon-beta (IFN-beta) gene. It is a non-histone chromatine associated protein that has the dual capacity of binding to a non-B-DNA structure such as cruciform-DNA as well as to AT rich B-DNA sequences. In this work we compare the binding affinity of HMGI for a synthetic cruciform-DNA to its binding affinity for the HMGI-binding-site present in the positive regulatory domain II (PRDII) of the IFN-beta promoter. Using gel retardation experiments, we show that HMGI protein binds with at least ten times more affinity to the synthetic cruciform-DNA structure than to the PRDII B-DNA sequence. DNA hairpin sequences are present in both the human and the murine PRDII-DNAs. We discuss in this work the presence of, yet putative, non-B-DNA structures in the IFN-beta promoter.

Enantioselective binding of L, D-phenylalanine to ct DNA

NASA Astrophysics Data System (ADS)

Zhang, Lijin; Xu, Jianhua; Huang, Yan; Min, Shungeng

2009-10-01

The enantioselective binding of L, D-phenylalanine to calf thymus DNA was studied by absorption, circular dichroism, fluorescence quenching, viscosity, salt effect and emission experiments. The results obtained from absorption, circular dichroism, fluorescence quenching and viscosity experiments excluded the intercalative binding and salt effect experiments did not support electrostatic binding. So the binding of L, D-phenylalanine to ct DNA should be groove binding. Furthermore, the emission spectra revealed that the binding is enantioselective.

Enantioselective binding of L,D-phenylalanine to ct DNA.

PubMed

Zhang, Lijin; Xu, Jianhua; Huang, Yan; Min, Shungeng

2009-10-15

The enantioselective binding of L,D-phenylalanine to calf thymus DNA was studied by absorption, circular dichroism, fluorescence quenching, viscosity, salt effect and emission experiments. The results obtained from absorption, circular dichroism, fluorescence quenching and viscosity experiments excluded the intercalative binding and salt effect experiments did not support electrostatic binding. So the binding of l,d-phenylalanine to ct DNA should be groove binding. Furthermore, the emission spectra revealed that the binding is enantioselective.

The λ Integrase Site-specific Recombination Pathway

PubMed Central

LANDY, ARTHUR

2017-01-01

The site-specific recombinase encoded by bacteriophage λ (Int) is responsible for integrating and excising the viral chromosome into and out of the chromosome of its Escherichia coli host. Int carries out a reaction that is highly directional, tightly regulated, and depends upon an ensemble of accessory DNA bending proteins acting on 240 bp of DNA encoding 16 protein binding sites. This additional complexity enables two pathways, integrative and excisive recombination, whose opposite, and effectively irreversible, directions are dictated by different physiological and environmental signals. Int recombinase is a heterobivalent DNA binding protein and each of the four Int protomers, within a multiprotein 400 kDa recombinogenic complex, is thought to bind and, with the aid of DNA bending proteins, bridge one arm- and one core-type DNA site. In the 12 years since the publication of the last review focused solely on the λ site-specific recombination pathway in Mobile DNA II, there has been a great deal of progress in elucidating the molecular details of this pathway. The most dramatic advances in our understanding of the reaction have been in the area of X-ray crystallography where protein-DNA structures have now been determined for of all of the DNA-protein interfaces driving the Int pathway. Building on this foundation of structures, it has been possible to derive models for the assembly of components that determine the regulatory apparatus in the P-arm, and for the overall architectures that define excisive and integrative recombinogenic complexes. The most fundamental additional mechanistic insights derive from the application of hexapeptide inhibitors and single molecule kinetics. PMID:26104711

Titration of DnaA protein by oriC DnaA-boxes increases dnaA gene expression in Escherichia coli.

PubMed Central

Hansen, F G; Koefoed, S; Sørensen, L; Atlung, T

1987-01-01

Binding of the DnaA protein to its binding sites, the DnaA-boxes (TTATCCACA), was measured by a simple physiological approach. The presence of extra DnaA-boxes in growing cells leads to a derepression of dnaA gene expression, measured as beta-galactosidase activity of a dnaA-lacZ fusion polypeptide. Different DnaA-boxes caused different degrees of derepression indicating that the DnaA protein requires sequences in addition to the DnaA-box for efficient binding. The DnaA-boxes in oriC might act cooperatively in binding of the DnaA protein. The derepressed levels of DnaA protein obtained in a strain carrying an oriC+-pBR322 chimera were very high and sufficient to activate oriC on the chimeric plasmid, which was maintained at a copy number more than three times that of pBR322. PMID:3034578

An ancient protein-DNA interaction underlying metazoan sex determination.

PubMed

Murphy, Mark W; Lee, John K; Rojo, Sandra; Gearhart, Micah D; Kurahashi, Kayo; Banerjee, Surajit; Loeuille, Guy-André; Bashamboo, Anu; McElreavey, Kenneth; Zarkower, David; Aihara, Hideki; Bardwell, Vivian J

2015-06-01

DMRT transcription factors are deeply conserved regulators of metazoan sexual development. They share the DM DNA-binding domain, a unique intertwined double zinc-binding module followed by a C-terminal recognition helix, which binds a pseudopalindromic target DNA. Here we show that DMRT proteins use a unique binding interaction, inserting two adjacent antiparallel recognition helices into a widened DNA major groove to make base-specific contacts. Versatility in how specific base contacts are made allows human DMRT1 to use multiple DNA binding modes (tetramer, trimer and dimer). Chromatin immunoprecipitation with exonuclease treatment (ChIP-exo) indicates that multiple DNA binding modes also are used in vivo. We show that mutations affecting residues crucial for DNA recognition are associated with an intersex phenotype in flies and with male-to-female sex reversal in humans. Our results illuminate an ancient molecular interaction underlying much of metazoan sexual development.

An ancient protein-DNA interaction underlying metazoan sex determination

DOE PAGES

Murphy, Mark W.; Lee, John K.; Rojo, Sandra; ...

2015-05-25

DMRT transcription factors are deeply conserved regulators of metazoan sexual development. They share the DM DNA-binding domain, a unique intertwined double zinc-binding module followed by a C-terminal recognition helix, which binds a pseudopalindromic target DNA. In this paper, we show that DMRT proteins use a unique binding interaction, inserting two adjacent antiparallel recognition helices into a widened DNA major groove to make base-specific contacts. Versatility in how specific base contacts are made allows human DMRT1 to use multiple DNA binding modes (tetramer, trimer and dimer). Chromatin immunoprecipitation with exonuclease treatment (ChIP-exo) indicates that multiple DNA binding modes also are usedmore » in vivo. We show that mutations affecting residues crucial for DNA recognition are associated with an intersex phenotype in flies and with male-to-female sex reversal in humans. Finally, our results illuminate an ancient molecular interaction underlying much of metazoan sexual development.« less

An ancient protein-DNA interaction underlying metazoan sex determination

DOE Office of Scientific and Technical Information (OSTI.GOV)

Murphy, Mark W.; Lee, John K.; Rojo, Sandra

DMRT transcription factors are deeply conserved regulators of metazoan sexual development. They share the DM DNA-binding domain, a unique intertwined double zinc-binding module followed by a C-terminal recognition helix, which binds a pseudopalindromic target DNA. In this paper, we show that DMRT proteins use a unique binding interaction, inserting two adjacent antiparallel recognition helices into a widened DNA major groove to make base-specific contacts. Versatility in how specific base contacts are made allows human DMRT1 to use multiple DNA binding modes (tetramer, trimer and dimer). Chromatin immunoprecipitation with exonuclease treatment (ChIP-exo) indicates that multiple DNA binding modes also are usedmore » in vivo. We show that mutations affecting residues crucial for DNA recognition are associated with an intersex phenotype in flies and with male-to-female sex reversal in humans. Finally, our results illuminate an ancient molecular interaction underlying much of metazoan sexual development.« less

Chimeric proteins for detection and quantitation of DNA mutations, DNA sequence variations, DNA damage and DNA mismatches

DOEpatents

McCutchen-Maloney, Sandra L.

2002-01-01

Chimeric proteins having both DNA mutation binding activity and nuclease activity are synthesized by recombinant technology. The proteins are of the general formula A-L-B and B-L-A where A is a peptide having DNA mutation binding activity, L is a linker and B is a peptide having nuclease activity. The chimeric proteins are useful for detection and identification of DNA sequence variations including DNA mutations (including DNA damage and mismatches) by binding to the DNA mutation and cutting the DNA once the DNA mutation is detected.

Paramagnetic decoration of DNA origami nanostructures by Eu³⁺ coordination.

PubMed

Opherden, Lars; Oertel, Jana; Barkleit, Astrid; Fahmy, Karim; Keller, Adrian

2014-07-15

The folding of DNA into arbitrary two- and three-dimensional shapes, called DNA origami, represents a powerful tool for the synthesis of functional nanostructures. Here, we present the first approach toward the paramagnetic functionalization of DNA origami nanostructures by utilizing postassembly coordination with Eu(3+) ions. In contrast to the usual formation of toroidal dsDNA condensates in the presence of trivalent cations, planar as well as rod-like DNA origami maintain their shape and monomeric state even under high loading with the trivalent lanthanide. Europium coordination was demonstrated by the change in Eu(3+) luminescence upon binding to the two DNA origami. Their natural circular dichroism in the Mg(2+)- and Eu(3+)-bound state was found to be very similar to that of genomic DNA, evidencing little influence of the DNA origami superstructure on the local chirality of the stacked base pairs. In contrast, the magnetic circular dichroism of the Mg(2+)-bound DNA origami deviates from that of genomic DNA. Furthermore, the lanthanide affects the magnetic properties of DNA in a superstructure-dependent fashion, indicative of the existence of superstructure-specific geometry of Eu(3+) binding sites in the DNA origami that are not formed in genomic DNA. This simple approach lays the foundation for the generation of magneto-responsive DNA origami nanostructures. Such systems do not require covalent modifications and can be used for the magnetic manipulation of DNA nanostructures or for the paramagnetic alignment of molecules in NMR spectroscopy.

DNA Damage Signaling Is Induced in the Absence of Epstein-Barr Virus (EBV) Lytic DNA Replication and in Response to Expression of ZEBRA.

PubMed

Wang'ondu, Ruth; Teal, Stuart; Park, Richard; Heston, Lee; Delecluse, Henri; Miller, George

2015-01-01

Epstein Barr virus (EBV), like other oncogenic viruses, modulates the activity of cellular DNA damage responses (DDR) during its life cycle. Our aim was to characterize the role of early lytic proteins and viral lytic DNA replication in activation of DNA damage signaling during the EBV lytic cycle. Our data challenge the prevalent hypothesis that activation of DDR pathways during the EBV lytic cycle occurs solely in response to large amounts of exogenous double stranded DNA products generated during lytic viral DNA replication. In immunofluorescence or immunoblot assays, DDR activation markers, specifically phosphorylated ATM (pATM), H2AX (γH2AX), or 53BP1 (p53BP1), were induced in the presence or absence of viral DNA amplification or replication compartments during the EBV lytic cycle. In assays with an ATM inhibitor and DNA damaging reagents in Burkitt lymphoma cell lines, γH2AX induction was necessary for optimal expression of early EBV genes, but not sufficient for lytic reactivation. Studies in lytically reactivated EBV-positive cells in which early EBV proteins, BGLF4, BGLF5, or BALF2, were not expressed showed that these proteins were not necessary for DDR activation during the EBV lytic cycle. Expression of ZEBRA, a viral protein that is necessary for EBV entry into the lytic phase, induced pATM foci and γH2AX independent of other EBV gene products. ZEBRA mutants deficient in DNA binding, Z(R183E) and Z(S186E), did not induce foci of pATM. ZEBRA co-localized with HP1β, a heterochromatin associated protein involved in DNA damage signaling. We propose a model of DDR activation during the EBV lytic cycle in which ZEBRA induces ATM kinase phosphorylation, in a DNA binding dependent manner, to modulate gene expression. ATM and H2AX phosphorylation induced prior to EBV replication may be critical for creating a microenvironment of viral and cellular gene expression that enables lytic cycle progression.

Activation of cGAS-dependent antiviral responses by DNA intercalating agents

PubMed Central

Pépin, Geneviève; Nejad, Charlotte; Thomas, Belinda J.; Ferrand, Jonathan; McArthur, Kate; Bardin, Philip G.; Williams, Bryan R.G.; Gantier, Michael P.

2017-01-01

Acridine dyes, including proflavine and acriflavine, were commonly used as antiseptics before the advent of penicillins in the mid-1940s. While their mode of action on pathogens was originally attributed to their DNA intercalating activity, work in the early 1970s suggested involvement of the host immune responses, characterized by induction of interferon (IFN)-like activities through an unknown mechanism. We demonstrate here that sub-toxic concentrations of a mixture of acriflavine and proflavine instigate a cyclic-GMP-AMP (cGAMP) synthase (cGAS)-dependent type-I IFN antiviral response. This pertains to the capacity of these compounds to induce low level DNA damage and cytoplasmic DNA leakage, resulting in cGAS-dependent cGAMP-like activity. Critically, acriflavine:proflavine pre-treatment of human primary bronchial epithelial cells significantly reduced rhinovirus infection. Collectively, our findings constitute the first evidence that non-toxic DNA binding agents have the capacity to act as indirect agonists of cGAS, to exert potent antiviral effects in mammalian cells. PMID:27694309

DNA Binding Mode Transitions of Escherichia coli HUαβ: Evidence for Formation of a Bent DNA – Protein Complex on Intact, Linear Duplex DNA

PubMed Central

Koh, Junseock; Saecker, Ruth M.; Record, M. Thomas

2008-01-01

Escherichia coli HUαβ, a major nucleoid associated protein (NAP), organizes the DNA chromosome and facilitates numerous DNA transactions. Using isothermal titration calorimetry (ITC), fluorescence resonance energy transfer (FRET) and a series of DNA lengths (8, 15, 34, 38 and 160 base pairs) we establish that HUαβ interacts with duplex DNA using three different nonspecific binding modes. Both the HU to DNA mole ratio ([HU]/[DNA]) and DNA length dictate the dominant HU binding mode. On sufficiently long DNA (≥ 34 base pairs), at low [HU]/[DNA], HU populates a noncooperative 34 bp binding mode with a binding constant of 2.1 (± 0.4) × 106 M−1, and a binding enthalpy of +7.7 (± 0.6) kcal/mol at 15 °C and 0.15 M Na+. With increasing [HU]/[DNA], HU bound in the noncooperative 34 bp mode progressively converts to two cooperative (ω ~ 20) modes with site sizes of 10 bp and 6 bp. These latter modes exhibit smaller binding constants (1.1 (± 0.2) × 105 M−1 for the 10 bp mode, 3.5 (± 1.4) × 104 M−1 for the 6 bp mode) and binding enthalpies (4.2 (± 0.3) kcal/mol for the 10 bp mode, −1.6 (±0.3) kcal/mol for the 6 bp mode). As DNA length increases to 34 bp or more at low [HU]/[DNA], the small modes are replaced by the 34 bp binding mode. FRET data demonstrate that the 34 bp mode bends DNA by 143 ± 6° whereas the 6 and 10 bp modes do not. The model proposed in this study provides a novel quantitative and comprehensive framework for reconciling previous structural and solution studies of HU, including single molecule (force extension measurement, AFM), fluorescence, and electrophoretic gel mobility shift assays. In particular, it explains how HU condenses or extends DNA depending on the relative concentrations of HU and DNA. PMID:18657548

A damaged DNA binding protein 2 mutation disrupting interaction with proliferating-cell nuclear antigen affects DNA repair and confers proliferation advantage.

PubMed

Perucca, Paola; Mocchi, Roberto; Guardamagna, Isabella; Bassi, Elisabetta; Sommatis, Sabrina; Nardo, Tiziana; Prosperi, Ennio; Stivala, Lucia Anna; Cazzalini, Ornella

2018-06-01

In mammalian cells, Nucleotide Excision Repair (NER) plays a role in removing DNA damage induced by UV radiation. In Global Genome-NER subpathway, DDB2 protein forms a complex with DDB1 (UV-DDB), recognizing photolesions. During DNA repair, DDB2 interacts directly with PCNA through a conserved region in N-terminal tail and this interaction is important for DDB2 degradation. In this work, we sought to investigate the role of DDB2-PCNA association in DNA repair and cell proliferation after UV-induced DNA damage. To this end, stable clones expressing DDB2 Wt and DDB2 PCNA- were used. We have found that cells expressing a mutant DDB2 show inefficient photolesions removal, and a concomitant lack of binding to damaged DNA in vitro. Unexpected cellular behaviour after DNA damage, such as UV-resistance, increased cell growth and motility were found in DDB2 PCNA- stable cell clones, in which the most significant defects in cell cycle checkpoint were observed, suggesting a role in the new cellular phenotype. Based on these findings, we propose that DDB2-PCNA interaction may contribute to a correct DNA damage response for maintaining genome integrity. Copyright © 2018 Elsevier B.V. All rights reserved.

Genotoxic effect and antigen binding characteristics of SLE auto-antibodies to peroxynitrite-modified human DNA.

PubMed

Khan, Md Asad; Alam, Khursheed; Mehdi, Syed Hassan; Rizvi, M Moshahid A

2017-12-01

Systemic lupus erythematosus (SLE) is an inflammatory autoimmune disease characterized by auto-antibodies against native deoxyribonucleic acid after modification and is one of the reasons for the development of SLE. Here, we have evaluated the structural perturbations in human placental DNA by peroxynitrite using spectroscopy, thermal denaturation and high-performance liquid chromatography (HPLC). Peroxynitrite is a powerful potent bi-functional oxidative/nitrative agent that is produced both endogenously and exogenously. In experimental animals, the peroxynitrite-modified DNA was found to be highly immunogenic. The induced antibodies showed cross-reactions with different types of DNA and nitrogen bases that were modified with peroxynitrite by inhibition ELISA. The antibody activity was inhibited by approximately 89% with its immunogen as the inhibitor. The antigen-antibodies interaction between induced antibodies with peroxynitrite-modified DNA showed retarded mobility as compared to the native form. Furthermore, significantly increased binding was also observed in SLE autoantibodies with peroxynitrite-modified DNA than native form. Moreover, DNA isolated from lymphocyte of SLE patients revealed significant recognition of anti-peroxynitrite-modified DNA immunoglobulin G (IgG). Our data indicates that DNA modified with peroxynitrite presents unique antigenic determinants that may induce autoantibody response in SLE. Copyright © 2017 Elsevier Inc. All rights reserved.

Extracellular DNA Impedes the Transport of Vancomycin in Staphylococcus epidermidis Biofilms Preexposed to Subinhibitory Concentrations of Vancomycin

PubMed Central

Tseng, Boo Shan; Howlin, Robert P.; Deacon, Jill; Wharton, Julian A.; Thurner, Philipp J.; Gilmore, Brendan F.; Parsek, Matthew R.; Stoodley, Paul

2014-01-01

Staphylococcus epidermidis biofilm formation is responsible for the persistence of orthopedic implant infections. Previous studies have shown that exposure of S. epidermidis biofilms to sub-MICs of antibiotics induced an increased level of biofilm persistence. BODIPY FL-vancomycin (a fluorescent vancomycin conjugate) and confocal microscopy were used to show that the penetration of vancomycin through sub-MIC-vancomycin-treated S. epidermidis biofilms was impeded compared to that of control, untreated biofilms. Further experiments showed an increase in the extracellular DNA (eDNA) concentration in biofilms preexposed to sub-MIC vancomycin, suggesting a potential role for eDNA in the hindrance of vancomycin activity. Exogenously added, S. epidermidis DNA increased the planktonic vancomycin MIC and protected biofilm cells from lethal vancomycin concentrations. Finally, isothermal titration calorimetry (ITC) revealed that the binding constant of DNA and vancomycin was 100-fold higher than the previously reported binding constant of vancomycin and its intended cellular d-Ala-d-Ala peptide target. This study provides an explanation of the eDNA-based mechanism of antibiotic tolerance in sub-MIC-vancomycin-treated S. epidermidis biofilms, which might be an important factor for the persistence of biofilm infections. PMID:25267673

Radiation damage to DNA in DNA-protein complexes.

PubMed

Spotheim-Maurizot, M; Davídková, M

2011-06-03

The most aggressive product of water radiolysis, the hydroxyl (OH) radical, is responsible for the indirect effect of ionizing radiations on DNA in solution and aerobic conditions. According to radiolytic footprinting experiments, the resulting strand breaks and base modifications are inhomogeneously distributed along the DNA molecule irradiated free or bound to ligands (polyamines, thiols, proteins). A Monte-Carlo based model of simulation of the reaction of OH radicals with the macromolecules, called RADACK, allows calculating the relative probability of damage of each nucleotide of DNA irradiated alone or in complexes with proteins. RADACK calculations require the knowledge of the three dimensional structure of DNA and its complexes (determined by X-ray crystallography, NMR spectroscopy or molecular modeling). The confrontation of the calculated values with the results of the radiolytic footprinting experiments together with molecular modeling calculations show that: (1) the extent and location of the lesions are strongly dependent on the structure of DNA, which in turns is modulated by the base sequence and by the binding of proteins and (2) the regions in contact with the protein can be protected against the attack by the hydroxyl radicals via masking of the binding site and by scavenging of the radicals. 2011 Elsevier B.V. All rights reserved.

Glutamate Ligation in the Ni(II)- and Co(II)-Responsive Escherichia coli Transcriptional Regulator, RcnR

DOE Office of Scientific and Technical Information (OSTI.GOV)

Carr, Carolyn E.; Musiani, Francesco; Huang, Hsin-Ting

Escherichia coli RcnR (resistance to cobalt and nickel regulator, EcRcnR) is a metal-responsive repressor of the genes encoding the Ni(II) and Co(II) exporter proteins RcnAB by binding to PRcnAB. The DNA binding affinity is weakened when the cognate ions Ni(II) and Co(II) bind to EcRcnR in a six-coordinate site that features a (N/O)5S ligand donor-atom set in distinct sites: while both metal ions are bound by the N terminus, Cys35, and His64, Co(II) is additionally bound by His3. On the other hand, the noncognate Zn(II) and Cu(I) ions feature a lower coordination number, have a solvent-accessible binding site, and coordinatemore » protein ligands that do not include the N-terminal amine. A molecular model of apo-EcRcnR suggested potential roles for Glu34 and Glu63 in binding Ni(II) and Co(II) to EcRcnR. The roles of Glu34 and Glu63 in metal binding, metal selectivity, and function were therefore investigated using a structure/function approach. X-ray absorption spectroscopy was used to assess the structural changes in the Ni(II), Co(II), and Zn(II) binding sites of Glu → Ala and Glu → Cys variants at both positions. The effect of these structural alterations on the regulation of PrcnA by EcRcnR in response to metal binding was explored using LacZ reporter assays. These combined studies indicate that while Glu63 is a ligand for both metal ions, Glu34 is a ligand for Co(II) but possibly not for Ni(II). The Glu34 variants affect the structure of the cognate metal sites, but they have no effect on the transcriptional response. In contrast, the Glu63 variants affect both the structure and transcriptional response, although they do not completely abolish the function of EcRcnR. The structure of the Zn(II) site is not significantly perturbed by any of the glutamic acid variations. The spectroscopic and functional data obtained on the mutants were used to calculate models of the metal-site structures of EcRcnR bound to Ni(II), Co(II), and Zn(II). The results are interpreted in terms of a switch mechanism, in which a subset of the metal-binding ligands is responsible for the allosteric response required for DNA release.« less

Engineering and Application of Zinc Finger Proteins and TALEs for Biomedical Research.

PubMed

Kim, Moon-Soo; Kini, Anu Ganesh

2017-08-01

Engineered DNA-binding domains provide a powerful technology for numerous biomedical studies due to their ability to recognize specific DNA sequences. Zinc fingers (ZF) are one of the most common DNA-binding domains and have been extensively studied for a variety of applications, such as gene regulation, genome engineering and diagnostics. Another novel DNA-binding domain known as a transcriptional activator-like effector (TALE) has been more recently discovered, which has a previously undescribed DNA-binding mode. Due to their modular architecture and flexibility, TALEs have been rapidly developed into artificial gene targeting reagents. Here, we describe the methods used to design these DNA-binding proteins and their key applications in biomedical research.

Spectroscopic and molecular docking studies on the interaction of antiviral drug nevirapine with calf thymus DNA.

PubMed

Moghadam, Neda Hosseinpour; Salehzadeh, Sadegh; Shahabadi, Nahid

2017-09-02

The interaction of calf thymus DNA with nevirapine at physiological pH was studied by using absorption, circular dichroism, viscosity, differential pulse voltammetry, fluorescence techniques, salt effect studies and computational methods. The drug binds to ct-DNA in a groove binding mode, as shown by slight variation in the viscosity of ct-DNA. Furthermore, competitive fluorimetric studies with Hoechst 33258 indicate that nevirapine binds to DNA via groove binding. Moreover, the structure of nevirapine was optimized by DFT calculations and was used for the molecular docking calculations. The molecular docking results suggested that nevirapine prefers to bind on the minor groove of ct-DNA.

STAT3 selectively interacts with Smad3 to antagonize TGF-β signaling

PubMed Central

Wang, Gaohang; Yu, Yi; Sun, Chuang; Liu, Ting; Liang, Tingbo; Zhan, Lixing; Lin, Xia; Feng, Xin-Hua

2015-01-01

Smad and STAT proteins are critical signal transducers and transcription factors in controlling cell growth and tumorigenesis. Here we report that the STAT3 signaling pathway attenuates TGF-β-induced responses through a direct Smad3-STAT3 interplay. Activated STAT3 blunts TGF-β-mediated signaling. Depletion of STAT3 promotes TGF-β-mediated transcriptional and physiological responses, including cell cycle arrest, apoptosis and epithelial-to-mesenchymal transition. STAT3 directly interacts with Smad3 in vivo and in vitro, resulting in attenuation of the Smad3-Smad4 complex formation and suppression of DNA-binding ability of Smad3. The N-terminal region of DNA-binding domain of STAT3 is responsible for the STAT3-Smad3 interaction and also indispensable for STAT3-mediated inhibition of TGF-β signaling. Thus, our finding illustrates a direct crosstalk between the STAT3 and Smad3 signaling pathways that may contribute to tumor development and inflammation. PMID:26616859

A comprehensive approach to ascertain the binding mode of curcumin with DNA

NASA Astrophysics Data System (ADS)

Haris, P.; Mary, Varughese; Aparna, P.; Dileep, K. V.; Sudarsanakumar, C.

2017-03-01

Curcumin is a natural phytochemical from the rhizoma of Curcuma longa, the popular Indian spice that exhibits a wide range of pharmacological properties like antioxidant, anticancer, anti-inflammatory, antitumor, and antiviral activities. In the published literatures we can see different studies and arguments on the interaction of curcumin with DNA. The intercalative binding, groove binding and no binding of curcumin with DNA were reported. In this context, we conducted a detailed study to understand the mechanism of recognition of dimethylsulfoxide-solubilized curcumin by DNA. The interaction of curcumin with calf thymus DNA (ctDNA) was confirmed by agarose gel electrophoresis. The nature of binding and energetics of interaction were studied by Isothermal Titration Calorimetry (ITC), Differential Scanning Calorimetry (DSC), UV-visible, fluorescence and melting temperature (Tm) analysis. The experimental data were compared with molecular modeling studies. Our investigation confirmed that dimethylsulfoxide-solubilized curcumin binds in the minor groove of the ctDNA without causing significant structural alteration to the DNA.

Structural and Thermodynamic Signatures of DNA Recognition by Mycobacterium tuberculosis DnaA

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tsodikov, Oleg V.; Biswas, Tapan

An essential protein, DnaA, binds to 9-bp DNA sites within the origin of replication oriC. These binding events are prerequisite to forming an enigmatic nucleoprotein scaffold that initiates replication. The number, sequences, positions, and orientations of these short DNA sites, or DnaA boxes, within the oriCs of different bacteria vary considerably. To investigate features of DnaA boxes that are important for binding Mycobacterium tuberculosis DnaA (MtDnaA), we have determined the crystal structures of the DNA binding domain (DBD) of MtDnaA bound to a cognate MtDnaA-box (at 2.0 {angstrom} resolution) and to a consensus Escherichia coli DnaA-box (at 2.3 {angstrom}). Thesemore » structures, complemented by calorimetric equilibrium binding studies of MtDnaA DBD in a series of DnaA-box variants, reveal the main determinants of DNA recognition and establish the [T/C][T/A][G/A]TCCACA sequence as a high-affinity MtDnaA-box. Bioinformatic and calorimetric analyses indicate that DnaA-box sequences in mycobacterial oriCs generally differ from the optimal binding sequence. This sequence variation occurs commonly at the first 2 bp, making an in vivo mycobacterial DnaA-box effectively a 7-mer and not a 9-mer. We demonstrate that the decrease in the affinity of these MtDnaA-box variants for MtDnaA DBD relative to that of the highest-affinity box TTGTCCACA is less than 10-fold. The understanding of DnaA-box recognition by MtDnaA and E. coli DnaA enables one to map DnaA-box sequences in the genomes of M. tuberculosis and other eubacteria.« less

Binding Linkage in a Telomere DNA–Protein Complex at the Ends of Oxytricha nova Chromosomes

PubMed Central

Buczek, Pawel; Orr, Rochelle S.; Pyper, Sean R.; Shum, Mili; Ota, Emily Kimmel Irene; Gerum, Shawn E.; Horvath, Martin P.

2005-01-01

Alpha and beta protein subunits of the telomere end binding protein from Oxytricha nova (OnTEBP) combine with telomere single strand DNA to form a protective cap at the ends of chromosomes. We tested how protein–protein interactions seen in the co-crystal structure relate to DNA binding through use of fusion proteins engineered as different combinations of domains and subunits derived from OnTEBP. Joining alpha and beta resulted in a protein that bound single strand telomere DNA with high affinity (KD-DNA=1.4 nM). Another fusion protein, constructed without the C-terminal protein–protein interaction domain of alpha, bound DNA with 200-fold diminished affinity (KD-DNA=290 nM) even though the DNA-binding domains of alpha and beta were joined through a peptide linker. Adding back the alpha C-terminal domain as a separate protein restored high-affinity DNA binding. The binding behaviors of these fusion proteins and the native protein subunits are consistent with cooperative linkage between protein-association and DNA-binding equilibria. Linking DNA–protein stability to protein–protein contacts at a remote site may provide a trigger point for DNA–protein disassembly during telomere replication when the single strand telomere DNA must exchange between a very stable OnTEBP complex and telomerase. PMID:15967465

Structural integration in hypoxia-inducible factors

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wu, Dalei; Potluri, Nalini; Lu, Jingping

The hypoxia-inducible factors (HIFs) coordinate cellular adaptations to low oxygen stress by regulating transcriptional programs in erythropoiesis, angiogenesis and metabolism. These programs promote the growth and progression of many tumours, making HIFs attractive anticancer targets. Transcriptionally active HIFs consist of HIF-alpha and ARNT (also called HIF-1 beta) subunits. Here we describe crystal structures for each of mouse HIF-2 alpha-ARNT and HIF-1 alpha-ARNT heterodimers in states that include bound small molecules and their hypoxia response element. A highly integrated quaternary architecture is shared by HIF-2 alpha-ARNT and HIF-1 alpha-ARNT, wherein ARNT spirals around the outside of each HIF-alpha subunit. Five distinctmore » pockets are observed that permit small-molecule binding, including PAS domain encapsulated sites and an interfacial cavity formed through subunit heterodimerization. The DNA-reading head rotates, extends and cooperates with a distal PAS domain to bind hypoxia response elements. HIF-alpha mutations linked to human cancers map to sensitive sites that establish DNA binding and the stability of PAS domains and pockets.« less

Sequence-dependent response of DNA to torsional stress: a potential biological regulation mechanism.

PubMed

Reymer, Anna; Zakrzewska, Krystyna; Lavery, Richard

2018-02-28

Torsional restraints on DNA change in time and space during the life of the cell and are an integral part of processes such as gene expression, DNA repair and packaging. The mechanical behavior of DNA under torsional stress has been studied on a mesoscopic scale, but little is known concerning its response at the level of individual base pairs and the effects of base pair composition. To answer this question, we have developed a geometrical restraint that can accurately control the total twist of a DNA segment during all-atom molecular dynamics simulations. By applying this restraint to four different DNA oligomers, we are able to show that DNA responds to both under- and overtwisting in a very heterogeneous manner. Certain base pair steps, in specific sequence environments, are able to absorb most of the torsional stress, leaving other steps close to their relaxed conformation. This heterogeneity also affects the local torsional modulus of DNA. These findings suggest that modifying torsional stress on DNA could act as a modulator for protein binding via the heterogeneous changes in local DNA structure.

Sequence-dependent response of DNA to torsional stress: a potential biological regulation mechanism

PubMed Central

Reymer, Anna; Zakrzewska, Krystyna; Lavery, Richard

2018-01-01

Abstract Torsional restraints on DNA change in time and space during the life of the cell and are an integral part of processes such as gene expression, DNA repair and packaging. The mechanical behavior of DNA under torsional stress has been studied on a mesoscopic scale, but little is known concerning its response at the level of individual base pairs and the effects of base pair composition. To answer this question, we have developed a geometrical restraint that can accurately control the total twist of a DNA segment during all-atom molecular dynamics simulations. By applying this restraint to four different DNA oligomers, we are able to show that DNA responds to both under- and overtwisting in a very heterogeneous manner. Certain base pair steps, in specific sequence environments, are able to absorb most of the torsional stress, leaving other steps close to their relaxed conformation. This heterogeneity also affects the local torsional modulus of DNA. These findings suggest that modifying torsional stress on DNA could act as a modulator for protein binding via the heterogeneous changes in local DNA structure. PMID:29267977

A novel pathway to detect and cope with exogenous dsDNA.

PubMed

Kobayashi, Shouhei; Haraguchi, Tokuko

2015-01-01

How a living cell responds to exogenous materials is one of the fundamental questions in the life sciences. In particular, understanding the mechanisms by which a cell recognizes exogenous double-stranded DNA (dsDNA) is important for immunology research because it will facilitate the control of pathogen infections that entail the presence of exogenous dsDNA in the cytoplasm of host cells. Several cytosolic dsDNA sensor proteins that trigger innate immune responses have been identified and the downstream signaling pathways have been investigated. However, the events that occur at the site of exogenous dsDNA when it is exposed to the cytosol of the host cell remain unknown. Using dsDNA-coated polystyrene beads incorporated into living cells, we recently found that barrier-to-autointegration factor (BAF) binds to the exogenous dsDNA immediately after its appearance in the cytosol and plays a role in DNA avoidance of autophagy. Our findings reveal a novel pathway in which BAF plays a key role in the detection of and response to exogenous dsDNA.

The Molecular Origin of the MMR-dependent Apoptosis Pathway from Dynamics Analysis of MutSα-DNA Complexes

PubMed Central

Negureanu, Lacramioara; Salsbury, Freddie R.

2012-01-01

The cellular response to DNA damage signaling by MMR proteins is incompletely understood. It is generally accepted that MMR-dependent apoptosis pathway in response to DNA damage detection is independent of MMR's DNA repair function. In this study we investigate correlated motions in response to the binding of mismatched and PCL DNA fragments by MutSα, as derived from 50 ns molecular dynamics simulations. The protein dynamics in response to the mismatched and damaged DNA recognition suggests that MutSα signals their recognition through independent pathways providing evidence for the molecular origin of the MMR-dependent apoptosis. MSH2 subunit is indicated to play a key role in signaling both mismatched and damaged DNA recognition; localized and collective motions within the protein allow identifying sites on the MSH2 surface possible involved in recruiting proteins responsible for downstream events. Unlike in the mismatch complex, predicted key communication sites specific for the damage recognition are on the list of known cancer causing mutations or deletions. This confirms MSH2's role in signaling DNA-damage induced apoptosis and suggests that defects in MMR alone is sufficient to trigger tumorigenesis, supporting the experimental evidence that MMR-damage response function could protect from the early occurrence of tumors. Identifying these particular communication sites may have implications for the treatment of cancers that are not defective for MMR, but are unable to function optimally for MMR-dependent responses following DNA damage such as the case of resistance to cisplatin. PMID:22712459

Zn(II) stimulation of Fe(II)-activated repression in the iron-dependent repressor from Mycobacterium tuberculosis.

PubMed

Stapleton, Brian; Walker, Lawrence R; Logan, Timothy M

2013-03-19

Thermodynamic measurements of Fe(II) binding and activation of repressor function in the iron-dependent repressor from Mycobacterium tuberculosis (IdeR) are reported. IdeR, a member of the diphtheria toxin repressor family of proteins, regulates iron homeostasis and contributes to the virulence response in M. tuberculosis. Although iron is the physiological ligand, this is the first detailed analysis of iron binding and activation in this protein. The results showed that IdeR binds 2 equiv of Fe(II) with dissociation constants that differ by a factor of 25. The high- and low-affinity iron binding sites were assigned to physical binding sites I and II, respectively, using metal binding site mutants. IdeR was also found to contain a high-affinity Zn(II) binding site that was assigned to physical metal binding site II through the use of binding site mutants and metal competition assays. Fe(II) binding was modestly weaker in the presence of Zn(II), but the coupled metal binding-DNA binding affinity was significantly stronger, requiring 30-fold less Fe(II) to activate DNA binding compared to Fe(II) alone. Together, these results suggest that IdeR is a mixed-metal repressor, where Zn(II) acts as a structural metal and Fe(II) acts to trigger the physiologically relevant promoter binding. This new model for IdeR activation provides a better understanding of IdeR and the biology of iron homeostasis in M. tuberculosis.

Deciphering the groove binding modes of tau-fluvalinate and flumethrin with calf thymus DNA

NASA Astrophysics Data System (ADS)

Tao, Mo; Zhang, Guowen; Pan, Junhui; Xiong, Chunhong

2016-02-01

Tau-fluvalinate (TFL) and flumethrin (FL), widely used in agriculture and a class of synthetic pyrethroid pesticides with a similar structure, may cause a potential security risk. Herein, the modes of binding in vitro of TFL and FL with calf thymus DNA (ctDNA) were characterized by fluorescence, UV-vis absorption, circular dichroism (CD) and Fourier transform infrared (FT-IR) spectroscopy with the aid of viscosity measurements, melting analyses and molecular docking studies. The fluorescence titration indicated that both TFL and FL bound to ctDNA forming complexes through hydrogen bonding and van der Waals forces. The binding constants of TFL and FL with ctDNA were in the range of 104 L mol- 1, and FL exhibited a higher binding propensity than TFL. The iodide quenching effect, single/double-stranded DNA effects, and ctDNA melting and viscosity measurements demonstrated that the binding of both TFL and FL to ctDNA was groove mode. The FT-IR analyses suggested the A-T region of the minor groove of ctDNA as the preferential binding for TFL and FL, which was confirmed by the displacement assays with Hoechst 33258 probe, and the molecular docking visualized the specific binding. The changes in CD spectra indicated that both FL and TFL induced the perturbation on the base stacking and helicity of B-DNA, but the disturbance caused by FL was more obvious. Gel electrophoresis analyses indicated that both TFL and FL did not cause significant DNA cleavage. This study provides novel insights into the binding properties of TFL/FL with ctDNA and its toxic mechanisms.

DNA Supercoiling and the Lrp Protein Determine the Directionality of fim Switch DNA Inversion in Escherichia coli K-12

PubMed Central

Kelly, Arlene; Conway, Colin; Ó Cróinín, Tadhg; Smith, Stephen G. J.; Dorman, Charles J.

2006-01-01

Site-specific recombinases of the integrase family usually require cofactors to impart directionality in the recombination reactions that they catalyze. The FimB integrase inverts the Escherichia coli fim switch (fimS) in the on-to-off and off-to-on directions with approximately equal efficiency. Inhibiting DNA gyrase with novobiocin caused inversion to become biased in the off-to-on direction. This directionality was not due to differential DNA topological distortion of fimS in the on and off phases by the activity of its resident PfimA promoter. Instead, the leucine-responsive regulatory (Lrp) protein was found to determine switching outcomes. Knocking out the lrp gene or abolishing Lrp binding sites 1 and 2 within fimS completely reversed the response of the switch to DNA relaxation. Inactivation of either Lrp site alone resulted in mild on-to-off bias, showing that they act together to influence the response of the switch to changes in DNA supercoiling. Thus, Lrp is not merely an architectural element organizing the fim invertasome, it collaborates with DNA supercoiling to determine the directionality of the DNA inversion event. PMID:16855224

Deep-sea vent phage DNA polymerase specifically initiates DNA synthesis in the absence of primers.

PubMed

Zhu, Bin; Wang, Longfei; Mitsunobu, Hitoshi; Lu, Xueling; Hernandez, Alfredo J; Yoshida-Takashima, Yukari; Nunoura, Takuro; Tabor, Stanley; Richardson, Charles C

2017-03-21

A DNA polymerase is encoded by the deep-sea vent phage NrS-1. NrS-1 has a unique genome organization containing genes that are predicted to encode a helicase and a single-stranded DNA (ssDNA)-binding protein. The gene for an unknown protein shares weak homology with the bifunctional primase-polymerases (prim-pols) from archaeal plasmids but is missing the zinc-binding domain typically found in primases. We show that this gene product has efficient DNA polymerase activity and is processive in DNA synthesis in the presence of the NrS-1 helicase and ssDNA-binding protein. Remarkably, this NrS-1 DNA polymerase initiates DNA synthesis from a specific template DNA sequence in the absence of any primer. The de novo DNA polymerase activity resides in the N-terminal domain of the protein, whereas the C-terminal domain enhances DNA binding.

Modeling the interactions of the nucleotide excision repair UvrA(2) dimer with DNA.

PubMed

Gantchev, Tsvetan G; Hunting, Darel J

2010-12-28

The UvrA protein initiates the DNA damage recognition process by the bacterial nucleotide excision repair (NER) system. Recently, crystallographic structures of holo-UvrA(2) dimers from two different microorganisms have been released (Protein Data Bank entries 2r6f , 2vf7 , and 2vf8 ). However, the details of the DNA binding by UvrA(2) and other peculiarities involved in the damage recognition process remain unknown. We have undertaken a molecular modeling approach to appraise the possible modes of DNA-UvrA(2) interaction using molecular docking and short-scale guided molecular dynamics [continuum field, constrained, and/or unrestricted simulated annealing (SA)], taking into account the three-dimensional location of a series of mutation-identified UvrA residues implicated in DNA binding. The molecular docking was based on the assumptions that the UvrA(2) dimer is preformed prior to DNA binding and that no major protein conformational rearrangements, except moderate domain reorientations, are required for binding of undamaged DNA. As a first approximation, DNA was treated as a rigid ligand. From the electrostatic relief of the ventral surface of UvrA(2), we initially identified three, noncollinear DNA binding paths. Each of the three resulting nucleoprotein complexes (C1, C2, and C3) was analyzed separately, including calculation of binding energies, the number and type of interaction residues (including mutated ones), and the predominant mode of translational and rotational motion of specific protein domains after SA to ensure improved DNA binding. The UvrA(2) dimer can accommodate DNA in all three orientations, albeit with different binding strengths. One of the UvrA(2)-DNA complexes (C1) fulfilled most of the requirements (high interaction energy, proximity of DNA to mutated residues, etc.) expected for a natural, high-affinity DNA binding site. This nucleoprotein presents a structural organization that is designed to clamp and bend double-stranded DNA. We examined the binding site in more detail by docking DNAs of significantly different (AT- vs CG-enriched) sequences and by submitting the complexes to DNA-unrestricted SA. It was found that in a manner independent of the DNA sequence and applied MD protocols, UvrA(2) favors binding of a bent and unwound undamaged DNA, with a kink positioned in the proximity of the Zn3 hairpins, anticollinearly aligned at the bottom of the ventral protein surface. It is further hypothesized that the Zn3 modules play an essential role in the damage recognition process and that the apparent existence of a family of DNA binding sites might be biologically relevant. Our data should prove to be useful in rational (structure-based) mutation studies.

DNA sensing by a Eu-binding peptide containing a proflavine unit.

PubMed

Ancel, Laetitia; Gateau, Christelle; Lebrun, Colette; Delangle, Pascale

2013-01-18

Synthesis of a lanthanide-binding peptide (LBP) for the detection of double-stranded DNA is presented. A proflavine moiety was introduced into a high affinity LBP involving two unnatural chelating amino acids in the Ln ion coordination. The Eu(3+)-LBP complex is demonstrated to bind to ct-DNA and to sensitize Eu luminescence. The DNA binding process is effectively detected via the Eu-centered luminescence thanks to the intimate coupling between the LBP scaffold and DNA intercalating unit.

Thermodynamic characterization of binding Oxytricha nova single strand telomere DNA with the alpha protein N-terminal domain.

PubMed

Buczek, Pawel; Horvath, Martin P

2006-06-23

The Oxytricha nova telemere binding protein alpha subunit binds single strand DNA and participates in a nucleoprotein complex that protects the very ends of chromosomes. To understand how the N-terminal, DNA binding domain of alpha interacts with DNA we measured the stoichiometry, enthalpy (DeltaH), entropy (DeltaS), and dissociation constant (K(D-DNA)) for binding telomere DNA fragments at different temperatures and salt concentrations using native gel electrophoresis and isothermal titration calorimetry (ITC). About 85% of the total free energy of binding corresponded with non-electrostatic interactions for all DNAs. Telomere DNA fragments d(T(2)G(4)), d(T(4)G(4)), d(G(3)T(4)G(4)), and d(G(4)T(4)G(4)) each formed monovalent protein complexes. In the case of d(T(4)G(4)T(4)G(4)), which has two tandemly repeated d(TTTTTGGGG) telomere motifs, two binding sites were observed. The high-affinity "A site" has a dissociation constant, K(D-DNA(A)) = 13(+/-4) nM, while the low-affinity "B site" is characterized by K(D-DNA(B)) = 5600(+/-600) nM at 25 degrees C. Nucleotide substitution variants verified that the A site corresponds principally with the 3'-terminal portion of d(T(4)G(4)T(4)G(4)). The relative contributions of entropy (DeltaS) and enthalpy (DeltaH) for binding reactions were DNA length-dependent as was heat capacity (DeltaCp). These trends with respect to DNA length likely reflect structural transitions in the DNA molecule that are coupled with DNA-protein association. Results presented here are important for understanding early intermediates and subsequent stages in the assembly of the full telomere nucleoprotein complex and how binding events can prepare the telomere DNA for extension by telomerase, a critical event in telomere biology.

The emerging role of nuclear viral DNA sensors.

PubMed

Diner, Benjamin A; Lum, Krystal K; Cristea, Ileana M

2015-10-30

Detecting pathogenic DNA by intracellular receptors termed "sensors" is critical toward galvanizing host immune responses and eliminating microbial infections. Emerging evidence has challenged the dogma that sensing of viral DNA occurs exclusively in sub-cellular compartments normally devoid of cellular DNA. The interferon-inducible protein IFI16 was shown to bind nuclear viral DNA and initiate immune signaling, culminating in antiviral cytokine secretion. Here, we review the newly characterized nucleus-originating immune signaling pathways, their links to other crucial host defenses, and unique mechanisms by which viruses suppress their functions. We frame these findings in the context of human pathologies associated with nuclear replicating DNA viruses. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

Nanoscale Proteomic Analysis of Oncoproteins in Hematopoietic Cancers

DTIC Science & Technology

2012-05-01

MYC, signaling proteins, BCR-ABL, lymphoma, leukemia, MDS, atorvastatin , imatinib, apoptosis, cell proliferation, cellular senescence, tumor regression...interrogate the mechanism of clinical response of patients with lymphoma to atorvastatin and the clinical response of leukemia to imatinib in vitro...oncoprotein and signaling protein expression, phosphorylation and DNA binding in response to atorvastatin and imatinib in vitro in mouse and human cell lines

Structural basis for DNA binding by replication initiator Mcm10

DOE Office of Scientific and Technical Information (OSTI.GOV)

Warren, Eric M.; Vaithiyalingam, Sivaraja; Haworth, Justin

2009-06-30

Mcm10 is an essential eukaryotic DNA replication protein required for assembly and progression of the replication fork. The highly conserved internal domain (Mcm10-ID) has been shown to physically interact with single-stranded (ss) DNA, DNA polymerase alpha, and proliferating cell nuclear antigen (PCNA). The crystal structure of Xenopus laevis Mcm10-ID presented here reveals a DNA binding architecture composed of an oligonucleotide/oligosaccharide-fold followed in tandem by a variant and highly basic zinc finger. NMR chemical shift perturbation and mutational studies of DNA binding activity in vitro reveal how Mcm10 uses this unique surface to engage ssDNA. Corresponding mutations in Saccharomyces cerevisiae resultmore » in increased sensitivity to replication stress, demonstrating the functional importance of DNA binding by this region of Mcm10 to replication. In addition, mapping Mcm10 mutations known to disrupt PCNA, polymerase alpha, and DNA interactions onto the crystal structure provides insight into how Mcm10 might coordinate protein and DNA binding within the replisome.« less

Non-B-Form DNA Is Enriched at Centromeres

PubMed Central

Henikoff, Steven

2018-01-01

Abstract Animal and plant centromeres are embedded in repetitive “satellite” DNA, but are thought to be epigenetically specified. To define genetic characteristics of centromeres, we surveyed satellite DNA from diverse eukaryotes and identified variation in <10-bp dyad symmetries predicted to adopt non-B-form conformations. Organisms lacking centromeric dyad symmetries had binding sites for sequence-specific DNA-binding proteins with DNA-bending activity. For example, human and mouse centromeres are depleted for dyad symmetries, but are enriched for non-B-form DNA and are associated with binding sites for the conserved DNA-binding protein CENP-B, which is required for artificial centromere function but is paradoxically nonessential. We also detected dyad symmetries and predicted non-B-form DNA structures at neocentromeres, which form at ectopic loci. We propose that centromeres form at non-B-form DNA because of dyad symmetries or are strengthened by sequence-specific DNA binding proteins. This may resolve the CENP-B paradox and provide a general basis for centromere specification. PMID:29365169

Cdc45-induced loading of human RPA onto single-stranded DNA

PubMed Central

Tessmer, Ingrid; Prus, Piotr; Schlott, Bernhard; Pospiech, Helmut

2017-01-01

Abstract Cell division cycle protein 45 (Cdc45) is an essential component of the eukaryotic replicative DNA helicase. We found that human Cdc45 forms a complex with the single-stranded DNA (ssDNA) binding protein RPA. Moreover, it actively loads RPA onto nascent ssDNA. Pull-down assays and surface plasmon resonance studies revealed that Cdc45-bound RPA complexed with ssDNA in the 8–10 nucleotide binding mode, but dissociated when RPA covered a 30-mer. Real-time analysis of RPA-ssDNA binding demonstrated that Cdc45 catalytically loaded RPA onto ssDNA. This placement reaction required physical contacts of Cdc45 with the RPA70A subdomain. Our results imply that Cdc45 controlled stabilization of the 8-nt RPA binding mode, the subsequent RPA transition into 30-mer mode and facilitated an ordered binding to ssDNA. We propose that a Cdc45-mediated loading guarantees a seamless deposition of RPA on newly emerging ssDNA at the nascent replication fork. PMID:28100698

Replication protein A, the laxative that keeps DNA regular: The importance of RPA phosphorylation in maintaining genome stability.

PubMed

Byrne, Brendan M; Oakley, Gregory G

2018-04-20

The eukaryotic ssDNA-binding protein, Replication protein A (RPA), was first discovered almost three decades ago. Since then, much progress has been made to elucidate the critical roles for RPA in DNA metabolic pathways that help promote genomic stability. The canonical RPA heterotrimer (RPA1-3) is an essential coordinator of DNA metabolism that interacts with ssDNA and numerous protein partners to coordinate its roles in DNA replication, repair, recombination and telomere maintenance. An alternative form of RPA, termed aRPA, is formed by a complex of RPA4 with RPA1 and RPA3. aRPA is expressed differentially in cells compared to canonical RPA and has been shown to inhibit canonical RPA function while allowing for regular maintenance of cell viability. Interestingly, while aRPA is defective in DNA replication and cell cycle progression, it was shown to play a supporting role in nucleotide excision repair and recombination. The binding domains of canonical RPA interact with a growing number of partners involved in numerous genome maintenance processes. The protein interactions of the RPA-ssDNA complex are not only governed by competition between the binding proteins but also by post-translation modifications such as phosphorylation. Phosphorylation of RPA2 is an important post-translational modification of the RPA complex, and is essential for directing context-specific functions of the RPA complex in the DNA damage response. Due to the importance of RPA in cellular metabolism, it was identified as an appealing target for chemotherapeutic drug development that could be used in future cancer treatment regimens. Copyright © 2018 Elsevier Ltd. All rights reserved.

Genome-wide survey of DNA-binding proteins in Arabidopsis thaliana: analysis of distribution and functions.

PubMed

Malhotra, Sony; Sowdhamini, Ramanathan

2013-08-01

The interaction of proteins with their respective DNA targets is known to control many high-fidelity cellular processes. Performing a comprehensive survey of the sequenced genomes for DNA-binding proteins (DBPs) will help in understanding their distribution and the associated functions in a particular genome. Availability of fully sequenced genome of Arabidopsis thaliana enables the review of distribution of DBPs in this model plant genome. We used profiles of both structure and sequence-based DNA-binding families, derived from PDB and PFam databases, to perform the survey. This resulted in 4471 proteins, identified as DNA-binding in Arabidopsis genome, which are distributed across 300 different PFam families. Apart from several plant-specific DNA-binding families, certain RING fingers and leucine zippers also had high representation. Our search protocol helped to assign DNA-binding property to several proteins that were previously marked as unknown, putative or hypothetical in function. The distribution of Arabidopsis genes having a role in plant DNA repair were particularly studied and noted for their functional mapping. The functions observed to be overrepresented in the plant genome harbour DNA-3-methyladenine glycosylase activity, alkylbase DNA N-glycosylase activity and DNA-(apurinic or apyrimidinic site) lyase activity, suggesting their role in specialized functions such as gene regulation and DNA repair.

The large terminase DNA packaging motor grips DNA with its ATPase domain for cleavage by the flexible nuclease domain

PubMed Central

Hilbert, Brendan J.; Hayes, Janelle A.; Stone, Nicholas P.; Xu, Rui-Gang

2017-01-01

Abstract Many viruses use a powerful terminase motor to pump their genome inside an empty procapsid shell during virus maturation. The large terminase (TerL) protein contains both enzymatic activities necessary for packaging in such viruses: the adenosine triphosphatase (ATPase) that powers DNA translocation and an endonuclease that cleaves the concatemeric genome at both initiation and completion of genome packaging. However, how TerL binds DNA during translocation and cleavage remains mysterious. Here we investigate DNA binding and cleavage using TerL from the thermophilic phage P74-26. We report the structure of the P74-26 TerL nuclease domain, which allows us to model DNA binding in the nuclease active site. We screened a large panel of TerL variants for defects in binding and DNA cleavage, revealing that the ATPase domain is the primary site for DNA binding, and is required for nuclease activity. The nuclease domain is dispensable for DNA binding but residues lining the active site guide DNA for cleavage. Kinetic analysis of DNA cleavage suggests flexible tethering of the nuclease domains during DNA cleavage. We propose that interactions with the procapsid during DNA translocation conformationally restrict the nuclease domain, inhibiting cleavage; TerL release from the capsid upon completion of packaging unlocks the nuclease domains to cleave DNA. PMID:28082398

Effect of Escherichia coli DNA binding protein on the transcription of single-stranded phage M13 DNA by Escherichia coli RNA polymerase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Niyogi, S.K.; Ratrie, H. III; Datta, A.K.

E. coli DNA binding protein strongly inhibits the transcription of single-stranded rather than double-stranded phage M13 DNA by E. coli RNA polymerase. This inhibition cannot be significantly overcome by increasing the concentration of RNA polymerase. Nor does the order of addition of binding protein affect its inhibitory property: inhibition is evident whether binding protein is added before or after the formation of the RNA polymerase--DNA complex. Inhibition is also observed if binding protein is added at various times after initiation of RNA synthesis. Maximal inhibition occurs at a binding protein-to-DNA ratio (w/w) of about 8:1. This corresponds to one bindingmore » protein molecule covering about 30 nucleotides, in good agreement with values obtained by physical measurements.« less

Binding modes and pathway of RHPS4 to human telomeric G-quadruplex and duplex DNA probed by all-atom molecular dynamics simulations with explicit solvent.

PubMed

Mulholland, Kelly; Siddiquei, Farzana; Wu, Chun

2017-07-19

RHPS4, a potent binder to human telomeric DNA G-quadruplex, shows high efficacy in tumor cell growth inhibition. However, it's preferential binding to DNA G-quadruplex over DNA duplex (about 10 fold) remains to be improved toward its clinical application. A high resolution structure of the single-stranded telomeric DNA G-quadruplexes, or B-DNA duplex, in complex with RHPS4 is not available yet, and the binding nature of this ligand to these DNA forms remains to be elusive. In this study, we carried out 40 μs molecular dynamics binding simulations with a free ligand to decipher the binding pathway of RHPS4 to a DNA duplex and three G-quadruplex folders (parallel, antiparallel and hybrid) of the human telomeric DNA sequence. The most stable binding mode identified for the duplex, parallel, antiparallel and hybrid G-quadruplexes is an intercalation, bottom stacking, top intercalation and bottom intercalation mode, respectively. The intercalation mode with similar binding strength to both the duplex and the G-quadruplexes, explains the lack of binding selectivity of RHPS4 to the G-quadruplex form. Therefore, a ligand modification that destabilizes the duplex intercalation mode but stabilizes the G-quadruplex intercalation mode will improve the binding selectivity toward G-quadruplex. The intercalation mode of RHPS4 to both the duplex and the antiparallel and the hybrid G-quadruplex follows a base flipping-insertion mechanism rather than an open-insertion mechanism. The groove binding, the side binding and the intercalation with flipping out of base were observed to be intermediate states before the full intercalation state with paired bases.

DNA Repair, Redox Regulation and Modulation of Estrogen Receptor Alpha Mediated Transcription

ERIC Educational Resources Information Center

Curtis-Ducey, Carol Dianne

2009-01-01

Interaction of estrogen receptor [alpha] (ER[alpha]) with 17[beta]-estradiol (E[subscript 2]) facilitates binding of the receptor to estrogen response elements (EREs) in target genes, which in turn leads to recruitment of coregulatory proteins. To better understand how estrogen-responsive genes are regulated, our laboratory identified a number of…

Sequence-based prediction of protein-binding sites in DNA: comparative study of two SVM models.

PubMed

Park, Byungkyu; Im, Jinyong; Tuvshinjargal, Narankhuu; Lee, Wook; Han, Kyungsook

2014-11-01

As many structures of protein-DNA complexes have been known in the past years, several computational methods have been developed to predict DNA-binding sites in proteins. However, its inverse problem (i.e., predicting protein-binding sites in DNA) has received much less attention. One of the reasons is that the differences between the interaction propensities of nucleotides are much smaller than those between amino acids. Another reason is that DNA exhibits less diverse sequence patterns than protein. Therefore, predicting protein-binding DNA nucleotides is much harder than predicting DNA-binding amino acids. We computed the interaction propensity (IP) of nucleotide triplets with amino acids using an extensive dataset of protein-DNA complexes, and developed two support vector machine (SVM) models that predict protein-binding nucleotides from sequence data alone. One SVM model predicts protein-binding nucleotides using DNA sequence data alone, and the other SVM model predicts protein-binding nucleotides using both DNA and protein sequences. In a 10-fold cross-validation with 1519 DNA sequences, the SVM model that uses DNA sequence data only predicted protein-binding nucleotides with an accuracy of 67.0%, an F-measure of 67.1%, and a Matthews correlation coefficient (MCC) of 0.340. With an independent dataset of 181 DNAs that were not used in training, it achieved an accuracy of 66.2%, an F-measure 66.3% and a MCC of 0.324. Another SVM model that uses both DNA and protein sequences achieved an accuracy of 69.6%, an F-measure of 69.6%, and a MCC of 0.383 in a 10-fold cross-validation with 1519 DNA sequences and 859 protein sequences. With an independent dataset of 181 DNAs and 143 proteins, it showed an accuracy of 67.3%, an F-measure of 66.5% and a MCC of 0.329. Both in cross-validation and independent testing, the second SVM model that used both DNA and protein sequence data showed better performance than the first model that used DNA sequence data. To the best of our knowledge, this is the first attempt to predict protein-binding nucleotides in a given DNA sequence from the sequence data alone. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

Loop L1 governs the DNA-binding specificity and order for RecA-catalyzed reactions in homologous recombination and DNA repair

PubMed Central

Shinohara, Takeshi; Ikawa, Shukuko; Iwasaki, Wakana; Hiraki, Toshiki; Hikima, Takaaki; Mikawa, Tsutomu; Arai, Naoto; Kamiya, Nobuo; Shibata, Takehiko

2015-01-01

In all organisms, RecA-family recombinases catalyze homologous joint formation in homologous genetic recombination, which is essential for genome stability and diversification. In homologous joint formation, ATP-bound RecA/Rad51-recombinases first bind single-stranded DNA at its primary site and then interact with double-stranded DNA at another site. The underlying reason and the regulatory mechanism for this conserved binding order remain unknown. A comparison of the loop L1 structures in a DNA-free RecA crystal that we originally determined and in the reported DNA-bound active RecA crystals suggested that the aspartate at position 161 in loop L1 in DNA-free RecA prevented double-stranded, but not single-stranded, DNA-binding to the primary site. This was confirmed by the effects of the Ala-replacement of Asp-161 (D161A), analyzed directly by gel-mobility shift assays and indirectly by DNA-dependent ATPase activity and SOS repressor cleavage. When RecA/Rad51-recombinases interact with double-stranded DNA before single-stranded DNA, homologous joint-formation is suppressed, likely by forming a dead-end product. We found that the D161A-replacement reduced this suppression, probably by allowing double-stranded DNA to bind preferentially and reversibly to the primary site. Thus, Asp-161 in the flexible loop L1 of wild-type RecA determines the preference for single-stranded DNA-binding to the primary site and regulates the DNA-binding order in RecA-catalyzed recombinase reactions. PMID:25561575

Depletion of ribosomal protein L37 occurs in response to DNA damage and activates p53 through the L11/MDM2 pathway.

PubMed

Llanos, Susana; Serrano, Manuel

2010-10-01

Perturbation of ribosomal biogenesis has recently emerged as a relevant p53-activating pathway. This pathway can be initiated by depletion of certain ribosomal proteins, which is followed by the binding and inhibition of MDM2 by a different subset of ribosomal proteins that includes L11. Here, we report that depletion of L37 leads to cell cycle arrest in a L11- and p53-dependent manner. DNA damage can initiate ribosomal stress, although little is known about the mechanisms involved. We have found that some genotoxic insults, namely, UV light and cisplatin, lead to proteasomal degradation of L37 in the nucleoplasm and to the ensuing L11-dependent stabilization of p53. Moreover, ectopic L37 overexpression can attenuate the DNA damage response mediated by p53. These results support the concept that DNA damage-induced proteasomal degradation of L37 constitutes a mechanistic link between DNA damage and the ribosomal stress pathway, and is a relevant contributing signaling pathway for the activation of p53 in response to DNA damage.

E2F1 induces p19INK4d, a protein involved in the DNA damage response, following UV irradiation.

PubMed

Carcagno, Abel L; Giono, Luciana E; Marazita, Mariela C; Castillo, Daniela S; Pregi, Nicolás; Cánepa, Eduardo T

2012-07-01

Central to the maintenance of genomic integrity is the cellular DNA damage response. Depending on the type of genotoxic stress and through the activation of multiple signaling cascades, it can lead to cell cycle arrest, DNA repair, senescence, and apoptosis. p19INK4d, a member of the INK4 family of CDK inhibitors, plays a dual role in the DNA damage response, inhibiting cell proliferation and promoting DNA repair. Consistently, p19INK4d has been reported to become upregulated in response to UV irradiation and a great variety of genotoxic agents. Here, this induction is shown to result from a transcriptional stimulatory mechanism that can occur at every phase of the cell cycle except during mitosis. Moreover, evidence is presented that demonstrates that E2F1 is involved in the induction of p19INK4d following UV treatment, as it is prevented by E2F1 protein ablation and DNA-binding inhibition. Specific inhibition of this regulation using triplex-forming oligonucleotides that target the E2F response elements present in the p19INK4d promoter also block p19INK4d upregulation and sensitize cells to DNA damage. These results constitute the first description of a mechanism for the induction of p19INK4d in response to UV irradiation and demonstrate the physiological relevance of this regulation following DNA damage.

Molecular Mechanism Underlying the Action of Substituted Pro-Gly Dipeptide Noopept.

PubMed

Vakhitova, Y V; Sadovnikov, S V; Borisevich, S S; Ostrovskaya, R U; A Gudasheva, T; Seredenin, S B

2016-01-01

This study was performed in order to reveal the effect of Noopept (ethyl ester of N-phenylacetyl-Lprolylglycine, GVS-111) on the DNA-binding activity of transcriptional factors (TF) in HEK293 cells transiently transfected with luciferase reporter constructs containing sequences for CREB, NFAT, NF-κB, p53, STAT1, GAS, VDR, HSF1, and HIF-1. Noopept (10 μM) was shown to increase the DNA-binding activity of HIF-1 only, while lacking the ability to affect that of CREB, NFAT, NF-κB, p53, STAT1, GAS, VDR, and HSF1. Noopept provoked an additional increase in the DNA-binding activity of HIF-1 when applied in conditions of CoCl2-induced HIF- 1 stabilization. The degree of this HIF-positive effect of Noopept was shown to be concentration-dependent. Piracetam (1 mM) failed to affect significantly any of the TF under study. The results of molecular docking showed that Noopept (L-isomer), as well as its metabolite, L-isomer of N-phenyl-acetylprolyl, unlike its pharmacologically ineffective D-isomer, is able to bind to the active site of prolyl hydroxylase 2. Taking into account the important role of the genes activated by HIF-1 in the formation of an adaptive response to hypoxia, data on the ability of Noopept to provoke a selective increase in the DNA-binding activity of HIF-1 explain the wide spectrum of neurochemical and pharmacological effects of Noopept revealed before. The obtained data allow one to propose the HIF-positive effect as the primary mechanism of the activity of this Pro-Gly-containing dipeptide.

Acrolein preferentially damages nucleolus eliciting ribosomal stress and apoptosis in human cancer cells.

PubMed

Wang, Hsiang-Tsui; Chen, Tzu-Ying; Weng, Ching-Wen; Yang, Chun-Hsiang; Tang, Moon-Shong

2016-12-06

Acrolein (Acr) is a potent cytotoxic and DNA damaging agent which is ubiquitous in the environment and abundant in tobacco smoke. Acr is also an active cytotoxic metabolite of the anti-cancer drugs cyclophosphamide and ifosfamide. The mechanisms via which Acr exerts its anti-cancer activity and cytotoxicity are not clear. In this study, we found that Acr induces cytotoxicity and cell death in human cancer cells with different activities of p53. Acr preferentially binds nucleolar ribosomal DNA (rDNA) to form Acr-deoxyguanosine adducts, and induces oxidative damage to both rDNA and ribosomal RNA (rRNA). Acr triggers ribosomal stress responses, inhibits rRNA synthesis, reduces RNA polymerase I binding to the promoter of rRNA gene, disrupts nucleolar integrity, and impairs ribosome biogenesis and polysome formation. Acr causes an increase in MDM2 levels and phosphorylation of MDM2 in A549 and HeLa cells which are p53 active and p53 inactive, respectively. It enhances the binding of ribosomal protein RPL11 to MDM2 and reduces the binding of p53 and E2F-1 to MDM2 resulting in stabilization/activation of p53 in A549 cells and degradation of E2F-1 in A549 and HeLa cells. We propose that Acr induces ribosomal stress which leads to activation of MDM2 and RPL11-MDM2 binding, consequently, activates p53 and enhances E2F-1 degradation, and that taken together these two processes induce apoptosis and cell death.

Histone-like DNA binding protein of Streptococcus intermedius induces the expression of pro-inflammatory cytokines in human monocytes via activation of ERK1/2 and JNK pathways.

PubMed

Liu, Dali; Yumoto, Hiromichi; Hirota, Katsuhiko; Murakami, Keiji; Takahashi, Kanako; Hirao, Kouji; Matsuo, Takashi; Ohkura, Kazuto; Nagamune, Hideaki; Miyake, Yoichiro

2008-01-01

Streptococcus intermedius is a commensal associated with serious, deep-seated purulent infections in major organs, such as the brain and liver. Histone-like DNA binding protein (HLP) is an accessory architectural protein in a variety of bacterial cellular processes. In this study, we investigated the mechanisms of pro-inflammatory cytokine inductions in THP-1 cells by stimulation with recombinant HLP of S. intermedius (rSi-HLP). rSi-HLP stimulation-induced production of pro-inflammatory cytokines (IL-8, IL-1 beta and TNF-alpha) occurred in a time- and dose-dependent manner. In contrast with the heat-stable activity of DNA binding, the induction activity of rSi-HLP was heat-unstable. In subsequent studies, rSi-HLP acted cooperatively with lipoteichoic acid, the synthetic Toll-like receptor 2 agonist, Pam3CSK4, and the cytosolic nucleotide binding oligomerization domain 2 receptor agonist, muramyldipeptide. Furthermore, Western blot and blocking assays with specific inhibitors showed that rSi-HLP stimulation induced the activation of cell signal transduction pathways, extracellular signal-regulated kinase 1/2 (ERK1/2) and c-Jun N-terminal kinase (JNK). In addition to its physiological role in bacterial growth through DNA binding, these results indicate that Si-HLP can trigger a cascade of events that induce pro-inflammatory responses via ERK1/2 and JNK signal pathways, and suggest that bacterial HLP may contribute to the activation of host innate immunity during bacterial infection.

Isolation and characterization of target sequences of the chicken CdxA homeobox gene.

PubMed Central

Margalit, Y; Yarus, S; Shapira, E; Gruenbaum, Y; Fainsod, A

1993-01-01

The DNA binding specificity of the chicken homeodomain protein CDXA was studied. Using a CDXA-glutathione-S-transferase fusion protein, DNA fragments containing the binding site for this protein were isolated. The sources of DNA were oligonucleotides with random sequence and chicken genomic DNA. The DNA fragments isolated were sequenced and tested in DNA binding assays. Sequencing revealed that most DNA fragments are AT rich which is a common feature of homeodomain binding sites. By electrophoretic mobility shift assays it was shown that the different target sequences isolated bind to the CDXA protein with different affinities. The specific sequences bound by the CDXA protein in the genomic fragments isolated, were determined by DNase I footprinting. From the footprinted sequences, the CDXA consensus binding site was determined. The CDXA protein binds the consensus sequence A, A/T, T, A/T, A, T, A/G. The CAUDAL binding site in the ftz promoter is also included in this consensus sequence. When tested, some of the genomic target sequences were capable of enhancing the transcriptional activity of reporter plasmids when introduced into CDXA expressing cells. This study determined the DNA sequence specificity of the CDXA protein and it also shows that this protein can further activate transcription in cells in culture. Images PMID:7909943

Randomized phase I trial HIV-CORE 003: Depletion of serum amyloid P component and immunogenicity of DNA vaccination against HIV-1.

PubMed

Borthwick, Nicola J; Lane, Thirusha; Moyo, Nathifa; Crook, Alison; Shim, Jung Min; Baines, Ian; Wee, Edmund G; Hawkins, Philip N; Gillmore, Julian D; Hanke, Tomáš; Pepys, Mark B

2018-01-01

The failure of DNA vaccination in humans, in contrast to its efficacy in some species, is unexplained. Observational and interventional experimental evidence suggests that DNA immunogenicity may be prevented by binding of human serum amyloid P component (SAP). SAP is the single normal DNA binding protein in human plasma. The drug (R)-1-[6-[(R)-2-carboxypyrrolidin-1-yl]-6-oxo-hexanoyl]pyrrolidine-2-carboxylic acid (CPHPC, miridesap), developed for treatment of systemic amyloidosis and Alzheimer's disease, depletes circulating SAP by 95-99%. The proof-of-concept HIV-CORE 003 clinical trial tested whether SAP depletion by CPHPC would enhance the immune response in human volunteers to DNA vaccination delivering the HIVconsv immunogen derived from conserved sub-protein regions of HIV-1. Human volunteers received 3 intramuscular immunizations with an experimental DNA vaccine (DDD) expressing HIV-1-derived immunogen HIVconsv, with or without prior depletion of SAP by CPHPC. All subjects were subsequently boosted by simian (chimpanzee) adenovirus (C)- and poxvirus MVA (M)-vectored vaccines delivering the same immunogen. After administration of each vaccine modality, the peak total magnitudes, kinetics, functionality and memory subsets of the T-cell responses to HIVconsv were thoroughly characterized. No differences were observed between the CPHPC treated and control groups in any of the multiple quantitative and qualitative parameters of the T-cell responses to HIVconsv, except that after SAP depletion, there was a statistically significantly greater breadth of T-cell specificities, that is the number of recognized epitopes, following the DDDC vaccination. The protocol used here for SAP depletion by CPHPC prior to DNA vaccination produced only a very modest suggestion of enhanced immunogenicity. Further studies will be required to determine whether SAP depletion might have a practical value in DNA vaccination for other plasmid backbones and/or immunogens. Clinicaltrials.gov NCT02425241.

Interrelations of secondary structure stability and DNA-binding affinity in the bacteriophage SPO1-encoded type II DNA-binding protein TF1.

PubMed

Andera, L; Spangler, C J; Galeone, A; Mayol, L; Geiduschek, E P

1994-02-11

TF1, a homodimeric DNA-binding and -bending protein with a preference for hydroxymethyluracil-containing DNA is the Bacillus subtilis-encoded homolog of the bacterial HU proteins and of the E. coli integration host factor. A temperature-sensitive mutation at amino acid 25 of TF1 (L25-->A) and two intragenic second site revertants at amino acids 15 (E15-->G) and 32 (L32-->I) were previously identified and their effects on virus development were examined. The DNA-binding properties of these proteins and the thermal stability of their secondary structures have now been analyzed. Amino acids 15 and 32 are far removed from the putative DNA-binding domains of TF1 but changes there exert striking effects on DNA affinity that correlate with effects on structure. The double mutant protein TF1-G15I32 binds to a preferred site in hydroxymethyluracil-containing DNA 40 times more tightly, denatures at higher temperature (delta tm = 21 degrees C), and also exchanges subunits much more slowly than does the wild-type protein. The L25-->A mutation makes TF1 secondary structure and DNA-binding highly salt concentration-dependent. The E15-->G mutation partly suppresses this effect: secondary structure of TF1-A25G15 is restored at 21 degrees C by 1 M NaCl or, at low NaCl concentration, by binding to DNA.

A Computational Analysis of ATP Binding of SV40 Large Tumor Antigen Helicase Motor

PubMed Central

Shi, Yemin; Liu, Hanbin; Gai, Dahai; Ma, Jianpeng; Chen, Xiaojiang S.

2009-01-01

Simian Virus 40 Large Tumor Antigen (LTag) is an efficient helicase motor that unwinds and translocates DNA. The DNA unwinding and translocation of LTag is powered by ATP binding and hydrolysis at the nucleotide pocket between two adjacent subunits of an LTag hexamer. Based on the set of high-resolution hexameric structures of LTag helicase in different nucleotide binding states, we simulated a conformational transition pathway of the ATP binding process using the targeted molecular dynamics method and calculated the corresponding energy profile using the linear response approximation (LRA) version of the semi-macroscopic Protein Dipoles Langevin Dipoles method (PDLD/S). The simulation results suggest a three-step process for the ATP binding from the initial interaction to the final tight binding at the nucleotide pocket, in which ATP is eventually “locked” by three pairs of charge-charge interactions across the pocket. Such a “cross-locking” ATP binding process is similar to the binding zipper model reported for the F1-ATPase hexameric motor. The simulation also shows a transition mechanism of Mg2+ coordination to form the Mg-ATP complex during ATP binding, which is accompanied by the large conformational changes of LTag. This simulation study of the ATP binding process to an LTag and the accompanying conformational changes in the context of a hexamer leads to a refined cooperative iris model that has been proposed previously. PMID:19779548

Dehydration responsive element binding transcription factors and their applications for the engineering of stress tolerance.

PubMed

Agarwal, Pradeep K; Gupta, Kapil; Lopato, Sergiy; Agarwal, Parinita

2017-04-01

Dehydration responsive element binding (DREB) factors or CRT element binding factors (CBFs) are members of the AP2/ERF family, which comprises a large number of stress-responsive regulatory genes. This review traverses almost two decades of research, from the discovery of DREB/CBF factors to their optimization for application in plant biotechnology. In this review, we describe (i) the discovery, classification, structure, and evolution of DREB genes and proteins; (ii) induction of DREB genes by abiotic stresses and involvement of their products in stress responses; (iii) protein structure and DNA binding selectivity of different groups of DREB proteins; (iv) post-transcriptional and post-translational mechanisms of DREB transcription factor (TF) regulation; and (v) physical and/or functional interaction of DREB TFs with other proteins during plant stress responses. We also discuss existing issues in applications of DREB TFs for engineering of enhanced stress tolerance and improved performance under stress of transgenic crop plants. © The Author 2017. Published by Oxford University Press on behalf of the Society for Experimental Biology. All rights reserved. For permissions, please email: journals.permissions@oup.com.

Determination of the DNA-binding characteristics of ethidium bromide, proflavine, and cisplatin by flow injection analysis: usefulness in studies on antitumor drugs.

PubMed

Alonso, A; Almendral, M J; Curto, Y; Criado, J J; Rodríguez, E; Manzano, J L

2006-08-15

Flow injection analysis was used to study the reactions occurring between DNA and certain compounds that bind to its double helix, deforming this and even breaking it, such that some of them (e.g., cisplatin) are endowed with antitumoral activity. Use of this technique in the merging zones and stopped-flow modes afforded data on the binding parameters and the kinetic characteristics of the process. The first compound studied was ethidium bromide (EtdBr), used as a fluorescent marker because its fluorescence is enhanced when it binds to DNA. The DNA-EtdBr binding parameters, the apparent intrinsic binding constant (0.31+/-0.02 microM(-1)), and the maximum number of binding sites per nucleotide (0.327+/-0.009) were determined. The modification introduced in these parameters by the presence of proflavine (Prf), a classic competitive inhibitor of the binding of EtdBr to the DNA double helix, was also studied, determining the value of the intrinsic binding constant of Prf (K(Prf) = 0.119+/-9x10(-3) microM(-1)). Finally, we determined the binding parameters between DNA and EtdBr in the presence of the antitumor agent cisplatin, a noncompetitive inhibitor of such binding. This provided information about the binding mechanism as well as the duration and activity of the binding of the compound in its pharmacological use.

Cellular corepressor TLE2 inhibits replication-and-transcription- activator-mediated transactivation and lytic reactivation of Kaposi's sarcoma-associated herpesvirus.

PubMed

He, Zhiheng; Liu, Yunhua; Liang, Deguang; Wang, Zhuo; Robertson, Erle S; Lan, Ke

2010-02-01

Replication and transcription activator (RTA) encoded by open reading frame 50 (ORF50) of Kaposi's sarcoma-associated herpesvirus (KSHV) is essential and sufficient to initiate lytic reactivation. RTA activates its target genes through direct binding with high affinity to its responsive elements or by interaction with cellular factors, such as RBP-Jkappa, Ap-1, C/EBP-alpha, and Oct-1. In this study, we identified transducin-like enhancer of split 2 (TLE2) as a novel RTA binding protein by using yeast two-hybrid screening of a human spleen cDNA library. The interaction between TLE2 and RTA was confirmed by glutathione S-transferase (GST) binding and coimmunoprecipitation assays. Immunofluorescence analysis showed that TLE2 and RTA were colocalized in the same nuclear compartment in KSHV-infected cells. This interaction recruited TLE2 to RTA bound to its recognition sites on DNA and repressed RTA auto-activation and transactivation activity. Moreover, TLE2 also inhibited the induction of lytic replication and virion production driven by RTA. We further showed that the Q (Gln-rich), SP (Ser-Pro-rich), and WDR (Trp-Asp repeat) domains of TLE2 and the Pro-rich domain of RTA were essential for this interaction. RBP-Jkappa has been shown previously to bind to the same Pro-rich domain of RTA, and this binding can be subject to competition by TLE2. In addition, TLE2 can form a complex with RTA to access the cognate DNA sequence of the RTA-responsive element at different promoters. Intriguingly, the transcription level of TLE2 could be upregulated by RTA during the lytic reactivation process. In conclusion, we identified a new RTA binding protein, TLE2, and demonstrated that TLE2 inhibited replication and transactivation mediated by RTA. This provides another potentially important mechanism for maintenance of KSHV viral latency through interaction with a host protein.

Thermodynamic Characterization of Binding Oxytricha nova Single Strand Telomere DNA with the Alpha Protein N-terminal Domain

PubMed Central

Buczek, Pawel; Horvath, Martin P.

2010-01-01

The Oxytricha nova telomere binding protein alpha subunit binds single strand DNA and participates in a nucleoprotein complex that protects the very ends of chromosomes. To understand how the N-terminal, DNA binding domain of alpha interacts with DNA we measured the stoichiometry, enthalpy (ΔH), entropy (ΔS), and dissociation constant (KD-DNA) for binding telomere DNA fragments at different temperatures and salt concentrations using native gel electrophoresis and isothermal titration calorimetry (ITC). About 85% of the total free energy of binding corresponded with non-electrostatic interactions for all DNAs. Telomere DNA fragments d(T2G4), d(T4G4), d(G3T4G4), and d(G4T4G4) each formed monovalent protein complexes. In the case of d(T4G4T4G4), which has two tandemly repeated d(TTTTTGGGG) telomere motifs, two binding sites were observed. The high-affinity “A site” has a dissociation constant, KD-DNA(A)=13(±4) nM, while the low-affinity “B site” is characterized by KD-DNA(B)=5600(±600) nM at 25 °C. Nucleotide substitution variants verified that the A site corresponds principally with the 3′-terminal portion of d(T4G4T4G4). The relative contributions of entropy (ΔS) and enthalpy (ΔH) for binding reactions were DNA length-dependent as was heat capacity (ΔCp). These trends with respect to DNA length likely reflect structural transitions in the DNA molecule that are coupled with DNA–protein association. Results presented here are important for understanding early intermediates and subsequent stages in the assembly of the full telomere nucleoprotein complex and how binding events can prepare the telomere DNA for extension by telomerase, a critical event in telomere biology. PMID:16678852

The DnaK Chaperone Uses Different Mechanisms To Promote and Inhibit Replication of Vibrio cholerae Chromosome 2

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jha, Jyoti K.; Li, Mi; Ghirlando, Rodolfo

Replication of Vibrio cholerae chromosome 2 (Chr2) depends on molecular chaperone DnaK to facilitate binding of the initiator (RctB) to the replication origin. The binding occurs at two kinds of site, 12-mers and 39-mers, which promote and inhibit replication, respectively. Here we show that DnaK employs different mechanisms to enhance the two kinds of binding. We found that mutations inrctBthat reduce DnaK binding also reduce 12-mer binding and initiation. The initiation defect is suppressed by second-site mutations that increase 12-mer binding only marginally. Instead, they reduce replication inhibitory mechanisms: RctB dimerization and 39-mer binding. One suppressing change was in amore » dimerization domain which is folded similarly to the initiator of an iteron plasmid—the presumed progenitor of Chr2. In plasmids, DnaK promotes initiation by reducing dimerization. A different mutation was in the 39-mer binding domain of RctB and inactivated it, indicating an alternative suppression mechanism. Paradoxically, although DnaK increases 39-mer binding, the increase was also achieved by inactivating the DnaK binding site of RctB. This result suggests that the site inhibits the 39-mer binding domain (via autoinhibition) when prevented from binding DnaK. Taken together, our results reveal an important feature of the transition from plasmid to chromosome: the Chr2 initiator retains the plasmid-like dimerization domain and its control by chaperones but uses the chaperones in an unprecedented way to control the inhibitory 39-mer binding. IMPORTANCE The capacity of proteins to undergo remodeling provides opportunities to control their function. However, remodeling remains a poorly understood aspect of the structure-function paradigm due to its dynamic nature. Here we have studied remodeling of the initiator of replication ofVibrio choleraeChr2 by the molecular chaperone, DnaK. We show that DnaK binds to a site on the Chr2 initiator (RctB) that promotes initiation by reducing the initiator’s propensity to dimerize. Dimerization of the initiator of the putative plasmid progenitor of Chr2 is also reduced by DnaK, which promotes initiation. Paradoxically, the DnaK binding also promotes replication inhibition by reducing an autoinhibitory activity of RctB. In the plasmid-to-chromosome transition, it appears that the initiator has acquired an autoinhibitory activity and along with it a new chaperone activity that apparently helps to control replication inhibition independently of replication promotion.« less

New phthalimide-appended Schiff bases: Studies of DNA binding, molecular docking and antioxidant activities.

PubMed

Nayab, Pattan Sirajuddin; Akrema; Ansari, Istikhar A; Shahid, Mohammad; Rahisuddin

2017-08-01

Herein, we investigated new phthalimide-based Schiff base molecules as promising DNA-binding and free radical scavenging agents. Physicochemical properties of these molecules were demonstrated on the basis of elemental analysis, ultraviolet-visible (UV-Vis), infra-red (IR), 1 H and 13 C nuclear magnetic resonance (NMR) spectroscopy. All spectral data are agreed well with the proposed Schiff base framework. The DNA-binding potential of synthesized compounds were investigated by means of UV-visible, fluorescence, iodide quenching, circular dichroism, viscosity and thermal denaturation studies. The intrinsic binding constants (K b ) were calculated from absorption studies were found to be 1.1 × 10 4 and 1.0 × 10 4  M -1 for compounds 2a and 2b suggesting that compound 2a binding abilities with DNA were stronger than the compound 2b. Our studies showed that the presented compounds interact with DNA through groove binding. Molecular docking studies were carried out to predict the binding between Ct-DNA and test compounds. Interestingly, in silico predictions were corroborated with in vitro DNA-binding conclusions. Furthermore, the title compounds displayed remarkable antioxidant activity compared with reference standard. Copyright © 2016 John Wiley & Sons, Ltd.

pUL34 binding near the human cytomegalovirus origin of lytic replication enhances DNA replication and viral growth.

PubMed

Slayton, Mark; Hossain, Tanvir; Biegalke, Bonita J

2018-05-01

The human cytomegalovirus (HCMV) UL34 gene encodes sequence-specific DNA-binding proteins (pUL34) which are required for viral replication. Interactions of pUL34 with DNA binding sites represses transcription of two viral immune evasion genes, US3 and US9. 12 additional predicted pUL34-binding sites are present in the HCMV genome (strain AD169) with three binding sites concentrated near the HCMV origin of lytic replication (oriLyt). We used ChIP-seq analysis of pUL34-DNA interactions to confirm that pUL34 binds to the oriLyt region during infection. Mutagenesis of the UL34-binding sites in an oriLyt-containing plasmid significantly reduced viral-mediated oriLyt-dependent DNA replication. Mutagenesis of these sites in the HCMV genome reduced the replication efficiencies of the resulting viruses. Protein-protein interaction analyses demonstrated that pUL34 interacts with the viral proteins IE2, UL44, and UL84, that are essential for viral DNA replication, suggesting that pUL34-DNA interactions in the oriLyt region are involved in the DNA replication cascade. Copyright © 2018 Elsevier Inc. All rights reserved.