Sample records for response element binding

  1. The structure of distractor-response bindings: Conditions for configural and elemental integration.

    PubMed

    Moeller, Birte; Frings, Christian; Pfister, Roland

    2016-04-01

    Human action control is influenced by bindings between perceived stimuli and responses carried out in their presence. Notably, responses given to a target stimulus can also be integrated with additional response-irrelevant distractor stimuli that accompany the target (distractor-response binding). Subsequently reencountering such a distractor then retrieves the associated response. Although a large body of evidence supports the existence of this effect, the specific structure of distractor-response bindings is still unclear. Here, we test the predictions derived from 2 possible assumptions about the structure of bindings between distractors and responses. According to a configural approach, the entire distractor object is integrated with a response, and only upon repetition of the entire distractor object the associated response would be retrieved. According to an elemental approach, one would predict integration of individual distractor features with the response and retrieval due to the repetition of an individual distractor feature. Four experiments indicate that both, configural and elemental bindings exist and specify boundary conditions for each type of binding. These findings provide detailed insights into the architecture of bindings between response-irrelevant stimuli and actions and thus allow for specifying how distractor stimuli influence human behavior. (PsycINFO Database Record (c) 2016 APA, all rights reserved).

  2. Ternary Complex Factors and Cofactors Are Essential for Human T-Cell Leukemia Virus Type 1 Tax Transactivation of the Serum Response Element

    PubMed Central

    Shuh, Maureen; Derse, David

    2000-01-01

    The human T-cell leukemia virus type 1 Tax protein activates the expression of cellular immediate early genes controlled by the serum response element (SRE), which contains both the serum response factor (SRF) binding element (CArG box) and the ternary complex factor (TCF) binding element (Ets box). We show that TCF binding is necessary for Tax activation of the SRE and that Tax directly interacts with TCFs in vitro. In addition, Tax interactions with CREB binding protein (CBP) and p300- and CBP-associated factor were found to be essential for Tax activation of SRF-mediated transcription. PMID:11070040

  3. Mechanisms of extracellular signal-regulated kinase/cAMP response element-binding protein/brain-derived neurotrophic factor signal transduction pathway in depressive disorder☆

    PubMed Central

    Wang, Hongyan; Zhang, Yingquan; Qiao, Mingqi

    2013-01-01

    The extracellular signal-regulated kinase/cAMP response element-binding protein/brain-derived neurotrophic factor signal transduction pathway plays an important role in the mechanism of action of antidepressant drugs and has dominated recent studies on the pathogenesis of depression. In the present review we summarize the known roles of extracellular signal-regulated kinase, cAMP response element-binding protein and brain-derived neurotrophic factor in the pathogenesis of depression and in the mechanism of action of antidepressant medicines. The extracellular signal-regulated kinase/cAMP response element-binding protein/brain-derived neurotrophic factor pathway has potential to be used as a biological index to help diagnose depression, and as such it is considered as an important new target in the treatment of depression. PMID:25206732

  4. Meta-analysis of the effect of overexpression of dehydration-responsive element binding family genes on temperature stress tolerance and related responses

    USDA-ARS?s Scientific Manuscript database

    C-repeat/dehydration-responsive element binding proteins are transcription factors that play a critical role in plant response to temperature stress. Over-expression of CBF/DREB genes has been demonstrated to enhance temperature stress tolerance. A series of physiological and biochemical modificat...

  5. Cryptic glucocorticoid receptor-binding sites pervade genomic NF-κB response elements.

    PubMed

    Hudson, William H; Vera, Ian Mitchelle S de; Nwachukwu, Jerome C; Weikum, Emily R; Herbst, Austin G; Yang, Qin; Bain, David L; Nettles, Kendall W; Kojetin, Douglas J; Ortlund, Eric A

    2018-04-06

    Glucocorticoids (GCs) are potent repressors of NF-κB activity, making them a preferred choice for treatment of inflammation-driven conditions. Despite the widespread use of GCs in the clinic, current models are inadequate to explain the role of the glucocorticoid receptor (GR) within this critical signaling pathway. GR binding directly to NF-κB itself-tethering in a DNA binding-independent manner-represents the standing model of how GCs inhibit NF-κB-driven transcription. We demonstrate that direct binding of GR to genomic NF-κB response elements (κBREs) mediates GR-driven repression of inflammatory gene expression. We report five crystal structures and solution NMR data of GR DBD-κBRE complexes, which reveal that GR recognizes a cryptic response element between the binding footprints of NF-κB subunits within κBREs. These cryptic sequences exhibit high sequence and functional conservation, suggesting that GR binding to κBREs is an evolutionarily conserved mechanism of controlling the inflammatory response.

  6. Identification and characterization of a HeLa nuclear protein that specifically binds to the trans-activation-response (TAR) element of human immunodeficiency virus.

    PubMed Central

    Marciniak, R A; Garcia-Blanco, M A; Sharp, P A

    1990-01-01

    Human immunodeficiency virus type 1 RNAs contain a sequence, trans-activation-response (TAR) element, which is required for tat protein-mediated trans-activation of viral gene expression. We have identified a nuclear protein from extracts of HeLa cells that binds to the TAR element RNA in a sequence-specific manner. The binding of this 68-kDa polypeptide was detected by UV cross-linking proteins to TAR element RNA transcribed in vitro. Competition experiments were performed by using a partially purified preparation of the protein to quantify the relative binding affinities of TAR element RNA mutants. The binding affinity of the TAR mutants paralleled the reported ability of those mutants to support tat trans-activation in vivo. We propose that this cellular protein moderates TAR activity in vivo. Images PMID:2333305

  7. Transcriptional switches in the control of macronutrient metabolism.

    PubMed

    Wise, Alan

    2008-06-01

    This review shows how some transcription factors respond to alterations in macronutrients. Carbohydrates induce enzymes for their metabolism and fatty acid synthesis. Fatty acids reduce carbohydrate processing, induce enzymes for their metabolism, and increase both gluconeogenesis and storage of fat. Fat stores help control carbohydrate uptake by other cells. The following main transcription factors are discussed: carbohydrate response element-binding protein; sterol regulatory element-binding protein-1c, cyclic AMP response element-binding protein, peroxisome proliferator-activated receptor-alpha, and peroxisome proliferator-activated receptor-gamma.

  8. ABFs, a family of ABA-responsive element binding factors.

    PubMed

    Choi, H; Hong, J; Ha, J; Kang, J; Kim, S Y

    2000-01-21

    Abscisic acid (ABA) plays an important role in environmental stress responses of higher plants during vegetative growth. One of the ABA-mediated responses is the induced expression of a large number of genes, which is mediated by cis-regulatory elements known as abscisic acid-responsive elements (ABREs). Although a number of ABRE binding transcription factors have been known, they are not specifically from vegetative tissues under induced conditions. Considering the tissue specificity of ABA signaling pathways, factors mediating ABA-dependent stress responses during vegetative growth phase may thus have been unidentified so far. Here, we report a family of ABRE binding factors isolated from young Arabidopsis plants under stress conditions. The factors, isolated by a yeast one-hybrid system using a prototypical ABRE and named as ABFs (ABRE binding factors) belong to a distinct subfamily of bZIP proteins. Binding site selection assay performed with one ABF showed that its preferred binding site is the strong ABRE, CACGTGGC. ABFs can transactivate an ABRE-containing reporter gene in yeast. Expression of ABFs is induced by ABA and various stress treatments, whereas their induction patterns are different from one another. Thus, a new family of ABRE binding factors indeed exists that have the potential to activate a large number of ABA/stress-responsive genes in Arabidopsis.

  9. An ABA-responsive DRE-binding protein gene from Setaria italica, SiARDP, the target gene of SiAREB, plays a critical role under drought stress.

    PubMed

    Li, Cong; Yue, Jing; Wu, Xiaowei; Xu, Cong; Yu, Jingjuan

    2014-10-01

    The DREB (dehydration-responsive element binding)-type transcription factors regulate the expression of stress-inducible genes by binding the DRE/CRT cis-elements in promoter regions. The upstream transcription factors that regulate the transcription of DREB transcription factors have not been clearly defined, although the function of DREB transcription factors in abiotic stress is known. In this study, an abscisic acid (ABA)-responsive DREB-binding protein gene (SiARDP) was cloned from foxtail millet (Setaria italica). The transcript level of SiARDP increased not only after drought, high salt, and low temperature stresses, but also after an ABA treatment in foxtail millet seedlings. Two ABA-responsive elements (ABRE1: ACGTGTC; ABRE2: ACGTGGC) exist in the promoter of SiARDP. Further analyses showed that two ABA-responsive element binding (AREB)-type transcription factors, SiAREB1 and SiAREB2, could physically bind to the ABRE core element in vitro and in vivo. The constitutive expression of SiARDP in Arabidopsis thaliana enhanced drought and salt tolerance during seed germination and seedling development, and overexpression of SiARDP in foxtail millet improved drought tolerance. The expression levels of target genes of SiARDP were upregulated in transgenic Arabidopsis and foxtail millet. These results reveal that SiARDP, one of the target genes of SiAREB, is involved in ABA-dependent signal pathways and plays a critical role in the abiotic stress response in plants. © The Author 2014. Published by Oxford University Press on behalf of the Society for Experimental Biology.

  10. Long-Lasting Impairment of mGluR5-Activated Intracellular Pathways in the Striatum After Withdrawal of Cocaine Self-Administration

    PubMed Central

    Hoffmann, Hanne Mette; Crouzin, Nadine; Moreno, Estefanía; Raivio, Noora; Fuentes, Silvia; McCormick, Peter J.; Vignes, Michel

    2017-01-01

    Abstract Background: Cocaine addiction continues to be a major heath concern, and despite public health intervention there is a lack of efficient pharmacological treatment options. A newly identified potential target are the group I metabotropic glutamate receptors, with allosteric modulators showing particular promise. Methods: We evaluated the capacity of group I metabotropic glutamate receptors to induce functional responses in ex vivo striatal slices from rats with (1) acute cocaine self-administration, (2) chronic cocaine self-administration, and (3) 60 days cocaine self-administration withdrawal by Western blot and extracellular recordings of synaptic transmission. Results: We found that striatal group I metabotropic glutamate receptors are the principal mediator of the mGluR1/5 agonist (RS)-3,5-dihydroxyphenylglycine-induced cAMP responsive-element binding protein phosphorylation. Both acute and chronic cocaine self-administration blunted group I metabotropic glutamate receptor effects on cAMP responsive-element binding protein phosphorylation in the striatum, which correlated with the capacity to induce long-term depression, an effect that was maintained 60 days after chronic cocaine self-administration withdrawal. In the nucleus accumbens, the principal brain region mediating the rewarding effects of drugs, chronic cocaine self-administration blunted group I metabotropic glutamate receptor stimulation of extracellular signal-regulated protein kinases 1/2 and cAMP responsive-element binding protein. Interestingly, the group I metabotropic glutamate receptor antagonist/inverse-agonist, 2-methyl-6-(phenylethynyl)pyridine hydrochloride, led to a specific increase in cAMP responsive-element binding protein phosphorylation after chronic cocaine self-administration, specifically in the nucleus accumbens, but not in the striatum. Conclusions: Prolonged cocaine self-administration, through withdrawal, leads to a blunting of group I metabotropic glutamate receptor responses in the striatum. In addition, specifically in the accumbens, group I metabotropic glutamate receptor signaling to cAMP responsive-element binding protein shifts from an agonist-induced to an antagonist-induced cAMP responsive-element binding protein phosphorylation. PMID:27744406

  11. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lee, Sungsoo, E-mail: sungsoo.lee@utsouthwestern.edu; Wang, Ping-Yuan; Jeong, Yangsik

    Oxysterol binding protein related protein 1S (ORP1S) is a member of a family of sterol transport proteins. Here we present evidence that ORP1S translocates from the cytoplasm to the nucleus in response to sterol binding. The sterols that best promote nuclear import of ORP1S also activate the liver X receptor (LXR) transcription factors and we show that ORP1S binds to LXRs, promotes binding of LXRs to LXR response elements (LXREs) and specifically enhances LXR-dependent transcription via the ME.1 and ME.2 enhancer elements of the apoE gene. We propose that ORP1S is a cytoplasmic sterol sensor, which transports sterols to themore » nucleus and promotes LXR-dependent gene transcription through select enhancer elements. -- Highlights: Black-Right-Pointing-Pointer ORP1S translocates to the nucleus in response to sterol binding. Black-Right-Pointing-Pointer The sterols that best promote nuclear import of ORP1S are LXR agonists. Black-Right-Pointing-Pointer ORP1S binds to LXRs, enhances binding of LXRs to LXREs and promotes LXR-dependent transcription of apoE.« less

  12. The high mobility group protein 1 enhances binding of the estrogen receptor DNA binding domain to the estrogen response element.

    PubMed

    Romine, L E; Wood, J R; Lamia, L A; Prendergast, P; Edwards, D P; Nardulli, A M

    1998-05-01

    We have examined the ability of the high-mobility group protein 1 (HMG1) to alter binding of the estrogen receptor DNA-binding domain (DBD) to the estrogen response element (ERE). HMG1 dramatically enhanced binding of purified, bacterially expressed DBD to the consensus vitellogenin A2 ERE in a dose-dependent manner. The ability of HMG1 to stabilize the DBD-ERE complex resulted in part from a decrease in the dissociation rate of the DBD from the ERE. Antibody supershift experiments demonstrated that HMG1 was also capable of forming a ternary complex with the ERE-bound DBD in the presence of HMG1-specific antibody. HMG1 did not substantially affect DBD-ERE contacts as assessed by methylation interference assays, nor did it alter the ability of the DBD to induce distortion in ERE-containing DNA fragments. Because HMG1 dramatically enhanced estrogen receptor DBD binding to the ERE, and the DBD is the most highly conserved region among the nuclear receptor superfamily members, HMG1 may function to enhance binding of other nuclear receptors to their respective response elements and act in concert with coactivator proteins to regulate expression of hormone-responsive genes.

  13. Interaction between two cis-acting elements, ABRE and DRE, in ABA-dependent expression of Arabidopsis rd29A gene in response to dehydration and high-salinity stresses.

    PubMed

    Narusaka, Yoshihiro; Nakashima, Kazuo; Shinwari, Zabta K; Sakuma, Yoh; Furihata, Takashi; Abe, Hiroshi; Narusaka, Mari; Shinozaki, Kazuo; Yamaguchi-Shinozaki, Kazuko

    2003-04-01

    Many abiotic stress-inducible genes contain two cis-acting elements, namely a dehydration-responsive element (DRE; TACCGACAT) and an ABA-responsive element (ABRE; ACGTGG/TC), in their promoter regions. We precisely analyzed the 120 bp promoter region (-174 to -55) of the Arabidopsis rd29A gene whose expression is induced by dehydration, high-salinity, low-temperature, and abscisic acid (ABA) treatments and whose 120 bp promoter region contains the DRE, DRE/CRT-core motif (A/GCCGAC), and ABRE sequences. Deletion and base substitution analyses of this region showed that the DRE-core motif functions as DRE and that the DRE/DRE-core motif could be a coupling element of ABRE. Gel mobility shift assays revealed that DRE-binding proteins (DREB1s/CBFs and DREB2s) bind to both DRE and the DRE-core motif and that ABRE-binding proteins (AREBs/ABFs) bind to ABRE in the 120 bp promoter region. In addition, transactivation experiments using Arabidopsis leaf protoplasts showed that DREBs and AREBs cumulatively transactivate the expression of a GUS reporter gene fused to the 120 bp promoter region of rd29A. These results indicate that DRE and ABRE are interdependent in the ABA-responsive expression of the rd29A gene in response to ABA in Arabidopsis.

  14. Estrogen-dependent downregulation of hairy and enhancer of split homolog-1 gene expression in breast cancer cells is mediated via a 3' distal element.

    PubMed

    Müller, Patrick; Merrell, Kenneth W; Crofts, Justin D; Rönnlund, Caroline; Lin, Chin-Yo; Gustafsson, Jan-Ake; Ström, Anders

    2009-03-01

    Regulation of hairy and enhancer of split homologue-1 (HES-1) by estradiol and all-trans retinoic acid affects proliferation of human breast cancer cells. Here, we identify and characterize cis-regulatory elements involved in HES-1 regulation. In the distal 5' promoter of the HES-1 gene, we found a retinoic acid response element and in the distal 3' region, an estrogen receptor alpha(ER)alpha binding site. The ERalpha binding site, composed of an estrogen response element (ERE) and an ERE half-site, is important for both ERalpha binding and transcriptional regulation. Chromatin immunoprecipitation assays revealed that ERalpha is recruited to the ERE and associates with the HES-1 promoter. We also show recruitment of nuclear receptor co-regulators to the ERE in response to estradiol, followed by a decrease in histone acetylation and RNA polymerase II docking in the HES-1 promoter region. Our findings are consistent with a novel type of repressive estrogen response element in the distal 3' region of the HES-1 gene.

  15. Regulatory elements in vivo in the promoter of the abscisic acid responsive gene rab17 from maize.

    PubMed

    Busk, P K; Jensen, A B; Pagès, M

    1997-06-01

    The rab17 gene from maize is transcribed in late embryonic development and is responsive to abscisic acid and water stress in embryo and vegetative tissues. In vivo footprinting and transient transformation of rab17 were performed in embryos and vegetative tissues to characterize the cis-elements involved in regulation of the gene. By in vivo footprinting, protein binding was observed to nine elements in the promoter, which correspond to five putative ABREs (abscisic acid responsive elements) and four other sequences. The footprints indicated that distinct proteins interact with these elements in the two developmental stages. In transient transformation, six of the elements were important for high level expression of the rab17 promoter in embryos, whereas only three elements were important in leaves. The cis-acting sequences can be divided in embryo-specific, ABA-specific and leaf-specific elements on the basis of protein binding and the ability to confer expression of rab17. We found one positive, new element, called GRA, with the sequence CACTGGCCGCCC. This element was important for transcription in leaves but not in embryos. Two other non-ABRE elements that stimulated transcription from the rab17 promoter resemble previously described abscisic acid and drought-inducible elements. There were differences in protein binding and function of the five ABREs in the rab17 promoter. The possible reasons for these differences are discussed. The in vivo data obtained suggest that an embryo-specific pathway regulates transcription of the rab genes during development, whereas another pathway is responsible for induction in response to ABA and drought in vegetative tissues.

  16. Dehydration responsive element binding transcription factors and their applications for the engineering of stress tolerance.

    PubMed

    Agarwal, Pradeep K; Gupta, Kapil; Lopato, Sergiy; Agarwal, Parinita

    2017-04-01

    Dehydration responsive element binding (DREB) factors or CRT element binding factors (CBFs) are members of the AP2/ERF family, which comprises a large number of stress-responsive regulatory genes. This review traverses almost two decades of research, from the discovery of DREB/CBF factors to their optimization for application in plant biotechnology. In this review, we describe (i) the discovery, classification, structure, and evolution of DREB genes and proteins; (ii) induction of DREB genes by abiotic stresses and involvement of their products in stress responses; (iii) protein structure and DNA binding selectivity of different groups of DREB proteins; (iv) post-transcriptional and post-translational mechanisms of DREB transcription factor (TF) regulation; and (v) physical and/or functional interaction of DREB TFs with other proteins during plant stress responses. We also discuss existing issues in applications of DREB TFs for engineering of enhanced stress tolerance and improved performance under stress of transgenic crop plants. © The Author 2017. Published by Oxford University Press on behalf of the Society for Experimental Biology. All rights reserved. For permissions, please email: journals.permissions@oup.com.

  17. Long-Term Memory for Place Learning Is Facilitated by Expression of cAMP Response Element-Binding Protein in the Dorsal Hippocampus

    ERIC Educational Resources Information Center

    Brightwell, Jennifer J.; Smith, Clayton A.; Neve, Rachael L.; Colombo, Paul J.

    2007-01-01

    Extensive research has shown that the hippocampus is necessary for consolidation of long-term spatial memory in rodents. We reported previously that rats using a place strategy to solve a cross maze task showed sustained phosphorylation of hippocampus cyclic AMP response element-binding protein (CREB), a transcription factor implicated in…

  18. Molecular analysis of UAS(E), a cis element containing stress response elements responsible for ethanol induction of the KlADH4 gene of Kluyveromyces lactis.

    PubMed

    Mazzoni, C; Santori, F; Saliola, M; Falcone, C

    2000-01-01

    KlADH4 is a gene of Kluyveromyces lactis encoding a mitochondrial alcohol dehydrogenase activity, which is specifically induced by ethanol and insensitive to glucose repression. In this work, we report the molecular analysis of UAS(E), an element of the KlADH4 promoter which is essential for the induction of KlADH4 in the presence of ethanol. UAS(E) contains five stress response elements (STREs), which have been found in many genes of Saccharomyces cerevisiae involved in the response of cells to conditions of stress. Whereas KlADH4 is not responsive to stress conditions, the STREs present in UAS(E) seem to play a key role in the induction of the gene by ethanol, a situation that has not been observed in the related yeast S. cerevisiae. Gel retardation experiments showed that STREs in the KlADH4 promoter can bind factor(s) under non-inducing conditions. Moreover, we observed that the RAP1 binding site present in UAS(E) binds KlRap1p.

  19. Isolation and functional characterization of CE1 binding proteins.

    PubMed

    Lee, Sun-ji; Park, Ji Hye; Lee, Mi Hun; Yu, Ji-hyun; Kim, Soo Young

    2010-12-16

    Abscisic acid (ABA) is a plant hormone that controls seed germination, protective responses to various abiotic stresses and seed maturation. The ABA-dependent processes entail changes in gene expression. Numerous genes are regulated by ABA, and promoter analyses of the genes revealed that cis-elements sharing the ACGTGGC consensus sequence are ubiquitous among ABA-regulated gene promoters. The importance of the core sequence, which is generally known as ABA response element (ABRE), has been demonstrated by various experiments, and its cognate transcription factors known as ABFs/AREBs have been identified. Although necessary, ABRE alone is not sufficient, and another cis-element known as "coupling element (CE)" is required for full range ABA-regulation of gene expression. Several CEs are known. However, despite their importance, the cognate transcription factors mediating ABA response via CEs have not been reported to date. Here, we report the isolation of transcription factors that bind one of the coupling elements, CE1. To isolate CE1 binding proteins, we carried out yeast one-hybrid screens. Reporter genes containing a trimer of the CE1 element were prepared and introduced into a yeast strain. The yeast was transformed with library DNA that represents RNA isolated from ABA-treated Arabidopsis seedlings. From the screen of 3.6 million yeast transformants, we isolated 78 positive clones. Analysis of the clones revealed that a group of AP2/ERF domain proteins binds the CE1 element. We investigated their expression patterns and analyzed their overexpression lines to investigate the in vivo functions of the CE element binding factors (CEBFs). Here, we show that one of the CEBFs, AtERF13, confers ABA hypersensitivity in Arabidopsis, whereas two other CEBFs enhance sugar sensitivity. Our results indicate that a group of AP2/ERF superfamily proteins interacts with CE1. Several CEBFs are known to mediate defense or abiotic stress response, but the physiological functions of other CEBFs remain to be determined. Our in vivo functional analysis of several CEBFs suggests that they are likely to be involved in ABA and/or sugar response. Together with previous results reported by others, our current data raise an interesting possibility that the coupling element CE1 may function not only as an ABRE but also as an element mediating biotic and abiotic stress responses.

  20. Resveratrol stimulates c-Fos gene transcription via activation of ERK1/2 involving multiple genetic elements.

    PubMed

    Thiel, Gerald; Rössler, Oliver G

    2018-06-05

    The polyphenol resveratrol is found in many plant and fruits and is a constituent of our diet. Resveratrol has been proposed to have chemopreventive and anti-inflammatory activities. On the cellular level, resveratrol activates stimulus-regulated transcription factors. To identify resveratrol-responsive elements within a natural gene promoter, the molecular pathway leading to c-Fos gene expression by resveratrol was dissected. The c-Fos gene encodes a basic region leucine zipper transcription factor and is a prototype of an immediate-early gene that is regulated by a wide range of signaling molecules. We analyzed chromatin-integrated c-Fos promoter-luciferase reporter genes where transcription factor binding sites were destroyed by point mutations or deletion mutagenesis. The results show that mutation of the binding sites for serum response factor (SRF), activator protein-1 (AP-1) and cAMP response element binding protein (CREB) significantly reduced reporter gene transcription following stimulation of the cells with resveratrol. Inactivation of the binding sites for signal transducer and activator of transcription (STAT) or ternary complex factors did not influence resveratrol-regulated c-Fos promoter activity. Thus, the c-Fos promoter contains three resveratrol-responsive elements, the cAMP response element (CRE), and the binding sites for SRF and AP-1. Moreover, we show that the transcriptional activation potential of the c-Fos protein is increased in resveratrol-stimulated cells, indicating that the biological activity of c-Fos is elevated by resveratrol stimulation. Pharmacological and genetic experiments revealed that the protein kinase ERK1/2 is the signal transducer that connects resveratrol treatment with the c-Fos gene. Copyright © 2018 Elsevier B.V. All rights reserved.

  1. Capacity for cooperative binding of thyroid hormone (T3) receptor dimers defines wild type T3 response elements.

    PubMed

    Brent, G A; Williams, G R; Harney, J W; Forman, B M; Samuels, H H; Moore, D D; Larsen, P R

    1992-04-01

    Thyroid hormone response elements (T3REs) have been identified in a variety of promoters including those directing expression of rat GH (rGH), alpha-myosin heavy chain (rMHC), and malic enzyme (rME). A detailed biochemical and genetic analysis of the rGH element has shown that it consists of three hexamers related to the consensus [(A/G)GGT(C/A)A]. We have extended this analysis to the rMHC and rME elements. Binding of highly purified thyroid hormone receptor (T3R) to T3REs was determined using the gel shift assay, and thyroid hormone (T3) induction was measured in transient tranfections. We show that the wild type version of each of the three elements binds T3R dimers cooperatively. Mutational analysis of the rMHC and rME elements identified domains important for binding T3R dimers and allowed a direct determination of the relationship between T3R binding and function. In each element two hexamers are required for dimer binding, and mutations that interfere with dimer formation significantly reduce T3 induction. Similar to the rGH element, the rMHC T3RE contains three hexameric domains arranged as a direct repeat followed by an inverted copy, although the third domain is weaker than in rGH. All three are required for full function and T3R binding. The rME T3RE is a two-hexamer direct repeat T3RE, which also binds T3R monomer and dimer. Across a series of mutant elements, there was a strong correlation between dimer binding in vitro and function in vivo for rMHC (r = 0.99, P less than 0.01) and rME (r = 0.67, P less than 0.05) T3REs. Our results demonstrate a similar pattern of T3R dimer binding to a diverse array of hexameric sequences and arrangements in three wild type T3REs. Addition of nuclear protein enhanced T3R binding but did not alter the specificity of binding to wild type or mutant elements. Binding of purified T3R to T3REs was highly correlated with function, both with and without the addition of nuclear protein. T3R dimer formation is the common feature which defines the capacity of these elements to confer T3 induction.

  2. Lost time: Bindings do not represent temporal order information.

    PubMed

    Moeller, Birte; Frings, Christian

    2018-06-04

    Many accounts of human action control assume bindings between features of stimuli and responses of individual events. One widely accepted assumption about these bindings is that they do not contain temporal-order representations regarding the integrated elements. Even though several theories either explicitly or implicitly include it, this assumption has never been tested directly. One reason for this lack of evidence is likely that typical stimulus-response binding paradigms are inapt for such a test. Adapting a new paradigm of response-response binding to include order switches between response integration and retrieval, we were able to analyze possible representation of order information in bindings for the first time. Binding effects were identical for intact and switched response orders, indicating that bindings indeed include no temporal-order information.

  3. Signaling cross-talk between peroxisome proliferator-activated receptor/retinoid X receptor and estrogen receptor through estrogen response elements.

    PubMed

    Keller, H; Givel, F; Perroud, M; Wahli, W

    1995-07-01

    Peroxisome proliferator-activated receptors (PPARs) and retinoid X receptors (RXRs) are nuclear hormone receptors that are activated by fatty acids and 9-cis-retinoic acid, respectively. PPARs and RXRs form heterodimers that activate transcription by binding to PPAR response elements (PPREs) in the promoter of target genes. The PPREs described thus far consist of a direct tandem repeat of the AGGTCA core element with one intervening nucleotide. We show here that the vitellogenin A2 estrogen response element (ERE) can also function as a PPRE and is bound by a PPAR/RXR heterodimer. Although this heterodimer can bind to several other ERE-related palindromic response elements containing AGGTCA half-sites, only the ERE is able to confer transactivation of test reporter plasmids, when the ERE is placed either close to or at a distance from the transcription initiation site. Examination of natural ERE-containing promoters, including the pS2, very-low-density apolipoprotein II and vitellogenin A2 genes, revealed considerable differences in the binding of PPAR/RXR heterodimers to these EREs. In their natural promoter context, these EREs did not allow transcriptional activation by PPARs/RXRs. Analysis of this lack of stimulation of the vitellogenin A2 promoter demonstrated that PPARs/RXRs bind to the ERE but cannot transactivate due to a nonpermissive promoter structure. As a consequence, PPARs/RXRs inhibit transactivation by the estrogen receptor through competition for ERE binding. This is the first example of signaling cross-talk between PPAR/RXR and estrogen receptor.

  4. Amino Acid Change in the Carbohydrate Response Element Binding Protein is associated with lower triglycerides and myocardial infarction incidence depending on level of adherence to the Mediterranean diet in the PREDIMED trial

    USDA-ARS?s Scientific Manuscript database

    A variant (rs3812316, C771G, and Gln241His) in the MLXIPL (Max-like protein X interacting protein-like) gene encoding the carbohydrate response element binding protein has been associated with lower triglycerides. However, its association with cardiovascular diseases and gene-diet interactions modul...

  5. Spatial Memory in the Morris Water Maze and Activation of Cyclic AMP Response Element-Binding (CREB) Protein within the Mouse Hippocampus

    ERIC Educational Resources Information Center

    Porte, Yves; Buhot, Marie Christine; Mons, Nicole E.

    2008-01-01

    We investigated the spatio-temporal dynamics of learning-induced cAMP response element-binding protein activation/phosphorylation (pCREB) in mice trained in a spatial reference memory task in the water maze. Using immunohistochemistry, we examined pCREB immunoreactivity (pCREB-ir) in hippocampal CA1 and CA3 and related brain structures. During the…

  6. Regulation of cyclic adenosine monophosphate response element binding protein on renin expression in kidney via complex cyclic adenosine monophosphate response element-binding-protein-binding protein/P300 recruitment.

    PubMed

    Li, Pei; Zhang, Jing; Zhu, Yuanfang; Liu, Ming; Xuan, Jin

    2015-11-01

    Renin synthesis and release is the rate-limiting step in the renin-angiotensin system, because cyclic adenosine monophosphate (cAMP) has been identified as dominant pathway for renin gene expression, and cAMP response element-binding protein (CREB) is found in the human and mouse renin promoter. This study aimed to evaluate the role of CREB in expression of the renin gene. We created conditional deletion of CREB in mice with low-sodium diet, specifically in renin cells of the kidney. To assess the effect of CREB on renin expression, immunostaining of renin was used in samples from wild-type mice and mice with gene knock-down of CREB. Cyclic AMP response element-binding-protein-binding protein (CBP) and p300 were measured in cultured renin cells of the mice, and RNA detection was done with real-time polymerase chain reaction. With low-sodium diet, renin was expressed along the whole wall of the afferent glomerular arterioles in wild-type mice, while there was no increase or even decrease in renin expression in CREB-specific deletion mice; RNA level of renin in cultured cells decreased by 50% with single knock-down of CREB, CBP, or p300, and decreased 70% with triple knock-down of CREB, CBP, and p300. This study found that CREB was important for renin synthesis and the role of CREB can be achieved through the recruitment of co-activators CBP and p300.

  7. Hydrogen-Deuterium Exchange Mass Spectrometry Reveals Calcium Binding Properties and Allosteric Regulation of Downstream Regulatory Element Antagonist Modulator (DREAM).

    PubMed

    Zhang, Jun; Li, Jing; Craig, Theodore A; Kumar, Rajiv; Gross, Michael L

    2017-07-18

    Downstream regulatory element antagonist modulator (DREAM) is an EF-hand Ca 2+ -binding protein that also binds to a specific DNA sequence, downstream regulatory elements (DRE), and thereby regulates transcription in a calcium-dependent fashion. DREAM binds to DRE in the absence of Ca 2+ but detaches from DRE under Ca 2+ stimulation, allowing gene expression. The Ca 2+ binding properties of DREAM and the consequences of the binding on protein structure are key to understanding the function of DREAM. Here we describe the application of hydrogen-deuterium exchange mass spectrometry (HDX-MS) and site-directed mutagenesis to investigate the Ca 2+ binding properties and the subsequent conformational changes of full-length DREAM. We demonstrate that all EF-hands undergo large conformation changes upon calcium binding even though the EF-1 hand is not capable of binding to Ca 2+ . Moreover, EF-2 is a lower-affinity site compared to EF-3 and -4 hands. Comparison of HDX profiles between wild-type DREAM and two EF-1 mutated constructs illustrates that the conformational changes in the EF-1 hand are induced by long-range structural interactions. HDX analyses also reveal a conformational change in an N-terminal leucine-charged residue-rich domain (LCD) remote from Ca 2+ -binding EF-hands. This LCD domain is responsible for the direct interaction between DREAM and cAMP response element-binding protein (CREB) and regulates the recruitment of the co-activator, CREB-binding protein. These long-range interactions strongly suggest how conformational changes transmit the Ca 2+ signal to CREB-mediated gene transcription.

  8. Novel DNA Motif Binding Activity Observed In Vivo With an Estrogen Receptor α Mutant Mouse

    PubMed Central

    Li, Leping; Grimm, Sara A.; Winuthayanon, Wipawee; Hamilton, Katherine J.; Pockette, Brianna; Rubel, Cory A.; Pedersen, Lars C.; Fargo, David; Lanz, Rainer B.; DeMayo, Francesco J.; Schütz, Günther; Korach, Kenneth S.

    2014-01-01

    Estrogen receptor α (ERα) interacts with DNA directly or indirectly via other transcription factors, referred to as “tethering.” Evidence for tethering is based on in vitro studies and a widely used “KIKO” mouse model containing mutations that prevent direct estrogen response element DNA- binding. KIKO mice are infertile, due in part to the inability of estradiol (E2) to induce uterine epithelial proliferation. To elucidate the molecular events that prevent KIKO uterine growth, regulation of the pro-proliferative E2 target gene Klf4 and of Klf15, a progesterone (P4) target gene that opposes the pro-proliferative activity of KLF4, was evaluated. Klf4 induction was impaired in KIKO uteri; however, Klf15 was induced by E2 rather than by P4. Whole uterine chromatin immunoprecipitation-sequencing revealed enrichment of KIKO ERα binding to hormone response elements (HREs) motifs. KIKO binding to HRE motifs was verified using reporter gene and DNA-binding assays. Because the KIKO ERα has HRE DNA-binding activity, we evaluated the “EAAE” ERα, which has more severe DNA-binding domain mutations, and demonstrated a lack of estrogen response element or HRE reporter gene induction or DNA-binding. The EAAE mouse has an ERα null–like phenotype, with impaired uterine growth and transcriptional activity. Our findings demonstrate that the KIKO mouse model, which has been used by numerous investigators, cannot be used to establish biological functions for ERα tethering, because KIKO ERα effectively stimulates transcription using HRE motifs. The EAAE-ERα DNA-binding domain mutant mouse demonstrates that ERα DNA-binding is crucial for biological and transcriptional processes in reproductive tissues and that ERα tethering may not contribute to estrogen responsiveness in vivo. PMID:24713037

  9. Specificity determinants for the abscisic acid response element.

    PubMed

    Sarkar, Aditya Kumar; Lahiri, Ansuman

    2013-01-01

    Abscisic acid (ABA) response elements (ABREs) are a group of cis-acting DNA elements that have been identified from promoter analysis of many ABA-regulated genes in plants. We are interested in understanding the mechanism of binding specificity between ABREs and a class of bZIP transcription factors known as ABRE binding factors (ABFs). In this work, we have modeled the homodimeric structure of the bZIP domain of ABRE binding factor 1 from Arabidopsis thaliana (AtABF1) and studied its interaction with ACGT core motif-containing ABRE sequences. We have also examined the variation in the stability of the protein-DNA complex upon mutating ABRE sequences using the protein design algorithm FoldX. The high throughput free energy calculations successfully predicted the ability of ABF1 to bind to alternative core motifs like GCGT or AAGT and also rationalized the role of the flanking sequences in determining the specificity of the protein-DNA interaction.

  10. Dual DNA binding property of ABA insensitive 3 like factors targeted to promoters responsive to ABA and auxin.

    PubMed

    Nag, Ronita; Maity, Manas Kanti; Dasgupta, Maitrayee

    2005-11-01

    The ABA responsive ABI3 and the auxin responsive ARF family of transcription factors bind the CATGCATG (Sph) and TGTCTC core motifs in ABA and auxin response elements (ABRE and AuxRE), respectively. Several evidences indicate ABI3s to act downstream to auxin too. Because DNA binding domain of ABI3s shows significant overlap with ARFs we enquired whether auxin responsiveness through ABI3s could be mediated by their binding to canonical AuxREs. Investigations were undertaken through in vitro gel mobility shift assays (GMSA) using the DNA binding domain B3 of PvAlf (Phaseolus vulgaris ABI3 like factor) and upstream regions of auxin responsive gene GH3 (-267 to -141) and ABA responsive gene Em (-316 to -146) harboring AuxRE and ABRE, respectively. We demonstrate that B3 domain of PvAlf could bind AuxRE only when B3 was associated with its flanking domain B2 (B2B3). Such strict requirement of B2 domain was not observed with ABRE, where B3 could bind with or without being associated with B2. This dual specificity in DNA binding of ABI3s was also demonstrated with nuclear extracts of cultured cells of Arachis hypogea. Supershift analysis of ABRE and AuxRE bound nuclear proteins with antibodies raised against B2B3 domains of PvAlf revealed that ABI3 associated complexes were detectable in association with both cis elements. Competition GMSA confirmed the same complexes to bind ABRE and AuxRE. This dual specificity of ABI3 like factors in DNA binding targeted to natural promoters responsive to ABA and auxin suggests them to have a potential role in conferring crosstalk between these two phytohormones.

  11. A mammary cell-specific enhancer in mouse mammary tumor virus DNA is composed of multiple regulatory elements including binding sites for CTF/NFI and a novel transcription factor, mammary cell-activating factor.

    PubMed Central

    Mink, S; Härtig, E; Jennewein, P; Doppler, W; Cato, A C

    1992-01-01

    Mouse mammary tumor virus (MMTV) is a milk-transmitted retrovirus involved in the neoplastic transformation of mouse mammary gland cells. The expression of this virus is regulated by mammary cell type-specific factors, steroid hormones, and polypeptide growth factors. Sequences for mammary cell-specific expression are located in an enhancer element in the extreme 5' end of the long terminal repeat region of this virus. This enhancer, when cloned in front of the herpes simplex thymidine kinase promoter, endows the promoter with mammary cell-specific response. Using functional and DNA-protein-binding studies with constructs mutated in the MMTV long terminal repeat enhancer, we have identified two main regulatory elements necessary for the mammary cell-specific response. These elements consist of binding sites for a transcription factor in the family of CTF/NFI proteins and the transcription factor mammary cell-activating factor (MAF) that recognizes the sequence G Pu Pu G C/G A A G G/T. Combinations of CTF/NFI- and MAF-binding sites or multiple copies of either one of these binding sites but not solitary binding sites mediate mammary cell-specific expression. The functional activities of these two regulatory elements are enhanced by another factor that binds to the core sequence ACAAAG. Interdigitated binding sites for CTF/NFI, MAF, and/or the ACAAAG factor are also found in the 5' upstream regions of genes encoding whey milk proteins from different species. These findings suggest that mammary cell-specific regulation is achieved by a concerted action of factors binding to multiple regulatory sites. Images PMID:1328867

  12. Repeated administration of CGP 46381, a gamma-aminobutyric acidB antagonist, and ethosuximide suppresses seizure-associated cyclic adenosine 3'5' monophosphate response element- and activator protein-1 DNA-binding activities in lethargic (lh/lh) mice.

    PubMed

    Ishige, K; Endo, H; Saito, H; Ito, Y

    2001-01-19

    To characterize seizure-associated increases in cerebral cortical and thalamic cyclic AMP responsive element (CRE)- and activator protein 1 (AP-1) DNA-binding activities in lethargic (lh/lh) mice, a genetic model of absence seizures, we examined the effects of ethosuximide and CGP 46381 on these DNA-binding activities. Repeated administration (twice a day for 5 days) of ethosuximide (200 mg/kg) or CGP 46381 (60 mg/kg) attenuated both seizure behavior and the increased DNA-binding activities, and was more effective than a single administration of these drugs. These treatments did not affect either normal behavior or basal DNA-binding activities in non-epileptic control (+/+) mice. Gel supershift assays revealed that the increased CRE-binding activity was attributable to activation of the binding activity of CREB, and that the c-Fos-c-Jun complex was a component of the increased AP-1 DNA-binding activity.

  13. Multivalent DNA-binding properties of the HMG-1 proteins.

    PubMed Central

    Maher, J F; Nathans, D

    1996-01-01

    HMG-I proteins are DNA-binding proteins thought to affect the formation and function of transcription complexes. Each protein contains three DNA-binding motifs, known as AT-hooks, that bind in the minor groove of AT tracts in DNA. Multiple AT-hooks within a polypeptide chain should contact multiple AT tracts, but the rules governing these interactions have not been defined. In this study, we demonstrate that high-affinity binding uses two or three appropriately spaced AT tracts as a single multivalent binding site. These principles have implications for binding to regulatory elements such as the interferon beta enhancer, TATA boxes, and serum response elements. Images Fig. 1 Fig. 2 Fig. 3 Fig. 4 Fig. 5 PMID:8692884

  14. Two CGTCA motifs and a GHF1/Pit1 binding site mediate cAMP-dependent protein kinase A regulation of human growth hormone gene expression in rat anterior pituitary GC cells.

    PubMed

    Shepard, A R; Zhang, W; Eberhardt, N L

    1994-01-21

    We established the cis-acting elements which mediate cAMP responsiveness of the human growth hormone (hGH) gene in transiently transfected rat anterior pituitary tumor GC cells. Analysis of the intact hGH gene or hGH 5'-flanking DNA (5'-FR) coupled to the hGh cDNA or chloramphenicol acetyltransferase or luciferase genes, indicated that cAMP primarily stimulated hGH promoter activity. Cotransfection of a protein kinase A inhibitory protein cDNA demonstrated that the cAMP response was mediated by protein kinase A. Mutational analysis of the hGH promoter identified two core cAMP response element motifs (CGTCA) located at nucleotides -187/-183 (distal cAMP response element; dCRE) and -99/-95 (proximal cAMP response element; pCRE) and a pituitary-specific transcription factor (GHF1/Pit1) binding site at nucleotides -123/-112 (dGHF1) which were required for cAMP responsiveness. GHF1 was not a limiting factor, since overexpression of GHF1 in cotransfections increased basal but not forskolin induction levels. Gel shift analyses indicated that similar, ubiquitous, thermostable protein(s) specifically bound the pCRE and dCRE motifs. The CGTCA motif-binding factors were cAMP response element binding protein (CREB)/activating transcription factor-1 (ATF-1)-related, since the DNA-protein complex was competed by unlabeled CREB consensus oligonucleotide, specifically supershifted by antisera to CREB and ATF-1 but not ATF-2, and was bound by purified CREB with the same relative binding affinity (pCRE < dCRE < CREB) and mobility as the GC nuclear extract. UV cross-linking and Southwestern blot analyses revealed multiple DNA-protein interactions of which approximately 100- and approximately 45-kDa proteins were predominant; the approximately 45-kDa protein may represent CREB. These results indicate that CREB/ATF-1-related factors act coordinately with the cell-specific factor GHF1 to mediate cAMP-dependent regulation of hGH-1 gene transcription in anterior pituitary somatotrophs.

  15. Prefrontal Consolidation Supports the Attainment of Fear Memory Accuracy

    ERIC Educational Resources Information Center

    Vieira, Philip A.; Lovelace, Jonathan W.; Corches, Alex; Rashid, Asim J.; Josselyn, Sheena A.; Korzus, Edward

    2014-01-01

    The neural mechanisms underlying the attainment of fear memory accuracy for appropriate discriminative responses to aversive and nonaversive stimuli are unclear. Considerable evidence indicates that coactivator of transcription and histone acetyltransferase cAMP response element binding protein (CREB) binding protein (CBP) is critically required…

  16. The human haptoglobin gene promoter: interleukin-6-responsive elements interact with a DNA-binding protein induced by interleukin-6.

    PubMed Central

    Oliviero, S; Cortese, R

    1989-01-01

    Transcription of the human haptoglobin (Hp) gene is induced by interleukin-6 (IL-6) in the human hepatoma cell line Hep3B. Cis-acting elements responsible for this response are localized within the first 186 bp of the 5'-flanking region. Site-specific mutants of the Hp promoter fused to the chloramphenicol acetyl transferase (CAT) gene were analysed by transient transfection into uninduced and IL-6-treated Hep3B cells. We identified three regions, A, B and C, defined by mutation, which are important for the IL-6 response. Band shift experiments using nuclear extracts from untreated or IL-6-treated cells revealed the presence of IL-6-inducible DNA binding activities when DNA fragments containing the A or the C sequences were used. Competition experiments showed that both sequences bind to the same nuclear factors. Polymers of oligonucleotides containing either the A or the C regions confer IL-6 responsiveness to a truncated SV40 promoter. The B region forms several complexes with specific DNA-binding proteins different from those which bind to the A and C region. The B region complexes are identical in nuclear extracts from IL-6-treated and untreated cells. While important for IL-6 induction in the context of the haptoglobin promoter, the B site does not confer IL-6 inducibility to the SV40 promoter. Our results indicate that the IL-6 response of the haptoglobin promoter is dependent on the presence of multiple, partly redundant, cis-acting elements. Images PMID:2787245

  17. Effects of rare earth elements and REE-binding proteins on physiological responses in plants.

    PubMed

    Liu, Dongwu; Wang, Xue; Chen, Zhiwei

    2012-02-01

    Rare earth elements (REEs), which include 17 elements in the periodic table, share chemical properties related to a similar external electronic configuration. REEs enriched fertilizers have been used in China since the 1980s. REEs could enter the cell and cell organelles, influence plant growth, and mainly be bound with the biological macromolecules. REE-binding proteins have been found in some plants. In addition, the chlorophyll activities and photosynthetic rate can be regulated by REEs. REEs could promote the protective function of cell membrane and enhance the plant resistance capability to stress produced by environmental factors, and affect the plant physiological mechanism by regulating the Ca²⁺ level in the plant cells. The focus of present review is to describe how REEs and REE-binding proteins participate in the physiological responses in plants.

  18. Identification and functional characterization of BTas transactivator as a DNA-binding protein.

    PubMed

    Tan, Juan; Hao, Peng; Jia, Rui; Yang, Wei; Liu, Ruichang; Wang, Jinzhong; Xi, Zhen; Geng, Yunqi; Qiao, Wentao

    2010-09-30

    The genome of bovine foamy virus (BFV) encodes a transcriptional transactivator, namely BTas, that remarkably enhances gene expression by binding to the viral long-terminal repeat promoter (LTR) and internal promoter (IP). In this report, we characterized the functional domains of BFV BTas. BTas contains two major functional domains: the N-terminal DNA-binding domain (residues 1-133) and the C-terminal activation domain (residues 198-249). The complete BTas responsive regions were mapped to the positions -380/-140 of LTR and 9205/9276 of IP. Four BTas responsive elements were identified at the positions -368/-346, -327/-307, -306/-285 and -186/-165 of the BFV LTR, and one element was identified at the position 9243/9264 of the BFV IP. Unlike other foamy viruses, the five BTas responsive elements in BFV shared obvious sequence homology. These data suggest that among the complex retroviruses, BFV appears to have a unique transactivation mechanism. Crown Copyright 2010. Published by Elsevier Inc. All rights reserved.

  19. Inhibition of estrogen-responsive gene activation by the retinoid X receptor beta: evidence for multiple inhibitory pathways.

    PubMed

    Segars, J H; Marks, M S; Hirschfeld, S; Driggers, P H; Martinez, E; Grippo, J F; Brown, M; Wahli, W; Ozato, K

    1993-04-01

    The retinoid X receptor beta (RXR beta; H-2RIIBP) forms heterodimers with various nuclear hormone receptors and binds multiple hormone response elements, including the estrogen response element (ERE). In this report, we show that endogenous RXR beta contributes to ERE binding activity in nuclear extracts of the human breast cancer cell line MCF-7. To define a possible regulatory role of RXR beta regarding estrogen-responsive transcription in breast cancer cells, RXR beta and a reporter gene driven by the vitellogenin A2 ERE were transfected into estrogen-treated MCF-7 cells. RXR beta inhibited ERE-driven reporter activity in a dose-dependent and element-specific fashion. This inhibition occurred in the absence of the RXR ligand 9-cis retinoic acid. The RXR beta-induced inhibition was specific for estrogen receptor (ER)-mediated ERE activation because inhibition was observed in ER-negative MDA-MB-231 cells only following transfection of the estrogen-activated ER. No inhibition of the basal reporter activity was observed. The inhibition was not caused by simple competition of RXR beta with the ER for ERE binding, since deletion mutants retaining DNA binding activity but lacking the N-terminal or C-terminal domain failed to inhibit reporter activity. In addition, cross-linking studies indicated the presence of an auxiliary nuclear factor present in MCF-7 cells that contributed to RXR beta binding of the ERE. Studies using known heterodimerization partners of RXR beta confirmed that RXR beta/triiodothyronine receptor alpha heterodimers avidly bind the ERE but revealed the existence of another triiodothyronine-independent pathway of ERE inhibition. These results indicate that estrogen-responsive genes may be negatively regulated by RXR beta through two distinct pathways.

  20. An IFNG SNP with an estrogen-like response element selectively enhances promoter expression in peripheral but not lamina propria T cells.

    PubMed

    Gonsky, R; Deem, R L; Bream, J H; Young, H A; Targan, S R

    2006-07-01

    This study examines mucosa-specific regulatory pathways involved in modulation of interferon-gamma (IFN-gamma) in lamina propria T cells. Previous studies identified mucosa-specific CD2 cis-elements within the -204 to -108 bp IFNG promoter. Within this region, a single-site nucleotide polymorphism, -179G/T, imparts tumor necrosis factor-alpha stimulation of IFNG in peripheral blood lymphocytes, and is linked with accelerated AIDS progression. We discovered a putative estrogen response element (ERE) introduced by the -179T, which displays selective activation in peripheral blood mononuclear cells (PBMC) vs lamina propria mononuclear cells (LPMC). Transfection of PBMC with constructs containing the -179G or -179T site revealed CD2-mediated enhancement of the -179T compared to -179G allele, although, in LPMC, a similar level of expression was detected. Electrophoretic mobility shift assay (EMSA) analysis demonstrated CD2-mediated nucleoprotein binding to the -179T but not the -179G in PBMC. In LPMC, binding is constitutive to both -179G and -179T regions. Sequence and EMSA analysis suggests that the -179T allele creates an ERE-like binding site capable of binding recombinant estrogen receptor. Estrogen response element transactivation is enhanced by CD2 signaling, but inhibited by estrogen in PBMC but not in LPMC, although expression of estrogen receptor was similar. This is the first report to describe a potential molecular mechanism responsible for selectively controlling IFN-gamma production in LPMC.

  1. Cross-talk between abscisic acid-dependent and abscisic acid-independent pathways during abiotic stress.

    PubMed

    Roychoudhury, Aryadeep; Paul, Saikat; Basu, Supratim

    2013-07-01

    Salinity, drought and low temperature are the common forms of abiotic stress encountered by land plants. To cope with these adverse environmental factors, plants execute several physiological and metabolic responses. Both osmotic stress (elicited by water deficit or high salt) and cold stress increase the endogenous level of the phytohormone abscisic acid (ABA). ABA-dependent stomatal closure to reduce water loss is associated with small signaling molecules like nitric oxide, reactive oxygen species and cytosolic free calcium, and mediated by rapidly altering ion fluxes in guard cells. ABA also triggers the expression of osmotic stress-responsive (OR) genes, which usually contain single/multiple copies of cis-acting sequence called abscisic acid-responsive element (ABRE) in their upstream regions, mostly recognized by the basic leucine zipper-transcription factors (TFs), namely, ABA-responsive element-binding protein/ABA-binding factor. Another conserved sequence called the dehydration-responsive element (DRE)/C-repeat, responding to cold or osmotic stress, but not to ABA, occurs in some OR promoters, to which the DRE-binding protein/C-repeat-binding factor binds. In contrast, there are genes or TFs containing both DRE/CRT and ABRE, which can integrate input stimuli from salinity, drought, cold and ABA signaling pathways, thereby enabling cross-tolerance to multiple stresses. A strong candidate that mediates such cross-talk is calcium, which serves as a common second messenger for abiotic stress conditions and ABA. The present review highlights the involvement of both ABA-dependent and ABA-independent signaling components and their interaction or convergence in activating the stress genes. We restrict our discussion to salinity, drought and cold stress.

  2. Studies on the mechanism of functional cooperativity between progesterone and estrogen receptors.

    PubMed

    Bradshaw, M S; Tsai, S Y; Leng, X H; Dobson, A D; Conneely, O M; O'Malley, B W; Tsai, M J

    1991-09-05

    Steroid response elements (SREs) cooperate with many different cis-acting elements including NF-1 sites, CACCC boxes, and other SREs to induce target gene expression (Schule, R., Muller, M., Otsuka-Murakami, H., and Renkawitz, R. (1988) Nature 332, 87-90; Strahle, U., Schmid, W., and Schutz, G. (1988) EMBO J. 7, 3389-3395). Induction of gene expression can be additive or synergistic with respect to the level of activation by either transactivators. Two mechanisms have been proposed for how synergism occurs: 1) cooperative binding of transcriptional activators to DNA or 2) simultaneous interaction of individually bound activators with a common target protein. We have shown previously that cooperative binding of receptors is important for synergism between two progesterone response elements (PREs). Here we showed that an estrogen response element (ERE) and a PRE can also functionally cooperate and this synergism between an ERE and a PRE is not contributed by cooperative DNA binding. Furthermore, we have demonstrated that the activation domains of the progesterone receptor (PR) (C1Act) are required for synergism between two PREs and sufficient for confirming cooperative binding. However these two activation domains of PR are not sufficient for synergism between an ERE and a PRE. Additional regions within the NH2-terminal and COOH-terminal domains are also required for synergistic interaction between two heterologous SREs.

  3. The STAT3 HIES mutation is a gain-of-function mutation that activates genes via AGG-element carrying promoters.

    PubMed

    Xu, Li; Ji, Jin-Jun; Le, Wangping; Xu, Yan S; Dou, Dandan; Pan, Jieli; Jiao, Yifeng; Zhong, Tianfei; Wu, Dehong; Wang, Yumei; Wen, Chengping; Xie, Guan-Qun; Yao, Feng; Zhao, Heng; Fan, Yong-Sheng; Chin, Y Eugene

    2015-10-15

    Cytokine or growth factor activated STAT3 undergoes multiple post-translational modifications, dimerization and translocation into nuclei, where it binds to serum-inducible element (SIE, 'TTC(N3)GAA')-bearing promoters to activate transcription. The STAT3 DNA binding domain (DBD, 320-494) mutation in hyper immunoglobulin E syndrome (HIES), called the HIES mutation (R382Q, R382W or V463Δ), which elevates IgE synthesis, inhibits SIE binding activity and sensitizes genes such as TNF-α for expression. However, the mechanism by which the HIES mutation sensitizes STAT3 in gene induction remains elusive. Here, we report that STAT3 binds directly to the AGG-element with the consensus sequence 'AGG(N3)AGG'. Surprisingly, the helical N-terminal region (1-355), rather than the canonical STAT3 DBD, is responsible for AGG-element binding. The HIES mutation markedly enhances STAT3 AGG-element binding and AGG-promoter activation activity. Thus, STAT3 is a dual specificity transcription factor that promotes gene expression not only via SIE- but also AGG-promoter activity. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  4. Quantification of transcription factor-DNA binding affinity in a living cell

    PubMed Central

    Belikov, Sergey; Berg, Otto G.; Wrange, Örjan

    2016-01-01

    The apparent dissociation constant (Kd) for specific binding of glucocorticoid receptor (GR) and androgen receptor (AR) to DNA was determined in vivo in Xenopus oocytes. The total nuclear receptor concentration was quantified as specifically retained [3H]-hormone in manually isolated oocyte nuclei. DNA was introduced by nuclear microinjection of single stranded phagemid DNA, chromatin is then formed during second strand synthesis. The fraction of DNA sites occupied by the expressed receptor was determined by dimethylsulphate in vivo footprinting and used for calculation of the receptor-DNA binding affinity. The forkhead transcription factor FoxA1 enhanced the DNA binding by GR with an apparent Kd of ∼1 μM and dramatically stimulated DNA binding by AR with an apparent Kd of ∼0.13 μM at a composite androgen responsive DNA element containing one FoxA1 binding site and one palindromic hormone receptor binding site known to bind one receptor homodimer. FoxA1 exerted a weak constitutive- and strongly cooperative DNA binding together with AR but had a less prominent effect with GR, the difference reflecting the licensing function of FoxA1 at this androgen responsive DNA element. PMID:26657626

  5. Sequestration of cAMP response element-binding proteins by transcription factor decoys causes collateral elaboration of regenerating Aplysia motor neuron axons.

    PubMed

    Dash, P K; Tian, L M; Moore, A N

    1998-07-07

    Axonal injury increases intracellular Ca2+ and cAMP and has been shown to induce gene expression, which is thought to be a key event for regeneration. Increases in intracellular Ca2+ and/or cAMP can alter gene expression via activation of a family of transcription factors that bind to and modulate the expression of CRE (Ca2+/cAMP response element) sequence-containing genes. We have used Aplysia motor neurons to examine the role of CRE-binding proteins in axonal regeneration after injury. We report that axonal injury increases the binding of proteins to a CRE sequence-containing probe. In addition, Western blot analysis revealed that the level of ApCREB2, a CRE sequence-binding repressor, was enhanced as a result of axonal injury. The sequestration of CRE-binding proteins by microinjection of CRE sequence-containing plasmids enhanced axon collateral formation (both number and length) as compared with control plasmid injections. These findings show that Ca2+/cAMP-mediated gene expression via CRE-binding transcription factors participates in the regeneration of motor neuron axons.

  6. Participation of Water in the Binding of Estrogen Receptor with Estrogen Responsive Element in vitro.

    PubMed

    Zhu, Guo-Zhang; Tang, Guo-Qing; Ruan, Kang-Cheng; Gong, Yue-Ting; Zhang, Yong-Lian

    1998-01-01

    Many reports have showed that bound water was involved in the interaction between/among the macromolecules. However, it has not been reported whether bound water is also involved in the binding of trans-factors and cis-elements in the regulation of the eukaryotic gene trans-cription or not. Preliminary studies have been made on the effect of bound water on the binding of estrogen receptor with estrogen responsive element in vitro. In the gel retardation assay using the cytosol extract of rat uterus as the supplier of estrogen receptor and 32 bp oligonucleotide containing a concensus vitellogenin A(2) ERE as the probe, various cosolvents, such as glycerol, sucrose, N-dimethylformamide and dimethylsulfoxide, were added respectively to the reaction mixture in varying concentrations to regulate the osmotic pressure. The results indicated that the binding of ER-ERE was enhanced with the increase in the final concentration of these individual cosolvents. On the other hand, when the reaction was carried out under an increasing hydrostatic pressure, the ER-ERE binding was decreased sharply. After decompression the binding of ER-ERE was gradually restored to the normal level with the lapse of time. These results suggested that bound water was directly involved in the binding of ER-ERE and may play an important role in the regulation of the eukaryotic gene transcription.

  7. Vitamin D receptor displays DNA binding and transactivation as a heterodimer with the retinoid X receptor, but not with the thyroid hormone receptor.

    PubMed

    Thompson, P D; Hsieh, J C; Whitfield, G K; Haussler, C A; Jurutka, P W; Galligan, M A; Tillman, J B; Spindler, S R; Haussler, M R

    1999-12-01

    The vitamin D receptor (VDR) is a transcription factor believed to function as a heterodimer with the retinoid X receptor (RXR). However, it was reported [Schräder et al., 1994] that, on putative vitamin D response elements (VDREs) within the rat 9k and mouse 28k calcium binding protein genes (rCaBP 9k and mCaBP 28k), VDR and thyroid hormone receptor (TR) form heterodimers that transactivate in response to both 1,25-dihydroxyvitamin D(3) (1,25(OH)(2)D(3)) and triiodothyronine (T(3)). We, therefore, examined associations of these receptors on the putative rCaBP 9k and mCaBP 28k VDREs, as well as on established VDREs from the rat osteocalcin (rOC) and mouse osteopontin (mOP) genes, plus the thyroid hormone response element (TRE) from the rat myosin heavy chain (rMHC) gene. In gel mobility shift assays, we found no evidence for VDR-TR heterodimer interaction with any tested element. Further, employing these hormone response elements linked to reporter genes in transfected cells, VDR and TR mediated responses to their cognate ligands only from the rOC/mOP and rMHC elements, respectively, while the CaBP elements were unresponsive to any combination of ligand(s). Utilizing the rOC and mOP VDREs, two distinct repressive actions of TR on VDR-mediated signaling were demonstrated: a T(3)-independent action, presumably via direct TR-RXR competition for DNA binding, and a T(3)-dependent repression, likely by diversion of limiting RXR from VDR-RXR toward the formation of TR-RXR heterodimers. The relative importance of these two mechanisms differed in a response element-specific manner. These results may provide a partial explanation for the observed association between hyperthyroidism and bone demineralization/osteoporosis. Copyright 1999 Wiley-Liss, Inc.

  8. Age-related decline in oligodendrogenesis retards white matter repair in mice.

    PubMed

    Miyamoto, Nobukazu; Pham, Loc-Duyen D; Hayakawa, Kazuhide; Matsuzaki, Toshinori; Seo, Ji Hae; Magnain, Caroline; Ayata, Cenk; Kim, Kyu-Won; Boas, David; Lo, Eng H; Arai, Ken

    2013-09-01

    Aging is one of the major risk factors for white matter injury in cerebrovascular disease. However, the effects of age on the mechanisms of injury/repair in white matter remain to be fully elucidated. Here, we ask whether, compared with young brains, white matter regions in older brains may be more vulnerable in part because of decreased rates of compensatory oligodendrogenesis after injury. A mouse model of prolonged cerebral hypoperfusion was prepared by bilateral common carotid artery stenosis in 2-month and 8-month-old mice. Matching in vitro studies were performed by subjecting oligodendrocyte precursor cells to sublethal 7-day CoCl2 treatment to induce chemical hypoxic stress. Baseline myelin density in the corpus callosum was similar in 2-month and 8-month-old mice. But after induction of prolonged cerebral hypoperfusion, older mice showed more severe white matter injury together with worse deficits in working memory. The numbers of newborn oligodendrocytes and their precursors were increased by cerebral hypoperfusion in young mice, whereas these endogenous responses were significantly dampened in older mice. Defects in cyclic AMP response element-binding protein signaling may be involved because activating cyclic AMP response element-binding protein with the type-III phosphodiesterase inhibitor cilostazol in older mice restored the differentiation of oligodendrocyte precursor cells, alleviated myelin loss, and improved cognitive dysfunction during cerebral hypoperfusion. Cell culture systems confirmed that cilostazol promoted the differentiation of oligodendrocyte precursor cells. An age-related decline in cyclic AMP response element-binding protein-mediated oligodendrogenesis may compromise endogenous white matter repair mechanisms, and therefore, drugs that activate cyclic AMP response element-binding protein signaling provide a potential therapeutic approach for treating white matter injury in aging brains.

  9. OsDREB2A, a Rice Transcription Factor, Significantly Affects Salt Tolerance in Transgenic Soybean

    PubMed Central

    Ma, Qi-bin; Yang, Cun-yi; Mu, Ying-hui; Suo, Hai-cui; Luo, Lai-hui; Nian, Hai

    2013-01-01

    The dehydration responsive element binding (DREB) transcription factors play an important role in regulating stress-related genes. OsDREB2A, a member of the DREBP subfamily of AP2/ERF transcription factors in rice (Oryza sativa), is involved in the abiotic stress response. OsDREB2A expression is induced by drought, low-temperature and salt stresses. Here, we report the ability of OsDREB2A to regulate high-salt response in transgenic soybean. Overexpressing OsDREB2A in soybeans enhanced salt tolerance by accumulating osmolytes, such as soluble sugars and free proline, and improving the expression levels of some stress-responsive transcription factors and key genes. The phenotypic characterization of transgenic soybean were significantly better than those of wild-type (WT). Electrophoresis mobility shift assay (EMSA) revealed that the OsDREB2A can bind to the DRE core element in vitro. These results indicate that OsDREB2A may participate in abiotic stress by directly binding with DRE element to regulate the expression of downstream genes. Overexpression of OsDREB2A in soybean might be used to improve tolerance to salt stress. PMID:24376625

  10. The transcriptional regulatory network in the drought response and its crosstalk in abiotic stress responses including drought, cold, and heat.

    PubMed

    Nakashima, Kazuo; Yamaguchi-Shinozaki, Kazuko; Shinozaki, Kazuo

    2014-01-01

    Drought negatively impacts plant growth and the productivity of crops around the world. Understanding the molecular mechanisms in the drought response is important for improvement of drought tolerance using molecular techniques. In plants, abscisic acid (ABA) is accumulated under osmotic stress conditions caused by drought, and has a key role in stress responses and tolerance. Comprehensive molecular analyses have shown that ABA regulates the expression of many genes under osmotic stress conditions, and the ABA-responsive element (ABRE) is the major cis-element for ABA-responsive gene expression. Transcription factors (TFs) are master regulators of gene expression. ABRE-binding protein and ABRE-binding factor TFs control gene expression in an ABA-dependent manner. SNF1-related protein kinases 2, group A 2C-type protein phosphatases, and ABA receptors were shown to control the ABA signaling pathway. ABA-independent signaling pathways such as dehydration-responsive element-binding protein TFs and NAC TFs are also involved in stress responses including drought, heat, and cold. Recent studies have suggested that there are interactions between the major ABA signaling pathway and other signaling factors in stress responses. The important roles of these TFs in crosstalk among abiotic stress responses will be discussed. Control of ABA or stress signaling factor expression can improve tolerance to environmental stresses. Recent studies using crops have shown that stress-specific overexpression of TFs improves drought tolerance and grain yield compared with controls in the field.

  11. Reversible cobalt ion binding to imidazole-modified nanopipettes

    PubMed Central

    Sa, Niya; Fu, Yaqin; Baker, Lane A.

    2010-01-01

    In this report, we demonstrate that quartz nanopipettes modified with an imidazole-terminated silane respond to metal ions (Co2+) in solution. The response of nanopipettes is evaluated through examination of the ion current rectification response. By cycling nanopipettes between solutions of different pH, adsorbed Co2+ can be released from the nanopipette surface, to regenerate binding sites of the nanopipette. These results demonstrate that rectification-based sensing strategies for nanopore sensors can benefit from selection of recognition elements with intermediate binding affinities, such that reversible responses to be attained. PMID:21090777

  12. A Polymorphic p53 Response Element in KIT Ligand Influences Cancer Risk and Has Undergone Natural Selection

    PubMed Central

    Zeron-Medina, Jorge; Wang, Xuting; Repapi, Emmanouela; Campbell, Michelle R.; Su, Dan; Castro-Giner, Francesc; Davies, Benjamin; Peterse, Elisabeth F.P.; Sacilotto, Natalia; Walker, Graeme J.; Terzian, Tamara; Tomlinson, Ian P.; Box, Neil F.; Meinshausen, Nicolai; De Val, Sarah; Bell, Douglas A.; Bond, Gareth L.

    2014-01-01

    SUMMARY The ability of p53 to regulate transcription is crucial for tumor suppression and implies that inherited polymorphisms in functional p53-binding sites could influence cancer. Here, we identify a polymorphic p53 responsive element and demonstrate its influence on cancer risk using genome-wide data sets of cancer susceptibility loci, genetic variation, p53 occupancy, and p53-binding sites. We uncover a single-nucleotide polymorphism (SNP) in a functional p53-binding site and establish its influence on the ability of p53 to bind to and regulate transcription of the KITLG gene. The SNP resides in KITLG and associates with one of the largest risks identified among cancer genome-wide association studies. We establish that the SNP has undergone positive selection throughout evolution, signifying a selective benefit, but go on to show that similar SNPs are rare in the genome due to negative selection, indicating that polymorphisms in p53-binding sites are primarily detrimental to humans. PMID:24120139

  13. Statins Increase Plasminogen Activator Inhibitor Type 1 Gene Transcription through a Pregnane X Receptor Regulated Element

    PubMed Central

    Stanley, Frederick M.; Linder, Kathryn M.; Cardozo, Timothy J.

    2015-01-01

    Plasminogen activator inhibitor type 1 (PAI-1) is a multifunctional protein that has important roles in inflammation and wound healing. Its aberrant regulation may contribute to many disease processes such as heart disease. The PAI-1 promoter is responsive to multiple inputs including cytokines, growth factors, steroids and oxidative stress. The statin drugs, atorvastatin, mevastatin and rosuvastatin, increased basal and stimulated expression of the PAI-1 promoter 3-fold. A statin-responsive, nuclear hormone response element was previously identified in the PAI-1 promoter, but it was incompletely characterized. We characterized this direct repeat (DR) of AGGTCA with a 3-nucleotide spacer at -269/-255 using deletion and directed mutagenesis. Deletion or mutation of this element increased basal transcription from the promoter suggesting that it repressed PAI-1 transcription in the unliganded state. The half-site spacing and the ligand specificity suggested that this might be a pregnane X receptor (PXR) responsive element. Computational molecular docking showed that atorvastatin, mevastatin and rosuvastatin were structurally compatible with the PXR ligand-binding pocket in its agonist conformation. Experiments with Gal4 DNA binding domain fusion proteins showed that Gal4-PXR was activated by statins while other DR + 3 binding nuclear receptor fusions were not. Overexpression of PXR further enhanced PAI-1 transcription in response to statins. Finally, ChIP experiments using Halo-tagged PXR and RXR demonstrated that both components of the PXR-RXR heterodimer bound to this region of the PAI-1 promoter. PMID:26379245

  14. Retinoid X receptor and peroxisome proliferator-activated receptor activate an estrogen responsive gene independent of the estrogen receptor.

    PubMed

    Nuñez, S B; Medin, J A; Braissant, O; Kemp, L; Wahli, W; Ozato, K; Segars, J H

    1997-03-14

    Estrogen receptors regulate transcription of genes essential for sexual development and reproductive function. Since the retinoid X receptor (RXR) is able to modulate estrogen responsive genes and both 9-cis RA and fatty acids influenced development of estrogen responsive tumors, we hypothesized that estrogen responsive genes might be modulated by RXR and the fatty acid receptor (peroxisome proliferator-activated receptor, PPAR). To test this hypothesis, transfection assays in CV-1 cells were performed with an estrogen response element (ERE) coupled to a luciferase reporter construct. Addition of expression vectors for RXR and PPAR resulted in an 11-fold increase in luciferase activity in the presence of 9-cis RA. Furthermore, mobility shift assays demonstrated binding of RXR and PPAR to the vitellogenin A2-ERE and an ERE in the oxytocin promoter. Methylation interference assays demonstrated that specific guanine residues required for RXR/PPAR binding to the ERE were similar to residues required for ER binding. Moreover, RXR domain-deleted constructs in transfection assays showed that activation required RXR since an RXR delta AF-2 mutant completely abrogated reporter activity. Oligoprecipitation binding studies with biotinylated ERE and (35)S-labeled in vitro translated RXR constructs confirmed binding of delta AF-2 RXR mutant to the ERE in the presence of baculovirus-expressed PPAR. Finally, in situ hybridization confirmed RXR and PPAR mRNA expression in estrogen responsive tissues. Collectively, these data suggest that RXR and PPAR are present in reproductive tissues, are capable of activating estrogen responsive genes and suggest that the mechanism of activation may involve direct binding of the receptors to estrogen response elements.

  15. The Nrf2-antioxidant response element pathway: a target for regulating energy metabolism

    USDA-ARS?s Scientific Manuscript database

    The nuclear factor E2-related factor 2 (Nrf2) is a transcription factor that responds to oxidative stress by binding to the antioxidant response element (ARE) in the promoter of genes coding for antioxidant enzymes like NAD(P)H:quinone oxidoreductase 1 (NQO1) and proteins for glutathione synthesis. ...

  16. Basic Fibroblast Growth Factor Activates Serum Response Factor Gene Expression by Multiple Distinct Signaling Mechanisms

    PubMed Central

    Spencer, Jeffrey A.; Major, Michael L.; Misra, Ravi P.

    1999-01-01

    Serum response factor (SRF) plays a central role in the transcriptional response of mammalian cells to a variety of extracellular signals. It is a key regulator of many cellular early response genes which are believed to be involved in cell growth and differentiation. The mechanism by which SRF activates transcription in response to mitogenic agents has been extensively studied; however, significantly less is known about regulation of the SRF gene itself. Previously, we identified distinct regulatory elements in the SRF promoter that play a role in activation, including a consensus ETS domain binding site, a consensus overlapping Sp/Egr-1 binding site, and two SRF binding sites. We further showed that serum induces SRF by a mechanism that requires an intact SRF binding site, also termed a CArG box. In the present study we demonstrate that in response to stimulation of cells by a purified growth factor, basic fibroblast growth factor (bFGF), the SRF promoter is upregulated by a complex pathway that involves at least two independent mechanisms: a CArG box-independent mechanism that is mediated by an ETS binding site, and a novel CArG box-dependent mechanism that requires both an Sp factor binding site and the CArG motifs for maximal stimulation. Our analysis indicates that the CArG/Sp element activation mechanism is mediated by distinct signaling pathways. The CArG box-dependent component is targeted by a Rho-mediated pathway, and the Sp binding site-dependent component is targeted by a Ras-mediated pathway. Both SRF and bFGF have been implicated in playing an important role in mediating cardiogenesis during development. The implications of our findings for SRF expression during development are discussed. PMID:10330138

  17. Characterisation of a DNA sequence element that directs Dictyostelium stalk cell-specific gene expression.

    PubMed

    Ceccarelli, A; Zhukovskaya, N; Kawata, T; Bozzaro, S; Williams, J

    2000-12-01

    The ecmB gene of Dictyostelium is expressed at culmination both in the prestalk cells that enter the stalk tube and in ancillary stalk cell structures such as the basal disc. Stalk tube-specific expression is regulated by sequence elements within the cap-site proximal part of the promoter, the stalk tube (ST) promoter region. Dd-STATa, a member of the STAT transcription factor family, binds to elements present in the ST promoter-region and represses transcription prior to entry into the stalk tube. We have characterised an activatory DNA sequence element, that lies distal to the repressor elements and that is both necessary and sufficient for expression within the stalk tube. We have mapped this activator to a 28 nucleotide region (the 28-mer) within which we have identified a GA-containing sequence element that is required for efficient gene transcription. The Dd-STATa protein binds to the 28-mer in an in vitro binding assay, and binding is dependent upon the GA-containing sequence. However, the ecmB gene is expressed in a Dd-STATa null mutant, therefore Dd-STATa cannot be responsible for activating the 28-mer in vivo. Instead, we identified a distinct 28-mer binding activity in nuclear extracts from the Dd-STATa null mutant, the activity of this GA binding activity being largely masked in wild type extracts by the high affinity binding of the Dd-STATa protein. We suggest, that in addition to the long range repression exerted by binding to the two known repressor sites, Dd-STATa inhibits transcription by direct competition with this putative activator for binding to the GA sequence.

  18. The Specificity of Innate Immune Responses Is Enforced by Repression of Interferon Response Elements by NF-κB p50

    PubMed Central

    Cheng, Christine S.; Feldman, Kristyn E.; Lee, James; Verma, Shilpi; Huang, De-Bin; Huynh, Kim; Chang, Mikyoung; Ponomarenko, Julia V.; Sun, Shao-Cong; Benedict, Chris A.; Ghosh, Gourisankar; Hoffmann, Alexander

    2011-01-01

    The specific binding of transcription factors to cognate sequence elements is thought to be critical for the generation of specific gene expression programs. Members of the nuclear factor κB (NF-κB) and interferon (IFN) regulatory factor (IRF) transcription factor families bind to the κB site and the IFN response element (IRE), respectively, of target genes, and they are activated in macrophages after exposure to pathogens. However, how these factors produce pathogen-specific inflammatory and immune responses remains poorly understood. Combining top-down and bottom-up systems biology approaches, we have identified the NF-κB p50 homodimer as a regulator of IRF responses. Unbiased genome-wide expression and biochemical and structural analyses revealed that the p50 homodimer repressed a subset of IFN-inducible genes through a previously uncharacterized subclass of guanine-rich IRE (G-IRE) sequences. Mathematical modeling predicted that the p50 homodimer might enforce the stimulus specificity of composite promoters. Indeed, the production of the antiviral regulator IFN-β was rendered stimulus-specific by the binding of the p50 homodimer to the G-IRE–containing IFNβ enhancer to suppress cytotoxic IFN signaling. Specifically, a deficiency in p50 resulted in the inappropriate production of IFN-β in response to bacterial DNA sensed by Toll-like receptor 9. This role for the NF-κB p50 homodimer in enforcing the specificity of the cellular response to pathogens by binding to a subset of IRE sequences alters our understanding of how the NF-κB and IRF signaling systems cooperate to regulate antimicrobial immunity. PMID:21343618

  19. Hypoxia-induced endothelial NO synthase gene transcriptional activation is mediated through the tax-responsive element in endothelial cells.

    PubMed

    Min, Jiho; Jin, Yoon-Mi; Moon, Je-Sung; Sung, Min-Sun; Jo, Sangmee Ahn; Jo, Inho

    2006-06-01

    Although hypoxia is known to induce upregulation of endothelial NO synthase (eNOS) gene expression, the underlying mechanism is largely unclear. In this study, we show that hypoxia increases eNOS gene expression through the binding of phosphorylated cAMP-responsive element binding (CREB) protein (pCREB) to the eNOS gene promoter. Hypoxia (1% O2) increased both eNOS expression and NO production, peaking at 24 hours, in bovine aortic endothelial cells, and these increases were accompanied by increases in pCREB. Treatment with the protein kinase A inhibitor H-89 or transfection with dominant-negative inhibitor of CREB reversed the hypoxia-induced increases in eNOS expression and NO production, with concomitant inhibition of the phosphorylation of CREB induced by hypoxia, suggesting an involvement of protein kinase A/pCREB-mediated pathway. To map the regulatory elements of the eNOS gene responsible for pCREB binding under hypoxia, we constructed an eNOS gene promoter (-1600 to +22 nucleotides) fused with a luciferase reporter gene [pGL2-eNOS(-1600)]. Hypoxia (for 24-hour incubation) increased the promoter activity by 2.36+/-0.18-fold in the bovine aortic endothelial cells transfected with pGL2-eNOS(-1600). However, progressive 5'-deletion from -1600 to -873 completely attenuated the hypoxia-induced increase in promoter activity. Electrophoretic mobility shift, anti-pCREB antibody supershift, and site-specific mutation analyses showed that pCREB is bound to the Tax-responsive element (TRE) site, a cAMP-responsive element-like site, located at -924 to -921 of the eNOS promoter. Our data demonstrate that the interaction between pCREB and the Tax-responsive element site within the eNOS promoter may represent a novel mechanism for the mediation of hypoxia-stimulated eNOS gene expression.

  20. Cryptic MCAT enhancer regulation in fibroblasts and smooth muscle cells. Suppression of TEF-1 mediated activation by the single-stranded DNA-binding proteins, Pur alpha, Pur beta, and MSY1.

    PubMed

    Carlini, Leslie E; Getz, Michael J; Strauch, Arthur R; Kelm, Robert J

    2002-03-08

    An asymmetric polypurine-polypyrimidine cis-element located in the 5' region of the mouse vascular smooth muscle alpha-actin gene serves as a binding site for multiple proteins with specific affinity for either single- or double-stranded DNA. Here, we test the hypothesis that single-stranded DNA-binding proteins are responsible for preventing a cryptic MCAT enhancer centered within this element from cooperating with a nearby serum response factor-interacting CArG motif to trans-activate the minimal promoter in fibroblasts and smooth muscle cells. DNA binding studies revealed that the core MCAT sequence mediates binding of transcription enhancer factor-1 to the double-stranded polypurine-polypyrimidine element while flanking nucleotides account for interaction of Pur alpha and Pur beta with the purine-rich strand and MSY1 with the complementary pyrimidine-rich strand. Mutations that selectively impaired high affinity single-stranded DNA binding by fibroblast or smooth muscle cell-derived Pur alpha, Pur beta, and MSY1 in vitro, released the cryptic MCAT enhancer from repression in transfected cells. Additional experiments indicated that Pur alpha, Pur beta, and MSY1 also interact specifically, albeit weakly, with double-stranded DNA and with transcription enhancer factor-1. These results are consistent with two plausible models of cryptic MCAT enhancer regulation by Pur alpha, Pur beta, and MSY1 involving either competitive single-stranded DNA binding or masking of MCAT-bound transcription enhancer factor-1.

  1. Estrogen regulation of chicken riboflavin carrier protein gene is mediated by ERE half sites without direct binding of estrogen receptor.

    PubMed

    Bahadur, Urvashi; Ganjam, Goutham K; Vasudevan, Nandini; Kondaiah, Paturu

    2005-02-28

    Estrogen is an important steroid hormone that mediates most of its effects on regulation of gene expression by binding to intracellular receptors. The consensus estrogen response element (ERE) is a 13bp palindromic inverted repeat with a three nucleotide spacer. However, several reports suggest that many estrogen target genes are regulated by diverse elements, such as imperfect EREs and ERE half sites (ERE 1/2), which are either the proximal or the distal half of the palindrome. To gain more insight into ERE half site-mediated gene regulation, we used a region from the estrogen-regulated chicken riboflavin carrier protein (RCP) gene promoter that contains ERE half sites. Using moxestrol, an analogue of estrogen and transient transfection of deletion and mutation containing RCP promoter/reporter constructs in chicken hepatoma (LMH2A) cells, we identified an estrogen response unit (ERU) composed of two consensus ERE 1/2 sites and one non-consensus ERE 1/2 site. Mutation of any of these sites within this ERU abolishes moxestrol response. Further, the ERU is able to confer moxestrol responsiveness to a heterologous promoter. Interestingly, RCP promoter is regulated by moxestrol in estrogen responsive human MCF-7 cells, but not in other cell lines such as NIH3T3 and HepG2 despite estrogen receptor-alpha (ER-alpha) co transfection. Electrophoretic mobility shift assays (EMSAs) with promoter regions encompassing the half sites and nuclear extracts from LMH2A cells show the presence of a moxestrol-induced complex that is abolished by a polyclonal anti-ERalpha antibody. Surprisingly, estrogen receptor cannot bind to these promoter elements in isolation. Thus, there appears to be a definite requirement for some other factor(s) in addition to estrogen receptor, for the generation of a suitable response of this promoter to estrogen. Our studies therefore suggest a novel mechanism of gene regulation by estrogen, involving ERE half sites without direct binding of ER to the cognate elements.

  2. An ABRE promoter sequence is involved in osmotic stress-responsive expression of the DREB2A gene, which encodes a transcription factor regulating drought-inducible genes in Arabidopsis.

    PubMed

    Kim, June-Sik; Mizoi, Junya; Yoshida, Takuya; Fujita, Yasunari; Nakajima, Jun; Ohori, Teppei; Todaka, Daisuke; Nakashima, Kazuo; Hirayama, Takashi; Shinozaki, Kazuo; Yamaguchi-Shinozaki, Kazuko

    2011-12-01

    In plants, osmotic stress-responsive transcriptional regulation depends mainly on two major classes of cis-acting elements found in the promoter regions of stress-inducible genes: ABA-responsive elements (ABREs) and dehydration-responsive elements (DREs). ABRE has been shown to perceive ABA-mediated osmotic stress signals, whereas DRE is known to be involved in an ABA-independent pathway. Previously, we reported that the transcription factor DRE-BINDING PROTEIN 2A (DREB2A) regulates DRE-mediated transcription of target genes under osmotic stress conditions in Arabidopsis (Arabidopsis thaliana). However, the transcriptional regulation of DREB2A itself remains largely uncharacterized. To elucidate the transcriptional mechanism associated with the DREB2A gene under osmotic stress conditions, we generated a series of truncated and base-substituted variants of the DREB2A promoter and evaluated their transcriptional activities individually. We found that both ABRE and coupling element 3 (CE3)-like sequences located approximately -100 bp from the transcriptional initiation site are necessary for the dehydration-responsive expression of DREB2A. Coupling our transient expression analyses with yeast one-hybrid and chromatin immunoprecipitation (ChIP) assays indicated that the ABRE-BINDING PROTEIN 1 (AREB1), AREB2 and ABRE-BINDING FACTOR 3 (ABF3) bZIP transcription factors can bind to and activate the DREB2A promoter in an ABRE-dependent manner. Exogenous ABA application induced only a modest accumulation of the DREB2A transcript when compared with the osmotic stress treatment. However, the osmotic stress-induced DREB2A expression was found to be markedly impaired in several ABA-deficient and ABA-insensitive mutants. These results suggest that in addition to an ABA-independent pathway, the ABA-dependent pathway plays a positive role in the osmotic stress-responsive expression of DREB2A.

  3. Identification of the G13 (cAMP-response-element-binding protein-related protein) gene product related to activating transcription factor 6 as a transcriptional activator of the mammalian unfolded protein response.

    PubMed

    Haze, K; Okada, T; Yoshida, H; Yanagi, H; Yura, T; Negishi, M; Mori, K

    2001-04-01

    Eukaryotic cells control the levels of molecular chaperones and folding enzymes in the endoplasmic reticulum (ER) by a transcriptional induction process termed the unfolded protein response (UPR). The mammalian UPR is mediated by the cis-acting ER stress response element consisting of 19 nt (CCAATN(9)CCACG), the CCACG part of which is considered to provide specificity. We recently identified the basic leucine zipper (bZIP) protein ATF6 as a mammalian UPR-specific transcription factor; ATF6 is activated by ER stress-induced proteolysis and binds directly to CCACG. Here we report that eukaryotic cells express another bZIP protein closely related to ATF6 in both structure and function. This protein encoded by the G13 (cAMP response element binding protein-related protein) gene is constitutively synthesized as a type II transmembrane glycoprotein anchored in the ER membrane and processed into a soluble form upon ER stress as occurs with ATF6. The proteolytic processing of ATF6 and the G13 gene product is accompanied by their relocation from the ER to the nucleus; their basic regions seem to function as a nuclear localization signal. Overexpression of the soluble form of the G13 product constitutively activates the UPR, whereas overexpression of a mutant lacking the activation domain exhibits a strong dominant-negative effect. Furthermore, the soluble forms of ATF6 and the G13 gene product are unable to bind to several point mutants of the cis-acting ER stress response element in vitro that hardly respond to ER stress in vivo. We thus concluded that the two related bZIP proteins are crucial transcriptional regulators of the mammalian UPR, and propose calling the ATF6 gene product ATF6alpha and the G13 gene product ATF6beta.

  4. Four regulatory elements in the human c-fos promoter mediate transactivation by HTLV-1 Tax protein.

    PubMed

    Alexandre, C; Verrier, B

    1991-04-01

    Expression of the human c-fos proto-oncogene is activated in trans by the Tax protein encoded by human T-cell leukemia virus type-1 (HTLV-1). Indeed, we show here that a HeLa clone stably transfected by Tax expresses Fos at a high level. We also show that multiple elements of the human c-fos promoter, i.e. the v-sis conditioned medium inducible element (SIE), the dyad symmetry element (DSE) necessary for growth factor induction, the octanucleotide direct repeat element (DR), and the cyclic AMP response element (CRE) centred at -60, can all mediate Tax transactivation. In the DSE, the 10bp central core that binds the serum response factor (SRF) is, by itself, sufficient to mediate Tax transactivation. Moreover, a CRE-binding protein is involved in Tax activation through the CRE-60 element. Since Fos is a transregulator of cellular genes, our results suggest that the oncoprotein plays a crucial role in T-cell transformation by HTLV-1 in conjunction with other Tax-inducible genes.

  5. Promoter selection in human mitochondria involves binding of a transcription factor to orientation-independent upstream regulatory elements.

    PubMed

    Fisher, R P; Topper, J N; Clayton, D A

    1987-07-17

    Selective transcription of human mitochondrial DNA requires a transcription factor (mtTF) in addition to an essentially nonselective RNA polymerase. Partially purified mtTF is able to sequester promoter-containing DNA in preinitiation complexes in the absence of mitochondrial RNA polymerase, suggesting a DNA-binding mechanism for factor activity. Functional domains, required for positive transcriptional regulation by mtTF, are identified within both major promoters of human mtDNA through transcription of mutant promoter templates in a reconstituted in vitro system. These domains are essentially coextensive with DNA sequences protected from nuclease digestion by mtTF-binding. Comparison of the sequences of the two mtTF-responsive elements reveals significant homology only when one sequence is inverted; the binding sites are in opposite orientations with respect to the predominant direction of transcription. Thus mtTF may function bidirectionally, requiring additional protein-DNA interactions to dictate transcriptional polarity. The mtTF-responsive elements are arrayed as direct repeats, separated by approximately 80 bp within the displacement-loop region of human mitochondrial DNA; this arrangement may reflect duplication of an ancestral bidirectional promoter, giving rise to separate, unidirectional promoters for each strand.

  6. Identification of an estrogen response element in the 3'-flanking region of the murine c-fos protooncogene.

    PubMed

    Hyder, S M; Stancel, G M; Nawaz, Z; McDonnell, D P; Loose-Mitchell, D S

    1992-09-05

    We have used transient transfection assays with reporter plasmids expressing chloramphenicol acetyltransferase, linked to regions of mouse c-fos, to identify a specific estrogen response element (ERE) in this protooncogene. This element is located in the untranslated 3'-flanking region of the c-fos gene, 5 kilobases (kb) downstream from the c-fos promoter and 1.5 kb downstream of the poly(A) signal. This element confers estrogen responsiveness to chloramphenicol acetyltransferase reporters linked to both the herpes simplex virus thymidine kinase promoter and the homologous c-fos promoter. Deletion analysis localized the response element to a 200-base pair fragment which contains the element GGTCACCACAGCC that resembles the consensus ERE sequence GGTCACAGTGACC originally identified in Xenopus vitellogenin A2 gene. A synthetic 36-base pair oligodeoxynucleotide containing this c-fos sequence conferred estrogen inducibility to the thymidine kinase promoter. The corresponding sequence also induced reporter activity when present in the c-fos gene fragment 3 kb from the thymidine kinase promoter. Gel-shift experiments demonstrated that synthetic oligonucleotides containing either the consensus ERE or the c-fos element bind human estrogen receptor obtained from a yeast expression system. However, the mobility of the shifted band is faster for the fos-ERE-complex than the consensus ERE complex suggesting that the three-dimensional structure of the protein-DNA complexes is different or that other factors are differentially involved in the two reactions. When the 5'-GGTCA sequence present in the c-fos ERE is mutated to 5'-TTTCA, transcriptional activation and receptor binding activities are both lost. Mutation of the CAGCC-3' element corresponding to the second half-site of the c-fos sequence also led to the loss of receptor binding activity, suggesting that both half-sites of this element are involved in this function. The estrogen induction mediated by either the c-fos or the consensus ERE was blunted by the antiestrogen tamoxifen. Based on these studies, we believe the 3'-fos ERE sequence we have identified may be a major cis-acting element involved in the physiological regulation of the gene by estrogens in vivo.

  7. The cis decoy against the estrogen response element suppresses breast cancer cells via target disrupting c-fos not mitogen-activated protein kinase activity.

    PubMed

    Wang, Li Hua; Yang, Xiao Yi; Zhang, Xiaohu; Mihalic, Kelly; Xiao, Weihua; Farrar, William L

    2003-05-01

    Breast cancer, the most common malignancy in women, has been demonstrated to be associated with the steroid hormone estrogen and its receptor (ER), a ligand-activated transcription factor. Therefore, we developed a phosphorothiolate cis-element decoy against the estrogen response element (ERE decoy) to target disruption of ER DNA binding and transcriptional activity. Here, we showed that the ERE decoy potently ablated the 17beta-estrogen-inducible cell proliferation and induced apoptosis of human breast carcinoma cells by functionally affecting expression of c-fos gene and AP-1 luciferase gene reporter activity. Specificity of the decoy was demonstrated by its ability to directly block ER binding to a cis-element probe and transactivation. Moreover, the decoy failed to inhibit ER-mediated mitogen-activated protein kinase signaling pathways and cell growth of ER-negative breast cancer cells. Taken together, these data suggest that estrogen-mediated cell growth of breast cancer cells can be preferentially restricted via targeted disruption of ER at the level of DNA binding by a novel and specific decoy strategy applied to steroid nuclear receptors.

  8. A novel role for CRTC2 in hepatic cholesterol synthesis through SREBP‐2

    PubMed Central

    Li, Yujie; Song, Yongfeng; Zhao, Meng; Guo, Yanjing; Yu, Chunxiao; Chen, Wenbin; Shao, Shanshan; Xu, Chao; Zhou, Xinli; Zhao, Lifang; Zhang, Zhenhai; Bo, Tao; Xia, Yu; Proud, Christopher G.; Wang, Xuemin; Wang, Li; Zhao, Jiajun

    2017-01-01

    Cholesterol synthesis is regulated by the transcription factor sterol regulatory element binding protein 2 (SREBP‐2) and its target gene 3‐hydroxy‐3‐methylglutaryl‐coenzyme A reductase (HMGCR), which is the rate‐limiting enzyme in cholesterol synthesis. Cyclic adenosine monophosphate–responsive element (CRE) binding protein–regulated transcription coactivator (CRTC) 2 is the master regulator of glucose metabolism. However, the effect of CRTC2 on cholesterol and its potential molecular mechanism remain unclear. Here, we demonstrated that CRTC2 expression and liver cholesterol content were increased in patients with high serum cholesterol levels who underwent resection of liver hemangiomas, as well as in mice fed a 4% cholesterol diet. Mice with adenovirus‐mediated CRTC2 overexpression also showed elevated lipid levels in both serum and liver tissues. Intriguingly, hepatic de novo cholesterol synthesis was markedly increased under these conditions. In contrast, CRTC2 ablation in mice fed a 4% cholesterol diet (18 weeks) showed decreased lipid levels in serum and liver tissues compared with those in littermate wild‐type mice. The expression of lipogenic genes (SREBP‐2 and HMGCR) was consistent with hepatic CRTC2 levels. In vivo imaging showed enhanced adenovirus‐mediated HMGCR‐luciferase activity in adenovirus‐mediated CRTC2 mouse livers; however, the activity was attenuated after mutation of CRE or sterol regulatory element sequences in the HMGCR reporter construct. The effect of CRTC2 on HMGCR in mouse livers was alleviated upon SREBP‐2 knockdown. CRTC2 modulated SREBP‐2 transcription by CRE binding protein, which recognizes the half‐site CRE sequence in the SREBP‐2 promoter. CRTC2 reduced the nuclear protein expression of forkhead box O1 and subsequently increased SREBP‐2 transcription by binding insulin response element 1, rather than insulin response element 2, in the SREBP‐2 promoter. Conclusion: CRTC2 regulates the transcription of SREBP‐2 by interfering with the recognition of insulin response element 1 in the SREBP‐2 promoter by forkhead box O1, thus inducing SREBP‐2/HMGCR signaling and subsequently facilitating hepatic cholesterol synthesis. (Hepatology 2017;66:481–497). PMID:28395113

  9. Structure of p73 DNA-binding domain tetramer modulates p73 transactivation

    PubMed Central

    Ethayathulla, Abdul S.; Tse, Pui-Wah; Monti, Paola; Nguyen, Sonha; Inga, Alberto; Fronza, Gilberto; Viadiu, Hector

    2012-01-01

    The transcription factor p73 triggers developmental pathways and overlaps stress-induced p53 transcriptional pathways. How p53-family response elements determine and regulate transcriptional specificity remains an unsolved problem. In this work, we have determined the first crystal structures of p73 DNA-binding domain tetramer bound to response elements with spacers of different length. The structure and function of the adaptable tetramer are determined by the distance between two half-sites. The structures with zero and one base-pair spacers show compact p73 DNA-binding domain tetramers with large tetramerization interfaces; a two base-pair spacer results in DNA unwinding and a smaller tetramerization interface, whereas a four base-pair spacer hinders tetramerization. Functionally, p73 is more sensitive to spacer length than p53, with one base-pair spacer reducing 90% of transactivation activity and longer spacers reducing transactivation to basal levels. Our results establish the quaternary structure of the p73 DNA-binding domain required as a scaffold to promote transactivation. PMID:22474346

  10. ETHYLENE RESPONSE FACTOR 96 positively regulates Arabidopsis resistance to necrotrophic pathogens by direct binding to GCC elements of jasmonate - and ethylene-responsive defence genes.

    PubMed

    Catinot, Jérémy; Huang, Jing-Bo; Huang, Pin-Yao; Tseng, Min-Yuan; Chen, Ying-Lan; Gu, Shin-Yuan; Lo, Wan-Sheng; Wang, Long-Chi; Chen, Yet-Ran; Zimmerli, Laurent

    2015-12-01

    The ERF (ethylene responsive factor) family is composed of transcription factors (TFs) that are critical for appropriate Arabidopsis thaliana responses to biotic and abiotic stresses. Here we identified and characterized a member of the ERF TF group IX, namely ERF96, that when overexpressed enhances Arabidopsis resistance to necrotrophic pathogens such as the fungus Botrytis cinerea and the bacterium Pectobacterium carotovorum. ERF96 is jasmonate (JA) and ethylene (ET) responsive and ERF96 transcripts accumulation was abolished in JA-insensitive coi1-16 and in ET-insensitive ein2-1 mutants. Protoplast transactivation and electrophoresis mobility shift analyses revealed that ERF96 is an activator of transcription that binds to GCC elements. In addition, ERF96 mainly localized to the nucleus. Microarray analysis coupled to chromatin immunoprecipitation-PCR of Arabidopsis overexpressing ERF96 revealed that ERF96 enhances the expression of the JA/ET defence genes PDF1.2a, PR-3 and PR-4 as well as the TF ORA59 by direct binding to GCC elements present in their promoters. While ERF96-RNAi plants demonstrated wild-type resistance to necrotrophic pathogens, basal PDF1.2 expression levels were reduced in ERF96-silenced plants. This work revealed ERF96 as a key player of the ERF network that positively regulates the Arabidopsis resistance response to necrotrophic pathogens. © 2015 John Wiley & Sons Ltd.

  11. Connecting Effective Immune Response, Fluorescent Granzyme B-like Peptide, Specific Peptide Binding Patterns, Patients with Cancer and Viral Infection, in Remission, Clinical Significance, and Liquid Biopsy.

    PubMed

    Lo, Wai Chun Jennifer; Luther, Donald Gene

    2016-11-01

    Functional cytotoxic-T-lymphocytes (CTL) with granzyme B play an important role in an effective immune response to tumor growth and infection progression. Tumor cells and platelets in peripheral whole blood smears of cancer patients have shown the presence of innate binding targets for GP1R, a fluorescent synthetic Granzyme B-like peptide. It is not known if similar GP1R-binding targets and specific binding patterns are detectable in peripheral blood of patients with viral infection. It is also not known if a specific binding pattern may be associated with an effective immune response to indicate a favorable prognosis. We reviewed the GP1R-binding patterns in the peripheral blood smears of 5 patients in remission at the time of sampling (3 with cancer and 2 with flu-like symptoms) and a negative control. We show with fluoroscopic images that there are: 1) fluorescent GP1R-binding targets mostly in the cytoplasmic areas of nucleated cells in patients with breast and lung cancer who have longer survival, 2) intense fluorescent deposits mostly in the nuclear areas of segmented neutrophils in patients recovered from severe to mild flu-like symptoms, 3) discernible fluorescent deposits in the cytoplasmic areas of small lymphocyte-like elements and overall intense fluorescent stain in large cells in the patient with advanced pancreatic cancer who had shorter survival, 4) GP1R-binding targets in numerous platelet-like elements in all 5 patients. The control sample did not show similar binding patterns. The potential association between specific GP1R-binding patterns in peripheral blood samples and prognostic significance, and its use as liquid biopsy are discussed.

  12. Reversible cobalt ion binding to imidazole-modified nanopipettes.

    PubMed

    Sa, Niya; Fu, Yaqin; Baker, Lane A

    2010-12-15

    In this report, we demonstrate that quartz nanopipettes modified with an imidazole-terminated silane respond to metal ions (Co(2+)) in solution. The response of nanopipettes is evaluated through examination of the ion current rectification ratio. When nanopipettes are cycled between solutions of different pH, adsorbed Co(2+) can be released from the nanopipette surface, to regenerate binding sites of the nanopipette. These results demonstrate that rectification-based sensing strategies for nanopore sensors can benefit from selection of recognition elements with intermediate binding affinities, such that reversible responses can be attained.

  13. Cold shock protein YB-1 is involved in hypoxia-dependent gene transcription

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rauen, Thomas; Frye, Bjoern C.; Pneumology, University Medical Center, University of Freiburg, Freiburg

    Hypoxia-dependent gene regulation is largely orchestrated by hypoxia-inducible factors (HIFs), which associate with defined nucleotide sequences of hypoxia-responsive elements (HREs). Comparison of the regulatory HRE within the 3′ enhancer of the human erythropoietin (EPO) gene with known binding motifs for cold shock protein Y-box (YB) protein-1 yielded strong similarities within the Y-box element and 3′ adjacent sequences. DNA binding assays confirmed YB-1 binding to both, single- and double-stranded HRE templates. Under hypoxia, we observed nuclear shuttling of YB-1 and co-immunoprecipitation assays demonstrated that YB-1 and HIF-1α physically interact with each other. Cellular YB-1 depletion using siRNA significantly induced hypoxia-dependent EPOmore » production at both, promoter and mRNA level. Vice versa, overexpressed YB-1 significantly reduced EPO-HRE-dependent gene transcription, whereas this effect was minor under normoxia. HIF-1α overexpression induced hypoxia-dependent gene transcription through the same element and accordingly, co-expression with YB-1 reduced HIF-1α-mediated EPO induction under hypoxic conditions. Taken together, we identified YB-1 as a novel binding factor for HREs that participates in fine-tuning of the hypoxia transcriptome. - Highlights: • Hypoxia drives nuclear translocation of cold shock protein YB-1. • YB-1 physically interacts with hypoxia-inducible factor (HIF)-1α. • YB-1 binds to the hypoxia-responsive element (HRE) within the erythropoietin (EPO) 3′ enhancer. • YB-1 trans-regulates transcription of hypoxia-dependent genes such as EPO and VEGF.« less

  14. Abnormal expression and functional characteristics of cyclic adenosine monophosphate response element binding protein in postmortem brain of suicide subjects.

    PubMed

    Dwivedi, Yogesh; Rao, Jagadeesh Sridhara; Rizavi, Hooriyah S; Kotowski, Jacek; Conley, Robert R; Roberts, Rosalinda C; Tamminga, Carol A; Pandey, Ghanshyam N

    2003-03-01

    Cyclic adenosine monophosphate response element binding protein (CREB) is a transcription factor that, on phosphorylation by protein kinases, is activated, and in response, regulates the transcription of many neuronally expressed genes. In view of the recent observations that catalytic properties and/or expression of many kinases that mediate their physiological responses through the activation of CREB are altered in the postmortem brain of subjects who commit suicide (hereafter referred to as suicide subjects), we examined the status of CREB in suicidal behavior. These studies were performed in Brodmann area (BA) 9 and hippocampus obtained from 26 suicide subjects and 20 nonpsychiatric healthy control subjects. Messenger RNA levels of CREB and neuron-specific enolase were determined in total RNA by means of quantitative reverse transcriptase-polymerase chain reaction. Protein levels and the functional characteristics of CREB were determined in nuclear fractions by means of Western blot and cyclic adenosine monophosphate response element (CRE)-DNA binding activity, respectively. In the same nuclear fraction, we determined the catalytic activity of cyclic adenosine monophosphate-stimulated protein kinase A by means of enzymatic assay. We observed a significant reduction in messenger RNA and protein levels of CREB, CRE-DNA binding activity, and basal and cyclic adenosine monophosphate-stimulated protein kinase A activity in BA 9 and hippocampus of suicide subjects, without any change in messenger RNA levels of neuron-specific enolase in BA 9. Except for protein kinase A activity, changes in CREB expression and CRE-DNA binding activity were present in all suicide subjects, irrespective of diagnosis. These changes were unrelated to postmortem intervals, age, sex, or antidepressant treatment. Given the significance of CREB in mediating various physiological functions through gene transcription, our results of decreased expression and functional characteristics of CREB in postmortem brain of suicide subjects suggest that CREB may play an important role in suicidal behavior.

  15. Mutational studies reveal a complex set of positive and negative control elements within the chicken vitellogenin II promoter.

    PubMed

    Seal, S N; Davis, D L; Burch, J B

    1991-05-01

    The endogenous chicken vitellogenin II (VTGII) gene is transcribed exclusively in hepatocytes in response to estrogen. We previously identified two estrogen response elements (EREs) upstream of this gene. We now present an analysis of the VTGII promoter activated by these EREs in response to estrogen. Chimeric VTGII-CAT genes were cotransfected into LMH chicken hepatoma cells along with an estrogen receptor expression vector, and transient CAT expression was assayed after culturing the cells in the absence or presence of estrogen. An analysis of constructs bearing deletions downstream of the more proximal ERE indicated that promoter elements relevant to transcription in LMH cells extend to between -113 and -96. The relative importance of sequences within the VTGII promoter was examined by using 10 contiguous linker scanner mutations spanning the region from -117 to -24. Although most of these mutations compromised VTGII promoter function, one dramatically increased expression in LMH cells and also rendered the VTGII promoter capable of being activated by cis-linked EREs in fibroblasts cotransfected with an estrogen receptor expression vector. Gel retardation and DNase I footprinting assays revealed four factor-binding sites within this promoter. We demonstrate that three of these sites bind C/EBP, SP1, and USF (or related factors), respectively; the fourth site binds a factor that we denote TF-V beta. The biological relevance of these findings is suggested by the fact that three of these binding sites map to sites previously shown to be occupied in vivo in response to estrogen.

  16. Identification of distal silencing elements in the murine interferon-A11 gene promoter.

    PubMed

    Roffet, P; Lopez, S; Navarro, S; Bandu, M T; Coulombel, C; Vignal, M; Doly, J; Vodjdani, G

    1996-08-01

    The murine interferon-A11 (Mu IFN-A11) gene is a member of the IFN-A multigenic family. In mouse L929 cells, the weak response of the gene's promoter to viral induction is due to a combination of both a point mutation in the virus responsive element (VRE) and the presence of negatively regulating sequences surrounding the VRE. In the distal part of the promoter, the negatively acting E1E2 sequence was delimited. This sequence displays an inhibitory effect in either orientation or position on the inducibility of a virus-responsive heterologous promoter. It selectively represses VRE-dependent transcription but is not able to reduce the transcriptional activity of a VRE-lacking promoter. In a transient transfection assay, an E1E2-containing DNA competitor was able to derepress the native Mu IFN-A11 promoter. Specific nuclear factors bind to this sequence; thus the binding of trans-regulators participates in the repression of the Mu IFN-A11 gene. The E1E2 sequence contains an IFN regulatory factor (IRF)-binding site. Recombinant IRF2 binds this sequence and anti-IRF2 antibodies supershift a major complex formed with nuclear extracts. The protein composing the complex is 50 kDa in size, indicating the presence of IRF2 or antigenically related proteins in the complex. The Mu IFN-A11 gene is the first example within the murine IFN-A family, in which a distal promoter element has been identified that can negatively modulate the transcriptional response to viral induction.

  17. The Serum Response Factor and a Putative Novel Transcription Factor Regulate Expression of the Immediate-Early Gene Arc/Arg3.1 in Cultured Cortical Neurons

    PubMed Central

    Pintchovski, Sean A.; Peebles, Carol L.; Kim, Hong Joo; Verdin, Eric; Finkbeiner, Steven

    2010-01-01

    The immediate-early effector gene Arc/Arg3.1 is robustly upregulated by synaptic activity associated with learning and memory. Here we show in primary cortical neuron culture that diverse stimuli induce Arc expression through new transcription. Searching for regulatory regions important for Arc transcription, we found nine DNaseI-sensitive nucleosome-depleted sites at this genomic locus. A reporter gene encompassing these sites responded to synaptic activity in an NMDA receptor–dependent manner, consistent with endogenous Arc mRNA. Responsiveness mapped to two enhancer regions ∼6.5 kb and ∼1.4 kb upstream of Arc. We dissected these regions further and found that the proximal enhancer contains a functional and conserved “Zeste-like” response element that binds a putative novel nuclear protein in neurons. Therefore, activity regulates Arc transcription partly by a novel signaling pathway. We also found that the distal enhancer has a functional and highly conserved serum response element. This element binds serum response factor, which is recruited by synaptic activity to regulate Arc. Thus, Arc is the first target of serum response factor that functions at synapses to mediate plasticity. PMID:19193899

  18. High affinity binding of a fungal oligopeptide elicitor to parsley plasma membranes triggers multiple defense responses.

    PubMed

    Nürnberger, T; Nennstiel, D; Jabs, T; Sacks, W R; Hahlbrock, K; Scheel, D

    1994-08-12

    An oligopeptide of 13 amino acids (Pep-13) identified within a 42 kDa glycoprotein elicitor from P. mega-sperma was shown to be necessary and sufficient to stimulate a complex defense response in parsley cells comprising H+/Ca2+ influxes, K+/Cl- effluxes, an oxidative burst, defense-related gene activation, and phytoalexin formation. Binding of radiolabeled Pep-13 to parsley microsomes and protoplasts was specific, reversible, and saturable. Identical structural features of Pep-13 were found to be responsible for specific binding and initiation of all plant responses analyzed. The high affinity binding site recognizing the peptide ligand (KD = 2.4 nM) may therefore represent a novel class of receptors in plants, and the rapidly induced ion fluxes may constitute elements of the signal transduction cascade triggering pathogen defense in plants.

  19. The Yeast Anaerobic Response Element AR1b Regulates Aerobic Antifungal Drug-dependent Sterol Gene Expression*

    PubMed Central

    Gallo-Ebert, Christina; Donigan, Melissa; Liu, Hsing-Yin; Pascual, Florencia; Manners, Melissa; Pandya, Devanshi; Swanson, Robert; Gallagher, Denise; Chen, WeiWei; Carman, George M.; Nickels, Joseph T.

    2013-01-01

    Saccharomyces cerevisiae ergosterol biosynthesis, like cholesterol biosynthesis in mammals, is regulated at the transcriptional level by a sterol feedback mechanism. Yeast studies defined a 7-bp consensus sterol-response element (SRE) common to genes involved in sterol biosynthesis and two transcription factors, Upc2 and Ecm22, which direct transcription of sterol biosynthetic genes. The 7-bp consensus SRE is identical to the anaerobic response element, AR1c. Data indicate that Upc2 and Ecm22 function through binding to this SRE site. We now show that it is two novel anaerobic AR1b elements in the UPC2 promoter that direct global ERG gene expression in response to a block in de novo ergosterol biosynthesis, brought about by antifungal drug treatment. The AR1b elements are absolutely required for auto-induction of UPC2 gene expression and protein and require Upc2 and Ecm22 for function. We further demonstrate the direct binding of recombinant expressed S. cerevisiae ScUpc2 and pathogenic Candida albicans CaUpc2 and Candida glabrata CgUpc2 to AR1b and SRE/AR1c elements. Recombinant endogenous promoter studies show that the UPC2 anaerobic AR1b elements act in trans to regulate ergosterol gene expression. Our results indicate that Upc2 must occupy UPC2 AR1b elements in order for ERG gene expression induction to take place. Thus, the two UPC2-AR1b elements drive expression of all ERG genes necessary for maintaining normal antifungal susceptibility, as wild type cells lacking these elements have increased susceptibility to azole antifungal drugs. Therefore, targeting these specific sites for antifungal therapy represents a novel approach to treat systemic fungal infections. PMID:24163365

  20. H-2RIIBP, a member of the nuclear hormone receptor superfamily that binds to both the regulatory element of major histocompatibility class I genes and the estrogen response element.

    PubMed

    Hamada, K; Gleason, S L; Levi, B Z; Hirschfeld, S; Appella, E; Ozato, K

    1989-11-01

    Transcription of major histocompatibility complex (MHC) class I genes is regulated by the conserved MHC class I regulatory element (CRE). The CRE has two factor-binding sites, region I and region II, both of which elicit enhancer function. By screening a mouse lambda gt 11 library with the CRE as a probe, we isolated a cDNA clone that encodes a protein capable of binding to region II of the CRE. This protein, H-2RIIBP (H-2 region II binding protein), bound to the native region II sequence, but not to other MHC cis-acting sequences or to mutant region II sequences, similar to the naturally occurring region II factor in mouse cells. The deduced amino acid sequence of H-2RIIBP revealed two putative zinc fingers homologous to the DNA-binding domain of steroid/thyroid hormone receptors. Although sequence similarity in other regions was minimal, H-2RIIBP has apparent modular domains characteristic of the nuclear hormone receptors. Further analyses showed that both H-2RIIBP and the natural region II factor bind to the estrogen response element (ERE) of the vitellogenin A2 gene. The ERE is composed of a palindrome, and half of this palindrome resembles the region II binding site of the MHC CRE. These results indicate that H-2RIIBP (i) is a member of the superfamily of nuclear hormone receptors and (ii) may regulate not only MHC class I genes but also genes containing the ERE and related sequences. Sequences homologous to the H-2RIIBP gene are widely conserved in the animal kingdom. H-2RIIBP mRNA is expressed in many mouse tissues, in agreement with the distribution of the natural region II factor.

  1. Cross-linking of surface Ig receptors on murine B lymphocytes stimulates the expression of nuclear tetradecanoyl phorbol acetate-response element-binding proteins

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chiles, T.C.; Liu, J.L.; Rothstein, T.L.

    1991-03-15

    Cross-linking of sIg on primary B lymphocytes leads to increased nuclear DNA-binding activity specific for the tetradecanoyl phorbol acetate-response element (TRE), as judged by gel mobility shift assays. Stimulation of B cells to enter S phase of the cell cycle by treatment with the combination of phorbol ester plus calcium ionophore also stimulated nuclear TRE-binding activity within 2 h, with maximal expression at 4 h; however, phorbol ester and calcium ionophore were not as effective in stimulating binding activity when examined separately. Stimulated nuclear expression of TRE-binding activity appears to require protein synthesis. Fos- and Jun/AP-1-related proteins participate directly inmore » the identified nucleoprotein complex, as shown by the ability of c-fos- and c-jun-specific antisera to either alter or completely abolish electrophoretic migration of the complex in native gels. Further, UV photo-cross-linking studies identified two major TRE-binding protein species, whose sizes correspond to TRE-binding proteins derived from HeLa cell nuclear extracts. The results suggest that in primary B cells nuclear TRE-binding activity represents a downstream signaling event that occurs subsequent to changes in protein kinase C activity and intracellular Ca2+ but that can be triggered physiologically through sIg.« less

  2. ERalpha and AP-1 interact in vivo with a specific sequence of the F promoter of the human ERalpha gene in osteoblasts.

    PubMed

    Lambertini, Elisabetta; Tavanti, Elisa; Torreggiani, Elena; Penolazzi, Letizia; Gambari, Roberto; Piva, Roberta

    2008-07-01

    Estrogen-responsive genes often have an estrogen response element (ERE) positioned next to activator protein-1 (AP-1) binding sites. Considering that the interaction between ERE and AP-1 elements has been described for the modulation of bone-specific genes, we investigated the 17-beta-estradiol responsiveness and the role of these cis-elements present in the F promoter of the human estrogen receptor alpha (ERalpha) gene. The F promoter, containing the sequence analyzed here, is one of the multiple promoters of the human ERalpha gene and is the only active promoter in bone tissue. Through electrophoretic mobility shift (EMSA), chromatin immunoprecipitation (ChIP), and re-ChIP assays, we investigated the binding of ERalpha and four members of the AP-1 family (c-Jun, c-fos, Fra-2, and ATF2) to a region located approximately 800 bp upstream of the transcriptional start site of exon F of the human ERalpha gene in SaOS-2 osteoblast-like cells. Reporter gene assay experiments in combination with DNA binding assays demonstrated that F promoter activity is under the control of upstream cis-acting elements which are recognized by specific combinations of ERalpha, c-Jun, c-fos, and ATF2 homo- and heterodimers. Moreover, ChIP and re-ChIP experiments showed that these nuclear factors bind the F promoter in vivo with a simultaneous occupancy stimulated by 17-beta-estradiol. Taken together, our findings support a model in which ERalpha/AP-1 complexes modulate F promoter activity under conditions of 17-beta-estradiol stimulation. (c) 2008 Wiley-Liss, Inc.

  3. Activation of the carbohydrate response element binding protein (ChREBP) in response to anoxia in the turtle Trachemys scripta elegans.

    PubMed

    Krivoruchko, Anastasia; Storey, Kenneth B

    2014-10-01

    ChREBP (carbohydrate response element binding protein) is a glucose-responsive transcription factor that is known to be an important regulator of glycolytic and lipogenic genes in response to glucose. We hypothesized that activation of ChREBP could be relevant to anoxia survival by the anoxia-tolerant turtle, Trachemys scripta elegans. Expression of ChREBP in response to 5 and 20h of anoxia was examined using RT-PCR and Western immunoblotting. In addition, subcellular localization and DNA-binding activity of ChREBP protein were assessed and transcript levels of liver pyruvate kinase (LPK), a downstream gene under ChREBP control were quantified using RT-PCR. ChREBP was anoxia-responsive in kidney and liver, with transcript levels increasing by 1.2-1.8 fold in response to anoxia and protein levels increasing by 1.8-1.9 fold. Enhanced nuclear presence under anoxia was also observed in both tissues by 2.2-2.8 fold. A 4.2 fold increase in DNA binding activity of ChREBP was also observed in liver in response to 5h of anoxia. In addition, transcript levels of LPK increased by 2.1 fold in response to 5h of anoxia in the liver. The results suggest that activation of ChREBP in response to anoxia might be a crucial factor for anoxia survival in turtle liver by contributing to elevated glycolytic flux in the initial phases of oxygen limitation. This study provides the first demonstration of activation of ChREBP in response to anoxia in a natural model of anoxia tolerance, further improving our understanding of the molecular nature of anoxia tolerance. Copyright © 2014 Elsevier B.V. All rights reserved.

  4. ABF2, an ABRE-binding bZIP factor, is an essential component of glucose signaling and its overexpression affects multiple stress tolerance.

    PubMed

    Kim, Sunmi; Kang, Jung-Youn; Cho, Dong-Im; Park, Ji Hye; Kim, Soo Young

    2004-10-01

    Phytohormone abscisic acid (ABA) regulates stress-responsive gene expression during vegetative growth, which is mediated largely by cis-elements sharing the ACGTGGC consensus. Although many transcription factors are known to bind the elements in vitro, only a few have been demonstrated to have in vivo functions and their specific roles in ABA/stress responses are mostly unknown. Here, we report that ABF2, an ABF subfamily member of bZIP proteins interacting with the ABA-responsive elements, is involved in ABA/stress responses. Its overexpression altered ABA sensitivity, dehydration tolerance, and the expression levels of ABA/stress-regulated genes. Furthermore, ABF2 overexpression promoted glucose-induced inhibition of seedling development, whereas its mutation impaired glucose response. The reduced sugar sensitivity was not observed with mutants of two other ABF family members, ABF3 and ABF4. Instead, these mutants displayed defects in ABA, salt, and dehydration responses, which were not observed with the abf2 mutant. Our data indicate distinct roles of ABF family members: whereas ABF3 and ABF4 play essential roles in ABA/stress responses, ABF2 is required for normal glucose response. We also show that ABF2 overexpression affects multiple stress tolerance.

  5. Contributions of individual domains to function of the HIV-1 Rev response element.

    PubMed

    O'Carroll, Ina P; Thappeta, Yashna; Fan, Lixin; Ramirez-Valdez, Edric A; Smith, Sean; Wang, Yun-Xing; Rein, Alan

    2017-08-16

    The HIV-1 Rev response element (RRE) is a 351-base element in unspliced and partially spliced viral RNA; binding of the RRE by the viral Rev protein induces nuclear export of RRE-containing RNAs, as required for virus replication. It contains one long, imperfect double helix (domain I), one branched domain (domain II) containing a high-affinity Rev-binding site, and two or three additional domains. We previously reported that the RRE assumes an "A" shape in solution and suggested that the location of the Rev binding sites in domains I and II, opposite each other on the two legs of the A, is optimal for Rev binding and explains Rev's specificity for RRE-containing RNAs. Using SAXS and a quantitative functional assay, we have now analyzed a panel of RRE mutants. All the results support the essential role of the A shape for RRE function. Moreover, they suggest that the distal portion of domain I and the three crowning domains all contribute to the maintenance of the A shape. Domains I and II are necessary and sufficient for substantial RRE function, provided they are joined by a flexible linker that allows the two domains to face each other. IMPORTANCE Retroviral replication requires that some of the viral RNAs transcribed in the cell nucleus be exported to the cytoplasm without being spliced. To achieve this, HIV-1 encodes a protein, Rev, which binds to a complex, highly structured element within viral RNA, the Rev Response Element (RRE), and escorts RRE-containing RNAs from the nucleus. We previously reported that the RRE is "A"-shaped and suggested that this architecture, with the 2 legs opposite one another, can explain the specificity of Rev for the RRE. We have analyzed the functional contributions of individual RRE domains, and now report that several domains contribute, with some redundancy, to maintenance of the overall RRE shape. The data strongly support the hypothesis that the opposed placement of the 2 legs is essential for RRE function. Copyright © 2017 American Society for Microbiology.

  6. Contributions of Individual Domains to Function of the HIV-1 Rev Response Element

    PubMed Central

    O'Carroll, Ina P.; Thappeta, Yashna; Fan, Lixin; Ramirez-Valdez, Edric A.; Smith, Sean; Wang, Yun-Xing

    2017-01-01

    ABSTRACT The HIV-1 Rev response element (RRE) is a 351-base element in unspliced and partially spliced viral RNA; binding of the RRE by the viral Rev protein induces nuclear export of RRE-containing RNAs, as required for virus replication. It contains one long, imperfect double helix (domain I), one branched domain (domain II) containing a high-affinity Rev-binding site, and two or three additional domains. We previously reported that the RRE assumes an “A” shape in solution and suggested that the location of the Rev binding sites in domains I and II, opposite each other on the two legs of the A, is optimal for Rev binding and explains Rev's specificity for RRE-containing RNAs. Using small-angle X-ray scattering (SAXS) and a quantitative functional assay, we have now analyzed a panel of RRE mutants. All the results support the essential role of the A shape for RRE function. Moreover, they suggest that the distal portion of domain I and the three crowning domains all contribute to the maintenance of the A shape. Domains I and II are necessary and sufficient for substantial RRE function, provided they are joined by a flexible linker that allows the two domains to face each other. IMPORTANCE Retroviral replication requires that some of the viral RNAs transcribed in the cell nucleus be exported to the cytoplasm without being spliced. To achieve this, HIV-1 encodes a protein, Rev, which binds to a complex, highly structured element within viral RNA, the Rev response element (RRE), and escorts RRE-containing RNAs from the nucleus. We previously reported that the RRE is “A” shaped and suggested that this architecture, with the 2 legs opposite one another, can explain the specificity of Rev for the RRE. We have analyzed the functional contributions of individual RRE domains and now report that several domains contribute, with some redundancy, to maintenance of the overall RRE shape. The data strongly support the hypothesis that the opposed placement of the 2 legs is essential for RRE function. PMID:28814520

  7. Long noncoding RNA H19 interacts with polypyrimidine tract-binding protein 1 to reprogram hepatic lipid homeostasis.

    PubMed

    Liu, Chune; Yang, Zhihong; Wu, Jianguo; Zhang, Li; Lee, Sangmin; Shin, Dong-Ju; Tran, Melanie; Wang, Li

    2018-05-01

    H19 is an imprinted long noncoding RNA abundantly expressed in embryonic liver and repressed after birth. We show that H19 serves as a lipid sensor by synergizing with the RNA-binding polypyrimidine tract-binding protein 1 (PTBP1) to modulate hepatic metabolic homeostasis. H19 RNA interacts with PTBP1 to facilitate its association with sterol regulatory element-binding protein 1c mRNA and protein, leading to increased stability and nuclear transcriptional activity. H19 and PTBP1 are up-regulated by fatty acids in hepatocytes and in diet-induced fatty liver, which further augments lipid accumulation. Ectopic expression of H19 induces steatosis and pushes the liver into a "pseudo-fed" state in response to fasting by promoting sterol regulatory element-binding protein 1c protein cleavage and nuclear translocation. Deletion of H19 or knockdown of PTBP1 abolishes high-fat and high-sucrose diet-induced steatosis. Our study unveils an H19/PTBP1/sterol regulatory element-binding protein 1 feedforward amplifying signaling pathway to exacerbate the development of fatty liver. (Hepatology 2018;67:1768-1783). © 2017 by the American Association for the Study of Liver Diseases.

  8. EBP1 is a novel E2F target gene regulated by transforming growth factor-β.

    PubMed

    Judah, David; Chang, Wing Y; Dagnino, Lina

    2010-11-10

    Regulation of gene expression requires transcription factor binding to specific DNA elements, and a large body of work has focused on the identification of such sequences. However, it is becoming increasingly clear that eukaryotic transcription factors can exhibit widespread, nonfunctional binding to genomic DNA sites. Conversely, some of these proteins, such as E2F, can also modulate gene expression by binding to non-consensus elements. E2F comprises a family of transcription factors that play key roles in a wide variety of cellular functions, including survival, differentiation, activation during tissue regeneration, metabolism, and proliferation. E2F factors bind to the Erb3-binding protein 1 (EBP1) promoter in live cells. We now show that E2F binding to the EBP1 promoter occurs through two tandem DNA elements that do not conform to typical consensus E2F motifs. Exogenously expressed E2F1 activates EBP1 reporters lacking one, but not both sites, suggesting a degree of redundancy under certain conditions. E2F1 increases the levels of endogenous EBP1 mRNA in breast carcinoma and other transformed cell lines. In contrast, in non-transformed primary epidermal keratinocytes, E2F, together with the retinoblastoma family of proteins, appears to be involved in decreasing EBP1 mRNA abundance in response to growth inhibition by transforming growth factor-β1. Thus, E2F is likely a central coordinator of multiple responses that culminate in regulation of EBP1 gene expression, and which may vary depending on cell type and context.

  9. Identification of cis-elements for ethylene and circadian regulation of the Solanum melongena gene encoding cysteine proteinase.

    PubMed

    Rawat, Reetika; Xu, Zeng-Fu; Yao, Kwok-Ming; Chye, Mee-Len

    2005-03-01

    We have previously shown that the expression of SmCP which encodes Solanum melongena cysteine proteinase is ethylene-inducible and is under circadian control. To understand the regulation of SmCP, a 1.34-kb SmCP 5'-flanking region and its deletion derivatives were analyzed for cis-elements using GUS and luc fusions and by in vitro binding assays. Analysis of transgenic tobacco transformed with SmCP promoter-GUS constructs confirmed that the promoter region -415/+54 containing Ethylene Responsive Element ERE(-355/-348) conferred threefold ethylene-induction of GUS expression, while -827/+54 which also contains ERE(-683/-676), produced fivefold induction. Using gel mobility shift assays, we demonstrated that each ERE binds nuclear proteins from both ethephon-treated and untreated 5-week-old seedlings, suggesting that different transcriptions factors bind each ERE under varying physiological conditions. Binding was also observed in extracts from senescent, but not young, fruits. The variation in binding at the EREs in fruits and seedlings imply that organ-specific factors may participate in binding. Analysis of transgenic tobacco expressing various SmCP promoter-luc constructs containing wild-type or mutant Evening Elements (EEs) confirmed that both conserved EEs at -795/-787 and -785/-777 are important in circadian control. We confirmed the binding of total nuclear proteins to EEs in gel mobility shift assays and in DNase I footprinting. Our results suggest that multiple proteins bind the EEs which are conserved in plants other than Arabidopsis and that functional EEs and EREs are present in the 5'-flanking region of a gene encoding cysteine proteinase.

  10. Membrane and Integrative Nuclear Fibroblastic Growth Factor Receptor (FGFR) Regulation of FGF-23*

    PubMed Central

    Han, Xiaobin; Xiao, Zhousheng; Quarles, L. Darryl

    2015-01-01

    Fibroblastic growth factor receptor 1 (FGFR1) signaling pathways are implicated in the regulation of FGF-23 gene transcription, but the molecular pathways remain poorly defined. We used low molecular weight (LMW, 18 kDa) FGF-2 and high molecular weight (HMW) FGF-2 isoforms, which, respectively, activate cell surface FGF receptors and intranuclear FGFR1, to determine the roles of membrane FGFRs and integrative nuclear FGFR1 signaling (INFS) in the regulation of FGF-23 gene transcription in osteoblasts. We found that LMW-FGF-2 induced NFAT and Ets1 binding to conserved cis-elements in the proximal FGF-23 promoter and stimulated FGF-23 promoter activity through PLCγ/calcineurin/NFAT and MAPK pathways in SaOS-2 and MC3T3-E1 osteoblasts. In contrast, HMW-FGF-2 stimulated FGF-23 promoter activity in osteoblasts through a cAMP-dependent binding of FGFR1 and cAMP-response element-binding protein (CREB) to a conserved cAMP response element (CRE) contiguous with the NFAT binding site in the FGF-23 promoter. Mutagenesis of the NFAT and CRE binding sites, respectively, inhibited the effects of LMW-FGF-2 and HMW-FGF-23 to stimulate FGF-23 promoter activity. FGF-2 activation of both membrane FGFRs and INFS-dependent FGFR1 pathways may provide a means to integrate systemic and local regulation of FGF-23 transcription under diverse physiological and pathological conditions. PMID:25752607

  11. Stress-Induced Transcriptional Regulation in the Developing Rat Brain Involves Increased Cyclic Adenosine 3′,5′-Monophosphate-Regulatory Element Binding Activity

    PubMed Central

    Hatalski, Carolyn G.; Baram, Tallie Z.

    2012-01-01

    The cAMP-regulatory element (CRE) binding protein (CREB) functions as a trans-acting regulator of genes containing the CRE sequence in their promoter. These include a number of critical genes, such as CRF, involved in the hypothalamic response to stressful stimuli in the adult. The ability of the developing rat (during the first 2 postnatal weeks) to mount the full complement of this stress response has been questioned. We have previously demonstrated the stress-induced up-regulation of the transcription of hypothalamic CRF during the second postnatal week in the rat. The focus of the current study was to explore the mechanism of transcriptional regulation in response to stress through the physiological induction of transcriptional trans-activators that bind to the CRE in the developing rat brain. CRE-binding activity was detected via gel shift analysis in extracts from both the hypothalamus and the cerebral cortex of the developing rat. CREB was identified in these extracts by Western blot analysis and was shown to be the major contributor to the CRE-binding activity by gel shift analysis with two specific antibodies directed against CREB. After acute hypothermic stress, the abundance of CRE-binding activity (but not of total immunoreactive CREB), increased in hypothalamic extracts. This enhanced CRE-binding activity was blocked by an antiserum directed against CREB and was accompanied by an apparent increase in CREB phosphorylation. These results indicate that posttranslational enhancement of CRE-binding activity is likely to constitute an important mechanism for up-regulation of genes possessing the CRE sequence in the developing rat hypothalamus by adverse external signals. PMID:9415405

  12. HDAC Inhibition Modulates Hippocampus-Dependent Long-Term Memory for Object Location in a CBP-Dependent Manner

    ERIC Educational Resources Information Center

    Haettig, Jakob; Stefanko, Daniel P.; Multani, Monica L.; Figueroa, Dario X.; McQuown, Susan C.; Wood, Marcelo A.

    2011-01-01

    Transcription of genes required for long-term memory not only involves transcription factors, but also enzymatic protein complexes that modify chromatin structure. Chromatin-modifying enzymes, such as the histone acetyltransferase (HAT) CREB (cyclic-AMP response element binding) binding protein (CBP), are pivotal for the transcriptional regulation…

  13. The viral protein A238L inhibits TNF-alpha expression through a CBP/p300 transcriptional coactivators pathway.

    PubMed

    Granja, Aitor G; Nogal, Maria L; Hurtado, Carolina; Del Aguila, Carmen; Carrascosa, Angel L; Salas, María L; Fresno, Manuel; Revilla, Yolanda

    2006-01-01

    African swine fever virus (ASFV) is able to inhibit TNF-alpha-induced gene expression through the synthesis of A238L protein. This was shown by the use of deletion mutants lacking the A238L gene from the Vero cell-adapted Ba71V ASFV strain and from the virulent isolate E70. To further analyze the molecular mechanism by which the viral gene controls TNF-alpha, we have used Jurkat cells stably transfected with the viral gene to identify the TNF-alpha regulatory elements involved in the induction of the gene after stimulation with PMA and calcium ionophore. We have thus identified the cAMP-responsive element and kappa3 sites on the TNF-alpha promoter as the responsible of the gene activation, and demonstrate that A238L inhibits TNF-alpha expression through these DNA binding sites. This inhibition was partially reverted by overexpression of the transcriptional factors NF-AT, NF-kappaB, and c-Jun. Furthermore, we present evidence that A238L inhibits the activation of TNF-alpha by modulating NF-kappaB, NF-AT, and c-Jun trans activation through a mechanism that involves CREB binding protein/p300 function, because overexpression of these transcriptional coactivators recovers TNF-alpha promoter activity. In addition, we show that A238L is a nuclear protein that binds to the cyclic AMP-responsive element/kappa3 complex, thus displacing the CREB binding protein/p300 coactivators. Taken together, these results establish a novel mechanism in the control of TNF-alpha gene expression by a viral protein that could represent an efficient strategy used by ASFV to evade the innate immune response.

  14. Metabolite Regulation of Nuclear Localization of Carbohydrate-response Element-binding Protein (ChREBP)

    PubMed Central

    Sato, Shogo; Jung, Hunmin; Nakagawa, Tsutomu; Pawlosky, Robert; Takeshima, Tomomi; Lee, Wan-Ru; Sakiyama, Haruhiko; Laxman, Sunil; Wynn, R. Max; Tu, Benjamin P.; MacMillan, John B.; De Brabander, Jef K.; Veech, Richard L.; Uyeda, Kosaku

    2016-01-01

    The carbohydrate-response element-binding protein (ChREBP) is a glucose-responsive transcription factor that plays an essential role in converting excess carbohydrate to fat storage in the liver. In response to glucose levels, ChREBP is regulated by nuclear/cytosol trafficking via interaction with 14-3-3 proteins, CRM-1 (exportin-1 or XPO-1), or importins. Nuclear localization of ChREBP was rapidly inhibited when incubated in branched-chain α-ketoacids, saturated and unsaturated fatty acids, or 5-aminoimidazole-4-carboxamide ribonucleotide. Here, we discovered that protein-free extracts of high fat-fed livers contained, in addition to ketone bodies, a new metabolite, identified as AMP, which specifically activates the interaction between ChREBP and 14-3-3. The crystal structure showed that AMP binds directly to the N terminus of ChREBP-α2 helix. Our results suggest that AMP inhibits the nuclear localization of ChREBP through an allosteric activation of ChREBP/14-3-3 interactions and not by activation of AMPK. AMP and ketone bodies together can therefore inhibit lipogenesis by restricting localization of ChREBP to the cytoplasm during periods of ketosis. PMID:26984404

  15. A nuclear factor I-like activity and a liver-specific repressor govern estrogen-regulated in vitro transcription from the Xenopus laevis vitellogenin B1 promoter.

    PubMed

    Corthésy, B; Cardinaux, J R; Claret, F X; Wahli, W

    1989-12-01

    A hormone-controlled in vitro transcription system derived from Xenopus liver nuclear extracts was exploited to identify novel cis-acting elements within the vitellogenin gene B1 promoter region. In addition to the already well-documented estrogen-responsive element (ERE), two elements were found within the 140 base pairs upstream of the transcription initiation site. One of them, a negative regulatory element, is responsible for the lack of promoter activity in the absence of the hormone and, as demonstrated by DNA-binding assays, interacts with a liver-specific transcription factor. The second is required in association with the estrogen-responsive element to mediate hormonal induction and is recognized by the Xenopus liver homolog of nuclear factor I.

  16. A role for neuronal cAMP responsive-element binding (CREB)-1 in brain responses to calorie restriction

    PubMed Central

    Fusco, Salvatore; Ripoli, Cristian; Podda, Maria Vittoria; Ranieri, Sofia Chiatamone; Leone, Lucia; Toietta, Gabriele; McBurney, Michael W.; Schütz, Günther; Riccio, Antonella; Grassi, Claudio; Galeotti, Tommaso; Pani, Giovambattista

    2012-01-01

    Calorie restriction delays brain senescence and prevents neurodegeneration, but critical regulators of these beneficial responses other than the NAD+-dependent histone deacetylase Sirtuin-1 (Sirt-1) are unknown. We report that effects of calorie restriction on neuronal plasticity, memory and social behavior are abolished in mice lacking cAMP responsive-element binding (CREB)-1 in the forebrain. Moreover, CREB deficiency drastically reduces the expression of Sirt-1 and the induction of genes relevant to neuronal metabolism and survival in the cortex and hippocampus of dietary-restricted animals. Biochemical studies reveal a complex interplay between CREB and Sirt-1: CREB directly regulates the transcription of the sirtuin in neuronal cells by binding to Sirt-1 chromatin; Sirt-1, in turn, is recruited by CREB to DNA and promotes CREB-dependent expression of target gene peroxisome proliferator-activated receptor-γ coactivator-1α and neuronal NO Synthase. Accordingly, expression of these CREB targets is markedly reduced in the brain of Sirt KO mice that are, like CREB-deficient mice, poorly responsive to calorie restriction. Thus, the above circuitry, modulated by nutrient availability, links energy metabolism with neurotrophin signaling, participates in brain adaptation to nutrient restriction, and is potentially relevant to accelerated brain aging by overnutrition and diabetes. PMID:22190495

  17. An ethylene-responsive enhancer element is involved in the senescence-related expression of the carnation glutathione-S-transferase (GST1) gene.

    PubMed

    Itzhaki, H; Maxson, J M; Woodson, W R

    1994-09-13

    The increased production of ethylene during carnation petal senescence regulates the transcription of the GST1 gene encoding a subunit of glutathione-S-transferase. We have investigated the molecular basis for this ethylene-responsive transcription by examining the cis elements and trans-acting factors involved in the expression of the GST1 gene. Transient expression assays following delivery of GST1 5' flanking DNA fused to a beta-glucuronidase receptor gene were used to functionally define sequences responsible for ethylene-responsive expression. Deletion analysis of the 5' flanking sequences of GST1 identified a single positive regulatory element of 197 bp between -667 and -470 necessary for ethylene-responsive expression. The sequences within this ethylene-responsive region were further localized to 126 bp between -596 and -470. The ethylene-responsive element (ERE) within this region conferred ethylene-regulated expression upon a minimal cauliflower mosaic virus-35S TATA-box promoter in an orientation-independent manner. Gel electrophoresis mobility-shift assays and DNase I footprinting were used to identify proteins that bind to sequences within the ERE. Nuclear proteins from carnation petals were shown to specifically interact with the 126-bp ERE and the presence and binding of these proteins were independent of ethylene or petal senescence. DNase I footprinting defined DNA sequences between -510 and -488 within the ERE specifically protected by bound protein. An 8-bp sequence (ATTTCAAA) within the protected region shares significant homology with promoter sequences required for ethylene responsiveness from the tomato fruit-ripening E4 gene.

  18. Maize DRE-binding proteins DBF1 and DBF2 are involved in rab17 regulation through the drought-responsive element in an ABA-dependent pathway.

    PubMed

    Kizis, Dimosthenis; Pagès, Montserrat

    2002-06-01

    The abscisic acid-responsive gene rab17 of maize is expressed during late embryogenesis, and is induced by ABA and desiccation in embryo and vegetative tissues. ABRE and DRE cis-elements are involved in regulation of the gene by ABA and drought. Using yeast one-hybrid screening, we isolated two cDNAs encoding two new DRE-binding proteins, designated DBF1 and DBF2, that are members of the AP2/EREBP transcription factor family. Analysis of mRNA accumulation profiles showed that DBF1 is induced during maize embryogenesis and after desiccation, NaCl and ABA treatments in plant seedlings, whereas the DBF2 mRNA is not induced. DNA-binding preferences of DBFs were analysed by electrophoretic mobility shift assays, and showed that both DBF1 and DBF2 bound to the wild-type DRE2 element, but not to the DRE2 mutant or to the DRE1 element which differs only in a single nucleotide. Transactivation activity using particle bombardment showed that DBF1 functioned as activator of DRE2-dependent transcription of rab17 promoter by ABA, whereas DBF2 overexpression had a repression action downregulating not only the basal promoter activity, but also the ABA effect. These results show that ABA plays a role in the regulation of DBF activity, and suggests the existence of an ABA-dependent pathway for the regulation of genes through the C-repeat/DRE element.

  19. Transcriptional targets shared by estrogen receptor- related receptors (ERRs) and estrogen receptor (ER) alpha, but not by ERbeta.

    PubMed Central

    Vanacker, J M; Pettersson, K; Gustafsson, J A; Laudet, V

    1999-01-01

    The physiological activities of estrogens are thought to be mediated by specific nuclear receptors, ERalpha and ERbeta. However, certain tissues, such as the bone, that are highly responsive to estrogens only express a low level of these receptors. Starting from this apparent contradiction, we have evaluated the potentials of two related receptors ERRalpha and ERRbeta to intervene in estrogen signaling. ERalpha, ERRalpha and ERRbeta bind to and activate transcription through both the classical estrogen response element (ERE) and the SF-1 response element (SFRE). In contrast, ERbeta DNA-binding and transcriptional activity is restricted to the ERE. Accordingly, the osteopontin gene promoter is stimulated through SFRE sequences, by ERRalpha as well as by ERalpha, but not by ERbeta. Analysis of the cross-talk within the ER/ERR subgroup of nuclear receptors thus revealed common targets but also functional differences between the two ERs. PMID:10428965

  20. The Saccharomyces cerevisiae zinc finger proteins Msn2p and Msn4p are required for transcriptional induction through the stress response element (STRE).

    PubMed Central

    Martínez-Pastor, M T; Marchler, G; Schüller, C; Marchler-Bauer, A; Ruis, H; Estruch, F

    1996-01-01

    The MSN2 and MSN4 genes encode homologous and functionally redundant Cys2His2 zinc finger proteins. A disruption of both MSN2 and MSN4 genes results in a higher sensitivity to different stresses, including carbon source starvation, heat shock and severe osmotic and oxidative stresses. We show that MSN2 and MSN4 are required for activation of several yeast genes such as CTT1, DDR2 and HSP12, whose induction is mediated through stress-response elements (STREs). Msn2p and Msn4p are important factors for the stress-induced activation of STRE dependent promoters and bind specifically to STRE-containing oligonucleotides. Our results suggest that MSN2 and MSN4 encode a DNA-binding component of the stress responsive system and it is likely that they act as positive transcription factors. Images PMID:8641288

  1. Steap4 Plays a Critical Role in Osteoclastogenesis in Vitro by Regulating Cellular Iron/Reactive Oxygen Species (ROS) Levels and cAMP Response Element-binding Protein (CREB) Activation*

    PubMed Central

    Zhou, Jian; Ye, Shiqiao; Fujiwara, Toshifumi; Manolagas, Stavros C.; Zhao, Haibo

    2013-01-01

    Iron is essential for osteoclast differentiation, and iron overload in a variety of hematologic diseases is associated with excessive bone resorption. Iron uptake by osteoclast precursors via the transferrin cycle increases mitochondrial biogenesis, reactive oxygen species production, and activation of cAMP response element-binding protein, a critical transcription factor downstream of receptor activator of NF-κB-ligand-induced calcium signaling. These changes are required for the differentiation of osteoclast precursors to mature bone-resorbing osteoclasts. However, the molecular mechanisms regulating cellular iron metabolism in osteoclasts remain largely unknown. In this report, we provide evidence that Steap4, a member of the six-transmembrane epithelial antigen of prostate (Steap) family proteins, is an endosomal ferrireductase with a critical role in cellular iron utilization in osteoclasts. Specifically, we show that Steap4 is the only Steap family protein that is up-regulated during osteoclast differentiation. Knocking down Steap4 expression in vitro by lentivirus-mediated short hairpin RNAs inhibits osteoclast formation and decreases cellular ferrous iron, reactive oxygen species, and the activation of cAMP response element-binding protein. These results demonstrate that Steap4 is a critical enzyme for cellular iron uptake and utilization in osteoclasts and, thus, indispensable for osteoclast development and function. PMID:23990467

  2. De-novo discovery of differentially abundant transcription factor binding sites including their positional preference.

    PubMed

    Keilwagen, Jens; Grau, Jan; Paponov, Ivan A; Posch, Stefan; Strickert, Marc; Grosse, Ivo

    2011-02-10

    Transcription factors are a main component of gene regulation as they activate or repress gene expression by binding to specific binding sites in promoters. The de-novo discovery of transcription factor binding sites in target regions obtained by wet-lab experiments is a challenging problem in computational biology, which has not been fully solved yet. Here, we present a de-novo motif discovery tool called Dispom for finding differentially abundant transcription factor binding sites that models existing positional preferences of binding sites and adjusts the length of the motif in the learning process. Evaluating Dispom, we find that its prediction performance is superior to existing tools for de-novo motif discovery for 18 benchmark data sets with planted binding sites, and for a metazoan compendium based on experimental data from micro-array, ChIP-chip, ChIP-DSL, and DamID as well as Gene Ontology data. Finally, we apply Dispom to find binding sites differentially abundant in promoters of auxin-responsive genes extracted from Arabidopsis thaliana microarray data, and we find a motif that can be interpreted as a refined auxin responsive element predominately positioned in the 250-bp region upstream of the transcription start site. Using an independent data set of auxin-responsive genes, we find in genome-wide predictions that the refined motif is more specific for auxin-responsive genes than the canonical auxin-responsive element. In general, Dispom can be used to find differentially abundant motifs in sequences of any origin. However, the positional distribution learned by Dispom is especially beneficial if all sequences are aligned to some anchor point like the transcription start site in case of promoter sequences. We demonstrate that the combination of searching for differentially abundant motifs and inferring a position distribution from the data is beneficial for de-novo motif discovery. Hence, we make the tool freely available as a component of the open-source Java framework Jstacs and as a stand-alone application at http://www.jstacs.de/index.php/Dispom.

  3. Activation of Basal Gluconeogenesis by Coactivator p300 Maintains Hepatic Glycogen Storage

    PubMed Central

    Cao, Jia; Meng, Shumei; Ma, Anlin; Radovick, Sally; Wondisford, Fredric E.

    2013-01-01

    Because hepatic glycogenolysis maintains euglycemia during early fasting, proper hepatic glycogen synthesis in the fed/postprandial states is critical. It has been known for decades that gluconeogenesis is essential for hepatic glycogen synthesis; however, the molecular mechanism remains unknown. In this report, we show that depletion of hepatic p300 reduces glycogen synthesis, decreases hepatic glycogen storage, and leads to relative hypoglycemia. We previously reported that insulin suppressed gluconeogenesis by phosphorylating cAMP response element binding protein-binding protein (CBP) at S436 and disassembling the cAMP response element-binding protein-CBP complex. However, p300, which is closely related to CBP, lacks the corresponding S436 phosphorylation site found on CBP. In a phosphorylation-competent p300G422S knock-in mouse model, we found that mutant mice exhibited reduced hepatic glycogen content and produced significantly less glycogen in a tracer incorporation assay in the postprandial state. Our study demonstrates the important and unique role of p300 in glycogen synthesis through maintaining basal gluconeogenesis. PMID:23770612

  4. Robust Translation of the Nucleoid Protein Fis Requires a Remote Upstream AU Element and Is Enhanced by RNA Secondary Structure

    PubMed Central

    Nafissi, Maryam; Chau, Jeannette; Xu, Jimin

    2012-01-01

    Synthesis of the Fis nucleoid protein rapidly increases in response to nutrient upshifts, and Fis is one of the most abundant DNA binding proteins in Escherichia coli under nutrient-rich growth conditions. Previous work has shown that control of Fis synthesis occurs at transcription initiation of the dusB-fis operon. We show here that while translation of the dihydrouridine synthase gene dusB is low, unusual mechanisms operate to enable robust translation of fis. At least two RNA sequence elements located within the dusB coding region are responsible for high fis translation. The most important is an AU element centered 35 nucleotides (nt) upstream of the fis AUG, which may function as a binding site for ribosomal protein S1. In addition, a 44-nt segment located upstream of the AU element and predicted to form a stem-loop secondary structure plays a prominent role in enhancing fis translation. On the other hand, mutations close to the AUG, including over a potential Shine-Dalgarno sequence, have little effect on Fis protein levels. The AU element and stem-loop regions are phylogenetically conserved within dusB-fis operons of representative enteric bacteria. PMID:22389479

  5. Meta-analysis of the effect of overexpression of CBF/DREB family genes on drought stress response

    USDA-ARS?s Scientific Manuscript database

    Transcription factors C-repeat/dehydration-responsive element binding proteins (CBF/DREB) play an important role in plant response to abiotic stresses. Over-expression of various CBF/DREB genes in diverse plants have been reported, but inconsistency of gene donor, recipient genus, parameters used i...

  6. The coactivator CBP stimulates human T-cell lymphotrophic virus type I Tax transactivation in vitro.

    PubMed

    Kashanchi, F; Duvall, J F; Kwok, R P; Lundblad, J R; Goodman, R H; Brady, J N

    1998-12-18

    Tax interacts with the cellular cyclic AMP-responsive element binding protein (CREB) and facilitates the binding of the coactivator CREB binding protein (CBP), forming a multimeric complex on the cyclic AMP-responsive element (CRE)-like sites in the human T-cell lymphotrophic virus type I (HTLV-I) promoter. The trimeric complex is believed to recruit additional regulatory proteins to the HTLV-I long terminal repeat, but there has been no direct evidence that CBP is required for Tax-mediated transactivation. We present evidence that Tax and CBP activate transcription from the HTLV-I 21 base pair repeats on naked DNA templates. Transcriptional activation of the HTLV-I sequences required both Tax and CBP and could be mediated by either the N-terminal activation domain of CBP or the full-length protein. Fluorescence polarization binding assays indicated that CBP does not markedly enhance the affinity of Tax for the trimeric complex. Transcription analyses suggest that CBP activates Tax-dependent transcription by promoting transcriptional initiation and reinitiation. The ability of CBP to activate the HTLV-I promoter does not involve the stabilization of Tax binding, but rather depends upon gene activation properties of the co-activator that function in the context of a naked DNA template.

  7. Binding of serum response factor to cystic fibrosis transmembrane conductance regulator CArG-like elements, as a new potential CFTR transcriptional regulation pathway

    PubMed Central

    René, Céline; Taulan, Magali; Iral, Florence; Doudement, Julien; L'Honoré, Aurore; Gerbon, Catherine; Demaille, Jacques; Claustres, Mireille; Romey, Marie-Catherine

    2005-01-01

    CFTR expression is tightly controlled by a complex network of ubiquitous and tissue-specific cis-elements and trans-factors. To better understand mechanisms that regulate transcription of CFTR, we examined transcription factors that specifically bind a CFTR CArG-like motif we have previously shown to modulate CFTR expression. Gel mobility shift assays and chromatin immunoprecipitation analyses demonstrated the CFTR CArG-like motif binds serum response factor both in vitro and in vivo. Transient co-transfections with various SRF expression vector, including dominant-negative forms and small interfering RNA, demonstrated that SRF significantly increases CFTR transcriptional activity in bronchial epithelial cells. Mutagenesis studies suggested that in addition to SRF other co-factors, such as Yin Yang 1 (YY1) previously shown to bind the CFTR promoter, are potentially involved in the CFTR regulation. Here, we show that functional interplay between SRF and YY1 might provide interesting perspectives to further characterize the underlying molecular mechanism of the basal CFTR transcriptional activity. Furthermore, the identification of multiple CArG binding sites in highly conserved CFTR untranslated regions, which form specific SRF complexes, provides direct evidence for a considerable role of SRF in the CFTR transcriptional regulation into specialized epithelial lung cells. PMID:16170155

  8. Characterization of the mouse junD promoter--high basal level activity due to an octamer motif.

    PubMed Central

    de Groot, R P; Karperien, M; Pals, C; Kruijer, W

    1991-01-01

    The product of the junD gene belongs to the Jun/Fos family of nuclear DNA binding transcription factors. This family regulates the expression of TPA responsive genes by binding to the TPA responsive element (TRE). Unlike its counterparts c-jun and junB, junD expression is hardly inducible by growth factors and phorbol esters. In fact, junD is constitutively expressed at high levels in a wide variety of cells. To unravel the molecular mechanisms underlying constitutive junD expression, we have cloned and characterized the mouse junD promoter. We show that the high constitutive expression is caused by multiple cis-acting elements in its promoter, including an SP1 binding site, an octamer motif, a CAAT box, a Zif268 binding site and a TRE-like sequence. The octamer motif is the major determinant of junD promoter activity, while somewhat smaller contributions are made by the TRE and Zif268 binding site. The SP1 and CAAT box are shown to be of minor importance. The junD TRE is in its behavior indistinguishable from previously identified TREs. However, the junD promoter is not TPA inducible due to the presence of the octamer motif. Images PMID:1714380

  9. Saccharomyces cerevisiae gene expression changes during rotating wall vessel suspension culture

    NASA Technical Reports Server (NTRS)

    Johanson, Kelly; Allen, Patricia L.; Lewis, Fawn; Cubano, Luis A.; Hyman, Linda E.; Hammond, Timothy G.

    2002-01-01

    This study utilizes Saccharomyces cerevisiae to study genetic responses to suspension culture. The suspension culture system used in this study is the high-aspect-ratio vessel, one type of the rotating wall vessel, that provides a high rate of gas exchange necessary for rapidly dividing cells. Cells were grown in the high-aspect-ratio vessel, and DNA microarray and metabolic analyses were used to determine the resulting changes in yeast gene expression. A significant number of genes were found to be up- or downregulated by at least twofold as a result of rotational growth. By using Gibbs promoter alignment, clusters of genes were examined for promoter elements mediating these genetic changes. Candidate binding motifs similar to the Rap1p binding site and the stress-responsive element were identified in the promoter regions of differentially regulated genes. This study shows that, as in higher order organisms, S. cerevisiae changes gene expression in response to rotational culture and also provides clues for investigations into the signaling pathways involved in gravitational response.

  10. HIV-1 RRE RNA acts as an RNA silencing suppressor by competing with TRBP-bound siRNAs

    PubMed Central

    Daniels, Sylvanne M; Sinck, Lucile; Ward, Natalie J; Melendez-Peña, Carlos E; Scarborough, Robert J; Azar, Ibrahim; Rance, Elodie; Daher, Aïcha; Pang, Ka-Ming; Rossi, John J; Gatignol, Anne

    2015-01-01

    Several proteins and RNAs expressed by mammalian viruses have been reported to interfere with RNA interference (RNAi) activity. We investigated the ability of the HIV-1-encoded RNA elements Trans-Activation Response (TAR) and Rev-Response Element (RRE) to alter RNAi. MicroRNA let7-based assays showed that RRE is a potent suppressor of RNAi activity, while TAR displayed moderate RNAi suppression. We demonstrate that RRE binds to TAR-RNA Binding Protein (TRBP), an essential component of the RNA Induced Silencing Complex (RISC). The binding of TAR and RRE to TRBP displaces small interfering (si)RNAs from binding to TRBP. Several stem-deleted RRE mutants lost their ability to suppress RNAi activity, which correlated with a reduced ability to compete with siRNA-TRBP binding. A lentiviral vector expressing TAR and RRE restricted RNAi, but RNAi was restored when Rev or GagPol were coexpressed. Adenoviruses are restricted by RNAi and encode their own suppressors of RNAi, the Virus-Associated (VA) RNA elements. RRE enhanced the replication of wild-type and VA-deficient adenovirus. Our work describes RRE as a novel suppressor of RNAi that acts by competing with siRNAs rather than by disrupting the RISC. This function is masked in lentiviral vectors co-expressed with viral proteins and thus will not affect their use in gene therapy. The potent RNAi suppressive effects of RRE identified in this study could be used to enhance the expression of RNAi restricted viruses used in oncolysis such as adenoviruses. PMID:25668122

  11. HIV-1 RRE RNA acts as an RNA silencing suppressor by competing with TRBP-bound siRNAs.

    PubMed

    Daniels, Sylvanne M; Sinck, Lucile; Ward, Natalie J; Melendez-Peña, Carlos E; Scarborough, Robert J; Azar, Ibrahim; Rance, Elodie; Daher, Aïcha; Pang, Ka-Ming; Rossi, John J; Gatignol, Anne

    2015-01-01

    Several proteins and RNAs expressed by mammalian viruses have been reported to interfere with RNA interference (RNAi) activity. We investigated the ability of the HIV-1-encoded RNA elements Trans-Activation Response (TAR) and Rev-Response Element (RRE) to alter RNAi. MicroRNA let7-based assays showed that RRE is a potent suppressor of RNAi activity, while TAR displayed moderate RNAi suppression. We demonstrate that RRE binds to TAR-RNA Binding Protein (TRBP), an essential component of the RNA Induced Silencing Complex (RISC). The binding of TAR and RRE to TRBP displaces small interfering (si)RNAs from binding to TRBP. Several stem-deleted RRE mutants lost their ability to suppress RNAi activity, which correlated with a reduced ability to compete with siRNA-TRBP binding. A lentiviral vector expressing TAR and RRE restricted RNAi, but RNAi was restored when Rev or GagPol were coexpressed. Adenoviruses are restricted by RNAi and encode their own suppressors of RNAi, the Virus-Associated (VA) RNA elements. RRE enhanced the replication of wild-type and VA-deficient adenovirus. Our work describes RRE as a novel suppressor of RNAi that acts by competing with siRNAs rather than by disrupting the RISC. This function is masked in lentiviral vectors co-expressed with viral proteins and thus will not affect their use in gene therapy. The potent RNAi suppressive effects of RRE identified in this study could be used to enhance the expression of RNAi restricted viruses used in oncolysis such as adenoviruses.

  12. Intercalation of XR5944 with the estrogen response element is modulated by the tri-nucleotide spacer sequence between half-sites

    PubMed Central

    Sidell, Neil; Mathad, Raveendra I.; Shu, Feng-jue; Zhang, Zhenjiang; Kallen, Caleb B.; Yang, Danzhou

    2011-01-01

    DNA-intercalating molecules can impair DNA replication, DNA repair, and gene transcription. We previously demonstrated that XR5944, a DNA bis-intercalator, specifically blocks binding of estrogen receptor-α (ERα) to the consensus estrogen response element (ERE). The consensus ERE sequence is AGGTCAnnnTGACCT, where nnn is known as the tri-nucleotide spacer. Recent work has shown that the tri-nucleotide spacer can modulate ERα-ERE binding affinity and ligand-mediated transcriptional responses. To further understand the mechanism by which XR5944 inhibits ERα-ERE binding, we tested its ability to interact with consensus EREs with variable tri-nucleotide spacer sequences and with natural but non-consensus ERE sequences using one dimensional nuclear magnetic resonance (1D 1H NMR) titration studies. We found that the tri-nucleotide spacer sequence significantly modulates the binding of XR5944 to EREs. Of the sequences that were tested, EREs with CGG and AGG spacers showed the best binding specificity with XR5944, while those spaced with TTT demonstrated the least specific binding. The binding stoichiometry of XR5944 with EREs was 2:1, which can explain why the spacer influences the drug-DNA interaction; each XR5944 spans four nucleotides (including portions of the spacer) when intercalating with DNA. To validate our NMR results, we conducted functional studies using reporter constructs containing consensus EREs with tri-nucleotide spacers CGG, CTG, and TTT. Results of reporter assays in MCF-7 cells indicated that XR5944 was significantly more potent in inhibiting the activity of CGG- than TTT-spaced EREs, consistent with our NMR results. Taken together, these findings predict that the anti-estrogenic effects of XR5944 will depend not only on ERE half-site composition but also on the tri-nucleotide spacer sequence of EREs located in the promoters of estrogen-responsive genes. PMID:21333738

  13. The pure estrogen receptor antagonist ICI 182,780 promotes a novel interaction of estrogen receptor-alpha with the 3',5'-cyclic adenosine monophosphate response element-binding protein-binding protein/p300 coactivators.

    PubMed

    Jaber, Basem M; Gao, Tong; Huang, Luping; Karmakar, Sudipan; Smith, Carolyn L

    2006-11-01

    Estrogen receptor-alpha (ERalpha) is a member of the nuclear receptor superfamily of ligand-activated transcription factors. Abundant evidence demonstrates that ERalpha agonists promote, whereas antagonists inhibit, receptor binding to coactivators. In this report we demonstrate that binding of the ICI 182,780 (ICI) pure antiestrogen to ERalpha promotes its interaction with the cAMP response element-binding protein-binding protein (CBP)/p300 but not the p160 family of coactivators, demonstrating the specificity of this interaction. Amino acid mutations within the coactivator binding surface of the ERalpha ligand-binding domain revealed that CBP binds to this region of the ICI-liganded receptor. The carboxy-terminal cysteine-histidine rich domain 3 of CBP, rather than its amino-terminal nuclear interacting domain, shown previously to mediate agonist-dependent interactions of CBP with nuclear receptors, is required for binding to ICI-liganded ERalpha. Chromatin immunoprecipitation assays revealed that ICI but not the partial agonist/antagonist 4-hydroxytamoxifen is able to recruit CBP to the pS2 promoter, and this distinguishes ICI from this class of antiestrogens. Chromatin immunoprecipitation assays for pS2 and cytochrome P450 1B1 promoter regions revealed that ICI-dependent recruitment of CBP, but not receptor, to ERalpha targets is gene specific. ICI treatment did not recruit the steroid receptor coactivator 1 to the pS2 promoter, and it failed to induce the expression of this gene. Taken together, these data indicate that recruitment of the CBP coactivator/cointegrator without steroid receptor coactivator 1 to ERalpha is insufficient to promote transcription of ERalpha target genes.

  14. The HILDA Complex Coordinates a Conditional Switch in the 3′-Untranslated Region of the VEGFA mRNA

    PubMed Central

    Yao, Peng; Potdar, Alka A.; Ray, Partho Sarothi; Eswarappa, Sandeepa M.; Flagg, Andrew C.; Willard, Belinda; Fox, Paul L.

    2013-01-01

    Cell regulatory circuits integrate diverse, and sometimes conflicting, environmental cues to generate appropriate, condition-dependent responses. Here, we elucidate the components and mechanisms driving a protein-directed RNA switch in the 3′UTR of vascular endothelial growth factor (VEGF)-A. We describe a novel HILDA (hypoxia-inducible hnRNP L–DRBP76–hnRNP A2/B1) complex that coordinates a three-element RNA switch, enabling VEGFA mRNA translation during combined hypoxia and inflammation. In addition to binding the CA-rich element (CARE), heterogeneous nuclear ribonucleoprotein (hnRNP) L regulates switch assembly and function. hnRNP L undergoes two previously unrecognized, condition-dependent posttranslational modifications: IFN-γ induces prolyl hydroxylation and von Hippel-Lindau (VHL)-mediated proteasomal degradation, whereas hypoxia stimulates hnRNP L phosphorylation at Tyr359, inducing binding to hnRNP A2/B1, which stabilizes the protein. Also, phospho-hnRNP L recruits DRBP76 (double-stranded RNA binding protein 76) to the 3′UTR, where it binds an adjacent AU-rich stem-loop (AUSL) element, “flipping” the RNA switch by disrupting the GAIT (interferon-gamma-activated inhibitor of translation) element, preventing GAIT complex binding, and driving robust VEGFA mRNA translation. The signal-dependent, HILDA complex coordinates the function of a trio of neighboring RNA elements, thereby regulating translation of VEGFA and potentially other mRNA targets. The VEGFA RNA switch might function to ensure appropriate angiogenesis and tissue oxygenation during conflicting signals from combined inflammation and hypoxia. We propose the VEGFA RNA switch as an archetype for signal-activated, protein-directed, multi-element RNA switches that regulate posttranscriptional gene expression in complex environments. PMID:23976881

  15. S-adenosylmethionine directly inhibits binding of 30S ribosomal subunits to the SMK box translational riboswitch RNA

    PubMed Central

    Fuchs, Ryan T.; Grundy, Frank J.; Henkin, Tina M.

    2007-01-01

    The SMK box is a conserved riboswitch motif found in the 5′ untranslated region of metK genes [encoding S-adenosylmethionine (SAM) synthetase] in lactic acid bacteria, including Enterococcus, Streptococcus, and Lactococcus sp. Previous studies showed that this RNA element binds SAM in vitro, and SAM binding causes a structural rearrangement that sequesters the Shine–Dalgarno (SD) sequence by pairing with an anti-SD (ASD) element. A model was proposed in which SAM binding inhibits metK translation by preventing binding of the ribosome to the SD region of the mRNA. In the current work, the addition of SAM was shown to inhibit binding of 30S ribosomal subunits to SMK box RNA; in contrast, the addition of S-adenosylhomocysteine (SAH) had no effect. A mutant RNA, which has a disrupted SD-ASD pairing, was defective in SAM binding and showed no reduction of ribosome binding in the presence of SAM, whereas a compensatory mutation that restored SD-ASD pairing restored the response to SAM. Primer extension inhibition assays provided further evidence for SD-ASD pairing in the presence of SAM. These results strongly support the model that SMK box translational repression operates through occlusion of the ribosome binding site and that SAM binding requires the SD-ASD pairing. PMID:17360376

  16. Serine 133 Phosphorylation Is Not Required for Hippocampal CREB-Mediated Transcription and Behavior

    ERIC Educational Resources Information Center

    Brian, Lisa A.; Lee, Bridgin G.; Lelay, John; Kaestner, Klaus H.; Blendy, Julie A.

    2015-01-01

    The cAMP response element (CRE)-binding protein, CREB, is a transcription factor whose activity in the brain is critical for long-term memory formation. Phosphorylation of Ser133 in the kinase-inducible domain (KID), that in turn leads to the recruitment of the transcriptional coactivator CREB-binding protein (CBP), is thought to mediate the…

  17. L-rhamnose-binding lectins (RBLs) in Nile tilapia, Oreochromis niloticus: characterization and expression profiling in mucosal tissues

    USDA-ARS?s Scientific Manuscript database

    Rhamnose-binding lectins (RBLs) are crucial elements associated with innate immune responses to infections and have been characterized from a variety of teleost fishes. Our previous work highlighted a major role of a RBL (IpRBL1a) in mediating F. columnare adhesion and IpRBL1a showed higher expressi...

  18. Berberine Suppresses Adipocyte Differentiation via Decreasing CREB Transcriptional Activity

    PubMed Central

    Deng, Ruyuan; Wang, Ning; Zhang, Yuqing; Wang, Yao; Liu, Yun; Li, Fengying; Wang, Xiao; Zhou, Libin

    2015-01-01

    Berberine, one of the major constituents of Chinese herb Rhizoma coptidis, has been demonstrated to lower blood glucose, blood lipid, and body weight in patients with type 2 diabetes mellitus. The anti-obesity effect of berberine has been attributed to its anti-adipogenic activity. However, the underlying molecular mechanism remains largely unknown. In the present study, we found that berberine significantly suppressed the expressions of CCAAT/enhancer-binding protein (C/EBP)α, peroxisome proliferators-activated receptor γ2 (PPARγ2), and other adipogenic genes in the process of adipogenesis. Berberine decreased cAMP-response element-binding protein (CREB) phosphorylation and C/EBPβ expression at the early stage of 3T3-L1 preadipocyte differentiation. In addition, CREB phosphorylation and C/EBPβ expression induced by 3-isobutyl-1-methylxanthine (IBMX) and forskolin were also attenuated by berberine. The binding activities of cAMP responsive element (CRE) stimulated by IBMX and forskolin were inhibited by berberine. The binding of phosphorylated CREB to the promoter of C/EBPβ was abrogated by berberine after the induction of preadipocyte differentiation. These results suggest that berberine blocks adipogenesis mainly via suppressing CREB activity, which leads to a decrease in C/EBPβ-triggered transcriptional cascades. PMID:25928058

  19. Metabolite Regulation of Nuclear Localization of Carbohydrate-response Element-binding Protein (ChREBP): ROLE OF AMP AS AN ALLOSTERIC INHIBITOR.

    PubMed

    Sato, Shogo; Jung, Hunmin; Nakagawa, Tsutomu; Pawlosky, Robert; Takeshima, Tomomi; Lee, Wan-Ru; Sakiyama, Haruhiko; Laxman, Sunil; Wynn, R Max; Tu, Benjamin P; MacMillan, John B; De Brabander, Jef K; Veech, Richard L; Uyeda, Kosaku

    2016-05-13

    The carbohydrate-response element-binding protein (ChREBP) is a glucose-responsive transcription factor that plays an essential role in converting excess carbohydrate to fat storage in the liver. In response to glucose levels, ChREBP is regulated by nuclear/cytosol trafficking via interaction with 14-3-3 proteins, CRM-1 (exportin-1 or XPO-1), or importins. Nuclear localization of ChREBP was rapidly inhibited when incubated in branched-chain α-ketoacids, saturated and unsaturated fatty acids, or 5-aminoimidazole-4-carboxamide ribonucleotide. Here, we discovered that protein-free extracts of high fat-fed livers contained, in addition to ketone bodies, a new metabolite, identified as AMP, which specifically activates the interaction between ChREBP and 14-3-3. The crystal structure showed that AMP binds directly to the N terminus of ChREBP-α2 helix. Our results suggest that AMP inhibits the nuclear localization of ChREBP through an allosteric activation of ChREBP/14-3-3 interactions and not by activation of AMPK. AMP and ketone bodies together can therefore inhibit lipogenesis by restricting localization of ChREBP to the cytoplasm during periods of ketosis. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  20. A Catharanthus roseus BPF-1 homologue interacts with an elicitor-responsive region of the secondary metabolite biosynthetic gene Str and is induced by elicitor via a JA-independent signal transduction pathway.

    PubMed

    van der Fits, L; Zhang, H; Menke, F L; Deneka, M; Memelink, J

    2000-11-01

    Plants respond to pathogen attack by induction of various defence responses, including the biosynthesis of protective secondary metabolites. In Catharanthus roseus, the elicitor-induced expression of the terpenoid indole alkaloid biosynthetic gene Strictosidine synthase (Str) is mediated via the plant stress hormonejasmonate. In the promoters of several defence-related genes, cis-acting elements have been identified that are important for transcriptional regulation upon stress signals. Here we show that an upstream region in the Str promoter confers responsiveness to partially purified yeast elicitor and jasmonate. Yeast one-hybrid screening with this element as a bait identified a MYB-like protein, which shows high homology to parsley box P-binding factor-1 (PcBPF-1). In vitro analyses showed that the Str promoter fragment contained a novel binding site for BPF-1-like proteins with higher binding affinity than the previously described box P. CrBPF-1 mRNA accumulated rapidly in elicitor-treated C. roseus suspension cells, whereas no induction was observed with jasmonate. Inhibitor studies indicated that CrBPF-1 plays a role in an elicitor-responsive but jasmonate-independent signal transduction pathway, acting downstream of protein phosphorylation and calcium influx.

  1. Regulation of nrf operon expression in pathogenic enteric bacteria: sequence divergence reveals new regulatory complexity

    PubMed Central

    Godfrey, Rita E.; Lee, David J.; Busby, Stephen J. W.

    2017-01-01

    Summary The Escherichia coli K‐12 nrf operon encodes a periplasmic nitrite reductase, the expression of which is driven from a single promoter, pnrf. Expression from pnrf is activated by the FNR transcription factor in response to anaerobiosis and further increased in response to nitrite by the response regulator proteins, NarL and NarP. FNR‐dependent transcription is suppressed by the binding of two nucleoid associated proteins, IHF and Fis. As Fis levels increase in cells grown in rich medium, the positioning of its binding site, overlapping the promoter −10 element, ensures that pnrf is sharply repressed. Here, we investigate the expression of the nrf operon promoter from various pathogenic enteric bacteria. We show that pnrf from enterohaemorrhagic E. coli is more active than its K‐12 counterpart, exhibits substantial FNR‐independent activity and is insensitive to nutrient quality, due to an improved −10 element. We also demonstrate that the Salmonella enterica serovar Typhimurium core promoter is more active than previously thought, due to differences around the transcription start site, and that its expression is repressed by downstream sequences. We identify the CsrA RNA binding protein as being responsible for this, and show that CsrA differentially regulates the E. coli K‐12 and Salmonella nrf operons. PMID:28211111

  2. A remorin gene SiREM6, the target gene of SiARDP, from foxtail millet (Setaria italica) promotes high salt tolerance in transgenic Arabidopsis.

    PubMed

    Yue, Jing; Li, Cong; Liu, Yuwei; Yu, Jingjuan

    2014-01-01

    Remorin proteins (REMs) form a plant-specific protein family, with some REMs being responsive to abiotic stress. However, the precise functions of REMs in abiotic stress tolerance are not clear. In this study, we identified 11 remorin genes from foxtail millet (Setaria italica) and cloned a remorin gene, SiREM6, for further investigation. The transcript level of SiREM6 was increased by high salt stress, low temperature stress and abscisic acid (ABA) treatment, but not by drought stress. The potential oligomerization of SiREM6 was examined by negative staining electron microscopy. The overexpression of SiREM6 improved high salt stress tolerance in transgenic Arabidopsis at the germination and seedling stages as revealed by germination rate, survival rate, relative electrolyte leakage and proline content. The SiREM6 promoter contains two dehydration responsive elements (DRE) and one ABA responsive element (ABRE). An ABA responsive DRE-binding transcription factor, SiARDP, and an ABRE-binding transcription factor, SiAREB1, were cloned from foxtail millet. SiARDP could physically bind to the DREs, but SiAREB1 could not. These results revealed that SiREM6 is a target gene of SiARDP and plays a critical role in high salt stress tolerance.

  3. The prokaryotic enhancer binding protein NTRC has an ATPase activity which is phosphorylation and DNA dependent.

    PubMed Central

    Austin, S; Dixon, R

    1992-01-01

    The prokaryotic activator protein NTRC binds to enhancer-like elements and activates transcription in response to nitrogen limitation by catalysing open complex formation by sigma 54 RNA polymerase holoenzyme. Formation of open complexes requires the phosphorylated form of NTRC and the reaction is ATP dependent. We find that NTRC has an ATPase activity which is activated by phosphorylation and is strongly stimulated by the presence of DNA containing specific NTRC binding sites. Images PMID:1534752

  4. Conserved structures formed by heterogeneous RNA sequences drive silencing of an inflammation responsive post-transcriptional operon

    PubMed Central

    Basu, Abhijit; Jain, Niyati; Tolbert, Blanton S.; Komar, Anton A.

    2017-01-01

    Abstract RNA–protein interactions with physiological outcomes usually rely on conserved sequences within the RNA element. By contrast, activity of the diverse gamma-interferon-activated inhibitor of translation (GAIT)-elements relies on the conserved RNA folding motifs rather than the conserved sequence motifs. These elements drive the translational silencing of a group of chemokine (CC/CXC) and chemokine receptor (CCR) mRNAs, thereby helping to resolve physiological inflammation. Despite sequence dissimilarity, these RNA elements adopt common secondary structures (as revealed by 2D-1H NMR spectroscopy), providing a basis for their interaction with the RNA-binding GAIT complex. However, many of these elements (e.g. those derived from CCL22, CXCL13, CCR4 and ceruloplasmin (Cp) mRNAs) have substantially different affinities for GAIT complex binding. Toeprinting analysis shows that different positions within the overall conserved GAIT element structure contribute to differential affinities of the GAIT protein complex towards the elements. Thus, heterogeneity of GAIT elements may provide hierarchical fine-tuning of the resolution of inflammation. PMID:29069516

  5. Liver X receptor regulates hepatic nuclear O-GlcNAc signaling and carbohydrate responsive element-binding protein activity[S

    PubMed Central

    Bindesbøll, Christian; Fan, Qiong; Nørgaard, Rikke C.; MacPherson, Laura; Ruan, Hai-Bin; Wu, Jing; Pedersen, Thomas Å.; Steffensen, Knut R.; Yang, Xiaoyong; Matthews, Jason; Mandrup, Susanne; Nebb, Hilde I.; Grønning-Wang, Line M.

    2015-01-01

    Liver X receptor (LXR)α and LXRβ play key roles in hepatic de novo lipogenesis through their regulation of lipogenic genes, including sterol regulatory element-binding protein (SREBP)-1c and carbohydrate responsive element-binding protein (ChREBP). LXRs activate lipogenic gene transcription in response to feeding, which is believed to be mediated by insulin. We have previously shown that LXRs are targets for glucose-hexosamine-derived O-linked β-N-acetylglucosamine (O-GlcNAc) modification enhancing their ability to regulate SREBP-1c promoter activity in vitro. To elucidate insulin-independent effects of feeding on LXR-mediated lipogenic gene expression in vivo, we subjected control and streptozotocin-treated LXRα/β+/+ and LXRα/β−/− mice to a fasting-refeeding regime. We show that under hyperglycemic and hypoinsulinemic conditions, LXRs maintain their ability to upregulate the expression of glycolytic and lipogenic enzymes, including glucokinase (GK), SREBP-1c, ChREBPα, and the newly identified shorter isoform ChREBPβ. Furthermore, glucose-dependent increases in LXR/retinoid X receptor-regulated luciferase activity driven by the ChREBPα promoter was mediated, at least in part, by O-GlcNAc transferase (OGT) signaling in Huh7 cells. Moreover, we show that LXR and OGT interact and colocalize in the nucleus and that loss of LXRs profoundly reduced nuclear O-GlcNAc signaling and ChREBPα promoter binding activity in vivo. In summary, our study provides evidence that LXRs act as nutrient and glucose metabolic sensors upstream of ChREBP by modulating GK expression, nuclear O-GlcNAc signaling, and ChREBP expression and activity. PMID:25724563

  6. The influence of repressor DNA binding site architecture on transcriptional control.

    PubMed

    Park, Dan M; Kiley, Patricia J

    2014-08-26

    How the architecture of DNA binding sites dictates the extent of repression of promoters is not well understood. Here, we addressed the importance of the number and information content of the three direct repeats (DRs) in the binding and repression of the icdA promoter by the phosphorylated form of the global Escherichia coli repressor ArcA (ArcA-P). We show that decreasing the information content of the two sites with the highest information (DR1 and DR2) eliminated ArcA binding to all three DRs and ArcA repression of icdA. Unexpectedly, we also found that DR3 occupancy functions principally in repression, since mutation of this low-information-content site both eliminated DNA binding to DR3 and significantly weakened icdA repression, despite the fact that binding to DR1 and DR2 was intact. In addition, increasing the information content of any one of the three DRs or addition of a fourth DR increased ArcA-dependent repression but perturbed signal-dependent regulation of repression. Thus, our data show that the information content and number of DR elements are critical architectural features for maintaining a balance between high-affinity binding and signal-dependent regulation of icdA promoter function in response to changes in ArcA-P levels. Optimization of such architectural features may be a common strategy to either dampen or enhance the sensitivity of DNA binding among the members of the large OmpR/PhoB family of regulators as well as other transcription factors. In Escherichia coli, the response regulator ArcA maintains homeostasis of redox carriers under O2-limiting conditions through a comprehensive repression of carbon oxidation pathways that require aerobic respiration to recycle redox carriers. Although a binding site architecture comprised of a variable number of sequence recognition elements has been identified within the promoter regions of ArcA-repressed operons, it is unclear how this variable architecture dictates transcriptional regulation. By dissecting the role of multiple sequence elements within the icdA promoter, we provide insight into the design principles that allow ArcA to repress transcription within diverse promoter contexts. Our data suggest that the arrangement of recognition elements is tailored to achieve sufficient repression of a given promoter while maintaining appropriate signal-dependent regulation of repression, providing insight into how diverse binding site architectures link changes in O2 with the fine-tuning of carbon oxidation pathway levels. Copyright © 2014 Park and Kiley.

  7. Specific DNA binding of a potential transcriptional regulator, inosine 5'-monophosphate dehydrogenase-related protein VII, to the promoter region of a methyl coenzyme m reductase I-encoding operon retrieved from Methanothermobacter thermautotrophicus strain DeltaH.

    PubMed

    Shinzato, Naoya; Enoki, Miho; Sato, Hiroaki; Nakamura, Kohei; Matsui, Toru; Kamagata, Yoichi

    2008-10-01

    Two methyl coenzyme M reductases (MCRs) encoded by the mcr and mrt operons of the hydrogenotrophic methanogen Methanothermobacter thermautotrophicus DeltaH are expressed in response to H(2) availability. In the present study, cis elements and trans-acting factors responsible for the gene expression of MCRs were investigated by using electrophoretic mobility shift assay (EMSA) and affinity particle purification. A survey of their operator regions by EMSA with protein extracts from mrt-expressing cultures restricted them to 46- and 41-bp-long mcr and mrt upstream regions, respectively. Affinity particle purification of DNA-binding proteins conjugated with putative operator regions resulted in the retrieval of a protein attributed to IMP dehydrogenase-related protein VII (IMPDH VII). IMPDH VII is predicted to have a winged helix-turn-helix DNA-binding motif and two cystathionine beta-synthase domains, and it has been suspected to be an energy-sensing module. EMSA with oligonucleotide probes with unusual sequences showed that the binding site of IMPDH VII mostly overlaps the factor B-responsible element-TATA box of the mcr operon. The results presented here suggest that IMPDH VII encoded by MTH126 is a plausible candidate for the transcriptional regulator of the mcr operon in this methanogen.

  8. Insulation and wiring specificity of BceR-like response regulators and their target promoters in Bacillus subtilis.

    PubMed

    Fang, Chong; Nagy-Staroń, Anna; Grafe, Martin; Heermann, Ralf; Jung, Kirsten; Gebhard, Susanne; Mascher, Thorsten

    2017-04-01

    BceRS and PsdRS are paralogous two-component systems in Bacillus subtilis controlling the response to antimicrobial peptides. In the presence of extracellular bacitracin and nisin, respectively, the two response regulators (RRs) bind their target promoters, P bceA or P psdA , resulting in a strong up-regulation of target gene expression and ultimately antibiotic resistance. Despite high sequence similarity between the RRs BceR and PsdR and their known binding sites, no cross-regulation has been observed between them. We therefore investigated the specificity determinants of P bceA and P psdA that ensure the insulation of these two paralogous pathways at the RR-promoter interface. In vivo and in vitro analyses demonstrate that the regulatory regions within these two promoters contain three important elements: in addition to the known (main) binding site, we identified a linker region and a secondary binding site that are crucial for functionality. Initial binding to the high-affinity, low-specificity main binding site is a prerequisite for the subsequent highly specific binding of a second RR dimer to the low-affinity secondary binding site. In addition to this hierarchical cooperative binding, discrimination requires a competition of the two RRs for their respective binding site mediated by only slight differences in binding affinities. © 2016 John Wiley & Sons Ltd.

  9. Structural characterization of a novel full-length transcript promoter from Horseradish Latent Virus (HRLV) and its transcriptional regulation by multiple stress responsive transcription factors.

    PubMed

    Khan, Ahamed; Shrestha, Ankita; Bhuyan, Kashyap; Maiti, Indu B; Dey, Nrisingha

    2018-01-01

    The promoter fragment described in this study can be employed for strong transgene expression under both biotic and abiotic stress conditions. Plant-infecting Caulimoviruses have evolved multiple regulatory mechanisms to address various environmental stimuli during the course of evolution. One such mechanism involves the retention of discrete stress responsive cis-elements which are required for their survival and host-specificity. Here we describe the characterization of a novel Caulimoviral promoter isolated from Horseradish Latent Virus (HRLV) and its regulation by multiple stress responsive Transcription factors (TFs) namely DREB1, AREB1 and TGA1a. The activity of full length transcript (Flt-) promoter from HRLV (- 677 to + 283) was investigated in both transient and transgenic assays where we identified H12 (- 427 to + 73) as the highest expressing fragment having ~ 2.5-fold stronger activity than the CaMV35S promoter. The H12 promoter was highly active and near-constitutive in the vegetative and reproductive parts of both Tobacco and Arabidopsis transgenic plants. Interestingly, H12 contains a distinct cluster of cis-elements like dehydration-responsive element (DRE-core; GCCGAC), an ABA-responsive element (ABRE; ACGTGTC) and as-1 element (TGACG) which are known to be induced by cold, drought and pathogen/SA respectively. The specific binding of DREB1, AREB1 and TGA1a to DRE, ABRE and as-1 elements respectively were confirmed by the gel-binding assays using H12 promoter-specific probes. Detailed mutational analysis of the H12 promoter suggested that the presence of DRE-core and as-1 element was indispensable for its activity which was further confirmed by the transactivation assays. Our studies imply that H12 could be a valuable genetic tool for regulated transgene expression under diverse environmental conditions.

  10. Isolation and analysis of a multifunctional triterpene synthase KcMS promoter region from mangrove plant kandelia candel

    NASA Astrophysics Data System (ADS)

    Basyuni, M.; Wati, R.; Sulistiyono, N.; Sumardi; Oku, H.; Baba, S.; Sagami, H.

    2018-03-01

    Molecular cloning of Kandelia candel KcMS gene has previously been cloned and encoded a multifunctional triterpene synthase. In this study, the KcMS gene promoter was cloned through Genome walking, sequenced, and analyzed. A 1,358 bp genomic DNA fragment of KcMS promoter was obtained. PLACE and PlantCARE analysis of the KcMS promoter revealed that there was some regulatory elements in response to environmental signals and involved in the regulation of gene expression. Results showed that four kinds of elements are regulated by hormone binding, namely 2 MeJA-responsiveness elements (CGTCA-motif and TGACG-motif), the ABRE (TACGTG) involved in abscisic acid responsiveness, gibberellin-related GARE-motif (AAACAGA), and the TGA-element (AACGAC) as an auxin-responsive element. Several elements in the KcMS have been shown in other plants to be responsive to abiotic stress. These motifs were MBS (CAACTG), TC-rich repeats, and eight light responsive elements. The KcMS promoter was also involved in the activation of defense genes in plants such as HSE (AAAAAATTC) and four circadian control elements (CAANNNNATC). The presence of multipotential regulatory motifs suggested that KcMS may be involved in regulation of plant tolerance to several types of stresses.

  11. The cellular transcription factor CREB corresponds to activating transcription factor 47 (ATF-47) and forms complexes with a group of polypeptides related to ATF-43.

    PubMed

    Hurst, H C; Masson, N; Jones, N C; Lee, K A

    1990-12-01

    Promoter elements containing the sequence motif CGTCA are important for a variety of inducible responses at the transcriptional level. Multiple cellular factors specifically bind to these elements and are encoded by a multigene family. Among these factors, polypeptides termed activating transcription factor 43 (ATF-43) and ATF-47 have been purified from HeLa cells and a factor referred to as cyclic AMP response element-binding protein (CREB) has been isolated from PC12 cells and rat brain. We demonstrated that CREB and ATF-47 are identical and that CREB and ATF-43 form protein-protein complexes. We also found that the cis requirements for stable DNA binding by ATF-43 and CREB are different. Using antibodies to ATF-43 we have identified a group of polypeptides (ATF-43) in the size range from 40 to 43 kDa. ATF-43 polypeptides are related by their reactivity with anti-ATF-43, DNA-binding specificity, complex formation with CREB, heat stability, and phosphorylation by protein kinase A. Certain cell types vary in their ATF-43 complement, suggesting that CREB activity is modulated in a cell-type-specific manner through interaction with ATF-43. ATF-43 polypeptides do not appear simply to correspond to the gene products of the ATF multigene family, suggesting that the size of the ATF family at the protein level is even larger than predicted from cDNA-cloning studies.

  12. Ski acts as a co-repressor with Smad2 and Smad3 to regulate the response to type β transforming growth factor

    PubMed Central

    Xu, Weidong; Angelis, Konstantina; Danielpour, David; Haddad, Maher M.; Bischof, Oliver; Campisi, Judith; Stavnezer, Ed; Medrano, Estela E.

    2000-01-01

    The c-ski protooncogene encodes a transcription factor that binds DNA only in association with other proteins. To identify co-binding proteins, we performed a yeast two-hybrid screen. The results of the screen and subsequent co-immunoprecipitation studies identified Smad2 and Smad3, two transcriptional activators that mediate the type β transforming growth factor (TGF-β) response, as Ski-interacting proteins. In Ski-transformed cells, all of the Ski protein was found in Smad3-containing complexes that accumulated in the nucleus in the absence of added TGF-β. DNA binding assays showed that Ski, Smad2, Smad3, and Smad4 form a complex with the Smad/Ski binding element GTCTAGAC (SBE). Ski repressed TGF-β-induced expression of 3TP-Lux, the natural plasminogen activator inhibitor 1 promoter and of reporter genes driven by the SBE and the related CAGA element. In addition, Ski repressed a TGF-β-inducible promoter containing AP-1 (TRE) elements activated by a combination of Smads, Fos, and/or Jun proteins. Ski also repressed synergistic activation of promoters by combinations of Smad proteins but failed to repress in the absence of Smad4. Thus, Ski acts in opposition to TGF-β-induced transcriptional activation by functioning as a Smad-dependent co-repressor. The biological relevance of this transcriptional repression was established by showing that overexpression of Ski abolished TGF-β-mediated growth inhibition in a prostate-derived epithelial cell line. PMID:10811875

  13. Ski acts as a co-repressor with Smad2 and Smad3 to regulate the response to type beta transforming growth factor.

    PubMed

    Xu, W; Angelis, K; Danielpour, D; Haddad, M M; Bischof, O; Campisi, J; Stavnezer, E; Medrano, E E

    2000-05-23

    The c-ski protooncogene encodes a transcription factor that binds DNA only in association with other proteins. To identify co-binding proteins, we performed a yeast two-hybrid screen. The results of the screen and subsequent co-immunoprecipitation studies identified Smad2 and Smad3, two transcriptional activators that mediate the type beta transforming growth factor (TGF-beta) response, as Ski-interacting proteins. In Ski-transformed cells, all of the Ski protein was found in Smad3-containing complexes that accumulated in the nucleus in the absence of added TGF-beta. DNA binding assays showed that Ski, Smad2, Smad3, and Smad4 form a complex with the Smad/Ski binding element GTCTAGAC (SBE). Ski repressed TGF-beta-induced expression of 3TP-Lux, the natural plasminogen activator inhibitor 1 promoter and of reporter genes driven by the SBE and the related CAGA element. In addition, Ski repressed a TGF-beta-inducible promoter containing AP-1 (TRE) elements activated by a combination of Smads, Fos, and/or Jun proteins. Ski also repressed synergistic activation of promoters by combinations of Smad proteins but failed to repress in the absence of Smad4. Thus, Ski acts in opposition to TGF-beta-induced transcriptional activation by functioning as a Smad-dependent co-repressor. The biological relevance of this transcriptional repression was established by showing that overexpression of Ski abolished TGF-beta-mediated growth inhibition in a prostate-derived epithelial cell line.

  14. β-Amylase–Like Proteins Function as Transcription Factors in Arabidopsis, Controlling Shoot Growth and Development[C][W][OA

    PubMed Central

    Reinhold, Heike; Soyk, Sebastian; Šimková, Klára; Hostettler, Carmen; Marafino, John; Mainiero, Samantha; Vaughan, Cara K.; Monroe, Jonathan D.; Zeeman, Samuel C.

    2011-01-01

    Plants contain β-amylase–like proteins (BAMs; enzymes usually associated with starch breakdown) present in the nucleus rather than targeted to the chloroplast. They possess BRASSINAZOLE RESISTANT1 (BZR1)-type DNA binding domains—also found in transcription factors mediating brassinosteroid (BR) responses. The two Arabidopsis thaliana BZR1-BAM proteins (BAM7 and BAM8) bind a cis-regulatory element that both contains a G box and resembles a BR-responsive element. In protoplast transactivation assays, these BZR1-BAMs activate gene expression. Structural modeling suggests that the BAM domain’s glucan binding cleft is intact, but the recombinant proteins are at least 1000 times less active than chloroplastic β-amylases. Deregulation of BZR1-BAMs (the bam7bam8 double mutant and BAM8-overexpressing plants) causes altered leaf growth and development. Of the genes upregulated in plants overexpressing BAM8 and downregulated in bam7bam8 plants, many carry the cis-regulatory element in their promoters. Many genes that respond to BRs are inversely regulated by BZR1-BAMs. We propose a role for BZR1-BAMs in controlling plant growth and development through crosstalk with BR signaling. Furthermore, we speculate that BZR1-BAMs may transmit metabolic signals by binding a ligand in their BAM domain, although diurnal changes in the concentration of maltose, a candidate ligand produced by chloroplastic β-amylases, do not influence their transcription factor function. PMID:21487098

  15. β-amylase-like proteins function as transcription factors in Arabidopsis, controlling shoot growth and development.

    PubMed

    Reinhold, Heike; Soyk, Sebastian; Simková, Klára; Hostettler, Carmen; Marafino, John; Mainiero, Samantha; Vaughan, Cara K; Monroe, Jonathan D; Zeeman, Samuel C

    2011-04-01

    Plants contain β-amylase-like proteins (BAMs; enzymes usually associated with starch breakdown) present in the nucleus rather than targeted to the chloroplast. They possess BRASSINAZOLE RESISTANT1 (BZR1)-type DNA binding domains--also found in transcription factors mediating brassinosteroid (BR) responses. The two Arabidopsis thaliana BZR1-BAM proteins (BAM7 and BAM8) bind a cis-regulatory element that both contains a G box and resembles a BR-responsive element. In protoplast transactivation assays, these BZR1-BAMs activate gene expression. Structural modeling suggests that the BAM domain's glucan binding cleft is intact, but the recombinant proteins are at least 1000 times less active than chloroplastic β-amylases. Deregulation of BZR1-BAMs (the bam7bam8 double mutant and BAM8-overexpressing plants) causes altered leaf growth and development. Of the genes upregulated in plants overexpressing BAM8 and downregulated in bam7bam8 plants, many carry the cis-regulatory element in their promoters. Many genes that respond to BRs are inversely regulated by BZR1-BAMs. We propose a role for BZR1-BAMs in controlling plant growth and development through crosstalk with BR signaling. Furthermore, we speculate that BZR1-BAMs may transmit metabolic signals by binding a ligand in their BAM domain, although diurnal changes in the concentration of maltose, a candidate ligand produced by chloroplastic β-amylases, do not influence their transcription factor function.

  16. Downstream promoter interactions of TFIID TAFs facilitate transcription reinitiation

    PubMed Central

    Joo, Yoo Jin; Ficarro, Scott B.; Soares, Luis M.; Chun, Yujin; Marto, Jarrod A.; Buratowski, Stephen

    2017-01-01

    TFIID binds promoter DNA to recruit RNA polymerase II and other basal factors for transcription. Although the TATA-binding protein (TBP) subunit of TFIID is necessary and sufficient for in vitro transcription, the TBP-associated factor (TAF) subunits recognize downstream promoter elements, act as coactivators, and interact with nucleosomes. In yeast nuclear extracts, transcription induces stable TAF binding to downstream promoter DNA, promoting subsequent activator-independent transcription reinitiation. In vivo, promoter responses to TAF mutations correlate with the level of downstream, rather than overall, Taf1 cross-linking. We propose a new model in which TAFs function as reinitiation factors, accounting for the differential responses of promoters to various transcription factor mutations. PMID:29203645

  17. Characterization of calcineurin-dependent response element binding protein and its involvement in copper-metallothionein gene expression in Neurospora

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kumar, Kalari Satish; Ravi Kumar, B.; Siddavattam, Dayananda

    2006-07-07

    In continuation of our recent observations indicating the presence of a lone calcineurin-dependent response element (CDRE) in the -3730 bp upstream region of copper-induced metallothionein (CuMT) gene of Neurospora [K.S. Kumar, S. Dayananda, C. Subramanyam, Copper alone, but not oxidative stress, induces copper-metallothionein gene in Neurospora crassa, FEMS Microbiol. Lett. 242 (2005) 45-50], we isolated and characterized the CDRE-binding protein. The cloned upstream region of CuMT gene was used as the template to specifically amplify CDRE element, which was immobilized on CNBr-activated Sepharose 4B for use as the affinity matrix to purify the CDRE binding protein from nuclear extracts obtainedmore » from Neurospora cultures grown in presence of copper. Two-dimensional gel electrophoresis of the affinity purified protein revealed the presence of a single 17 kDa protein, which was identified and characterized by MALDI-TOF. Peptide mass finger printing of tryptic digests and analysis of the 17 kDa protein matched with the regulatory {beta}-subunit of calcineurin (Ca{sup 2+}-calmodulin dependent protein phosphatase). Parallel identification of nuclear localization signals in this protein by in silico analysis suggests a putative role for calcineurin in the regulation of CuMT gene expression.« less

  18. A novel cold-inducible zinc finger protein from soybean, SCOF-1, enhances cold tolerance in transgenic plants.

    PubMed

    Kim, J C; Lee, S H; Cheong, Y H; Yoo, C M; Lee, S I; Chun, H J; Yun, D J; Hong, J C; Lee, S Y; Lim, C O; Cho, M J

    2001-02-01

    Cold stress on plants induces changes in the transcription of cold response genes. A cDNA clone encoding C2H2-type zinc finger protein, SCOF-1, was isolated from soybean. The transcription of SCOF-1 is specifically induced by low temperature and abscisic acid (ABA) but not by dehydration or high salinity. Constitutive overexpression of SCOF-1 induced cold-regulated (COR) gene expression and enhanced cold tolerance of non-acclimated transgenic Arabidopsis and tobacco plants. SCOF-1 localized to the nucleus but did not bind directly to either C-repeat/dehydration (CRT/DRE) or ABA responsive element (ABRE), cis-acting DNA regulatory elements present in COR gene promoters. However, SCOF-1 greatly enhanced the DNA binding activity of SGBF-1, a soybean G-box binding bZIP transcription factor, to ABRE in vitro. SCOF-1 also interacted with SGBF-1 in a yeast two-hybrid system. The SGBF-1 transactivated the beta-glucuronidase reporter gene driven by the ABRE element in Arabidopsis leaf protoplasts. Furthermore, the SCOF-1 enhanced ABRE-dependent gene expression mediated by SGBF-1. These results suggest that SCOF-1 may function as a positive regulator of COR gene expression mediated by ABRE via protein-protein interaction, which in turn enhances cold tolerance of plants.

  19. Mutations on the DNA Binding Surface of TBP Discriminate between Yeast TATA and TATA-Less Gene Transcription

    PubMed Central

    Kamenova, Ivanka; Warfield, Linda

    2014-01-01

    Most RNA polymerase (Pol) II promoters lack a TATA element, yet nearly all Pol II transcription requires TATA binding protein (TBP). While the TBP-TATA interaction is critical for transcription at TATA-containing promoters, it has been unclear whether TBP sequence-specific DNA contacts are required for transcription at TATA-less genes. Transcription factor IID (TFIID), the TBP-containing coactivator that functions at most TATA-less genes, recognizes short sequence-specific promoter elements in metazoans, but analogous promoter elements have not been identified in Saccharomyces cerevisiae. We generated a set of mutations in the yeast TBP DNA binding surface and found that most support growth of yeast. Both in vivo and in vitro, many of these mutations are specifically defective for transcription of two TATA-containing genes with only minor defects in transcription of two TATA-less, TFIID-dependent genes. TBP binds several TATA-less promoters with apparent high affinity, but our results suggest that this binding is not important for transcription activity. Our results are consistent with the model that sequence-specific TBP-DNA contacts are not important at yeast TATA-less genes and suggest that other general transcription factors or coactivator subunits are responsible for recognition of TATA-less promoters. Our results also explain why yeast TBP derivatives defective for TATA binding appear defective in activated transcription. PMID:24865972

  20. Mutations on the DNA binding surface of TBP discriminate between yeast TATA and TATA-less gene transcription.

    PubMed

    Kamenova, Ivanka; Warfield, Linda; Hahn, Steven

    2014-08-01

    Most RNA polymerase (Pol) II promoters lack a TATA element, yet nearly all Pol II transcription requires TATA binding protein (TBP). While the TBP-TATA interaction is critical for transcription at TATA-containing promoters, it has been unclear whether TBP sequence-specific DNA contacts are required for transcription at TATA-less genes. Transcription factor IID (TFIID), the TBP-containing coactivator that functions at most TATA-less genes, recognizes short sequence-specific promoter elements in metazoans, but analogous promoter elements have not been identified in Saccharomyces cerevisiae. We generated a set of mutations in the yeast TBP DNA binding surface and found that most support growth of yeast. Both in vivo and in vitro, many of these mutations are specifically defective for transcription of two TATA-containing genes with only minor defects in transcription of two TATA-less, TFIID-dependent genes. TBP binds several TATA-less promoters with apparent high affinity, but our results suggest that this binding is not important for transcription activity. Our results are consistent with the model that sequence-specific TBP-DNA contacts are not important at yeast TATA-less genes and suggest that other general transcription factors or coactivator subunits are responsible for recognition of TATA-less promoters. Our results also explain why yeast TBP derivatives defective for TATA binding appear defective in activated transcription. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  1. Two distinct cellular proteins interact with the EIa-responsive element of an adenovirus early promoter.

    PubMed Central

    Jansen-Durr, P; Wintzerith, M; Reimund, B; Hauss, C; Kédinger, C

    1990-01-01

    EIa-dependent transactivation of the adenovirus EIIa early (EIIaE) promoter is correlated with the activation of the cellular transcription factor E2F. In this study we identified a cellular protein, C alpha, that is distinct from E2F and that binds two sites in the EIIaE promoter, one of which overlaps with the proximal E2F binding site of the EIIaE promoter. The possible involvement of C alpha in the EIa responsiveness of this promoter is discussed. Images PMID:2139142

  2. Internal loop/bulge and hairpin loop of the iron-responsive element of ferritin mRNA contribute to maximal iron regulatory protein 2 binding and translational regulation in the iso-iron-responsive element/iso-iron regulatory protein family.

    PubMed

    Ke, Y; Sierzputowska-Gracz, H; Gdaniec, Z; Theil, E C

    2000-05-23

    Iron-responsive elements (IREs), a natural group of mRNA-specific sequences, bind iron regulatory proteins (IRPs) differentially and fold into hairpins [with a hexaloop (HL) CAGUGX] with helical distortions: an internal loop/bulge (IL/B) (UGC/C) or C-bulge. C-bulge iso-IREs bind IRP2 more poorly, as oligomers (n = 28-30), and have a weaker signal response in vivo. Two trans-loop GC base pairs occur in the ferritin IRE (IL/B and HL) but only one in C-bulge iso-IREs (HL); metal ions and protons perturb the IL/B [Gdaniec et al. (1998) Biochemistry 37, 1505-1512]. IRE function (translation) and physical properties (T(m) and accessibility to nucleases) are now compared for IL/B and C-bulge IREs and for HL mutants. Conversion of the IL/B into a C-bulge by a single deletion in the IL/B or by substituting the HL CG base pair with UA both derepressed ferritin synthesis 4-fold in rabbit reticulocyte lysates (IRP1 + IRP2), confirming differences in IRP2 binding observed for the oligomers. Since the engineered C-bulge IRE was more helical near the IL/B [Cu(phen)(2) resistant] and more stable (T(m) increased) and the HL mutant was less helical near the IL/B (ribonuclease T1 sensitive) and less stable (T(m) decreased), both CG trans-loop base pairs contribute to maximum IRP2 binding and translational regulation. The (1)H NMR spectrum of the Mg-IRE complex revealed, in contrast to the localized IL/B effects of Co(III) hexaammine observed previously, perturbation of the IL/B plus HL and interloop helix. The lower stability and greater helix distortion in the ferritin IL/B-IRE compared to the C-bulge iso-IREs create a combinatorial set of RNA/protein interactions that control protein synthesis rates with a range of signal sensitivities.

  3. In vitro selection of DNA elements highly responsive to the human T-cell lymphotropic virus type I transcriptional activator, Tax.

    PubMed

    Paca-Uccaralertkun, S; Zhao, L J; Adya, N; Cross, J V; Cullen, B R; Boros, I M; Giam, C Z

    1994-01-01

    The human T-cell lymphotropic virus type I (HTLV-I) transactivator, Tax, the ubiquitous transcriptional factor cyclic AMP (cAMP) response element-binding protein (CREB protein), and the 21-bp repeats in the HTLV-I transcriptional enhancer form a ternary nucleoprotein complex (L. J. Zhao and C. Z. Giam, Proc. Natl. Acad. Sci. USA 89:7070-7074, 1992). Using an antibody directed against the COOH-terminal region of Tax along with purified Tax and CREB proteins, we selected DNA elements bound specifically by the Tax-CREB complex in vitro. Two distinct but related groups of sequences containing the cAMP response element (CRE) flanked by long runs of G and C residues in the 5' and 3' regions, respectively, were preferentially recognized by Tax-CREB. In contrast, CREB alone binds only to CRE motifs (GNTGACG[T/C]) without neighboring G- or C-rich sequences. The Tax-CREB-selected sequences bear a striking resemblance to the 5' or 3' two-thirds of the HTLV-I 21-bp repeats and are highly inducible by Tax. Gel electrophoretic mobility shift assays, DNA transfection, and DNase I footprinting analyses indicated that the G- and C-rich sequences flanking the CRE motif are crucial for Tax-CREB-DNA ternary complex assembly and Tax transactivation but are not in direct contact with the Tax-CREB complex. These data show that Tax recruits CREB to form a multiprotein complex that specifically recognizes the viral 21-bp repeats. The expanded DNA binding specificity of Tax-CREB and the obligatory role the ternary Tax-CREB-DNA complex plays in transactivation reveal a novel mechanism for regulating the transcriptional activity of leucine zipper proteins like CREB.

  4. Transcription factor ThWRKY4 binds to a novel WLS motif and a RAV1A element in addition to the W-box to regulate gene expression.

    PubMed

    Xu, Hongyun; Shi, Xinxin; Wang, Zhibo; Gao, Caiqiu; Wang, Chao; Wang, Yucheng

    2017-08-01

    WRKY transcription factors play important roles in many biological processes, and mainly bind to the W-box element to regulate gene expression. Previously, we characterized a WRKY gene from Tamarix hispida, ThWRKY4, in response to abiotic stress, and showed that it bound to the W-box motif. However, whether ThWRKY4 could bind to other motifs remains unknown. In this study, we employed a Transcription Factor-Centered Yeast one Hybrid (TF-Centered Y1H) screen to study the motifs recognized by ThWRKY4. In addition to the W-box core cis-element (termed W-box), we identified that ThWRKY4 could bind to two other motifs: the RAV1A element (CAACA) and a novel motif with sequence of GTCTA (W-box like sequence, WLS). The distributions of these motifs were screened in the promoter regions of genes regulated by some WRKYs. The results showed that the W-box, RAV1A, and WLS motifs were all present in high numbers, suggesting that they play key roles in gene expression mediated by WRKYs. Furthermore, five WRKY proteins from different WRKY subfamilies in Arabidopsis thaliana were selected and confirmed to bind to the RAV1A and WLS motifs, indicating that they are recognized commonly by WRKYs. These findings will help to further reveal the functions of WRKY proteins. Copyright © 2017 Elsevier B.V. All rights reserved.

  5. cis- and trans-acting elements of the estrogen-regulated vitellogenin gene B1 of Xenopus laevis.

    PubMed

    Wahli, W; Martinez, E; Corthésy, B; Cardinaux, J R

    1989-01-01

    Vitellogenin genes are expressed under strict estrogen control in the liver of female oviparous vertebrates. Gene transfer experiments using estrogen-responsive cells have shown that the 13 bp perfect palindromic element GGTCACTGTGACC found upstream of the Xenopus laevis vitellogenin gene A2 promoter mediates hormonal stimulation and thus, was called the estrogen-responsive element (ERE). In the Xenopus vitellogenin genes B1 and B2 there are two closely adjacent EREs with one or more base substitutions when compared to the consensus ERE GGTCANNNTGACC. On their own, these degenerated elements have only a low or no regulatory capacity at all but act together synergistically to form an estrogen-responsive unit (ERU) with the same strength as the perfect palindromic 13 bp element. Analysis of estrogen receptor binding to the gene B1 ERU revealed a cooperative interaction of receptor dimers to the two adjacent imperfect EREs which most likely explains the synergistic stimulation observed in vivo. Furthermore, a promoter activator element located between positions --113 and --42 of the gene B1 and functional in the human MCF-7 and the Xenopus B3.2 cells has been identified and shown to be involved in the high level of induced transcription activity when the ERE is placed at a distance from the promoter. Finally, a hormone-controlled in vitro transcription system derived from Xenopus liver nuclear extracts was exploited to characterize two additional novel cis-acting elements within the vitellogenin gene B1 promoter. One of them, a negative regulatory element (NRE), is responsible for repression of promoter activity in the absence of hormone. The second is related to the NF-I binding site and is required, together with the ERE, to mediate hormonal induction. Moreover, we detected three trans-acting activities in Xenopus liver nuclear extracts that interact with these regions and demonstrated that they participate in the regulation of the expression of the vitellogenin promoter in vitro.

  6. Alteration of Cyclic-AMP Response Element Binding Protein in the Postmortem Brain of Subjects with Bipolar Disorder and Schizophrenia

    PubMed Central

    Ren, Xinguo; Rizavi, Hooriyah S.; Khan, Mansoor A.; Bhaumik, Runa; Dwivedi, Yogesh; Pandey, Ghanshyam N.

    2013-01-01

    Background Abnormalities of cyclic-AMP (cAMP) response element binding protein (CREB) function has been suggested in bipolar (BP) illness and schizophrenia (SZ), based on both indirect and direct evidence. To further elucidate the role of CREB in these disorders, we studied CREB expression and function in two brain areas implicated in these disorders, i.e., dorsolateral prefrontal cortex (DLPFC) and cingulate gyrus (CG). Methods We determined CREB protein expression using Western blot technique, CRE-DNA binding using gel shift assay, and mRNA expression using real-time RT-polymerase chain reaction (qPCR) in DLPFC and CG of the postmortem brain of BP (n = 19), SZ (n = 20), and normal control (NC, n = 20) subjects. Results We observed that CREB protein and mRNA expression and CRE-DNA binding activity were significantly decreased in the nuclear fraction of DLPFC and CG obtained from BP subjects compared with NC subjects. However, the protein and mRNA expression and CRE-DNA binding in SZ subjects was significantly decreased in CG, but not in DLPFC, compared with NC. Conclusion These studies thus indicate region-specific abnormalities of CREB expression and function in both BP and SZ. They suggest that abnormalities of CREB in CG may be associated with both BP and SZ, but its abnormality in DLPFC is specific to BP illness. PMID:24148789

  7. Identification of conserved cis-elements and transcription factors required for sterol-regulated transcription of stearoyl-CoA desaturase 1 and 2.

    PubMed

    Tabor, D E; Kim, J B; Spiegelman, B M; Edwards, P A

    1999-07-16

    We previously identified stearoyl-CoA desaturase 2 (SCD2) as a new member of the family of genes that are transcriptionally regulated in response to changing levels of nuclear sterol regulatory element binding proteins (SREBPs) or adipocyte determination and differentiation factor 1 (ADD1). A novel sterol regulatory element (SRE) (5'-AGCAGATTGTG-3') identified in the proximal promoter of the mouse SCD2 gene is required for induction of SCD2 promoter-reporter genes in response to cellular sterol depletion (Tabor, D. E., Kim, J. B., Spiegelman, B. M., and Edwards, P. A. (1998) J. Biol. Chem. 273, 22052-22058). In this report, we demonstrate that this novel SRE is both present in the promoter of the SCD1 gene and is critical for the sterol-dependent transcription of SCD1 promoter-reporter genes. Two conserved cis elements (5'-CCAAT-3') lie 5 and 48 base pairs 3' of the novel SREs in the promoters of both the SCD1 and SCD2 murine genes. Mutation of either of these putative NF-Y binding sites attenuates the transcriptional activation of SCD1 or SCD2 promoter-reporter genes in response to cellular sterol deprivation. Induction of both reporter genes is also attenuated when cells are cotransfected with dominant-negative forms of either NF-Y or SREBP. In addition, we demonstrate that the induction of SCD1 and SCD2 mRNAs that occurs during the differentiation of 3T3-L1 preadipocytes to adipocytes is paralleled by an increase in the levels of ADD1/SREBP-1c and that the SCD1 and SCD2 mRNAs are induced to even higher levels in response to ectopic expression of ADD1/SREBP-1c. We conclude that transcription of both SCD1 and SCD2 genes is responsive to cellular sterol levels and to the levels of nuclear SREBP/ADD1 and that transcriptional induction requires three spatially conserved cis elements, that bind SREBP and NF-Y. Additional studies demonstrate that maximal transcriptional repression of SCD2 reporter genes in response to an exogenous polyunsaturated fatty acid is dependent upon the SRE and the adjacent CCAAT motif.

  8. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kwon, Deug-Nam; Park, Mi-Ryung; Park, Jong-Yi

    Highlights: {yields} The sequences of -604 to -84 bp of the pUPII promoter contained the region of a putative negative cis-regulatory element. {yields} The core promoter was located in the 5F-1. {yields} Transcription factor HNF4 can directly bind in the pUPII core promoter region, which plays a critical role in controlling promoter activity. {yields} These features of the pUPII promoter are fundamental to development of a target-specific vector. -- Abstract: Uroplakin II (UPII) is a one of the integral membrane proteins synthesized as a major differentiation product of mammalian urothelium. UPII gene expression is bladder specific and differentiation dependent, butmore » little is known about its transcription response elements and molecular mechanism. To identify the cis-regulatory elements in the pig UPII (pUPII) gene promoter region, we constructed pUPII 5' upstream region deletion mutants and demonstrated that each of the deletion mutants participates in controlling the expression of the pUPII gene in human bladder carcinoma RT4 cells. We also identified a new core promoter region and putative negative cis-regulatory element within a minimal promoter region. In addition, we showed that hepatocyte nuclear factor 4 (HNF4) can directly bind in the pUPII core promoter (5F-1) region, which plays a critical role in controlling promoter activity. Transient cotransfection experiments showed that HNF4 positively regulates pUPII gene promoter activity. Thus, the binding element and its binding protein, HNF4 transcription factor, may be involved in the mechanism that specifically regulates pUPII gene transcription.« less

  9. Extracellular Acidic pH Activates the Sterol Regulatory Element-Binding Protein 2 to Promote Tumor Progression.

    PubMed

    Kondo, Ayano; Yamamoto, Shogo; Nakaki, Ryo; Shimamura, Teppei; Hamakubo, Takao; Sakai, Juro; Kodama, Tatsuhiko; Yoshida, Tetsuo; Aburatani, Hiroyuki; Osawa, Tsuyoshi

    2017-02-28

    Conditions of the tumor microenvironment, such as hypoxia and nutrient starvation, play critical roles in cancer progression. However, the role of acidic extracellular pH in cancer progression is not studied as extensively as that of hypoxia. Here, we show that extracellular acidic pH (pH 6.8) triggered activation of sterol regulatory element-binding protein 2 (SREBP2) by stimulating nuclear translocation and promoter binding to its targets, along with intracellular acidification. Interestingly, inhibition of SREBP2, but not SREBP1, suppressed the upregulation of low pH-induced cholesterol biosynthesis-related genes. Moreover, acyl-CoA synthetase short-chain family member 2 (ACSS2), a direct SREBP2 target, provided a growth advantage to cancer cells under acidic pH. Furthermore, acidic pH-responsive SREBP2 target genes were associated with reduced overall survival of cancer patients. Thus, our findings show that SREBP2 is a key transcriptional regulator of metabolic genes and progression of cancer cells, partly in response to extracellular acidification. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

  10. A coordinated phosphorylation cascade initiated by p38MAPK/MSK1 directs RARα to target promoters

    PubMed Central

    Bruck, Nathalie; Vitoux, Dominique; Ferry, Christine; Duong, Vanessa; Bauer, Annie; de Thé, Hughes; Rochette-Egly, Cécile

    2009-01-01

    The nuclear retinoic acid (RA) receptor alpha (RARα) is a transcriptional transregulator that controls the expression of specific gene subsets through binding at response elements and dynamic interactions with coregulators, which are coordinated by the ligand. Here, we highlighted a novel paradigm in which the transcription of RARα target genes is controlled by phosphorylation cascades initiated by the rapid RA activation of the p38MAPK/MSK1 pathway. We demonstrate that MSK1 phosphorylates RARα at S369 located in the ligand-binding domain, allowing the binding of TFIIH and thereby phosphorylation of the N-terminal domain at S77 by cdk7/cyclin H. MSK1 also phosphorylates histone H3 at S10. Finally, the phosphorylation cascade initiated by MSK1 controls the recruitment of RARα/TFIIH complexes to response elements and subsequently RARα target gene activation. Cancer cells characterized by a deregulated p38MAPK/MSK1 pathway, do not respond to RA, outlining the essential contribution of the RA-triggered phosphorylation cascade in RA signalling. PMID:19078967

  11. Structural integration in hypoxia-inducible factors

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wu, Dalei; Potluri, Nalini; Lu, Jingping

    The hypoxia-inducible factors (HIFs) coordinate cellular adaptations to low oxygen stress by regulating transcriptional programs in erythropoiesis, angiogenesis and metabolism. These programs promote the growth and progression of many tumours, making HIFs attractive anticancer targets. Transcriptionally active HIFs consist of HIF-alpha and ARNT (also called HIF-1 beta) subunits. Here we describe crystal structures for each of mouse HIF-2 alpha-ARNT and HIF-1 alpha-ARNT heterodimers in states that include bound small molecules and their hypoxia response element. A highly integrated quaternary architecture is shared by HIF-2 alpha-ARNT and HIF-1 alpha-ARNT, wherein ARNT spirals around the outside of each HIF-alpha subunit. Five distinctmore » pockets are observed that permit small-molecule binding, including PAS domain encapsulated sites and an interfacial cavity formed through subunit heterodimerization. The DNA-reading head rotates, extends and cooperates with a distal PAS domain to bind hypoxia response elements. HIF-alpha mutations linked to human cancers map to sensitive sites that establish DNA binding and the stability of PAS domains and pockets.« less

  12. Cold shock protein YB-1 is involved in hypoxia-dependent gene transcription.

    PubMed

    Rauen, Thomas; Frye, Bjoern C; Wang, Jialin; Raffetseder, Ute; Alidousty, Christina; En-Nia, Abdelaziz; Floege, Jürgen; Mertens, Peter R

    2016-09-16

    Hypoxia-dependent gene regulation is largely orchestrated by hypoxia-inducible factors (HIFs), which associate with defined nucleotide sequences of hypoxia-responsive elements (HREs). Comparison of the regulatory HRE within the 3' enhancer of the human erythropoietin (EPO) gene with known binding motifs for cold shock protein Y-box (YB) protein-1 yielded strong similarities within the Y-box element and 3' adjacent sequences. DNA binding assays confirmed YB-1 binding to both, single- and double-stranded HRE templates. Under hypoxia, we observed nuclear shuttling of YB-1 and co-immunoprecipitation assays demonstrated that YB-1 and HIF-1α physically interact with each other. Cellular YB-1 depletion using siRNA significantly induced hypoxia-dependent EPO production at both, promoter and mRNA level. Vice versa, overexpressed YB-1 significantly reduced EPO-HRE-dependent gene transcription, whereas this effect was minor under normoxia. HIF-1α overexpression induced hypoxia-dependent gene transcription through the same element and accordingly, co-expression with YB-1 reduced HIF-1α-mediated EPO induction under hypoxic conditions. Taken together, we identified YB-1 as a novel binding factor for HREs that participates in fine-tuning of the hypoxia transcriptome. Copyright © 2016 Elsevier Inc. All rights reserved.

  13. Tunable regulation of CREB DNA binding activity couples genotoxic stress response and metabolism

    PubMed Central

    Kim, Sang Hwa; Trinh, Anthony T.; Larsen, Michele Campaigne; Mastrocola, Adam S.; Jefcoate, Colin R.; Bushel, Pierre R.; Tibbetts, Randal S.

    2016-01-01

    cAMP response element binding protein (CREB) is a key regulator of glucose metabolism and synaptic plasticity that is canonically regulated through recruitment of transcriptional coactivators. Here we show that phosphorylation of CREB on a conserved cluster of Ser residues (the ATM/CK cluster) by the DNA damage-activated protein kinase ataxia-telangiectasia-mutated (ATM) and casein kinase1 (CK1) and casein kinase2 (CK2) positively and negatively regulates CREB-mediated transcription in a signal dependent manner. In response to genotoxic stress, phosphorylation of the ATM/CK cluster inhibited CREB-mediated gene expression, DNA binding activity and chromatin occupancy proportional to the number of modified Ser residues. Paradoxically, substoichiometric, ATM-independent, phosphorylation of the ATM/CK cluster potentiated bursts in CREB-mediated transcription by promoting recruitment of the CREB coactivator, cAMP-regulated transcriptional coactivators (CRTC2). Livers from mice expressing a non-phosphorylatable CREB allele failed to attenuate gluconeogenic genes in response to DNA damage or fully activate the same genes in response to glucagon. We propose that phosphorylation-dependent regulation of DNA binding activity evolved as a tunable mechanism to control CREB transcriptional output and promote metabolic homeostasis in response to rapidly changing environmental conditions. PMID:27431323

  14. v-src induction of the TIS10/PGS2 prostaglandin synthase gene is mediated by an ATF/CRE transcription response element.

    PubMed

    Xie, W; Fletcher, B S; Andersen, R D; Herschman, H R

    1994-10-01

    We recently reported the cloning of a mitogen-inducible prostaglandin synthase gene, TIS10/PGS2. In addition to growth factors and tumor promoters, the v-src oncogene induces TIS10/PGS2 expression in 3T3 cells. Deletion analysis, using luciferase reporters, identifies a region between -80 and -40 nucleotides 5' of the TIS10/PGS2 transcription start site that mediates pp60v-src induction in 3T3 cells. This region contains the sequence CGTCACGTG, which includes overlapping ATF/CRE (CGTCA) and E-box (CACGTG) sequences. Gel shift-oligonucleotide competition experiments with nuclear extracts from cells stably transfected with a temperature-sensitive v-src gene demonstrate that the CGTCACGTG sequence can bind proteins at both the ATF/CRE and E-box sequences. Dominant-negative CREB and Myc proteins that bind DNA, but do not transactivate, block v-src induction of a luciferase reporter driven by the first 80 nucleotides of the TIS10/PGS2 promoter. Mutational analysis distinguishes which TIS10/PGS2 cis-acting element mediates pp60v-src induction. E-box mutation has no effect on the fold induction in response to pp60v-src. In contrast, ATF/CRE mutation attenuates the pp60v-src response. Antibody supershift and methylation interference experiments demonstrate that CREB and at least one other ATF transcription factor in these extracts bind to the TIS10/PGS2 ATF/CRE element. Expression of a dominant-negative ras gene also blocks TIS10/PGS2 induction by v-src. Our data suggest that Ras mediates pp60v-src activation of an ATF transcription factor, leading to induced TIS10/PGS2 expression via the ATF/CRE element of the TIS10/PGS2 promoter. This is the first description of v-src activation of gene expression via an ATF/CRE element.

  15. 17beta-estradiol stimulates the growth of human keratinocytes by inducing cyclin D2 expression.

    PubMed

    Kanda, Naoko; Watanabe, Shinichi

    2004-08-01

    Estrogen is reported to prevent age-associated epidermal thinning in the skin. We examined if 17beta-estradiol (E2) may enhance the growth of human keratinocytes, focusing on its effects on the expression of cell cycle-regulatory proteins. E2 enhanced proliferation, bromodeoxyuridine incorporation of keratinocytes, and increased the proportion of cells in the S phase. The E2-induced stimulation of proliferation and bromodeoxyuridine incorporation was suppressed by antisense oligonucleotide against cyclin D2, which induces G1 to S phase progression. E2 increased protein and mRNA levels of cyclin D2, and resultantly enhanced assembly and kinase activities of cyclin D2-cyclin-dependent kinases 4 or 6 complexes. E2 enhanced cyclin D2 promoter activity, and the element homologous to cAMP response element (CRE) on the promoter was responsible for the effect. Cyclin D2 expression was enhanced by antiestrogens, ICI 182,780 and 4-hydroxytamoxifen, and membrane-impermeable bovine serum albumin-conjugated E2, indicating the effects via membrane E2-binding sites. E2 increased the enhancer activity of CRE-like element and the amount of phosphorylated cAMP response element binding protein (CREB) binding this element, and the increases were suppressed by H-89, an inhibitor of cAMP-dependent protein kinase A. H-89 also suppressed E2-induced cyclin D2 expression, proliferation, and bromodeoxyuridine incorporation in keratinocytes. Antisense oligonucleotide against G-protein-coupled receptor GPR30 suppressed the E2-induced increases of phosphorylated CREB, cyclin D2 level, proliferation, and bromodeoxyuridine incorporation in keratinocytes. These results suggest that E2 may stimulate the growth of keratinocytes by inducing cyclin D2 expression via CREB phosphorylation by protein kinase A, dependent on cAMP. These effects of E2 may be mediated via cell surface GPR30.

  16. Dimerization Controls Marburg Virus VP24-dependent Modulation of Host Antioxidative Stress Responses.

    PubMed

    Johnson, Britney; Li, Jing; Adhikari, Jagat; Edwards, Megan R; Zhang, Hao; Schwarz, Toni; Leung, Daisy W; Basler, Christopher F; Gross, Michael L; Amarasinghe, Gaya K

    2016-08-28

    Marburg virus (MARV), a member of the Filoviridae family that also includes Ebola virus (EBOV), causes lethal hemorrhagic fever with case fatality rates that have exceeded 50% in some outbreaks. Within an infected cell, there are numerous host-viral interactions that contribute to the outcome of infection. Recent studies identified MARV protein 24 (mVP24) as a modulator of the host antioxidative responses, but the molecular mechanism remains unclear. Using a combination of biochemical and mass spectrometry studies, we show that mVP24 is a dimer in solution that directly binds to the Kelch domain of Kelch-like ECH-associated protein 1 (Keap1) to regulate nuclear factor (erythroid-derived 2)-like 2 (Nrf2). This interaction between Keap1 and mVP24 occurs through the Kelch interaction loop (K-Loop) of mVP24 leading to upregulation of antioxidant response element transcription, which is distinct from other Kelch binders that regulate Nrf2 activity. N-terminal truncations disrupt mVP24 dimerization, allowing monomeric mVP24 to bind Kelch with higher affinity and stimulate higher antioxidative stress response element (ARE) reporter activity. Mass spectrometry-based mapping of the interface revealed overlapping binding sites on Kelch for mVP24 and the Nrf2 proteins. Substitution of conserved cysteines, C209 and C210, to alanine in the mVP24 K-Loop abrogates Kelch binding and ARE activation. Our studies identify a shift in the monomer-dimer equilibrium of MARV VP24, driven by its interaction with Keap1 Kelch domain, as a critical determinant that modulates host responses to pathogenic Marburg viral infections. Copyright © 2016 Elsevier Ltd. All rights reserved.

  17. Dimerization Controls Marburg Virus VP24-dependent Modulation of Host Antioxidative Stress Responses

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Johnson, Britney; Li, Jing; Adhikari, Jagat

    Marburg virus (MARV), a member of the Filoviridae family that also includes Ebola virus (EBOV), causes lethal hemorrhagic fever with case fatality rates that have exceeded 50% in some outbreaks. Within an infected cell, there are numerous host-viral interactions that contribute to the outcome of infection. Recent studies identified MARV protein 24 (mVP24) as a modulator of the host antioxidative responses, but the molecular mechanism remains unclear. Using a combination of biochemical and mass spectrometry studies, we show that mVP24 is a dimer in solution that directly binds to the Kelch domain of Kelch-like ECH-associated protein 1 (Keap1) to regulatemore » nuclear factor (erythroid-derived 2)-like 2 (Nrf2). This interaction between Keap1 and mVP24 occurs through the Kelch interaction loop (K-Loop) of mVP24 leading to upregulation of antioxidant response element transcription, which is distinct from other Kelch binders that regulate Nrf2 activity. N-terminal truncations disrupt mVP24 dimerization, allowing monomeric mVP24 to bind Kelch with higher affinity and stimulate higher antioxidative stress response element (ARE) reporter activity. Mass spectrometry-based mapping of the interface revealed overlapping binding sites on Kelch for mVP24 and the Nrf2 proteins. Substitution of conserved cysteines, C209 and C210, to alanine in the mVP24 K-Loop abrogates Kelch binding and ARE activation. Our studies identify a shift in the monomer-dimer equilibrium of MARV VP24, driven by its interaction with Keap1 Kelch domain, as a critical determinant that modulates host responses to pathogenic Marburg viral infections.« less

  18. Transcriptional regulation of drought response: a tortuous network of transcriptional factors

    PubMed Central

    Singh, Dhriti; Laxmi, Ashverya

    2015-01-01

    Drought is one of the leading factors responsible for the reduction in crop yield worldwide. Due to climate change, in future, more areas are going to be affected by drought and for prolonged periods. Therefore, understanding the mechanisms underlying the drought response is one of the major scientific concerns for improving crop yield. Plants deploy diverse strategies and mechanisms to respond and tolerate drought stress. Expression of numerous genes is modulated in different plants under drought stress that help them to optimize their growth and development. Plant hormone abscisic acid (ABA) plays a major role in plant response and tolerance by regulating the expression of many genes under drought stress. Transcription factors being the major regulator of gene expression play a crucial role in stress response. ABA regulates the expression of most of the target genes through ABA-responsive element (ABRE) binding protein/ABRE binding factor (AREB/ABF) transcription factors. Genes regulated by AREB/ABFs constitute a regulon termed as AREB/ABF regulon. In addition to this, drought responsive genes are also regulated by ABA-independent mechanisms. In ABA-independent regulation, dehydration-responsive element binding protein (DREB), NAM, ATAF, and CUC regulons play an important role by regulating many drought-responsive genes. Apart from these major regulons, MYB/MYC, WRKY, and nuclear factor-Y (NF-Y) transcription factors are also involved in drought response and tolerance. Our understanding about transcriptional regulation of drought is still evolving. Recent reports have suggested the existence of crosstalk between different transcription factors operating under drought stress. In this article, we have reviewed various regulons working under drought stress and their crosstalk with each other. PMID:26579147

  19. Involvement of Phosphorylated "Apis Mellifera" CREB in Gating a Honeybee's Behavioral Response to an External Stimulus

    ERIC Educational Resources Information Center

    Gehring, Katrin B.; Heufelder, Karin; Feige, Janina; Bauer, Paul; Dyck, Yan; Ehrhardt, Lea; Kühnemund, Johannes; Bergmann, Anja; Göbel, Josefine; Isecke, Marlene; Eisenhardt, Dorothea

    2016-01-01

    The transcription factor cAMP-response element-binding protein (CREB) is involved in neuronal plasticity. Phosphorylation activates CREB and an increased level of phosphorylated CREB is regarded as an indicator of CREB-dependent transcriptional activation. In honeybees ("Apis mellifera") we recently demonstrated a particular high…

  20. A Genomic Response to Trace Fear Conditioning in the Amygdala of Female Rats After Developmental Exposure to Manganese

    EPA Science Inventory

    Increases in brain-derived neurotrophic factor (Bdnf), Ca2+/calmodulin-dependent protein kinase II alpha (Camk2a), and cyclic adenosine monophosphate (cAMP) response element binding (Creb1) gene expression have been associated with learning in a variety of different rodent studie...

  1. DNA Repair, Redox Regulation and Modulation of Estrogen Receptor Alpha Mediated Transcription

    ERIC Educational Resources Information Center

    Curtis-Ducey, Carol Dianne

    2009-01-01

    Interaction of estrogen receptor [alpha] (ER[alpha]) with 17[beta]-estradiol (E[subscript 2]) facilitates binding of the receptor to estrogen response elements (EREs) in target genes, which in turn leads to recruitment of coregulatory proteins. To better understand how estrogen-responsive genes are regulated, our laboratory identified a number of…

  2. Regulatory motifs for CREB-binding protein and Nfe2l2 transcription factors in the upstream enhancer of the mitochondrial uncoupling protein 1 gene.

    PubMed

    Rim, Jong S; Kozak, Leslie P

    2002-09-13

    Thermogenesis against cold exposure in mammals occurs in brown adipose tissue (BAT) through mitochondrial uncoupling protein (UCP1). Expression of the Ucp1 gene is unique in brown adipocytes and is regulated tightly. The 5'-flanking region of the mouse Ucp1 gene contains cis-acting elements including PPRE, TRE, and four half-site cAMP-responsive elements (CRE) with BAT-specific enhancer elements. In the course of analyzing how these half-site CREs are involved in Ucp1 expression, we found that a DNA regulatory element for NF-E2 overlaps CRE2. Electrophoretic mobility shift assay and competition assays with the CRE2 element indicates that nuclear proteins from BAT, inguinal fat, and retroperitoneal fat tissue interact with the CRE2 motif (CGTCA) in a specific manner. A supershift assay using an antibody against the CRE-binding protein (CREB) shows specific affinity to the complex from CRE2 and nuclear extract of BAT. Additionally, Western blot analysis for phospho-CREB/ATF1 shows an increase in phosphorylation of CREB/ATF1 in HIB-1B cells after norepinephrine treatment. Transient transfection assay using luciferase reporter constructs also indicates that the two half-site CREs are involved in transcriptional regulation of Ucp1 in response to norepinephrine and cAMP. We also show that a second DNA regulatory element for NF-E2 is located upstream of the CRE2 region. This element, which is found in a similar location in the 5'-flanking region of the human and rodent Ucp1 genes, shows specific binding to rat and human NF-E2 by electrophoretic mobility shift assay with nuclear extracts from brown fat. Co-transfections with an Nfe2l2 expression vector and a luciferase reporter construct of the Ucp1 enhancer region provide additional evidence that Nfe2l2 is involved in the regulation of Ucp1 by cAMP-mediated signaling.

  3. BPF-1, a pathogen-induced DNA-binding protein involved in the plant defense response.

    PubMed

    da Costa e Silva, O; Klein, L; Schmelzer, E; Trezzini, G F; Hahlbrock, K

    1993-07-01

    The mechanisms by which plants restrict the growth of pathogens include transient activation of numerous defense-related genes. Box P is a putative cis-acting element of a distinct group of such genes, including those encoding the enzyme phenylalanine ammonialyase (PAL). A DNA-binding activity to Box P was identified in nuclear extracts from cultured parsley cells and a cDNA encoding the protein BPF-1 (Box P-binding Factor) partially characterized. BPF-1 binds to this element with specificity similar to that of the binding activity in nuclear extracts. BPF-1 mRNA accumulates rapidly in elicitor-treated parsley cells and around fungal infection sites on parsley leaves. This accumulation is, at least partly, due to a rapid and transient increase in the transcription rate of BPF-1. Moreover, tight correlation between the relative amounts of BPF-1 and PAL mRNAs was observed in different organs of a parsley plant. These results are consistent with the hypothesis that BPF-1 is involved in disease resistance by modulating plant defense gene expression.

  4. Up-Regulation of HSFA2c and HSPs by ABA Contributing to Improved Heat Tolerance in Tall Fescue and Arabidopsis

    PubMed Central

    Wang, Xiuyun; Zhuang, Lili; Huang, Bingru

    2017-01-01

    Abscisic acid (ABA) is known to play roles in regulating plant tolerance to various abiotic stresses, but whether ABA’s effects on heat tolerance are associated with its regulation of heat stress transcription factors (HSFs) and heat shock proteins (HSPs) is not well documented. The objective of this study was to determine whether improved heat tolerance of tall fescue (Festuca arundinacea Schreb.) by ABA was through the regulation of HSFs and HSPs. ABA-responsive transcriptional factors, ABA-responsive element binding protein 3 (FaAREB3) and dehydration-responsive element binding protein 2A (FaDREB2A) of tall fescue, were able to bind to the cis-elements in the promoter of tall fescue heat stress transcription factor A2c (FaHSFA2c). Exogenous ABA (5 μM) application enhanced heat tolerance of tall fescue, as manifested by increased leaf photochemical efficiency and membrane stability under heat stress (37/32 °C, day/night). The expression levels of FaHSFA2c, several tall fescue HSPs (FaHSPs), and ABA-responsive transcriptional factors were up-regulated in plants treated with ABA. Deficiency of Arabidopsis heat stress transcription factor A2 (AtHSFA2) suppressed ABA-induction of AtHSPs expression and ABA-improved heat tolerance in Arabidopsis. These results suggested that HSFA2 plays an important role in ABA-mediated plant heat tolerance, and FaAREB3 and FaDREB2A may function as upstream trans-acting factors and regulate transcriptional activity of FaHSFA2c and the downstream FaHSPs, leading to improved heat tolerance. PMID:28914758

  5. Epigenetic Programming of Breast Cancer and Nutrition Prevention

    DTIC Science & Technology

    2011-05-01

    is to test the role of xenobiotics and food compounds that bind the aromatic hydrocarbon receptor (AhR). AhR-ligands include the dioxin -like and...tumor promoter 2,3,7,8 tetrachlorobenzo-p- dioxin (TCDD). The activated AhR regulates transcription through binding to xenobiotic response elements (XRE...phytoalexin resveratrol, selected as a prototype dietary AhR antagonist, antagonizes at physiologically relevant doses (1  mol /L) the TCDD-induced

  6. AP1 binding site is another target of FGF2 regulation of bone sialoprotein gene transcription.

    PubMed

    Takai, Hideki; Araki, Shouta; Mezawa, Masaru; Kim, Dong-Soon; Li, Xinyue; Yang, Li; Li, Zhengyang; Wang, Zhitao; Nakayama, Youhei; Ogata, Yorimasa

    2008-02-29

    Bone sialoprotein (BSP) is an early marker of osteoblast differentiation. We previously reported that fibroblast growth factor 2 (FGF2) regulates BSP gene transcription via FGF2 response element (FRE) in the proximal promoter of rat BSP gene. We here report that activator protein 1 (AP1) binding site overlapping with glucocorticoid response element (GRE) AP1/GRE in the rat BSP gene promoter is another target of FGF2. Using the osteoblastic cell line ROS17/2.8, we determined that BSP mRNA levels increased by 10 ng/ml FGF2 at 6 and 12 h. Runx2 protein levels increased by FGF2 (10 ng/ml) at 3 h. Treatment of ROS17/2.8 cells with FGF2 (10 ng/ml, 12 h) increased luciferase activities of constructs including -116 to +60 and -938 to +60 of the rat BSP gene promoter. Effects of FGF2 abrogated in constructs included 2 bp mutations in the FRE and AP1/GRE elements. Luciferase activities induced by FGF2 were blocked by tyrosine kinase inhibitor herbimycin A, src-tyrosine kinase inhibitor PP1 and MAP kinase kinase inhibitor U0126. Gel shift analyses showed that FGF2 increased binding of FRE and AP1/GRE elements. Notably, the AP1/GRE-protein complexes were supershifted by Smad1 and c-Fos antibodies, c-Jun and Dlx5 antibodies disrupted the complexes formation, on the other hand AP1/GRE-protein complexes did not change by Runx2 antibody. These studies demonstrate that FGF2 stimulates BSP gene transcription by targeting the FRE and AP1/GRE elements in the rat BSP gene promoter.

  7. The interaction between the iron-responsive element binding protein and its cognate RNA is highly dependent upon both RNA sequence and structure.

    PubMed

    Jaffrey, S R; Haile, D J; Klausner, R D; Harford, J B

    1993-09-25

    To assess the influence of RNA sequence/structure on the interaction RNAs with the iron-responsive element binding protein (IRE-BP), twenty eight altered RNAs were tested as competitors for an RNA corresponding to the ferritin H chain IRE. All changes in the loop of the predicted IRE hairpin and in the unpaired cytosine residue characteristically found in IRE stems significantly decreased the apparent affinity of the RNA for the IRE-BP. Similarly, alteration in the spacing and/or orientation of the loop and the unpaired cytosine of the stem by either increasing or decreasing the number of base pairs separating them significantly reduced efficacy as a competitor. It is inferred that the IRE-BP forms multiple contacts with its cognate RNA, and that these contacts, acting in concert, provide the basis for the high affinity of this interaction.

  8. The yeast genome may harbor hypoxia response elements (HRE).

    PubMed

    Ferreira, Túlio César; Hertzberg, Libi; Gassmann, Max; Campos, Elida Geralda

    2007-01-01

    The hypoxia-inducible factor-1 (HIF-1) is a heterodimeric transcription factor activated when cells are submitted to hypoxia. The heterodimer is composed of two subunits, HIF-1alpha and the constitutively expressed HIF-1beta. During normoxia, HIF-1alpha is degraded by the 26S proteasome, but hypoxia causes HIF-1alpha to be stabilized, enter the nucleus and bind to HIF-1beta, thus forming the active complex. The complex then binds to the regulatory sequences of various genes involved in physiological and pathological processes. The specific regulatory sequence recognized by HIF-1 is the hypoxia response element (HRE) that has the consensus sequence 5'BRCGTGVBBB3'. Although the basic transcriptional regulation machinery is conserved between yeast and mammals, Saccharomyces cerevisiae does not express HIF-1 subunits. However, we hypothesized that baker's yeast has a protein analogous to HIF-1 which participates in the response to changes in oxygen levels by binding to HRE sequences. In this study we screened the yeast genome for HREs using probabilistic motif search tools. We described 24 yeast genes containing motifs with high probability of being HREs (p-value<0.1) and classified them according to biological function. Our results show that S. cerevisiae may harbor HREs and indicate that a transcription factor analogous to HIF-1 may exist in this organism.

  9. Parathyroid hormone regulation of the human bone sialoprotein gene transcription is mediated through two cAMP response elements.

    PubMed

    Araki, Shouta; Mezawa, Masaru; Sasaki, Yoko; Yang, Li; Li, Zhengyang; Takai, Hideki; Nakayama, Youhei; Ogata, Yorimasa

    2009-03-01

    Parathyroid hormone (PTH) regulates serum calcium and inorganic phosphate levels through its actions on kidney and bone. Bone sialoprotein (BSP) is an early marker of osteoblast differentiation and bone metabolism. We here report that two cAMP response elements (CRE) in the human BSP gene promoter are target of PTH. In human osteoblast-like Saos2 cells, PTH (human 1-34 PTH, 10 nM) increased BSP mRNA and protein levels at 3 h. From transient transfection assays, 2- to 2.5-fold increase in transcription by PTH was observed at 3 and 6 h in -184, -211, -428, -868, and -927 luciferase constructs that included the human BSP gene promoter. Effect of PTH was abrogated by 2 bp mutations in either the CRE1 (-79 to -72) or CRE2 (-674 to -667). Luciferase activities induced by PTH were blocked by protein kinase A inhibitor H89 and tyrosine kinase inhibitor herbimycin A. Gel shift analyses showed that PTH increased binding of nuclear proteins to the CRE1 and CRE2 elements. The CRE1-protein and CRE2-protein complexes were disrupted by CRE binding protein 1 (CREB1) antibodies and supershifted by phospho-CREB1 antibody. ChIP assays detected binding of CREB1 and phospho-CREB1 to a chromatin fragment containing CRE1 and CRE2, and increased binding of phospho-CREB1 to the both sites. These studies demonstrate that PTH stimulates human BSP gene transcription by targeting the two CREs in the promoter of the human BSP gene.

  10. Identification of multiple binding sites for the THAP domain of the Galileo transposase in the long terminal inverted-repeats☆

    PubMed Central

    Marzo, Mar; Liu, Danxu; Ruiz, Alfredo; Chalmers, Ronald

    2013-01-01

    Galileo is a DNA transposon responsible for the generation of several chromosomal inversions in Drosophila. In contrast to other members of the P-element superfamily, it has unusually long terminal inverted-repeats (TIRs) that resemble those of Foldback elements. To investigate the function of the long TIRs we derived consensus and ancestral sequences for the Galileo transposase in three species of Drosophilids. Following gene synthesis, we expressed and purified their constituent THAP domains and tested their binding activity towards the respective Galileo TIRs. DNase I footprinting located the most proximal DNA binding site about 70 bp from the transposon end. Using this sequence we identified further binding sites in the tandem repeats that are found within the long TIRs. This suggests that the synaptic complex between Galileo ends may be a complicated structure containing higher-order multimers of the transposase. We also attempted to reconstitute Galileo transposition in Drosophila embryos but no events were detected. Thus, although the limited numbers of Galileo copies in each genome were sufficient to provide functional consensus sequences for the THAP domains, they do not specify a fully active transposase. Since the THAP recognition sequence is short, and will occur many times in a large genome, it seems likely that the multiple binding sites within the long, internally repetitive, TIRs of Galileo and other Foldback-like elements may provide the transposase with its binding specificity. PMID:23648487

  11. Identification of multiple binding sites for the THAP domain of the Galileo transposase in the long terminal inverted-repeats.

    PubMed

    Marzo, Mar; Liu, Danxu; Ruiz, Alfredo; Chalmers, Ronald

    2013-08-01

    Galileo is a DNA transposon responsible for the generation of several chromosomal inversions in Drosophila. In contrast to other members of the P-element superfamily, it has unusually long terminal inverted-repeats (TIRs) that resemble those of Foldback elements. To investigate the function of the long TIRs we derived consensus and ancestral sequences for the Galileo transposase in three species of Drosophilids. Following gene synthesis, we expressed and purified their constituent THAP domains and tested their binding activity towards the respective Galileo TIRs. DNase I footprinting located the most proximal DNA binding site about 70 bp from the transposon end. Using this sequence we identified further binding sites in the tandem repeats that are found within the long TIRs. This suggests that the synaptic complex between Galileo ends may be a complicated structure containing higher-order multimers of the transposase. We also attempted to reconstitute Galileo transposition in Drosophila embryos but no events were detected. Thus, although the limited numbers of Galileo copies in each genome were sufficient to provide functional consensus sequences for the THAP domains, they do not specify a fully active transposase. Since the THAP recognition sequence is short, and will occur many times in a large genome, it seems likely that the multiple binding sites within the long, internally repetitive, TIRs of Galileo and other Foldback-like elements may provide the transposase with its binding specificity. Copyright © 2013 The Authors. Published by Elsevier B.V. All rights reserved.

  12. Identification of cis-acting regulatory elements in the human oxytocin gene promoter.

    PubMed

    Richard, S; Zingg, H H

    1991-12-01

    The expression of hormone-inducible genes is determined by the interaction of trans-acting factors with hormone-inducible elements and elements mediating basal and cell-specific expression. We have shown earlier that the gene encoding the hypothalamic nonapeptide oxytocin (OT) is under the control of an estrogen response element (ERE). The present study was aimed at identifying cis-acting elements mediating basal expression of the OT gene. A construct containing sequences -381 to +36 of the human OT gene was linked to a reporter gene and transiently transfected into a series of neuronal and nonneuronal cell lines. Expression of this construct was cell specific: it was highest in the neuroblastoma-derived cell line, Neuro-2a, and lowest in NIH 3T3 and JEG-3 cells. By 5' deletion analysis, we determined that a segment from -49 to +36 was capable of mediating cells-pecific promoter activity. Within this segment, we identified three proximal promoter elements (PPE-1, PPE-2, and PPE-3) that are each required for promoter activity. Most notably, mutation of a conserved purine-rich element (GAGAGA) contained within PPE-2 leads to a 10-fold decrease in promoter strength. Gel mobility shift analysis with three different double-stranded oligonucleotides demonstrated that each proximal promoter element binds distinct nuclear factors. In each case, only the homologous oligonucleotide, but neither of the oligonucleotides corresponding to adjacent elements, was able to act as a competitor. Thus, a different set of factors appears to bind independently to each element. By reinserting the homologous ERE or a heterologous glucocorticoid response element upstream of intact or altered proximal promoter segments we determined that removal or mutation of proximal promoter elements decreases basal expression, but does not abrogate the hormone responsiveness of the promoter. In conclusion, these results indicate that an important component of the transcriptional activity of the OT promoter resides in a small region extending only 50 bases upstream of the cap site and that this activity is the result of a cooperative interaction of at least three distinct proximal promoter elements.

  13. Iron Homeostasis and Nutritional Iron Deficiency123

    PubMed Central

    Theil, Elizabeth C.

    2011-01-01

    Nonheme food ferritin (FTN) iron minerals, nonheme iron complexes, and heme iron contribute to the balance between food iron absorption and body iron homeostasis. Iron absorption depends on membrane transporter proteins DMT1, PCP/HCP1, ferroportin (FPN), TRF2, and matriptase 2. Mutations in DMT1 and matriptase-2 cause iron deficiency; mutations in FPN, HFE, and TRF2 cause iron excess. Intracellular iron homeostasis depends on coordinated regulation of iron trafficking and storage proteins encoded in iron responsive element (IRE)-mRNA. The noncoding IRE-mRNA structures bind protein repressors, IRP1 or 2, during iron deficiency. Integration of the IRE-RNA in translation regulators (near the cap) or turnover elements (after the coding region) increases iron uptake (DMT1/TRF1) or decreases iron storage/efflux (FTN/FPN) when IRP binds. An antioxidant response element in FTN DNA binds Bach1, a heme-sensitive transcription factor that coordinates expression among antioxidant response proteins like FTN, thioredoxin reductase, and quinone reductase. FTN, an antioxidant because Fe2+ and O2 (reactive oxygen species generators) are consumed to make iron mineral, is also a nutritional iron concentrate that is an efficiently absorbed, nonheme source of iron from whole legumes. FTN protein cages contain thousands of mineralized iron atoms and enter cells by receptor-mediated endocytosis, an absorption mechanism distinct from transport of nonheme iron salts (ferrous sulfate), iron chelators (ferric-EDTA), or heme. Recognition of 2 nutritional nonheme iron sources, small and large (FTN), will aid the solution of iron deficiency, a major public health problem, and the development of new policies on iron nutrition. PMID:21346101

  14. A functional study of proximal goat β-casein promoter and intron 1 in immortalized goat mammary epithelial cells.

    PubMed

    Kung, M H; Lee, Y J; Hsu, J T; Huang, M C; Ju, Y T

    2015-06-01

    Goat β-casein (CSN2) promoter has been extensively used to derive expression of recombinant therapeutic protein in transgenic goats; however, little direct evidence exists for signaling molecules and the cis-elements of goat CSN2 promoter in response to lactogenic hormone stimulation in goat mammary epithelial cells. Here, we use an immortalized caprine mammary epithelial cell line (CMC) to search for evidence of the above. Serial 5'-flanking regions deleted of promoter and intron 1 in goat CSN2 (-4,047 to +2,054) driven by firefly luciferase reporter gene were constructed and applied to measure promoter activity in CMC. The intron 1 region (+393 to +501) significantly decreased basal activity of the promoter. This finding contradicts other studies of the role of intron 1. The signal transducer and activator of transcription (STAT)5a played a significant role in activating promoter activity by prolactin stimulation. Hydrocortisone enhanced and prolonged the activity of STAT5a and promoter in CMC, but was independent of the glucocorticoid receptor response element. The minimum length of the CSN2 promoter segment in response to lactogenic stimulation was confirmed by 5' serial deletions. A cis-element located from -300 to -90 in proximal goat CSN2 promoter that is absent in bovine and human CSN2 promoter was newly identified. We demonstrated the presence of a STAT5a binding site (-102 to -82) and preservation of the guanosine nucleotide at position -90 based on responses to the presence of lactogenic hormone using internal deletions and point mutations of the predicted STAT5a binding site, and chromatin immunoprecipitation assay. Together, these findings demonstrate that the proximal -300 bp of goat CSN2 promoter containing the STAT5a binding site (-102 to -82) is the response element for lactogenic hormone stimulation. Additionally, intron 1 may be required for tissue or developmental stage-specific expression in mammary gland. The role of the far-distal regions of goat CSN2 promoter in high-level lactogenic hormone induction and specific expression require further examination. Copyright © 2015 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  15. NF-Y, a CCAAT box-binding protein, is one of the trans-acting factors necessary for the response of the murine ERp72 gene to protein traffic.

    PubMed

    Marcus, N; Green, M

    1997-09-01

    The accumulation of incompletely assembled immunoglobulin mu heavy chain in transfected COS cells stimulates the cellular response to protein traffic that results in the increased transcription and elevated synthesis of several ER chaperones, including ERP72, a member of the protein disulfide isomerase family of molecular chaperones. The ERp72 promoter contains an 82 bp ER protein traffic response element (ERPTRE) that is sufficient to mediate this response. Previously, it had been shown that the alteration of a putative AP-2 site and a CCAAT and inverted CCAAT site within the ERPTRE significantly decreased the response of ERp72 promoter to mu chain accumulation. We have extended these findings by demonstrating a role for NF-Y and a potentially novel DNA-binding protein in the regulation of transcription from the ERp72 promoter. The fact that NF-Y binding to the ERPTRE is observed in extracts from both control cells and cells in which the response to protein traffic has been activated indicates that the binding of NF-Y, while necessary, is not sufficient to account for the response. Each of the two CCAAT sites in the ERPTRE can bind NF-Y independently, but both sites must be intact for full ERPTRE function. A second protein can bind to the ERPTRE independently of NF-Y and at a site overlapping or close to the 3' end of the reverse CCAAT site. It is possible that interactions between NF-Y, this protein and perhaps other factors are responsible for the regulation of the protein traffic response.

  16. Proto-oncogene FBI-1 (Pokemon) and SREBP-1 Synergistically Activate Transcription of Fatty-acid Synthase Gene (FASN)*S⃞

    PubMed Central

    Choi, Won-Il; Jeon, Bu-Nam; Park, Hyejin; Yoo, Jung-Yoon; Kim, Yeon-Sook; Koh, Dong-In; Kim, Myung-Hwa; Kim, Yu-Ri; Lee, Choong-Eun; Kim, Kyung-Sup; Osborne, Timothy F.; Hur, Man-Wook

    2008-01-01

    FBI-1 (Pokemon/ZBTB7A) is a proto-oncogenic transcription factor of the BTB/POZ (bric-à-brac, tramtrack, and broad complex and pox virus zinc finger) domain family. Recent evidence suggested that FBI-1 might be involved in adipogenic gene expression. Coincidentally, expression of FBI-1 and fatty-acid synthase (FASN) genes are often increased in cancer and immortalized cells. Both FBI-1 and FASN are important in cancer cell proliferation. SREBP-1 is a major regulator of many adipogenic genes, and FBI-1 and SREBP-1 (sterol-responsive element (SRE)-binding protein 1) interact with each other directly via their DNA binding domains. FBI-1 enhanced the transcriptional activation of SREBP-1 on responsive promoters, pGL2-6x(SRE)-Luc and FASN gene. FBI-1 and SREBP-1 synergistically activate transcription of the FASN gene by acting on the proximal GC-box and SRE/E-box. FBI-1, Sp1, and SREBP-1 can bind to all three SRE, GC-box, and SRE/E-box. Binding competition among the three transcription factors on the GC-box and SRE/E-box appears important in the transcription regulation. FBI-1 is apparently changing the binding pattern of Sp1 and SREBP-1 on the two elements in the presence of induced SREBP-1 and drives more Sp1 binding to the proximal promoter with less of an effect on SREBP-1 binding. The changes induced by FBI-1 appear critical in the synergistic transcription activation. The molecular mechanism revealed provides insight into how proto-oncogene FBI-1 may attack the cellular regulatory mechanism of FASN gene expression to provide more phospholipid membrane components needed for rapid cancer cell proliferation. PMID:18682402

  17. Proto-oncogene FBI-1 (Pokemon) and SREBP-1 synergistically activate transcription of fatty-acid synthase gene (FASN).

    PubMed

    Choi, Won-Il; Jeon, Bu-Nam; Park, Hyejin; Yoo, Jung-Yoon; Kim, Yeon-Sook; Koh, Dong-In; Kim, Myung-Hwa; Kim, Yu-Ri; Lee, Choong-Eun; Kim, Kyung-Sup; Osborne, Timothy F; Hur, Man-Wook

    2008-10-24

    FBI-1 (Pokemon/ZBTB7A) is a proto-oncogenic transcription factor of the BTB/POZ (bric-à-brac, tramtrack, and broad complex and pox virus zinc finger) domain family. Recent evidence suggested that FBI-1 might be involved in adipogenic gene expression. Coincidentally, expression of FBI-1 and fatty-acid synthase (FASN) genes are often increased in cancer and immortalized cells. Both FBI-1 and FASN are important in cancer cell proliferation. SREBP-1 is a major regulator of many adipogenic genes, and FBI-1 and SREBP-1 (sterol-responsive element (SRE)-binding protein 1) interact with each other directly via their DNA binding domains. FBI-1 enhanced the transcriptional activation of SREBP-1 on responsive promoters, pGL2-6x(SRE)-Luc and FASN gene. FBI-1 and SREBP-1 synergistically activate transcription of the FASN gene by acting on the proximal GC-box and SRE/E-box. FBI-1, Sp1, and SREBP-1 can bind to all three SRE, GC-box, and SRE/E-box. Binding competition among the three transcription factors on the GC-box and SRE/E-box appears important in the transcription regulation. FBI-1 is apparently changing the binding pattern of Sp1 and SREBP-1 on the two elements in the presence of induced SREBP-1 and drives more Sp1 binding to the proximal promoter with less of an effect on SREBP-1 binding. The changes induced by FBI-1 appear critical in the synergistic transcription activation. The molecular mechanism revealed provides insight into how proto-oncogene FBI-1 may attack the cellular regulatory mechanism of FASN gene expression to provide more phospholipid membrane components needed for rapid cancer cell proliferation.

  18. Effects of interferon-gamma and lipopolysaccharide on macrophage iron metabolism are mediated by nitric oxide-induced degradation of iron regulatory protein 2.

    PubMed

    Kim, S; Ponka, P

    2000-03-03

    Iron regulatory proteins (IRP-1 and IRP-2) control the synthesis of transferrin receptors (TfR) and ferritin by binding to iron-responsive elements, which are located in the 3'-untranslated region and the 5'-untranslated region of their respective mRNAs. Cellular iron levels affect binding of IRPs to iron-responsive elements and consequently expression of TfR and ferritin. Moreover, NO(*), a redox species of nitric oxide that interacts primarily with iron, can activate IRP-1 RNA binding activity resulting in an increase in TfR mRNA levels. Recently we found that treatment of RAW 264.7 cells (a murine macrophage cell line) with NO(+) (nitrosonium ion, which causes S-nitrosylation of thiol groups) resulted in a rapid decrease in RNA binding of IRP-2 followed by IRP-2 degradation, and these changes were associated with a decrease in TfR mRNA levels (Kim, S., and Ponka, P. (1999) J. Biol. Chem. 274, 33035-33042). In this study, we demonstrated that stimulation of RAW 264.7 cells with lipopolysaccharide (LPS) and interferon-gamma (IFN-gamma) increased IRP-1 binding activity, whereas RNA binding of IRP-2 decreased and was followed by a degradation of this protein. Moreover, the decrease of IRP-2 binding/protein levels was associated with a decrease in TfR mRNA levels in LPS/IFN-gamma-treated cells, and these changes were prevented by inhibitors of inducible nitric oxide synthase. Furthermore, LPS/IFN-gamma-stimulated RAW 264.7 cells showed increased rates of ferritin synthesis. These results suggest that NO(+)-mediated degradation of IRP-2 plays a major role in iron metabolism during inflammation.

  19. The transcriptional regulatory network mediated by banana (Musa acuminata) dehydration-responsive element binding (MaDREB) transcription factors in fruit ripening.

    PubMed

    Kuang, Jian-Fei; Chen, Jian-Ye; Liu, Xun-Cheng; Han, Yan-Chao; Xiao, Yun-Yi; Shan, Wei; Tang, Yang; Wu, Ke-Qiang; He, Jun-Xian; Lu, Wang-Jin

    2017-04-01

    Fruit ripening is a complex, genetically programmed process involving the action of critical transcription factors (TFs). Despite the established significance of dehydration-responsive element binding (DREB) TFs in plant abiotic stress responses, the involvement of DREBs in fruit ripening is yet to be determined. Here, we identified four genes encoding ripening-regulated DREB TFs in banana (Musa acuminata), MaDREB1, MaDREB2, MaDREB3, and MaDREB4, and demonstrated that they play regulatory roles in fruit ripening. We showed that MaDREB1-MaDREB4 are nucleus-localized, induced by ethylene and encompass transcriptional activation activities. We performed a genome-wide chromatin immunoprecipitation and high-throughput sequencing (ChIP-Seq) experiment for MaDREB2 and identified 697 genomic regions as potential targets of MaDREB2. MaDREB2 binds to hundreds of loci with diverse functions and its binding sites are distributed in the promoter regions proximal to the transcriptional start site (TSS). Most of the MaDREB2-binding targets contain the conserved (A/G)CC(G/C)AC motif and MaDREB2 appears to directly regulate the expression of a number of genes involved in fruit ripening. In combination with transcriptome profiling (RNA sequencing) data, our results indicate that MaDREB2 may serve as both transcriptional activator and repressor during banana fruit ripening. In conclusion, our study suggests a hierarchical regulatory model of fruit ripening in banana and that the MaDREB TFs may act as transcriptional regulators in the regulatory network. © 2017 The Authors. New Phytologist © 2017 New Phytologist Trust.

  20. Bean Metal-Responsive Element-Binding Transcription Factor Confers Cadmium Resistance in Tobacco1

    PubMed Central

    Sun, Na; Liu, Meng; Zhang, Wentao; Yang, Wanning; Bei, Xiujuan; Ma, Hui; Qiao, Fan; Qi, Xiaoting

    2015-01-01

    Cadmium (Cd) is highly toxic to plants. Modulation of Cd-responsive transcription is an important way for Cd detoxification in plants. Metal-responsive element (MRE) is originally described in animal metallothionein genes. Although functional MREs also exist in Cd-regulated plant genes, specific transcription factors that bind MRE to regulate Cd tolerance have not been identified. Previously, we showed that Cd-inducible bean (Phaseolus vulgaris) stress-related gene2 (PvSR2) produces a short (S) PvSR2 transcript (S-PvSR2) driven by an intronic promoter. Here, we demonstrate that S-PvSR2 encodes a bean MRE-binding transcription factor1 (PvMTF-1) that confers Cd tolerance in tobacco (Nicotiana tabacum). PvMTF-1 expression was up-regulated by Cd at the levels of RNA and protein. Importantly, expression of PvMTF-1 in tobacco enhanced Cd tolerance, indicating its role in regulating Cd resistance in planta. This was achieved through direct regulation of a feedback-insensitive Anthranilate Synthase α-2 chain gene (ASA2), which catalyzes the first step for tryptophan biosynthesis. In vitro and in vivo DNA-protein interaction studies further revealed that PvMTF-1 directly binds to the MRE in the ASA2 promoter, and this binding depends on the zinc finger-like motif of PvMTF-1. Through modulating ASA2 up-regulation by Cd, PvMTF-1 increased free tryptophan level and subsequently reduced Cd accumulation, thereby enhancing Cd tolerance of transgenic tobacco plants. Consistent with this observation, tobacco transiently overexpressing ASA2 also exhibited increased tolerance to Cd. We conclude that PvMTF-1 is a zinc finger-like transcription factor that links MRE to Cd resistance in transgenic tobacco through activation of tryptophan biosynthesis. PMID:25624396

  1. Inositol polyphosphate multikinase is a coactivator for serum response factor-dependent induction of immediate early genes

    PubMed Central

    Kim, Eunha; Tyagi, Richa; Lee, Joo-Young; Park, Jina; Kim, Young-ran; Beon, Jiyoon; Chen, Po Yu; Cha, Jiyoung Y.; Snyder, Solomon H.; Kim, Seyun

    2013-01-01

    Inositol polyphosphate multikinase (IPMK) is a notably pleiotropic protein. It displays both inositol phosphate kinase and phosphatidylinositol kinase catalytic activities. Noncatalytically, IPMK stabilizes the mammalian target of rapamycin complex 1 and acts as a transcriptional coactivator for CREB-binding protein/E1A binding protein p300 and tumor suppressor protein p53. Serum response factor (SRF) is a major transcription factor for a wide range of immediate early genes. We report that IPMK, in a noncatalytic role, is a transcriptional coactivator for SRF mediating the transcription of immediate early genes. Stimulation by serum of many immediate early genes is greatly reduced by IPMK deletion. IPMK stimulates expression of these genes, an influence also displayed by catalytically inactive IPMK. IPMK acts by binding directly to SRF and thereby enhancing interactions of SRF with the serum response element of diverse genes. PMID:24248338

  2. Identification of a p53-response element in the promoter of the proline oxidase gene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Maxwell, Steve A.; Kochevar, Gerald J.

    2008-05-02

    Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less

  3. Glucose-dependent downregulation of glucagon gene expression mediated by selective interactions between ALX3 and PAX6 in mouse alpha cells.

    PubMed

    Mirasierra, Mercedes; Vallejo, Mario

    2016-04-01

    The stimulation of glucagon secretion in response to decreased glucose levels has been studied extensively. In contrast, little is known about the regulation of glucagon gene expression in response to fluctuations in glucose concentration. Paired box 6 (PAX6) is a key transcription factor that regulates the glucagon promoter by binding to the G1 and G3 elements. Here, we investigated the role of the transcription factor aristaless-like homeobox 3 (ALX3) as a glucose-dependent modulator of PAX6 activity in alpha cells. Experiments were performed in wild-type or Alx3-deficient islets and alphaTC1 cells. We used chromatin immunoprecipitations and electrophoretic mobility shift assays for DNA binding, immunoprecipitations and pull-down assays for protein interactions, transfected cells for promoter activity, and small interfering RNA and quantitative RT-PCR for gene expression. Elevated glucose concentration resulted in stimulated expression of Alx3 and decreased glucagon gene expression in wild-type islets. In ALX3-deficient islets, basal glucagon levels were non-responsive to changes in glucose concentration. In basal conditions ALX3 bound to the glucagon promoter at G3, but not at G1. ALX3 could form heterodimers with PAX6 that were permissive for binding to G3 but not to G1. Thus, increasing the levels of ALX3 in response to glucose resulted in the sequestration of PAX6 by ALX3 for binding to G1, thus reducing glucagon promoter activation and glucagon gene expression. Glucose-stimulated expression of ALX3 in alpha cells provides a regulatory mechanism for the downregulation of glucagon gene expression by interfering with PAX6-mediated transactivation on the glucagon G1 promoter element.

  4. Estrogen Receptor-β Agonist Diarylpropionitrile: Biological Activities of R- and S-Enantiomers on Behavior and Hormonal Response to Stress

    PubMed Central

    Weiser, Michael J.; Wu, T. John; Handa, Robert J.

    2009-01-01

    Estrogens have been shown to have positive and negative effects on anxiety and depressive-like behaviors, perhaps explained by the existence of two distinct estrogen receptor (ER) systems, ERα and ERβ. The ERβ agonist, diarylpropionitrile (DPN) has been shown to have anxiolytic properties in rats. DPN exists as a racemic mixture of two enantiomers, R-DPN and S-DPN. In this study, we compared R-DPN and S-DPN for their in vitro binding affinity, ability to activate transcription in vitro at an estrogen response element, and in vivo endocrine and behavioral responses. In vitro binding studies using recombinant rat ERβ revealed that S-DPN has a severalfold greater relative binding affinity for ERβ than does R-DPN. Furthermore, cotransfection of N-38 immortalized hypothalamic cells with an estrogen response element-luc reporter and ERβ revealed that S-DPN is a potent activator of transcription in vitro, whereas R-DPN is not. Subsequently, we examined anxiety-like behaviors using the open-field test and elevated plus maze or depressive-like behaviors, using the forced swim test. Ovariectomized young adult female Sprague Dawley rats treated with racemic DPN, S-DPN, and the ERβ agonist, WAY-200070, showed significantly decreased anxiety-like behaviors in both the open-field and elevated plus maze and significantly less depressive-like behaviors in the forced swim test compared with vehicle-, R-DPN-, or propylpyrazoletriol (ERα agonist)-treated animals. In concordance with the relative binding affinity and transcriptional potency, these results demonstrate that the S-enantiomer is the biologically active form of DPN. These studies also indicate that estrogen's positive effects on mood, including its anxiolytic and antidepressive actions, are due to its actions at ERβ. PMID:19074580

  5. DEAR1, a transcriptional repressor of DREB protein that mediates plant defense and freezing stress responses in Arabidopsis.

    PubMed

    Tsutsui, Tomokazu; Kato, Wataru; Asada, Yutaka; Sako, Kaori; Sato, Takeo; Sonoda, Yutaka; Kidokoro, Satoshi; Yamaguchi-Shinozaki, Kazuko; Tamaoki, Masanori; Arakawa, Keita; Ichikawa, Takanari; Nakazawa, Miki; Seki, Motoaki; Shinozaki, Kazuo; Matsui, Minami; Ikeda, Akira; Yamaguchi, Junji

    2009-11-01

    Plants have evolved intricate mechanisms to respond and adapt to a wide variety of biotic and abiotic stresses in their environment. The Arabidopsis DEAR1 (DREB and EAR motif protein 1; At3g50260) gene encodes a protein containing significant homology to the DREB1/CBF (dehydration-responsive element binding protein 1/C-repeat binding factor) domain and the EAR (ethylene response factor-associated amphiphilic repression) motif. We show here that DEAR1 mRNA accumulates in response to both pathogen infection and cold treatment. Transgenic Arabidopsis overexpressing DEAR1 (DEAR1ox) showed a dwarf phenotype and lesion-like cell death, together with constitutive expression of PR genes and accumulation of salicylic acid. DEAR1ox also showed more limited P. syringae pathogen growth compared to wild-type, consistent with an activated defense phenotype. In addition, transient expression experiments revealed that the DEAR1 protein represses DRE/CRT (dehydration-responsive element/C-repeat)-dependent transcription, which is regulated by low temperature. Furthermore, the induction of DREB1/CBF family genes by cold treatment was suppressed in DEAR1ox, leading to a reduction in freezing tolerance. These results suggest that DEAR1 has an upstream regulatory role in mediating crosstalk between signaling pathways for biotic and abiotic stress responses.

  6. ABA signaling in stress-response and seed development.

    PubMed

    Nakashima, Kazuo; Yamaguchi-Shinozaki, Kazuko

    2013-07-01

    KEY MESSAGE : We review the recent progress on ABA signaling, especially ABA signaling for ABA-dependent gene expression, including the AREB/ABF regulon, SnRK2 protein kinase, 2C-type protein phosphatases and ABA receptors. Drought negatively impacts plant growth and the productivity of crops. Drought causes osmotic stress to organisms, and the osmotic stress causes dehydration in plant cells. Abscisic acid (ABA) is produced under osmotic stress conditions, and it plays an important role in the stress response and tolerance of plants. ABA regulates many genes under osmotic stress conditions. It also regulates gene expression during seed development and germination. The ABA-responsive element (ABRE) is the major cis-element for ABA-responsive gene expression. ABRE-binding protein (AREB)/ABRE-binding factor (ABF) transcription factors (TFs) regulate ABRE-dependent gene expression. Other TFs are also involved in ABA-responsive gene expression. SNF1-related protein kinases 2 are the key regulators of ABA signaling including the AREB/ABF regulon. Recently, ABA receptors and group A 2C-type protein phosphatases were shown to govern the ABA signaling pathway. Moreover, recent studies have suggested that there are interactions between the major ABA signaling pathway and other signaling factors in stress-response and seed development. The control of the expression of ABA signaling factors may improve tolerance to environmental stresses.

  7. Proflavine acts as a Rev inhibitor by targeting the high-affinity Rev binding site of the Rev responsive element of HIV-1.

    PubMed

    DeJong, Eric S; Chang, Chia-en; Gilson, Michael K; Marino, John P

    2003-07-08

    Rev is an essential regulatory HIV-1 protein that binds the Rev responsive element (RRE) within the env gene of the HIV-1 RNA genome, activating the switch between viral latency and active viral replication. Previously, we have shown that selective incorporation of the fluorescent probe 2-aminopurine (2-AP) into a truncated form of the RRE sequence (RRE-IIB) allowed the binding of an arginine-rich peptide derived from Rev and aminoglycosides to be characterized directly by fluorescence methods. Using these fluorescence and nuclear magnetic resonance (NMR) methods, proflavine has been identified, through a limited screen of selected small heterocyclic compounds, as a specific and high-affinity RRE-IIB binder which inhibits the interaction of the Rev peptide with RRE-IIB. Direct and competitive 2-AP fluorescence binding assays reveal that there are at least two classes of proflavine binding sites on RRE-IIB: a high-affinity site that competes with the Rev peptide for binding to RRE-IIB (K(D) approximately 0.1 +/- 0.05 microM) and a weaker binding site(s) (K(D) approximately 1.1 +/- 0.05 microM). Titrations of RRE-IIB with proflavine, monitored using (1)H NMR, demonstrate that the high-affinity proflavine binding interaction occurs with a 2:1 (proflavine:RRE-IIB) stoichiometry, and NOEs observed in the NOESY spectrum of the 2:1 proflavine.RRE-IIB complex indicate that the two proflavine molecules bind specifically and close to each other within a single binding site. NOESY data further indicate that formation of the 2:1 proflavine.RRE-IIB complex stabilizes base pairing and stacking within the internal purine-rich bulge of RRE-IIB in a manner analogous to what has been observed in the Rev peptide.RRE-IIB complex. The observation that proflavine competes with Rev for binding to RRE-IIB by binding as a dimer to a single high-affinity site opens the possibility for rational drug design based on linking and modifying it and related compounds.

  8. Diversification, phylogeny and evolution of auxin response factor (ARF) family: insights gained from analyzing maize ARF genes.

    PubMed

    Wang, Yijun; Deng, Dexiang; Shi, Yating; Miao, Nan; Bian, Yunlong; Yin, Zhitong

    2012-03-01

    Auxin response factors (ARFs), member of the plant-specific B3 DNA binding superfamily, target specifically to auxin response elements (AuxREs) in promoters of primary auxin-responsive genes and heterodimerize with Aux/IAA proteins in auxin signaling transduction cascade. In previous research, we have isolated and characterized maize Aux/IAA genes in whole-genome scale. Here, we report the comprehensive analysis of ARF genes in maize. A total of 36 ARF genes were identified and validated from the B73 maize genome through an iterative strategy. Thirty-six maize ARF genes are distributed in all maize chromosomes except chromosome 7. Maize ARF genes expansion is mainly due to recent segmental duplications. Maize ARF proteins share one B3 DNA binding domain which consists of seven-stranded β sheets and two short α helixes. Twelve maize ARFs with glutamine-rich middle regions could be as activators in modulating expression of auxin-responsive genes. Eleven maize ARF proteins are lack of homo- and heterodimerization domains. Putative cis-elements involved in phytohormones and light signaling responses, biotic and abiotic stress adaption locate in promoters of maize ARF genes. Expression patterns vary greatly between clades and sister pairs of maize ARF genes. The B3 DNA binding and auxin response factor domains of maize ARF proteins are primarily subjected to negative selection during selective sweep. The mixed selective forces drive the diversification and evolution of genomic regions outside of B3 and ARF domains. Additionally, the dicot-specific proliferation of ARF genes was detected. Comparative genomics analysis indicated that maize, sorghum and rice duplicate chromosomal blocks containing ARF homologs are highly syntenic. This study provides insights into the distribution, phylogeny and evolution of ARF gene family.

  9. The RY/Sph element mediates transcriptional repression of maturation genes from late maturation to early seedling growth.

    PubMed

    Guerriero, Gea; Martin, Nathalie; Golovko, Anna; Sundström, Jens F; Rask, Lars; Ezcurra, Ines

    2009-11-01

    In orthodox seeds, the transcriptional activator ABI3 regulates two major stages in embryo maturation: a mid-maturation (MAT) stage leading to accumulation of storage compounds, and a late maturation (LEA) stage leading to quiescence and desiccation tolerance. Our aim was to elucidate mechanisms for transcriptional shutdown of MAT genes during late maturation, to better understand phase transition between MAT and LEA stages. Using transgenic and transient approaches in Nicotiana, we examined activities of two ABI3-dependent reporter genes driven by multimeric RY and abscisic acid response elements (ABREs) from a Brassica napus napin gene, termed RY and ABRE, where the RY reporter requires ABI3 DNA binding. Expression of RY peaks during mid-maturation and drops during late maturation, mimicking the MAT gene program, and in Arabidopsis thaliana RY elements are over-represented in MAT, but not in LEA, genes. The ABI3 transactivation of RY is inhibited by staurosporine, by a PP2C phosphatase, and by a repressor of maturation genes, VAL1/HSI2. The RY element mediates repression of MAT genes, and we propose that transcriptional shutdown of the MAT program during late maturation involves inhibition of ABI3 DNA binding by dephosphorylation. Later, during seedling growth, VAL1/HSI2 family repressors silence MAT genes by binding RY elements.

  10. Bi-functional, substrate mimicking RNA inhibits MSK1-mediated cAMP-response element-binding protein phosphorylation and reveals magnesium ion-dependent conformational changes of the kinase.

    PubMed

    Hamm, Jorg; Alessi, Dario R; Biondi, Ricardo M

    2002-11-29

    The design of specific inhibitors for protein kinases is an important step toward elucidation of intracellular signal transduction pathways and to guide drug discovery programs. We devised a model approach to generate specific, competitive kinase inhibitors by isolating substrate mimics containing two independent binding sites with an anti-idiotype strategy from combinatorial RNA libraries. As a general test for the ability to generate highly specific kinase inhibitors, we selected the transcription factor cAMP-response element-binding protein (CREB) that is phosphorylated on the same serine residue by the protein kinase MSK1 as well as by RSK1. The sequences and structures of these kinases are very similar, about 60% of their amino acids are identical. Nevertheless, we can demonstrate that the selected RNA inhibitors inhibit specifically CREB phosphorylation by MSK1 but do not affect CREB phosphorylation by RSK1. The inhibitors interact preferentially with the inactive form of MSK1. Furthermore, we demonstrate that RNA ligands can be conformation-specific probes, and this feature allowed us to describe magnesium ion-dependent conformational changes of MSK1 upon activation.

  11. Location analysis for the estrogen receptor-α reveals binding to diverse ERE sequences and widespread binding within repetitive DNA elements

    PubMed Central

    Mason, Christopher E.; Shu, Feng-Jue; Wang, Cheng; Session, Ryan M.; Kallen, Roland G.; Sidell, Neil; Yu, Tianwei; Liu, Mei Hui; Cheung, Edwin; Kallen, Caleb B.

    2010-01-01

    Location analysis for estrogen receptor-α (ERα)-bound cis-regulatory elements was determined in MCF7 cells using chromatin immunoprecipitation (ChIP)-on-chip. Here, we present the estrogen response element (ERE) sequences that were identified at ERα-bound loci and quantify the incidence of ERE sequences under two stringencies of detection: <10% and 10–20% nucleotide deviation from the canonical ERE sequence. We demonstrate that ∼50% of all ERα-bound loci do not have a discernable ERE and show that most ERα-bound EREs are not perfect consensus EREs. Approximately one-third of all ERα-bound ERE sequences reside within repetitive DNA sequences, most commonly of the AluS family. In addition, the 3-bp spacer between the inverted ERE half-sites, rather than being random nucleotides, is C(A/T)G-enriched at bona fide receptor targets. Diverse ERα-bound loci were validated using electrophoretic mobility shift assay and ChIP-polymerase chain reaction (PCR). The functional significance of receptor-bound loci was demonstrated using luciferase reporter assays which proved that repetitive element ERE sequences contribute to enhancer function. ChIP-PCR demonstrated estrogen-dependent recruitment of the coactivator SRC3 to these loci in vivo. Our data demonstrate that ERα binds to widely variant EREs with less sequence specificity than had previously been suspected and that binding at repetitive and nonrepetitive genomic targets is favored by specific trinucleotide spacers. PMID:20047966

  12. Location analysis for the estrogen receptor-alpha reveals binding to diverse ERE sequences and widespread binding within repetitive DNA elements.

    PubMed

    Mason, Christopher E; Shu, Feng-Jue; Wang, Cheng; Session, Ryan M; Kallen, Roland G; Sidell, Neil; Yu, Tianwei; Liu, Mei Hui; Cheung, Edwin; Kallen, Caleb B

    2010-04-01

    Location analysis for estrogen receptor-alpha (ERalpha)-bound cis-regulatory elements was determined in MCF7 cells using chromatin immunoprecipitation (ChIP)-on-chip. Here, we present the estrogen response element (ERE) sequences that were identified at ERalpha-bound loci and quantify the incidence of ERE sequences under two stringencies of detection: <10% and 10-20% nucleotide deviation from the canonical ERE sequence. We demonstrate that approximately 50% of all ERalpha-bound loci do not have a discernable ERE and show that most ERalpha-bound EREs are not perfect consensus EREs. Approximately one-third of all ERalpha-bound ERE sequences reside within repetitive DNA sequences, most commonly of the AluS family. In addition, the 3-bp spacer between the inverted ERE half-sites, rather than being random nucleotides, is C(A/T)G-enriched at bona fide receptor targets. Diverse ERalpha-bound loci were validated using electrophoretic mobility shift assay and ChIP-polymerase chain reaction (PCR). The functional significance of receptor-bound loci was demonstrated using luciferase reporter assays which proved that repetitive element ERE sequences contribute to enhancer function. ChIP-PCR demonstrated estrogen-dependent recruitment of the coactivator SRC3 to these loci in vivo. Our data demonstrate that ERalpha binds to widely variant EREs with less sequence specificity than had previously been suspected and that binding at repetitive and nonrepetitive genomic targets is favored by specific trinucleotide spacers.

  13. Differential tissue distribution, developmental programming, estrogen regulation and promoter characteristics of cyp19 genes in teleost fish.

    PubMed

    Callard, G V; Tchoudakova, A V; Kishida, M; Wood, E

    2001-12-01

    Teleost fish are characterized by exceptionally high levels of brain estrogen biosynthesis when compared to the brains of other vertebrates or to the ovaries of the same fish. Goldfish (Carassius auratus) and zebrafish (Danio rerio) have utility as complementary models for understanding the molecular basis and functional significance of exaggerated neural estrogen biosynthesis. Multiple cytochrome P450 aromatase (P450arom) cDNAs that derive from separate gene loci (cyp19a and cyp19b) are differentially expressed in brain (P450aromB>A) and ovary (P450aromA>B) and have a different developmental program (B>A) and response to estrogen upregulation (B only). As measured by increased P450aromB mRNA, a functional estrogen response system is first detected 24-48 h post-fertilization (hpf), consistent with the onset of estrogen receptor (ER) expression (alpha, beta, and gamma). The 5'-flanking region of the cyp19b gene has a TATA box, two estrogen response elements (EREs), an ERE half-site (ERE1/2), a nerve growth factor inducible-B protein (NGFI-B)/Nur77 responsive element (NBRE) binding site, and a sequence identical to the zebrafish GATA-2 gene neural specific enhancer. The cyp19a promoter region has TATA and CAAT boxes, a steroidogenic factor-1 (SF-1) binding site, and two aryl hydrocarbon receptor (AhR)/AhR nuclear translocator factor (ARNT) binding motifs. Both genes have multiple potential SRY/SOX binding sites (16 and 8 in cyp19b and cyp19a, respectively). Luciferase reporters have basal promoter activity in GH3 cells, but differences (a>b) are opposite to fish pituitary (b>a). When microinjected into fertilized zebrafish eggs, a cyp19b promoter-driven green fluorescent protein (GFP) reporter (but not cyp19a) is expressed in neurons of 30-48 hpf embryos, most prominently in retinal ganglion cells (RGCs) and their projections to optic tectum. Further studies are required to identify functionally relevant cis-elements and cellular factors, and to determine the regulatory role of estrogen in neurodevelopment.

  14. Neisseria conserved protein DMP19 is a DNA mimic protein that prevents DNA binding to a hypothetical nitrogen-response transcription factor

    PubMed Central

    Wang, Hao-Ching; Ko, Tzu-Ping; Wu, Mao-Lun; Ku, Shan-Chi; Wu, Hsing-Ju; Wang, Andrew H.-J.

    2012-01-01

    DNA mimic proteins occupy the DNA binding sites of DNA-binding proteins, and prevent these sites from being accessed by DNA. We show here that the Neisseria conserved hypothetical protein DMP19 acts as a DNA mimic. The crystal structure of DMP19 shows a dsDNA-like negative charge distribution on the surface, suggesting that this protein should be added to the short list of known DNA mimic proteins. The crystal structure of another related protein, NHTF (Neisseria hypothetical transcription factor), provides evidence that it is a member of the xenobiotic-response element (XRE) family of transcriptional factors. NHTF binds to a palindromic DNA sequence containing a 5′-TGTNAN11TNACA-3′ recognition box that controls the expression of an NHTF-related operon in which the conserved nitrogen-response protein [i.e. (Protein-PII) uridylyltransferase] is encoded. The complementary surface charges between DMP19 and NHTF suggest specific charge–charge interaction. In a DNA-binding assay, we found that DMP19 can prevent NHTF from binding to its DNA-binding sites. Finally, we used an in situ gene regulation assay to provide evidence that NHTF is a repressor of its down-stream genes and that DMP19 can neutralize this effect. We therefore conclude that the interaction of DMP19 and NHTF provides a novel gene regulation mechanism in Neisseria spps. PMID:22373915

  15. Niacin improves renal lipid metabolism and slows progression in chronic kidney disease.

    PubMed

    Cho, Kyu-hyang; Kim, Hyun-ju; Kamanna, Vaijinath S; Vaziri, Nosratola D

    2010-01-01

    Mounting evidence points to lipid accumulation in the diseased kidney and its contribution to progression of nephropathy. We recently found heavy lipid accumulation and marked dysregulation of lipid metabolism in the remnant kidneys of rats with chronic renal failure (CRF). Present study sought to determine efficacy of niacin supplementation on renal tissue lipid metabolism in CRF. Kidney function, lipid content, and expression of molecules involved in cholesterol and fatty acid metabolism were determined in untreated CRF (5/6 nephrectomized), niacin-treated CRF (50 mg/kg/day in drinking water for 12 weeks) and control rats. CRF resulted in hypertension, proteinuria, renal tissue lipid accumulation, up-regulation of scavenger receptor A1 (SR-A1), acyl-CoA cholesterol acyltransferase-1 (ACAT1), carbohydrate-responsive element binding protein (ChREBP), fatty acid synthase (FAS), acyl-CoA carboxylase (ACC), liver X receptor (LXR), ATP binding cassette (ABC) A-1, ABCG-1, and SR-B1 and down-regulation of sterol responsive element binding protein-1 (SREBP-1), SREBP-2, HMG-CoA reductase, PPAR-alpha, fatty acid binding protein (L-FABP), and CPT1A. Niacin therapy attenuated hypertension, proteinuria, and tubulo-interstitial injury, reduced renal tissue lipids, CD36, ChREBP, LXR, ABCA-1, ABCG-1, and SR-B1 abundance and raised PPAR-alpha and L-FABP. Niacin administration improves renal tissue lipid metabolism and renal function and structure in experimental CRF.

  16. Type I human T cell leukemia virus tax protein transforms rat fibroblasts through the cyclic adenosine monophosphate response element binding protein/activating transcription factor pathway.

    PubMed Central

    Smith, M R; Greene, W C

    1991-01-01

    The Tax oncoprotein of the type I human T cell leukemia virus (HTLV-I) activates transcription of cellular and viral genes through at least two different transcription factor pathways. Tax activates transcription of the c-fos proto-oncogene by a mechanism that appears to involve members of the cAMP response element binding protein (CREB) and activating transcription factor (ATF) family of DNA-binding proteins. Tax also induces the nuclear expression of the NF-kappa B family of rel oncogene-related enhancer-binding proteins. We have investigated the potential role of these CREB/ATF and NF-kappa B/Rel transcription factors in Tax-mediated transformation by analyzing the oncogenic potential of Tax mutants that functionally segregate these two pathways of transactivation. Rat fibroblasts (Rat2) stably expressing either the wild-type Tax protein or a Tax mutant selectively deficient in the ability to induce NF-kappa B/Rel demonstrated marked changes in morphology and growth characteristics including the ability to form tumors in athymic mice. In contrast, Rat2 cells stably expressing a Tax mutant selectively deficient in the ability to activate transcription through CREB/ATF demonstrated no detectable changes in morphology or growth characteristics. These results suggest that transcriptional activation through the CREB/ATF pathway may play an important role in Tax-mediated cellular transformation. Images PMID:1832173

  17. Context-dependent EKLF responsiveness defines the developmental specificity of the human ɛ-globin gene in erythroid cells of YAC transgenic mice

    PubMed Central

    Tanimoto, Keiji; Liu, Qinghui; Grosveld, Frank; Bungert, Jörg; Engel, James Douglas

    2000-01-01

    We explored the mechanism of definitive-stage ɛ-globin transcriptional inactivity within a human β-globin YAC expressed in transgenic mice. We focused on the globin CAC and CAAT promoter motifs, as previous laboratory and clinical studies indicated a pivotal role for these elements in globin gene activation. A high-affinity CAC-binding site for the erythroid krüppel-like factor (EKLF) was placed in the ɛ-globin promoter at a position corresponding to that in the adult β-globin promoter, thereby simultaneously ablating a direct repeat (DR) element. This mutation led to EKLF-independent ɛ-globin transcription during definitive erythropoiesis. A second 4-bp substitution in the ɛ-globin CAAT sequence, which simultaneously disrupts a second DR element, further enhanced ectopic definitive erythroid activation of ɛ-globin transcription, which surprisingly became EKLF dependent. We finally examined factors in nuclear extracts prepared from embryonic or adult erythroid cells that bound these elements in vitro, and we identified a novel DR-binding protein (DRED) whose properties are consistent with those expected for a definitive-stage ɛ-globin repressor. We conclude that the suppression of ɛ-globin transcription during definitive erythropoiesis is mediated by the binding of a repressor that prevents EKLF from activating the ɛ-globin gene. PMID:11069894

  18. Effects of cyclic adenosine monophosphate response element binding protein overexpression in the basolateral amygdala on behavioral models of depression and anxiety.

    PubMed

    Wallace, Tanya L; Stellitano, Kathryn E; Neve, Rachael L; Duman, Ronald S

    2004-08-01

    Chronic antidepressant administration increases the cyclic adenosine monophosphate response element binding protein (CREB) in the amygdala, a critical neural substrate involved in the physiologic responses to stress, fear, and anxiety. To determine the role of CREB in the amygdala in animal models of depression and anxiety, a viral gene transfer approach was used to selectively express CREB in this region of the rat brain. In the learned helplessness model of depression, induction of CREB in the basolateral amygdala after training decreased the number of escape failures, an antidepressant response. However, expression of CREB before training increased escape failures, and increased immobility in the forced swim test, depressive effects. Expression of CREB in the basolateral amygdala also increased behavioral measures of anxiety in both the open field test and the elevated plus maze, and enhanced cued fear conditioning. Taken together, these data demonstrate that CREB expression in the basolateral amygdala influences behavior in models of depression, anxiety, and fear. Moreover, in the basolateral amygdala, the temporal expression of CREB in relation to learned helplessness training, determines the qualitative outcome in this animal model of depression.

  19. hobo Induced rearrangements in the yellow locus influence the insulation effect of the gypsy su(Hw)-binding region in Drosophila melanogaster.

    PubMed Central

    Gause, M; Hovhannisyan, H; Kan, T; Kuhfittig, S; Mogila, V; Georgiev, P

    1998-01-01

    The su(Hw) protein is responsible for the insulation mediated by the su(Hw)-binding region present in the gypsy retrotransposon. In the y2 mutant, su(Hw) protein partially inhibits yellow transcription by repressing the function of transcriptional enhancers located distally from the yellow promoter with respect to gypsy. y2 mutation derivatives have been induced by the insertion of two hobo copies on the both sides of gypsy: into the yellow intron and into the 5' regulatory region upstream of the wing and body enhancers. The hobo elements have the same structure and orientation, opposite to the direction of yellow transcription. In the sequence context, where two copies of hobo are separated by the su(Hw)-binding region, hobo-dependent rearrangements are frequently associated with duplications of the region between the hobo elements. Duplication of the su(Hw)-binding region strongly inhibits the insulation of the yellow promoter separated from the body and wing enhancers by gypsy. These results provide a better insight into mechanisms by which the su(Hw)-binding region affects the enhancer function. PMID:9649529

  20. Identification of a DNA-binding site for the transcription factor Haa1, required for Saccharomyces cerevisiae response to acetic acid stress

    PubMed Central

    Mira, Nuno P.; Henriques, Sílvia F.; Keller, Greg; Teixeira, Miguel C.; Matos, Rute G.; Arraiano, Cecília M.; Winge, Dennis R.; Sá-Correia, Isabel

    2011-01-01

    The transcription factor Haa1 is the main player in reprogramming yeast genomic expression in response to acetic acid stress. Mapping of the promoter region of one of the Haa1-activated genes, TPO3, allowed the identification of an acetic acid responsive element (ACRE) to which Haa1 binds in vivo. The in silico analysis of the promoter regions of the genes of the Haa1-regulon led to the identification of an Haa1-responsive element (HRE) 5′-GNN(G/C)(A/C)(A/G)G(A/G/C)G-3′. Using surface plasmon resonance experiments and electrophoretic mobility shift assays it is demonstrated that Haa1 interacts with high affinity (KD of 2 nM) with the HRE motif present in the ACRE region of TPO3 promoter. No significant interaction was found between Haa1 and HRE motifs having adenine nucleotides at positions 6 and 8 (KD of 396 and 6780 nM, respectively) suggesting that Haa1p does not recognize these motifs in vivo. A lower affinity of Haa1 toward HRE motifs having mutations in the guanine nucleotides at position 7 and 9 (KD of 21 and 119 nM, respectively) was also observed. Altogether, the results obtained indicate that the minimal functional binding site of Haa1 is 5′-(G/C)(A/C)GG(G/C)G-3′. The Haa1-dependent transcriptional regulatory network active in yeast response to acetic acid stress is proposed. PMID:21586585

  1. Thyroid hormone and COUP-TF1 regulate kallikrein-binding protein (KBP) gene expression.

    PubMed

    Liu, Yan-Yun; Nakatani, Teruyo; Kogai, Takahiko; Mody, Kaizeen; Brent, Gregory A

    2011-03-01

    Kallikrein-binding protein (KBP) is a component of the kallikrein-kinin system that mediates vasodilation and inhibits tumor growth by antagonizing vascular endothelial growth factor-mediated angiogenesis. We demonstrate that KBP gene expression is repressed by T(3) and modulated by the orphan nuclear receptor, chicken ovalbumin upstream promoter transcription factor 1 (COUP-TF1). In hypothyroid mice, KBP mRNA expression in the testis was increased 2.1-fold compared with euthyroid mice. We have identified two negative thyroid hormone response elements (nTREs) in the mouse KBP gene, nTRE1 located in the 5' flanking region (-53 to -29) and nTRE2, located in the first intron (104-132). We used functional assays, cofactor knockdown, and chromatin immunoprecipitation assays to characterize nTRE1 and nTRE2 in hepatic (HepG2) and testes (GC-1spg) cell lines. Reporter expression directed by both elements was enhanced with addition of thyroid hormone receptor and repressed with the addition of T(3). COUP-TF1 enhanced basal expression of both elements but blunted unliganded thyroid hormone receptor enhancement and T(3) repression of nTRE1 but not nTRE2. Both nTREs bound nuclear corepressor and binding increased in response to T(3). Nuclear corepressor knockdown resulted in loss of T(3) repression of both nTRE1 and nTRE2. COUP-TF1, which usually represses T(3) induction of positive thyroid hormone response elements, reverses T(3) repression mediated by nTRE1 in the mouse KBP gene. Endogenous KBP expression is repressed by T(3) and two functional nTREs, both of which are required, have been characterized in the KBP gene. COUP-TF1 may be an important factor to modulate expression of genes that are repressed by T(3).

  2. Thyroid Hormone and COUP-TF1 Regulate Kallikrein-Binding Protein (KBP) Gene Expression

    PubMed Central

    Liu, Yan-Yun; Nakatani, Teruyo; Kogai, Takahiko; Mody, Kaizeen

    2011-01-01

    Kallikrein-binding protein (KBP) is a component of the kallikrein-kinin system that mediates vasodilation and inhibits tumor growth by antagonizing vascular endothelial growth factor-mediated angiogenesis. We demonstrate that KBP gene expression is repressed by T3 and modulated by the orphan nuclear receptor, chicken ovalbumin upstream promoter transcription factor 1 (COUP-TF1). In hypothyroid mice, KBP mRNA expression in the testis was increased 2.1-fold compared with euthyroid mice. We have identified two negative thyroid hormone response elements (nTREs) in the mouse KBP gene, nTRE1 located in the 5′ flanking region (−53 to −29) and nTRE2, located in the first intron (104–132). We used functional assays, cofactor knockdown, and chromatin immunoprecipitation assays to characterize nTRE1 and nTRE2 in hepatic (HepG2) and testes (GC-1spg) cell lines. Reporter expression directed by both elements was enhanced with addition of thyroid hormone receptor and repressed with the addition of T3. COUP-TF1 enhanced basal expression of both elements but blunted unliganded thyroid hormone receptor enhancement and T3 repression of nTRE1 but not nTRE2. Both nTREs bound nuclear corepressor and binding increased in response to T3. Nuclear corepressor knockdown resulted in loss of T3 repression of both nTRE1 and nTRE2. COUP-TF1, which usually represses T3 induction of positive thyroid hormone response elements, reverses T3 repression mediated by nTRE1 in the mouse KBP gene. Endogenous KBP expression is repressed by T3 and two functional nTREs, both of which are required, have been characterized in the KBP gene. COUP-TF1 may be an important factor to modulate expression of genes that are repressed by T3. PMID:21266512

  3. Sub-micron surface plasmon resonance sensor systems

    NASA Technical Reports Server (NTRS)

    Glazier, James A. (Inventor); Amarie, Dragos (Inventor)

    2012-01-01

    A sensor for detecting the presence of a target analyte, ligand or molecule in a test fluid, comprising a light transmissive substrate on which an array of surface plasmon resonant (SPR) elements is mounted is described. A multi-channel sensor for detecting the presence of several targets with a single microchip sensor is described. A multi-channel sensor including collections of SPR elements which are commonly functionalized to one of several targets is also described. The detectors sense changes in the resonant response of the SPR elements indicative of binding with the targets.

  4. Sub-micron surface plasmon resonance sensor systems

    NASA Technical Reports Server (NTRS)

    Amarie, Dragos (Inventor); Glazier, James A. (Inventor)

    2011-01-01

    A sensor for detecting the presence of a target analyte, ligand or molecule in a test fluid, comprising a light transmissive substrate on which an array of surface plasmon resonant (SPR) elements is mounted is described. A multichannel sensor for detecting the presence of several targets with a single microchip sensor is described. A multichannel sensor including collections of SPR elements which are commonly functionalized to one of several targets is also described. The detectors sense changes in the resonant response of the SPR elements indicative of binding with the targets.

  5. Sub-micron surface plasmon resonance sensor systems

    NASA Technical Reports Server (NTRS)

    Glazier, James A. (Inventor); Dragnea, Bogdan (Inventor); Amarie, Dragos (Inventor)

    2010-01-01

    A sensor for detecting the presence of a target analyte, ligand or molecule in a test fluid, comprising a light transmissive substrate on which an array of surface plasmon resonant (SPR) elements is mounted is described. A multi-channel sensor for detecting the presence of several targets with a single microchip sensor is described. A multi-channel sensor including collections of SPR elements which are commonly functionalized to one of several targets is also described. The detectors sense changes in the resonant response of the SPR elements indicative of binding with the targets.

  6. Sub-micron surface plasmon resonance sensor systems

    NASA Technical Reports Server (NTRS)

    Amarie, Dragos (Inventor); Glazier, James A. (Inventor); Dragnea, Bogdan (Inventor)

    2010-01-01

    A sensor for detecting the presence of a target analyte, ligand or molecule in a test fluid, comprising a light transmissive substrate on which an array of surface plasmon resonant (SPR) elements is mounted is described. A multi-channel sensor for detecting the presence of several targets with a single micro-chip sensor is described. A multi-channel sensor including collections of SPR elements which are commonly functionalized to one of several targets is also described. The detectors sense changes in the resonant response of the SPR elements indicative of binding with the targets.

  7. Sub-micron surface plasmon resonance sensor systems

    NASA Technical Reports Server (NTRS)

    Glazier, James A. (Inventor); Amarie, Dragos (Inventor)

    2011-01-01

    A sensor for detecting the presence of a target analyte, ligand or molecule in a test fluid, comprising a light transmissive substrate on which an array of surface plasmon resonant (SPR) elements is mounted is described. A multi-channel sensor for detecting the presence of several targets with a single micro-chip sensor is described. A multi-channel sensor including collections of SPR elements which are commonly functionalized to one of several targets is also described. The detectors sense changes in the resonant response of the SPR elements indicative of binding with the targets.

  8. 24-Methylenecycloartanyl ferulate, a major compound of γ-oryzanol, promotes parvin-beta expression through an interaction with peroxisome proliferator-activated receptor-gamma 2 in human breast cancer cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kim, Heon Woong; Lim, Eun Joung; Jang, Hwan Hee

    2015-12-25

    Parvin-β is an adaptor protein that binds to integrin-linked kinase (ILK) and is significantly downregulated in breast tumors and breast cancer cell lines. We treated the breast cancer cell line MCF7 with 24-methylenecycloartanyl ferulate (24-MCF), a γ-oryzanol compound. We observed upregulation of parvin-β (GenBank Accession No. (AF237769)) and peroxisome proliferator-activated receptor (PPAR)-γ2 (GenBank Accession No. (NM-015869)). Among γ-oryzanol compounds, only treatment with 24-MCF led to the formation of reverse transcription-PCR products of parvin-β (650 and 500 bp) and PPAR-γ2 (580 bp) in MCF7 cells, but not in T47D, SK-BR-3, or MDA-MB-231 cells. 24-MCF treatment increased the mRNA and protein levels of parvin-β inmore » MCF7 cells in a dose-dependent manner. We hypothesized that there is a correlation between parvin-β expression and induction of PPAR-γ2. This hypothesis was investigated by using a promoter-reporter assay, chromatin immunoprecipitation, and an electrophoretic mobility shift assay. 24-MCF treatment induced binding of PPAR-γ2 to a peroxisome proliferator response element-like cis-element (ACTAGGACAAAGGACA) in the parvin-β promoter in MCF7 cells in a dose-dependent manner. 24-MCF treatment significantly decreased anchorage-independent growth and inhibited cell movement in comparison to control treatment with dimethyl sulfoxide. 24-MCF treatment reduced the levels of GTP-bound Rac1 and Cdc42. Evaluation of Akt1 inhibition by 24-MCF revealed that the half maximal effective concentration was 33.3 μM. Docking evaluations revealed that 24-MCF binds to the ATP-binding site of Akt1(PDB ID: (3OCB)) and the compound binding energy is -8.870 kcal/mol. Taken together, our results indicate that 24-MCF treatment increases parvin-β expression, which may inhibit ILK downstream signaling. - Highlights: • Treatment with 24-MCF increases gene expression of parvin-β and PPAR-ϒ2 in MCF7 cells. • PPAR-ϒ2 interacts with the parvin-β gene via its peroxisome proliferator response element-like cis-element. • 24-MCF treatment inhibits anchorage-dependent growth of MCF7 cells. • 24-MCF treatment inhibits MCF7 cell migration and Rac1 and Cdc42 activation. • 24-MCF may be a new ATP-competitive Akt1 inhibitor that binds to the ATP-binding site of Akt1.« less

  9. cAMP Response Element-Binding Protein Is Required for Dopamine-Dependent Gene Expression in the Intact But Not the Dopamine-Denervated Striatum

    PubMed Central

    Andersson, Malin; Konradi, Christine; Cenci, M. Angela

    2014-01-01

    The cAMP response element-binding protein (CREB) is believed to play a pivotal role in dopamine (DA) receptor-mediated nuclear signaling and neuroplasticity. Here we demonstrate that the significance of CREB for gene expression depends on the experimental paradigm. We compared the role of CREB in two different but related models: L-DOPA administration to unilaterally 6-hydroxydopamine lesioned rats, and cocaine administration to neurologically intact animals. Antisense technology was used to produce a local knockdown of CREB in the lateral caudate–putamen, a region that mediates the dyskinetic or stereotypic manifestations associated with L-DOPA or cocaine treatment, respectively. In intact rats, CREB antisense reduced both basal and cocaine-induced expression of c-Fos, FosB/ΔFosB, and prodynorphin mRNA. In the DA-denervated striatum, CREB was not required for L-DOPA to induce these gene products, nor did CREB contribute considerably to DNA binding activity at cAMP responsive elements (CREs) and CRE-like enhancers. ΔFosB-related proteins and JunD were the main contributors to both CRE and AP-1 DNA–protein complexes in L-DOPA-treated animals. In behavioral studies, intrastriatal CREB knockdown caused enhanced activity scores in intact control animals and exacerbated the dyskinetic effects of acute L-DOPA treatment in 6-OHDA-lesioned animals. These data demonstrate that CREB is not required for the development of L-DOPA-induced dyskinesia in hemiparkinsonian rats. Moreover, our results reveal an unexpected alteration of nuclear signaling mechanisms in the parkinsonian striatum treated with L-DOPA, where AP-1 transcription factors appear to supersede CREB in the activation of CRE-containing genes. PMID:11739600

  10. Role of transcription factor Sp1 and RNA binding protein HuR in the down-regulation of Dr+ Escherichia coli receptor protein Decay Accelerating Factor (DAF or CD55) by Nitric oxide

    PubMed Central

    Banadakoppa, Manu; Liebenthal, Daniel; Nowak, David E; Urvil, Petri; Yallampalli, Uma; Wilson, Gerald M; Kishor, Aparna; Yallampalli, Chandra

    2012-01-01

    We previously reported that nitric oxide (NO) reduces the rate of bacteremia and maternal mortality in pregnant rats with uterine infection by Escherichia coli expressing the Dr Fimbria (Dr+). The epithelial invasion of Dr+ E. coli is dependent on the expression level of its cellular receptor decay accelerating factor (DAF). NO reduces the rate of bacteremia by down-regulating the expression of DAF. In this study, we elucidated the role of transcription factor Sp1 and RNA binding protein HuR in the down-regulation of human DAF by NO. We generated a series of deletion mutant constructs of DAF gene 5′-untranslated region and mapped NO-response region upstream to the core promoter region of the DAF gene. One of the several Sp1 binding sites in the DAF 5′-untranslated region was located within the NO-response region. The binding of Sp1 to this site was inhibited by NO. Furthermore, NO also promoted the degradation of DAF mRNA. The 3′-untranslated region of DAF harbors an AU-rich element and this element destabilized the mRNA transcript. The NO promoted the rapid degradation of DAF mRNA by inhibiting the binding of mRNA stabilizing protein HuR to this AU-rich region. The inhibition of binding of HuR to AU-rich region was due to the S-nitrosylation of one or more cysteine residues by NO. Thus, these data reveal the molecular mediators of transcriptional and post-transcriptional regulation of DAF by NO with implications in pathophysiology related to DAF. PMID:23176121

  11. Role of transcription factor Sp1 and RNA binding protein HuR in the downregulation of Dr+ Escherichia coli receptor protein decay accelerating factor (DAF or CD55) by nitric oxide.

    PubMed

    Banadakoppa, Manu; Liebenthal, Daniel; Nowak, David E; Urvil, Petri; Yallampalli, Uma; Wilson, Gerald M; Kishor, Aparna; Yallampalli, Chandra

    2013-02-01

    We previously reported that nitric oxide (NO) reduces the rate of bacteremia and maternal mortality in pregnant rats with uterine infection by Escherichia coli expressing the Dr Fimbria (Dr(+) ). The epithelial invasion of Dr(+) E. coli is dependent on the expression level of its cellular receptor decay accelerating factor (DAF). NO reduces the rate of bacteremia by downregulating the expression of DAF. In this study, we elucidated the role of transcription factor Sp1 and RNA binding protein HuR in the downregulation of human DAF by NO. We generated a series of deletion mutant constructs of DAF gene 5'-untranslated region and mapped the NO-response region upstream to the core promoter region of the DAF gene. One of the several Sp1 binding sites in the DAF 5'-untranslated region was located within the NO-response region. The binding of Sp1 to this site was inhibited by NO. Furthermore, NO also promoted the degradation of DAF mRNA. The 3'-untranslated region of DAF harbors an AU-rich element and this element destabilized the mRNA transcript. NO promoted the rapid degradation of DAF mRNA by inhibiting the binding of mRNA stabilizing protein HuR to this AU-rich region. The inhibition of binding of HuR to the AU-rich region was due to the S-nitrosylation of one or more cysteine residues by NO. Thus, these data reveal the molecular mediators of transcriptional and post-transcriptional regulation of DAF by NO with implications in pathophysiology related to DAF. © 2012 The Authors Journal compilation © 2012 FEBS.

  12. Presenilins regulate neurotrypsin gene expression and neurotrypsin-dependent agrin cleavage via cyclic AMP response element-binding protein (CREB) modulation.

    PubMed

    Almenar-Queralt, Angels; Kim, Sonia N; Benner, Christopher; Herrera, Cheryl M; Kang, David E; Garcia-Bassets, Ivan; Goldstein, Lawrence S B

    2013-12-06

    Presenilins, the catalytic components of the γ-secretase complex, are upstream regulators of multiple cellular pathways via regulation of gene transcription. However, the underlying mechanisms and the genes regulated by these pathways are poorly characterized. In this study, we identify Tequila and its mammalian ortholog Prss12 as genes negatively regulated by presenilins in Drosophila larval brains and mouse embryonic fibroblasts, respectively. Prss12 encodes the serine protease neurotrypsin, which cleaves the heparan sulfate proteoglycan agrin. Altered neurotrypsin activity causes serious synaptic and cognitive defects; despite this, the molecular processes regulating neurotrypsin expression and activity are poorly understood. Using γ-secretase drug inhibitors and presenilin mutants in mouse embryonic fibroblasts, we found that a mature γ-secretase complex was required to repress neurotrypsin expression and agrin cleavage. We also determined that PSEN1 endoproteolysis or processing of well known γ-secretase substrates was not essential for this process. At the transcriptional level, PSEN1/2 removal induced cyclic AMP response element-binding protein (CREB)/CREB-binding protein binding, accumulation of activating histone marks at the neurotrypsin promoter, and neurotrypsin transcriptional and functional up-regulation that was dependent on GSK3 activity. Upon PSEN1/2 reintroduction, this active epigenetic state was replaced by a methyl CpG-binding protein 2 (MeCP2)-containing repressive state and reduced neurotrypsin expression. Genome-wide analysis revealed hundreds of other mouse promoters in which CREB binding is similarly modulated by the presence/absence of presenilins. Our study thus identifies Tequila and neurotrypsin as new genes repressed by presenilins and reveals a novel mechanism used by presenilins to modulate CREB signaling based on controlling CREB recruitment.

  13. Presenilins Regulate Neurotrypsin Gene Expression and Neurotrypsin-dependent Agrin Cleavage via Cyclic AMP Response Element-binding Protein (CREB) Modulation*

    PubMed Central

    Almenar-Queralt, Angels; Kim, Sonia N.; Benner, Christopher; Herrera, Cheryl M.; Kang, David E.; Garcia-Bassets, Ivan; Goldstein, Lawrence S. B.

    2013-01-01

    Presenilins, the catalytic components of the γ-secretase complex, are upstream regulators of multiple cellular pathways via regulation of gene transcription. However, the underlying mechanisms and the genes regulated by these pathways are poorly characterized. In this study, we identify Tequila and its mammalian ortholog Prss12 as genes negatively regulated by presenilins in Drosophila larval brains and mouse embryonic fibroblasts, respectively. Prss12 encodes the serine protease neurotrypsin, which cleaves the heparan sulfate proteoglycan agrin. Altered neurotrypsin activity causes serious synaptic and cognitive defects; despite this, the molecular processes regulating neurotrypsin expression and activity are poorly understood. Using γ-secretase drug inhibitors and presenilin mutants in mouse embryonic fibroblasts, we found that a mature γ-secretase complex was required to repress neurotrypsin expression and agrin cleavage. We also determined that PSEN1 endoproteolysis or processing of well known γ-secretase substrates was not essential for this process. At the transcriptional level, PSEN1/2 removal induced cyclic AMP response element-binding protein (CREB)/CREB-binding protein binding, accumulation of activating histone marks at the neurotrypsin promoter, and neurotrypsin transcriptional and functional up-regulation that was dependent on GSK3 activity. Upon PSEN1/2 reintroduction, this active epigenetic state was replaced by a methyl CpG-binding protein 2 (MeCP2)-containing repressive state and reduced neurotrypsin expression. Genome-wide analysis revealed hundreds of other mouse promoters in which CREB binding is similarly modulated by the presence/absence of presenilins. Our study thus identifies Tequila and neurotrypsin as new genes repressed by presenilins and reveals a novel mechanism used by presenilins to modulate CREB signaling based on controlling CREB recruitment. PMID:24145027

  14. A proximal promoter region of Arabidopsis DREB2C confers tissue-specific expression under heat stress.

    PubMed

    Chen, Huan; Je, Jihyun; Song, Chieun; Hwang, Jung Eun; Lim, Chae Oh

    2012-09-01

    The dehydration-responsive element-binding factor 2C (DREB2C) is a member of the CBF/DREB subfamily of proteins, which contains a single APETALA2/Ethylene responsive element-binding factor (AP2/ERF) domain. To identify the expression pattern of the DREB2C gene, which contains multiple transcription cis-regulatory elements in its promoter, an approximately 1.4 kb upstream DREB2C sequence was fused to the β-glucuronidase reporter gene (GUS) and the recombinant p1244 construct was transformed into Arabidopsis thaliana (L.) Heynh. The promoter of the gene directed prominent GUS activity in the vasculature in diverse young dividing tissues. Upon applying heat stress (HS), GUS staining was also enhanced in the vasculature of the growing tissues. Analysis of a series of 5'-deletions of the DREB2C promoter revealed that a proximal upstream sequence sufficient for the tissue-specific spatial and temporal induction of GUS expression by HS is localized in the promoter region between -204 and -34 bps relative to the transcriptional start site. Furthermore, electrophoretic mobility shift assay (EMSA) demonstrated that nuclear protein binding activities specific to a -120 to -32 bp promoter fragment increased after HS. These results indicate that the TATA-proximal region and some latent trans-acting factors may cooperate in HS-induced activation of the Arabidopsis DREB2C promoter. © 2012 Institute of Botany, Chinese Academy of Sciences.

  15. Targeting ESR1-Mutant Breast Cancer

    DTIC Science & Technology

    2015-09-01

    Approved OMB No. 0704-0188 Public reporting burden for this collection of information is estimated to average 1 hour per response , including the time...CLASSIFICATION OF: 17. LIMITATION OF ABSTRACT 18. NUMBER OF PAGES 19a. NAME OF RESPONSIBLE PERSON USAMRMC a. REPORT U b. ABSTRACT U c. THIS PAGE U UU...Cancer W81XWH-14-1-0359 5 2. Keywords Estrogen Receptor Estrogen Response Element Metastatic Breast Cancer Ligand Binding Domain Mutation

  16. Cassava C-repeat binding factor 1 gene responds to low temperature and enhances cold tolerance when overexpressed in Arabidopsis and cassava.

    PubMed

    An, Dong; Ma, Qiuxiang; Wang, Hongxia; Yang, Jun; Zhou, Wenzhi; Zhang, Peng

    2017-05-01

    Cassava MeCBF1 is a typical CBF transcription factor mediating cold responses but its low expression in apical buds along with a retarded response cause inefficient upregulation of downstream cold-related genes, rendering cassava chilling-sensitive. Low temperature is a major abiotic stress factor affecting survival, productivity and geographic distribution of important crops worldwide. The C-repeat/dehydration-responsive element binding transcription factors (CBF/DREB) are important regulators of abiotic stress response in plants. In this study, MeCBF1, a CBF-like gene, was identified in the tropical root crop cassava (Manihot esculenta Crantz). The MeCBF1 encodes a protein that shares strong homology with DREB1As/CBFs from Arabidopsis as well as other species. The MeCBF1 was localized to the nucleus and is mainly expressed in stem and mature leaves, but not in apical buds or stem cambium. MeCBF1 expression was not only highly responsive to cold, but also significantly induced by salt, PEG and ABA treatment. Several stress-associated cis-elements were found in its promoter region, e.g., ABRE-related, MYC recognition sites, and MYB responsive element. Compared with AtCBF1, the MeCBF1 expression induced by cold in cassava was retarded and upregulated only after 4 h, which was also confirmed by its promoter activity. Overexpression of MeCBF1 in transgenic Arabidopsis and cassava plants conferred enhanced crytolerance. The CBF regulon was smaller and not entirely co-regulated with MeCBF1 expression in overexpressed cassava. The retarded MeCBF1 expression in response to cold and attenuated CBF-regulon might lead cassava to chilling sensitivity.

  17. Regulation of insulin-like growth factor I transcription by cyclic adenosine 3',5'-monophosphate (cAMP) in fetal rat bone cells through an element within exon 1: protein kinase A-dependent control without a consensus AMP response element

    NASA Technical Reports Server (NTRS)

    McCarthy, T. L.; Thomas, M. J.; Centrella, M.; Rotwein, P.

    1995-01-01

    Insulin-like growth factor I (IGF-I) is a locally synthesized anabolic growth factor for bone. IGF-I synthesis by primary fetal rat osteoblasts (Ob) is stimulated by agents that increase the intracellular cAMP concentration, including prostaglandin E2 (PGE2). Previous studies with Ob cultures demonstrated that PGE2 enhanced IGF-I transcription through selective use of IGF-I promoter 1, with little effect on IGF-I messenger RNA half-life. Transient transfection of Ob cultures with an array of promoter 1-luciferase reporter fusion constructs has now allowed localization of a potential cis-acting promoter element(s) responsible for cAMP-stimulated gene expression to the 5'-untranslated region (5'-UTR) of IGF-I exon 1, within a segment lacking a consensus cAMP response element. Our evidence derives from three principal observations: 1) a transfection construct containing only 122 nucleotides (nt) of promoter 1 and 328 nt of the 5'-UTR retained full PGE2-stimulated reporter expression; 2) maximal PGE2-driven reporter expression required the presence of nt 196 to 328 of exon 1 when tested within the context of IGF-I promoter 1; 3) cotransfection of IGF-I promoter-luciferase-reporter constructs with a plasmid encoding the alpha-isoform of the catalytic subunit of murine cAMP-dependent protein kinase (PKA) produced results comparable to those seen with PGE2 treatment, whereas cotransfection with a plasmid encoding a mutant regulatory subunit of PKA that cannot bind cAMP blocked PGE2-induced reporter expression. Deoxyribonuclease I footprinting of the 5'-UTR of exon 1 demonstrated protected sequences at HS3A, HS3B, and HS3D, three of six DNA-protein binding sites previously characterized with rat liver nuclear extracts. Of these three regions, only the HS3D binding site is located within the functionally identified hormonally responsive segment of IGF-I exon 1. These results directly implicate PKA in the control of IGF-I gene transcription by PGE2 and identify a segment of IGF-I exon 1 as being essential for this hormonal regulation.

  18. GLUCOCORTICOID RECEPTOR EXPRESSION DURING THE DEVELOPMENT OF THE EMBRYONIC MOUSE SECONDARY PALATE

    EPA Science Inventory

    Glucocorticoids are important regulators of embryonic growth and development. hese effects are mediated through glucocorticoid receptors (GR) which bind to glucocorticoid response elements upstream of regulated genes. his study examines the expression of GR and GR mRNA in embryon...

  19. ACGT-containing abscisic acid response element (ABRE) and coupling element 3 (CE3) are functionally equivalent.

    PubMed

    Hobo, T; Asada, M; Kowyama, Y; Hattori, T

    1999-09-01

    ACGT-containing ABA response elements (ABREs) have been functionally identified in the promoters of various genes. In addition, single copies of ABRE have been found to require a cis-acting, coupling element to achieve ABA induction. A coupling element 3 (CE3) sequence, originally identified as such in the barley HVA1 promoter, is found approximately 30 bp downstream of motif A (ACGT-containing ABRE) in the promoter of the Osem gene. The relationship between these two elements was further defined by linker-scan analyses of a 55 bp fragment of the Osem promoter, which is sufficient for ABA-responsiveness and VP1 activation. The analyses revealed that both motif A and CE3 sequence were required not only for ABA-responsiveness but also for VP1 activation. Since the sequences of motif A and CE3 were found to be similar, motif-exchange experiments were carried out. The experiments demonstrated that motif A and CE3 were interchangeable by each other with respect to both ABA and VP1 regulation. In addition, both sequences were shown to be recognized by a VP1-interacting, ABA-responsive bZIP factor TRAB1. These results indicate that ACGT-containing ABREs and CE3 are functionally equivalent cis-acting elements. Furthermore, TRAB1 was shown to bind two other non-ACGT ABREs. Based on these results, all these ABREs including CE3 are proposed to be categorized into a single class of cis-acting elements.

  20. Structural and functional analysis of an enhancer GPEI having a phorbol 12-O-tetradecanoate 13-acetate responsive element-like sequence found in the rat glutathione transferase P gene.

    PubMed

    Okuda, A; Imagawa, M; Maeda, Y; Sakai, M; Muramatsu, M

    1989-10-05

    We have recently identified a typical enhancer, termed GPEI, located about 2.5 kilobases upstream from the transcription initiation site of the rat glutathione transferase P gene. Analyses of 5' and 3' deletion mutants revealed that the cis-acting sequence of GPEI contained the phorbol 12-O-tetradecanoate 13-acetate responsive element (TRE)-like sequence in it. For the maximal activity, however, GPEI required an adjacent upstream sequence of about 19 base pairs in addition to the TRE-like sequence. With the DNA binding gel-shift assay, we could detect protein(s) that specifically binds to the TRE-like sequence of GPEI fragment, which was possibly c-jun.c-fos complex or a similar protein complex. The sequence immediately upstream of the TRE-like sequence did not have any activity by itself, but augmented the latter activity by about 5-fold.

  1. Advanced glycation end products increase carbohydrate responsive element binding protein expression and promote cancer cell proliferation.

    PubMed

    Chen, Hanbei; Wu, Lifang; Li, Yakui; Meng, Jian; Lin, Ning; Yang, Dianqiang; Zhu, Yemin; Li, Xiaoyong; Li, Minle; Xu, Ye; Wu, Yuchen; Tong, Xuemei; Su, Qing

    2014-09-01

    Diabetic patients have increased levels of advanced glycation end products (AGEs) and the role of AGEs in regulating cancer cell proliferation is unclear. Here, we found that treating colorectal and liver cancer cells with AGEs promoted cell proliferation. AGEs stimulated both the expression and activation of a key transcription factor called carbohydrate responsive element binding protein (ChREBP) which had been shown to promote glycolytic and anabolic activity as well as proliferation of colorectal and liver cancer cells. Using siRNAs or the antagonistic antibody for the receptor for advanced glycation end-products (RAGE) blocked AGEs-induced ChREBP expression or cell proliferation in cancer cells. Suppressing ChREBP expression severely impaired AGEs-induced cancer cell proliferation. Taken together, these results demonstrate that AGEs-RAGE signaling enhances cancer cell proliferation in which AGEs-mediated ChREBP induction plays an important role. These findings may provide new explanation for increased cancer progression in diabetic patients. Copyright © 2014. Published by Elsevier Ireland Ltd.

  2. The human apolipoprotein AV gene is regulated by peroxisome proliferator-activated receptor-alpha and contains a novel farnesoid X-activated receptor response element.

    PubMed

    Prieur, Xavier; Coste, Herve; Rodriguez, Joan C

    2003-07-11

    The newly identified apolipoprotein AV (apoAV) gene is a key player in determining plasma triglyceride concentrations. Because hypertriglyceridemia is a major independent risk factor in coronary artery disease, the understanding of the regulation of the expression of this gene is of considerable importance. We presently characterize the structure, the transcription start site, and the promoter of the human apoAV gene. Since the peroxisome proliferator-activated receptor-alpha (PPARalpha) and the farnesoid X-activated receptor (FXR) have been shown to modulate the expression of genes involved in triglyceride metabolism, we evaluated the potential role of these nuclear receptors in the regulation of apoAV transcription. Bile acids and FXR induced the apoAV gene promoter activity. 5'-Deletion, mutagenesis, and gel shift analysis identified a heretofore unknown element at positions -103/-84 consisting of an inverted repeat of two consensus receptor-binding hexads separated by 8 nucleotides (IR8), which was required for the response to bile acid-activated FXR. The isolated IR8 element conferred FXR responsiveness on a heterologous promoter. On the other hand, in apoAV-expressing human hepatic Hep3B cells, transfection of PPARalpha specifically enhanced apoAV promoter activity. By deletion, site-directed mutagenesis, and binding analysis, a PPARalpha response element located 271 bp upstream of the transcription start site was identified. Finally, treatment with a specific PPARalpha activator led to a significant induction of apoAV mRNA expression in hepatocytes. The identification of apoAV as a PPARalpha target gene has major implications with respect to mechanisms whereby pharmacological PPARalpha agonists may exert their beneficial hypotriglyceridemic actions.

  3. Thyroid Hormone Receptor β (TRβ) and Liver X Receptor (LXR) Regulate Carbohydrate-response Element-binding Protein (ChREBP) Expression in a Tissue-selective Manner*

    PubMed Central

    Gauthier, Karine; Billon, Cyrielle; Bissler, Marie; Beylot, Michel; Lobaccaro, Jean-Marc; Vanacker, Jean-Marc; Samarut, Jacques

    2010-01-01

    Thyroid hormone (TR) and liver X (LXR) receptors are transcription factors involved in lipogenesis. Both receptors recognize the same consensus DNA-response element in vitro. It was previously shown that their signaling pathways interact in the control of cholesterol elimination in the liver. In the present study, carbohydrate-response element-binding protein (ChREBP), a major transcription factor controlling the activation of glucose-induced lipogenesis in liver, is characterized as a direct target of thyroid hormones (TH) in liver and white adipose tissue (WAT), the two main lipogenic tissues in mice. Using genetic and molecular approaches, ChREBP is shown to be specifically regulated by TRβ but not by TRα in vivo, even in WAT where both TR isoforms are expressed. However, this isotype specificity is not found in vitro. This TRβ specific regulation correlates with the loss of TH-induced lipogenesis in TRβ−/− mice. Fasting/refeeding experiments show that TRβ is not required for the activation of ChREBP expression particularly marked in WAT following refeeding. However, TH can stimulate ChREBP expression in WAT even under fasting conditions, suggesting completely independent pathways. Because ChREBP has been described as an LXR target, the interaction of LXR and TRβ in ChREBP regulation was assayed both in vitro and in vivo. Each receptor recognizes a different response element on the ChREBP promoter, located only 8 bp apart. There is a cross-talk between LXR and TRβ signaling on the ChREBP promoter in liver but not in WAT where LXR does not regulate ChREBP expression. The molecular basis for this cross-talk has been determined in in vitro systems. PMID:20615868

  4. Stimulation of interleukin-13 expression by human T-cell leukemia virus type 1 oncoprotein Tax via a dually active promoter element responsive to NF-kappaB and NFAT.

    PubMed

    Silbermann, Katrin; Schneider, Grit; Grassmann, Ralph

    2008-11-01

    The human T-cell leukemia virus type 1 (HTLV-1) Tax oncoprotein transforms human lymphocytes and is critical for the pathogenesis of HTLV-1-induced adult T-cell leukaemia. In HTLV-transformed cells, Tax upregulates interleukin (IL)-13, a cytokine with proliferative and anti-apoptotic functions that is linked to leukaemogenesis. Tax-stimulated IL-13 is thought to result in autocrine stimulation of HTLV-infected cells and thus may be relevant to their growth. The causal transactivation of the IL-13 promoter by Tax is predominantly dependent on a nuclear factor of activated T cells (NFAT)-binding P element. Here, it was shown that the isolated IL-13 Tax-responsive element (IL13TaxRE) was sufficient to mediate IL-13 transactivation by Tax and NFAT1. However, cyclosporin A, a specific NFAT inhibitor, revealed that Tax transactivation of IL13TaxRE or wild-type IL-13 promoter was independent of NFAT and that NFAT did not contribute to IL-13 upregulation in HTLV-transformed cells. By contrast, Tax stimulation was repressible by an efficient nuclear factor (NF)-kappaB inhibitor (IkBaDN), indicating the requirement for NF-kappaB. The capacity of NF-kappaB to stimulate IL13TaxRE was demonstrated by a strong response to NF-kappaB in reporter assays and by direct binding of NF-kappaB to IL13TaxRE. Thus, IL13TaxRE in the IL-13 promoter represents a dually active promoter element responsive to NF-kappaB and NFAT. Together, these results indicate that Tax causes IL-13 upregulation in HTLV-1-infected cells via NF-kappaB.

  5. Heterogeneous Nuclear Ribonucleoprotein (hnRNP) E1 Binds to hnRNP A2 and Inhibits Translation of A2 Response Element mRNAs

    PubMed Central

    Kosturko, Linda D.; Maggipinto, Michael J.; Korza, George; Lee, Joo Won; Carson, John H.

    2006-01-01

    Heterogeneous nuclear ribonucleoprotein (hnRNP) A2 is a trans-acting RNA-binding protein that mediates trafficking of RNAs containing the cis-acting A2 response element (A2RE). Previous work has shown that A2RE RNAs are transported to myelin in oligodendrocytes and to dendrites in neurons. hnRNP E1 is an RNA-binding protein that regulates translation of specific mRNAs. Here, we show by yeast two-hybrid analysis, in vivo and in vitro coimmunoprecipitation, in vitro cross-linking, and fluorescence correlation spectroscopy that hnRNP E1 binds to hnRNP A2 and is recruited to A2RE RNA in an hnRNP A2-dependent manner. hnRNP E1 is colocalized with hnRNP A2 and A2RE mRNA in granules in dendrites of oligodendrocytes. Overexpression of hnRNP E1 or microinjection of exogenous hnRNP E1 in neural cells inhibits translation of A2RE mRNA, but not of non-A2RE RNA. Excess hnRNP E1 added to an in vitro translation system reduces translation efficiency of A2RE mRNA, but not of nonA2RE RNA, in an hnRNP A2-dependent manner. These results are consistent with a model where hnRNP E1 recruited to A2RE RNA granules by binding to hnRNP A2 inhibits translation of A2RE RNA during granule transport. PMID:16775011

  6. Characterization of an estrogen-responsive element implicated in regulation of the rainbow trout estrogen receptor gene.

    PubMed

    Le Dréan, Y; Lazennec, G; Kern, L; Saligaut, D; Pakdel, F; Valotaire, Y

    1995-08-01

    We previously reported that the expression of the rainbow trout estrogen receptor (rtER) gene is markedly increased by estradiol (E2). In this paper, we have used transient transfection assays with reporter plasmids expressing chloramphenicol acetyl transferase (CAT), linked to 5' flanking regions of the rtER gene promoter, to identify cis-elements responsible for E2 inducibility. Deletion analysis localized an estrogen-responsive element (ERE), at position +242, with one mutation on the first base compared with the consensus sequence. This element confers estrogen responsiveness to CAT reporter linked to both the herpes simplex virus thymidine kinase promoter and the homologous rtER promoter. Moreover, using a 0.2 kb fragment of the rtER promoter encompassing the ERE and the rtER DNA binding domain obtained from a bacterial expression system, DNase I footprinting experiments demonstrated a specific protection covering 20 bp (+240/+260) containing the ERE sequence. Based on these studies, we believe that this ERE sequence, identified in the rtER gene promoter, may be a major cis-acting element involved in the regulation of the gene by estrogen.

  7. Transcriptional activation of the Escherichia coli adaptive response gene aidB is mediated by binding of methylated Ada protein. Evidence for a new consensus sequence for Ada-binding sites.

    PubMed

    Landini, P; Volkert, M R

    1995-04-07

    The Escherichia coli aidB gene is part of the adaptive response to DNA methylation damage. Genes belonging to the adaptive response are positively regulated by the ada gene; the Ada protein acts as a transcriptional activator when methylated in one of its cysteine residues at position 69. Through DNaseI protection assays, we show that methylated Ada (meAda) is able to bind a DNA sequence between 40 and 60 base pairs upstream of the aidB transcriptional startpoint. Binding of meAda is necessary to activate transcription of the adaptive response genes; accordingly, in vitro transcription of aidB is dependent on the presence of meAda. Unmethylated Ada protein shows no protection against DNaseI digestion in the aidB promoter region nor does it promote aidB in vitro transcription. The aidB Ada-binding site shows only weak homology to the proposed consensus sequences for Ada-binding sites in E. coli (AAANNAA and AAAGCGCA) but shares a higher degree of similarity with the Ada-binding regions from other bacterial species, such as Salmonella typhimurium and Bacillus subtilis. Based on the comparison of five different Ada-dependent promoter regions, we suggest that a possible recognition sequence for meAda might be AATnnnnnnG-CAA. Higher concentrations of Ada are required for the binding of aidB than for the ada promoter, suggesting lower affinity of the protein for the aidB Ada-binding site. Common features in the Ada-binding regions of ada and aidB are a high A/T content, the presence of an inverted repeat structure, and their position relative to the transcriptional start site. We propose that these elements, in addition to the proposed recognition sequence, are important for binding of the Ada protein.

  8. Remission of Diabetes by Insulin Gene Therapy Using a Hepatocyte-specific and Glucose-responsive Synthetic Promoter

    PubMed Central

    Han, Jaeseok; McLane, Brienne; Kim, Eung-Hwi; Yoon, Ji-Won; Jun, Hee-Sook

    2011-01-01

    Efficient production of insulin in response to changes in glucose levels has been a major issue for insulin gene therapy to treat diabetes. To express target genes in response to glucose specifically in hepatocytes, we generated a synthetic promoter library containing hepatocyte nuclear factor-1, CAAT/enhancer-binding protein (C/EBP) response element, and glucose-response element. Combinations of these three cis-elements in 3-, 6-, or 9-element configurations were screened for transcriptional activity and then glucose responsiveness in vitro. The most effective promoter (SP23137) was selected for further study. Intravenous administration of a recombinant adenovirus expressing furin-cleavable rat insulin under control of the SP23137 promoter into streptozotocin (STZ)-induced diabetic mice resulted in normoglycemia, which was maintained for >30 days. Glucose tolerance tests showed that treated mice produced insulin in response to glucose and cleared exogenous glucose from the blood in a manner similar to nondiabetic control mice, although the clearance was somewhat delayed. Insulin expression was seen specifically in the liver and not in other organs. These observations indicate the potential of this synthetic, artificial promoter to regulate glucose-responsive insulin production and remit hyperglycemia, thus providing a new method of liver-directed insulin gene therapy for type 1 diabetes. PMID:21119621

  9. Remission of diabetes by insulin gene therapy using a hepatocyte-specific and glucose-responsive synthetic promoter.

    PubMed

    Han, Jaeseok; McLane, Brienne; Kim, Eung-Hwi; Yoon, Ji-Won; Jun, Hee-Sook

    2011-03-01

    Efficient production of insulin in response to changes in glucose levels has been a major issue for insulin gene therapy to treat diabetes. To express target genes in response to glucose specifically in hepatocytes, we generated a synthetic promoter library containing hepatocyte nuclear factor-1, CAAT/enhancer-binding protein (C/EBP) response element, and glucose-response element. Combinations of these three cis-elements in 3-, 6-, or 9-element configurations were screened for transcriptional activity and then glucose responsiveness in vitro. The most effective promoter (SP23137) was selected for further study. Intravenous administration of a recombinant adenovirus expressing furin-cleavable rat insulin under control of the SP23137 promoter into streptozotocin (STZ)-induced diabetic mice resulted in normoglycemia, which was maintained for >30 days. Glucose tolerance tests showed that treated mice produced insulin in response to glucose and cleared exogenous glucose from the blood in a manner similar to nondiabetic control mice, although the clearance was somewhat delayed. Insulin expression was seen specifically in the liver and not in other organs. These observations indicate the potential of this synthetic, artificial promoter to regulate glucose-responsive insulin production and remit hyperglycemia, thus providing a new method of liver-directed insulin gene therapy for type 1 diabetes.

  10. Characterization of carotenoid hydroxylase gene promoter in Haematococcus pluvialis.

    PubMed

    Meng, C X; Wei, W; Su, Z- L; Qin, S

    2006-10-01

    Astaxanthin, a high-value ketocarotenoid is mainly used in fish aquaculture. It also has potential in human health due to its higher antioxidant capacity than beta-carotene and vitamin E. The unicellular green alga Haematococcus pluvialis is known to accumulate astaxanthin in response to environmental stresses, such as high light intensity and salt stress. Carotenoid hydroxylase plays a key role in astaxanthin biosynthesis in H. pluvialis. In this paper, we report the characterization of a promoter-like region (-378 to -22 bp) of carotenoid hydroxylase gene by cloning, sequence analysis and functional verification of its 919 bp 5'-flanking region in H. pluvialis. The 5'-flanking region was characterized using micro-particle bombardment method and transient expression of LacZ reporter gene. Results of sequence analysis showed that the 5'-flanking region might have putative cis-acting elements, such as ABA (abscisic acid)-responsive element (ABRE), C-repeat/dehydration responsive element (C-repeat/DRE), ethylene-responsive element (ERE), heat-shock element (HSE), wound-responsive element (WUN-motif), gibberellin-responsive element (P-box), MYB-binding site (MBS) etc., except for typical TATA and CCAAT boxes. Results of 5' deletions construct and beta-galactosidase assays revealed that a highest promoter-like region might exist from -378 to -22 bp and some negative regulatory elements might lie in the region from -919 to -378 bp. Results of site-directed mutagenesis of a putative C-repeat/DRE and an ABRE-like motif in the promoter-like region (-378 to -22 bp) indicated that the putative C-repeat/DRE and ABRE-like motif might be important for expression of carotenoid hydroxylase gene.

  11. Genome-wide identification and characterization of Notch transcription complex-binding sequence paired sites in leukemia cells

    PubMed Central

    Severson, Eric; Arnett, Kelly L.; Wang, Hongfang; Zang, Chongzhi; Taing, Len; Liu, Hudan; Pear, Warren S.; Liu, X. Shirley; Blacklow, Stephen C.; Aster, Jon C.

    2018-01-01

    Notch transcription complexes (NTCs) drive target gene expression by binding to two distinct types of genomic response elements, NTC monomer-binding sites and sequence-paired sites (SPSs) that bind NTC dimers. SPSs are conserved and are linked to the Notch-responsiveness of a few genes, but their overall contribution to Notch-dependent gene regulation is unknown. To address this issue, we determined the DNA sequence requirements for NTC dimerization using a fluorescence resonance energy transfer (FRET) assay, and applied insights from these in vitro studies to Notch-“addicted” leukemia cells. We find that SPSs contribute to the regulation of approximately a third of direct Notch target genes. While originally described in promoters, SPSs are present mainly in long-range enhancers, including an enhancer containing a newly described SPS that regulates HES5. Our work provides a general method for identifying sequence-paired sites in genome-wide data sets and highlights the widespread role of NTC dimerization in Notch-transformed leukemia cells. PMID:28465412

  12. Conserved elements in the nanos3 3'UTR of olive flounder are responsible for the selective retention of RNA in germ cells.

    PubMed

    Li, Meijie; Tan, Xungang; Sui, Yulei; Jiao, Shuang; Wu, Zhihao; You, Feng

    2016-08-01

    In teleost fish, primordial germ cells (PGCs) are specified very early during embryogenesis and migrate to the site that gonads are formed. A previous study indicated that nanos3 is specifically expressed in PGCs, and the 3' untranslated region (UTR) of nanos3 is responsible for the localization of mRNA in these cells. In this study, we aimed to investigate the functional regions of nanos3 3'UTR in olive flounder using truncated and mutated nanos3 3'UTRs fused to chimeric RNAs and microinjected into fertilized zebrafish eggs. The results indicated that a 68-bp functional element in the nanos3 3'UTR of olive flounder played important roles in the protection and degradation of RNA. Within this element, a U-rich region was identified to be responsible for the protection of RNA in PGCs and two GCAC sites for the degradation of RNA in somatic cells. The first GCAC was located adjacently to the U-rich region and the second GCAC within the U-rich region. Overall, we concluded that the two GCACs were the binding sites of miR-430, a microRNA that suppresses translation, whereas the U-rich region was the binding site of Dnd, a protein that antagonizes the miR-430-mediated silencing of mRNA. Copyright © 2016 Elsevier Inc. All rights reserved.

  13. Reprogramming cellular events by poly(ADP-ribose)-binding proteins

    PubMed Central

    Pic, Émilie; Ethier, Chantal; Dawson, Ted M.; Dawson, Valina L.; Masson, Jean-Yves; Poirier, Guy G.; Gagné, Jean-Philippe

    2013-01-01

    Poly(ADP-ribosyl)ation is a posttranslational modification catalyzed by the poly(ADP-ribose) polymerases (PARPs). These enzymes covalently modify glutamic, aspartic and lysine amino acid side chains of acceptor proteins by the sequential addition of ADP-ribose (ADPr) units. The poly(ADP-ribose) (pADPr) polymers formed alter the physico-chemical characteristics of the substrate with functional consequences on its biological activities. Recently, non-covalent binding to pADPr has emerged as a key mechanism to modulate and coordinate several intracellular pathways including the DNA damage response, protein stability and cell death. In this review, we describe the basis of non-covalent binding to pADPr that has led to the emerging concept of pADPr-responsive signaling pathways. This review emphasizes the structural elements and the modular strategies developed by pADPr-binding proteins to exert a fine-tuned control of a variety of pathways. Poly(ADP-ribosyl)ation reactions are highly regulated processes, both spatially and temporally, for which at least four specialized pADPr-binding modules accommodate different pADPr structures and reprogram protein functions. In this review, we highlight the role of well-characterized and newly discovered pADPr-binding modules in a diverse set of physiological functions. PMID:23268355

  14. SnoN co-repressor binds and represses smad7 gene promoter.

    PubMed

    Briones-Orta, Marco A; Sosa-Garrocho, Marcela; Moreno-Alvarez, Paola; Fonseca-Sánchez, Miguel A; Macías-Silva, Marina

    2006-03-17

    SnoN and Ski oncoproteins are co-repressors for Smad proteins and repress TGF-beta-responsive gene expression. The smad7 gene is a TGF-beta target induced by Smad signaling, and its promoter contains the Smad-binding element (SBE) required for a positive regulation by the TGF-beta/Smad pathway. SnoN and Ski co-repressors also bind SBE but regulate negatively smad7 gene. Ski along with Smad4 binds and represses the smad7 promoter, whereas the repression mechanism by SnoN is not clear. Ski and SnoN overexpression inhibits smad7 reporter expression induced through TGF-beta signaling. Using chromatin immunoprecipitation assays, we found that SnoN binds smad7 promoter at the basal condition, whereas after a short TGF-beta treatment for 15-30 min SnoN is downregulated and no longer bound smad7 promoter. Interestingly, after a prolonged TGF-beta treatment SnoN is upregulated and returns to its position on the smad7 promoter, functioning probably as a negative feedback control. Thus, SnoN also seems to regulate negatively the TGF-beta-responsive smad7 gene by binding and repressing its promoter in a similar way to Ski.

  15. A distal ABA responsive element in AtNCED3 promoter is required for positive feedback regulation of ABA biosynthesis in Arabidopsis.

    PubMed

    Yang, Yan-Zhuo; Tan, Bao-Cai

    2014-01-01

    The plant hormone abscisic acid (ABA) plays a crucial role in plant development and responses to abiotic stresses. Recent studies indicate that a positive feedback regulation by ABA exists in ABA biosynthesis in plants under dehydration stress. To understand the molecular basis of this regulation, we analyzed the cis-elements of the AtNCED3 promoter in Arabidopsis. AtNCED3 encodes the first committed and highly regulated dioxygenase in the ABA biosynthetic pathway. Through delineated and mutagenesis analyses in stable-transformed Arabidopsis, we revealed that a distal ABA responsive element (ABRE: GGCACGTG, -2372 to -2364 bp) is required for ABA-induced AtNCED3 expression. By analyzing the AtNCED3 expression in ABRE binding protein ABF3 over-expression transgenic plants and knock-out mutants, we provide evidence that the ABA feedback regulation of AtNCED3 expression is not mediated by ABF3.

  16. Concerted formation of macromolecular Suppressor–mutator transposition complexes

    PubMed Central

    Raina, Ramesh; Schläppi, Michael; Karunanandaa, Balasulojini; Elhofy, Adam; Fedoroff, Nina

    1998-01-01

    Transposition of the maize Suppressor–mutator (Spm) transposon requires two element-encoded proteins, TnpA and TnpD. Although there are multiple TnpA binding sites near each element end, binding of TnpA to DNA is not cooperative, and the binding affinity is not markedly affected by the number of binding sites per DNA fragment. However, intermolecular complexes form cooperatively between DNA fragments with three or more TnpA binding sites. TnpD, itself not a sequence-specific DNA-binding protein, binds to TnpA and stabilizes the TnpA–DNA complex. The high redundancy of TnpA binding sites at both element ends and the protein–protein interactions between DNA-bound TnpA complexes and between these and TnpD imply a concerted transition of the element from a linear to a protein crosslinked transposition complex within a very narrow protein concentration range. PMID:9671711

  17. Integration of growth factor signals at the c-fos serum response element.

    PubMed

    Price, M A; Hill, C; Treisman, R

    1996-04-29

    A transcription factor ternary complex composed of serum response factor (SRF) and a second factor, ternary complex factor (TCF), mediates the response of the c-fos Serum Response Element to growth factors and mitogens. In NIH3T3 fibroblasts, TCF binding is required for transcriptional activation by the SRE in response to activation of the Ras-Raf-ERK pathway. We compared the properties of three members of the TCF family, Elk-1, SAP-1 and SAP-2 (ERP/NET). Although all the proteins contain sequences required for ternary complex formation with SRF, only Elk-1 and SAP-1 appear to interact with the c-fos SRE efficiently in vivo. Each TCF contains a C-terminal activation domain capable of transcriptional activation in response to activation of the Ras-Raf-ERK pathway, and this is dependent on the integrity of S/T-P motifs conserved between all the TCF family members. In contrast, activation of the SRE by whole serum and the mitogenic phospholipid LPA requires SRF binding alone. Constitutively activated members of the Rho subfamily of Ras-like GTPases are also capable of inducing activation of the SRE in the absence of TCF; unlike activated Ras itself, these proteins do not activate the TCFs in NIH3T3 cells. At the SRE, SRF- and TCF-linked signalling pathways act synergistically to potentiate transcription.

  18. Cis-regulatory element based targeted gene finding: genome-wide identification of abscisic acid- and abiotic stress-responsive genes in Arabidopsis thaliana.

    PubMed

    Zhang, Weixiong; Ruan, Jianhua; Ho, Tuan-Hua David; You, Youngsook; Yu, Taotao; Quatrano, Ralph S

    2005-07-15

    A fundamental problem of computational genomics is identifying the genes that respond to certain endogenous cues and environmental stimuli. This problem can be referred to as targeted gene finding. Since gene regulation is mainly determined by the binding of transcription factors and cis-regulatory DNA sequences, most existing gene annotation methods, which exploit the conservation of open reading frames, are not effective in finding target genes. A viable approach to targeted gene finding is to exploit the cis-regulatory elements that are known to be responsible for the transcription of target genes. Given such cis-elements, putative target genes whose promoters contain the elements can be identified. As a case study, we apply the above approach to predict the genes in model plant Arabidopsis thaliana which are inducible by a phytohormone, abscisic acid (ABA), and abiotic stress, such as drought, cold and salinity. We first construct and analyze two ABA specific cis-elements, ABA-responsive element (ABRE) and its coupling element (CE), in A.thaliana, based on their conservation in rice and other cereal plants. We then use the ABRE-CE module to identify putative ABA-responsive genes in A.thaliana. Based on RT-PCR verification and the results from literature, this method has an accuracy rate of 67.5% for the top 40 predictions. The cis-element based targeted gene finding approach is expected to be widely applicable since a large number of cis-elements in many species are available.

  19. c-Ski inhibits the TGF-beta signaling pathway through stabilization of inactive Smad complexes on Smad-binding elements.

    PubMed

    Suzuki, Hiroyuki; Yagi, Ken; Kondo, Miki; Kato, Mitsuyasu; Miyazono, Kohei; Miyazawa, Keiji

    2004-06-24

    c-Ski inhibits transforming growth factor-beta (TGF-beta) signaling through interaction with Smad proteins. c-Ski represses Smad-mediated transcriptional activation, probably through its action as a transcriptional co-repressor. c-Ski also inhibits TGF-beta-induced downregulation of genes such as c-myc. However, mechanisms for transcriptional regulation of target genes by c-Ski have not been fully determined. In this study, we examined how c-Ski inhibits both TGF-beta-induced transcriptional activation and repression. DNA-affinity precipitation analysis revealed that c-Ski enhances the binding of Smad2 and 4, and to a lesser extent Smad3, to both CAGA and TGF-beta1 inhibitory element probes. A c-Ski mutant, which is unable to interact with Smad4, failed to enhance the binding of Smad complex on these probes and to inhibit the Smad-responsive promoter. These results suggest that stabilization of inactive Smad complexes on DNA is a critical event in c-Ski-mediated inhibition of TGF-beta signaling.

  20. Sinensetin enhances adipogenesis and lipolysis by increasing cyclic adenosine monophosphate levels in 3T3-L1 adipocytes.

    PubMed

    Kang, Seong-Il; Shin, Hye-Sun; Kim, Se-Jae

    2015-01-01

    Sinensetin is a rare polymethoxylated flavone (PMF) found in certain citrus fruits. In this study, we investigated the effects of sinensetin on lipid metabolism in 3T3-L1 cells. Sinensetin promoted adipogenesis in 3T3-L1 preadipocytes growing in incomplete differentiation medium, which did not contain 3-isobutyl-1-methylxanthine. Sinensetin up-regulated expression of the adipogenic transcription factors peroxisome proliferator-activated receptor γ, CCAAT/enhancer-binding protein (C/EBP) α, and sterol regulatory element-binding protein 1c. It also potentiated expression of C/EBPβ and activation of cAMP-responsive element-binding protein. Sinensetin enhanced activation of protein kinase A and increased intracellular cAMP levels in 3T3-L1 preadipocytes. In mature 3T3-L1 adipocytes, sinensetin stimulated lipolysis via a cAMP pathway. Taken together, these results suggest that sinensetin enhances adipogenesis and lipolysis by increasing cAMP levels in adipocytes.

  1. Transcription factor trapping by RNA in gene regulatory elements.

    PubMed

    Sigova, Alla A; Abraham, Brian J; Ji, Xiong; Molinie, Benoit; Hannett, Nancy M; Guo, Yang Eric; Jangi, Mohini; Giallourakis, Cosmas C; Sharp, Phillip A; Young, Richard A

    2015-11-20

    Transcription factors (TFs) bind specific sequences in promoter-proximal and -distal DNA elements to regulate gene transcription. RNA is transcribed from both of these DNA elements, and some DNA binding TFs bind RNA. Hence, RNA transcribed from regulatory elements may contribute to stable TF occupancy at these sites. We show that the ubiquitously expressed TF Yin-Yang 1 (YY1) binds to both gene regulatory elements and their associated RNA species across the entire genome. Reduced transcription of regulatory elements diminishes YY1 occupancy, whereas artificial tethering of RNA enhances YY1 occupancy at these elements. We propose that RNA makes a modest but important contribution to the maintenance of certain TFs at gene regulatory elements and suggest that transcription of regulatory elements produces a positive-feedback loop that contributes to the stability of gene expression programs. Copyright © 2015, American Association for the Advancement of Science.

  2. Transcriptional regulation of miR-15b by c-Rel and CREB in Japanese encephalitis virus infection

    PubMed Central

    Zhu, Bibo; Ye, Jing; Ashraf, Usama; Li, Yunchuan; Chen, Huanchun; Song, Yunfeng; Cao, Shengbo

    2016-01-01

    MicroRNAs (miRNAs) have been well known to play diverse roles in viral infection at the level of posttranscriptional repression. However, much less is understood about the mechanism by which miRNAs are regulated during viral infection. It is likely that both host and virus contain factors to modulate miRNA expression. Here we report the up-regulation of microRNA-15b (miR-15b) in vitro upon infection with Japanese encephalitis virus (JEV). Analysis of miR-15b precursor, pri-miR-15b and pre-miR-15b, suggest that the regulation occurs transcriptionally. Further, we identified the transcriptional regulatory region of miR-15b that contains consensus binding motif for NF-κB subunit c-Rel and cAMP-response element binding protein (CREB), which are known as transcription factor to regulate gene expression. By promoter fusion and mutational analyses, we demonstrated that c-Rel and CREB bind directly to the promoter elements of miR-15b, which are responsible for miR-15b transcription in response to JEV infection. Finally, we showed that pharmacological inhibition of ERK and NF-κB signaling pathway blocked induction of miR-15b in JEV infection, suggesting important roles of ERK and NF-κB pathway in the regulation of miR-15b gene. Therefore, our observations indicate that induced expression of miR-15b is modulated by c-Rel and CREB in response to JEV infection. PMID:26931521

  3. [Receptor elements for biosensors in two ways of methylotrophic yeast immobilization].

    PubMed

    Zaĭtsev, M G; Arliapov, V A; Alferov, V A; Reshetilov, A N

    2012-01-01

    Receptor elements for biosensors based on Hansenula polymorpha NCYC 495 In yeast cells for ethanol assay were developed using two ways of cell immobilization, i.e., physical adsorption on a glass fiber membrane and covalent binding on a modified nitrocellulose membrane. The linear diapason of ethanol assays for a biosensor based on yeast cells adsorbed on glass fiber was 0.05-1.18; for a biosensor based on yeasts immobilized on a nitrocellulose membrane, 0.2-1.53 mM. Receptor elements based on sorbed cells possessed 2.5 times higher long-term stability. The time response was 1.5 times less for cells immobilized using DEAE-dextran and benzochinone. The results of ethyl alcohol assays using biosensors based on cells immobilized via adsorption and covalent binding, as well as using the standard areometric method, had high correlation coefficients (0.998 and 0.997, respectively, for the two ways of immobilization). The results indicate the possibility to consider the described models of receptor elements for biosensors as prototypes for experimental samples for practical use.

  4. Small Molecule Inhibition of cAMP Response Element Binding Protein in Human Acute Myeloid Leukemia Cells

    PubMed Central

    Mitton, Bryan; Chae, Hee-Don; Hsu, Katie; Dutta, Ritika; Aldana-Masangkay, Grace; Ferrari, Roberto; Davis, Kara; Tiu, Bruce C.; Kaul, Arya; Lacayo, Norman; Dahl, Gary; Xie, Fuchun; Li, Bingbing X.; Breese, Marcus R.; Landaw, Elliot M.; Nolan, Garry; Pellegrini, Matteo; Romanov, Sergei; Xiao, Xiangshu; Sakamoto, Kathleen M.

    2016-01-01

    The transcription factor CREB (cAMP Response Element Binding Protein) is overexpressed in the majority of acute myeloid leukemia (AML) patients, and this is associated with a worse prognosis. Previous work revealed that CREB overexpression augmented AML cell growth, while CREB knockdown disrupted key AML cell functions in vitro. In contrast, CREB knockdown had no effect on long-term hematopoietic stem cell activity in mouse transduction/transplantation assays. Together, these studies position CREB as a promising drug target for AML. To test this concept, a small molecule inhibitor of CREB, XX-650-23, was developed. This molecule blocks a critical interaction between CREB and its required co-activator CBP (CREB Binding Protein), leading to disruption of CREB-driven gene expression. Inhibition of CBP-CREB interaction induced apoptosis and cell cycle arrest in AML cells, and prolonged survival in vivo in mice injected with human AML cells. XX-650-23 had little toxicity on normal human hematopoietic cells and tissues in mice. To understand the mechanism of XX-650-23, we performed RNA-seq, ChIP-seq and Cytometry Time of Flight with human AML cells. Our results demonstrate that small molecule inhibition of CBP-CREB interaction mostly affects apoptotic, cell cycle, and survival pathways, which may represent a novel approach for AML therapy. PMID:27211267

  5. Arabidopsis DREB2C modulates ABA biosynthesis during germination.

    PubMed

    Je, Jihyun; Chen, Huan; Song, Chieun; Lim, Chae Oh

    2014-09-12

    Plant dehydration-responsive element binding factors (DREBs) are transcriptional regulators of the APETELA2/Ethylene Responsive element-binding Factor (AP2/ERF) family that control expression of abiotic stress-related genes. We show here that under conditions of mild heat stress, constitutive overexpression seeds of transgenic DREB2C overexpression Arabidopsis exhibit delayed germination and increased abscisic acid (ABA) content compared to untransformed wild-type (WT). Treatment with fluridone, an inhibitor of the ABA biosynthesis abrogated these effects. Expression of an ABA biosynthesis-related gene, 9-cis-epoxycarotenoid dioxygenase 9 (NCED9) was up-regulated in the DREB2C overexpression lines compared to WT. DREB2C was able to trans-activate expression of NCED9 in Arabidopsis leaf protoplasts in vitro. Direct and specific binding of DREB2C to a complete DRE on the NCED9 promoter was observed in electrophoretic mobility shift assays. Exogenous ABA treatment induced DREB2C expression in germinating seeds of WT. Vegetative growth of transgenic DREB2C overexpression lines was more strongly inhibited by exogenous ABA compared to WT. These results suggest that DREB2C is a stress- and ABA-inducible gene that acts as a positive regulator of ABA biosynthesis in germinating seeds through activating NCED9 expression. Copyright © 2014 Elsevier Inc. All rights reserved.

  6. Human T-cell leukemia virus type 1 Tax requires direct access to DNA for recruitment of CREB binding protein to the viral promoter.

    PubMed

    Lenzmeier, B A; Giebler, H A; Nyborg, J K

    1998-02-01

    Efficient human T-cell leukemia virus type 1 (HTLV-1) replication and viral gene expression are dependent upon the virally encoded oncoprotein Tax. To activate HTLV-1 transcription, Tax interacts with the cellular DNA binding protein cyclic AMP-responsive element binding protein (CREB) and recruits the coactivator CREB binding protein (CBP), forming a nucleoprotein complex on the three viral cyclic AMP-responsive elements (CREs) in the HTLV-1 promoter. Short stretches of dG-dC-rich (GC-rich) DNA, immediately flanking each of the viral CREs, are essential for Tax recruitment of CBP in vitro and Tax transactivation in vivo. Although the importance of the viral CRE-flanking sequences is well established, several studies have failed to identify an interaction between Tax and the DNA. The mechanistic role of the viral CRE-flanking sequences has therefore remained enigmatic. In this study, we used high resolution methidiumpropyl-EDTA iron(II) footprinting to show that Tax extended the CREB footprint into the GC-rich DNA flanking sequences of the viral CRE. The Tax-CREB footprint was enhanced but not extended by the KIX domain of CBP, suggesting that the coactivator increased the stability of the nucleoprotein complex. Conversely, the footprint pattern of CREB on a cellular CRE lacking GC-rich flanking sequences did not change in the presence of Tax or Tax plus KIX. The minor-groove DNA binding drug chromomycin A3 bound to the GC-rich flanking sequences and inhibited the association of Tax and the Tax-CBP complex without affecting CREB binding. Tax specifically cross-linked to the viral CRE in the 5'-flanking sequence, and this cross-link was blocked by chromomycin A3. Together, these data support a model where Tax interacts directly with both CREB and the minor-groove viral CRE-flanking sequences to form a high-affinity binding site for the recruitment of CBP to the HTLV-1 promoter.

  7. Molecular Determinants of Magnolol Targeting Both RXRα and PPARγ

    PubMed Central

    Chen, Lili; Chen, Jing; Hu, Lihong; Jiang, Hualiang; Shen, Xu

    2011-01-01

    Nuclear receptors retinoic X receptor α (RXRα) and peroxisome proliferator activated receptor γ (PPARγ) function potently in metabolic diseases, and are both important targets for anti-diabetic drugs. Coactivation of RXRα and PPARγ is believed to synergize their effects on glucose and lipid metabolism. Here we identify the natural product magnolol as a dual agonist targeting both RXRα and PPARγ. Magnolol was previously reported to enhance adipocyte differentiation and glucose uptake, ameliorate blood glucose level and prevent development of diabetic nephropathy. Although magnolol can bind and activate both of these two nuclear receptors, the transactivation assays indicate that magnolol exhibits biased agonism on the transcription of PPAR-response element (PPRE) mediated by RXRα:PPARγ heterodimer, instead of RXR-response element (RXRE) mediated by RXRα:RXRα homodimer. To further elucidate the molecular basis for magnolol agonism, we determine both the co-crystal structures of RXRα and PPARγ ligand-binding domains (LBDs) with magnolol. Structural analyses reveal that magnolol adopts its two 5-allyl-2-hydroxyphenyl moieties occupying the acidic and hydrophobic cavities of RXRα L-shaped ligand-binding pocket, respectively. While, two magnolol molecules cooperatively accommodate into PPARγ Y-shaped ligand-binding pocket. Based on these two complex structures, the key interactions for magnolol activating RXRα and PPARγ are determined. As the first report on the dual agonist targeting RXRα and PPARγ with receptor-ligand complex structures, our results are thus expected to help inspect the potential pharmacological mechanism for magnolol functions, and supply useful hits for nuclear receptor multi-target ligand design. PMID:22140563

  8. Zinc deficiency-induced iron accumulation, a consequence of alterations in iron regulatory protein-binding activity, iron transporters, and iron storage proteins.

    PubMed

    Niles, Brad J; Clegg, Michael S; Hanna, Lynn A; Chou, Susan S; Momma, Tony Y; Hong, Heeok; Keen, Carl L

    2008-02-22

    One consequence of zinc deficiency is an elevation in cell and tissue iron concentrations. To examine the mechanism(s) underlying this phenomenon, Swiss 3T3 cells were cultured in zinc-deficient (D, 0.5 microM zinc), zinc-supplemented (S, 50 microM zinc), or control (C, 4 microM zinc) media. After 24 h of culture, cells in the D group were characterized by a 50% decrease in intracellular zinc and a 35% increase in intracellular iron relative to cells in the S and C groups. The increase in cellular iron was associated with increased transferrin receptor 1 protein and mRNA levels and increased ferritin light chain expression. The divalent metal transporter 1(+)iron-responsive element isoform mRNA was decreased during zinc deficiency-induced iron accumulation. Examination of zinc-deficient cells revealed increased binding of iron regulatory protein 2 (IRP2) and decreased binding of IRP1 to a consensus iron-responsive element. The increased IRP2-binding activity in zinc-deficient cells coincided with an increased level of IRP2 protein. The accumulation of IRP2 protein was independent of zinc deficiency-induced intracellular nitric oxide production but was attenuated by the addition of the antioxidant N-acetylcysteine or ascorbate to the D medium. These data support the concept that zinc deficiency can result in alterations in iron transporter, storage, and regulatory proteins, which facilitate iron accumulation.

  9. Removal of a putative inhibitory element reduces the calcium-dependent calmodulin activation of neuronal nitric-oxide synthase.

    PubMed

    Montgomery, H J; Romanov, V; Guillemette, J G

    2000-02-18

    Neuronal nitric-oxide synthase (NOS) and endothelial NOS are constitutive NOS isoforms that are activated by binding calmodulin in response to elevated intracellular calcium. In contrast, the inducible NOS isoform binds calmodulin at low basal levels of calcium in resting cells. Primary sequence comparisons show that each constitutive NOS isozyme contains a polypeptide segment within its reductase domain, which is absent in the inducible NOS enzyme. To study a possible link between the presence of these additional polypeptide segments in constitutive NOS enzymes and their calcium-dependent calmodulin activation, three deletion mutants were created. The putative inhibitory insert was removed from the FMN binding regions of the neuronal NOS holoenzyme and from two truncated neuronal NOS reductase enzymes in which the calmodulin binding region was either included or deleted. All three mutant enzymes showed reduced incorporation of FMN and required reconstitution with exogenous FMN for activity. The combined removal of both the calmodulin binding domain and the putative inhibitory insert did not result in a calmodulin-independent neuronal NOS reductase. Thus, although the putative inhibitory element has an effect on the calcium-dependent calmodulin activation of neuronal NOS, it does not have the properties of the typical autoinhibitory domain found in calmodulin-activated enzymes.

  10. Dephosphorylation of HuR Protein during Alphavirus Infection Is Associated with HuR Relocalization to the Cytoplasm*

    PubMed Central

    Dickson, Alexa M.; Anderson, John R.; Barnhart, Michael D.; Sokoloski, Kevin J.; Oko, Lauren; Opyrchal, Mateusz; Galanis, Evanthia; Wilusz, Carol J.; Morrison, Thomas E.; Wilusz, Jeffrey

    2012-01-01

    We have demonstrated previously that the cellular HuR protein binds U-rich elements in the 3′ untranslated region (UTR) of Sindbis virus RNA and relocalizes from the nucleus to the cytoplasm upon Sindbis virus infection in 293T cells. In this study, we show that two alphaviruses, Ross River virus and Chikungunya virus, lack the conserved high-affinity U-rich HuR binding element in their 3′ UTRs but still maintain the ability to interact with HuR with nanomolar affinities through alternative binding elements. The relocalization of HuR protein occurs during Sindbis infection of multiple mammalian cell types as well as during infections with three other alphaviruses. Interestingly, the relocalization of HuR is not a general cellular reaction to viral infection, as HuR protein remained largely nuclear during infections with dengue and measles virus. Relocalization of HuR in a Sindbis infection required viral gene expression, was independent of the presence of a high-affinity U-rich HuR binding site in the 3′ UTR of the virus, and was associated with an alteration in the phosphorylation state of HuR. Sindbis virus-induced HuR relocalization was mechanistically distinct from the movement of HuR observed during a cellular stress response, as there was no accumulation of caspase-mediated HuR cleavage products. Collectively, these data indicate that virus-induced HuR relocalization to the cytoplasm is specific to alphavirus infections and is associated with distinct posttranslational modifications of this RNA-binding protein. PMID:22915590

  11. The transcription factor DREAM represses A20 and mediates inflammation

    PubMed Central

    Tiruppathi, Chinnaswamy; Soni, Dheeraj; Wang, Dong-Mei; Xue, Jiaping; Singh, Vandana; Thippegowda, Prabhakar B.; Cheppudira, Bopaiah P.; Mishra, Rakesh K.; DebRoy, Auditi; Qian, Zhijian; Bachmaier, Kurt; Zhao, Youyang; Christman, John W.; Vogel, Stephen M.; Ma, Averil; Malik, Asrar B.

    2014-01-01

    Here we show that the transcription-repressor DREAM binds to the A20 promoter to repress the expression of A20, the deubiquitinase suppressing inflammatory NF-κB signaling. DREAM-deficient (Dream−/−) mice displayed persistent and unchecked A20 expression in response to endotoxin. DREAM functioned by transcriptionally repressing A20 through binding to downstream regulatory elements (DREs). In contrast, USF1 binding to the DRE-associated E-box domain activated A20 expression in response to inflammatory stimuli. These studies define the critical opposing functions of DREAM and USF1 in inhibiting and inducing A20 expression, respectively, and thereby the strength of NF-κB signaling. Targeting of DREAM to induce USF1-mediated A20 expression is therefore a potential anti-inflammatory strategy in diseases such as acute lung injury associated with unconstrained NF-κB activity. PMID:24487321

  12. Novel cAMP binding protein-BP (CREBBP) mutation in a girl with Rubinstein-Taybi syndrome, GH deficiency, Arnold Chiari malformation and pituitary hypoplasia

    PubMed Central

    2013-01-01

    Background Rubinstein-Taybi syndrome (RTS) is a rare autosomal dominant disorder (prevalence 1:125,000) characterised by broad thumbs and halluces, facial dysmorphism, psychomotor development delay, skeletal defects, abnormalities in the posterior fossa and short stature. The known genetic causes are point mutations or deletions of the cAMP-response element binding protein-BP (CREBBP) (50-60% of the cases) and of the homologous gene E1A-binding protein (EP300) (5%). Case presentation We describe, for the first time in literature, a RTS Caucasian girl, 14-year-old, with growth hormone (GH) deficiency, pituitary hypoplasia, Arnold Chiari malformation type 1, double syringomyelic cavity and a novel CREBBP mutation (c.3546insCC). Conclusion We hypothesize that CREBBP mutation we have identified in this patient could be responsible also for RTS atypical features as GH deficiency and pituitary hypoplasia. PMID:23432975

  13. Deoxycholate-Enhanced Shigella Virulence Is Regulated by a Rare π-Helix in the Type Three Secretion System Tip Protein IpaD.

    PubMed

    Bernard, Abram R; Jessop, T Carson; Kumar, Prashant; Dickenson, Nicholas E

    2017-12-12

    Type three secretion systems (T3SS) are specialized nanomachines that support infection by injecting bacterial proteins directly into host cells. The Shigella T3SS has uniquely evolved to sense environmental levels of the bile salt deoxycholate (DOC) and upregulate virulence in response to DOC. In this study, we describe a rare i + 5 hydrogen bonding secondary structure element (π-helix) within the type three secretion system tip protein IpaD that plays a critical role in DOC-enhanced virulence. Specifically, engineered mutations within the π-helix altered the pathogen's response to DOC, with one mutant construct in particular exhibiting an unprecedented reduction in virulence following DOC exposure. Fluorescence polarization binding assays showed that these altered DOC responses are not the result of differences in affinity between IpaD and DOC, but rather differences in the DOC-dependent T3SS tip maturation resulting from binding of IpaD to translocator/effector protein IpaB. Together, these findings begin to uncover the complex mechanism of DOC-enhanced Shigella virulence while identifying an uncommon structural element that may provide a much needed target for non-antibiotic treatment of Shigella infection.

  14. Responses of plant calmodulin to endocytosis induced by rare earth elements.

    PubMed

    Wang, Lihong; Cheng, Mengzhu; Chu, Yunxia; Li, Xiaodong; Chen, David D Y; Huang, Xiaohua; Zhou, Qing

    2016-07-01

    The wide application of rare earth elements (REEs) have led to their diffusion and accumulation in the environment. The activation of endocytosis is the primary response of plant cells to REEs. Calmodulin (CaM), as an important substance in calcium (Ca) signaling systems, regulating almost all of the physiological activities in plants, such as cellular metabolism, cell growth and division. However, the response of CaM to endocytosis activated by REEs remains unknown. By using immunofluorescence labeling and a confocal laser scanning microscope, we found that trivalent lanthanum [La(III)], an REE ion, affected the expression of CaM in endocytosis. Using circular dichroism, X-ray photoelectron spectroscopy and computer simulations, we demonstrated that a low concentration of La(III) could interact with extracellular CaM by electrostatic attraction and was then bound to two Ca-binding sites of CaM, making the molecular structure more compact and orderly, whereas a high concentration of La(III) could be coordinated with cytoplasmic CaM or bound to other Ca-binding sites, making the molecular structure more loose and disorderly. Our results provide a reference for revealing the action mechanisms of REEs in plant cells. Copyright © 2016 Elsevier Ltd. All rights reserved.

  15. Molecular Mechanotransduction: how forces trigger cytoskeletal dynamics

    NASA Astrophysics Data System (ADS)

    Ehrlicher, Allen

    2012-02-01

    Mechanical stresses elicit cellular reactions mediated by chemical signals. Defective responses to forces underlie human medical disorders, such as cardiac failure and pulmonary injury. Despite detailed knowledge of the cytoskeleton's structure, the specific molecular switches that convert mechanical stimuli into chemical signals have remained elusive. Here we identify the actin-binding protein, filamin A (FLNa) as a central mechanotransduction element of the cytoskeleton by using Fluorescence Loss After photoConversion (FLAC), a novel high-speed alternative to FRAP. We reconstituted a minimal system consisting of actin filaments, FLNa and two FLNa-binding partners: the cytoplasmic tail of ß-integrin, and FilGAP. Integrins form an essential mechanical linkage between extracellular and intracellular environments, with ß integrin tails connecting to the actin cytoskeleton by binding directly to filamin. FilGAP is a FLNa-binding GTPase-activating protein specific for Rac, which in vivo regulates cell spreading and bleb formation. We demonstrate that both externally-imposed bulk shear and myosin II driven forces differentially regulate the binding of integrin and FilGAP to FLNa. Consistent with structural predictions, strain increases ß-integrin binding to FLNa, whereas it causes FilGAP to dissociate from FLNa, providing a direct and specific molecular basis for cellular mechanotransduction. These results identify the first molecular mechanotransduction element within the actin cytoskeleton, revealing that mechanical strain of key proteins regulates the binding of signaling molecules. Moreover, GAP activity has been shown to switch cell movement from mesenchymal to amoeboid motility, suggesting that mechanical forces directly impact the invasiveness of cancer.

  16. The DEK oncogene activates VEGF expression and promotes tumor angiogenesis and growth in HIF-1α-dependent and -independent manners

    PubMed Central

    Li, Yang; Lv, Zhaohui; Zhu, Jie; Lin, Jing; Ding, Lihua; Ye, Qinong

    2016-01-01

    The DEK oncogene is overexpressed in various cancers and overexpression of DEK correlates with poor clinical outcome. Vascular endothelial growth factor (VEGF) is the most important regulator of tumor angiogenesis, a process essential for tumor growth and metastasis. However, whether DEK enhances tumor angiogenesis remains unclear. Here, we show that DEK is a key regulator of VEGF expression and tumor angiogenesis. Using chromatin immunoprecipitation assay, we found that DEK promoted VEGF transcription in breast cancer cells (MCF7, ZR75-1 and MDA-MB-231) by directly binding to putative DEK-responsive element (DRE) of the VEGF promoter and indirectly binding to hypoxia response element (HRE) upstream of the DRE through its interaction with the transcription factor hypoxia-inducible factor 1α (HIF-1α), a master regulator of tumor angiogenesis and growth. DEK is responsible for recruitment of HIF-1α and the histone acetyltransferase p300 to the VEGF promoter. DEK-enhanced VEGF increases vascular endothelial cell proliferation, migration and tube formation as well as angiogenesis in the chick chorioallantoic membrane. DEK promotes tumor angiogenesis and growth in nude mice in HIF-1α-dependent and -independent manners. Immunohistochemical staining showed that DEK expression positively correlates with the expression of VEGF and microvessel number in 58 breast cancer patients. Our data establish DEK as a sequence-specific binding transcription factor, a novel coactivator for HIF-1α in regulation of VEGF transcription and a novel promoter of angiogenesis. PMID:26988756

  17. Ectopic Overexpression of SsCBF1, a CRT/DRE-Binding Factor from the Nightshade Plant Solanum lycopersicoides, Confers Freezing and Salt Tolerance in Transgenic Arabidopsis

    PubMed Central

    Zhang, Lili; Li, Zhenjun; Li, Jingfu; Wang, Aoxue

    2013-01-01

    The C-repeat (CRT)/dehydration-responsive element (DRE) binding factor (CBF/DREB1) transcription factors play a key role in cold response. However, the detailed roles of many plant CBFs are far from fully understood. A CBF gene (SsCBF1) was isolated from the cold-hardy plant Solanum lycopersicoides. A subcellular localization study using GFP fusion protein indicated that SsCBF1 is localized in the nucleus. We delimited the SsCBF1 transcriptional activation domain to the C-terminal segment comprising amino acid residues 193–228 (SsCBF1193–228). The expression of SsCBF1 could be dramatically induced by cold, drought and high salinity. Transactivation assays in tobacco leaves revealed that SsCBF1 could specifically bind to the CRT cis-elements in vivo to activate the expression of downstream reporter genes. The ectopic overexpression of SsCBF1 conferred increased freezing and high-salinity tolerance and late flowering phenotype to transgenic Arabidopsis. RNA-sequencing data exhibited that a set of cold and salt stress responsive genes were up-regulated in transgenic Arabidopsis. Our results suggest that SsCBF1 behaves as a typical CBF to contribute to plant freezing tolerance. Increased resistance to high-salinity and late flowering phenotype derived from SsCBF1 OE lines lend more credence to the hypothesis that plant CBFs participate in diverse physiological and biochemical processes related to adverse conditions. PMID:23755095

  18. Glucose Sensors Based on Microcapsules Containing an Orange/Red Competitive Binding Resonance Energy Transfer Assay

    PubMed Central

    CHINNAYELKA, SWETHA; McSHANE, and MICHAEL J.

    2015-01-01

    Fluorescent sensing systems offer the potential for noninvasive monitoring with implantable devices, but they require carrier technologies that provide suitable immobilization, accessibility, and biocompatibility while maintaining adequate response characteristics. A recent development towards this goal is a highly specific and sensitive competitive binding assay for glucose using apo-glucose oxidase (apo-GOx) as the recognition element and dextran as the competing ligand; this has been demonstrated as a glucose sensor system by encapsulating the competitive binding assay in semipermeable microcapsule carriers. This paper describes the extension of this sensor design to longer wavelengths in an attempt to increase the applicability to in vivo monitoring. The glucose sensitivity of the tetramethylrhodamine isothiocyanate-dextran (TD) and cyanine Cy5-apo-GOx (CAG) complexes showed five to 10 times greater specificity for β-D-glucose over other sugars. Microcapsules loaded with TD/CAG complexes exhibited a linear, totally reversible response in the range of 0–720 mg/dL, with a sensitivity (percent change in intensity ratio) of 0.06%/(mg/dL). The decrease in sensitivity observed with the use of longer-wavelength dyes is most likely to be compensated with the deeper penetration of light and reduced tissue scattering. These findings imply that the encapsulation of sensing assay elements in microcapsules is a simple and translatable method for the fabrication of stable biosensors, and optimization of resonance energy transfer pairs and assay component preparation will further improve the response to approach clinically relevant performance. PMID:16800748

  19. Sex change strategy and the aromatase genes.

    PubMed

    Gardner, L; Anderson, T; Place, A R; Dixon, B; Elizur, A

    2005-04-01

    Sequential hermaphroditism is a common reproductive strategy in many teleosts. Steroid production is known to mediate both the natural and induced sex change, yet beyond this the physiology directing this process has received little attention. Cytochrome P450 aromatase is a key enzyme in the hormonal pathway catalysing the conversion of sex steroids, androgens to oestrogens, and thus is highly relevant to the process of sex change. This study reports the isolation of cDNA sequences for aromatase isoforms CYP19A1 and CYP19A2 from teleost species representing three forms of sexual hermaphroditism: Lates calcarifer (protandry), Cromileptes altivelis (protogyny), and Gobiodon histrio (bi-directional). Deduced amino acid analysis of these isoforms with other reported isoforms from gonochoristic (single sex) teleosts revealed 56-95% identity within the same isoform while only 48-65% identity between isoforms irrespective of species and sexual strategy. Phylogenetic analysis supported this result separating sequences into isoform exclusive clades in spite of species apparent evolutionary distance. Furthermore, this study isolates 5' flanking regions of all above genes and describes putative cis-acting elements therein. Elements identified include steroidogenic factor 1 binding site (SF-1), oestrogen response element (ERE), progesterone response element (PRE), androgen response element (ARE), glucocorticoid response elements (GRE), peroxisome proliferator-activated receptor alpha/retinoid X receptor alpha heterodimer responsive element (PPARalpha/RXRalpha), nuclear factor kappabeta (NF-kappabeta), SOX 5, SOX 9, and Wilms tumor suppressor (WTI). A hypothetical in vivo model was constructed for both isoforms highlighting potential roles of these putative cis-acting elements with reference to normal function and sexual hermaphroditism.

  20. Cloning of an ets-Related Transcription Factor Involved in a Novel Epigenetic Mechanism of Mammary Carcinogenesis

    DTIC Science & Technology

    2001-05-01

    dystrophin gene promoter is regulated by YY1 and DPBF (33). Other studies showed that serum response factor (SRF) is required for muscle-specific...transcriptional activation through CArG boxes (68) and that SRF competes with YY1 for binding to wild-type CArG elements (51). CBF-A has significant...between SRF and YY1 proteins at CArG elements has been described in chicken skeletal muscle cells(36). Our previous study in a rat mammary carcinoma cell

  1. The beginning of kinesin's force-generating cycle visualized at 9-Å resolution

    PubMed Central

    Sindelar, Charles V.; Downing, Kenneth H.

    2007-01-01

    We have used cryo-electron microscopy of kinesin-decorated microtubules to resolve the structure of the motor protein kinesin's crucial nucleotide response elements, switch I and the switch II helix, in kinesin's poorly understood nucleotide-free state. Both of the switch elements undergo conformational change relative to the microtubule-free state. The changes in switch I suggest a role for it in “ejecting” adenosine diphosphate when kinesin initially binds to the microtubule. The switch II helix has an N-terminal extension, apparently stabilized by conserved microtubule contacts, implying a microtubule activation mechanism that could convey the state of the bound nucleotide to kinesin's putative force-delivering element (the “neck linker”). In deriving this structure, we have adapted an image-processing technique, single-particle reconstruction, for analyzing decorated microtubules. The resulting reconstruction visualizes the asymmetric seam present in native, 13-protofilament microtubules, and this method will provide an avenue to higher-resolution characterization of a variety of microtubule- binding proteins, as well as the microtubule itself. PMID:17470637

  2. Metal dealing at the origin of the Chordata phylum: the metallothionein system and metal overload response in amphioxus.

    PubMed

    Guirola, Maria; Pérez-Rafael, Sílvia; Capdevila, Mercè; Palacios, Oscar; Atrian, Sílvia

    2012-01-01

    Non-vertebrate chordates, specifically amphioxus, are considered of the utmost interest for gaining insight into the evolutionary trends, i.e. differentiation and specialization, of gene/protein systems. In this work, MTs (metallothioneins), the most important metal binding proteins, are characterized for the first time in the cephalochordate subphylum at both gene and protein level, together with the main features defining the amphioxus response to cadmium and copper overload. Two MT genes (BfMT1 and BfMT2) have been identified in a contiguous region of the genome, as well as several ARE (antioxidant response element) and MRE (metal response element) located upstream the transcribed region. Their corresponding cDNAs exhibit identical sequence in the two lancelet species (B. floridae and B. lanceolatum), BfMT2 cDNA resulting from an alternative splicing event. BfMT1 is a polyvalent metal binding peptide that coordinates any of the studied metal ions (Zn, Cd or Cu) rendering complexes stable enough to last in physiological environments, which is fully concordant with the constitutive expression of its gene, and therefore, with a metal homeostasis housekeeping role. On the contrary, BfMT2 exhibits a clear ability to coordinate Cd(II) ions, while it is absolutely unable to fold into stable Cu (I) complexes, even as mixed species. This identifies it as an essential detoxification agent, which is consequently only induced in emergency situations. The cephalochordate MTs are not directly related to vertebrate MTs, neither by gene structure, protein similarity nor metal-binding behavior of the encoded peptides. The closest relative is the echinoderm MT, which confirm proposed phylogenetic relationships between these two groups. The current findings support the existence in most organisms of two types of MTs as for their metal binding preferences, devoted to different biological functions: multivalent MTs for housekeeping roles, and specialized MTs that evolve either as Cd-thioneins or Cu-thioneins, according to the ecophysiological needs of each kind of organisms.

  3. Metal Dealing at the Origin of the Chordata Phylum: The Metallothionein System and Metal Overload Response in Amphioxus

    PubMed Central

    Capdevila, Mercè; Palacios, Òscar; Atrian, Sílvia

    2012-01-01

    Non-vertebrate chordates, specifically amphioxus, are considered of the utmost interest for gaining insight into the evolutionary trends, i.e. differentiation and specialization, of gene/protein systems. In this work, MTs (metallothioneins), the most important metal binding proteins, are characterized for the first time in the cephalochordate subphylum at both gene and protein level, together with the main features defining the amphioxus response to cadmium and copper overload. Two MT genes (BfMT1 and BfMT2) have been identified in a contiguous region of the genome, as well as several ARE (antioxidant response element) and MRE (metal response element) located upstream the transcribed region. Their corresponding cDNAs exhibit identical sequence in the two lancelet species (B. floridae and B. lanceolatum), BfMT2 cDNA resulting from an alternative splicing event. BfMT1 is a polyvalent metal binding peptide that coordinates any of the studied metal ions (Zn, Cd or Cu) rendering complexes stable enough to last in physiological environments, which is fully concordant with the constitutive expression of its gene, and therefore, with a metal homeostasis housekeeping role. On the contrary, BfMT2 exhibits a clear ability to coordinate Cd(II) ions, while it is absolutely unable to fold into stable Cu (I) complexes, even as mixed species. This identifies it as an essential detoxification agent, which is consequently only induced in emergency situations. The cephalochordate MTs are not directly related to vertebrate MTs, neither by gene structure, protein similarity nor metal-binding behavior of the encoded peptides. The closest relative is the echinoderm MT, which confirm proposed phylogenetic relationships between these two groups. The current findings support the existence in most organisms of two types of MTs as for their metal binding preferences, devoted to different biological functions: multivalent MTs for housekeeping roles, and specialized MTs that evolve either as Cd-thioneins or Cu-thioneins, according to the ecophysiological needs of each kind of organisms. PMID:22905252

  4. Alpha-crystallins are involved in specific interactions with the murine gamma D/E/F-crystallin-encoding gene.

    PubMed

    Pietrowski, D; Durante, M J; Liebstein, A; Schmitt-John, T; Werner, T; Graw, J

    1994-07-08

    The promoter of the murine gamma E-crystallin (gamma E-Cry) encoding gene (gamma E-cry) was analyzed for specific interactions with lenticular proteins in a gel-retardation assay. A 21-bp fragment immediately downstream of the transcription initiation site (DOTIS) is demonstrated to be responsible for specific interactions with lens extracts. The DOTIS-binding protein(s) accept only the sense DNA strand as target; anti-sense or double-stranded DNA do not interact with these proteins. The DOTIS sequence element is highly conserved among the murine gamma D-, gamma E- and gamma F-cry and is present at comparable positions in the orthologous rat genes. Only a weak or even no protein-binding activity is observed if a few particular bases are changed, as in the rat gamma A-, gamma C- and gamma E-cry elements. DOTIS-binding proteins were found in commercially available bovine alpha-Cry preparations. The essential participation of alpha-Cry in the DNA-binding protein complex was confirmed using alpha-Cry-specific monoclonal antibody. The results reported here point to a novel function of alpha-Cry besides the structural properties in the lens.

  5. Glucocorticoid Induction of Occludin Expression and Endothelial Barrier Requires Transcription Factor p54 NONO

    PubMed Central

    Keil, Jason M.; Liu, Xuwen; Antonetti, David A.

    2013-01-01

    Purpose. Glucocorticoids (GCs) effectively reduce retinal edema and induce vascular barrier properties but possess unwanted side effects. Understanding GC induction of barrier properties may lead to more effective and specific therapies. Previous work identified the occludin enhancer element (OEE) as a GC-responsive cis-element in the promoters of multiple junctional genes, including occludin, claudin-5, and cadherin-9. Here, we identify two OEE-binding factors and determine their contribution to GC induction of tight junction (TJ) gene expression and endothelial barrier properties. Methods. OEE-binding factors were isolated from human retinal endothelial cells (HREC) using DNA affinity purification followed by MALDI-TOF MS/MS. Chromatin immunoprecipitation (ChIP) assays determined in situ binding. siRNA was used to evaluate the role of trans-acting factors in transcription of TJ genes in response to GC stimulation. Paracellular permeability was determined by quantifying flux through a cell monolayer, whereas transendothelial electrical resistance (TER) was measured using the ECIS system. Results. MS/MS analysis of HREC nuclear extracts identified the heterodimer of transcription factors p54/NONO (p54) and polypyrimidine tract-binding protein-associated splicing factor (PSF) as OEE-binding factors, which was confirmed by ChIP assay from GC-treated endothelial cells and rat retina. siRNA knockdown of p54 demonstrated that this factor is necessary for GC induction of occludin and claudin-5 expression. Further, p54 knockdown ablated the pro-barrier effects of GC treatment. Conclusions. p54 is essential for GC-mediated expression of occludin, claudin-5, and barrier induction, and the p54/PSF heterodimer may contribute to normal blood-retinal barrier (BRB) induction in vivo. Understanding the mechanism of GC induction of BRB properties may provide novel therapies for macular edema. PMID:23640037

  6. Glucocorticoid induction of occludin expression and endothelial barrier requires transcription factor p54 NONO.

    PubMed

    Keil, Jason M; Liu, Xuwen; Antonetti, David A

    2013-06-12

    Glucocorticoids (GCs) effectively reduce retinal edema and induce vascular barrier properties but possess unwanted side effects. Understanding GC induction of barrier properties may lead to more effective and specific therapies. Previous work identified the occludin enhancer element (OEE) as a GC-responsive cis-element in the promoters of multiple junctional genes, including occludin, claudin-5, and cadherin-9. Here, we identify two OEE-binding factors and determine their contribution to GC induction of tight junction (TJ) gene expression and endothelial barrier properties. OEE-binding factors were isolated from human retinal endothelial cells (HREC) using DNA affinity purification followed by MALDI-TOF MS/MS. Chromatin immunoprecipitation (ChIP) assays determined in situ binding. siRNA was used to evaluate the role of trans-acting factors in transcription of TJ genes in response to GC stimulation. Paracellular permeability was determined by quantifying flux through a cell monolayer, whereas transendothelial electrical resistance (TER) was measured using the ECIS system. MS/MS analysis of HREC nuclear extracts identified the heterodimer of transcription factors p54/NONO (p54) and polypyrimidine tract-binding protein-associated splicing factor (PSF) as OEE-binding factors, which was confirmed by ChIP assay from GC-treated endothelial cells and rat retina. siRNA knockdown of p54 demonstrated that this factor is necessary for GC induction of occludin and claudin-5 expression. Further, p54 knockdown ablated the pro-barrier effects of GC treatment. p54 is essential for GC-mediated expression of occludin, claudin-5, and barrier induction, and the p54/PSF heterodimer may contribute to normal blood-retinal barrier (BRB) induction in vivo. Understanding the mechanism of GC induction of BRB properties may provide novel therapies for macular edema.

  7. An Exposed KID-Like Domain in Human T-Cell Lymphotropic Virus Type 1 Tax Is Responsible for the Recruitment of Coactivators CBP/p300

    PubMed Central

    Harrod, Robert; Tang, Yong; Nicot, Christophe; Lu, Hsieng S.; Vassilev, Alex; Nakatani, Yoshihiro; Giam, Chou-Zen

    1998-01-01

    Human T-cell lymphotropic virus type 1 (HTLV-1) transcriptional activation is mediated by the viral transactivator, Tax, and three 21-bp repeats (Tax response element [TxRE]) located in the U3 region of the viral long terminal repeat (LTR). Each TxRE contains a core cyclic AMP response element (CRE) flanked by 5′ G-rich and 3′ C-rich sequences. The TxRE binds CREB (CRE-binding protein) and Tax to form a ternary complex and confers Tax-dependent transactivation. Recent data indicate that Tax functions as a specific link to connect CREB-binding protein (CBP)/p300 in a phosphorylation-independent manner to CREB/ATF-1 assembled on the viral 21-bp repeats. Glutathione S-transferase pull-down performed with Tax deletion mutants and peptide competition have localized the site in Tax critical for binding CBP/p300 to a highly protease-sensitive region around amino acid residues 81 to 95 (81QRTSKTLKVLTPPIT95) which lies between the domains previously proposed to be important for CREB binding and Tax subunit dimerization. Amino acid residues around the trypsin- and chymotrypsin-sensitive sites (88KVL90) of Tax bear resemblance to those in the kinase-inducible domain of CREB (129SRRPSYRKILNE140) surrounding Ser-133, which undergoes signal-induced phosphorylation to recruit CBP/p300. Site-directed mutagenesis of residues in this domain (R82A, K85A, K88A, and V89A) resulted in proteins which failed to transactivate from the HTLV-1 LTR in vivo. These mutants (K85A, K88A, and V89A) bind CREB with similar affinities as wild-type Tax, yet interaction with CBP/p300 is abrogated in various biochemical assays, indicating that the recruitment of CBP/p300 is crucial for Tax transactivation. A Tax mutant, M47, defective in the COOH-terminal transactivation domain, continued to interact with CBP/p300, suggesting that interactions with additional cellular factors are required for proper Tax function. PMID:9710589

  8. Arabidopsis basic leucine zipper transcription factors involved in an abscisic acid-dependent signal transduction pathway under drought and high-salinity conditions

    PubMed Central

    Uno, Yuichi; Furihata, Takashi; Abe, Hiroshi; Yoshida, Riichiro; Shinozaki, Kazuo; Yamaguchi-Shinozaki, Kazuko

    2000-01-01

    The induction of the dehydration-responsive Arabidopsis gene, rd29B, is mediated mainly by abscisic acid (ABA). Promoter analysis of rd29B indicated that two ABA-responsive elements (ABREs) are required for the dehydration-responsive expression of rd29B as cis-acting elements. Three cDNAs encoding basic leucine zipper (bZIP)-type ABRE-binding proteins were isolated by using the yeast one-hybrid system and were designated AREB1, AREB2, and AREB3 (ABA-responsive element binding protein). Transcription of the AREB1 and AREB2 genes is up-regulated by drought, NaCl, and ABA treatment in vegetative tissues. In a transient transactivation experiment using Arabidopsis leaf protoplasts, both the AREB1 and AREB2 proteins activated transcription of a reporter gene driven by ABRE. AREB1 and AREB2 required ABA for their activation, because their transactivation activities were repressed in aba2 and abi1 mutants and enhanced in an era1 mutant. Activation of AREBs by ABA was suppressed by protein kinase inhibitors. These results suggest that both AREB1 and AREB2 function as transcriptional activators in the ABA-inducible expression of rd29B, and further that ABA-dependent posttranscriptional activation of AREB1 and AREB2, probably by phosphorylation, is necessary for their maximum activation by ABA. Using cultured Arabidopsis cells, we demonstrated that a specific ABA-activated protein kinase of 42-kDa phosphorylated conserved N-terminal regions in the AREB proteins. PMID:11005831

  9. Arabidopsis basic leucine zipper transcription factors involved in an abscisic acid-dependent signal transduction pathway under drought and high-salinity conditions.

    PubMed

    Uno, Y; Furihata, T; Abe, H; Yoshida, R; Shinozaki, K; Yamaguchi-Shinozaki, K

    2000-10-10

    The induction of the dehydration-responsive Arabidopsis gene, rd29B, is mediated mainly by abscisic acid (ABA). Promoter analysis of rd29B indicated that two ABA-responsive elements (ABREs) are required for the dehydration-responsive expression of rd29B as cis-acting elements. Three cDNAs encoding basic leucine zipper (bZIP)-type ABRE-binding proteins were isolated by using the yeast one-hybrid system and were designated AREB1, AREB2, and AREB3 (ABA-responsive element binding protein). Transcription of the AREB1 and AREB2 genes is up-regulated by drought, NaCl, and ABA treatment in vegetative tissues. In a transient transactivation experiment using Arabidopsis leaf protoplasts, both the AREB1 and AREB2 proteins activated transcription of a reporter gene driven by ABRE. AREB1 and AREB2 required ABA for their activation, because their transactivation activities were repressed in aba2 and abi1 mutants and enhanced in an era1 mutant. Activation of AREBs by ABA was suppressed by protein kinase inhibitors. These results suggest that both AREB1 and AREB2 function as transcriptional activators in the ABA-inducible expression of rd29B, and further that ABA-dependent posttranscriptional activation of AREB1 and AREB2, probably by phosphorylation, is necessary for their maximum activation by ABA. Using cultured Arabidopsis cells, we demonstrated that a specific ABA-activated protein kinase of 42-kDa phosphorylated conserved N-terminal regions in the AREB proteins.

  10. Transcription initiation from the dihydrofolate reductase promoter is positioned by HIP1 binding at the initiation site.

    PubMed

    Means, A L; Farnham, P J

    1990-02-01

    We have identified a sequence element that specifies the position of transcription initiation for the dihydrofolate reductase gene. Unlike the functionally analogous TATA box that directs RNA polymerase II to initiate transcription 30 nucleotides downstream, the positioning element of the dihydrofolate reductase promoter is located directly at the site of transcription initiation. By using DNase I footprint analysis, we have shown that a protein binds to this initiator element. Transcription initiated at the dihydrofolate reductase initiator element when 28 nucleotides were inserted between it and all other upstream sequences, or when it was placed on either side of the DNA helix, suggesting that there is no strict spatial requirement between the initiator and an upstream element. Although neither a single Sp1-binding site nor a single initiator element was sufficient for transcriptional activity, the combination of one Sp1-binding site and the dihydrofolate reductase initiator element cloned into a plasmid vector resulted in transcription starting at the initiator element. We have also shown that the simian virus 40 late major initiation site has striking sequence homology to the dihydrofolate reductase initiation site and that the same, or a similar, protein binds to both sites. Examination of the sequences at other RNA polymerase II initiation sites suggests that we have identified an element that is important in the transcription of other housekeeping genes. We have thus named the protein that binds to the initiator element HIP1 (Housekeeping Initiator Protein 1).

  11. Gene regulatory network of unfolded protein response genes in endoplasmic reticulum stress.

    PubMed

    Takayanagi, Sayuri; Fukuda, Riga; Takeuchi, Yuuki; Tsukada, Sakiko; Yoshida, Kenichi

    2013-01-01

    In the endoplasmic reticulum (ER), secretory and membrane proteins are properly folded and modified, and the failure of these processes leads to ER stress. At the same time, unfolded protein response (UPR) genes are activated to maintain homeostasis. Despite the thorough characterization of the individual gene regulation of UPR genes to date, further investigation of the mutual regulation among UPR genes is required to understand the complex mechanism underlying the ER stress response. In this study, we aimed to reveal a gene regulatory network formed by UPR genes, including immunoglobulin heavy chain-binding protein (BiP), X-box binding protein 1 (XBP1), C/EBP [CCAAT/enhancer-binding protein]-homologous protein (CHOP), PKR-like endoplasmic reticulum kinase (PERK), inositol-requiring 1 (IRE1), activating transcription factor 6 (ATF6), and ATF4. For this purpose, we focused on promoter-luciferase reporters for BiP, XBP1, and CHOP genes, which bear an ER stress response element (ERSE), and p5 × ATF6-GL3, which bears an unfolded protein response element (UPRE). We demonstrated that the luciferase activities of the BiP and CHOP promoters were upregulated by all the UPR genes, whereas those of the XBP1 promoter and p5 × ATF6-GL3 were upregulated by all the UPR genes except for BiP, CHOP, and ATF4 in HeLa cells. Therefore, an ERSE- and UPRE-centered gene regulatory network of UPR genes could be responsible for the robustness of the ER stress response. Finally, we revealed that BiP protein was degraded when cells were treated with DNA-damaging reagents, such as etoposide and doxorubicin; this finding suggests that the expression level of BiP is tightly regulated at the post-translational level, rather than at the transcriptional level, in the presence of DNA damage.

  12. Identification of trans-acting factors regulating SamDC expression in Oryza sativa

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Basu, Supratim, E-mail: supratim_genetics@yahoo.co.in; Division of Plant Biology, Bose Institute, Kolkata; Roychoudhury, Aryadeep

    2014-03-07

    Highlights: • Identification of cis elements responsible for SamDC expression by in silico analysis. • qPCR analysis of SamDC expression to abiotic and biotic stress treatments. • Detection of SamDC regulators using identified cis-elements as probe by EMSA. • Southwestern Blot analysis to predict the size of the trans-acting factors. - Abstract: Abiotic stress affects the growth and productivity of crop plants; to cope with the adverse environmental conditions, plants have developed efficient defense machinery comprising of antioxidants like phenolics and flavonoids, and osmolytes like polyamines. SamDC is a key enzyme in the polyamine biosynthesis pathway in plants. In ourmore » present communication we have done in silico analysis of the promoter region of SamDC to look for the presence of different cis-regulatory elements contributing to its expression. Based on the presence of different cis-regulatory elements we completed comparative analysis of SamDC gene expression in rice lamina of IR-29 and Nonabokra by qPCR in response to the abiotic stress treatments of salinity, drought, cold and the biotic stress treatments of ABA and light. Additionally, to explore the role of the cis-regulatory elements in regulating the expression of SamDC gene in plants we comparatively analyzed the binding of rice nuclear proteins prepared from IR-29 and Nonabokra undergoing various stress treatments. The intensity of the complex formed was low and inducible in IR-29 in contrast to Nonabokra. Southwestern blot analysis helped in predicting the size of the trans-acting factors binding to these cis-elements. To our knowledge this is the first report on the comprehensive analysis of SamDC gene expression in rice and identification of the trans-acting factors regulating its expression.« less

  13. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Walden, William E.; Selezneva, Anna I.; Dupuy, Jérôme

    Iron regulatory protein 1 (IRP1) binds iron-responsive elements (IREs) in messenger RNAs (mRNAs), to repress translation or degradation, or binds an iron-sulfur cluster, to become a cytosolic aconitase enzyme. The 2.8 angstrom resolution crystal structure of the IRP1:ferritin H IRE complex shows an open protein conformation compared with that of cytosolic aconitase. The extended, L-shaped IRP1 molecule embraces the IRE stem-loop through interactions at two sites separated by {approx}30 angstroms, each involving about a dozen protein:RNA bonds. Extensive conformational changes related to binding the IRE or an iron-sulfur cluster explain the alternate functions of IRP1 as an mRNA regulator ormore » enzyme.« less

  14. Genome-wide targeted prediction of ABA responsive genes in rice based on over-represented cis-motif in co-expressed genes.

    PubMed

    Lenka, Sangram K; Lohia, Bikash; Kumar, Abhay; Chinnusamy, Viswanathan; Bansal, Kailash C

    2009-02-01

    Abscisic acid (ABA), the popular plant stress hormone, plays a key role in regulation of sub-set of stress responsive genes. These genes respond to ABA through specific transcription factors which bind to cis-regulatory elements present in their promoters. We discovered the ABA Responsive Element (ABRE) core (ACGT) containing CGMCACGTGB motif as over-represented motif among the promoters of ABA responsive co-expressed genes in rice. Targeted gene prediction strategy using this motif led to the identification of 402 protein coding genes potentially regulated by ABA-dependent molecular genetic network. RT-PCR analysis of arbitrarily chosen 45 genes from the predicted 402 genes confirmed 80% accuracy of our prediction. Plant Gene Ontology (GO) analysis of ABA responsive genes showed enrichment of signal transduction and stress related genes among diverse functional categories.

  15. [The effect of hypoxia preconditioning no binding activity of HIF-1 on the HRE with EPO in the hippocampus of mice].

    PubMed

    Shao, Guo; Zhou, Wei-Hua; Gao, Cui-Ying; Zhang, Ran; Lu, Guo-Wei

    2007-02-01

    To observe change of binding activity of HIF-1 with erythropoietin (EPO) hypoxia response element (HRE) in the hippocampus of mice preconditioned to hypoxia and explore relationship between the changes and the preconditioning. The hippocampus was removed from mice exposed to hypoxia for 0 run (control group), 1 run (H1 group) and 4 runs(H4 group). Electrophoretic mobility shift assays (EMSA), chromatin immunoprecipitation (ChIP)and real time PCR were used to detect the change of activity of HIF-1 on HRE of EPO. Both in vitro and in vivo binding tests showed that the HIF-1 DNA-binding activities were increased in group H1 and markedly increased in group H4. The increase of HIF-1 and HRE of EPO binding activities is thought be involved in hypoxic preconditioning.

  16. Out of Place, Out of Mind: Schema-Driven False Memory Effects for Object-Location Bindings

    ERIC Educational Resources Information Center

    Lew, Adina R.; Howe, Mark L.

    2017-01-01

    Events consist of diverse elements, each processed in specialized neocortical networks, with temporal lobe memory systems binding these elements to form coherent event memories. We provide a novel theoretical analysis of an unexplored consequence of the independence of memory systems for elements and their bindings, 1 that raises the paradoxical…

  17. Co-operative intra-protein structural response due to protein-protein complexation revealed through thermodynamic quantification: study of MDM2-p53 binding

    NASA Astrophysics Data System (ADS)

    Samanta, Sudipta; Mukherjee, Sanchita

    2017-10-01

    The p53 protein activation protects the organism from propagation of cells with damaged DNA having oncogenic mutations. In normal cells, activity of p53 is controlled by interaction with MDM2. The well understood p53-MDM2 interaction facilitates design of ligands that could potentially disrupt or prevent the complexation owing to its emergence as an important objective for cancer therapy. However, thermodynamic quantification of the p53-peptide induced structural changes of the MDM2-protein remains an area to be explored. This study attempts to understand the conformational free energy and entropy costs due to this complex formation from the histograms of dihedral angles generated from molecular dynamics simulations. Residue-specific quantification illustrates that, hydrophobic residues of the protein contribute maximum to the conformational thermodynamic changes. Thermodynamic quantification of structural changes of the protein unfold the fact that, p53 binding provides a source of inter-element cooperativity among the protein secondary structural elements, where the highest affected structural elements (α2 and α4) found at the binding site of the protein affects faraway structural elements (β1 and Loop1) of the protein. The communication perhaps involves water mediated hydrogen bonded network formation. Further, we infer that in inhibitory F19A mutation of P53, though Phe19 is important in the recognition process, it has less prominent contribution in the stability of the complex. Collectively, this study provides vivid microscopic understanding of the interaction within the protein complex along with exploring mutation sites, which will contribute further to engineer the protein function and binding affinity.

  18. The Tomato Transcription Factor Pti4 Regulates Defense-Related Gene Expression via GCC Box and Non-GCC Box cis ElementsW⃞

    PubMed Central

    Chakravarthy, Suma; Tuori, Robert P.; D'Ascenzo, Mark D.; Fobert, Pierre R.; Després, Charles; Martin, Gregory B.

    2003-01-01

    The tomato transcription factor Pti4, an ethylene-responsive factor (ERF), interacts physically with the disease resistance protein Pto and binds the GCC box cis element that is present in the promoters of many pathogenesis-related (PR) genes. We reported previously that Arabidopsis plants expressing Pti4 constitutively express several GCC box–containing PR genes and show reduced disease symptoms compared with wild-type plants after inoculation with Pseudomonas syringae pv tomato or Erysiphe orontii. To gain insight into how genome-wide gene expression is affected by Pti4, we used serial analysis of gene expression (SAGE) to compare transcripts in wild-type and Pti4-expressing Arabidopsis plants. SAGE provided quantitative measurements of >20,000 transcripts and identified the 50 most highly expressed genes in Arabidopsis vegetative tissues. Comparison of the profiles from wild-type and Pti4-expressing Arabidopsis plants revealed 78 differentially abundant transcripts encoding defense-related proteins, protein kinases, ribosomal proteins, transporters, and two transcription factors (TFs). Many of the genes identified were expressed differentially in wild-type Arabidopsis during infection by Pseudomonas syringae pv tomato, supporting a role for them in defense-related processes. Unexpectedly, the promoters of most Pti4-regulated genes did not have a GCC box. Chromatin immunoprecipitation experiments confirmed that Pti4 binds in vivo to promoters lacking this cis element. Potential binding sites for ERF, MYB, and GBF TFs were present in statistically significantly increased numbers in promoters regulated by Pti4. Thus, Pti4 appears to regulate gene expression directly by binding the GCC box and possibly a non-GCC box element and indirectly by either activating the expression of TF genes or interacting physically with other TFs. PMID:14630974

  19. A calmodulin-binding/CGCG box DNA-binding protein family involved in multiple signaling pathways in plants

    NASA Technical Reports Server (NTRS)

    Yang, Tianbao; Poovaiah, B. W.

    2002-01-01

    We reported earlier that the tobacco early ethylene-responsive gene NtER1 encodes a calmodulin-binding protein (Yang, T., and Poovaiah, B. W. (2000) J. Biol. Chem. 275, 38467-38473). Here we demonstrate that there is one NtER1 homolog as well as five related genes in Arabidopsis. These six genes are rapidly and differentially induced by environmental signals such as temperature extremes, UVB, salt, and wounding; hormones such as ethylene and abscisic acid; and signal molecules such as methyl jasmonate, H(2)O(2), and salicylic acid. Hence, they were designated as AtSR1-6 (Arabidopsis thaliana signal-responsive genes). Ca(2+)/calmodulin binds to all AtSRs, and their calmodulin-binding regions are located on a conserved basic amphiphilic alpha-helical motif in the C terminus. AtSR1 targets the nucleus and specifically recognizes a novel 6-bp CGCG box (A/C/G)CGCG(G/T/C). The multiple CGCG cis-elements are found in promoters of genes such as those involved in ethylene signaling, abscisic acid signaling, and light signal perception. The DNA-binding domain in AtSR1 is located on the N-terminal 146 bp where all AtSR1-related proteins share high similarity but have no similarity to other known DNA-binding proteins. The calmodulin-binding nuclear proteins isolated from wounded leaves exhibit specific CGCG box DNA binding activities. These results suggest that the AtSR gene family encodes a family of calmodulin-binding/DNA-binding proteins involved in multiple signal transduction pathways in plants.

  20. Zac1, an Sp1-like protein, regulates human p21{sup WAF1/Cip1} gene expression in HeLa cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Liu, Pei-Yao; Hsieh, Tsai-Yuan; Liu, Shu-Ting

    2011-12-10

    Zac1 functions as both a transcription factor and a transcriptional cofactor for p53, nuclear receptors (NRs) and NR coactivators. Zac1 might also act as a transcriptional repressor via the recruitment of histone deacetylase 1 (HDAC1). The ability of Zac1 to interact directly with GC-specific elements indicates that Zac1 possibly binds to Sp1-responsive elements. In the present study, our data show that Zac1 is able to interact directly with the Sp1-responsive element in the p21{sup WAF1/Cip1} gene promoter and enhance the transactivation activity of Sp1 through direct physical interaction. Our data further demonstrate that Zac1 might enhance Sp1-specific promoter activity bymore » interacting with the Sp1-responsive element, affecting the transactivation activity of Sp1 via a protein-protein interaction, or competing the HDAC1 protein away from the pre-existing Sp1/HDAC1 complex. Finally, the synergistic regulation of p21{sup WAF1/Cip1} gene expression by Zac1 and Sp1 is mediated by endogenous p53 protein and p53-responsive elements in HeLa cells. Our work suggests that Zac1 might serve as an Sp1-like protein that directly interacts with the Sp1-responsive element to oligomerize with and/or to coactivate Sp1.« less

  1. Porcine bocavirus NP1 negatively regulates interferon signaling pathway by targeting the DNA-binding domain of IRF9

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhang, Ruoxi; The Cooperative Innovation Center for Sustainable Pig Production, Wuhan 430070; Fang, Liurong, E-mail: fanglr@mail.hzau.edu.cn

    2015-11-15

    To subvert host antiviral immune responses, many viruses have evolved countermeasures to inhibit IFN signaling pathway. Porcine bocavirus (PBoV), a newly identified porcine parvovirus, has received attention because it shows clinically high co-infection prevalence with other pathogens in post-weaning multisystemic wasting syndrome (PWMS) and diarrheic piglets. In this study, we screened the structural and non-structural proteins encoded by PBoV and found that the non-structural protein NP1 significantly suppressed IFN-stimulated response element (ISRE) activity and subsequent IFN-stimulated gene (ISG) expression. However, NP1 affected neither the activation and translocation of STAT1/STAT2, nor the formation of the heterotrimeric transcription factor complex ISGF3 (STAT1/STAT2/IRF9).more » Detailed analysis demonstrated that PBoV NP1 blocked the ISGF3 DNA-binding activity by combining with the DNA-binding domain (DBD) of IRF9. In summary, these results indicate that PBoV NP1 interferes with type I IFN signaling pathway by blocking DNA binding of ISGF3 to attenuate innate immune responses. - Highlights: • Porcine bocavirus (PBoV) NP1 interferes with the IFN α/β signaling pathway. • PBoV NP1 does not prevent STAT1/STAT2 phosphorylation and nuclear translocation. • PBoV NP1 inhibits the DNA-binding activity of ISGF3. • PBoV NP1 interacts with the DNA-binding domain of IRF9.« less

  2. Out of place, out of mind: Schema-driven false memory effects for object-location bindings.

    PubMed

    Lew, Adina R; Howe, Mark L

    2017-03-01

    Events consist of diverse elements, each processed in specialized neocortical networks, with temporal lobe memory systems binding these elements to form coherent event memories. We provide a novel theoretical analysis of an unexplored consequence of the independence of memory systems for elements and their bindings, 1 that raises the paradoxical prediction that schema-driven false memories can act solely on the binding of event elements despite the superior retrieval of individual elements. This is because if 2, or more, schema-relevant elements are bound together in unexpected conjunctions, the unexpected conjunction will increase attention during encoding to both the elements and their bindings, but only the bindings will receive competition with evoked schema-expected bindings. We test our model by examining memory for object-location bindings in recognition (Study 1) and recall (Studies 2 and 3) tasks. After studying schema-relevant objects in unexpected locations (e.g., pan on a stool in a kitchen scene), participants who then viewed these objects in expected locations (e.g., pan on stove) at test were more likely to falsely remember this object-location pairing as correct, compared with participants that viewed a different unexpected object-location pairing (e.g., pan on floor). In recall, participants were more likely to correctly remember individual schema-relevant objects originally viewed in unexpected, as opposed to expected locations, but were then more likely to misplace these items in the original room scene to expected places, relative to control schema-irrelevant objects. Our theoretical analysis and novel paradigm provide a tool for investigating memory distortions acting on binding processes. (PsycINFO Database Record (c) 2017 APA, all rights reserved).

  3. E2-mediated cathepsin D (CTSD) activation involves looping of distal enhancer elements.

    PubMed

    Bretschneider, Nancy; Kangaspeska, Sara; Seifert, Martin; Reid, George; Gannon, Frank; Denger, Stefanie

    2008-08-01

    Estrogen receptor alpha (ERalpha) is a ligand dependent transcription factor that regulates the expression of target genes through interacting with cis-acting estrogen response elements (EREs). However, only a minority of ERalpha binding sites are located within the proximal promoter regions of responsive genes. Here we report the characterization of an ERE located 9kbp upstream of the TSS of the cathepsin D gene (CTSD) that up-regulates CTSD expression upon estrogen stimulation in MCF-7 cells. Using ChIP, we show recruitment of ERalpha and phosphorylated PolII at the CTSD distal enhancer region. Moreover, we determine the kinetics of transient CpG methylation on the promoter region of CTSD and for the first time, at a distal enhancer element. We show that ERalpha is crucial for long-distance regulation of CTSD expression involving a looping mechanism.

  4. An interferon regulatory factor binding site in the U5 region of the bovine leukemia virus long terminal repeat stimulates Tax-independent gene expression.

    PubMed

    Kiermer, V; Van Lint, C; Briclet, D; Vanhulle, C; Kettmann, R; Verdin, E; Burny, A; Droogmans, L

    1998-07-01

    Bovine leukemia virus (BLV) replication is controlled by both cis- and trans-acting elements. The virus-encoded transactivator, Tax, is necessary for efficient transcription from the BLV promoter, although it is not present during the early stages of infection. Therefore, sequences that control Tax-independent transcription must play an important role in the initiation of viral gene expression. This study demonstrates that the R-U5 sequence of BLV stimulates Tax-independent reporter gene expression directed by the BLV promoter. R-U5 was also stimulatory when inserted immediately downstream from the transcription initiation site of a heterologous promoter. Progressive deletion analysis of this region revealed that a 46-bp element corresponding to the 5' half of U5 is principally responsible for the stimulation. This element exhibited enhancer activity when inserted upstream or downstream from the herpes simplex virus thymidine kinase promoter. This enhancer contains a binding site for the interferon regulatory factors IRF-1 and IRF-2. A 3-bp mutation that destroys the IRF recognition site caused a twofold decrease in Tax-independent BLV long terminal repeat-driven gene expression. These observations suggest that the IRF binding site in the U5 region of BLV plays a role in the initiation of virus replication.

  5. Interactions of trans-acting factor(s) with the estradiol response element and nuclear factor 1 of the vitellogenin II gene of Japanese quail.

    PubMed

    Gupta, S; Upadhayay, R; Kanungo, M S

    1996-08-01

    This study was directed at achieving an understanding of the mechanisms by which steroid hormones control the synthesis of vitellogenin (VTG) protein in the liver of the Japanese quail. Northern hybridization shows that administration of estradiol alone or with progesterone stimulates the synthesis of VTG mRNA. Gel mobility shift assay of DNA fragments containing the ERE and NF 1 shows that estradiol alone or with progesterone increases the levels of nuclear proteins that bind to these cis-acting elements of the promoter of the VTG gene. The cooperative effect of the two hormones seen at the level of expression of the VTG gene may be due to protein-protein interactions of trans-acting factors that bind to ERE and NF 1.

  6. A petunia ethylene-responsive element binding factor, PhERF2, plays an important role in antiviral RNA silencing

    USDA-ARS?s Scientific Manuscript database

    Virus-induced gene silencing (VIGS) is a useful technique for functional characterization of plant genes. However, the silencing efficiency of the VIGS system is variable largely depending on compatibility between the host and the virus. Antiviral RNA silencing is involved in plant antiviral defense...

  7. CREB Selectively Controls Learning-Induced Structural Remodeling of Neurons

    ERIC Educational Resources Information Center

    Middei, Silvia; Spalloni, Alida; Longone, Patrizia; Pittenger, Christopher; O'Mara, Shane M.; Marie, Helene; Ammassari-Teule, Martine

    2012-01-01

    The modulation of synaptic strength associated with learning is post-synaptically regulated by changes in density and shape of dendritic spines. The transcription factor CREB (cAMP response element binding protein) is required for memory formation and in vitro dendritic spine rearrangements, but its role in learning-induced remodeling of neurons…

  8. FABP4-Cre mediated expression of constitutively active ChREBP protects against obesity

    USDA-ARS?s Scientific Manuscript database

    Carbohydrate response element binding protein (ChREBP) regulates cellular glucose and lipid homeostasis. Although ChREBP is highly expressed in many key metabolic tissues, the role of ChREBP in most of those tissues and consequent effects on whole-body glucose and lipid metabolism are not well under...

  9. Alterations in phosphorylated cyclic adenosine monophosphate response element of binding protein activity: a pathway for fetal alcohol syndrome-related neurotoxicity.

    PubMed

    Roberson, Robin; Cameroni, Irene; Toso, Laura; Abebe, Daniel; Bissel, Stephanie; Spong, Catherine Y

    2009-02-01

    Fetal alcohol syndrome (FAS) is the leading cause of a spectrum of preventable nongenetic learning and behavioral disorders. In adult (FAS) mice, we measured phosphorylated cyclic adenosine monophosphate response element of binding protein (pCREB) staining in hippocampal subregions to evaluate a possible mechanism underlying FAS learning deficits. Pregnant C57BL6/J mice were treated on gestational day 8 with alcohol or control (saline). After learning assessment, the offspring were perfused for immunohistochemistry and brain sections probed using SER 133 pCREB antibody. Relative staining density was assessed using National Institutes of Health Image software. Statistical analysis included analysis of variance with P < .05 considered significant. In all hippocampal subregions, pCREB staining was greater in the control animals than in the alcohol-treated group (P < or = .0001). In utero alcohol exposure decreased pCREB activity in hippocampal subregions of adult mice. The dentate gyrus had the most robust cumulative decrease in pCREB staining, suggesting FAS adult learning deficits may correlate to enhanced dentate gyrus neurodegeneration.

  10. Gotu Kola (Centella Asiatica) extract enhances phosphorylation of cyclic AMP response element binding protein in neuroblastoma cells expressing amyloid beta peptide.

    PubMed

    Xu, Yanan; Cao, Zhiming; Khan, Ikhlas; Luo, Yuan

    2008-04-01

    Alzheimer's disease (AD) is a progressive neurodegenerative disorder that shows cognitive deficits and memory impairment. Extract from the leaves of Gotu Kola (Centella Asiatica) have been used as an alternative medicine for memory improvement in Indian Ayurvedic system of medicine for a long time. Although several studies have revealed its effect in ameliorating the cognitive impairment in rat models of AD and stimulating property on neuronal dendrites of hippocampal region, the molecular mechanism of Gotu Kola on neuroprotection still remains to be elucidated. In this study, we report that phosphorylation of cyclic AMP response element binding protein (CREB) is enhanced in both a neuroblastoma cell line expressing amyloid beta 1-42 (Abeta) and in rat embryonic cortical primary cell culture. In addition, the contribution of two major single components to the enhanced CREB phosphorylatioin was examined. Furthermore, inhibitors were applied in this study revealing that ERK/RSK signaling pathway might mediate this effect of Gotu Kola extract. Taken together, we provide a possible molecular mechanism for memory enhancing property of Gotu Kola extract for the first time.

  11. Functional analysis of the OCA-B promoter.

    PubMed

    Stevens, S; Wang, L; Roeder, R G

    2000-06-15

    OCA-B was identified as a B cell-specific coactivator that functions with either Oct-1 or Oct-2 to mediate efficient cell type-specific transcription via the octamer site (ATGCAAAT) both in vivo and in vitro. Mice lacking OCA-B exhibit normal Ag-independent B cell maturation. In contrast, Ag-dependent functions, including production of secondary Ig isotypes and germinal center formation, are greatly affected. To better understand OCA-B expression and, ultimately, the defects observed in the OCA-B knockout mice, we have cloned the OCA-B promoter and examined its function in both transformed and primary B cells. We show here that the OCA-B promoter is developmentally regulated, with activity increasing throughout B cell differentiation. Through physical and functional assays, we have found an activating transcription factor/cAMP response element binding protein binding site (or cAMP response element) that is crucial for OCA-B promoter activity. Furthermore, we demonstrate that IL-4 and anti-CD40 induce both the OCA-B promoter and octamer-dependent promoters, thus implicating OCA-B in B cell signaling events in the nucleus.

  12. Chimeric RNase H–Competent Oligonucleotides Directed to the HIV-1 Rev Response Element

    PubMed Central

    Prater, Chrissy E.; Saleh, Anthony D.; Wear, Maggie P.; Miller, Paul S.

    2007-01-01

    Chimeric oligo-2′-O-methylribonucleotides containing centrally located patches of contiguous 2′-deoxyribonucleotides and terminating in a nuclease resistant 3′-methylphosphonate internucleotide linkage were prepared. The oligonucleotides were targeted to the 3′-side of HIV Rev response element (RRE) stem-loop IIB RNA, which is adjacent to the high affinity Rev protein binding site and is critical to virus function. Thermal denaturation experiments showed that chimeric oligonucleotides form very stable duplexes with a complementary single-stranded RNA, and gel electrophoretic mobility shift assays (EMSA) showed that they bind with high affinity and specificity to RRE stem-loop II RNA (KD approximately 200 nM). The chimeric oligonucleotides promote RNase H-mediated hydrolysis of RRE stem-loop II RNA and have half lives exceeding 24 h when incubated in cell culture medium containing 10% fetal calf serum. One of the chimeric oligonucleotides inhibited RRE mediated expression of chloramphenicol acetyl transferase (CAT) approximately 60% at a concentration of 300 nM in HEK 293T cells co-transfected with p-RRE/CAT and p-Rev mammalian expression vectors. PMID:17566743

  13. Analysis of LexA binding sites and transcriptomics in response to genotoxic stress in Leptospira interrogans.

    PubMed

    Schons-Fonseca, Luciane; da Silva, Josefa B; Milanez, Juliana S; Domingos, Renan H; Smith, Janet L; Nakaya, Helder I; Grossman, Alan D; Ho, Paulo L; da Costa, Renata M A

    2016-02-18

    We determined the effects of DNA damage caused by ultraviolet radiation on gene expression in Leptospira interrogans using DNA microarrays. These data were integrated with DNA binding in vivo of LexA1, a regulator of the DNA damage response, assessed by chromatin immunoprecipitation and massively parallel DNA sequencing (ChIP-seq). In response to DNA damage, Leptospira induced expression of genes involved in DNA metabolism, in mobile genetic elements and defective prophages. The DNA repair genes involved in removal of photo-damage (e.g. nucleotide excision repair uvrABC, recombinases recBCD and resolvases ruvABC) were not induced. Genes involved in various metabolic pathways were down regulated, including genes involved in cell growth, RNA metabolism and the tricarboxylic acid cycle. From ChIP-seq data, we observed 24 LexA1 binding sites located throughout chromosome 1 and one binding site in chromosome 2. Expression of many, but not all, genes near those sites was increased following DNA damage. Binding sites were found as far as 550 bp upstream from the start codon, or 1 kb into the coding sequence. Our findings indicate that there is a shift in gene expression following DNA damage that represses genes involved in cell growth and virulence, and induces genes involved in mutagenesis and recombination. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  14. Genome-wide identification and characterization of Notch transcription complex-binding sequence-paired sites in leukemia cells.

    PubMed

    Severson, Eric; Arnett, Kelly L; Wang, Hongfang; Zang, Chongzhi; Taing, Len; Liu, Hudan; Pear, Warren S; Shirley Liu, X; Blacklow, Stephen C; Aster, Jon C

    2017-05-02

    Notch transcription complexes (NTCs) drive target gene expression by binding to two distinct types of genomic response elements, NTC monomer-binding sites and sequence-paired sites (SPSs) that bind NTC dimers. SPSs are conserved and have been linked to the Notch responsiveness of a few genes. To assess the overall contribution of SPSs to Notch-dependent gene regulation, we determined the DNA sequence requirements for NTC dimerization using a fluorescence resonance energy transfer (FRET) assay and applied insights from these in vitro studies to Notch-"addicted" T cell acute lymphoblastic leukemia (T-ALL) cells. We found that SPSs contributed to the regulation of about a third of direct Notch target genes. Although originally described in promoters, SPSs are present mainly in long-range enhancers, including an enhancer containing a newly described SPS that regulates HES5 expression. Our work provides a general method for identifying SPSs in genome-wide data sets and highlights the widespread role of NTC dimerization in Notch-transformed leukemia cells. Copyright © 2017, American Association for the Advancement of Science.

  15. High-mobility group (HMG) protein HMG-1 and TATA-binding protein-associated factor TAF(II)30 affect estrogen receptor-mediated transcriptional activation.

    PubMed

    Verrier, C S; Roodi, N; Yee, C J; Bailey, L R; Jensen, R A; Bustin, M; Parl, F F

    1997-07-01

    The estrogen receptor (ER) belongs to a family of ligand-inducible nuclear receptors that exert their effects by binding to cis-acting DNA elements in the regulatory region of target genes. The detailed mechanisms by which ER interacts with the estrogen response element (ERE) and affects transcription still remain to be elucidated. To study the ER-ERE interaction and transcription initiation, we employed purified recombinant ER expressed in both the baculovirus-Sf9 and his-tagged bacterial systems. The effect of high-mobility group (HMG) protein HMG-1 and purified recombinant TATA-binding protein-associated factor TAF(II)30 on ER-ERE binding and transcription initiation were assessed by electrophoretic mobility shift assay and in vitro transcription from an ERE-containing template (pERE2LovTATA), respectively. We find that purified, recombinant ER fails to bind to ERE in spite of high ligand-binding activity and electrophoretic and immunological properties identical to ER in MCF-7 breast cancer cells. HMG-1 interacts with ER and promotes ER-ERE binding in a concentration- and time-dependent manner. The effectiveness of HMG-1 to stimulate ER-ERE binding in the electrophoretic mobility shift assay depends on the sequence flanking the ERE consensus as well as the position of the latter in the oligonucleotide. We find that TAF(II)30 has no effect on ER-ERE binding either alone or in combination with ER and HMG-1. Although HMG-1 promotes ER-ERE binding, it fails to stimulate transcription initiation either in the presence or absence of hormone. In contrast, TAF(II)30, while not affecting ER-ERE binding, stimulates transcription initiation 20-fold in the presence of HMG-1. These results indicate that HMG-1 and TAF(II)30 act in sequence, the former acting to promote ER-ERE binding followed by the latter to stimulate transcription initiation.

  16. Cellular corepressor TLE2 inhibits replication-and-transcription- activator-mediated transactivation and lytic reactivation of Kaposi's sarcoma-associated herpesvirus.

    PubMed

    He, Zhiheng; Liu, Yunhua; Liang, Deguang; Wang, Zhuo; Robertson, Erle S; Lan, Ke

    2010-02-01

    Replication and transcription activator (RTA) encoded by open reading frame 50 (ORF50) of Kaposi's sarcoma-associated herpesvirus (KSHV) is essential and sufficient to initiate lytic reactivation. RTA activates its target genes through direct binding with high affinity to its responsive elements or by interaction with cellular factors, such as RBP-Jkappa, Ap-1, C/EBP-alpha, and Oct-1. In this study, we identified transducin-like enhancer of split 2 (TLE2) as a novel RTA binding protein by using yeast two-hybrid screening of a human spleen cDNA library. The interaction between TLE2 and RTA was confirmed by glutathione S-transferase (GST) binding and coimmunoprecipitation assays. Immunofluorescence analysis showed that TLE2 and RTA were colocalized in the same nuclear compartment in KSHV-infected cells. This interaction recruited TLE2 to RTA bound to its recognition sites on DNA and repressed RTA auto-activation and transactivation activity. Moreover, TLE2 also inhibited the induction of lytic replication and virion production driven by RTA. We further showed that the Q (Gln-rich), SP (Ser-Pro-rich), and WDR (Trp-Asp repeat) domains of TLE2 and the Pro-rich domain of RTA were essential for this interaction. RBP-Jkappa has been shown previously to bind to the same Pro-rich domain of RTA, and this binding can be subject to competition by TLE2. In addition, TLE2 can form a complex with RTA to access the cognate DNA sequence of the RTA-responsive element at different promoters. Intriguingly, the transcription level of TLE2 could be upregulated by RTA during the lytic reactivation process. In conclusion, we identified a new RTA binding protein, TLE2, and demonstrated that TLE2 inhibited replication and transactivation mediated by RTA. This provides another potentially important mechanism for maintenance of KSHV viral latency through interaction with a host protein.

  17. Molecular cloning and preliminary function study of iron responsive element binding protein 1 gene from cypermethrin-resistant Culex pipiens pallens

    PubMed Central

    2011-01-01

    Background Insecticide resistance jeopardizes the control of mosquito populations and mosquito-borne disease control, which creates a major public health concern. Two-dimensional electrophoresis identified one protein segment with high sequence homology to part of Aedes aegypti iron-responsive element binding protein (IRE-BP). Method RT-PCR and RACE (rapid amplification of cDNA end) were used to clone a cDNA encoding full length IRE-BP 1. Real-time quantitative RT-PCR was used to evaluate the transcriptional level changes in the Cr-IRE strain Aedes aegypti compared to the susceptible strain of Cx. pipiens pallens. The expression profile of the gene was established in the mosquito life cycle. Methyl tritiated thymidine (3H-TdR) was used to observe the cypermethrin resistance changes in C6/36 cells containing the stably transfected IRE-BP 1 gene of Cx. pipiens pallens. Results The complete sequence of iron responsive element binding protein 1 (IRE-BP 1) has been cloned from the cypermethrin-resistant strain of Culex pipiens pallens (Cr-IRE strain). Quantitative RT-PCR analysis indicated that the IRE-BP 1 transcription level was 6.7 times higher in the Cr-IRE strain than in the susceptible strain of 4th instar larvae. The IRE-BP 1 expression was also found to be consistently higher throughout the life cycle of the Cr-IRE strain. A protein of predicted size 109.4 kDa has been detected by Western blotting in IRE-BP 1-transfected mosquito C6/36 cells. These IRE-BP 1-transfected cells also showed enhanced cypermethrin resistance compared to null-transfected or plasmid vector-transfected cells as determined by 3H-TdR incorporation. Conclusion IRE-BP 1 is expressed at higher levels in the Cr-IRE strain, and may confer some insecticide resistance in Cx. pipiens pallens. PMID:22075242

  18. Human T cell lymphotropic virus type I genomic expression and impact on intracellular signaling pathways during neurodegenerative disease and leukemia.

    PubMed

    Yao, J; Wigdahl, B

    2000-01-01

    HTLV-I has been identified as the etiologic agent of neoplasia within the human peripheral blood T lymphocyte population, and a progressive neurologic disorder based primarily within the central nervous system. We have examined the role of HTLV-I in these two distinctly different clinical syndromes by examining the life cycle of the virus, with emphasis on the regulation of viral gene expression within relevant target cell populations. In particular, we have examined the impact of specific viral gene products, particularly Tax, on cellular metabolic function. Tax is a highly promiscuous and pleiotropic viral oncoprotein, and is the most important factor contributing to the initial stages of viral-mediated transformation of T cells after HTLV-I infection. Tax, which weakly binds to Tax response element 1 (TRE-1) in the viral long terminal repeat (LTR), can dramatically trans-activate viral gene expression by interacting with cellular transcription factors, such as activated transcription factors and cyclic AMP response element binding proteins (ATF/CREB), CREB binding protein (CBP/p300), and factors involved with the basic transcription apparatus. At the same time, Tax alters cellular gene expression by directly or indirectly interacting with a variety of cellular transcription factors, cell cycle control elements, and cellular signal transduction molecules ultimately resulting in dysregulated cell proliferation. The mechanisms associated with HTLV-I infection, leading to tropical spastic paraparesis (TSP) are not as clearly resolved. Possible explanations of viral-induced neurologic disease range from central nervous system (CNS) damage caused by direct viral invasion of the CNS to bystander CNS damage caused by the immune response to HTLV-I infection. It is interesting to note that it is very rare for an HTLV-I infected individual to develop both adult T cell leukemia (ATL) and TSP in his/her life time, suggesting that the mechanisms governing development of these two diseases are mutually exclusive.

  19. UV-induced DNA damage is an intermediate step in UV-induced expression of human immunodeficiency virus type 1, collagenase, c-fos, and metallothionein.

    PubMed Central

    Stein, B; Rahmsdorf, H J; Steffen, A; Litfin, M; Herrlich, P

    1989-01-01

    UV irradiation of human and murine cells enhances the transcription of several genes. Here we report on the primary target of relevant UV absorption, on pathways leading to gene activation, and on the elements receiving the UV-induced signal in the human immunodeficiency virus type 1 (HIV-1) long terminal repeat, in the gene coding for collagenase, and in the cellular oncogene fos. In order to induce the expression of genes. UV radiation needs to be absorbed by DNA and to cause DNA damage of the kind that cannot be repaired by cells from patients with xeroderma pigmentosum group A. UV-induced activation of the three genes is mediated by the major enhancer elements (located between nucleotide positions -105 and -79 of HIV-1, between positions -72 and -65 of the collagenase gene, and between positions -320 and -299 of fos). These elements share no apparent sequence motif and bind different trans-acting proteins; a member of the NF kappa B family binds to the HIV-1 enhancer, the heterodimer of Jun and Fos (AP-1) binds to the collagenase enhancer, and the serum response factors p67 and p62 bind to fos. DNA-binding activities of the factors recognizing the HIV-1 and collagenase enhancers are augmented in extracts from UV-treated cells. The increase in activity is due to posttranslational modification. While AP-1 resides in the nucleus and must be modulated there, NF kappa B is activated in the cytoplasm, indicating the existence of a cytoplasmic signal transduction pathway triggered by UV-induced DNA damage. In addition to activation, new synthesis of AP-1 is induced by UV radiation. Images PMID:2557547

  20. Promoter activity of polypyrimidine tract-binding protein genes of potato responds to environmental cues.

    PubMed

    Butler, Nathaniel M; Hannapel, David J

    2012-12-01

    Polypyrimidine tract-binding (PTB) proteins are RNA-binding proteins that target specific RNAs for post-transcriptional processing by binding cytosine/uracil motifs. PTBs have established functions in a range of RNA processes including splicing, translation, stability and long-distance transport. Six PTB-like genes identified in potato have been grouped into two clades based on homology to other known plant PTBs. StPTB1 and StPTB6 are closely related to a PTB protein discovered in pumpkin, designated CmRBP50, and contain four canonical RNA-recognition motifs. CmRBP50 is expressed in phloem tissues and functions as the core protein of a phloem-mobile RNA/protein complex. Sequence from the potato genome database was used to clone the upstream sequence of these two PTB genes and analyzed to identify conserved cis-elements. The promoter of StPTB6 was enriched for regulatory elements for light and sucrose induction and defense. Upstream sequence of both PTB genes was fused to β-glucuronidase and monitored in transgenic potato lines. In whole plants, the StPTB1 promoter was most active in leaf veins and petioles, whereas StPTB6 was most active in leaf mesophyll. Both genes are active in new tubers and tuber sprouts. StPTB6 expression was induced in stems and stolon sections in response to sucrose and in leaves or petioles in response to light, heat, drought and mechanical wounding. These results show that CmRBP50-like genes of potato exhibit distinct expression patterns and respond to both developmental and environmental cues.

  1. A Distal ABA Responsive Element in AtNCED3 Promoter Is Required for Positive Feedback Regulation of ABA Biosynthesis in Arabidopsis

    PubMed Central

    Yang, Yan-Zhuo; Tan, Bao-Cai

    2014-01-01

    The plant hormone abscisic acid (ABA) plays a crucial role in plant development and responses to abiotic stresses. Recent studies indicate that a positive feedback regulation by ABA exists in ABA biosynthesis in plants under dehydration stress. To understand the molecular basis of this regulation, we analyzed the cis-elements of the AtNCED3 promoter in Arabidopsis. AtNCED3 encodes the first committed and highly regulated dioxygenase in the ABA biosynthetic pathway. Through delineated and mutagenesis analyses in stable-transformed Arabidopsis, we revealed that a distal ABA responsive element (ABRE: GGCACGTG, -2372 to -2364 bp) is required for ABA-induced AtNCED3 expression. By analyzing the AtNCED3 expression in ABRE binding protein ABF3 over-expression transgenic plants and knock-out mutants, we provide evidence that the ABA feedback regulation of AtNCED3 expression is not mediated by ABF3. PMID:24475264

  2. Genomic Heat Shock Element Sequences Drive Cooperative Human Heat Shock Factor 1 DNA Binding and Selectivity*

    PubMed Central

    Jaeger, Alex M.; Makley, Leah N.; Gestwicki, Jason E.; Thiele, Dennis J.

    2014-01-01

    The heat shock transcription factor 1 (HSF1) activates expression of a variety of genes involved in cell survival, including protein chaperones, the protein degradation machinery, anti-apoptotic proteins, and transcription factors. Although HSF1 activation has been linked to amelioration of neurodegenerative disease, cancer cells exhibit a dependence on HSF1 for survival. Indeed, HSF1 drives a program of gene expression in cancer cells that is distinct from that activated in response to proteotoxic stress, and HSF1 DNA binding activity is elevated in cycling cells as compared with arrested cells. Active HSF1 homotrimerizes and binds to a DNA sequence consisting of inverted repeats of the pentameric sequence nGAAn, known as heat shock elements (HSEs). Recent comprehensive ChIP-seq experiments demonstrated that the architecture of HSEs is very diverse in the human genome, with deviations from the consensus sequence in the spacing, orientation, and extent of HSE repeats that could influence HSF1 DNA binding efficacy and the kinetics and magnitude of target gene expression. To understand the mechanisms that dictate binding specificity, HSF1 was purified as either a monomer or trimer and used to evaluate DNA-binding site preferences in vitro using fluorescence polarization and thermal denaturation profiling. These results were compared with quantitative chromatin immunoprecipitation assays in vivo. We demonstrate a role for specific orientations of extended HSE sequences in driving preferential HSF1 DNA binding to target loci in vivo. These studies provide a biochemical basis for understanding differential HSF1 target gene recognition and transcription in neurodegenerative disease and in cancer. PMID:25204655

  3. Insulin-like growth factor-I increases bone sialoprotein (BSP) expression through fibroblast growth factor-2 response element and homeodomain protein-binding site in the proximal promoter of the BSP gene.

    PubMed

    Nakayama, Youhei; Nakajima, Yu; Kato, Naoko; Takai, Hideki; Kim, Dong-Soon; Arai, Masato; Mezawa, Masaru; Araki, Shouta; Sodek, Jaro; Ogata, Yorimasa

    2006-08-01

    Insulin-like growth factor-I (IGF-I) promotes bone formation by stimulating proliferation and differentiation of osteoblasts. Bone sialoprotein (BSP), is thought to function in the initial mineralization of bone, is selectively expressed by differentiated osteoblast. To determine the molecular mechanism of IGF-I regulation of osteogenesis, we analyzed the effects of IGF-I on the expression of BSP in osteoblast-like Saos2 and in rat stromal bone marrow (RBMC-D8) cells. IGF-I (50 ng/ml) increased BSP mRNA levels at 12 h in Saos2 cells. In RBMC-D8 cells, IGF-I increased BSP mRNA levels at 3 h. From transient transfection assays, a twofold increase in transcription by IGF-I was observed at 12 h in pLUC3 construct that included the promoter sequence from -116 to +60. Effect of IGF-I was abrogated by 2-bp mutations in either the FGF2 response element (FRE) or homeodomain protein-binding site (HOX). Gel shift analyses showed that IGF-I increased binding of nuclear proteins to the FRE and HOX elements. Notably, the HOX-protein complex was supershifted by Smad1 antibody, while the FRE-protein complex was shifted by Smad1 and Cbfa1 antibodies. Dlx2 and Dlx5 antibodies disrupted the formation of the FRE- and HOX-protein complexes. The IGF-I effects on the formation of FRE-protein complexes were abolished by tyrosine kinase inhibitor herbimycin A (HA), PI3-kinase/Akt inhibitor LY249002, and MAP kinase kinase inhibitor U0126, while IGF-I effects on HOX-protein complexes were abolished by HA and LY249002. These studies demonstrate that IGF-I stimulates BSP transcription by targeting the FRE and HOX elements in the proximal promoter of BSP gene.

  4. Wheat Transcription Factor TaAREB3 Participates in Drought and Freezing Tolerances in Arabidopsis.

    PubMed

    Wang, Jingyi; Li, Qian; Mao, Xinguo; Li, Ang; Jing, Ruilian

    2016-01-01

    AREB (ABA response element binding) proteins in plants play direct regulatory roles in response to multiple stresses, but their functions in wheat (Triticum aestivum L.) are not clear. In the present study, TaAREB3, a new member of the AREB transcription factor family, was isolated from wheat. Sequence analysis showed that the TaAREB3 protein is composed of three parts, a conserved N-terminal, a variable M region, and a conserved C-terminal with a bZIP domain. It belongs to the group A subfamily of bZIP transcription factors. TaAREB3 was constitutively expressed in stems, leaves, florets, anthers, pistils, seeds, and most highly, in roots. TaAREB3 gene expression was induced with abscisic acid (ABA) and low temperature stress, and its protein was localized in the nucleus when transiently expressed in tobacco epidermal cells and stably expressed in transgenic Arabidopsis. TaAREB3 protein has transcriptional activation activity, and can bind to the ABRE cis-element in vitro. Overexpression of TaAREB3 in Arabidopsis not only enhanced ABA sensitivity, but also strengthened drought and freezing tolerances. TaAREB3 also activated RD29A, RD29B, COR15A, and COR47 by binding to their promoter regions in transgenic Arabidopsis. These results demonstrated that TaAREB3 plays an important role in drought and freezing tolerances in Arabidopsis.

  5. Wheat Transcription Factor TaAREB3 Participates in Drought and Freezing Tolerances in Arabidopsis

    PubMed Central

    Wang, Jingyi; Li, Qian; Mao, Xinguo; Li, Ang; Jing, Ruilian

    2016-01-01

    AREB (ABA response element binding) proteins in plants play direct regulatory roles in response to multiple stresses, but their functions in wheat (Triticum aestivum L.) are not clear. In the present study, TaAREB3, a new member of the AREB transcription factor family, was isolated from wheat. Sequence analysis showed that the TaAREB3 protein is composed of three parts, a conserved N-terminal, a variable M region, and a conserved C-terminal with a bZIP domain. It belongs to the group A subfamily of bZIP transcription factors. TaAREB3 was constitutively expressed in stems, leaves, florets, anthers, pistils, seeds, and most highly, in roots. TaAREB3 gene expression was induced with abscisic acid (ABA) and low temperature stress, and its protein was localized in the nucleus when transiently expressed in tobacco epidermal cells and stably expressed in transgenic Arabidopsis. TaAREB3 protein has transcriptional activation activity, and can bind to the ABRE cis-element in vitro. Overexpression of TaAREB3 in Arabidopsis not only enhanced ABA sensitivity, but also strengthened drought and freezing tolerances. TaAREB3 also activated RD29A, RD29B, COR15A, and COR47 by binding to their promoter regions in transgenic Arabidopsis. These results demonstrated that TaAREB3 plays an important role in drought and freezing tolerances in Arabidopsis. PMID:26884722

  6. Identification and characterization of TF1(phox), a DNA-binding protein that increases expression of gp91(phox) in PLB985 myeloid leukemia cells.

    PubMed

    Eklund, E A; Kakar, R

    1997-04-04

    The CYBB gene encodes gp91(phox), the heavy chain of the phagocyte-specific NADPH oxidase. CYBB is transcriptionally inactive until the promyelocyte stage of myelopoiesis, and in mature phagocytes, expression of gp91(phox) is further increased by interferon-gamma (IFN-gamma) and other inflammatory mediators. The CYBB promoter region contains several lineage-specific cis-elements involved in the IFN-gamma response. We screened a leukocyte cDNA expression library for proteins able to bind to one of these cis-elements (-214 to -262 base pairs) and identified TF1(phox), a protein with sequence-specific binding to the CYBB promoter. Electrophoretic mobility shift assay with nuclear proteins from a variety of cell lines demonstrated binding of a protein to the CYBB promoter that was cross-immunoreactive with TF1(phox). DNA binding of this protein was increased by IFN-gamma treatment in the myeloid cell line PLB985, but not in the non-myeloid cell line HeLa. Overexpression of recombinant TF1(phox) in PLB985 cells increased endogenous gp91(phox) message abundance, but did not lead to cellular differentiation. Overexpression of TF1(phox) in myeloid leukemia cell lines increased reporter gene expression from artificial promoter constructs containing CYBB promoter sequence. These data suggested that TF1(phox) increased expression of gp91(phox).

  7. Negative modulation of the chicken infectious anemia virus promoter by COUP-TF1 and an E box-like element at the transcription start site binding deltaEF1.

    PubMed

    Miller, Myrna M; Jarosinski, Keith W; Schat, Karel A

    2008-12-01

    Expression of enhanced green fluorescent protein (EGFP) under control of the promoter-enhancer of chicken infectious anemia virus (CAV) is increased in an oestrogen receptor-enhanced cell line when treated with oestrogen and the promoter-enhancer binds unidentified proteins that recognize a consensus oestrogen response element (ERE). Co-transfection assays with the CAV promoter and the nuclear receptor chicken ovalbumin upstream promoter transcription factor 1 (COUP-TF1) showed that expression of EGFP was decreased by 50 to 60 % in DF-1 and LMH cells. The CAV promoter that included sequences at and downstream of the transcription start point had less expression than a short promoter construct. Mutation of a putative E box at this site restored expression levels. Electromobility shift assays showed that the transcription regulator delta-EF1 (deltaEF1) binds to this E box region. These findings indicate that the CAV promoter activity can be affected directly or indirectly by COUP-TF1 and deltaEF1.

  8. Bisphenol A induces corticotropin-releasing hormone expression in the placental cells JEG-3.

    PubMed

    Huang, Hui; Tan, Wenjuan; Wang, C C; Leung, Lai K

    2012-11-01

    Bisphenol A is utilized to make polycarbonate plastics and is an environmental pollutant. Recent research has indicated that it is an endocrine disruptor and may interfere with reproduction. Placental corticotrophin-releasing hormone (CRH) is a peptide hormone which is involved in fetal development. Increased plasma CRH is associated with elevated risk of premature delivery. In the present study, we demonstrated that bisphenol A increased CRH mRNA expression in the placental JEG-3 cells at or above 25μM. Reporter gene assay also demonstrated that bisphenol A could induce CRH gene transactivity. Since cyclic AMP response element (CRE) is a major regulatory element located in CRH promoter, the sequence-specific binding activity was investigated by using electrophoretic mobility shift assay. Our data indicated that bisphenol A increased the CRE binding activity. Western analysis further illustrated that PKA could be the signal triggering the CRE binding and CRH gene transactivation. In summary, the present study demonstrated that bisphenol A could induce CRH expression in placental cells and the underlying signal transduction pathway was also described. Copyright © 2012 Elsevier Inc. All rights reserved.

  9. Thermodynamic and structural insights into CSL-DNA complexes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Friedmann, David R.; Kovall, Rhett A.

    The Notch pathway is an intercellular signaling mechanism that plays important roles in cell fates decisions throughout the developing and adult organism. Extracellular complexation of Notch receptors with ligands ultimately results in changes in gene expression, which is regulated by the nuclear effector of the pathway, CSL (C-promoter binding factor 1 (CBF-1), suppressor of hairless (Su(H)), lin-12 and glp-1 (Lag-1)). CSL is a DNA binding protein that is involved in both repression and activation of transcription from genes that are responsive to Notch signaling. One well-characterized Notch target gene is hairy and enhancer of split-1 (HES-1), which is regulated bymore » a promoter element consisting of two CSL binding sites oriented in a head-to-head arrangement. Although previous studies have identified in vivo and consensus binding sites for CSL, and crystal structures of these complexes have been determined, to date, a quantitative description of the energetics that underlie CSL-DNA binding is unknown. Here, we provide a thermodynamic and structural analysis of the interaction between CSL and the two individual sites that comprise the HES-1 promoter element. Our comprehensive studies that analyze binding as a function of temperature, salt, and pH reveal moderate, but distinct, differences in the affinities of CSL for the two HES-1 binding sites. Similarly, our structural results indicate that overall CSL binds both DNA sites in a similar manner; however, minor changes are observed in both the conformation of CSL and DNA. Taken together, our results provide a quantitative and biophysical basis for understanding how CSL interacts with DNA sites in vivo.« less

  10. Krüppel-like factors are effectors of nuclear receptor signaling

    PubMed Central

    Knoedler, Joseph R.; Denver, Robert J.

    2015-01-01

    Binding of steroid and thyroid hormones to their cognate nuclear receptors (NRs) impacts virtually every aspect of postembryonic development, physiology and behavior, and inappropriate signaling by NRs may contribute to disease. While NRs regulate genes by direct binding to hormone response elements in the genome, their actions may depend on the activity of other transcription factors (TFs) that may or may not bind DNA. The Krüppel-like family of transcription factors (KLF) is an evolutionarily conserved class of DNA-binding proteins that influence many aspects of development and physiology. Several members of this family have been shown to play diverse roles in NR signaling. For example, KLFs 1) act as accessory transcription factors for NR actions, 2) regulate expression of NR genes, and 3) as gene products of primary NR response genes function as key players in NR-dependent transcriptional networks. In mouse models, deletion of different KLFs leads to aberrant transcriptional and physiological responses to hormones, underscoring the importance of these proteins in the regulation of hormonal signaling. Understanding the functional relationships between NRs and KLFs will yield important insights into mechanisms of NR signaling. In this review we present a conceptual framework for understanding how KLFs participate in NR signaling, and we provide examples of how these proteins function to effect hormone action. PMID:24642391

  11. Identification of an enhancer element of class Pi glutathione S-transferase gene required for expression by a co-planar polychlorinated biphenyl.

    PubMed Central

    Matsumoto, M; Imagawa, M; Aoki, Y

    1999-01-01

    3,3',4,4',5-Pentachlorobiphenyl (PenCB), one of the most toxic co-planar polychlorinated biphenyl congeners, specifically induces class Pi glutathione S-transferase (GSTP1) as well as cytochrome P-450 1A1 in primary cultured rat liver parenchymal cells [Aoki, Matsumoto and Suzuki (1993) FEBS Lett. 333, 114-118]. However, the 5'-flanking sequence of the GSTP1 gene does not contain a xenobiotic responsive element, to which arylhydrocarbon receptor binds. Using a chloramphenicol acetyltransferase assay we demonstrate here that the enhancer termed GSTP1 enhancer I (GPEI) is necessary for the stimulation by PenCB of GSTP1 gene expression in primary cultured rat liver parenchymal cells. GPEI is already known to contain a dyad of PMA responsive element-like elements oriented palindromically. It is suggested that a novel signal transduction pathway activated by PenCB contributes to the stimulation of GSTP1 expression. PMID:10051428

  12. Ethylene-responsive element-binding factor 5, ERF5, is involved in chitin-induced innate immunity response.

    PubMed

    Son, Geon Hui; Wan, Jinrong; Kim, Hye Jin; Nguyen, Xuan Canh; Chung, Woo Sik; Hong, Jong Chan; Stacey, Gary

    2012-01-01

    Our recent work demonstrated that chitin treatment modulated the expression of 118 transcription factor (TF) genes in Arabidopsis. To investigate the potential roles of these TF in chitin signaling and plant defense, we initiated an interaction study among these TF proteins, as well as two chitin-activated mitogen-activated protein kinases (MPK3 and MPK6), using a yeast two-hybrid system. This study revealed interactions among the following proteins: three ethylene-responsive element-binding factors (ERF), five WRKY transcription factors, one scarecrow-like (SCL), and the two MPK, in addition to many other interactions, reflecting a complex TF interaction network. Most of these interactions were subsequently validated by other methods, such as pull-down and in planta bimolecular fluorescence complementation assays. The key node ERF5 was shown to interact with multiple proteins in the network, such as ERF6, ERF8, and SCL13, as well as MPK3 and MPK6. Interestingly, ERF5 appeared to negatively regulate chitin signaling and plant defense against the fungal pathogen Alternaria brassicicola and positively regulate salicylic acid signaling and plant defense against the bacterial pathogen Pseudomonas syringae pv. tomato DC3000. Therefore, ERF5 may play an important role in plant innate immunity, likely through coordinating chitin and other defense pathways in plants in response to different pathogens.

  13. Specificity of RSG-1.2 Peptide Binding to RRE-IIB RNA Element of HIV-1 over Rev Peptide Is Mainly Enthalpic in Origin

    PubMed Central

    Kumar, Santosh; Bose, Debojit; Suryawanshi, Hemant; Sabharwal, Harshana; Mapa, Koyeli; Maiti, Souvik

    2011-01-01

    Rev is an essential HIV-1 regulatory protein which binds to the Rev responsive element (RRE) present within the env gene of HIV-1 RNA genome. This binding facilitates the transport of the RNA to the cytoplasm, which in turn triggers the switch between viral latency and active viral replication. Essential components of this complex have been localized to a minimal arginine rich Rev peptide and stem IIB region of RRE. A synthetic peptide known as RSG-1.2 binds with high binding affinity and specificity to the RRE-IIB than the Rev peptide, however the thermodynamic basis of this specificity has not yet been addressed. The present study aims to probe the thermodynamic origin of this specificity of RSG-1.2 over Rev Peptide for RRE-IIB. The temperature dependent melting studies show that RSG-1.2 binding stabilizes the RRE structure significantly (ΔT m = 4.3°C), in contrast to Rev binding. Interestingly the thermodynamic signatures of the binding have also been found to be different for both the peptides. At pH 7.5, RSG-1.2 binds RRE-IIB with a Ka = 16.2±0.6×107 M−1 where enthalpic change ΔH = −13.9±0.1 kcal/mol is the main driving force with limited unfavorable contribution from entropic change TΔS = −2.8±0.1 kcal/mol. A large part of ΔH may be due to specific stacking between U72 and Arg15. In contrast binding of Rev (Ka = 3.1±0.4×107 M−1) is driven mainly by entropy (ΔH = 0 kcal/mol and TΔS = 10.2±0.2 kcal/mol) which arises from major conformational changes in the RNA upon binding. PMID:21853108

  14. Specificity of RSG-1.2 peptide binding to RRE-IIB RNA element of HIV-1 over Rev peptide is mainly enthalpic in origin.

    PubMed

    Kumar, Santosh; Bose, Debojit; Suryawanshi, Hemant; Sabharwal, Harshana; Mapa, Koyeli; Maiti, Souvik

    2011-01-01

    Rev is an essential HIV-1 regulatory protein which binds to the Rev responsive element (RRE) present within the env gene of HIV-1 RNA genome. This binding facilitates the transport of the RNA to the cytoplasm, which in turn triggers the switch between viral latency and active viral replication. Essential components of this complex have been localized to a minimal arginine rich Rev peptide and stem IIB region of RRE. A synthetic peptide known as RSG-1.2 binds with high binding affinity and specificity to the RRE-IIB than the Rev peptide, however the thermodynamic basis of this specificity has not yet been addressed. The present study aims to probe the thermodynamic origin of this specificity of RSG-1.2 over Rev Peptide for RRE-IIB. The temperature dependent melting studies show that RSG-1.2 binding stabilizes the RRE structure significantly (ΔT(m) = 4.3°C), in contrast to Rev binding. Interestingly the thermodynamic signatures of the binding have also been found to be different for both the peptides. At pH 7.5, RSG-1.2 binds RRE-IIB with a K(a) = 16.2±0.6×10(7) M(-1) where enthalpic change ΔH = -13.9±0.1 kcal/mol is the main driving force with limited unfavorable contribution from entropic change TΔS = -2.8±0.1 kcal/mol. A large part of ΔH may be due to specific stacking between U72 and Arg15. In contrast binding of Rev (K(a) = 3.1±0.4×10(7) M(-1)) is driven mainly by entropy (ΔH = 0 kcal/mol and TΔS = 10.2±0.2 kcal/mol) which arises from major conformational changes in the RNA upon binding.

  15. Evolutionarily Conserved, Growth Plate Zone-Specific Regulation of the Matrilin-1 Promoter: L-Sox5/Sox6 and Nfi Factors Bound near TATA Finely Tune Activation by Sox9 ▿

    PubMed Central

    Nagy, Andrea; Kénesi, Erzsébet; Rentsendorj, Otgonchimeg; Molnár, Annamária; Szénási, Tibor; Sinkó, Ildikó; Zvara, Ágnes; Thottathil Oommen, Sajit; Barta, Endre; Puskás, László G.; Lefebvre, Veronique; Kiss, Ibolya

    2011-01-01

    To help uncover the mechanisms underlying the staggered expression of cartilage-specific genes in the growth plate, we dissected the transcriptional mechanisms driving expression of the matrilin-1 gene (Matn1). We show that a unique assembly of evolutionarily conserved cis-acting elements in the Matn1 proximal promoter restricts expression to the proliferative and prehypertrophic zones of the growth plate. These elements functionally interact with distal elements and likewise are capable of restricting the domain of activity of a pancartilaginous Col2a1 enhancer. The proximal elements include a Pe1 element binding the chondrogenic L-Sox5, Sox6, and Sox9 proteins, a SI element binding Nfi proteins, and an initiator Ine element binding the Sox trio and other factors. Sox9 binding to Pe1 is indispensable for functional interaction with the distal promoter. Binding of L-Sox5/Sox6 to Ine and Nfib to SI modulates Sox9 transactivation in a protein dose-dependent manner, possibly to enhance Sox9 activity in early stages of chondrogenesis and repress it at later stages. Hence, our data suggest a novel model whereby Sox and Nfi proteins bind to conserved Matn1 proximal elements and functionally interact with each other to finely tune gene expression in specific zones of the cartilage growth plate. PMID:21173167

  16. Functional analysis of the Arabidopsis PLDZ2 promoter reveals an evolutionarily conserved low-Pi-responsive transcriptional enhancer element

    PubMed Central

    Oropeza-Aburto, Araceli; Cruz-Ramírez, Alfredo; Acevedo-Hernández, Gustavo J.; Pérez-Torres, Claudia-Anahí; Caballero-Pérez, Juan; Herrera-Estrella, Luis

    2012-01-01

    Plants have evolved a plethora of responses to cope with phosphate (Pi) deficiency, including the transcriptional activation of a large set of genes. Among Pi-responsive genes, the expression of the Arabidopsis phospholipase DZ2 (PLDZ2) is activated to participate in the degradation of phospholipids in roots in order to release Pi to support other cellular activities. A deletion analysis was performed to identify the regions determining the strength, tissue-specific expression, and Pi responsiveness of this regulatory region. This study also reports the identification and characterization of a transcriptional enhancer element that is present in the PLDZ2 promoter and able to confer Pi responsiveness to a minimal, inactive 35S promoter. This enhancer also shares the cytokinin and sucrose responsive properties observed for the intact PLDZ2 promoter. The EZ2 element contains two P1BS motifs, each of which is the DNA binding site of transcription factor PHR1. Mutation analysis showed that the P1BS motifs present in EZ2 are necessary but not sufficient for the enhancer function, revealing the importance of adjacent sequences. The structural organization of EZ2 is conserved in the orthologous genes of at least eight families of rosids, suggesting that architectural features such as the distance between the two P1BS motifs are also important for the regulatory properties of this enhancer element. PMID:22210906

  17. Glucocorticoid Regulation of the Vitamin D Receptor

    PubMed Central

    Hidalgo, Alejandro A.; Trump, Donald L.; Johnson, Candace S.

    2010-01-01

    Many studies indicate calcitriol has potent anti-tumor activity in different types of cancers. However, high levels of vitamin D can produce hypercalcemia in some patients. Glucocorticoids are used to ameliorate hypercalcemia and to enhance calcitriol anti-tumor activity. Calcitriol in combination with the glucocorticoid dexamethasone (Dex) increased vitamin D receptor (VDR) protein levels and ligand binding in squamous cell carcinoma VII (SCC). In this study we found that both calcitriol and Dex induce VDR- and glucocorticoid receptor (GR)-mediated transcription respectively, indicating both hormone receptors are active in SCC. Pre-treatment with Dex increases VDR-mediated transcription at the human CYP24A1 promoter. Whereas, pre-treatment with other steroid hormones, including dihydrotestosterone and R1881, has no effect on VDR-mediated transcription. Real-time PCR indicates treatment with Dex increases Vdr transcripts in a time-dependent manner, suggesting Dex may directly regulate expression of Vdr. Numerous putative glucocorticoid response elements (GREs) were found in the Vdr gene. Chromatin immunoprecipitation (ChIP) assay demonstrated GR binding at several putative GREs located within the mouse Vdr gene. However, none of the putative GREs studied increase GR-mediated transcription in luciferase reporter assays. In an attempt to identify the response element responsible for Vdr transcript regulation, future studies will continue to analyze newly identified GREs more distal from the Vdr gene promoter. PMID:20398752

  18. Investigating the Regulation and Potential Role of Nonhypoxic Hypoxia-Inducible Factor 1 (HIF-1) in Aromatase Inhibitor Resistant Breast Cancer

    DTIC Science & Technology

    2013-10-01

    hypoxia responsive element ( HRE ) to which HIF-1 binds in order to regulate vimentin gene expresson has not been identified. We have currently, analyzed...the vimentin promoter and have identified 2 potential HRE sites, based on sequence (Figure 5). Primers have been designed and ordered, and

  19. Distinctive Roles for Amygdalar CREB in Reconsolidation and Extinction of Fear Memory

    ERIC Educational Resources Information Center

    Tronson, Natalie C.; Wiseman, Shari L.; Neve, Rachael L.; Nestler, Eric J.; Olausson, Peter; Taylor, Jane R.

    2012-01-01

    Cyclic AMP response element binding protein (CREB) plays a critical role in fear memory formation. Here we determined the role of CREB selectively within the amygdala in reconsolidation and extinction of auditory fear. Viral overexpression of the inducible cAMP early repressor (ICER) or the dominant-negative mCREB, specifically within the lateral…

  20. CYCLIC AMP-DEPENDENT PROTEIN KINASE INDUCTION BY POLYCHLORINATED BIPHENYLS (PCBS) STIMULATES CREB PHOSPHORYLATION VIA A CALCIUM-DEPENDENT, PKC-INDEPENDENT PATHWAY IN CORTICAL NEURONS.

    EPA Science Inventory

    We have previously demonstrated that the PCB mixture, Aroclor 1254 (A1254), increases the phosphorylated form of CREB (pCREB), the cAMP-responsive element binding protein. This transcription factor is important in nervous system development and plasticity. Phosphorylation
    of C...

  1. Transcription factor assisted loading and enhancer dynamics dictate the hepatic fasting response

    PubMed Central

    Goldstein, Ido; Baek, Songjoon; Presman, Diego M.; Paakinaho, Ville; Swinstead, Erin E.; Hager, Gordon L.

    2017-01-01

    Fasting elicits transcriptional programs in hepatocytes leading to glucose and ketone production. This transcriptional program is regulated by many transcription factors (TFs). To understand how this complex network regulates the metabolic response to fasting, we aimed at isolating the enhancers and TFs dictating it. Measuring chromatin accessibility revealed that fasting massively reorganizes liver chromatin, exposing numerous fasting-induced enhancers. By utilizing computational methods in combination with dissecting enhancer features and TF cistromes, we implicated four key TFs regulating the fasting response: glucocorticoid receptor (GR), cAMP responsive element binding protein 1 (CREB1), peroxisome proliferator activated receptor alpha (PPARA), and CCAAT/enhancer binding protein beta (CEBPB). These TFs regulate fuel production by two distinctly operating modules, each controlling a separate metabolic pathway. The gluconeogenic module operates through assisted loading, whereby GR doubles the number of sites occupied by CREB1 as well as enhances CREB1 binding intensity and increases accessibility of CREB1 binding sites. Importantly, this GR-assisted CREB1 binding was enhancer-selective and did not affect all CREB1-bound enhancers. Single-molecule tracking revealed that GR increases the number and DNA residence time of a portion of chromatin-bound CREB1 molecules. These events collectively result in rapid synergistic gene expression and higher hepatic glucose production. Conversely, the ketogenic module operates via a GR-induced TF cascade, whereby PPARA levels are increased following GR activation, facilitating gradual enhancer maturation next to PPARA target genes and delayed ketogenic gene expression. Our findings reveal a complex network of enhancers and TFs that dynamically cooperate to restore homeostasis upon fasting. PMID:28031249

  2. Functional Elements on SIRPα IgV domain Mediate Cell Surface Binding to CD47

    PubMed Central

    Liu, Yuan; Tong, Qiao; Zhou, Yubin; Lee, Hsiau-Wei; Yang, Jenny J.; Bühring, Hans-Jörg; Chen, Yi-Tien; Ha, Binh; Chen, Celia X-J.; Zen, Ke

    2007-01-01

    Summary SIRPα and SIRPβ1, the two major isoforms of the signal regulatory protein (SIRP) family, are co-expressed in human leukocytes but mediate distinct extracellular binding interactions and divergent cell signaling responses. Previous studies have demonstrated that binding of SIRPα with CD47, another important cell surface molecule, through the extracellular IgV domain regulates important leukocyte functions including macrophage recognition, leukocyte adhesion and transmigration. Although SIRPβ1 shares highly homologous extracellular IgV structure with SIRPα, it does not bind to CD47. In this study, we defined key amino acid residues exclusively expressing in the IgV domain of SIRPα, but not SIRPβ1, which determine the extracellular binding interaction of SIRPα to CD47. These key residues include Gln67, a small hydrophobic amino acid (Ala or Val) at the 57th position and Met102. We found that Gln67 and Ala/Val57 are critical. Mutation of either of these residues abates SIRPα directly binding to CD47. Functional cell adhesion and leukocyte transmigration assays further demonstrated central roles of Gln67 and Ala/Val57 in SIRPα extracellular binding mediated cell interactions and cell migration. Another SIRPα-specific residue, Met102, appears to assist SIRPα IgV binding through Gln67 and Ala/Val57. An essential role of these amino acids in SIRPα binding to CD47 was further confirmed by introducing these residues into the SIRPβ1 IgV domain, which dramatically converts SIRPβ1 into a CD47-binding molecule. Our results thus revealed the molecular basis by which SIRPα selectively binds to CD47 and shed new light into the structural mechanisms of SIRP isoform mediated distinctive extracellular interactions and cellular responses. PMID:17070842

  3. Functional elements on SIRPalpha IgV domain mediate cell surface binding to CD47.

    PubMed

    Liu, Yuan; Tong, Qiao; Zhou, Yubin; Lee, Hsiau-Wei; Yang, Jenny J; Bühring, Hans-Jörg; Chen, Yi-Tien; Ha, Binh; Chen, Celia X-J; Yang, Yang; Zen, Ke

    2007-01-19

    SIRPalpha and SIRPbeta1, the two major isoforms of the signal regulatory protein (SIRP) family, are co-expressed in human leukocytes but mediate distinct extracellular binding interactions and divergent cell signaling responses. Previous studies have demonstrated that binding of SIRPalpha with CD47, another important cell surface molecule, through the extracellular IgV domain regulates important leukocyte functions including macrophage recognition, leukocyte adhesion and transmigration. Although SIRPbeta1 shares highly homologous extracellular IgV structure with SIRPalpha, it does not bind to CD47. Here, we defined key amino acid residues exclusively expressing in the IgV domain of SIRPalpha, but not SIRPbeta1, which determine the extracellular binding interaction of SIRPalpha to CD47. These key residues include Gln67, a small hydrophobic amino acid (Ala or Val) at the 57th position and Met102. We found that Gln67 and Ala/Val57 are critical. Mutation of either of these residues abates SIRPalpha directly binding to CD47. Functional cell adhesion and leukocyte transmigration assays further demonstrated central roles of Gln67 and Ala/Val57 in SIRPalpha extracellular binding mediated cell interactions and cell migration. Another SIRPalpha-specific residue, Met102, appears to assist SIRPalpha IgV binding through Gln67 and Ala/Val57. An essential role of these amino acid residues in SIRPalpha binding to CD47 was further confirmed by introducing these residues into the SIRPbeta1 IgV domain, which dramatically converts SIRPbeta1 into a CD47-binding molecule. Our results thus revealed the molecular basis by which SIRPalpha binds to CD47 and shed new light into the structural mechanisms of SIRP isoform mediated distinctive extracellular interactions and cellular responses.

  4. The Basic Leucine Zipper Transcription Factor ABSCISIC ACID RESPONSE ELEMENT-BINDING FACTOR2 Is an Important Transcriptional Regulator of Abscisic Acid-Dependent Grape Berry Ripening Processes1[W][OPEN

    PubMed Central

    Nicolas, Philippe; Lecourieux, David; Kappel, Christian; Cluzet, Stéphanie; Cramer, Grant; Delrot, Serge; Lecourieux, Fatma

    2014-01-01

    In grape (Vitis vinifera), abscisic acid (ABA) accumulates during fruit ripening and is thought to play a pivotal role in this process, but the molecular basis of this control is poorly understood. This work characterizes ABSCISIC ACID RESPONSE ELEMENT-BINDING FACTOR2 (VvABF2), a grape basic leucine zipper transcription factor belonging to a phylogenetic subgroup previously shown to be involved in ABA and abiotic stress signaling in other plant species. VvABF2 transcripts mainly accumulated in the berry, from the onset of ripening to the harvesting stage, and were up-regulated by ABA. Microarray analysis of transgenic grape cells overexpressing VvABF2 showed that this transcription factor up-regulates and/or modifies existing networks related to ABA responses. In addition, grape cells overexpressing VvABF2 exhibited enhanced responses to ABA treatment compared with control cells. Among the VvABF2-mediated responses highlighted in this study, the synthesis of phenolic compounds and cell wall softening were the most strongly affected. VvABF2 overexpression strongly increased the accumulation of stilbenes that play a role in plant defense and human health (resveratrol and piceid). In addition, the firmness of fruits from tomato (Solanum lycopersicum) plants overexpressing VvABF2 was strongly reduced. These data indicate that VvABF2 is an important transcriptional regulator of ABA-dependent grape berry ripening. PMID:24276949

  5. Different mechanisms are involved in the transcriptional activation by yeast heat shock transcription factor through two different types of heat shock elements.

    PubMed

    Hashikawa, Naoya; Yamamoto, Noritaka; Sakurai, Hiroshi

    2007-04-06

    The hydrophobic repeat is a conserved structural motif of eukaryotic heat shock transcription factor (HSF) that enables HSF to form a homotrimer. Homotrimeric HSF binds to heat shock elements (HSEs) consisting of three inverted repeats of the sequence nGAAn. Sequences consisting of four or more nGAAn units are bound cooperatively by two HSF trimers. We show that in Saccharomyces cerevisiae cells oligomerization-defective Hsf1 is not able to bind HSEs with three units and is not extensively phosphorylated in response to stress; it is therefore unable to activate genes containing this type of HSE. Several lines of evidence indicate that oligomerization is a prerequisite for stress-induced hyperphosphorylation of Hsf1. In contrast, oligomerization and hyperphosphorylation are not necessary for gene activation via HSEs with four units. Intragenic suppressor screening of oligomerization-defective hsf1 showed that an interface between adjacent DNA-binding domains is important for the binding of Hsf1 to the HSE. We suggest that Saccharomyces cerevisiae HSEs with different structures are regulated differently; HSEs with three units require Hsf1 to be both oligomerized and hyperphosphorylated, whereas HSEs with four or more units do not require either.

  6. Transcription factor MBF-I interacts with metal regulatory elements of higher eucaryotic metallothionein genes.

    PubMed Central

    Imbert, J; Zafarullah, M; Culotta, V C; Gedamu, L; Hamer, D

    1989-01-01

    Metallothionein (MT) gene promoters in higher eucaryotes contain multiple metal regulatory elements (MREs) that are responsible for the metal induction of MT gene transcription. We identified and purified to near homogeneity a 74-kilodalton mouse nuclear protein that specifically binds to certain MRE sequences. This protein, MBF-I, was purified employing as an affinity reagent a trout MRE that is shown to be functional in mouse cells but which lacks the G+C-rich and SP1-like sequences found in many mammalian MT gene promoters. Using point-mutated MREs, we showed that there is a strong correlation between DNA binding in vitro and MT gene regulation in vivo, suggesting a direct role of MBF-I in MT gene transcription. We also showed that MBF-I can induce MT gene transcription in vitro in a mouse extract and that this stimulation requires zinc. Images PMID:2586522

  7. Abscisic acid-activated SNRK2 protein kinases function in the gene-regulation pathway of ABA signal transduction by phosphorylating ABA response element-binding factors.

    PubMed

    Kobayashi, Yuhko; Murata, Michiharu; Minami, Hideyuki; Yamamoto, Shuhei; Kagaya, Yasuaki; Hobo, Tokunori; Yamamoto, Akiko; Hattori, Tsukaho

    2005-12-01

    The plant hormone abscisic acid (ABA) induces gene expression via the ABA-response element (ABRE) present in the promoters of ABA-regulated genes. A group of bZIP proteins have been identified as ABRE-binding factors (ABFs) that activate transcription through this cis element. A rice ABF, TRAB1, has been shown to be activated via ABA-dependent phosphorylation. While a large number of signalling factors have been identified that are involved in stomatal regulation by ABA, relatively less is known about the ABA-signalling pathway that leads to gene expression. We have shown recently that three members of the rice SnRK2 protein kinase family, SAPK8, SAPK9 and SAPK10, are activated by ABA signal as well as by hyperosmotic stress. Here we show that transient overexpression in cultured cell protoplasts of these ABA-activated SnRK2 protein kinases leads to the activation of an ABRE-regulated promoter, suggesting that these kinases are involved in the gene-regulation pathway of ABA signalling. We further show several lines of evidence that these ABA-activated SnRK2 protein kinases directly phosphorylate TRAB1 in response to ABA. Kinetic analysis of SAPK10 activation and TRAB1 phosphorylation indicated that the latter immediately followed the former. TRAB1 was found to be phosphorylated not only in response to ABA, but also in response to hyperosmotic stress, which was interpreted as the consequence of phosphorylation of TRAB1 by hyperosmotically activated SAPKs. Physical interaction between TRAB1 and SAPK10 in vivo was demonstrated by a co-immunoprecipitation experiment. Finally, TRAB1 was phosphorylated in vitro by the ABA-activated SnRK2 protein kinases at Ser102, which is phosphorylated in vivo in response to ABA and is critical for the activation function.

  8. N-3 polyunsaturated fatty acid regulation of hepatic gene transcription

    PubMed Central

    Jump, Donald B.

    2009-01-01

    Purpose of review The liver plays a central role in whole body lipid metabolism and adapts rapidly to changes in dietary fat composition. This adaption involves changes in the expression of genes involved in glycolysis, de-novo lipogenesis, fatty acid elongation, desaturation and oxidation. This review brings together metabolic and molecular studies that help explain n-3 (omega-3) polyunsaturated fatty acid regulation of hepatic gene transcription. Recent findings Dietary n-3 polyunsaturated fatty acid regulates hepatic gene expression by targeting three major transcriptional regulatory networks: peroxisome proliferator-activated receptor α, sterol regulatory element binding protein-1 and the carbohydrate regulatory element binding protein/Max-like factor X heterodimer. 22 : 6,n-3, the most prominent n-3 polyunsaturated fatty acid in tissues, is a weak activator of peroxisome proliferator-activated receptor α. Hepatic metabolism of 22 : 6,n-3, however, generates 20 : 5,n-3, a strong peroxisome proliferator-activated receptor α activator. In contrast to peroxisome proliferator-activated receptor α, 22 : 6,n-3 is the most potent fatty acid regulator of hepatic sterol regulatory element binding protein-1. 22 : 6,n-3 suppresses sterol regulatory element binding protein-1 gene expression while enhancing degradation of nuclear sterol regulatory element binding protein-1 through 26S proteasome and Erk1/2-dependent mechanisms. Both n-3 and n-6 polyunsaturated fatty acid suppress carbohydrate regulatory element binding protein and Max-like factor X nuclear abundance and interfere with glucose-regulated hepatic metabolism. Summary These studies have revealed unique mechanisms by which specific polyunsaturated fatty acids control peroxisome proliferator activated receptor α, sterol regulatory element binding protein-1 and carbohydrate regulatory element binding protein/Max-like factor X function. As such, specific metabolic and signal transduction pathways contribute significantly to the fatty acid regulation of these transcription factors and their corresponding regulatory networks. PMID:18460914

  9. Direct trans-activation of the human cyclin D2 gene by the oncogene product Tax of human T-cell leukemia virus type I.

    PubMed

    Huang, Y; Ohtani, K; Iwanaga, R; Matsumura, Y; Nakamura, M

    2001-03-01

    Cyclins are one of the pivotal determinants regulating cell cycle progression. We previously reported that the trans-activator Tax of human T-cell leukemia virus type I (HTLV-I) induces endogenous cyclin D2 expression along with cell cycle progression in a resting human T-cell line, Kit 225, suggesting a role of cyclin D2 in Tax-mediated cell cycle progression. The cyclin D2 gene has a typical E2F binding element, raising the possibility that induction of cyclin D2 expression is a consequence of cell cycle progression. In this study, we examined the role and molecular mechanism of induction of the endogenous human cyclin D2 gene by Tax. Introduction of p19(INK4d), a cyclin dependent kinase (CDK) inhibitor of the INK4 family specific for D-type CDK, inhibited Tax-mediated activation of E2F, indicating requirement of D-type CDK in Tax-mediated activation of E2F. Previously indicated E2F binding element and two NF-kappaB-like binding elements in the 1.6 kbp cyclin D2 promoter fragment had little, if any, effect on responsiveness to Tax. We found that trans-activation of the cyclin D2 promoter by Tax was mainly mediated by a newly identified NF-kappaB-like element with auxiliary contribution of a CRE-like element residing in sequences downstream of -444 which were by themselves sufficient for trans-activation by Tax. These results indicate that Tax directly trans-activates the cyclin D2 gene, resulting in growth promotion and perhaps leukemogenesis through activation of D-type CDK.

  10. Azadirachtin interacts with retinoic acid receptors and inhibits retinoic acid-mediated biological responses.

    PubMed

    Thoh, Maikho; Babajan, Banaganapalli; Raghavendra, Pongali B; Sureshkumar, Chitta; Manna, Sunil K

    2011-02-11

    Considering the role of retinoids in regulation of more than 500 genes involved in cell cycle and growth arrest, a detailed understanding of the mechanism and its regulation is useful for therapy. The extract of the medicinal plant Neem (Azadirachta indica) is used against several ailments especially for anti-inflammatory, anti-itching, spermicidal, anticancer, and insecticidal activities. In this report we prove the detailed mechanism on the regulation of retinoic acid-mediated cell signaling by azadirachtin, active components of neem extract. Azadirachtin repressed all trans-retinoic acid (ATRA)-mediated nuclear transcription factor κB (NF-κB) activation, not the DNA binding but the NF-κB-dependent gene expression. It did not inhibit IκBα degradation, IκBα kinase activity, or p65 phosphorylation and its nuclear translocation but inhibited NF-κB-dependent reporter gene expression. Azadirachtin inhibited TRAF6-mediated, but not TRAF2-mediated NF-κB activation. It inhibited ATRA-induced Sp1 and CREB (cAMP-response element-binding protein) DNA binding. Azadirachtin inhibited ATRA binding with retinoid receptors, which is supported by biochemical and in silico evidences. Azadirachtin showed strong interaction with retinoid receptors. It suppressed ATRA-mediated removal of retinoid receptors, bound with DNA by inhibiting ATRA binding to its receptors. Overall, our data suggest that azadirachtin interacts with retinoic acid receptors and suppresses ATRA binding, inhibits falling off the receptors, and activates transcription factors like CREB, Sp1, NF-κB, etc. Thus, azadirachtin exerts anti-inflammatory and anti-metastatic responses by a novel pathway that would be beneficial for further anti-inflammatory and anti-cancer therapies.

  11. Endoplasmic reticulum stress-responsive transcription factor ATF6α directs recruitment of the Mediator of RNA polymerase II transcription and multiple histone acetyltransferase complexes.

    PubMed

    Sela, Dotan; Chen, Lu; Martin-Brown, Skylar; Washburn, Michael P; Florens, Laurence; Conaway, Joan Weliky; Conaway, Ronald C

    2012-06-29

    The basic leucine zipper transcription factor ATF6α functions as a master regulator of endoplasmic reticulum (ER) stress response genes. Previous studies have established that, in response to ER stress, ATF6α translocates to the nucleus and activates transcription of ER stress response genes upon binding sequence specifically to ER stress response enhancer elements in their promoters. In this study, we investigate the biochemical mechanism by which ATF6α activates transcription. By exploiting a combination of biochemical and multidimensional protein identification technology-based mass spectrometry approaches, we have obtained evidence that ATF6α functions at least in part by recruiting to the ER stress response enhancer elements of ER stress response genes a collection of RNA polymerase II coregulatory complexes, including the Mediator and multiple histone acetyltransferase complexes, among which are the Spt-Ada-Gcn5 acetyltransferase (SAGA) and Ada-Two-A-containing (ATAC) complexes. Our findings shed new light on the mechanism of action of ATF6α, and they outline a straightforward strategy for applying multidimensional protein identification technology mass spectrometry to determine which RNA polymerase II transcription factors and coregulators are recruited to promoters and other regulatory elements to control transcription.

  12. Molecular identification and transcriptional regulation of porcine IFIT2 gene.

    PubMed

    Yang, Xiuqin; Jing, Xiaoyan; Song, Yanfang; Zhang, Caixia; Liu, Di

    2018-04-06

    IFN-induced protein with tetratricopeptide repeats 2 (IFIT2) plays important roles in host defense against viral infection as revealed by studies in humans and mice. However, little is known on porcine IFIT2 (pIFIT2). Here, we performed molecular cloning, expression profile, and transcriptional regulation analysis of pIFIT2. pIFIT2 gene, located on chromosome 14, is composed of two exons and have a complete coding sequence of 1407 bp. The encoded polypeptide, 468 aa in length, has three tetratricopeptide repeat motifs. pIFIT2 gene was unevenly distributed in all eleven tissues studied with the most abundance in spleen. Poly(I:C) treatment notably strongly upregulated the mRNA level and promoter activity of pIFIT2 gene. Upstream sequence of 1759 bp from the start codon which was assigned +1 here has promoter activity, and deltaEF1 acts as transcription repressor through binding to sequences at position - 1774 to - 1764. Minimal promoter region exists within nucleotide position - 162 and - 126. Two adjacent interferon-stimulated response elements (ISREs) and two nuclear factor (NF)-κB binding sites were identified within position - 310 and - 126. The ISRE elements act alone and in synergy with the one closer to start codon having more strength, so do the NF-κB binding sites. Synergistic effect was also found between the ISRE and NF-κB binding sites. Additionally, a third ISRE element was identified within position - 1661 to - 1579. These findings will contribute to clarifying the antiviral effect and underlying mechanisms of pIFIT2.

  13. Analysis of Protein-RNA and Protein-Peptide Interactions in Equine Infectious Anemia

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lee, Jae-Hyung

    2007-01-01

    Macromolecular interactions are essential for virtually all cellular functions including signal transduction processes, metabolic processes, regulation of gene expression and immune responses. This dissertation focuses on the characterization of two important macromolecular interactions involved in the relationship between Equine Infectious Anemia Virus (EIAV) and its host cell in horse: (1) the interaction between the EIAV Rev protein and its binding site, the Rev-responsive element (RRE) and (2) interactions between equine MHC class I molecules and epitope peptides derived from EIAV proteins. EIAV, one of the most divergent members of the lentivirus family, has a single-stranded RNA genome and carries severalmore » regulatory and structural proteins within its viral particle. Rev is an essential EIAV regulatory encoded protein that interacts with the viral RRE, a specific binding site in the viral mRNA. Using a combination of experimental and computational methods, the interactions between EIAV Rev and RRE were characterized in detail. EIAV Rev was shown to have a bipartite RNA binding domain contain two arginine rich motifs (ARMs). The RRE secondary structure was determined and specific structural motifs that act as cis-regulatory elements for EIAV Rev-RRE interaction were identified. Interestingly, a structural motif located in the high affinity Rev binding site is well conserved in several diverse lentiviral genoes, including HIV-1. Macromolecular interactions involved in the immune response of the horse to EIAV infection were investigated by analyzing complexes between MHC class I proteins and epitope peptides derived from EIAV Rev, Env and Gag proteins. Computational modeling results provided a mechanistic explanation for the experimental finding that a single amino acid change in the peptide binding domain of the quine MHC class I molecule differentially affectes the recognitino of specific epitopes by EIAV-specific CTL. Together, the findings in this dissertation provide novel insights into the strategy used by EIAV to replicate itself, and provide new details about how the host cell responds to and defends against EIAV upon the infection. Moreover, they have contributed to the understanding of the macromolecular recognition events that regulate these processes.« less

  14. Identification of ERdj3 and OBF-1/BOB-1/OCA-B as direct targets of XBP-1 during plasma cell differentiation.

    PubMed

    Shen, Ying; Hendershot, Linda M

    2007-09-01

    Plasma cell differentiation is accompanied by a modified unfolded protein response (UPR), which involves activation of the Ire1 and activating transcription factor 6 branches, but not the PKR-like endoplasmic reticulum kinase branch. Ire1-mediated splicing of XBP-1 (XBP-1(S)) is required for terminal differentiation, although the direct targets of XBP-1(S) in this process have not been identified. We demonstrate that XBP-1(S) binds to the promoter of ERdj3 in plasmacytoma cells and in LPS-stimulated primary splenic B cells, which corresponds to increased expression of ERdj3 transcripts in both cases. When small hairpin RNA was used to decrease XBP-1 expression in plasmacytoma lines, ERdj3 transcripts were concomitantly reduced. The accumulation of Ig gamma H chain protein was also diminished, but unexpectedly this occurred at the transcriptional level as opposed to effects on H chain stability. The decrease in H chain transcripts correlated with a reduction in mRNA encoding the H chain transcription factor, OBF-1/BOB-1/OCA-B. Chromatin immunoprecipitation experiments revealed that XBP-1(S) binds to the OBF-1/BOB-1/OCA-B promoter in the plasmacytoma line and in primary B cells not only during plasma cell differentiation, but also in response to classical UPR activation. Gel shift assays suggest that XBP-1(S) binding occurs through a UPR element conserved in both murine and human OBF-1/BOB-1/OCA-B promoters as opposed to endoplasmic reticulum stress response elements. Our studies are the first to identify direct downstream targets of XBP-1(S) during either plasma cell differentiation or the UPR. In addition, our data further define the XBP-1(S)-binding sequence and provide yet another role for this protein as a master regulator of plasma cell differentiation.

  15. Differential Regulation of Interferon Responses by Ebola and Marburg Virus VP35 Proteins

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Edwards, Megan R.; Liu, Gai; Mire, Chad E.

    2016-02-11

    Suppression of innate immune responses during filoviral infection contributes to disease severity. Ebola (EBOV) and Marburg (MARV) viruses each encode a VP35 protein that suppresses RIG-I-like receptor signaling and interferon-α/β (IFN-α/β) production by several mechanisms, including direct binding to double stranded RNA (dsRNA). Here, we demonstrate that in cell culture, MARV infection results in a greater upregulation of IFN responses as compared to EBOV infection. This correlates with differences in the efficiencies by which EBOV and MARV VP35s antagonize RIG-I signaling. Furthermore, structural and biochemical studies suggest that differential recognition of RNA elements by the respective VP35 C-terminal IFN inhibitorymore » domain (IID) rather than affinity for RNA by the respective VP35s is critical for this observation. Our studies reveal functional differences in EBOV versus MARV VP35 RNA binding that result in unexpected differences in the host response to deadly viral pathogens.« less

  16. n-Alkane and clofibrate, a peroxisome proliferator, activate transcription of ALK2 gene encoding cytochrome P450alk2 through distinct cis-acting promoter elements in Candida maltosa

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kogure, Takahisa; Faculty of Applied Life Sciences, Niigata University of Pharmacy and Applied Life Sciences, Higashijima 265-1, Niitsu, Niigata 956-8603; Takagi, Masamichi

    2005-04-01

    The ALK2 gene, encoding one of the n-alkane-hydroxylating cytochromes P450 in Candida maltosa, is induced by n-alkanes and a peroxisome proliferator, clofibrate. Deletion analysis of this gene's promoter revealed two cis-acting elements-an n-alkane-responsive element (ARE2) and a clofibrate-responsive element (CRE2)-that partly overlap in sequence but have distinct functions. ARE2-mediated activation responded to n-alkanes but not to clofibrate and was repressed by glucose. CRE2-mediated activation responded to polyunsaturated fatty acids and steroid hormones as well as to peroxisome proliferators but not to n-alkanes, and it was not repressed by glucose. Both elements mediated activation by oleic acid. Mutational analysis demonstrated thatmore » three CCG sequences in CRE2 were critical to the activation by clofibrate as well as to the in vitro binding of a specific protein to this element. These findings suggest that ALK2 is induced by peroxisome proliferators and steroid hormones through a specific CRE2-mediated regulatory mechanism.« less

  17. Two residues in the basic region of the yeast transcription factor Yap8 are crucial for its DNA-binding specificity.

    PubMed

    Amaral, Catarina; Pimentel, Catarina; Matos, Rute G; Arraiano, Cecília M; Matzapetakis, Manolis; Rodrigues-Pousada, Claudina

    2013-01-01

    In Saccharomyces cerevisiae, the transcription factor Yap8 is a key determinant in arsenic stress response. Contrary to Yap1, another basic region-leucine zipper (bZIP) yeast regulator, Yap8 has a very restricted DNA-binding specificity and only orchestrates the expression of ACR2 and ACR3 genes. In the DNA-binding basic region, Yap8 has three distinct amino acids residues, Leu26, Ser29 and Asn31, at sites of highly conserved positions in the other Yap family of transcriptional regulators and Pap1 of Schizosaccharomyces pombe. To evaluate whether these residues are relevant to Yap8 specificity, we first built a homology model of the complex Yap8bZIP-DNA based on Pap1-DNA crystal structure. Several Yap8 mutants were then generated in order to confirm the contribution of the residues predicted to interact with DNA. Using bioinformatics analysis together with in vivo and in vitro approaches, we have identified several conserved residues critical for Yap8-DNA binding. Moreover, our data suggest that Leu26 is required for Yap8 binding to DNA and that this residue together with Asn31, hinder Yap1 response element recognition by Yap8, thus narrowing its DNA-binding specificity. Furthermore our results point to a role of these two amino acids in the stability of the Yap8-DNA complex.

  18. Site-specific cleavage of the transactivation response site of human immunodeficiency virus RNA with a tat-based chemical nuclease.

    PubMed Central

    Jayasena, S D; Johnston, B H

    1992-01-01

    tat, an essential transactivator of gene transcription in the human immunodeficiency virus (HIV), is believed to activate viral gene expression by binding to the transactivation response (TAR) site located at the 5' end of all viral mRNAs. The TAR element forms a stem-loop structure containing a 3-nucleotide bulge that is the site for tat binding and is required for transactivation. Here we report the synthesis of a site-specific chemical ribonuclease based on the TAR binding domain of the HIV type 1 (HIV-1) tat. A peptide consisting of this 24-amino acid domain plus an additional C-terminal cysteine residue was chemically synthesized and covalently linked to 1,10-phenanthroline at the cysteine residue. The modified peptide binds to TAR sequences of both HIV-1 and HIV-2 and, in the presence of cupric ions and a reducing agent, cleaves these RNAs at specific sites. Cleavage sites on TAR sequences are consistent with peptide binding to the 3-nucleotide bulge, and the relative displacement of cleavage sites on the two strands suggests peptide binding to the major groove of the RNA. These results and existing evidence of the rapid cellular uptake of tat-derived peptides suggest that chemical nucleases based on tat may be useful for inactivating HIV mRNA in vivo. Images PMID:1565648

  19. Induction of cyclooxygenase-2 by ginsenoside Rd via activation of CCAAT-enhancer binding proteins and cyclic AMP response binding protein

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Jeong, Hye Gwang; Pokharel, Yuba Raj; Han, Eun Hee

    2007-07-20

    Panax ginseng is a widely used herbal medicine in East Asia and is reported to have a variety of pharmacological effects against cardiovascular diseases and cancers. Here we show a unique effect of ginsenoside Rd (Rd) on cyclooxygenase-2 (COX-2) expression in RAW264.7 macrophages. Rd (100 {mu}g/ml), but not other ginsenosides induced COX-2 and increased prostaglandin E{sub 2} production. Gel shift and Western blot analyses using nuclear fractions revealed that Rd increased both the DNA binding of and the nuclear levels of CCAAT/enhancer binding protein (C/EBP){alpha}/{beta} and cyclic AMP response element binding protein (CREB), but not of p65, in RAW264.7 cells.more » Moreover, Rd increased the luciferase reporter gene activity in cells transfected with a 574-bp mouse COX-2 promoter construct. Site-specific mutation analyses confirmed that Rd-mediated transcriptional activation of COX-2 gene was regulated by C/EBP and CREB. These results provide evidence that Rd activated C/EBP and CREB, and that the activation of C/EBP and CREB appears to be essential for induction of COX-2 in RAW264.7 cells.« less

  20. Mechanism of repression of the inhibin alpha-subunit gene by inducible 3',5'-cyclic adenosine monophosphate early repressor.

    PubMed

    Burkart, Anna D; Mukherjee, Abir; Mayo, Kelly E

    2006-03-01

    The rodent ovary is regulated throughout the reproductive cycle to maintain normal cyclicity. Ovarian follicular development is controlled by changes in gene expression in response to the gonadotropins FSH and LH. The inhibin alpha-subunit gene belongs to a group of genes that is positively regulated by FSH and negatively regulated by LH. Previous studies established an important role for inducible cAMP early repressor (ICER) in repression of alpha-inhibin. These current studies investigate the mechanisms of repression by ICER. It is not clear whether all four ICER isoforms expressed in the ovary can act as repressors of the inhibin alpha-subunit gene. EMSAs demonstrate binding of all isoforms to the inhibin alpha-subunit CRE (cAMP response element), and transfection studies demonstrate that all isoforms can repress the inhibin alpha-subunit gene. Repression by ICER is dependent on its binding to DNA as demonstrated by mutations to ICER's DNA-binding domain. These mutational studies also demonstrate that repression by ICER is not dependent on heterodimerization with CREB (CRE-binding protein). Competitive EMSAs show that ICER effectively competes with CREB for binding to the inhibin alpha CRE in vitro. Chromatin immunoprecipitation assays demonstrate a replacement of CREB dimers bound to the inhibin alpha CRE by ICER dimers in ovarian granulosa cells in response to LH signaling. Thus, there is a temporal association of transcription factors bound to the inhibin alpha-CRE controlling inhibin alpha-subunit gene expression.

  1. Antihelminthic benzimidazoles are novel HIF activators that prevent oxidative neuronal death via binding to tubulin.

    PubMed

    Aleyasin, Hossein; Karuppagounder, Saravanan S; Kumar, Amit; Sleiman, Sama; Basso, Manuela; Ma, Thong; Siddiq, Ambreena; Chinta, Shankar J; Brochier, Camille; Langley, Brett; Haskew-Layton, Renee; Bane, Susan L; Riggins, Gregory J; Gazaryan, Irina; Starkov, Anatoly A; Andersen, Julie K; Ratan, Rajiv R

    2015-01-10

    Pharmacological activation of the adaptive response to hypoxia is a therapeutic strategy of growing interest for neurological conditions, including stroke, Huntington's disease, and Parkinson's disease. We screened a drug library with known safety in humans using a hippocampal neuroblast line expressing a reporter of hypoxia-inducible factor (HIF)-dependent transcription. Our screen identified more than 40 compounds with the ability to induce hypoxia response element-driven luciferase activity as well or better than deferoxamine, a canonical activator of hypoxic adaptation. Among the chemical entities identified, the antihelminthic benzimidazoles represented one pharmacophore that appeared multiple times in our screen. Secondary assays confirmed that antihelminthics stabilized the transcriptional activator HIF-1α and induced expression of a known HIF target gene, p21(cip1/waf1), in post-mitotic cortical neurons. The on-target effect of these agents in stimulating hypoxic signaling was binding to free tubulin. Moreover, antihelminthic benzimidazoles also abrogated oxidative stress-induced death in vitro, and this on-target effect also involves binding to free tubulin. These studies demonstrate that tubulin-binding drugs can activate a component of the hypoxic adaptive response, specifically the stabilization of HIF-1α and its downstream targets. Tubulin-binding drugs, including antihelminthic benzimidazoles, also abrogate oxidative neuronal death in primary neurons. Given their safety in humans and known ability to penetrate into the central nervous system, antihelminthic benzimidazoles may be considered viable candidates for treating diseases associated with oxidative neuronal death, including stroke.

  2. Nuclear factor ETF specifically stimulates transcription from promoters without a TATA box.

    PubMed

    Kageyama, R; Merlino, G T; Pastan, I

    1989-09-15

    Transcription factor ETF stimulates the expression of the epidermal growth factor receptor (EGFR) gene which does not have a TATA box in the promoter region. Here, we show that ETF recognizes various GC-rich sequences including stretches of deoxycytidine or deoxyguanosine residues and GC boxes with similar affinities. ETF also binds to TATA boxes but with a lower affinity. ETF stimulated in vitro transcription from several promoters without TATA boxes but had little or no effect on TATA box-containing promoters even though they had strong ETF-binding sites. These inactive ETF-binding sites became functional when placed upstream of the EGFR promoter whose own ETF-binding sites were removed. Furthermore, when a TATA box was introduced into the EGFR promoter, the responsiveness to ETF was abolished. These results indicate that ETF is a specific transcription factor for promoters which do not contain TATA elements.

  3. UV-B-Responsive Association of the Arabidopsis bZIP Transcription Factor ELONGATED HYPOCOTYL5 with Target Genes, Including Its Own Promoter[W][OPEN

    PubMed Central

    Binkert, Melanie; Kozma-Bognár, László; Terecskei, Kata; De Veylder, Lieven; Nagy, Ferenc; Ulm, Roman

    2014-01-01

    In plants subjected to UV-B radiation, responses are activated that minimize damage caused by UV-B. The bZIP transcription factor ELONGATED HYPOCOTYL5 (HY5) acts downstream of the UV-B photoreceptor UV RESISTANCE LOCUS8 (UVR8) and promotes UV-B-induced photomorphogenesis and acclimation. Expression of HY5 is induced by UV-B; however, the transcription factor(s) that regulate HY5 transcription in response to UV-B and the impact of UV-B on the association of HY5 with its target promoters are currently unclear. Here, we show that HY5 binding to the promoters of UV-B-responsive genes is enhanced by UV-B in a UVR8-dependent manner in Arabidopsis thaliana. In agreement, overexpression of REPRESSOR OF UV-B PHOTOMORPHOGENESIS2, a negative regulator of UVR8 function, blocks UV-B-responsive HY5 enrichment at target promoters. Moreover, we have identified a T/G-box in the HY5 promoter that is required for its UV-B responsiveness. We show that HY5 and its homolog HYH bind to the T/GHY5-box cis-acting element and that they act redundantly in the induction of HY5 expression upon UV-B exposure. Therefore, HY5 is enriched at target promoters in response to UV-B in a UVR8 photoreceptor-dependent manner, and HY5 and HYH interact directly with a T/G-box cis-acting element of the HY5 promoter, mediating the transcriptional activation of HY5 in response to UV-B. PMID:25351492

  4. The nuclear orphan receptors COUP-TF and ARP-1 positively regulate the trout estrogen receptor gene through enhancing autoregulation.

    PubMed Central

    Lazennec, G; Kern, L; Valotaire, Y; Salbert, G

    1997-01-01

    The rainbow trout estrogen receptor (rtER) is a positively autoregulated gene in liver cells. In a previous report, we showed that upregulation is mediated by an estrogen response element (ERE) located in the proximal promoter of the gene and that a half binding site for nuclear receptors (5'-TGACCT-3') located 15 bp upstream of the ERE is involved in the magnitude of the estrogen response. We now report that the human orphan receptor COUP-TF and a COUP-TF-like protein from trout liver are able to bind to the consensus half-site. When cotransfected with the rtER gene proximal promoter, COUP-TF had no regulatory functions on its own. Interestingly, COUP-TF enhanced rtER transactivation properties in the presence of estradiol in a dose-dependent manner when cotransfected with the rtER gene promoter. Unliganded retinoid receptor heterodimers had the same helper function as COUP-TF in the presence of estradiol but were switched to repressors when the ligand all-trans-retinoic acid was added. Mutation of the consensus half-site only slightly reduced COUP-TF helper function, suggesting that it actually results from a complex mechanism that probably involves both DNA binding of COUP-TF to the promoter and protein-protein interaction with another transcription factor bound to the promoter. Nevertheless, a DNA-binding-defective mutant of COUP-TF was also defective in ER helper function. Competition footprinting analysis suggested that COUP-TF actually establishes contacts with the consensus upstream half-site and the downstream ERE half-site that would form a DR-24-like response element. Interaction of COUP-TF with the DR-24 element was confirmed in footprinting assays by using nuclear extracts from Saccharomyces cerevisiae expressing COUP-TF. Finally, interaction of COUP-TF with mutants of the rtER gene promoter showed that COUP-TF recognizes the ERE when the upstream half-site is mutated. These data show that COUP-TF may activate transcription through interaction with other nuclear receptors. This cross-talk between liganded nuclear receptors and orphan receptors is likely to modulate the spectrum of action of a particular ligand-receptor complex and may participate in the cell-type specificity of the ligand effect. PMID:9271383

  5. Transcriptional regulation of human MUC4 gene: identification of a novel inhibitory element and its nuclear binding protein.

    PubMed

    Zhang, Jing-Jing; Zhu, Yi; Zhang, Xiong-Fei; Liang, Wen-Biao; Xie, Kun-Ling; Tao, Jin-Qiu; Peng, Yun-Peng; Xu, Ze-Kuan; Miao, Yi

    2013-08-01

    The human mucin 4 (MUC4) is aberrantly expressed in pancreatic adenocarcinoma and tumor cell lines, while remaining undetectable in normal pancreas, indicating its important role in pancreatic cancer development. Although its transcriptional regulation has been investigated in considerable detail, some important elements remain unknown. The aim of the present study was to demonstrate the existence of a novel inhibitory element in the MUC4 promoter and characterize some of its binding proteins. By luciferase reporter assay, we located the inhibitory element between nucleotides -2530 and -2521 in the MUC4 promoter using a series of deletion and mutant reporter constructs. Electrophoretic mobility shift assay (EMSA) with Bxpc-3 cell nuclear extracts revealed that one protein or protein complex bind to this element. The proteins binding to this element were purified and identified as Yin Yang 1 (YY1) by mass spectrometry. Supershift assay and chromatin immunoprecipitation (ChIP) assay confirmed that YY1 binds to this element in vitro and in vivo. Moreover, transient YY1 overexpression significantly inhibited MUC4 promoter activity and endogenous MUC4 protein expression. In conclusion, we reported here a novel inhibitory element in the human MUC4 promoter. This provides additional data on MUC4 gene regulation and indicates that YY1 may be a potential target for abnormal MUC4 expression.

  6. The increasing diversity of functions attributed to the SAFB family of RNA-/DNA-binding proteins.

    PubMed

    Norman, Michael; Rivers, Caroline; Lee, Youn-Bok; Idris, Jalilah; Uney, James

    2016-12-01

    RNA-binding proteins play a central role in cellular metabolism by orchestrating the complex interactions of coding, structural and regulatory RNA species. The SAFB (scaffold attachment factor B) proteins (SAFB1, SAFB2 and SAFB-like transcriptional modulator, SLTM), which are highly conserved evolutionarily, were first identified on the basis of their ability to bind scaffold attachment region DNA elements, but attention has subsequently shifted to their RNA-binding and protein-protein interactions. Initial studies identified the involvement of these proteins in the cellular stress response and other aspects of gene regulation. More recently, the multifunctional capabilities of SAFB proteins have shown that they play crucial roles in DNA repair, processing of mRNA and regulatory RNA, as well as in interaction with chromatin-modifying complexes. With the advent of new techniques for identifying RNA-binding sites, enumeration of individual RNA targets has now begun. This review aims to summarise what is currently known about the functions of SAFB proteins. © 2016 The Author(s).

  7. Operator design and mechanism for CarA repressor-mediated down-regulation of the photoinducible carB operon in Myxococcus xanthus.

    PubMed

    López-Rubio, José Juan; Padmanabhan, S; Lázaro, Jose María; Salas, Margarita; Murillo, Francisco José; Elías-Arnanz, Montserrat

    2004-07-09

    The carB operon encodes all except one of the enzymes involved in light-induced carotenogenesis in Myxococcus xanthus. Expression of its promoter (P(B)) is repressed in the dark by sequence-specific DNA binding of CarA to a palindrome (pI) located between positions -47 and -64 relative to the transcription start site. This promotes subsequent binding of CarA to additional sites that remain to be defined. CarS, produced in the light, interacts physically with CarA, abrogates CarA-DNA binding, and thereby derepresses P(B). In this study, we delineate the operator design that exists for CarA by precisely mapping out the second operator element. For this, we examined how stepwise deletions and site-directed mutagenesis in the region between the palindrome and the transcription start site affect CarA binding around P(B) in vitro and expression of P(B) in vivo. These revealed the second operator element to be an imperfect interrupted palindrome (pII) spanning positions -26 to -40. In vitro assays using purified M. xanthus RNA polymerase showed that CarA abolishes P(B)-RNA polymerase binding and runoff transcription and that both were restored by CarS, thus rationalizing the observations in vivo. CarA binding to pII (after association with pI) effectively occludes RNA polymerase from P(B) and so provides the operative mechanism for the repression of the carB operon by CarA. The bipartite operator design, whereby transcription is blocked by the low affinity CarA-pII binding and is readily restored by CarS, may have evolved to match the needs for a rapid and an effective response to light.

  8. pH-Dependent DNA Distortion and Repression of Gene Expression by Pectobacterium atrosepticum PecS.

    PubMed

    Deochand, Dinesh K; Meariman, Jacob K; Grove, Anne

    2016-07-15

    Transcriptional activity is exquisitely sensitive to changes in promoter DNA topology. Transcription factors may therefore control gene activity by modulating the relative positioning of -10 and -35 promoter elements. The plant pathogen Pectobacterium atrosepticum, which causes soft rot in potatoes, must alter gene expression patterns to ensure growth in planta. In the related soft-rot enterobacterium Dickeya dadantii, PecS functions as a master regulator of virulence gene expression. Here, we report that P. atrosepticum PecS controls gene activity by altering promoter DNA topology in response to pH. While PecS binds the pecS promoter with high affinity regardless of pH, it induces significant DNA distortion only at neutral pH, the pH at which the pecS promoter is repressed in vivo. At pH ∼8, DNA distortions are attenuated, and PecS no longer represses the pecS promoter. A specific histidine (H142) located in a crevice between the dimerization- and DNA-binding regions is required for pH-dependent changes in DNA distortion and repression of gene activity, and mutation of this histidine renders the mutant protein incapable of repressing the pecS promoter. We propose that protonated PecS induces a DNA conformation at neutral pH in which -10 and -35 promoter elements are suboptimally positioned for RNA polymerase binding; on deprotonation of PecS, binding is no longer associated with significant changes in DNA conformation, allowing gene expression. We suggest that this mode of gene regulation leads to differential expression of the PecS regulon in response to alkalinization of the plant apoplast.

  9. Angiotensin II regulates brain (pro)renin receptor expression through activation of cAMP response element-binding protein

    PubMed Central

    Li, Wencheng; Liu, Jiao; Hammond, Sean L.; Tjalkens, Ronald B.; Saifudeen, Zubaida

    2015-01-01

    We reported that brain (pro)renin receptor (PRR) expression levels are elevated in DOCA-salt-induced hypertension; however, the underlying mechanism remained unknown. To address whether ANG II type 1 receptor (AT1R) signaling is involved in this regulation, we implanted a DOCA pellet and supplied 0.9% saline as the drinking solution to C57BL/6J mice. Sham pellet-implanted mice that were provided regular drinking water served as controls. Concurrently, mice were intracerebroventricularly infused with the AT1R blocker losartan, angiotensin-converting-enzyme inhibitor captopril, or artificial cerebrospinal fluid for 3 wk. Intracerebroventricular infusion of losartan or captopril attenuated DOCA-salt-induced PRR mRNA elevation in the paraventricular nucleus of the hypothalamus, suggesting a role for ANG II/AT1R signaling in regulating PRR expression during DOCA-salt hypertension. To test which ANG II/AT1R downstream transcription factors were involved in PRR regulation, we treated Neuro-2A cells with ANG II with or without CREB (cAMP response element-binding protein) or AP-1 (activator protein-1) inhibitors, or CREB siRNA. CREB and AP-1 inhibitors, as well as CREB knockdown abolished ANG II-induced increases in PRR levels. ANG II also induced PRR upregulation in primary cultured neurons. Chromatin immunoprecipitation assays revealed that ANG II treatment increased CREB binding to the endogenous PRR promoter in both cultured neurons and hypothalamic tissues of DOCA-salt hypertensive mice. This increase in CREB activity was reversed by AT1R blockade. Collectively, these findings indicate that ANG II acts via AT1R to upregulate PRR expression both in cultured cells and in DOCA-salt hypertensive mice by increasing CREB binding to the PRR promoter. PMID:25994957

  10. The organic solute transporters alpha and beta are induced by hypoxia in human hepatocytes

    PubMed Central

    Schaffner, Carlos A; Mwinyi, Jessica; Gai, Zhibo; Thasler, Wolfgang E; Eloranta, Jyrki J; Kullak-Ublick, Gerd A

    2015-01-01

    Background & Aims The organic solute transporters alpha and beta (OSTα-OSTβ) form a heterodimeric transporter located at the basolateral membrane of intestinal epithelial cells and hepatocytes. Liver injury caused by ischaemia-reperfusion, cancer, inflammation or cholestasis can induce a state of hypoxia in hepatocytes. Here, we studied the effect of hypoxia on the expression of OSTα-OSTβ. Methods OSTα-OSTβ expression was measured in Huh7 cells and primary human hepatocytes (PHH) exposed to chenodeoxycholic acid (CDCA), hypoxia or both. OSTα-OSTβ promoter activity was analysed in luciferase reporter gene assays. Binding of hypoxia-inducible factor-1 alpha (HIF-1α) to the OSTα-OSTβ gene promoters was studied in electrophoretic mobility shift assays (EMSA). Results Expression of OSTα and OSTβ increased in PHH under conditions of hypoxia. Exposure of Huh7 cells or PHH to CDCA (50 μM) enhanced the effect of hypoxia on OSTα mRNA levels. In luciferase assays and EMSA, the inducing effect of low oxygen could be assigned to HIF-1α, which binds to hypoxia responsive elements (HRE) in the OSTα and OSTβ gene promoters. Site-directed mutagenesis of either the predicted HRE or the bile acid responsive FXR binding site abolished inducibility of the OSTα promoter, indicating that both elements need to be intact for induction by hypoxia and CDCA. In a rat model of chronic renal failure, the known increase in hepatic OSTα expression was associated with an increase in HIF-1α protein levels. Conclusion OSTα-OSTβ expression is induced by hypoxia. FXR and HIF-1α bind in close proximity to the OSTα gene promoter and produce synergistic effects on OSTα expression. PMID:24703425

  11. Yeast transcriptional activator INO2 interacts as an Ino2p/Ino4p basic helix-loop-helix heteromeric complex with the inositol/choline-responsive element necessary for expression of phospholipid biosynthetic genes in Saccharomyces cerevisiae.

    PubMed Central

    Schwank, S; Ebbert, R; Rautenstrauss, K; Schweizer, E; Schüller, H J

    1995-01-01

    Coordinate transcriptional control of yeast genes involved in phospholipid biosynthesis is mediated by the inositol/choline-responsive element (ICRE) contained in the respective promoter regions. Regulatory genes INO2 and INO4, both encoding basic helix-loop-helix (bHLH) proteins, are necessary for ICRE-dependent gene activation. By the use of size variants and by heterologous expression in E. coli we demonstrate that Ino2p and Ino4p are both necessary and sufficient for the formation of the previously described FAS binding factor 1, Fbf1, interacting with the ICRE. Formation of a heteromeric complex between Ino2p and Ino4p by means of the respective bHLH domains was demonstrated in vivo by the interaction of appropriate two-hybrid constructs and in vitro by Far-Western analyses. Neither Ino2p nor Ino4p binds to the ICRE as a homodimer. When fused to the DNA-binding domain of Gal4p, Ino2p but not Ino4p was able to activate a UASGAL-containing reporter gene even in the absence of the heterologous Fbf1 subunit. By deletion studies, two separate transcriptional activation domains were identified in the N-terminal part of Ino2p. Thus, the bHLH domains of Ino2p and Ino4p constitute the dimerization/DNA-binding module of Fbf1 mediating its interaction with the ICRE, while transcriptional activation is effected exclusively by Ino2p. Images PMID:7862526

  12. Transforming Growth Factor-β/SMAD Target Gene SKIL Is Negatively Regulated by the Transcriptional Cofactor Complex SNON-SMAD4*

    PubMed Central

    Tecalco-Cruz, Angeles C.; Sosa-Garrocho, Marcela; Vázquez-Victorio, Genaro; Ortiz-García, Layla; Domínguez-Hüttinger, Elisa; Macías-Silva, Marina

    2012-01-01

    The human SKI-like (SKIL) gene encodes the SMAD transcriptional corepressor SNON that antagonizes TGF-β signaling. SNON protein levels are tightly regulated by the TGF-β pathway: whereas a short stimulation with TGF-β decreases SNON levels by its degradation via the proteasome, longer TGF-β treatment increases SNON levels by inducing SKIL gene expression. Here, we investigated the molecular mechanisms involved in the self-regulation of SKIL gene expression by SNON. Bioinformatics analysis showed that the human SKIL gene proximal promoter contains a TGF-β response element (TRE) bearing four groups of SMAD-binding elements that are also conserved in mouse. Two regions of 408 and 648 bp of the human SKIL gene (∼2.4 kb upstream of the ATG initiation codon) containing the core promoter, transcription start site, and the TRE were cloned for functional analysis. Binding of SMAD and SNON proteins to the TRE region of the SKIL gene promoter after TGF-β treatment was demonstrated by ChIP and sequential ChIP assays. Interestingly, the SNON-SMAD4 complex negatively regulated basal SKIL gene expression through binding the promoter and recruiting histone deacetylases. In response to TGF-β signal, SNON is removed from the SKIL gene promoter, and then the activated SMAD complexes bind the promoter to induce SKIL gene expression. Subsequently, the up-regulated SNON protein in complex with SMAD4 represses its own expression as part of the negative feedback loop regulating the TGF-β pathway. Accordingly, when the SNON-SMAD4 complex is absent as in some cancer cells lacking SMAD4 the regulation of some TGF-β target genes is modified. PMID:22674574

  13. Transforming growth factor-β/SMAD Target gene SKIL is negatively regulated by the transcriptional cofactor complex SNON-SMAD4.

    PubMed

    Tecalco-Cruz, Angeles C; Sosa-Garrocho, Marcela; Vázquez-Victorio, Genaro; Ortiz-García, Layla; Domínguez-Hüttinger, Elisa; Macías-Silva, Marina

    2012-08-03

    The human SKI-like (SKIL) gene encodes the SMAD transcriptional corepressor SNON that antagonizes TGF-β signaling. SNON protein levels are tightly regulated by the TGF-β pathway: whereas a short stimulation with TGF-β decreases SNON levels by its degradation via the proteasome, longer TGF-β treatment increases SNON levels by inducing SKIL gene expression. Here, we investigated the molecular mechanisms involved in the self-regulation of SKIL gene expression by SNON. Bioinformatics analysis showed that the human SKIL gene proximal promoter contains a TGF-β response element (TRE) bearing four groups of SMAD-binding elements that are also conserved in mouse. Two regions of 408 and 648 bp of the human SKIL gene (∼2.4 kb upstream of the ATG initiation codon) containing the core promoter, transcription start site, and the TRE were cloned for functional analysis. Binding of SMAD and SNON proteins to the TRE region of the SKIL gene promoter after TGF-β treatment was demonstrated by ChIP and sequential ChIP assays. Interestingly, the SNON-SMAD4 complex negatively regulated basal SKIL gene expression through binding the promoter and recruiting histone deacetylases. In response to TGF-β signal, SNON is removed from the SKIL gene promoter, and then the activated SMAD complexes bind the promoter to induce SKIL gene expression. Subsequently, the up-regulated SNON protein in complex with SMAD4 represses its own expression as part of the negative feedback loop regulating the TGF-β pathway. Accordingly, when the SNON-SMAD4 complex is absent as in some cancer cells lacking SMAD4 the regulation of some TGF-β target genes is modified.

  14. Gonadotropin-Inhibitory Hormone, the Piscine Ortholog of LPXRFa, Participates in 17β-Estradiol Feedback in Female Goldfish Reproduction.

    PubMed

    Qi, Xin; Zhou, Wenyi; Wang, Qingqing; Guo, Liang; Lu, Danqi; Lin, Haoran

    2017-04-01

    Gonadotropin-inhibitory hormone (GnIH) plays a critical role in regulating gonadotropin-releasing hormone, gonadotropin hormone, and steroidogenesis in teleosts. In the present study, we sought to determine whether 17β-estradiol (E2) acts directly on GnIH neurons to regulate reproduction in goldfish, a seasonal breeder, and we investigated the role of estrogen receptors (ERs) in mediating this process. We found that GnIH neurons coexpress three types of ERs. Ovariectomy and letrozole implantation into female goldfish at the vitellogenic stage elicited a substantial decrease in the expression of GnIH messenger RNA (mRNA), and E2 supplementation abolished this effect. In primary cultured hypothalamus cells, E2 increased GnIH mRNA levels; surprisingly, selective ERα and ERβ agonists showed opposite effects in regulating GnIH mRNA levels. Using genome walking, we isolated a 2329-bp section of the GnIH promoter sequence, and 7 half-estrogen response elements (EREs) were found in the promoter region. Luciferase assays and electrophoretic mobility shift assay results show that the half-ERE element at -2203 is the key site for competitive binding between ERα and ERβ. Ovariectomy and letrozole implantation into female goldfish in the maturating stage did not change the GnIH mRNA expression levels. Taken together, these findings suggest that E2 binds to multiple types of ERs, which competitively bind to the same half-ERE binding site of the GnIH promoter to achieve both positive and negative feedback in response to estrogen to regulate goldfish reproduction at different stages of ovarian development. Copyright © 2017 Endocrine Society.

  15. Identification of the cAMP response element that controls transcriptional activation of the insulin-like growth factor-I gene by prostaglandin E2 in osteoblasts

    NASA Technical Reports Server (NTRS)

    Thomas, M. J.; Umayahara, Y.; Shu, H.; Centrella, M.; Rotwein, P.; McCarthy, T. L.

    1996-01-01

    Insulin-like growth factor-I (IGF-I), a multifunctional growth factor, plays a key role in skeletal growth and can enhance bone cell replication and differentiation. We previously showed that prostaglandin E2 (PGE2) and other agents that increase cAMP activated IGF-I gene transcription in primary rat osteoblast cultures through promoter 1 (P1), the major IGF-I promoter, and found that transcriptional induction was mediated by protein kinase A. We now have identified a short segment of P1 that is essential for full hormonal regulation and have characterized inducible DNA-protein interactions involving this site. Transient transfections of IGF-I P1 reporter genes into primary rat osteoblasts showed that the 328-base pair untranslated region of exon 1 was required for a full 5.3-fold response to PGE2; mutation in a previously footprinted site, HS3D (base pairs +193 to +215), reduced induction by 65%. PGE2 stimulated nuclear protein binding to HS3D. Binding, as determined by gel mobility shift assay, was not seen in nuclear extracts from untreated osteoblast cultures, was detected within 2 h of PGE2 treatment, and was maximal by 4 h. This DNA-protein interaction was not observed in cytoplasmic extracts from PGE2-treated cultures, indicating nuclear localization of the protein kinase A-activated factor(s). Activation of this factor was not blocked by cycloheximide (Chx), and Chx did not impair stimulation of IGF-I gene expression by PGE2. In contrast, binding to a consensus cAMP response element (CRE; 5'-TGACGTCA-3') from the rat somatostatin gene was not modulated by PGE2 or Chx. Competition gel mobility shift analysis using mutated DNA probes identified 5'-CGCAATCG-3' as the minimal sequence needed for inducible binding. All modified IGF-I P1 promoterreporter genes with mutations within this CRE sequence also showed a diminished functional response to PGE2. These results identify the CRE within the 5'-untranslated region of IGF-I exon 1 that is required for hormonal activation of IGF-I gene transcription by cAMP in osteoblasts.

  16. The dyad palindromic glutathione transferase P enhancer binds multiple factors including AP1.

    PubMed Central

    Diccianni, M B; Imagawa, M; Muramatsu, M

    1992-01-01

    Glutathione Transferase P (GST-P) gene expression is dominantly regulated by an upstream enhancer (GPEI) consisting of a dyad of palindromically oriented imperfect TPA (12-O-tetradecanoyl-phorbol-13-acetate)-responsive elements (TRE). GPEI is active in AP1-lacking F9 cells as well in AP1-containing HeLa cells. Despite GPEI's similarity to a TRE, c-jun co-transfection has only a minimal effect on transactivation. Antisense c-jun and c-fos co-transfection experiments further demonstrate the lack of a role for AP1 in GPEI mediated trans-activation in F9 cells, although endogenously present AP1 can influence GPEI in HeLa cells. Co-transfection of delta fosB with c-jun, which forms an inactive c-Jun/delta FosB heterodimer that binds TRE sequences, inhibits GPEI-mediated transcription in AP1-lacking F9 cells as well as AP1-containing HeLa cells. These data suggest novel factor(s) other than AP1 are influencing GPEI. Binding studies reveal multiple nucleoproteins bind to GPEI. These factors are likely responsible for the high level of GPEI-mediated transcription observed in the absence of AP1 and during hepatocarcinogenesis. Images PMID:1408831

  17. The dyad palindromic glutathione transferase P enhancer binds multiple factors including AP1.

    PubMed

    Diccianni, M B; Imagawa, M; Muramatsu, M

    1992-10-11

    Glutathione Transferase P (GST-P) gene expression is dominantly regulated by an upstream enhancer (GPEI) consisting of a dyad of palindromically oriented imperfect TPA (12-O-tetradecanoyl-phorbol-13-acetate)-responsive elements (TRE). GPEI is active in AP1-lacking F9 cells as well in AP1-containing HeLa cells. Despite GPEI's similarity to a TRE, c-jun co-transfection has only a minimal effect on transactivation. Antisense c-jun and c-fos co-transfection experiments further demonstrate the lack of a role for AP1 in GPEI mediated trans-activation in F9 cells, although endogenously present AP1 can influence GPEI in HeLa cells. Co-transfection of delta fosB with c-jun, which forms an inactive c-Jun/delta FosB heterodimer that binds TRE sequences, inhibits GPEI-mediated transcription in AP1-lacking F9 cells as well as AP1-containing HeLa cells. These data suggest novel factor(s) other than AP1 are influencing GPEI. Binding studies reveal multiple nucleoproteins bind to GPEI. These factors are likely responsible for the high level of GPEI-mediated transcription observed in the absence of AP1 and during hepatocarcinogenesis.

  18. Multivalent interaction based carbohydrate biosensors for signal amplification

    PubMed Central

    Wang, Yanyan; Chalagalla, Srinivas; Li, Tiehai; Sun, Xue-long; Zhao, Wei; Wang, Peng; Zeng, Xiangqun

    2010-01-01

    Multivalent interaction between boronic acids immobilized on Quartz Crystal Microbalance (QCM) sensor surface and the carbohydrates modified Au - nanoparticle (AuNP) has been demonstrated for the development of a sensitive carbohydrate biosensor. Briefly, a boronic acid - containing polymer (boropolymer) as multivalent carbohydrate receptor was oriented immobilized on the cysteamine coated electrode through isourea bond formation. Carbohydrates were conjugated to AuNPs to generate a multivalent carbohydrates moiety to amplify the response signal. Thus, the binding of the carbohydrate conjugated AuNPs to the boropolymer surface are multivalent which could simultaneously increase the binding affinity and specificity. We systematically studied the binding between five carbohydrate conjugated AuNPs and the boropolymer. Our studies show that the associate constant (Ka) was in the order of fucose < glucose < mannose < galactose < maltose. A linear response in the range from 23 µM to 3.83 mM was observed for mannose conjugated AuNPs and the boropolymer recognition elements, with the lower detection limit of 1.5 µM for the carbohydrate analytes. Furthermore, the multivalent binding between carbohydrates and boronic acids are reversible and allow the regeneration of boropolymer surface by using 1M acetic acid so as to sequentially capture and release the carbohydrate analytes. PMID:20863680

  19. Chronic Enhancement of CREB Activity in the Hippocampus Interferes with the Retrieval of Spatial Information

    ERIC Educational Resources Information Center

    Viosca, Jose; Malleret, Gael; Bourtchouladze, Rusiko; Benito, Eva; Vronskava, Svetlana; Kandel, Eric R.; Barco, Angel

    2009-01-01

    The activation of cAMP-responsive element-binding protein (CREB)-dependent gene expression is thought to be critical for the formation of different types of long-term memory. To explore the consequences of chronic enhancement of CREB function on spatial memory in mammals, we examined spatial navigation in bitransgenic mice that express in a…

  20. Sugar-sweetened beverage intake associations with fasting glucose and insulin concentrations are not modified by selected genetic variants in a ChREBP-FGF21 pathway: a meta-analysis

    USDA-ARS?s Scientific Manuscript database

    Aims & Hypothesis: Sugar sweetened beverages are a major dietary contributor to fructose intake. A molecular pathway involving the carbohydrate responsive-element binding protein (ChREBP) and the metabolic hormone fibroblast growth factor 21 (FGF21) may influence sugar metabolism and thereby contrib...

  1. Sugar-sweetened beverage intake associations with fasting glucose and insulin concentrations are not modified by selected genetic variants in a ChREBP-FGF21 pathway: A meta-analysis

    USDA-ARS?s Scientific Manuscript database

    Sugar-sweetened beverages (SSBs) are a major dietary contributor to fructose intake. A molecular pathway involving the carbohydrate responsive element-binding protein (ChREBP) and the metabolic hormone fibroblast growth factor 21 (FGF21) may influence sugar metabolism and, thereby, contribute to fru...

  2. Identifying a Mechanism for Crosstalk Between the Estrogen and Glucocorticoid Receptors | Center for Cancer Research

    Cancer.gov

    Estrogen has long been known to play important roles in the development and progression of breast cancer. Its receptor (ER), a member of the steroid receptor family, binds to estrogen response elements (EREs) in DNA and regulates gene transcription. More recently, another steroid receptor family member, the glucocorticoid receptor (GR), has been implicated in breast cancer

  3. Analysis of the interactions between host factor Sam68 and viral elements during foot-and-mouth disease virus infection

    USDA-ARS?s Scientific Manuscript database

    The nuclear protein Src-associated protein of 68 kDa in mitosis (Sam68) is known to bind RNA and be involved in cellular processes triggered in response to environmental stresses, including virus infection. Interestingly, Sam68, is a multi-functional protein implicated in the life cycle of retroviru...

  4. Salicylic-Acid-Induced Chilling- and Oxidative-Stress Tolerance in Relation to Gibberellin Homeostasis, C-Repeat/Dehydration-Responsive Element Binding Factor Pathway, and Antioxidant Enzyme Systems in Cold-Stored Tomato Fruit.

    PubMed

    Ding, Yang; Zhao, Jinhong; Nie, Ying; Fan, Bei; Wu, Shujuan; Zhang, Yu; Sheng, Jiping; Shen, Lin; Zhao, Ruirui; Tang, Xuanming

    2016-11-02

    Effects of salicylic acid (SA) on gibberellin (GA) homeostasis, C-repeat/dehydration-responsive element binding factor (CBF) pathway, and antioxidant enzyme systems linked to chilling- and oxidative-stress tolerance in tomato fruit were investigated. Mature green tomatoes (Solanum lycopersicum L. cv. Moneymaker) were treated with 0, 0.5, and 1 mM SA solution for 15 min before storage at 4 °C for 28 days. In comparison to 0 or 0.5 mM SA, 1 mM SA significantly decreased the chilling injury (CI) index in tomato fruit. In the SA-treated fruit, the upregulation of GA biosynthetic gene (GA3ox1) expression was followed by gibberellic acid (GA 3 ) surge and DELLA protein degradation. CBF1 participated in the SA-modulated tolerance and stimulated the expression of GA catabolic gene (GA2ox1). Furthermore, 1 mM SA enhanced activities of antioxidant enzymes and, thus, reduced reactive oxygen species accumulation. Our findings suggest that SA might protect tomato fruit from CI and oxidative damage through regulating GA metabolism, CBF1 gene expression, and antioxidant enzyme activities.

  5. DNA cytosine methylation in the bovine leukemia virus promoter is associated with latency in a lymphoma-derived B-cell line: potential involvement of direct inhibition of cAMP-responsive element (CRE)-binding protein/CRE modulator/activation transcription factor binding.

    PubMed

    Pierard, Valérie; Guiguen, Allan; Colin, Laurence; Wijmeersch, Gaëlle; Vanhulle, Caroline; Van Driessche, Benoît; Dekoninck, Ann; Blazkova, Jana; Cardona, Christelle; Merimi, Makram; Vierendeel, Valérie; Calomme, Claire; Nguyên, Thi Liên-Anh; Nuttinck, Michèle; Twizere, Jean-Claude; Kettmann, Richard; Portetelle, Daniel; Burny, Arsène; Hirsch, Ivan; Rohr, Olivier; Van Lint, Carine

    2010-06-18

    Bovine leukemia virus (BLV) proviral latency represents a viral strategy to escape the host immune system and allow tumor development. Besides the previously demonstrated role of histone deacetylation in the epigenetic repression of BLV expression, we showed here that BLV promoter activity was induced by several DNA methylation inhibitors (such as 5-aza-2'-deoxycytidine) and that overexpressed DNMT1 and DNMT3A, but not DNMT3B, down-regulated BLV promoter activity. Importantly, cytosine hypermethylation in the 5'-long terminal repeat (LTR) U3 and R regions was associated with true latency in the lymphoma-derived B-cell line L267 but not with defective latency in YR2 cells. Moreover, the virus-encoded transactivator Tax(BLV) decreased DNA methyltransferase expression levels, which could explain the lower level of cytosine methylation observed in the L267(LTaxSN) 5'-LTR compared with the L267 5'-LTR. Interestingly, DNA methylation inhibitors and Tax(BLV) synergistically activated BLV promoter transcriptional activity in a cAMP-responsive element (CRE)-dependent manner. Mechanistically, methylation at the -154 or -129 CpG position (relative to the transcription start site) impaired in vitro binding of CRE-binding protein (CREB) transcription factors to their respective CRE sites. Methylation at -129 CpG alone was sufficient to decrease BLV promoter-driven reporter gene expression by 2-fold. We demonstrated in vivo the recruitment of CREB/CRE modulator (CREM) and to a lesser extent activating transcription factor-1 (ATF-1) to the hypomethylated CRE region of the YR2 5'-LTR, whereas we detected no CREB/CREM/ATF recruitment to the hypermethylated corresponding region in the L267 cells. Altogether, these findings suggest that site-specific DNA methylation of the BLV promoter represses viral transcription by directly inhibiting transcription factor binding, thereby contributing to true proviral latency.

  6. Binding characteristics of Cu2+ to natural humic acid fractions sequentially extracted from the lake sediments.

    PubMed

    He, En; Lü, Changwei; He, Jiang; Zhao, Boyi; Wang, Jinghua; Zhang, Ruiqing; Ding, Tao

    2016-11-01

    Humic acids (HAs) determine the distribution, toxicity, bioavailability, and ultimate fate of heavy metals in the environment. In this work, ten HA fractions (F1-F10) were used as adsorbent, which were sequentially extracted from natural sediments of Lake Wuliangsuhai, to investigate the binding characteristics of Cu 2+ to HA. On the basis of the characterization results, differences were found between the ten extracted HA fractions responding to their elemental compositions and acidic functional groups. The characterization results reveal that the responses of ten extracted HA fractions to their elemental compositions and acidic functional groups were different. The O/C and (O + N)/C ratio of F1-F8 approximately ranged from 0.66 to 0.53 and from 0.72 to 0.61, respectively; the measured results showed that the contents of phenolic groups and carboxyl groups decreased from 4.46 to 2.60 mmol/g and 1.60 to 0.58 mmol/g, respectively. The binding characteristics of Cu 2+ to the ten HA fractions were well modeled by the bi-Langmuir model; the binding behavior of Cu 2+ to all the ten HA fractions were strongly impacted by pH and ionic strength. The FTIR and SEM-EDX image of HA fractions (pre- and post-adsorption) revealed that carboxyl and phenolic groups were responsible for the Cu 2+ sorption on the ten sequentially extracted HA fractions process, which is the same with the analysis of the ligand binding and bi-Langmuir models Accordingly, the adsorption capacity of the former HA fractions on Cu 2+ were higher than the latter ones, which may be attributed to the difference of carboxyl and phenolic group contents between the former and latter extracted HA fractions. Additionally, the functional groups with N and S should not be neglected. This work is hopeful to understand the environmental effect of humic substances, environmental geochemical behavior, and bioavailability of heavy metals in lakes.

  7. New tRNA contacts facilitate ligand binding in a Mycobacterium smegmatis T box riboswitch.

    PubMed

    Sherwood, Anna V; Frandsen, Jane K; Grundy, Frank J; Henkin, Tina M

    2018-04-10

    T box riboswitches are RNA regulatory elements widely used by organisms in the phyla Firmicutes and Actinobacteria to regulate expression of amino acid-related genes. Expression of T box family genes is down-regulated by transcription attenuation or inhibition of translation initiation in response to increased charging of the cognate tRNA. Three direct contacts with tRNA have been described; however, one of these contacts is absent in a subclass of T box RNAs and the roles of several structural domains conserved in most T box RNAs are unknown. In this study, structural elements of a Mycobacterium smegmatis ileS T box riboswitch variant with an Ultrashort (US) Stem I were sequentially deleted, which resulted in a progressive decrease in binding affinity for the tRNA Ile ligand. Selective 2'-hydroxyl acylation analyzed by primer extension (SHAPE) revealed structural changes in conserved riboswitch domains upon interaction with the tRNA ligand. Cross-linking and mutational analyses identified two interaction sites, one between the S-turn element in Stem II and the T arm of tRNA Ile and the other between the Stem IIA/B pseudoknot and the D loop of tRNA Ile These newly identified RNA contacts add information about tRNA recognition by the T box riboswitch and demonstrate a role for the S-turn and pseudoknot elements, which resemble structural elements that are common in many cellular RNAs.

  8. Challenging the Metallothionein (MT) Gene of Biomphalaria glabrata: Unexpected Response Patterns Due to Cadmium Exposure and Temperature Stress.

    PubMed

    Niederwanger, Michael; Dvorak, Martin; Schnegg, Raimund; Pedrini-Martha, Veronika; Bacher, Katharina; Bidoli, Massimo; Dallinger, Reinhard

    2017-08-11

    Metallothioneins (MTs) are low-molecular-mass, cysteine-rich, metal binding proteins. In most animal species, they are involved in metal homeostasis and detoxification, and provide protection from oxidative stress. Gastropod MTs are highly diversified, exhibiting unique features and adaptations like metal specificity and multiplications of their metal binding domains. Here, we show that the MT gene of Biomphalaria glabrata , one of the largest MT genes identified so far, is composed in a unique way. The encoding for an MT protein has a three-domain structure and a C-terminal, Cys-rich extension. Using a bioinformatic approach involving structural and in silico analysis of putative transcription factor binding sites (TFBs), we found that this MT gene consists of five exons and four introns. It exhibits a regulatory promoter region containing three metal-responsive elements (MREs) and several TFBs with putative involvement in environmental stress response, and regulation of gene expression. Quantitative real-time polymerase chain reaction (qRT-PCR) data indicate that the MT gene is not inducible by cadmium (Cd) nor by temperature challenges (heat and cold), despite significant Cd uptake within the midgut gland and the high Cd tolerance of metal-exposed snails.

  9. Challenging the Metallothionein (MT) Gene of Biomphalaria glabrata: Unexpected Response Patterns Due to Cadmium Exposure and Temperature Stress

    PubMed Central

    Dvorak, Martin; Schnegg, Raimund; Pedrini-Martha, Veronika; Bacher, Katharina; Bidoli, Massimo; Dallinger, Reinhard

    2017-01-01

    Metallothioneins (MTs) are low-molecular-mass, cysteine-rich, metal binding proteins. In most animal species, they are involved in metal homeostasis and detoxification, and provide protection from oxidative stress. Gastropod MTs are highly diversified, exhibiting unique features and adaptations like metal specificity and multiplications of their metal binding domains. Here, we show that the MT gene of Biomphalaria glabrata, one of the largest MT genes identified so far, is composed in a unique way. The encoding for an MT protein has a three-domain structure and a C-terminal, Cys-rich extension. Using a bioinformatic approach involving structural and in silico analysis of putative transcription factor binding sites (TFBs), we found that this MT gene consists of five exons and four introns. It exhibits a regulatory promoter region containing three metal-responsive elements (MREs) and several TFBs with putative involvement in environmental stress response, and regulation of gene expression. Quantitative real-time polymerase chain reaction (qRT-PCR) data indicate that the MT gene is not inducible by cadmium (Cd) nor by temperature challenges (heat and cold), despite significant Cd uptake within the midgut gland and the high Cd tolerance of metal-exposed snails. PMID:28800079

  10. Requirement of the cyclic adenosine monophosphate response element-binding protein for hepatitis B virus replication.

    PubMed

    Kim, Bo Kyung; Lim, Seoung Ok; Park, Yun Gyu

    2008-08-01

    The cyclic adenosine monophosphate-response element (CRE)-transcription factor complex participates in the regulation of viral gene expression and pathologic processes caused by various viruses. The hepatitis B virus (HBV) enhancer I directs liver-specific transcription of viral genes and contains a CRE sequence (HBV-CRE); however, whether the HBV-CRE and CRE-binding protein (CREB) are required for the HBV life cycle remains to be determined. This study was designed to investigate the role of CREB in HBV replication and gene expression. Sequence-comparison analysis of 984 HBVs reported worldwide showed that the HBV-CRE sequence is highly conserved, indicating the possibility that it plays an important role in the HBV life cycle. The binding of CREB to the HBV-CRE site was markedly inhibited by oligonucleotides containing HBV-CRE and consensus CRE sequences in vitro and in vivo. The HBV promoter activity was demonstrated to be dependent upon the transactivation activity of CREB. Treatment with CRE decoy oligonucleotides reduced HBV promoter activity, and this was reversed by CREB overexpression. The levels of viral transcripts, DNA, and antigens were remarkably decreased in response to the overexpression of CREB mutants or treatment with the CRE decoy oligonucleotides, whereas enhancing CREB activity increased the levels of viral transcripts. In addition, introduction of a three-base mutation into the HBV-CRE led to a marked reduction in HBV messenger RNA synthesis. Taken together, our results demonstrate that both replication and gene expression of HBV require a functional CREB and HBV-CRE. We have also demonstrated that CRE decoy oligonucleotides and the overexpression of CREB mutants can effectively block the HBV life cycle, suggesting that interventions against CREB activity could provide a new avenue to treat HBV infection.

  11. Variable p-CREB expression depicts different asthma phenotypes.

    PubMed

    Chiappara, G; Chanez, P; Bruno, A; Pace, E; Pompeo, F; Bousquet, J; Bonsignore, G; Gjomarkaj, M

    2007-07-01

    Chromatin modification may play a role in inflammatory gene regulation in asthma. Cyclic adenosine mono-phosphate response element-binding protein (CREB), with the specific co-activator, the CREB-binding protein (CBP), contributes to the acetylation of chromatin and to the transcription of pro-inflammatory genes. To evaluate the expression of CBP and of phospho-CREB (p-CREB) in bronchial biopsies and in peripheral blood mononuclear cells (PBMC) of controls (C), untreated (UA), inhaled steroid treated (ICS) and steroid-dependent asthmatic (SDA) patients. We used immunohistochemistry in bronchial biopsies and western blot analysis and immunocytochemistry in PBMC. Cyclic adenosine mono-phosphate response element-binding protein expression, in the epithelium was similar in all groups, while p-CREB expression was increased in UA and in SDA in comparison with ICS and C subjects (C vs UA P = 0.002, C vs SDA P = 0.007), (ICS vs SDA P = 0.005), (ICS vs UA P = 0.001). Interestingly, also in the submucosa, p-CREB was increased in UA and SDA in comparison with ICS and C subjects (C vs UA P = 0.0004) (C vs SDA P < 0.0001) (ICS vs UA P = 0.002) (ICS vs SDA P < 0.0001) and positively correlated with leukocyte infiltration within the bronchi (CD45RB+ cells). Similar results were obtained with PBMC isolated from the same patient groups. Incubation of PBMC in vitro, with fluticasone propionate, decreased the p-CREB expression induced by cytokine activation (interferon-gamma, tumor necrosis factor-alpha). This study demonstrates that the expression of p-CREB is related, in asthma, to the persistent inflammation according to the disease severity. p-CREB expression can be modulated by glucocorticoids in responsive patients.

  12. Molecular interactions involved in the transactivation of the human T-cell leukemia virus type 1 promoter mediated by Tax and CREB-2 (ATF-4).

    PubMed

    Gachon, F; Thebault, S; Peleraux, A; Devaux, C; Mesnard, J M

    2000-05-01

    The human T-cell leukemia virus type 1 (HTLV-1) Tax protein activates viral transcription through three 21-bp repeats located in the U3 region of the HTLV-1 long terminal repeat and called Tax-responsive elements (TxREs). Each TxRE contains nucleotide sequences corresponding to imperfect cyclic AMP response elements (CRE). In this study, we demonstrate that the bZIP transcriptional factor CREB-2 is able to bind in vitro to the TxREs and that CREB-2 binding to each of the 21-bp motifs is enhanced by Tax. We also demonstrate that Tax can weakly interact with CREB-2 bound to a cellular palindromic CRE motif such as that found in the somatostatin promoter. Mutagenesis of Tax and CREB-2 demonstrates that both N- and C-terminal domains of Tax and the C-terminal region of CREB-2 are required for direct interaction between the two proteins. In addition, the Tax mutant M47, defective for HTLV-1 activation, is unable to form in vitro a ternary complex with CREB-2 and TxRE. In agreement with recent results suggesting that Tax can recruit the coactivator CREB-binding protein (CBP) on the HTLV-1 promoter, we provide evidence that Tax, CREB-2, and CBP are capable of cooperating to stimulate viral transcription. Taken together, our data highlight the major role played by CREB-2 in Tax-mediated transactivation.

  13. Sodium Phenylbutyrate Enhances Astrocytic Neurotrophin Synthesis via Protein Kinase C (PKC)-mediated Activation of cAMP-response Element-binding Protein (CREB)

    PubMed Central

    Corbett, Grant T.; Roy, Avik; Pahan, Kalipada

    2013-01-01

    Neurotrophins, such as brain-derived neurotrophic factor (BDNF) and neurotrophin-3 (NT-3), are believed to be genuine molecular mediators of neuronal growth and homeostatic synapse activity. However, levels of these neurotrophic factors decrease in different brain regions of patients with Alzheimer disease (AD). Induction of astrocytic neurotrophin synthesis is a poorly understood phenomenon but represents a plausible therapeutic target because neuronal neurotrophin production is aberrant in AD and other neurodegenerative diseases. Here, we delineate that sodium phenylbutyrate (NaPB), a Food and Drug Administration-approved oral medication for hyperammonemia, induces astrocytic BDNF and NT-3 expression via the protein kinase C (PKC)-cAMP-response element-binding protein (CREB) pathway. NaPB treatment increased the direct association between PKC and CREB followed by phosphorylation of CREB (Ser133) and induction of DNA binding and transcriptional activation of CREB. Up-regulation of markers for synaptic function and plasticity in cultured hippocampal neurons by NaPB-treated astroglial supernatants and its abrogation by anti-TrkB blocking antibody suggest that NaPB-induced astroglial neurotrophins are functionally active. Moreover, oral administration of NaPB increased the levels of BDNF and NT-3 in the CNS and improved spatial learning and memory in a mouse model of AD. Our results highlight a novel neurotrophic property of NaPB that may be used to augment neurotrophins in the CNS and improve synaptic function in disease states such as AD. PMID:23404502

  14. Sodium phenylbutyrate enhances astrocytic neurotrophin synthesis via protein kinase C (PKC)-mediated activation of cAMP-response element-binding protein (CREB): implications for Alzheimer disease therapy.

    PubMed

    Corbett, Grant T; Roy, Avik; Pahan, Kalipada

    2013-03-22

    Neurotrophins, such as brain-derived neurotrophic factor (BDNF) and neurotrophin-3 (NT-3), are believed to be genuine molecular mediators of neuronal growth and homeostatic synapse activity. However, levels of these neurotrophic factors decrease in different brain regions of patients with Alzheimer disease (AD). Induction of astrocytic neurotrophin synthesis is a poorly understood phenomenon but represents a plausible therapeutic target because neuronal neurotrophin production is aberrant in AD and other neurodegenerative diseases. Here, we delineate that sodium phenylbutyrate (NaPB), a Food and Drug Administration-approved oral medication for hyperammonemia, induces astrocytic BDNF and NT-3 expression via the protein kinase C (PKC)-cAMP-response element-binding protein (CREB) pathway. NaPB treatment increased the direct association between PKC and CREB followed by phosphorylation of CREB (Ser(133)) and induction of DNA binding and transcriptional activation of CREB. Up-regulation of markers for synaptic function and plasticity in cultured hippocampal neurons by NaPB-treated astroglial supernatants and its abrogation by anti-TrkB blocking antibody suggest that NaPB-induced astroglial neurotrophins are functionally active. Moreover, oral administration of NaPB increased the levels of BDNF and NT-3 in the CNS and improved spatial learning and memory in a mouse model of AD. Our results highlight a novel neurotrophic property of NaPB that may be used to augment neurotrophins in the CNS and improve synaptic function in disease states such as AD.

  15. Molecular Interactions Involved in the Transactivation of the Human T-Cell Leukemia Virus Type 1 Promoter Mediated by Tax and CREB-2 (ATF-4)

    PubMed Central

    Gachon, Frederic; Thebault, Sabine; Peleraux, Annick; Devaux, Christian; Mesnard, Jean-Michel

    2000-01-01

    The human T-cell leukemia virus type 1 (HTLV-1) Tax protein activates viral transcription through three 21-bp repeats located in the U3 region of the HTLV-1 long terminal repeat and called Tax-responsive elements (TxREs). Each TxRE contains nucleotide sequences corresponding to imperfect cyclic AMP response elements (CRE). In this study, we demonstrate that the bZIP transcriptional factor CREB-2 is able to bind in vitro to the TxREs and that CREB-2 binding to each of the 21-bp motifs is enhanced by Tax. We also demonstrate that Tax can weakly interact with CREB-2 bound to a cellular palindromic CRE motif such as that found in the somatostatin promoter. Mutagenesis of Tax and CREB-2 demonstrates that both N- and C-terminal domains of Tax and the C-terminal region of CREB-2 are required for direct interaction between the two proteins. In addition, the Tax mutant M47, defective for HTLV-1 activation, is unable to form in vitro a ternary complex with CREB-2 and TxRE. In agreement with recent results suggesting that Tax can recruit the coactivator CREB-binding protein (CBP) on the HTLV-1 promoter, we provide evidence that Tax, CREB-2, and CBP are capable of cooperating to stimulate viral transcription. Taken together, our data highlight the major role played by CREB-2 in Tax-mediated transactivation. PMID:10779337

  16. Transcriptional regulation of ABI3- and ABA-responsive genes including RD29B and RD29A in seeds, germinating embryos, and seedlings of Arabidopsis.

    PubMed

    Nakashima, Kazuo; Fujita, Yasunari; Katsura, Koji; Maruyama, Kyonoshin; Narusaka, Yoshihiro; Seki, Motoaki; Shinozaki, Kazuo; Yamaguchi-Shinozaki, Kazuko

    2006-01-01

    ABA-responsive elements (ABREs) are cis-acting elements and basic leucine zipper (bZIP)-type ABRE-binding proteins (AREBs) are transcriptional activators that function in the expression of RD29B in vegetative tissue of Arabidopsis in response to abscisic acid (ABA) treatment. Dehydration-responsive elements (DREs) function as coupling elements of ABRE in the expression of RD29A in response to ABA. Expression analysis using abi3 and abi5 mutants showed that ABI3 and ABI5 play important roles in the expression of RD29B in seeds. Base-substitution analysis showed that two ABREs function strongly and one ABRE coupled with DRE functions weakly in the expression of RD29A in embryos. In a transient transactivation experiment, ABI3, ABI5 and AREB1 activated transcription of a GUS reporter gene driven by the RD29B promoter strongly but these proteins activated the transcription driven by the RD29A promoter weakly. In 35S::ABI3 Arabidopsis plants, the expression of RD29B was up-regulated strongly, but that of RD29A was up-regulated weakly. These results indicate that the expression of RD29B having ABREs in the promoter is up-regulated strongly by ABI3, whereas that of RD29A having one ABRE coupled with DREs in the promoter is up-regulated weakly by ABI3. We compared the expression of 7000 Arabidopsis genes in response to ABA treatment during germination and in the vegetative growth stage, and that in 35S::ABI3 plants using a full-length cDNA microarray. The expression of ABI3- and/or ABA-responsive genes and cis-elements in the promoters are discussed.

  17. Myostatin induces insulin resistance via Casitas B-lineage lymphoma b (Cblb)-mediated degradation of insulin receptor substrate 1 (IRS1) protein in response to high calorie diet intake.

    PubMed

    Bonala, Sabeera; Lokireddy, Sudarsanareddy; McFarlane, Craig; Patnam, Sreekanth; Sharma, Mridula; Kambadur, Ravi

    2014-03-14

    To date a plethora of evidence has clearly demonstrated that continued high calorie intake leads to insulin resistance and type-2 diabetes with or without obesity. However, the necessary signals that initiate insulin resistance during high calorie intake remain largely unknown. Our results here show that in response to a regimen of high fat or high glucose diets, Mstn levels were induced in muscle and liver of mice. High glucose- or fat-mediated induction of Mstn was controlled at the level of transcription, as highly conserved carbohydrate response and sterol-responsive (E-box) elements were present in the Mstn promoter and were revealed to be critical for ChREBP (carbohydrate-responsive element-binding protein) or SREBP1c (sterol regulatory element-binding protein 1c) regulation of Mstn expression. Further molecular analysis suggested that the increased Mstn levels (due to high glucose or fatty acid loading) resulted in increased expression of Cblb in a Smad3-dependent manner. Casitas B-lineage lymphoma b (Cblb) is an ubiquitin E3 ligase that has been shown to specifically degrade insulin receptor substrate 1 (IRS1) protein. Consistent with this, our results revealed that elevated Mstn levels specifically up-regulated Cblb, resulting in enhanced ubiquitin proteasome-mediated degradation of IRS1. In addition, over expression or knock down of Cblb had a major impact on IRS1 and pAkt levels in the presence or absence of insulin. Collectively, these observations strongly suggest that increased glucose levels and high fat diet, both, result in increased circulatory Mstn levels. The increased Mstn in turn is a potent inducer of insulin resistance by degrading IRS1 protein via the E3 ligase, Cblb, in a Smad3-dependent manner.

  18. Sterol regulatory element binding protein-1 (SREBP1) gene expression is similarly increased in polycystic ovary syndrome and endometrial cancer.

    PubMed

    Shafiee, Mohamad N; Mongan, Nigel; Seedhouse, Claire; Chapman, Caroline; Deen, Suha; Abu, Jafaru; Atiomo, William

    2017-05-01

    Women with polycystic ovary syndrome have a three-fold higher risk of endometrial cancer. Insulin resistance and hyperlipidemia may be pertinent factors in the pathogenesis of both conditions. The aim of this study was to investigate endometrial sterol regulatory element binding protein-1 gene expression in polycystic ovary syndrome and endometrial cancer endometrium, and to correlate endometrial sterol regulatory element binding protein-1 gene expression with serum lipid profiles. A cross-sectional study was performed at Nottingham University Hospital, UK. A total of 102 women (polycystic ovary syndrome, endometrial cancer and controls; 34 participants in each group) were recruited. Clinical and biochemical assessments were performed before endometrial biopsies were obtained from all participants. Taqman real-time polymerase chain reaction for endometrial sterol regulatory element binding protein-1 gene and its systemic protein expression were analyzed. The body mass indices of women with polycystic ovary syndrome (29.28 ± 2.91 kg/m 2 ) and controls (28.58 ± 2.62 kg/m 2 ) were not significantly different. Women with endometrial cancer had a higher mean body mass index (32.22 ± 5.70 kg/m 2 ). Sterol regulatory element binding protein-1 gene expression was significantly increased in polycystic ovary syndrome and endometrial cancer endometrium compared with controls (p < 0.0001). Sterol regulatory element binding protein-1 gene expression was positively correlated with body mass index (r = 0.017, p = 0.921) and waist-hip ratio (r = 0.023, p = 0.544) in polycystic ovary syndrome, but this was not statistically significant. Similarly, statistically insignificant positive correlations were found between endometrial sterol regulatory element binding protein-1 gene expression and body mass index in endometrial cancer (r = 0.643, p = 0.06) and waist-hip ratio (r = 0.096, p = 0.073). Sterol regulatory element binding protein-1 gene expression was significantly positively correlated with triglyceride in both polycystic ovary syndrome and endometrial cancer (p = 0.028 and p = 0.027, respectively). Quantitative serum sterol regulatory element binding protein-1 gene correlated with endometrial gene expression (p < 0.05). Sterol regulatory element binding protein-1 gene expression is significantly increased in the endometrium of women with polycystic ovary syndrome and women with endometrial cancer compared with controls and positively correlates with serum triglyceride in both polycystic ovary syndrome and endometrial cancer. © 2017 Nordic Federation of Societies of Obstetrics and Gynecology.

  19. Design of a Temperature-Responsive Transcription Terminator.

    PubMed

    Roßmanith, Johanna; Weskamp, Mareen; Narberhaus, Franz

    2018-02-16

    RNA structures regulate various steps in gene expression. Transcription in bacteria is typically terminated by stable hairpin structures. Translation initiation can be modulated by metabolite- or temperature-sensitive RNA structures, called riboswitches or RNA thermometers (RNATs), respectively. RNATs control translation initiation by occlusion of the ribosome binding site at low temperatures. Increasing temperatures destabilize the RNA structure and facilitate ribosome access. In this study, we exploited temperature-responsive RNAT structures to design regulatory elements that control transcription termination instead of translation initiation in Escherichia coli. In order to mimic the structure of factor-independent intrinsic terminators, naturally occurring RNAT hairpins were genetically engineered to be followed by a U-stretch. Functional temperature-responsive terminators (thermoterms) prevented mRNA synthesis at low temperatures but resumed transcription after a temperature upshift. The successful design of temperature-controlled terminators highlights the potential of RNA structures as versatile gene expression control elements.

  20. Induced Genome-Wide Binding of Three Arabidopsis WRKY Transcription Factors during Early MAMP-Triggered Immunity

    PubMed Central

    Birkenbihl, Rainer P.; Kracher, Barbara; Roccaro, Mario

    2017-01-01

    During microbial-associated molecular pattern-triggered immunity (MTI), molecules derived from microbes are perceived by cell surface receptors and upon signaling to the nucleus initiate a massive transcriptional reprogramming critical to mount an appropriate host defense response. WRKY transcription factors play an important role in regulating these transcriptional processes. Here, we determined on a genome-wide scale the flg22-induced in vivo DNA binding dynamics of three of the most prominent WRKY factors, WRKY18, WRKY40, and WRKY33. The three WRKY factors each bound to more than 1000 gene loci predominantly at W-box elements, the known WRKY binding motif. Binding occurred mainly in the 500-bp promoter regions of these genes. Many of the targeted genes are involved in signal perception and transduction not only during MTI but also upon damage-associated molecular pattern-triggered immunity, providing a mechanistic link between these functionally interconnected basal defense pathways. Among the additional targets were genes involved in the production of indolic secondary metabolites and in modulating distinct plant hormone pathways. Importantly, among the targeted genes were numerous transcription factors, encoding predominantly ethylene response factors, active during early MTI, and WRKY factors, supporting the previously hypothesized existence of a WRKY subregulatory network. Transcriptional analysis revealed that WRKY18 and WRKY40 function redundantly as negative regulators of flg22-induced genes often to prevent exaggerated defense responses. PMID:28011690

  1. Transcription factor assisted loading and enhancer dynamics dictate the hepatic fasting response.

    PubMed

    Goldstein, Ido; Baek, Songjoon; Presman, Diego M; Paakinaho, Ville; Swinstead, Erin E; Hager, Gordon L

    2017-03-01

    Fasting elicits transcriptional programs in hepatocytes leading to glucose and ketone production. This transcriptional program is regulated by many transcription factors (TFs). To understand how this complex network regulates the metabolic response to fasting, we aimed at isolating the enhancers and TFs dictating it. Measuring chromatin accessibility revealed that fasting massively reorganizes liver chromatin, exposing numerous fasting-induced enhancers. By utilizing computational methods in combination with dissecting enhancer features and TF cistromes, we implicated four key TFs regulating the fasting response: glucocorticoid receptor (GR), cAMP responsive element binding protein 1 (CREB1), peroxisome proliferator activated receptor alpha (PPARA), and CCAAT/enhancer binding protein beta (CEBPB). These TFs regulate fuel production by two distinctly operating modules, each controlling a separate metabolic pathway. The gluconeogenic module operates through assisted loading, whereby GR doubles the number of sites occupied by CREB1 as well as enhances CREB1 binding intensity and increases accessibility of CREB1 binding sites. Importantly, this GR-assisted CREB1 binding was enhancer-selective and did not affect all CREB1-bound enhancers. Single-molecule tracking revealed that GR increases the number and DNA residence time of a portion of chromatin-bound CREB1 molecules. These events collectively result in rapid synergistic gene expression and higher hepatic glucose production. Conversely, the ketogenic module operates via a GR-induced TF cascade, whereby PPARA levels are increased following GR activation, facilitating gradual enhancer maturation next to PPARA target genes and delayed ketogenic gene expression. Our findings reveal a complex network of enhancers and TFs that dynamically cooperate to restore homeostasis upon fasting. Published by Cold Spring Harbor Laboratory Press.

  2. FOXO3 Modulates Endothelial Gene Expression and Function by Classical and Alternative Mechanisms*

    PubMed Central

    Czymai, Tobias; Viemann, Dorothee; Sticht, Carsten; Molema, Grietje; Goebeler, Matthias; Schmidt, Marc

    2010-01-01

    FOXO transcription factors represent targets of the phosphatidylinositol 3-kinase/protein kinase B survival pathway controlling important biological processes, such as cell cycle progression, apoptosis, vascular remodeling, stress responses, and metabolism. Recent studies suggested the existence of alternative mechanisms of FOXO-dependent gene expression beyond classical binding to a FOXO-responsive DNA-binding element (FRE). Here we analyzed the relative contribution of those mechanisms to vascular function by comparing the transcriptional and cellular responses to conditional activation of FOXO3 and a corresponding FRE-binding mutant in human primary endothelial cells. We demonstrate that FOXO3 controls expression of vascular remodeling genes in an FRE-dependent manner. In contrast, FOXO3-induced cell cycle arrest and apoptosis occurs independently of FRE binding, albeit FRE-dependent gene expression augments the proapoptotic response. These findings are supported by bioinformatical analysis, which revealed a statistical overrepresentation of cell cycle regulators and apoptosis-related genes in the group of co-regulated genes. Molecular analysis of FOXO3-induced endothelial apoptosis excluded modulators of the extrinsic death receptor pathway and demonstrated important roles for the BCL-2 family members BIM and NOXA in this process. Although NOXA essentially contributed to FRE-dependent apoptosis, BIM was effectively induced in the absence of FRE-binding, and small interfering RNA-mediated BIM depletion could rescue apoptosis induced by both FOXO3 mutants. These data suggest BIM as a critical cell type-specific mediator of FOXO3-induced endothelial apoptosis, whereas NOXA functions as an amplifying factor. Our study provides the first comprehensive analysis of alternatively regulated FOXO3 targets in relevant primary cells and underscores the importance of such genes for endothelial function and integrity. PMID:20123982

  3. Modular arrangement of regulatory RNA elements.

    PubMed

    Roßmanith, Johanna; Narberhaus, Franz

    2017-03-04

    Due to their simple architecture and control mechanism, regulatory RNA modules are attractive building blocks in synthetic biology. This is especially true for riboswitches, which are natural ligand-binding regulators of gene expression. The discovery of various tandem riboswitches inspired the design of combined RNA modules with activities not yet found in nature. Riboswitches were placed in tandem or in combination with a ribozyme or temperature-responsive RNA thermometer resulting in new functionalities. Here, we compare natural examples of tandem riboswitches with recently designed artificial RNA regulators suggesting substantial modularity of regulatory RNA elements. Challenges associated with modular RNA design are discussed.

  4. Co-regulation analysis of co-expressed modules under cold and pathogen stress conditions in tomato.

    PubMed

    Abedini, Davar; Rashidi Monfared, Sajad

    2018-06-01

    A primary mechanism for controlling the development of multicellular organisms is transcriptional regulation, which carried out by transcription factors (TFs) that recognize and bind to their binding sites on promoter region. The distance from translation start site, order, orientation, and spacing between cis elements are key factors in the concentration of active nuclear TFs and transcriptional regulation of target genes. In this study, overrepresented motifs in cold and pathogenesis responsive genes were scanned via Gibbs sampling method, this method is based on detection of overrepresented motifs by means of a stochastic optimization strategy that searches for all possible sets of short DNA segments. Then, identified motifs were checked by TRANSFAC, PLACE and Soft Berry databases in order to identify putative TFs which, interact to the motifs. Several cis/trans regulatory elements were found using these databases. Moreover, cross-talk between cold and pathogenesis responsive genes were confirmed. Statistical analysis was used to determine distribution of identified motifs on promoter region. In addition, co-regulation analysis results, illustrated genes in pathogenesis responsive module are divided into two main groups. Also, promoter region was crunched to six subareas in order to draw the pattern of distribution of motifs in promoter subareas. The result showed the majority of motifs are concentrated on 700 nucleotides upstream of the translational start site (ATG). In contrast, this result isn't true in another group. In other words, there was no difference between total and compartmentalized regions in cold responsive genes.

  5. Interferon-gamma interferes with transforming growth factor-beta signaling through direct interaction of YB-1 with Smad3.

    PubMed

    Higashi, Kiyoshi; Inagaki, Yutaka; Fujimori, Ko; Nakao, Atsuhito; Kaneko, Hideo; Nakatsuka, Iwao

    2003-10-31

    Transforming growth factor-beta (TGF-beta) and interferon-gamma (IFN-gamma) exert antagonistic effects on collagen synthesis in human dermal fibroblasts. We have recently shown that Y box-binding protein YB-1 mediates the inhibitory effects of IFN-gamma on alpha2(I) procollagen gene (COL1A2) transcription through the IFN-gamma response element located between -161 and -150. Here we report that YB-1 counter-represses TGF-beta-stimulated COL1A2 transcription by interfering with Smad3 bound to the upstream sequence around -265 and subsequently by interrupting the Smad3-p300 interaction. Western blot and immunofluorescence analyses using inhibitors for Janus kinases or casein kinase II suggested that the casein kinase II-dependent signaling pathway mediates IFN-gamma-induced nuclear translocation of YB-1. Down-regulation of endogenous YB-1 expression by double-stranded YB-1-specific RNA abrogated the transcriptional repression of COL1A2 by IFN-gamma in the absence and presence of TGF-beta. In transient transfection assays, overexpression of YB-1 in human dermal fibroblasts exhibited antagonistic actions against TGF-beta and Smad3. Physical interaction between Smad3 and YB-1 was demonstrated by immunoprecipitation-Western blot analyses, and electrophoretic mobility shift assays using the recombinant Smad3 and YB-1 proteins indicated that YB-1 forms a complex with Smad3 bound to the Smad-binding element. Glutathione S-transferase pull-down assays showed that YB-1 binds to the MH1 domain of Smad3, whereas the central and carboxyl-terminal regions of YB-1 were required for its interaction with Smad3. YB-1 also interferes with the Smad3-p300 interaction by its preferential binding to p300. Altogether, the results provide a novel insight into the mechanism by which IFN-gamma/YB-1 counteracts TGF-beta/Smad3. They also indicate that IFN-gamma/YB-1 inhibits COL1A2 transcription by dual actions: via the IFN-gamma response element and through a cross-talk with the TGF-beta/Smad signaling pathway.

  6. Optical binding with cold atoms

    NASA Astrophysics Data System (ADS)

    Máximo, C. E.; Bachelard, R.; Kaiser, R.

    2018-04-01

    Optical binding is a form of light-mediated forces between elements of matter which emerge in response to the collective scattering of light. Such a phenomenon has been studied mainly in the context of the equilibrium stability of dielectric sphere arrays which move amid dissipative media. In this article, we demonstrate that optically bounded states of a pair of cold atoms can exist, in the absence of nonradiative damping. We study the scaling laws for the unstable-stable phase transition at negative detuning and the unstable-metastable one for positive detuning. In addition, we show that angular momentum can lead to dynamical stabilization with infinite-range scaling.

  7. Spike synchrony reveals emergence of proto-objects in visual cortex.

    PubMed

    Martin, Anne B; von der Heydt, Rüdiger

    2015-04-29

    Neurons at early stages of the visual cortex signal elemental features, such as pieces of contour, but how these signals are organized into perceptual objects is unclear. Theories have proposed that spiking synchrony between these neurons encodes how features are grouped (binding-by-synchrony), but recent studies did not find the predicted increase in synchrony with binding. Here we propose that features are grouped to "proto-objects" by intrinsic feedback circuits that enhance the responses of the participating feature neurons. This hypothesis predicts synchrony exclusively between feature neurons that receive feedback from the same grouping circuit. We recorded from neurons in macaque visual cortex and used border-ownership selectivity, an intrinsic property of the neurons, to infer whether or not two neurons are part of the same grouping circuit. We found that binding produced synchrony between same-circuit neurons, but not between other pairs of neurons, as predicted by the grouping hypothesis. In a selective attention task, synchrony emerged with ignored as well as attended objects, and higher synchrony was associated with faster behavioral responses, as would be expected from early grouping mechanisms that provide the structure for object-based processing. Thus, synchrony could be produced by automatic activation of intrinsic grouping circuits. However, the binding-related elevation of synchrony was weak compared with its random fluctuations, arguing against synchrony as a code for binding. In contrast, feedback grouping circuits encode binding by modulating the response strength of related feature neurons. Thus, our results suggest a novel coding mechanism that might underlie the proto-objects of perception. Copyright © 2015 the authors 0270-6474/15/356860-11$15.00/0.

  8. Rapid kinetics of iron responsive element (IRE) RNA/iron regulatory protein 1 and IRE-RNA/eIF4F complexes respond differently to metal ions.

    PubMed

    Khan, Mateen A; Ma, Jia; Walden, William E; Merrick, William C; Theil, Elizabeth C; Goss, Dixie J

    2014-06-01

    Metal ion binding was previously shown to destabilize IRE-RNA/IRP1 equilibria and enhanced IRE-RNA/eIF4F equilibria. In order to understand the relative importance of kinetics and stability, we now report rapid rates of protein/RNA complex assembly and dissociation for two IRE-RNAs with IRP1, and quantitatively different metal ion response kinetics that coincide with the different iron responses in vivo. kon, for FRT IRE-RNA binding to IRP1 was eight times faster than ACO2 IRE-RNA. Mn(2+) decreased kon and increased koff for IRP1 binding to both FRT and ACO2 IRE-RNA, with a larger effect for FRT IRE-RNA. In order to further understand IRE-mRNA regulation in terms of kinetics and stability, eIF4F kinetics with FRT IRE-RNA were determined. kon for eIF4F binding to FRT IRE-RNA in the absence of metal ions was 5-times slower than the IRP1 binding to FRT IRE-RNA. Mn(2+) increased the association rate for eIF4F binding to FRT IRE-RNA, so that at 50 µM Mn(2+) eIF4F bound more than 3-times faster than IRP1. IRP1/IRE-RNA complex has a much shorter life-time than the eIF4F/IRE-RNA complex, which suggests that both rate of assembly and stability of the complexes are important, and that allows this regulatory system to respond rapidly to change in cellular iron. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  9. Azadirachtin Interacts with Retinoic Acid Receptors and Inhibits Retinoic Acid-mediated Biological Responses*

    PubMed Central

    Thoh, Maikho; Babajan, Banaganapalli; Raghavendra, Pongali B.; Sureshkumar, Chitta; Manna, Sunil K.

    2011-01-01

    Considering the role of retinoids in regulation of more than 500 genes involved in cell cycle and growth arrest, a detailed understanding of the mechanism and its regulation is useful for therapy. The extract of the medicinal plant Neem (Azadirachta indica) is used against several ailments especially for anti-inflammatory, anti-itching, spermicidal, anticancer, and insecticidal activities. In this report we prove the detailed mechanism on the regulation of retinoic acid-mediated cell signaling by azadirachtin, active components of neem extract. Azadirachtin repressed all trans-retinoic acid (ATRA)-mediated nuclear transcription factor κB (NF-κB) activation, not the DNA binding but the NF-κB-dependent gene expression. It did not inhibit IκBα degradation, IκBα kinase activity, or p65 phosphorylation and its nuclear translocation but inhibited NF-κB-dependent reporter gene expression. Azadirachtin inhibited TRAF6-mediated, but not TRAF2-mediated NF-κB activation. It inhibited ATRA-induced Sp1 and CREB (cAMP-response element-binding protein) DNA binding. Azadirachtin inhibited ATRA binding with retinoid receptors, which is supported by biochemical and in silico evidences. Azadirachtin showed strong interaction with retinoid receptors. It suppressed ATRA-mediated removal of retinoid receptors, bound with DNA by inhibiting ATRA binding to its receptors. Overall, our data suggest that azadirachtin interacts with retinoic acid receptors and suppresses ATRA binding, inhibits falling off the receptors, and activates transcription factors like CREB, Sp1, NF-κB, etc. Thus, azadirachtin exerts anti-inflammatory and anti-metastatic responses by a novel pathway that would be beneficial for further anti-inflammatory and anti-cancer therapies. PMID:21127062

  10. Circular RNA expression in basal cell carcinoma.

    PubMed

    Sand, Michael; Bechara, Falk G; Sand, Daniel; Gambichler, Thilo; Hahn, Stephan A; Bromba, Michael; Stockfleth, Eggert; Hessam, Schapoor

    2016-05-01

    Circular RNAs (circRNAs), are nonprotein coding RNAs consisting of a circular loop with multiple miRNA, binding sites called miRNA response elements (MREs), functioning as miRNA sponges. This study was performed to identify differentially expressed circRNAs and their MREs in basal cell carcinoma (BCC). Microarray circRNA expression profiles were acquired from BCC and control followed by qRT-PCR validation. Bioinformatical target prediction revealed multiple MREs. Sequence analysis was performed concerning MRE interaction potential with the BCC miRNome. We identified 23 upregulated and 48 downregulated circRNAs with 354 miRNA response elements capable of sequestering miRNA target sequences of the BCC miRNome. The present study describes a variety of circRNAs that are potentially involved in the molecular pathogenesis of BCC.

  11. Destruction of a distal hypoxia response element abolishes trans-activation of the PAG1 gene mediated by HIF-independent chromatin looping

    PubMed Central

    Schörg, Alexandra; Santambrogio, Sara; Platt, James L.; Schödel, Johannes; Lindenmeyer, Maja T.; Cohen, Clemens D.; Schrödter, Katrin; Mole, David R.; Wenger, Roland H.; Hoogewijs, David

    2015-01-01

    A crucial step in the cellular adaptation to oxygen deficiency is the binding of hypoxia-inducible factors (HIFs) to hypoxia response elements (HREs) of oxygen-regulated genes. Genome-wide HIF-1α/2α/β DNA-binding studies revealed that the majority of HREs reside distant to the promoter regions, but the function of these distal HREs has only been marginally studied in the genomic context. We used chromatin immunoprecipitation (ChIP), gene editing (TALEN) and chromosome conformation capture (3C) to localize and functionally characterize a 82 kb upstream HRE that solely drives oxygen-regulated expression of the newly identified HIF target gene PAG1. PAG1, a transmembrane adaptor protein involved in Src signalling, was hypoxically induced in various cell lines and mouse tissues. ChIP and reporter gene assays demonstrated that the −82 kb HRE regulates PAG1, but not an equally distant gene further upstream, by direct interaction with HIF. Ablation of the consensus HRE motif abolished the hypoxic induction of PAG1 but not general oxygen signalling. 3C assays revealed that the −82 kb HRE physically associates with the PAG1 promoter region, independent of HIF-DNA interaction. These results demonstrate a constitutive interaction between the −82 kb HRE and the PAG1 promoter, suggesting a physiologically important rapid response to hypoxia. PMID:26007655

  12. Regulation of the intronic promoter of rat estrogen receptor alpha gene, responsible for truncated estrogen receptor product-1 expression.

    PubMed

    Schausi, Diane; Tiffoche, Christophe; Thieulant, Marie-Lise

    2003-07-01

    We have characterized the intronic promoter of the rat estrogen receptor (ER) alpha gene, responsible for the lactotrope-specific truncated ER product (TERP)-1 isoform expression. Transcriptional regulation was investigated by transient transfections using 5'-deletion constructs. TERP promoter constructs were highly active in MMQ cells, a pure lactotrope cell line, whereas a low basal activity was detected in alphaT3-1 gonadotrope cells or in COS-7 monkey kidney cells. Serial deletion analysis revealed that 1) a minimal -693-bp region encompassing the TATA box is sufficient to allow lactotrope-specific expression; 2) the promoter contains strong positive cis-acting elements both in the distal and proximal regions, and 3) the region spanning the -1698/-1194 region includes repressor elements. Transient transfection studies, EMSAs, and gel shifts demonstrated that estrogen activates the TERP promoter via an estrogen-responsive element (ERE1) located within the proximal region. Mutation of ERE1 site completely abolishes the estradiol-dependent transcription, indicating that ERE1 site is sufficient to confer estrogen responsiveness to TERP promoter. In addition, ERalpha action was synergized by transfection of the pituitary-specific factor Pit-1. EMSAs showed that a single Pit-1 DNA binding element in the vicinity of the TATA box is sufficient to confer response by the TERP promoter. In conclusion, we demonstrated, for the first time, that TERP promoter regulation involves ERE and Pit-1 cis-elements and corresponding trans-acting factors, which could play a role in the physiological changes that occur in TERP-1 transcription in lactotrope cells.

  13. DNA-aptamers binding aminoglycoside antibiotics.

    PubMed

    Nikolaus, Nadia; Strehlitz, Beate

    2014-02-21

    Aptamers are short, single stranded DNA or RNA oligonucleotides that are able to bind specifically and with high affinity to their non-nucleic acid target molecules. This binding reaction enables their application as biorecognition elements in biosensors and assays. As antibiotic residues pose a problem contributing to the emergence of antibiotic-resistant pathogens and thereby reducing the effectiveness of the drug to fight human infections, we selected aptamers targeted against the aminoglycoside antibiotic kanamycin A with the aim of constructing a robust and functional assay that can be used for water analysis. With this work we show that aptamers that were derived from a Capture-SELEX procedure targeting against kanamycin A also display binding to related aminoglycoside antibiotics. The binding patterns differ among all tested aptamers so that there are highly substance specific aptamers and more group specific aptamers binding to a different variety of aminoglycoside antibiotics. Also the region of the aminoglycoside antibiotics responsible for aptamer binding can be estimated. Affinities of the different aptamers for their target substance, kanamycin A, are measured with different approaches and are in the micromolar range. Finally, the proof of principle of an assay for detection of kanamycin A in a real water sample is given.

  14. The putative Agrobacterium transcriptional activator-like virulence protein VirD5 may target T-complex to prevent the degradation of coat proteins in the plant cell nucleus.

    PubMed

    Wang, Yafei; Peng, Wei; Zhou, Xu; Huang, Fei; Shao, Lingyun; Luo, Meizhong

    2014-09-01

    Agrobacterium exports at least five virulence proteins (VirE2, VirE3, VirF, VirD2, VirD5) into host cells and hijacks some host plant factors to facilitate its transformation process. Random DNA binding selection assays (RDSAs), electrophoretic mobility shift assays (EMSAs) and yeast one-hybrid systems were used to identify protein-bound DNA elements. Bimolecular fluorescence complementation, glutathione S-transferase pull-down and yeast two-hybrid assays were used to detect protein interactions. Protoplast transformation, coprecipitation, competitive binding and cell-free degradation assays were used to analyze the relationships among proteins. We found that Agrobacterium VirD5 exhibits transcriptional activation activity in yeast, is located in the plant cell nucleus, and forms homodimers. A specific VirD5-bound DNA element designated D5RE (VirD5 response element) was identified. VirD5 interacted directly with Arabidopsis VirE2 Interacting Protein 1 (AtVIP1). However, the ternary complex of VirD5-AtVIP1-VirE2 could be detected, whereas that of VirD5-AtVIP1-VBF (AtVIP1 Binding F-box protein) could not. We demonstrated that VirD5 competes with VBF for binding to AtVIP1 and stabilizes AtVIP1 and VirE2 in the cell-free degradation system. Our results indicated that VirD5 may act as both a transcriptional activator-like effector to regulate host gene expression and a protector preventing the coat proteins of the T-complex from being quickly degraded by the host's ubiquitin proteasome system (UPS). © 2014 The Authors. New Phytologist © 2014 New Phytologist Trust.

  15. Co-regulation of nuclear respiratory factor-1 by NFκB and CREB links LPS-induced inflammation to mitochondrial biogenesis

    PubMed Central

    Suliman, Hagir B.; Sweeney, Timothy E.; Withers, Crystal M.; Piantadosi, Claude A.

    2010-01-01

    The nuclear respiratory factor-1 (NRF1) gene is activated by lipopolysaccharide (LPS), which might reflect TLR4-mediated mitigation of cellular inflammatory damage via initiation of mitochondrial biogenesis. To test this hypothesis, we examined NRF1 promoter regulation by NFκB, and identified interspecies-conserved κB-responsive promoter and intronic elements in the NRF1 locus. In mice, activation of Nrf1 and its downstream target, Tfam, by Escherichia coli was contingent on NFκB, and in LPS-treated hepatocytes, NFκB served as an NRF1 enhancer element in conjunction with NFκB promoter binding. Unexpectedly, optimal NRF1 promoter activity after LPS also required binding by the energy-state-dependent transcription factor CREB. EMSA and ChIP assays confirmed p65 and CREB binding to the NRF1 promoter and p65 binding to intron 1. Functionality for both transcription factors was validated by gene-knockdown studies. LPS regulation of NRF1 led to mtDNA-encoded gene expression and expansion of mtDNA copy number. In cells expressing plasmid constructs containing the NRF-1 promoter and GFP, LPS-dependent reporter activity was abolished by cis-acting κB-element mutations, and nuclear accumulation of NFκB and CREB demonstrated dependence on mitochondrial H2O2. These findings indicate that TLR4-dependent NFκB and CREB activation co-regulate the NRF1 promoter with NFκB intronic enhancement and redox-regulated nuclear translocation, leading to downstream target-gene expression, and identify NRF-1 as an early-phase component of the host antibacterial defenses. PMID:20587593

  16. Corticotropin-releasing hormone or dexamethasone regulates rat proopiomelanocortin transcription through Tpit/Pitx-responsive element in its promoter.

    PubMed

    Murakami, Itsuo; Takeuchi, Sakae; Kudo, Toshiyuki; Sutou, Shizuyo; Takahashi, Sumio

    2007-05-01

    Tpit/Pitx-responsive element (Tpit/PitxRE), which binds transcription factors Tpit and Pitx1, confers cell-type specific expression of proopiomelanocortin (POMC) gene in pituitary corticotrops where the gene expression is mainly regulated by corticotropin-releasing hormone (CRH) and glucocorticoids (Gcs). CRH stimulates POMC gene expression, which is mediated by the accumulation of intracellular cAMP and requires binding of Nur factors to Nur-responsive element (NurRE). Gcs antagonize NurRE-dependent POMC gene expression through direct interaction between glucocorticoid receptors and Nur factors. We examined whether Tpit/PitxRE and NurRE are involved in CRH/cAMP-induced activation and Gc-induced repression of POMC gene expression by reporter assay in AtT-20 corticotropic cells. Deletion and mutation of Tpit/PitxRE markedly reduced basal activity of the promoter, and those of NurRE decreased the levels of the CRH/cAMP-induced activation. Nifedipine, KN-62, and W-7, specific inhibitors of the L-type calcium channel, calmodulin-dependent protein kinase II, and calmodulin respectively, attenuated CRH/cAMP-induced activation of promoters with three copies of either Tpit/PitxRE or NurRE, indicating that both Tpit/PitxRE and NurRE mediate CRH-induced activation of POMC gene expression in a calcium-dependent manner. Deletion and mutation of Tpit/PitxRE abolished dexamethasone (DEX)-induced repression of POMC gene expression, while those of NurRE did not, indicating that Tpit/PitxRE predominantly mediates Gc-induced repression of POMC transcription. However, DEX treatment attenuated activities of promoters with three copies of either Tpit/PitxRE or NurRE, suggesting that Gcs act at NurRE as well as Tpit/PitxRE to repress POMC gene expression. We conclude that Tpit/PitxRE is an important element by which CRH and Gcs regulate the POMC gene expression.

  17. Structural features of diverse Pin-II proteinase inhibitor genes from Capsicum annuum.

    PubMed

    Mahajan, Neha S; Dewangan, Veena; Lomate, Purushottam R; Joshi, Rakesh S; Mishra, Manasi; Gupta, Vidya S; Giri, Ashok P

    2015-02-01

    The proteinase inhibitor (PI) genes from Capsicum annuum were characterized with respect to their UTR, introns and promoter elements. The occurrence of PIs with circularly permuted domain organization was evident. Several potato inhibitor II (Pin-II) type proteinase inhibitor (PI) genes have been analyzed from Capsicum annuum (L.) with respect to their differential expression during plant defense response. However, complete gene characterization of any of these C. annuum PIs (CanPIs) has not been carried out so far. Complete gene architectures of a previously identified CanPI-7 (Beads-on-string, Type A) and a member of newly isolated Bracelet type B, CanPI-69 are reported in this study. The 5' UTR (untranslated region), 3'UTR, and intronic sequences of both the CanPI genes were obtained. The genomic sequence of CanPI-7 exhibited, exon 1 (49 base pair, bp) and exon 2 (740 bp) interrupted by a 294-bp long type I intron. We noted the occurrence of three multi-domain PIs (CanPI-69, 70, 71) with circularly permuted domain organization. CanPI-69 was found to possess exon 1 (49 bp), exon 2 (551 bp) and a 584-bp long type I intron. The upstream sequence analysis of CanPI-7 and CanPI-69 predicted various transcription factor-binding sites including TATA and CAAT boxes, hormone-responsive elements (ABRELATERD1, DOFCOREZM, ERELEE4), and a defense-responsive element (WRKY71OS). Binding of transcription factors such as zinc finger motif MADS-box and MYB to the promoter regions was confirmed using electrophoretic mobility shift assay followed by mass spectrometric identification. The 3' UTR analysis for 25 CanPI genes revealed unique/distinct 3' UTR sequence for each gene. Structures of three domain CanPIs of type A and B were predicted and further analyzed for their attributes. This investigation of CanPI gene architecture will enable the better understanding of the genetic elements present in CanPIs.

  18. Identification of estrogen-responsive genes using a genome-wide analysis of promoter elements for transcription factor binding sites.

    PubMed

    Kamalakaran, Sitharthan; Radhakrishnan, Senthil K; Beck, William T

    2005-06-03

    We developed a pipeline to identify novel genes regulated by the steroid hormone-dependent transcription factor, estrogen receptor, through a systematic analysis of upstream regions of all human and mouse genes. We built a data base of putative promoter regions for 23,077 human and 19,984 mouse transcripts from National Center for Biotechnology Information annotation and 8793 human and 6785 mouse promoters from the Data Base of Transcriptional Start Sites. We used this data base of putative promoters to identify potential targets of estrogen receptor by identifying estrogen response elements (EREs) in their promoters. Our program correctly identified EREs in genes known to be regulated by estrogen in addition to several new genes whose putative promoters contained EREs. We validated six genes (KIAA1243, NRIP1, MADH9, NME3, TPD52L, and ABCG2) to be estrogen-responsive in MCF7 cells using reverse transcription PCR. To allow for extensibility of our program in identifying targets of other transcription factors, we have built a Web interface to access our data base and programs. Our Web-based program for Promoter Analysis of Genome, PAGen@UIC, allows a user to identify putative target genes for vertebrate transcription factors through the analysis of their upstream sequences. The interface allows the user to search the human and mouse promoter data bases for potential target genes containing one or more listed transcription factor binding sites (TFBSs) in their upstream elements, using either regular expression-based consensus or position weight matrices. The data base can also be searched for promoters harboring user-defined TFBSs given as a consensus or a position weight matrix. Furthermore, the user can retrieve putative promoter sequences for any given gene together with identified TFBSs located on its promoter. Orthologous promoters are also analyzed to determine conserved elements.

  19. Biochemical and redox characterization of the mediator complex and its associated transcription factor GeBPL, a GLABROUS1 enhancer binding protein.

    PubMed

    Shaikhali, Jehad; Davoine, Céline; Brännström, Kristoffer; Rouhier, Nicolas; Bygdell, Joakim; Björklund, Stefan; Wingsle, Gunnar

    2015-06-15

    The eukaryotic mediator integrates regulatory signals from promoter-bound transcription factors (TFs) and transmits them to RNA polymerase II (Pol II) machinery. Although redox signalling is important in adjusting plant metabolism and development, nothing is known about a possible redox regulation of mediator. In the present study, using pull-down and yeast two-hybrid assays, we demonstrate the association of mediator (MED) subunits MED10a, MED28 and MED32 with the GLABROUS1 (GL1) enhancer-binding protein-like (GeBPL), a plant-specific TF that binds a promoter containing cryptochrome 1 response element 2 (CryR2) element. All the corresponding recombinant proteins form various types of covalent oligomers linked by intermolecular disulfide bonds that are reduced in vitro by the thioredoxin (TRX) and/or glutathione/glutaredoxin (GRX) systems. The presence of recombinant MED10a, MED28 and MED32 subunits or changes of its redox state affect the DNA-binding capacity of GeBPL suggesting that redox-driven conformational changes might modulate its activity. Overall, these results advance our understanding of how redox signalling affects transcription and identify mediator as a novel actor in redox signalling pathways, relaying or integrating redox changes in combination with specific TFs as GeBPL. © The Authors Journal compilation © 2015 Biochemical Society.

  20. Curcumin differentially regulates endoplasmic reticulum stress through transcriptional corepressor SMILE (small heterodimer partner-interacting leucine zipper protein)-mediated inhibition of CREBH (cAMP responsive element-binding protein H).

    PubMed

    Misra, Jagannath; Chanda, Dipanjan; Kim, Don-kyu; Li, Tiangang; Koo, Seung-Hoi; Back, Sung-Hoon; Chiang, John Y L; Choi, Hueng-Sik

    2011-12-09

    Curcumin (diferuloylmethane), a major active component of turmeric (Curcuma longa), is a natural polyphenolic compound. Herein the effect of curcumin on endoplasmic reticulum (ER) stress responsive gene expression was investigated. We report that curcumin induces transcriptional corepressor small heterodimer partner-interacting leucine zipper protein (SMILE) gene expression through liver kinase B1 (LKB1)/adenosine monophosphate-activated kinase (AMPK) signaling pathway and represses ER stress-responsive gene transcription in an ER-bound transcription factor specific manner. cAMP responsive element-binding protein H (CREBH) and activating transcription factor 6 (ATF6) are both ER-bound bZIP family transcription factors that are activated upon ER stress. Of interest, we observed that both curcumin treatment and SMILE overexpression only represses CREBH-mediated transactivation of the target gene but not ATF6-mediated transactivation. Knockdown of endogenous SMILE significantly releases the inhibitory effect of curcumin on CREBH transactivation. Intrinsic repressive activity of SMILE is observed in the Gal4 fusion system, and the intrinsic repressive domain is mapped to the C terminus of SMILE spanning amino acid residues 203-269, corresponding to the basic region leucine zipper (bZIP) domain. In vivo interaction assay revealed that through its bZIP domain, SMILE interacts with CREBH and inhibits its transcriptional activity. Interestingly, we observed that SMILE does not interact with ATF6. Furthermore, competition between SMILE and the coactivator peroxisome proliferator-activated receptor α (PGC-1α) on CREBH transactivation has been demonstrated in vitro and in vivo. Finally, chromatin immunoprecipitation assays revealed that curcumin decreases the binding of PGC-1α and CREBH on target gene promoter in a SMILE-dependent manner. Overall, for the first time we suggest a novel phenomenon that the curcumin/LKB1/AMPK/SMILE/PGC1α pathway differentially regulates ER stress-mediated gene transcription.

  1. Selective Modulation of Some Forms of Schaffer Collateral-CA1 Synaptic Plasticity in Mice with a Disruption of the "CPEB-1" Gene

    ERIC Educational Resources Information Center

    Alarcon, Juan M.; Hodgman, Rebecca; Theis, Martin; Huang, Yi-Shuian; Kandel, Eric R.; Richter, Joel D.

    2004-01-01

    CPEB-1 is a sequence-specific RNA binding protein that stimulates the polyadenylation-induced translation of mRNAs containing the cytoplasmic polyadenylation element (CPE). Although CPEB-1 was identified originally in Xenopus oocytes, it has also been found at postsynaptic sites of hippocampal neurons where, in response to N-methyl-D-aspartate…

  2. WRKY Transcription Factors Phosphorylated by MAPK Regulate a Plant Immune NADPH Oxidase in Nicotiana benthamiana[OPEN

    PubMed Central

    Adachi, Hiroaki; Nakano, Takaaki; Miyagawa, Noriko; Ishihama, Nobuaki; Yoshioka, Miki; Katou, Yuri; Yaeno, Takashi

    2015-01-01

    Pathogen attack sequentially confers pattern-triggered immunity (PTI) and effector-triggered immunity (ETI) after sensing of pathogen patterns and effectors by plant immune receptors, respectively. Reactive oxygen species (ROS) play pivotal roles in PTI and ETI as signaling molecules. Nicotiana benthamiana RBOHB, an NADPH oxidase, is responsible for both the transient PTI ROS burst and the robust ETI ROS burst. Here, we show that RBOHB transactivation mediated by MAPK contributes to R3a/AVR3a-triggered ETI (AVR3a-ETI) ROS burst. RBOHB is markedly induced during the ETI and INF1-triggered PTI (INF1-PTI), but not flg22-tiggered PTI (flg22-PTI). We found that the RBOHB promoter contains a functional W-box in the R3a/AVR3a and INF1 signal-responsive cis-element. Ectopic expression of four phospho-mimicking mutants of WRKY transcription factors, which are MAPK substrates, induced RBOHB, and yeast one-hybrid analysis indicated that these mutants bind to the cis-element. Chromatin immunoprecipitation assays indicated direct binding of the WRKY to the cis-element in plants. Silencing of multiple WRKY genes compromised the upregulation of RBOHB, resulting in impairment of AVR3a-ETI and INF1-PTI ROS bursts, but not the flg22-PTI ROS burst. These results suggest that the MAPK-WRKY pathway is required for AVR3a-ETI and INF1-PTI ROS bursts by activation of RBOHB. PMID:26373453

  3. Fibroblast growth factor 2 regulates bone sialoprotein gene transcription in human breast cancer cells.

    PubMed

    Li, Zhengyang; Wang, Zhitao; Yang, Li; Li, Xinyue; Sasaki, Yoko; Wang, Shuang; Araki, Shouta; Mezawa, Masaru; Takai, Hideki; Nakayama, Youhei; Ogata, Yorimasa

    2010-03-01

    Bone sialoprotein (BSP) is a major non-collagenous, extracellular matrix glycoprotein associated with mineralized tissues. Fibroblast growth factor 2 (FGF2) is recognized as a potent mitogen for a variety of mesenchymal cells. FGF2 produced by osteoblasts accumulates in the bone matrix and acts as an autocrine/paracrine regulator of osteoblasts. We previously reported that FGF2 regulates BSP gene transcription through the FGF2 response element (FRE) and activator protein 1 (AP1) binding site overlapping with the glucocorticoid response element in the rat BSP gene promoter. In the present study, FGF2 (10 ng/ml) increased BSP and Runx2 mRNA levels at 6 h in MCF7 human breast cancer cells. Transient transfection analyses were performed using chimeric constructs of the human BSP gene promoter linked to a luciferase reporter gene. Treatment of MCF7 cells with FGF2 (10 ng/ml) increased the luciferase activity of the constructs between -84LUC and -927LUC. Gel mobility shift analyses showed that FGF2 increased the binding of AP1 and CRE2. The CRE2- and AP1-protein complexes were disrupted by antibodies against CREB1, c-Fos, c-Jun, Fra2, p300 and Runx2. These studies demonstrate that FGF2 stimulates BSP transcription in MCF7 human breast cancer cells by targeting the AP1 and CRE2 elements in the human BSP gene promoter.

  4. Nicotine suppresses bone sialoprotein gene expression.

    PubMed

    Nakayama, Y; Mezawa, M; Araki, S; Sasaki, Y; Wang, S; Han, J; Li, X; Takai, H; Ogata, Y

    2009-10-01

    Tobacco smoking is a risk factor for periodontitis and osteoporosis. Nicotine is a major component of tobacco, and has been reported to inhibit proliferation and differentiation of osteoblasts. Bone sialoprotein (BSP) is a mineralized tissue-specific protein expressed by differentiated osteoblasts that appears to function in the initial mineralization of bone. The purpose of this study was to determine the effects of nicotine on bone metabolism. We used rat osteobast-like UMR106 and ROS 17/2.8 cells and rat stromal bone marrow RBMC-D8 cells. To determine the molecular basis of the transcriptional regulation of the BSP gene by nicotine, we conducted Northern hybridization, transient transfection analyses with chimeric constructs of the BSP gene promoter linked to a luciferase reporter gene and gel mobility shift assays. Nicotine (250 microg/mL) decreased the BSP mRNA levels at 12 and 24 h in UMR106 and ROS 17/2.8 cells. From transient transfection assays using various sized BSP promoter-luciferase constructs, nicotine decreased the luciferase activities of the construct, including the promoter sequence nucleotides -116 to +60, in UMR106 and RBMC-D8 cells. Nicotine decreased the nuclear protein binding to the cAMP response element (CRE), fibroblast growth factor 2 response element (FRE) and homeodomain protein-binding site (HOX) at 12 and 24 h. This study indicates that nicotine suppresses BSP transcription mediated through CRE, FRE and HOX elements in the proximal promoter of the rat BSP gene.

  5. Specific TATAA and bZIP requirements suggest that HTLV-I Tax has transcriptional activity subsequent to the assembly of an initiation complex

    PubMed Central

    Ching, Yick-Pang; Chun, Abel CS; Chin, King-Tung; Zhang, Zhi-Qing; Jeang, Kuan-Teh; Jin, Dong-Yan

    2004-01-01

    Background Human T-cell leukemia virus type I (HTLV-I) Tax protein is a transcriptional regulator of viral and cellular genes. In this study we have examined in detail the determinants for Tax-mediated transcriptional activation. Results Whereas previously the LTR enhancer elements were thought to be the sole Tax-targets, herein, we find that the core HTLV-I TATAA motif also provides specific responsiveness not seen with either the SV40 or the E1b TATAA boxes. When enhancer elements which can mediate Tax-responsiveness were compared, the authentic HTLV-I 21-bp repeats were found to be the most effective. Related bZIP factors such as CREB, ATF4, c-Jun and LZIP are often thought to recognize the 21-bp repeats equivalently. However, amongst bZIP factors, we found that CREB, by far, is preferred by Tax for activation. When LTR transcription was reconstituted by substituting either κB or serum response elements in place of the 21-bp repeats, Tax activated these surrogate motifs using surfaces which are different from that utilized for CREB interaction. Finally, we employed artificial recruitment of TATA-binding protein to the HTLV-I promoter in "bypass" experiments to show for the first time that Tax has transcriptional activity subsequent to the assembly of an initiation complex at the promoter. Conclusions Optimal activation of the HTLV-I LTR by Tax specifically requires the core HTLV-I TATAA promoter, CREB and the 21-bp repeats. In addition, we also provide the first evidence for transcriptional activity of Tax after the recruitment of TATA-binding protein to the promoter. PMID:15285791

  6. Supra-optimal expression of the cold-regulated OsMyb4 transcription factor in transgenic rice changes the complexity of transcriptional network with major effects on stress tolerance and panicle development.

    PubMed

    Park, Myoung-Ryoul; Yun, Kil-Young; Mohanty, Bijayalaxmi; Herath, Venura; Xu, Fuyu; Wijaya, Edward; Bajic, Vladimir B; Yun, Song-Joong; De Los Reyes, Benildo G

    2010-12-01

    The R2R3-type OsMyb4 transcription factor of rice has been shown to play a role in the regulation of osmotic adjustment in heterologous overexpression studies. However, the exact composition and organization of its underlying transcriptional network has not been established to be a robust tool for stress tolerance enhancement by regulon engineering. OsMyb4 network was dissected based on commonalities between the global chilling stress transcriptome and the transcriptome configured by OsMyb4 overexpression. OsMyb4 controls a hierarchical network comprised of several regulatory sub-clusters associated with cellular defense and rescue, metabolism and development. It regulates target genes either directly or indirectly through intermediary MYB, ERF, bZIP, NAC, ARF and CCAAT-HAP transcription factors. Regulatory sub-clusters have different combinations of MYB-like, GCC-box-like, ERD1-box-like, ABRE-like, G-box-like, as1/ocs/TGA-like, AuxRE-like, gibberellic acid response element (GARE)-like and JAre-like cis-elements. Cold-dependent network activity enhanced cellular antioxidant capacity through radical scavenging mechanisms and increased activities of phenylpropanoid and isoprenoid metabolic processes involving various abscisic acid (ABA), jasmonic acid (JA), salicylic acid (SA), ethylene and reactive oxygen species (ROS) responsive genes. OsMyb4 network is independent of drought response element binding protein/C-repeat binding factor (DREB/CBF) and its sub-regulons operate with possible co-regulators including nuclear factor-Y. Because of its upstream position in the network hierarchy, OsMyb4 functions quantitatively and pleiotrophically. Supra-optimal expression causes misexpression of alternative targets with costly trade-offs to panicle development. © 2010 Blackwell Publishing Ltd.

  7. Glucose-6-phosphate mediates activation of the carbohydrate responsive binding protein (ChREBP)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Li, Ming V.; Departments of Medicine and Molecular and Cellular Biology, Baylor College of Medicine, Houston, TX 77030; Chen, Weiqin

    2010-05-07

    Carbohydrate response element binding protein (ChREBP) is a Mondo family transcription factor that activates a number of glycolytic and lipogenic genes in response to glucose stimulation. We have previously reported that high glucose can activate the transcriptional activity of ChREBP independent of the protein phosphatase 2A (PP2A)-mediated increase in nuclear entry and DNA binding. Here, we found that formation of glucose-6-phosphate (G-6-P) is essential for glucose activation of ChREBP. The glucose response of GAL4-ChREBP is attenuated by D-mannoheptulose, a potent hexokinase inhibitor, as well as over-expression of glucose-6-phosphatase (G6Pase); kinetics of activation of GAL4-ChREBP can be modified by exogenously expressedmore » GCK. Further metabolism of G-6-P through the two major glucose metabolic pathways, glycolysis and pentose-phosphate pathway, is not required for activation of ChREBP; over-expression of glucose-6-phosphate dehydrogenase (G6PD) diminishes, whereas RNAi knockdown of the enzyme enhances, the glucose response of GAL4-ChREBP, respectively. Moreover, the glucose analogue 2-deoxyglucose (2-DG), which is phosphorylated by hexokinase, but not further metabolized, effectively upregulates the transcription activity of ChREBP. In addition, over-expression of phosphofructokinase (PFK) 1 and 2, synergistically diminishes the glucose response of GAL4-ChREBP. These multiple lines of evidence support the conclusion that G-6-P mediates the activation of ChREBP.« less

  8. A HLA class I cis-regulatory element whose activity can be modulated by hormones.

    PubMed

    Sim, B C; Hui, K M

    1994-12-01

    To elucidate the basis of the down-regulation in major histocompatibility complex (MHC) class I gene expression and to identify possible DNA-binding regulatory elements that have the potential to interact with class I MHC genes, we have studied the transcriptional regulation of class I HLA genes in human breast carcinoma cells. A 9 base pair (bp) negative cis-regulatory element (NRE) has been identified using band-shift assays employing DNA sequences derived from the 5'-flanking region of HLA class I genes. This 9-bp element, GTCATGGCG, located within exon I of the HLA class I gene, can potently inhibit the expression of a heterologous thymidine kinase (TK) gene promoter and the HLA enhancer element. Furthermore, this regulatory element can exert its suppressive function in either the sense or anti-sense orientation. More interestingly, NRE can suppress dexamethasone-mediated gene activation in the context of the reported glucocorticoid-responsive element (GRE) in MCF-7 cells but has no influence on the estrogen-mediated transcriptional activation of MCF-7 cells in the context of the reported estrogen-responsive element (ERE). Furthermore, the presence of such a regulatory element within the HLA class I gene whose activity can be modulated by hormones correlates well with our observation that the level of HLA class I gene expression can be down-regulated by hormones in human breast carcinoma cells. Such interactions between negative regulatory elements and specific hormone trans-activators are novel and suggest a versatile form of transcriptional control.

  9. Activation of Nrf2 is required for up-regulation of the π class of glutathione S-transferase in rat primary hepatocytes with L-methionine starvation.

    PubMed

    Lin, Ai-Hsuan; Chen, Haw-Wen; Liu, Cheng-Tze; Tsai, Chia-Wen; Lii, Chong-Kuei

    2012-07-04

    Numerous genes expression is regulated in response to amino acid shortage, which helps organisms adapt to amino acid limitation. The expression of the π class of glutathione (GSH) S-transferase (GSTP), a highly inducible phase II detoxification enzyme, is regulated mainly by activates activating protein 1 (AP-1) binding to the enhancer I of GSTP (GPEI). Here we show the critical role of nuclear factor erythroid-2-related factor 2 (Nrf2) in up-regulating GSTP gene transcription. Primary rat hepatocytes were cultured in a methionine-restricted medium, and immunoblotting and RT-PCR analyses showed that methionine restriction time-dependently increased GSTP protein and mRNA expression over a 48 h period. Nrf2 translocation to the nucleus, nuclear proteins binding to GPEI, and antioxidant response element (ARE) luciferase reporter activity were increased by methionine restriction as well as by l-buthionine sulfoximine (BSO), a GSH synthesis inhibitor. Transfection with Nrf2 siRNA knocked down Nrf2 expression and reversed the methionine-induced GSTP expression and GPEI binding activity. Chromatin immunoprecipitation assay confirmed the binding of Nrf2 to the GPEI. Phosphorylation of extracellular signal-regulated kinase 2 (ERK2) was increased in methionine-restricted and BSO-treated cells. ERK2 siRNA abolished methionine restriction-induced Nrf2 nuclear translocation, GPEI binding activity, ARE-luciferase reporter activity, and GSTP expression. Our results suggest that the up-regulation of GSTP gene transcription in response to methionine restriction likely occurs via the ERK-Nrf2-GPEI signaling pathway.

  10. Antihelminthic Benzimidazoles Are Novel HIF Activators That Prevent Oxidative Neuronal Death via Binding to Tubulin

    PubMed Central

    Aleyasin, Hossein; Karuppagounder, Saravanan S.; Kumar, Amit; Sleiman, Sama; Basso, Manuela; Ma, Thong; Siddiq, Ambreena; Chinta, Shankar J.; Brochier, Camille; Langley, Brett; Haskew-Layton, Renee; Bane, Susan L.; Riggins, Gregory J.; Gazaryan, Irina; Starkov, Anatoly A.; Andersen, Julie K.

    2015-01-01

    Abstract Aims: Pharmacological activation of the adaptive response to hypoxia is a therapeutic strategy of growing interest for neurological conditions, including stroke, Huntington's disease, and Parkinson's disease. We screened a drug library with known safety in humans using a hippocampal neuroblast line expressing a reporter of hypoxia-inducible factor (HIF)-dependent transcription. Results: Our screen identified more than 40 compounds with the ability to induce hypoxia response element-driven luciferase activity as well or better than deferoxamine, a canonical activator of hypoxic adaptation. Among the chemical entities identified, the antihelminthic benzimidazoles represented one pharmacophore that appeared multiple times in our screen. Secondary assays confirmed that antihelminthics stabilized the transcriptional activator HIF-1α and induced expression of a known HIF target gene, p21cip1/waf1, in post-mitotic cortical neurons. The on-target effect of these agents in stimulating hypoxic signaling was binding to free tubulin. Moreover, antihelminthic benzimidazoles also abrogated oxidative stress-induced death in vitro, and this on-target effect also involves binding to free tubulin. Innovation and Conclusions: These studies demonstrate that tubulin-binding drugs can activate a component of the hypoxic adaptive response, specifically the stabilization of HIF-1α and its downstream targets. Tubulin-binding drugs, including antihelminthic benzimidazoles, also abrogate oxidative neuronal death in primary neurons. Given their safety in humans and known ability to penetrate into the central nervous system, antihelminthic benzimidazoles may be considered viable candidates for treating diseases associated with oxidative neuronal death, including stroke. Antioxid. Redox Signal. 22, 121–134. PMID:24766300

  11. Hepatic nuclear factor 3 and nuclear factor 1 regulate 5-aminolevulinate synthase gene expression and are involved in insulin repression.

    PubMed

    Scassa, María E; Guberman, Alejandra S; Ceruti, Julieta M; Cánepa, Eduardo T

    2004-07-02

    Although the negative regulation of gene expression by insulin has been widely studied, the transcription factors responsible for the insulin effect are still unknown. The purpose of this work was to explore the molecular mechanisms involved in the insulin repression of the 5-aminolevulinate synthase (ALAS) gene. Deletion analysis of the 5'-regulatory region allowed us to identify an insulin-responsive region located at -459 to -354 bp. This fragment contains a highly homologous insulin-responsive (IRE) sequence. By transient transfection assays, we determined that hepatic nuclear factor 3 (HNF3) and nuclear factor 1 (NF1) are necessary for an appropriate expression of the ALAS gene. Insulin overrides the HNF3beta or HNF3beta plus NF1-mediated stimulation of ALAS transcriptional activity. Electrophoretic mobility shift assay and Southwestern blotting indicate that HNF3 binds to the ALAS promoter. Mutational analysis of this region revealed that IRE disruption abrogates insulin action, whereas mutation of the HNF3 element maintains hormone responsiveness. This dissociation between HNF3 binding and insulin action suggests that HNF3beta is not the sole physiologic mediator of insulin-induced transcriptional repression. Furthermore, Southwestern blotting assay shows that at least two polypeptides other than HNF3beta can bind to ALAS promoter and that this binding is dependent on the integrity of the IRE. We propose a model in which insulin exerts its negative effect through the disturbance of HNF3beta binding or transactivation potential, probably due to specific phosphorylation of this transcription factor by Akt. In this regard, results obtained from transfection experiments using kinase inhibitors support this hypothesis. Due to this event, NF1 would lose accessibility to the promoter. The posttranslational modification of HNF3 would allow the binding of a protein complex that recognizes the core IRE. These results provide a potential mechanism for the insulin-mediated repression of IRE-containing promoters.

  12. Identification of high-confidence RNA regulatory elements by combinatorial classification of RNA-protein binding sites.

    PubMed

    Li, Yang Eric; Xiao, Mu; Shi, Binbin; Yang, Yu-Cheng T; Wang, Dong; Wang, Fei; Marcia, Marco; Lu, Zhi John

    2017-09-08

    Crosslinking immunoprecipitation sequencing (CLIP-seq) technologies have enabled researchers to characterize transcriptome-wide binding sites of RNA-binding protein (RBP) with high resolution. We apply a soft-clustering method, RBPgroup, to various CLIP-seq datasets to group together RBPs that specifically bind the same RNA sites. Such combinatorial clustering of RBPs helps interpret CLIP-seq data and suggests functional RNA regulatory elements. Furthermore, we validate two RBP-RBP interactions in cell lines. Our approach links proteins and RNA motifs known to possess similar biochemical and cellular properties and can, when used in conjunction with additional experimental data, identify high-confidence RBP groups and their associated RNA regulatory elements.

  13. Dissecting protein:protein interactions between transcription factors with an RNA aptamer.

    PubMed Central

    Tian, Y; Adya, N; Wagner, S; Giam, C Z; Green, M R; Ellington, A D

    1995-01-01

    Nucleic acid aptamers isolated from random sequence pools have generally proven useful at inhibiting the interactions of nucleic acid binding proteins with their cognate nucleic acids. In order to develop reagents that could also be used to study protein:protein interactions, we have used in vitro selection to search for RNA aptamers that could interact with the transactivating protein Tax from human T-cell leukemia virus. Tax does not normally bind to nucleic acids, but instead stimulates transcription by interacting with a variety of cellular transcription factors, including the cyclic AMP-response element binding protein (CREB), NF-kappa B, and the serum response factor (SRF). Starting from a pool of greater than 10(13) different RNAs with a core of 120 random sequence positions, RNAs were selected for their ability to be co-retained on nitrocellulose filters with Tax. After five cycles of selection and amplification, a single nucleic acid species remained. This aptamer was found to bind Tax with high affinity and specificity, and could disrupt complex formation between Tax and NF-kappa B, but not with SRF. The differential effects of our aptamer probe on protein:protein interactions suggest a model for how the transcription factor binding sites on the surface of the Tax protein are organized. This model is consistent with data from a variety of other studies. PMID:7489503

  14. Bacterial Surface Glycans: Microarray and QCM Strategies for Glycophenotyping and Exploration of Recognition by Host Receptors.

    PubMed

    Kalograiaki, Ioanna; Campanero-Rhodes, María A; Proverbio, Davide; Euba, Begoña; Garmendia, Junkal; Aastrup, Teodor; Solís, Dolores

    2018-01-01

    Bacterial surfaces are decorated with a diversity of carbohydrate structures that play important roles in the bacteria-host relationships. They may offer protection against host defense mechanisms, elicit strong antigenic responses, or serve as ligands for host receptors, including lectins of the innate immune system. Binding by these lectins may trigger defense responses or, alternatively, promote attachment, thereby enhancing infection. The outcome will depend on the particular bacterial surface landscape, which may substantially differ among species and strains. In this chapter, we describe two novel methods for exploring interactions directly on the bacterial surface, based on the generation of bacterial microarrays and quartz crystal microbalance (QCM) sensor chips. Bacterial microarrays enable profiling of accessible carbohydrate structures and screening of their recognition by host receptors, also providing information on binding avidity, while the QCM approach allows determination of binding affinity and kinetics. In both cases, the chief element is the use of entire bacterial cells, so that recognition of the bacterial glycan epitopes is explored in their natural environment. © 2018 Elsevier Inc. All rights reserved.

  15. NF-Y and the immune response: Dissecting the complex regulation of MHC genes.

    PubMed

    Sachini, Nikoleta; Papamatheakis, Joseph

    2017-05-01

    Nuclear Factor Y (NF-Y) was first described as one of the CCAAT binding factors. Although CCAAT motifs were found to be present in various genes, NF-Y attracted a lot of interest early on, due to its role in Major Histocompatibility Complex (MHC) gene regulation. MHC genes are crucial in immune response and show peculiar expression patterns. Among other conserved elements on MHC promoters, an NF-Y binding CCAAT box was found to contribute to MHC transcriptional regulation. NF-Y along with other DNA binding factors assembles in a stereospecific manner to form a multiprotein scaffold, the MHC enhanceosome, which is necessary but not sufficient to drive transcription. Transcriptional activation is achieved by the recruitment of yet another factor, the class II transcriptional activator (CIITA). In this review, we briefly discuss basic findings on MHCII transcription regulation and we highlight NF-Y different modes of function in MHCII gene activation. This article is part of a Special Issue entitled: Nuclear Factor Y in Development and Disease, edited by Prof. Roberto Mantovani. Copyright © 2016 Elsevier B.V. All rights reserved.

  16. Lepidium meyenii (Maca) does not exert direct androgenic activities.

    PubMed

    Bogani, P; Simonini, F; Iriti, M; Rossoni, M; Faoro, F; Poletti, A; Visioli, F

    2006-04-06

    Maca is the edible root of the Peruvian plant Lepidum meyenii, traditionally employed for its purported aphrodisiac and fertility-enhancing properties. This study aimed at testing the hypothesis that Maca contains testosterone-like compounds, able to bind the human androgen receptor and promote transcription pathways regulated by steroid hormone signaling. Maca extracts (obtained with different solvents: methanol, ethanol, hexane and chloroform) are not able to regulate GRE (glucocorticoid response element) activation. Further experiments are needed to assess which compound, of the several Maca's components, is responsible of the observed in vivo effects.

  17. Conservation of CD44 exon v3 functional elements in mammals

    PubMed Central

    Vela, Elena; Hilari, Josep M; Delclaux, María; Fernández-Bellon, Hugo; Isamat, Marcos

    2008-01-01

    Background The human CD44 gene contains 10 variable exons (v1 to v10) that can be alternatively spliced to generate hundreds of different CD44 protein isoforms. Human CD44 variable exon v3 inclusion in the final mRNA depends on a multisite bipartite splicing enhancer located within the exon itself, which we have recently described, and provides the protein domain responsible for growth factor binding to CD44. Findings We have analyzed the sequence of CD44v3 in 95 mammalian species to report high conservation levels for both its splicing regulatory elements (the 3' splice site and the exonic splicing enhancer), and the functional glycosaminglycan binding site coded by v3. We also report the functional expression of CD44v3 isoforms in peripheral blood cells of different mammalian taxa with both consensus and variant v3 sequences. Conclusion CD44v3 mammalian sequences maintain all functional splicing regulatory elements as well as the GAG binding site with the same relative positions and sequence identity previously described during alternative splicing of human CD44. The sequence within the GAG attachment site, which in turn contains the Y motif of the exonic splicing enhancer, is more conserved relative to the rest of exon. Amplification of CD44v3 sequence from mammalian species but not from birds, fish or reptiles, may lead to classify CD44v3 as an exclusive mammalian gene trait. PMID:18710510

  18. Regulatory elements involved in tax-mediated transactivation of the HTLV-I LTR.

    PubMed

    Seeler, J S; Muchardt, C; Podar, M; Gaynor, R B

    1993-10-01

    HTLV-I is the etiologic agent of adult T-cell leukemia. In this study, we investigated the regulatory elements and cellular transcription factors which function in modulating HTLV-I gene expression in response to the viral transactivator protein, tax. Transfection experiments into Jurkat cells of a variety of site-directed mutants in the HTLV-1 LTR indicated that each of the three motifs A, B, and C within the 21-bp repeats, the binding sites for the Ets family of proteins, and the TATA box all influenced the degree of tax-mediated activation. Tax is also able to activate gene expression of other viral and cellular promoters. Tax activation of the IL-2 receptor and the HIV-1 LTR is mediated through NF-kappa B motifs. Interestingly, sequences in the 21-bp repeat B and C motifs contain significant homology with NF-kappa B regulatory elements. We demonstrated that an NF-kappa B binding protein, PRDII-BF1, but not the rel protein, bound to the B and C motifs in the 21-bp repeat. PRDII-BF1 was also able to stimulate activation of HTLV-I gene expression by tax. The role of the Ets proteins on modulating tax activation was also studied. Ets 1 but not Ets 2 was capable of increasing the degree of tax activation of the HTLV-I LTR. These results suggest that tax activates gene expression by either direct or indirect interaction with several cellular transcription factors that bind to the HTLV-I LTR.

  19. A Novel Heat Shock Element (HSE) in Entamoeba histolytica that Regulates the Transcriptional Activation of the EhPgp5 Gene in the Presence of Emetine Drug.

    PubMed

    Nieto, Alma; Pérez Ishiwara, David G; Orozco, Esther; Sánchez Monroy, Virginia; Gómez García, Consuelo

    2017-01-01

    Transcriptional regulation of the multidrug resistance EhPgp5 gene in Entamoeba histolytica is induced by emetine stress. EhPgp5 overexpression alters the chloride-dependent currents that cause trophozoite swelling, diminishing induced programmed cell death (PCD) susceptibility. In contrast, antisense inhibition of P-glycoprotein (PGP) expression produces synchronous death of trophozoites and the enhancement of the biochemical and morphological characteristics of PCD induced by G418. Transcriptional gene regulation analysis identified a 59 bp region at position -170 to -111 bp promoter as putative emetine response elements (EREs). However, insights into transcription factors controlling EhPgp5 gene transcription are missing; to fill this knowledge gap, we used deletion studies and transient CAT activity assays. Our findings suggested an activating motif (-151 to -136 bp) that corresponds to a heat shock element (HSE). Gel-shift assays, UV-crosslinking, binding protein purification, and western blotting assays revealed proteins of 94, 66, 62, and 51 kDa binding to the EhPgp5 HSE that could be heat shock-like transcription factors that regulate the transcriptional activation of the EhPgp5 gene in the presence of emetine drug.

  20. Preparation of oligoribonucleotides containing 4-thiouridine using Fpmp chemistry. Photo-crosslinking to RNA binding proteins using 350 nm irradiation.

    PubMed Central

    McGregor, A; Rao, M V; Duckworth, G; Stockley, P G; Connolly, B A

    1996-01-01

    The preparation of a 4-thiouridine phosphoramidite suitable for RNA synthesis and its subsequent incorporation into oligoribonucleotides is described. The thiol group is protected with a 2-cyanoethyl group and the 2'-OH with a 1-(2-fluorophenyl)-4-methoxypiperidin-4-yl function. Thiouridine-containing oligoribonucleotides were used as 350 nm UV crosslinking probes for the photoaffinity labelling of RNA binding proteins. Specific crosslinking was demonstrated between the Rev protein of HIV-1 (as a glutathione S-transferase fusion protein) and its RNA target, the Rev-responsive element. It was not possible to generate crosslinks between the RNA bacteriophage MS2 coat protein and the initiator stem-loop of the replicase gene, to which it binds. These results are consistent with the structural data available on both systems. PMID:8774897

  1. Identification of a negative element in the human vimentin promoter: modulation by the human T-cell leukemia virus type I Tax protein.

    PubMed Central

    Salvetti, A; Lilienbaum, A; Li, Z; Paulin, D; Gazzolo, L

    1993-01-01

    The vimentin gene is a member of the intermediate filament multigene family and encodes a protein expressed, in vivo, in all mesenchymal derivatives and, in vitro, in cell types of various origin. We have previously demonstrated that the expression of this growth-regulated gene could be trans activated by the 40-kDa Tax protein of HTLV-I (human T-cell leukemia virus type I) and that responsiveness to this viral protein was mediated by the presence of an NF-kappa B binding site located between -241 and -210 bp upstream of the mRNA cap site (A. Lilienbaum, M. Duc Dodon, C. Alexandre, L. Gazzolo, and D. Paulin, J. Virol. 64:256-263, 1990). These previous assays, performed with deletion mutants of the vimentin promoter linked to the chloramphenicol acetyltransferase gene, also revealed the presence of an upstream negative region between -529 and -241 bp. Interestingly, the inhibitory activity exerted by this negative region was overcome after cotransfection of a Tax-expressing plasmid. In this study, we further characterize the vimentin negative element and define the effect of the Tax protein on the inhibitory activity of this element. We first demonstrate that a 187-bp domain (-424 to -237 bp) behaves as a negative region when placed upstream either of the NF-kappa B binding site of vimentin or of a heterologous enhancer such as that present in the desmin gene promoter. The negative effect can be further assigned to a 32-bp element which is indeed shown to repress the basal or induced activity of the NF-kappa B binding site.(ABSTRACT TRUNCATED AT 250 WORDS) Images PMID:8417364

  2. Determining ERβ Binding Affinity to Singly Mutant ERE Using Dual Polarization Interferometry

    NASA Astrophysics Data System (ADS)

    Song, Hong Yan; Su, Xiaodi

    In a classic mode of estrogen action, estrogen receptors (ERs) bind to estrogen responsive element (ERE) to activate gene transcription. A perfect ERE contains a 13-base pair sequence of a palindromic repeat separated by a three-base spacer, 5‧-GGTCAnnnTGACC-3‧. In addition to the consensus or wild-type ERE (wtERE), naturally occurring EREs often have one or two base pairs’ alternation. Based on the newly constructed Thermodynamic Modeling of ChIP-seq (TherMos) model, binding energy between ERβ and a series of 34-bp mutant EREs (mutERE) was simulated to predict the binding affinity between ERs and EREs with single base pair deviation at different sites of the 13-bp inverted sequence. Experimentally, dual polarization interferometry (DPI) method was developed to measure ERβ-mutEREs binding affinity. On a biotin-NeutrAvidin (NA)-biotin treated DPI chip, wtERE is immobilized. In a direct binding assay, ERβ-wtERE binding affinity is determined. In a competition assay, ERβ was preincubated with mutant EREs before being added for competitive binding to the immobilized wtERE. This competition strategy provided a successful platform to evaluate the binding affinity variation among large number of ERE with different base mutations. The experimental result correlates well with the mathematically predicted binding energy with a Spearman correlation coefficient of 0.97.

  3. Characterization of a Smad motif similar to Drosophila mad in the mouse Msx 1 promoter.

    PubMed

    Alvarez Martinez, Cristina E; Binato, Renata; Gonzalez, Sayonara; Pereira, Monica; Robert, Benoit; Abdelhay, Eliana

    2002-03-01

    Mouse Msx 1 gene, orthologous of the Drosophila msh, is involved in several developmental processes. BMP family members are major proteins in the regulation of Msx 1 expression. BMP signaling activates Smad 1/5/8 proteins, which associate to Smad 4 before translocating to the nucleus. Analysis of Msx 1 promoter revealed the presence of three elements similar to the consensus established for Mad, the Smad 1 Drosophila counterpart. Notably, such an element was identified in an enhancer important for Msx 1 regulation. Gel shift analysis demonstrated that proteins from 13.5 dpc embryo associate to this enhancer. Remarkably, supershift assays showed that Smad proteins are present in the complex. Purified Smad 1 and 4 also bind to this fragment. We demonstrate that functional binding sites in this enhancer are confined to the Mad motif and flanking region. Our data suggest that this Mad motif may be functional in response to BMP signaling. ©2002 Elsevier Science (USA).

  4. Transcriptional regulation of hepatic lipogenesis.

    PubMed

    Wang, Yuhui; Viscarra, Jose; Kim, Sun-Joong; Sul, Hei Sook

    2015-11-01

    Fatty acid and fat synthesis in the liver is a highly regulated metabolic pathway that is important for very low-density lipoprotein (VLDL) production and thus energy distribution to other tissues. Having common features at their promoter regions, lipogenic genes are coordinately regulated at the transcriptional level. Transcription factors, such as upstream stimulatory factors (USFs), sterol regulatory element-binding protein 1C (SREBP1C), liver X receptors (LXRs) and carbohydrate-responsive element-binding protein (ChREBP) have crucial roles in this process. Recently, insights have been gained into the signalling pathways that regulate these transcription factors. After feeding, high blood glucose and insulin levels activate lipogenic genes through several pathways, including the DNA-dependent protein kinase (DNA-PK), atypical protein kinase C (aPKC) and AKT-mTOR pathways. These pathways control the post-translational modifications of transcription factors and co-regulators, such as phosphorylation, acetylation or ubiquitylation, that affect their function, stability and/or localization. Dysregulation of lipogenesis can contribute to hepatosteatosis, which is associated with obesity and insulin resistance.

  5. Coordinate action of distinct sequence elements localizes checkpoint kinase Hsl1 to the septin collar at the bud neck in Saccharomyces cerevisiae

    PubMed Central

    Finnigan, Gregory C.; Sterling, Sarah M.; Duvalyan, Angela; Liao, Elizabeth N.; Sargsyan, Aspram; Garcia, Galo; Nogales, Eva; Thorner, Jeremy

    2016-01-01

    Passage through the eukaryotic cell cycle requires processes that are tightly regulated both spatially and temporally. Surveillance mechanisms (checkpoints) exert quality control and impose order on the timing and organization of downstream events by impeding cell cycle progression until the necessary components are available and undamaged and have acted in the proper sequence. In budding yeast, a checkpoint exists that does not allow timely execution of the G2/M transition unless and until a collar of septin filaments has properly assembled at the bud neck, which is the site where subsequent cytokinesis will occur. An essential component of this checkpoint is the large (1518-residue) protein kinase Hsl1, which localizes to the bud neck only if the septin collar has been correctly formed. Hsl1 reportedly interacts with particular septins; however, the precise molecular determinants in Hsl1 responsible for its recruitment to this cellular location during G2 have not been elucidated. We performed a comprehensive mutational dissection and accompanying image analysis to identify the sequence elements within Hsl1 responsible for its localization to the septins at the bud neck. Unexpectedly, we found that this targeting is multipartite. A segment of the central region of Hsl1 (residues 611–950), composed of two tandem, semiredundant but distinct septin-associating elements, is necessary and sufficient for binding to septin filaments both in vitro and in vivo. However, in addition to 611–950, efficient localization of Hsl1 to the septin collar in the cell obligatorily requires generalized targeting to the cytosolic face of the plasma membrane, a function normally provided by the C-terminal phosphatidylserine-binding KA1 domain (residues 1379–1518) in Hsl1 but that can be replaced by other, heterologous phosphatidylserine-binding sequences. PMID:27193302

  6. The lytic origin of herpesvirus papio is highly homologous to Epstein-Barr virus ori-Lyt: evolutionary conservation of transcriptional activation and replication signals.

    PubMed Central

    Ryon, J J; Fixman, E D; Houchens, C; Zong, J; Lieberman, P M; Chang, Y N; Hayward, G S; Hayward, S D

    1993-01-01

    Herpesvirus papio (HVP) is a B-lymphotropic baboon virus with an estimated 40% homology to Epstein-Barr virus (EBV). We have cloned and sequenced ori-Lyt of herpesvirus papio and found a striking degree of nucleotide homology (89%) with ori-Lyt of EBV. Transcriptional elements form an integral part of EBV ori-Lyt. The promoter and enhancer domains of EBV ori-Lyt are conserved in herpesvirus papio. The EBV ori-Lyt promoter contains four binding sites for the EBV lytic cycle transactivator Zta, and the enhancer includes one Zta and two Rta response elements. All five of the Zta response elements and one of the Rta motifs are conserved in HVP ori-Lyt, and the HVP DS-L leftward promoter and the enhancer were activated in transient transfection assays by the EBV Zta and Rta transactivators. The EBV ori-Lyt enhancer contains a palindromic sequence, GGTCAGCTGACC, centered on a PvuII restriction site. This sequence, with a single base change, is also present in the HVP ori-Lyt enhancer. DNase I footprinting demonstrated that the PvuII sequence was bound by a protein present in a Raji nuclear extract. Mobility shift and competition assays using oligonucleotide probes identified this sequence as a binding site for the cellular transcription factor MLTF. Mutagenesis of the binding site indicated that MLTF contributes significantly to the constitutive activity of the ori-Lyt enhancer. The high degree of conservation of cis-acting signal sequences in HVP ori-Lyt was further emphasized by the finding that an HVP ori-Lyt-containing plasmid was replicated in Vero cells by a set of cotransfected EBV replication genes. The central domain of EBV ori-Lyt contains two related AT-rich palindromes, one of which is partially duplicated in the HVP sequence. The AT-rich palindromes are functionally important cis-acting motifs. Deletion of these palindromes severely diminished replication of an ori-Lyt target plasmid. Images PMID:8389916

  7. Segmental expression of Hoxb2 in r4 requires two separate sites that integrate cooperative interactions between Prep1, Pbx and Hox proteins.

    PubMed

    Ferretti, E; Marshall, H; Pöpperl, H; Maconochie, M; Krumlauf, R; Blasi, F

    2000-01-01

    Direct auto- and cross-regulatory interactions between Hox genes serve to establish and maintain segmentally restricted patterns in the developing hindbrain. Rhombomere r4-specific expression of both Hoxb1 and Hoxb2 depends upon bipartite cis Hox response elements for the group 1 paralogous proteins, Hoxal and Hoxbl. The DNA-binding ability and selectivity of these proteins depend upon the formation of specific heterodimeric complexes with members of the PBC homeodomain protein family (Pbx genes). The r4 enhancers from Hoxb1 and Hoxb2 have the same activity, but differ with respect to the number and organisation of bipartite Pbx/Hox (PH) sites required, suggesting the intervention of other components/sequences. We report here that another family of homeodomain proteins (TALE, Three-Amino acids-Loop-Extension: Prep1, Meis, HTH), capable of dimerizing with Pbx/EXD, is involved in the mechanisms of r4-restricted expression. We show that: (1) the r4-specific Hoxb1 and Hoxb2 enhancers are complex elements containing separate PH and Prep/Meis (PM) sites; (2) the PM site of the Hoxb2, but not Hoxb1, enhancer is essential in vivo for r4 expression and also influences other sites of expression; (3) both PM and PH sites are required for in vitro binding of Prepl-Pbx and formation and binding of a ternary Hoxbl-Pbxla (or 1b)-Prepl complex. (4) A similar ternary association forms in nuclear extracts from embryonal P19 cells, but only upon retinoic acid induction. This requires synthesis of Hoxbl and also contains Pbx with either Prepl or Meisl. Together these findings highlight the fact that PM sites are found in close proximity to bipartite PH motifs in several Hox responsive elements shown to be important in vivo and that such sites play an essential role in potentiating regulatory activity in combination with the PH motifs.

  8. Microscopic insight into thermodynamics of conformational changes of SAP-SLAM complex in signal transduction cascade

    NASA Astrophysics Data System (ADS)

    Samanta, Sudipta; Mukherjee, Sanchita

    2017-04-01

    The signalling lymphocytic activation molecule (SLAM) family of receptors, expressed by an array of immune cells, associate with SLAM-associated protein (SAP)-related molecules, composed of single SH2 domain architecture. SAP activates Src-family kinase Fyn after SLAM ligation, resulting in a SLAM-SAP-Fyn complex, where, SAP binds the Fyn SH3 domain that does not involve canonical SH3 or SH2 interactions. This demands insight into this SAP mediated signalling cascade. Thermodynamics of the conformational changes are extracted from the histograms of dihedral angles obtained from the all-atom molecular dynamics simulations of this structurally well characterized SAP-SLAM complex. The results incorporate the binding induced thermodynamic changes of individual amino acid as well as the secondary structural elements of the protein and the solvent. Stabilization of the peptide partially comes through a strong hydrogen bonding network with the protein, while hydrophobic interactions also play a significant role where the peptide inserts itself into a hydrophobic cavity of the protein. SLAM binding widens SAP's second binding site for Fyn, which is the next step in the signal transduction cascade. The higher stabilization and less fluctuation of specific residues of SAP in the Fyn binding site, induced by SAP-SLAM complexation, emerge as the key structural elements to trigger the recognition of SAP by the SH3 domain of Fyn. The thermodynamic quantification of the protein due to complexation not only throws deeper understanding in the established mode of SAP-SLAM interaction but also assists in the recognition of the relevant residues of the protein responsible for alterations in its activity.

  9. Microscopic insight into thermodynamics of conformational changes of SAP-SLAM complex in signal transduction cascade.

    PubMed

    Samanta, Sudipta; Mukherjee, Sanchita

    2017-04-28

    The signalling lymphocytic activation molecule (SLAM) family of receptors, expressed by an array of immune cells, associate with SLAM-associated protein (SAP)-related molecules, composed of single SH2 domain architecture. SAP activates Src-family kinase Fyn after SLAM ligation, resulting in a SLAM-SAP-Fyn complex, where, SAP binds the Fyn SH3 domain that does not involve canonical SH3 or SH2 interactions. This demands insight into this SAP mediated signalling cascade. Thermodynamics of the conformational changes are extracted from the histograms of dihedral angles obtained from the all-atom molecular dynamics simulations of this structurally well characterized SAP-SLAM complex. The results incorporate the binding induced thermodynamic changes of individual amino acid as well as the secondary structural elements of the protein and the solvent. Stabilization of the peptide partially comes through a strong hydrogen bonding network with the protein, while hydrophobic interactions also play a significant role where the peptide inserts itself into a hydrophobic cavity of the protein. SLAM binding widens SAP's second binding site for Fyn, which is the next step in the signal transduction cascade. The higher stabilization and less fluctuation of specific residues of SAP in the Fyn binding site, induced by SAP-SLAM complexation, emerge as the key structural elements to trigger the recognition of SAP by the SH3 domain of Fyn. The thermodynamic quantification of the protein due to complexation not only throws deeper understanding in the established mode of SAP-SLAM interaction but also assists in the recognition of the relevant residues of the protein responsible for alterations in its activity.

  10. Probing a 2-aminobenzimidazole library for binding to RNA internal loops via two-dimensional combinatorial screening.

    PubMed

    Velagapudi, Sai Pradeep; Pushechnikov, Alexei; Labuda, Lucas P; French, Jonathan M; Disney, Matthew D

    2012-11-16

    There are many potential RNA drug targets in bacterial, viral, and human transcriptomes. However, there are few small molecules that modulate RNA function. This is due, in part, to a lack of fundamental understanding about RNA-ligand interactions including the types of small molecules that bind to RNA structural elements and the RNA structural elements that bind to small molecules. In an effort to better understand RNA-ligand interactions, we diversified the 2-aminobenzimidazole core (2AB) and probed the resulting library for binding to a library of RNA internal loops. We chose the 2AB core for these studies because it is a privileged scaffold for binding RNA based on previous reports. These studies identified that N-methyl pyrrolidine, imidazole, and propylamine diversity elements at the R1 position increase binding to internal loops; variability at the R2 position is well tolerated. The preferred RNA loop space was also determined for five ligands using a statistical approach and identified trends that lead to selective recognition.

  11. The PROGINS polymorphism of the human progesterone receptor diminishes the response to progesterone.

    PubMed

    Romano, Andrea; Delvoux, Bert; Fischer, Dagmar-Christiane; Groothuis, Patrick

    2007-02-01

    The human progesterone receptor (PR) is a ligand-dependent transcription factor and two isoforms, (PRA and PRB), can be distinguished. PROGINS, a PR polymorphic variant, affects PRA and PRB and acts as a risk-modulating factor in several gynaecological disorders. Little is known about the functional consequences of this variant. Here, we characterise the properties of PROGINS with respect to transcription, mRNA maturation, protein activity and proliferation. PROGINS is characterised by a 320 bp PV/HS-1 Alu insertion in intron G and two point mutations, V660L in exon 4 and H770H (silent substitution) in exon 5. The Alu element contains a half oestrogen-response element/Sp1-binding site (Alu-ERE/Sp1), which acts as an in-cis intronic enhancer leading to increased transcription of the PROGINS allele in response to 17beta-oestradiol. Moreover, Alu insertions in the human genome are frequently methylated. Our data indicate that the PROGINS-Alu does not affect gene transcription due to DNA methylation. However, the Alu element reduced the stability of the PROGINS transcript compared with the CP allele and does not generate splice variants. The amino acid substitution (V600L) in exon 4 leads to differences in PR phosphorylation and degradation in the two PR variants upon ligand binding, most likely as a result of differences in the three-dimensional structures of the two PR variants. As a consequence, the PR-L660 (PROGINS) variant (1) displays decreased transactivation activity in a luciferase reporter system and (2) is less efficient in opposing cell proliferation in hamster ovarian cells expressing human PRA, when compared with the PR-V660 (most common variant). Taken together, our results indicate that the PROGINS variant of PR is less responsive to progestin compared with the most common PR because of (i) reduced amounts of gene transcript and (ii) decreased protein activity.

  12. Micromechanical antibody sensor

    DOEpatents

    Thundat, Thomas G.; Jacobson, K. Bruce; Doktycz, Mitchel J.; Kennel, Stephen J.; Warmack, Robert J.

    2001-01-01

    A sensor apparatus is provided using a microcantilevered spring element having a coating of a detector molecule such as an antibody or antigen. A sample containing a target molecule or substrate is provided to the coating. The spring element bends in response to the stress induced by the binding which occurs between the detector and target molecules. Deflections of the cantilever are detected by a variety of detection techniques. The microcantilever may be approximately 1 to 200 .mu.m long, approximately 1 to 50 .mu.m wide, and approximately 0.3 to 3.0 .mu.m thick. A sensitivity for detection of deflections is in the range of 0.01 nanometers.

  13. RNA-Binding Proteins in Female Reproductive Pathologies.

    PubMed

    Khalaj, Kasra; Miller, Jessica E; Fenn, Christian R; Ahn, SooHyun; Luna, Rayana L; Symons, Lindsey; Monsanto, Stephany P; Koti, Madhuri; Tayade, Chandrakant

    2017-06-01

    RNA-binding proteins are key regulatory molecules involved primarily in post-transcriptional gene regulation of RNAs. Post-transcriptional gene regulation is critical for adequate cellular growth and survival. Recent reports have shown key interactions between these RNA-binding proteins and other regulatory elements, such as miRNAs and long noncoding RNAs, either enhancing or diminishing their response to RNA stabilization. Many RNA-binding proteins have been reported to play a functional role in mediation of cytokines involved in inflammation and immune dysfunction, and some have been classified as global post-transcriptional regulators of inflammation. The ubiquitous expression of RNA-binding proteins in a wide variety of cell types and their unique mechanisms of degradative action provide evidence that they are involved in reproductive tract pathologies. Aberrant inflammation and immune dysfunction are major contributors to the pathogenesis and disease pathophysiology of many reproductive pathologies, including ovarian and endometrial cancers in the female reproductive tract. Herein, we discuss various RNA-binding proteins and their unique contributions to female reproductive pathologies with a focus on those mediated by aberrant inflammation and immune dysfunction. Copyright © 2017 American Society for Investigative Pathology. Published by Elsevier Inc. All rights reserved.

  14. Phosphorylation of poly(rC) binding protein 1 (PCBP1) contributes to stabilization of mu opioid receptor (MOR) mRNA via interaction with AU-rich element RNA-binding protein 1 (AUF1) and poly A binding protein (PABP)

    PubMed Central

    Hwang, Cheol Kyu; Wagley, Yadav; Law, Ping-Yee; Wei, Li-Na; Loh, Horace H.

    2016-01-01

    Gene regulation at the post-transcriptional level is frequently based on cis- and trans-acting factors on target mRNAs. We found a C-rich element (CRE) in mu-opioid receptor (MOR) 3′-untranslated region (UTR) to which poly (rC) binding protein 1 (PCBP1) binds, resulting in MOR mRNA stabilization. RNA immunoprecipitation and RNA EMSA revealed the formation of PCBP1-RNA complexes at the element. Knockdown of PCBP1 decreased MOR mRNA half-life and protein expression. Stimulation by forskolin increased cytoplasmic localization of PCBP1 and PCBP1/MOR 3′-UTR interactions via increased serine phosphorylation that was blocked by protein kinase A (PKA) or (phosphatidyl inositol-3) PI3-kinase inhibitors. The forskolin treatment also enhanced serine- and tyrosine-phosphorylation of AU-rich element binding protein (AUF1), concurrent with its increased binding to the CRE, and led to an increased interaction of poly A binding protein (PABP) with the CRE and poly(A) sites. AUF1 phosphorylation also led to an increased interaction with PCBP1. These findings suggest that a single co-regulator, PCBP1, plays a crucial role in stabilizing MOR mRNA, and is induced by PKA signaling by conforming to AUF1 and PABP. PMID:27836661

  15. The Role of Carbohydrate Response Element Binding Protein in Intestinal and Hepatic Fructose Metabolism.

    PubMed

    Iizuka, Katsumi

    2017-02-22

    Many articles have discussed the relationship between fructose consumption and the incidence of obesity and related diseases. Fructose is absorbed in the intestine and metabolized in the liver to glucose, lactate, glycogen, and, to a lesser extent, lipids. Unabsorbed fructose causes bacterial fermentation, resulting in irritable bowl syndrome. Therefore, understanding the mechanisms underlying intestinal and hepatic fructose metabolism is important for the treatment of metabolic syndrome and fructose malabsorption. Carbohydrate response element binding protein (ChREBP) is a glucose-activated transcription factor that controls approximately 50% of de novo lipogenesis in the liver. ChREBP target genes are involved in glycolysis (Glut2, liver pyruvate kinase), fructolysis (Glut5, ketohexokinase), and lipogenesis (acetyl CoA carboxylase, fatty acid synthase). ChREBP gene deletion protects against high sucrose diet-induced and leptin-deficient obesity, because Chrebp -/- mice cannot consume fructose or sucrose. Moreover, ChREBP contributes to some of the physiological effects of fructose on sweet taste preference and glucose production through regulation of ChREBP target genes, such as fibroblast growth factor-21 and glucose-6-phosphatase catalytic subunits. Thus, ChREBP might play roles in fructose metabolism. Restriction of excess fructose intake will be beneficial for preventing not only metabolic syndrome but also irritable bowl syndrome.

  16. The Role of Carbohydrate Response Element Binding Protein in Intestinal and Hepatic Fructose Metabolism

    PubMed Central

    Iizuka, Katsumi

    2017-01-01

    Many articles have discussed the relationship between fructose consumption and the incidence of obesity and related diseases. Fructose is absorbed in the intestine and metabolized in the liver to glucose, lactate, glycogen, and, to a lesser extent, lipids. Unabsorbed fructose causes bacterial fermentation, resulting in irritable bowl syndrome. Therefore, understanding the mechanisms underlying intestinal and hepatic fructose metabolism is important for the treatment of metabolic syndrome and fructose malabsorption. Carbohydrate response element binding protein (ChREBP) is a glucose-activated transcription factor that controls approximately 50% of de novo lipogenesis in the liver. ChREBP target genes are involved in glycolysis (Glut2, liver pyruvate kinase), fructolysis (Glut5, ketohexokinase), and lipogenesis (acetyl CoA carboxylase, fatty acid synthase). ChREBP gene deletion protects against high sucrose diet-induced and leptin-deficient obesity, because Chrebp−/− mice cannot consume fructose or sucrose. Moreover, ChREBP contributes to some of the physiological effects of fructose on sweet taste preference and glucose production through regulation of ChREBP target genes, such as fibroblast growth factor-21 and glucose-6-phosphatase catalytic subunits. Thus, ChREBP might play roles in fructose metabolism. Restriction of excess fructose intake will be beneficial for preventing not only metabolic syndrome but also irritable bowl syndrome. PMID:28241431

  17. O-linked N-acetylglucosamine transferase enhances secretory clusterin expression via liver X receptors and sterol response element binding protein regulation in cervical cancer.

    PubMed

    Kim, Min Jun; Choi, Mee Young; Lee, Dong Hoon; Roh, Gu Seob; Kim, Hyun Joon; Kang, Sang Soo; Cho, Gyeong Jae; Kim, Yoon Sook; Choi, Wan Sung

    2018-01-12

    O-linked N-acetylglucosamine transferase (OGT) expression is increased in various cancer types, indicating the potential importance of O-GlcNAcylation in tumorigenesis. Secretory clusterin (sCLU) is involved in cancer cell proliferation and drug resistance, and recently, liver X receptors (LXRs) and sterol response element binding protein-1 (SREBP-1) were reported to regulate sCLU transcription. Here, we found that sCLU is significantly increased in cervical cancer cell lines, which have higher expression levels of O-GlcNAc and OGT than keratinocytes. OGT knockdown decreased expression of LXRs, SREBP-1 and sCLU through hypo-O-GlcNAcylation of LXRs. Additionally, treatment with Thiamet G, O-GlcNAcase OGA inhibitor, increased expression of O-GlcNAcylation and sCLU, and high glucose increased levels of LXRs, SREBP-1 and sCLU in HeLa cells. Moreover, OGT knockdown induced G 0 /G 1 phase cell cycle arrest and late apoptosis in cisplatin-treated HeLa cells, and decreased viability compared to OGT intact HeLa cells. Taken together, these findings suggest that OGT, O-GlcNAcylated LXRs, and SREBP-1 increase sCLU expression in cervical cancer cells, which contributes to drug resistance.

  18. Essential role for cyclic-AMP responsive element binding protein 1 (CREB) in the survival of acute lymphoblastic leukemia.

    PubMed

    van der Sligte, Naomi E; Kampen, Kim R; ter Elst, Arja; Scherpen, Frank J G; Meeuwsen-de Boer, Tiny G J; Guryev, Victor; van Leeuwen, Frank N; Kornblau, Steven M; de Bont, Eveline S J M

    2015-06-20

    Acute lymphoblastic leukemia (ALL) relapse remains a leading cause of cancer related death in children, therefore, new therapeutic options are needed. Recently, we showed that a peptide derived from Cyclic-AMP Responsive Element Binding Protein (CREB) was highly phosphorylated in pediatric leukemias. In this study, we determined CREB phosphorylation and mRNA levels showing that CREB expression was significantly higher in ALL compared to normal bone marrow (phosphorylation: P < 0.0001, mRNA: P = 0.004). High CREB and phospho-CREB expression was correlated with a lower median overall survival in a cohort of 140 adult ALL patients. ShRNA mediated knockdown of CREB in ALL cell lines blocked leukemic cell growth by inducing cell cycle arrest and apoptosis. Gene expression array analysis showed downregulation of CREB target genes regulating cell proliferation and glucose metabolism and upregulation of apoptosis inducing genes. Similar to CREB knockdown, the CREB inhibitor KG-501 decreased leukemic cell viability and induced apoptosis in ALL cell lines, as well as primary T-ALL samples, with cases showing high phospho-CREB levels being more sensitive than those with lower phospho-CREB levels. Together, these in vitro findings support an important role for CREB in the survival of ALL cells and identify this transcription factor as a potential target for treatment.

  19. Cyclic AMP response element binding protein and brain-derived neurotrophic factor: Molecules that modulate our mood?

    PubMed Central

    Nair, A; Vaidya, V A

    2008-01-01

    Depression is the major psychiatric ailment of our times, afflicting ~20% of the population. Despite its prevalence, the pathophysiology of this complex disorder is not well understood. In addition, although antidepressants have been in existence for the past several decades, the mechanisms that underlie their therapeutic effects remain elusive. Building evidence implicates a role for the plasticity of specific neuro-circuitry in both the pathophysiology and treatment of depression. Damage to limbic regions is thought to contribute to the etiology of depression and antidepressants have been reported to reverse such damage and promote adaptive plasticity. The molecular pathways that contribute to the damage associated with depression and antidepressant-mediated plasticity are a major focus of scientific enquiry. The transcription factor cyclic AMP response element binding protein (CREB) and the neurotrophin brain-derived neurotrophic factor (BDNF) are targets of diverse classes of antidepressants and are known to be regulated in animal models and in patients suffering from depression. Given their role in neuronal plasticity, CREB and BDNF have emerged as molecules that may play an important role in modulating mood. The purpose of this review is to discuss the role of CREB and BDNF in depression and as targets/mediators of antidepressant action. PMID:17006024

  20. The wheat R2R3-MYB transcription factor TaRIM1 participates in resistance response against the pathogen Rhizoctonia cerealis infection through regulating defense genes.

    PubMed

    Shan, Tianlei; Rong, Wei; Xu, Huijun; Du, Lipu; Liu, Xin; Zhang, Zengyan

    2016-07-01

    The necrotrophic fungus Rhizoctonia cerealis is a major pathogen of sharp eyespot that is a devastating disease of wheat (Triticum aestivum). Little is known about roles of MYB genes in wheat defense response to R. cerealis. In this study, TaRIM1, a R. cerealis-induced wheat MYB gene, was identified by transcriptome analysis, then cloned from resistant wheat CI12633, and its function and preliminary mechanism were studied. Sequence analysis showed that TaRIM1 encodes a R2R3-MYB transcription factor with transcription-activation activity. The molecular-biological assays revealed that the TaRIM1 protein localizes to nuclear and can bind to five MYB-binding site cis-elements. Functional dissection results showed that following R. cerealis inoculation, TaRIM1 silencing impaired the resistance of wheat CI12633, whereas TaRIM1 overexpression significantly increased resistance of transgenic wheat compared with susceptible recipient. TaRIM1 positively regulated the expression of five defense genes (Defensin, PR10, PR17c, nsLTP1, and chitinase1) possibly through binding to MYB-binding sites in their promoters. These results suggest that the R2R3-MYB transcription factor TaRIM1 positively regulates resistance response to R. cerealis infection through modulating the expression of a range of defense genes, and that TaRIM1 is a candidate gene to improve sharp eyespot resistance in wheat.

  1. The wheat R2R3-MYB transcription factor TaRIM1 participates in resistance response against the pathogen Rhizoctonia cerealis infection through regulating defense genes

    PubMed Central

    Shan, Tianlei; Rong, Wei; Xu, Huijun; Du, Lipu; Liu, Xin; Zhang, Zengyan

    2016-01-01

    The necrotrophic fungus Rhizoctonia cerealis is a major pathogen of sharp eyespot that is a devastating disease of wheat (Triticum aestivum). Little is known about roles of MYB genes in wheat defense response to R. cerealis. In this study, TaRIM1, a R. cerealis-induced wheat MYB gene, was identified by transcriptome analysis, then cloned from resistant wheat CI12633, and its function and preliminary mechanism were studied. Sequence analysis showed that TaRIM1 encodes a R2R3-MYB transcription factor with transcription-activation activity. The molecular-biological assays revealed that the TaRIM1 protein localizes to nuclear and can bind to five MYB-binding site cis-elements. Functional dissection results showed that following R. cerealis inoculation, TaRIM1 silencing impaired the resistance of wheat CI12633, whereas TaRIM1 overexpression significantly increased resistance of transgenic wheat compared with susceptible recipient. TaRIM1 positively regulated the expression of five defense genes (Defensin, PR10, PR17c, nsLTP1, and chitinase1) possibly through binding to MYB-binding sites in their promoters. These results suggest that the R2R3-MYB transcription factor TaRIM1 positively regulates resistance response to R. cerealis infection through modulating the expression of a range of defense genes, and that TaRIM1 is a candidate gene to improve sharp eyespot resistance in wheat. PMID:27364458

  2. Induced Genome-Wide Binding of Three Arabidopsis WRKY Transcription Factors during Early MAMP-Triggered Immunity.

    PubMed

    Birkenbihl, Rainer P; Kracher, Barbara; Somssich, Imre E

    2017-01-01

    During microbial-associated molecular pattern-triggered immunity (MTI), molecules derived from microbes are perceived by cell surface receptors and upon signaling to the nucleus initiate a massive transcriptional reprogramming critical to mount an appropriate host defense response. WRKY transcription factors play an important role in regulating these transcriptional processes. Here, we determined on a genome-wide scale the flg22-induced in vivo DNA binding dynamics of three of the most prominent WRKY factors, WRKY18, WRKY40, and WRKY33. The three WRKY factors each bound to more than 1000 gene loci predominantly at W-box elements, the known WRKY binding motif. Binding occurred mainly in the 500-bp promoter regions of these genes. Many of the targeted genes are involved in signal perception and transduction not only during MTI but also upon damage-associated molecular pattern-triggered immunity, providing a mechanistic link between these functionally interconnected basal defense pathways. Among the additional targets were genes involved in the production of indolic secondary metabolites and in modulating distinct plant hormone pathways. Importantly, among the targeted genes were numerous transcription factors, encoding predominantly ethylene response factors, active during early MTI, and WRKY factors, supporting the previously hypothesized existence of a WRKY subregulatory network. Transcriptional analysis revealed that WRKY18 and WRKY40 function redundantly as negative regulators of flg22-induced genes often to prevent exaggerated defense responses. © 2016 American Society of Plant Biologists. All rights reserved.

  3. Androgen receptor stimulates bone sialoprotein (BSP) gene transcription via cAMP response element and activator protein 1/glucocorticoid response elements.

    PubMed

    Takai, Hideki; Nakayama, Youhei; Kim, Dong-Soon; Arai, Masato; Araki, Shouta; Mezawa, Masaru; Nakajima, Yu; Kato, Naoko; Masunaga, Hiroshi; Ogata, Yorimasa

    2007-09-01

    Bone sialoprotein (BSP) is an early marker of osteoblast differentiation. Androgens are steroid hormones that are essential for skeletal development. The androgen receptor (AR) is a transcription factor and a member of the steroid receptor superfamily that plays an important role in male sexual differentiation and prostate cell proliferation. To determine the molecular mechanism involved in the stimulation of bone formation, we have analyzed the effects of androgens and AR effects on BSP gene transcription. AR protein levels were increased after AR overexpression in ROS17/2.8 cells. BSP mRNA levels were increased by AR overexpression. However, the endogenous and overexpressed BSP mRNA levels were not changed by DHT (10(-8) M, 24 h). Whereas luciferase (LUC) activities in all constructs, including a short construct (nts -116 to +60), were increased by AR overexpression, the basal and LUC activities enhanced by AR overexpression were not induced by DHT (10(-8)M, 24 h). The effect of AR overexpression was abrogated by 2 bp mutations in either the cAMP response element (CRE) or activator protein 1 (AP1)/glucocorticoid response element (GRE). Gel shift analyses showed that AR overexpression increased binding to the CRE and AP1/GRE elements. Notably, the CRE-protein complexes were supershifted by phospho-CREB antibody, and CREB, c-Fos, c-Jun, and AR antibodies disrupted the complexes formation. The AP1/GRE-protein complexes were supershifted by c-Fos antibody and c-Jun, and AR antibodies disrupted the complexes formation. These studies demonstrate that AR stimulates BSP gene transcription by targeting the CRE and AP1/GRE elements in the promoter of the rat BSP gene.

  4. CREB-binding protein controls response to cocaine by acetylating histones at the fosB promoter in the mouse striatum

    PubMed Central

    Levine, Amir A.; Guan, Zhonghui; Barco, Angel; Xu, Shiqin; Kandel, Eric R.; Schwartz, James H.

    2005-01-01

    Remodeling chromatin is essential for cAMP-regulated gene expression, necessary not only for development but also for memory storage and other enduring mental states. Histone acetylation and deacetylation mediate long-lasting forms of synaptic plasticity in Aplysia as well as cognition in mice. Here, we show that histone acetylation by the cAMP-response element binding protein (CREB)-binding protein (CBP) mediates sensitivity to cocaine by regulating expression of the fosB gene and its splice variant, ΔfosB, a transcription factor previously implicated in addiction. Using the chromatin immunoprecipitation assay with antibodies against histone H4 or CBP, we find that CBP is recruited to the fosB promoter to acetylate histone H4 in response to acute exposure to cocaine. We show that mutant mice that lack one allele of the CBP gene and have normal levels of fosB expression are less sensitive to chronic (10-day) administration of cocaine than are wild-type mice. This decreased sensitivity is correlated with decreased histone acetylation and results in decreased fosB expression and diminished accumulation of ΔfosB. Thus, CBP, which forms part of the promoter complex with CREB, mediates sensitivity to cocaine by acetylating histones. PMID:16380431

  5. Meta-Analysis of the Effect of Overexpression of Dehydration-Responsive Element Binding Family Genes on Temperature Stress Tolerance and Related Responses

    PubMed Central

    Dong, Chao; Ma, Yuanchun; Zheng, Dan; Wisniewski, Michael; Cheng, Zong-Ming

    2018-01-01

    Dehydration-responsive element binding proteins are transcription factors that play a critical role in plant response to temperature stress. Over-expression of DREB genes has been demonstrated to enhance temperature stress tolerance. A series of physiological and biochemical modifications occur in a complex and integrated way when plants respond to temperature stress, which makes it difficult to assess the mechanism underlying the DREB enhancement of stress tolerance. A meta-analysis was conducted of the effect of DREB overexpression on temperature stress tolerance and the various parameters modulated by overexpression that were statistically quantified in 75 published articles. The meta-analysis was conducted to identify the overall influence of DREB on stress-related parameters in transgenic plants, and to determine how different experimental variables affect the impact of DREB overexpression. Viewed across all the examined studies, 7 of the 8 measured plant parameters were significantly (p ≤ 0.05) modulated in DREB-transgenic plants when they were subjected to temperature stress, while 2 of the 8 parameters were significantly affected in non-stressed control plants. The measured parameters were modulated by 32% or more by various experimental variables. The modulating variables included, acclimated or non-acclimated, type of promoter, stress time and severity, source of the donor gene, and whether the donor and recipient were the same genus. These variables all had a significant effect on the observed impact of DREB overexpression. Further studies should be conducted under field conditions to better understand the role of DREB transcription factors in enhancing plant tolerance to temperature stress. PMID:29896212

  6. Connexin31.1 deficiency in the mouse impairs object memory and modulates open-field exploration, acetylcholine esterase levels in the striatum, and cAMP response element-binding protein levels in the striatum and piriform cortex.

    PubMed

    Dere, E; Zheng-Fischhöfer, Q; Viggiano, D; Gironi Carnevale, U A; Ruocco, L A; Zlomuzica, A; Schnichels, M; Willecke, K; Huston, J P; Sadile, A G

    2008-05-02

    Neuronal gap junctions in the brain, providing intercellular electrotonic signal transfer, have been implicated in physiological and behavioral correlates of learning and memory. In connexin31.1 (Cx31.1) knockout (KO) mice the coding region of the Cx31.1 gene was replaced by a LacZ reporter gene. We investigated the impact of Cx31.1 deficiency on open-field exploration, the behavioral response to an odor, non-selective attention, learning and memory performance, and the levels of memory-related proteins in the hippocampus, striatum and the piriform cortex. In terms of behavior, the deletion of the Cx31.1 coding DNA in the mouse led to increased exploratory behaviors in a novel environment, and impaired one-trial object recognition at all delays tested. Despite strong Cx31.1 expression in the peripheral and central olfactory system, Cx31.1 KO mice exhibited normal behavioral responses to an odor. We found increased levels of acetylcholine esterase (AChE) and cAMP response element-binding protein (CREB) in the striatum of Cx31.1 KO mice. In the piriform cortex the Cx31.1 KO mice had an increased heterogeneity of CREB expression among neurons. In conclusion, gap-junctions featuring the Cx31.1 protein might be involved in open-field exploration as well as object memory and modulate levels of AChE and CREB in the striatum and piriform cortex.

  7. PTTG1, A novel androgen responsive gene is required for androgen-induced prostate cancer cell growth and invasion

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhang, Zheng; Jin, Bo; Jin, Yaqiong

    Androgens (AR) play an important role in initiation and progression of prostate cancer. It has been shown that AR exert their effects mainly through the androgen-activated AR which binds to androgen response elements (AREs) in the regulatory regions of target genes to regulate the transcription of androgen-responsive genes, thus, identification of AR downstream target gene is critical to understand androgen function in prostate cancer. In this study, our results showed that androgen treatment of LNCaP cells induced PTTG1 expression, which was blocked by the androgen receptor antagonist, Casodex. Bioinformatics analysis and experiments using PTTG1 promoter deletion mutants showed that themore » PTTG1 promoter contains a putative androgen response element (ARE), which localizes in the −851 to −836 region of the promoter. Androgen activated androgen receptor (AR) binding to this ARE was confirmed by Chromatin immunoprecipitation (ChIP) assay. Furthermore, Knockdown of PTTG1 expression using short hairpin RNA significantly reduced androgen-induced LNCaP cell growth and invasion. In addition, we showed PTTG1 is highly expressed in metastasis prostate cancer tissue. These results suggest that PTTG1 is a novel downstream target gene of androgen receptor and take part in prostate cancer proliferation and metastasis. - Highlights: • Androgen treatment of LNCaP cells induced PTTG1 expression. • Knockdown of PTTG1 expression significantly reduced androgen-induced LNCaP cell growth and invasion. • PTTG1 is highly expressed in metastasis prostate cancer tissue. • PTTG1 is a novel downstream target gene of androgen receptor.« less

  8. Structural and functional analysis of mouse Msx1 gene promoter: sequence conservation with human MSX1 promoter points at potential regulatory elements.

    PubMed

    Gonzalez, S M; Ferland, L H; Robert, B; Abdelhay, E

    1998-06-01

    Vertebrate Msx genes are related to one of the most divergent homeobox genes of Drosophila, the muscle segment homeobox (msh) gene, and are expressed in a well-defined pattern at sites of tissue interactions. This pattern of expression is conserved in vertebrates as diverse as quail, zebrafish, and mouse in a range of sites including neural crest, appendages, and craniofacial structures. In the present work, we performed structural and functional analyses in order to identify potential cis-acting elements that may be regulating Msx1 gene expression. To this end, a 4.9-kb segment of the 5'-flanking region was sequenced and analyzed for transcription-factor binding sites. Four regions showing a high concentration of these sites were identified. Transfection assays with fragments of regulatory sequences driving the expression of the bacterial lacZ reporter gene showed that a region of 4 kb upstream of the transcription start site contains positive and negative elements responsible for controlling gene expression. Interestingly, a fragment of 130 bp seems to contain the minimal elements necessary for gene expression, as its removal completely abolishes gene expression in cultured cells. These results are reinforced by comparison of this region with the human Msx1 gene promoter, which shows extensive conservation, including many consensus binding sites, suggesting a regulatory role for them.

  9. Phytoplasma infection in tomato is associated with re-organization of plasma membrane, ER stacks, and actin filaments in sieve elements.

    PubMed

    Buxa, Stefanie V; Degola, Francesca; Polizzotto, Rachele; De Marco, Federica; Loschi, Alberto; Kogel, Karl-Heinz; di Toppi, Luigi Sanità; van Bel, Aart J E; Musetti, Rita

    2015-01-01

    Phytoplasmas, biotrophic wall-less prokaryotes, only reside in sieve elements of their host plants. The essentials of the intimate interaction between phytoplasmas and their hosts are poorly understood, which calls for research on potential ultrastructural modifications. We investigated modifications of the sieve-element ultrastructure induced in tomato plants by 'Candidatus Phytoplasma solani,' the pathogen associated with the stolbur disease. Phytoplasma infection induces a drastic re-organization of sieve-element substructures including changes in plasma membrane surface and distortion of the sieve-element reticulum. Observations of healthy and stolbur-diseased plants provided evidence for the emergence of structural links between sieve-element plasma membrane and phytoplasmas. One-sided actin aggregates on the phytoplasma surface also inferred a connection between phytoplasma and sieve-element cytoskeleton. Actin filaments displaced from the sieve-element mictoplasm to the surface of the phytoplasmas in infected sieve elements. Western blot analysis revealed a decrease of actin and an increase of ER-resident chaperone luminal binding protein (BiP) in midribs of phytoplasma-infected plants. Collectively, the studies provided novel insights into ultrastructural responses of host sieve elements to phloem-restricted prokaryotes.

  10. Phytoplasma infection in tomato is associated with re-organization of plasma membrane, ER stacks, and actin filaments in sieve elements

    PubMed Central

    Buxa, Stefanie V.; Degola, Francesca; Polizzotto, Rachele; De Marco, Federica; Loschi, Alberto; Kogel, Karl-Heinz; di Toppi, Luigi Sanità; van Bel, Aart J. E.; Musetti, Rita

    2015-01-01

    Phytoplasmas, biotrophic wall-less prokaryotes, only reside in sieve elements of their host plants. The essentials of the intimate interaction between phytoplasmas and their hosts are poorly understood, which calls for research on potential ultrastructural modifications. We investigated modifications of the sieve-element ultrastructure induced in tomato plants by ‘Candidatus Phytoplasma solani,’ the pathogen associated with the stolbur disease. Phytoplasma infection induces a drastic re-organization of sieve-element substructures including changes in plasma membrane surface and distortion of the sieve-element reticulum. Observations of healthy and stolbur-diseased plants provided evidence for the emergence of structural links between sieve-element plasma membrane and phytoplasmas. One-sided actin aggregates on the phytoplasma surface also inferred a connection between phytoplasma and sieve-element cytoskeleton. Actin filaments displaced from the sieve-element mictoplasm to the surface of the phytoplasmas in infected sieve elements. Western blot analysis revealed a decrease of actin and an increase of ER-resident chaperone luminal binding protein (BiP) in midribs of phytoplasma-infected plants. Collectively, the studies provided novel insights into ultrastructural responses of host sieve elements to phloem-restricted prokaryotes. PMID:26347766

  11. Transcriptional Regulation of Arabidopsis MIR168a and ARGONAUTE1 Homeostasis in Abscisic Acid and Abiotic Stress Responses1[W

    PubMed Central

    Li, Wei; Cui, Xiao; Meng, Zhaolu; Huang, Xiahe; Xie, Qi; Wu, Heng; Jin, Hailing; Zhang, Dabing; Liang, Wanqi

    2012-01-01

    The accumulation of a number of small RNAs in plants is affected by abscisic acid (ABA) and abiotic stresses, but the underlying mechanisms are poorly understood. The miR168-mediated feedback regulatory loop regulates ARGONAUTE1 (AGO1) homeostasis, which is crucial for gene expression modulation and plant development. Here, we reveal a transcriptional regulatory mechanism by which MIR168 controls AGO1 homeostasis during ABA treatment and abiotic stress responses in Arabidopsis (Arabidopsis thaliana). Plants overexpressing MIR168a and the AGO1 loss-of-function mutant ago1-27 display ABA hypersensitivity and drought tolerance, while the mir168a-2 mutant shows ABA hyposensitivity and drought hypersensitivity. Both the precursor and mature miR168 were induced under ABA and several abiotic stress treatments, but no obvious decrease for the target of miR168, AGO1, was shown under the same conditions. However, promoter activity analysis indicated that AGO1 transcription activity was increased under ABA and drought treatments, suggesting that transcriptional elevation of MIR168a is required for maintaining a stable AGO1 transcript level during the stress response. Furthermore, we showed both in vitro and in vivo that the transcription of MIR168a is directly regulated by four abscisic acid-responsive element (ABRE) binding factors, which bind to the ABRE cis-element within the MIR168a promoter. This ABRE motif is also found in the promoter of MIR168a homologs in diverse plant species. Our findings suggest that transcriptional regulation of miR168 and posttranscriptional control of AGO1 homeostasis may play an important and conserved role in stress response and signal transduction in plants. PMID:22247272

  12. Transcriptional regulation of Arabidopsis MIR168a and argonaute1 homeostasis in abscisic acid and abiotic stress responses.

    PubMed

    Li, Wei; Cui, Xiao; Meng, Zhaolu; Huang, Xiahe; Xie, Qi; Wu, Heng; Jin, Hailing; Zhang, Dabing; Liang, Wanqi

    2012-03-01

    The accumulation of a number of small RNAs in plants is affected by abscisic acid (ABA) and abiotic stresses, but the underlying mechanisms are poorly understood. The miR168-mediated feedback regulatory loop regulates ARGONAUTE1 (AGO1) homeostasis, which is crucial for gene expression modulation and plant development. Here, we reveal a transcriptional regulatory mechanism by which MIR168 controls AGO1 homeostasis during ABA treatment and abiotic stress responses in Arabidopsis (Arabidopsis thaliana). Plants overexpressing MIR168a and the AGO1 loss-of-function mutant ago1-27 display ABA hypersensitivity and drought tolerance, while the mir168a-2 mutant shows ABA hyposensitivity and drought hypersensitivity. Both the precursor and mature miR168 were induced under ABA and several abiotic stress treatments, but no obvious decrease for the target of miR168, AGO1, was shown under the same conditions. However, promoter activity analysis indicated that AGO1 transcription activity was increased under ABA and drought treatments, suggesting that transcriptional elevation of MIR168a is required for maintaining a stable AGO1 transcript level during the stress response. Furthermore, we showed both in vitro and in vivo that the transcription of MIR168a is directly regulated by four abscisic acid-responsive element (ABRE) binding factors, which bind to the ABRE cis-element within the MIR168a promoter. This ABRE motif is also found in the promoter of MIR168a homologs in diverse plant species. Our findings suggest that transcriptional regulation of miR168 and posttranscriptional control of AGO1 homeostasis may play an important and conserved role in stress response and signal transduction in plants.

  13. Asymmetric binding of histone H1 stabilizes MMTV nucleosomes and the interaction of progesterone receptor with the exposed HRE.

    PubMed

    Vicent, Guillermo P; Meliá, María J; Beato, Miguel

    2002-11-29

    Packaging of mouse mammary tumor virus (MMTV) promoter sequences in nucleosomes modulates access of DNA binding proteins and influences the interaction among DNA bound transcription factors. Here we analyze the binding of histone H1 to MMTV mononucleosomes assembled with recombinant histones and study its influence on nucleosome structure and stability as well as on progesterone receptor (PR) binding to the hormone responsive elements (HREs). The MMTV nucleosomes can be separated into three main populations, two of which exhibited precise translational positioning. Histone H1 bound preferentially to the 5' distal nucleosomal DNA protecting additional 27-28 nt from digestion by micrococcal nuclease. Binding of histone H1 was unaffected by prior crosslinking of protein and DNA in nucleosomes with formaldehyde. Neither the translational nor the rotational nucleosome positioning was altered by histone H1 binding, but the nucleosomes were stabilized as judged by the kinetics of nuclease cleavage. Unexpectedly, binding of recombinant PR to the exposed distal HRE-I in nucleosomes was enhanced in the presence of histone H1, as demonstrated by band shift and footprinting experiments. This enhanced PR affinity may contribute to the reported positive effect of histone H1 on the hormonal activation of MMTV reporter genes.

  14. Optimization of a cAMP response element signal pathway reporter system.

    PubMed

    Shan, Qiang; Storm, Daniel R

    2010-08-15

    A sensitive cAMP response element (CRE) reporter system is essential for studying the cAMP/protein kinase A/cAMP response element binding protein signal pathway. Here we have tested a few CRE promoters and found one with high sensitivity to external stimuli. Using this optimal CRE promoter and the enhanced green fluorescent protein as the reporter, we have established a CRE reporter cell line. This cell line can be used to study the signal pathway by fluorescent microscope, fluorescence-activated cell analysis and luciferase assay. This cell line's sensitivity to forskolin, using the technique of fluorescence-activated cell sorting, was increased to approximately seven times that of its parental HEK 293 cell line, which is currently the most commonly used cell line in the field for the signal pathway study. Therefore, this newly created cell line is potentially useful for studying the signal pathway's modulators, which generally have weaker effect than its mediators. Our research has also established a general procedure for optimizing transcription-based reporter cell lines, which might be useful in performing the same task when studying many other transcription-based signal pathways. (c) 2010 Elsevier B.V. All rights reserved.

  15. NF-κB– and AP-1–Mediated DNA Looping Regulates Osteopontin Transcription in Endotoxin-Stimulated Murine Macrophages

    PubMed Central

    Zhao, Wei; Wang, Lijuan; Zhang, Meng; Wang, Peng; Zhang, Lei; Yuan, Chao; Qi, Jianni; Qiao, Yu; Kuo, Paul C.; Gao, Chengjiang

    2013-01-01

    Osteopontin (OPN) is expressed by various immune cells and modulates both innate and adaptive immune responses. However, the molecular mechanisms that control opn gene expression, especially at the chromatin level, remain largely unknown. We have previously demonstrated many specific cis- and trans-regulatory elements that determine the extent of endotoxin (LPS)-mediated induction of OPN synthesis in murine macrophages. In the present study, we confirm that NF-κB also plays an important role in the setting of LPS-stimulated OPN expression through binding to a distal regulatory element. Importantly, we demonstrate that LPS stimulates chromosomal loops in the OPN promoter between NF-κB binding site and AP-1 binding site using chromosome conformation capture technology. The crucial role of NF-κB and AP-1 in LPS-stimulated DNA looping was confirmed, as small interfering RNA knock-down of NF-κB p65 and AP-1 c-Jun exhibited decreased levels of DNA looping. Furthermore, we demonstrate that p300 can form a complex with NF-κB and AP-1 and is involved in DNA looping and LPS-induced OPN expression. Therefore, we have identified an essential mechanism to remodel the local chromatin structures and spatial conformations to regulate LPS-induced OPN expression. PMID:21257959

  16. Thermodynamics of complex structures formed between single-stranded DNA oligomers and the KH domains of the far upstream element binding protein

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chakraborty, Kaushik; Sinha, Sudipta Kumar; Bandyopadhyay, Sanjoy, E-mail: sanjoy@chem.iitkgp.ernet.in

    The noncovalent interaction between protein and DNA is responsible for regulating the genetic activities in living organisms. The most critical issue in this problem is to understand the underlying driving force for the formation and stability of the complex. To address this issue, we have performed atomistic molecular dynamics simulations of two DNA binding K homology (KH) domains (KH3 and KH4) of the far upstream element binding protein (FBP) complexed with two single-stranded DNA (ss-DNA) oligomers in aqueous media. Attempts have been made to calculate the individual components of the net entropy change for the complexation process by adopting suitablemore » statistical mechanical approaches. Our calculations reveal that translational, rotational, and configurational entropy changes of the protein and the DNA components have unfavourable contributions for this protein-DNA association process and such entropy lost is compensated by the entropy gained due to the release of hydration layer water molecules. The free energy change corresponding to the association process has also been calculated using the Free Energy Perturbation (FEP) method. The free energy gain associated with the KH4–DNA complex formation has been found to be noticeably higher than that involving the formation of the KH3–DNA complex.« less

  17. The Enzyme-Like Domain of Arabidopsis Nuclear β-Amylases Is Critical for DNA Sequence Recognition and Transcriptional Activation.

    PubMed

    Soyk, Sebastian; Simková, Klára; Zürcher, Evelyne; Luginbühl, Leonie; Brand, Luise H; Vaughan, Cara K; Wanke, Dierk; Zeeman, Samuel C

    2014-04-01

    Plant BZR1-BAM transcription factors contain a β-amylase (BAM)-like domain, characteristic of proteins involved in starch breakdown. The enzyme-derived domains appear to be noncatalytic, but they determine the function of the two Arabidopsis thaliana BZR1-BAM isoforms (BAM7 and BAM8) during transcriptional initiation. Removal or swapping of the BAM domains demonstrates that the BAM7 BAM domain restricts DNA binding and transcriptional activation, while the BAM8 BAM domain allows both activities. Furthermore, we demonstrate that BAM7 and BAM8 interact on the protein level and cooperate during transcriptional regulation. Site-directed mutagenesis of residues in the BAM domain of BAM8 shows that its function as a transcriptional activator is independent of catalysis but requires an intact substrate binding site, suggesting it may bind a ligand. Microarray experiments with plants overexpressing truncated versions lacking the BAM domain indicate that the pseudo-enzymatic domain increases selectivity for the preferred cis-regulatory element BBRE (BZR1-BAM Responsive Element). Side specificity toward the G-box may allow crosstalk to other signaling networks. This work highlights the importance of the enzyme-derived domain of BZR1-BAMs, supporting their potential role as metabolic sensors. © 2014 American Society of Plant Biologists. All rights reserved.

  18. Synthesis and biological evaluation of Santacruzamate-A based analogues.

    PubMed

    Randino, Rosario; Gazzerro, Patrizia; Mazitschek, Ralph; Rodriquez, Manuela

    2017-12-15

    Several derivatives of Santacruzamate-A, a natural product that is structurally related to SAHA, were synthesized to explore the potential of carbamates and oxalylamides as novel biasing element for targeting the catalytic site of zinc-dependent histone deacetylases (HDACs). An additional class of Santacruzamate-A derivatives was synthesized to investigate the influence of the cap group and the linker element on HDAC inhibitory activity. All compounds were evaluated in dose response for their in vitro cytotoxic activity in MTT assay in HCT116 cells. HDAC inhibitory activity was evaluated in vitro by western blot analysis for histone hyperacetylation assay and biochemically for representative human HDACs isoforms. Two novel compounds were identified to exhibit potent time dependent anti proliferative activity. However, unlike hydroxamic acid analogues, the tested Santacruzamate-A derivatives showed no noticeable HDAC inhibitory activity. The ethylcarbamate moiety as unusual zinc-binding group displayed no ability to coordinate the zinc ion and thus, presumably, was not able to reproduce known inhibitor-substrate zinc-binding group interactions with the HDAC catalytic site. This study confirmed that the accommodation of the zinc-binding group is deeply critical of the positioning of the linker and the projection of the cap group toward the different surface pockets of the enzyme. Copyright © 2017 Elsevier Ltd. All rights reserved.

  19. Dual Role of OhrR as a Repressor and an Activator in Response to Organic Hydroperoxides in Streptomyces coelicolor▿

    PubMed Central

    Oh, So-Young; Shin, Jung-Ho; Roe, Jung-Hye

    2007-01-01

    Organic hydroperoxide resistance in bacteria is achieved primarily through reducing oxidized membrane lipids. The soil-inhabiting aerobic bacterium Streptomyces coelicolor contains three paralogous genes for organic hydroperoxide resistance: ohrA, ohrB, and ohrC. The ohrA gene is transcribed divergently from ohrR, which encodes a putative regulator of MarR family. Both the ohrA and ohrR genes were induced highly by various organic hydroperoxides. The ohrA gene was induced through removal of repression by OhrR, whereas the ohrR gene was induced through activation by OhrR. Reduced OhrR bound to the ohrA-ohrR intergenic region, which contains a central (primary) and two adjacent (secondary) inverted-repeat motifs that overlap with promoter elements. Organic peroxide decreased the binding affinity of OhrR for the primary site, with a concomitant decrease in cooperative binding to the adjacent secondary sites. The single cysteine C28 in OhrR was involved in sensing oxidants, as determined by substitution mutagenesis. The C28S mutant of OhrR bound to the intergenic region without any change in binding affinity in response to organic peroxides. These results lead us to propose a model for the dual action of OhrR as a repressor and an activator in S. coelicolor. Under reduced conditions, OhrR binds cooperatively to the intergenic region, repressing transcription from both genes. Upon oxidation, the binding affinity of OhrR decreases, with a concomitant loss of cooperative binding, which allows RNA polymerase to bind to both the ohrA and ohrR promoters. The loosely bound oxidized OhrR can further activate transcription from the ohrR promoter. PMID:17586628

  20. Changes in Global Transcriptional Profiling of Women Following Obesity Surgery Bypass.

    PubMed

    Pinhel, Marcela Augusta de Souza; Noronha, Natalia Yumi; Nicoletti, Carolina Ferreira; de Oliveira, Bruno Affonso Parente; Cortes-Oliveira, Cristiana; Pinhanelli, Vitor Caressato; Salgado Junior, Wilson; Machry, Ana Julia; da Silva Junior, Wilson Araújo; Souza, Dorotéia Rossi Silva; Marchini, Júlio Sérgio; Nonino, Carla Barbosa

    2018-01-01

    Differential gene expression in peripheral blood mononuclear cells (PBMCs) after Roux-en-Y gastric bypass (RYGB) is poorly characterized. Markers of these processes may provide a deeper understanding of the mechanisms that underlie these events. The main goal of this study was to identify changes in PBMC gene expression in women with obesity before and 6 months after RYGB-induced weight loss. The ribonucleic acid (RNA) of PBMCs from 13 obese women was analyzed before and 6 months after RYGB; the RNA of PBMCs from nine healthy women served as control. The gene expression levels were determined by microarray analysis. Significant differences in gene expression were validated by real-time quantitative polymerase chain reaction (RT-qPCR). Microarray analysis for comparison of the pre- and postoperative periods showed that 1366 genes were differentially expressed genes (DEGs). The main pathways were related to gene transcription; lipid, energy, and glycide metabolism; inflammatory and immunological response; cell differentiation; oxidative stress regulation; response to endogenous and exogenous stimuli; substrate oxidation; mTOR signaling pathway; interferon signaling; mitogen-activated protein kinases (MAPK), cAMP response element binding protein (CREB1), heat shock factor 1 (HSF1), and sterol regulatory element binding protein 1c (SREBP-1c) gene expression; adipocyte differentiation; and methylation. Six months after bariatric surgery and significant weight loss, many molecular pathways involved in obesity and metabolic diseases change. These findings are an important tool to identify potential targets for therapeutic intervention and clinical practice of nutritional genomics in obesity.

  1. Destruction of a distal hypoxia response element abolishes trans-activation of the PAG1 gene mediated by HIF-independent chromatin looping.

    PubMed

    Schörg, Alexandra; Santambrogio, Sara; Platt, James L; Schödel, Johannes; Lindenmeyer, Maja T; Cohen, Clemens D; Schrödter, Katrin; Mole, David R; Wenger, Roland H; Hoogewijs, David

    2015-07-13

    A crucial step in the cellular adaptation to oxygen deficiency is the binding of hypoxia-inducible factors (HIFs) to hypoxia response elements (HREs) of oxygen-regulated genes. Genome-wide HIF-1α/2α/β DNA-binding studies revealed that the majority of HREs reside distant to the promoter regions, but the function of these distal HREs has only been marginally studied in the genomic context. We used chromatin immunoprecipitation (ChIP), gene editing (TALEN) and chromosome conformation capture (3C) to localize and functionally characterize a 82 kb upstream HRE that solely drives oxygen-regulated expression of the newly identified HIF target gene PAG1. PAG1, a transmembrane adaptor protein involved in Src signalling, was hypoxically induced in various cell lines and mouse tissues. ChIP and reporter gene assays demonstrated that the -82 kb HRE regulates PAG1, but not an equally distant gene further upstream, by direct interaction with HIF. Ablation of the consensus HRE motif abolished the hypoxic induction of PAG1 but not general oxygen signalling. 3C assays revealed that the -82 kb HRE physically associates with the PAG1 promoter region, independent of HIF-DNA interaction. These results demonstrate a constitutive interaction between the -82 kb HRE and the PAG1 promoter, suggesting a physiologically important rapid response to hypoxia. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  2. Transcriptional regulation of the cytosolic chaperonin theta subunit gene, Cctq, by Ets domain transcription factors Elk-1, Sap-1a, and Net in the absence of serum response factor.

    PubMed

    Yamazaki, Yuji; Kubota, Hiroshi; Nozaki, Masami; Nagata, Kazuhiro

    2003-08-15

    The chaperonin-containing t-complex polypeptide 1 (CCT) is a molecular chaperone that facilitates protein folding in eukaryotic cytosol, and the expression of CCT is highly dependent on cell growth. We show here that transcription of the gene encoding the theta subunit of mouse CCT, Cctq, is regulated by the ternary complex factors (TCFs), Elk-1, Sap-1a, and Net (Sap-2). Reporter gene assay using HeLa cells indicated that the Cctq gene promoter contains a cis-acting element of the CCGGAAGT sequence (CQE1) at -36 bp. The major CQE1-binding proteins in HeLa cell nuclear extract was recognized by anti-Elk-1 or anti-Sap-1a antibodies in electrophoretic mobility shift assay, and recombinant Elk-1, Sap-1a, or Net specifically recognized CQE1. The CQE1-dependent transcriptional activity in HeLa cells was virtually abolished by overexpression of the DNA binding domains of TCFs. Overexpression of full-length TCFs with Ras indicated that exogenous TCFs can regulate the CQE1-dependent transcription in a Ras-dependent manner. PD98059, an inhibitor of MAPK, significantly repressed the CQE1-dependent transcription. However, no serum response factor was detected by electrophoretic mobility shift assay using the CQE1 element. These results indicate that transcription of the Cctq gene is regulated by TCFs under the control of the Ras/MAPK pathway, probably independently of serum response factor.

  3. A petunia ethylene-responsive element binding factor, PhERF2, plays an important role in antiviral RNA silencing

    PubMed Central

    Sun, Daoyang; Nandety, Raja Sekhar; Zhang, Yanlong; Reid, Michael S.; Niu, Lixin; Jiang, Cai-Zhong

    2016-01-01

    Virus-induced RNA silencing is involved in plant antiviral defense and requires key enzyme components, including RNA-dependent RNA polymerases (RDRs), Dicer-like RNase III enzymes (DCLs), and Argonaute proteins (AGOs). However, the transcriptional regulation of these critical components is largely unknown. In petunia (Petunia hybrida), an ethylene-responsive element binding factor, PhERF2, is induced by Tobacco rattle virus (TRV) infection. Inclusion of a PhERF2 fragment in a TRV silencing construct containing reporter fragments of phytoene desaturase (PDS) or chalcone synthase (CHS) substantially impaired silencing efficiency of both the PDS and CHS reporters. Silencing was also impaired in PhERF2- RNAi lines, where TRV-PhPDS infection did not show the expected silencing phenotype (photobleaching). In contrast, photobleaching in response to infiltration with the TRV-PhPDS construct was enhanced in plants overexpressing PhERF2. Transcript abundance of the RNA silencing-related genes RDR2, RDR6, DCL2, and AGO2 was lower in PhERF2-silenced plants but higher in PhERF2-overexpressing plants. Moreover, PhERF2-silenced lines showed higher susceptibility to Cucumber mosaic virus (CMV) than wild-type (WT) plants, while plants overexpressing PhERF2 exhibited increased resistance. Interestingly, growth and development of PhERF2-RNAi lines were substantially slower, whereas the overexpressing lines were more vigorous than the controls. Taken together, our results indicate that PhERF2 functions as a positive regulator in antiviral RNA silencing. PMID:27099376

  4. Identification of miR-185 as a regulator of de novo cholesterol biosynthesis and low density lipoprotein uptake

    PubMed Central

    Yang, Muhua; Liu, Weidong; Pellicane, Christina; Sahyoun, Christine; Joseph, Biny K.; Gallo-Ebert, Christina; Donigan, Melissa; Pandya, Devanshi; Giordano, Caroline; Bata, Adam; Nickels, Joseph T.

    2014-01-01

    Dysregulation of cholesterol homeostasis is associated with various metabolic diseases, including atherosclerosis and type 2 diabetes. The sterol response element binding protein (SREBP)-2 transcription factor induces the expression of genes involved in de novo cholesterol biosynthesis and low density lipoprotein (LDL) uptake, thus it plays a crucial role in maintaining cholesterol homeostasis. Here, we found that overexpressing microRNA (miR)-185 in HepG2 cells repressed SREBP-2 expression and protein level. miR-185-directed inhibition caused decreased SREBP-2-dependent gene expression, LDL uptake, and HMG-CoA reductase activity. In addition, we found that miR-185 expression was tightly regulated by SREBP-1c, through its binding to a single sterol response element in the miR-185 promoter. Moreover, we found that miR-185 expression levels were elevated in mice fed a high-fat diet, and this increase correlated with an increase in total cholesterol level and a decrease in SREBP-2 expression and protein. Finally, we found that individuals with high cholesterol had a 5-fold increase in serum miR-185 expression compared with control individuals. Thus, miR-185 controls cholesterol homeostasis through regulating SREBP-2 expression and activity. In turn, SREBP-1c regulates miR-185 expression through a complex cholesterol-responsive feedback loop. Thus, a novel axis regulating cholesterol homeostasis exists that exploits miR-185-dependent regulation of SREBP-2 and requires SREBP-1c for function. PMID:24296663

  5. A comparative analysis of localized and propagating surface plasmon resonance sensors: the binding of concanavalin a to a monosaccharide functionalized self-assembled monolayer.

    PubMed

    Yonzon, Chanda Ranjit; Jeoung, Eunhee; Zou, Shengli; Schatz, George C; Mrksich, Milan; Van Duyne, Richard P

    2004-10-06

    A comparative analysis of the properties of two optical biosensor platforms: (1) the propagating surface plasmon resonance (SPR) sensor based on a planar, thin film gold surface and (2) the localized surface plasmon resonance (LSPR) sensor based on surface confined Ag nanoparticles fabricated by nanosphere lithography (NSL) are presented. The binding of Concanavalin A (ConA) to mannose-functionalized self-assembled monolayers (SAMs) was chosen to highlight the similarities and differences between the responses of the real-time angle shift SPR and wavelength shift LSPR biosensors. During the association phase in the real-time binding studies, both SPR and LSPR sensors exhibited qualitatively similar signal vs time curves. However, in the dissociation phase, the SPR sensor showed an approximately 5 times greater loss of signal than the LSPR sensor. A comprehensive set of nonspecific binding studies demonstrated that this signal difference was not the consequence of greater nonspecific binding to the LSPR sensor but rather a systematic function of the Ag nanoparticle's nanoscale structure. Ag nanoparticles with larger aspect ratios showed larger dissociation phase responses than those with smaller aspect ratios. A theoretical analysis based on finite element electrodynamics demonstrates that this results from the characteristic decay length of the electromagnetic fields surrounding Ag nanoparticles being of comparable dimensions to the ConA molecules. Finally, an elementary (2 x 1) multiplexed version of an LSPR carbohydrate sensing chip to probe the simultaneous binding of ConA to mannose and galactose-functionalized SAMs has been demonstrated.

  6. Somatostatin increases glucocorticoid binding and signaling in macrophages by blocking the calpain-specific cleavage of Hsp 90.

    PubMed

    Bellocq, A; Doublier, S; Suberville, S; Perez, J; Escoubet, B; Fouqueray, B; Puyol, D R; Baud, L

    1999-12-24

    Somatostatin has direct anti-inflammatory actions and participates in the anti-inflammatory actions of glucocorticoids, but the mechanisms underlying this regulation remain poorly understood. The objective of this study was to evaluate whether somatostatin increases glucocorticoid responsiveness by up-regulating glucocorticoid receptor (GR) expression and signaling. Somatostatin promoted a time- and dose-dependent increase in [(3)H]dexamethasone binding to RAW 264.7 macrophages. Cell exposure to 10 nM somatostatin for 18 h promoted a 2-fold increase in the number of GR sites per cell without significant modification of the affinity. Analysis of GR heterocomplex components demonstrated that somatostatin increased the level of heat shock protein (Hsp) 90, whereas the level of GR remained almost unchanged. The increase in Hsp 90 was associated with a decrease in the cleavage of its carboxyl-terminal domain. Evidence for the involvement of calpain inhibition in this process was obtained by the demonstration that 1) somatostatin induced a dose-dependent decrease in calpain activity and 2) calpain inhibitors, calpain inhibitor I and calpeptin, both abolished the cleavage of Hsp 90 and induced a dose-dependent increase in [(3)H]dexamethasone binding. Increases in glucocorticoid binding after somatostatin treatment were associated with similar increases in the ability of GR to transactivate a minimal promoter containing two glucocorticoid response elements (GRE) and to interfere with the activation of nuclear factor-kappaB (NF-kappaB). Thus, the present findings indicate that somatostatin increases glucocorticoid binding and signaling by limiting the calpain-specific cleavage of GR-associated Hsp 90. This mechanism may represent a novel target for intervention to increase glucocorticoid responsiveness.

  7. PlantPAN 2.0: an update of plant promoter analysis navigator for reconstructing transcriptional regulatory networks in plants.

    PubMed

    Chow, Chi-Nga; Zheng, Han-Qin; Wu, Nai-Yun; Chien, Chia-Hung; Huang, Hsien-Da; Lee, Tzong-Yi; Chiang-Hsieh, Yi-Fan; Hou, Ping-Fu; Yang, Tien-Yi; Chang, Wen-Chi

    2016-01-04

    Transcription factors (TFs) are sequence-specific DNA-binding proteins acting as critical regulators of gene expression. The Plant Promoter Analysis Navigator (PlantPAN; http://PlantPAN2.itps.ncku.edu.tw) provides an informative resource for detecting transcription factor binding sites (TFBSs), corresponding TFs, and other important regulatory elements (CpG islands and tandem repeats) in a promoter or a set of plant promoters. Additionally, TFBSs, CpG islands, and tandem repeats in the conserve regions between similar gene promoters are also identified. The current PlantPAN release (version 2.0) contains 16 960 TFs and 1143 TF binding site matrices among 76 plant species. In addition to updating of the annotation information, adding experimentally verified TF matrices, and making improvements in the visualization of transcriptional regulatory networks, several new features and functions are incorporated. These features include: (i) comprehensive curation of TF information (response conditions, target genes, and sequence logos of binding motifs, etc.), (ii) co-expression profiles of TFs and their target genes under various conditions, (iii) protein-protein interactions among TFs and their co-factors, (iv) TF-target networks, and (v) downstream promoter elements. Furthermore, a dynamic transcriptional regulatory network under various conditions is provided in PlantPAN 2.0. The PlantPAN 2.0 is a systematic platform for plant promoter analysis and reconstructing transcriptional regulatory networks. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  8. A regulatory network to segregate the identity of neuronal subtypes.

    PubMed

    Lee, Seunghee; Lee, Bora; Joshi, Kaumudi; Pfaff, Samuel L; Lee, Jae W; Lee, Soo-Kyung

    2008-06-01

    Spinal motor neurons (MNs) and V2 interneurons (V2-INs) are specified by two related LIM-complexes, MN-hexamer and V2-tetramer, respectively. Here we show how multiple parallel and complementary feedback loops are integrated to assign these two cell fates accurately. While MN-hexamer response elements (REs) are specific to MN-hexamer, V2-tetramer-REs can bind both LIM-complexes. In embryonic MNs, however, two factors cooperatively suppress the aberrant activation of V2-tetramer-REs. First, LMO4 blocks V2-tetramer assembly. Second, MN-hexamer induces a repressor, Hb9, which binds V2-tetramer-REs and suppresses their activation. V2-INs use a similar approach; V2-tetramer induces a repressor, Chx10, which binds MN-hexamer-REs and blocks their activation. Thus, our study uncovers a regulatory network to segregate related cell fates, which involves reciprocal feedforward gene regulatory loops.

  9. Expression analysis and functional characterization of a novel cold-responsive gene CbCOR15a from Capsella bursa-pastoris.

    PubMed

    Zhou, Mingqi; Wu, Lihua; Liang, Jing; Shen, Chen; Lin, Juan

    2012-05-01

    The cold-responsive (COR) genes involved in C-repeat binding factor signaling pathway function essentially in cold acclimation of higher plants. A novel COR gene CbCOR15a from shepherd's purse (Capsella bursa-pastoris) was predicted to be a homolog of COR15 in Arabidopsis. The analysis of tissue specific expression pattern as well as characterization of the CbCOR15a promoter revealed that the expression of CbCOR15a was induced by coldness not only in leaves and stem but also in roots. Sequence analysis showed that a 909 bp promoter region of CbCOR15a contained two CRT/DRE elements, two ABRE elements, one auxin-responsive TGA-element and one MeJA-responsive CGTCA-motif. In young seedlings the expression of CbCOR15a could be apparently increased by SA, ABA, MeJA and IAA, and transiently increased by GA(3) accompanied by obvious feedback suppression. According to the altered physiological index values in tobacco under cold treatments, the overexpression of CbCOR15a significantly increased the cold tolerance of transgenic tobacco plants. It can be suggested that CbCOR15a was involved in cold response of Capsella bursa-pastoris associated with SA, ABA, MeJA, IAA and GA(3) regulation and confers enhanced cold acclimation in transgenic plants.

  10. A retinoic acid response element that overlaps an estrogen response element mediates multihormonal sensitivity in transcriptional activation of the lactoferrin gene.

    PubMed

    Lee, M O; Liu, Y; Zhang, X K

    1995-08-01

    The lactoferrin gene is highly expressed in many different tissues, and its expression is controlled by different regulators. In this report, we have defined a retinoic acid response element (RARE) in the 5'-flanking region of the lactoferrin gene promoter. The lactoferrin-RARE is composed of two AGGTCA-like motifs arranged as a direct repeat with 1-bp spacing (DR-1). A gel retardation assay demonstrated that it bound strongly with retinoid X receptor (RXR) homodimers and RXR-retinoic acid receptor (RAR) heterodimers as well as chicken ovalbumin upstream promoter transcription factor (COUP-TF) orphan receptor. In CV-1 cells, the lactoferrin-RARE linked with a heterologous thymidine kinase promoter was strongly activated by RXR homodimers in response to 9-cis-retinoic acid (9-cis-RA) but not to all-trans-RA. When the COUP-TF orphan receptor was cotransfected, the 9-cis-RA-induced RXR homodimer activity was strongly repressed. A unique feature of the lactoferrin-RARE is that it has an AGGTCA-like motif in common with an estrogen-responsive element (ERE). The composite RARE/ERE contributes to the functional interaction between retinoid receptors and the estrogen receptor (ER) and their ligands. In CV-1 cells, cotransfection of the retinoid and estrogen receptors led to mutual inhibition of the other's activity, while an RA-dependent inhibition of ER activity was observed in breast cancer cells. Furthermore, the lactoferrin-RARE/ERE showed differential transactivation activity in different cell types. RAs could activate the lactoferrin-RARE/ERE in human leukemia HL-60 cells and U937 cells but not in human breast cancer cells. By gel retardation analyses, we demonstrated that strong binding of the endogenous COUP-TF in breast cancer cells to the composite element contributed to diminished RA response in these cells. Thus, the lactoferrin-RARE/ERE functions as a signaling switch module that mediates multihormonal responsiveness in the regulation of lactoferrin gene expression.

  11. Association of MMP7 -181A→G Promoter Polymorphism with Gastric Cancer Risk: INFLUENCE OF NICOTINE IN DIFFERENTIAL ALLELE-SPECIFIC TRANSCRIPTION VIA INCREASED PHOSPHORYLATION OF cAMP-RESPONSE ELEMENT-BINDING PROTEIN (CREB).

    PubMed

    Kesh, Kousik; Subramanian, Lakshmi; Ghosh, Nillu; Gupta, Vinayak; Gupta, Arnab; Bhattacharya, Samir; Mahapatra, Nitish R; Swarnakar, Snehasikta

    2015-06-05

    Elevated expression of matrix metalloproteinase7 (MMP7) has been demonstrated to play a pivotal role in cancer invasion. The -181A→G (rs11568818) polymorphism in the MMP7 promoter modulates gene expression and possibly affects cancer progression. Here, we evaluated the impact of -181A→G polymorphism on MMP7 promoter activity and its association with gastric cancer risk in eastern Indian case-control cohorts (n = 520). The GG genotype as compared with the AA genotype was predisposed (p = 0.02; odds ratio = 1.9, 95% confidence interval = 1.1-3.3) to gastric cancer risk. Stratification analysis showed that tobacco addiction enhanced gastric cancer risk in GG subjects when compared with AA subjects (p = 0.03, odds ratio = 2.46, and 95% confidence interval = 1.07-5.68). Meta-analysis revealed that tobacco enhanced the risk for cancer more markedly in AG and GG carriers. Activity and expression of MMP7 were significantly higher in GG than in AA carriers. In support, MMP7 promoter-reporter assays showed greater transcriptional activity toward A to G transition under basal/nicotine-induced/cAMP-response element-binding protein (CREB) overexpressed conditions in gastric adenocarcinoma cells. Moreover, nicotine (a major component of tobacco) treatment significantly up-regulated MMP7 expression due to enhanced CREB phosphorylation followed by its nuclear translocation in gastric adenocarcinoma cells. Furthermore, chromatin immunoprecipitation experiments revealed higher binding of phosphorylated CREB with the -181G than the -181A allele. Altogether, specific binding of phosphorylated CREB to the G allele-carrying promoter enhances MMP7 gene expression that is further augmented by nicotine due to increased CREB phosphorylation and thereby increases the risk for gastric cancer. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  12. The effect of redox-related species of nitrogen monoxide on transferrin and iron uptake and cellular proliferation of erythroleukemia (K562) cells.

    PubMed

    Richardson, D R; Neumannova, V; Nagy, E; Ponka, P

    1995-10-15

    The iron-responsive element-binding protein (IRE-BP) modulates both ferritin mRNA translation and transferrin receptor (TfR) mRNA stability by binding to specific mRNA sequences called iron-responsive elements (IREs). The regulation of IRE-BP in situ could possibly occur either through its Fe-S cluster and/or via free cysteine sulphydryl groups such as cysteine 437 (Philpott et al, J Biol Chem 268:17655, 1993; and Hirling et al, EMBO J 13:453, 1994). Recently, nitrogen monoxide (NO) has been shown to have markedly different biologic effects depending on its redox state (Lipton et al, Nature 364:626, 1993). Considering this fact, it is conceivable that the NO group, as either the nitrosonium ion (NO+) or nitric oxide (NO+), may regulate IRE-BP activity by S-nitrosylation of key sulphydryl groups or via ligation of NO. to the Fe-S cluster, respectively. This hypothesis has been examined using the NO+ generator, sodium nitroprusside (SNP); the NO. generator, S-nitroso-N-acetylpenicillamine (SNAP); and the NO./peroxynitrite (ONOO-) generator, 3-morpholinosydnonimine hydrochloride (SIN-1). Treatment of K562 cells for 18 hours with SNP (1 mmol/L) resulted in a pronounced decrease in both the RNA-binding activity of IRE-BP and the level of TfR mRNA. In addition, Scatchard analysis showed a marked decrease in the number of specific Tf-binding sites, from 590,000/cell (control) to 170,000/cell (test), and there was also a distinct decrease in Fe uptake. Furthermore, SNP did not decrease cellular viability or proliferation. In contrast, the NO. generator, SNAP (1 mmol/L), increased RNA-binding activity of IRE-BP, the level of TfR mRNA, and the number of TfRs in K562 cells. Moreover, both SNAP (1 mmol/L) and SIN-1 (0.5 mmol/L) reduced cellular proliferation. The results are discussed in context of the possible physiologic role of redox-related species of NO in regulating iron metabolism.

  13. Cloning the uteroglobin gene promoter from the relic volcano rabbit (Romerolagus diazi) reveals an ancient estrogen-response element.

    PubMed

    Acosta-MontesdeOca, Adriana; Zariñán, Teresa; Macías, Héctor; Pérez-Solís, Marco A; Ulloa-Aguirre, Alfredo; Gutiérrez-Sagal, Rubén

    2012-05-01

    To gain further insight on the estrogen-dependent transcriptional regulation of the uteroglobin (UG) gene, we cloned the 5'-flanking region of the UG gene from the phylogenetically ancient volcano rabbit (Romerolagus diazi; Rd). The cloned region spans 812 base pairs (bp; -812/-1) and contains a noncanonical TATA box (TACA). The translation start site is 48 bp downstream from the putative transcription initiation site (AGA), and is preceded by a consensus Kozak box. Comparison of the Rd-UG gene with that previously isolated from rabbits (Oryctolagus cuniculus) showed 93% in sequence identity as well as a number of conserved cis-acting elements, including the estrogen-response element (ERE; -265/-251), which differs from the consensus by two nucleotides. In MCF-7 cells, 17β-estradiol (E(2)) induced transcription of a luciferase reporter driven by the Rd-UG promoter in a similar manner as in an equivalent rabbit UG reporter; the Rd-UG promoter was 30% more responsive to E(2) than the rabbit promoter. Mutagenesis studies on the Rd-ERE confirmed this cis-element as a target of E(2) as two luciferase mutant reporters of the Rd-promoter, one with the rabbit and the other with the consensus ERE, were more responsive to the hormone than the wild-type reporter. Gel shift and super-shift assays showed that estrogen receptor-α indeed binds to the imperfect palindromic sequence of the Rd-ERE. Copyright © 2012 Wiley Periodicals, Inc.

  14. The Fate of Visible Features of Invisible Elements

    PubMed Central

    Herzog, Michael H.; Otto, Thomas U.; Ögmen, Haluk

    2012-01-01

    To investigate the integration of features, we have developed a paradigm in which an element is rendered invisible by visual masking. Still, the features of the element are visible as part of other display elements presented at different locations and times (sequential metacontrast). In this sense, we can “transport” features non-retinotopically across space and time. The features of the invisible element integrate with features of other elements if and only if the elements belong to the same spatio-temporal group. The mechanisms of this kind of feature integration seem to be quite different from classical mechanisms proposed for feature binding. We propose that feature processing, binding, and integration occur concurrently during processes that group elements into wholes. PMID:22557985

  15. The Bacterial Response Regulator ArcA Uses a Diverse Binding Site Architecture to Regulate Carbon Oxidation Globally

    PubMed Central

    Park, Dan M.; Akhtar, Md. Sohail; Ansari, Aseem Z.; Landick, Robert; Kiley, Patricia J.

    2013-01-01

    Despite the importance of maintaining redox homeostasis for cellular viability, how cells control redox balance globally is poorly understood. Here we provide new mechanistic insight into how the balance between reduced and oxidized electron carriers is regulated at the level of gene expression by mapping the regulon of the response regulator ArcA from Escherichia coli, which responds to the quinone/quinol redox couple via its membrane-bound sensor kinase, ArcB. Our genome-wide analysis reveals that ArcA reprograms metabolism under anaerobic conditions such that carbon oxidation pathways that recycle redox carriers via respiration are transcriptionally repressed by ArcA. We propose that this strategy favors use of catabolic pathways that recycle redox carriers via fermentation akin to lactate production in mammalian cells. Unexpectedly, bioinformatic analysis of the sequences bound by ArcA in ChIP-seq revealed that most ArcA binding sites contain additional direct repeat elements beyond the two required for binding an ArcA dimer. DNase I footprinting assays suggest that non-canonical arrangements of cis-regulatory modules dictate both the length and concentration-sensitive occupancy of DNA sites. We propose that this plasticity in ArcA binding site architecture provides both an efficient means of encoding binding sites for ArcA, σ70-RNAP and perhaps other transcription factors within the same narrow sequence space and an effective mechanism for global control of carbon metabolism to maintain redox homeostasis. PMID:24146625

  16. Genome-Wide Profiling of p63 DNA–Binding Sites Identifies an Element that Regulates Gene Expression during Limb Development in the 7q21 SHFM1 Locus

    PubMed Central

    Oti, Martin; Dutilh, Bas E.; Alonso, M. Eva; de la Calle-Mustienes, Elisa; Smeenk, Leonie; Rinne, Tuula; Parsaulian, Lilian; Bolat, Emine; Jurgelenaite, Rasa; Huynen, Martijn A.; Hoischen, Alexander; Veltman, Joris A.; Brunner, Han G.; Roscioli, Tony; Oates, Emily; Wilson, Meredith; Manzanares, Miguel; Gómez-Skarmeta, José Luis; Stunnenberg, Hendrik G.; Lohrum, Marion; van Bokhoven, Hans; Zhou, Huiqing

    2010-01-01

    Heterozygous mutations in p63 are associated with split hand/foot malformations (SHFM), orofacial clefting, and ectodermal abnormalities. Elucidation of the p63 gene network that includes target genes and regulatory elements may reveal new genes for other malformation disorders. We performed genome-wide DNA–binding profiling by chromatin immunoprecipitation (ChIP), followed by deep sequencing (ChIP–seq) in primary human keratinocytes, and identified potential target genes and regulatory elements controlled by p63. We show that p63 binds to an enhancer element in the SHFM1 locus on chromosome 7q and that this element controls expression of DLX6 and possibly DLX5, both of which are important for limb development. A unique micro-deletion including this enhancer element, but not the DLX5/DLX6 genes, was identified in a patient with SHFM. Our study strongly indicates disruption of a non-coding cis-regulatory element located more than 250 kb from the DLX5/DLX6 genes as a novel disease mechanism in SHFM1. These data provide a proof-of-concept that the catalogue of p63 binding sites identified in this study may be of relevance to the studies of SHFM and other congenital malformations that resemble the p63-associated phenotypes. PMID:20808887

  17. Analysis of tandem E-box motifs within human Complement receptor 2 (CR2/CD21) promoter reveals cell specific roles for RP58, E2A, USF and localized chromatin accessibility.

    PubMed

    Cruickshank, Mark N; Dods, James; Taylor, Rhonda L; Karimi, Mahdad; Fenwick, Emily J; Quail, Elizabeth A; Rea, Alexander J; Holers, V Michael; Abraham, Lawrence J; Ulgiati, Daniela

    2015-07-01

    Complement receptor 2 (CR2/CD21) plays an important role in the generation of normal B cell immune responses. As transcription appears to be the prime mechanism via which surface CR2/CD21 expression is controlled, understanding transcriptional regulation of this gene will have broader implications to B cell biology. Here we report opposing, cell-context specific control of CR2/CD21 promoter activity by tandem E-box elements, spaced 22 bp apart and within 70 bp of the transcription initiation site. We have identified E2A and USF transcription factors as binding to the distal and proximal E-box sites respectively in CR2-positive B-cells, at a site that is hypersensitive to restriction enzyme digestion compared to non-expressing K562 cells. However, additional unidentified proteins have also been found to bind these functionally important elements. By utilizing a proteomics approach we have identified a repressor protein, RP58, binding the distal E-box motif. Co-transfection experiments using RP58 overexpression constructs demonstrated a specific 10-fold repression of CR2/CD21 transcriptional activity mediated through the distal E-box repressor element. Taken together, our results indicate that repression of the CR2/CD21 promoter can occur through one of the E-box motifs via recruitment of RP58 and other factors to bring about a silenced chromatin context within CR2/CD21 non-expressing cells. Copyright © 2015 Elsevier Ltd. All rights reserved.

  18. GFP tagging of sieve element occlusion (SEO) proteins results in green fluorescent forisomes.

    PubMed

    Pélissier, Hélène C; Peters, Winfried S; Collier, Ray; van Bel, Aart J E; Knoblauch, Michael

    2008-11-01

    Forisomes are Ca(2+)-driven, ATP-independent contractile protein bodies that reversibly occlude sieve elements in faboid legumes. They apparently consist of at least three proteins; potential candidates have been described previously as 'FOR' proteins. We isolated three genes from Medicago truncatula that correspond to the putative forisome proteins and expressed their green fluorescent protein (GFP) fusion products in Vicia faba and Glycine max using the composite plant methodology. In both species, expression of any of the constructs resulted in homogenously fluorescent forisomes that formed sieve tube plugs upon stimulation; no GFP fluorescence occurred elsewhere. Isolated fluorescent forisomes reacted to Ca(2+) and chelators by contraction and expansion, respectively, and did not lose fluorescence in the process. Wild-type forisomes showed no affinity for free GFP in vitro. The three proteins shared numerous conserved motifs between themselves and with hypothetical proteins derived from the genomes of M. truncatula, Vitis vinifera and Arabidopsis thaliana. However, they showed neither significant similarities to proteins of known function nor canonical metal-binding motifs. We conclude that 'FOR'-like proteins are components of forisomes that are encoded by a well-defined gene family with relatives in taxa that lack forisomes. Since the mnemonic FOR is already registered and in use for unrelated genes, we suggest the acronym SEO (sieve element occlusion) for this family. The absence of binding sites for divalent cations suggests that the Ca(2+) binding responsible for forisome contraction is achieved either by as yet unidentified additional proteins, or by SEO proteins through a novel, uncharacterized mechanism.

  19. GFP Tagging of Sieve Element Occlusion (SEO) Proteins Results in Green Fluorescent Forisomes

    PubMed Central

    Pélissier, Hélène C.; Peters, Winfried S.; Collier, Ray; van Bel, Aart J. E.; Knoblauch, Michael

    2008-01-01

    Forisomes are Ca2+-driven, ATP-independent contractile protein bodies that reversibly occlude sieve elements in faboid legumes. They apparently consist of at least three proteins; potential candidates have been described previously as ‘FOR’ proteins. We isolated three genes from Medicago truncatula that correspond to the putative forisome proteins and expressed their green fluorescent protein (GFP) fusion products in Vicia faba and Glycine max using the composite plant methodology. In both species, expression of any of the constructs resulted in homogenously fluorescent forisomes that formed sieve tube plugs upon stimulation; no GFP fluorescence occurred elsewhere. Isolated fluorescent forisomes reacted to Ca2+ and chelators by contraction and expansion, respectively, and did not lose fluorescence in the process. Wild-type forisomes showed no affinity for free GFP in vitro. The three proteins shared numerous conserved motifs between themselves and with hypothetical proteins derived from the genomes of M. truncatula, Vitis vinifera and Arabidopsis thaliana. However, they showed neither significant similarities to proteins of known function nor canonical metal-binding motifs. We conclude that ‘FOR’-like proteins are components of forisomes that are encoded by a well-defined gene family with relatives in taxa that lack forisomes. Since the mnemonic FOR is already registered and in use for unrelated genes, we suggest the acronym SEO (sieve element occlusion) for this family. The absence of binding sites for divalent cations suggests that the Ca2+ binding responsible for forisome contraction is achieved either by as yet unidentified additional proteins, or by SEO proteins through a novel, uncharacterized mechanism. PMID:18784195

  20. Enhanced Radio Frequency Biosensor for Food Quality Detection Using Functionalized Carbon Nanofillers.

    PubMed

    Tanguy, Nicolas R; Fiddes, Lindsey K; Yan, Ning

    2015-06-10

    This paper outlines an improved design of inexpensive, wireless and battery free biosensors for in situ monitoring of food quality. This type of device has an additional advantage of being operated remotely. To make the device, a portion of an antenna of a passive 13.56 MHz radio frequency identification (RFID) tag was altered with a sensing element composed of conductive nanofillers/particles, a binding agent, and a polymer matrix. These novel RFID tags were exposed to biogenic amine putrescine, commonly used as a marker for food spoilage, and their response was monitored over time using a general-purpose network analyzer. The effect of conductive filler properties, including conductivity and morphology, and filler functionalization was investigated by preparing sensing composites containing carbon particles (CPs), multiwall carbon nanotubes (MWCNTs), and binding agent grafted-multiwall carbon nanotubes (g-MWCNTs), respectively. During exposure to putrescine, the amount of reflected waves, frequency at resonance, and quality factor of the novel RFID tags decreased in response. The use of MWCNTs reduced tag cutoff time (i.e., faster response time) as compared with the use of CPs, which highlighted the effectiveness of the conductive nanofiller morphology, while the addition of g-MWCNTs further accelerated the sensor response time as a result of localized binding on the conductive nanofiller surface. Microstructural investigation of the film morphology indicated a better dispersion of g-MWCNTs in the sensing composite as compared to MWCNTs and CPs, as well as a smoother texture of the surface of the resulting coating. These results demonstrated that grafting of the binding agent onto the conductive particles in the sensing composite is an effective way to further enhance the detection sensitivity of the RFID tag based sensor.

  1. Identification of the interleukin 4 receptor alpha gene as a direct target for p73.

    PubMed

    Sasaki, Yasushi; Mita, Hiroaki; Toyota, Minoru; Ishida, Setsuko; Morimoto, Ichiro; Yamashita, Toshiharu; Tanaka, Toshihiro; Imai, Kohzoh; Nakamura, Yusuke; Tokino, Takashi

    2003-12-01

    p73 has a high degree of structural homology to p53 and can activate transcription of p53-responsive genes. However, analysis of p73-deficient mice revealed a marked divergence in the physiological activities of p53 family genes and distinguishes p73 from p53. Mice deficient for p73 exhibit profound defects, including hippocampal dysgenesis, chronic infection, and inflammation, as well as abnormalities in pheromone sensory pathways. p73 plays important roles in neurogenesis, sensory pathways, and homeostatic regulation. Here, we found that the interleukin 4 receptor alpha (IL-4Ralpha) gene is up-regulated by p73 but not significantly by p53 in several human cancer cell lines. IL-4Ralphatranscription is also activated in response to cisplatin, a DNA-damaging agent known to induce p73. By using small interference RNA designed to target p73, we demonstrated that silencing endogenous p73 abrogates the induction of the IL-4Ralpha gene after cisplatin treatment. Furthermore, we identified a p73-binding site in the first intron of the IL-4Ralpha gene that can directly interact with the p73 protein in vivo. This p73-binding site consists of eight copies of a 10-bp consensus p53-binding motif and is a functional response element that is relatively specific for p73 among the p53 family. p73beta promoted localized nucleosomal acetylation through recruitment of coactivator p300, indicating that p73 regulates transcription of IL-4Ralpha through the unique p73-binding site. We also found that p73beta-transfected tumor cells are sensitive to IL-4-mediated apoptosis. Our data suggest that IL-4Ralpha could mediate, in part, certain immune responses and p73-dependent cell death.

  2. Structures of apo IRF-3 and IRF-7 DNA binding domains: effect of loop L1 on DNA binding

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    De Ioannes, Pablo; Escalante, Carlos R.; Aggarwal, Aneel K.

    2013-11-20

    Interferon regulatory factors IRF-3 and IRF-7 are transcription factors essential in the activation of interferon-{beta} (IFN-{beta}) gene in response to viral infections. Although, both proteins recognize the same consensus IRF binding site AANNGAAA, they have distinct DNA binding preferences for sites in vivo. The X-ray structures of IRF-3 and IRF-7 DNA binding domains (DBDs) bound to IFN-{beta} promoter elements revealed flexibility in the loops (L1-L3) and the residues that make contacts with the target sequence. To characterize the conformational changes that occur on DNA binding and how they differ between IRF family members, we have solved the X-ray structures ofmore » IRF-3 and IRF-7 DBDs in the absence of DNA. We found that loop L1, carrying the conserved histidine that interacts with the DNA minor groove, is disordered in apo IRF-3 but is ordered in apo IRF-7. This is reflected in differences in DNA binding affinities when the conserved histidine in loop L1 is mutated to alanine in the two proteins. The stability of loop L1 in IRF-7 derives from a unique combination of hydrophobic residues that pack against the protein core. Together, our data show that differences in flexibility of loop L1 are an important determinant of differential IRF-DNA binding.« less

  3. Electrostatic steering and ionic tethering in enzyme-ligand binding: insights from simulations.

    PubMed

    Wade, R C; Gabdoulline, R R; Lüdemann, S K; Lounnas, V

    1998-05-26

    To bind at an enzyme's active site, a ligand must diffuse or be transported to the enzyme's surface, and, if the binding site is buried, the ligand must diffuse through the protein to reach it. Although the driving force for ligand binding is often ascribed to the hydrophobic effect, electrostatic interactions also influence the binding process of both charged and nonpolar ligands. First, electrostatic steering of charged substrates into enzyme active sites is discussed. This is of particular relevance for diffusion-influenced enzymes. By comparing the results of Brownian dynamics simulations and electrostatic potential similarity analysis for triose-phosphate isomerases, superoxide dismutases, and beta-lactamases from different species, we identify the conserved features responsible for the electrostatic substrate-steering fields. The conserved potentials are localized at the active sites and are the primary determinants of the bimolecular association rates. Then we focus on a more subtle effect, which we will refer to as "ionic tethering." We explore, by means of molecular and Brownian dynamics simulations and electrostatic continuum calculations, how salt links can act as tethers between structural elements of an enzyme that undergo conformational change upon substrate binding, and thereby regulate or modulate substrate binding. This is illustrated for the lipase and cytochrome P450 enzymes. Ionic tethering can provide a control mechanism for substrate binding that is sensitive to the electrostatic properties of the enzyme's surroundings even when the substrate is nonpolar.

  4. Targeting chromatin binding regulation of constitutively active AR variants to overcome prostate cancer resistance to endocrine-based therapies

    PubMed Central

    Chan, Siu Chiu; Selth, Luke A.; Li, Yingming; Nyquist, Michael D.; Miao, Lu; Bradner, James E.; Raj, Ganesh V.; Tilley, Wayne D.; Dehm, Scott M.

    2015-01-01

    Androgen receptor (AR) variants (AR-Vs) expressed in prostate cancer (PCa) lack the AR ligand binding domain (LBD) and function as constitutively active transcription factors. AR-V expression in patient tissues or circulating tumor cells is associated with resistance to AR-targeting endocrine therapies and poor outcomes. Here, we investigated the mechanisms governing chromatin binding of AR-Vs with the goal of identifying therapeutic vulnerabilities. By chromatin immunoprecipitation and sequencing (ChIP-seq) and complementary biochemical experiments, we show that AR-Vs display a binding preference for the same canonical high-affinity androgen response elements (AREs) that are preferentially engaged by AR, albeit with lower affinity. Dimerization was an absolute requirement for constitutive AR-V DNA binding and transcriptional activation. Treatment with the bromodomain and extraterminal (BET) inhibitor JQ1 resulted in inhibition of AR-V chromatin binding and impaired AR-V driven PCa cell growth in vitro and in vivo. Importantly, this was associated with a novel JQ1 action of down-regulating AR-V transcript and protein expression. Overall, this study demonstrates that AR-Vs broadly restore AR chromatin binding events that are otherwise suppressed during endocrine therapy, and provides pre-clinical rationale for BET inhibition as a strategy for inhibiting expression and chromatin binding of AR-Vs in PCa. PMID:25908785

  5. Probing a 2-Aminobenzimidazole Library for Binding to RNA Internal Loops via Two-Dimensional Combinatorial Screening

    PubMed Central

    Velegapudi, Sai Pradeep; Pushechnikov, Alexei; Labuda, Lucas P.; French, Jonathan M.; Disney, Matthew D.

    2012-01-01

    There are many potential RNA drug targets in bacterial, viral, and the human transcriptomes. However, there are few small molecules that modulate RNA function. This is due, in part, to a lack of fundamental understanding about RNA-ligand interactions including the types of small molecules that bind to RNA structural elements and the RNA structural elements that bind to small molecules. In an effort to better understand RNA-ligand interactions, we diversified the 2-aminobenzimidazole core (2AB) and probed the resulting library for binding to a library of RNA internal loops. We chose the 2AB core for these studies because it is a privileged scaffold for binding RNA based on previous reports. These studies identified that N-methyl pyrrolidine, imidazole, and propylamine diversity elements at the R1 position increase binding to internal loops; variability at the R2 position is well tolerated. The preferred RNA loop space was also determined for five ligands using a statistical approach and identified trends that lead to selective recognition. PMID:22958065

  6. High-Mobility Group Chromatin Proteins 1 and 2 Functionally Interact with Steroid Hormone Receptors To Enhance Their DNA Binding In Vitro and Transcriptional Activity in Mammalian Cells

    PubMed Central

    Boonyaratanakornkit, Viroj; Melvin, Vida; Prendergast, Paul; Altmann, Magda; Ronfani, Lorenza; Bianchi, Marco E.; Taraseviciene, Laima; Nordeen, Steven K.; Allegretto, Elizabeth A.; Edwards, Dean P.

    1998-01-01

    We previously reported that the chromatin high-mobility group protein 1 (HMG-1) enhances the sequence-specific DNA binding activity of progesterone receptor (PR) in vitro, thus providing the first evidence that HMG-1 may have a coregulatory role in steroid receptor-mediated gene transcription. Here we show that HMG-1 and the highly related HMG-2 stimulate DNA binding by other steroid receptors, including estrogen, androgen, and glucocorticoid receptors, but have no effect on DNA binding by several nonsteroid nuclear receptors, including retinoid acid receptor (RAR), retinoic X receptor (RXR), and vitamin D receptor (VDR). As highly purified recombinant full-length proteins, all steroid receptors tested exhibited weak binding affinity for their optimal palindromic hormone response elements (HREs), and the addition of purified HMG-1 or -2 substantially increased their affinity for HREs. Purified RAR, RXR, and VDR also exhibited little to no detectable binding to their cognate direct repeat HREs but, in contrast to results with steroid receptors, the addition of HMG-1 or HMG-2 had no stimulatory effect. Instead, the addition of purified RXR enhanced RAR and VDR DNA binding through a heterodimerization mechanism and HMG-1 or HMG-2 had no further effect on DNA binding by RXR-RAR or RXR-VDR heterodimers. HMG-1 and HMG-2 (HMG-1/-2) themselves do not bind to progesterone response elements, but in the presence of PR they were detected as part of an HMG-PR-DNA ternary complex. HMG-1/-2 can also interact transiently in vitro with PR in the absence of DNA; however, no direct protein interaction was detected with VDR. These results, taken together with the fact that PR can bend its target DNA and that HMG-1/-2 are non-sequence-specific DNA binding proteins that recognize DNA structure, suggest that HMG-1/-2 are recruited to the PR-DNA complex by the combined effect of transient protein interaction and DNA bending. In transient-transfection assays, coexpression of HMG-1 or HMG-2 increased PR-mediated transcription in mammalian cells by as much as 7- to 10-fold without altering the basal promoter activity of target reporter genes. This increase in PR-mediated gene activation by coexpression of HMG-1/-2 was observed in different cell types and with different target promoters, suggesting a generality to the functional interaction between HMG-1/-2 and PR in vivo. Cotransfection of HMG-1 also increased reporter gene activation mediated by other steroid receptors, including glucocorticoid and androgen receptors, but it had a minimal influence on VDR-dependent transcription in vivo. These results support the conclusion that HMG-1/-2 are coregulatory proteins that increase the DNA binding and transcriptional activity of the steroid hormone class of receptors but that do not functionally interact with certain nonsteroid classes of nuclear receptors. PMID:9671457

  7. The human immunodeficiency virus type 1 long terminal repeat specifies two different transcription complexes, only one of which is regulated by Tat.

    PubMed Central

    Lu, X; Welsh, T M; Peterlin, B M

    1993-01-01

    The human immunodeficiency virus type 1 long terminal repeat sets up two different transcription complexes, which have been called processive and nonprocessive complexes. By mutating and substituting cis-acting sequences, we mapped elements of the human immunodeficiency virus long terminal repeat that are responsible for creating each transcription complex. Whereas processive complexes are efficiently assembled by upstream promoter elements in the absence of the TATA box, nonprocessive complexes absolutely require the TATA box. Moreover, the TATA box alone can set up these nonprocessive complexes, and nonprocessive but not processive complexes are trans activated by Tat. Finally, a strong DNA-binding site between the TATA box and trans-activation-responsive region interferes with either the assembly or movement of these nonprocessive complexes and diminishes the effects of Tat. Thus, Tat affects a critical step in the formation of elongation-competent transcription complexes. Images PMID:8445708

  8. Transcriptional responses of Arabidopsis thaliana to chewing and sucking insect herbivores

    DOE PAGES

    Appel, Heidi M.; Fescemyer, Howard; Ehlting, Juergen; ...

    2014-11-14

    We tested the hypothesis that Arabidopsis can recognize and respond differentially to insect species at the transcriptional level using a genome wide microarray. Transcriptional reprogramming was characterized using co-expression analysis in damaged and undamaged leaves at two times in response to mechanical wounding and four insect species. In all, 2778 (10.6%) of annotated genes on the array were differentially expressed in at least one treatment. Responses differed mainly between aphid and caterpillar and sampling times. Responses to aphids and caterpillars shared only 10% of up-regulated and 8% of down-regulated genes. Responses to two caterpillars shared 21 and 12% of up-more » and down-regulated genes, whereas responses to the two aphids shared only 7 and 4% of up-regulated and down-regulated genes. Overlap in genes expressed between 6 and 24 h was 3–15%, and depended on the insect species. Responses in attacked and unattacked leaves differed at 6 h but converged by 24 h. Genes responding to the insects are also responsive to many stressors and included primary metabolism. Aphids down-regulated amino acid catabolism; caterpillars stimulated production of amino acids involved in glucosinolate synthesis. Co-expression analysis revealed 17 response networks. Transcription factors were a major portion of differentially expressed genes throughout and responsive genes shared most of the known or postulated binding sites. However, cis-element composition of genes down regulated by the aphid M. persicae was unique, as were those of genes down-regulated by caterpillars. As many as 20 cis-elements were over-represented in one or more treatments, including some from well-characterized classes and others as yet uncharacterized. We suggest that transcriptional changes elicited by wounding and insects are heavily influenced by transcription factors and involve both enrichment of a common set of cis-elements and a unique enrichment of a few cis-elements in responding genes.« less

  9. Transcriptional responses of Arabidopsis thaliana to chewing and sucking insect herbivores

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Appel, Heidi M.; Fescemyer, Howard; Ehlting, Juergen

    We tested the hypothesis that Arabidopsis can recognize and respond differentially to insect species at the transcriptional level using a genome wide microarray. Transcriptional reprogramming was characterized using co-expression analysis in damaged and undamaged leaves at two times in response to mechanical wounding and four insect species. In all, 2778 (10.6%) of annotated genes on the array were differentially expressed in at least one treatment. Responses differed mainly between aphid and caterpillar and sampling times. Responses to aphids and caterpillars shared only 10% of up-regulated and 8% of down-regulated genes. Responses to two caterpillars shared 21 and 12% of up-more » and down-regulated genes, whereas responses to the two aphids shared only 7 and 4% of up-regulated and down-regulated genes. Overlap in genes expressed between 6 and 24 h was 3–15%, and depended on the insect species. Responses in attacked and unattacked leaves differed at 6 h but converged by 24 h. Genes responding to the insects are also responsive to many stressors and included primary metabolism. Aphids down-regulated amino acid catabolism; caterpillars stimulated production of amino acids involved in glucosinolate synthesis. Co-expression analysis revealed 17 response networks. Transcription factors were a major portion of differentially expressed genes throughout and responsive genes shared most of the known or postulated binding sites. However, cis-element composition of genes down regulated by the aphid M. persicae was unique, as were those of genes down-regulated by caterpillars. As many as 20 cis-elements were over-represented in one or more treatments, including some from well-characterized classes and others as yet uncharacterized. We suggest that transcriptional changes elicited by wounding and insects are heavily influenced by transcription factors and involve both enrichment of a common set of cis-elements and a unique enrichment of a few cis-elements in responding genes.« less

  10. Effect of DNA type on response of DNA biosensor for carcinogens

    NASA Astrophysics Data System (ADS)

    Sani, Nor Diyana bt. Md.; Heng, Lee Yook; Surif, Salmijah; Lazim, Azwani Mat

    2013-11-01

    Carcinogens are cancer causing chemicals that can bind to DNA and cause damage to the DNA. These chemicals are available everywhere including in water, air, soil and food. Therefore, a sensor that can detect the presence of these chemicals will be a very useful tool. Since carcinogens bind to DNA, DNA can be used as the biological element in a biosensor. This study has utilized different types of DNA in a biosensor for carcinogen detection. The DNAs include double stranded calf thymus DNA, single stranded calf thymus DNA and guanine rich single stranded DNA. The modified SPE was exposed to a carcinogen followed by interaction with methylene blue which acts as the electroactive indicator. The SPE was then analysed using differential pulse voltammetry (DPV). Optimization studies were conducted for MB concentration and accumulation time, DNA concentration, as well as effect of buffer concentration, buffer pH and ionic strength. The performance of the biosensor was tested on a group 1 carcinogen, formaldehyde. The results indicated that the usage of guanine rich single stranded DNA also gives higher response as carcinogens prefer to bind with guanine compared to other bases.

  11. A Novel Heat Shock Element (HSE) in Entamoeba histolytica that Regulates the Transcriptional Activation of the EhPgp5 Gene in the Presence of Emetine Drug

    PubMed Central

    Nieto, Alma; Pérez Ishiwara, David G.; Orozco, Esther; Sánchez Monroy, Virginia; Gómez García, Consuelo

    2017-01-01

    Transcriptional regulation of the multidrug resistance EhPgp5 gene in Entamoeba histolytica is induced by emetine stress. EhPgp5 overexpression alters the chloride-dependent currents that cause trophozoite swelling, diminishing induced programmed cell death (PCD) susceptibility. In contrast, antisense inhibition of P-glycoprotein (PGP) expression produces synchronous death of trophozoites and the enhancement of the biochemical and morphological characteristics of PCD induced by G418. Transcriptional gene regulation analysis identified a 59 bp region at position −170 to −111 bp promoter as putative emetine response elements (EREs). However, insights into transcription factors controlling EhPgp5 gene transcription are missing; to fill this knowledge gap, we used deletion studies and transient CAT activity assays. Our findings suggested an activating motif (−151 to −136 bp) that corresponds to a heat shock element (HSE). Gel-shift assays, UV-crosslinking, binding protein purification, and western blotting assays revealed proteins of 94, 66, 62, and 51 kDa binding to the EhPgp5 HSE that could be heat shock-like transcription factors that regulate the transcriptional activation of the EhPgp5 gene in the presence of emetine drug. PMID:29238701

  12. Comparing anterior and posterior Hox complex formation reveals guidelines for predicting cis-regulatory elements

    PubMed Central

    Uhl, Juli D.; Cook, Tiffany A.; Gebelein, Brian

    2010-01-01

    Hox transcription factors specify numerous cell fates along the anterior-posterior axis by regulating the expression of downstream target genes. While expression analysis has uncovered large numbers of de-regulated genes in cells with altered Hox activity, determining which are direct versus indirect targets has remained a significant challenge. Here, we characterize the DNA binding activity of Hox transcription factor complexes on eight experimentally verified cis-regulatory elements. Hox factors regulate the activity of each element by forming protein complexes with two cofactor proteins, Extradenticle (Exd) and Homothorax (Hth). Using comparative DNA binding assays, we found that a number of flexible arrangements of Hox, Exd, and Hth binding sites mediate cooperative transcription factor complexes. Moreover, analysis of a Distal-less regulatory element (DMXR) that is repressed by abdominal Hox factors revealed that suboptimal binding sites can be combined to form high affinity transcription complexes. Lastly, we determined that the anterior Hox factors are more dependent upon Exd and Hth for complex formation than posterior Hox factors. Based upon these findings, we suggest a general set of guidelines to serve as a basis for designing bioinformatics algorithms aimed at identifying Hox regulatory elements using the wealth of recently sequenced genomes. PMID:20398649

  13. Extended HSR/CARD domain mediates AIRE binding to DNA

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Maslovskaja, Julia, E-mail: julia.maslovskaja@ut.ee; Saare, Mario; Liiv, Ingrid

    Autoimmune regulator (AIRE) activates the transcription of many genes in an unusual promiscuous and stochastic manner. The mechanism by which AIRE binds to the chromatin and DNA is not fully understood, and the regulatory elements that AIRE target genes possess are not delineated. In the current study, we demonstrate that AIRE activates the expression of transiently transfected luciferase reporters that lack defined promoter regions, as well as intron and poly(A) signal sequences. Our protein-DNA interaction experiments with mutated AIRE reveal that the intact homogeneously staining region/caspase recruitment domain (HSR/CARD) and amino acids R113 and K114 are key elements involved inmore » AIRE binding to DNA. - Highlights: • Promoter and mRNA processing elements are not important for AIRE to activate gene expression from reporter plasmids. • AIRE protein fragment aa 1–138 mediates direct binding to DNA. • Integrity of the HSR/CARD domain is needed for AIRE binding to DNA.« less

  14. [Construction of a general AAV vector regulated by minimal and artificial hypoxic-responsive element].

    PubMed

    Nie, Xiao-wei; Sun, Li-jun; Hao, Yue-wen; Yang, Guang-xiao; Wang, Quan-ying

    2011-03-01

    To synthesize the minimal and artificial HRE, and to insert it into the anterior extremity of CMV promoter of a AAV plasmid, and then to construct the AAV regulated by hypoxic-responsive element which was introduced into 293 cell by method of Ca3(PO4)2 using three plasmids. Thus obtaining the adenoassociated virus vector regulated by hypoxic-responsive element was possibly used for gene therapy in ischemia angiocardiopathy and cerebrovascular disease. Artificially synthesize the 36 bp nucleotide sequences of four connection in series HIF-binding sites A/GCGTG(4×HBS)and a 35 bp nucleotide sequences spacing inserted into anterior extremity of CMV promoter TATA Box, then amplified by PCR. The cDNA fragment was confirmed to be right by DNA sequencing. Molecular biology routine method was used to construct a AAV vector regulated by minimal hypoxic-responsive element after the normal CMV promoter in AAV vector was replaced by the CMV promoter included minimal hypoxic-responsive element. Then, NT4-6His-PR39 fusogenic peptide was inserted into MCS of the plasmid, the recombinant AAV vector was obtained by three plasmid co-transfection in 293 cells, in which we can also investigate the expression of 6×His using immunochemistry in hypoxia environment. Artificial HRE was inserted into anterior extremity of CMV promoter and there was a correct spacing between the HRE and the TATA-box. The DNA sequencing and restriction enzyme digestion results indicated that the AAV regulated by hypoxic-responsive element was successfully constructed. Compared to the control group, the expressions of 6×His was significantly increased in the experimental groups in hypoxia environment, which confirmed that the AAV effectually regulated by the minimal HRE was inserted into anterior extremity of CMV promoter. The HRE is inserted into anterior extremity of CMV promoter to lack incision enzyme recognition site by PCR. And eukaryotic expression vector regulated by hypoxic-responsive is constructed. The AAV effectually regulated by the minimal HRE inserted into anterior extremity of CMV promoter. The vector is successfully constructed and it has important theoretical and practical value in the synteresis and therapy of ischemia angiocardiopathy and cerebrovascular disease.

  15. An experimental investigation of fractionation by sputter deposition. [application to solar wind irradiation of lunar soil

    NASA Technical Reports Server (NTRS)

    Paruso, D. M.; Cassidy, W. A.; Hapke, B. W.

    1978-01-01

    Artificial glass targets composed of elements varying widely in atomic weight were irradiated at an angle of incidence of 45 deg by 2-keV hydrogen ions at a current density of .33 mA/sq cm, and sputtered atoms were caught on a molybdenum film. Analyses of the sputter-deposited films and unsputtered target glasses were carried out by electron microprobe. The backward-sputtered component was found to be enriched in elements of low atomic weight, while the forward-sputtered component was enriched in heavy atoms. These results indicate that at the lunar surface lighter elements and isotopes would tend to be ejected in backward directions, escaping directly through the openings which admit bombarding ions without first striking an adjacent grain surface; heavy elements and isotopes would be forward-sputtered deeper into the soil and be preferentially retained, contributing to the reported enrichments of heavy elements and isotopes. Additional results show that the binding energy of an element in its oxide form influences the sticking coefficient of a sputtered atom; elements of low binding energy are likely to desorb, while elements of high binding energy tend to stick to the first bounce surface.

  16. Cap-proximal nucleotides via differential eIF4E binding and alternative promoter usage mediate translational response to energy stress.

    PubMed

    Tamarkin-Ben-Harush, Ana; Vasseur, Jean-Jacques; Debart, Françoise; Ulitsky, Igor; Dikstein, Rivka

    2017-02-08

    Transcription start-site (TSS) selection and alternative promoter (AP) usage contribute to gene expression complexity but little is known about their impact on translation. Here we performed TSS mapping of the translatome following energy stress. Assessing the contribution of cap-proximal TSS nucleotides, we found dramatic effect on translation only upon stress. As eIF4E levels were reduced, we determined its binding to capped-RNAs with different initiating nucleotides and found the lowest affinity to 5'cytidine in correlation with the translational stress-response. In addition, the number of differentially translated APs was elevated following stress. These include novel glucose starvation-induced downstream transcripts for the translation regulators eIF4A and Pabp, which are also translationally-induced despite general translational inhibition. The resultant eIF4A protein is N-terminally truncated and acts as eIF4A inhibitor. The induced Pabp isoform has shorter 5'UTR removing an auto-inhibitory element. Our findings uncovered several levels of coordination of transcription and translation responses to energy stress.

  17. On the Minimization of Fluctuations in the Response Times of Autoregulatory Gene Networks

    PubMed Central

    Murugan, Rajamanickam; Kreiman, Gabriel

    2011-01-01

    The temporal dynamics of the concentrations of several proteins are tightly regulated, particularly for critical nodes in biological networks such as transcription factors. An important mechanism to control transcription factor levels is through autoregulatory feedback loops where the protein can bind its own promoter. Here we use theoretical tools and computational simulations to further our understanding of transcription-factor autoregulatory loops. We show that the stochastic dynamics of feedback and mRNA synthesis can significantly influence the speed of response of autoregulatory genetic networks toward external stimuli. The fluctuations in the response-times associated with the accumulation of the transcription factor in the presence of negative or positive autoregulation can be minimized by confining the ratio of mRNA/protein lifetimes within 1:10. This predicted range of mRNA/protein lifetime agrees with ranges observed empirically in prokaryotes and eukaryotes. The theory can quantitatively and systematically account for the influence of regulatory element binding and unbinding dynamics on the transcription-factor concentration rise-times. The simulation results are robust against changes in several system parameters of the gene expression machinery. PMID:21943410

  18. Analysis of the regulation of viral transcription.

    PubMed

    Gloss, Bernd; Kalantari, Mina; Bernard, Hans-Ulrich

    2005-01-01

    Despite the small genomes and number of genes of papillomaviruses, regulation of their transcription is very complex and governed by numerous transcription factors, cis-responsive elements, and epigenetic phenomena. This chapter describes the strategies of how one can approach a systematic analysis of these factors, elements, and mechanisms. From the numerous different techniques useful for studying transcription, we describe in detail three selected protocols of approaches that have been relevant in shaping our knowledge of human papillomavirus transcription. These are DNAse I protection ("footprinting") for location of transcription-factor binding sites, electrophoretic mobility shifts ("gelshifts") for analysis of bound transcription factors, and bisulfite sequencing for analysis of DNA methylation as a prerequisite for epigenetic transcriptional regulation.

  19. Role of various microorganisms on Tc behavior in sediments

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Pignolet, L.; Auvray, F.; Fonsny, K.

    1989-11-01

    Marine bacteria (Moraxella sp., Planococcus sp. and a mixed population of anaerobes) from a coastal sediment were found to concentrate Tc. Maximum concentration of this element occurred during the stationary phase of growth of the bacteria, at low redox potential. A metabolic process seems responsible for Tc concentration by bacteria, in which it binds to high molecular weight cellular constituents. Polysaccharidic polymers, which were visualized around the bacterial cells with the scanning electron microscope, might bind Tc, but direct experimental evidence in favor of this hypothesis was not yet obtained. The role of sedimentary bacteria in the behavior of Tcmore » in the marine environment is briefly discussed. The action of sulfate-reducing microorganisms is considered.« less

  20. Nuclear Factor YY1 Inhibits Transforming Growth Factor β- and Bone Morphogenetic Protein-Induced Cell Differentiation

    PubMed Central

    Kurisaki, Keiko; Kurisaki, Akira; Valcourt, Ulrich; Terentiev, Alexei A.; Pardali, Katerina; ten Dijke, Peter; Heldin, Carl-Henrik; Ericsson, Johan; Moustakas, Aristidis

    2003-01-01

    Smad proteins transduce transforming growth factor β (TGF-β) and bone morphogenetic protein (BMP) signals that regulate cell growth and differentiation. We have identified YY1, a transcription factor that positively or negatively regulates transcription of many genes, as a novel Smad-interacting protein. YY1 represses the induction of immediate-early genes to TGF-β and BMP, such as the plasminogen activator inhibitor 1 gene (PAI-1) and the inhibitor of differentiation/inhibitor of DNA binding 1 gene (Id-1). YY1 inhibits binding of Smads to their cognate DNA elements in vitro and blocks Smad recruitment to the Smad-binding element-rich region of the PAI-1 promoter in vivo. YY1 interacts with the conserved N-terminal Mad homology 1 domain of Smad4 and to a lesser extent with Smad1, Smad2, and Smad3. The YY1 zinc finger domain mediates the association with Smads and is necessary for the repressive effect of YY1 on Smad transcriptional activity. Moreover, downregulation of endogenous YY1 by antisense and small interfering RNA strategies results in enhanced transcriptional responses to TGF-β or BMP. Ectopic expression of YY1 inhibits, while knockdown of endogenous YY1 enhances, TGF-β- and BMP-induced cell differentiation. In contrast, overexpression or knockdown of YY1 does not affect growth inhibition induced by TGF-β or BMP. Accordingly, YY1 does not interfere with the regulation of immediate-early genes involved in the TGF-β growth-inhibitory response, the cell cycle inhibitors p15 and p21, and the proto-oncogene c-myc. In conclusion, YY1 represses Smad transcriptional activities in a gene-specific manner and thus regulates cell differentiation induced by TGF-β superfamily pathways. PMID:12808092

Top