[Construction of a general AAV vector regulated by minimal and artificial hypoxic-responsive element].

PubMed

Nie, Xiao-wei; Sun, Li-jun; Hao, Yue-wen; Yang, Guang-xiao; Wang, Quan-ying

2011-03-01

To synthesize the minimal and artificial HRE, and to insert it into the anterior extremity of CMV promoter of a AAV plasmid, and then to construct the AAV regulated by hypoxic-responsive element which was introduced into 293 cell by method of Ca3(PO4)2 using three plasmids. Thus obtaining the adenoassociated virus vector regulated by hypoxic-responsive element was possibly used for gene therapy in ischemia angiocardiopathy and cerebrovascular disease. Artificially synthesize the 36 bp nucleotide sequences of four connection in series HIF-binding sites A/GCGTG(4×HBS)and a 35 bp nucleotide sequences spacing inserted into anterior extremity of CMV promoter TATA Box, then amplified by PCR. The cDNA fragment was confirmed to be right by DNA sequencing. Molecular biology routine method was used to construct a AAV vector regulated by minimal hypoxic-responsive element after the normal CMV promoter in AAV vector was replaced by the CMV promoter included minimal hypoxic-responsive element. Then, NT4-6His-PR39 fusogenic peptide was inserted into MCS of the plasmid, the recombinant AAV vector was obtained by three plasmid co-transfection in 293 cells, in which we can also investigate the expression of 6×His using immunochemistry in hypoxia environment. Artificial HRE was inserted into anterior extremity of CMV promoter and there was a correct spacing between the HRE and the TATA-box. The DNA sequencing and restriction enzyme digestion results indicated that the AAV regulated by hypoxic-responsive element was successfully constructed. Compared to the control group, the expressions of 6×His was significantly increased in the experimental groups in hypoxia environment, which confirmed that the AAV effectually regulated by the minimal HRE was inserted into anterior extremity of CMV promoter. The HRE is inserted into anterior extremity of CMV promoter to lack incision enzyme recognition site by PCR. And eukaryotic expression vector regulated by hypoxic-responsive is constructed. The AAV effectually regulated by the minimal HRE inserted into anterior extremity of CMV promoter. The vector is successfully constructed and it has important theoretical and practical value in the synteresis and therapy of ischemia angiocardiopathy and cerebrovascular disease.

Identification of Cis-Acting Promoter Elements in Cold- and Dehydration-Induced Transcriptional Pathways in Arabidopsis, Rice, and Soybean

PubMed Central

Maruyama, Kyonoshin; Todaka, Daisuke; Mizoi, Junya; Yoshida, Takuya; Kidokoro, Satoshi; Matsukura, Satoko; Takasaki, Hironori; Sakurai, Tetsuya; Yamamoto, Yoshiharu Y.; Yoshiwara, Kyouko; Kojima, Mikiko; Sakakibara, Hitoshi; Shinozaki, Kazuo; Yamaguchi-Shinozaki, Kazuko

2012-01-01

The genomes of three plants, Arabidopsis (Arabidopsis thaliana), rice (Oryza sativa), and soybean (Glycine max), have been sequenced, and their many genes and promoters have been predicted. In Arabidopsis, cis-acting promoter elements involved in cold- and dehydration-responsive gene expression have been extensively analysed; however, the characteristics of such cis-acting promoter sequences in cold- and dehydration-inducible genes of rice and soybean remain to be clarified. In this study, we performed microarray analyses using the three species, and compared characteristics of identified cold- and dehydration-inducible genes. Transcription profiles of the cold- and dehydration-responsive genes were similar among these three species, showing representative upregulated (dehydrin/LEA) and downregulated (photosynthesis-related) genes. All (46 = 4096) hexamer sequences in the promoters of the three species were investigated, revealing the frequency of conserved sequences in cold- and dehydration-inducible promoters. A core sequence of the abscisic acid-responsive element (ABRE) was the most conserved in dehydration-inducible promoters of all three species, suggesting that transcriptional regulation for dehydration-inducible genes is similar among these three species, with the ABRE-dependent transcriptional pathway. In contrast, for cold-inducible promoters, the conserved hexamer sequences were diversified among these three species, suggesting the existence of diverse transcriptional regulatory pathways for cold-inducible genes among the species. PMID:22184637

Conserved structures formed by heterogeneous RNA sequences drive silencing of an inflammation responsive post-transcriptional operon

PubMed Central

Basu, Abhijit; Jain, Niyati; Tolbert, Blanton S.; Komar, Anton A.

2017-01-01

Abstract RNA–protein interactions with physiological outcomes usually rely on conserved sequences within the RNA element. By contrast, activity of the diverse gamma-interferon-activated inhibitor of translation (GAIT)-elements relies on the conserved RNA folding motifs rather than the conserved sequence motifs. These elements drive the translational silencing of a group of chemokine (CC/CXC) and chemokine receptor (CCR) mRNAs, thereby helping to resolve physiological inflammation. Despite sequence dissimilarity, these RNA elements adopt common secondary structures (as revealed by 2D-1H NMR spectroscopy), providing a basis for their interaction with the RNA-binding GAIT complex. However, many of these elements (e.g. those derived from CCL22, CXCL13, CCR4 and ceruloplasmin (Cp) mRNAs) have substantially different affinities for GAIT complex binding. Toeprinting analysis shows that different positions within the overall conserved GAIT element structure contribute to differential affinities of the GAIT protein complex towards the elements. Thus, heterogeneity of GAIT elements may provide hierarchical fine-tuning of the resolution of inflammation. PMID:29069516

Genomic organization, complete sequence, and chromosomal location of the gene for human eotaxin (SCYA11), an eosinophil-specific CC chemokine

DOE Office of Scientific and Technical Information (OSTI.GOV)

Garcia-Zepeda, E.A.; Sarafi, M.N.; Luster, A.D.

1997-05-01

Eotaxin is a CC chemokine that is a specific chemoattractant for eosinophils and is implicated in the pathogenesis of eosinophilic inflammatory diseases, such as asthma. We describe the genomic organization, complete sequence, including 1354 bp 5{prime} of the RNA initiation site, and chromosomal localization of the human eotaxin gene. Fluorescence in situ hybridization analysis localized eotaxin to human chromosome 17, in the region q21.1-q21.2, and the human gene name SCYA11 was assigned. We also present the 5{prime} flanking sequence of the mouse eotaxin gene and have identified several regulatory elements that are conserved between the murine and the human promoters.more » In particular, the presence of elements such as NF-{Kappa}B, interferon-{gamma} response element, and glucocorticoid response element may explain the observed regulation of the eotaxin gene by cytokines and glucocorticoids. 17 refs., 4 figs., 1 tab.« less

Isolation of Persicaria minor sesquiterpene synthase promoter and its deletions for transgenic Arabidopsis thaliana

NASA Astrophysics Data System (ADS)

Omar, Aimi Farehah; Ismail, Ismanizan

2016-11-01

Sesquiterpene synthase (SS) catalyzes the formation of sesquiterpenes from farnesyl diphosphate (FDP) via carbocation intermediates. In this study, the promoter region of sesquiterpene synthase was isolated from Persicaria minor to identify possible cis-acting elements in the promoter. The full-length PmSS promoter of P. minor is 1824-bp sequences. The sequence was analyzed and several putative cis-acting regulatory elements were identified. Three cis-acting regulatory elements were selected for deletion analysis which are cis-acting element involved in wound responsiveness (WUN), cis - acting element involved in defense and stress responsiveness (TC) and cis-acting element involved in ABA responsiveness (ABRE). Series of deletions were conducted to assess the promoter activity producing three truncated fragments promoter; Prom 2 1606-bp, Prom 3 1144- bp, and Prom 4 921-bp. The full-length promoter and its deletion series were cloned into the pBGWFS7 vector which contain β-glucuronidase (GUS) gene and green fluorescent protein (GFP) as the reporter gene. All constructs were successfully transformed into Arabidopsis thaliana based on PCR of positive BASTA resistance plants.

Transposable elements in cancer.

PubMed

Burns, Kathleen H

2017-07-01

Transposable elements give rise to interspersed repeats, sequences that comprise most of our genomes. These mobile DNAs have been historically underappreciated - both because they have been presumed to be unimportant, and because their high copy number and variability pose unique technical challenges. Neither impediment now seems steadfast. Interest in the human mobilome has never been greater, and methods enabling its study are maturing at a fast pace. This Review describes the activity of transposable elements in human cancers, particularly long interspersed element-1 (LINE-1). LINE-1 sequences are self-propagating, protein-coding retrotransposons, and their activity results in somatically acquired insertions in cancer genomes. Altered expression of transposable elements and animation of genomic LINE-1 sequences appear to be hallmarks of cancer, and can be responsible for driving mutations in tumorigenesis.

Quantifying transfer after perceptual-motor sequence learning: how inflexible is implicit learning?

PubMed Central

Sanchez, Daniel J.; Yarnik, Eric N.

2015-01-01

Studies of implicit perceptual-motor sequence learning have often shown learning to be inflexibly tied to the training conditions during learning. Since sequence learning is seen as a model task of skill acquisition, limits on the ability to transfer knowledge from the training context to a performance context indicates important constraints on skill learning approaches. Lack of transfer across contexts has been demonstrated by showing that when task elements are changed following training, this leads to a disruption in performance. These results have typically been taken as suggesting that the sequence knowledge relies on integrated representations across task elements (Abrahamse, Jiménez, Verwey, & Clegg, Psychon Bull Rev 17:603–623, 2010a). Using a relatively new sequence learning task, serial interception sequence learning, three experiments are reported that quantify this magnitude of performance disruption after selectively manipulating individual aspects of motor performance or perceptual information. In Experiment 1, selective disruption of the timing or order of sequential actions was examined using a novel response manipulandum that allowed for separate analysis of these two motor response components. In Experiments 2 and 3, transfer was examined after selective disruption of perceptual information that left the motor response sequence intact. All three experiments provided quantifiable estimates of partial transfer to novel contexts that suggest some level of information integration across task elements. However, the ability to identify quantifiable levels of successful transfer indicates that integration is not all-or-none and that measurement sensitivity is a key in understanding sequence knowledge representations. PMID:24668505

Identification of distal silencing elements in the murine interferon-A11 gene promoter.

PubMed

Roffet, P; Lopez, S; Navarro, S; Bandu, M T; Coulombel, C; Vignal, M; Doly, J; Vodjdani, G

1996-08-01

The murine interferon-A11 (Mu IFN-A11) gene is a member of the IFN-A multigenic family. In mouse L929 cells, the weak response of the gene's promoter to viral induction is due to a combination of both a point mutation in the virus responsive element (VRE) and the presence of negatively regulating sequences surrounding the VRE. In the distal part of the promoter, the negatively acting E1E2 sequence was delimited. This sequence displays an inhibitory effect in either orientation or position on the inducibility of a virus-responsive heterologous promoter. It selectively represses VRE-dependent transcription but is not able to reduce the transcriptional activity of a VRE-lacking promoter. In a transient transfection assay, an E1E2-containing DNA competitor was able to derepress the native Mu IFN-A11 promoter. Specific nuclear factors bind to this sequence; thus the binding of trans-regulators participates in the repression of the Mu IFN-A11 gene. The E1E2 sequence contains an IFN regulatory factor (IRF)-binding site. Recombinant IRF2 binds this sequence and anti-IRF2 antibodies supershift a major complex formed with nuclear extracts. The protein composing the complex is 50 kDa in size, indicating the presence of IRF2 or antigenically related proteins in the complex. The Mu IFN-A11 gene is the first example within the murine IFN-A family, in which a distal promoter element has been identified that can negatively modulate the transcriptional response to viral induction.

Specificity determinants for the abscisic acid response element.

PubMed

Sarkar, Aditya Kumar; Lahiri, Ansuman

2013-01-01

Abscisic acid (ABA) response elements (ABREs) are a group of cis-acting DNA elements that have been identified from promoter analysis of many ABA-regulated genes in plants. We are interested in understanding the mechanism of binding specificity between ABREs and a class of bZIP transcription factors known as ABRE binding factors (ABFs). In this work, we have modeled the homodimeric structure of the bZIP domain of ABRE binding factor 1 from Arabidopsis thaliana (AtABF1) and studied its interaction with ACGT core motif-containing ABRE sequences. We have also examined the variation in the stability of the protein-DNA complex upon mutating ABRE sequences using the protein design algorithm FoldX. The high throughput free energy calculations successfully predicted the ability of ABF1 to bind to alternative core motifs like GCGT or AAGT and also rationalized the role of the flanking sequences in determining the specificity of the protein-DNA interaction.

Identification and characterization of a HeLa nuclear protein that specifically binds to the trans-activation-response (TAR) element of human immunodeficiency virus.

PubMed Central

Marciniak, R A; Garcia-Blanco, M A; Sharp, P A

1990-01-01

Human immunodeficiency virus type 1 RNAs contain a sequence, trans-activation-response (TAR) element, which is required for tat protein-mediated trans-activation of viral gene expression. We have identified a nuclear protein from extracts of HeLa cells that binds to the TAR element RNA in a sequence-specific manner. The binding of this 68-kDa polypeptide was detected by UV cross-linking proteins to TAR element RNA transcribed in vitro. Competition experiments were performed by using a partially purified preparation of the protein to quantify the relative binding affinities of TAR element RNA mutants. The binding affinity of the TAR mutants paralleled the reported ability of those mutants to support tat trans-activation in vivo. We propose that this cellular protein moderates TAR activity in vivo. Images PMID:2333305

Uncovering drug-responsive regulatory elements

PubMed Central

Luizon, Marcelo R; Ahituv, Nadav

2015-01-01

Nucleotide changes in gene regulatory elements can have a major effect on interindividual differences in drug response. For example, by reviewing all published pharmacogenomic genome-wide association studies, we show here that 96.4% of the associated single nucleotide polymorphisms reside in noncoding regions. We discuss how sequencing technologies are improving our ability to identify drug response-associated regulatory elements genome-wide and to annotate nucleotide variants within them. We highlight specific examples of how nucleotide changes in these elements can affect drug response and illustrate the techniques used to find them and functionally characterize them. Finally, we also discuss challenges in the field of drug-responsive regulatory elements that need to be considered in order to translate these findings into the clinic. PMID:26555224

Characterization of carotenoid hydroxylase gene promoter in Haematococcus pluvialis.

PubMed

Meng, C X; Wei, W; Su, Z- L; Qin, S

2006-10-01

Astaxanthin, a high-value ketocarotenoid is mainly used in fish aquaculture. It also has potential in human health due to its higher antioxidant capacity than beta-carotene and vitamin E. The unicellular green alga Haematococcus pluvialis is known to accumulate astaxanthin in response to environmental stresses, such as high light intensity and salt stress. Carotenoid hydroxylase plays a key role in astaxanthin biosynthesis in H. pluvialis. In this paper, we report the characterization of a promoter-like region (-378 to -22 bp) of carotenoid hydroxylase gene by cloning, sequence analysis and functional verification of its 919 bp 5'-flanking region in H. pluvialis. The 5'-flanking region was characterized using micro-particle bombardment method and transient expression of LacZ reporter gene. Results of sequence analysis showed that the 5'-flanking region might have putative cis-acting elements, such as ABA (abscisic acid)-responsive element (ABRE), C-repeat/dehydration responsive element (C-repeat/DRE), ethylene-responsive element (ERE), heat-shock element (HSE), wound-responsive element (WUN-motif), gibberellin-responsive element (P-box), MYB-binding site (MBS) etc., except for typical TATA and CCAAT boxes. Results of 5' deletions construct and beta-galactosidase assays revealed that a highest promoter-like region might exist from -378 to -22 bp and some negative regulatory elements might lie in the region from -919 to -378 bp. Results of site-directed mutagenesis of a putative C-repeat/DRE and an ABRE-like motif in the promoter-like region (-378 to -22 bp) indicated that the putative C-repeat/DRE and ABRE-like motif might be important for expression of carotenoid hydroxylase gene.

Two estrogen response element sequences near the PCNA gene are not responsible for its estrogen-enhanced expression in MCF7 cells.

PubMed

Wang, Cheng; Yu, Jie; Kallen, Caleb B

2008-01-01

The proliferating cell nuclear antigen (PCNA) is an essential component of DNA replication, cell cycle regulation, and epigenetic inheritance. High expression of PCNA is associated with poor prognosis in patients with breast cancer. The 5'-region of the PCNA gene contains two computationally-detected estrogen response element (ERE) sequences, one of which is evolutionarily conserved. Both of these sequences are of undocumented cis-regulatory function. We recently demonstrated that estradiol (E2) enhances PCNA mRNA expression in MCF7 breast cancer cells. MCF7 cells proliferate in response to E2. Here, we demonstrate that E2 rapidly enhanced PCNA mRNA and protein expression in a process that requires ERalpha as well as de novo protein synthesis. One of the two upstream ERE sequences was specifically bound by ERalpha-containing protein complexes, in vitro, in gel shift analysis. Yet, each ERE sequence, when cloned as a single copy, or when engineered as two tandem copies of the ERE-containing sequence, was not capable of activating a luciferase reporter construct in response to E2. In MCF7 cells, neither ERE-containing genomic region demonstrated E2-dependent recruitment of ERalpha by sensitive ChIP-PCR assays. We conclude that E2 enhances PCNA gene expression by an indirect process and that computational detection of EREs, even when evolutionarily conserved and when near E2-responsive genes, requires biochemical validation.

Structure of genes for Hsp30 from the white-rot fungus Coriolus versicolor and the increase of their expression by heat shock and exposure to a hazardous chemical.

PubMed

Iimura, Yosuke; Tatsumi, Kenji

2002-07-01

We isolated and analysed two genomic DNAs that encode the heat-shock protein Hsp30 from Coriolus versicolor. The amino acid sequences substitute only three amino acid substitutions. The promoter regions contain the consensus heat-shock element, a xenobiotic-response element, a stress-response element, and a metal-response element. The levels of mRNAs for Hsp30 increased markedly after exposure of C. versicolor to pentachlorophenol and levels were higher than those after heat shock.

Differential Regulation of Native Estrogen Receptor-Regulatory Elements by Estradiol, Tamoxifen, and Raloxifene

PubMed Central

Levy, Nitzan; Tatomer, Dierdre; Herber, Candice B.; Zhao, Xiaoyue; Tang, Hui; Sargeant, Toby; Ball, Lonnele J.; Summers, Jonathan; Speed, Terence P.; Leitman, Dale C.

2008-01-01

Estrogen receptors (ERs) regulate gene transcription by interacting with regulatory elements. Most information regarding how ER activates genes has come from studies using a small set of target genes or simple consensus sequences such as estrogen response element, activator protein 1, and Sp1 elements. However, these elements cannot explain the differences in gene regulation patterns and clinical effects observed with estradiol (E2) and selective estrogen receptor modulators. To obtain a greater understanding of how E2 and selective estrogen receptor modulators differentially regulate genes, it is necessary to investigate their action on a more comprehensive set of native regulatory elements derived from ER target genes. Here we used chromatin immunoprecipitation-cloning and sequencing to isolate 173 regulatory elements associated with ERα. Most elements were found in the introns (38%) and regions greater than 10 kb upstream of the transcription initiation site (38%); 24% of the elements were found in the proximal promoter region (<10 kb). Only 11% of the elements contained a classical estrogen response element; 23% of the elements did not have any known response elements, including one derived from the naked cuticle homolog gene, which was associated with the recruitment of p160 coactivators. Transfection studies found that 80% of the 173 elements were regulated by E2, raloxifene, or tamoxifen with ERα or ERβ. Tamoxifen was more effective than raloxifene at activating the elements with ERα, whereas raloxifene was superior with ERβ. Our findings demonstrate that E2, tamoxifen, and raloxifene differentially regulate native ER-regulatory elements isolated by chromatin immunoprecipitation with ERα and ERβ. PMID:17962382

Sex change strategy and the aromatase genes.

PubMed

Gardner, L; Anderson, T; Place, A R; Dixon, B; Elizur, A

2005-04-01

Sequential hermaphroditism is a common reproductive strategy in many teleosts. Steroid production is known to mediate both the natural and induced sex change, yet beyond this the physiology directing this process has received little attention. Cytochrome P450 aromatase is a key enzyme in the hormonal pathway catalysing the conversion of sex steroids, androgens to oestrogens, and thus is highly relevant to the process of sex change. This study reports the isolation of cDNA sequences for aromatase isoforms CYP19A1 and CYP19A2 from teleost species representing three forms of sexual hermaphroditism: Lates calcarifer (protandry), Cromileptes altivelis (protogyny), and Gobiodon histrio (bi-directional). Deduced amino acid analysis of these isoforms with other reported isoforms from gonochoristic (single sex) teleosts revealed 56-95% identity within the same isoform while only 48-65% identity between isoforms irrespective of species and sexual strategy. Phylogenetic analysis supported this result separating sequences into isoform exclusive clades in spite of species apparent evolutionary distance. Furthermore, this study isolates 5' flanking regions of all above genes and describes putative cis-acting elements therein. Elements identified include steroidogenic factor 1 binding site (SF-1), oestrogen response element (ERE), progesterone response element (PRE), androgen response element (ARE), glucocorticoid response elements (GRE), peroxisome proliferator-activated receptor alpha/retinoid X receptor alpha heterodimer responsive element (PPARalpha/RXRalpha), nuclear factor kappabeta (NF-kappabeta), SOX 5, SOX 9, and Wilms tumor suppressor (WTI). A hypothetical in vivo model was constructed for both isoforms highlighting potential roles of these putative cis-acting elements with reference to normal function and sexual hermaphroditism.

Cryptic glucocorticoid receptor-binding sites pervade genomic NF-κB response elements.

PubMed

Hudson, William H; Vera, Ian Mitchelle S de; Nwachukwu, Jerome C; Weikum, Emily R; Herbst, Austin G; Yang, Qin; Bain, David L; Nettles, Kendall W; Kojetin, Douglas J; Ortlund, Eric A

2018-04-06

Glucocorticoids (GCs) are potent repressors of NF-κB activity, making them a preferred choice for treatment of inflammation-driven conditions. Despite the widespread use of GCs in the clinic, current models are inadequate to explain the role of the glucocorticoid receptor (GR) within this critical signaling pathway. GR binding directly to NF-κB itself-tethering in a DNA binding-independent manner-represents the standing model of how GCs inhibit NF-κB-driven transcription. We demonstrate that direct binding of GR to genomic NF-κB response elements (κBREs) mediates GR-driven repression of inflammatory gene expression. We report five crystal structures and solution NMR data of GR DBD-κBRE complexes, which reveal that GR recognizes a cryptic response element between the binding footprints of NF-κB subunits within κBREs. These cryptic sequences exhibit high sequence and functional conservation, suggesting that GR binding to κBREs is an evolutionarily conserved mechanism of controlling the inflammatory response.

A versatile transfection assay system to evaluate the biological effects of diverse industrial chemicals.

PubMed

Koizumi, Shinji; Ohno, Shotaro; Otsuka, Fuminori

2012-01-01

Gene expression processes are now recognized as important targets of the toxic effects exerted by industrial chemicals. The transient transfection assay is a powerful tool to evaluate such effects. Thus, we developed a versatile assay system by constructing a basic reporter plasmid in which the regulatory DNA sequence to be studied can easily be substituted. To verify the performance of this system, reporter plasmids carrying any of the three distinct regulatory sequences, estrogen responsive element (ERE), glucocorticoid responsive element (GRE) and xenobiotic responsive element (XRE) were constructed. After transfection of human cells, these plasmids successfully expressed the relevant reporter genes in response to specific inducers, β-estradiol, dexamethasone and 3-methylcholanthrene, respectively. Several industrial chemicals were assayed using these reporter plasmids, and the ability of p-dimethylaminoazobenzene to elevate GRE- and XRE-mediated transcription was detected. α-Naphthylamine and o-tolidine were also observed to increase the XRE-mediated response. The transfection assay system established here will be useful to evaluate the effects of a wide variety of industrial chemicals.

A mutation in the interferon regulatory element of HBV may influence the response of interferon treatment in chronic hepatitis B patients.

PubMed

Lu, Jia-Jie; Chen, En-Qiang; Yang, Jia-Hong; Zhou, Tao-You; Liu, Li; Tang, Hong

2012-01-10

A functional interferon regulatory element (IRE) has been found in the EnhI/X promoter region of hepatitis B virus (HBV) genome. The purpose of this study is to compare the gene order of responder and non-responder to interferon therapy in patients with chronic hepatitis B (CHB), so as to evaluate the relationship between IRE mutation and the response to interferon treatment for CHB patients. Synthetic therapeutic effect is divided into complete response (CR), partial response (PR) and non-response (NR). Among the 62 cases included in this study, 40 cases (64.5%) were in the response group (CR and PR) and 22 (35.5%) cases were in the NR group. Wild type sequence of HBV IRE TTTCACTTTC were found in 35 cases (56.5%), and five different IRE gene sequences. included TTTtACTTTC, TTTCAtTTTC, TTTtAtTTTC, TTTtACTTTt and cTTtACcTTC, were found in 22 cases (35.5%), 1 case (1.6%), 1 case (1.6%), 2 cases (3.2%) and 1 case (1.6%) respectively. There were 41.9%cases (26/62) with forth base C→T mutation, consisted of 32.5% (13/40) cases in response group and 59.1% (13/22) cases in NR group. Among the 35 cases with IRE sequences, there were 67.5% (27/40) cases in response group and 36.4% (8/22) in NR group, and the difference in IRE sequences between two groups was statistic significantly (P = 0.027). The result suggested that there is likely relationship between the forth base mutation (C→T) of IRE region and the response of HBV to Interferon therapy, and this mutation may partially decrease the inhibition effect of interferon on HBV. The forth base C→T mutation in IRE element of HBV may partially influence the response of Interferon treatment in CHB patients.

Inducible in vivo DNA footprints define sequences necessary for UV light activation of the parsley chalcone synthase gene.

PubMed Central

Schulze-Lefert, P; Dangl, J L; Becker-André, M; Hahlbrock, K; Schulz, W

1989-01-01

We began characterization of the protein--DNA interactions necessary for UV light induced transcriptional activation of the gene encoding chalcone synthase (CHS), a key plant defense enzyme. Three light dependent in vivo footprints appear on a 90 bp stretch of the CHS promoter with a time course correlated with the onset of CHS transcription. We define a minimal light responsive promoter by functional analysis of truncated CHS promoter fusions with a reporter gene in transient expression experiments in parsley protoplasts. Two of the three footprinted sequence 'boxes' reside within the minimal promoter. Replacement of 10 bp within either of these 'boxes' leads to complete loss of light responsiveness. We conclude that these sequences define the necessary cis elements of the minimal CHS promoter's light responsive element. One of the functionally defined 'boxes' is homologous to an element implicated in regulation of genes involved in photosynthesis. These data represent the first example in a plant defense gene of an induced change in protein--DNA contacts necessary for transcriptional activation. Also, our data argue strongly that divergent light induced biosynthetic pathways share common regulatory units. Images PMID:2566481

Analysis of an osmotically regulated pathogenesis-related osmotin gene promoter.

PubMed

Raghothama, K G; Liu, D; Nelson, D E; Hasegawa, P M; Bressan, R A

1993-12-01

Osmotin is a small (24 kDa), basic, pathogenesis-related protein, that accumulates during adaptation of tobacco (Nicotiana tabacum) cells to osmotic stress. There are more than 10 inducers that activate the osmotin gene in various plant tissues. The osmotin promoter contains several sequences bearing a high degree of similarity to ABRE, as-1 and E-8 cis element sequences. Gel retardation studies indicated the presence of at least two regions in the osmotin promoter that show specific interactions with nuclear factors isolated from cultured cells or leaves. The abundance of these binding factors increased in response to salt, ABA and ethylene. Nuclear factors protected a 35 bp sequence of the promoter from DNase I digestion. Different 5' deletions of the osmotin promoter cloned into a promoter-less GUSNOS plasmid (pBI 201) were used in transient expression studies with a Biolistic gun. The transient expression studies revealed the presence of three distinct regions in the osmotin promoter. The promoter sequence from -108 to -248 bp is absolutely required for reporter gene activity, followed by a long stretch (up to -1052) of enhancer-like sequence and then a sequence upstream of -1052, which appears to contain negative elements. The responses to ABA, ethylene, salt, desiccation and wounding appear to be associated with the -248 bp sequence of the promoter. This region also contains a putative ABRE (CACTGTG) core element. Activation of the osmotin gene by various inducers is discussed in view of antifungal activity of the osmotin protein.

Single sea urchin phagocytes express messages of a single sequence from the diverse Sp185/333 gene family in response to bacterial challenge.

PubMed

Majeske, Audrey J; Oren, Matan; Sacchi, Sandro; Smith, L Courtney

2014-12-01

Immune systems in animals rely on fast and efficient responses to a wide variety of pathogens. The Sp185/333 gene family in the purple sea urchin, Strongylocentrotus purpuratus, consists of an estimated 50 (±10) members per genome that share a basic gene structure but show high sequence diversity, primarily due to the mosaic appearance of short blocks of sequence called elements. The genes show significantly elevated expression in three subpopulations of phagocytes responding to marine bacteria. The encoded Sp185/333 proteins are highly diverse and have central effector functions in the immune system. In this study we report the Sp185/333 gene expression in single sea urchin phagocytes. Sea urchins challenged with heat-killed marine bacteria resulted in a typical increase in coelomocyte concentration within 24 h, which included an increased proportion of phagocytes expressing Sp185/333 proteins. Phagocyte fractions enriched from coelomocytes were used in limiting dilutions to obtain samples of single cells that were evaluated for Sp185/333 gene expression by nested RT-PCR. Amplicon sequences showed identical or nearly identical Sp185/333 amplicon sequences in single phagocytes with matches to six known Sp185/333 element patterns, including both common and rare element patterns. This suggested that single phagocytes show restricted expression from the Sp185/333 gene family and infers a diverse, flexible, and efficient response to pathogens. This type of expression pattern from a family of immune response genes in single cells has not been identified previously in other invertebrates. Copyright © 2014 by The American Association of Immunologists, Inc.

Efficient generation of complete sequences of MDR-encoding plasmids by rapid assembly of MinION barcoding sequencing data.

PubMed

Li, Ruichao; Xie, Miaomiao; Dong, Ning; Lin, Dachuan; Yang, Xuemei; Wong, Marcus Ho Yin; Chan, Edward Wai-Chi; Chen, Sheng

2018-03-01

Multidrug resistance (MDR)-encoding plasmids are considered major molecular vehicles responsible for transmission of antibiotic resistance genes among bacteria of the same or different species. Delineating the complete sequences of such plasmids could provide valuable insight into the evolution and transmission mechanisms underlying bacterial antibiotic resistance development. However, due to the presence of multiple repeats of mobile elements, complete sequencing of MDR plasmids remains technically complicated, expensive, and time-consuming. Here, we demonstrate a rapid and efficient approach to obtaining multiple MDR plasmid sequences through the use of the MinION nanopore sequencing platform, which is incorporated in a portable device. By assembling the long sequencing reads generated by a single MinION run according to a rapid barcoding sequencing protocol, we obtained the complete sequences of 20 plasmids harbored by multiple bacterial strains. Importantly, single long reads covering a plasmid end-to-end were recorded, indicating that de novo assembly may be unnecessary if the single reads exhibit high accuracy. This workflow represents a convenient and cost-effective approach for systematic assessment of MDR plasmids responsible for treatment failure of bacterial infections, offering the opportunity to perform detailed molecular epidemiological studies to probe the evolutionary and transmission mechanisms of MDR-encoding elements.

Influence of gag and RRE Sequences on HIV-1 RNA Packaging Signal Structure and Function.

PubMed

Kharytonchyk, Siarhei; Brown, Joshua D; Stilger, Krista; Yasin, Saif; Iyer, Aishwarya S; Collins, John; Summers, Michael F; Telesnitsky, Alice

2018-07-06

The packaging signal (Ψ) and Rev-responsive element (RRE) enable unspliced HIV-1 RNAs' export from the nucleus and packaging into virions. For some retroviruses, engrafting Ψ onto a heterologous RNA is sufficient to direct encapsidation. In contrast, HIV-1 RNA packaging requires 5' leader Ψ elements plus poorly defined additional features. We previously defined minimal 5' leader sequences competitive with intact Ψ for HIV-1 packaging, and here examined the potential roles of additional downstream elements. The findings confirmed that together, HIV-1 5' leader Ψ sequences plus a nuclear export element are sufficient to specify packaging. However, RNAs trafficked using a heterologous export element did not compete well with RNAs using HIV-1's RRE. Furthermore, some RNA additions to well-packaged minimal vectors rendered them packaging-defective. These defects were rescued by extending gag sequences in their native context. To understand these packaging defects' causes, in vitro dimerization properties of RNAs containing minimal packaging elements were compared to RNAs with sequence extensions that were or were not compatible with packaging. In vitro dimerization was found to correlate with packaging phenotypes, suggesting that HIV-1 evolved to prevent 5' leader residues' base pairing with downstream residues and misfolding of the packaging signal. Our findings explain why gag sequences have been implicated in packaging and show that RRE's packaging contributions appear more specific than nuclear export alone. Paired with recent work showing that sequences upstream of Ψ can dictate RNA folds, the current work explains how genetic context of minimal packaging elements contributes to HIV-1 RNA fate determination. Copyright © 2018 Elsevier Ltd. All rights reserved.

Image Understanding Research.

DTIC Science & Technology

1978-09-30

element output sequence, and h is an L element impulse response sequence with M = N+L-l, and E (m) represents noise or - measurement uncertainty at the...William K. Pratt ......... 123 3.2 Estimation of Image Signal with Poisson Noise - I - Chun Moo Lo and Alexander A. Sawchuk ........ 135 3.3 Computer... noise ratio (SNR) of 10.0. From these curves, it is apparent that the Sobel and Prewitt 3 x 3 operators are superior to the Roberts 2 x 2 operators. The

In vitro selection of DNA elements highly responsive to the human T-cell lymphotropic virus type I transcriptional activator, Tax.

PubMed

Paca-Uccaralertkun, S; Zhao, L J; Adya, N; Cross, J V; Cullen, B R; Boros, I M; Giam, C Z

1994-01-01

The human T-cell lymphotropic virus type I (HTLV-I) transactivator, Tax, the ubiquitous transcriptional factor cyclic AMP (cAMP) response element-binding protein (CREB protein), and the 21-bp repeats in the HTLV-I transcriptional enhancer form a ternary nucleoprotein complex (L. J. Zhao and C. Z. Giam, Proc. Natl. Acad. Sci. USA 89:7070-7074, 1992). Using an antibody directed against the COOH-terminal region of Tax along with purified Tax and CREB proteins, we selected DNA elements bound specifically by the Tax-CREB complex in vitro. Two distinct but related groups of sequences containing the cAMP response element (CRE) flanked by long runs of G and C residues in the 5' and 3' regions, respectively, were preferentially recognized by Tax-CREB. In contrast, CREB alone binds only to CRE motifs (GNTGACG[T/C]) without neighboring G- or C-rich sequences. The Tax-CREB-selected sequences bear a striking resemblance to the 5' or 3' two-thirds of the HTLV-I 21-bp repeats and are highly inducible by Tax. Gel electrophoretic mobility shift assays, DNA transfection, and DNase I footprinting analyses indicated that the G- and C-rich sequences flanking the CRE motif are crucial for Tax-CREB-DNA ternary complex assembly and Tax transactivation but are not in direct contact with the Tax-CREB complex. These data show that Tax recruits CREB to form a multiprotein complex that specifically recognizes the viral 21-bp repeats. The expanded DNA binding specificity of Tax-CREB and the obligatory role the ternary Tax-CREB-DNA complex plays in transactivation reveal a novel mechanism for regulating the transcriptional activity of leucine zipper proteins like CREB.

Reprint of: Early Behavioural Facilitation by Temporal Expectations in Complex Visual-motor Sequences.

PubMed

Heideman, Simone G; van Ede, Freek; Nobre, Anna C

2018-05-24

In daily life, temporal expectations may derive from incidental learning of recurring patterns of intervals. We investigated the incidental acquisition and utilisation of combined temporal-ordinal (spatial/effector) structure in complex visual-motor sequences using a modified version of a serial reaction time (SRT) task. In this task, not only the series of targets/responses, but also the series of intervals between subsequent targets was repeated across multiple presentations of the same sequence. Each participant completed three sessions. In the first session, only the repeating sequence was presented. During the second and third session, occasional probe blocks were presented, where a new (unlearned) spatial-temporal sequence was introduced. We first confirm that participants not only got faster over time, but that they were slower and less accurate during probe blocks, indicating that they incidentally learned the sequence structure. Having established a robust behavioural benefit induced by the repeating spatial-temporal sequence, we next addressed our central hypothesis that implicit temporal orienting (evoked by the learned temporal structure) would have the largest influence on performance for targets following short (as opposed to longer) intervals between temporally structured sequence elements, paralleling classical observations in tasks using explicit temporal cues. We found that indeed, reaction time differences between new and repeated sequences were largest for the short interval, compared to the medium and long intervals, and that this was the case, even when comparing late blocks (where the repeated sequence had been incidentally learned), to early blocks (where this sequence was still unfamiliar). We conclude that incidentally acquired temporal expectations that follow a sequential structure can have a robust facilitatory influence on visually-guided behavioural responses and that, like more explicit forms of temporal orienting, this effect is most pronounced for sequence elements that are expected at short inter-element intervals. Copyright © 2017 The Author(s). Published by Elsevier Ltd.. All rights reserved.

Control of transcriptional pausing by biased thermal fluctuations on repetitive genomic sequences

PubMed Central

Imashimizu, Masahiko; Afek, Ariel; Takahashi, Hiroki; Lubkowska, Lucyna; Lukatsky, David B.

2016-01-01

In the process of transcription elongation, RNA polymerase (RNAP) pauses at highly nonrandom positions across genomic DNA, broadly regulating transcription; however, molecular mechanisms responsible for the recognition of such pausing positions remain poorly understood. Here, using a combination of statistical mechanical modeling and high-throughput sequencing and biochemical data, we evaluate the effect of thermal fluctuations on the regulation of RNAP pausing. We demonstrate that diffusive backtracking of RNAP, which is biased by repetitive DNA sequence elements, causes transcriptional pausing. This effect stems from the increased microscopic heterogeneity of an elongation complex, and thus is entropy-dominated. This report shows a linkage between repetitive sequence elements encoded in the genome and regulation of RNAP pausing driven by thermal fluctuations. PMID:27830653

cDNA cloning, genomic organization and expression analysis during somatic embryogenesis of the translationally controlled tumor protein (TCTP) gene from Japanese larch (Larix leptolepis).

PubMed

Zhang, Li-Feng; Li, Wan-Feng; Han, Su-Ying; Yang, Wen-Hua; Qi, Li-Wang

2013-10-15

A full-length cDNA and genomic sequences of a translationally controlled tumor protein (TCTP) gene were isolated from Japanese larch (Larix leptolepis) and designated LaTCTP. The length of the cDNA was 1, 043 bp and contained a 504 bp open reading frame that encodes a predicted protein of 167 amino acids, characterized by two signature sequences of the TCTP protein family. Analysis of the LaTCTP gene structure indicated four introns and five exons, and it is the largest of all currently known TCTP genes in plants. The 5'-flanking promoter region of LaTCTP was cloned using an improved TAIL-PCR technique. In this region we identified many important potential cis-acting elements, such as a Box-W1 (fungal elicitor responsive element), a CAT-box (cis-acting regulatory element related to meristem expression), a CGTCA-motif (cis-acting regulatory element involved in MeJA-responsiveness), a GT1-motif (light responsive element), a Skn-1-motif (cis-acting regulatory element required for endosperm expression) and a TGA-element (auxin-responsive element), suggesting that expression of LaTCTP is highly regulated. Expression analysis demonstrated ubiquitous localization of LaTCTP mRNA in the roots, stems and needles, high mRNA levels in the embryonal-suspensor mass (ESM), browning embryogenic cultures and mature somatic embryos, and low levels of mRNA at day five during somatic embryogenesis. We suggest that LaTCTP might participate in the regulation of somatic embryo development. These results provide a theoretical basis for understanding the molecular regulatory mechanism of LaTCTP and lay the foundation for artificial regulation of somatic embryogenesis. © 2013.

Control of Task Sequences: What is the Role of Language?

PubMed Central

Mayr, Ulrich; Kleffner, Killian; Kikumoto, Atsushi; Redford, Melissa A.

2015-01-01

It is almost a truism that language aids serial-order control through self-cuing of upcoming sequential elements. We measured speech onset latencies as subjects performed hierarchically organized task sequences while "thinking aloud" each task label. Surprisingly, speech onset latencies and response times (RTs) were highly synchronized, a pattern that is not consistent with the hypothesis that speaking aids proactive retrieval of upcoming sequential elements during serial-order control. We also found that when instructed to do so, participants were able to speak task labels prior to presentation of response-relevant stimuli and that this substantially reduced RT signatures of retrieval—however at the cost of more sequencing errors. Thus, while proactive retrieval is possible in principle, in natural situations it seems to be prevented through a strong, "gestalt-like" tendency to synchronize speech and action. We suggest that this tendency may support context updating rather than proactive control. PMID:24274386

n-Alkane and clofibrate, a peroxisome proliferator, activate transcription of ALK2 gene encoding cytochrome P450alk2 through distinct cis-acting promoter elements in Candida maltosa

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kogure, Takahisa; Faculty of Applied Life Sciences, Niigata University of Pharmacy and Applied Life Sciences, Higashijima 265-1, Niitsu, Niigata 956-8603; Takagi, Masamichi

2005-04-01

The ALK2 gene, encoding one of the n-alkane-hydroxylating cytochromes P450 in Candida maltosa, is induced by n-alkanes and a peroxisome proliferator, clofibrate. Deletion analysis of this gene's promoter revealed two cis-acting elements-an n-alkane-responsive element (ARE2) and a clofibrate-responsive element (CRE2)-that partly overlap in sequence but have distinct functions. ARE2-mediated activation responded to n-alkanes but not to clofibrate and was repressed by glucose. CRE2-mediated activation responded to polyunsaturated fatty acids and steroid hormones as well as to peroxisome proliferators but not to n-alkanes, and it was not repressed by glucose. Both elements mediated activation by oleic acid. Mutational analysis demonstrated thatmore » three CCG sequences in CRE2 were critical to the activation by clofibrate as well as to the in vitro binding of a specific protein to this element. These findings suggest that ALK2 is induced by peroxisome proliferators and steroid hormones through a specific CRE2-mediated regulatory mechanism.« less

Event sequence detector

NASA Technical Reports Server (NTRS)

Hanna, M. F. (Inventor)

1973-01-01

An event sequence detector is described with input units, each associated with a row of bistable elements arranged in an array of rows and columns. The detector also includes a shift register which is responsive to clock pulses from any of the units to sequentially provide signals on its output lines each of which is connected to the bistable elements in a corresponding column. When the event-indicating signal is received by an input unit it provides a clock pulse to the shift register to provide the signal on one of its output lines. The input unit also enables all its bistable elements so that the particular element in the column supplied with the signal from the register is driven to an event-indicating state.

Divergence of Drosophila melanogaster repeatomes in response to a sharp microclimate contrast in Evolution Canyon, Israel

PubMed Central

Kim, Young Bun; Oh, Jung Hun; McIver, Lauren J.; Rashkovetsky, Eugenia; Michalak, Katarzyna; Garner, Harold R.; Kang, Lin; Nevo, Eviatar; Korol, Abraham B.; Michalak, Pawel

2014-01-01

Repeat sequences, especially mobile elements, make up large portions of most eukaryotic genomes and provide enormous, albeit commonly underappreciated, evolutionary potential. We analyzed repeatomes of Drosophila melanogaster that have been diverging in response to a microclimate contrast in Evolution Canyon (Mount Carmel, Israel), a natural evolutionary laboratory with two abutting slopes at an average distance of only 200 m, which pose a constant ecological challenge to their local biotas. Flies inhabiting the colder and more humid north-facing slope carried about 6% more transposable elements than those from the hot and dry south-facing slope, in parallel to a suite of other genetic and phenotypic differences between the two populations. Nearly 50% of all mobile element insertions were slope unique, with many of them disrupting coding sequences of genes critical for cognition, olfaction, and thermotolerance, consistent with the observed patterns of thermotolerance differences and assortative mating. PMID:25006263

Divergence of Drosophila melanogaster repeatomes in response to a sharp microclimate contrast in Evolution Canyon, Israel.

PubMed

Kim, Young Bun; Oh, Jung Hun; McIver, Lauren J; Rashkovetsky, Eugenia; Michalak, Katarzyna; Garner, Harold R; Kang, Lin; Nevo, Eviatar; Korol, Abraham B; Michalak, Pawel

2014-07-22

Repeat sequences, especially mobile elements, make up large portions of most eukaryotic genomes and provide enormous, albeit commonly underappreciated, evolutionary potential. We analyzed repeatomes of Drosophila melanogaster that have been diverging in response to a microclimate contrast in Evolution Canyon (Mount Carmel, Israel), a natural evolutionary laboratory with two abutting slopes at an average distance of only 200 m, which pose a constant ecological challenge to their local biotas. Flies inhabiting the colder and more humid north-facing slope carried about 6% more transposable elements than those from the hot and dry south-facing slope, in parallel to a suite of other genetic and phenotypic differences between the two populations. Nearly 50% of all mobile element insertions were slope unique, with many of them disrupting coding sequences of genes critical for cognition, olfaction, and thermotolerance, consistent with the observed patterns of thermotolerance differences and assortative mating.

v-src induction of the TIS10/PGS2 prostaglandin synthase gene is mediated by an ATF/CRE transcription response element.

PubMed

Xie, W; Fletcher, B S; Andersen, R D; Herschman, H R

1994-10-01

We recently reported the cloning of a mitogen-inducible prostaglandin synthase gene, TIS10/PGS2. In addition to growth factors and tumor promoters, the v-src oncogene induces TIS10/PGS2 expression in 3T3 cells. Deletion analysis, using luciferase reporters, identifies a region between -80 and -40 nucleotides 5' of the TIS10/PGS2 transcription start site that mediates pp60v-src induction in 3T3 cells. This region contains the sequence CGTCACGTG, which includes overlapping ATF/CRE (CGTCA) and E-box (CACGTG) sequences. Gel shift-oligonucleotide competition experiments with nuclear extracts from cells stably transfected with a temperature-sensitive v-src gene demonstrate that the CGTCACGTG sequence can bind proteins at both the ATF/CRE and E-box sequences. Dominant-negative CREB and Myc proteins that bind DNA, but do not transactivate, block v-src induction of a luciferase reporter driven by the first 80 nucleotides of the TIS10/PGS2 promoter. Mutational analysis distinguishes which TIS10/PGS2 cis-acting element mediates pp60v-src induction. E-box mutation has no effect on the fold induction in response to pp60v-src. In contrast, ATF/CRE mutation attenuates the pp60v-src response. Antibody supershift and methylation interference experiments demonstrate that CREB and at least one other ATF transcription factor in these extracts bind to the TIS10/PGS2 ATF/CRE element. Expression of a dominant-negative ras gene also blocks TIS10/PGS2 induction by v-src. Our data suggest that Ras mediates pp60v-src activation of an ATF transcription factor, leading to induced TIS10/PGS2 expression via the ATF/CRE element of the TIS10/PGS2 promoter. This is the first description of v-src activation of gene expression via an ATF/CRE element.

Hypoxia-induced oxidative base modifications in the VEGF hypoxia-response element are associated with transcriptionally active nucleosomes.

PubMed

Ruchko, Mykhaylo V; Gorodnya, Olena M; Pastukh, Viktor M; Swiger, Brad M; Middleton, Natavia S; Wilson, Glenn L; Gillespie, Mark N

2009-02-01

Reactive oxygen species (ROS) generated in hypoxic pulmonary artery endothelial cells cause transient oxidative base modifications in the hypoxia-response element (HRE) of the VEGF gene that bear a conspicuous relationship to induction of VEGF mRNA expression (K.A. Ziel et al., FASEB J. 19, 387-394, 2005). If such base modifications are indeed linked to transcriptional regulation, then they should be detected in HRE sequences associated with transcriptionally active nucleosomes. Southern blot analysis of the VEGF HRE associated with nucleosome fractions prepared by micrococcal nuclease digestion indicated that hypoxia redistributed some HRE sequences from multinucleosomes to transcriptionally active mono- and dinucleosome fractions. A simple PCR method revealed that VEGF HRE sequences harboring oxidative base modifications were found exclusively in mononucleosomes. Inhibition of hypoxia-induced ROS generation with myxathiozol prevented formation of oxidative base modifications but not the redistribution of HRE sequences into mono- and dinucleosome fractions. The histone deacetylase inhibitor trichostatin A caused retention of HRE sequences in compacted nucleosome fractions and prevented formation of oxidative base modifications. These findings suggest that the hypoxia-induced oxidant stress directed at the VEGF HRE requires the sequence to be repositioned into mononucleosomes and support the prospect that oxidative modifications in this sequence are an important step in transcriptional activation.

Control of Task Sequences: What Is the Role of Language?

ERIC Educational Resources Information Center

Mayr, Ulrich; Kleffner-Canucci, Killian; Kikumoto, Atsushi; Redford, Melissa A.

2014-01-01

It is almost a truism that language aids serial-order control through self-cuing of upcoming sequential elements. We measured speech onset latencies as subjects performed hierarchically organized task sequences while "thinking aloud" each task label. Surprisingly, speech onset latencies and response times (RTs) were highly synchronized,…

Production of Functional Proteins: Balance of Shear Stress and Gravity

NASA Technical Reports Server (NTRS)

Goodwin, Thomas John (Inventor); Hammond, Timothy Grant (Inventor); Haysen, James Howard (Inventor)

2005-01-01

The present invention provides for a method of culturing cells and inducing the expression of at least one gene in the cell culture. The method provides for contacting the cell with a transcription factor decoy oligonucleotide sequence directed against a nucleotide sequence encoding a shear stress response element.

Location analysis for the estrogen receptor-α reveals binding to diverse ERE sequences and widespread binding within repetitive DNA elements

PubMed Central

Mason, Christopher E.; Shu, Feng-Jue; Wang, Cheng; Session, Ryan M.; Kallen, Roland G.; Sidell, Neil; Yu, Tianwei; Liu, Mei Hui; Cheung, Edwin; Kallen, Caleb B.

2010-01-01

Location analysis for estrogen receptor-α (ERα)-bound cis-regulatory elements was determined in MCF7 cells using chromatin immunoprecipitation (ChIP)-on-chip. Here, we present the estrogen response element (ERE) sequences that were identified at ERα-bound loci and quantify the incidence of ERE sequences under two stringencies of detection: <10% and 10–20% nucleotide deviation from the canonical ERE sequence. We demonstrate that ∼50% of all ERα-bound loci do not have a discernable ERE and show that most ERα-bound EREs are not perfect consensus EREs. Approximately one-third of all ERα-bound ERE sequences reside within repetitive DNA sequences, most commonly of the AluS family. In addition, the 3-bp spacer between the inverted ERE half-sites, rather than being random nucleotides, is C(A/T)G-enriched at bona fide receptor targets. Diverse ERα-bound loci were validated using electrophoretic mobility shift assay and ChIP-polymerase chain reaction (PCR). The functional significance of receptor-bound loci was demonstrated using luciferase reporter assays which proved that repetitive element ERE sequences contribute to enhancer function. ChIP-PCR demonstrated estrogen-dependent recruitment of the coactivator SRC3 to these loci in vivo. Our data demonstrate that ERα binds to widely variant EREs with less sequence specificity than had previously been suspected and that binding at repetitive and nonrepetitive genomic targets is favored by specific trinucleotide spacers. PMID:20047966

Location analysis for the estrogen receptor-alpha reveals binding to diverse ERE sequences and widespread binding within repetitive DNA elements.

PubMed

Mason, Christopher E; Shu, Feng-Jue; Wang, Cheng; Session, Ryan M; Kallen, Roland G; Sidell, Neil; Yu, Tianwei; Liu, Mei Hui; Cheung, Edwin; Kallen, Caleb B

2010-04-01

Location analysis for estrogen receptor-alpha (ERalpha)-bound cis-regulatory elements was determined in MCF7 cells using chromatin immunoprecipitation (ChIP)-on-chip. Here, we present the estrogen response element (ERE) sequences that were identified at ERalpha-bound loci and quantify the incidence of ERE sequences under two stringencies of detection: <10% and 10-20% nucleotide deviation from the canonical ERE sequence. We demonstrate that approximately 50% of all ERalpha-bound loci do not have a discernable ERE and show that most ERalpha-bound EREs are not perfect consensus EREs. Approximately one-third of all ERalpha-bound ERE sequences reside within repetitive DNA sequences, most commonly of the AluS family. In addition, the 3-bp spacer between the inverted ERE half-sites, rather than being random nucleotides, is C(A/T)G-enriched at bona fide receptor targets. Diverse ERalpha-bound loci were validated using electrophoretic mobility shift assay and ChIP-polymerase chain reaction (PCR). The functional significance of receptor-bound loci was demonstrated using luciferase reporter assays which proved that repetitive element ERE sequences contribute to enhancer function. ChIP-PCR demonstrated estrogen-dependent recruitment of the coactivator SRC3 to these loci in vivo. Our data demonstrate that ERalpha binds to widely variant EREs with less sequence specificity than had previously been suspected and that binding at repetitive and nonrepetitive genomic targets is favored by specific trinucleotide spacers.

H-2RIIBP, a member of the nuclear hormone receptor superfamily that binds to both the regulatory element of major histocompatibility class I genes and the estrogen response element.

PubMed

Hamada, K; Gleason, S L; Levi, B Z; Hirschfeld, S; Appella, E; Ozato, K

1989-11-01

Transcription of major histocompatibility complex (MHC) class I genes is regulated by the conserved MHC class I regulatory element (CRE). The CRE has two factor-binding sites, region I and region II, both of which elicit enhancer function. By screening a mouse lambda gt 11 library with the CRE as a probe, we isolated a cDNA clone that encodes a protein capable of binding to region II of the CRE. This protein, H-2RIIBP (H-2 region II binding protein), bound to the native region II sequence, but not to other MHC cis-acting sequences or to mutant region II sequences, similar to the naturally occurring region II factor in mouse cells. The deduced amino acid sequence of H-2RIIBP revealed two putative zinc fingers homologous to the DNA-binding domain of steroid/thyroid hormone receptors. Although sequence similarity in other regions was minimal, H-2RIIBP has apparent modular domains characteristic of the nuclear hormone receptors. Further analyses showed that both H-2RIIBP and the natural region II factor bind to the estrogen response element (ERE) of the vitellogenin A2 gene. The ERE is composed of a palindrome, and half of this palindrome resembles the region II binding site of the MHC CRE. These results indicate that H-2RIIBP (i) is a member of the superfamily of nuclear hormone receptors and (ii) may regulate not only MHC class I genes but also genes containing the ERE and related sequences. Sequences homologous to the H-2RIIBP gene are widely conserved in the animal kingdom. H-2RIIBP mRNA is expressed in many mouse tissues, in agreement with the distribution of the natural region II factor.

The Specificity of Innate Immune Responses Is Enforced by Repression of Interferon Response Elements by NF-κB p50

PubMed Central

Cheng, Christine S.; Feldman, Kristyn E.; Lee, James; Verma, Shilpi; Huang, De-Bin; Huynh, Kim; Chang, Mikyoung; Ponomarenko, Julia V.; Sun, Shao-Cong; Benedict, Chris A.; Ghosh, Gourisankar; Hoffmann, Alexander

2011-01-01

The specific binding of transcription factors to cognate sequence elements is thought to be critical for the generation of specific gene expression programs. Members of the nuclear factor κB (NF-κB) and interferon (IFN) regulatory factor (IRF) transcription factor families bind to the κB site and the IFN response element (IRE), respectively, of target genes, and they are activated in macrophages after exposure to pathogens. However, how these factors produce pathogen-specific inflammatory and immune responses remains poorly understood. Combining top-down and bottom-up systems biology approaches, we have identified the NF-κB p50 homodimer as a regulator of IRF responses. Unbiased genome-wide expression and biochemical and structural analyses revealed that the p50 homodimer repressed a subset of IFN-inducible genes through a previously uncharacterized subclass of guanine-rich IRE (G-IRE) sequences. Mathematical modeling predicted that the p50 homodimer might enforce the stimulus specificity of composite promoters. Indeed, the production of the antiviral regulator IFN-β was rendered stimulus-specific by the binding of the p50 homodimer to the G-IRE–containing IFNβ enhancer to suppress cytotoxic IFN signaling. Specifically, a deficiency in p50 resulted in the inappropriate production of IFN-β in response to bacterial DNA sensed by Toll-like receptor 9. This role for the NF-κB p50 homodimer in enforcing the specificity of the cellular response to pathogens by binding to a subset of IRE sequences alters our understanding of how the NF-κB and IRF signaling systems cooperate to regulate antimicrobial immunity. PMID:21343618

Translation-coupling systems

DOEpatents

Pfleger, Brian; Mendez-Perez, Daniel

2013-11-05

Disclosed are systems and methods for coupling translation of a target gene to a detectable response gene. A version of the invention includes a translation-coupling cassette. The translation-coupling cassette includes a target gene, a response gene, a response-gene translation control element, and a secondary structure-forming sequence that reversibly forms a secondary structure masking the response-gene translation control element. Masking of the response-gene translation control element inhibits translation of the response gene. Full translation of the target gene results in unfolding of the secondary structure and consequent translation of the response gene. Translation of the target gene is determined by detecting presence of the response-gene protein product. The invention further includes RNA transcripts of the translation-coupling cassettes, vectors comprising the translation-coupling cassettes, hosts comprising the translation-coupling cassettes, methods of using the translation-coupling cassettes, and gene products produced with the translation-coupling cassettes.

Translation-coupling systems

DOEpatents

Pfleger, Brian; Mendez-Perez, Daniel

2015-05-19

Disclosed are systems and methods for coupling translation of a target gene to a detectable response gene. A version of the invention includes a translation-coupling cassette. The translation-coupling cassette includes a target gene, a response gene, a response-gene translation control element, and a secondary structure-forming sequence that reversibly forms a secondary structure masking the response-gene translation control element. Masking of the response-gene translation control element inhibits translation of the response gene. Full translation of the target gene results in unfolding of the secondary structure and consequent translation of the response gene. Translation of the target gene is determined by detecting presence of the response-gene protein product. The invention further includes RNA transcripts of the translation-coupling cassettes, vectors comprising the translation-coupling cassettes, hosts comprising the translation-coupling cassettes, methods of using the translation-coupling cassettes, and gene products produced with the translation-coupling cassettes.

Isolation and analysis of a multifunctional triterpene synthase KcMS promoter region from mangrove plant kandelia candel

NASA Astrophysics Data System (ADS)

Basyuni, M.; Wati, R.; Sulistiyono, N.; Sumardi; Oku, H.; Baba, S.; Sagami, H.

2018-03-01

Molecular cloning of Kandelia candel KcMS gene has previously been cloned and encoded a multifunctional triterpene synthase. In this study, the KcMS gene promoter was cloned through Genome walking, sequenced, and analyzed. A 1,358 bp genomic DNA fragment of KcMS promoter was obtained. PLACE and PlantCARE analysis of the KcMS promoter revealed that there was some regulatory elements in response to environmental signals and involved in the regulation of gene expression. Results showed that four kinds of elements are regulated by hormone binding, namely 2 MeJA-responsiveness elements (CGTCA-motif and TGACG-motif), the ABRE (TACGTG) involved in abscisic acid responsiveness, gibberellin-related GARE-motif (AAACAGA), and the TGA-element (AACGAC) as an auxin-responsive element. Several elements in the KcMS have been shown in other plants to be responsive to abiotic stress. These motifs were MBS (CAACTG), TC-rich repeats, and eight light responsive elements. The KcMS promoter was also involved in the activation of defense genes in plants such as HSE (AAAAAATTC) and four circadian control elements (CAANNNNATC). The presence of multipotential regulatory motifs suggested that KcMS may be involved in regulation of plant tolerance to several types of stresses.

Structures of Escherichia coli DNA adenine methyltransferase (Dam) in complex with a non-GATC sequence: Potential implications for methylation-independent transcriptional repression

DOE Office of Scientific and Technical Information (OSTI.GOV)

Horton, John R.; Zhang, Xing; Blumenthal, Robert M.

DNA adenine methyltransferase (Dam) is widespread and conserved among the γ-proteobacteria. Methylation of the Ade in GATC sequences regulates diverse bacterial cell functions, including gene expression, mismatch repair and chromosome replication. Dam also controls virulence in many pathogenic Gram-negative bacteria. An unexplained and perplexing observation about Escherichia coli Dam (EcoDam) is that there is no obvious relationship between the genes that are transcriptionally responsive to Dam and the promoter-proximal presence of GATC sequences. Here, we demonstrate that EcoDam interacts with a 5-base pair non-cognate sequence distinct from GATC. The crystal structure of a non-cognate complex allowed us to identify amore » DNA binding element, GTYTA/TARAC (where Y = C/T and R = A/G). This element immediately flanks GATC sites in some Dam-regulated promoters, including the Pap operon which specifies pyelonephritis-associated pili. In addition, Dam interacts with near-cognate GATC sequences (i.e. 3/4-site ATC and GAT). All together, these results imply that Dam, in addition to being responsible for GATC methylation, could also function as a methylation-independent transcriptional repressor.« less

Structures of Escherichia coli DNA adenine methyltransferase (Dam) in complex with a non-GATC sequence: Potential implications for methylation-independent transcriptional repression

DOE PAGES

Horton, John R.; Zhang, Xing; Blumenthal, Robert M.; ...

2015-04-06

DNA adenine methyltransferase (Dam) is widespread and conserved among the γ-proteobacteria. Methylation of the Ade in GATC sequences regulates diverse bacterial cell functions, including gene expression, mismatch repair and chromosome replication. Dam also controls virulence in many pathogenic Gram-negative bacteria. An unexplained and perplexing observation about Escherichia coli Dam (EcoDam) is that there is no obvious relationship between the genes that are transcriptionally responsive to Dam and the promoter-proximal presence of GATC sequences. Here, we demonstrate that EcoDam interacts with a 5-base pair non-cognate sequence distinct from GATC. The crystal structure of a non-cognate complex allowed us to identify amore » DNA binding element, GTYTA/TARAC (where Y = C/T and R = A/G). This element immediately flanks GATC sites in some Dam-regulated promoters, including the Pap operon which specifies pyelonephritis-associated pili. In addition, Dam interacts with near-cognate GATC sequences (i.e. 3/4-site ATC and GAT). All together, these results imply that Dam, in addition to being responsible for GATC methylation, could also function as a methylation-independent transcriptional repressor.« less

Draft Genome Sequence of Lactobacillus salivarius SGL 03, a Novel Potential Probiotic Strain.

PubMed

Federici, Federica; Manna, Laura; Rizzi, Eleonora; Galantini, Elena; Marini, Umberto

2017-12-07

In this work, we report the draft genome sequence of Lactobacillus salivarius SGL 03, a novel potential probiotic strain isolated from healthy infant stools. Antibiotic resistance analysis revealed the presence of a tetracycline resistance gene without elements potentially responsible for interspecific horizontal gene transfer. Copyright © 2017 Federici et al.

Sequestration of cAMP response element-binding proteins by transcription factor decoys causes collateral elaboration of regenerating Aplysia motor neuron axons.

PubMed

Dash, P K; Tian, L M; Moore, A N

1998-07-07

Axonal injury increases intracellular Ca2+ and cAMP and has been shown to induce gene expression, which is thought to be a key event for regeneration. Increases in intracellular Ca2+ and/or cAMP can alter gene expression via activation of a family of transcription factors that bind to and modulate the expression of CRE (Ca2+/cAMP response element) sequence-containing genes. We have used Aplysia motor neurons to examine the role of CRE-binding proteins in axonal regeneration after injury. We report that axonal injury increases the binding of proteins to a CRE sequence-containing probe. In addition, Western blot analysis revealed that the level of ApCREB2, a CRE sequence-binding repressor, was enhanced as a result of axonal injury. The sequestration of CRE-binding proteins by microinjection of CRE sequence-containing plasmids enhanced axon collateral formation (both number and length) as compared with control plasmid injections. These findings show that Ca2+/cAMP-mediated gene expression via CRE-binding transcription factors participates in the regeneration of motor neuron axons.

Characterisation of a DNA sequence element that directs Dictyostelium stalk cell-specific gene expression.

PubMed

Ceccarelli, A; Zhukovskaya, N; Kawata, T; Bozzaro, S; Williams, J

2000-12-01

The ecmB gene of Dictyostelium is expressed at culmination both in the prestalk cells that enter the stalk tube and in ancillary stalk cell structures such as the basal disc. Stalk tube-specific expression is regulated by sequence elements within the cap-site proximal part of the promoter, the stalk tube (ST) promoter region. Dd-STATa, a member of the STAT transcription factor family, binds to elements present in the ST promoter-region and represses transcription prior to entry into the stalk tube. We have characterised an activatory DNA sequence element, that lies distal to the repressor elements and that is both necessary and sufficient for expression within the stalk tube. We have mapped this activator to a 28 nucleotide region (the 28-mer) within which we have identified a GA-containing sequence element that is required for efficient gene transcription. The Dd-STATa protein binds to the 28-mer in an in vitro binding assay, and binding is dependent upon the GA-containing sequence. However, the ecmB gene is expressed in a Dd-STATa null mutant, therefore Dd-STATa cannot be responsible for activating the 28-mer in vivo. Instead, we identified a distinct 28-mer binding activity in nuclear extracts from the Dd-STATa null mutant, the activity of this GA binding activity being largely masked in wild type extracts by the high affinity binding of the Dd-STATa protein. We suggest, that in addition to the long range repression exerted by binding to the two known repressor sites, Dd-STATa inhibits transcription by direct competition with this putative activator for binding to the GA sequence.

Robust Translation of the Nucleoid Protein Fis Requires a Remote Upstream AU Element and Is Enhanced by RNA Secondary Structure

PubMed Central

Nafissi, Maryam; Chau, Jeannette; Xu, Jimin

2012-01-01

Synthesis of the Fis nucleoid protein rapidly increases in response to nutrient upshifts, and Fis is one of the most abundant DNA binding proteins in Escherichia coli under nutrient-rich growth conditions. Previous work has shown that control of Fis synthesis occurs at transcription initiation of the dusB-fis operon. We show here that while translation of the dihydrouridine synthase gene dusB is low, unusual mechanisms operate to enable robust translation of fis. At least two RNA sequence elements located within the dusB coding region are responsible for high fis translation. The most important is an AU element centered 35 nucleotides (nt) upstream of the fis AUG, which may function as a binding site for ribosomal protein S1. In addition, a 44-nt segment located upstream of the AU element and predicted to form a stem-loop secondary structure plays a prominent role in enhancing fis translation. On the other hand, mutations close to the AUG, including over a potential Shine-Dalgarno sequence, have little effect on Fis protein levels. The AU element and stem-loop regions are phylogenetically conserved within dusB-fis operons of representative enteric bacteria. PMID:22389479

Promoter selection in human mitochondria involves binding of a transcription factor to orientation-independent upstream regulatory elements.

PubMed

Fisher, R P; Topper, J N; Clayton, D A

1987-07-17

Selective transcription of human mitochondrial DNA requires a transcription factor (mtTF) in addition to an essentially nonselective RNA polymerase. Partially purified mtTF is able to sequester promoter-containing DNA in preinitiation complexes in the absence of mitochondrial RNA polymerase, suggesting a DNA-binding mechanism for factor activity. Functional domains, required for positive transcriptional regulation by mtTF, are identified within both major promoters of human mtDNA through transcription of mutant promoter templates in a reconstituted in vitro system. These domains are essentially coextensive with DNA sequences protected from nuclease digestion by mtTF-binding. Comparison of the sequences of the two mtTF-responsive elements reveals significant homology only when one sequence is inverted; the binding sites are in opposite orientations with respect to the predominant direction of transcription. Thus mtTF may function bidirectionally, requiring additional protein-DNA interactions to dictate transcriptional polarity. The mtTF-responsive elements are arrayed as direct repeats, separated by approximately 80 bp within the displacement-loop region of human mitochondrial DNA; this arrangement may reflect duplication of an ancestral bidirectional promoter, giving rise to separate, unidirectional promoters for each strand.

Disruption of Boundary Encoding During Sensorimotor Sequence Learning: An MEG Study.

PubMed

Michail, Georgios; Nikulin, Vadim V; Curio, Gabriel; Maess, Burkhard; Herrojo Ruiz, María

2018-01-01

Music performance relies on the ability to learn and execute actions and their associated sounds. The process of learning these auditory-motor contingencies depends on the proper encoding of the serial order of the actions and sounds. Among the different serial positions of a behavioral sequence, the first and last (boundary) elements are particularly relevant. Animal and patient studies have demonstrated a specific neural representation for boundary elements in prefrontal cortical regions and in the basal ganglia, highlighting the relevance of their proper encoding. The neural mechanisms underlying the encoding of sequence boundaries in the general human population remain, however, largely unknown. In this study, we examined how alterations of auditory feedback, introduced at different ordinal positions (boundary or within-sequence element), affect the neural and behavioral responses during sensorimotor sequence learning. Analysing the neuromagnetic signals from 20 participants while they performed short piano sequences under the occasional effect of altered feedback (AF), we found that at around 150-200 ms post-keystroke, the neural activities in the dorsolateral prefrontal cortex (DLPFC) and supplementary motor area (SMA) were dissociated for boundary and within-sequence elements. Furthermore, the behavioral data demonstrated that feedback alterations on boundaries led to greater performance costs, such as more errors in the subsequent keystrokes. These findings jointly support the idea that the proper encoding of boundaries is critical in acquiring sensorimotor sequences. They also provide evidence for the involvement of a distinct neural circuitry in humans including prefrontal and higher-order motor areas during the encoding of the different classes of serial order.

Elements in the transcriptional regulatory region flanking herpes simplex virus type 1 oriS stimulate origin function.

PubMed

Wong, S W; Schaffer, P A

1991-05-01

Like other DNA-containing viruses, the three origins of herpes simplex virus type 1 (HSV-1) DNA replication are flanked by sequences containing transcriptional regulatory elements. In a transient plasmid replication assay, deletion of sequences comprising the transcriptional regulatory elements of ICP4 and ICP22/47, which flank oriS, resulted in a greater than 80-fold decrease in origin function compared with a plasmid, pOS-822, which retains these sequences. In an effort to identify specific cis-acting elements responsible for this effect, we conducted systematic deletion analysis of the flanking region with plasmid pOS-822 and tested the resulting mutant plasmids for origin function. Stimulation by cis-acting elements was shown to be both distance and orientation dependent, as changes in either parameter resulted in a decrease in oriS function. Additional evidence for the stimulatory effect of flanking sequences on origin function was demonstrated by replacement of these sequences with the cytomegalovirus immediate-early promoter, resulting in nearly wild-type levels of oriS function. In competition experiments, cotransfection of cells with the test plasmid, pOS-822, and increasing molar concentrations of a competitor plasmid which contained the ICP4 and ICP22/47 transcriptional regulatory regions but lacked core origin sequences resulted in a significant reduction in the replication efficiency of pOS-822, demonstrating that factors which bind specifically to the oriS-flanking sequences are likely involved as auxiliary proteins in oriS function. Together, these studies demonstrate that trans-acting factors and the sites to which they bind play a critical role in the efficiency of HSV-1 DNA replication from oriS in transient-replication assays.

The yeast genome may harbor hypoxia response elements (HRE).

PubMed

Ferreira, Túlio César; Hertzberg, Libi; Gassmann, Max; Campos, Elida Geralda

2007-01-01

The hypoxia-inducible factor-1 (HIF-1) is a heterodimeric transcription factor activated when cells are submitted to hypoxia. The heterodimer is composed of two subunits, HIF-1alpha and the constitutively expressed HIF-1beta. During normoxia, HIF-1alpha is degraded by the 26S proteasome, but hypoxia causes HIF-1alpha to be stabilized, enter the nucleus and bind to HIF-1beta, thus forming the active complex. The complex then binds to the regulatory sequences of various genes involved in physiological and pathological processes. The specific regulatory sequence recognized by HIF-1 is the hypoxia response element (HRE) that has the consensus sequence 5'BRCGTGVBBB3'. Although the basic transcriptional regulation machinery is conserved between yeast and mammals, Saccharomyces cerevisiae does not express HIF-1 subunits. However, we hypothesized that baker's yeast has a protein analogous to HIF-1 which participates in the response to changes in oxygen levels by binding to HRE sequences. In this study we screened the yeast genome for HREs using probabilistic motif search tools. We described 24 yeast genes containing motifs with high probability of being HREs (p-value<0.1) and classified them according to biological function. Our results show that S. cerevisiae may harbor HREs and indicate that a transcription factor analogous to HIF-1 may exist in this organism.

Characterization of promoter of EgPAL1, a novel PAL gene from the oil palm Elaeis guineensis Jacq.

PubMed

Yusuf, Chong Yu Lok; Abdullah, Janna Ong; Shaharuddin, Noor Azmi; Abu Seman, Idris; Abdullah, Mohd Puad

2018-02-01

The oil palm EgPAL1 gene promoter and its regulatory region were functional as a promoter in the heterologous system of Arabidopsis according to the cis-acting elements present in that region. The promoter was developmentally regulated, vascular tissue specific and responsive to water stress agents. Phenylalanine ammonia lyase (PAL, EC 4.3.1.24) is the key enzyme of the phenylpropanoid pathway which plays important roles in plant development and adaptation. To date, there is no report on the study of PAL from oil palm (Elaeis guineensis), an economically important oil crop. In this study, the 5' regulatory sequence of a highly divergent oil palm PAL gene (EgPAL1) was isolated and fused with GUS in Arabidopsis to create two transgenic plants carrying the minimal promoter with (2302 bp) and without its regulatory elements (139 bp). The regulatory sequence contained cis-acting elements known to be important for plant development and stress response including the AC-II element for lignin biosynthesis and several stress responsive elements. The promoter and its regulatory region were fully functional in Arabidopsis. Its activities were characterised by two common fundamental features of PAL which are responsive to plant internal developmental programme and external factors. The promoter was developmentally regulated in certain organs; highly active in young organs but less active or inactive in mature organs. The presence of the AC elements and global activity of the EgPAL1 promoter in all organs resembled the property of lignin-related genes. The existence of the MBS element and enhancement of the promoter activity by PEG reflected the behaviour of drought-responsive genes. Our findings provide a platform for evaluating oil palm gene promoters in the heterologous system of Arabidopsis and give insights into the activities of EgPAL1 promoter in oil palm.

Overexpression of the OsIMP Gene Increases the Accumulation of Inositol and Confers Enhanced Cold Tolerance in Tobacco through Modulation of the Antioxidant Enzymes' Activities.

PubMed

Zhang, Rong-Xiang; Qin, Li-Jun; Zhao, De-Gang

2017-07-20

Inositol is a cyclic polyol that is involved in various physiological processes, including signal transduction and stress adaptation in plants. l- myo -inositol monophosphatase (IMPase) is one of the metal-dependent phosphatase family members and catalyzes the last reaction step of biosynthesis of inositol. Although increased IMPase activity induced by abiotic stress has been reported in chickpea plants, the role and regulation of the IMP gene in rice ( Oryza sativa L.) remains poorly understood. In the present work, we obtained a full-length cDNA sequence coding IMPase in the cold tolerant rice landraces in Gaogonggui, which is named as OsIMP . Multiple alignment results have displayed that this sequence has characteristic signature motifs and conserved enzyme active sites of the phosphatase super family. Phylogenetic analysis showed that IMPase is most closely related to that of the wild rice Oryza brachyantha , while transcript analysis revealed that the expression of the OsIMP is significantly induced by cold stress and exogenous abscisic acid (ABA) treatment. Meanwhile, we cloned the 5' flanking promoter sequence of the OsIMP gene and identified several important cis -acting elements, such as LTR (low-temperature responsiveness), TCA-element (salicylic acid responsiveness), ABRE-element (abscisic acid responsiveness), GARE-motif (gibberellin responsive), MBS (MYB Binding Site) and other cis -acting elements related to defense and stress responsiveness. To further investigate the potential function of the OsIMP gene, we generated transgenic tobacco plants overexpressing the OsIMP gene and the cold tolerance test indicated that these transgenic tobacco plants exhibit improved cold tolerance. Furthermore, transgenic tobacco plants have a lower level of hydrogen peroxide (H₂O₂) and malondialdehyde (MDA), and a higher content of total chlorophyll as well as increased antioxidant enzyme activities of superoxide dismutase (SOD), catalase (CAT) and peroxidase (POD), when compared to wild type (WT) tobacco plants under normal and cold stress conditions.

Circular RNA expression in basal cell carcinoma.

PubMed

Sand, Michael; Bechara, Falk G; Sand, Daniel; Gambichler, Thilo; Hahn, Stephan A; Bromba, Michael; Stockfleth, Eggert; Hessam, Schapoor

2016-05-01

Circular RNAs (circRNAs), are nonprotein coding RNAs consisting of a circular loop with multiple miRNA, binding sites called miRNA response elements (MREs), functioning as miRNA sponges. This study was performed to identify differentially expressed circRNAs and their MREs in basal cell carcinoma (BCC). Microarray circRNA expression profiles were acquired from BCC and control followed by qRT-PCR validation. Bioinformatical target prediction revealed multiple MREs. Sequence analysis was performed concerning MRE interaction potential with the BCC miRNome. We identified 23 upregulated and 48 downregulated circRNAs with 354 miRNA response elements capable of sequestering miRNA target sequences of the BCC miRNome. The present study describes a variety of circRNAs that are potentially involved in the molecular pathogenesis of BCC.

Isolation and functional characterization of CE1 binding proteins.

PubMed

Lee, Sun-ji; Park, Ji Hye; Lee, Mi Hun; Yu, Ji-hyun; Kim, Soo Young

2010-12-16

Abscisic acid (ABA) is a plant hormone that controls seed germination, protective responses to various abiotic stresses and seed maturation. The ABA-dependent processes entail changes in gene expression. Numerous genes are regulated by ABA, and promoter analyses of the genes revealed that cis-elements sharing the ACGTGGC consensus sequence are ubiquitous among ABA-regulated gene promoters. The importance of the core sequence, which is generally known as ABA response element (ABRE), has been demonstrated by various experiments, and its cognate transcription factors known as ABFs/AREBs have been identified. Although necessary, ABRE alone is not sufficient, and another cis-element known as "coupling element (CE)" is required for full range ABA-regulation of gene expression. Several CEs are known. However, despite their importance, the cognate transcription factors mediating ABA response via CEs have not been reported to date. Here, we report the isolation of transcription factors that bind one of the coupling elements, CE1. To isolate CE1 binding proteins, we carried out yeast one-hybrid screens. Reporter genes containing a trimer of the CE1 element were prepared and introduced into a yeast strain. The yeast was transformed with library DNA that represents RNA isolated from ABA-treated Arabidopsis seedlings. From the screen of 3.6 million yeast transformants, we isolated 78 positive clones. Analysis of the clones revealed that a group of AP2/ERF domain proteins binds the CE1 element. We investigated their expression patterns and analyzed their overexpression lines to investigate the in vivo functions of the CE element binding factors (CEBFs). Here, we show that one of the CEBFs, AtERF13, confers ABA hypersensitivity in Arabidopsis, whereas two other CEBFs enhance sugar sensitivity. Our results indicate that a group of AP2/ERF superfamily proteins interacts with CE1. Several CEBFs are known to mediate defense or abiotic stress response, but the physiological functions of other CEBFs remain to be determined. Our in vivo functional analysis of several CEBFs suggests that they are likely to be involved in ABA and/or sugar response. Together with previous results reported by others, our current data raise an interesting possibility that the coupling element CE1 may function not only as an ABRE but also as an element mediating biotic and abiotic stress responses.

Modulation of hepatocyte growth factor gene expression by estrogen in mouse ovary.

PubMed

Liu, Y; Lin, L; Zarnegar, R

1994-09-01

Hepatocyte growth factor (HGF) is expressed in a variety of tissues and cell types under normal conditions and in response to various stimuli such as tissue injury. In the present study, we demonstrate that the transcription of the HGF gene is stimulated by estrogen in mouse ovary. A single injection of 17 beta-estradiol results in a dramatic and transient elevation of the levels of mouse HGF mRNA. Sequence analysis has found that two putative estrogen responsive elements (ERE) reside at -872 in the 5'-flanking region and at +511 in the first intron, respectively, of the mouse HGF gene. To test whether these ERE elements are responsible for estrogen induction of HGF gene expression, chimeric plasmids containing variable regions of the 5'-flanking sequence of HGF gene and the coding region for chloramphenicol acetyltransferase (CAT) gene were transiently transfected into both human endometrial carcinoma RL 95-2 cells and mouse fibroblast NIH 3T3 cells to assess hormone responsiveness. Transfection results indicate that the ERE elements of the mouse HGF gene can confer estrogen action to either homologous or heterologous promoters. Nuclear protein extracts either from RL95-2 cells transfected with the estrogen receptor expression vector or from mouse liver bound in vitro to ERE elements specifically, as shown by band shift assay. Therefore, our results demonstrate that the HGF gene is transcriptionally regulated by estrogen in mouse ovary; and such regulation is mediated via a direct interaction of the estrogen receptor complex with cis-acting ERE elements identified in the mouse HGF gene.

Structural features of diverse Pin-II proteinase inhibitor genes from Capsicum annuum.

PubMed

Mahajan, Neha S; Dewangan, Veena; Lomate, Purushottam R; Joshi, Rakesh S; Mishra, Manasi; Gupta, Vidya S; Giri, Ashok P

2015-02-01

The proteinase inhibitor (PI) genes from Capsicum annuum were characterized with respect to their UTR, introns and promoter elements. The occurrence of PIs with circularly permuted domain organization was evident. Several potato inhibitor II (Pin-II) type proteinase inhibitor (PI) genes have been analyzed from Capsicum annuum (L.) with respect to their differential expression during plant defense response. However, complete gene characterization of any of these C. annuum PIs (CanPIs) has not been carried out so far. Complete gene architectures of a previously identified CanPI-7 (Beads-on-string, Type A) and a member of newly isolated Bracelet type B, CanPI-69 are reported in this study. The 5' UTR (untranslated region), 3'UTR, and intronic sequences of both the CanPI genes were obtained. The genomic sequence of CanPI-7 exhibited, exon 1 (49 base pair, bp) and exon 2 (740 bp) interrupted by a 294-bp long type I intron. We noted the occurrence of three multi-domain PIs (CanPI-69, 70, 71) with circularly permuted domain organization. CanPI-69 was found to possess exon 1 (49 bp), exon 2 (551 bp) and a 584-bp long type I intron. The upstream sequence analysis of CanPI-7 and CanPI-69 predicted various transcription factor-binding sites including TATA and CAAT boxes, hormone-responsive elements (ABRELATERD1, DOFCOREZM, ERELEE4), and a defense-responsive element (WRKY71OS). Binding of transcription factors such as zinc finger motif MADS-box and MYB to the promoter regions was confirmed using electrophoretic mobility shift assay followed by mass spectrometric identification. The 3' UTR analysis for 25 CanPI genes revealed unique/distinct 3' UTR sequence for each gene. Structures of three domain CanPIs of type A and B were predicted and further analyzed for their attributes. This investigation of CanPI gene architecture will enable the better understanding of the genetic elements present in CanPIs.

Visualization of information with an established order

DOEpatents

Wong, Pak Chung [Richland, WA; Foote, Harlan P [Richmond, WA; Thomas, James J [Richland, WA; Wong, Kwong-Kwok [Sugar Land, TX

2007-02-13

Among the embodiments of the present invention is a system including one or more processors operable to access data representative of a biopolymer sequence of monomer units. The one or more processors are further operable to establish a pattern corresponding to at least one fractal curve and generate one or more output signals corresponding to a number of image elements each representative of one of the monomer units. Also included is a display device responsive to the one or more output signals to visualize the biopolymer sequence by displaying the image elements in accordance with the pattern.

Intercalation of XR5944 with the estrogen response element is modulated by the tri-nucleotide spacer sequence between half-sites

PubMed Central

Sidell, Neil; Mathad, Raveendra I.; Shu, Feng-jue; Zhang, Zhenjiang; Kallen, Caleb B.; Yang, Danzhou

2011-01-01

DNA-intercalating molecules can impair DNA replication, DNA repair, and gene transcription. We previously demonstrated that XR5944, a DNA bis-intercalator, specifically blocks binding of estrogen receptor-α (ERα) to the consensus estrogen response element (ERE). The consensus ERE sequence is AGGTCAnnnTGACCT, where nnn is known as the tri-nucleotide spacer. Recent work has shown that the tri-nucleotide spacer can modulate ERα-ERE binding affinity and ligand-mediated transcriptional responses. To further understand the mechanism by which XR5944 inhibits ERα-ERE binding, we tested its ability to interact with consensus EREs with variable tri-nucleotide spacer sequences and with natural but non-consensus ERE sequences using one dimensional nuclear magnetic resonance (1D 1H NMR) titration studies. We found that the tri-nucleotide spacer sequence significantly modulates the binding of XR5944 to EREs. Of the sequences that were tested, EREs with CGG and AGG spacers showed the best binding specificity with XR5944, while those spaced with TTT demonstrated the least specific binding. The binding stoichiometry of XR5944 with EREs was 2:1, which can explain why the spacer influences the drug-DNA interaction; each XR5944 spans four nucleotides (including portions of the spacer) when intercalating with DNA. To validate our NMR results, we conducted functional studies using reporter constructs containing consensus EREs with tri-nucleotide spacers CGG, CTG, and TTT. Results of reporter assays in MCF-7 cells indicated that XR5944 was significantly more potent in inhibiting the activity of CGG- than TTT-spaced EREs, consistent with our NMR results. Taken together, these findings predict that the anti-estrogenic effects of XR5944 will depend not only on ERE half-site composition but also on the tri-nucleotide spacer sequence of EREs located in the promoters of estrogen-responsive genes. PMID:21333738

Cloning the uteroglobin gene promoter from the relic volcano rabbit (Romerolagus diazi) reveals an ancient estrogen-response element.

PubMed

Acosta-MontesdeOca, Adriana; Zariñán, Teresa; Macías, Héctor; Pérez-Solís, Marco A; Ulloa-Aguirre, Alfredo; Gutiérrez-Sagal, Rubén

2012-05-01

To gain further insight on the estrogen-dependent transcriptional regulation of the uteroglobin (UG) gene, we cloned the 5'-flanking region of the UG gene from the phylogenetically ancient volcano rabbit (Romerolagus diazi; Rd). The cloned region spans 812 base pairs (bp; -812/-1) and contains a noncanonical TATA box (TACA). The translation start site is 48 bp downstream from the putative transcription initiation site (AGA), and is preceded by a consensus Kozak box. Comparison of the Rd-UG gene with that previously isolated from rabbits (Oryctolagus cuniculus) showed 93% in sequence identity as well as a number of conserved cis-acting elements, including the estrogen-response element (ERE; -265/-251), which differs from the consensus by two nucleotides. In MCF-7 cells, 17β-estradiol (E(2)) induced transcription of a luciferase reporter driven by the Rd-UG promoter in a similar manner as in an equivalent rabbit UG reporter; the Rd-UG promoter was 30% more responsive to E(2) than the rabbit promoter. Mutagenesis studies on the Rd-ERE confirmed this cis-element as a target of E(2) as two luciferase mutant reporters of the Rd-promoter, one with the rabbit and the other with the consensus ERE, were more responsive to the hormone than the wild-type reporter. Gel shift and super-shift assays showed that estrogen receptor-α indeed binds to the imperfect palindromic sequence of the Rd-ERE. Copyright © 2012 Wiley Periodicals, Inc.

Integration of Bioinformatics and Synthetic Promoters Leads to the Discovery of Novel Elicitor-Responsive cis-Regulatory Sequences in Arabidopsis1[C][W][OA

PubMed Central

Koschmann, Jeannette; Machens, Fabian; Becker, Marlies; Niemeyer, Julia; Schulze, Jutta; Bülow, Lorenz; Stahl, Dietmar J.; Hehl, Reinhard

2012-01-01

A combination of bioinformatic tools, high-throughput gene expression profiles, and the use of synthetic promoters is a powerful approach to discover and evaluate novel cis-sequences in response to specific stimuli. With Arabidopsis (Arabidopsis thaliana) microarray data annotated to the PathoPlant database, 732 different queries with a focus on fungal and oomycete pathogens were performed, leading to 510 up-regulated gene groups. Using the binding site estimation suite of tools, BEST, 407 conserved sequence motifs were identified in promoter regions of these coregulated gene sets. Motif similarities were determined with STAMP, classifying the 407 sequence motifs into 37 families. A comparative analysis of these 37 families with the AthaMap, PLACE, and AGRIS databases revealed similarities to known cis-elements but also led to the discovery of cis-sequences not yet implicated in pathogen response. Using a parsley (Petroselinum crispum) protoplast system and a modified reporter gene vector with an internal transformation control, 25 elicitor-responsive cis-sequences from 10 different motif families were identified. Many of the elicitor-responsive cis-sequences also drive reporter gene expression in an Agrobacterium tumefaciens infection assay in Nicotiana benthamiana. This work significantly increases the number of known elicitor-responsive cis-sequences and demonstrates the successful integration of a diverse set of bioinformatic resources combined with synthetic promoter analysis for data mining and functional screening in plant-pathogen interaction. PMID:22744985

A Helitron-like Transposon Superfamily from Lepidoptera Disrupts (GAAA)n Microsatellites and is Responsible for Flanking Sequence Similarity within a Microsatellite Family

USDA-ARS?s Scientific Manuscript database

Transposable elements (TEs) are mobile DNA regions that alter host genome structure and gene expression. A novel 588 bp non-autonomous high copy number TE in the Ostrinia nubilalis genome has features in common with miniature inverted-repeat transposable elements (MITEs): high A+T content (62.3%),...

Early Evolution of Conserved Regulatory Sequences Associated with Development in Vertebrates

PubMed Central

McEwen, Gayle K.; Goode, Debbie K.; Parker, Hugo J.; Woolfe, Adam; Callaway, Heather; Elgar, Greg

2009-01-01

Comparisons between diverse vertebrate genomes have uncovered thousands of highly conserved non-coding sequences, an increasing number of which have been shown to function as enhancers during early development. Despite their extreme conservation over 500 million years from humans to cartilaginous fish, these elements appear to be largely absent in invertebrates, and, to date, there has been little understanding of their mode of action or the evolutionary processes that have modelled them. We have now exploited emerging genomic sequence data for the sea lamprey, Petromyzon marinus, to explore the depth of conservation of this type of element in the earliest diverging extant vertebrate lineage, the jawless fish (agnathans). We searched for conserved non-coding elements (CNEs) at 13 human gene loci and identified lamprey elements associated with all but two of these gene regions. Although markedly shorter and less well conserved than within jawed vertebrates, identified lamprey CNEs are able to drive specific patterns of expression in zebrafish embryos, which are almost identical to those driven by the equivalent human elements. These CNEs are therefore a unique and defining characteristic of all vertebrates. Furthermore, alignment of lamprey and other vertebrate CNEs should permit the identification of persistent sequence signatures that are responsible for common patterns of expression and contribute to the elucidation of the regulatory language in CNEs. Identifying the core regulatory code for development, common to all vertebrates, provides a foundation upon which regulatory networks can be constructed and might also illuminate how large conserved regulatory sequence blocks evolve and become fixed in genomic DNA. PMID:20011110

The lytic origin of herpesvirus papio is highly homologous to Epstein-Barr virus ori-Lyt: evolutionary conservation of transcriptional activation and replication signals.

PubMed Central

Ryon, J J; Fixman, E D; Houchens, C; Zong, J; Lieberman, P M; Chang, Y N; Hayward, G S; Hayward, S D

1993-01-01

Herpesvirus papio (HVP) is a B-lymphotropic baboon virus with an estimated 40% homology to Epstein-Barr virus (EBV). We have cloned and sequenced ori-Lyt of herpesvirus papio and found a striking degree of nucleotide homology (89%) with ori-Lyt of EBV. Transcriptional elements form an integral part of EBV ori-Lyt. The promoter and enhancer domains of EBV ori-Lyt are conserved in herpesvirus papio. The EBV ori-Lyt promoter contains four binding sites for the EBV lytic cycle transactivator Zta, and the enhancer includes one Zta and two Rta response elements. All five of the Zta response elements and one of the Rta motifs are conserved in HVP ori-Lyt, and the HVP DS-L leftward promoter and the enhancer were activated in transient transfection assays by the EBV Zta and Rta transactivators. The EBV ori-Lyt enhancer contains a palindromic sequence, GGTCAGCTGACC, centered on a PvuII restriction site. This sequence, with a single base change, is also present in the HVP ori-Lyt enhancer. DNase I footprinting demonstrated that the PvuII sequence was bound by a protein present in a Raji nuclear extract. Mobility shift and competition assays using oligonucleotide probes identified this sequence as a binding site for the cellular transcription factor MLTF. Mutagenesis of the binding site indicated that MLTF contributes significantly to the constitutive activity of the ori-Lyt enhancer. The high degree of conservation of cis-acting signal sequences in HVP ori-Lyt was further emphasized by the finding that an HVP ori-Lyt-containing plasmid was replicated in Vero cells by a set of cotransfected EBV replication genes. The central domain of EBV ori-Lyt contains two related AT-rich palindromes, one of which is partially duplicated in the HVP sequence. The AT-rich palindromes are functionally important cis-acting motifs. Deletion of these palindromes severely diminished replication of an ori-Lyt target plasmid. Images PMID:8389916

Translocation and gross deletion breakpoints in human inherited disease and cancer II: Potential involvement of repetitive sequence elements in secondary structure formation between DNA ends.

PubMed

Chuzhanova, Nadia; Abeysinghe, Shaun S; Krawczak, Michael; Cooper, David N

2003-09-01

Translocations and gross deletions are responsible for a significant proportion of both cancer and inherited disease. Although such gene rearrangements are nonuniformly distributed in the human genome, the underlying mutational mechanisms remain unclear. We have studied the potential involvement of various types of repetitive sequence elements in the formation of secondary structure intermediates between the single-stranded DNA ends that recombine during rearrangements. Complexity analysis was used to assess the potential of these ends to form secondary structures, the maximum decrease in complexity consequent to a gross rearrangement being used as an indicator of the type of repeat and the specific DNA ends involved. A total of 175 pairs of deletion/translocation breakpoint junction sequences available from the Gross Rearrangement Breakpoint Database [GRaBD; www.uwcm.ac.uk/uwcm/mg/grabd/grabd.html] were analyzed. Potential secondary structure was noted between the 5' flanking sequence of the first breakpoint and the 3' flanking sequence of the second breakpoint in 49% of rearrangements and between the 5' flanking sequence of the second breakpoint and the 3' flanking sequence of the first breakpoint in 36% of rearrangements. Inverted repeats, inversions of inverted repeats, and symmetric elements were found in association with gross rearrangements at approximately the same frequency. However, inverted repeats and inversions of inverted repeats accounted for the vast majority (83%) of deletions plus small insertions, symmetric elements for one-half of all antigen receptor-mediated translocations, while direct repeats appear only to be involved in mediating simple deletions. These findings extend our understanding of illegitimate recombination by highlighting the importance of secondary structure formation between single-stranded DNA ends at breakpoint junctions. Copyright 2003 Wiley-Liss, Inc.

Sequences spanning the leader-repeat junction mediate CRISPR adaptation to phage in Streptococcus thermophilus

PubMed Central

Wei, Yunzhou; Chesne, Megan T.; Terns, Rebecca M.; Terns, Michael P.

2015-01-01

CRISPR-Cas systems are RNA-based immune systems that protect prokaryotes from invaders such as phages and plasmids. In adaptation, the initial phase of the immune response, short foreign DNA fragments are captured and integrated into host CRISPR loci to provide heritable defense against encountered foreign nucleic acids. Each CRISPR contains a ∼100–500 bp leader element that typically includes a transcription promoter, followed by an array of captured ∼35 bp sequences (spacers) sandwiched between copies of an identical ∼35 bp direct repeat sequence. New spacers are added immediately downstream of the leader. Here, we have analyzed adaptation to phage infection in Streptococcus thermophilus at the CRISPR1 locus to identify cis-acting elements essential for the process. We show that the leader and a single repeat of the CRISPR locus are sufficient for adaptation in this system. Moreover, we identified a leader sequence element capable of stimulating adaptation at a dormant repeat. We found that sequences within 10 bp of the site of integration, in both the leader and repeat of the CRISPR, are required for the process. Our results indicate that information at the CRISPR leader-repeat junction is critical for adaptation in this Type II-A system and likely other CRISPR-Cas systems. PMID:25589547

A mammary cell-specific enhancer in mouse mammary tumor virus DNA is composed of multiple regulatory elements including binding sites for CTF/NFI and a novel transcription factor, mammary cell-activating factor.

PubMed Central

Mink, S; Härtig, E; Jennewein, P; Doppler, W; Cato, A C

1992-01-01

Mouse mammary tumor virus (MMTV) is a milk-transmitted retrovirus involved in the neoplastic transformation of mouse mammary gland cells. The expression of this virus is regulated by mammary cell type-specific factors, steroid hormones, and polypeptide growth factors. Sequences for mammary cell-specific expression are located in an enhancer element in the extreme 5' end of the long terminal repeat region of this virus. This enhancer, when cloned in front of the herpes simplex thymidine kinase promoter, endows the promoter with mammary cell-specific response. Using functional and DNA-protein-binding studies with constructs mutated in the MMTV long terminal repeat enhancer, we have identified two main regulatory elements necessary for the mammary cell-specific response. These elements consist of binding sites for a transcription factor in the family of CTF/NFI proteins and the transcription factor mammary cell-activating factor (MAF) that recognizes the sequence G Pu Pu G C/G A A G G/T. Combinations of CTF/NFI- and MAF-binding sites or multiple copies of either one of these binding sites but not solitary binding sites mediate mammary cell-specific expression. The functional activities of these two regulatory elements are enhanced by another factor that binds to the core sequence ACAAAG. Interdigitated binding sites for CTF/NFI, MAF, and/or the ACAAAG factor are also found in the 5' upstream regions of genes encoding whey milk proteins from different species. These findings suggest that mammary cell-specific regulation is achieved by a concerted action of factors binding to multiple regulatory sites. Images PMID:1328867

The interaction between the iron-responsive element binding protein and its cognate RNA is highly dependent upon both RNA sequence and structure.

PubMed

Jaffrey, S R; Haile, D J; Klausner, R D; Harford, J B

1993-09-25

To assess the influence of RNA sequence/structure on the interaction RNAs with the iron-responsive element binding protein (IRE-BP), twenty eight altered RNAs were tested as competitors for an RNA corresponding to the ferritin H chain IRE. All changes in the loop of the predicted IRE hairpin and in the unpaired cytosine residue characteristically found in IRE stems significantly decreased the apparent affinity of the RNA for the IRE-BP. Similarly, alteration in the spacing and/or orientation of the loop and the unpaired cytosine of the stem by either increasing or decreasing the number of base pairs separating them significantly reduced efficacy as a competitor. It is inferred that the IRE-BP forms multiple contacts with its cognate RNA, and that these contacts, acting in concert, provide the basis for the high affinity of this interaction.

Genome-wide analysis of ABA-responsive elements ABRE and CE3 reveals divergent patterns in Arabidopsis and rice

PubMed Central

Gómez-Porras, Judith L; Riaño-Pachón, Diego Mauricio; Dreyer, Ingo; Mayer, Jorge E; Mueller-Roeber, Bernd

2007-01-01

Background In plants, complex regulatory mechanisms are at the core of physiological and developmental processes. The phytohormone abscisic acid (ABA) is involved in the regulation of various such processes, including stomatal closure, seed and bud dormancy, and physiological responses to cold, drought and salinity stress. The underlying tissue or plant-wide control circuits often include combinatorial gene regulatory mechanisms and networks that we are only beginning to unravel with the help of new molecular tools. The increasing availability of genomic sequences and gene expression data enables us to dissect ABA regulatory mechanisms at the individual gene expression level. In this paper we used an in-silico-based approach directed towards genome-wide prediction and identification of specific features of ABA-responsive elements. In particular we analysed the genome-wide occurrence and positional arrangements of two well-described ABA-responsive cis-regulatory elements (CREs), ABRE and CE3, in thale cress (Arabidopsis thaliana) and rice (Oryza sativa). Results Our results show that Arabidopsis and rice use the ABA-responsive elements ABRE and CE3 distinctively. Earlier reports for various monocots have identified CE3 as a coupling element (CE) associated with ABRE. Surprisingly, we found that while ABRE is equally abundant in both species, CE3 is practically absent in Arabidopsis. ABRE-ABRE pairs are common in both genomes, suggesting that these can form functional ABA-responsive complexes (ABRCs) in Arabidopsis and rice. Furthermore, we detected distinct combinations, orientation patterns and DNA strand preferences of ABRE and CE3 motifs in rice gene promoters. Conclusion Our computational analyses revealed distinct recruitment patterns of ABA-responsive CREs in upstream sequences of Arabidopsis and rice. The apparent absence of CE3s in Arabidopsis suggests that another CE pairs with ABRE to establish a functional ABRC capable of interacting with transcription factors. Further studies will be needed to test whether the observed differences are extrapolatable to monocots and dicots in general, and to understand how they contribute to the fine-tuning of the hormonal response. The outcome of our investigation can now be used to direct future experimentation designed to further dissect the ABA-dependent regulatory networks. PMID:17672917

Genome-wide analysis of ABA-responsive elements ABRE and CE3 reveals divergent patterns in Arabidopsis and rice.

PubMed

Gómez-Porras, Judith L; Riaño-Pachón, Diego Mauricio; Dreyer, Ingo; Mayer, Jorge E; Mueller-Roeber, Bernd

2007-08-01

In plants, complex regulatory mechanisms are at the core of physiological and developmental processes. The phytohormone abscisic acid (ABA) is involved in the regulation of various such processes, including stomatal closure, seed and bud dormancy, and physiological responses to cold, drought and salinity stress. The underlying tissue or plant-wide control circuits often include combinatorial gene regulatory mechanisms and networks that we are only beginning to unravel with the help of new molecular tools. The increasing availability of genomic sequences and gene expression data enables us to dissect ABA regulatory mechanisms at the individual gene expression level. In this paper we used an in-silico-based approach directed towards genome-wide prediction and identification of specific features of ABA-responsive elements. In particular we analysed the genome-wide occurrence and positional arrangements of two well-described ABA-responsive cis-regulatory elements (CREs), ABRE and CE3, in thale cress (Arabidopsis thaliana) and rice (Oryza sativa). Our results show that Arabidopsis and rice use the ABA-responsive elements ABRE and CE3 distinctively. Earlier reports for various monocots have identified CE3 as a coupling element (CE) associated with ABRE. Surprisingly, we found that while ABRE is equally abundant in both species, CE3 is practically absent in Arabidopsis. ABRE-ABRE pairs are common in both genomes, suggesting that these can form functional ABA-responsive complexes (ABRCs) in Arabidopsis and rice. Furthermore, we detected distinct combinations, orientation patterns and DNA strand preferences of ABRE and CE3 motifs in rice gene promoters. Our computational analyses revealed distinct recruitment patterns of ABA-responsive CREs in upstream sequences of Arabidopsis and rice. The apparent absence of CE3s in Arabidopsis suggests that another CE pairs with ABRE to establish a functional ABRC capable of interacting with transcription factors. Further studies will be needed to test whether the observed differences are extrapolatable to monocots and dicots in general, and to understand how they contribute to the fine-tuning of the hormonal response. The outcome of our investigation can now be used to direct future experimentation designed to further dissect the ABA-dependent regulatory networks.

Sequence information signal processor

DOEpatents

Peterson, John C.; Chow, Edward T.; Waterman, Michael S.; Hunkapillar, Timothy J.

1999-01-01

An electronic circuit is used to compare two sequences, such as genetic sequences, to determine which alignment of the sequences produces the greatest similarity. The circuit includes a linear array of series-connected processors, each of which stores a single element from one of the sequences and compares that element with each successive element in the other sequence. For each comparison, the processor generates a scoring parameter that indicates which segment ending at those two elements produces the greatest degree of similarity between the sequences. The processor uses the scoring parameter to generate a similar scoring parameter for a comparison between the stored element and the next successive element from the other sequence. The processor also delivers the scoring parameter to the next processor in the array for use in generating a similar scoring parameter for another pair of elements. The electronic circuit determines which processor and alignment of the sequences produce the scoring parameter with the highest value.

Transcriptional activation of transforming growth factor alpha by estradiol: requirement for both a GC-rich site and an estrogen response element half-site.

PubMed

Vyhlidal, C; Samudio, I; Kladde, M P; Safe, S

2000-06-01

17beta-Estradiol (E2) induces transforming growth factor alpha (TGFalpha) gene expression in MCF-7 cells and previous studies have identified a 53 bp (-252 to -200) sequence containing two imperfect estrogen responsive elements (EREs) that contribute to E2 responsiveness. Deletion analysis of the TGFalpha gene promoter in this study identified a second upstream region of the promoter (-623 to -549) that is also E2 responsive. This sequence contains three GC-rich sites and an imperfect ERE half-site, and the specific cis-elements and trans-acting factors were determined by promoter analysis in transient transfection experiments, gel mobility shift assays and in vitro DNA footprinting. The results are consistent with an estrogen receptor alpha (ERalpha)/Sp1 complex interacting with an Sp1(N)(30) ERE half-site ((1/2)) motif in which both ERalpha and Sp1 bind promoter DNA. The ER/Sp1-DNA complex is formed using nuclear extracts from MCF-7 cells but not with recombinant human ERalpha or Sp1 proteins, suggesting that other nuclear factor(s) are required for complex stabilization. The E2-responsive Sp1(N)(x)ERE(1/2) motif identified in the TGFalpha gene promoter has also been characterized in the cathepsin D and heat shock protein 27 gene promoters; however, in the latter two promoters the numbers of intervening nucleotides are 23 and 10 respectively.

Defective distal regulatory element at the 5' upstream of rat prolactin gene of steroid-nonresponsive GH-subclone.

PubMed

Kumar, V; Wong, D T; Pasion, S G; Biswas, D K

1987-12-08

The prolactin-nonproducing (PRL-) GH cell strains (rat pituitary tumor cells in culture). GH12C1 and F1BGH12C1, do not respond to steroid hormones estradiol or hydrocortisone (HC). However, the stimulatory effect of estradiol and the inhibitory effect of hydrocortisone on prolactin synthesis can be demonstrated in the prolactin-producing GH cell strain, GH4C1. In this investigation we have examined the 5' end flanking region of rat prolactin (rat PRL) gene of steroid-responsive, GH4C1 cells to identify the positive and negative regulatory elements and to verify the status of these elements in steroid-nonresponsive F1BGH12C1 cells. Results presented in this report demonstrate that the basel level expression of the co-transferred Neo gene (neomycin phosphoribosyl transferase) is modulated by the distal upstream regulatory elements of rat PRL gene in response to steroid hormones. The expression of adjacent Neo gene is inhibited by dexamethasone and is stimulated by estradiol in transfectants carrying distal regulatory elements (SRE) of steroid-responsive cells. These responses are not observed in transfectants with the rat PRL upstream sequences derived from steroid-nonresponsive cells. The basal level expression of the host cell alpha-2 tubulin gene is not affected by dexamethasone. We report here the identification of the distal steroid regulatory element (SRE) located between 3.8 and 7.8 kb upstream of the transcription initiation site of rat PRL gene. Both the positive and the negative effects of steroid hormones can be identified within this upstream sequence. This distal SRE appears to be nonfunctional in steroid-nonresponsive cells. Though the proximal SRE is functional, the defect in the distal SRE makes the GH substrain nonresponsive to steroid hormones. These results suggest that both the proximal and the distal SREs are essential for the mediation of action of steroid hormones in GH cells.

Genome-wide identification of galactinol synthase (GolS) genes in Solanum lycopersicum and Brachypodium distachyon.

PubMed

Filiz, Ertugrul; Ozyigit, Ibrahim Ilker; Vatansever, Recep

2015-10-01

GolS genes stand as potential candidate genes for molecular breeding and/or engineering programs in order for improving abiotic stress tolerance in plant species. In this study, a total of six galactinol synthase (GolS) genes/proteins were retrieved for Solanum lycopersicum and Brachypodium distachyon. GolS protein sequences were identified to include glyco_transf_8 (PF01501) domain structure, and to have a close molecular weight (36.40-39.59kDa) and amino acid length (318-347 aa) with a slightly acidic pI (5.35-6.40). The sub-cellular location was mainly predicted as cytoplasmic. S. lycopersicum genes located on chr 1 and 2, and included one segmental duplication while genes of B. distachyon were only on chr 1 with one tandem duplication. GolS sequences were found to have well conserved motif structures. Cis-acting analysis was performed for three abiotic stress responsive elements, including ABA responsive element (ABRE), dehydration and cold responsive elements (DRE/CRT) and low-temperature responsive element (LTRE). ABRE elements were found in all GolS genes, except for SlGolS4; DRE/CRT was not detected in any GolS genes and LTRE element found in SlGolS1 and BdGolS1 genes. AU analysis in UTR and ORF regions indicated that SlGolS and BdGolS mRNAs may have a short half-life. SlGolS3 and SlGolS4 genes may generate more stable transcripts since they included AATTAAA motif for polyadenylation signal POLASIG2. Seconder structures of SlGolS proteins were well conserved than that of BdGolS. Some structural divergences were detected in 3D structures and predicted binding sites exhibited various patterns in GolS proteins. Copyright © 2015 Elsevier Ltd. All rights reserved.

Premature terminator analysis sheds light on a hidden world of bacterial transcriptional attenuation.

PubMed

Naville, Magali; Gautheret, Daniel

2010-01-01

Bacterial transcription attenuation occurs through a variety of cis-regulatory elements that control gene expression in response to a wide range of signals. The signal-sensing structures in attenuators are so diverse and rapidly evolving that only a small fraction have been properly annotated and characterized to date. Here we apply a broad-spectrum detection tool in order to achieve a more complete view of the transcriptional attenuation complement of key bacterial species. Our protocol seeks gene families with an unusual frequency of 5' terminators found across multiple species. Many of the detected attenuators are part of annotated elements, such as riboswitches or T-boxes, which often operate through transcriptional attenuation. However, a significant fraction of candidates were not previously characterized in spite of their unmistakable footprint. We further characterized some of these new elements using sequence and secondary structure analysis. We also present elements that may control the expression of several non-homologous genes, suggesting co-transcription and response to common signals. An important class of such elements, which we called mobile attenuators, is provided by 3' terminators of insertion sequences or prophages that may be exapted as 5' regulators when inserted directly upstream of a cellular gene. We show here that attenuators involve a complex landscape of signal-detection structures spanning the entire bacterial domain. We discuss possible scenarios through which these diverse 5' regulatory structures may arise or evolve.

Functional analysis of the stress response element and its role in the multistress response of Saccharomyces cerevisiae.

PubMed

Treger, J M; Magee, T R; McEntee, K

1998-02-04

The DDR2 gene of Saccharomyces cerevisiae is a multistress response gene whose transcription is rapidly and strongly induced by a diverse array of xenobiotic agents, and environmental and physiological conditions. The multistress response of this gene requires the pentanucleotide, 5' CCCCT, (C4T;STRE (STress Response Element)) and the zinc-finger transcription factors, Msn2p and Msn4p. A 51bp oligonucleotide (oligo 31/32) containing two STREs from the DDR2 promoter region was previously shown to direct heat shock activation of a lacZ reporter gene. In this work we demonstrate that the same element conferred a complete multistress response to an E. coli galK reporter gene introduced into yeast cells. A variant oligonucleotide in which both the STRE spacing and neighboring sequences were altered responded to the same spectrum of stresses, while substitution of nucleotides within the pentanucleotide completely abolished the multistress response. These results directly demonstrate that STREs are not only necessary but are sufficient for mediating a transcriptional response to a surprisingly diverse set of environmental and physiological conditions.

Transactivation of a cellular promoter by the NS1 protein of the parvovirus minute virus of mice through a putative hormone-responsive element.

PubMed Central

Vanacker, J M; Corbau, R; Adelmant, G; Perros, M; Laudet, V; Rommelaere, J

1996-01-01

The promoter of the thyroid hormone receptor alpha gene (c-erbA-1) is activated by the nonstructural protein 1 (NS1) of parvovirus minute virus of mice (prototype strain [MVMp]) in ras-transformed FREJ4 cells that are permissive for lytic MVMp replication. This stimulation may be related to the sensitivity of host cells to MVMp, as it does not take place in parental FR3T3 cells, which are resistant to the parvovirus killing effect. The analysis of a series of deletion and point mutants of the c-erbA-1 promoter led to the identification of an upstream region that is necessary for NS1-driven transactivation. This sequence harbors a putative hormone-responsive element and is sufficient to render a minimal promoter NS1 inducible in FREJ4 but not in FR3T3 cells, and it is involved in distinct interactions with proteins from the respective cell lines. The NS1-responsive element of the c-erbA-1 promoter bears no homology with sequences that were previously reported to be necessary for NS1 DNA binding and transactivation. Altogether, our data point to a novel, cell-specific mechanism of promoter activation by NS1. PMID:8642664

The cis-regulatory element CCACGTGG is involved in ABA and water-stress responses of the maize gene rab28.

PubMed

Pla, M; Vilardell, J; Guiltinan, M J; Marcotte, W R; Niogret, M F; Quatrano, R S; Pagès, M

1993-01-01

The maize gene rab28 has been identified as ABA-inducible in embryos and vegetative tissues. It is also induced by water stress in young leaves. The proximal promoter region contains the conserved cis-acting element CCACGTGG (ABRE) reported for ABA induction in other plant genes. Transient expression assays in rice protoplasts indicate that a 134 bp fragment (-194 to -60 containing the ABRE) fused to a truncated cauliflower mosaic virus promoter (35S) is sufficient to confer ABA-responsiveness upon the GUS reporter gene. Gel retardation experiments indicate that nuclear proteins from tissues in which the rab28 gene is expressed can interact specifically with this 134 bp DNA fragment. Nuclear protein extracts from embryo and water-stressed leaves generate specific complexes of different electrophoretic mobility which are stable in the presence of detergent and high salt. However, by DMS footprinting the same guanine-specific contacts with the ABRE in both the embryo and leaf binding activities were detected. These results indicate that the rab28 promoter sequence CCACGTGG is a functional ABA-responsive element, and suggest that distinct regulatory factors with apparent similar affinity for the ABRE sequence may be involved in the hormone action during embryo development and in vegetative tissues subjected to osmotic stress.

Multimodal sequence learning.

PubMed

Kemény, Ferenc; Meier, Beat

2016-02-01

While sequence learning research models complex phenomena, previous studies have mostly focused on unimodal sequences. The goal of the current experiment is to put implicit sequence learning into a multimodal context: to test whether it can operate across different modalities. We used the Task Sequence Learning paradigm to test whether sequence learning varies across modalities, and whether participants are able to learn multimodal sequences. Our results show that implicit sequence learning is very similar regardless of the source modality. However, the presence of correlated task and response sequences was required for learning to take place. The experiment provides new evidence for implicit sequence learning of abstract conceptual representations. In general, the results suggest that correlated sequences are necessary for implicit sequence learning to occur. Moreover, they show that elements from different modalities can be automatically integrated into one unitary multimodal sequence. Copyright © 2015 Elsevier B.V. All rights reserved.

Pattern of eyelid motion predictive of decision errors during drowsiness: oculomotor indices of altered states.

PubMed

Lobb, M L; Stern, J A

1986-08-01

Sequential patterns of eye and eyelid motion were identified in seven subjects performing a modified serial probe recognition task under drowsy conditions. Using simultaneous EOG and video recordings, eyelid motion was divided into components above, within, and below the pupil and the durations in sequence were recorded. A serial probe recognition task was modified to allow for distinguishing decision errors from attention errors. Decision errors were found to be more frequent following a downward shift in the gaze angle which the eyelid closing sequence was reduced from a five element to a three element sequence. The velocity of the eyelid moving over the pupil during decision errors was slow in the closing and fast in the reopening phase, while on decision correct trials it was fast in closing and slower in reopening. Due to the high variability of eyelid motion under drowsy conditions these findings were only marginally significant. When a five element blink occurred, the velocity of the lid over pupil motion component of these endogenous eye blinks was significantly faster on decision correct than on decision error trials. Furthermore, the highly variable, long duration closings associated with the decision response produced slow eye movements in the horizontal plane (SEM) which were more frequent and significantly longer in duration on decision error versus decision correct responses.

De Novo Regulatory Motif Discovery Identifies Significant Motifs in Promoters of Five Classes of Plant Dehydrin Genes.

PubMed

Zolotarov, Yevgen; Strömvik, Martina

2015-01-01

Plants accumulate dehydrins in response to osmotic stresses. Dehydrins are divided into five different classes, which are thought to be regulated in different manners. To better understand differences in transcriptional regulation of the five dehydrin classes, de novo motif discovery was performed on 350 dehydrin promoter sequences from a total of 51 plant genomes. Overrepresented motifs were identified in the promoters of five dehydrin classes. The Kn dehydrin promoters contain motifs linked with meristem specific expression, as well as motifs linked with cold/dehydration and abscisic acid response. KS dehydrin promoters contain a motif with a GATA core. SKn and YnSKn dehydrin promoters contain motifs that match elements connected with cold/dehydration, abscisic acid and light response. YnKn dehydrin promoters contain motifs that match abscisic acid and light response elements, but not cold/dehydration response elements. Conserved promoter motifs are present in the dehydrin classes and across different plant lineages, indicating that dehydrin gene regulation is likely also conserved.

The human haptoglobin gene promoter: interleukin-6-responsive elements interact with a DNA-binding protein induced by interleukin-6.

PubMed Central

Oliviero, S; Cortese, R

1989-01-01

Transcription of the human haptoglobin (Hp) gene is induced by interleukin-6 (IL-6) in the human hepatoma cell line Hep3B. Cis-acting elements responsible for this response are localized within the first 186 bp of the 5'-flanking region. Site-specific mutants of the Hp promoter fused to the chloramphenicol acetyl transferase (CAT) gene were analysed by transient transfection into uninduced and IL-6-treated Hep3B cells. We identified three regions, A, B and C, defined by mutation, which are important for the IL-6 response. Band shift experiments using nuclear extracts from untreated or IL-6-treated cells revealed the presence of IL-6-inducible DNA binding activities when DNA fragments containing the A or the C sequences were used. Competition experiments showed that both sequences bind to the same nuclear factors. Polymers of oligonucleotides containing either the A or the C regions confer IL-6 responsiveness to a truncated SV40 promoter. The B region forms several complexes with specific DNA-binding proteins different from those which bind to the A and C region. The B region complexes are identical in nuclear extracts from IL-6-treated and untreated cells. While important for IL-6 induction in the context of the haptoglobin promoter, the B site does not confer IL-6 inducibility to the SV40 promoter. Our results indicate that the IL-6 response of the haptoglobin promoter is dependent on the presence of multiple, partly redundant, cis-acting elements. Images PMID:2787245

Cloning and Functional Analysis of the Promoter of an Ascorbate Oxidase Gene from Gossypium hirsutum

PubMed Central

Xin, Shan; Tao, Chengcheng; Li, Hongbin

2016-01-01

Apoplastic ascorbate oxidase (AO) plays significant roles in plant cell growth. However, the mechanism of underlying the transcriptional regulation of AO in Gossypium hirsutum remains unclear. Here, we obtained a 1,920-bp promoter sequence from the Gossypium hirsutum ascorbate oxidase (GhAO1) gene, and this GhAO1 promoter included a number of known cis-elements. Promoter activity analysis in overexpressing pGhAO1::GFP-GUS tobacco (Nicotiana benthamiana) showed that the GhAO1 promoter exhibited high activity, driving strong reporter gene expression in tobacco trichomes, leaves and roots. Promoter 5’-deletion analysis demonstrated that truncated GhAO1 promoters with serial 5’-end deletions had different GUS activities. A 360-bp fragment was sufficient to activate GUS expression. The P-1040 region had less GUS activity than the P-720 region, suggesting that the 320-bp region from nucleotide -720 to -1040 might include a cis-element acting as a silencer. Interestingly, an auxin-responsive cis-acting element (TGA-element) was uncovered in the promoter. To analyze the function of the TGA-element, tobacco leaves transformed with promoters with different 5’ truncations were treated with indole-3-acetic acid (IAA). Tobacco leaves transformed with the promoter regions containing the TGA-element showed significantly increased GUS activity after IAA treatment, implying that the fragment spanning nucleotides -1760 to -1600 (which includes the TGA-element) might be a key component for IAA responsiveness. Analyses of the AO promoter region and AO expression pattern in Gossypium arboreum (Ga, diploid cotton with an AA genome), Gossypium raimondii (Gr, diploid cotton with a DD genome) and Gossypium hirsutum (Gh, tetraploid cotton with an AADD genome) indicated that AO promoter activation and AO transcription were detected together only in D genome/sub-genome (Gr and Gh) cotton. Taken together, these results suggest that the 1,920-bp GhAO1 promoter is a functional sequence with a potential effect on fiber cell development, mediated by TGA-element containing sequences, via the auxin-signaling pathway. PMID:27597995

Cloning and Functional Analysis of the Promoter of an Ascorbate Oxidase Gene from Gossypium hirsutum.

PubMed

Xin, Shan; Tao, Chengcheng; Li, Hongbin

2016-01-01

Apoplastic ascorbate oxidase (AO) plays significant roles in plant cell growth. However, the mechanism of underlying the transcriptional regulation of AO in Gossypium hirsutum remains unclear. Here, we obtained a 1,920-bp promoter sequence from the Gossypium hirsutum ascorbate oxidase (GhAO1) gene, and this GhAO1 promoter included a number of known cis-elements. Promoter activity analysis in overexpressing pGhAO1::GFP-GUS tobacco (Nicotiana benthamiana) showed that the GhAO1 promoter exhibited high activity, driving strong reporter gene expression in tobacco trichomes, leaves and roots. Promoter 5'-deletion analysis demonstrated that truncated GhAO1 promoters with serial 5'-end deletions had different GUS activities. A 360-bp fragment was sufficient to activate GUS expression. The P-1040 region had less GUS activity than the P-720 region, suggesting that the 320-bp region from nucleotide -720 to -1040 might include a cis-element acting as a silencer. Interestingly, an auxin-responsive cis-acting element (TGA-element) was uncovered in the promoter. To analyze the function of the TGA-element, tobacco leaves transformed with promoters with different 5' truncations were treated with indole-3-acetic acid (IAA). Tobacco leaves transformed with the promoter regions containing the TGA-element showed significantly increased GUS activity after IAA treatment, implying that the fragment spanning nucleotides -1760 to -1600 (which includes the TGA-element) might be a key component for IAA responsiveness. Analyses of the AO promoter region and AO expression pattern in Gossypium arboreum (Ga, diploid cotton with an AA genome), Gossypium raimondii (Gr, diploid cotton with a DD genome) and Gossypium hirsutum (Gh, tetraploid cotton with an AADD genome) indicated that AO promoter activation and AO transcription were detected together only in D genome/sub-genome (Gr and Gh) cotton. Taken together, these results suggest that the 1,920-bp GhAO1 promoter is a functional sequence with a potential effect on fiber cell development, mediated by TGA-element containing sequences, via the auxin-signaling pathway.

Songbirds and humans apply different strategies in a sound sequence discrimination task.

PubMed

Seki, Yoshimasa; Suzuki, Kenta; Osawa, Ayumi M; Okanoya, Kazuo

2013-01-01

The abilities of animals and humans to extract rules from sound sequences have previously been compared using observation of spontaneous responses and conditioning techniques. However, the results were inconsistently interpreted across studies possibly due to methodological and/or species differences. Therefore, we examined the strategies for discrimination of sound sequences in Bengalese finches and humans using the same protocol. Birds were trained on a GO/NOGO task to discriminate between two categories of sound stimulus generated based on an "AAB" or "ABB" rule. The sound elements used were taken from a variety of male (M) and female (F) calls, such that the sequences could be represented as MMF and MFF. In test sessions, FFM and FMM sequences, which were never presented in the training sessions but conformed to the rule, were presented as probe stimuli. The results suggested two discriminative strategies were being applied: (1) memorizing sound patterns of either GO or NOGO stimuli and generating the appropriate responses for only those sounds; and (2) using the repeated element as a cue. There was no evidence that the birds successfully extracted the abstract rule (i.e., AAB and ABB); MMF-GO subjects did not produce a GO response for FFM and vice versa. Next we examined whether those strategies were also applicable for human participants on the same task. The results and questionnaires revealed that participants extracted the abstract rule, and most of them employed it to discriminate the sequences. This strategy was never observed in bird subjects, although some participants used strategies similar to the birds when responding to the probe stimuli. Our results showed that the human participants applied the abstract rule in the task even without instruction but Bengalese finches did not, thereby reconfirming that humans have to extract abstract rules from sound sequences that is distinct from non-human animals.

Cis-regulatory element based targeted gene finding: genome-wide identification of abscisic acid- and abiotic stress-responsive genes in Arabidopsis thaliana.

PubMed

Zhang, Weixiong; Ruan, Jianhua; Ho, Tuan-Hua David; You, Youngsook; Yu, Taotao; Quatrano, Ralph S

2005-07-15

A fundamental problem of computational genomics is identifying the genes that respond to certain endogenous cues and environmental stimuli. This problem can be referred to as targeted gene finding. Since gene regulation is mainly determined by the binding of transcription factors and cis-regulatory DNA sequences, most existing gene annotation methods, which exploit the conservation of open reading frames, are not effective in finding target genes. A viable approach to targeted gene finding is to exploit the cis-regulatory elements that are known to be responsible for the transcription of target genes. Given such cis-elements, putative target genes whose promoters contain the elements can be identified. As a case study, we apply the above approach to predict the genes in model plant Arabidopsis thaliana which are inducible by a phytohormone, abscisic acid (ABA), and abiotic stress, such as drought, cold and salinity. We first construct and analyze two ABA specific cis-elements, ABA-responsive element (ABRE) and its coupling element (CE), in A.thaliana, based on their conservation in rice and other cereal plants. We then use the ABRE-CE module to identify putative ABA-responsive genes in A.thaliana. Based on RT-PCR verification and the results from literature, this method has an accuracy rate of 67.5% for the top 40 predictions. The cis-element based targeted gene finding approach is expected to be widely applicable since a large number of cis-elements in many species are available.

Identification of Genetic Elements Associated with EPSPS Gene Amplification

PubMed Central

Gaines, Todd A.; Wright, Alice A.; Molin, William T.; Lorentz, Lothar; Riggins, Chance W.; Tranel, Patrick J.; Beffa, Roland; Westra, Philip; Powles, Stephen B.

2013-01-01

Weed populations can have high genetic plasticity and rapid responses to environmental selection pressures. For example, 100-fold amplification of the 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) gene evolved in the weed species Amaranthus palmeri to confer resistance to glyphosate, the world’s most important herbicide. However, the gene amplification mechanism is unknown. We sequenced the EPSPS gene and genomic regions flanking EPSPS loci in A. palmeri, and searched for mobile genetic elements or repetitive sequences. The EPSPS gene was 10,229 bp, containing 8 exons and 7 introns. The gene amplification likely proceeded through a DNA-mediated mechanism, as introns exist in the amplified gene copies and the entire amplified sequence is at least 30 kb in length. Our data support the presence of two EPSPS loci in susceptible (S) A. palmeri, and that only one of these was amplified in glyphosate-resistant (R) A. palmeri. The EPSPS gene amplification event likely occurred recently, as no sequence polymorphisms were found within introns of amplified EPSPS copies from R individuals. Sequences with homology to miniature inverted-repeat transposable elements (MITEs) were identified next to EPSPS gene copies only in R individuals. Additionally, a putative Activator (Ac) transposase and a repetitive sequence region were associated with amplified EPSPS genes. The mechanism controlling this DNA-mediated amplification remains unknown. Further investigation is necessary to determine if the gene amplification may have proceeded via DNA transposon-mediated replication, and/or unequal recombination between different genomic regions resulting in replication of the EPSPS gene. PMID:23762434

Conservation of CD44 exon v3 functional elements in mammals

PubMed Central

Vela, Elena; Hilari, Josep M; Delclaux, María; Fernández-Bellon, Hugo; Isamat, Marcos

2008-01-01

Background The human CD44 gene contains 10 variable exons (v1 to v10) that can be alternatively spliced to generate hundreds of different CD44 protein isoforms. Human CD44 variable exon v3 inclusion in the final mRNA depends on a multisite bipartite splicing enhancer located within the exon itself, which we have recently described, and provides the protein domain responsible for growth factor binding to CD44. Findings We have analyzed the sequence of CD44v3 in 95 mammalian species to report high conservation levels for both its splicing regulatory elements (the 3' splice site and the exonic splicing enhancer), and the functional glycosaminglycan binding site coded by v3. We also report the functional expression of CD44v3 isoforms in peripheral blood cells of different mammalian taxa with both consensus and variant v3 sequences. Conclusion CD44v3 mammalian sequences maintain all functional splicing regulatory elements as well as the GAG binding site with the same relative positions and sequence identity previously described during alternative splicing of human CD44. The sequence within the GAG attachment site, which in turn contains the Y motif of the exonic splicing enhancer, is more conserved relative to the rest of exon. Amplification of CD44v3 sequence from mammalian species but not from birds, fish or reptiles, may lead to classify CD44v3 as an exclusive mammalian gene trait. PMID:18710510

Reversible second-order conditional sequences in incidental sequence learning tasks.

PubMed

Pasquali, Antoine; Cleeremans, Axel; Gaillard, Vinciane

2018-06-01

In sequence learning tasks, participants' sensitivity to the sequential structure of a series of events often overshoots their ability to express relevant knowledge intentionally, as in generation tasks that require participants to produce either the next element of a sequence (inclusion) or a different element (exclusion). Comparing generation performance under inclusion and exclusion conditions makes it possible to assess the respective influences of conscious and unconscious learning. Recently, two main concerns have been expressed concerning such tasks. First, it is often difficult to design control sequences in such a way that they enable clear comparisons with the training material. Second, it is challenging to ask participants to perform appropriately under exclusion instructions, for the requirement to exclude familiar responses often leads them to adopt degenerate strategies (e.g., pushing on the same key all the time), which then need to be specifically singled out as invalid. To overcome both concerns, we introduce reversible second-order conditional (RSOC) sequences and show (a) that they elicit particularly strong transfer effects, (b) that dissociation of implicit and explicit influences becomes possible thanks to the removal of salient transitions in RSOCs, and (c) that exclusion instructions can be greatly simplified without losing sensitivity.

cDNA sequence and expression of a cold-responsive gene in Citrus unshiu.

PubMed

Hara, M; Wakasugi, Y; Ikoma, Y; Yano, M; Ogawa, K; Kuboi, T

1999-02-01

A cDNA clone encoding a protein (CuCOR19), the sequence of which is similar to Poncirus COR19, of the dehydrin family was isolated from the epicarp of Citrus unshiu. The molecular mass of the predicted protein was 18,980 daltons. CuCOR19 was highly hydrophilic and contained three repeating elements including Lys-rich motifs. The gene expression in leaves increased by cold stress.

A Role for the GCC-Box in Jasmonate-Mediated Activation of the PDF1.2 Gene of Arabidopsis1

PubMed Central

Brown, Rebecca L.; Kazan, Kemal; McGrath, Ken C.; Maclean, Don J.; Manners, John M.

2003-01-01

The PDF1.2 gene of Arabidopsis encoding a plant defensin is commonly used as a marker for characterization of the jasmonate-dependent defense responses. Here, using PDF1.2 promoter-deletion lines linked to the β-glucoronidase-reporter gene, we examined putative promoter elements associated with jasmonate-responsive expression of this gene. Using stably transformed plants, we first characterized the extended promoter region that positively regulates basal expression from the PDF1.2 promoter. Second, using promoter deletion constructs including one from which the GCC-box region was deleted, we observed a substantially lower response to jasmonate than lines carrying this motif. In addition, point mutations introduced into the core GCC-box sequence substantially reduced jasmonate responsiveness, whereas addition of a 20-nucleotide-long promoter element carrying the core GCC-box and flanking nucleotides provided jasmonate responsiveness to a 35S minimal promoter. Taken together, these results indicated that the GCC-box plays a key role in conferring jasmonate responsiveness to the PDF1.2 promoter. However, deletion or specific mutations introduced into the core GCC-box did not completely abolish the jasmonate responsiveness of the promoter, suggesting that the other promoter elements lying downstream from the GCC-box region may also contribute to jasmonate responsiveness. In other experiments, we identified a jasmonate- and pathogen-responsive ethylene response factor transcription factor, AtERF2, which when overexpressed in transgenic Arabidopsis plants activated transcription from the PDF1.2, Thi2.1, and PR4 (basic chitinase) genes, all of which contain a GCC-box sequence in their promoters. Our results suggest that in addition to their roles in regulating ethylene-mediated gene expression, ethylene response factors also appear to play important roles in regulating jasmonate-responsive gene expression, possibly via interaction with the GCC-box. PMID:12805630

Compositions and methods for the expression of selenoproteins in eukaryotic cells

DOEpatents

Gladyshev, Vadim [Lincoln, NE; Novoselov, Sergey [Puschino, RU

2012-09-25

Recombinant nucleic acid constructs for the efficient expression of eukaryotic selenoproteins and related methods for production of recombinant selenoproteins are provided. The nucleic acid constructs comprise novel selenocysteine insertion sequence (SECIS) elements. Certain novel SECIS elements of the invention contain non-canonical quartet sequences. Other novel SECIS elements provided by the invention are chimeric SECIS elements comprising a canonical SECIS element that contains a non-canonical quartet sequence and chimeric SECIS elements comprising a non-canonical SECIS element that contains a canonical quartet sequence. The novel SECIS elements of the invention facilitate the insertion of selenocysteine residues into recombinant polypeptides.

An ABRE promoter sequence is involved in osmotic stress-responsive expression of the DREB2A gene, which encodes a transcription factor regulating drought-inducible genes in Arabidopsis.

PubMed

Kim, June-Sik; Mizoi, Junya; Yoshida, Takuya; Fujita, Yasunari; Nakajima, Jun; Ohori, Teppei; Todaka, Daisuke; Nakashima, Kazuo; Hirayama, Takashi; Shinozaki, Kazuo; Yamaguchi-Shinozaki, Kazuko

2011-12-01

In plants, osmotic stress-responsive transcriptional regulation depends mainly on two major classes of cis-acting elements found in the promoter regions of stress-inducible genes: ABA-responsive elements (ABREs) and dehydration-responsive elements (DREs). ABRE has been shown to perceive ABA-mediated osmotic stress signals, whereas DRE is known to be involved in an ABA-independent pathway. Previously, we reported that the transcription factor DRE-BINDING PROTEIN 2A (DREB2A) regulates DRE-mediated transcription of target genes under osmotic stress conditions in Arabidopsis (Arabidopsis thaliana). However, the transcriptional regulation of DREB2A itself remains largely uncharacterized. To elucidate the transcriptional mechanism associated with the DREB2A gene under osmotic stress conditions, we generated a series of truncated and base-substituted variants of the DREB2A promoter and evaluated their transcriptional activities individually. We found that both ABRE and coupling element 3 (CE3)-like sequences located approximately -100 bp from the transcriptional initiation site are necessary for the dehydration-responsive expression of DREB2A. Coupling our transient expression analyses with yeast one-hybrid and chromatin immunoprecipitation (ChIP) assays indicated that the ABRE-BINDING PROTEIN 1 (AREB1), AREB2 and ABRE-BINDING FACTOR 3 (ABF3) bZIP transcription factors can bind to and activate the DREB2A promoter in an ABRE-dependent manner. Exogenous ABA application induced only a modest accumulation of the DREB2A transcript when compared with the osmotic stress treatment. However, the osmotic stress-induced DREB2A expression was found to be markedly impaired in several ABA-deficient and ABA-insensitive mutants. These results suggest that in addition to an ABA-independent pathway, the ABA-dependent pathway plays a positive role in the osmotic stress-responsive expression of DREB2A.

Complete Genome Sequence of Sporisorium scitamineum and Biotrophic Interaction Transcriptome with Sugarcane

PubMed Central

Benevenuto, Juliana; Peters, Leila P.; Carvalho, Giselle; Palhares, Alessandra; Quecine, Maria C.; Nunes, Filipe R. S.; Kmit, Maria C. P.; Wai, Alvan; Hausner, Georg; Aitken, Karen S.; Berkman, Paul J.; Fraser, James A.; Moolhuijzen, Paula M.; Coutinho, Luiz L.; Creste, Silvana; Vieira, Maria L. C.; Kitajima, João P.; Monteiro-Vitorello, Claudia B.

2015-01-01

Sporisorium scitamineum is a biotrophic fungus responsible for the sugarcane smut, a worldwide spread disease. This study provides the complete sequence of individual chromosomes of S. scitamineum from telomere to telomere achieved by a combination of PacBio long reads and Illumina short reads sequence data, as well as a draft sequence of a second fungal strain. Comparative analysis to previous available sequences of another strain detected few polymorphisms among the three genomes. The novel complete sequence described herein allowed us to identify and annotate extended subtelomeric regions, repetitive elements and the mitochondrial DNA sequence. The genome comprises 19,979,571 bases, 6,677 genes encoding proteins, 111 tRNAs and 3 assembled copies of rDNA, out of our estimated number of copies as 130. Chromosomal reorganizations were detected when comparing to sequences of S. reilianum, the closest smut relative, potentially influenced by repeats of transposable elements. Repetitive elements may have also directed the linkage of the two mating-type loci. The fungal transcriptome profiling from in vitro and from interaction with sugarcane at two time points (early infection and whip emergence) revealed that 13.5% of the genes were differentially expressed in planta and particular to each developmental stage. Among them are plant cell wall degrading enzymes, proteases, lipases, chitin modification and lignin degradation enzymes, sugar transporters and transcriptional factors. The fungus also modulates transcription of genes related to surviving against reactive oxygen species and other toxic metabolites produced by the plant. Previously described effectors in smut/plant interactions were detected but some new candidates are proposed. Ten genomic islands harboring some of the candidate genes unique to S. scitamineum were expressed only in planta. RNAseq data was also used to reassure gene predictions. PMID:26065709

Gene expression promoted by the SV40 DNA targeting sequence and the hypoxia-responsive element under normoxia and hypoxia.

PubMed

Sacramento, C B; Moraes, J Z; Denapolis, P M A; Han, S W

2010-08-01

The main objective of the present study was to find suitable DNA-targeting sequences (DTS) for the construction of plasmid vectors to be used to treat ischemic diseases. The well-known Simian virus 40 nuclear DTS (SV40-DTS) and hypoxia-responsive element (HRE) sequences were used to construct plasmid vectors to express the human vascular endothelial growth factor gene (hVEGF). The rate of plasmid nuclear transport and consequent gene expression under normoxia (20% O2) and hypoxia (less than 5% O2) were determined. Plasmids containing the SV40-DTS or HRE sequences were constructed and used to transfect the A293T cell line (a human embryonic kidney cell line) in vitro and mouse skeletal muscle cells in vivo. Plasmid transport to the nucleus was monitored by real-time PCR, and the expression level of the hVEGF gene was measured by ELISA. The in vitro nuclear transport efficiency of the SV40-DTS plasmid was about 50% lower under hypoxia, while the HRE plasmid was about 50% higher under hypoxia. Quantitation of reporter gene expression in vitro and in vivo, under hypoxia and normoxia, confirmed that the SV40-DTS plasmid functioned better under normoxia, while the HRE plasmid was superior under hypoxia. These results indicate that the efficiency of gene expression by plasmids containing DNA binding sequences is affected by the concentration of oxygen in the medium.

The hormone response element mimic sequence of GAS5 lncRNA is sufficient to induce apoptosis in breast cancer cells

PubMed Central

Pickard, Mark R.; Williams, Gwyn T.

2016-01-01

Growth arrest-specific 5 (GAS5) lncRNA promotes apoptosis, and its expression is down-regulated in breast cancer. GAS5 lncRNA is a decoy of glucocorticoid/related receptors; a stem-loop sequence constitutes the GAS5 hormone response element mimic (HREM), which is essential for the regulation of breast cancer cell apoptosis. This preclinical study aimed to determine if the GAS5 HREM sequence alone promotes the apoptosis of breast cancer cells. Nucleofection of hormone-sensitive and –insensitive breast cancer cell lines with a GAS5 HREM DNA oligonucleotide increased both basal and ultraviolet-C-induced apoptosis, and decreased culture viability and clonogenic growth, similar to GAS5 lncRNA. The HREM oligonucleotide demonstrated similar sequence specificity to the native HREM for its functional activity and had no effect on endogenous GAS5 lncRNA levels. Certain chemically modified HREM oligonucleotides, notably DNA and RNA phosphorothioates, retained pro-apoptotic. activity. Crucially the HREM oligonucleotide could overcome apoptosis resistance secondary to deficient endogenous GAS5 lncRNA levels. Thus, the GAS5 lncRNA HREM sequence alone is sufficient to induce apoptosis in breast cancer cells, including triple-negative breast cancer cells. These findings further suggest that emerging knowledge of structure/function relationships in the field of lncRNA biology can be exploited for the development of entirely novel, oligonucleotide mimic-based, cancer therapies. PMID:26862727

Cross-talk between abscisic acid-dependent and abscisic acid-independent pathways during abiotic stress.

PubMed

Roychoudhury, Aryadeep; Paul, Saikat; Basu, Supratim

2013-07-01

Salinity, drought and low temperature are the common forms of abiotic stress encountered by land plants. To cope with these adverse environmental factors, plants execute several physiological and metabolic responses. Both osmotic stress (elicited by water deficit or high salt) and cold stress increase the endogenous level of the phytohormone abscisic acid (ABA). ABA-dependent stomatal closure to reduce water loss is associated with small signaling molecules like nitric oxide, reactive oxygen species and cytosolic free calcium, and mediated by rapidly altering ion fluxes in guard cells. ABA also triggers the expression of osmotic stress-responsive (OR) genes, which usually contain single/multiple copies of cis-acting sequence called abscisic acid-responsive element (ABRE) in their upstream regions, mostly recognized by the basic leucine zipper-transcription factors (TFs), namely, ABA-responsive element-binding protein/ABA-binding factor. Another conserved sequence called the dehydration-responsive element (DRE)/C-repeat, responding to cold or osmotic stress, but not to ABA, occurs in some OR promoters, to which the DRE-binding protein/C-repeat-binding factor binds. In contrast, there are genes or TFs containing both DRE/CRT and ABRE, which can integrate input stimuli from salinity, drought, cold and ABA signaling pathways, thereby enabling cross-tolerance to multiple stresses. A strong candidate that mediates such cross-talk is calcium, which serves as a common second messenger for abiotic stress conditions and ABA. The present review highlights the involvement of both ABA-dependent and ABA-independent signaling components and their interaction or convergence in activating the stress genes. We restrict our discussion to salinity, drought and cold stress.

Discovery of stimulation-responsive immune enhancers with CRISPR activation

PubMed Central

Simeonov, Dimitre R.; Gowen, Benjamin G.; Boontanrart, Mandy; Roth, Theodore L.; Gagnon, John D.; Mumbach, Maxwell R.; Satpathy, Ansuman T.; Lee, Youjin; Bray, Nicolas L.; Chan, Alice Y.; Lituiev, Dmytro S.; Nguyen, Michelle L.; Gate, Rachel E.; Subramaniam, Meena; Li, Zhongmei; Woo, Jonathan M.; Mitros, Therese; Ray, Graham J.; Curie, Gemma L.; Naddaf, Nicki; Chu, Julia S.; Ma, Hong; Boyer, Eric; Van Gool, Frederic; Huang, Hailiang; Liu, Ruize; Tobin, Victoria R.; Schumann, Kathrin; Daly, Mark J.; Farh, Kyle K; Ansel, K. Mark; Ye, Chun J.; Greenleaf, William J.; Anderson, Mark S.; Bluestone, Jeffrey A.; Chang, Howard Y.; Corn, Jacob E.; Marson, Alexander

2017-01-01

The majority of genetic variants associated with common human diseases map to enhancers, non-coding elements that shape cell-type-specific transcriptional programs and responses to extracellular cues1–3. Systematic mapping of functional enhancers and their biological contexts is required to understand the mechanisms by which variation in non-coding genetic sequences contributes to disease. Functional enhancers can be mapped by genomic sequence disruption4–6, but this approach is limited to the subset of enhancers that are necessary in the particular cellular context being studied. We hypothesized that recruitment of a strong transcriptional activator to an enhancer would be sufficient to drive target gene expression, even if that enhancer was not currently active in the assayed cells. Here we describe a discovery platform that can identify stimulus-responsive enhancers for a target gene independent of stimulus exposure. We used tiled CRISPR activation (CRISPRa)7 to synthetically recruit a transcriptional activator to sites across large genomic regions (more than 100 kilobases) surrounding two key autoimmunity risk loci, CD69 and IL2RA. We identified several CRISPRa-responsive elements with chromatin features of stimulus-responsive enhancers, including an IL2RA enhancer that harbours an autoimmunity risk variant. Using engineered mouse models, we found that sequence perturbation of the disease-associated Il2ra enhancer did not entirely block Il2ra expression, but rather delayed the timing of gene activation in response to specific extracellular signals. Enhancer deletion skewed polarization of naive T cells towards a pro-inflammatory T helper (TH17) cell state and away from a regulatory T cell state. This integrated approach identifies functional enhancers and reveals how non-coding variation associated with human immune dysfunction alters context-specific gene programs. PMID:28854172

Discovery of stimulation-responsive immune enhancers with CRISPR activation.

PubMed

Simeonov, Dimitre R; Gowen, Benjamin G; Boontanrart, Mandy; Roth, Theodore L; Gagnon, John D; Mumbach, Maxwell R; Satpathy, Ansuman T; Lee, Youjin; Bray, Nicolas L; Chan, Alice Y; Lituiev, Dmytro S; Nguyen, Michelle L; Gate, Rachel E; Subramaniam, Meena; Li, Zhongmei; Woo, Jonathan M; Mitros, Therese; Ray, Graham J; Curie, Gemma L; Naddaf, Nicki; Chu, Julia S; Ma, Hong; Boyer, Eric; Van Gool, Frederic; Huang, Hailiang; Liu, Ruize; Tobin, Victoria R; Schumann, Kathrin; Daly, Mark J; Farh, Kyle K; Ansel, K Mark; Ye, Chun J; Greenleaf, William J; Anderson, Mark S; Bluestone, Jeffrey A; Chang, Howard Y; Corn, Jacob E; Marson, Alexander

2017-09-07

The majority of genetic variants associated with common human diseases map to enhancers, non-coding elements that shape cell-type-specific transcriptional programs and responses to extracellular cues. Systematic mapping of functional enhancers and their biological contexts is required to understand the mechanisms by which variation in non-coding genetic sequences contributes to disease. Functional enhancers can be mapped by genomic sequence disruption, but this approach is limited to the subset of enhancers that are necessary in the particular cellular context being studied. We hypothesized that recruitment of a strong transcriptional activator to an enhancer would be sufficient to drive target gene expression, even if that enhancer was not currently active in the assayed cells. Here we describe a discovery platform that can identify stimulus-responsive enhancers for a target gene independent of stimulus exposure. We used tiled CRISPR activation (CRISPRa) to synthetically recruit a transcriptional activator to sites across large genomic regions (more than 100 kilobases) surrounding two key autoimmunity risk loci, CD69 and IL2RA. We identified several CRISPRa-responsive elements with chromatin features of stimulus-responsive enhancers, including an IL2RA enhancer that harbours an autoimmunity risk variant. Using engineered mouse models, we found that sequence perturbation of the disease-associated Il2ra enhancer did not entirely block Il2ra expression, but rather delayed the timing of gene activation in response to specific extracellular signals. Enhancer deletion skewed polarization of naive T cells towards a pro-inflammatory T helper (T H 17) cell state and away from a regulatory T cell state. This integrated approach identifies functional enhancers and reveals how non-coding variation associated with human immune dysfunction alters context-specific gene programs.

Discovery of stimulation-responsive immune enhancers with CRISPR activation

NASA Astrophysics Data System (ADS)

Simeonov, Dimitre R.; Gowen, Benjamin G.; Boontanrart, Mandy; Roth, Theodore L.; Gagnon, John D.; Mumbach, Maxwell R.; Satpathy, Ansuman T.; Lee, Youjin; Bray, Nicolas L.; Chan, Alice Y.; Lituiev, Dmytro S.; Nguyen, Michelle L.; Gate, Rachel E.; Subramaniam, Meena; Li, Zhongmei; Woo, Jonathan M.; Mitros, Therese; Ray, Graham J.; Curie, Gemma L.; Naddaf, Nicki; Chu, Julia S.; Ma, Hong; Boyer, Eric; van Gool, Frederic; Huang, Hailiang; Liu, Ruize; Tobin, Victoria R.; Schumann, Kathrin; Daly, Mark J.; Farh, Kyle K.; Ansel, K. Mark; Ye, Chun J.; Greenleaf, William J.; Anderson, Mark S.; Bluestone, Jeffrey A.; Chang, Howard Y.; Corn, Jacob E.; Marson, Alexander

2017-09-01

The majority of genetic variants associated with common human diseases map to enhancers, non-coding elements that shape cell-type-specific transcriptional programs and responses to extracellular cues. Systematic mapping of functional enhancers and their biological contexts is required to understand the mechanisms by which variation in non-coding genetic sequences contributes to disease. Functional enhancers can be mapped by genomic sequence disruption, but this approach is limited to the subset of enhancers that are necessary in the particular cellular context being studied. We hypothesized that recruitment of a strong transcriptional activator to an enhancer would be sufficient to drive target gene expression, even if that enhancer was not currently active in the assayed cells. Here we describe a discovery platform that can identify stimulus-responsive enhancers for a target gene independent of stimulus exposure. We used tiled CRISPR activation (CRISPRa) to synthetically recruit a transcriptional activator to sites across large genomic regions (more than 100 kilobases) surrounding two key autoimmunity risk loci, CD69 and IL2RA. We identified several CRISPRa-responsive elements with chromatin features of stimulus-responsive enhancers, including an IL2RA enhancer that harbours an autoimmunity risk variant. Using engineered mouse models, we found that sequence perturbation of the disease-associated Il2ra enhancer did not entirely block Il2ra expression, but rather delayed the timing of gene activation in response to specific extracellular signals. Enhancer deletion skewed polarization of naive T cells towards a pro-inflammatory T helper (TH17) cell state and away from a regulatory T cell state. This integrated approach identifies functional enhancers and reveals how non-coding variation associated with human immune dysfunction alters context-specific gene programs.

Identification of a peroxisome proliferator-responsive element upstream of the gene encoding rat peroxisomal enoyl-CoA hydratase/3-hydroxyacyl-CoA dehydrogenase.

PubMed Central

Zhang, B; Marcus, S L; Sajjadi, F G; Alvares, K; Reddy, J K; Subramani, S; Rachubinski, R A; Capone, J P

1992-01-01

Ciprofibrate, a hypolipidemic drug that acts as a peroxisome proliferator, induces the transcription of genes encoding peroxisomal beta-oxidation enzymes. To identify cis-acting promoter elements involved in this induction, 5.8 kilobase pairs of promoter sequence from the gene encoding rat peroxisomal enoyl-CoA hydratase/3-hydroxyacyl-CoA dehydrogenase (EC 4.2.1.17/EC 1.1.1.35) was inserted upstream of a luciferase reporter gene. Transfection of this expression vector into rat hepatoma H4IIEC3 cells in the presence of ciprofibrate resulted in a 5- to 10-fold, cell type-specific increase in luciferase activity as compared to cells transfected in the absence of drug. A peroxisome proliferator-responsive element (PPRE) was localized to a 196-nucleotide region centered at position -2943 from the transcription start site. This PPRE conferred ciprofibrate responsiveness on a heterologous promoter and functioned independently of orientation or position. Gel retardation analysis with nuclear extracts demonstrated that ciprofibrate-treated or untreated H4IIEC3 cells, but not HeLa cells or monkey kidney cells, contained sequence-specific DNA binding factors that interact with the PPRE. These results have implications for understanding the mechanisms of coordinated transcriptional induction of genes encoding peroxisomal proteins by hypolipidemic agents and other peroxisome proliferators. Images PMID:1502166

Implicit chaining in cotton-top tamarins (Saguinus oedipus) with elements equated for probability of reinforcement

PubMed Central

Dillon, Laura; Collins, Meaghan; Conway, Maura; Cunningham, Kate

2013-01-01

Three experiments examined the implicit learning of sequences under conditions in which the elements comprising a sequence were equated in terms of reinforcement probability. In Experiment 1 cotton-top tamarins (Saguinus oedipus) experienced a five-element sequence displayed serially on a touch screen in which reinforcement probability was equated across elements at .16 per element. Tamarins demonstrated learning of this sequence with higher latencies during a random test as compared to baseline sequence training. In Experiments 2 and 3, manipulations of the procedure used in the first experiment were undertaken to rule out a confound owing to the fact that the elements in Experiment 1 bore different temporal relations to the intertrial interval (ITI), an inhibitory period. The results of Experiments 2 and 3 indicated that the implicit learning observed in Experiment 1 was not due to temporal proximity between some elements and the inhibitory ITI. The results taken together support two conclusion: First that tamarins engaged in sequence learning whether or not there was contingent reinforcement for learning the sequence, and second that this learning was not due to subtle differences in associative strength between the elements of the sequence. PMID:23344718

Occurrence, distribution, and possible functional roles of simple sequence repeats in phytoplasma genomes

USDA-ARS?s Scientific Manuscript database

Phytoplasmas are unculturable, cell wall-less bacteria that parasitize plants and insects. This transkingdom life cycle requires rapid responses to vastly different environments including transitions from plant phloem sieve elements to various insect tissues and alterations of diverse plant hosts. ...

32 CFR 179.5 - Responsibilities.

Code of Federal Regulations, 2010 CFR

2010-07-01

... populate all the data elements within any or all of the three hazard evaluation modules that comprise the... in the application of the rule and making sequencing recommendations. (1) To ensure EPA, other... assurance panel of Component personnel to review, initially, all MRS prioritization decisions. Once the...

Genome-Wide Identification of Regulatory Elements and Reconstruction of Gene Regulatory Networks of the Green Alga Chlamydomonas reinhardtii under Carbon Deprivation

PubMed Central

Vischi Winck, Flavia; Arvidsson, Samuel; Riaño-Pachón, Diego Mauricio; Hempel, Sabrina; Koseska, Aneta; Nikoloski, Zoran; Urbina Gomez, David Alejandro; Rupprecht, Jens; Mueller-Roeber, Bernd

2013-01-01

The unicellular green alga Chlamydomonas reinhardtii is a long-established model organism for studies on photosynthesis and carbon metabolism-related physiology. Under conditions of air-level carbon dioxide concentration [CO2], a carbon concentrating mechanism (CCM) is induced to facilitate cellular carbon uptake. CCM increases the availability of carbon dioxide at the site of cellular carbon fixation. To improve our understanding of the transcriptional control of the CCM, we employed FAIRE-seq (formaldehyde-assisted Isolation of Regulatory Elements, followed by deep sequencing) to determine nucleosome-depleted chromatin regions of algal cells subjected to carbon deprivation. Our FAIRE data recapitulated the positions of known regulatory elements in the promoter of the periplasmic carbonic anhydrase (Cah1) gene, which is upregulated during CCM induction, and revealed new candidate regulatory elements at a genome-wide scale. In addition, time series expression patterns of 130 transcription factor (TF) and transcription regulator (TR) genes were obtained for cells cultured under photoautotrophic condition and subjected to a shift from high to low [CO2]. Groups of co-expressed genes were identified and a putative directed gene-regulatory network underlying the CCM was reconstructed from the gene expression data using the recently developed IOTA (inner composition alignment) method. Among the candidate regulatory genes, two members of the MYB-related TF family, Lcr1 (Low-CO 2 response regulator 1) and Lcr2 (Low-CO 2 response regulator 2), may play an important role in down-regulating the expression of a particular set of TF and TR genes in response to low [CO2]. The results obtained provide new insights into the transcriptional control of the CCM and revealed more than 60 new candidate regulatory genes. Deep sequencing of nucleosome-depleted genomic regions indicated the presence of new, previously unknown regulatory elements in the C. reinhardtii genome. Our work can serve as a basis for future functional studies of transcriptional regulator genes and genomic regulatory elements in Chlamydomonas. PMID:24224019

Interaction between two cis-acting elements, ABRE and DRE, in ABA-dependent expression of Arabidopsis rd29A gene in response to dehydration and high-salinity stresses.

PubMed

Narusaka, Yoshihiro; Nakashima, Kazuo; Shinwari, Zabta K; Sakuma, Yoh; Furihata, Takashi; Abe, Hiroshi; Narusaka, Mari; Shinozaki, Kazuo; Yamaguchi-Shinozaki, Kazuko

2003-04-01

Many abiotic stress-inducible genes contain two cis-acting elements, namely a dehydration-responsive element (DRE; TACCGACAT) and an ABA-responsive element (ABRE; ACGTGG/TC), in their promoter regions. We precisely analyzed the 120 bp promoter region (-174 to -55) of the Arabidopsis rd29A gene whose expression is induced by dehydration, high-salinity, low-temperature, and abscisic acid (ABA) treatments and whose 120 bp promoter region contains the DRE, DRE/CRT-core motif (A/GCCGAC), and ABRE sequences. Deletion and base substitution analyses of this region showed that the DRE-core motif functions as DRE and that the DRE/DRE-core motif could be a coupling element of ABRE. Gel mobility shift assays revealed that DRE-binding proteins (DREB1s/CBFs and DREB2s) bind to both DRE and the DRE-core motif and that ABRE-binding proteins (AREBs/ABFs) bind to ABRE in the 120 bp promoter region. In addition, transactivation experiments using Arabidopsis leaf protoplasts showed that DREBs and AREBs cumulatively transactivate the expression of a GUS reporter gene fused to the 120 bp promoter region of rd29A. These results indicate that DRE and ABRE are interdependent in the ABA-responsive expression of the rd29A gene in response to ABA in Arabidopsis.

The contribution of alu elements to mutagenic DNA double-strand break repair.

PubMed

Morales, Maria E; White, Travis B; Streva, Vincent A; DeFreece, Cecily B; Hedges, Dale J; Deininger, Prescott L

2015-03-01

Alu elements make up the largest family of human mobile elements, numbering 1.1 million copies and comprising 11% of the human genome. As a consequence of evolution and genetic drift, Alu elements of various sequence divergence exist throughout the human genome. Alu/Alu recombination has been shown to cause approximately 0.5% of new human genetic diseases and contribute to extensive genomic structural variation. To begin understanding the molecular mechanisms leading to these rearrangements in mammalian cells, we constructed Alu/Alu recombination reporter cell lines containing Alu elements ranging in sequence divergence from 0%-30% that allow detection of both Alu/Alu recombination and large non-homologous end joining (NHEJ) deletions that range from 1.0 to 1.9 kb in size. Introduction of as little as 0.7% sequence divergence between Alu elements resulted in a significant reduction in recombination, which indicates even small degrees of sequence divergence reduce the efficiency of homology-directed DNA double-strand break (DSB) repair. Further reduction in recombination was observed in a sequence divergence-dependent manner for diverged Alu/Alu recombination constructs with up to 10% sequence divergence. With greater levels of sequence divergence (15%-30%), we observed a significant increase in DSB repair due to a shift from Alu/Alu recombination to variable-length NHEJ which removes sequence between the two Alu elements. This increase in NHEJ deletions depends on the presence of Alu sequence homeology (similar but not identical sequences). Analysis of recombination products revealed that Alu/Alu recombination junctions occur more frequently in the first 100 bp of the Alu element within our reporter assay, just as they do in genomic Alu/Alu recombination events. This is the first extensive study characterizing the influence of Alu element sequence divergence on DNA repair, which will inform predictions regarding the effect of Alu element sequence divergence on both the rate and nature of DNA repair events.

Variation in the genomic locations and sequence conservation of STAR elements among staphylococcal species provides insight into DNA repeat evolution

PubMed Central

2012-01-01

Background Staphylococcus aureus Repeat (STAR) elements are a type of interspersed intergenic direct repeat. In this study the conservation and variation in these elements was explored by bioinformatic analyses of published staphylococcal genome sequences and through sequencing of specific STAR element loci from a large set of S. aureus isolates. Results Using bioinformatic analyses, we found that the STAR elements were located in different genomic loci within each staphylococcal species. There was no correlation between the number of STAR elements in each genome and the evolutionary relatedness of staphylococcal species, however higher levels of repeats were observed in both S. aureus and S. lugdunensis compared to other staphylococcal species. Unexpectedly, sequencing of the internal spacer sequences of individual repeat elements from multiple isolates showed conservation at the sequence level within deep evolutionary lineages of S. aureus. Whilst individual STAR element loci were demonstrated to expand and contract, the sequences associated with each locus were stable and distinct from one another. Conclusions The high degree of lineage and locus-specific conservation of these intergenic repeat regions suggests that STAR elements are maintained due to selective or molecular forces with some of these elements having an important role in cell physiology. The high prevalence in two of the more virulent staphylococcal species is indicative of a potential role for STAR elements in pathogenesis. PMID:23020678

A novel role for CRTC2 in hepatic cholesterol synthesis through SREBP‐2

PubMed Central

Li, Yujie; Song, Yongfeng; Zhao, Meng; Guo, Yanjing; Yu, Chunxiao; Chen, Wenbin; Shao, Shanshan; Xu, Chao; Zhou, Xinli; Zhao, Lifang; Zhang, Zhenhai; Bo, Tao; Xia, Yu; Proud, Christopher G.; Wang, Xuemin; Wang, Li; Zhao, Jiajun

2017-01-01

Cholesterol synthesis is regulated by the transcription factor sterol regulatory element binding protein 2 (SREBP‐2) and its target gene 3‐hydroxy‐3‐methylglutaryl‐coenzyme A reductase (HMGCR), which is the rate‐limiting enzyme in cholesterol synthesis. Cyclic adenosine monophosphate–responsive element (CRE) binding protein–regulated transcription coactivator (CRTC) 2 is the master regulator of glucose metabolism. However, the effect of CRTC2 on cholesterol and its potential molecular mechanism remain unclear. Here, we demonstrated that CRTC2 expression and liver cholesterol content were increased in patients with high serum cholesterol levels who underwent resection of liver hemangiomas, as well as in mice fed a 4% cholesterol diet. Mice with adenovirus‐mediated CRTC2 overexpression also showed elevated lipid levels in both serum and liver tissues. Intriguingly, hepatic de novo cholesterol synthesis was markedly increased under these conditions. In contrast, CRTC2 ablation in mice fed a 4% cholesterol diet (18 weeks) showed decreased lipid levels in serum and liver tissues compared with those in littermate wild‐type mice. The expression of lipogenic genes (SREBP‐2 and HMGCR) was consistent with hepatic CRTC2 levels. In vivo imaging showed enhanced adenovirus‐mediated HMGCR‐luciferase activity in adenovirus‐mediated CRTC2 mouse livers; however, the activity was attenuated after mutation of CRE or sterol regulatory element sequences in the HMGCR reporter construct. The effect of CRTC2 on HMGCR in mouse livers was alleviated upon SREBP‐2 knockdown. CRTC2 modulated SREBP‐2 transcription by CRE binding protein, which recognizes the half‐site CRE sequence in the SREBP‐2 promoter. CRTC2 reduced the nuclear protein expression of forkhead box O1 and subsequently increased SREBP‐2 transcription by binding insulin response element 1, rather than insulin response element 2, in the SREBP‐2 promoter. Conclusion: CRTC2 regulates the transcription of SREBP‐2 by interfering with the recognition of insulin response element 1 in the SREBP‐2 promoter by forkhead box O1, thus inducing SREBP‐2/HMGCR signaling and subsequently facilitating hepatic cholesterol synthesis. (Hepatology 2017;66:481–497). PMID:28395113

Continuous in vitro evolution of bacteriophage RNA polymerase promoters

NASA Technical Reports Server (NTRS)

Breaker, R. R.; Banerji, A.; Joyce, G. F.

1994-01-01

Rapid in vitro evolution of bacteriophage T7, T3, and SP6 RNA polymerase promoters was achieved by a method that allows continuous enrichment of DNAs that contain functional promoter elements. This method exploits the ability of a special class of nucleic acid molecules to replicate continuously in the presence of both a reverse transcriptase and a DNA-dependent RNA polymerase. Replication involves the synthesis of both RNA and cDNA intermediates. The cDNA strand contains an embedded promoter sequence, which becomes converted to a functional double-stranded promoter element, leading to the production of RNA transcripts. Synthetic cDNAs, including those that contain randomized promoter sequences, can be used to initiate the amplification cycle. However, only those cDNAs that contain functional promoter sequences are able to produce RNA transcripts. Furthermore, each RNA transcript encodes the RNA polymerase promoter sequence that was responsible for initiation of its own transcription. Thus, the population of amplifying molecules quickly becomes enriched for those templates that encode functional promoters. Optimal promoter sequences for phage T7, T3, and SP6 RNA polymerase were identified after a 2-h amplification reaction, initiated in each case with a pool of synthetic cDNAs encoding greater than 10(10) promoter sequence variants.

FARME DB: a functional antibiotic resistance element database

PubMed Central

Wallace, James C.; Port, Jesse A.; Smith, Marissa N.; Faustman, Elaine M.

2017-01-01

Antibiotic resistance (AR) is a major global public health threat but few resources exist that catalog AR genes outside of a clinical context. Current AR sequence databases are assembled almost exclusively from genomic sequences derived from clinical bacterial isolates and thus do not include many microbial sequences derived from environmental samples that confer resistance in functional metagenomic studies. These environmental metagenomic sequences often show little or no similarity to AR sequences from clinical isolates using standard classification criteria. In addition, existing AR databases provide no information about flanking sequences containing regulatory or mobile genetic elements. To help address this issue, we created an annotated database of DNA and protein sequences derived exclusively from environmental metagenomic sequences showing AR in laboratory experiments. Our Functional Antibiotic Resistant Metagenomic Element (FARME) database is a compilation of publically available DNA sequences and predicted protein sequences conferring AR as well as regulatory elements, mobile genetic elements and predicted proteins flanking antibiotic resistant genes. FARME is the first database to focus on functional metagenomic AR gene elements and provides a resource to better understand AR in the 99% of bacteria which cannot be cultured and the relationship between environmental AR sequences and antibiotic resistant genes derived from cultured isolates. Database URL: http://staff.washington.edu/jwallace/farme PMID:28077567

Transposon integration enhances expression of stress response genes.

PubMed

Feng, Gang; Leem, Young-Eun; Levin, Henry L

2013-01-01

Transposable elements possess specific patterns of integration. The biological impact of these integration profiles is not well understood. Tf1, a long-terminal repeat retrotransposon in Schizosaccharomyces pombe, integrates into promoters with a preference for the promoters of stress response genes. To determine the biological significance of Tf1 integration, we took advantage of saturated maps of insertion activity and studied how integration at hot spots affected the expression of the adjacent genes. Our study revealed that Tf1 integration did not reduce gene expression. Importantly, the insertions activated the expression of 6 of 32 genes tested. We found that Tf1 increased gene expression by inserting enhancer activity. Interestingly, the enhancer activity of Tf1 could be limited by Abp1, a host surveillance factor that sequesters transposon sequences into structures containing histone deacetylases. We found the Tf1 promoter was activated by heat treatment and, remarkably, only genes that themselves were induced by heat could be activated by Tf1 integration, suggesting a synergy of Tf1 enhancer sequence with the stress response elements of target promoters. We propose that the integration preference of Tf1 for the promoters of stress response genes and the ability of Tf1 to enhance the expression of these genes co-evolved to promote the survival of cells under stress.

Regulation of nrf operon expression in pathogenic enteric bacteria: sequence divergence reveals new regulatory complexity

PubMed Central

Godfrey, Rita E.; Lee, David J.; Busby, Stephen J. W.

2017-01-01

Summary The Escherichia coli K‐12 nrf operon encodes a periplasmic nitrite reductase, the expression of which is driven from a single promoter, pnrf. Expression from pnrf is activated by the FNR transcription factor in response to anaerobiosis and further increased in response to nitrite by the response regulator proteins, NarL and NarP. FNR‐dependent transcription is suppressed by the binding of two nucleoid associated proteins, IHF and Fis. As Fis levels increase in cells grown in rich medium, the positioning of its binding site, overlapping the promoter −10 element, ensures that pnrf is sharply repressed. Here, we investigate the expression of the nrf operon promoter from various pathogenic enteric bacteria. We show that pnrf from enterohaemorrhagic E. coli is more active than its K‐12 counterpart, exhibits substantial FNR‐independent activity and is insensitive to nutrient quality, due to an improved −10 element. We also demonstrate that the Salmonella enterica serovar Typhimurium core promoter is more active than previously thought, due to differences around the transcription start site, and that its expression is repressed by downstream sequences. We identify the CsrA RNA binding protein as being responsible for this, and show that CsrA differentially regulates the E. coli K‐12 and Salmonella nrf operons. PMID:28211111

Transposon integration enhances expression of stress response genes

PubMed Central

Feng, Gang; Leem, Young-Eun; Levin, Henry L.

2013-01-01

Transposable elements possess specific patterns of integration. The biological impact of these integration profiles is not well understood. Tf1, a long-terminal repeat retrotransposon in Schizosaccharomyces pombe, integrates into promoters with a preference for the promoters of stress response genes. To determine the biological significance of Tf1 integration, we took advantage of saturated maps of insertion activity and studied how integration at hot spots affected the expression of the adjacent genes. Our study revealed that Tf1 integration did not reduce gene expression. Importantly, the insertions activated the expression of 6 of 32 genes tested. We found that Tf1 increased gene expression by inserting enhancer activity. Interestingly, the enhancer activity of Tf1 could be limited by Abp1, a host surveillance factor that sequesters transposon sequences into structures containing histone deacetylases. We found the Tf1 promoter was activated by heat treatment and, remarkably, only genes that themselves were induced by heat could be activated by Tf1 integration, suggesting a synergy of Tf1 enhancer sequence with the stress response elements of target promoters. We propose that the integration preference of Tf1 for the promoters of stress response genes and the ability of Tf1 to enhance the expression of these genes co-evolved to promote the survival of cells under stress. PMID:23193295

Casein kinase II induces c-fos expression via the serum response element pathway and p67SRF phosphorylation in living fibroblasts.

PubMed Central

Gauthier-Rouvière, C; Basset, M; Blanchard, J M; Cavadore, J C; Fernandez, A; Lamb, N J

1991-01-01

Elevation of intracellular casein kinase II (CKII) levels through microinjection of purified CKII results in the rapid and transient induction of c-fos in quiescent rat embryo fibroblasts, and activation of quiescent cells by serum is accompanied by the nuclear relocation of endogenous CKII. The induction of c-fos by CKII is inhibited by coinjection of oligonucleotides corresponding to the sequence of the serum response element (SRE) present in the c-fos promoter, indicating that competitive displacement of positive factors from the endogenous c-fos SRE prevents c-fos induction by CKII. Furthermore, the expression of c-fos induced by either CKII injection or serum activation is also inhibited by microinjection of antibodies against the 67 kDa serum response factor (p67SRF) indicating the absolute requirement of p67SRF in this process. Finally, we show the specific phosphorylation of p67SRF in vivo following microinjection of CKII into quiescent cells. Together, these data strongly support that CKII induces c-fos expression through binding/activation of the phosphorylated p67SRF at the SRE sequence. Images PMID:1915270

Inverted repeat Alu elements in the human lincRNA-p21 adopt a conserved secondary structure that regulates RNA function

PubMed Central

Chillón, Isabel; Pyle, Anna M.

2016-01-01

LincRNA-p21 is a long intergenic non-coding RNA (lincRNA) involved in the p53-mediated stress response. We sequenced the human lincRNA-p21 (hLincRNA-p21) and found that it has a single exon that includes inverted repeat Alu elements (IRAlus). Sense and antisense Alu elements fold independently of one another into a secondary structure that is conserved in lincRNA-p21 among primates. Moreover, the structures formed by IRAlus are involved in the localization of hLincRNA-p21 in the nucleus, where hLincRNA-p21 colocalizes with paraspeckles. Our results underscore the importance of IRAlus structures for the function of hLincRNA-p21 during the stress response. PMID:27378782

Structural and functional analysis of mouse Msx1 gene promoter: sequence conservation with human MSX1 promoter points at potential regulatory elements.

PubMed

Gonzalez, S M; Ferland, L H; Robert, B; Abdelhay, E

1998-06-01

Vertebrate Msx genes are related to one of the most divergent homeobox genes of Drosophila, the muscle segment homeobox (msh) gene, and are expressed in a well-defined pattern at sites of tissue interactions. This pattern of expression is conserved in vertebrates as diverse as quail, zebrafish, and mouse in a range of sites including neural crest, appendages, and craniofacial structures. In the present work, we performed structural and functional analyses in order to identify potential cis-acting elements that may be regulating Msx1 gene expression. To this end, a 4.9-kb segment of the 5'-flanking region was sequenced and analyzed for transcription-factor binding sites. Four regions showing a high concentration of these sites were identified. Transfection assays with fragments of regulatory sequences driving the expression of the bacterial lacZ reporter gene showed that a region of 4 kb upstream of the transcription start site contains positive and negative elements responsible for controlling gene expression. Interestingly, a fragment of 130 bp seems to contain the minimal elements necessary for gene expression, as its removal completely abolishes gene expression in cultured cells. These results are reinforced by comparison of this region with the human Msx1 gene promoter, which shows extensive conservation, including many consensus binding sites, suggesting a regulatory role for them.

Differential Effects of Paced and Unpaced Responding on delayed Serial Order Recall in Schizophrenia

PubMed Central

Hill, S. Kristian; Griffin, Ginny B.; Houk, James C.; Sweeney, John A.

2011-01-01

Working memory for temporal order is a component of working memory that is especially dependent on striatal systems, but has not been extensively studied in schizophrenia. This study was designed to characterize serial order reproduction by adapting a spatial serial order task developed for nonhuman primate studies, while controlling for working memory load and whether responses were initiated freely (unpaced) or in an externally paced format. Clinically stable schizophrenia patients (n=27) and psychiatrically healthy individuals (n=25) were comparable on demographic variables and performance on standardized tests of immediate serial order recall (Digit Span, Spatial Span). No group differences were observed for serial order recall when read sequence reproduction was unpaced. However, schizophrenia patients exhibited significant impairments when responding was paced, regardless of sequence length or retention delay. Intact performance by schizophrenia patients during the unpaced condition indicates that prefrontal storage and striatal output systems are sufficiently intact to learn novel response sequences and hold them in working memory to perform serial order tasks. However, retention for newly learned response sequences was disrupted in schizophrenia patients by paced responding, when read-out of each element in the response sequence was externally controlled. The disruption of memory for serial order in paced read-out condition indicates a deficit in frontostriatal interaction characterized by an inability to update working memory stores and deconstruct ‘chunked’ information. PMID:21705197

Processing of Natural Echolocation Sequences in the Inferior Colliculus of Seba’s Fruit Eating Bat, Carollia perspicillata

PubMed Central

Kordes, Sebastian; Kössl, Manfred

2017-01-01

Abstract For the purpose of orientation, echolocating bats emit highly repetitive and spatially directed sonar calls. Echoes arising from call reflections are used to create an acoustic image of the environment. The inferior colliculus (IC) represents an important auditory stage for initial processing of echolocation signals. The present study addresses the following questions: (1) how does the temporal context of an echolocation sequence mimicking an approach flight of an animal affect neuronal processing of distance information to echo delays? (2) how does the IC process complex echolocation sequences containing echo information from multiple objects (multiobject sequence)? Here, we conducted neurophysiological recordings from the IC of ketamine-anaesthetized bats of the species Carollia perspicillata and compared the results from the IC with the ones from the auditory cortex (AC). Neuronal responses to an echolocation sequence was suppressed when compared to the responses to temporally isolated and randomized segments of the sequence. The neuronal suppression was weaker in the IC than in the AC. In contrast to the cortex, the time course of the acoustic events is reflected by IC activity. In the IC, suppression sharpens the neuronal tuning to specific call-echo elements and increases the signal-to-noise ratio in the units’ responses. When presenting multiple-object sequences, despite collicular suppression, the neurons responded to each object-specific echo. The latter allows parallel processing of multiple echolocation streams at the IC level. Altogether, our data suggests that temporally-precise neuronal responses in the IC could allow fast and parallel processing of multiple acoustic streams. PMID:29242823

Processing of Natural Echolocation Sequences in the Inferior Colliculus of Seba's Fruit Eating Bat, Carollia perspicillata.

PubMed

Beetz, M Jerome; Kordes, Sebastian; García-Rosales, Francisco; Kössl, Manfred; Hechavarría, Julio C

2017-01-01

For the purpose of orientation, echolocating bats emit highly repetitive and spatially directed sonar calls. Echoes arising from call reflections are used to create an acoustic image of the environment. The inferior colliculus (IC) represents an important auditory stage for initial processing of echolocation signals. The present study addresses the following questions: (1) how does the temporal context of an echolocation sequence mimicking an approach flight of an animal affect neuronal processing of distance information to echo delays? (2) how does the IC process complex echolocation sequences containing echo information from multiple objects (multiobject sequence)? Here, we conducted neurophysiological recordings from the IC of ketamine-anaesthetized bats of the species Carollia perspicillata and compared the results from the IC with the ones from the auditory cortex (AC). Neuronal responses to an echolocation sequence was suppressed when compared to the responses to temporally isolated and randomized segments of the sequence. The neuronal suppression was weaker in the IC than in the AC. In contrast to the cortex, the time course of the acoustic events is reflected by IC activity. In the IC, suppression sharpens the neuronal tuning to specific call-echo elements and increases the signal-to-noise ratio in the units' responses. When presenting multiple-object sequences, despite collicular suppression, the neurons responded to each object-specific echo. The latter allows parallel processing of multiple echolocation streams at the IC level. Altogether, our data suggests that temporally-precise neuronal responses in the IC could allow fast and parallel processing of multiple acoustic streams.

Requirement of the cyclic adenosine monophosphate response element-binding protein for hepatitis B virus replication.

PubMed

Kim, Bo Kyung; Lim, Seoung Ok; Park, Yun Gyu

2008-08-01

The cyclic adenosine monophosphate-response element (CRE)-transcription factor complex participates in the regulation of viral gene expression and pathologic processes caused by various viruses. The hepatitis B virus (HBV) enhancer I directs liver-specific transcription of viral genes and contains a CRE sequence (HBV-CRE); however, whether the HBV-CRE and CRE-binding protein (CREB) are required for the HBV life cycle remains to be determined. This study was designed to investigate the role of CREB in HBV replication and gene expression. Sequence-comparison analysis of 984 HBVs reported worldwide showed that the HBV-CRE sequence is highly conserved, indicating the possibility that it plays an important role in the HBV life cycle. The binding of CREB to the HBV-CRE site was markedly inhibited by oligonucleotides containing HBV-CRE and consensus CRE sequences in vitro and in vivo. The HBV promoter activity was demonstrated to be dependent upon the transactivation activity of CREB. Treatment with CRE decoy oligonucleotides reduced HBV promoter activity, and this was reversed by CREB overexpression. The levels of viral transcripts, DNA, and antigens were remarkably decreased in response to the overexpression of CREB mutants or treatment with the CRE decoy oligonucleotides, whereas enhancing CREB activity increased the levels of viral transcripts. In addition, introduction of a three-base mutation into the HBV-CRE led to a marked reduction in HBV messenger RNA synthesis. Taken together, our results demonstrate that both replication and gene expression of HBV require a functional CREB and HBV-CRE. We have also demonstrated that CRE decoy oligonucleotides and the overexpression of CREB mutants can effectively block the HBV life cycle, suggesting that interventions against CREB activity could provide a new avenue to treat HBV infection.

Genome-wide identification and characterization of Notch transcription complex-binding sequence paired sites in leukemia cells

PubMed Central

Severson, Eric; Arnett, Kelly L.; Wang, Hongfang; Zang, Chongzhi; Taing, Len; Liu, Hudan; Pear, Warren S.; Liu, X. Shirley; Blacklow, Stephen C.; Aster, Jon C.

2018-01-01

Notch transcription complexes (NTCs) drive target gene expression by binding to two distinct types of genomic response elements, NTC monomer-binding sites and sequence-paired sites (SPSs) that bind NTC dimers. SPSs are conserved and are linked to the Notch-responsiveness of a few genes, but their overall contribution to Notch-dependent gene regulation is unknown. To address this issue, we determined the DNA sequence requirements for NTC dimerization using a fluorescence resonance energy transfer (FRET) assay, and applied insights from these in vitro studies to Notch-“addicted” leukemia cells. We find that SPSs contribute to the regulation of approximately a third of direct Notch target genes. While originally described in promoters, SPSs are present mainly in long-range enhancers, including an enhancer containing a newly described SPS that regulates HES5. Our work provides a general method for identifying sequence-paired sites in genome-wide data sets and highlights the widespread role of NTC dimerization in Notch-transformed leukemia cells. PMID:28465412

Characterization of a cis-acting element involved in cell-specific expression of the zebrafish brain aromatase gene.

PubMed

Le Page, Yann; Menuet, Arnaud; Kah, Olivier; Pakdel, Farzad

2008-10-01

The cytochrome P450 Aromatase is the key enzyme catalyzing the conversion of androgens into estrogens. In zebrafish, the brain aromatase is encoded by cyp19b. Expression of cyp19b is restricted to radial glial cells bordering forebrain ventricles and is strongly stimulated by estrogens during development. At the promoter level, we have previously shown that an estrogen responsive element (ERE) is required for induction by estrogens. Here, we investigated the role of ERE flanking regions in the control of cell-specific expression. First, we show that a 20 bp length motif, named G x RE (glial x responsive element), acts in synergy with the ERE to mediate the estrogenic induction specifically in glial cells. Second, we demonstrate that, in vitro, this sequence binds factors exclusively present in glial or neuro-glial cells and is able to confer a glial specificity to an artificial estrogen-dependent gene. Taken together, these results contribute to the understanding of the molecular mechanisms allowing cyp19b regulation by estrogens and allowed to identify a promoter sequence involved in the strong estrogen inducibility of cyp19b which is specific for glial cells. The exceptional aromatase activity measured in the brain of teleost fish could rely on such mechanisms.

Multiple independent regulatory pathways control UBI4 expression after heat shock in Saccharomyces cerevisiae.

PubMed

Simon, J R; Treger, J M; McEntee, K

1999-02-01

Transcription of the polyubiquitin gene UBI4 of Saccharomyces cerevisiae is strongly induced by a variety of environmental stresses, such as heat shock, nutrient depletion and exposure to DNA-damaging agents. This transcriptional response of UBI4 is likely to be the primary mechanism for increasing the pool of ubiquitin for degradation of stress-damaged proteins. Deletion and promoter fusion studies of the 5' regulatory sequences indicated that two different elements, heat shock elements (HSEs) and stress response element (STREs), contributed independently to heat shock regulation of the UBI4 gene. In the absence of HSEs, STRE sequences localized to the intervals -264 to -238 and -215 to -183 were needed for stress control of transcription after heat shock. Site-directed mutagenesis of the STRE (AG4) at -252 to -248 abolished heat shock induction of UBI4 transcription. Northern analysis demonstrated that cells containing either a temperature-sensitive HSF or non-functional Msn2p/Msn4p transcription factors induced high levels of UBI4 transcripts after heat shock. In cells deficient in both heat stress pathways, heat-induced UBI4 transcript levels were considerably lower but not abolished, suggesting a role for another factor(s) in stress control of its expression.

Functional analysis of the Arabidopsis PLDZ2 promoter reveals an evolutionarily conserved low-Pi-responsive transcriptional enhancer element

PubMed Central

Oropeza-Aburto, Araceli; Cruz-Ramírez, Alfredo; Acevedo-Hernández, Gustavo J.; Pérez-Torres, Claudia-Anahí; Caballero-Pérez, Juan; Herrera-Estrella, Luis

2012-01-01

Plants have evolved a plethora of responses to cope with phosphate (Pi) deficiency, including the transcriptional activation of a large set of genes. Among Pi-responsive genes, the expression of the Arabidopsis phospholipase DZ2 (PLDZ2) is activated to participate in the degradation of phospholipids in roots in order to release Pi to support other cellular activities. A deletion analysis was performed to identify the regions determining the strength, tissue-specific expression, and Pi responsiveness of this regulatory region. This study also reports the identification and characterization of a transcriptional enhancer element that is present in the PLDZ2 promoter and able to confer Pi responsiveness to a minimal, inactive 35S promoter. This enhancer also shares the cytokinin and sucrose responsive properties observed for the intact PLDZ2 promoter. The EZ2 element contains two P1BS motifs, each of which is the DNA binding site of transcription factor PHR1. Mutation analysis showed that the P1BS motifs present in EZ2 are necessary but not sufficient for the enhancer function, revealing the importance of adjacent sequences. The structural organization of EZ2 is conserved in the orthologous genes of at least eight families of rosids, suggesting that architectural features such as the distance between the two P1BS motifs are also important for the regulatory properties of this enhancer element. PMID:22210906

An experimental and analytical investigation on the response of GR/EP composite I-frames

NASA Technical Reports Server (NTRS)

Moas, E., Jr.; Boitnott, R. L.; Griffin, O. H., Jr.

1991-01-01

Six-foot diameter, semicircular graphite/epoxy specimens representative of generic aircraft frames were loaded quasi-statically to determine their load response and failure mechanisms for large deflections that occur in an airplane crash. These frame-skin specimens consisted of a cylindrical skin section cocured with a semicircular I-frame. Various frame laminate stacking sequences and geometries were evaluated by statically loading the specimen until multiple failures occurred. Two analytical methods were compared for modeling the frame-skin specimens: a two-dimensional branched-shell finite element analysis and a one-dimensional, closed-form, curved beam solution derived using an energy method. Excellent correlation was obtained between experimental results and the finite element predictions of the linear response of the frames prior to the initial failure. The beam solution was used for rapid parameter and design studies, and was found to be stiff in comparison with the finite element analysis. The specimens were found to be useful for evaluating composite frame designs.

Identification and functional characterization of BTas transactivator as a DNA-binding protein.

PubMed

Tan, Juan; Hao, Peng; Jia, Rui; Yang, Wei; Liu, Ruichang; Wang, Jinzhong; Xi, Zhen; Geng, Yunqi; Qiao, Wentao

2010-09-30

The genome of bovine foamy virus (BFV) encodes a transcriptional transactivator, namely BTas, that remarkably enhances gene expression by binding to the viral long-terminal repeat promoter (LTR) and internal promoter (IP). In this report, we characterized the functional domains of BFV BTas. BTas contains two major functional domains: the N-terminal DNA-binding domain (residues 1-133) and the C-terminal activation domain (residues 198-249). The complete BTas responsive regions were mapped to the positions -380/-140 of LTR and 9205/9276 of IP. Four BTas responsive elements were identified at the positions -368/-346, -327/-307, -306/-285 and -186/-165 of the BFV LTR, and one element was identified at the position 9243/9264 of the BFV IP. Unlike other foamy viruses, the five BTas responsive elements in BFV shared obvious sequence homology. These data suggest that among the complex retroviruses, BFV appears to have a unique transactivation mechanism. Crown Copyright 2010. Published by Elsevier Inc. All rights reserved.

High throughput sequencing reveals novel and abiotic stress-regulated microRNAs in the inflorescences of rice.

PubMed

Barrera-Figueroa, Blanca E; Gao, Lei; Wu, Zhigang; Zhou, Xuefeng; Zhu, Jianhua; Jin, Hailing; Liu, Renyi; Zhu, Jian-Kang

2012-08-03

MicroRNAs (miRNAs) are small RNA molecules that play important regulatory roles in plant development and stress responses. Identification of stress-regulated miRNAs is crucial for understanding how plants respond to environmental stimuli. Abiotic stresses are one of the major factors that limit crop growth and yield. Whereas abiotic stress-regulated miRNAs have been identified in vegetative tissues in several plants, they are not well studied in reproductive tissues such as inflorescences. We used Illumina deep sequencing technology to sequence four small RNA libraries that were constructed from the inflorescences of rice plants that were grown under control condition and drought, cold, or salt stress. We identified 227 miRNAs that belong to 127 families, including 70 miRNAs that are not present in the miRBase. We validated 62 miRNAs (including 10 novel miRNAs) using published small RNA expression data in DCL1, DCL3, and RDR2 RNAi lines and confirmed 210 targets from 86 miRNAs using published degradome data. By comparing the expression levels of miRNAs, we identified 18, 15, and 10 miRNAs that were regulated by drought, cold and salt stress conditions, respectively. In addition, we identified 80 candidate miRNAs that originated from transposable elements or repeats, especially miniature inverted-repeat elements (MITEs). We discovered novel miRNAs and stress-regulated miRNAs that may play critical roles in stress response in rice inflorescences. Transposable elements or repeats, especially MITEs, are rich sources for miRNA origination.

ERalpha and AP-1 interact in vivo with a specific sequence of the F promoter of the human ERalpha gene in osteoblasts.

PubMed

Lambertini, Elisabetta; Tavanti, Elisa; Torreggiani, Elena; Penolazzi, Letizia; Gambari, Roberto; Piva, Roberta

2008-07-01

Estrogen-responsive genes often have an estrogen response element (ERE) positioned next to activator protein-1 (AP-1) binding sites. Considering that the interaction between ERE and AP-1 elements has been described for the modulation of bone-specific genes, we investigated the 17-beta-estradiol responsiveness and the role of these cis-elements present in the F promoter of the human estrogen receptor alpha (ERalpha) gene. The F promoter, containing the sequence analyzed here, is one of the multiple promoters of the human ERalpha gene and is the only active promoter in bone tissue. Through electrophoretic mobility shift (EMSA), chromatin immunoprecipitation (ChIP), and re-ChIP assays, we investigated the binding of ERalpha and four members of the AP-1 family (c-Jun, c-fos, Fra-2, and ATF2) to a region located approximately 800 bp upstream of the transcriptional start site of exon F of the human ERalpha gene in SaOS-2 osteoblast-like cells. Reporter gene assay experiments in combination with DNA binding assays demonstrated that F promoter activity is under the control of upstream cis-acting elements which are recognized by specific combinations of ERalpha, c-Jun, c-fos, and ATF2 homo- and heterodimers. Moreover, ChIP and re-ChIP experiments showed that these nuclear factors bind the F promoter in vivo with a simultaneous occupancy stimulated by 17-beta-estradiol. Taken together, our findings support a model in which ERalpha/AP-1 complexes modulate F promoter activity under conditions of 17-beta-estradiol stimulation. (c) 2008 Wiley-Liss, Inc.

Identification of a sequence element on the 3' side of AAUAAA which is necessary for simian virus 40 late mRNA 3'-end processing.

PubMed Central

Sadofsky, M; Connelly, S; Manley, J L; Alwine, J C

1985-01-01

Our previous studies of the 3'-end processing of simian virus 40 late mRNAs indicated the existence of an essential element (or elements) downstream of the AAUAAA signal. We report here the use of transient expression analysis to study a functional element which we located within the sequence AGGUUUUUU, beginning 59 nucleotides downstream of the recognized signal AAUAAA. Deletion of this element resulted in (i) at least a 75% drop in 3'-end processing at the normal site and (ii) appearance of readthrough transcripts with alternate 3' ends. Some flexibility in the downstream position of this element relative to the AAUAAA was noted by deletion analysis. Using computer sequence comparison, we located homologous regions within downstream sequences of other genes, suggesting a generalized sequence element. In addition, specific complementarity is noted between the downstream element and U4 RNA. The possibility that this complementarity could participate in 3'-end site selection is discussed. Images PMID:3016512

The SIDER2 elements, interspersed repeated sequences that populate the Leishmania genomes, constitute subfamilies showing chromosomal proximity relationship.

PubMed

Requena, Jose M; Folgueira, Cristina; López, Manuel C; Thomas, M Carmen

2008-06-02

Protozoan parasites of the genus Leishmania are causative agents of a diverse spectrum of human diseases collectively known as leishmaniasis. These eukaryotic pathogens that diverged early from the main eukaryotic lineage possess a number of unusual genomic, molecular and biochemical features. The completion of the genome projects for three Leishmania species has generated invaluable information enabling a direct analysis of genome structure and organization. By using DNA macroarrays, made with Leishmania infantum genomic clones and hybridized with total DNA from the parasite, we identified a clone containing a repeated sequence. An analysis of the recently completed genome sequence of L. infantum, using this repeated sequence as bait, led to the identification of a new class of repeated elements that are interspersed along the different L. infantum chromosomes. These elements turned out to be homologues of SIDER2 sequences, which were recently identified in the Leishmania major genome; thus, we adopted this nomenclature for the Leishmania elements described herein. Since SIDER2 elements are very heterogeneous in sequence, their precise identification is rather laborious. We have characterized 54 LiSIDER2 elements in chromosome 32 and 27 ones in chromosome 20. The mean size for these elements is 550 bp and their sequence is G+C rich (mean value of 66.5%). On the basis of sequence similarity, these elements can be grouped in subfamilies that show a remarkable relationship of proximity, i.e. SIDER2s of a given subfamily locate close in a chromosomal region without intercalating elements. For comparative purposes, we have identified the SIDER2 elements existing in L. major and Leishmania braziliensis chromosomes 32. While SIDER2 elements are highly conserved both in number and location between L. infantum and L. major, no such conservation exists when comparing with SIDER2s in L. braziliensis chromosome 32. SIDER2 elements constitute a relevant piece in the Leishmania genome organization. Sequence characteristics, genomic distribution and evolutionarily conservation of SIDER2s are suggestive of relevant functions for these elements in Leishmania. Apart from a proved involvement in post-transcriptional mechanisms of gene regulation, SIDER2 elements could be involved in DNA amplification processes and, perhaps, in chromosome segregation as centromeric sequences.

Convergence of the transcriptional responses to heat shock and singlet oxygen stresses.

PubMed

Dufour, Yann S; Imam, Saheed; Koo, Byoung-Mo; Green, Heather A; Donohue, Timothy J

2012-09-01

Cells often mount transcriptional responses and activate specific sets of genes in response to stress-inducing signals such as heat or reactive oxygen species. Transcription factors in the RpoH family of bacterial alternative σ factors usually control gene expression during a heat shock response. Interestingly, several α-proteobacteria possess two or more paralogs of RpoH, suggesting some functional distinction. We investigated the target promoters of Rhodobacter sphaeroides RpoH(I) and RpoH(II) using genome-scale data derived from gene expression profiling and the direct interactions of each protein with DNA in vivo. We found that the RpoH(I) and RpoH(II) regulons have both distinct and overlapping gene sets. We predicted DNA sequence elements that dictate promoter recognition specificity by each RpoH paralog. We found that several bases in the highly conserved TTG in the -35 element are important for activity with both RpoH homologs; that the T-9 position, which is over-represented in the RpoH(I) promoter sequence logo, is critical for RpoH(I)-dependent transcription; and that several bases in the predicted -10 element were important for activity with either RpoH(II) or both RpoH homologs. Genes that are transcribed by both RpoH(I) and RpoH(II) are predicted to encode for functions involved in general cell maintenance. The functions specific to the RpoH(I) regulon are associated with a classic heat shock response, while those specific to RpoH(II) are associated with the response to the reactive oxygen species, singlet oxygen. We propose that a gene duplication event followed by changes in promoter recognition by RpoH(I) and RpoH(II) allowed convergence of the transcriptional responses to heat and singlet oxygen stress in R. sphaeroides and possibly other bacteria.

Identification of an enhancer element of class Pi glutathione S-transferase gene required for expression by a co-planar polychlorinated biphenyl.

PubMed Central

Matsumoto, M; Imagawa, M; Aoki, Y

1999-01-01

3,3',4,4',5-Pentachlorobiphenyl (PenCB), one of the most toxic co-planar polychlorinated biphenyl congeners, specifically induces class Pi glutathione S-transferase (GSTP1) as well as cytochrome P-450 1A1 in primary cultured rat liver parenchymal cells [Aoki, Matsumoto and Suzuki (1993) FEBS Lett. 333, 114-118]. However, the 5'-flanking sequence of the GSTP1 gene does not contain a xenobiotic responsive element, to which arylhydrocarbon receptor binds. Using a chloramphenicol acetyltransferase assay we demonstrate here that the enhancer termed GSTP1 enhancer I (GPEI) is necessary for the stimulation by PenCB of GSTP1 gene expression in primary cultured rat liver parenchymal cells. GPEI is already known to contain a dyad of PMA responsive element-like elements oriented palindromically. It is suggested that a novel signal transduction pathway activated by PenCB contributes to the stimulation of GSTP1 expression. PMID:10051428

Palindromic repetitive DNA elements with coding potential in Methanocaldococcus jannaschii.

PubMed

Suyama, Mikita; Lathe, Warren C; Bork, Peer

2005-10-10

We have identified 141 novel palindromic repetitive elements in the genome of euryarchaeon Methanocaldococcus jannaschii. The total length of these elements is 14.3kb, which corresponds to 0.9% of the total genomic sequence and 6.3% of all extragenic regions. The elements can be divided into three groups (MJRE1-3) based on the sequence similarity. The low sequence identity within each of the groups suggests rather old origin of these elements in M. jannaschii. Three MJRE2 elements were located within the protein coding regions without disrupting the coding potential of the host genes, indicating that insertion of repeats might be a widespread mechanism to enhance sequence diversity in coding regions.

NAC transcription factor genes: genome-wide identification, phylogenetic, motif and cis-regulatory element analysis in pigeonpea (Cajanus cajan (L.) Millsp.).

PubMed

Satheesh, Viswanathan; Jagannadham, P Tej Kumar; Chidambaranathan, Parameswaran; Jain, P K; Srinivasan, R

2014-12-01

The NAC (NAM, ATAF and CUC) proteins are plant-specific transcription factors implicated in development and stress responses. In the present study 88 pigeonpea NAC genes were identified from the recently published draft genome of pigeonpea by using homology based and de novo prediction programmes. These sequences were further subjected to phylogenetic, motif and promoter analyses. In motif analysis, highly conserved motifs were identified in the NAC domain and also in the C-terminal region of the NAC proteins. A phylogenetic reconstruction using pigeonpea, Arabidopsis and soybean NAC genes revealed 33 putative stress-responsive pigeonpea NAC genes. Several stress-responsive cis-elements were identified through in silico analysis of the promoters of these putative stress-responsive genes. This analysis is the first report of NAC gene family in pigeonpea and will be useful for the identification and selection of candidate genes associated with stress tolerance.

Short Interspersed Nuclear Element (SINE) Sequences in the Genome of the Human Pathogenic Fungus Aspergillus fumigatus Af293

PubMed Central

Kanhayuwa, Lakkhana; Coutts, Robert H. A.

2016-01-01

Novel families of short interspersed nuclear element (SINE) sequences in the human pathogenic fungus Aspergillus fumigatus, clinical isolate Af293, were identified and categorised into tRNA-related and 5S rRNA-related SINEs. Eight predicted tRNA-related SINE families originating from different tRNAs, and nominated as AfuSINE2 sequences, contained target site duplications of short direct repeat sequences (4–14 bp) flanking the elements, an extended tRNA-unrelated region and typical features of RNA polymerase III promoter sequences. The elements ranged in size from 140–493 bp and were present in low copy number in the genome and five out of eight were actively transcribed. One putative tRNAArg-derived sequence, AfuSINE2-1a possessed a unique feature of repeated trinucleotide ACT residues at its 3’-terminus. This element was similar in sequence to the I-4_AO element found in A. oryzae and an I-1_AF long nuclear interspersed element-like sequence identified in A. fumigatus Af293. Families of 5S rRNA-related SINE sequences, nominated as AfuSINE3, were also identified and their 5'-5S rRNA-related regions show 50–65% and 60–75% similarity to respectively A. fumigatus 5S rRNAs and SINE3-1_AO found in A. oryzae. A. fumigatus Af293 contains five copies of AfuSINE3 sequences ranging in size from 259–343 bp and two out of five AfuSINE3 sequences were actively transcribed. Investigations on AfuSINE distribution in the fungal genome revealed that the elements are enriched in pericentromeric and subtelomeric regions and inserted within gene-rich regions. We also demonstrated that some, but not all, AfuSINE sequences are targeted by host RNA silencing mechanisms. Finally, we demonstrated that infection of the fungus with mycoviruses had no apparent effects on SINE activity. PMID:27736869

Short Interspersed Nuclear Element (SINE) Sequences in the Genome of the Human Pathogenic Fungus Aspergillus fumigatus Af293.

PubMed

Kanhayuwa, Lakkhana; Coutts, Robert H A

2016-01-01

Novel families of short interspersed nuclear element (SINE) sequences in the human pathogenic fungus Aspergillus fumigatus, clinical isolate Af293, were identified and categorised into tRNA-related and 5S rRNA-related SINEs. Eight predicted tRNA-related SINE families originating from different tRNAs, and nominated as AfuSINE2 sequences, contained target site duplications of short direct repeat sequences (4-14 bp) flanking the elements, an extended tRNA-unrelated region and typical features of RNA polymerase III promoter sequences. The elements ranged in size from 140-493 bp and were present in low copy number in the genome and five out of eight were actively transcribed. One putative tRNAArg-derived sequence, AfuSINE2-1a possessed a unique feature of repeated trinucleotide ACT residues at its 3'-terminus. This element was similar in sequence to the I-4_AO element found in A. oryzae and an I-1_AF long nuclear interspersed element-like sequence identified in A. fumigatus Af293. Families of 5S rRNA-related SINE sequences, nominated as AfuSINE3, were also identified and their 5'-5S rRNA-related regions show 50-65% and 60-75% similarity to respectively A. fumigatus 5S rRNAs and SINE3-1_AO found in A. oryzae. A. fumigatus Af293 contains five copies of AfuSINE3 sequences ranging in size from 259-343 bp and two out of five AfuSINE3 sequences were actively transcribed. Investigations on AfuSINE distribution in the fungal genome revealed that the elements are enriched in pericentromeric and subtelomeric regions and inserted within gene-rich regions. We also demonstrated that some, but not all, AfuSINE sequences are targeted by host RNA silencing mechanisms. Finally, we demonstrated that infection of the fungus with mycoviruses had no apparent effects on SINE activity.

The 'dark matter' in the plant genomes: non-coding and unannotated DNA sequences associated with open chromatin.

PubMed

Jiang, Jiming

2015-04-01

Sequencing of complete plant genomes has become increasingly more routine since the advent of the next-generation sequencing technology. Identification and annotation of large amounts of noncoding but functional DNA sequences, including cis-regulatory DNA elements (CREs), have become a new frontier in plant genome research. Genomic regions containing active CREs bound to regulatory proteins are hypersensitive to DNase I digestion and are called DNase I hypersensitive sites (DHSs). Several recent DHS studies in plants illustrate that DHS datasets produced by DNase I digestion followed by next-generation sequencing (DNase-seq) are highly valuable for the identification and characterization of CREs associated with plant development and responses to environmental cues. DHS-based genomic profiling has opened a door to identify and annotate the 'dark matter' in sequenced plant genomes. Copyright © 2015 Elsevier Ltd. All rights reserved.

Human T-cell leukemia virus type 1 Tax requires direct access to DNA for recruitment of CREB binding protein to the viral promoter.

PubMed

Lenzmeier, B A; Giebler, H A; Nyborg, J K

1998-02-01

Efficient human T-cell leukemia virus type 1 (HTLV-1) replication and viral gene expression are dependent upon the virally encoded oncoprotein Tax. To activate HTLV-1 transcription, Tax interacts with the cellular DNA binding protein cyclic AMP-responsive element binding protein (CREB) and recruits the coactivator CREB binding protein (CBP), forming a nucleoprotein complex on the three viral cyclic AMP-responsive elements (CREs) in the HTLV-1 promoter. Short stretches of dG-dC-rich (GC-rich) DNA, immediately flanking each of the viral CREs, are essential for Tax recruitment of CBP in vitro and Tax transactivation in vivo. Although the importance of the viral CRE-flanking sequences is well established, several studies have failed to identify an interaction between Tax and the DNA. The mechanistic role of the viral CRE-flanking sequences has therefore remained enigmatic. In this study, we used high resolution methidiumpropyl-EDTA iron(II) footprinting to show that Tax extended the CREB footprint into the GC-rich DNA flanking sequences of the viral CRE. The Tax-CREB footprint was enhanced but not extended by the KIX domain of CBP, suggesting that the coactivator increased the stability of the nucleoprotein complex. Conversely, the footprint pattern of CREB on a cellular CRE lacking GC-rich flanking sequences did not change in the presence of Tax or Tax plus KIX. The minor-groove DNA binding drug chromomycin A3 bound to the GC-rich flanking sequences and inhibited the association of Tax and the Tax-CBP complex without affecting CREB binding. Tax specifically cross-linked to the viral CRE in the 5'-flanking sequence, and this cross-link was blocked by chromomycin A3. Together, these data support a model where Tax interacts directly with both CREB and the minor-groove viral CRE-flanking sequences to form a high-affinity binding site for the recruitment of CBP to the HTLV-1 promoter.

Endoplasmic reticulum stress-responsive transcription factor ATF6α directs recruitment of the Mediator of RNA polymerase II transcription and multiple histone acetyltransferase complexes.

PubMed

Sela, Dotan; Chen, Lu; Martin-Brown, Skylar; Washburn, Michael P; Florens, Laurence; Conaway, Joan Weliky; Conaway, Ronald C

2012-06-29

The basic leucine zipper transcription factor ATF6α functions as a master regulator of endoplasmic reticulum (ER) stress response genes. Previous studies have established that, in response to ER stress, ATF6α translocates to the nucleus and activates transcription of ER stress response genes upon binding sequence specifically to ER stress response enhancer elements in their promoters. In this study, we investigate the biochemical mechanism by which ATF6α activates transcription. By exploiting a combination of biochemical and multidimensional protein identification technology-based mass spectrometry approaches, we have obtained evidence that ATF6α functions at least in part by recruiting to the ER stress response enhancer elements of ER stress response genes a collection of RNA polymerase II coregulatory complexes, including the Mediator and multiple histone acetyltransferase complexes, among which are the Spt-Ada-Gcn5 acetyltransferase (SAGA) and Ada-Two-A-containing (ATAC) complexes. Our findings shed new light on the mechanism of action of ATF6α, and they outline a straightforward strategy for applying multidimensional protein identification technology mass spectrometry to determine which RNA polymerase II transcription factors and coregulators are recruited to promoters and other regulatory elements to control transcription.

Dehydration-induced WRKY genes from tobacco and soybean respond to jasmonic acid treatments in BY-2 cell culture.

PubMed

Rabara, Roel C; Tripathi, Prateek; Lin, Jun; Rushton, Paul J

2013-02-15

Drought is one of the important environmental factors affecting crop production worldwide and therefore understanding the molecular response of plant to stress is an important step in crop improvement. WRKY transcription factors are one of the 10 largest transcription factor families across the green lineage. In this study, highly upregulated dehydration-induced WRKY and enzyme-coding genes from tobacco and soybean were selected from microarray data for promoter analyses. Putative stress-related cis-regulatory elements such as TGACG motif, ABRE-like elements; W and G-like sequences were identified by an in silico analyses of promoter region of the selected genes. GFP quantification of transgenic BY-2 cell culture showed these promoters direct higher expression in-response to 100 μM JA treatment compared to 100 μM ABA, 10% PEG and 85 mM NaCl treatments. Thus promoter activity upon JA treatment and enrichment of MeJA-responsive elements in the promoter of the selected genes provides insights for these genes to be jasmonic acid responsive with potential of mediating cross-talk during dehydration responses. Copyright © 2013 Elsevier Inc. All rights reserved.

Dissection of cis-regulatory element architecture of the rice oleosin gene promoters to assess abscisic acid responsiveness in suspension-cultured rice cells.

PubMed

Kim, Sol; Lee, Soo-Bin; Han, Chae-Seong; Lim, Mi-Na; Lee, Sung-Eun; Yoon, In Sun; Hwang, Yong-Sic

2017-08-01

Oleosins are the most abundant proteins in the monolipid layer surrounding neutral storage lipids that form oil bodies in plants. Several lines of evidence indicate that they are physiologically important for the maintenance of oil body structure and for mobilization of the lipids stored inside. Rice has six oleosin genes in its genome, the expression of all of which was found to be responsive to abscisic acid (ABA) in our examination of mature embryo and aleurone tissues. The 5'-flanking region of OsOle5 was initially characterized for its responsiveness to ABA through a transient expression assay system using the protoplasts from suspension-cultured rice cells. A series of successive deletions and site-directed mutations identified five regions critical for the hormonal induction of its promoter activity. A search for cis-acting elements in these regions deposited in a public database revealed that they contain various promoter elements previously reported to be involved in the ABA response of various genes. A gain-of-function experiment indicated that multiple copies of all five regions were sufficient to provide the minimal promoter with a distinct ABA responsiveness. Comparative sequence analysis of the short, but still ABA-responsive, promoters of OsOle genes revealed no common modular architecture shared by them, indicating that various distinct promoter elements and independent trans-acting factors are involved in the ABA responsiveness of rice oleosin multigenes. Copyright © 2017 Elsevier GmbH. All rights reserved.

Unusually long-lived pause required for regulation of a Rho-dependent transcription terminator.

PubMed

Hollands, Kerry; Sevostiyanova, Anastasia; Groisman, Eduardo A

2014-05-13

Up to half of all transcription termination events in bacteria rely on the RNA-dependent helicase Rho. However, the nucleic acid sequences that promote Rho-dependent termination remain poorly characterized. Defining the molecular determinants that confer Rho-dependent termination is especially important for understanding how such terminators can be regulated in response to specific signals. Here, we identify an extraordinarily long-lived pause at the site where Rho terminates transcription in the 5'-leader region of the Mg(2+) transporter gene mgtA in Salmonella enterica. We dissect the sequence elements required for prolonged pausing in the mgtA leader and establish that the remarkable longevity of this pause is required for a riboswitch to stimulate Rho-dependent termination in the mgtA leader region in response to Mg(2+) availability. Unlike Rho-dependent terminators described previously, where termination occurs at multiple pause sites, there is a single site of transcription termination directed by Rho in the mgtA leader. Our data suggest that Rho-dependent termination events that are subject to regulation may require elements distinct from those operating at constitutive Rho-dependent terminators.

Curcumin activates human glutathione S-transferase P1 expression through antioxidant response element.

PubMed

Nishinaka, Toru; Ichijo, Yusuke; Ito, Maki; Kimura, Masayoshi; Katsuyama, Masato; Iwata, Kazumi; Miura, Takeshi; Terada, Tomoyuki; Yabe-Nishimura, Chihiro

2007-05-15

Curcumin is a plant-derived diferuloylmethane compound extracted from Curcuma longa, possessing antioxidative and anticarcinogenic properties. Antioxidants and oxidative stress are known to induce the expression of certain classes of detoxification enzymes. Since the upregulation of detoxifying enzymes affects the drug metabolism and cell defense system, it is important to understand the gene regulation by such agents. In this study, we demonstrated that curcumin could induce the expression of human glutathione S-transferase P1 (GSTP1). In HepG2 cells treated with 20muM curcumin, the level of GSTP1 mRNA was significantly increased. In luciferase reporter assays, curcumin augmented the promoter activity of a reporter construct carrying 336bp upstream of the 5'-flanking region of the GSTP1 gene. Mutation analyses revealed that the region including antioxidant response element (ARE), which overlaps AP1 in sequence, was essential to the response to curcumin. While the introduction of a wild-type Nrf2 expression construct augmented the promoter activity of the GSTP1 gene, co-expression of a dominant-negative Nrf2 abolished the responsiveness to curcumin. In addition, curcumin activated the expression of the luciferase gene from a reporter construct carrying multiple ARE consensus sequences but not one with multiple AP1 sites. In a gel mobility shift assay with an oligonucleotide with GSTP1 ARE, an increase in the amount of the binding complex was observed in the nuclear extracts of curcumin-treated HepG2 cells. These results suggested that ARE is the primary sequence for the curcumin-induced transactivation of the GSTP1 gene. The induction of GSTP1 may be one of the mechanisms underlying the multiple actions of curcumin.

Regulation of the Osem gene by abscisic acid and the transcriptional activator VP1: analysis of cis-acting promoter elements required for regulation by abscisic acid and VP1.

PubMed

Hattori, T; Terada, T; Hamasuna, S

1995-06-01

Osem, a rice gene homologous to the wheat Em gene, which encodes one of the late-embryogenesis abundant proteins was isolated. The gene was characterized with respect to control of transcription by abscisic acid (ABA) and the transcriptional activator VP1, which is involved in the ABA-regulated gene expression during late embryo-genesis. A fusion gene (Osem-GUS) consisting of the Osem promoter and the bacterial beta-glucuronidase (GUS) gene was constructed and tested in a transient expression system, using protoplasts derived from a suspension-cultured line of rice cells, for activation by ABA and by co-transfection with an expression vector (35S-Osvp1) for the rice VP1 (OSVP1) cDNA. The expression of Osem-GUS was strongly (40- to 150-fold) activated by externally applied ABA and by over-expression of (OS)VP1. The Osem promoter has three ACGTG-containing sequences, motif A, motif B and motif A', which resemble the abscisic acid-responsive element (ABRE) that was previously identified in the wheat Em and the rice Rab16. There is also a CATGCATG sequence, which is known as the Sph box and is shown to be essential for the regulation by VP1 of the maize anthocyanin regulatory gene C1. Focusing on these sequence elements, various mutant derivatives of the Osem promoter in the transient expression system were assayed. The analysis revealed that motif A functions not only as an ABRE but also as a sequence element required for the regulation by (OS)VP1.

Coordinate action of distinct sequence elements localizes checkpoint kinase Hsl1 to the septin collar at the bud neck in Saccharomyces cerevisiae

PubMed Central

Finnigan, Gregory C.; Sterling, Sarah M.; Duvalyan, Angela; Liao, Elizabeth N.; Sargsyan, Aspram; Garcia, Galo; Nogales, Eva; Thorner, Jeremy

2016-01-01

Passage through the eukaryotic cell cycle requires processes that are tightly regulated both spatially and temporally. Surveillance mechanisms (checkpoints) exert quality control and impose order on the timing and organization of downstream events by impeding cell cycle progression until the necessary components are available and undamaged and have acted in the proper sequence. In budding yeast, a checkpoint exists that does not allow timely execution of the G2/M transition unless and until a collar of septin filaments has properly assembled at the bud neck, which is the site where subsequent cytokinesis will occur. An essential component of this checkpoint is the large (1518-residue) protein kinase Hsl1, which localizes to the bud neck only if the septin collar has been correctly formed. Hsl1 reportedly interacts with particular septins; however, the precise molecular determinants in Hsl1 responsible for its recruitment to this cellular location during G2 have not been elucidated. We performed a comprehensive mutational dissection and accompanying image analysis to identify the sequence elements within Hsl1 responsible for its localization to the septins at the bud neck. Unexpectedly, we found that this targeting is multipartite. A segment of the central region of Hsl1 (residues 611–950), composed of two tandem, semiredundant but distinct septin-associating elements, is necessary and sufficient for binding to septin filaments both in vitro and in vivo. However, in addition to 611–950, efficient localization of Hsl1 to the septin collar in the cell obligatorily requires generalized targeting to the cytosolic face of the plasma membrane, a function normally provided by the C-terminal phosphatidylserine-binding KA1 domain (residues 1379–1518) in Hsl1 but that can be replaced by other, heterologous phosphatidylserine-binding sequences. PMID:27193302

Multidrug-resistant enterococci lack CRISPR-cas.

PubMed

Palmer, Kelli L; Gilmore, Michael S

2010-10-12

Clustered, regularly interspaced short palindromic repeats (CRISPR) provide bacteria and archaea with sequence-specific, acquired defense against plasmids and phage. Because mobile elements constitute up to 25% of the genome of multidrug-resistant (MDR) enterococci, it was of interest to examine the codistribution of CRISPR and acquired antibiotic resistance in enterococcal lineages. A database was built from 16 Enterococcus faecalis draft genome sequences to identify commonalities and polymorphisms in the location and content of CRISPR loci. With this data set, we were able to detect identities between CRISPR spacers and sequences from mobile elements, including pheromone-responsive plasmids and phage, suggesting that CRISPR regulates the flux of these elements through the E. faecalis species. Based on conserved locations of CRISPR and CRISPR-cas loci and the discovery of a new CRISPR locus with associated functional genes, CRISPR3-cas, we screened additional E. faecalis strains for CRISPR content, including isolates predating the use of antibiotics. We found a highly significant inverse correlation between the presence of a CRISPR-cas locus and acquired antibiotic resistance in E. faecalis, and examination of an additional eight E. faecium genomes yielded similar results for that species. A mechanism for CRISPR-cas loss in E. faecalis was identified. The inverse relationship between CRISPR-cas and antibiotic resistance suggests that antibiotic use inadvertently selects for enterococcal strains with compromised genome defense.

DNA sequence analysis of ARS elements from chromosome III of Saccharomyces cerevisiae: identification of a new conserved sequence.

PubMed Central

Palzkill, T G; Oliver, S G; Newlon, C S

1986-01-01

Four fragments of Saccharomyces cerevisiae chromosome III DNA which carry ARS elements have been sequenced. Each fragment contains multiple copies of sequences that have at least 10 out of 11 bases of homology to a previously reported 11 bp core consensus sequence. A survey of these new ARS sequences and previously reported sequences revealed the presence of an additional 11 bp conserved element located on the 3' side of the T-rich strand of the core consensus. Subcloning analysis as well as deletion and transposon insertion mutagenesis of ARS fragments support a role for 3' conserved sequence in promoting ARS activity. PMID:3529036

The human tartrate-resistant acid phosphatase (TRAP): involvement of the hemin responsive elements (HRE) in transcriptional regulation.

PubMed

Fleckenstein, E C; Dirks, W G; Drexler, H G

2000-02-01

The biochemical properties and protein structure of the tartrate-resistant acid phosphatase (TRAP), an iron-containing lysosomal glycoprotein in cells of the mononuclear phagocyte system, are well known. In contrast, little is known about the physiology and genic structure of this unique enzyme. In some diseases, like hairy cell leukemia, Gaucher's disease and osteoclastoma, cytochemically detected TRAP expression is used as a disease-associated marker. In order to begin to elucidate the regulation of this gene we generated different deletion constructs of the TRAP 5'-flanking region, placed them upstream of the luciferase reporter gene and assayed them for their ability to direct luciferase expression in human 293 cells. Treatment of these cells with the iron-modulating reagents transferrin and hemin causes opposite effects on the TRAP promoter activity. Two regulatory GAGGC tandem repeat sequences (the hemin responsive elements, HRE) within the 5'-flanking region of the human TRAP gene were identified. Studies with specific HRE-deletion constructs of the human TRAP 5'-flanking region upstream of the luciferase reporter gene document the functionality of these HRE-sequences which are apparently responsible for mediating transcriptional inhibition upon exposure to hemin. In addition to the previously published functional characterization of the murine TRAP HRE motifs, these results provide the first description of a new iron/hemin-responsive transcriptional regulation in the human TRAP gene.

Scanning sequences after Gibbs sampling to find multiple occurrences of functional elements

PubMed Central

Tharakaraman, Kannan; Mariño-Ramírez, Leonardo; Sheetlin, Sergey L; Landsman, David; Spouge, John L

2006-01-01

Background Many DNA regulatory elements occur as multiple instances within a target promoter. Gibbs sampling programs for finding DNA regulatory elements de novo can be prohibitively slow in locating all instances of such an element in a sequence set. Results We describe an improvement to the A-GLAM computer program, which predicts regulatory elements within DNA sequences with Gibbs sampling. The improvement adds an optional "scanning step" after Gibbs sampling. Gibbs sampling produces a position specific scoring matrix (PSSM). The new scanning step resembles an iterative PSI-BLAST search based on the PSSM. First, it assigns an "individual score" to each subsequence of appropriate length within the input sequences using the initial PSSM. Second, it computes an E-value from each individual score, to assess the agreement between the corresponding subsequence and the PSSM. Third, it permits subsequences with E-values falling below a threshold to contribute to the underlying PSSM, which is then updated using the Bayesian calculus. A-GLAM iterates its scanning step to convergence, at which point no new subsequences contribute to the PSSM. After convergence, A-GLAM reports predicted regulatory elements within each sequence in order of increasing E-values, so users have a statistical evaluation of the predicted elements in a convenient presentation. Thus, although the Gibbs sampling step in A-GLAM finds at most one regulatory element per input sequence, the scanning step can now rapidly locate further instances of the element in each sequence. Conclusion Datasets from experiments determining the binding sites of transcription factors were used to evaluate the improvement to A-GLAM. Typically, the datasets included several sequences containing multiple instances of a regulatory motif. The improvements to A-GLAM permitted it to predict the multiple instances. PMID:16961919

Uncovering microRNA-mediated response to SO2 stress in Arabidopsis thaliana by deep sequencing.

PubMed

Li, Lihong; Xue, Meizhao; Yi, Huilan

2016-10-05

Sulfur dioxide (SO2) is a major air pollutant and has significant impacts on plants. MicroRNAs (miRNAs) are a class of gene expression regulators that play important roles in response to environmental stresses. In this study, deep sequencing was used for genome-wide identification of miRNAs and their expression profiles in response to SO2 stress in Arabidopsis thaliana shoots. A total of 27 conserved miRNAs and 5 novel miRNAs were found to be differentially expressed under SO2 stress. qRT-PCR analysis showed mostly negative correlation between miRNA accumulation and target gene mRNA abundance, suggesting regulatory roles of these miRNAs during SO2 exposure. The target genes of SO2-responsive miRNAs encode transcription factors and proteins that regulate auxin signaling and stress response, and the miRNAs-mediated suppression of these genes could improve plant resistance to SO2 stress. Promoter sequence analysis of genes encoding SO2-responsive miRNAs showed that stress-responsive and phytohormone-related cis-regulatory elements occurred frequently, providing additional evidence of the involvement of miRNAs in adaption to SO2 stress. This study represents a comprehensive expression profiling of SO2-responsive miRNAs in Arabidopsis and broads our perspective on the ubiquitous regulatory roles of miRNAs under stress conditions. Copyright © 2016 Elsevier B.V. All rights reserved.

Developmental rearrangement of cyanobacterial nif genes: nucleotide sequence, open reading frames, and cytochrome P-450 homology of the Anabaena sp. strain PCC 7120 nifD element.

PubMed Central

Lammers, P J; McLaughlin, S; Papin, S; Trujillo-Provencio, C; Ryncarz, A J

1990-01-01

An 11-kbp DNA element of unknown function interrupts the nifD gene in vegetative cells of Anabaena sp. strain PCC 7120. In developing heterocysts the nifD element excises from the chromosome via site-specific recombination between short repeat sequences that flank the element. The nucleotide sequence of the nifH-proximal half of the element was determined to elucidate the genetic potential of the element. Four open reading frames with the same relative orientation as the nifD element-encoded xisA gene were identified in the sequenced region. Each of the open reading frames was preceded by a reasonable ribosome-binding site and had biased codon utilization preferences consistent with low levels of expression. Open reading frame 3 was highly homologous with three cytochrome P-450 omega-hydroxylase proteins and showed regional homology to functionally significant domains common to the cytochrome P-450 superfamily. The sequence encoding open reading frame 2 was the most highly conserved portion of the sequenced region based on heterologous hybridization experiments with three genera of heterocystous cyanobacteria. Images PMID:2123860

Identification of multiple binding sites for the THAP domain of the Galileo transposase in the long terminal inverted-repeats☆

PubMed Central

Marzo, Mar; Liu, Danxu; Ruiz, Alfredo; Chalmers, Ronald

2013-01-01

Galileo is a DNA transposon responsible for the generation of several chromosomal inversions in Drosophila. In contrast to other members of the P-element superfamily, it has unusually long terminal inverted-repeats (TIRs) that resemble those of Foldback elements. To investigate the function of the long TIRs we derived consensus and ancestral sequences for the Galileo transposase in three species of Drosophilids. Following gene synthesis, we expressed and purified their constituent THAP domains and tested their binding activity towards the respective Galileo TIRs. DNase I footprinting located the most proximal DNA binding site about 70 bp from the transposon end. Using this sequence we identified further binding sites in the tandem repeats that are found within the long TIRs. This suggests that the synaptic complex between Galileo ends may be a complicated structure containing higher-order multimers of the transposase. We also attempted to reconstitute Galileo transposition in Drosophila embryos but no events were detected. Thus, although the limited numbers of Galileo copies in each genome were sufficient to provide functional consensus sequences for the THAP domains, they do not specify a fully active transposase. Since the THAP recognition sequence is short, and will occur many times in a large genome, it seems likely that the multiple binding sites within the long, internally repetitive, TIRs of Galileo and other Foldback-like elements may provide the transposase with its binding specificity. PMID:23648487

Identification of multiple binding sites for the THAP domain of the Galileo transposase in the long terminal inverted-repeats.

PubMed

Marzo, Mar; Liu, Danxu; Ruiz, Alfredo; Chalmers, Ronald

2013-08-01

Galileo is a DNA transposon responsible for the generation of several chromosomal inversions in Drosophila. In contrast to other members of the P-element superfamily, it has unusually long terminal inverted-repeats (TIRs) that resemble those of Foldback elements. To investigate the function of the long TIRs we derived consensus and ancestral sequences for the Galileo transposase in three species of Drosophilids. Following gene synthesis, we expressed and purified their constituent THAP domains and tested their binding activity towards the respective Galileo TIRs. DNase I footprinting located the most proximal DNA binding site about 70 bp from the transposon end. Using this sequence we identified further binding sites in the tandem repeats that are found within the long TIRs. This suggests that the synaptic complex between Galileo ends may be a complicated structure containing higher-order multimers of the transposase. We also attempted to reconstitute Galileo transposition in Drosophila embryos but no events were detected. Thus, although the limited numbers of Galileo copies in each genome were sufficient to provide functional consensus sequences for the THAP domains, they do not specify a fully active transposase. Since the THAP recognition sequence is short, and will occur many times in a large genome, it seems likely that the multiple binding sites within the long, internally repetitive, TIRs of Galileo and other Foldback-like elements may provide the transposase with its binding specificity. Copyright © 2013 The Authors. Published by Elsevier B.V. All rights reserved.

Isolation, characterization and expression analysis of the BABY BOOM (BBM) gene from Larix kaempferi × L. olgensis during adventitious rooting.

PubMed

Li, Kui-Peng; Sun, Xiao-Mei; Han, Hua; Zhang, Shou-Gong

2014-11-10

The full-length cDNA and genomic sequences of the BABY BOOM (BBM) gene, designated LkBBM, were isolated from Larix kaempferi × Larix olgensis. The 3324 bp cDNA was cloned and its open reading frame (ORF) consists of 2370 nucleotides. The deduced 789 amino acid protein contains two AP2 domains and a BBM specific motif. Four conserved motifs between BBM and PLT were identified, which may be conducive to the similar function of BBM and PLT. The three dimensional (3D) structure of LkBBM was predicted and β-sheets in the AP2-R2 domain of LkBBM might recognize the specific base pairs in the major groove. Analysis of the LkBBM gene structure indicates that the gene has eight introns and nine exons. In the 5'-flanking promoter region of LkBBM, many important potential cis-acting elements were identified, such as the TATABOX5 element (a functional TATA element), ROOTMOTIFTAPOX1 element (element of root specificity), AUXREPSIAA4 element (element involved in auxin responsiveness and gene expression in root meristem), MYB1AT element (element involved in MYB recognition), ARR1AT element (element involved in cytokinin responsiveness), GARE1OSREP1 element (element involved in gibberellin responsiveness) and PYRIMIDINEBOXHVEPB1 element (element involved in abscisic acid responsiveness), which all suggested that the expression of LkBBM is highly regulated. Compared with gene expression levels in the stem, stem tip and leaf, LkBBM shows a specific expression in the root, which indicates that LkBBM plays a key role in regulating the development and growth of root in larch. In the processing of larch adventitious root formation, LkBBM started to express on the eighth day after rooting treatment and its transcript level increased continuously afterwards. According to the gene characteristics, LkBBM is proposed as a molecular marker for root primordia of larch, and the initial period of LkBBM expression may be the formation period of root primordia in the processing of adventitious rooting of larch. Copyright © 2014 Elsevier B.V. All rights reserved.

Mechanisms of radiation-induced gene responses

DOE Office of Scientific and Technical Information (OSTI.GOV)

Woloschak, G.E.; Paunesku, T.

1996-10-01

In the process of identifying genes differentially expressed in cells exposed ultraviolet radiation, we have identified a transcript having a 26-bp region that is highly conserved in a variety of species including Bacillus circulans, yeast, pumpkin, Drosophila, mouse, and man. When the 5` region (flanking region or UTR) of a gene, the sequence is predominantly in +/+ orientation with respect to the coding DNA strand; while in the coding region and the 3` region (UTR), the sequence is most frequently in the +/-orientation with respect to the coding DNA strand. In two genes, the element is split into two parts;more » however, in most cases, it is found only once but with a minimum of 11 consecutive nucleotides precisely depicting the original sequence. The element is found in a large number of different genes with diverse functions (from human ras p21 to B. circulans chitonase). Gel shift assays demonstrated the presence of a protein in HeLa cell extracts that binds to the sense and antisense single-stranded consensus oligomers, as well as to the double- stranded oligonucleotide. When double-stranded oligomer was used, the size shift demonstrated as additional protein-oligomer complex larger than the one bound to either sense or antisense single-stranded consensus oligomers alone. It is speculated either that this element binds to protein(s) important in maintaining DNA is a single-stranded orientation for transcription or, alternatively that this element is important in the transcription-coupled DNA repair process.« less

Structure of a Burkholderia pseudomallei Trimeric Autotransporter Adhesin Head

PubMed Central

Edwards, Thomas E.; Phan, Isabelle; Abendroth, Jan; Dieterich, Shellie H.; Masoudi, Amir; Guo, Wenjin; Hewitt, Stephen N.; Kelley, Angela; Leibly, David; Brittnacher, Mitch J.; Staker, Bart L.; Miller, Samuel I.; Van Voorhis, Wesley C.; Myler, Peter J.; Stewart, Lance J.

2010-01-01

Background Pathogenic bacteria adhere to the host cell surface using a family of outer membrane proteins called Trimeric Autotransporter Adhesins (TAAs). Although TAAs are highly divergent in sequence and domain structure, they are all conceptually comprised of a C-terminal membrane anchoring domain and an N-terminal passenger domain. Passenger domains consist of a secretion sequence, a head region that facilitates binding to the host cell surface, and a stalk region. Methodology/Principal Findings Pathogenic species of Burkholderia contain an overabundance of TAAs, some of which have been shown to elicit an immune response in the host. To understand the structural basis for host cell adhesion, we solved a 1.35 Å resolution crystal structure of a BpaA TAA head domain from Burkholderia pseudomallei, the pathogen that causes melioidosis. The structure reveals a novel fold of an intricately intertwined trimer. The BpaA head is composed of structural elements that have been observed in other TAA head structures as well as several elements of previously unknown structure predicted from low sequence homology between TAAs. These elements are typically up to 40 amino acids long and are not domains, but rather modular structural elements that may be duplicated or omitted through evolution, creating molecular diversity among TAAs. Conclusions/Significance The modular nature of BpaA, as demonstrated by its head domain crystal structure, and of TAAs in general provides insights into evolution of pathogen-host adhesion and may provide an avenue for diagnostics. PMID:20862217

Porcine calbindin-D9k gene: expression in endometrium, myometrium, and placenta in the absence of a functional estrogen response element in intron A.

PubMed

Krisinger, J; Jeung, E B; Simmen, R C; Leung, P C

1995-01-01

The expression of Calbindin-D9k (CaBP-9k) in the pig uterus and placenta was measured by Northern blot analysis and reverse transcription polymerase chain reaction (PCR), respectively. Progesterone (P4) administration to ovariectomized pigs decreased CaBP-9k mRNA levels. Expression of endometrial CaBP-9k mRNA was high on pregnancy Days 10-12 and below the detection limit on Days 15 and 18. On Day 60, expression could be detected at low levels. In myometrium and placenta, CaBP-9k mRNA expression was not detectable by Northern analysis using total RNA. Reverse-transcribed RNA from both tissues demonstrated the presence of CaBP-9k transcripts by means of PCR. The partial CaBP-9k gene was amplified by PCR and cloned to determine the sequence of intron A. In contrast to the rat CaBP-9k gene, the pig gene does not contain a functional estrogen response element (ERE) within this region. A similar ERE-like sequence located at the identical location was examined by gel retardation analysis and failed to bind the estradiol receptor. A similar disruption of this ERE-like sequence has been described in the human CaBP-9k gene, which is not expressed at any level in placenta, myometrium, or endometrium. It is concluded that the pig CaBP-9k gene is regulated in these reproductive tissues in a manner distinct from that in rat and human tissues. The regulation is probably due to a regulatory region outside of intron A, which in the rat gene contains the key cis element for uterine expression of the CaBP-9k gene.

Characterization of the human gene (TBXAS1) encoding thromboxane synthase.

PubMed

Miyata, A; Yokoyama, C; Ihara, H; Bandoh, S; Takeda, O; Takahashi, E; Tanabe, T

1994-09-01

The gene encoding human thromboxane synthase (TBXAS1) was isolated from a human EMBL3 genomic library using human platelet thromboxane synthase cDNA as a probe. Nucleotide sequencing revealed that the human thromboxane synthase gene spans more than 75 kb and consists of 13 exons and 12 introns, of which the splice donor and acceptor sites conform to the GT/AG rule. The exon-intron boundaries of the thromboxane synthase gene were similar to those of the human cytochrome P450 nifedipine oxidase gene (CYP3A4) except for introns 9 and 10, although the primary sequences of these enzymes exhibited 35.8% identity each other. The 1.2-kb of the 5'-flanking region sequence contained potential binding sites for several transcription factors (AP-1, AP-2, GATA-1, CCAAT box, xenobiotic-response element, PEA-3, LF-A1, myb, basic transcription element and cAMP-response element). Primer-extension analysis indicated the multiple transcription-start sites, and the major start site was identified as an adenine residue located 142 bases upstream of the translation-initiation site. However, neither a typical TATA box nor a typical CAAT box is found within the 100-b upstream of the translation-initiation site. Southern-blot analysis revealed the presence of one copy of the thromboxane synthase gene per haploid genome. Furthermore, a fluorescence in situ hybridization study revealed that the human gene for thromboxane synthase is localized to band q33-q34 of the long arm of chromosome 7. A tissue-distribution study demonstrated that thromboxane synthase mRNA is widely expressed in human tissues and is particularly abundant in peripheral blood leukocyte, spleen, lung and liver. The low but significant levels of mRNA were observed in kidney, placenta and thymus.

Optically intraconnected computer employing dynamically reconfigurable holographic optical element

NASA Technical Reports Server (NTRS)

Bergman, Larry A. (Inventor)

1992-01-01

An optically intraconnected computer and a reconfigurable holographic optical element employed therein. The basic computer comprises a memory for holding a sequence of instructions to be executed; logic for accessing the instructions in sequence; logic for determining for each the instruction the function to be performed and the effective address thereof; a plurality of individual elements on a common support substrate optimized to perform certain logical sequences employed in executing the instructions; and, element selection logic connected to the logic determining the function to be performed for each the instruction for determining the class of each function and for causing the instruction to be executed by those the elements which perform those associated the logical sequences affecting the instruction execution in an optimum manner. In the optically intraconnected version, the element selection logic is adapted for transmitting and switching signals to the elements optically.

Investigating the Regulation and Potential Role of Nonhypoxic Hypoxia-Inducible Factor 1 (HIF-1) in Aromatase Inhibitor Resistant Breast Cancer

DTIC Science & Technology

2013-10-01

hypoxia responsive element ( HRE ) to which HIF-1 binds in order to regulate vimentin gene expresson has not been identified. We have currently, analyzed...the vimentin promoter and have identified 2 potential HRE sites, based on sequence (Figure 5). Primers have been designed and ordered, and

NASTRAN maintenance and enhancement experiences

NASA Technical Reports Server (NTRS)

Schmitz, R. P.

1975-01-01

The current capability is described which includes isoparametric elements, optimization of grid point sequencing, and eigenvalue routine. Overlay and coding errors were corrected for cyclic symmetry, transient response, and differential stiffness rigid formats. Error corrections and program enhancements are discussed along with developments scheduled for the current year and a brief description of analyses being performed using the program.

Involvement of Ethylene in Stress-Induced Expression of the TLC1.1 Retrotransposon from Lycopersicon chilense Dun.1[w

PubMed Central

Tapia, Gerardo; Verdugo, Isabel; Yañez, Mónica; Ahumada, Iván; Theoduloz, Cristina; Cordero, Cecilia; Poblete, Fernando; González, Enrique; Ruiz-Lara, Simón

2005-01-01

The TLC1 family is one of the four families of long terminal repeat (LTR) retrotransposons identified in the genome of Lycopersicon chilense. Here, we show that this family of retroelements is transcriptionally active and its expression is induced in response to diverse stress conditions such as wounding, protoplast preparation, and high salt concentrations. Several stress-associated signaling molecules, including ethylene, methyl jasmonate, salicylic acid, and 2,4-dichlorophenoxyacetic acid, are capable of inducing TLC1 family expression in vivo. A representative of this family, named TLC1.1, was isolated from a genomic library from L. chilense. Transient expression assays in leaf protoplasts and stably transformed tobacco (Nicotiana tabacum) plants demonstrate that the U3 domain of the 5′-LTR region of this element can drive stress-induced transcriptional activation of the β-glucuronidase reporter gene. Two 57-bp tandem repeated sequences are found in this region, including an 8-bp motif, ATTTCAAA, previously identified as an ethylene-responsive element box in the promoter region of ethylene-induced genes. Expression analysis of wild-type LTR and single and double ethylene-responsive element box mutants fused to the β-glucuronidase gene shows that these elements are required for ethylene-responsive gene expression in protoplasts and transgenic plants. We suggest that ethylene-dependent signaling is the main signaling pathway involved in the regulation of the expression of the TLC1.1 element from L. chilense. PMID:16040666

Cold shock protein YB-1 is involved in hypoxia-dependent gene transcription

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rauen, Thomas; Frye, Bjoern C.; Pneumology, University Medical Center, University of Freiburg, Freiburg

Hypoxia-dependent gene regulation is largely orchestrated by hypoxia-inducible factors (HIFs), which associate with defined nucleotide sequences of hypoxia-responsive elements (HREs). Comparison of the regulatory HRE within the 3′ enhancer of the human erythropoietin (EPO) gene with known binding motifs for cold shock protein Y-box (YB) protein-1 yielded strong similarities within the Y-box element and 3′ adjacent sequences. DNA binding assays confirmed YB-1 binding to both, single- and double-stranded HRE templates. Under hypoxia, we observed nuclear shuttling of YB-1 and co-immunoprecipitation assays demonstrated that YB-1 and HIF-1α physically interact with each other. Cellular YB-1 depletion using siRNA significantly induced hypoxia-dependent EPOmore » production at both, promoter and mRNA level. Vice versa, overexpressed YB-1 significantly reduced EPO-HRE-dependent gene transcription, whereas this effect was minor under normoxia. HIF-1α overexpression induced hypoxia-dependent gene transcription through the same element and accordingly, co-expression with YB-1 reduced HIF-1α-mediated EPO induction under hypoxic conditions. Taken together, we identified YB-1 as a novel binding factor for HREs that participates in fine-tuning of the hypoxia transcriptome. - Highlights: • Hypoxia drives nuclear translocation of cold shock protein YB-1. • YB-1 physically interacts with hypoxia-inducible factor (HIF)-1α. • YB-1 binds to the hypoxia-responsive element (HRE) within the erythropoietin (EPO) 3′ enhancer. • YB-1 trans-regulates transcription of hypoxia-dependent genes such as EPO and VEGF.« less

Zaba: a novel miniature transposable element present in genomes of legume plants.

PubMed

Macas, J; Neumann, P; Pozárková, D

2003-08-01

A novel family of miniature transposable elements, named Zaba, was identified in pea (Pisum sativum) and subsequently also in other legume species using computer analysis of their DNA sequences. Zaba elements are 141-190 bp long, generate 10-bp target site duplications, and their terminal inverted repeats make up most of the sequence. Zaba elements thus resemble class 3 foldback transposons. The elements are only moderately repetitive in pea (tens to hundreds copies per haploid genome), but they are present in up to thousands of copies in the genomes of several Medicago and Vicia species. More detailed analysis of the elements from pea, including isolation of new sequences from a genomic library, revealed that a fraction of these elements are truncated, and that their last transposition probably did not occur recently. A search for Zaba sequences in EST databases showed that at least some elements are transcribed, most probably due to their association with genic regions.

Two new miniature inverted-repeat transposable elements in the genome of the clam Donax trunculus.

PubMed

Šatović, Eva; Plohl, Miroslav

2017-10-01

Repetitive sequences are important components of eukaryotic genomes that drive their evolution. Among them are different types of mobile elements that share the ability to spread throughout the genome and form interspersed repeats. To broaden the generally scarce knowledge on bivalves at the genome level, in the clam Donax trunculus we described two new non-autonomous DNA transposons, miniature inverted-repeat transposable elements (MITEs), named DTC M1 and DTC M2. Like other MITEs, they are characterized by their small size, their A + T richness, and the presence of terminal inverted repeats (TIRs). DTC M1 and DTC M2 are 261 and 286 bp long, respectively, and in addition to TIRs, both of them contain a long imperfect palindrome sequence in their central parts. These elements are present in complete and truncated versions within the genome of the clam D. trunculus. The two new MITEs share only structural similarity, but lack any nucleotide sequence similarity to each other. In a search for related elements in databases, blast search revealed within the Crassostrea gigas genome a larger element sharing sequence similarity only to DTC M1 in its TIR sequences. The lack of sequence similarity with any previously published mobile elements indicates that DTC M1 and DTC M2 elements may be unique to D. trunculus.

Mycobacterium tuberculosis Exploits a Molecular Off Switch of the Immune System for Intracellular Survival.

PubMed

von Both, Ulrich; Berk, Maurice; Agapow, Paul-Michael; Wright, Joseph D; Git, Anna; Hamilton, Melissa Shea; Goldgof, Greg; Siddiqui, Nazneen; Bellos, Evangelos; Wright, Victoria J; Coin, Lachlan J; Newton, Sandra M; Levin, Michael

2018-01-12

Mycobacterium tuberculosis (M. tuberculosis) survives and multiplies inside human macrophages by subversion of immune mechanisms. Although these immune evasion strategies are well characterised functionally, the underlying molecular mechanisms are poorly understood. Here we show that during infection of human whole blood with M. tuberculosis, host gene transcriptional suppression, rather than activation, is the predominant response. Spatial, temporal and functional characterisation of repressed genes revealed their involvement in pathogen sensing and phagocytosis, degradation within the phagolysosome and antigen processing and presentation. To identify mechanisms underlying suppression of multiple immune genes we undertook epigenetic analyses. We identified significantly differentially expressed microRNAs with known targets in suppressed genes. In addition, after searching regions upstream of the start of transcription of suppressed genes for common sequence motifs, we discovered novel enriched composite sequence patterns, which corresponded to Alu repeat elements, transposable elements known to have wide ranging influences on gene expression. Our findings suggest that to survive within infected cells, mycobacteria exploit a complex immune "molecular off switch" controlled by both microRNAs and Alu regulatory elements.

Identification of a Retroelement from the Resurrection Plant Boea hygrometrica That Confers Osmotic and Alkaline Tolerance in Arabidopsis thaliana

PubMed Central

Shen, Chun-Ying; Xu, Guang-Hui; Chen, Shi-Xuan; Song, Li-Zhen; Li, Mei-Jing; Wang, Li-Li; Zhu, Yan; Lv, Wei-Tao; Gong, Zhi-Zhong; Liu, Chun-Ming; Deng, Xin

2014-01-01

Functional genomic elements, including transposable elements, small RNAs and non-coding RNAs, are involved in regulation of gene expression in response to plant stress. To identify genomic elements that regulate dehydration and alkaline tolerance in Boea hygrometrica, a resurrection plant that inhabits drought and alkaline Karst areas, a genomic DNA library from B. hygrometrica was constructed and subsequently transformed into Arabidopsis using binary bacterial artificial chromosome (BIBAC) vectors. Transgenic lines were screened under osmotic and alkaline conditions, leading to the identification of Clone L1-4 that conferred osmotic and alkaline tolerance. Sequence analyses revealed that L1-4 contained a 49-kb retroelement fragment from B. hygrometrica, of which only a truncated sequence was present in L1-4 transgenic Arabidopsis plants. Additional subcloning revealed that activity resided in a 2-kb sequence, designated Osmotic and Alkaline Resistance 1 (OAR1). In addition, transgenic Arabidopsis lines carrying an OAR1-homologue also showed similar stress tolerance phenotypes. Physiological and molecular analyses demonstrated that OAR1-transgenic plants exhibited improved photochemical efficiency and membrane integrity and biomarker gene expression under both osmotic and alkaline stresses. Short transcripts that originated from OAR1 were increased under stress conditions in both B. hygrometrica and Arabidopsis carrying OAR1. The relative copy number of OAR1 was stable in transgenic Arabidopsis under stress but increased in B. hygrometrica. Taken together, our results indicated a potential role of OAR1 element in plant tolerance to osmotic and alkaline stresses, and verified the feasibility of the BIBAC transformation technique to identify functional genomic elements from physiological model species. PMID:24851859

Transcription factor MBF-I interacts with metal regulatory elements of higher eucaryotic metallothionein genes.

PubMed Central

Imbert, J; Zafarullah, M; Culotta, V C; Gedamu, L; Hamer, D

1989-01-01

Metallothionein (MT) gene promoters in higher eucaryotes contain multiple metal regulatory elements (MREs) that are responsible for the metal induction of MT gene transcription. We identified and purified to near homogeneity a 74-kilodalton mouse nuclear protein that specifically binds to certain MRE sequences. This protein, MBF-I, was purified employing as an affinity reagent a trout MRE that is shown to be functional in mouse cells but which lacks the G+C-rich and SP1-like sequences found in many mammalian MT gene promoters. Using point-mutated MREs, we showed that there is a strong correlation between DNA binding in vitro and MT gene regulation in vivo, suggesting a direct role of MBF-I in MT gene transcription. We also showed that MBF-I can induce MT gene transcription in vitro in a mouse extract and that this stimulation requires zinc. Images PMID:2586522

Transcriptional targets shared by estrogen receptor- related receptors (ERRs) and estrogen receptor (ER) alpha, but not by ERbeta.

PubMed Central

Vanacker, J M; Pettersson, K; Gustafsson, J A; Laudet, V

1999-01-01

The physiological activities of estrogens are thought to be mediated by specific nuclear receptors, ERalpha and ERbeta. However, certain tissues, such as the bone, that are highly responsive to estrogens only express a low level of these receptors. Starting from this apparent contradiction, we have evaluated the potentials of two related receptors ERRalpha and ERRbeta to intervene in estrogen signaling. ERalpha, ERRalpha and ERRbeta bind to and activate transcription through both the classical estrogen response element (ERE) and the SF-1 response element (SFRE). In contrast, ERbeta DNA-binding and transcriptional activity is restricted to the ERE. Accordingly, the osteopontin gene promoter is stimulated through SFRE sequences, by ERRalpha as well as by ERalpha, but not by ERbeta. Analysis of the cross-talk within the ER/ERR subgroup of nuclear receptors thus revealed common targets but also functional differences between the two ERs. PMID:10428965

HRGFish: A database of hypoxia responsive genes in fishes

NASA Astrophysics Data System (ADS)

Rashid, Iliyas; Nagpure, Naresh Sahebrao; Srivastava, Prachi; Kumar, Ravindra; Pathak, Ajey Kumar; Singh, Mahender; Kushwaha, Basdeo

2017-02-01

Several studies have highlighted the changes in the gene expression due to the hypoxia response in fishes, but the systematic organization of the information and the analytical platform for such genes are lacking. In the present study, an attempt was made to develop a database of hypoxia responsive genes in fishes (HRGFish), integrated with analytical tools, using LAMPP technology. Genes reported in hypoxia response for fishes were compiled through literature survey and the database presently covers 818 gene sequences and 35 gene types from 38 fishes. The upstream fragments (3,000 bp), covered in this database, enables to compute CG dinucleotides frequencies, motif finding of the hypoxia response element, identification of CpG island and mapping with the reference promoter of zebrafish. The database also includes functional annotation of genes and provides tools for analyzing sequences and designing primers for selected gene fragments. This may be the first database on the hypoxia response genes in fishes that provides a workbench to the scientific community involved in studying the evolution and ecological adaptation of the fish species in relation to hypoxia.

A HLA class I cis-regulatory element whose activity can be modulated by hormones.

PubMed

Sim, B C; Hui, K M

1994-12-01

To elucidate the basis of the down-regulation in major histocompatibility complex (MHC) class I gene expression and to identify possible DNA-binding regulatory elements that have the potential to interact with class I MHC genes, we have studied the transcriptional regulation of class I HLA genes in human breast carcinoma cells. A 9 base pair (bp) negative cis-regulatory element (NRE) has been identified using band-shift assays employing DNA sequences derived from the 5'-flanking region of HLA class I genes. This 9-bp element, GTCATGGCG, located within exon I of the HLA class I gene, can potently inhibit the expression of a heterologous thymidine kinase (TK) gene promoter and the HLA enhancer element. Furthermore, this regulatory element can exert its suppressive function in either the sense or anti-sense orientation. More interestingly, NRE can suppress dexamethasone-mediated gene activation in the context of the reported glucocorticoid-responsive element (GRE) in MCF-7 cells but has no influence on the estrogen-mediated transcriptional activation of MCF-7 cells in the context of the reported estrogen-responsive element (ERE). Furthermore, the presence of such a regulatory element within the HLA class I gene whose activity can be modulated by hormones correlates well with our observation that the level of HLA class I gene expression can be down-regulated by hormones in human breast carcinoma cells. Such interactions between negative regulatory elements and specific hormone trans-activators are novel and suggest a versatile form of transcriptional control.

Both positive and negative regulatory elements mediate expression of a photoregulated CAB gene from Nicotiana plumbaginifolia.

PubMed Central

Castresana, C; Garcia-Luque, I; Alonso, E; Malik, V S; Cashmore, A R

1988-01-01

We have analyzed promoter regulatory elements from a photoregulated CAB gene (Cab-E) isolated from Nicotiana plumbaginifolia. These studies have been performed by introducing chimeric gene constructs into tobacco cells via Agrobacterium tumefaciens-mediated transformation. Expression studies on the regenerated transgenic plants have allowed us to characterize three positive and one negative cis-acting elements that influence photoregulated expression of the Cab-E gene. Within the upstream sequences we have identified two positive regulatory elements (PRE1 and PRE2) which confer maximum levels of photoregulated expression. These sequences contain multiple repeated elements related to the sequence-ACCGGCCCACTT-. We have also identified within the upstream region a negative regulatory element (NRE) extremely rich in AT sequences, which reduces the level of gene expression in the light. We have defined a light regulatory element (LRE) within the promoter region extending from -396 to -186 bp which confers photoregulated expression when fused to a constitutive nopaline synthase ('nos') promoter. Within this region there is a 132-bp element, extending from -368 to -234 bp, which on deletion from the Cab-E promoter reduces gene expression from high levels to undetectable levels. Finally, we have demonstrated for a full length Cab-E promoter conferring high levels of photoregulated expression, that sequences proximal to the Cab-E TATA box are not replaceable by corresponding sequences from a 'nos' promoter. This contrasts with the apparent equivalence of these Cab-E and 'nos' TATA box-proximal sequences in truncated promoters conferring low levels of photoregulated expression. Images PMID:2901343

Identification and characterization of cryptic SHOX intragenic deletions in three Japanese patients with Léri-Weill dyschondrosteosis.

PubMed

Fukami, Maki; Dateki, Sumito; Kato, Fumiko; Hasegawa, Yukihiro; Mochizuki, Hiroshi; Horikawa, Reiko; Ogata, Tsutomu

2008-01-01

Although short-stature homeobox-containing gene (SHOX ) haploinsufficiency is responsible for Léri-Weill dyschondrosteosis (LWD), the molecular defect has not been identified in approximately 20% of Japanese LWD patients. Furthermore, although high prevalence of microdeletions affecting SHOX is primarily ascribed to the presence of repeat sequences such as Alu elements around SHOX, it remains to be determined whether microdeletions are actually mediated by repeat sequences. We performed multiple ligation probe amplification (MLPA) assay in six Japanese LWD patients with apparently normal SHOX, followed by fluorescent in situ hybridization (FISH) analysis and sequencing for polymerase chain reaction (PCR) products encompassing the deletion junctions in patients with abnormal MLPA patterns. Consequently, heterozygous intragenic deletions were identified in three cases, i.e., a 5,906-bp deletion involving exons 4-5 in case 1, a 5,594-bp deletion involving exons 4-6a in case 2, and a 50,199-bp deletion involving exons 4-6b in case 3. The deletion breakpoints of cases 1 and 2 were present in nonrepeat sequences, whereas those of case 3 resided within Alu elements. The results suggest that cryptic SHOX intragenic deletions account for a small fraction of LWD and that microdeletions affecting SHOX can be generated by repeat-sequence-mediated aberrant recombinations and by nonhomologous end joining.

Chromosomal insertion and excision of a 30 kb unstable genetic element is responsible for phase variation of lipopolysaccharide and other virulence determinants in Legionella pneumophila.

PubMed

Lüneberg, E; Mayer, B; Daryab, N; Kooistra, O; Zähringer, U; Rohde, M; Swanson, J; Frosch, M

2001-03-01

We recently described the phase-variable expression of a virulence-associated lipopolysaccharide (LPS) epitope in Legionella pneumophila. In this study, the molecular mechanism for phase variation was investigated. We identified a 30 kb unstable genetic element as the molecular origin for LPS phase variation. Thirty putative genes were encoded on the 30 kb sequence, organized in two putative opposite transcription units. Some of the open reading frames (ORFs) shared homologies with bacteriophage genes, suggesting that the 30 kb element was of phage origin. In the virulent wild-type strain, the 30 kb element was located on the chromosome, whereas excision from the chromosome and replication as a high-copy plasmid resulted in the mutant phenotype, which is characterized by alteration of an LPS epitope and loss of virulence. Mapping and sequencing of the insertion site in the genome revealed that the chromosomal attachment site was located in an intergenic region flanked by genes of unknown function. As phage release could not be induced by mitomycin C, it is conceivable that the 30 kb element is a non-functional phage remnant. The protein encoded by ORF T on the 30 kb plasmid could be isolated by an outer membrane preparation, indicating that the genes encoded on the 30 kb element are expressed in the mutant phenotype. Therefore, it is conceivable that the phenotypic alterations seen in the mutant depend on high-copy replication of the 30 kb element and expression of the encoded genes. Excision of the 30 kb element from the chromosome was found to occur in a RecA-independent pathway, presumably by the involvement of RecE, RecT and RusA homologues that are encoded on the 30 kb element.

The expanding universe of p53 targets.

PubMed

Menendez, Daniel; Inga, Alberto; Resnick, Michael A

2009-10-01

The p53 tumour suppressor is modified through mutation or changes in expression in most cancers, leading to the altered regulation of hundreds of genes that are directly influenced by this sequence-specific transcription factor. Central to the p53 master regulatory network are the target response element (RE) sequences. The extent of p53 transactivation and transcriptional repression is influenced by many factors, including p53 levels, cofactors and the specific RE sequences, all of which contribute to the role that p53 has in the aetiology of cancer. This Review describes the identification and functionality of REs and highlights the inclusion of non-canonical REs that expand the universe of genes and regulation mechanisms in the p53 tumour suppressor network.

The twilight zone of cis element alignments.

PubMed

Sebastian, Alvaro; Contreras-Moreira, Bruno

2013-02-01

Sequence alignment of proteins and nucleic acids is a routine task in bioinformatics. Although the comparison of complete peptides, genes or genomes can be undertaken with a great variety of tools, the alignment of short DNA sequences and motifs entails pitfalls that have not been fully addressed yet. Here we confront the structural superposition of transcription factors with the sequence alignment of their recognized cis elements. Our goals are (i) to test TFcompare (http://floresta.eead.csic.es/tfcompare), a structural alignment method for protein-DNA complexes; (ii) to benchmark the pairwise alignment of regulatory elements; (iii) to define the confidence limits and the twilight zone of such alignments and (iv) to evaluate the relevance of these thresholds with elements obtained experimentally. We find that the structure of cis elements and protein-DNA interfaces is significantly more conserved than their sequence and measures how this correlates with alignment errors when only sequence information is considered. Our results confirm that DNA motifs in the form of matrices produce better alignments than individual sequences. Finally, we report that empirical and theoretically derived twilight thresholds are useful for estimating the natural plasticity of regulatory sequences, and hence for filtering out unreliable alignments.

The twilight zone of cis element alignments

PubMed Central

Sebastian, Alvaro; Contreras-Moreira, Bruno

2013-01-01

Sequence alignment of proteins and nucleic acids is a routine task in bioinformatics. Although the comparison of complete peptides, genes or genomes can be undertaken with a great variety of tools, the alignment of short DNA sequences and motifs entails pitfalls that have not been fully addressed yet. Here we confront the structural superposition of transcription factors with the sequence alignment of their recognized cis elements. Our goals are (i) to test TFcompare (http://floresta.eead.csic.es/tfcompare), a structural alignment method for protein–DNA complexes; (ii) to benchmark the pairwise alignment of regulatory elements; (iii) to define the confidence limits and the twilight zone of such alignments and (iv) to evaluate the relevance of these thresholds with elements obtained experimentally. We find that the structure of cis elements and protein–DNA interfaces is significantly more conserved than their sequence and measures how this correlates with alignment errors when only sequence information is considered. Our results confirm that DNA motifs in the form of matrices produce better alignments than individual sequences. Finally, we report that empirical and theoretically derived twilight thresholds are useful for estimating the natural plasticity of regulatory sequences, and hence for filtering out unreliable alignments. PMID:23268451

Detecting authorized and unauthorized genetically modified organisms containing vip3A by real-time PCR and next-generation sequencing.

PubMed

Liang, Chanjuan; van Dijk, Jeroen P; Scholtens, Ingrid M J; Staats, Martijn; Prins, Theo W; Voorhuijzen, Marleen M; da Silva, Andrea M; Arisi, Ana Carolina Maisonnave; den Dunnen, Johan T; Kok, Esther J

2014-04-01

The growing number of biotech crops with novel genetic elements increasingly complicates the detection of genetically modified organisms (GMOs) in food and feed samples using conventional screening methods. Unauthorized GMOs (UGMOs) in food and feed are currently identified through combining GMO element screening with sequencing the DNA flanking these elements. In this study, a specific and sensitive qPCR assay was developed for vip3A element detection based on the vip3Aa20 coding sequences of the recently marketed MIR162 maize and COT102 cotton. Furthermore, SiteFinding-PCR in combination with Sanger, Illumina or Pacific BioSciences (PacBio) sequencing was performed targeting the flanking DNA of the vip3Aa20 element in MIR162. De novo assembly and Basic Local Alignment Search Tool searches were used to mimic UGMO identification. PacBio data resulted in relatively long contigs in the upstream (1,326 nucleotides (nt); 95 % identity) and downstream (1,135 nt; 92 % identity) regions, whereas Illumina data resulted in two smaller contigs of 858 and 1,038 nt with higher sequence identity (>99 % identity). Both approaches outperformed Sanger sequencing, underlining the potential for next-generation sequencing in UGMO identification.

Gene space and transcriptome assemblies of leafy spurge (Euphorbia esula) identify promoter sequences, repetitive elements, high-quality markers, and a full-length chloroplast genome

USDA-ARS?s Scientific Manuscript database

Leafy spurge is an invasive perennial weed infesting range and recreational lands of North America. Previous research and omics projects with leafy spurge have helped develop it as a model for studying numerous aspects of perennial plant development and response to abiotic stress. However, the lack ...

Unusually long-lived pause required for regulation of a Rho-dependent transcription terminator

PubMed Central

Hollands, Kerry; Sevostiyanova, Anastasia; Groisman, Eduardo A.

2014-01-01

Up to half of all transcription termination events in bacteria rely on the RNA-dependent helicase Rho. However, the nucleic acid sequences that promote Rho-dependent termination remain poorly characterized. Defining the molecular determinants that confer Rho-dependent termination is especially important for understanding how such terminators can be regulated in response to specific signals. Here, we identify an extraordinarily long-lived pause at the site where Rho terminates transcription in the 5′-leader region of the Mg2+ transporter gene mgtA in Salmonella enterica. We dissect the sequence elements required for prolonged pausing in the mgtA leader and establish that the remarkable longevity of this pause is required for a riboswitch to stimulate Rho-dependent termination in the mgtA leader region in response to Mg2+ availability. Unlike Rho-dependent terminators described previously, where termination occurs at multiple pause sites, there is a single site of transcription termination directed by Rho in the mgtA leader. Our data suggest that Rho-dependent termination events that are subject to regulation may require elements distinct from those operating at constitutive Rho-dependent terminators. PMID:24778260

Novel green tissue-specific synthetic promoters and cis-regulatory elements in rice.

PubMed

Wang, Rui; Zhu, Menglin; Ye, Rongjian; Liu, Zuoxiong; Zhou, Fei; Chen, Hao; Lin, Yongjun

2015-12-11

As an important part of synthetic biology, synthetic promoter has gradually become a hotspot in current biology. The purposes of the present study were to synthesize green tissue-specific promoters and to discover green tissue-specific cis-elements. We first assembled several regulatory sequences related to tissue-specific expression in different combinations, aiming to obtain novel green tissue-specific synthetic promoters. GUS assays of the transgenic plants indicated 5 synthetic promoters showed green tissue-specific expression patterns and different expression efficiencies in various tissues. Subsequently, we scanned and counted the cis-elements in different tissue-specific promoters based on the plant cis-elements database PLACE and the rice cDNA microarray database CREP for green tissue-specific cis-element discovery, resulting in 10 potential cis-elements. The flanking sequence of one potential core element (GEAT) was predicted by bioinformatics. Then, the combination of GEAT and its flanking sequence was functionally identified with synthetic promoter. GUS assays of the transgenic plants proved its green tissue-specificity. Furthermore, the function of GEAT flanking sequence was analyzed in detail with site-directed mutagenesis. Our study provides an example for the synthesis of rice tissue-specific promoters and develops a feasible method for screening and functional identification of tissue-specific cis-elements with their flanking sequences at the genome-wide level in rice.

A ribosomal orphon sequence from Xenopus laevis flanked by novel low copy number repetitive elements.

PubMed

Guimond, A; Moss, T

1999-02-01

We have used a differential cloning approach to isolate ribosomal/non-ribosomal frontier sequences from Xenopus laevis. A ribosomal intergenic spacer sequence (IGS) was cloned and shown not to be physically linked with the ribosomal locus. This ribosomal orphon contained the IGS sequences found immediately downstream of the 28S gene and included an array of enhancer repetitions and a non-functional spacer promoter. The orphon sequence was flanked by a member of the novel 'Frt' low copy repetitive element family. Three individual Frt repeats were sequenced and all members of this family were shown to lie clustered at two chromosomal sites, one of which contained the ribosomal orphon. One of the Frt elements contained an insertion of 297 bp that showed extensive homology to sequences within at least three other Xenopus genes. Each homology region was flanked by members of the T2 family of short interspersed repetitive elements, (SINEs), and by its target insertion sequence, suggesting multiple translocation events. The data are discussed in terms of the evolution of the ribosomal gene locus.

Mutations on the DNA Binding Surface of TBP Discriminate between Yeast TATA and TATA-Less Gene Transcription

PubMed Central

Kamenova, Ivanka; Warfield, Linda

2014-01-01

Most RNA polymerase (Pol) II promoters lack a TATA element, yet nearly all Pol II transcription requires TATA binding protein (TBP). While the TBP-TATA interaction is critical for transcription at TATA-containing promoters, it has been unclear whether TBP sequence-specific DNA contacts are required for transcription at TATA-less genes. Transcription factor IID (TFIID), the TBP-containing coactivator that functions at most TATA-less genes, recognizes short sequence-specific promoter elements in metazoans, but analogous promoter elements have not been identified in Saccharomyces cerevisiae. We generated a set of mutations in the yeast TBP DNA binding surface and found that most support growth of yeast. Both in vivo and in vitro, many of these mutations are specifically defective for transcription of two TATA-containing genes with only minor defects in transcription of two TATA-less, TFIID-dependent genes. TBP binds several TATA-less promoters with apparent high affinity, but our results suggest that this binding is not important for transcription activity. Our results are consistent with the model that sequence-specific TBP-DNA contacts are not important at yeast TATA-less genes and suggest that other general transcription factors or coactivator subunits are responsible for recognition of TATA-less promoters. Our results also explain why yeast TBP derivatives defective for TATA binding appear defective in activated transcription. PMID:24865972

Mutations on the DNA binding surface of TBP discriminate between yeast TATA and TATA-less gene transcription.

PubMed

Kamenova, Ivanka; Warfield, Linda; Hahn, Steven

2014-08-01

Most RNA polymerase (Pol) II promoters lack a TATA element, yet nearly all Pol II transcription requires TATA binding protein (TBP). While the TBP-TATA interaction is critical for transcription at TATA-containing promoters, it has been unclear whether TBP sequence-specific DNA contacts are required for transcription at TATA-less genes. Transcription factor IID (TFIID), the TBP-containing coactivator that functions at most TATA-less genes, recognizes short sequence-specific promoter elements in metazoans, but analogous promoter elements have not been identified in Saccharomyces cerevisiae. We generated a set of mutations in the yeast TBP DNA binding surface and found that most support growth of yeast. Both in vivo and in vitro, many of these mutations are specifically defective for transcription of two TATA-containing genes with only minor defects in transcription of two TATA-less, TFIID-dependent genes. TBP binds several TATA-less promoters with apparent high affinity, but our results suggest that this binding is not important for transcription activity. Our results are consistent with the model that sequence-specific TBP-DNA contacts are not important at yeast TATA-less genes and suggest that other general transcription factors or coactivator subunits are responsible for recognition of TATA-less promoters. Our results also explain why yeast TBP derivatives defective for TATA binding appear defective in activated transcription. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

Interfamilial recombination between viruses led to acquisition of a novel translation-enhancing RNA element that allows resistance breaking

PubMed Central

Miras, Manuel; Sempere, Raquel N.; Kraft, Jelena J.; Miller, W. Allen; Aranda, Miguel A.; Truniger, Veronica

2015-01-01

Summary Many plant viruses depend on functional RNA elements, called 3′-UTR cap-independent translation enhancers (3′-CITEs), for translation of their RNAs. In this manuscript we provide direct proof for the existing hypothesis that 3′-CITEs are modular and transferable by recombination in nature, and that this is associated with an advantage for the created virus. By characterizing a newly identified Melon necrotic spot virus (MNSV; Tombusviridae) isolate, which is able to overcome eukaryotic translation initiation factor 4E (eIF4E)-mediated resistance, we found that it contains a 55 nucleotide insertion in its 3′-UTR. We provide strong evidence that this insertion was acquired by interfamilial recombination with the 3′-UTR of an Asiatic Cucurbit aphid-borne yellows virus (CABYV; Luteoviridae). By constructing chimeric viruses, we showed that this recombined sequence is responsible for resistance breaking. Analysis of the translational efficiency of reporter constructs showed that this sequence functions as a novel 3′-CITE in both resistant and susceptible plants, being essential for translation control in resistant plants. In conclusion, we showed that a recombination event between two clearly identified viruses from different families led to the transfer of exactly the sequence corresponding to a functional RNA element, giving rise to a new isolate with the capacity to infect an otherwise non-susceptible host. PMID:24372390

Interfamilial recombination between viruses led to acquisition of a novel translation-enhancing RNA element that allows resistance breaking.

PubMed

Miras, Manuel; Sempere, Raquel N; Kraft, Jelena J; Miller, W Allen; Aranda, Miguel A; Truniger, Veronica

2014-04-01

Many plant viruses depend on functional RNA elements, called 3'-UTR cap-independent translation enhancers (3'-CITEs), for translation of their RNAs. In this manuscript we provide direct proof for the existing hypothesis that 3'-CITEs are modular and transferable by recombination in nature, and that this is associated with an advantage for the created virus. By characterizing a newly identified Melon necrotic spot virus (MNSV; Tombusviridae) isolate, which is able to overcome eukaryotic translation initiation factor 4E (eIF4E)-mediated resistance, we found that it contains a 55 nucleotide insertion in its 3'-UTR. We provide strong evidence that this insertion was acquired by interfamilial recombination with the 3'-UTR of an Asiatic Cucurbit aphid-borne yellows virus (CABYV; Luteoviridae). By constructing chimeric viruses, we showed that this recombined sequence is responsible for resistance breaking. Analysis of the translational efficiency of reporter constructs showed that this sequence functions as a novel 3'-CITE in both resistant and susceptible plants, being essential for translation control in resistant plants. In conclusion, we showed that a recombination event between two clearly identified viruses from different families led to the transfer of exactly the sequence corresponding to a functional RNA element, giving rise to a new isolate with the capacity to infect an otherwise nonsusceptible host. © 2013 The Authors. New Phytologist © 2013 New Phytologist Trust.

Feature co-localization landscape of the human genome

PubMed Central

Ng, Siu-Kin; Hu, Taobo; Long, Xi; Chan, Cheuk-Hin; Tsang, Shui-Ying; Xue, Hong

2016-01-01

Although feature co-localizations could serve as useful guide-posts to genome architecture, a comprehensive and quantitative feature co-localization map of the human genome has been lacking. Herein we show that, in contrast to the conventional bipartite division of genomic sequences into genic and inter-genic regions, pairwise co-localizations of forty-two genomic features in the twenty-two autosomes based on 50-kb to 2,000-kb sequence windows indicate a tripartite zonal architecture comprising Genic zones enriched with gene-related features and Alu-elements; Proximal zones enriched with MIR- and L2-elements, transcription-factor-binding-sites (TFBSs), and conserved-indels (CIDs); and Distal zones enriched with L1-elements. Co-localizations between single-nucleotide-polymorphisms (SNPs) and copy-number-variations (CNVs) reveal a fraction of sequence windows displaying steeply enhanced levels of SNPs, CNVs and recombination rates that point to active adaptive evolution in such pathways as immune response, sensory perceptions, and cognition. The strongest positive co-localization observed between TFBSs and CIDs suggests a regulatory role of CIDs in cooperation with TFBSs. The positive co-localizations of cancer somatic CNVs (CNVT) with all Proximal zone and most Genic zone features, in contrast to the distinctly more restricted co-localizations exhibited by germline CNVs (CNVG), reveal disparate distributions of CNVTs and CNVGs indicative of dissimilarity in their underlying mechanisms. PMID:26854351

CORE-SINEs: eukaryotic short interspersed retroposing elements with common sequence motifs.

PubMed

Gilbert, N; Labuda, D

1999-03-16

A 65-bp "core" sequence is dispersed in hundreds of thousands copies in the human genome. This sequence was found to constitute the central segment of a group of short interspersed elements (SINEs), referred to as mammalian-wide interspersed repeats, that proliferated before the radiation of placental mammals. Here, we propose that the core identifies an ancient tRNA-like SINE element, which survived in different lineages such as mammals, reptiles, birds, and fish, as well as mollusks, presumably for >550 million years. This element gave rise to a number of sequence families (CORE-SINEs), including mammalian-wide interspersed repeats, whose distinct 3' ends are shared with different families of long interspersed elements (LINEs). The evolutionary success of the generic CORE-SINE element can be related to the recruitment of the internal promoter from highly transcribed host RNA as well as to its capacity to adapt to changing retropositional opportunities by sequence exchange with actively amplifying LINEs. It reinforces the notion that the very existence of SINEs depends on the cohabitation with both LINEs and the host genome.

CORE-SINEs: Eukaryotic short interspersed retroposing elements with common sequence motifs

PubMed Central

Gilbert, Nicolas; Labuda, Damian

1999-01-01

A 65-bp “core” sequence is dispersed in hundreds of thousands copies in the human genome. This sequence was found to constitute the central segment of a group of short interspersed elements (SINEs), referred to as mammalian-wide interspersed repeats, that proliferated before the radiation of placental mammals. Here, we propose that the core identifies an ancient tRNA-like SINE element, which survived in different lineages such as mammals, reptiles, birds, and fish, as well as mollusks, presumably for >550 million years. This element gave rise to a number of sequence families (CORE-SINEs), including mammalian-wide interspersed repeats, whose distinct 3′ ends are shared with different families of long interspersed elements (LINEs). The evolutionary success of the generic CORE-SINE element can be related to the recruitment of the internal promoter from highly transcribed host RNA as well as to its capacity to adapt to changing retropositional opportunities by sequence exchange with actively amplifying LINEs. It reinforces the notion that the very existence of SINEs depends on the cohabitation with both LINEs and the host genome. PMID:10077603

ElemeNT: a computational tool for detecting core promoter elements.

PubMed

Sloutskin, Anna; Danino, Yehuda M; Orenstein, Yaron; Zehavi, Yonathan; Doniger, Tirza; Shamir, Ron; Juven-Gershon, Tamar

2015-01-01

Core promoter elements play a pivotal role in the transcriptional output, yet they are often detected manually within sequences of interest. Here, we present 2 contributions to the detection and curation of core promoter elements within given sequences. First, the Elements Navigation Tool (ElemeNT) is a user-friendly web-based, interactive tool for prediction and display of putative core promoter elements and their biologically-relevant combinations. Second, the CORE database summarizes ElemeNT-predicted core promoter elements near CAGE and RNA-seq-defined Drosophila melanogaster transcription start sites (TSSs). ElemeNT's predictions are based on biologically-functional core promoter elements, and can be used to infer core promoter compositions. ElemeNT does not assume prior knowledge of the actual TSS position, and can therefore assist in annotation of any given sequence. These resources, freely accessible at http://lifefaculty.biu.ac.il/gershon-tamar/index.php/resources, facilitate the identification of core promoter elements as active contributors to gene expression.

[Influence of "prehistory" of sequential movements of the right and the left hand on reproduction: coding of positions, movements and sequence structure].

PubMed

Bobrova, E V; Liakhovetskiĭ, V A; Borshchevskaia, E R

2011-01-01

The dependence of errors during reproduction of a sequence of hand movements without visual feedback on the previous right- and left-hand performance ("prehistory") and on positions in space of sequence elements (random or ordered by the explicit rule) was analyzed. It was shown that the preceding information about the ordered positions of the sequence elements was used during right-hand movements, whereas left-hand movements were performed with involvement of the information about the random sequence. The data testify to a central mechanism of the analysis of spatial structure of sequence elements. This mechanism activates movement coding specific for the left hemisphere (vector coding) in case of an ordered sequence structure and positional coding specific for the right hemisphere in case of a random sequence structure.

The Evolution of Bony Vertebrate Enhancers at Odds with Their Coding Sequence Landscape.

PubMed

Yousaf, Aisha; Sohail Raza, Muhammad; Ali Abbasi, Amir

2015-08-06

Enhancers lie at the heart of transcriptional and developmental gene regulation. Therefore, changes in enhancer sequences usually disrupt the target gene expression and result in disease phenotypes. Despite the well-established role of enhancers in development and disease, evolutionary sequence studies are lacking. The current study attempts to unravel the puzzle of bony vertebrates' conserved noncoding elements (CNE) enhancer evolution. Bayesian phylogenetics of enhancer sequences spotlights promising interordinal relationships among placental mammals, proposing a closer relationship between humans and laurasiatherians while placing rodents at the basal position. Clock-based estimates of enhancer evolution provided a dynamic picture of interspecific rate changes across the bony vertebrate lineage. Moreover, coelacanth in the study augmented our appreciation of the vertebrate cis-regulatory evolution during water-land transition. Intriguingly, we observed a pronounced upsurge in enhancer evolution in land-dwelling vertebrates. These novel findings triggered us to further investigate the evolutionary trend of coding as well as CNE nonenhancer repertoires, to highlight the relative evolutionary dynamics of diverse genomic landscapes. Surprisingly, the evolutionary rates of enhancer sequences were clearly at odds with those of the coding and the CNE nonenhancer sequences during vertebrate adaptation to land, with land vertebrates exhibiting significantly reduced rates of coding sequence evolution in comparison to their fast evolving regulatory landscape. The observed variation in tetrapod cis-regulatory elements caused the fine-tuning of associated gene regulatory networks. Therefore, the increased evolutionary rate of tetrapods' enhancer sequences might be responsible for the variation in developmental regulatory circuits during the process of vertebrate adaptation to land. © The Author(s) 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

The human oxytocin gene promoter is regulated by estrogens.

PubMed

Richard, S; Zingg, H H

1990-04-15

Gonadal steroids affect brain function primarily by altering the expression of specific genes, yet the specific mechanisms by which neuronal target genes undergo such regulation are unknown. Recent evidence suggests that the expression of the neuropeptide gene for oxytocin (OT) is modulated by estrogens. We therefore examined the possibility that this regulation occurred via a direct interaction of the estrogen-receptor complex with cis-acting elements flanking the OT gene. DNA-mediated gene transfer experiments were performed using Neuro-2a neuroblastoma cells and chimeric plasmids containing portions of the human OT gene 5'-glanking region linked to the chloramphenicol acetyltransferase gene. We identified a 19-base pair region located at -164 to -146 upstream of the transcription start site which is capable of conferring estrogen responsiveness to the homologous as well as to a heterologous promoter. The hormonal response is strictly dependent on the presence of intracellular estrogen receptors, since estrogen induced stimulation occurred only in Neuro-2a cells co-transfected with an expression vector for the human estrogen receptor. The identified region contains a novel imperfect palindrome (GGTGACCTTGACC) with sequence similarity to other estrogen response elements (EREs). To define cis-acting elements that function in synergism with the ERE, sequences 3' to the ERE were deleted, including the CCAAT box, two additional motifs corresponding to the right half of the ERE palindrome (TGACC), as well as a CTGCTAA heptamer similar to the "elegans box" found in Caenorhabditis elegans. Interestingly, optimal function of the identified ERE was fully independent of these elements and only required a short promoter region (-49 to +36). Our studies define a molecular mechanism by which estrogens can directly modulate OT gene expression. However, only a subset of OT neurons are capable of binding estrogens, therefore, direct action of estrogens on the OT gene may be restricted to a subpopulation of OT neurons.

Identification of estrogen-responsive genes using a genome-wide analysis of promoter elements for transcription factor binding sites.

PubMed

Kamalakaran, Sitharthan; Radhakrishnan, Senthil K; Beck, William T

2005-06-03

We developed a pipeline to identify novel genes regulated by the steroid hormone-dependent transcription factor, estrogen receptor, through a systematic analysis of upstream regions of all human and mouse genes. We built a data base of putative promoter regions for 23,077 human and 19,984 mouse transcripts from National Center for Biotechnology Information annotation and 8793 human and 6785 mouse promoters from the Data Base of Transcriptional Start Sites. We used this data base of putative promoters to identify potential targets of estrogen receptor by identifying estrogen response elements (EREs) in their promoters. Our program correctly identified EREs in genes known to be regulated by estrogen in addition to several new genes whose putative promoters contained EREs. We validated six genes (KIAA1243, NRIP1, MADH9, NME3, TPD52L, and ABCG2) to be estrogen-responsive in MCF7 cells using reverse transcription PCR. To allow for extensibility of our program in identifying targets of other transcription factors, we have built a Web interface to access our data base and programs. Our Web-based program for Promoter Analysis of Genome, PAGen@UIC, allows a user to identify putative target genes for vertebrate transcription factors through the analysis of their upstream sequences. The interface allows the user to search the human and mouse promoter data bases for potential target genes containing one or more listed transcription factor binding sites (TFBSs) in their upstream elements, using either regular expression-based consensus or position weight matrices. The data base can also be searched for promoters harboring user-defined TFBSs given as a consensus or a position weight matrix. Furthermore, the user can retrieve putative promoter sequences for any given gene together with identified TFBSs located on its promoter. Orthologous promoters are also analyzed to determine conserved elements.

Prediction and phylogenetic analysis of mammalian short interspersed elements (SINEs).

PubMed

Rogozin, I B; Mayorov, V I; Lavrentieva, M V; Milanesi, L; Adkison, L R

2000-09-01

The presence of repetitive elements can create serious problems for sequence analysis, especially in the case of homology searches in nucleotide sequence databases. Repetitive elements should be treated carefully by using special programs and databases. In this paper, various aspects of SINE (short interspersed repetitive element) identification, analysis and evolution are discussed.

Characterization of the repetitive DNA elements in the genome of fish lymphocystis disease viruses.

PubMed

Schnitzler, P; Darai, G

1989-09-01

The complete DNA nucleotide sequence of the repetitive DNA elements in the genome of fish lymphocystis disease virus (FLDV) isolated from two different species (flounder and dab) was determined. The size of these repetitive DNA elements was found to be 1413 bp which corresponds to the DNA sequences of the 5' terminus of the EcoRI DNA fragment B (0.034 to 0.052 m.u.) and to the EcoRI DNA fragment M (0.718 to 0.736 m.u.) of the FLDV genome causing lymphocystis disease in flounder and plaice. The degree of DNA nucleotide homology between both regions was found to be 99%. The repetitive DNA element in the genome of FLDV isolated from other fish species (dab) was identified and is located within the EcoRI DNA fragment B and J of the viral genome. The DNA nucleotide sequence of one duplicate of this repetition (EcoRI DNA fragment J) was determined (1410 bp) and compared to the DNA nucleotide sequences of the repetitive DNA elements of the genome of FLDV isolated from flounder. It was found that the repetitive DNA elements of the genome of FLDV derived from two different fish species are highly conserved and possess a degree of DNA sequence homology of 94%. The DNA sequences of each strand of the individual repetitive element possess one open reading frame.

Stress induced gene expression drives transient DNA methylation changes at adjacent repetitive elements.

PubMed

Secco, David; Wang, Chuang; Shou, Huixia; Schultz, Matthew D; Chiarenza, Serge; Nussaume, Laurent; Ecker, Joseph R; Whelan, James; Lister, Ryan

2015-07-21

Cytosine DNA methylation (mC) is a genome modification that can regulate the expression of coding and non-coding genetic elements. However, little is known about the involvement of mC in response to environmental cues. Using whole genome bisulfite sequencing to assess the spatio-temporal dynamics of mC in rice grown under phosphate starvation and recovery conditions, we identified widespread phosphate starvation-induced changes in mC, preferentially localized in transposable elements (TEs) close to highly induced genes. These changes in mC occurred after changes in nearby gene transcription, were mostly DCL3a-independent, and could partially be propagated through mitosis, however no evidence of meiotic transmission was observed. Similar analyses performed in Arabidopsis revealed a very limited effect of phosphate starvation on mC, suggesting a species-specific mechanism. Overall, this suggests that TEs in proximity to environmentally induced genes are silenced via hypermethylation, and establishes the temporal hierarchy of transcriptional and epigenomic changes in response to stress.

The impact of transposable elements in environmental adaptation.

PubMed

Casacuberta, Elena; González, Josefa

2013-03-01

Transposable elements (TEs) play an important role in the responsive capacity of their hosts in the face of environmental challenges. The variety of mechanisms by which TEs influence the capacity of adaptation of the host is as large as the variety of TEs and host genomes. For example, TEs might directly affect the function of individual genes, provide a mechanism for rapidly acquiring new genetic material and disseminate regulatory elements that can lead to the creation of stress-inducible regulatory networks. In this review, we summarize recent examples that are part of an increasing body of evidence suggesting a significant role of TEs in the host response to an ever-changing environment, both in prokaryote and in eukaryote organisms. We argue that in the near future, the increasing availability of genome sequences and the development of new tools to discover and analyse TE insertions will further show the relevant role of TEs in environmental adaptation. © 2013 Blackwell Publishing Ltd.

Transcriptional Activation Signals Found in the Epstein-Barr Virus (EBV) Latency C Promoter Are Conserved in the Latency C Promoter Sequences from Baboon and Rhesus Monkey EBV-Like Lymphocryptoviruses (Cercopithicine Herpesviruses 12 and 15)

PubMed Central

Fuentes-Pananá, Ezequiel M.; Swaminathan, Sankar; Ling, Paul D.

1999-01-01

The Epstein-Barr virus (EBV) EBNA2 protein is a transcriptional activator that controls viral latent gene expression and is essential for EBV-driven B-cell immortalization. EBNA2 is expressed from the viral C promoter (Cp) and regulates its own expression by activating Cp through interaction with the cellular DNA binding protein CBF1. Through regulation of Cp and EBNA2 expression, EBV controls the pattern of latent protein expression and the type of latency established. To gain further insight into the important regulatory elements that modulate Cp usage, we isolated and sequenced the Cp regions corresponding to nucleotides 10251 to 11479 of the EBV genome (−1079 to +144 relative to the transcription initiation site) from the EBV-like lymphocryptoviruses found in baboons (herpesvirus papio; HVP) and Rhesus macaques (RhEBV). Sequence comparison of the approximately 1,230-bp Cp regions from these primate viruses revealed that EBV and HVP Cp sequences are 64% conserved, EBV and RhEBV Cp sequences are 66% conserved, and HVP and RhEBV Cp sequences are 65% conserved relative to each other. Approximately 50% of the residues are conserved among all three sequences, yet all three viruses have retained response elements for glucocorticoids, two positionally conserved CCAAT boxes, and positionally conserved TATA boxes. The putative EBNA2 100-bp enhancers within these promoters contain 54 conserved residues, and the binding sites for CBF1 and CBF2 are well conserved. Cp usage in the HVP- and RhEBV-transformed cell lines was detected by S1 nuclease protection analysis. Transient-transfection analysis showed that promoters of both HVP and RhEBV are responsive to EBNA2 and that they bind CBF1 and CBF2 in gel mobility shift assays. These results suggest that similar mechanisms for regulation of latent gene expression are conserved among the EBV-related lymphocryptoviruses found in nonhuman primates. PMID:9847397

Transcriptional activation signals found in the Epstein-Barr virus (EBV) latency C promoter are conserved in the latency C promoter sequences from baboon and Rhesus monkey EBV-like lymphocryptoviruses (cercopithicine herpesviruses 12 and 15).

PubMed

Fuentes-Pananá, E M; Swaminathan, S; Ling, P D

1999-01-01

The Epstein-Barr virus (EBV) EBNA2 protein is a transcriptional activator that controls viral latent gene expression and is essential for EBV-driven B-cell immortalization. EBNA2 is expressed from the viral C promoter (Cp) and regulates its own expression by activating Cp through interaction with the cellular DNA binding protein CBF1. Through regulation of Cp and EBNA2 expression, EBV controls the pattern of latent protein expression and the type of latency established. To gain further insight into the important regulatory elements that modulate Cp usage, we isolated and sequenced the Cp regions corresponding to nucleotides 10251 to 11479 of the EBV genome (-1079 to +144 relative to the transcription initiation site) from the EBV-like lymphocryptoviruses found in baboons (herpesvirus papio; HVP) and Rhesus macaques (RhEBV). Sequence comparison of the approximately 1,230-bp Cp regions from these primate viruses revealed that EBV and HVP Cp sequences are 64% conserved, EBV and RhEBV Cp sequences are 66% conserved, and HVP and RhEBV Cp sequences are 65% conserved relative to each other. Approximately 50% of the residues are conserved among all three sequences, yet all three viruses have retained response elements for glucocorticoids, two positionally conserved CCAAT boxes, and positionally conserved TATA boxes. The putative EBNA2 100-bp enhancers within these promoters contain 54 conserved residues, and the binding sites for CBF1 and CBF2 are well conserved. Cp usage in the HVP- and RhEBV-transformed cell lines was detected by S1 nuclease protection analysis. Transient-transfection analysis showed that promoters of both HVP and RhEBV are responsive to EBNA2 and that they bind CBF1 and CBF2 in gel mobility shift assays. These results suggest that similar mechanisms for regulation of latent gene expression are conserved among the EBV-related lymphocryptoviruses found in nonhuman primates.

Functional Analysis of Promoter Region from Eel Cytochrome P450 1A1 Gene in Transgenic Medaka.

PubMed

Ogino; Itakura; Kato; Aoki; Sato

1999-07-01

: Transcription of the CYP1A1 genes in mammals and fish is stimulated by polyaromatic hydrocarbons. DNA sequencing analysis revealed that CYP1A1 gene in eel (Anguilla japonica) contains two kinds of putative cis-acting regulatory elements, XRE (xenobiotic-responsive element) and ERE (estrogen-responsive element). XRE is known as the enhancer that is responsible for the inducibility of the genes of CYP1A1 and some other drug-metabolizing enzymes. In the eel CYP1A1 gene, XRE motifs are distributed as follows: five times in the region from -2136 to -1125 bp, XRE(-6) to (-2); once in the proximal basal promoter region, XRE(-1); and once in the first intron, XRE(+1). The region between XRE(-2) and XRE(-1) contains three ERE motifs. To investigate the function of the cis-acting regulatory elements in the eel CYP1A1 gene, recombinant plasmids prepared with its 5' upstream sequence and the structural gene for luciferase were microinjected into fertilized eggs of medaka at the one-cell stage. Hatched fry were treated with 3-methylcholanthrene, and the transcription efficiency was assayed using competitive polymerase chain reaction analysis. Deletion of the region containing the five XREs, XRE(-6) to XRE(-2), and the point mutation of XRE(-1) reduced the inducible expressions by 75% and 56%, respectively, showing apparent dependency of the drug induction on the XREs. Constitutive expression, however, was not significantly affected by deletion or disruption of the XREs. When the region between XRE(-2) and XRE(-1) containing no XREs but three ERE motifs was internally deleted, the inducible expression and the constitutive expression were reduced by 88% and 75%, respectively. Replacement of this region with a partial fragment of eel CYP1A1 complementary DNA, with slight alteration of the distance between the five XREs and XRE(-1), reduced the inducible expression and the constitutive expression by 91% and 60%, respectively. These results strongly suggest that not only XRE but also other regulatory elements, possibly ERE, play an important role in induced and constitutive expressions of the eel CYP1A1 gene.

AT-rich sequence elements promote nascent transcript cleavage leading to RNA polymerase II termination

PubMed Central

White, Eleanor; Kamieniarz-Gdula, Kinga; Dye, Michael J.; Proudfoot, Nick J.

2013-01-01

RNA Polymerase II (Pol II) termination is dependent on RNA processing signals as well as specific terminator elements located downstream of the poly(A) site. One of the two major terminator classes described so far is the Co-Transcriptional Cleavage (CoTC) element. We show that homopolymer A/T tracts within the human β-globin CoTC-mediated terminator element play a critical role in Pol II termination. These short A/T tracts, dispersed within seemingly random sequences, are strong terminator elements, and bioinformatics analysis confirms the presence of such sequences in 70% of the putative terminator regions (PTRs) genome-wide. PMID:23258704

Sequenced drive for rotary valves

DOEpatents

Mittell, Larry C.

1981-01-01

A sequenced drive for rotary valves which provides the benefits of applying rotary and linear motions to the movable sealing element of the valve. The sequenced drive provides a close approximation of linear motion while engaging or disengaging the movable element with the seat minimizing wear and damage due to scrubbing action. The rotary motion of the drive swings the movable element out of the flowpath thus eliminating obstruction to flow through the valve.

Genetic exchange between endogenous and exogenous LINE-1 repetitive elements in mouse cells.

PubMed Central

Belmaaza, A; Wallenburg, J C; Brouillette, S; Gusew, N; Chartrand, P

1990-01-01

The repetitive LINE (L1) elements of the mouse, which are present at about 10(5) copies per genome and share over 80% of sequence homology, were examined for their ability to undergo genetic exchange with exogenous L1 sequences. The exogenous L1 sequences, carried by a shuttle vector, consisted of an internal fragment from L1Md-A2, a previously described member of the L1 family of the mouse. Using an assay that does not require the reconstitution of a selectable marker we found that this vector, in either circular or linear form, acquired DNA sequences from endogenous L1 elements at a frequency of 10(-3) to 10(-4) per rescued vector. Physical analysis of the acquired L1 sequences revealed that distinct endogenous L1 elements acted as donors and that different subfamilies participated. These results demonstrate that L1 elements are readily capable of genetic exchange. Apart from gene conversion events, the acquisition of L1 sequences outside the region of homology suggested that a second mechanism was also involved in the genetic exchange. A model which accounts for this mechanism is presented and its potential implication on the rearrangement of L1 elements is discussed. Images PMID:1978749

Effects of learning with explicit elaboration on implicit transfer of visuomotor sequence learning.

PubMed

Tanaka, Kanji; Watanabe, Katsumi

2013-08-01

Intervals between stimuli and/or responses have significant influences on sequential learning. In the present study, we investigated whether transfer would occur even when the intervals and the visual configurations in a sequence were drastically changed so that participants did not notice that the required sequences of responses were identical. In the experiment, two (or three) sequential button presses comprised a "set," and nine (or six) consecutive sets comprised a "hyperset." In the first session, participants learned either a 2 × 9 or 3 × 6 hyperset by trial and error until they completed it 20 times without error. In the second block, the 2 × 9 (3 × 6) hyperset was changed into the 3 × 6 (2 × 9) hyperset, resulting in different visual configurations and intervals between stimuli and responses. Participants were assigned into two groups: the Identical and Random groups. In the Identical group, the sequence (i.e., the buttons to be pressed) in the second block was identical to that in the first block. In the Random group, a new hyperset was learned. Even in the Identical group, no participants noticed that the sequences were identical. Nevertheless, a significant transfer of performance occurred. However, in the subsequent experiment that did not require explicit trial-and-error learning in the first session, implicit transfer in the second session did not occur. These results indicate that learning with explicit elaboration strengthens the implicit representation of the sequence order as a whole; this might occur independently of the intervals between elements and enable implicit transfer.

A role for palindromic structures in the cis-region of maize Sirevirus LTRs in transposable element evolution and host epigenetic response.

PubMed

Bousios, Alexandros; Diez, Concepcion M; Takuno, Shohei; Bystry, Vojtech; Darzentas, Nikos; Gaut, Brandon S

2016-02-01

Transposable elements (TEs) proliferate within the genome of their host, which responds by silencing them epigenetically. Much is known about the mechanisms of silencing in plants, particularly the role of siRNAs in guiding DNA methylation. In contrast, little is known about siRNA targeting patterns along the length of TEs, yet this information may provide crucial insights into the dynamics between hosts and TEs. By focusing on 6456 carefully annotated, full-length Sirevirus LTR retrotransposons in maize, we show that their silencing associates with underlying characteristics of the TE sequence and also uncover three features of the host-TE interaction. First, siRNA mapping varies among families and among elements, but particularly along the length of elements. Within the cis-regulatory portion of the LTRs, a complex palindrome-rich region acts as a hotspot of both siRNA matching and sequence evolution. These patterns are consistent across leaf, tassel, and immature ear libraries, but particularly emphasized for floral tissues and 21- to 22-nt siRNAs. Second, this region has the ability to form hairpins, making it a potential template for the production of miRNA-like, hairpin-derived small RNAs. Third, Sireviruses are targeted by siRNAs as a decreasing function of their age, but the oldest elements remain highly targeted, partially by siRNAs that cross-map to the youngest elements. We show that the targeting of older Sireviruses reflects their conserved palindromes. Altogether, we hypothesize that the palindromes aid the silencing of active elements and influence transposition potential, siRNA targeting levels, and ultimately the fate of an element within the genome. © 2016 Bousios et al.; Published by Cold Spring Harbor Laboratory Press.

Genome-wide identification of conserved intronic non-coding sequences using a Bayesian segmentation approach.

PubMed

Algama, Manjula; Tasker, Edward; Williams, Caitlin; Parslow, Adam C; Bryson-Richardson, Robert J; Keith, Jonathan M

2017-03-27

Computational identification of non-coding RNAs (ncRNAs) is a challenging problem. We describe a genome-wide analysis using Bayesian segmentation to identify intronic elements highly conserved between three evolutionarily distant vertebrate species: human, mouse and zebrafish. We investigate the extent to which these elements include ncRNAs (or conserved domains of ncRNAs) and regulatory sequences. We identified 655 deeply conserved intronic sequences in a genome-wide analysis. We also performed a pathway-focussed analysis on genes involved in muscle development, detecting 27 intronic elements, of which 22 were not detected in the genome-wide analysis. At least 87% of the genome-wide and 70% of the pathway-focussed elements have existing annotations indicative of conserved RNA secondary structure. The expression of 26 of the pathway-focused elements was examined using RT-PCR, providing confirmation that they include expressed ncRNAs. Consistent with previous studies, these elements are significantly over-represented in the introns of transcription factors. This study demonstrates a novel, highly effective, Bayesian approach to identifying conserved non-coding sequences. Our results complement previous findings that these sequences are enriched in transcription factors. However, in contrast to previous studies which suggest the majority of conserved sequences are regulatory factor binding sites, the majority of conserved sequences identified using our approach contain evidence of conserved RNA secondary structures, and our laboratory results suggest most are expressed. Functional roles at DNA and RNA levels are not mutually exclusive, and many of our elements possess evidence of both. Moreover, ncRNAs play roles in transcriptional and post-transcriptional regulation, and this may contribute to the over-representation of these elements in introns of transcription factors. We attribute the higher sensitivity of the pathway-focussed analysis compared to the genome-wide analysis to improved alignment quality, suggesting that enhanced genomic alignments may reveal many more conserved intronic sequences.

Speed in Information Processing with a Computer Driven Visual Display in a Real-time Digital Simulation. M.S. Thesis - Virginia Polytechnic Inst.

NASA Technical Reports Server (NTRS)

Kyle, R. G.

1972-01-01

Information transfer between the operator and computer-generated display systems is an area where the human factors engineer discovers little useful design data relating human performance to system effectiveness. This study utilized a computer-driven, cathode-ray-tube graphic display to quantify human response speed in a sequential information processing task. The performance criteria was response time to sixteen cell elements of a square matrix display. A stimulus signal instruction specified selected cell locations by both row and column identification. An equal probable number code, from one to four, was assigned at random to the sixteen cells of the matrix and correspondingly required one of four, matched keyed-response alternatives. The display format corresponded to a sequence of diagnostic system maintenance events, that enable the operator to verify prime system status, engage backup redundancy for failed subsystem components, and exercise alternate decision-making judgements. The experimental task bypassed the skilled decision-making element and computer processing time, in order to determine a lower bound on the basic response speed for given stimulus/response hardware arrangement.

Computational prediction and experimental verification of HVA1-like abscisic acid responsive promoters in rice (Oryza sativa).

PubMed

Ross, Christian; Shen, Qingxi J

2006-09-01

Abscisic acid (ABA) is one of the central plant hormones, responsible for controlling both maturation and germination in seeds, as well as mediating adaptive responses to desiccation, injury, and pathogen infection in vegetative tissues. Thorough analyses of two barley genes, HVA1 and HVA22, indicate that their response to ABA relies on the interaction of two cis-acting elements in their promoters, an ABA response element (ABRE) and a coupling element (CE). Together, they form an ABA response promoter complex (ABRC). Comparison of promoters of barley HVA1 and it rice orthologue indicates that the structures and sequences of their ABRCs are highly similar. Prediction of ABA responsive genes in the rice genome is then tractable to a bioinformatics approach based on the structures of the well-defined barley ABRCs. Here we describe a model developed based on the consensus, inter-element spacing and orientations of experimentally determined ABREs and CEs. Our search of the rice promoter database for promoters that fit the model has generated a partial list of genes in rice that have a high likelihood of being involved in the ABA signaling network. The ABA inducibility of some of the rice genes identified was validated with quantitative reverse transcription PCR (QPCR). By limiting our input data to known enhancer modules and experimentally derived rules, we have generated a high confidence subset of ABA-regulated genes. The results suggest that the pathways by which cereals respond to biotic and abiotic stresses overlap significantly, and that regulation is not confined to the level transcription. The large fraction of putative regulatory genes carrying HVA1-like enhancer modules in their promoters suggests the ABA signal enters at multiple points into a complex regulatory network that remains largely unmapped.

Variable responses of two VlMYBA gene promoters to ABA and ACC in Kyoho grape berries.

PubMed

Zhai, Xiawan; Zhang, Yushu; Kai, Wenbin; Liang, Bin; Jiang, Li; Du, Yangwei; Wang, Juan; Sun, Yufei; Leng, Ping

2017-04-01

The VlMYBA subfamily of transcription factors has been known to be the functional regulators in anthocyanin biosynthesis in red grapes. In this study, the expressions of the VlMYBA1-2 and VlMYBA 2 genes, and the responses of the VlMYBA1-2/2 promoters to ABA and ACC treatments in Kyoho grape berries are examined through quantitative real-time PCR analysis and the transient expression assay. The results show that the expressions of VlMYBA1-2/2 increase dramatically after véraison and reach their highest levels when the berries are nearly fully ripe. Exogenous ABA promotes the expressions of VlMYBA1-2/2, whereas the ACC treatment increases the expression of VlMYBA2, however, it has no effect on VlMYBA1-2. The ABA treatment has a faster and stronger effect on berry pigmentation than ACC does. The VlMYBA1-2 promoter sequence contains two ABA response elements (ABRE) but no ethylene response element (ERE), whereas the VlMYBA2 promoter sequence contains two ABRE and one ERE in the upstream region of the start codon. The VlMYBA2 promoter can be activated by both ABA (more effective) and ACC, whereas the VlMYBA1-2 promoter can be activated by ABA only. In sum, ABA can promote the coloring of Kyoho grape by the promotion of VlMYBA1-2/2 transcriptions via activating the response of their promoters to ABA, whereas ethylene only regulates VlMYBA2 through the response activation of its promoter to ACC which partially enhances the coloring. Copyright © 2017 Elsevier GmbH. All rights reserved.

Promoter analysis reveals cis-regulatory motifs associated with the expression of the WRKY transcription factor CrWRKY1 in Catharanthus roseus.

PubMed

Yang, Zhirong; Patra, Barunava; Li, Runzhi; Pattanaik, Sitakanta; Yuan, Ling

2013-12-01

WRKY transcription factors (TFs) are emerging as an important group of regulators of plant secondary metabolism. However, the cis-regulatory elements associated with their regulation have not been well characterized. We have previously demonstrated that CrWRKY1, a member of subgroup III of the WRKY TF family, regulates biosynthesis of terpenoid indole alkaloids in the ornamental and medicinal plant, Catharanthus roseus. Here, we report the isolation and functional characterization of the CrWRKY1 promoter. In silico analysis of the promoter sequence reveals the presence of several potential TF binding motifs, indicating the involvement of additional TFs in the regulation of the TIA pathway. The CrWRKY1 promoter can drive the expression of a β-glucuronidase (GUS) reporter gene in native (C. roseus protoplasts and transgenic hairy roots) and heterologous (transgenic tobacco seedlings) systems. Analysis of 5'- or 3'-end deletions indicates that the sequence located between positions -140 to -93 bp and -3 to +113 bp, relative to the transcription start site, is critical for promoter activity. Mutation analysis shows that two overlapping as-1 elements and a CT-rich motif contribute significantly to promoter activity. The CrWRKY1 promoter is induced in response to methyl jasmonate (MJ) treatment and the promoter region between -230 and -93 bp contains a putative MJ-responsive element. The CrWRKY1 promoter can potentially be used as a tool to isolate novel TFs involved in the regulation of the TIA pathway.

A proximal promoter region of Arabidopsis DREB2C confers tissue-specific expression under heat stress.

PubMed

Chen, Huan; Je, Jihyun; Song, Chieun; Hwang, Jung Eun; Lim, Chae Oh

2012-09-01

The dehydration-responsive element-binding factor 2C (DREB2C) is a member of the CBF/DREB subfamily of proteins, which contains a single APETALA2/Ethylene responsive element-binding factor (AP2/ERF) domain. To identify the expression pattern of the DREB2C gene, which contains multiple transcription cis-regulatory elements in its promoter, an approximately 1.4 kb upstream DREB2C sequence was fused to the β-glucuronidase reporter gene (GUS) and the recombinant p1244 construct was transformed into Arabidopsis thaliana (L.) Heynh. The promoter of the gene directed prominent GUS activity in the vasculature in diverse young dividing tissues. Upon applying heat stress (HS), GUS staining was also enhanced in the vasculature of the growing tissues. Analysis of a series of 5'-deletions of the DREB2C promoter revealed that a proximal upstream sequence sufficient for the tissue-specific spatial and temporal induction of GUS expression by HS is localized in the promoter region between -204 and -34 bps relative to the transcriptional start site. Furthermore, electrophoretic mobility shift assay (EMSA) demonstrated that nuclear protein binding activities specific to a -120 to -32 bp promoter fragment increased after HS. These results indicate that the TATA-proximal region and some latent trans-acting factors may cooperate in HS-induced activation of the Arabidopsis DREB2C promoter. © 2012 Institute of Botany, Chinese Academy of Sciences.

The site-specific ribosomal insertion element type II of Bombyx mori (R2Bm) contains the coding sequence for a reverse transcriptase-like enzyme.

PubMed Central

Burke, W D; Calalang, C C; Eickbush, T H

1987-01-01

Two classes of DNA elements interrupt a fraction of the rRNA repeats of Bombyx mori. We have analyzed by genomic blotting and sequence analysis one class of these elements which we have named R2. These elements occupy approximately 9% of the rDNA units of B. mori and appear to be homologous to the type II rDNA insertions detected in Drosophila melanogaster. Approximately 25 copies of R2 exist within the B. mori genome, of which at least 20 are located at a precise location within otherwise typical rDNA units. Nucleotide sequence analysis has revealed that the 4.2-kilobase-pair R2 element has a single large open reading frame, occupying over 82% of the total length of the element. The central region of this 1,151-amino-acid open reading frame shows homology to the reverse transcriptase enzymes found in retroviruses and certain transposable elements. Amino acid homology of this region is highest to the mobile line 1 elements of mammals, followed by the mitochondrial type II introns of fungi, and the pol gene of retroviruses. Less homology exists with transposable elements of D. melanogaster and Saccharomyces cerevisiae. Two additional regions of sequence homology between L1 and R2 elements were also found outside the reverse transcriptase region. We suggest that the R2 elements are retrotransposons that are site specific in their insertion into the genome. Such mobility would enable these elements to occupy a small fraction of the rDNA units of B. mori despite their continual elimination from the rDNA locus by sequence turnover. Images PMID:2439905

Structure, replication efficiency and fragility of yeast ARS elements.

PubMed

Dhar, Manoj K; Sehgal, Shelly; Kaul, Sanjana

2012-05-01

DNA replication in eukaryotes initiates at specific sites known as origins of replication, or replicators. These replication origins occur throughout the genome, though the propensity of their occurrence depends on the type of organism. In eukaryotes, zones of initiation of replication spanning from about 100 to 50,000 base pairs have been reported. The characteristics of eukaryotic replication origins are best understood in the budding yeast Saccharomyces cerevisiae, where some autonomously replicating sequences, or ARS elements, confer origin activity. ARS elements are short DNA sequences of a few hundred base pairs, identified by their efficiency at initiating a replication event when cloned in a plasmid. ARS elements, although structurally diverse, maintain a basic structure composed of three domains, A, B and C. Domain A is comprised of a consensus sequence designated ACS (ARS consensus sequence), while the B domain has the DNA unwinding element and the C domain is important for DNA-protein interactions. Although there are ∼400 ARS elements in the yeast genome, not all of them are active origins of replication. Different groups within the genus Saccharomyces have ARS elements as components of replication origin. The present paper provides a comprehensive review of various aspects of ARSs, starting from their structural conservation to sequence thermodynamics. All significant and conserved functional sequence motifs within different types of ARS elements have been extensively described. Issues like silencing at ARSs, their inherent fragility and factors governing their replication efficiency have also been addressed. Progress in understanding crucial components associated with the replication machinery and timing at these ARS elements is discussed in the section entitled "The replicon revisited". Copyright © 2012 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.

Helicos BioSciences.

PubMed

Milos, Patrice

2008-04-01

Helicos BioSciences Corporation is a life sciences company developing revolutionary new single molecule sequencing technology to provide the path to the US$1000 genome. True Single Molecule Sequencing (tSMS) will drive advancements in pharmacogenomics that can enable a better understanding of an individual's susceptibility to disease, develop more effective disease diagnoses and differentiate response to disease therapies. During 2007, genome-wide disease-association studies, the encylopedia of DNA elements (ENCODE) and the published genome sequence of two individuals have revealed human genome variation far more extensive than originally believed. These also demonstrated that common variations explain only a fraction of the genetic basis of disease. Therefore, the capability to understand an individual genome is critical in setting the foundation for the next great revolution in healthcare. Helicos is committed to this vision and will provide cost-effective genome sequencing and comprehensive analysis of the transcribed genome that can unlock the era of personalized healthcare.

Dynamic mesolimbic dopamine signaling during action sequence learning and expectation violation

PubMed Central

Collins, Anne L.; Greenfield, Venuz Y.; Bye, Jeffrey K.; Linker, Kay E.; Wang, Alice S.; Wassum, Kate M.

2016-01-01

Prolonged mesolimbic dopamine concentration changes have been detected during spatial navigation, but little is known about the conditions that engender this signaling profile or how it develops with learning. To address this, we monitored dopamine concentration changes in the nucleus accumbens core of rats throughout acquisition and performance of an instrumental action sequence task. Prolonged dopamine concentration changes were detected that ramped up as rats executed each action sequence and declined after earned reward collection. With learning, dopamine concentration began to rise increasingly earlier in the execution of the sequence and ultimately backpropagated away from stereotyped sequence actions, becoming only transiently elevated by the most distal and unexpected reward predictor. Action sequence-related dopamine signaling was reactivated in well-trained rats if they became disengaged in the task and in response to an unexpected change in the value, but not identity of the earned reward. Throughout training and test, dopamine signaling correlated with sequence performance. These results suggest that action sequences can engender a prolonged mode of dopamine signaling in the nucleus accumbens core and that such signaling relates to elements of the motivation underlying sequence execution and is dynamic with learning, overtraining and violations in reward expectation. PMID:26869075

Selective Modulation of Some Forms of Schaffer Collateral-CA1 Synaptic Plasticity in Mice with a Disruption of the "CPEB-1" Gene

ERIC Educational Resources Information Center

Alarcon, Juan M.; Hodgman, Rebecca; Theis, Martin; Huang, Yi-Shuian; Kandel, Eric R.; Richter, Joel D.

2004-01-01

CPEB-1 is a sequence-specific RNA binding protein that stimulates the polyadenylation-induced translation of mRNAs containing the cytoplasmic polyadenylation element (CPE). Although CPEB-1 was identified originally in Xenopus oocytes, it has also been found at postsynaptic sites of hippocampal neurons where, in response to N-methyl-D-aspartate…

Structure and regulation of KGD1, the structural gene for yeast alpha-ketoglutarate dehydrogenase.

PubMed

Repetto, B; Tzagoloff, A

1989-06-01

Nuclear respiratory-defective mutants of Saccharomyces cerevisiae have been screened for lesions in the mitochondrial alpha-ketoglutarate dehydrogenase complex. Strains assigned to complementation group G70 were ascertained to be deficient in enzyme activity due to mutations in the KGD1 gene coding for the alpha-ketoglutarate dehydrogenase component of the complex. The KGD1 gene has been cloned by transformation of a representative kgd1 mutant, C225/U1, with a recombinant plasmid library of wild-type yeast nuclear DNA. Transformants containing the gene on a multicopy plasmid had three- to four-times-higher alpha-ketoglutarate dehydrogenase activity than did wild-type S. cerevisiae. Substitution of the chromosomal copy of KGD1 with a disrupted allele (kgd1::URA3) induced a deficiency in alpha-ketoglutarate dehydrogenase. The sequence of the cloned region of DNA which complements kgd1 mutants was found to have an open reading frame of 3,042 nucleotides capable of coding for a protein of Mw 114,470. The encoded protein had 38% identical residues with the reported sequence of alpha-ketoglutarate dehydrogenase from Escherichia coli. Two lines of evidence indicated that transcription of KGD1 is catabolite repressed. Higher steady-state levels of KGD1 mRNA were detected in wild-type yeast grown on the nonrepressible sugar galactose than in yeast grown on high glucose. Regulation of KGD1 was also studied by fusing different 5'-flanking regions of KGD1 to the lacZ gene of E. coli and measuring the expression of beta-galactosidase in yeast. Transformants harboring a fusion of 693 nucleotides of the 5'-flanking sequence expressed 10 times more beta-galactosidase activity when grown under derepressed conditions. The response to the carbon source was reduced dramatically when the same lacZ fusion was present in a hap2 or hap3 mutant. The promoter element(s) responsible for the regulated expression of KGD1 has been mapped to the -354 to -143 region. This region contained several putative activation sites with sequences matching the core element proposed to be essential for binding of the HAP2 and HAP3 regulatory proteins.

Coordinate action of distinct sequence elements localizes checkpoint kinase Hsl1 to the septin collar at the bud neck in Saccharomyces cerevisiae.

PubMed

Finnigan, Gregory C; Sterling, Sarah M; Duvalyan, Angela; Liao, Elizabeth N; Sargsyan, Aspram; Garcia, Galo; Nogales, Eva; Thorner, Jeremy

2016-07-15

Passage through the eukaryotic cell cycle requires processes that are tightly regulated both spatially and temporally. Surveillance mechanisms (checkpoints) exert quality control and impose order on the timing and organization of downstream events by impeding cell cycle progression until the necessary components are available and undamaged and have acted in the proper sequence. In budding yeast, a checkpoint exists that does not allow timely execution of the G2/M transition unless and until a collar of septin filaments has properly assembled at the bud neck, which is the site where subsequent cytokinesis will occur. An essential component of this checkpoint is the large (1518-residue) protein kinase Hsl1, which localizes to the bud neck only if the septin collar has been correctly formed. Hsl1 reportedly interacts with particular septins; however, the precise molecular determinants in Hsl1 responsible for its recruitment to this cellular location during G2 have not been elucidated. We performed a comprehensive mutational dissection and accompanying image analysis to identify the sequence elements within Hsl1 responsible for its localization to the septins at the bud neck. Unexpectedly, we found that this targeting is multipartite. A segment of the central region of Hsl1 (residues 611-950), composed of two tandem, semiredundant but distinct septin-associating elements, is necessary and sufficient for binding to septin filaments both in vitro and in vivo. However, in addition to 611-950, efficient localization of Hsl1 to the septin collar in the cell obligatorily requires generalized targeting to the cytosolic face of the plasma membrane, a function normally provided by the C-terminal phosphatidylserine-binding KA1 domain (residues 1379-1518) in Hsl1 but that can be replaced by other, heterologous phosphatidylserine-binding sequences. © 2016 Finnigan et al. This article is distributed by The American Society for Cell Biology under license from the author(s). Two months after publication it is available to the public under an Attribution–Noncommercial–Share Alike 3.0 Unported Creative Commons License (http://creativecommons.org/licenses/by-nc-sa/3.0).

The Genome Sequence of Avibacterium paragallinarum Strain CL Has a Large Repertoire of Insertion Sequence Elements.

PubMed

Horta-Valerdi, Guillermo; Sanchez-Alonso, Maria Patricia; Perez-Marquez, Victor M; Negrete-Abascal, Erasmo; Vaca-Pacheco, Sergio; Hernandez-Gonzalez, Ismael; Gomez-Lunar, Zulema; Olmedo-Álvarez, Gabriela; Vázquez-Cruz, Candelario

2017-04-13

The draft genome sequence of Avibacterium paragallinarum strain CL serovar C is reported here. The genome comprises 154 contigs corresponding to 2.4 Mb with 41% G+C content and many insertion sequence (IS) elements, a characteristic not previously reported in A. paragallinarum . Copyright © 2017 Horta-Valerdi et al.

A retrotransposable element from the mosquito Anopheles gambiae .

PubMed Central

Besansky, N J

1990-01-01

A family of middle repetitive elements from the African malaria vector Anopheles gambiae is described. Approximately 100 copies of the element, designated T1Ag, are dispersed in the genome. Full-length elements are 4.6 kilobase pairs in length, but truncation of the 5' end is common. Nucleotide sequences of one full-length, two 5'-truncated, and two 5' ends of T1Ag elements were determined and aligned to define a consensus sequence. Sequence analysis revealed two long, overlapping open reading frames followed by a polyadenylation signal, AATAAA, and a tail consisting of tandem repetitions of the motif TGAAA. No direct or inverted long terminal repeats (LTRs) were detected. The first open reading frame, 442 amino acids in length, includes a domain resembling that of nucleic acid-binding proteins. The second open reading frame, 975 amino acids long, resembles the reverse transcriptases of a category of retrotransposable elements without LTRs, variously termed class II retrotransposons, class III elements or non-LTR retrotransposons. Similarity at the sequence and structural levels places T1Ag in this category. Images PMID:1689457

A novel species-specific tandem repeat DNA family from Sinapis arvensis: detection of telomere-like sequences.

PubMed

Kapila, R; Das, S; Srivastava, P S; Lakshmikumaran, M

1996-08-01

DNA sequences representing a tandemly repeated DNA family of the Sinapis arvensis genome were cloned and characterized. The 700-bp tandem repeat family is represented by two clones, pSA35 and pSA52, which are 697 and 709 bp in length, respectively. Dot matrix analysis of the sequences indicates the presence of repeated elements within each monomeric unit. Sequence analysis of the repetitive region of clones pSA35 and pSA52 shows that there are several copies of a 7-bp repeat element organized in tandem. The consensus sequence of this repeat element is 5'-TTTAGGG-3'. These elements are highly mutated and the difference in length between the two clones is due to different copy numbers of these elements. The repetitive region of clone pSA35 has 26 copies of the element TTTAGGG, whereas clone pSA52 has 28 copies. The repetitive region in both clones is flanked on either side by inverted repeats that may be footprints of a transposition event. Sequence comparison indicates that the element TTTAGGG is identical to telomeric repeats present in Arabidopsis, maize, tomato, and other plants. However, Bal31 digestion kinetics indicates non-telomeric localization of the 700-bp tandem repeats. The clones represent a novel repeat family as (i) they contain telomere-like motifs as subrepeats within each unit; and (ii) they do not hybridize to related crucifers and are species-specific in nature.

DNA methylation induced changes in chromatin conformation of the promoter of the vitellogenin II gene of Japanese quail during aging.

PubMed

Gupta, Sanjay; Pathak, Rashmi U; Kanungo, Madhu S

2006-08-01

One approach to the understanding of the molecular basis of aging in higher organisms may be to use genes whose timing and rate of expression during the life span run parallel with specific functions that can be monitored. The genes for egg proteins, such as vitellogenin (VTG), which is expressed in the liver, and ovalbumin, lysozyme etc. that are expressed in the oviduct of birds, meet these requirements. Egg laying function is dependent on the production of these proteins, which, in turn, depends on the expression of their genes. In this communication we present the age-related studies on the VTG II gene of the bird, Japanese quail. The gene is expressed only in the liver and its expression is considerably lower in old birds that do not lay eggs. Comparison of the promoter region of the gene carrying the two important cis-acting elements, estrogen responsive element (ERE) and progesterone responsive element (PRE), shows it to be 100% homologous to the corresponding region of the chicken VTG II gene. Methylation of DNA and conformation of chromatin of this region were studied, as they are known to be important for regulation of expression of genes. Our studies show that in the liver of adult female quails which lay eggs, a -CCGG- sequence located in this region is hypomethylated, and the chromatin encompassing this region of the gene is relaxed. In the old, the -CCGG- sequence is hypermethylated and the chromatin is compact. This is correlated with a decrease in the expression of the gene and decrease in egg production. Further, electrophoretic mobility shift assay (EMSA) shows that the levels/affinity of specific trans-acting factors that bind to ERE and PRE present in the region, are not different in adult and old birds. Hence the methylation status of the -CCGG- sequence that is located in-between the ERE and the PRE may be crucial for the conformation of chromatin and availability of these two important cis-acting elements for the binding of the trans-acting factors. This, in turn, may downregulate the expression of the gene in old birds.

Clinical Isolates of Vibrio cholerae O1 El Tor Ogawa of 2009 from Kolkata, India: Preponderance of SXT Element and Presence of Haitian ctxB Variant

PubMed Central

Kutar, Braj M. R. N. S.; Rajpara, Neha; Upadhyay, Hardik; Ramamurthy, Thandavarayan; Bhardwaj, Ashima K.

2013-01-01

Background Increase in the number of multidrug resistant pathogens and the accompanied rise in case fatality rates has hampered the treatment of many infectious diseases including cholera. Unraveling the mechanisms responsible for multidrug resistance in the clinical isolates of Vibrio cholerae would help in understanding evolution of these pathogenic bacteria and their epidemic potential. This study was carried out to identify genetic factors responsible for multiple drug resistance in clinical isolates of Vibrio cholerae O1, serotype Ogawa, biotype El Tor isolated from the patients admitted to the Infectious Diseases Hospital, Kolkata, India, in 2009. Methodology/Principal Findings One hundred and nineteen clinical isolates of V. cholerae were analysed for their antibiotic resistance phenotypes. Antibiogram analysis revealed that majority of the isolates showed resistance to co-trimoxazole, nalidixic acid, polymixin B and streptomycin. In PCR, SXT integrase was detected in 117 isolates and its sequence showed 99% identity notably to ICEVchInd5 from Sevagram, India, ICEVchBan5 from Bangladesh and VC1786ICE sequence from Haiti outbreak among others. Antibiotic resistance traits corresponding to SXT element were transferred from the parent Vibrio isolate to the recipient E. coli XL-1 Blue cells during conjugation. Double-mismatch-amplification mutation assay (DMAMA) revealed the presence of Haitian type ctxB allele of genotype 7 in 55 isolates and the classical ctxB allele of genotype 1 in 59 isolates. Analysis of topoisomerase sequences revealed the presence of mutation Ser83 → Ile in gyrA and Ser85→ Leu in parC. This clearly showed the circulation of SXT-containing V. cholerae as causative agent for cholera in Kolkata. Conclusions There was predominance of SXT element in these clinical isolates from Kolkata region which also accounted for their antibiotic resistance phenotype typical of this element. DMAMA PCR showed them to be a mixture of isolates with different ctxB alleles like classical, El Tor and Haitian variants. PMID:23431378

The genome sequence of taurine cattle: a window to ruminant biology and evolution.

PubMed

Elsik, Christine G; Tellam, Ross L; Worley, Kim C; Gibbs, Richard A; Muzny, Donna M; Weinstock, George M; Adelson, David L; Eichler, Evan E; Elnitski, Laura; Guigó, Roderic; Hamernik, Debora L; Kappes, Steve M; Lewin, Harris A; Lynn, David J; Nicholas, Frank W; Reymond, Alexandre; Rijnkels, Monique; Skow, Loren C; Zdobnov, Evgeny M; Schook, Lawrence; Womack, James; Alioto, Tyler; Antonarakis, Stylianos E; Astashyn, Alex; Chapple, Charles E; Chen, Hsiu-Chuan; Chrast, Jacqueline; Câmara, Francisco; Ermolaeva, Olga; Henrichsen, Charlotte N; Hlavina, Wratko; Kapustin, Yuri; Kiryutin, Boris; Kitts, Paul; Kokocinski, Felix; Landrum, Melissa; Maglott, Donna; Pruitt, Kim; Sapojnikov, Victor; Searle, Stephen M; Solovyev, Victor; Souvorov, Alexandre; Ucla, Catherine; Wyss, Carine; Anzola, Juan M; Gerlach, Daniel; Elhaik, Eran; Graur, Dan; Reese, Justin T; Edgar, Robert C; McEwan, John C; Payne, Gemma M; Raison, Joy M; Junier, Thomas; Kriventseva, Evgenia V; Eyras, Eduardo; Plass, Mireya; Donthu, Ravikiran; Larkin, Denis M; Reecy, James; Yang, Mary Q; Chen, Lin; Cheng, Ze; Chitko-McKown, Carol G; Liu, George E; Matukumalli, Lakshmi K; Song, Jiuzhou; Zhu, Bin; Bradley, Daniel G; Brinkman, Fiona S L; Lau, Lilian P L; Whiteside, Matthew D; Walker, Angela; Wheeler, Thomas T; Casey, Theresa; German, J Bruce; Lemay, Danielle G; Maqbool, Nauman J; Molenaar, Adrian J; Seo, Seongwon; Stothard, Paul; Baldwin, Cynthia L; Baxter, Rebecca; Brinkmeyer-Langford, Candice L; Brown, Wendy C; Childers, Christopher P; Connelley, Timothy; Ellis, Shirley A; Fritz, Krista; Glass, Elizabeth J; Herzig, Carolyn T A; Iivanainen, Antti; Lahmers, Kevin K; Bennett, Anna K; Dickens, C Michael; Gilbert, James G R; Hagen, Darren E; Salih, Hanni; Aerts, Jan; Caetano, Alexandre R; Dalrymple, Brian; Garcia, Jose Fernando; Gill, Clare A; Hiendleder, Stefan G; Memili, Erdogan; Spurlock, Diane; Williams, John L; Alexander, Lee; Brownstein, Michael J; Guan, Leluo; Holt, Robert A; Jones, Steven J M; Marra, Marco A; Moore, Richard; Moore, Stephen S; Roberts, Andy; Taniguchi, Masaaki; Waterman, Richard C; Chacko, Joseph; Chandrabose, Mimi M; Cree, Andy; Dao, Marvin Diep; Dinh, Huyen H; Gabisi, Ramatu Ayiesha; Hines, Sandra; Hume, Jennifer; Jhangiani, Shalini N; Joshi, Vandita; Kovar, Christie L; Lewis, Lora R; Liu, Yih-Shin; Lopez, John; Morgan, Margaret B; Nguyen, Ngoc Bich; Okwuonu, Geoffrey O; Ruiz, San Juana; Santibanez, Jireh; Wright, Rita A; Buhay, Christian; Ding, Yan; Dugan-Rocha, Shannon; Herdandez, Judith; Holder, Michael; Sabo, Aniko; Egan, Amy; Goodell, Jason; Wilczek-Boney, Katarzyna; Fowler, Gerald R; Hitchens, Matthew Edward; Lozado, Ryan J; Moen, Charles; Steffen, David; Warren, James T; Zhang, Jingkun; Chiu, Readman; Schein, Jacqueline E; Durbin, K James; Havlak, Paul; Jiang, Huaiyang; Liu, Yue; Qin, Xiang; Ren, Yanru; Shen, Yufeng; Song, Henry; Bell, Stephanie Nicole; Davis, Clay; Johnson, Angela Jolivet; Lee, Sandra; Nazareth, Lynne V; Patel, Bella Mayurkumar; Pu, Ling-Ling; Vattathil, Selina; Williams, Rex Lee; Curry, Stacey; Hamilton, Cerissa; Sodergren, Erica; Wheeler, David A; Barris, Wes; Bennett, Gary L; Eggen, André; Green, Ronnie D; Harhay, Gregory P; Hobbs, Matthew; Jann, Oliver; Keele, John W; Kent, Matthew P; Lien, Sigbjørn; McKay, Stephanie D; McWilliam, Sean; Ratnakumar, Abhirami; Schnabel, Robert D; Smith, Timothy; Snelling, Warren M; Sonstegard, Tad S; Stone, Roger T; Sugimoto, Yoshikazu; Takasuga, Akiko; Taylor, Jeremy F; Van Tassell, Curtis P; Macneil, Michael D; Abatepaulo, Antonio R R; Abbey, Colette A; Ahola, Virpi; Almeida, Iassudara G; Amadio, Ariel F; Anatriello, Elen; Bahadue, Suria M; Biase, Fernando H; Boldt, Clayton R; Carroll, Jeffery A; Carvalho, Wanessa A; Cervelatti, Eliane P; Chacko, Elsa; Chapin, Jennifer E; Cheng, Ye; Choi, Jungwoo; Colley, Adam J; de Campos, Tatiana A; De Donato, Marcos; Santos, Isabel K F de Miranda; de Oliveira, Carlo J F; Deobald, Heather; Devinoy, Eve; Donohue, Kaitlin E; Dovc, Peter; Eberlein, Annett; Fitzsimmons, Carolyn J; Franzin, Alessandra M; Garcia, Gustavo R; Genini, Sem; Gladney, Cody J; Grant, Jason R; Greaser, Marion L; Green, Jonathan A; Hadsell, Darryl L; Hakimov, Hatam A; Halgren, Rob; Harrow, Jennifer L; Hart, Elizabeth A; Hastings, Nicola; Hernandez, Marta; Hu, Zhi-Liang; Ingham, Aaron; Iso-Touru, Terhi; Jamis, Catherine; Jensen, Kirsty; Kapetis, Dimos; Kerr, Tovah; Khalil, Sari S; Khatib, Hasan; Kolbehdari, Davood; Kumar, Charu G; Kumar, Dinesh; Leach, Richard; Lee, Justin C-M; Li, Changxi; Logan, Krystin M; Malinverni, Roberto; Marques, Elisa; Martin, William F; Martins, Natalia F; Maruyama, Sandra R; Mazza, Raffaele; McLean, Kim L; Medrano, Juan F; Moreno, Barbara T; Moré, Daniela D; Muntean, Carl T; Nandakumar, Hari P; Nogueira, Marcelo F G; Olsaker, Ingrid; Pant, Sameer D; Panzitta, Francesca; Pastor, Rosemeire C P; Poli, Mario A; Poslusny, Nathan; Rachagani, Satyanarayana; Ranganathan, Shoba; Razpet, Andrej; Riggs, Penny K; Rincon, Gonzalo; Rodriguez-Osorio, Nelida; Rodriguez-Zas, Sandra L; Romero, Natasha E; Rosenwald, Anne; Sando, Lillian; Schmutz, Sheila M; Shen, Libing; Sherman, Laura; Southey, Bruce R; Lutzow, Ylva Strandberg; Sweedler, Jonathan V; Tammen, Imke; Telugu, Bhanu Prakash V L; Urbanski, Jennifer M; Utsunomiya, Yuri T; Verschoor, Chris P; Waardenberg, Ashley J; Wang, Zhiquan; Ward, Robert; Weikard, Rosemarie; Welsh, Thomas H; White, Stephen N; Wilming, Laurens G; Wunderlich, Kris R; Yang, Jianqi; Zhao, Feng-Qi

2009-04-24

To understand the biology and evolution of ruminants, the cattle genome was sequenced to about sevenfold coverage. The cattle genome contains a minimum of 22,000 genes, with a core set of 14,345 orthologs shared among seven mammalian species of which 1217 are absent or undetected in noneutherian (marsupial or monotreme) genomes. Cattle-specific evolutionary breakpoint regions in chromosomes have a higher density of segmental duplications, enrichment of repetitive elements, and species-specific variations in genes associated with lactation and immune responsiveness. Genes involved in metabolism are generally highly conserved, although five metabolic genes are deleted or extensively diverged from their human orthologs. The cattle genome sequence thus provides a resource for understanding mammalian evolution and accelerating livestock genetic improvement for milk and meat production.

Transcriptional regulation by retinoic acid of interleukin-2 alpha receptors in human B cells.

PubMed Central

Bhatti, L; Sidell, N

1994-01-01

In this study, we demonstrated that retinoic acid (RA) up-regulated interleukin-2 receptor-alpha (IL-2R alpha) expression on two human B-cell lines, IE8.6 and SKW6.4. Deleted forms of the human IL-2R alpha promoter linked to the bacterial chloramphenicol acetyltransferase reporter gene were transfected into IE8.6 cells in order to define RA-responsive regulatory domains. Experiments using the -1.6 kb construct, which contains all known regulatory regions in the IL-2R alpha promoter, indicated that RA could induce IL-2R alpha promoter activity. The basal activity of the -471 construct was initially low, but was markedly enhanced by the addition of RA. Deletion of promoter sequences between -471 and -317 resulted in a significant augmentation of basal promoter activity and abolished promoter induction by RA. This finding revealed a requirement for sequences 5' of base -317 for RA-induced promoter activation, raising the possibility of the presence of both a RA response element and a negative regulatory element (NRE) upstream of base -317. Transfection studies with internal deletion mutants with the putative NRE removed resulted in increases in basal promoter activity and unresponsiveness to RA similar to the -317 construct. In contrast, an internal deletion mutant with the NRE intact had low basal activity and was inducible by RA similar to the -471 construct. Taken together, our results suggested that RA-induced activation of the IL-2R alpha promoter was through changes in the function of a NRE present between bases -400 and -368. This 31-base pair element may interact with an adjacent RA-responsive regulatory site as well as being responsible for down-regulation of basal IL-2R alpha expression under certain conditions. Images Figure 3 Figure 4 Figure 5 Figure 6 PMID:8157276

Synergism between a half-site and an imperfect estrogen-responsive element, and cooperation with COUP-TFI are required for estrogen receptor (ER) to achieve a maximal estrogen-stimulation of rainbow trout ER gene.

PubMed

Petit, F G; Métivier, R; Valotaire, Y; Pakdel, F

1999-01-01

In all oviparous, liver represents one of the main E2-target tissues where estrogen receptor (ER) constitutes the key mediator of estrogen action. The rainbow trout estrogen receptor (rtER) gene expression is markedly up-regulated by estrogens and the sequences responsible for this autoregulation have been located in a 0.2 kb upstream transcription start site within - 40/- 248 enhancer region. Absence of interference with steroid hormone receptors and tissue-specific factors and a conserved basal transcriptional machinery between yeast and higher eukaryotes, make yeast a simple assay system that will enable determination of important cis-acting regulatory sequences within rtER gene promoter and identification of transcription factors implicated in the regulation of this gene. Deletion analysis allowed to show a synergistic effect between an imperfect estrogen-responsive element (ERE) and a consensus half-ERE to achieve a high hormone-dependent transcriptional activation of the rtER gene promoter in the presence of stably expressed rtER. As in mammalian cells, here we observed a positive regulation of the rtER gene promoter by the chicken ovalbumin upstream promoter-transcription factor I (COUP-TFI) through enhancing autoregulation. Using a point mutation COUP-TFI mutant unable to bind DNA demonstrates that enhancement of rtER gene autoregulation requires the interaction of COUP-TFI to the DNA. Moreover, this enhancement of transcriptional activation by COUP-TFI requires specifically the AF-1 transactivation function of ER and can be observed in the presence of E2 or 4-hydroxytamoxifen but not ICI 164384. Thus, this paper describes the reconstitution of a hormone-responsive transcription unit in yeast in which the regulation of rtER gene promoter could be enhanced by the participation of cis-elements and/or trans-acting factors, such as ER itself or COUP-TF.

Molecular cloning and characterization of a novel salt-inducible gene encoding an acidic isoform of PR-5 protein in soybean (Glycine max [L.] Merr.).

PubMed

Onishi, M; Tachi, H; Kojima, T; Shiraiwa, M; Takahara, H

2006-10-01

We identified a novel salt-inducible soybean gene encoding an acidic-isoform of pathogenesis-related protein group 5 (PR-5 protein). The soybean PR-5-homologous gene, designated as Glycine max osmotin-like protein, acidic isoform (GmOLPa)), encodes a putative polypeptide having an N-terminal signal peptide. The mature GmOLPa protein without the signal peptide has a calculated molecular mass of 21.5 kDa and a pI value of 4.4, and was distinguishable from a known PR-5-homologous gene of soybean (namely P21 protein) through examination of the structural features. A comparison with two intracellular salt-inducible PR-5 proteins, tobacco osmotin and tomato NP24, revealed that GmOLPa did not have a C-terminal extension sequence functioning as a vacuole-targeting motif. The GmOLPa gene was transcribed constitutively in the soybean root and was induced almost exclusively in the root during 24 h of high-salt stress (300 mM NaCl). Interestingly, GmOLPa gene expression in the stem and leaf, not observed until 24 h, was markedly induced at 48 and 72 h after commencement of the high-salt stress. Abscisic acid (ABA) and dehydration also induced expression of the GmOLPa gene in the root; additionally, dehydration slightly induced expression in the stem and leaf. In fact, the 5'-upstream sequence of the GmOLPa gene contained several putative cis-elements known to be involved in responsiveness to ABA and dehydration, e.g. ABA-responsive element (ABRE), MYB/MYC, and low temperature-responsive element (LTRE). These results suggested that GmOLPa may function as a protective PR-5 protein in the extracellular space of the soybean root in response to high-salt stress and dehydration.

Two cis elements collaborate to spatially repress transcription from a sea urchin promoter

NASA Technical Reports Server (NTRS)

Frudakis, T. N.; Wilt, F.

1995-01-01

The expression pattern of many territory-specific genes in metazoan embryos is maintained by an active process of negative spatial regulation. However, the mechanism of this strategy of gene regulation is not well understood in any system. Here we show that reporter constructs containing regulatory sequence for the SM30-alpha gene of Stronglyocentrotus purpuratus are expressed in a pattern congruent with that of the endogenous SM30 gene(s), largely as a result of active transcriptional repression in cell lineages in which the gene is not normally expressed. Chloramphenicol acetyl transferase assays of deletion constructs from the 2600-bp upstream region showed that repressive elements were present in the region from -1628 to -300. In situ hybridization analysis showed that the spatial fidelity of expression was severely compromised when the region from -1628 to -300 was deleted. Two highly repetitive sequence motifs, (G/A/C)CCCCT and (T/C)(T/A/C)CTTTT(T/A/C), are present in the -1628 to -300 region. Representatives of these elements were analyzed by gel mobility shift experiments and were found to interact specifically with protein in crude nuclear extracts. When oligonucleotides containing either sequence element were co-injected with a correctly regulated reporter as potential competitors, the reporter was expressed in inappropriate cells. When composite oligonucleotides, containing both sequence elements, were fused to a misregulated reporter, the expression of the reporter in inappropriate cells was suppressed. Comparison of composite oligonucleotides with oligonucleotides containing single constituent elements show that both sequence elements are required for effective spatial regulation. Thus, both individual elements are required, but only a composite element containing both elements is sufficient to function as a tissue-specific repressive element.

An IFNG SNP with an estrogen-like response element selectively enhances promoter expression in peripheral but not lamina propria T cells.

PubMed

Gonsky, R; Deem, R L; Bream, J H; Young, H A; Targan, S R

2006-07-01

This study examines mucosa-specific regulatory pathways involved in modulation of interferon-gamma (IFN-gamma) in lamina propria T cells. Previous studies identified mucosa-specific CD2 cis-elements within the -204 to -108 bp IFNG promoter. Within this region, a single-site nucleotide polymorphism, -179G/T, imparts tumor necrosis factor-alpha stimulation of IFNG in peripheral blood lymphocytes, and is linked with accelerated AIDS progression. We discovered a putative estrogen response element (ERE) introduced by the -179T, which displays selective activation in peripheral blood mononuclear cells (PBMC) vs lamina propria mononuclear cells (LPMC). Transfection of PBMC with constructs containing the -179G or -179T site revealed CD2-mediated enhancement of the -179T compared to -179G allele, although, in LPMC, a similar level of expression was detected. Electrophoretic mobility shift assay (EMSA) analysis demonstrated CD2-mediated nucleoprotein binding to the -179T but not the -179G in PBMC. In LPMC, binding is constitutive to both -179G and -179T regions. Sequence and EMSA analysis suggests that the -179T allele creates an ERE-like binding site capable of binding recombinant estrogen receptor. Estrogen response element transactivation is enhanced by CD2 signaling, but inhibited by estrogen in PBMC but not in LPMC, although expression of estrogen receptor was similar. This is the first report to describe a potential molecular mechanism responsible for selectively controlling IFN-gamma production in LPMC.

Characterizing the stress/defense transcriptome of Arabidopsis

PubMed Central

Mahalingam, Ramamurthy; Gomez-Buitrago, AnaMaria; Eckardt, Nancy; Shah, Nigam; Guevara-Garcia, Angel; Day, Philip; Raina, Ramesh; Fedoroff, Nina V

2003-01-01

Background To understand the gene networks that underlie plant stress and defense responses, it is necessary to identify and characterize the genes that respond both initially and as the physiological response to the stress or pathogen develops. We used PCR-based suppression subtractive hybridization to identify Arabidopsis genes that are differentially expressed in response to ozone, bacterial and oomycete pathogens and the signaling molecules salicylic acid (SA) and jasmonic acid. Results We identified a total of 1,058 differentially expressed genes from eight stress cDNA libraries. Digital northern analysis revealed that 55% of the stress-inducible genes are rarely transcribed in unstressed plants and 17% of them were not previously represented in Arabidopsis expressed sequence tag databases. More than two-thirds of the genes in the stress cDNA collection have not been identified in previous studies as stress/defense response genes. Several stress-responsive cis-elements showed a statistically significant over-representation in the promoters of the genes in the stress cDNA collection. These include W- and G-boxes, the SA-inducible element, the abscisic acid response element and the TGA motif. Conclusions The stress cDNA collection comprises a broad repertoire of stress-responsive genes encoding proteins that are involved in both the initial and subsequent stages of the physiological response to abiotic stress and pathogens. This set of stress-, pathogen- and hormone-modulated genes is an important resource for understanding the genetic interactions underlying stress signaling and responses and may contribute to the characterization of the stress transcriptome through the construction of standardized specialized arrays. PMID:12620105

In silico Analysis of 3′-End-Processing Signals in Aspergillus oryzae Using Expressed Sequence Tags and Genomic Sequencing Data

PubMed Central

Tanaka, Mizuki; Sakai, Yoshifumi; Yamada, Osamu; Shintani, Takahiro; Gomi, Katsuya

2011-01-01

To investigate 3′-end-processing signals in Aspergillus oryzae, we created a nucleotide sequence data set of the 3′-untranslated region (3′ UTR) plus 100 nucleotides (nt) sequence downstream of the poly(A) site using A. oryzae expressed sequence tags and genomic sequencing data. This data set comprised 1065 sequences derived from 1042 unique genes. The average 3′ UTR length in A. oryzae was 241 nt, which is greater than that in yeast but similar to that in plants. The 3′ UTR and 100 nt sequence downstream of the poly(A) site is notably U-rich, while the region located 15–30 nt upstream of the poly(A) site is markedly A-rich. The most frequently found hexanucleotide in this A-rich region is AAUGAA, although this sequence accounts for only 6% of all transcripts. These data suggested that A. oryzae has no highly conserved sequence element equivalent to AAUAAA, a mammalian polyadenylation signal. We identified that putative 3′-end-processing signals in A. oryzae, while less well conserved than those in mammals, comprised four sequence elements: the furthest upstream U-rich element, A-rich sequence, cleavage site, and downstream U-rich element flanking the cleavage site. Although these putative 3′-end-processing signals are similar to those in yeast and plants, some notable differences exist between them. PMID:21586533

ΔN-P63α and TA-P63α exhibit intrinsic differences in transactivation specificities that depend on distinct features of DNA target sites

PubMed Central

Foggetti, Giorgia; Raimondi, Ivan; Campomenosi, Paola; Menichini, Paola

2014-01-01

TP63 is a member of the TP53 gene family that encodes for up to ten different TA and ΔN isoforms through alternative promoter usage and alternative splicing. Besides being a master regulator of gene expression for squamous epithelial proliferation, differentiation and maintenance, P63, through differential expression of its isoforms, plays important roles in tumorigenesis. All P63 isoforms share an immunoglobulin-like folded DNA binding domain responsible for binding to sequence-specific response elements (REs), whose overall consensus sequence is similar to that of the canonical p53 RE. Using a defined assay in yeast, where P63 isoforms and RE sequences are the only variables, and gene expression assays in human cell lines, we demonstrated that human TA- and ΔN-P63α proteins exhibited differences in transactivation specificity not observed with the corresponding P73 or P53 protein isoforms. These differences 1) were dependent on specific features of the RE sequence, 2) could be related to intrinsic differences in their oligomeric state and cooperative DNA binding, and 3) appeared to be conserved in evolution. Since genotoxic stress can change relative ratio of TA- and ΔN-P63α protein levels, the different transactivation specificity of each P63 isoform could potentially influence cellular responses to specific stresses. PMID:24926492

Sequence variations in RepMP2/3 and RepMP4 elements reveal intragenomic homologous DNA recombination events in Mycoplasma pneumoniae.

PubMed

Spuesens, Emiel B M; Oduber, Minoushka; Hoogenboezem, Theo; Sluijter, Marcel; Hartwig, Nico G; van Rossum, Annemarie M C; Vink, Cornelis

2009-07-01

The gene encoding major adhesin protein P1 of Mycoplasma pneumoniae, MPN141, contains two DNA sequence stretches, designated RepMP2/3 and RepMP4, which display variation among strains. This variation allows strains to be differentiated into two major P1 genotypes (1 and 2) and several variants. Interestingly, multiple versions of the RepMP2/3 and RepMP4 elements exist at other sites within the bacterial genome. Because these versions are closely related in sequence, but not identical, it has been hypothesized that they have the capacity to recombine with their counterparts within MPN141, and thereby serve as a source of sequence variation of the P1 protein. In order to determine the variation within the RepMP2/3 and RepMP4 elements, both within the bacterial genome and among strains, we analysed the DNA sequences of all RepMP2/3 and RepMP4 elements within the genomes of 23 M. pneumoniae strains. Our data demonstrate that: (i) recombination is likely to have occurred between two RepMP2/3 elements in four of the strains, and (ii) all previously described P1 genotypes can be explained by inter-RepMP recombination events. Moreover, the difference between the two major P1 genotypes was reflected in all RepMP elements, such that subtype 1 and 2 strains can be differentiated on the basis of sequence variation in each RepMP element. This implies that subtype 1 and subtype 2 strains represent evolutionarily diverged strain lineages. Finally, a classification scheme is proposed in which the P1 genotype of M. pneumoniae isolates can be described in a sequence-based, universal fashion.

In and out of the rRNA genes: characterization of Pokey elements in the sequenced Daphnia genome

PubMed Central

2013-01-01

Background Only a few transposable elements are known to exhibit site-specific insertion patterns, including the well-studied R-element retrotransposons that insert into specific sites within the multigene rDNA. The only known rDNA-specific DNA transposon, Pokey (superfamily: piggyBac) is found in the freshwater microcrustacean, Daphnia pulex. Here, we present a genome-wide analysis of Pokey based on the recently completed whole genome sequencing project for D. pulex. Results Phylogenetic analysis of Pokey elements recovered from the genome sequence revealed the presence of four lineages corresponding to two divergent autonomous families and two related lineages of non-autonomous miniature inverted repeat transposable elements (MITEs). The MITEs are also found at the same 28S rRNA gene insertion site as the Pokey elements, and appear to have arisen as deletion derivatives of autonomous elements. Several copies of the full-length Pokey elements may be capable of producing an active transposase. Surprisingly, both families of Pokey possess a series of 200 bp repeats upstream of the transposase that is derived from the rDNA intergenic spacer (IGS). The IGS sequences within the Pokey elements appear to be evolving in concert with the rDNA units. Finally, analysis of the insertion sites of Pokey elements outside of rDNA showed a target preference for sites similar to the specific sequence that is targeted within rDNA. Conclusions Based on the target site preference of Pokey elements and the concerted evolution of a segment of the element with the rDNA unit, we propose an evolutionary path by which the ancestors of Pokey elements have invaded the rDNA niche. We discuss how specificity for the rDNA unit may have evolved and how this specificity has played a role in the long-term survival of these elements in the subgenus Daphnia. PMID:24059783

Expression analysis and functional characterization of a novel cold-responsive gene CbCOR15a from Capsella bursa-pastoris.

PubMed

Zhou, Mingqi; Wu, Lihua; Liang, Jing; Shen, Chen; Lin, Juan

2012-05-01

The cold-responsive (COR) genes involved in C-repeat binding factor signaling pathway function essentially in cold acclimation of higher plants. A novel COR gene CbCOR15a from shepherd's purse (Capsella bursa-pastoris) was predicted to be a homolog of COR15 in Arabidopsis. The analysis of tissue specific expression pattern as well as characterization of the CbCOR15a promoter revealed that the expression of CbCOR15a was induced by coldness not only in leaves and stem but also in roots. Sequence analysis showed that a 909 bp promoter region of CbCOR15a contained two CRT/DRE elements, two ABRE elements, one auxin-responsive TGA-element and one MeJA-responsive CGTCA-motif. In young seedlings the expression of CbCOR15a could be apparently increased by SA, ABA, MeJA and IAA, and transiently increased by GA(3) accompanied by obvious feedback suppression. According to the altered physiological index values in tobacco under cold treatments, the overexpression of CbCOR15a significantly increased the cold tolerance of transgenic tobacco plants. It can be suggested that CbCOR15a was involved in cold response of Capsella bursa-pastoris associated with SA, ABA, MeJA, IAA and GA(3) regulation and confers enhanced cold acclimation in transgenic plants.

Cold shock protein YB-1 is involved in hypoxia-dependent gene transcription.

PubMed

Rauen, Thomas; Frye, Bjoern C; Wang, Jialin; Raffetseder, Ute; Alidousty, Christina; En-Nia, Abdelaziz; Floege, Jürgen; Mertens, Peter R

2016-09-16

Hypoxia-dependent gene regulation is largely orchestrated by hypoxia-inducible factors (HIFs), which associate with defined nucleotide sequences of hypoxia-responsive elements (HREs). Comparison of the regulatory HRE within the 3' enhancer of the human erythropoietin (EPO) gene with known binding motifs for cold shock protein Y-box (YB) protein-1 yielded strong similarities within the Y-box element and 3' adjacent sequences. DNA binding assays confirmed YB-1 binding to both, single- and double-stranded HRE templates. Under hypoxia, we observed nuclear shuttling of YB-1 and co-immunoprecipitation assays demonstrated that YB-1 and HIF-1α physically interact with each other. Cellular YB-1 depletion using siRNA significantly induced hypoxia-dependent EPO production at both, promoter and mRNA level. Vice versa, overexpressed YB-1 significantly reduced EPO-HRE-dependent gene transcription, whereas this effect was minor under normoxia. HIF-1α overexpression induced hypoxia-dependent gene transcription through the same element and accordingly, co-expression with YB-1 reduced HIF-1α-mediated EPO induction under hypoxic conditions. Taken together, we identified YB-1 as a novel binding factor for HREs that participates in fine-tuning of the hypoxia transcriptome. Copyright © 2016 Elsevier Inc. All rights reserved.

Unequal crossing-over associated with asymmetrical synapsis between nomadic elements in the Drosophila melanogaster genome

PubMed Central

Goldberg, Michael L.; Sheen, Jenq-Yunn; Gehring, Walter J.; Green, M. M.

1983-01-01

The molecular structure of reciprocal duplications and deficiencies produced by unequal crossing-over at the white (w) locus of Drosophila melanogaster females heterozygous for the alleles wa and wa4 has been examined. A transposable, copia-like element is found at the rearrangement breakpoints. Further characterization indicates that asymmetrical pairing between two copies of this element, which are at least 60 kilobases apart in the parental chromosomes, followed by a crossover within the paired elements, is responsible for the duplication and deficiencies observed. The frequency of these events is high compared with normal homologous exchange, implying that synaptic pairing during meiosis must be sufficiently flexible as to allow efficient recognition of sequences located in nonidentical positions on homologous chromosomes. These results suggest a possible mechanism for the generation of tandem duplications in eukaryotic organisms. Images PMID:16593354

Evidence that a sequence similar to TAR is important for induction of the JC virus late promoter by human immunodeficiency virus type 1 Tat.

PubMed Central

Chowdhury, M; Taylor, J P; Chang, C F; Rappaport, J; Khalili, K

1992-01-01

A specific RNA sequence located in the leader of all human immunodeficiency virus type 1 (HIV-1) mRNAs termed the transactivation response element, or TAR, is a primary target for induction of HIV-1 long terminal repeat activity by the HIV-1-derived trans-regulatory protein, Tat. Human neurotropic virus, JC virus (JCV), a causative agent of the degenerative demyelinating disease progressive multifocal leukoencephalopathy, contains sequences in the 5' end of the late RNA species with an extensive homology to HIV-1 TAR. In this study, we examined the possible role of the JCV-derived TAR-homologous sequence in Tat-mediated activation of the JCV late promoter (Tada et al., Proc. Natl. Acad. Sci. USA 87:3479-3483, 1990). Results from site-directed mutagenesis revealed that critical G residues required for the function of HIV-1 TAR that are conserved in the JCV TAR homolog play an important role in Tat activation of the JCV promoter. In addition, in vivo competition studies suggest that shared regulatory components mediate Tat activation of the JCV late and HIV-1 long terminal repeat promoters. Furthermore, we showed that the JCV-derived TAR sequence behaves in the same way as HIV-1 TAR in response to two distinct Tat mutants, one of which that has no ability to bind to HIV-1 TAR and another that lacks transcriptional activity on a responsive promoter. These results suggest that the TAR homolog of the JCV late promoter is responsive to HIV-1 Tat induction and thus may participate in the overall activation of the JCV late promoter mediated by this transactivation. Images PMID:1331525

Delimiting regulatory sequences of the Drosophila melanogaster Ddc gene.

PubMed Central

Hirsh, J; Morgan, B A; Scholnick, S B

1986-01-01

We delimited sequences necessary for in vivo expression of the Drosophila melanogaster dopa decarboxylase gene Ddc. The expression of in vitro-altered genes was assayed following germ line integration via P-element vectors. Sequences between -209 and -24 were necessary for normally regulated expression, although genes lacking these sequences could be expressed at 10 to 50% of wild-type levels at specific developmental times. These genes showed components of normal developmental expression, which suggests that they retain some regulatory elements. All Ddc genes lacking the normal immediate 5'-flanking sequences were grossly deficient in larval central nervous system expression. Thus, this upstream region must contain at least one element necessary for this expression. A mutated Ddc gene without a normal TATA boxlike sequence used the normal RNA start points, indicating that this sequences is not required for start point specificity. Images PMID:3099170

Complete genomic sequence of Powassan virus: evaluation of genetic elements in tick-borne versus mosquito-borne flaviviruses.

PubMed

Mandl, C W; Holzmann, H; Kunz, C; Heinz, F X

1993-05-01

The complete nucleotide sequence of the positive-stranded RNA genome of the tick-borne flavivirus Powassan (10,839 nucleotides) was elucidated and the amino acid sequence of all viral proteins was derived. Based on this sequence as well as serological data, Powassan virus represents the most divergent member of the tick-borne serocomplex within the genus flaviviruses, family Flaviviridae. The primary nucleotide sequence and potential RNA secondary structures of the Powassan virus genome as well as the protein sequences and the reactivities of the virion with a panel of monoclonal antibodies were compared to other tick-borne and mosquito-borne flaviviruses. These analyses corroborated significant differences between tick-borne and mosquito-borne flaviviruses, but also emphasized structural elements that are conserved among both vector groups. The comparisons among tick-borne flaviviruses revealed conserved sequence elements that might represent important determinants of the tick-borne flavivirus phenotype.

Identification and characterization of cell-specific enhancer elements for the mouse ETF/Tead2 gene.

PubMed

Tanoue, Y; Yasunami, M; Suzuki, K; Ohkubo, H

2001-12-21

We have identified and characterized by transient transfection assays the cell-specific 117-bp enhancer sequence in the first intron of the mouse ETF (Embryonic TEA domain-containing factor)/Tead2 gene required for transcriptional activation in ETF/Tead2 gene-expressing cells, such as P19 cells. The 117-bp enhancer contains one GC-rich sequence (5'-GGGGCGGGG-3'), termed the GC box, and two tandemly repeated GA-rich sequences (5'-GGGGGAGGGG-3'), termed the proximal and distal GA elements. Further analyses, including transfection studies and electrophoretic mobility shift assays using a series of deletion and mutation constructs, indicated that Sp1, a putative activator, may be required to predominate over its competition with another unknown putative repressor, termed the GA element-binding factor, for binding to both the GC box, which overlapped with the proximal GA element, and the distal GA element in the 117-bp sequence in order to achieve a full enhancer activity. We also discuss a possible mechanism underlying the cell-specific enhancer activity of the 117-bp sequence.

Regulation of expression of transgenes in developing fish.

PubMed

Moav, B; Liu, Z; Caldovic, L D; Gross, M L; Faras, A J; Hackett, P B

1993-05-01

The transcriptional regulatory elements of the beta-actin gene of carp (Cyprinus carpio) have been examined in zebrafish and goldfish harbouring transgenes. The high sequence conservation of the putative regulatory elements in the beta-actin genes of animals suggested that their function would be conserved, so that transgenic constructs with the same transcriptional control elements would promote similar levels of transgene expression in different species of transgenic animals. To test this assumption, we analysed the temporal expression of a reporter gene under the control of transcriptional control sequences from the carp beta-actin gene in zebrafish (Brachydanio rerio) and goldfish (Carrasius auratus). Our results indicated that, contrary to expectations, combinations of different transcriptional control elements affected the level, duration, and onset of gene expression differently in developing zebrafish and goldfish. The major differences in expression of beta-actin/CAT (chloramphenicol acetyltransferase) constructs in zebrafish and goldfish were: (1) overall expression was almost 100-fold higher in goldfish than in zebrafish embryos, (2) the first intron had an enhancing effect on gene expression in zebrafish but not in goldfish, and (3) the serum-responsive/CArG-containing regulatory element in the proximal promoter was not always required for maximal CAT activity in goldfish, but was required in zebrafish. These results suggest that in the zebrafish, but not in the goldfish, there may be interactions between motifs in the proximal promoter and the first intron which appear to be required for maximal enhancement of transcription.

Parainfluenza virus chimeric mini-replicons indicate a novel regulatory element in the leader promoter.

PubMed

Matsumoto, Yusuke; Ohta, Keisuke; Goto, Hideo; Nishio, Machiko

2016-07-01

Gene expression of paramyxoviruses is regulated by genome-encoded cis-acting elements; however, whether all the required elements for viral growth have been identified is not clear. Using a mini-replicon system, it has been shown that human parainfluenza virus type 2 (hPIV2) polymerase can recognize the promoter elements of parainfluenza virus type 5 (PIV5), but reporter activity is lower in this case. We constructed a series of luciferase-encoding chimeric PIV2/5 mini-genomes that are basically hPIV2, but whose leader (le), mRNA start signal and trailer sequence are partially replaced with those of PIV5. Studies of the chimeric PIV2/5 mini-replicons demonstrated that replacement of hPIV2 le with PIV5 le results in remarkably weak luciferase expression. Further mutagenesis identified the responsible region as positions 25-30 of the PIV5 le. Using recombinant hPIV2, the impact of this region on viral life cycles was assessed. Insertion of the mutation at this region facilitated viral growth, genomic replication and mRNA transcription at the early stage of infection, which elicited severe cell damage. In contrast, at the late infection stage it caused a reduction in viral transcription. Here, we identify a novel cis-acting element in the internal region of an le sequence that is involved in the regulation of polymerase, and which contributes to maintaining a balance between viral growth and cytotoxicity.

Identification of Bari Transposons in 23 Sequenced Drosophila Genomes Reveals Novel Structural Variants, MITEs and Horizontal Transfer.

PubMed

Palazzo, Antonio; Lovero, Domenica; D'Addabbo, Pietro; Caizzi, Ruggiero; Marsano, René Massimiliano

2016-01-01

Bari elements are members of the Tc1-mariner superfamily of DNA transposons, originally discovered in Drosophila melanogaster, and subsequently identified in silico in 11 sequenced Drosophila genomes and as experimentally isolated in four non-sequenced Drosophila species. Bari-like elements have been also studied for their mobility both in vivo and in vitro. We analyzed 23 Drosophila genomes and carried out a detailed characterization of the Bari elements identified, including those from the heterochromatic Bari1 cluster in D. melanogaster. We have annotated 401 copies of Bari elements classified either as putatively autonomous or inactive according to the structure of the terminal sequences and the presence of a complete transposase-coding region. Analyses of the integration sites revealed that Bari transposase prefers AT-rich sequences in which the TA target is cleaved and duplicated. Furthermore evaluation of transposon's co-occurrence near the integration sites of Bari elements showed a non-random distribution of other transposable elements. We also unveil the existence of a putatively autonomous Bari1 variant characterized by two identical long Terminal Inverted Repeats, in D. rhopaloa. In addition, we detected MITEs related to Bari transposons in 9 species. Phylogenetic analyses based on transposase gene and the terminal sequences confirmed that Bari-like elements are distributed into three subfamilies. A few inconsistencies in Bari phylogenetic tree with respect to the Drosophila species tree could be explained by the occurrence of horizontal transfer events as also suggested by the results of dS analyses. This study further clarifies the Bari transposon's evolutionary dynamics and increases our understanding on the Tc1-mariner elements' biology.

Regulation of ecmF gene expression and genetic hierarchy among STATa, CudA, and MybC on several prestalk A-specific gene expressions in Dictyostelium.

PubMed

Saga, Yukika; Inamura, Tomoka; Shimada, Nao; Kawata, Takefumi

2016-05-01

STATa, a Dictyostelium homologue of metazoan signal transducer and activator of transcription, is important for the organizer function in the tip region of the migrating Dictyostelium slug. We previously showed that ecmF gene expression depends on STATa in prestalk A (pstA) cells, where STATa is activated. Deletion and site-directed mutagenesis analysis of the ecmF/lacZ fusion gene in wild-type and STATa null strains identified an imperfect inverted repeat sequence, ACAAATANTATTTGT, as a STATa-responsive element. An upstream sequence element was required for efficient expression in the rear region of pstA zone; an element downstream of the inverted repeat was necessary for sufficient prestalk expression during culmination. Band shift analyses using purified STATa protein detected no sequence-specific binding to those ecmF elements. The only verified upregulated target gene of STATa is cudA gene; CudA directly activates expL7 gene expression in prestalk cells. However, ecmF gene expression was almost unaffected in a cudA null mutant. Several previously reported putative STATa target genes were also expressed in cudA null mutant but were downregulated in STATa null mutant. Moreover, mybC, which encodes another transcription factor, belonged to this category, and ecmF expression was downregulated in a mybC null mutant. These findings demonstrate the existence of a genetic hierarchy for pstA-specific genes, which can be classified into two distinct STATa downstream pathways, CudA dependent and independent. The ecmF expression is indirectly upregulated by STATa in a CudA-independent activation manner but dependent on MybC, whose expression is positively regulated by STATa. © 2016 Japanese Society of Developmental Biologists.

Identification of cis-acting regulatory elements in the human oxytocin gene promoter.

PubMed

Richard, S; Zingg, H H

1991-12-01

The expression of hormone-inducible genes is determined by the interaction of trans-acting factors with hormone-inducible elements and elements mediating basal and cell-specific expression. We have shown earlier that the gene encoding the hypothalamic nonapeptide oxytocin (OT) is under the control of an estrogen response element (ERE). The present study was aimed at identifying cis-acting elements mediating basal expression of the OT gene. A construct containing sequences -381 to +36 of the human OT gene was linked to a reporter gene and transiently transfected into a series of neuronal and nonneuronal cell lines. Expression of this construct was cell specific: it was highest in the neuroblastoma-derived cell line, Neuro-2a, and lowest in NIH 3T3 and JEG-3 cells. By 5' deletion analysis, we determined that a segment from -49 to +36 was capable of mediating cells-pecific promoter activity. Within this segment, we identified three proximal promoter elements (PPE-1, PPE-2, and PPE-3) that are each required for promoter activity. Most notably, mutation of a conserved purine-rich element (GAGAGA) contained within PPE-2 leads to a 10-fold decrease in promoter strength. Gel mobility shift analysis with three different double-stranded oligonucleotides demonstrated that each proximal promoter element binds distinct nuclear factors. In each case, only the homologous oligonucleotide, but neither of the oligonucleotides corresponding to adjacent elements, was able to act as a competitor. Thus, a different set of factors appears to bind independently to each element. By reinserting the homologous ERE or a heterologous glucocorticoid response element upstream of intact or altered proximal promoter segments we determined that removal or mutation of proximal promoter elements decreases basal expression, but does not abrogate the hormone responsiveness of the promoter. In conclusion, these results indicate that an important component of the transcriptional activity of the OT promoter resides in a small region extending only 50 bases upstream of the cap site and that this activity is the result of a cooperative interaction of at least three distinct proximal promoter elements.

Genomic Organization of the Drosophila Telomere RetrotransposableElements

DOE Office of Scientific and Technical Information (OSTI.GOV)

George, J.A.; DeBaryshe, P.G.; Traverse, K.L.

2006-10-16

The emerging sequence of the heterochromatic portion of the Drosophila melanogaster genome, with the most recent update of euchromatic sequence, gives the first genome-wide view of the chromosomal distribution of the telomeric retrotransposons, HeT-A, TART, and Tahre. As expected, these elements are entirely excluded from euchromatin, although sequence fragments of HeT-A and TART 3 untranslated regions are found in nontelomeric heterochromatin on the Y chromosome. The proximal ends of HeT-A/TART arrays appear to be a transition zone because only here do other transposable elements mix in the array. The sharp distinction between the distribution of telomeric elements and that ofmore » other transposable elements suggests that chromatin structure is important in telomere element localization. Measurements reported here show (1) D. melanogaster telomeres are very long, in the size range reported for inbred mouse strains (averaging 46 kb per chromosome end in Drosophila stock 2057). As in organisms with telomerase, their length varies depending on genotype. There is also slight under-replication in polytene nuclei. (2) Surprisingly, the relationship between the number of HeT-A and TART elements is not stochastic but is strongly correlated across stocks, supporting the idea that the two elements are interdependent. Although currently assembled portions of the HeT-A/TART arrays are from the most-proximal part of long arrays, {approx}61% of the total HeT-A sequence in these regions consists of intact, potentially active elements with little evidence of sequence decay, making it likely that the content of the telomere arrays turns over more extensively than has been thought.« less

Structural variant of the intergenic internal ribosome entry site elements in dicistroviruses and computational search for their counterparts

PubMed Central

HATAKEYAMA, YOSHINORI; SHIBUYA, NORIHIRO; NISHIYAMA, TAKASHI; NAKASHIMA, NOBUHIKO

2004-01-01

The intergenic region (IGR) located upstream of the capsid protein gene in dicistroviruses contains an internal ribosome entry site (IRES). Translation initiation mediated by the IRES does not require initiator methionine tRNA. Comparison of the IGRs among dicistroviruses suggested that Taura syndrome virus (TSV) and acute bee paralysis virus have an extra side stem loop in the predicted IRES. We examined whether the side stem is responsible for translation activity mediated by the IGR using constructs with compensatory mutations. In vitro translation analysis showed that TSV has an IGR-IRES that is structurally distinct from those previously described. Because IGR-IRES elements determine the translation initiation site by virtue of their own tertiary structure formation, the discovery of this initiation mechanism suggests the possibility that eukaryotic mRNAs might have more extensive coding regions than previously predicted. To test this hypothesis, we searched full-length cDNA databases and whole genome sequences of eukaryotes using the pattern matching program, Scan For Matches, with parameters that can extract sequences containing secondary structure elements resembling those of IGR-IRES. Our search yielded several sequences, but their predicted secondary structures were suggested to be unstable in comparison to those of dicistroviruses. These results suggest that RNAs structurally similar to dicistroviruses are not common. If some eukaryotic mRNAs are translated independently of an initiator methionine tRNA, their structures are likely to be significantly distinct from those of dicistroviruses. PMID:15100433

Mechanisms of Evolution in High-Consequence Drug Resistance Plasmids.

PubMed

He, Susu; Chandler, Michael; Varani, Alessandro M; Hickman, Alison B; Dekker, John P; Dyda, Fred

2016-12-06

The dissemination of resistance among bacteria has been facilitated by the fact that resistance genes are usually located on a diverse and evolving set of transmissible plasmids. However, the mechanisms generating diversity and enabling adaptation within highly successful resistance plasmids have remained obscure, despite their profound clinical significance. To understand these mechanisms, we have performed a detailed analysis of the mobilome (the entire mobile genetic element content) of a set of previously sequenced carbapenemase-producing Enterobacteriaceae (CPE) from the National Institutes of Health Clinical Center. This analysis revealed that plasmid reorganizations occurring in the natural context of colonization of human hosts were overwhelmingly driven by genetic rearrangements carried out by replicative transposons working in concert with the process of homologous recombination. A more complete understanding of the molecular mechanisms and evolutionary forces driving rearrangements in resistance plasmids may lead to fundamentally new strategies to address the problem of antibiotic resistance. The spread of antibiotic resistance among Gram-negative bacteria is a serious public health threat, as it can critically limit the types of drugs that can be used to treat infected patients. In particular, carbapenem-resistant members of the Enterobacteriaceae family are responsible for a significant and growing burden of morbidity and mortality. Here, we report on the mechanisms underlying the evolution of several plasmids carried by previously sequenced clinical Enterobacteriaceae isolates from the National Institutes of Health Clinical Center (NIH CC). Our ability to track genetic rearrangements that occurred within resistance plasmids was dependent on accurate annotation of the mobile genetic elements within the plasmids, which was greatly aided by access to long-read DNA sequencing data and knowledge of their mechanisms. Mobile genetic elements such as transposons and integrons have been strongly associated with the rapid spread of genes responsible for antibiotic resistance. Understanding the consequences of their actions allowed us to establish unambiguous evolutionary relationships between plasmids in the analysis set. Copyright © 2016 He et al.

Comparative Analysis of the Shared Sex-Determination Region (SDR) among Salmonid Fishes.

PubMed

Faber-Hammond, Joshua J; Phillips, Ruth B; Brown, Kim H

2015-06-25

Salmonids present an excellent model for studying evolution of young sex-chromosomes. Within the genus, Oncorhynchus, at least six independent sex-chromosome pairs have evolved, many unique to individual species. This variation results from the movement of the sex-determining gene, sdY, throughout the salmonid genome. While sdY is known to define sexual differentiation in salmonids, the mechanism of its movement throughout the genome has remained elusive due to high frequencies of repetitive elements, rDNA sequences, and transposons surrounding the sex-determining regions (SDR). Despite these difficulties, bacterial artificial chromosome (BAC) library clones from both rainbow trout and Atlantic salmon containing the sdY region have been reported. Here, we report the sequences for these BACs as well as the extended sequence for the known SDR in Chinook gained through genome walking methods. Comparative analysis allowed us to study the overlapping SDRs from three unique salmonid Y chromosomes to define the specific content, size, and variation present between the species. We found approximately 4.1 kb of orthologous sequence common to all three species, which contains the genetic content necessary for masculinization. The regions contain transposable elements that may be responsible for the translocations of the SDR throughout salmonid genomes and we examine potential mechanistic roles of each one. © The Author(s) 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

Pstl repeat: a family of short interspersed nucleotide element (SINE)-like sequences in the genomes of cattle, goat, and buffalo.

PubMed

Sheikh, Faruk G; Mukhopadhyay, Sudit S; Gupta, Prabhakar

2002-02-01

The PstI family of elements are short, highly repetitive DNA sequences interspersed throughout the genome of the Bovidae. We have cloned and sequenced some members of the PstI family from cattle, goat, and buffalo. These elements are approximately 500 bp, have a copy number of 2 x 10(5) - 4 x 10(5), and comprise about 4% of the haploid genome. Studies of nucleotide sequence homology indicate that the buffalo and goat PstI repeats (type II) are similar types of short interspersed nucleotide element (SINE) sequences, but the cattle PstI repeat (type I) is considerably more divergent. Additionally, the goat PstI sequence showed significant sequence homology with bovine serine tRNA, and is therefore likely derived from serine tRNA. Interestingly, Southern hybridization suggests that both types of SINEs (I and II) are present in all the species of Bovidae. Dendrogram analysis indicates that cattle PstI SINE is similar to bovine Alu-like SINEs. Goat and buffalo SINEs formed a separate cluster, suggesting that these two types of SINEs evolved separately in the genome of the Bovidae.

Architecture and reservoir quality of low-permeable Eocene lacustrine turbidite sandstone from the Dongying Depression, East China

NASA Astrophysics Data System (ADS)

Munawar, Muhammad Jawad; Lin, Chengyan; Chunmei, Dong; Zhang, Xianguo; Zhao, Haiyan; Xiao, Shuming; Azeem, Tahir; Zahid, Muhammad Aleem; Ma, Cunfei

2018-05-01

The architecture and quality of lacustrine turbidites that act as petroleum reservoirs are less well documented. Reservoir architecture and multiscale heterogeneity in turbidites represent serious challenges to production performance. Additionally, establishing a hierarchy profile to delineate heterogeneity is a challenging task in lacustrine turbidite deposits. Here, we report on the turbidites in the middle third member of the Eocene Shahejie Formation (Es3), which was deposited during extensive Middle to Late Eocene rifting in the Dongying Depression. Seismic records, wireline log responses, and core observations were integrated to describe the reservoir heterogeneity by delineating the architectural elements, sequence stratigraphic framework and lithofacies assemblage. A petrographic approach was adopted to constrain microscopic heterogeneity using an optical microscope, routine core analyses and X-ray diffraction (XRD) analyses. The Es3m member is interpreted as a sequence set composed of four composite sequences: CS1, CS2, CS3 and CS4. A total of forty-five sequences were identified within these four composite sequences. Sand bodies were mainly deposited as channels, levees, overbank splays, lobes and lobe fringes. The combination of fining-upward and coarsening-upward lithofacies patterns in the architectural elements produces highly complex composite flow units. Microscopic heterogeneity is produced by diagenetic alteration processes (i.e., feldspar dissolution, authigenic clay formation and quartz cementation). The widespread kaolinization of feldspar and mobilization of materials enhanced the quality of the reservoir by producing secondary enlarged pores. In contrast, the formation of pore-filling authigenic illite and illite/smectite clays reduced its permeability. Recovery rates are higher in the axial areas and smaller in the marginal areas of architectural elements. This study represents a significant insight into the reservoir architecture and heterogeneity of lacustrine turbidites, and the understanding of compartmentalization and distribution of high-quality sand reservoirs can be applied to improve primary and secondary production in these fields.

BIPAD: A web server for modeling bipartite sequence elements

PubMed Central

Bi, Chengpeng; Rogan, Peter K

2006-01-01

Background Many dimeric protein complexes bind cooperatively to families of bipartite nucleic acid sequence elements, which consist of pairs of conserved half-site sequences separated by intervening distances that vary among individual sites. Results We introduce the Bipad Server [1], a web interface to predict sequence elements embedded within unaligned sequences. Either a bipartite model, consisting of a pair of one-block position weight matrices (PWM's) with a gap distribution, or a single PWM matrix for contiguous single block motifs may be produced. The Bipad program performs multiple local alignment by entropy minimization and cyclic refinement using a stochastic greedy search strategy. The best models are refined by maximizing incremental information contents among a set of potential models with varying half site and gap lengths. Conclusion The web service generates information positional weight matrices, identifies binding site motifs, graphically represents the set of discovered elements as a sequence logo, and depicts the gap distribution as a histogram. Server performance was evaluated by generating a collection of bipartite models for distinct DNA binding proteins. PMID:16503993

Genome-wide identification and characterization of Notch transcription complex-binding sequence-paired sites in leukemia cells.

PubMed

Severson, Eric; Arnett, Kelly L; Wang, Hongfang; Zang, Chongzhi; Taing, Len; Liu, Hudan; Pear, Warren S; Shirley Liu, X; Blacklow, Stephen C; Aster, Jon C

2017-05-02

Notch transcription complexes (NTCs) drive target gene expression by binding to two distinct types of genomic response elements, NTC monomer-binding sites and sequence-paired sites (SPSs) that bind NTC dimers. SPSs are conserved and have been linked to the Notch responsiveness of a few genes. To assess the overall contribution of SPSs to Notch-dependent gene regulation, we determined the DNA sequence requirements for NTC dimerization using a fluorescence resonance energy transfer (FRET) assay and applied insights from these in vitro studies to Notch-"addicted" T cell acute lymphoblastic leukemia (T-ALL) cells. We found that SPSs contributed to the regulation of about a third of direct Notch target genes. Although originally described in promoters, SPSs are present mainly in long-range enhancers, including an enhancer containing a newly described SPS that regulates HES5 expression. Our work provides a general method for identifying SPSs in genome-wide data sets and highlights the widespread role of NTC dimerization in Notch-transformed leukemia cells. Copyright © 2017, American Association for the Advancement of Science.

Identification of a p53-response element in the promoter of the proline oxidase gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Maxwell, Steve A.; Kochevar, Gerald J.

2008-05-02

Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less

Comparative genome sequencing of Drosophila pseudoobscura: Chromosomal, gene, and cis-element evolution

PubMed Central

Richards, Stephen; Liu, Yue; Bettencourt, Brian R.; Hradecky, Pavel; Letovsky, Stan; Nielsen, Rasmus; Thornton, Kevin; Hubisz, Melissa J.; Chen, Rui; Meisel, Richard P.; Couronne, Olivier; Hua, Sujun; Smith, Mark A.; Zhang, Peili; Liu, Jing; Bussemaker, Harmen J.; van Batenburg, Marinus F.; Howells, Sally L.; Scherer, Steven E.; Sodergren, Erica; Matthews, Beverly B.; Crosby, Madeline A.; Schroeder, Andrew J.; Ortiz-Barrientos, Daniel; Rives, Catharine M.; Metzker, Michael L.; Muzny, Donna M.; Scott, Graham; Steffen, David; Wheeler, David A.; Worley, Kim C.; Havlak, Paul; Durbin, K. James; Egan, Amy; Gill, Rachel; Hume, Jennifer; Morgan, Margaret B.; Miner, George; Hamilton, Cerissa; Huang, Yanmei; Waldron, Lenée; Verduzco, Daniel; Clerc-Blankenburg, Kerstin P.; Dubchak, Inna; Noor, Mohamed A.F.; Anderson, Wyatt; White, Kevin P.; Clark, Andrew G.; Schaeffer, Stephen W.; Gelbart, William; Weinstock, George M.; Gibbs, Richard A.

2005-01-01

We have sequenced the genome of a second Drosophila species, Drosophila pseudoobscura, and compared this to the genome sequence of Drosophila melanogaster, a primary model organism. Throughout evolution the vast majority of Drosophila genes have remained on the same chromosome arm, but within each arm gene order has been extensively reshuffled, leading to a minimum of 921 syntenic blocks shared between the species. A repetitive sequence is found in the D. pseudoobscura genome at many junctions between adjacent syntenic blocks. Analysis of this novel repetitive element family suggests that recombination between offset elements may have given rise to many paracentric inversions, thereby contributing to the shuffling of gene order in the D. pseudoobscura lineage. Based on sequence similarity and synteny, 10,516 putative orthologs have been identified as a core gene set conserved over 25–55 million years (Myr) since the pseudoobscura/melanogaster divergence. Genes expressed in the testes had higher amino acid sequence divergence than the genome-wide average, consistent with the rapid evolution of sex-specific proteins. Cis-regulatory sequences are more conserved than random and nearby sequences between the species—but the difference is slight, suggesting that the evolution of cis-regulatory elements is flexible. Overall, a pattern of repeat-mediated chromosomal rearrangement, and high coadaptation of both male genes and cis-regulatory sequences emerges as important themes of genome divergence between these species of Drosophila. PMID:15632085

Compact genome of the Antarctic midge is likely an adaptation to an extreme environment.

PubMed

Kelley, Joanna L; Peyton, Justin T; Fiston-Lavier, Anna-Sophie; Teets, Nicholas M; Yee, Muh-Ching; Johnston, J Spencer; Bustamante, Carlos D; Lee, Richard E; Denlinger, David L

2014-08-12

The midge, Belgica antarctica, is the only insect endemic to Antarctica, and thus it offers a powerful model for probing responses to extreme temperatures, freeze tolerance, dehydration, osmotic stress, ultraviolet radiation and other forms of environmental stress. Here we present the first genome assembly of an extremophile, the first dipteran in the family Chironomidae, and the first Antarctic eukaryote to be sequenced. At 99 megabases, B. antarctica has the smallest insect genome sequenced thus far. Although it has a similar number of genes as other Diptera, the midge genome has very low repeat density and a reduction in intron length. Environmental extremes appear to constrain genome architecture, not gene content. The few transposable elements present are mainly ancient, inactive retroelements. An abundance of genes associated with development, regulation of metabolism and responses to external stimuli may reflect adaptations for surviving in this harsh environment.

Compact genome of the Antarctic midge is likely an adaptation to an extreme environment

PubMed Central

Kelley, Joanna L.; Peyton, Justin T.; Fiston-Lavier, Anna-Sophie; Teets, Nicholas M.; Yee, Muh-Ching; Johnston, J. Spencer; Bustamante, Carlos D.; Lee, Richard E.; Denlinger, David L.

2014-01-01

The midge, Belgica antarctica, is the only insect endemic to Antarctica, and thus it offers a powerful model for probing responses to extreme temperatures, freeze tolerance, dehydration, osmotic stress, ultraviolet radiation and other forms of environmental stress. Here we present the first genome assembly of an extremophile, the first dipteran in the family Chironomidae, and the first Antarctic eukaryote to be sequenced. At 99 megabases, B. antarctica has the smallest insect genome sequenced thus far. Although it has a similar number of genes as other Diptera, the midge genome has very low repeat density and a reduction in intron length. Environmental extremes appear to constrain genome architecture, not gene content. The few transposable elements present are mainly ancient, inactive retroelements. An abundance of genes associated with development, regulation of metabolism and responses to external stimuli may reflect adaptations for surviving in this harsh environment. PMID:25118180

Finite element analysis when orthogonal cutting of hybrid composite CFRP/Ti

NASA Astrophysics Data System (ADS)

Xu, Jinyang; El Mansori, Mohamed

2015-07-01

Hybrid composite, especially CFRP/Ti stack, is usually considered as an innovative structural configuration for manufacturing the key load-bearing components in modern aerospace industry. This paper originally proposed an FE model to simulate the total chip formation process dominated the hybrid cutting operation. The hybrid composite model was established based on three physical constituents, i.e., Ti constituent, interface and CFRP constituent. Different constitutive models and damage criteria were introduced to replicate the interrelated cutting behaviour of the stack material. The CFRP/Ti interface was modelled as a third phase through the concept of cohesive zone (CZ). Particular attention was made on the comparative studies of the influence of different cutting-sequence strategies on the machining responses induced in hybrid stack cutting. The numerical results emphasized the pivotal role of cutting-sequence strategy on the various machining induced responses including cutting-force generation, machined surface quality and induced interface damage.

De-novo discovery of differentially abundant transcription factor binding sites including their positional preference.

PubMed

Keilwagen, Jens; Grau, Jan; Paponov, Ivan A; Posch, Stefan; Strickert, Marc; Grosse, Ivo

2011-02-10

Transcription factors are a main component of gene regulation as they activate or repress gene expression by binding to specific binding sites in promoters. The de-novo discovery of transcription factor binding sites in target regions obtained by wet-lab experiments is a challenging problem in computational biology, which has not been fully solved yet. Here, we present a de-novo motif discovery tool called Dispom for finding differentially abundant transcription factor binding sites that models existing positional preferences of binding sites and adjusts the length of the motif in the learning process. Evaluating Dispom, we find that its prediction performance is superior to existing tools for de-novo motif discovery for 18 benchmark data sets with planted binding sites, and for a metazoan compendium based on experimental data from micro-array, ChIP-chip, ChIP-DSL, and DamID as well as Gene Ontology data. Finally, we apply Dispom to find binding sites differentially abundant in promoters of auxin-responsive genes extracted from Arabidopsis thaliana microarray data, and we find a motif that can be interpreted as a refined auxin responsive element predominately positioned in the 250-bp region upstream of the transcription start site. Using an independent data set of auxin-responsive genes, we find in genome-wide predictions that the refined motif is more specific for auxin-responsive genes than the canonical auxin-responsive element. In general, Dispom can be used to find differentially abundant motifs in sequences of any origin. However, the positional distribution learned by Dispom is especially beneficial if all sequences are aligned to some anchor point like the transcription start site in case of promoter sequences. We demonstrate that the combination of searching for differentially abundant motifs and inferring a position distribution from the data is beneficial for de-novo motif discovery. Hence, we make the tool freely available as a component of the open-source Java framework Jstacs and as a stand-alone application at http://www.jstacs.de/index.php/Dispom.

Filament condition-specific response elements control the expression of NRG1 and UME6, key transcriptional regulators of morphology and virulence in Candida albicans.

PubMed

Childers, Delma S; Kadosh, David

2015-01-01

Candida albicans is the most frequently isolated human fungal pathogen and can cause a range of mucosal and systemic infections in immunocompromised individuals. Morphogenesis, the ability to undergo a reversible transition from budding yeast to elongated filaments, is an essential virulence trait. The yeast-to-filament transition is associated with expression of genes specifically important for filamentation as well as other virulence-related processes, and is controlled, in part, by the key transcriptional regulators Nrg1 and Ume6. Both of these regulators are themselves controlled at the transcriptional level by filament-inducing environmental cues, although little is known about how this process occurs. In order to address this question and determine whether environmental signals regulate transcription of UME6 and NRG1 via distinct and/or common promoter elements, we performed promoter deletion analyses. Strains bearing promoter deletion constructs were induced to form filaments in YEPD plus 10% serum at 37°C, Spider medium (nitrogen and carbon starvation) and/or Lee's medium pH 6.8 (neutral pH) and reporter gene expression was measured. In the NRG1 promoter we identified several distinct condition-specific response elements for YEPD plus 10% serum at 37°C and Spider medium. In the UME6 promoter we also identified response elements for YEPD plus 10% serum at 37°C. While a few of these elements are distinct, others overlap with those which respond to Lee's pH 6.8 medium. Consistent with UME6 possessing a very long 5' UTR, many response elements in the UME6 promoter are located significantly upstream from the coding sequence. Our data indicate that certain distinct condition-specific elements can control expression of C. albicans UME6 and NRG1 in response to key filament-inducing environmental cues. Because C. albicans encounters a variety of host microenvironments during infection, our results suggest that UME6 and NRG1 expression can be differentially modulated by multiple signaling pathways to control filamentation and virulence in vivo.

Structural requirements for recognition of the HLA-Dw14 class II epitope: A key HLA determinant associated with rheumatoid arthritis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hiraiwa, Akikazu; Yamanaka, Katsuo; Kwok, W.W.

Although HLA genes have been shown to be associated with certain diseases, the basis for this association is unknown. Recent studies, however, have documented patterns of nucleotide sequence variation among some HLA genes associated with a particular disease. For rheumatoid arthritis, HLA genes in most patients have a shared nucleotide sequence encoding a key structural element of an HLA class II polypeptide; this sequence element is critical for the interaction of the HLA molecule with antigenic peptides and with responding T cells, suggestive of a direct role for this sequence element in disease susceptibility. The authors describe the serological andmore » cellular immunologic characteristics encoded by this rheumatoid arthritis-associated sequence element. Site-directed mutagenesis of the DRB1 gene was used to define amino acids critical for antibody and T-cell recognition of this structural element, focusing on residues that distinguish the rheumatoid arthritis-associated alleles Dw4 and Dw14 from a closely related allele, Dw10, not associated with disease. Both the gain and loss of rheumatoid arthritis-associated epitopes were highly dependent on three residues within a discrete domain of the HLA-DR molecule. Recognition was most strongly influenced by the following amino acids (in order): 70 > 71 > 67. Some alloreactive T-cell clones were also influenced by amino acid variation in portions of the DR molecule lying outside the shared sequence element.« less

Promoter activity of polypyrimidine tract-binding protein genes of potato responds to environmental cues.

PubMed

Butler, Nathaniel M; Hannapel, David J

2012-12-01

Polypyrimidine tract-binding (PTB) proteins are RNA-binding proteins that target specific RNAs for post-transcriptional processing by binding cytosine/uracil motifs. PTBs have established functions in a range of RNA processes including splicing, translation, stability and long-distance transport. Six PTB-like genes identified in potato have been grouped into two clades based on homology to other known plant PTBs. StPTB1 and StPTB6 are closely related to a PTB protein discovered in pumpkin, designated CmRBP50, and contain four canonical RNA-recognition motifs. CmRBP50 is expressed in phloem tissues and functions as the core protein of a phloem-mobile RNA/protein complex. Sequence from the potato genome database was used to clone the upstream sequence of these two PTB genes and analyzed to identify conserved cis-elements. The promoter of StPTB6 was enriched for regulatory elements for light and sucrose induction and defense. Upstream sequence of both PTB genes was fused to β-glucuronidase and monitored in transgenic potato lines. In whole plants, the StPTB1 promoter was most active in leaf veins and petioles, whereas StPTB6 was most active in leaf mesophyll. Both genes are active in new tubers and tuber sprouts. StPTB6 expression was induced in stems and stolon sections in response to sucrose and in leaves or petioles in response to light, heat, drought and mechanical wounding. These results show that CmRBP50-like genes of potato exhibit distinct expression patterns and respond to both developmental and environmental cues.

Aberrant connections between climbing fibres and Purkinje cells induce alterations in the timing of an instrumental response in the rat.

PubMed

Gaytán-Tocavén, Lorena; López-Vázquez, Miguel Ángel; Guevara, Miguel Ángel; Olvera-Cortés, María Esther

2017-09-01

Cerebellar participation in timing and sensory-motor sequences has been supported by several experimental and clinical studies. A relevant role of the cerebellum in timing of conditioned responses in the range of milliseconds has been demonstrated, but less is known regarding the role of the cerebellum in supra-second timing of operant responses. A dissociated role of the cerebellum and striatum in timing in the millisecond and second range had been reported, respectively. The climbing fibre-Purkinje cell synapse is crucial in timing models; thus, the aberrant connection between these cellular elements is a suitable model for evaluating the contribution of the cerebellum in timing in the supra-second range. The aberrant connection between climbing fibres and Purkinje cells was induced by administration of the antagonist of NMDA receptors MK-801 to Sprague-Dawley rats at postnatal days 7-14. The timing of an operant response with two fixed intervals (5 and 8 s) and egocentric sequential learning was evaluated in 60-day-old adult rats. The aberrant connections caused a reduced accuracy in the timing of the instrumental response that was more evident in the 8-s interval and a reduced number of successive correct responses (responses emitted in the correct second without any other response between them) in the 8-s interval. In addition, an inability to incorporate new information in a sequence previously learned in egocentric-based sequence learning was apparent in rats with aberrant CF-PC synapses. These results support a relevant role for the cerebellum in the fine-tuning of the timing of operant responses in the supra-second range.

The viral protein A238L inhibits cyclooxygenase-2 expression through a nuclear factor of activated T cell-dependent transactivation pathway.

PubMed

Granja, Aitor G; Nogal, Maria L; Hurtado, Carolina; Vila, Virginia; Carrascosa, Angel L; Salas, María L; Fresno, Manuel; Revilla, Yolanda

2004-12-17

Cyclooxygenase-2 is transiently induced upon cell activation or viral infections, resulting in inflammation and modulation of the immune response. Here we report that A238L, an African swine fever virus protein, efficiently inhibits cyclooxygenase-2 gene expression in Jurkat T cells and in virus-infected Vero cells. Transfection of Jurkat cells stably expressing A238L with cyclooxygenase-2 promoter-luciferase constructs containing 5'-terminal deletions or mutations in distal or proximal nuclear factor of activated T cell (NFAT) response elements revealed that these sequences are involved in the inhibition induced by A238L. Overexpression of a constitutively active version of the calcium-dependent phosphatase calcineurin or NFAT reversed the inhibition mediated by A238L on cyclooxygenase-2 promoter activation, whereas overexpression of p65 NFkappaB had no effect. A238L does not modify the nuclear localization of NFAT after phorbol 12-myristate 13-acetate/calcium ionophore stimulation. Moreover, we show that the mechanism by which the viral protein down-regulates cyclooxygenase-2 activity does not involve inhibition of the binding between NFAT and its specific DNA sequences into the cyclooxygenase-2 promoter. Strikingly, A238L dramatically inhibited the transactivation mediated by a GAL4-NFAT fusion protein containing the N-terminal transactivation domain of NFAT1. Taken together, these data indicate that A238L down-regulates cyclooxygenase-2 transcription through the NFAT response elements, being NFAT-dependent transactivation implicated in this down-regulation.

Expression profiling during arabidopsis/downy mildew interaction reveals a highly-expressed effector that attenuates responses to salicylic acid.

PubMed

Asai, Shuta; Rallapalli, Ghanasyam; Piquerez, Sophie J M; Caillaud, Marie-Cécile; Furzer, Oliver J; Ishaque, Naveed; Wirthmueller, Lennart; Fabro, Georgina; Shirasu, Ken; Jones, Jonathan D G

2014-10-01

Plants have evolved strong innate immunity mechanisms, but successful pathogens evade or suppress plant immunity via effectors delivered into the plant cell. Hyaloperonospora arabidopsidis (Hpa) causes downy mildew on Arabidopsis thaliana, and a genome sequence is available for isolate Emoy2. Here, we exploit the availability of genome sequences for Hpa and Arabidopsis to measure gene-expression changes in both Hpa and Arabidopsis simultaneously during infection. Using a high-throughput cDNA tag sequencing method, we reveal expression patterns of Hpa predicted effectors and Arabidopsis genes in compatible and incompatible interactions, and promoter elements associated with Hpa genes expressed during infection. By resequencing Hpa isolate Waco9, we found it evades Arabidopsis resistance gene RPP1 through deletion of the cognate recognized effector ATR1. Arabidopsis salicylic acid (SA)-responsive genes including PR1 were activated not only at early time points in the incompatible interaction but also at late time points in the compatible interaction. By histochemical analysis, we found that Hpa suppresses SA-inducible PR1 expression, specifically in the haustoriated cells into which host-translocated effectors are delivered, but not in non-haustoriated adjacent cells. Finally, we found a highly-expressed Hpa effector candidate that suppresses responsiveness to SA. As this approach can be easily applied to host-pathogen interactions for which both host and pathogen genome sequences are available, this work opens the door towards transcriptome studies in infection biology that should help unravel pathogen infection strategies and the mechanisms by which host defense responses are overcome.

Effects of APC De-targeting and GAr modification on the duration of luciferase expression from plasmid DNA delivered to skeletal muscle.

PubMed

Subang, Maria C; Fatah, Rewas; Wu, Ying; Hannaman, Drew; Rice, Jason; Evans, Claire F; Chernajovsky, Yuti; Gould, David

2015-01-01

Immune responses to expressed foreign transgenes continue to hamper progress of gene therapy development. Translated foreign proteins with intracellular location are generally less accessible to the immune system, nevertheless they can be presented to the immune system through both MHC Class I and Class II pathways. When the foreign protein luciferase was expressed following intramuscular delivery of plasmid DNA in outbred mice, expression rapidly declined over 4 weeks. Through modifications to the expression plasmid and the luciferase transgene we examined the effect of detargeting expression away from antigen-presenting cells (APCs), targeting expression to skeletal muscle and fusion with glycine-alanine repeats (GAr) that block MHC-Class I presentation on the duration of luciferase expression. De-targeting expression from APCs with miR142-3p target sequences incorporated into the luciferase 3'UTR reduced the humoral immune response to both native and luciferase modified with a short GAr sequence but did not prolong the duration of expression. When a skeletal muscle specific promoter was combined with the miR target sequences the humoral immune response was dampened and luciferase expression persisted at higher levels for longer. Interestingly, fusion of luciferase with a longer GAr sequence promoted the decline in luciferase expression and increased the humoral immune response to luciferase. These studies demonstrate that expression elements and transgene modifications can alter the duration of transgene expression but other factors will need to overcome before foreign transgenes expressed in skeletal muscle are immunologically silent.

In silico analysis of cis-acting regulatory elements in 5' regulatory regions of sucrose transporter gene families in rice (Oryza sativa Japonica) and Arabidopsis thaliana.

PubMed

Ibraheem, Omodele; Botha, Christiaan E J; Bradley, Graeme

2010-12-01

The regulation of gene expression involves a multifarious regulatory system. Each gene contains a unique combination of cis-acting regulatory sequence elements in the 5' regulatory region that determines its temporal and spatial expression. Cis-acting regulatory elements are essential transcriptional gene regulatory units; they control many biological processes and stress responses. Thus a full understanding of the transcriptional gene regulation system will depend on successful functional analyses of cis-acting elements. Cis-acting regulatory elements present within the 5' regulatory region of the sucrose transporter gene families in rice (Oryza sativa Japonica cultivar-group) and Arabidopsis thaliana, were identified using a bioinformatics approach. The possible cis-acting regulatory elements were predicted by scanning 1.5kbp of 5' regulatory regions of the sucrose transporter genes translational start sites, using Plant CARE, PLACE and Genomatix Matinspector professional databases. Several cis-acting regulatory elements that are associated with plant development, plant hormonal regulation and stress response were identified, and were present in varying frequencies within the 1.5kbp of 5' regulatory region, among which are; A-box, RY, CAT, Pyrimidine-box, Sucrose-box, ABRE, ARF, ERE, GARE, Me-JA, ARE, DRE, GA-motif, GATA, GT-1, MYC, MYB, W-box, and I-box. This result reveals the probable cis-acting regulatory elements that possibly are involved in the expression and regulation of sucrose transporter gene families in rice and Arabidopsis thaliana during cellular development or environmental stress conditions. Copyright © 2010 Elsevier Ltd. All rights reserved.

Finite element modeling of ROPS in static testing and rear overturns.

PubMed

Harris, J R; Mucino, V H; Etherton, J R; Snyder, K A; Means, K H

2000-08-01

Even with the technological advances of the last several decades, agricultural production remains one of the most hazardous occupations in the United States. Death due to tractor rollover is a prime contributor to this hazard. Standards for rollover protective structures (ROPS) performance and certification have been developed by groups such as the Society of Automotive Engineers (SAE) and the American Society of Agricultural Engineers (ASAE) to combat these problems. The current ROPS certification standard, SAE J2194, requires either a dynamic or static testing sequence or both. Although some ROPS manufacturers perform both the dynamic and static phases of SAE J2194 testing, it is possible for a ROPS to be certified for field operation using static testing alone. This research compared ROPS deformation response from a simulated SAE J2194 static loading sequence to ROPS deformation response as a result of a simulated rearward tractor rollover. Finite element analysis techniques for plastic deformation were used to simulate both the static and dynamic rear rollover scenarios. Stress results from the rear rollover model were compared to results from simulated static testing per SAE J2194. Maximum stress values from simulated rear rollovers exceeded maximum stress values recorded during simulated static testing for half of the elements comprising the uprights. In the worst case, the static model underpredicts dynamic model results by approximately 7%. In the best case, the static model overpredicts dynamic model results by approximately 32%. These results suggest the need for additional experimental work to characterize ROPS stress levels during staged overturns and during testing according to the SAE standard.

The structure of the coding and 5'-flanking region of the type 1 iodothyronine deiodinase (dio1) gene is normal in a patient with suspected congenital dio1 deficiency.

PubMed

Toyoda, N; Kleinhaus, N; Larsen, P R

1996-06-01

We analyzed the exon-intron structure of the human type 1 deiodinase gene (dio1) and compared it with that of a patient with suspected congenital type 1 deiodinase (D1) deficiency. The hdio1 gene is identical in exon-intron arrangement to the mouse gene, with coding sequences and a selenocysteine insertion sequence (SECIS) element contained in four exons. There were no mutations in the sequences of exons 1-4 of the patient's genomic DNA. Functional studies by transient expression techniques showed no difference in basal promoter activity or T3 responsiveness between the patient's and the normal dio1 gene. A structural abnormality in the dio1 gene is not a likely explanation for this patient's D1-deficient phenotype.

The Genome Sequence of Taurine Cattle: A window to ruminant biology and evolution

PubMed Central

Elsik, Christine G.; Tellam, Ross L.; Worley, Kim C.

2010-01-01

To understand the biology and evolution of ruminants, the cattle genome was sequenced to ∼7× coverage. The cattle genome contains a minimum of 22,000 genes, with a core set of 14,345 orthologs shared among seven mammalian species of which 1,217 are absent or undetected in non-eutherian (marsupial or monotreme) genomes. Cattle-specific evolutionary breakpoint regions in chromosomes have a higher density of segmental duplications, enrichment of repetitive elements, and species-specific variations in genes associated with lactation and immune responsiveness. Genes involved in metabolism are generally highly conserved, although five metabolic genes are deleted or extensively diverged from their human orthologs. The cattle genome sequence thus provides an enabling resource for understanding mammalian evolution and accelerating livestock genetic improvement for milk and meat production. PMID:19390049

CREB expression in the brains of two closely related parasitic wasp species that differ in long-term memory formation.

PubMed

van den Berg, M; Verbaarschot, P; Hontelez, S; Vet, L E M; Dicke, M; Smid, H M

2010-06-01

The cAMP/PKA signalling pathway and transcription factor cAMP response element-binding protein (CREB) play key roles in long-term memory (LTM) formation. We used two closely related parasitic wasp species, Cotesia glomerata and Cotesia rubecula, which were previously shown to be different in LTM formation, and sequenced at least nine different CREB transcripts in both wasp species. The splicing patterns, functional domains and amino acid sequences were similar to those found in the CREB genes of other organisms. The predicted amino acid sequences of the CREB isoforms were identical in both wasp species. Using real-time quantitative PCR we found that two low abundant CREB transcripts are differentially expressed in the two wasps, whereas the expression levels of high abundant transcripts are similar.

Functional cooperativity between two TPA responsive elements in undifferentiated F9 embryonic stem cells.

PubMed Central

Okuda, A; Imagawa, M; Sakai, M; Muramatsu, M

1990-01-01

We have recently identified an enhancer, termed GPEI, in the 5'-flanking region of the rat glutathione transferase P gene, that is composed of two imperfect TPA (phorbol 12-O-tetradecanoate 13-acetate) responsive elements (TREs). Unlike other TRE-containing enhancers, GPEI exhibits a strong transcriptional enhancing activity in F9 embryonic stem cells. Mutational analyses have revealed that the high activity of GPEI is mediated by two imperfect TREs. Each TRE-like sequence has no activity by itself but acts synergistically to form a strong enhancer which is active even in the very low level of AP-1 activity in F9 cells. Furthermore, we show that synthetic DNAs containing two perfect TREs in certain arrangements have strong transcriptional enhancing activities in F9 cells and the activity is greatly influenced by the relative orientation and the distance of two TREs. Images Fig. 1. Fig. 2. Fig. 3. PMID:2323334

Marine Natural Product Honaucin A Attenuates Inflammation by Activating the Nrf2-ARE Pathway.

PubMed

Mascuch, Samantha J; Boudreau, Paul D; Carland, Tristan M; Pierce, N Tessa; Olson, Joshua; Hensler, Mary E; Choi, Hyukjae; Campanale, Joseph; Hamdoun, Amro; Nizet, Victor; Gerwick, William H; Gaasterland, Teresa; Gerwick, Lena

2018-03-23

The cyanobacterial marine natural product honaucin A inhibits mammalian innate inflammation in vitro and in vivo. To decipher its mechanism of action, RNA sequencing was used to evaluate differences in gene expression of cultured macrophages following honaucin A treatment. This analysis led to the hypothesis that honaucin A exerts its anti-inflammatory activity through activation of the cytoprotective nuclear erythroid 2-related factor 2 (Nrf2)-antioxidant response element/electrophile response element (ARE/EpRE) signaling pathway. Activation of this pathway by honaucin A in cultured human MCF7 cells was confirmed using an Nrf2 luciferase reporter assay. In vitro alkylation experiments with the natural product and N-acetyl-l-cysteine suggest that honaucin A activates this pathway through covalent interaction with the sulfhydryl residues of the cytosolic repressor protein Keap1. Honaucin A presents a potential therapeutic lead for diseases with an inflammatory component modulated by Nrf2-ARE.

The human immunodeficiency virus type 1 long terminal repeat specifies two different transcription complexes, only one of which is regulated by Tat.

PubMed Central

Lu, X; Welsh, T M; Peterlin, B M

1993-01-01

The human immunodeficiency virus type 1 long terminal repeat sets up two different transcription complexes, which have been called processive and nonprocessive complexes. By mutating and substituting cis-acting sequences, we mapped elements of the human immunodeficiency virus long terminal repeat that are responsible for creating each transcription complex. Whereas processive complexes are efficiently assembled by upstream promoter elements in the absence of the TATA box, nonprocessive complexes absolutely require the TATA box. Moreover, the TATA box alone can set up these nonprocessive complexes, and nonprocessive but not processive complexes are trans activated by Tat. Finally, a strong DNA-binding site between the TATA box and trans-activation-responsive region interferes with either the assembly or movement of these nonprocessive complexes and diminishes the effects of Tat. Thus, Tat affects a critical step in the formation of elongation-competent transcription complexes. Images PMID:8445708

Stress induced gene expression drives transient DNA methylation changes at adjacent repetitive elements

PubMed Central

Secco, David; Wang, Chuang; Shou, Huixia; Schultz, Matthew D; Chiarenza, Serge; Nussaume, Laurent; Ecker, Joseph R; Whelan, James; Lister, Ryan

2015-01-01

Cytosine DNA methylation (mC) is a genome modification that can regulate the expression of coding and non-coding genetic elements. However, little is known about the involvement of mC in response to environmental cues. Using whole genome bisulfite sequencing to assess the spatio-temporal dynamics of mC in rice grown under phosphate starvation and recovery conditions, we identified widespread phosphate starvation-induced changes in mC, preferentially localized in transposable elements (TEs) close to highly induced genes. These changes in mC occurred after changes in nearby gene transcription, were mostly DCL3a-independent, and could partially be propagated through mitosis, however no evidence of meiotic transmission was observed. Similar analyses performed in Arabidopsis revealed a very limited effect of phosphate starvation on mC, suggesting a species-specific mechanism. Overall, this suggests that TEs in proximity to environmentally induced genes are silenced via hypermethylation, and establishes the temporal hierarchy of transcriptional and epigenomic changes in response to stress. DOI: http://dx.doi.org/10.7554/eLife.09343.001 PMID:26196146

Storing and managing information artifacts collected by information analysts using a computing device

DOEpatents

Pike, William A; Riensche, Roderick M; Best, Daniel M; Roberts, Ian E; Whyatt, Marie V; Hart, Michelle L; Carr, Norman J; Thomas, James J

2012-09-18

Systems and computer-implemented processes for storage and management of information artifacts collected by information analysts using a computing device. The processes and systems can capture a sequence of interactive operation elements that are performed by the information analyst, who is collecting an information artifact from at least one of the plurality of software applications. The information artifact can then be stored together with the interactive operation elements as a snippet on a memory device, which is operably connected to the processor. The snippet comprises a view from an analysis application, data contained in the view, and the sequence of interactive operation elements stored as a provenance representation comprising operation element class, timestamp, and data object attributes for each interactive operation element in the sequence.

Identification of a Recently Active Mammalian SINE Derived from Ribosomal RNA

PubMed Central

Longo, Mark S.; Brown, Judy D.; Zhang, Chu; O’Neill, Michael J.; O’Neill, Rachel J.

2015-01-01

Complex eukaryotic genomes are riddled with repeated sequences whose derivation does not coincide with phylogenetic history and thus is often unknown. Among such sequences, the capacity for transcriptional activity coupled with the adaptive use of reverse transcription can lead to a diverse group of genomic elements across taxa, otherwise known as selfish elements or mobile elements. Short interspersed nuclear elements (SINEs) are nonautonomous mobile elements found in eukaryotic genomes, typically derived from cellular RNAs such as tRNAs, 7SL or 5S rRNA. Here, we identify and characterize a previously unknown SINE derived from the 3′-end of the large ribosomal subunit (LSU or 28S rDNA) and transcribed via RNA polymerase III. This new element, SINE28, is represented in low-copy numbers in the human reference genome assembly, wherein we have identified 27 discrete loci. Phylogenetic analysis indicates these elements have been transpositionally active within primate lineages as recently as 6 MYA while modern humans still carry transcriptionally active copies. Moreover, we have identified SINE28s in all currently available assembled mammalian genome sequences. Phylogenetic comparisons indicate that these elements are frequently rederived from the highly conserved LSU rRNA sequences in a lineage-specific manner. We propose that this element has not been previously recognized as a SINE given its high identity to the canonical LSU, and that SINE28 likely represents one of possibly many unidentified, active transposable elements within mammalian genomes. PMID:25637222

Transcription initiation from the dihydrofolate reductase promoter is positioned by HIP1 binding at the initiation site.

PubMed

Means, A L; Farnham, P J

1990-02-01

We have identified a sequence element that specifies the position of transcription initiation for the dihydrofolate reductase gene. Unlike the functionally analogous TATA box that directs RNA polymerase II to initiate transcription 30 nucleotides downstream, the positioning element of the dihydrofolate reductase promoter is located directly at the site of transcription initiation. By using DNase I footprint analysis, we have shown that a protein binds to this initiator element. Transcription initiated at the dihydrofolate reductase initiator element when 28 nucleotides were inserted between it and all other upstream sequences, or when it was placed on either side of the DNA helix, suggesting that there is no strict spatial requirement between the initiator and an upstream element. Although neither a single Sp1-binding site nor a single initiator element was sufficient for transcriptional activity, the combination of one Sp1-binding site and the dihydrofolate reductase initiator element cloned into a plasmid vector resulted in transcription starting at the initiator element. We have also shown that the simian virus 40 late major initiation site has striking sequence homology to the dihydrofolate reductase initiation site and that the same, or a similar, protein binds to both sites. Examination of the sequences at other RNA polymerase II initiation sites suggests that we have identified an element that is important in the transcription of other housekeeping genes. We have thus named the protein that binds to the initiator element HIP1 (Housekeeping Initiator Protein 1).

Project Report: Automatic Sequence Processor Software Analysis

NASA Technical Reports Server (NTRS)

Benjamin, Brandon

2011-01-01

The Mission Planning and Sequencing (MPS) element of Multi-Mission Ground System and Services (MGSS) provides space missions with multi-purpose software to plan spacecraft activities, sequence spacecraft commands, and then integrate these products and execute them on spacecraft. Jet Propulsion Laboratory (JPL) is currently is flying many missions. The processes for building, integrating, and testing the multi-mission uplink software need to be improved to meet the needs of the missions and the operations teams that command the spacecraft. The Multi-Mission Sequencing Team is responsible for collecting and processing the observations, experiments and engineering activities that are to be performed on a selected spacecraft. The collection of these activities is called a sequence and ultimately a sequence becomes a sequence of spacecraft commands. The operations teams check the sequence to make sure that no constraints are violated. The workflow process involves sending a program start command, which activates the Automatic Sequence Processor (ASP). The ASP is currently a file-based system that is comprised of scripts written in perl, c-shell and awk. Once this start process is complete, the system checks for errors and aborts if there are any; otherwise the system converts the commands to binary, and then sends the resultant information to be radiated to the spacecraft.

Low-pass sequencing for microbial comparative genomics

PubMed Central

Goo, Young Ah; Roach, Jared; Glusman, Gustavo; Baliga, Nitin S; Deutsch, Kerry; Pan, Min; Kennedy, Sean; DasSarma, Shiladitya; Victor Ng, Wailap; Hood, Leroy

2004-01-01

Background We studied four extremely halophilic archaea by low-pass shotgun sequencing: (1) the metabolically versatile Haloarcula marismortui; (2) the non-pigmented Natrialba asiatica; (3) the psychrophile Halorubrum lacusprofundi and (4) the Dead Sea isolate Halobaculum gomorrense. Approximately one thousand single pass genomic sequences per genome were obtained. The data were analyzed by comparative genomic analyses using the completed Halobacterium sp. NRC-1 genome as a reference. Low-pass shotgun sequencing is a simple, inexpensive, and rapid approach that can readily be performed on any cultured microbe. Results As expected, the four archaeal halophiles analyzed exhibit both bacterial and eukaryotic characteristics as well as uniquely archaeal traits. All five halophiles exhibit greater than sixty percent GC content and low isoelectric points (pI) for their predicted proteins. Multiple insertion sequence (IS) elements, often involved in genome rearrangements, were identified in H. lacusprofundi and H. marismortui. The core biological functions that govern cellular and genetic mechanisms of H. sp. NRC-1 appear to be conserved in these four other halophiles. Multiple TATA box binding protein (TBP) and transcription factor IIB (TFB) homologs were identified from most of the four shotgunned halophiles. The reconstructed molecular tree of all five halophiles shows a large divergence between these species, but with the closest relationship being between H. sp. NRC-1 and H. lacusprofundi. Conclusion Despite the diverse habitats of these species, all five halophiles share (1) high GC content and (2) low protein isoelectric points, which are characteristics associated with environmental exposure to UV radiation and hypersalinity, respectively. Identification of multiple IS elements in the genome of H. lacusprofundi and H. marismortui suggest that genome structure and dynamic genome reorganization might be similar to that previously observed in the IS-element rich genome of H. sp. NRC-1. Identification of multiple TBP and TFB homologs in these four halophiles are consistent with the hypothesis that different types of complex transcriptional regulation may occur through multiple TBP-TFB combinations in response to rapidly changing environmental conditions. Low-pass shotgun sequence analyses of genomes permit extensive and diverse analyses, and should be generally useful for comparative microbial genomics. PMID:14718067

Design sensitivity analysis of rotorcraft airframe structures for vibration reduction

NASA Technical Reports Server (NTRS)

Murthy, T. Sreekanta

1987-01-01

Optimization of rotorcraft structures for vibration reduction was studied. The objective of this study is to develop practical computational procedures for structural optimization of airframes subject to steady-state vibration response constraints. One of the key elements of any such computational procedure is design sensitivity analysis. A method for design sensitivity analysis of airframes under vibration response constraints is presented. The mathematical formulation of the method and its implementation as a new solution sequence in MSC/NASTRAN are described. The results of the application of the method to a simple finite element stick model of the AH-1G helicopter airframe are presented and discussed. Selection of design variables that are most likely to bring about changes in the response at specified locations in the airframe is based on consideration of forced response strain energy. Sensitivity coefficients are determined for the selected design variable set. Constraints on the natural frequencies are also included in addition to the constraints on the steady-state response. Sensitivity coefficients for these constraints are determined. Results of the analysis and insights gained in applying the method to the airframe model are discussed. The general nature of future work to be conducted is described.

The application of the high throughput sequencing technology in the transposable elements.

PubMed

Liu, Zhen; Xu, Jian-hong

2015-09-01

High throughput sequencing technology has dramatically improved the efficiency of DNA sequencing, and decreased the costs to a great extent. Meanwhile, this technology usually has advantages of better specificity, higher sensitivity and accuracy. Therefore, it has been applied to the research on genetic variations, transcriptomics and epigenomics. Recently, this technology has been widely employed in the studies of transposable elements and has achieved fruitful results. In this review, we summarize the application of high throughput sequencing technology in the fields of transposable elements, including the estimation of transposon content, preference of target sites and distribution, insertion polymorphism and population frequency, identification of rare copies, transposon horizontal transfers as well as transposon tagging. We also briefly introduce the major common sequencing strategies and algorithms, their advantages and disadvantages, and the corresponding solutions. Finally, we envision the developing trends of high throughput sequencing technology, especially the third generation sequencing technology, and its application in transposon studies in the future, hopefully providing a comprehensive understanding and reference for related scientific researchers.

Discovery of rare, diagnostic AluYb8/9 elements in diverse human populations.

PubMed

Feusier, Julie; Witherspoon, David J; Scott Watkins, W; Goubert, Clément; Sasani, Thomas A; Jorde, Lynn B

2017-01-01

Polymorphic human Alu elements are excellent tools for assessing population structure, and new retrotransposition events can contribute to disease. Next-generation sequencing has greatly increased the potential to discover Alu elements in human populations, and various sequencing and bioinformatics methods have been designed to tackle the problem of detecting these highly repetitive elements. However, current techniques for Alu discovery may miss rare, polymorphic Alu elements. Combining multiple discovery approaches may provide a better profile of the polymorphic Alu mobilome. Alu Yb8/9 elements have been a focus of our recent studies as they are young subfamilies (~2.3 million years old) that contribute ~30% of recent polymorphic Alu retrotransposition events. Here, we update our ME-Scan methods for detecting Alu elements and apply these methods to discover new insertions in a large set of individuals with diverse ancestral backgrounds. We identified 5,288 putative Alu insertion events, including several hundred novel Alu Yb8/9 elements from 213 individuals from 18 diverse human populations. Hundreds of these loci were specific to continental populations, and 23 non-reference population-specific loci were validated by PCR. We provide high-quality sequence information for 68 rare Alu Yb8/9 elements, of which 11 have hallmarks of an active source element. Our subfamily distribution of rare Alu Yb8/9 elements is consistent with previous datasets, and may be representative of rare loci. We also find that while ME-Scan and low-coverage, whole-genome sequencing (WGS) detect different Alu elements in 41 1000 Genomes individuals, the two methods yield similar population structure results. Current in-silico methods for Alu discovery may miss rare, polymorphic Alu elements. Therefore, using multiple techniques can provide a more accurate profile of Alu elements in individuals and populations. We improved our false-negative rate as an indicator of sample quality for future ME-Scan experiments. In conclusion, we demonstrate that ME-Scan is a good supplement for next-generation sequencing methods and is well-suited for population-level analyses.

Identification of Bari Transposons in 23 Sequenced Drosophila Genomes Reveals Novel Structural Variants, MITEs and Horizontal Transfer

PubMed Central

D’Addabbo, Pietro; Caizzi, Ruggiero

2016-01-01

Bari elements are members of the Tc1-mariner superfamily of DNA transposons, originally discovered in Drosophila melanogaster, and subsequently identified in silico in 11 sequenced Drosophila genomes and as experimentally isolated in four non-sequenced Drosophila species. Bari-like elements have been also studied for their mobility both in vivo and in vitro. We analyzed 23 Drosophila genomes and carried out a detailed characterization of the Bari elements identified, including those from the heterochromatic Bari1 cluster in D. melanogaster. We have annotated 401 copies of Bari elements classified either as putatively autonomous or inactive according to the structure of the terminal sequences and the presence of a complete transposase-coding region. Analyses of the integration sites revealed that Bari transposase prefers AT-rich sequences in which the TA target is cleaved and duplicated. Furthermore evaluation of transposon’s co-occurrence near the integration sites of Bari elements showed a non-random distribution of other transposable elements. We also unveil the existence of a putatively autonomous Bari1 variant characterized by two identical long Terminal Inverted Repeats, in D. rhopaloa. In addition, we detected MITEs related to Bari transposons in 9 species. Phylogenetic analyses based on transposase gene and the terminal sequences confirmed that Bari-like elements are distributed into three subfamilies. A few inconsistencies in Bari phylogenetic tree with respect to the Drosophila species tree could be explained by the occurrence of horizontal transfer events as also suggested by the results of dS analyses. This study further clarifies the Bari transposon’s evolutionary dynamics and increases our understanding on the Tc1-mariner elements’ biology. PMID:27213270

Isolation and molecular characterization of dTnp1, a mobile and defective transposable element of Nicotiana plumbaginifolia.

PubMed

Meyer, C; Pouteau, S; Rouzé, P; Caboche, M

1994-01-01

By Northern blot analysis of nitrate reductase-deficient mutants of Nicotiana plumbaginifolia, we identified a mutant (mutant D65), obtained after gamma-ray irradiation of protoplasts, which contained an insertion sequence in the nitrate reductase (NR) mRNA. This insertion sequence was localized by polymerase chain reaction (PCR) in the first exon of NR and was also shown to be present in the NR gene. The mutant gene contained a 565 bp insertion sequence that exhibits the sequence characteristics of a transposable element, which was thus named dTnp1. The dTnp1 element has 14 bp terminal inverted repeats and is flanked by an 8-bp target site duplication generated upon transposition. These inverted repeats have significant sequence homology with those of other transposable elements. Judging by its size and the absence of a long open reading frame, dTnp1 appears to represent a defective, although mobile, transposable element. The octamer motif TTTAGGCC was found several times in direct orientation near the 5' and 3' ends of dTnp1 together with a perfect palindrome located after the 5' inverted repeat. Southern blot analysis using an internal probe of dTnp1 suggested that this element occurs as a single copy in the genome of N. plumbaginifolia. It is also present in N. tabacum, but absent in tomato or petunia. The dTnp1 element is therefore of potential use for gene tagging in Nicotiana species.

Vertical Transmission of the Retrotransposable Elements R1 and R2 during the Evolution of the Drosophila Melanogaster Species Subgroup

PubMed Central

Eickbush, D. G.; Eickbush, T. H.

1995-01-01

R1 and R2 are non-long-terminal repeat retrotransposable elements that insert into specific sequences of insect 28S ribosomal RNA genes. These elements have been extensively described in Drosophila melanogaster. To determine whether these elements have been horizontally or vertically transmitted, we characterized R1 and R2 elements from the seven other members of the melanogaster species subgroup by genomic blotting and nucleotide sequencing. Each species was found to have homogeneous families of R1 and R2 elements with the exception of erecta and orena, which have no R2 elements. The DNA sequences of multiple R1 and R2 copies from each species indicated nucleotide divergence within each species averaged only 0.48% for R1 and 0.35% for R2, well below the level of divergence among the species. Most copies of R1 and R2 (40 of 47) sequenced from the seven species were potentially functional, as indicated by the absence of premature termination codons or translational frameshifts that would destroy the open reading frame of the element. The sequence relationships of both the R1 and R2 elements from the various members of the melanogaster subgroup closely followed that of the species phylogeny, suggesting that R1 and R2 have been stably maintained by vertical transmission since the origin of this species subgroup 17-20 million years ago. The remarkable stability of R1 and R2, compared to what has been suggested for transposable elements that insert at multiple locations in these same species, may be due to their unique specificity for sites in the rRNA gene locus. Under low copy number conditions, when it is essential for any mobile element to transpose, the insertion specificities of R1 and R2 ensure uniform developmentally regulated target sites that can be occupied with little or no detrimental effect on the host. PMID:7713424

TPA can overcome the requirement for EIa and together act synergistically in stimulating expression of the adenovirus EIII promoter.

PubMed Central

Buckbinder, L; Miralles, V J; Reinberg, D

1989-01-01

We have examined the control of gene expression from the adenovirus early region III (Ad-EIII) promoter, which contains two previously defined elements, the AP1 and ATF sites. We found that the AP1 element is capable of mediating activation by the adenovirus immediate early (EIa) gene products. Consistent with studies demonstrating that the AP1 site mediates signal transduction in response to 12-O-tetradecanoylphorbol 13-acetate (TPA) we have shown that TPA can activate Ad-EIII expression and overcome the requirement for EIa. Together TPA and EIa elicited a synergistic response in expression from the Ad-EIII promoter during both transient expression assays and viral infections. This synergistic effect required the AP1 element. An EIII promoter construct, in which sequences upstream of the TATA box had been replaced with four AP1 sites, was responsive to TPA and EIa and in combination promoted the synergistic effect. The analysis of specific factors involved in transcription from the Ad-EIII indicated that proteins recognizing the ATF and AP1 sites were important in expression from this promoter in vitro. Purification of protein factors that specifically stimulated EIII expression resulted in the isolation of a set of factors of the AP1 family. Affinity purified AP1 recognized and activated transcription through both the AP1 and ATF elements. In addition, a protein fraction was identified with DNA binding activity specific for the ATF element. This fraction was dependent on the ATF site for transcriptional activity. Images PMID:2531661

Genomic Heat Shock Element Sequences Drive Cooperative Human Heat Shock Factor 1 DNA Binding and Selectivity*

PubMed Central

Jaeger, Alex M.; Makley, Leah N.; Gestwicki, Jason E.; Thiele, Dennis J.

2014-01-01

The heat shock transcription factor 1 (HSF1) activates expression of a variety of genes involved in cell survival, including protein chaperones, the protein degradation machinery, anti-apoptotic proteins, and transcription factors. Although HSF1 activation has been linked to amelioration of neurodegenerative disease, cancer cells exhibit a dependence on HSF1 for survival. Indeed, HSF1 drives a program of gene expression in cancer cells that is distinct from that activated in response to proteotoxic stress, and HSF1 DNA binding activity is elevated in cycling cells as compared with arrested cells. Active HSF1 homotrimerizes and binds to a DNA sequence consisting of inverted repeats of the pentameric sequence nGAAn, known as heat shock elements (HSEs). Recent comprehensive ChIP-seq experiments demonstrated that the architecture of HSEs is very diverse in the human genome, with deviations from the consensus sequence in the spacing, orientation, and extent of HSE repeats that could influence HSF1 DNA binding efficacy and the kinetics and magnitude of target gene expression. To understand the mechanisms that dictate binding specificity, HSF1 was purified as either a monomer or trimer and used to evaluate DNA-binding site preferences in vitro using fluorescence polarization and thermal denaturation profiling. These results were compared with quantitative chromatin immunoprecipitation assays in vivo. We demonstrate a role for specific orientations of extended HSE sequences in driving preferential HSF1 DNA binding to target loci in vivo. These studies provide a biochemical basis for understanding differential HSF1 target gene recognition and transcription in neurodegenerative disease and in cancer. PMID:25204655

Characterization of a hypoxia-response element in the Epo locus of the pufferfish, Takifugu rubripes.

PubMed

Kulkarni, Rashmi P; Tohari, Sumanty; Ho, Adrian; Brenner, Sydney; Venkatesh, Byrappa

2010-06-01

Animals respond to hypoxia by increasing synthesis of the glycoprotein hormone erythropoietin (Epo) which in turn stimulates the production of red blood cells. The gene encoding Epo has been recently cloned in teleost fishes such as the pufferfish Takifugu rubripes (fugu) and zebrafish (Danio rerio). It has been shown that the transcription levels of Epo in teleost fishes increase in response to anemia or hypoxia in a manner similar to its human ortholog. However, the cis-regulatory element(s) mediating the hypoxia response of Epo gene in fishes has not been identified. In the present study, using the human hepatoma cell line (Hep3B), we have identified and characterized a hypoxia response element (HRE) in the fugu Epo locus. The sequence of the fugu HRE (ACGTGCTG) is identical to that of the HRE in the human EPO locus. However, unlike the HRE in the mammalian Epo locus, which is located in the 3' region of the gene, the fugu HRE is located in the 5' flanking region and on the opposite strand of DNA. This HRE is conserved in other teleosts such as Tetraodon and zebrafish in a similar location. A 365-bp fragment containing the fugu HRE was able to drive GFP expression in the liver of transgenic zebrafish. However, we could not ascertain if the expression of transgene is induced by hypoxia in vivo due to the low and variable levels of GFP expression in transgenic zebrafish. Our investigations also revealed that the Epo locus has experienced extensive rearrangements during vertebrate evolution. Copyright © 2010 Elsevier B.V. All rights reserved.

A role for circadian evening elements in cold-regulated gene expression in Arabidopsis.

PubMed

Mikkelsen, Michael D; Thomashow, Michael F

2009-10-01

The plant transcriptome is dramatically altered in response to low temperature. The cis-acting DNA regulatory elements and trans-acting factors that regulate the majority of cold-regulated genes are unknown. Previous bioinformatic analysis has indicated that the promoters of cold-induced genes are enriched in the Evening Element (EE), AAAATATCT, a DNA regulatory element that has a role in circadian-regulated gene expression. Here we tested the role of EE and EE-like (EEL) elements in cold-induced expression of two Arabidopsis genes, CONSTANS-like 1 (COL1; At5g54470) and a gene encoding a 27-kDa protein of unknown function that we designated COLD-REGULATED GENE 27 (COR27; At5g42900). Mutational analysis indicated that the EE/EEL elements were required for cold induction of COL1 and COR27, and that their action was amplified through coupling with ABA response element (ABRE)-like (ABREL) motifs. An artificial promoter consisting solely of four EE motifs interspersed with three ABREL motifs was sufficient to impart cold-induced gene expression. Both COL1 and COR27 were found to be regulated by the circadian clock at warm growth temperatures and cold-induction of COR27 was gated by the clock. These results suggest that cold- and clock-regulated gene expression are integrated through regulatory proteins that bind to EE and EEL elements supported by transcription factors acting at ABREL sequences. Bioinformatic analysis indicated that the coupling of EE and EEL motifs with ABREL motifs is highly enriched in cold-induced genes and thus may constitute a DNA regulatory element pair with a significant role in configuring the low-temperature transcriptome.

The CGTCA sequence motif is essential for biological activity of the vasoactive intestinal peptide gene cAMP-regulated enhancer.

PubMed Central

Fink, J S; Verhave, M; Kasper, S; Tsukada, T; Mandel, G; Goodman, R H

1988-01-01

cAMP-regulated transcription of the human vasoactive intestinal peptide gene is dependent upon a 17-base-pair DNA element located 70 base pairs upstream from the transcriptional initiation site. This element is similar to sequences in other genes known to be regulated by cAMP and to sequences in several viral enhancers. We have demonstrated that the vasoactive intestinal peptide regulatory element is an enhancer that depends upon the integrity of two CGTCA sequence motifs for biological activity. Mutations in either of the CGTCA motifs diminish the ability of the element to respond to cAMP. Enhancers containing the CGTCA motif from the somatostatin and adenovirus genes compete for binding of nuclear proteins from C6 glioma and PC12 cells to the vasoactive intestinal peptide enhancer, suggesting that CGTCA-containing enhancers interact with similar transacting factors. Images PMID:2842787

Analysis of the regulation of viral transcription.

PubMed

Gloss, Bernd; Kalantari, Mina; Bernard, Hans-Ulrich

2005-01-01

Despite the small genomes and number of genes of papillomaviruses, regulation of their transcription is very complex and governed by numerous transcription factors, cis-responsive elements, and epigenetic phenomena. This chapter describes the strategies of how one can approach a systematic analysis of these factors, elements, and mechanisms. From the numerous different techniques useful for studying transcription, we describe in detail three selected protocols of approaches that have been relevant in shaping our knowledge of human papillomavirus transcription. These are DNAse I protection ("footprinting") for location of transcription-factor binding sites, electrophoretic mobility shifts ("gelshifts") for analysis of bound transcription factors, and bisulfite sequencing for analysis of DNA methylation as a prerequisite for epigenetic transcriptional regulation.

Sleep-dependent learning and motor-skill complexity

PubMed Central

Kuriyama, Kenichi; Stickgold, Robert; Walker, Matthew P.

2004-01-01

Learning of a procedural motor-skill task is known to progress through a series of unique memory stages. Performance initially improves during training, and continues to improve, without further rehearsal, across subsequent periods of sleep. Here, we investigate how this delayed sleep-dependent learning is affected when the task characteristics are varied across several degrees of difficulty, and whether this improvement differentially enhances individual transitions of the motor-sequence pattern being learned. We report that subjects show similar overnight improvements in speed whether learning a five-element unimanual sequence (17.7% improvement), a nine-element unimanual sequence (20.2%), or a five-element bimanual sequence (17.5%), but show markedly increased overnight improvement (28.9%) with a nine-element bimanual sequence. In addition, individual transitions within the motor-sequence pattern that appeared most difficult at the end of training showed a significant 17.8% increase in speed overnight, whereas those transitions that were performed most rapidly at the end of training showed only a non-significant 1.4% improvement. Together, these findings suggest that the sleep-dependent learning process selectively provides maximum benefit to motor-skill procedures that proved to be most difficult prior to sleep. PMID:15576888

Gene conversion as a secondary mechanism of short interspersed element (SINE) evolution

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kass, D.H.; Batzer, M.A.; Deininger, P.L.

The Alu repetitive family of short interspersed elements (SINEs) in primates can be subdivided into distinct subfamilies by specific diagnostic nucleotide changes. The older subfamilies are generally very abundant, while the younger subfamilies have fewer copies. Some of the youngest Alu elements are absent in the orthologous loci of nonhuman primates, indicative of recent retroposition events, the primary mode of SINE evolutions. PCR analysis of one young Alu subfamily (Sb2) member found in the low-density lipoprotein receptor gene apparently revealed the presence of this element in the green monkey, orangutan, gorilla, and chimpanzee genomes, as well as the human genome.more » However, sequence analysis of these genomes revealed a highly mutated, older, primate-specific Alu element was present at this position in the nonhuman primates. Comparison of the flanking DNA sequences upstream of this Alu insertion corresponded to evolution expected for standard primate phylogeny, but comparison of the Alu repeat sequences revealed that the human element departed from this phylogeny. The change in the human sequence apparently occurred by a gene conversion event only within the Alu element itself, converting it from one of the oldest to one of the youngest Alu subfamilies. Although gene conversions of Alu elements are clearly very rare, this finding shows that such events can occur and contribute to specific cases of SINE subfamily evolution.« less

Transcriptional "silencer" element in rat repetitive sequences associated with the rat insulin 1 gene locus.

PubMed Central

Laimins, L; Holmgren-König, M; Khoury, G

1986-01-01

The enhancer elements from either simian virus 40 or murine sarcoma virus activate the expression of a transfected rat insulin 1 (rI1) gene when placed within 2.0 kilobases or less of the rI1 gene cap site. Inclusion of 4.0 kilobases of upstream rI1 sequence, however, results in a substantial reduction in the enhancer-dependent insulin gene expression. These observations suggested that a negative transcriptional regulatory element was present between 2.0 and 4.0 kilobases of the rI1 sequence. To test this notion, we employed a heterologous enhancer-dependent transcription assay in which the simian virus 40 72-base-pair repeat is linked to a human beta-globin gene. Addition of the upstream rI1 element to this system decreased the level of enhancer-dependent beta-globin transcription by a factor of 5 to 15. This rI1 "silencer" element functions in a manner relatively independent of position and orientation and requires a cis-dependent relationship to the transcription unit on which it acts. Thus, the silencer sequence seems to have a number of the characteristics of enhancer elements, and we suggest that it may function by the converse of the enhancer mechanism. The rI1 silencer sequence was identified as a member of a long interspersed rat repetitive family. Thus, a potential role for certain repetitive sequences interspersed throughout the eukaryotic genome may be to regulate gene expression by retaining transcriptional activity within defined domains. Images PMID:3010279

Dynamic and thermal response finite element models of multi-body space structural configurations

NASA Technical Reports Server (NTRS)

Edighoffer, Harold H.

1987-01-01

Presented is structural dynamics modeling of two multibody space structural configurations. The first configuration is a generic space station model of a cylindrical habitation module, two solar array panels, radiator panel, and central connecting tube. The second is a 15-m hoop-column antenna. Discussed is the special joint elimination sequence used for these large finite element models, so that eigenvalues could be extracted. The generic space station model aided test configuration design and analysis/test data correlation. The model consisted of six finite element models, one of each substructure and one of all substructures as a system. Static analysis and tests at the substructure level fine-tuned the finite element models. The 15-m hoop-column antenna is a truss column and structural ring interconnected with tension stabilizing cables. To the cables, pretensioned mesh membrane elements were attached to form four parabolic shaped antennae, one per quadrant. Imposing thermal preloads in the cables and mesh elements produced pretension in the finite element model. Thermal preload variation in the 96 control cables was adjusted to maintain antenna shape within the required tolerance and to give pointing accuracy.

The Diversity of Prokaryotic DDE Transposases of the Mutator Superfamily, Insertion Specificity, and Association with Conjugation Machineries

PubMed Central

Guérillot, Romain; Siguier, Patricia; Gourbeyre, Edith; Chandler, Michael; Glaser, Philippe

2014-01-01

Transposable elements (TEs) are major components of both prokaryotic and eukaryotic genomes and play a significant role in their evolution. In this study, we have identified new prokaryotic DDE transposase families related to the eukaryotic Mutator-like transposases. These genes were retrieved by cascade PSI-Blast using as initial query the transposase of the streptococcal integrative and conjugative element (ICE) TnGBS2. By combining secondary structure predictions and protein sequence alignments, we predicted the DDE catalytic triad and the DNA-binding domain recognizing the terminal inverted repeats. Furthermore, we systematically characterized the organization and the insertion specificity of the TEs relying on these prokaryotic Mutator-like transposases (p-MULT) for their mobility. Strikingly, two distant TE families target their integration upstream σA dependent promoters. This allowed us to identify a transposase sequence signature associated with this unique insertion specificity and to show that the dissymmetry between the two inverted repeats is responsible for the orientation of the insertion. Surprisingly, while DDE transposases are generally associated with small and simple transposons such as insertion sequences (ISs), p-MULT encoding TEs show an unprecedented diversity with several families of IS, transposons, and ICEs ranging in size from 1.1 to 52 kb. PMID:24418649

RNA Polymerase III promoter screen uncovers a novel noncoding RNA family conserved in Caenorhabditis and other clade V nematodes.

PubMed

Gruber, Andreas R

2014-07-10

RNA Polymerase III is a highly specialized enzyme complex responsible for the transcription of a very distinct set of housekeeping noncoding RNAs including tRNAs, 7SK snRNA, Y RNAs, U6 snRNA, and the RNA components of RNaseP and RNaseMRP. In this work we have utilized the conserved promoter structure of known RNA Polymerase III transcripts consisting of characteristic sequence elements termed proximal sequence elements (PSE) A and B and a TATA-box to uncover a novel RNA Polymerase III-transcribed, noncoding RNA family found to be conserved in Caenorhabditis as well as other clade V nematode species. Homology search in combination with detailed sequence and secondary structure analysis revealed that members of this novel ncRNA family evolve rapidly, and only maintain a potentially functional small stem structure that links the 5' end to the very 3' end of the transcript and a small hairpin structure at the 3' end. This is most likely required for efficient transcription termination. In addition, our study revealed evidence that canonical C/D box snoRNAs are also transcribed from a PSE A-PSE B-TATA-box promoter in Caenorhabditis elegans. Copyright © 2014 Elsevier B.V. All rights reserved.

Cis-acting elements in the promoter region of the human aldolase C gene.

PubMed

Buono, P; de Conciliis, L; Olivetta, E; Izzo, P; Salvatore, F

1993-08-16

We investigated the cis-acting sequences involved in the expression of the human aldolase C gene by transient transfections into human neuroblastoma cells (SKNBE). We demonstrate that 420 bp of the 5'-flanking DNA direct at high efficiency the transcription of the CAT reporter gene. A deletion between -420 bp and -164 bp causes a 60% decrease of CAT activity. Gel shift and DNase I footprinting analyses revealed four protected elements: A, B, C and D. Competition analyses indicate that Sp1 or factors sharing a similar sequence specificity bind to elements A and B, but not to elements C and D. Sequence analysis shows a half palindromic ERE motif (GGTCA), in elements B and D. Region D binds a transactivating factor which appears also essential to stabilize the initiation complex.

Implicit Learning of Predictive Relationships in Three-element Visual Sequences by Young and Old Adults

PubMed Central

Howard, James H.; Howard, Darlene V.; Dennis, Nancy A.; Kelly, Andrew J.

2008-01-01

Knowledge of sequential relationships enables future events to be anticipated and processed efficiently. Research with the serial reaction time task (SRTT) has shown that sequence learning often occurs implicitly without effort or awareness. Here we report four experiments that use a triplet-learning task (TLT) to investigate sequence learning in young and older adults. In the TLT people respond only to the last target event in a series of discrete, three-event sequences or triplets. Target predictability is manipulated by varying the triplet frequency (joint probability) and/or the statistical relationships (conditional probabilities) among events within the triplets. Results revealed that both groups learned, though older adults showed less learning of both joint and conditional probabilities. Young people used the statistical information in both cues, but older adults relied primarily on information in the second cue alone. We conclude that the TLT complements and extends the SRTT and other tasks by offering flexibility in the kinds of sequential statistical regularities that may be studied as well as by controlling event timing and eliminating motor response sequencing. PMID:18763897

An interferon regulatory factor binding site in the U5 region of the bovine leukemia virus long terminal repeat stimulates Tax-independent gene expression.

PubMed

Kiermer, V; Van Lint, C; Briclet, D; Vanhulle, C; Kettmann, R; Verdin, E; Burny, A; Droogmans, L

1998-07-01

Bovine leukemia virus (BLV) replication is controlled by both cis- and trans-acting elements. The virus-encoded transactivator, Tax, is necessary for efficient transcription from the BLV promoter, although it is not present during the early stages of infection. Therefore, sequences that control Tax-independent transcription must play an important role in the initiation of viral gene expression. This study demonstrates that the R-U5 sequence of BLV stimulates Tax-independent reporter gene expression directed by the BLV promoter. R-U5 was also stimulatory when inserted immediately downstream from the transcription initiation site of a heterologous promoter. Progressive deletion analysis of this region revealed that a 46-bp element corresponding to the 5' half of U5 is principally responsible for the stimulation. This element exhibited enhancer activity when inserted upstream or downstream from the herpes simplex virus thymidine kinase promoter. This enhancer contains a binding site for the interferon regulatory factors IRF-1 and IRF-2. A 3-bp mutation that destroys the IRF recognition site caused a twofold decrease in Tax-independent BLV long terminal repeat-driven gene expression. These observations suggest that the IRF binding site in the U5 region of BLV plays a role in the initiation of virus replication.

Two different factors act separately or together to specify functionally distinct activities at a single transcriptional enhancer.

PubMed Central

DeFranco, D; Yamamoto, K R

1986-01-01

The expression of genes fused downstream of the Moloney murine sarcoma virus (MoMSV) long terminal repeat is stimulated by glucocorticoids. We mapped the glucocorticoid response element that conferred this hormonal regulation and found that it is a hormone-dependent transcriptional enhancer, designated Sg; it resides within DNA fragments that also carry a previously described enhancer element (B. Levinson, G. Khoury, G. Vande Woude, and P. Gruss, Nature [London] 295:568-572, 1982), here termed Sa, whose activity is independent of the hormone. Nuclease footprinting revealed that purified glucocorticoid receptor bound at multiple discrete sites within and at the borders of the tandemly repeated sequence motif that defines Sa. The Sa and Sg activities stimulated the apparent efficiency of cognate or heterologous promoter utilization, individually providing modest enhancement and in concert yielding higher levels of activity. A deletion mutant lacking most of the tandem repeat but retaining a single receptor footprint sequence lost Sa activity but still conferred Sg activity. The two enhancer components could also be distinguished physiologically: both were operative within cultured rat fibroblasts, but only Sg activity was detectable in rat exocrine pancreas cells. Therefore, the sequence determinants of Sa and Sg activity may be interdigitated, and when both components are active, the receptor and a putative Sa factor can apparently bind and act simultaneously. We concluded that MoMSV enhancer activity is effected by at least two distinct binding factors, suggesting that combinatorial regulation of promoter function can be mediated even from a single genetic element. Images PMID:3023887

Molecular identification and transcriptional regulation of porcine IFIT2 gene.

PubMed

Yang, Xiuqin; Jing, Xiaoyan; Song, Yanfang; Zhang, Caixia; Liu, Di

2018-04-06

IFN-induced protein with tetratricopeptide repeats 2 (IFIT2) plays important roles in host defense against viral infection as revealed by studies in humans and mice. However, little is known on porcine IFIT2 (pIFIT2). Here, we performed molecular cloning, expression profile, and transcriptional regulation analysis of pIFIT2. pIFIT2 gene, located on chromosome 14, is composed of two exons and have a complete coding sequence of 1407 bp. The encoded polypeptide, 468 aa in length, has three tetratricopeptide repeat motifs. pIFIT2 gene was unevenly distributed in all eleven tissues studied with the most abundance in spleen. Poly(I:C) treatment notably strongly upregulated the mRNA level and promoter activity of pIFIT2 gene. Upstream sequence of 1759 bp from the start codon which was assigned +1 here has promoter activity, and deltaEF1 acts as transcription repressor through binding to sequences at position - 1774 to - 1764. Minimal promoter region exists within nucleotide position - 162 and - 126. Two adjacent interferon-stimulated response elements (ISREs) and two nuclear factor (NF)-κB binding sites were identified within position - 310 and - 126. The ISRE elements act alone and in synergy with the one closer to start codon having more strength, so do the NF-κB binding sites. Synergistic effect was also found between the ISRE and NF-κB binding sites. Additionally, a third ISRE element was identified within position - 1661 to - 1579. These findings will contribute to clarifying the antiviral effect and underlying mechanisms of pIFIT2.

Evolution of Genome Size and Complexity in Pinus

PubMed Central

Morse, Alison M.; Peterson, Daniel G.; Islam-Faridi, M. Nurul; Smith, Katherine E.; Magbanua, Zenaida; Garcia, Saul A.; Kubisiak, Thomas L.; Amerson, Henry V.; Carlson, John E.; Nelson, C. Dana; Davis, John M.

2009-01-01

Background Genome evolution in the gymnosperm lineage of seed plants has given rise to many of the most complex and largest plant genomes, however the elements involved are poorly understood. Methodology/Principal Findings Gymny is a previously undescribed retrotransposon family in Pinus that is related to Athila elements in Arabidopsis. Gymny elements are dispersed throughout the modern Pinus genome and occupy a physical space at least the size of the Arabidopsis thaliana genome. In contrast to previously described retroelements in Pinus, the Gymny family was amplified or introduced after the divergence of pine and spruce (Picea). If retrotransposon expansions are responsible for genome size differences within the Pinaceae, as they are in angiosperms, then they have yet to be identified. In contrast, molecular divergence of Gymny retrotransposons together with other families of retrotransposons can account for the large genome complexity of pines along with protein-coding genic DNA, as revealed by massively parallel DNA sequence analysis of Cot fractionated genomic DNA. Conclusions/Significance Most of the enormous genome complexity of pines can be explained by divergence of retrotransposons, however the elements responsible for genome size variation are yet to be identified. Genomic resources for Pinus including those reported here should assist in further defining whether and how the roles of retrotransposons differ in the evolution of angiosperm and gymnosperm genomes. PMID:19194510

The Response of Halophiles from the Atacama Desert to Humidity Changes

NASA Astrophysics Data System (ADS)

Allen, C.; Lera, M.; Chandra, J.; Webb, S.; Marcu, O.

2011-12-01

Survival of extremophiles in dry desert conditions implies adaptations to fluctuations in temperature, desiccation and radiation levels. The Atacama Desert, located in Chile, is the driest desert in the world. Despite the extreme desiccation conditions, cyanobacteria and heterotrophic bacteria are still able to survive in the evaporitic halite rocks that scatter the surface of the desert. The purpose of this study was to determine whether the extremely dry conditions cause cellular oxidative stress and to examine the adaptations that allow these extremophiles to survive. One potential adaptation is the import/export of redox metals which can scavenge reactive oxygen species, preventing oxidative stress. Another potential adaptation is based on changes in gene expression. Genes involved in the stress pathway, which help microorganisms combat intracellular oxidation and survive the harsh environment, are expected to have different expression levels based on the humidity and level of stress. The aims of this project were: 1. to characterize the elemental signature of cyanobacteria; 2. to identify possible intracellular elemental changes that may occur in response to changes in humidity; 3. to identify and quantify the expression of stress genes involved in the response to humidity changes. Here we will show the elemental composition of cells in the halite sample as determined by X-ray fluorescence imaging (microprobe beamline 2-3 at the Stanford Synchrotron Radiation Laboratory), real-time elemental fluctuations measured in live cells exposed to changing relative humidity values, and partial amplification of genes of interest using degenerate primers based on homologous cyanobacterial sequences.

Rapid Mitochondrial Genome Evolution through Invasion of Mobile Elements in Two Closely Related Species of Arbuscular Mycorrhizal Fungi

PubMed Central

Beaudet, Denis; Nadimi, Maryam; Iffis, Bachir; Hijri, Mohamed

2013-01-01

Arbuscular mycorrhizal fungi (AMF) are common and important plant symbionts. They have coenocytic hyphae and form multinucleated spores. The nuclear genome of AMF is polymorphic and its organization is not well understood, which makes the development of reliable molecular markers challenging. In stark contrast, their mitochondrial genome (mtDNA) is homogeneous. To assess the intra- and inter-specific mitochondrial variability in closely related Glomus species, we performed 454 sequencing on total genomic DNA of Glomus sp. isolate DAOM-229456 and we compared its mtDNA with two G. irregulare isolates. We found that the mtDNA of Glomus sp. is homogeneous, identical in gene order and, with respect to the sequences of coding regions, almost identical to G. irregulare. However, certain genomic regions vary substantially, due to insertions/deletions of elements such as introns, mitochondrial plasmid-like DNA polymerase genes and mobile open reading frames. We found no evidence of mitochondrial or cytoplasmic plasmids in Glomus species, and mobile ORFs in Glomus are responsible for the formation of four gene hybrids in atp6, atp9, cox2, and nad3, which are most probably the result of horizontal gene transfer and are expressed at the mRNA level. We found evidence for substantial sequence variation in defined regions of mtDNA, even among closely related isolates with otherwise identical coding gene sequences. This variation makes it possible to design reliable intra- and inter-specific markers. PMID:23637766

Rapid mitochondrial genome evolution through invasion of mobile elements in two closely related species of arbuscular mycorrhizal fungi.

PubMed

Beaudet, Denis; Nadimi, Maryam; Iffis, Bachir; Hijri, Mohamed

2013-01-01

Arbuscular mycorrhizal fungi (AMF) are common and important plant symbionts. They have coenocytic hyphae and form multinucleated spores. The nuclear genome of AMF is polymorphic and its organization is not well understood, which makes the development of reliable molecular markers challenging. In stark contrast, their mitochondrial genome (mtDNA) is homogeneous. To assess the intra- and inter-specific mitochondrial variability in closely related Glomus species, we performed 454 sequencing on total genomic DNA of Glomus sp. isolate DAOM-229456 and we compared its mtDNA with two G. irregulare isolates. We found that the mtDNA of Glomus sp. is homogeneous, identical in gene order and, with respect to the sequences of coding regions, almost identical to G. irregulare. However, certain genomic regions vary substantially, due to insertions/deletions of elements such as introns, mitochondrial plasmid-like DNA polymerase genes and mobile open reading frames. We found no evidence of mitochondrial or cytoplasmic plasmids in Glomus species, and mobile ORFs in Glomus are responsible for the formation of four gene hybrids in atp6, atp9, cox2, and nad3, which are most probably the result of horizontal gene transfer and are expressed at the mRNA level. We found evidence for substantial sequence variation in defined regions of mtDNA, even among closely related isolates with otherwise identical coding gene sequences. This variation makes it possible to design reliable intra- and inter-specific markers.

Alterations in the 5 'untranslated region of the EPSPS gene influence EPSPS overexpression in glyphosate-resistant Eleusine indica.

PubMed

Zhang, Chun; Feng, Li; Tian, Xing-Shan

2018-04-26

The herbicide glyphosate inhibits the enzyme 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS). Overexpression of the EPSPS gene is one of the molecular mechanisms conferring glyphosate resistance in weeds, but the transcriptional regulation of this gene is poorly understood. The EPSPS gene was found to be significantly up-regulated following glyphosate treatment in a glyphosate- resistant Eleusine indica population from South China. To further investigate the regulation of EPSPS overexpression, the promoter of the EPSPS gene from this E. indica population was cloned and analyzed. Two upstream regulatory sequences, Epro-S (862 bp) and Epro-R (877 bp) of EPSPS were obtained from glyphosate-susceptible (S) and -resistant (R) E. indica plants respectively by HiTAIL-PCR. The Epro-S and Epro-R sequences were 99% homologous, except for the two insertions (3 bp and12 bp) in the R sequence. The 12-base insertion of the Epro-R sequence was located in the 5'-UTR-Py-rich stretch element. The promoter activity tests showed that the 12-base insertion resulted in significant enhancement of the Epro-R promoter activity, whereas the 3-base insertion had little effect on Epro-R promoter activity. Alterations in the 5'-UTR-Py-rich stretch element of EPSPS are responsible for glyphosate induced EPSPS overexpression. Therefore, EPSPS transcriptional regulation confers glyphosate resistance in this E. indica population. This article is protected by copyright. All rights reserved.

Mobile element biology – new possibilities with high-throughput sequencing

PubMed Central

Xing, Jinchuan; Witherspoon, David J.; Jorde, Lynn B.

2014-01-01

Mobile elements compose more than half of the human genome, but until recently their large-scale detection was time-consuming and challenging. With the development of new high-throughput sequencing technologies, the complete spectrum of mobile element variation in humans can now be identified and analyzed. Thousands of new mobile element insertions have been discovered, yielding new insights into mobile element biology, evolution, and genomic variation. We review several high-throughput methods, with an emphasis on techniques that specifically target mobile element insertions in humans, and we highlight recent applications of these methods in evolutionary studies and in the analysis of somatic alterations in human cancers. PMID:23312846

Evolutionary conservation of regulatory elements in vertebrate HOX gene clusters

DOE Office of Scientific and Technical Information (OSTI.GOV)

Santini, Simona; Boore, Jeffrey L.; Meyer, Axel

2003-12-31

Due to their high degree of conservation, comparisons of DNA sequences among evolutionarily distantly-related genomes permit to identify functional regions in noncoding DNA. Hox genes are optimal candidate sequences for comparative genome analyses, because they are extremely conserved in vertebrates and occur in clusters. We aligned (Pipmaker) the nucleotide sequences of HoxA clusters of tilapia, pufferfish, striped bass, zebrafish, horn shark, human and mouse (over 500 million years of evolutionary distance). We identified several highly conserved intergenic sequences, likely to be important in gene regulation. Only a few of these putative regulatory elements have been previously described as being involvedmore » in the regulation of Hox genes, while several others are new elements that might have regulatory functions. The majority of these newly identified putative regulatory elements contain short fragments that are almost completely conserved and are identical to known binding sites for regulatory proteins (Transfac). The conserved intergenic regions located between the most rostrally expressed genes in the developing embryo are longer and better retained through evolution. We document that presumed regulatory sequences are retained differentially in either A or A clusters resulting from a genome duplication in the fish lineage. This observation supports both the hypothesis that the conserved elements are involved in gene regulation and the Duplication-Deletion-Complementation model.« less

Deletion endpoint allele-specificity in the developmentally regulated elimination of an internal sequence (IES) in Paramecium.

PubMed Central

Dubrana, K; Le Mouël, A; Amar, L

1997-01-01

Ciliated protozoa undergo thousands of site-specific DNA deletion events during the programmed development of micronuclear genomes to macronuclear genomes. Two deletion elements, W1 and W2, were identified in the Paramecium primaurelia wild-type 156 strain. Here, we report the characterization of both elements in wild-type strain 168 and show that they display variant deletion patterns when compared with those of strain 156. The W1 ( 168 ) element is defective for deletion. The W2 ( 168 ) element is excised utilizing two alternative boundaries on one side, both are different from the boundary utilized to excise the W2156 element. By crossing the 156 and 168 strains, we demonstrate that the definition of all deletion endpoints are each controlled by cis -acting determinant(s) rather than by strain-specific trans-acting factor(s). Sequence comparison of all deleted DNA segments indicates that the 5'-TA-3'terminal sequence is strictly required at their ends. Furthermore the identity of the first eight base pairs of these ends to a previously established consensus sequence correlates with the frequency of the corresponding deletion events. Our data implies the existence of an adaptive convergent evolution of these Paramecium deleted DNA segment end sequences. PMID:9171098

Families of short interspersed elements in the genome of the oomycete plant pathogen, Phytophthora infestans.

PubMed

Whisson, Stephen C; Avrova, Anna O; Lavrova, Olga; Pritchard, Leighton

2005-04-01

The first known families of tRNA-related short interspersed elements (SINEs) in the oomycetes were identified by exploiting the genomic DNA sequence resources for the potato late blight pathogen, Phytophthora infestans. Fifteen families of tRNA-related SINEs, as well as predicted tRNAs, and other possible RNA polymerase III-transcribed sequences were identified. The size of individual elements ranges from 101 to 392 bp, representing sequences present from low (1) to highly abundant (over 2000) copy number in the P. infestans genome, based on quantitative PCR analysis. Putative short direct repeat sequences (6-14 bp) flanking the elements were also identified for eight of the SINEs. Predicted SINEs were named in a series prefixed infSINE (for infestans-SINE). Two SINEs were apparently present as multimers of tRNA-related units; four copies of a related unit for infSINEr, and two unrelated units for infSINEz. Two SINEs, infSINEh and infSINEi, were typically located within 400 bp of each other. These were also the only two elements identified as being actively transcribed in the mycelial stage of P. infestans by RT-PCR. It is possible that infSINEh and infSINEi represent active retrotransposons in P. infestans. Based on the quantitative PCR estimates of copy number for all of the elements identified, tRNA-related SINEs were estimated to comprise 0.3% of the 250 Mb P. infestans genome. InfSINE-related sequences were found to occur in species throughout the genus Phytophthora. However, seven elements were shown to be exclusive to P. infestans.

A variant Tc4 transposable element in the nematode C. elegans could encode a novel protein.

PubMed Central

Li, W; Shaw, J E

1993-01-01

A variant C. elegans Tc4 transposable element, Tc4-rh1030, has been sequenced and is 3483 bp long. The Tc4 element that had been analyzed previously is 1605 bp long, consists of two 774-bp nearly perfect inverted terminal repeats connected by a 57-bp loop, and lacks significant open reading frames. In Tc4-rh1030, by comparison, a 2343-bp novel sequence is present in place of a 477-bp segment in one of the inverted repeats. The novel sequence of Tc4-rh1030 is present about five times per haploid genome and is invariably associated with Tc4 elements; we have used the designation Tc4v to denote this variant subfamily of Tc4 elements. Sequence analysis of three cDNA clones suggests that a Tc4v element contains at least five exons that could encode a novel basic protein of 537 amino acid residues. On northern blots, a 1.6-kb Tc4v-specific transcript was detected in the mutator strain TR679 but not in the wild-type strain N2; Tc4 elements are known to transpose in TR679 but appear to be quiescent in N2. We have analyzed transcripts produced by an unc-33 gene that has the Tc4-rh1030 insertional mutation in its transcribed region; all or almost all of the Tc4v sequence is frequently spliced out of the mutant unc-33 transcripts, sometimes by means of non-consensus splice acceptor sites. Images PMID:8382791

Molecular cloning and preliminary function study of iron responsive element binding protein 1 gene from cypermethrin-resistant Culex pipiens pallens

PubMed Central

2011-01-01

Background Insecticide resistance jeopardizes the control of mosquito populations and mosquito-borne disease control, which creates a major public health concern. Two-dimensional electrophoresis identified one protein segment with high sequence homology to part of Aedes aegypti iron-responsive element binding protein (IRE-BP). Method RT-PCR and RACE (rapid amplification of cDNA end) were used to clone a cDNA encoding full length IRE-BP 1. Real-time quantitative RT-PCR was used to evaluate the transcriptional level changes in the Cr-IRE strain Aedes aegypti compared to the susceptible strain of Cx. pipiens pallens. The expression profile of the gene was established in the mosquito life cycle. Methyl tritiated thymidine (3H-TdR) was used to observe the cypermethrin resistance changes in C6/36 cells containing the stably transfected IRE-BP 1 gene of Cx. pipiens pallens. Results The complete sequence of iron responsive element binding protein 1 (IRE-BP 1) has been cloned from the cypermethrin-resistant strain of Culex pipiens pallens (Cr-IRE strain). Quantitative RT-PCR analysis indicated that the IRE-BP 1 transcription level was 6.7 times higher in the Cr-IRE strain than in the susceptible strain of 4th instar larvae. The IRE-BP 1 expression was also found to be consistently higher throughout the life cycle of the Cr-IRE strain. A protein of predicted size 109.4 kDa has been detected by Western blotting in IRE-BP 1-transfected mosquito C6/36 cells. These IRE-BP 1-transfected cells also showed enhanced cypermethrin resistance compared to null-transfected or plasmid vector-transfected cells as determined by 3H-TdR incorporation. Conclusion IRE-BP 1 is expressed at higher levels in the Cr-IRE strain, and may confer some insecticide resistance in Cx. pipiens pallens. PMID:22075242

Identification of an ICP27-responsive element in the coding region of a herpes simplex virus type 1 late gene.

PubMed

Sedlackova, Lenka; Perkins, Keith D; Meyer, Julia; Strain, Anna K; Goldman, Oksana; Rice, Stephen A

2010-03-01

During productive herpes simplex virus type 1 (HSV-1) infection, a subset of viral delayed-early (DE) and late (L) genes require the immediate-early (IE) protein ICP27 for their expression. However, the cis-acting regulatory sequences in DE and L genes that mediate their specific induction by ICP27 are unknown. One viral L gene that is highly dependent on ICP27 is that encoding glycoprotein C (gC). We previously demonstrated that this gene is posttranscriptionally transactivated by ICP27 in a plasmid cotransfection assay. Based on our past results, we hypothesized that the gC gene possesses a cis-acting inhibitory sequence and that ICP27 overcomes the effects of this sequence to enable efficient gC expression. To test this model, we systematically deleted sequences from the body of the gC gene and tested the resulting constructs for expression. In so doing, we identified a 258-bp "silencing element" (SE) in the 5' portion of the gC coding region. When present, the SE inhibits gC mRNA accumulation from a transiently transfected gC gene, unless ICP27 is present. Moreover, the SE can be transferred to another HSV-1 gene, where it inhibits mRNA accumulation in the absence of ICP27 and confers high-level expression in the presence of ICP27. Thus, for the first time, an ICP27-responsive sequence has been identified in a physiologically relevant ICP27 target gene. To see if the SE functions during viral infection, we engineered HSV-1 recombinants that lack the SE, either in a wild-type (WT) or ICP27-null genetic background. In an ICP27-null background, deletion of the SE led to ICP27-independent expression of the gC gene, demonstrating that the SE functions during viral infection. Surprisingly, the ICP27-independent gC expression seen with the mutant occurred even in the absence of viral DNA synthesis, indicating that the SE helps to regulate the tight DNA replication-dependent expression of gC.

Transcription factor ThWRKY4 binds to a novel WLS motif and a RAV1A element in addition to the W-box to regulate gene expression.

PubMed

Xu, Hongyun; Shi, Xinxin; Wang, Zhibo; Gao, Caiqiu; Wang, Chao; Wang, Yucheng

2017-08-01

WRKY transcription factors play important roles in many biological processes, and mainly bind to the W-box element to regulate gene expression. Previously, we characterized a WRKY gene from Tamarix hispida, ThWRKY4, in response to abiotic stress, and showed that it bound to the W-box motif. However, whether ThWRKY4 could bind to other motifs remains unknown. In this study, we employed a Transcription Factor-Centered Yeast one Hybrid (TF-Centered Y1H) screen to study the motifs recognized by ThWRKY4. In addition to the W-box core cis-element (termed W-box), we identified that ThWRKY4 could bind to two other motifs: the RAV1A element (CAACA) and a novel motif with sequence of GTCTA (W-box like sequence, WLS). The distributions of these motifs were screened in the promoter regions of genes regulated by some WRKYs. The results showed that the W-box, RAV1A, and WLS motifs were all present in high numbers, suggesting that they play key roles in gene expression mediated by WRKYs. Furthermore, five WRKY proteins from different WRKY subfamilies in Arabidopsis thaliana were selected and confirmed to bind to the RAV1A and WLS motifs, indicating that they are recognized commonly by WRKYs. These findings will help to further reveal the functions of WRKY proteins. Copyright © 2017 Elsevier B.V. All rights reserved.

Genome-wide analyses of LINE–LINE-mediated nonallelic homologous recombination

PubMed Central

Startek, Michał; Szafranski, Przemyslaw; Gambin, Tomasz; Campbell, Ian M.; Hixson, Patricia; Shaw, Chad A.; Stankiewicz, Paweł; Gambin, Anna

2015-01-01

Nonallelic homologous recombination (NAHR), occurring between low-copy repeats (LCRs) >10 kb in size and sharing >97% DNA sequence identity, is responsible for the majority of recurrent genomic rearrangements in the human genome. Recent studies have shown that transposable elements (TEs) can also mediate recurrent deletions and translocations, indicating the features of substrates that mediate NAHR may be significantly less stringent than previously believed. Using >4 kb length and >95% sequence identity criteria, we analyzed of the genome-wide distribution of long interspersed element (LINE) retrotransposon and their potential to mediate NAHR. We identified 17 005 directly oriented LINE pairs located <10 Mbp from each other as potential NAHR substrates, placing 82.8% of the human genome at risk of LINE–LINE-mediated instability. Cross-referencing these regions with CNVs in the Baylor College of Medicine clinical chromosomal microarray database of 36 285 patients, we identified 516 CNVs potentially mediated by LINEs. Using long-range PCR of five different genomic regions in a total of 44 patients, we confirmed that the CNV breakpoints in each patient map within the LINE elements. To additionally assess the scale of LINE–LINE/NAHR phenomenon in the human genome, we tested DNA samples from six healthy individuals on a custom aCGH microarray targeting LINE elements predicted to mediate CNVs and identified 25 LINE–LINE rearrangements. Our data indicate that LINE–LINE-mediated NAHR is widespread and under-recognized, and is an important mechanism of structural rearrangement contributing to human genomic variability. PMID:25613453

High-speed optical phase-shifting apparatus

DOEpatents

Zortman, William A.

2016-11-08

An optical phase shifter includes an optical waveguide, a plurality of partial phase shifting elements arranged sequentially, and control circuitry electrically coupled to the partial phase shifting elements. The control circuitry is adapted to provide an activating signal to each of the N partial phase shifting elements such that the signal is delayed by a clock cycle between adjacent partial phase shifting elements in the sequence. The transit time for a guided optical pulse train between the input edges of consecutive partial phase shifting elements in the sequence is arranged to be equal to a clock cycle, thereby enabling pipelined processing of the optical pulses.

Inhibitory Effects of Bangladeshi Medicinal Plant Extracts on Interactions between Transcription Factors and Target DNA Sequences

PubMed Central

Lampronti, Ilaria; Khan, Mahmud T.H.; Borgatti, Monica; Bianchi, Nicoletta

2008-01-01

Several transcription factors (TFs) play crucial roles in governing the expression of different genes involved in the immune response, embryo or cell lineage development, cell apoptosis, cell cycle progression, oncogenesis, repair and fibrosis processes and inflammation. As far as inflammation, TFs playing pivotal roles are nuclear factor kappa B (NF-kB), activator protein (AP-1), signal transducer and activator of transcription (STATs), cAMP response element binding protein (CREB) and GATA-1 factors. All these TFs regulate the expression of pro-inflammatory cytokines and are involved in the pathogenesis of a number of human disorders, particularly those with an inflammatory component. Since several medicinal plants can be employed to produce extracts exhibiting biological effects and because alteration of gene transcription represents a very interesting approach to control the expression of selected genes, this study sought to verify the ability of several extracts derived from Bangladeshi medicinal plants in interfering with molecular interactions between different TFs and specific DNA sequences. We first analyzed the antiproliferative activity of 19 medicinal plants on different human cell lines, including erythroleukemia K562, B lymphoid Raji and T lymphoid Jurkat cell lines. Secondly, we employed the electrophoretic mobility shift assay as a suitable technique for a fast screening of plant extracts altering the binding between NF-kB, AP-1, GATA-1, STAT-3, CREB and the relative target DNA elements. PMID:18830455

A unique mitigator sequence determines the species specificity of the major late promoter in adenovirus type 12 DNA.

PubMed Central

Zock, C; Iselt, A; Doerfler, W

1993-01-01

Human adenovirus type 12 (Ad12) cannot replicate in hamster cells, whereas human cells are permissive for Ad12. Ad12 DNA replication and late-gene and virus-associated RNA expression are blocked in hamster cells. Early Ad12 genes are transcribed, and the viral DNA can be integrated into the host genome. Ad12 DNA replication and late-gene transcription can be complemented in hamster cells by E1 functions of Ad2 or Ad5, for which hamster cells are fully permissive (for a review, see W. Doerfler, Adv. Virus Res. 39:89-128, 1991). We have previously demonstrated that a 33-nucleotide mitigator sequence, which is located in the downstream region of the major late promoter (MLP) of Ad12 DNA, is responsible for the inactivity of the Ad12 MLP in hamster cells (C. Zock and W. Doerfler, EMBO J. 9:1615-1623, 1990). A similar negative regulator has not been found in the MLP of Ad2 DNA. We have now studied the mechanism of action of this mitigator element. The results of nuclear run-on experiments document the absence of MLP transcripts in the nuclei of Ad12-infected BHK21 hamster cells. Surprisingly, the mitigator element cannot elicit its function in in vitro transcription experiments with nuclear extracts from both hamster BHK21 and human HeLa cells. Intact nuclear topology and/or tightly bound nuclear elements that cannot be eluted in nuclear extracts are somehow required for recognition of the Ad12 mitigator. Electrophoretic mobility shift assays have not revealed significant differences in the binding of proteins from human HeLa or hamster BHK21 cells to the mitigator sequence in the MLP of Ad12 DNA or to the corresponding sequence in Ad2 DNA. We have converted the sequence of the mitigator in the MLP of Ad12 DNA to the equivalent sequence in the MLP of Ad2 DNA by site-directed mutagenesis. This construct was not active in hamster cells. When the Ad12 mitigator, on the other hand, was inserted into the Ad2 MLP, the latter's function in hamster cells was not compromised. Deletions in the 5' upstream region of the Ad12 MLP have provided evidence for the existence of additional sequences that codetermine the deficiency of the Ad12 MLP in hamster cells. The amphifunctional YY1 protein from HeLa cells can bind specifically to the mitigator and to upstream elements of the MLP of Ad12 DNA.(ABSTRACT TRUNCATED AT 400 WORDS) Images PMID:8419643

Mitochondrial divergence between slow- and fast-aging garter snakes.

PubMed

Schwartz, Tonia S; Arendsee, Zebulun W; Bronikowski, Anne M

2015-11-01

Mitochondrial function has long been hypothesized to be intimately involved in aging processes--either directly through declining efficiency of mitochondrial respiration and ATP production with advancing age, or indirectly, e.g., through increased mitochondrial production of damaging free radicals with age. Yet we lack a comprehensive understanding of the evolution of mitochondrial genotypes and phenotypes across diverse animal models, particularly in species that have extremely labile physiology. Here, we measure mitochondrial genome-types and transcription in ecotypes of garter snakes (Thamnophis elegans) that are adapted to disparate habitats and have diverged in aging rates and lifespans despite residing in close proximity. Using two RNA-seq datasets, we (1) reconstruct the garter snake mitochondrial genome sequence and bioinformatically identify regulatory elements, (2) test for divergence of mitochondrial gene expression between the ecotypes and in response to heat stress, and (3) test for sequence divergence in mitochondrial protein-coding regions in these slow-aging (SA) and fast-aging (FA) naturally occurring ecotypes. At the nucleotide sequence level, we confirmed two (duplicated) mitochondrial control regions one of which contains a glucocorticoid response element (GRE). Gene expression of protein-coding genes was higher in FA snakes relative to SA snakes for most genes, but was neither affected by heat stress nor an interaction between heat stress and ecotype. SA and FA ecotypes had unique mitochondrial haplotypes with amino acid substitutions in both CYTB and ND5. The CYTB amino acid change (Isoleucine → Threonine) was highly segregated between ecotypes. This divergence of mitochondrial haplotypes between SA and FA snakes contrasts with nuclear gene-flow estimates, but correlates with previously reported divergence in mitochondrial function (mitochondrial oxygen consumption, ATP production, and reactive oxygen species consequences). Copyright © 2015 Elsevier Inc. All rights reserved.

eShadow: A tool for comparing closely related sequences

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ovcharenko, Ivan; Boffelli, Dario; Loots, Gabriela G.

2004-01-15

Primate sequence comparisons are difficult to interpret due to the high degree of sequence similarity shared between such closely related species. Recently, a novel method, phylogenetic shadowing, has been pioneered for predicting functional elements in the human genome through the analysis of multiple primate sequence alignments. We have expanded this theoretical approach to create a computational tool, eShadow, for the identification of elements under selective pressure in multiple sequence alignments of closely related genomes, such as in comparisons of human to primate or mouse to rat DNA. This tool integrates two different statistical methods and allows for the dynamic visualizationmore » of the resulting conservation profile. eShadow also includes a versatile optimization module capable of training the underlying Hidden Markov Model to differentially predict functional sequences. This module grants the tool high flexibility in the analysis of multiple sequence alignments and in comparing sequences with different divergence rates. Here, we describe the eShadow comparative tool and its potential uses for analyzing both multiple nucleotide and protein alignments to predict putative functional elements. The eShadow tool is publicly available at http://eshadow.dcode.org/« less

[Learning and Repetive Reproduction of Memorized Sequences by the Right and the Left Hand].

PubMed

Bobrova, E V; Lyakhovetskii, V A; Bogacheva, I N

2015-01-01

An important stage of learning a new skill is repetitive reproduction of one and the same sequence of movements, which plays a significant role in forming of the movement stereotypes. Two groups of right-handers repeatedly memorized (6-10 repetitions) the sequences of their hand transitions by experimenter in 6 positions, firstly by the right hand (RH), and then--by the left hand (LH) or vice versa. Random sequences previously unknown to the volunteers were reproduced in the 11 series. Modified sequences were tested in the 2nd and 3rd series, where the same elements' positions were presented in different order. The processes of repetitive sequence reproduction were similar for RH and LH. However, the learning of the modified sequences differed: Information about elements' position disregarding the reproduction order was used only when LH initiated task performing. This information was not used when LH followed RH and when RH performed the task. Consequently, the type of information coding activated by LH helped learn the positions of sequence elements, while the type of information coding activated by RH prevented learning. It is supposedly connected with the predominant role of right hemisphere in the processes of positional coding and motor learning.

OsSLI1, a homeodomain containing transcription activator, involves abscisic acid related stress response in rice (Oryza sativa L.).

PubMed

Huang, Xi; Duan, Min; Liao, Jiakai; Yuan, Xi; Chen, Hui; Feng, Jiejie; Huang, Ji; Zhang, Hong-Sheng

2014-01-01

Homeodomain-leucine zipper type I (HD-Zip I) proteins are involved in the regulation of plant development and response to environmental stresses. In this study, OsSLI1 (Oryza sativa stress largely induced 1), encoding a member of the HD-Zip I subfamily, was isolated from rice. The expression of OsSLI1 was dramatically induced by multiple abiotic stresses and exogenous abscisic acid (ABA). In silico sequence analysis discovered several cis-acting elements including multiple ABREs (ABA-responsive element binding factors) in the upstream promoter region of OsSLI1. The OsSLI1-GFP fusion protein was localized in the nucleus of rice protoplast cells and the transcriptional activity of OsSLI1 was confirmed by the yeast hybrid system. Further, it was found that OsSLI1 expression was enhanced in an ABI5-Like1 (ABL1) deficiency rice mutant abl1 under stress conditions, suggesting that ABL1 probably negatively regulates OsSLI1 gene expression. Moreover, it was found that OsSLI1 was regulated in panicle development. Taken together, OsSLI1 may be a transcriptional activator regulating stress-responsive gene expression and panicle development in rice.

Mechanism of DNA-binding enhancement by the human T-cell leukaemia virus transactivator Tax.

PubMed

Baranger, A M; Palmer, C R; Hamm, M K; Giebler, H A; Brauweiler, A; Nyborg, J K; Schepartz, A

1995-08-17

Tax protein activates transcription of the human T-cell leukaemia virus type I (HTLV-I) genome through three imperfect cyclic AMP-responsive element (CRE) target sites located within the viral promoter. Previous work has shown that Tax interacts with the bZIP element of proteins that bind the CRE target site to promote peptide dimerization, suggesting an association between Tax and bZIP coiled coil. Here we show that the site of interaction with Tax is not the coiled coil, but the basic segment. This interaction increases the stability of the GCN4 bZIP dimer by 1.7 kcal mol-1 and the DNA affinity of the dimer by 1.9 kcal mol-1. The differential effect of Tax on several bZip-DNA complexes that differ in peptide sequence or DNA conformation suggests a model for Tax action based on stabilization of a distinct DNA-bound protein structure. This model may explain how Tax interacts with transcription factors of considerable sequence diversity to alter patterns of gene expression.

Catabolite repression in Lactobacillus casei ATCC 393 is mediated by CcpA.

PubMed Central

Monedero, V; Gosalbes, M J; Pérez-Martínez, G

1997-01-01

The chromosomal ccpA gene from Lactobacillus casei ATCC 393 has been cloned and sequenced. It encodes the CcpA protein, a central catabolite regulator belonging to the LacI-GalR family of bacterial repressors, and shows 54% identity with CcpA proteins from Bacillus subtilis and Bacillus megaterium. The L. casei ccpA gene was able to complement a B. subtilis ccpA mutant. An L. casei ccpA mutant showed increased doubling times and a relief of the catabolite repression of some enzymatic activities, such as N-acetylglucosaminidase and phospho-beta-galactosidase. Detailed analysis of CcpA activity was performed by using the promoter region of the L. casei chromosomal lacTEGF operon which is subject to catabolite repression and contains a catabolite responsive element (cre) consensus sequence. Deletion of this cre site or the presence of the ccpA mutation abolished the catabolite repression of a lacp::gusA fusion. These data support the role of CcpA as a common regulatory element mediating catabolite repression in low-GC-content gram-positive bacteria. PMID:9352913

Tardigrade workbench: comparing stress-related proteins, sequence-similar and functional protein clusters as well as RNA elements in tardigrades

PubMed Central

2009-01-01

Background Tardigrades represent an animal phylum with extraordinary resistance to environmental stress. Results To gain insights into their stress-specific adaptation potential, major clusters of related and similar proteins are identified, as well as specific functional clusters delineated comparing all tardigrades and individual species (Milnesium tardigradum, Hypsibius dujardini, Echiniscus testudo, Tulinus stephaniae, Richtersius coronifer) and functional elements in tardigrade mRNAs are analysed. We find that 39.3% of the total sequences clustered in 58 clusters of more than 20 proteins. Among these are ten tardigrade specific as well as a number of stress-specific protein clusters. Tardigrade-specific functional adaptations include strong protein, DNA- and redox protection, maintenance and protein recycling. Specific regulatory elements regulate tardigrade mRNA stability such as lox P DICE elements whereas 14 other RNA elements of higher eukaryotes are not found. Further features of tardigrade specific adaption are rapidly identified by sequence and/or pattern search on the web-tool tardigrade analyzer http://waterbear.bioapps.biozentrum.uni-wuerzburg.de. The work-bench offers nucleotide pattern analysis for promotor and regulatory element detection (tardigrade specific; nrdb) as well as rapid COG search for function assignments including species-specific repositories of all analysed data. Conclusion Different protein clusters and regulatory elements implicated in tardigrade stress adaptations are analysed including unpublished tardigrade sequences. PMID:19821996

Tardigrade workbench: comparing stress-related proteins, sequence-similar and functional protein clusters as well as RNA elements in tardigrades.

PubMed

Förster, Frank; Liang, Chunguang; Shkumatov, Alexander; Beisser, Daniela; Engelmann, Julia C; Schnölzer, Martina; Frohme, Marcus; Müller, Tobias; Schill, Ralph O; Dandekar, Thomas

2009-10-12

Tardigrades represent an animal phylum with extraordinary resistance to environmental stress. To gain insights into their stress-specific adaptation potential, major clusters of related and similar proteins are identified, as well as specific functional clusters delineated comparing all tardigrades and individual species (Milnesium tardigradum, Hypsibius dujardini, Echiniscus testudo, Tulinus stephaniae, Richtersius coronifer) and functional elements in tardigrade mRNAs are analysed. We find that 39.3% of the total sequences clustered in 58 clusters of more than 20 proteins. Among these are ten tardigrade specific as well as a number of stress-specific protein clusters. Tardigrade-specific functional adaptations include strong protein, DNA- and redox protection, maintenance and protein recycling. Specific regulatory elements regulate tardigrade mRNA stability such as lox P DICE elements whereas 14 other RNA elements of higher eukaryotes are not found. Further features of tardigrade specific adaption are rapidly identified by sequence and/or pattern search on the web-tool tardigrade analyzer http://waterbear.bioapps.biozentrum.uni-wuerzburg.de. The work-bench offers nucleotide pattern analysis for promotor and regulatory element detection (tardigrade specific; nrdb) as well as rapid COG search for function assignments including species-specific repositories of all analysed data. Different protein clusters and regulatory elements implicated in tardigrade stress adaptations are analysed including unpublished tardigrade sequences.

The Rose (Rosa hybrida) NAC Transcription Factor 3 Gene, RhNAC3, Involved in ABA Signaling Pathway Both in Rose and Arabidopsis

PubMed Central

Lü, Peitao; Liu, Jitao; Gao, Junping; Zhang, Changqing

2014-01-01

Plant transcription factors involved in stress responses are generally classified by their involvement in either the abscisic acid (ABA)-dependent or the ABA-independent regulatory pathways. A stress-associated NAC gene from rose (Rosa hybrida), RhNAC3, was previously found to increase dehydration tolerance in both rose and Arabidopsis. However, the regulatory mechanism involved in RhNAC3 action is still not fully understood. In this study, we isolated and analyzed the upstream regulatory sequence of RhNAC3 and found many stress-related cis-elements to be present in the promoter, with five ABA-responsive element (ABRE) motifs being of particular interest. Characterization of Arabidopsis thaliana plants transformed with the putative RhNAC3 promoter sequence fused to the β-glucuronidase (GUS) reporter gene revealed that RhNAC3 is expressed at high basal levels in leaf guard cells and in vascular tissues. Moreover, the ABRE motifs in the RhNAC3 promoter were observed to have a cumulative effect on the transcriptional activity of this gene both in the presence and absence of exogenous ABA. Overexpression of RhNAC3 in A. thaliana resulted in ABA hypersensitivity during seed germination and promoted leaf closure after ABA or drought treatments. Additionally, the expression of 11 ABA-responsive genes was induced to a greater degree by dehydration in the transgenic plants overexpressing RhNAC3 than control lines transformed with the vector alone. Further analysis revealed that all these genes contain NAC binding cis-elements in their promoter regions, and RhNAC3 was found to partially bind to these putative NAC recognition sites. We further found that of 219 A. thaliana genes previously shown by microarray analysis to be regulated by heterologous overexpression RhNAC3, 85 are responsive to ABA. In rose, the expression of genes downstream of the ABA-signaling pathways was also repressed in RhNAC3-silenced petals. Taken together, we propose that the rose RhNAC3 protein could mediate ABA signaling both in rose and in A. thaliana. PMID:25290154

The rose (Rosa hybrida) NAC transcription factor 3 gene, RhNAC3, involved in ABA signaling pathway both in rose and Arabidopsis.

PubMed

Jiang, Guimei; Jiang, Xinqiang; Lü, Peitao; Liu, Jitao; Gao, Junping; Zhang, Changqing

2014-01-01

Plant transcription factors involved in stress responses are generally classified by their involvement in either the abscisic acid (ABA)-dependent or the ABA-independent regulatory pathways. A stress-associated NAC gene from rose (Rosa hybrida), RhNAC3, was previously found to increase dehydration tolerance in both rose and Arabidopsis. However, the regulatory mechanism involved in RhNAC3 action is still not fully understood. In this study, we isolated and analyzed the upstream regulatory sequence of RhNAC3 and found many stress-related cis-elements to be present in the promoter, with five ABA-responsive element (ABRE) motifs being of particular interest. Characterization of Arabidopsis thaliana plants transformed with the putative RhNAC3 promoter sequence fused to the β-glucuronidase (GUS) reporter gene revealed that RhNAC3 is expressed at high basal levels in leaf guard cells and in vascular tissues. Moreover, the ABRE motifs in the RhNAC3 promoter were observed to have a cumulative effect on the transcriptional activity of this gene both in the presence and absence of exogenous ABA. Overexpression of RhNAC3 in A. thaliana resulted in ABA hypersensitivity during seed germination and promoted leaf closure after ABA or drought treatments. Additionally, the expression of 11 ABA-responsive genes was induced to a greater degree by dehydration in the transgenic plants overexpressing RhNAC3 than control lines transformed with the vector alone. Further analysis revealed that all these genes contain NAC binding cis-elements in their promoter regions, and RhNAC3 was found to partially bind to these putative NAC recognition sites. We further found that of 219 A. thaliana genes previously shown by microarray analysis to be regulated by heterologous overexpression RhNAC3, 85 are responsive to ABA. In rose, the expression of genes downstream of the ABA-signaling pathways was also repressed in RhNAC3-silenced petals. Taken together, we propose that the rose RhNAC3 protein could mediate ABA signaling both in rose and in A. thaliana.

Characterization of a Gene Encoding Clathrin Heavy Chain in Maize Up-Regulated by Salicylic Acid, Abscisic Acid and High Boron Supply

PubMed Central

Zeng, Mu-Heng; Liu, Sheng-Hong; Yang, Miao-Xian; Zhang, Ya-Jun; Liang, Jia-Yong; Wan, Xiao-Rong; Liang, Hong

2013-01-01

Clathrin, a three-legged triskelion composed of three clathrin heavy chains (CHCs) and three light chains (CLCs), plays a critical role in clathrin-mediated endocytosis (CME) in eukaryotic cells. In this study, the genes ZmCHC1 and ZmCHC2 encoding clathrin heavy chain in maize were cloned and characterized for the first time in monocots. ZmCHC1 encodes a 1693-amino acid-protein including 29 exons and 28 introns, and ZmCHC2 encodes a 1746-amino acid-protein including 28 exons and 27 introns. The high similarities of gene structure, protein sequences and 3D models among ZmCHC1, and Arabidopsis AtCHC1 and AtCHC2 suggest their similar functions in CME. ZmCHC1 gene is predominantly expressed in maize roots instead of ubiquitous expression of ZmCHC2. Consistent with a typical predicted salicylic acid (SA)-responsive element and four predicted ABA-responsive elements (ABREs) in the promoter sequence of ZmCHC1, the expression of ZmCHC1 instead of ZmCHC2 in maize roots is significantly up-regulated by SA or ABA, suggesting that ZmCHC1 gene may be involved in the SA signaling pathway in maize defense responses. The expressions of ZmCHC1 and ZmCHC2 genes in maize are down-regulated by azide or cold treatment, further revealing the energy requirement of CME and suggesting that CME in plants is sensitive to low temperatures. PMID:23880865

The site-specific ribosomal DNA insertion element R1Bm belongs to a class of non-long-terminal-repeat retrotransposons.

PubMed Central

Xiong, Y; Eickbush, T H

1988-01-01

Two types of insertion elements, R1 and R2 (previously called type I and type II), are known to interrupt the 28S ribosomal genes of several insect species. In the silkmoth, Bombyx mori, each element occupies approximately 10% of the estimated 240 ribosomal DNA units, while at most only a few copies are located outside the ribosomal DNA units. We present here the complete nucleotide sequence of an R1 insertion from B. mori (R1Bm). This 5.1-kilobase element contains two overlapping open reading frames (ORFs) which together occupy 88% of its length. ORF1 is 461 amino acids in length and exhibits characteristics of retroviral gag genes. ORF2 is 1,051 amino acids in length and contains homology to reverse transcriptase-like enzymes. The analysis of 3' and 5' ends of independent isolates from the ribosomal locus supports the suggestion that R1 is still functioning as a transposable element. The precise location of the element within the genome implies that its transposition must occur with remarkable insertion sequence specificity. Comparison of the deduced amino acid sequences from six retrotransposons, R1 and R2 of B. mori, I factor and F element of Drosophila melanogaster, L1 of Mus domesticus, and Ingi of Trypanosoma brucei, reveals a relatively high level of sequence homology in the reverse transcriptase region. Like R1, these elements lack long terminal repeats. We have therefore named this class of related elements the non-long-terminal-repeat (non-LTR) retrotransposons. Images PMID:2447482

Transcriptional activation of the Escherichia coli adaptive response gene aidB is mediated by binding of methylated Ada protein. Evidence for a new consensus sequence for Ada-binding sites.

PubMed

Landini, P; Volkert, M R

1995-04-07

The Escherichia coli aidB gene is part of the adaptive response to DNA methylation damage. Genes belonging to the adaptive response are positively regulated by the ada gene; the Ada protein acts as a transcriptional activator when methylated in one of its cysteine residues at position 69. Through DNaseI protection assays, we show that methylated Ada (meAda) is able to bind a DNA sequence between 40 and 60 base pairs upstream of the aidB transcriptional startpoint. Binding of meAda is necessary to activate transcription of the adaptive response genes; accordingly, in vitro transcription of aidB is dependent on the presence of meAda. Unmethylated Ada protein shows no protection against DNaseI digestion in the aidB promoter region nor does it promote aidB in vitro transcription. The aidB Ada-binding site shows only weak homology to the proposed consensus sequences for Ada-binding sites in E. coli (AAANNAA and AAAGCGCA) but shares a higher degree of similarity with the Ada-binding regions from other bacterial species, such as Salmonella typhimurium and Bacillus subtilis. Based on the comparison of five different Ada-dependent promoter regions, we suggest that a possible recognition sequence for meAda might be AATnnnnnnG-CAA. Higher concentrations of Ada are required for the binding of aidB than for the ada promoter, suggesting lower affinity of the protein for the aidB Ada-binding site. Common features in the Ada-binding regions of ada and aidB are a high A/T content, the presence of an inverted repeat structure, and their position relative to the transcriptional start site. We propose that these elements, in addition to the proposed recognition sequence, are important for binding of the Ada protein.

Deep sequencing leads to the identification of eukaryotic translation initiation factor 5A as a key element in Rsv1-mediated lethal systemic hypersensitive response to Soybean mosaic virus infection in soybean.

PubMed

Chen, Hui; Adam Arsovski, Andrej; Yu, Kangfu; Wang, Aiming

2017-04-01

Rsv1, a single dominant resistance locus in soybean, confers extreme resistance to the majority of Soybean mosaic virus (SMV) strains, but is susceptible to the G7 strain. In Rsv1-genotype soybean, G7 infection provokes a lethal systemic hypersensitive response (LSHR), a delayed host defence response. The Rsv1-mediated LSHR signalling pathway remains largely unknown. In this study, we employed a genome-wide investigation to gain an insight into the molecular interplay between SMV G7 and Rsv1-genotype soybean. Small RNA (sRNA), degradome and transcriptome sequencing analyses were used to identify differentially expressed genes (DEGs) and microRNAs (DEMs) in response to G7 infection. A number of DEGs, DEMs and microRNA targets, and the interaction network of DEMs and their target mRNAs responsive to G7 infection, were identified. Knock-down of one of the identified DEGs, the eukaryotic translation initiation factor 5A (eIF5A), diminished the LSHR and enhanced viral accumulation, suggesting the essential role of eIF5A in the G7-induced, Rsv1-mediated LSHR signalling pathway. This work provides an in-depth genome-wide analysis of high-throughput sequencing data, and identifies multiple genes and microRNA signatures that are associated with the Rsv1-mediated LSHR. © 2016 HER MAJESTY THE QUEEN IN RIGHT OF CANADA MOLECULAR PLANT PATHOLOGY © 2016 BSPP AND JOHN WILEY & SONS LTD.

Approximation algorithm for the problem of partitioning a sequence into clusters

NASA Astrophysics Data System (ADS)

Kel'manov, A. V.; Mikhailova, L. V.; Khamidullin, S. A.; Khandeev, V. I.

2017-08-01

We consider the problem of partitioning a finite sequence of Euclidean points into a given number of clusters (subsequences) using the criterion of the minimal sum (over all clusters) of intercluster sums of squared distances from the elements of the clusters to their centers. It is assumed that the center of one of the desired clusters is at the origin, while the center of each of the other clusters is unknown and determined as the mean value over all elements in this cluster. Additionally, the partition obeys two structural constraints on the indices of sequence elements contained in the clusters with unknown centers: (1) the concatenation of the indices of elements in these clusters is an increasing sequence, and (2) the difference between an index and the preceding one is bounded above and below by prescribed constants. It is shown that this problem is strongly NP-hard. A 2-approximation algorithm is constructed that is polynomial-time for a fixed number of clusters.

Characterization of an endogenous retrovirus class in elephants and their relatives

PubMed Central

Greenwood, Alex D; Englbrecht, Claudia C; MacPhee, Ross DE

2004-01-01

Background Endogenous retrovirus-like elements (ERV-Ls, primed with tRNA leucine) are a diverse group of reiterated sequences related to foamy viruses and widely distributed among mammals. As shown in previous investigations, in many primates and rodents this class of elements has remained transpositionally active, as reflected by increased copy number and high sequence diversity within and among taxa. Results Here we examine whether proviral-like sequences may be suitable molecular probes for investigating the phylogeny of groups known to have high element diversity. As a test we characterized ERV-Ls occurring in a sample of extant members of superorder Uranotheria (Asian and African elephants, manatees, and hyraxes). The ERV-L complement in this group is even more diverse than previously suspected, and there is sequence evidence for active expansion, particularly in elephantids. Many of the elements characterized have protein coding potential suggestive of activity. Conclusions In general, the evidence supports the hypothesis that the complement had a single origin within basal Uranotheria. PMID:15476555

Analysis of Tile-Reinforced Composite Armor. Part 1; Advanced Modeling and Strength Analyses

NASA Technical Reports Server (NTRS)

Davila, C. G.; Chen, Tzi-Kang; Baker, D. J.

1998-01-01

The results of an analytical and experimental study of the structural response and strength of tile-reinforced components of the Composite Armored Vehicle are presented. The analyses are based on specialized finite element techniques that properly account for the effects of the interaction between the armor tiles, the surrounding elastomers, and the glass-epoxy sublaminates. To validate the analytical predictions, tests were conducted with panels subjected to three-point bending loads. The sequence of progressive failure events for the laminates is described. This paper describes the results of Part 1 of a study of the response and strength of tile-reinforced composite armor.

Genomic Identification and Analysis of Shared Cis-regulator Elements in a Developmentally Critical homeobox Cluster

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chris Amemiya

2003-04-01

The goals of this project were to isolate, characterize, and sequence the Dlx3/Dlx7 bigene cluster from twelve different species of mammals. The Dlx3 and Dlx7 genes are known to encode homeobox transcription factors involved in patterning of structures in the vertebrate jaw as well as vertebrate limbs. Genomic sequences from the respective taxa will subsequently be compared in order to identify conserved non-coding sequences that are potential cis-regulatory elements. Based on the comparisons they will fashion transgenic mouse experiments to functionally test the strength of the potential cis-regulatory elements. A goal of the project is to attempt to identify thosemore » elements that may function in coordinately regulating both Dlx3 and Dlx7 functions.« less

Functional Analysis of Maize Silk-Specific ZmbZIP25 Promoter.

PubMed

Li, Wanying; Yu, Dan; Yu, Jingjuan; Zhu, Dengyun; Zhao, Qian

2018-03-12

ZmbZIP25 ( Zea mays bZIP (basic leucine zipper) transcription factor 25) is a function-unknown protein that belongs to the D group of the bZIP transcription factor family. RNA-seq data showed that the expression of ZmbZIP25 was tissue-specific in maize silks, and this specificity was confirmed by RT-PCR (reverse transcription-polymerase chain reaction). In situ RNA hybridization showed that ZmbZIP25 was expressed exclusively in the xylem of maize silks. A 5' RACE (rapid amplification of cDNA ends) assay identified an adenine residue as the transcription start site of the ZmbZIP25 gene. To characterize this silk-specific promoter, we isolated and analyzed a 2450 bp (from -2083 to +367) and a 2600 bp sequence of ZmbZIP25 (from -2083 to +517, the transcription start site was denoted +1). Stable expression assays in Arabidopsis showed that the expression of the reporter gene GUS driven by the 2450 bp ZmbZIP25 5'-flanking fragment occurred exclusively in the papillae of Arabidopsis stigmas. Furthermore, transient expression assays in maize indicated that GUS and GFP expression driven by the 2450 bp ZmbZIP25 5'-flanking sequences occurred only in maize silks and not in other tissues. However, no GUS or GFP expression was driven by the 2600 bp ZmbZIP25 5'-flanking sequences in either stable or transient expression assays. A series of deletion analyses of the 2450 bp ZmbZIP25 5'-flanking sequence was performed in transgenic Arabidopsis plants, and probable elements prediction analysis revealed the possible presence of negative regulatory elements within the 161 bp region from -1117 to -957 that were responsible for the specificity of the ZmbZIP25 5'-flanking sequence.

Functional Analysis of Maize Silk-Specific ZmbZIP25 Promoter

PubMed Central

Li, Wanying; Yu, Dan; Yu, Jingjuan; Zhu, Dengyun; Zhao, Qian

2018-01-01

ZmbZIP25 (Zea mays bZIP (basic leucine zipper) transcription factor 25) is a function-unknown protein that belongs to the D group of the bZIP transcription factor family. RNA-seq data showed that the expression of ZmbZIP25 was tissue-specific in maize silks, and this specificity was confirmed by RT-PCR (reverse transcription-polymerase chain reaction). In situ RNA hybridization showed that ZmbZIP25 was expressed exclusively in the xylem of maize silks. A 5′ RACE (rapid amplification of cDNA ends) assay identified an adenine residue as the transcription start site of the ZmbZIP25 gene. To characterize this silk-specific promoter, we isolated and analyzed a 2450 bp (from −2083 to +367) and a 2600 bp sequence of ZmbZIP25 (from −2083 to +517, the transcription start site was denoted +1). Stable expression assays in Arabidopsis showed that the expression of the reporter gene GUS driven by the 2450 bp ZmbZIP25 5′-flanking fragment occurred exclusively in the papillae of Arabidopsis stigmas. Furthermore, transient expression assays in maize indicated that GUS and GFP expression driven by the 2450 bp ZmbZIP25 5′-flanking sequences occurred only in maize silks and not in other tissues. However, no GUS or GFP expression was driven by the 2600 bp ZmbZIP25 5′-flanking sequences in either stable or transient expression assays. A series of deletion analyses of the 2450 bp ZmbZIP25 5′-flanking sequence was performed in transgenic Arabidopsis plants, and probable elements prediction analysis revealed the possible presence of negative regulatory elements within the 161 bp region from −1117 to −957 that were responsible for the specificity of the ZmbZIP25 5′-flanking sequence. PMID:29534529

Functional Analysis of Porphyromonas gingivalis W83 CRISPR-Cas Systems.

PubMed

Burmistrz, Michał; Dudek, Bartosz; Staniec, Dominika; Rodriguez Martinez, Jose Ignacio; Bochtler, Matthias; Potempa, Jan; Pyrc, Krzysztof

2015-08-01

The CRISPR-Cas (clustered regularly interspaced short palindromic repeats/CRISPR-associated genes) system provides prokaryotic cells with an adaptive and heritable immune response to foreign genetic elements, such as viruses, plasmids, and transposons. It is present in the majority of Archaea and almost half of species of Bacteria. Porphyromonas gingivalis is an important human pathogen that has been proven to be an etiological agent of periodontitis and has been linked to systemic conditions, such as rheumatoid arthritis and cardiovascular disease. At least 95% of clinical strains of P. gingivalis carry CRISPR arrays, suggesting that these arrays play an important function in vivo. Here we show that all four CRISPR arrays present in the P. gingivalis W83 genome are transcribed. For one of the arrays, we demonstrate in vivo activity against double-stranded DNA constructs containing protospacer sequences accompanied at the 3' end by an NGG protospacer-adjacent motif (PAM). Most of the 44 spacers present in the genome of P. gingivalis W83 share no significant similarity with any known sequences, although 4 spacers are similar to sequences from bacteria found in the oral cavity and the gastrointestinal tract. Four spacers match genomic sequences of the host; however, none of these is flanked at its 3' terminus by the appropriate PAM element. The CRISPR-Cas (clustered regularly interspaced short palindromic repeats/CRISPR-associated genes) system is a unique system that provides prokaryotic cells with an adaptive and heritable immunity. In this report, we show that the CRISPR-Cas system of P. gingivalis, an important human pathogen associated with periodontitis and possibly also other conditions, such as rheumatoid arthritis and cardiovascular disease, is active and provides protection from foreign genetic elements. Importantly, the data presented here may be useful for better understanding the communication between cells in larger bacterial communities and, consequently, the process of disease development and progression. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Functional Analysis of Porphyromonas gingivalis W83 CRISPR-Cas Systems

PubMed Central

Burmistrz, Michał; Dudek, Bartosz; Staniec, Dominika; Rodriguez Martinez, Jose Ignacio; Bochtler, Matthias; Potempa, Jan

2015-01-01

ABSTRACT The CRISPR-Cas (clustered regularly interspaced short palindromic repeats/CRISPR-associated genes) system provides prokaryotic cells with an adaptive and heritable immune response to foreign genetic elements, such as viruses, plasmids, and transposons. It is present in the majority of Archaea and almost half of species of Bacteria. Porphyromonas gingivalis is an important human pathogen that has been proven to be an etiological agent of periodontitis and has been linked to systemic conditions, such as rheumatoid arthritis and cardiovascular disease. At least 95% of clinical strains of P. gingivalis carry CRISPR arrays, suggesting that these arrays play an important function in vivo. Here we show that all four CRISPR arrays present in the P. gingivalis W83 genome are transcribed. For one of the arrays, we demonstrate in vivo activity against double-stranded DNA constructs containing protospacer sequences accompanied at the 3′ end by an NGG protospacer-adjacent motif (PAM). Most of the 44 spacers present in the genome of P. gingivalis W83 share no significant similarity with any known sequences, although 4 spacers are similar to sequences from bacteria found in the oral cavity and the gastrointestinal tract. Four spacers match genomic sequences of the host; however, none of these is flanked at its 3′ terminus by the appropriate PAM element. IMPORTANCE The CRISPR-Cas (clustered regularly interspaced short palindromic repeats/CRISPR-associated genes) system is a unique system that provides prokaryotic cells with an adaptive and heritable immunity. In this report, we show that the CRISPR-Cas system of P. gingivalis, an important human pathogen associated with periodontitis and possibly also other conditions, such as rheumatoid arthritis and cardiovascular disease, is active and provides protection from foreign genetic elements. Importantly, the data presented here may be useful for better understanding the communication between cells in larger bacterial communities and, consequently, the process of disease development and progression. PMID:26013482

Combinatorial events of insertion sequences and ICE in Gram-negative bacteria.

PubMed

Toleman, Mark A; Walsh, Timothy R

2011-09-01

The emergence of antibiotic and antimicrobial resistance in Gram-negative bacteria is incremental and linked to genetic elements that function in a so-called 'one-ended transposition' manner, including ISEcp1, ISCR elements and Tn3-like transposons. The power of these elements lies in their inability to consistently recognize one of their own terminal sequences, while recognizing more genetically distant surrogate sequences. This has the effect of mobilizing the DNA sequence found adjacent to their initial location. In general, resistance in Gram-negatives is closely linked to a few one-off events. These include the capture of the class 1 integron by a Tn5090-like transposon; the formation of the 3' conserved segment (3'-CS); and the fusion of the ISCR1 element to the 3'-CS. The structures formed by these rare events have been massively amplified and disseminated in Gram-negative bacteria, but hitherto, are rarely found in Gram-positives. Such events dominate current resistance gene acquisition and are instrumental in the construction of large resistance gene islands on chromosomes and plasmids. Similar combinatorial events appear to have occurred between conjugative plasmids and phages constructing hybrid elements called integrative and conjugative elements or conjugative transposons. These elements are beginning to be closely linked to some of the more powerful resistance mechanisms such as the extended spectrum β-lactamases, metallo- and AmpC type β-lactamases. Antibiotic resistance in Gram-negative bacteria is dominated by unusual combinatorial mistakes of Insertion sequences and gene fusions which have been selected and amplified by antibiotic pressure enabling the formation of extended resistance islands. © 2011 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

Emergence of Sequence Type 779 Methicillin-Resistant Staphylococcus aureus Harboring a Novel Pseudo Staphylococcal Cassette Chromosome mec (SCCmec)-SCC-SCCCRISPR Composite Element in Irish Hospitals

PubMed Central

Kinnevey, Peter M.; Shore, Anna C.; Brennan, Grainne I.; Sullivan, Derek J.; Ehricht, Ralf; Monecke, Stefan; Slickers, Peter

2013-01-01

Methicillin-resistant Staphylococcus aureus (MRSA) has been a major cause of nosocomial infection in Irish hospitals for 4 decades, and replacement of predominant MRSA clones has occurred several times. An MRSA isolate recovered in 2006 as part of a larger study of sporadic MRSA exhibited a rare spa (t878) and multilocus sequence (ST779) type and was nontypeable by PCR- and DNA microarray-based staphylococcal cassette chromosome mec (SCCmec) element typing. Whole-genome sequencing revealed the presence of a novel 51-kb composite island (CI) element with three distinct domains, each flanked by direct repeat and inverted repeat sequences, including (i) a pseudo SCCmec element (16.3 kb) carrying mecA with a novel mec class region, a fusidic acid resistance gene (fusC), and two copper resistance genes (copB and copC) but lacking ccr genes; (ii) an SCC element (17.5 kb) carrying a novel ccrAB4 allele; and (iii) an SCC element (17.4 kb) carrying a novel ccrC allele and a clustered regularly interspaced short palindromic repeat (CRISPR) region. The novel CI was subsequently identified by PCR in an additional 13 t878/ST779 MRSA isolates, six from bloodstream infections, recovered between 2006 and 2011 in 11 hospitals. Analysis of open reading frames (ORFs) carried by the CI showed amino acid sequence similarity of 44 to 100% to ORFs from S. aureus and coagulase-negative staphylococci (CoNS). These findings provide further evidence of genetic transfer between S. aureus and CoNS and show how this contributes to the emergence of novel SCCmec elements and MRSA strains. Ongoing surveillance of this MRSA strain is warranted and will require updating of currently used SCCmec typing methods. PMID:23147725

Repetitive sequence analysis and karyotyping reveals centromere-associated DNA sequences in radish (Raphanus sativus L.).

PubMed

He, Qunyan; Cai, Zexi; Hu, Tianhua; Liu, Huijun; Bao, Chonglai; Mao, Weihai; Jin, Weiwei

2015-04-18

Radish (Raphanus sativus L., 2n = 2x = 18) is a major root vegetable crop especially in eastern Asia. Radish root contains various nutritions which play an important role in strengthening immunity. Repetitive elements are primary components of the genomic sequence and the most important factors in genome size variations in higher eukaryotes. To date, studies about repetitive elements of radish are still limited. To better understand genome structure of radish, we undertook a study to evaluate the proportion of repetitive elements and their distribution in radish. We conducted genome-wide characterization of repetitive elements in radish with low coverage genome sequencing followed by similarity-based cluster analysis. Results showed that about 31% of the genome was composed of repetitive sequences. Satellite repeats were the most dominating elements of the genome. The distribution pattern of three satellite repeat sequences (CL1, CL25, and CL43) on radish chromosomes was characterized using fluorescence in situ hybridization (FISH). CL1 was predominantly located at the centromeric region of all chromosomes, CL25 located at the subtelomeric region, and CL43 was a telomeric satellite. FISH signals of two satellite repeats, CL1 and CL25, together with 5S rDNA and 45S rDNA, provide useful cytogenetic markers to identify each individual somatic metaphase chromosome. The centromere-specific histone H3 (CENH3) has been used as a marker to identify centromere DNA sequences. One putative CENH3 (RsCENH3) was characterized and cloned from radish. Its deduced amino acid sequence shares high similarities to those of the CENH3s in Brassica species. An antibody against B. rapa CENH3, specifically stained radish centromeres. Immunostaining and chromatin immunoprecipitation (ChIP) tests with anti-BrCENH3 antibody demonstrated that both the centromere-specific retrotransposon (CR-Radish) and satellite repeat (CL1) are directly associated with RsCENH3 in radish. Proportions of repetitive elements in radish were estimated and satellite repeats were the most dominating elements. Fine karyotyping analysis was established which allow us to easily identify each individual somatic metaphase chromosome. Immunofluorescence- and ChIP-based assays demonstrated the functional significance of satellite and centromere-specific retrotransposon at centromeres. Our study provides a valuable basis for future genomic studies in radish.

Evolutionary trajectory of Pack-MULEs is determined by their epigenetic status

USDA-ARS?s Scientific Manuscript database

Acquisition and rearrangement of host genes by transposable elements is one mechanism to increase gene diversity. The rice genome is replete in such sequences and while ~3,000 Pack- Mutator-like transposable elements containing gene sequences (Pack-MULEs) have been identified, their function remains...

p53 genes function to restrain mobile elements

PubMed Central

Wylie, Annika; Jones, Amanda E.; D'Brot, Alejandro; Lu, Wan-Jin; Kurtz, Paula; Moran, John V.; Rakheja, Dinesh; Chen, Kenneth S.; Hammer, Robert E.; Comerford, Sarah A.; Amatruda, James F.; Abrams, John M.

2016-01-01

Throughout the animal kingdom, p53 genes govern stress response networks by specifying adaptive transcriptional responses. The human member of this gene family is mutated in most cancers, but precisely how p53 functions to mediate tumor suppression is not well understood. Using Drosophila and zebrafish models, we show that p53 restricts retrotransposon activity and genetically interacts with components of the piRNA (piwi-interacting RNA) pathway. Furthermore, transposon eruptions occurring in the p53− germline were incited by meiotic recombination, and transcripts produced from these mobile elements accumulated in the germ plasm. In gene complementation studies, normal human p53 alleles suppressed transposons, but mutant p53 alleles from cancer patients could not. Consistent with these observations, we also found patterns of unrestrained retrotransposons in p53-driven mouse and human cancers. Furthermore, p53 status correlated with repressive chromatin marks in the 5′ sequence of a synthetic LINE-1 element. Together, these observations indicate that ancestral functions of p53 operate through conserved mechanisms to contain retrotransposons. Since human p53 mutants are disabled for this activity, our findings raise the possibility that p53 mitigates oncogenic disease in part by restricting transposon mobility. PMID:26701264

Identification of two novel functional p53 responsive elements in the Herpes Simplex Virus-1 genome

PubMed Central

Hsieh, Jui-Cheng; Kuta, Ryan; Armour, Courtney R.; Boehmer, Paul E.

2014-01-01

Analysis of the herpes simplex virus-1 (HSV-1) genome reveals two candidate p53 responsive elements (p53RE), located in proximity to the replication origins oriL and oriS, referred to as p53RE-L and p53RE-S, respectively. The sequences of p53RE-L and p53RE-S conform to the p53 consensus site and are present in HSV-1 strains KOS, 17, and F. p53 binds to both elements in vitro and in virus-infected cells. Both p53RE-L and p53RE-S are capable of conferring p53-dependent transcriptional activation onto a heterologous reporter gene. Importantly, expression of the essential immediate early viral transactivator ICP4 and the essential DNA replication protein ICP8, that are adjacent to p53RE-S and p53RE-L, are repressed in a p53-dependent manner. Taken together, this study identifies two novel functional p53RE in the HSV-1 genome and suggests a complex mechanism of viral gene regulation by p53 which may determine progression of the lytic viral replication cycle or the establishment of latency. PMID:25010269

Identifying structural variation in haploid microbial genomes from short-read resequencing data using breseq.

PubMed

Barrick, Jeffrey E; Colburn, Geoffrey; Deatherage, Daniel E; Traverse, Charles C; Strand, Matthew D; Borges, Jordan J; Knoester, David B; Reba, Aaron; Meyer, Austin G

2014-11-29

Mutations that alter chromosomal structure play critical roles in evolution and disease, including in the origin of new lifestyles and pathogenic traits in microbes. Large-scale rearrangements in genomes are often mediated by recombination events involving new or existing copies of mobile genetic elements, recently duplicated genes, or other repetitive sequences. Most current software programs for predicting structural variation from short-read DNA resequencing data are intended primarily for use on human genomes. They typically disregard information in reads mapping to repeat sequences, and significant post-processing and manual examination of their output is often required to rule out false-positive predictions and precisely describe mutational events. We have implemented an algorithm for identifying structural variation from DNA resequencing data as part of the breseq computational pipeline for predicting mutations in haploid microbial genomes. Our method evaluates the support for new sequence junctions present in a clonal sample from split-read alignments to a reference genome, including matches to repeat sequences. Then, it uses a statistical model of read coverage evenness to accept or reject these predictions. Finally, breseq combines predictions of new junctions and deleted chromosomal regions to output biologically relevant descriptions of mutations and their effects on genes. We demonstrate the performance of breseq on simulated Escherichia coli genomes with deletions generating unique breakpoint sequences, new insertions of mobile genetic elements, and deletions mediated by mobile elements. Then, we reanalyze data from an E. coli K-12 mutation accumulation evolution experiment in which structural variation was not previously identified. Transposon insertions and large-scale chromosomal changes detected by breseq account for ~25% of spontaneous mutations in this strain. In all cases, we find that breseq is able to reliably predict structural variation with modest read-depth coverage of the reference genome (>40-fold). Using breseq to predict structural variation should be useful for studies of microbial epidemiology, experimental evolution, synthetic biology, and genetics when a reference genome for a closely related strain is available. In these cases, breseq can discover mutations that may be responsible for important or unintended changes in genomes that might otherwise go undetected.

Sequence and functional characterization of hypoxia-inducible factors, HIF1α, HIF2αa, and HIF3α, from the estuarine fish, Fundulus heteroclitus

PubMed Central

Townley, Ian K.; Karchner, Sibel I.; Skripnikova, Elena; Wiese, Thomas E.; Hahn, Mark E.

2017-01-01

The hypoxia-inducible factor (HIF) family of transcription factors plays central roles in the development, physiology, pathology, and environmental adaptation of animals. Because many aquatic habitats are characterized by episodes of low dissolved oxygen, fish represent ideal models to study the roles of HIF in the response to aquatic hypoxia. The estuarine fish Fundulus heteroclitus is found in habitats prone to hypoxia. It responds to low oxygen via behavioral, physiological, and molecular changes, and one member of the HIF family, HIF2α, has been previously described. Herein, cDNA sequencing, phylogenetic analyses, and genomic approaches were used to determine other members of the HIFα family from F. heteroclitus and their relationships to HIFα subunits from other vertebrates. In vitro and cellular approaches demonstrated that full-length forms of HIF1α, HIF2α, and HIF3α independently formed complexes with the β-subunit, aryl hydrocarbon receptor nuclear translocator, to bind to hypoxia response elements and activate reporter gene expression. Quantitative PCR showed that HIFα mRNA abundance varied among organs of normoxic fish in an isoform-specific fashion. Analysis of the F. heteroclitus genome revealed a locus encoding a second HIF2α—HIF2αb—a predicted protein lacking oxygen sensing and transactivation domains. Finally, sequence analyses demonstrated polymorphism in the coding sequence of each F. heteroclitus HIFα subunit, suggesting that genetic variation in these transcription factors may play a role in the variation in hypoxia responses among individuals or populations. PMID:28039194

Sequence and functional characterization of hypoxia-inducible factors, HIF1α, HIF2αa, and HIF3α, from the estuarine fish, Fundulus heteroclitus.

PubMed

Townley, Ian K; Karchner, Sibel I; Skripnikova, Elena; Wiese, Thomas E; Hahn, Mark E; Rees, Bernard B

2017-03-01

The hypoxia-inducible factor (HIF) family of transcription factors plays central roles in the development, physiology, pathology, and environmental adaptation of animals. Because many aquatic habitats are characterized by episodes of low dissolved oxygen, fish represent ideal models to study the roles of HIF in the response to aquatic hypoxia. The estuarine fish Fundulus heteroclitus is found in habitats prone to hypoxia. It responds to low oxygen via behavioral, physiological, and molecular changes, and one member of the HIF family, HIF2α, has been previously described. Herein, cDNA sequencing, phylogenetic analyses, and genomic approaches were used to determine other members of the HIFα family from F. heteroclitus and their relationships to HIFα subunits from other vertebrates. In vitro and cellular approaches demonstrated that full-length forms of HIF1α, HIF2α, and HIF3α independently formed complexes with the β-subunit, aryl hydrocarbon receptor nuclear translocator, to bind to hypoxia response elements and activate reporter gene expression. Quantitative PCR showed that HIFα mRNA abundance varied among organs of normoxic fish in an isoform-specific fashion. Analysis of the F. heteroclitus genome revealed a locus encoding a second HIF2α-HIF2αb-a predicted protein lacking oxygen sensing and transactivation domains. Finally, sequence analyses demonstrated polymorphism in the coding sequence of each F. heteroclitus HIFα subunit, suggesting that genetic variation in these transcription factors may play a role in the variation in hypoxia responses among individuals or populations. Copyright © 2017 the American Physiological Society.

Isolation and sequencing of the gene encoding Sp23, a structural protein of spermatophore of the mealworm beetle, Tenebrio molitor.

PubMed

Feng, X; Happ, G M

1996-11-14

The cDNA for Sp23, a structural protein of the spermatophore of Tenebrio molitor, had been previously cloned and characterized (Paesen, G.C., Schwartz, M.B., Peferoen, M., Weyda, F. and Happ, G.M. (1992a) Amino acid sequence of Sp23, a structure protein of the spermatophore of the mealworm beetle, Tenebrio molitor. J. Biol. Chem. 257, 18852-18857). Using the labeled cDNA for Sp23 as a probe to screen a library of genomic DNA from Tenebrio molitor, we isolated a genomic clone for Sp23. A 5373-base pair (bp) restriction fragment containing the Sp23 gene was sequenced. The coding region is separated by a 55-bp intron which is located close to the translation start site. Three putative ecdysone response elements (EcRE) are identified in the 5' flanking region of the Sp23 gene. Comparison of the flanking regions of the Sp23 gene with those of the D-protein gene expressed in the accessory glands of Tenebrio reveals similar sequences present in the flanking regions of the two genes. The genomic organization of the coding region of the Sp23 gene shares similarities with that of the D-protein gene, three Drosophila accessory gland genes and two Drosophila 20-OH ecdysone-responsive genes.

Analyses of deep mammalian sequence alignments and constraint predictions for 1% of the human genome

PubMed Central

Margulies, Elliott H.; Cooper, Gregory M.; Asimenos, George; Thomas, Daryl J.; Dewey, Colin N.; Siepel, Adam; Birney, Ewan; Keefe, Damian; Schwartz, Ariel S.; Hou, Minmei; Taylor, James; Nikolaev, Sergey; Montoya-Burgos, Juan I.; Löytynoja, Ari; Whelan, Simon; Pardi, Fabio; Massingham, Tim; Brown, James B.; Bickel, Peter; Holmes, Ian; Mullikin, James C.; Ureta-Vidal, Abel; Paten, Benedict; Stone, Eric A.; Rosenbloom, Kate R.; Kent, W. James; Bouffard, Gerard G.; Guan, Xiaobin; Hansen, Nancy F.; Idol, Jacquelyn R.; Maduro, Valerie V.B.; Maskeri, Baishali; McDowell, Jennifer C.; Park, Morgan; Thomas, Pamela J.; Young, Alice C.; Blakesley, Robert W.; Muzny, Donna M.; Sodergren, Erica; Wheeler, David A.; Worley, Kim C.; Jiang, Huaiyang; Weinstock, George M.; Gibbs, Richard A.; Graves, Tina; Fulton, Robert; Mardis, Elaine R.; Wilson, Richard K.; Clamp, Michele; Cuff, James; Gnerre, Sante; Jaffe, David B.; Chang, Jean L.; Lindblad-Toh, Kerstin; Lander, Eric S.; Hinrichs, Angie; Trumbower, Heather; Clawson, Hiram; Zweig, Ann; Kuhn, Robert M.; Barber, Galt; Harte, Rachel; Karolchik, Donna; Field, Matthew A.; Moore, Richard A.; Matthewson, Carrie A.; Schein, Jacqueline E.; Marra, Marco A.; Antonarakis, Stylianos E.; Batzoglou, Serafim; Goldman, Nick; Hardison, Ross; Haussler, David; Miller, Webb; Pachter, Lior; Green, Eric D.; Sidow, Arend

2007-01-01

A key component of the ongoing ENCODE project involves rigorous comparative sequence analyses for the initially targeted 1% of the human genome. Here, we present orthologous sequence generation, alignment, and evolutionary constraint analyses of 23 mammalian species for all ENCODE targets. Alignments were generated using four different methods; comparisons of these methods reveal large-scale consistency but substantial differences in terms of small genomic rearrangements, sensitivity (sequence coverage), and specificity (alignment accuracy). We describe the quantitative and qualitative trade-offs concomitant with alignment method choice and the levels of technical error that need to be accounted for in applications that require multisequence alignments. Using the generated alignments, we identified constrained regions using three different methods. While the different constraint-detecting methods are in general agreement, there are important discrepancies relating to both the underlying alignments and the specific algorithms. However, by integrating the results across the alignments and constraint-detecting methods, we produced constraint annotations that were found to be robust based on multiple independent measures. Analyses of these annotations illustrate that most classes of experimentally annotated functional elements are enriched for constrained sequences; however, large portions of each class (with the exception of protein-coding sequences) do not overlap constrained regions. The latter elements might not be under primary sequence constraint, might not be constrained across all mammals, or might have expendable molecular functions. Conversely, 40% of the constrained sequences do not overlap any of the functional elements that have been experimentally identified. Together, these findings demonstrate and quantify how many genomic functional elements await basic molecular characterization. PMID:17567995

Analysis of Two Cosmid Clones from Chromosome 4 of Drosophila melanogaster Reveals Two New Genes Amid an Unusual Arrangement of Repeated Sequences

PubMed Central

Locke, John; Podemski, Lynn; Roy, Ken; Pilgrim, David; Hodgetts, Ross

1999-01-01

Chromosome 4 from Drosophila melanogaster has several unusual features that distinguish it from the other chromosomes. These include a diffuse appearance in salivary gland polytene chromosomes, an absence of recombination, and the variegated expression of P-element transgenes. As part of a larger project to understand these properties, we are assembling a physical map of this chromosome. Here we report the sequence of two cosmids representing ∼5% of the polytenized region. Both cosmid clones contain numerous repeated DNA sequences, as identified by cross hybridization with labeled genomic DNA, BLAST searches, and dot matrix analysis, which are positioned between and within the transcribed sequences. The repetitive sequences include three copies of the mobile element Hoppel, one copy of the mobile element HB, and 18 DINE repeats. DINE is a novel, short repeated sequence dispersed throughout both cosmid sequences. One cosmid includes the previously described cubitus interruptus (ci) gene and two new genes: that a gene with a predicted amino acid sequence similar to ribosomal protein S3a which is consistent with the Minute(4)101 locus thought to be in the region, and a novel member of the protein family that includes plexin and met–hepatocyte growth factor receptor. The other cosmid contains only the two short 5′-most exons from the zinc-finger-homolog-2 (zfh-2) gene. This is the first extensive sequence analysis of noncoding DNA from chromosome 4. The distribution of the various repeats suggests its organization is similar to the β-heterochromatic regions near the base of the major chromosome arms. Such a pattern may account for the diffuse banding of the polytene chromosome 4 and the variegation of many P-element transgenes on the chromosome. PMID:10022978

DNA sequence requirements for the accurate transcription of a protein-coding plastid gene in a plastid in vitro system from mustard (Sinapis alba L.)

PubMed Central

Link, Gerhard

1984-01-01

A nuclease-treated plastid extract from mustard (Sinapis alba L.) allows efficient transcription of cloned plastid DNA templates. In this in vitro system, the major runoff transcript of the truncated gene for the 32 000 mol. wt. photosystem II protein was accurately initiated from a site close to or identical with the in vivo start site. By using plasmids with deletions in the 5'-flanking region of this gene as templates, a DNA region required for efficient and selective initiation was detected ˜28-35 nucleotides upstream of the transcription start site. This region contains the sequence element TTGACA, which matches the consensus sequence for prokaryotic `−35' promoter elements. In the absence of this region, a region ˜13-27 nucleotides upstream of the start site still enables a basic level of specific transcription. This second region contains the sequence element TATATAA, which matches the consensus sequence for the `TATA' box of genes transcribed by RNA polymerase II (or B). The region between the `TATA'-like element and the transcription start site is not sufficient but may be required for specific transcription of the plastid gene. This latter region contains the sequence element TATACT, which resembles the prokaryotic `−10' (Pribnow) box. Based on the structural and transcriptional features of the 5' upstream region, a `promoter switch' mechanism is proposed, which may account for the developmentally regulated expression of this plastid gene. ImagesFig. 1.Fig. 2.Fig. 3.Fig. 4.Figure 5. PMID:16453540

Transdominant Rev and Protease Mutant Proteins of HIV-SIV as Potential Antiviral Agents in Vitro and in Vivo (AIDS)

DTIC Science & Technology

1993-10-30

hammerhead ribozymes (7-9) and a hairpin ribozyme (10) directed against HIV-l RNA has been shown to confer significant resistance to HIV-I infection...antisense oligodeoxynucleotides (ODN) directed to the Rev Response Element (RRE) and ribozymes that target viral mRNAs. The ribozyme approach, in...particular, has yielded extremely encouraging positive data. We showed that a hairpin ribozyme designed to cleave HIV-1 RNA in the 5’ leader sequence

Characterization of the Pathological and Biochemical Markers that Correlate to the Clinical Features of Autism

DTIC Science & Technology

2012-10-01

critical role of glutathione in maintenance of the mitochondrial genome . Free Radic Biol Med 49:1956–1968 54. Ji L, Chauhan A, Brown WT, Chauhan V (2009...studies in Drosophila have demonstrated the role of PKA in memory formation [25–29]. Mutations in the rutabaga gene, which encodes adenylate cyclase...certain DNA sequences (cAMP response elements), thereby stimulating the transcription of downstream genes and the synthesis of proteins. The CREB

Molecular and bioinformatic analysis of the FB-NOF transposable element.

PubMed

Badal, Martí; Portela, Anna; Xamena, Noel; Cabré, Oriol

2006-04-12

The Drosophila melanogaster transposable element FB-NOF is known to play a role in genome plasticity through the generation of all sort of genomic rearrangements. Moreover, several insertional mutants due to FB mobilizations have been reported. Its structure and sequence, however, have been poorly studied mainly as a consequence of the long, complex and repetitive sequence of FB inverted repeats. This repetitive region is composed of several 154 bp blocks, each with five almost identical repeats. In this paper, we report the sequencing process of 2 kb long FB inverted repeats of a complete FB-NOF element, with high precision and reliability. This achievement has been possible using a new map of the FB repetitive region, which identifies unambiguously each repeat with new features that can be used as landmarks. With this new vision of the element, a list of FB-NOF in the D. melanogaster genomic clones has been done, improving previous works that used only bioinformatic algorithms. The availability of many FB and FB-NOF sequences allowed an analysis of the FB insertion sequences that showed no sequence specificity, but a preference for A/T rich sequences. The position of NOF into FB is also studied, revealing that it is always located after a second repeat in a random block. With the results of this analysis, we propose a model of transposition in which NOF jumps from FB to FB, using an unidentified transposase enzyme that should specifically recognize the second repeat end of the FB blocks.

Statistical learning of movement.

PubMed

Ongchoco, Joan Danielle Khonghun; Uddenberg, Stefan; Chun, Marvin M

2016-12-01

The environment is dynamic, but objects move in predictable and characteristic ways, whether they are a dancer in motion, or a bee buzzing around in flight. Sequences of movement are comprised of simpler motion trajectory elements chained together. But how do we know where one trajectory element ends and another begins, much like we parse words from continuous streams of speech? As a novel test of statistical learning, we explored the ability to parse continuous movement sequences into simpler element trajectories. Across four experiments, we showed that people can robustly parse such sequences from a continuous stream of trajectories under increasingly stringent tests of segmentation ability and statistical learning. Observers viewed a single dot as it moved along simple sequences of paths, and were later able to discriminate these sequences from novel and partial ones shown at test. Observers demonstrated this ability when there were potentially helpful trajectory-segmentation cues such as a common origin for all movements (Experiment 1); when the dot's motions were entirely continuous and unconstrained (Experiment 2); when sequences were tested against partial sequences as a more stringent test of statistical learning (Experiment 3); and finally, even when the element trajectories were in fact pairs of trajectories, so that abrupt directional changes in the dot's motion could no longer signal inter-trajectory boundaries (Experiment 4). These results suggest that observers can automatically extract regularities in movement - an ability that may underpin our capacity to learn more complex biological motions, as in sport or dance.

Repetitive Elements May Comprise Over Two-Thirds of the Human Genome

PubMed Central

de Koning, A. P. Jason; Gu, Wanjun; Castoe, Todd A.; Batzer, Mark A.; Pollock, David D.

2011-01-01

Transposable elements (TEs) are conventionally identified in eukaryotic genomes by alignment to consensus element sequences. Using this approach, about half of the human genome has been previously identified as TEs and low-complexity repeats. We recently developed a highly sensitive alternative de novo strategy, P-clouds, that instead searches for clusters of high-abundance oligonucleotides that are related in sequence space (oligo “clouds”). We show here that P-clouds predicts >840 Mbp of additional repetitive sequences in the human genome, thus suggesting that 66%–69% of the human genome is repetitive or repeat-derived. To investigate this remarkable difference, we conducted detailed analyses of the ability of both P-clouds and a commonly used conventional approach, RepeatMasker (RM), to detect different sized fragments of the highly abundant human Alu and MIR SINEs. RM can have surprisingly low sensitivity for even moderately long fragments, in contrast to P-clouds, which has good sensitivity down to small fragment sizes (∼25 bp). Although short fragments have a high intrinsic probability of being false positives, we performed a probabilistic annotation that reflects this fact. We further developed “element-specific” P-clouds (ESPs) to identify novel Alu and MIR SINE elements, and using it we identified ∼100 Mb of previously unannotated human elements. ESP estimates of new MIR sequences are in good agreement with RM-based predictions of the amount that RM missed. These results highlight the need for combined, probabilistic genome annotation approaches and suggest that the human genome consists of substantially more repetitive sequence than previously believed. PMID:22144907

Method and apparatus for signal processing in a sensor system for use in spectroscopy

DOEpatents

O'Connor, Paul [Bellport, NY; DeGeronimo, Gianluigi [Nesconset, NY; Grosholz, Joseph [Natrona Heights, PA

2008-05-27

A method for processing pulses arriving randomly in time on at least one channel using multiple peak detectors includes asynchronously selecting a non-busy peak detector (PD) in response to a pulse-generated trigger signal, connecting the channel to the selected PD in response to the trigger signal, and detecting a pulse peak amplitude. Amplitude and time of arrival data are output in first-in first-out (FIFO) sequence. An apparatus includes trigger comparators to generate the trigger signal for the pulse-receiving channel, PDs, a switch for connecting the channel to the selected PD, and logic circuitry which maintains the write pointer. Also included, time-to-amplitude converters (TACs) convert time of arrival to analog voltage and an analog multiplexer provides FIFO output. A multi-element sensor system for spectroscopy includes detector elements, channels, trigger comparators, PDs, a switch, and a logic circuit with asynchronous write pointer. The system includes TACs, a multiplexer and analog-to-digital converter.

Domain- and nucleotide-specific Rev response element regulation of feline immunodeficiency virus production

PubMed Central

Na, Hong; Huisman, Willem; Ellestad, Kristofor K.; Phillips, Tom R.; Power, Christopher

2010-01-01

Computational analysis of feline immunodeficiency virus (FIV) RNA sequences indicated that common FIV strains contain a rev response element (RRE) defined by a long unbranched hairpin with 6 stem-loop sub-domains, termed stem-loop A (SLA). To examine the role of the RNA secondary structure of the RRE, mutational analyses were performed in both an infectious FIV molecular clone and a FIV CAT-RRE reporter system. These studies disclosed that the stems within SLA (SA1, 2, 3, 4, and 5) of the RRE were critical but SA6 was not essential for FIV replication and CAT expression. These studies also revealed that the secondary structure rather than an antisense protein (ASP) mediates virus expression and replication in vitro. In addition, a single synonymous mutation within the FIV-RRE, SA3/45, reduced viral reverse transcriptase activity and p24 expression after transfection but in addition also showed a marked reduction in viral expression and production following infection. PMID:20570310

Chromosomal Inversions between Human and Chimpanzee Lineages Caused by Retrotransposons

PubMed Central

Lee, Jungnam; Han, Kyudong; Meyer, Thomas J.; Kim, Heui-Soo; Batzer, Mark A.

2008-01-01

The long interspersed element-1 (LINE-1 or L1) and Alu elements are the most abundant mobile elements comprising 21% and 11% of the human genome, respectively. Since the divergence of human and chimpanzee lineages, these elements have vigorously created chromosomal rearrangements causing genomic difference between humans and chimpanzees by either increasing or decreasing the size of genome. Here, we report an exotic mechanism, retrotransposon recombination-mediated inversion (RRMI), that usually does not alter the amount of genomic material present. Through the comparison of the human and chimpanzee draft genome sequences, we identified 252 inversions whose respective inversion junctions can clearly be characterized. Our results suggest that L1 and Alu elements cause chromosomal inversions by either forming a secondary structure or providing a fragile site for double-strand breaks. The detailed analysis of the inversion breakpoints showed that L1 and Alu elements are responsible for at least 44% of the 252 inversion loci between human and chimpanzee lineages, including 49 RRMI loci. Among them, three RRMI loci inverted exonic regions in known genes, which implicates this mechanism in generating the genomic and phenotypic differences between human and chimpanzee lineages. This study is the first comprehensive analysis of mobile element bases inversion breakpoints between human and chimpanzee lineages, and highlights their role in primate genome evolution. PMID:19112500

copia-like retrotransposons are ubiquitous among plants.

PubMed Central

Voytas, D F; Cummings, M P; Koniczny, A; Ausubel, F M; Rodermel, S R

1992-01-01

Transposable genetic elements are assumed to be a feature of all eukaryotic genomes. Their identification, however, has largely been haphazard, limited principally to organisms subjected to molecular or genetic scrutiny. We assessed the phylogenetic distribution of copia-like retrotransposons, a class of transposable element that proliferates by reverse transcription, using a polymerase chain reaction assay designed to detect copia-like element reverse transcriptase sequences. copia-like retrotransposons were identified in 64 plant species as well as the photosynthetic protist Volvox carteri. The plant species included representatives from 9 of 10 plant divisions, including bryophytes, lycopods, ferns, gymnosperms, and angiosperms. DNA sequence analysis of 29 cloned PCR products and of a maize retrotransposon cDNA confirmed the identity of these sequences as copia-like reverse transcriptase sequences, thereby demonstrating that this class of retrotransposons is a ubiquitous component of plant genomes. Images PMID:1379734

A Mobile Element in mutS Drives Hypermutation in a Marine Vibrio

PubMed Central

Chu, Nathaniel D.; Clarke, Sean A.; Timberlake, Sonia; Polz, Martin F.; Grossman, Alan D.

2017-01-01

ABSTRACT Bacteria face a trade-off between genetic fidelity, which reduces deleterious mistakes in the genome, and genetic innovation, which allows organisms to adapt. Evidence suggests that many bacteria balance this trade-off by modulating their mutation rates, but few mechanisms have been described for such modulation. Following experimental evolution and whole-genome resequencing of the marine bacterium Vibrio splendidus 12B01, we discovered one such mechanism, which allows this bacterium to switch to an elevated mutation rate. This switch is driven by the excision of a mobile element residing in mutS, which encodes a DNA mismatch repair protein. When integrated within the bacterial genome, the mobile element provides independent promoter and translation start sequences for mutS—different from the bacterium’s original mutS promoter region—which allow the bacterium to make a functional mutS gene product. Excision of this mobile element rejoins the mutS gene with host promoter and translation start sequences but leaves a 2-bp deletion in the mutS sequence, resulting in a frameshift and a hypermutator phenotype. We further identified hundreds of clinical and environmental bacteria across Betaproteobacteria and Gammaproteobacteria that possess putative mobile elements within the same amino acid motif in mutS. In a subset of these bacteria, we detected excision of the element but not a frameshift mutation; the mobile elements leave an intact mutS coding sequence after excision. Our findings reveal a novel mechanism by which one bacterium alters its mutation rate and hint at a possible evolutionary role for mobile elements within mutS in other bacteria. PMID:28174306

Traffic at the tmRNA Gene

PubMed Central

Williams, Kelly P.

2003-01-01

A partial screen for genetic elements integrated into completely sequenced bacterial genomes shows more significant bias in specificity for the tmRNA gene (ssrA) than for any type of tRNA gene. Horizontal gene transfer, a major avenue of bacterial evolution, was assessed by focusing on elements using this single attachment locus. Diverse elements use ssrA; among enterobacteria alone, at least four different integrase subfamilies have independently evolved specificity for ssrA, and almost every strain analyzed presents a unique set of integrated elements. Even elements using essentially the same integrase can be very diverse, as is a group with an ssrA-specific integrase of the P4 subfamily. This same integrase appears to promote damage routinely at attachment sites, which may be adaptive. Elements in arrays can recombine; one such event mediated by invertible DNA segments within neighboring elements likely explains the monophasic nature of Salmonella enterica serovar Typhi. One of a limited set of conserved sequences occurs at the attachment site of each enterobacterial element, apparently serving as a transcriptional terminator for ssrA. Elements were usually found integrated into tRNA-like sequence at the 3′ end of ssrA, at subsites corresponding to those used in tRNA genes; an exception was found at the non-tRNA-like 3′ end produced by ssrA gene permutation in cyanobacteria, suggesting that, during the evolution of new site specificity by integrases, tropism toward a conserved 3′ end of an RNA gene may be as strong as toward a tRNA-like sequence. The proximity of ssrA and smpB, which act in concert, was also surveyed. PMID:12533482

Free Vibration of Uncertain Unsymmetrically Laminated Beams

NASA Technical Reports Server (NTRS)

Kapania, Rakesh K.; Goyal, Vijay K.

2001-01-01

Monte Carlo Simulation and Stochastic FEA are used to predict randomness in the free vibration response of thin unsymmetrically laminated beams. For the present study, it is assumed that randomness in the response is only caused by uncertainties in the ply orientations. The ply orientations may become random or uncertain during the manufacturing process. A new 16-dof beam element, based on the first-order shear deformation beam theory, is used to study the stochastic nature of the natural frequencies. Using variational principles, the element stiffness matrix and mass matrix are obtained through analytical integration. Using a random sequence a large data set is generated, containing possible random ply-orientations. This data is assumed to be symmetric. The stochastic-based finite element model for free vibrations predicts the relation between the randomness in fundamental natural frequencies and the randomness in ply-orientation. The sensitivity derivatives are calculated numerically through an exact formulation. The squared fundamental natural frequencies are expressed in terms of deterministic and probabilistic quantities, allowing to determine how sensitive they are to variations in ply angles. The predicted mean-valued fundamental natural frequency squared and the variance of the present model are in good agreement with Monte Carlo Simulation. Results, also, show that variations between plus or minus 5 degrees in ply-angles can affect free vibration response of unsymmetrically and symmetrically laminated beams.

Identification of Genes Associated with Lemon Floral Transition and Flower Development during Floral Inductive Water Deficits: A Hypothetical Model

PubMed Central

Li, Jin-Xue; Hou, Xiao-Jin; Zhu, Jiao; Zhou, Jing-Jing; Huang, Hua-Bin; Yue, Jian-Qiang; Gao, Jun-Yan; Du, Yu-Xia; Hu, Cheng-Xiao; Hu, Chun-Gen; Zhang, Jin-Zhi

2017-01-01

Water deficit is a key factor to induce flowering in many woody plants, but reports on the molecular mechanisms of floral induction and flowering by water deficit are scarce. Here, we analyzed the morphology, cytology, and different hormone levels of lemon buds during floral inductive water deficits. Higher levels of ABA were observed, and the initiation of floral bud differentiation was examined by paraffin sections analysis. A total of 1638 differentially expressed genes (DEGs) were identified by RNA sequencing. DEGs were related to flowering, hormone biosynthesis, or metabolism. The expression of some DEGs was associated with floral induction by real-time PCR analysis. However, some DEGs may not have anything to do with flowering induction/flower development; they may be involved in general stress/drought response. Four genes from the phosphatidylethanolamine-binding protein family were further investigated. Ectopic expression of these genes in Arabidopsis changed the flowering time of transgenic plants. Furthermore, the 5′ flanking region of these genes was also isolated and sequence analysis revealed the presence of several putative cis-regulatory elements, including basic elements and hormone regulation elements. The spatial and temporal expression patterns of these promoters were investigated under water deficit treatment. Based on these findings, we propose a model for citrus flowering under water deficit conditions, which will enable us to further understand the molecular mechanism of water deficit-regulated flowering in citrus. Highlight: Based on gene activity during floral inductive water deficits identified by RNA sequencing and genes associated with lemon floral transition, a model for citrus flowering under water deficit conditions is proposed. PMID:28659956

Program for User-Friendly Management of Input and Output Data Sets

NASA Technical Reports Server (NTRS)

Klimeck, Gerhard

2003-01-01

A computer program manages large, hierarchical sets of input and output (I/O) parameters (typically, sequences of alphanumeric data) involved in computational simulations in a variety of technological disciplines. This program represents sets of parameters as structures coded in object-oriented but otherwise standard American National Standards Institute C language. Each structure contains a group of I/O parameters that make sense as a unit in the simulation program with which this program is used. The addition of options and/or elements to sets of parameters amounts to the addition of new elements to data structures. By association of child data generated in response to a particular user input, a hierarchical ordering of input parameters can be achieved. Associated with child data structures are the creation and description mechanisms within the parent data structures. Child data structures can spawn further child data structures. In this program, the creation and representation of a sequence of data structures is effected by one line of code that looks for children of a sequence of structures until there are no more children to be found. A linked list of structures is created dynamically and is completely represented in the data structures themselves. Such hierarchical data presentation can guide users through otherwise complex setup procedures and it can be integrated within a variety of graphical representations.

Deletion of ultraconserved elements yields viable mice

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ahituv, Nadav; Zhu, Yiwen; Visel, Axel

2007-07-15

Ultraconserved elements have been suggested to retainextended perfect sequence identity between the human, mouse, and ratgenomes due to essential functional properties. To investigate thenecessities of these elements in vivo, we removed four non-codingultraconserved elements (ranging in length from 222 to 731 base pairs)from the mouse genome. To maximize the likelihood of observing aphenotype, we chose to delete elements that function as enhancers in amouse transgenic assay and that are near genes that exhibit markedphenotypes both when completely inactivated in the mouse as well as whentheir expression is altered due to other genomic modifications.Remarkably, all four resulting lines of mice lackingmore » these ultraconservedelements were viable and fertile, and failed to reveal any criticalabnormalities when assayed for a variety of phenotypes including growth,longevity, pathology and metabolism. In addition more targeted screens,informed by the abnormalities observed in mice where genes in proximityto the investigated elements had been altered, also failed to revealnotable abnormalities. These results, while not inclusive of all thepossible phenotypic impact of the deleted sequences, indicate thatextreme sequence constraint does not necessarily reflect crucialfunctions required for viability.« less

When Genomics Is Not Enough: Experimental Evidence for a Decrease in LINE-1 Activity During the Evolution of Australian Marsupials

PubMed Central

Gallus, Susanne; Lammers, Fritjof

2016-01-01

The autonomous transposable element LINE-1 is a highly abundant element that makes up between 15% and 20% of therian mammal genomes. Since their origin before the divergence of marsupials and placental mammals, LINE-1 elements have contributed actively to the genome landscape. A previous in silico screen of the Tasmanian devil genome revealed a lack of functional coding LINE-1 sequences. In this study we present the results of an in vitro analysis from a partial LINE-1 reverse transcriptase coding sequence in five marsupial species. Our experimental screen supports the in silico findings of the genome-wide degradation of LINE-1 sequences in the Tasmanian devil, and identifies a high frequency of degraded LINE-1 sequences in other Australian marsupials. The comparison between the experimentally obtained LINE-1 sequences and reference genome assemblies suggests that conclusions from in silico analyses of retrotransposition activity can be influenced by incomplete genome assemblies from short reads. PMID:27389686

Insights into Structural and Mechanistic Features of Viral IRES Elements

PubMed Central

Martinez-Salas, Encarnacion; Francisco-Velilla, Rosario; Fernandez-Chamorro, Javier; Embarek, Azman M.

2018-01-01

Internal ribosome entry site (IRES) elements are cis-acting RNA regions that promote internal initiation of protein synthesis using cap-independent mechanisms. However, distinct types of IRES elements present in the genome of various RNA viruses perform the same function despite lacking conservation of sequence and secondary RNA structure. Likewise, IRES elements differ in host factor requirement to recruit the ribosomal subunits. In spite of this diversity, evolutionarily conserved motifs in each family of RNA viruses preserve sequences impacting on RNA structure and RNA–protein interactions important for IRES activity. Indeed, IRES elements adopting remarkable different structural organizations contain RNA structural motifs that play an essential role in recruiting ribosomes, initiation factors and/or RNA-binding proteins using different mechanisms. Therefore, given that a universal IRES motif remains elusive, it is critical to understand how diverse structural motifs deliver functions relevant for IRES activity. This will be useful for understanding the molecular mechanisms beyond cap-independent translation, as well as the evolutionary history of these regulatory elements. Moreover, it could improve the accuracy to predict IRES-like motifs hidden in genome sequences. This review summarizes recent advances on the diversity and biological relevance of RNA structural motifs for viral IRES elements. PMID:29354113

The 5′ RNA Terminus of Spleen Necrosis Virus Stimulates Translation of Nonviral mRNA

PubMed Central

Roberts, Tiffiney M.; Boris-Lawrie, Kathleen

2000-01-01

The RU5 region at the 5′ RNA terminus of spleen necrosis virus (SNV) has been shown to facilitate expression of human immunodeficiency virus type 1 (HIV) unspliced RNA independently of the Rev-responsive element (RRE) and Rev. The SNV sequences act as a distinct posttranscriptional control element to stimulate gag RNA nuclear export and association with polyribosomes. Here we sought to determine whether RU5 functions to neutralize the cis-acting inhibitory sequences (INSs) in HIV RNA that confer RRE/Rev dependence or functions as an independent stimulatory sequence. Experiments with HIV gag reporter plasmids that contain inactivated INS-1 indicated that neutralization of INSs does not account for RU5 function. Results with luciferase reporter gene (luc) plasmids further indicated that RU5 stimulates expression of a nonretroviral RNA that lacks INSs. Northern blot and RT-PCR analyses indicated that RU5 does not increase the steady-state levels or nuclear export of the luc transcript but rather that the U5 region facilitates efficient polyribosomal association of the mRNA. RU5 does not function as an internal ribosome entry site in bicistronic reporter plasmids, and it requires the 5′-proximal position for efficient function. Our results indicate that RU5 contains stimulatory sequences that function in a 5′-proximal position to enhance initiation of translation of a nonretroviral reporter gene RNA. We speculate that RU5 evolved to overcome the translation-inhibitory effect of the highly structured encapsidation signal and other replication motifs in the 5′ untranslated region of the retroviral RNA. PMID:10933721

DNA capture elements for rapid detection and identification of biological agents

NASA Astrophysics Data System (ADS)

Kiel, Johnathan L.; Parker, Jill E.; Holwitt, Eric A.; Vivekananda, Jeeva

2004-08-01

DNA capture elements (DCEs; aptamers) are artificial DNA sequences, from a random pool of sequences, selected for their specific binding to potential biological warfare agents. These sequences were selected by an affinity method using filters to which the target agent was attached and the DNA isolated and amplified by polymerase chain reaction (PCR) in an iterative, increasingly stringent, process. Reporter molecules were attached to the finished sequences. To date, we have made DCEs to Bacillus anthracis spores, Shiga toxin, Venezuelan Equine Encephalitis (VEE) virus, and Francisella tularensis. These DCEs have demonstrated specificity and sensitivity equal to or better than antibody.

Genomic characterization of two large Alu-mediated rearrangements of the BRCA1 gene.

PubMed

Peixoto, Ana; Pinheiro, Manuela; Massena, Lígia; Santos, Catarina; Pinto, Pedro; Rocha, Patrícia; Pinto, Carla; Teixeira, Manuel R

2013-02-01

To determine whether a large genomic rearrangement is actually novel and to gain insight about the mutational mechanism responsible for its occurrence, molecular characterization with breakpoint identification is mandatory. We here report the characterization of two large deletions involving the BRCA1 gene. The first rearrangement harbored a 89,664-bp deletion comprising exon 7 of the BRCA1 gene to exon 11 of the NBR1 gene (c.441+1724_oNBR1:c.1073+480del). Two highly homologous Alu elements were found in the genomic sequences flanking the deletion breakpoints. Furthermore, a 20-bp overlapping sequence at the breakpoint junction was observed, suggesting that the most likely mechanism for the occurrence of this rearrangement was nonallelic homologous recombination. The second rearrangement fully characterized at the nucleotide level was a BRCA1 exons 11-15 deletion (c.671-319_4677-578delinsAlu). The case harbored a 23,363-bp deletion with an Alu element inserted at the breakpoints of the deleted region. As the Alu element inserted belongs to a still active AluY family, the observed rearrangement could be due to an insertion-mediated deletion mechanism caused by Alu retrotransposition. To conclude, we describe the breakpoints of two novel large deletions involving the BRCA1 gene and analysis of their genomic context allowed us to gain insight about the respective mutational mechanism.

RNA transcript sequencing reveals inorganic sulfur compound oxidation pathways in the acidophile Acidithiobacillus ferrivorans.

PubMed

Christel, Stephan; Fridlund, Jimmy; Buetti-Dinh, Antoine; Buck, Moritz; Watkin, Elizabeth L; Dopson, Mark

2016-04-01

Acidithiobacillus ferrivorans is an acidophile implicated in low-temperature biomining for the recovery of metals from sulfide minerals. Acidithiobacillus ferrivorans obtains its energy from the oxidation of inorganic sulfur compounds, and genes encoding several alternative pathways have been identified. Next-generation sequencing of At. ferrivorans RNA transcripts identified the genes coding for metabolic and electron transport proteins for energy conservation from tetrathionate as electron donor. RNA transcripts suggested that tetrathionate was hydrolyzed by the tetH1 gene product to form thiosulfate, elemental sulfur and sulfate. Despite two of the genes being truncated, RNA transcripts for the SoxXYZAB complex had higher levels than for thiosulfate quinone oxidoreductase (doxDAgenes). However, a lack of heme-binding sites in soxX suggested that DoxDA was responsible for thiosulfate metabolism. Higher RNA transcript counts also suggested that elemental sulfur was metabolized by heterodisulfide reductase (hdrgenes) rather than sulfur oxygenase reductase (sor). The sulfite produced as a product of heterodisulfide reductase was suggested to be oxidized by a pathway involving the sat gene product or abiotically react with elemental sulfur to form thiosulfate. Finally, several electron transport complexes were involved in energy conservation. This study has elucidated the previously unknown At. ferrivorans tetrathionate metabolic pathway that is important in biomining. © FEMS 2016. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Identification of novel mazEF/pemIK family toxin-antitoxin loci and their distribution in the Staphylococcus genus.

PubMed

Bukowski, Michal; Hyz, Karolina; Janczak, Monika; Hydzik, Marcin; Dubin, Grzegorz; Wladyka, Benedykt

2017-10-18

The versatile roles of toxin-antitoxin (TA) systems in bacterial physiology and pathogenesis have been investigated for more than three decades. Diverse TA loci in Bacteria and Archaea have been identified in genome-wide studies. The advent of massive parallel sequencing has substantially expanded the number of known bacterial genomic sequences over the last 5 years. In staphylococci, this has translated into an impressive increase from a few tens to a several thousands of available genomes, which has allowed us for the re-evalution of prior conclusions. In this study, we analysed the distribution of mazEF/pemIK family TA system operons in available staphylococcal genomes and their prevalence in mobile genetic elements. 10 novel m azEF/pemIK homologues were identified, each with a corresponding toxin that plays a potentially different and undetermined physiological role. A detailed characterisation of these TA systems would be exceptionally useful. Of particular interest are those associated with an SCCmec mobile genetic element (responsible for multidrug resistance transmission) or representing the joint horizontal transfer of TA systems and determinants of vancomycin resistance from enterococci. The involvement of TA systems in maintaining mobile genetic elements and the associations between novel mazEF/pemIK loci and those which carry drug resistance genes highlight their potential medical importance.

Genomic structure of two ras family genes in the slime mold Physarum polycephalum.

PubMed

Trzcińska-Danielewicz, Joanna; Kozlowski, Piotr; Gierdal, Katarzyna; Wiejak, Jolanta; Jagielski, Adam; Toczko, Kazimierz; Fronk, Jan

2002-08-01

Genomic structure of two Physarum polycephalum ras family genes, Ppras2 and Pprap1, has been determined, including the upstream region of the latter. The genes are interrupted by three and four introns, respectively. The first intron of Ppras2 has the same location within the coding sequence as the first intron in another ras homolog from this organism, Ppras1 [Trzcińska-Danielewicz, J., Kozlowski, P., and Toczko, K. (1996). "Cloning and genomic sequence of the Physarum polycephalum Ppras1 gene, a homologue of the ras protooncogene", Gene 169, pp. 143-144]. All introns, ranging from 53 to ca. 460 base pairs, have the canonical 5' and 3' ends, are greatly enriched in pyrimidines in the coding strand and have frequent pyrimidines-only tracts. These latter features seem to be responsible for the difficulties in cloning and sequencing of parts of these genes. Short sequences shared with P. polycephalum transposon-like repeats are common in the introns, indicating a possible role of transposition in intron evolution. In all three ras family genes phase zero introns are located mostly between sequences coding for regular protein secondary structure elements.

Novel cis-acting replication element in the adeno-associated virus type 2 genome is involved in amplification of integrated rep-cap sequences.

PubMed

Nony, P; Tessier, J; Chadeuf, G; Ward, P; Giraud, A; Dugast, M; Linden, R M; Moullier, P; Salvetti, A

2001-10-01

This study identifies a region of the adeno-associated virus type 2 (AAV-2) rep gene (nucleotides 190 to 540 of wild-type AAV-2) as a cis-acting Rep-dependent element able to promote the replication of transiently transfected plasmids. This viral element is also shown to be involved in the amplification of integrated sequences in the presence of adenovirus and Rep proteins.

GrTEdb: the first web-based database of transposable elements in cotton (Gossypium raimondii).

PubMed

Xu, Zhenzhen; Liu, Jing; Ni, Wanchao; Peng, Zhen; Guo, Yue; Ye, Wuwei; Huang, Fang; Zhang, Xianggui; Xu, Peng; Guo, Qi; Shen, Xinlian; Du, Jianchang

2017-01-01

Although several diploid and tetroploid Gossypium species genomes have been sequenced, the well annotated web-based transposable elements (TEs) database is lacking. To better understand the roles of TEs in structural, functional and evolutionary dynamics of the cotton genome, a comprehensive, specific, and user-friendly web-based database, Gossypium raimondii transposable elements database (GrTEdb), was constructed. A total of 14 332 TEs were structurally annotated and clearly categorized in G. raimondii genome, and these elements have been classified into seven distinct superfamilies based on the order of protein-coding domains, structures and/or sequence similarity, including 2929 Copia-like elements, 10 368 Gypsy-like elements, 299 L1 , 12 Mutators , 435 PIF-Harbingers , 275 CACTAs and 14 Helitrons . Meanwhile, the web-based sequence browsing, searching, downloading and blast tool were implemented to help users easily and effectively to annotate the TEs or TE fragments in genomic sequences from G. raimondii and other closely related Gossypium species. GrTEdb provides resources and information related with TEs in G. raimondii , and will facilitate gene and genome analyses within or across Gossypium species, evaluating the impact of TEs on their host genomes, and investigating the potential interaction between TEs and protein-coding genes in Gossypium species. http://www.grtedb.org/. © The Author(s) 2017. Published by Oxford University Press.

Integration of growth factor signals at the c-fos serum response element.

PubMed

Price, M A; Hill, C; Treisman, R

1996-04-29

A transcription factor ternary complex composed of serum response factor (SRF) and a second factor, ternary complex factor (TCF), mediates the response of the c-fos Serum Response Element to growth factors and mitogens. In NIH3T3 fibroblasts, TCF binding is required for transcriptional activation by the SRE in response to activation of the Ras-Raf-ERK pathway. We compared the properties of three members of the TCF family, Elk-1, SAP-1 and SAP-2 (ERP/NET). Although all the proteins contain sequences required for ternary complex formation with SRF, only Elk-1 and SAP-1 appear to interact with the c-fos SRE efficiently in vivo. Each TCF contains a C-terminal activation domain capable of transcriptional activation in response to activation of the Ras-Raf-ERK pathway, and this is dependent on the integrity of S/T-P motifs conserved between all the TCF family members. In contrast, activation of the SRE by whole serum and the mitogenic phospholipid LPA requires SRF binding alone. Constitutively activated members of the Rho subfamily of Ras-like GTPases are also capable of inducing activation of the SRE in the absence of TCF; unlike activated Ras itself, these proteins do not activate the TCFs in NIH3T3 cells. At the SRE, SRF- and TCF-linked signalling pathways act synergistically to potentiate transcription.

The foldase CYPB is a component of the secretory pathway of Aspergillus niger and contains the endoplasmic reticulum retention signal HEEL.

PubMed

Derkx, P M; Madrid, S M

2001-12-01

Here we report the isolation and characterization of the cypB gene from Aspergillus niger. The cypB gene encodes a protein with a predicted molecular weight of 20.7 kDa, which shows a high degree of identity to the cyclophilin family of peptidyl prolyl cis-trans isomerases (PPIases) from other eukaryotes. The 5' untranslated region of cypB includes three sequences resembling UPREs (unfolded protein response elements). The expression of cypB is upregulated by tunicamycin and DTT, suggesting that at least one UPRE is functional. The CYPB protein also has a 23-amino acid sequence which serves to target the protein to the endoplasmic reticulum (ER), and the ER retention sequence HEEL. CYPB-(His)(6) was expressed in Escherichia coli; the purified protein is capable of isomerizing a substrate peptide in vitro. This is also the first report to show that C-terminal addition of the sequence HEEL is sufficient to ensure retention of the green fluorescent protein (GFP) within the ER.

Impacts of visuomotor sequence learning methods on speed and accuracy: Starting over from the beginning or from the point of error.

PubMed

Tanaka, Kanji; Watanabe, Katsumi

2016-02-01

The present study examined whether sequence learning led to more accurate and shorter performance time if people who are learning a sequence start over from the beginning when they make an error (i.e., practice the whole sequence) or only from the point of error (i.e., practice a part of the sequence). We used a visuomotor sequence learning paradigm with a trial-and-error procedure. In Experiment 1, we found fewer errors, and shorter performance time for those who restarted their performance from the beginning of the sequence as compared to those who restarted from the point at which an error occurred, indicating better learning of spatial and motor representations of the sequence. This might be because the learned elements were repeated when the next performance started over from the beginning. In subsequent experiments, we increased the occasions for the repetitions of learned elements by modulating the number of fresh start points in the sequence after errors. The results showed that fewer fresh start points were likely to lead to fewer errors and shorter performance time, indicating that the repetitions of learned elements enabled participants to develop stronger spatial and motor representations of the sequence. Thus, a single or two fresh start points in the sequence (i.e., starting over only from the beginning or from the beginning or midpoint of the sequence after errors) is likely to lead to more accurate and faster performance. Copyright © 2016 Elsevier B.V. All rights reserved.

iPBS: a universal method for DNA fingerprinting and retrotransposon isolation.

PubMed

Kalendar, Ruslan; Antonius, Kristiina; Smýkal, Petr; Schulman, Alan H

2010-11-01

Molecular markers are essential in plant and animal breeding and biodiversity applications, in human forensics, and for map-based cloning of genes. The long terminal repeat (LTR) retrotransposons are well suited as molecular markers. As dispersed and ubiquitous transposable elements, their "copy and paste" life cycle of replicative transposition leads to new genome insertions without excision of the original element. Both the overall structure of retrotransposons and the domains responsible for the various phases of their replication are highly conserved in all eukaryotes. Nevertheless, up to a year has been required to develop a retrotransposon marker system in a new species, involving cloning and sequencing steps as well as the development of custom primers. Here, we describe a novel PCR-based method useful both as a marker system in its own right and for the rapid isolation of retrotransposon termini and full-length elements, making it ideal for "orphan crops" and other species with underdeveloped marker systems. The method, iPBS amplification, is based on the virtually universal presence of a tRNA complement as a reverse transcriptase primer binding site (PBS) in LTR retrotransposons. The method differs from earlier retrotransposon isolation methods because it is applicable not only to endogenous retroviruses and retroviruses, but also to both Gypsy and Copia LTR retrotransposons, as well as to non-autonomous LARD and TRIM elements, throughout the plant kingdom and to animals. Furthermore, the inter-PBS amplification technique as such has proved to be a powerful DNA fingerprinting technology without the need for prior sequence knowledge.

Molecular and functional characterization of the promoter of ETS2, the human c-ets-2 gene.

PubMed Central

Mavrothalassitis, G J; Watson, D K; Papas, T S

1990-01-01

The 5' end of the human c-ets-2 gene, ETS2, was cloned and characterized. The major transcription initiation start sites were identified, and the pertinent sequences surrounding the ETS2 promoter were determined. The promoter region of ETS2 does not possess typical "TATA" and "CAAT" elements. However, this promoter contains several repeat regions, as well as two consensus AP2 binding sites and three putative Sp1 sites. There is also a palindromic region similar to the serum response element of the c-fos gene, located 1400 base pairs (bp) upstream from the first major transcription initiation site. A G + C-rich sequence (GC element) with dyad symmetry can be seen in the ETS2 promoter, immediately following an unusually long (approximately 250-bp) polypurine-polypyrimidine tract. A series of deletion fragments from the putative promoter region were ligated in front of the bacterial chloramphenicol acetyltransferase gene and tested for activity following transfection into HeLa cells. The 5' boundary of the region needed for maximum promoter activity was found to be 159 bp upstream of the major initiation site. This region of 159 bp contains putative binding sites for transcription factors Sp1 and AP2 (one for each), the GC element, one small forward repeat, one inverted repeat, and half of the polypurine-pyrimidine tract. The promoter of ETS2 (within the polypyrimidine tract) serves to illustrate an alternative structure that may be present in genes with "TATA-less" promoters. Images PMID:2405393

Elements of Mathematics, Book O: Intuitive Background. Chapter 1, Operational Systems.

ERIC Educational Resources Information Center

Exner, Robert; And Others

The sixteen chapters of this book provide the core material for the Elements of Mathematics Program, a secondary sequence developed for highly motivated students with strong verbal abilities. The sequence is based on a functional-relational approach to mathematics teaching, and emphasizes teaching by analysis of real-life situations. This text is…

Elements of Mathematics, Book O: Intuitive Background. Chapter 5, Mappings.

ERIC Educational Resources Information Center

Exner, Robert; And Others

The sixteen chapters of this book provide the core material for the Elements of Mathematics Program, a secondary sequence developed for highly motivated students with strong verbal abilities. The sequence is based on a functional-relational approach to mathematics teaching, and emphasizes teaching by analysis of real-life situations. This text is…

Elements of Mathematics, Book O: Intuitive Background. Chapter 2, The Integers.

ERIC Educational Resources Information Center

Exner, Robert; And Others

The sixteen chapters of this book provide the core materials for the Elements of Mathematics Program, a secondary sequence developed for highly motivated students with strong verbal abilities. The sequence is based on a functional-relational approach to mathematics teaching, and emphasizes teaching by analysis of real-life situations. This text is…

Conformation of Tax-response elements in the human T-cell leukemia virus type I promoter.

PubMed

Cox, J M; Sloan, L S; Schepartz, A

1995-12-01

HTLV-I Tax is believed to activate viral gene expression by binding bZIP proteins (such as CREB) and increasing their affinities for proviral TRE target sites. Each 21 bp TRE target site contains an imperfect copy of the intrinsically bent CRE target site (the TRE core) surrounded by highly conserved flanking sequences. These flanking sequences are essential for maximal increases in DNA affinity and transactivation, but they are not, apparently, contacted by protein. Here we employ non-denaturing gel electrophoresis to evaluate TRE conformation in the presence and absence of bZIP proteins, and to explore the role of DNA conformation in viral transactivation. Our results show that the TRE-1 flanking sequences modulate the structure and modestly increase the affinity of a CREB bZIP peptide for the TRE-1 core recognition sequence. These flanking sequences are also essential for a maximal increase in stability of the CREB-DNA complex in the presence of Tax. The CRE-like TRE core and the TRE flanking sequences are both essential for formation of stable CREB-TRE-1 and Tax-CREB-TRE-1 complexes. These two DNA segments may have co-evolved into a unique structure capable of recognizing Tax and a bZIP protein.

Inhibition of hepatitis B virus replication with linear DNA sequences expressing antiviral micro-RNA shuttles

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chattopadhyay, Saket; Ely, Abdullah; Bloom, Kristie

2009-11-20

RNA interference (RNAi) may be harnessed to inhibit viral gene expression and this approach is being developed to counter chronic infection with hepatitis B virus (HBV). Compared to synthetic RNAi activators, DNA expression cassettes that generate silencing sequences have advantages of sustained efficacy and ease of propagation in plasmid DNA (pDNA). However, the large size of pDNAs and inclusion of sequences conferring antibiotic resistance and immunostimulation limit delivery efficiency and safety. To develop use of alternative DNA templates that may be applied for therapeutic gene silencing, we assessed the usefulness of PCR-generated linear expression cassettes that produce anti-HBV micro-RNA (miR)more » shuttles. We found that silencing of HBV markers of replication was efficient (>75%) in cell culture and in vivo. miR shuttles were processed to form anti-HBV guide strands and there was no evidence of induction of the interferon response. Modification of terminal sequences to include flanking human adenoviral type-5 inverted terminal repeats was easily achieved and did not compromise silencing efficacy. These linear DNA sequences should have utility in the development of gene silencing applications where modifications of terminal elements with elimination of potentially harmful and non-essential sequences are required.« less

The nonlinear, complex sequential organization of behavior in schizophrenic patients: neurocognitive strategies and clinical correlations.

PubMed

Paulus, M P; Perry, W; Braff, D L

1999-09-01

Thought disorder is a hallmark of schizophrenia and can be inferred from disorganized behavior. Measures of the sequential organization of behavior are important because they reflect the cognitive processes of the selection and sequencing of behavioral elements, which generate observable and analyzable behavioral patterns. In this context, sequences of choices generated by schizophrenic patients in a two-choice guessing task fluctuate significantly, which reflects an "oscillating dysregulation" between highly predictable and highly unpredictable subsequences within a single test session. In this study, we aimed to clarify the significance of dysregulation by seeing whether demographic, clinical, neuropsychological, and psychological measures predict the degree of dysregulation observed on this two-choice task. Thirty schizophrenic patients repeatedly performed a LEFT or RIGHT key press that was followed by a stimulus, which occurred randomly on the left or right side of the computer screen. Thus, the stimulus location had nothing to do with the key press behavior. The range of key press sequence predictabilities as measured by the dynamical entropy was used to quantify the dysregulation of response sequences and reflects the range of fixity and randomness of the responses. A factor analysis was performed and step-wise multiple regression analyses were used to relate the factor scores to demographic, clinical, symptomatic, Wisconsin Card Sorting Test (WCST), and Rorschach variables. The LEFT/RIGHT key press sequences were determined by three factors: 1) the degree of win-stay/lose-shift strategy; 2) the degree of contextual influence on the current choice; and 3) the degree of dysregulation on the choice task. Demographic and clinical variables did not predict any of the three response patterns on the choice task. In contrast, the WCST and Rorschach test predicted performance on various factors of choice task response patterns. Schizophrenic patients employ several rules, i.e., "win-stay/lose-shift" and "decide according to the previous choice," that fluctuate significantly when generating sequences on this task, confirming that a basic behavioral dysregulation occurs in a single schizophrenic subject across a single test session. The organization or the "temporal architecture" of the behavioral sequences is not related to symptoms per se, but is related to deficits in executive functioning, problem solving, and perceptual organizational abilities.

On the role of the SMA in the discrete sequence production task: a TMS study. Transcranial Magnetic Stimulation.

PubMed

Verwey, Willem B; Lammens, Robin; van Honk, Jack

2002-01-01

Participants practiced two discrete six-key sequences for a total of 420 trials. The 1 x 6 sequence had a unique order of key presses while the 2 x 3 sequence involved repetition of a three-key segment. Both sequences showed a long interkey interval halfway the sequence indicating hierarchical sequence control in that not only the 2 x 3 but also the 1 x 6 sequence was executed as two successive motor chunks. Besides, the second part of both sequences was executed faster than the first part. This supports the earlier notion of a motor processor executing the elements of familiar motor chunks and a cognitive processor triggering either these motor chunks or individual sequence elements. Low-frequency, off-line transcranial magnetic stimulation (TMS) of the supplementary motor area (SMA) counteracted normal improvement with practice of key presses at all sequence positions. Together, these results are in line with the notion that with moderate practice, the SMA executes short sequence fragments that are concatenated by other brain structures.

Beta-globin locus activation regions: conservation of organization, structure, and function.

PubMed Central

Li, Q L; Zhou, B; Powers, P; Enver, T; Stamatoyannopoulos, G

1990-01-01

The human beta-globin locus activation region (LAR) comprises four erythroid-specific DNase I hypersensitive sites (I-IV) thought to be largely responsible for activating the beta-globin domain and facilitating high-level erythroid-specific globin gene expression. We identified the goat beta-globin LAR, determined 10.2 kilobases of its sequence, and demonstrated its function in transgenic mice. The human and goat LARs share 6.5 kilobases of homologous sequences that are as highly conserved as the epsilon-globin gene promoters. Furthermore, the overall spatial organization of the two LARs has been conserved. These results suggest that the functionally relevant regions of the LAR are large and that in addition to their primary structure, the spatial relationship of the conserved elements is important for LAR function. Images PMID:2236034

Colonization of heterochromatic genes by transposable elements in Drosophila.

PubMed

Dimitri, Patrizio; Junakovic, Nikolaj; Arcà, Bruno

2003-04-01

As a further step toward understanding transposable element-host genome interactions, we investigated the molecular anatomy of introns from five heterochromatic and 22 euchromatic protein-coding genes of Drosophila melanogaster. A total of 79 kb of intronic sequences from heterochromatic genes and 355 kb of intronic sequences from euchromatic genes have been used in Blast searches against Drosophila transposable elements (TEs). The results show that TE-homologous sequences belonging to 19 different families represent about 50% of intronic DNA from heterochromatic genes. In contrast, only 0.1% of the euchromatic intron DNA exhibits homology to known TEs. Intraspecific and interspecific size polymorphisms of introns were found, which are likely to be associated with changes in TE-related sequences. Together, the enrichment in TEs and the apparent dynamic state of heterochromatic introns suggest that TEs contribute significantly to the evolution of genes located in heterochromatin.

Episodic sequence memory is supported by a theta-gamma phase code.

PubMed

Heusser, Andrew C; Poeppel, David; Ezzyat, Youssef; Davachi, Lila

2016-10-01

The meaning we derive from our experiences is not a simple static extraction of the elements but is largely based on the order in which those elements occur. Models propose that sequence encoding is supported by interactions between high- and low-frequency oscillations, such that elements within an experience are represented by neural cell assemblies firing at higher frequencies (gamma) and sequential order is encoded by the specific timing of firing with respect to a lower frequency oscillation (theta). During episodic sequence memory formation in humans, we provide evidence that items in different sequence positions exhibit greater gamma power along distinct phases of a theta oscillation. Furthermore, this segregation is related to successful temporal order memory. Our results provide compelling evidence that memory for order, a core component of an episodic memory, capitalizes on the ubiquitous physiological mechanism of theta-gamma phase-amplitude coupling.

Gene expression profiling of flax (Linum usitatissimum L.) under edaphic stress.

PubMed

Dmitriev, Alexey A; Kudryavtseva, Anna V; Krasnov, George S; Koroban, Nadezhda V; Speranskaya, Anna S; Krinitsina, Anastasia A; Belenikin, Maxim S; Snezhkina, Anastasiya V; Sadritdinova, Asiya F; Kishlyan, Natalya V; Rozhmina, Tatiana A; Yurkevich, Olga Yu; Muravenko, Olga V; Bolsheva, Nadezhda L; Melnikova, Nataliya V

2016-11-16

Cultivated flax (Linum usitatissimum L.) is widely used for production of textile, food, chemical and pharmaceutical products. However, various stresses decrease flax production. Search for genes, which are involved in stress response, is necessary for breeding of adaptive cultivars. Imbalanced concentration of nutrient elements in soil decrease flax yields and also results in heritable changes in some flax lines. The appearance of Linum Insertion Sequence 1 (LIS-1) is the most studied modification. However, LIS-1 function is still unclear. High-throughput sequencing of transcriptome of flax plants grown under normal (N), phosphate deficient (P), and nutrient excess (NPK) conditions was carried out using Illumina platform. The assembly of transcriptome was performed, and a total of 34924, 33797, and 33698 unique transcripts for N, P, and NPK sequencing libraries were identified, respectively. We have not revealed any LIS-1 derived mRNA in our sequencing data. The analysis of high-throughput sequencing data allowed us to identify genes with potentially differential expression under imbalanced nutrition. For further investigation with qPCR, 15 genes were chosen and their expression levels were evaluated in the extended sampling of 31 flax plants. Significant expression alterations were revealed for genes encoding WRKY and JAZ protein families under P and NPK conditions. Moreover, the alterations of WRKY family genes differed depending on LIS-1 presence in flax plant genome. Besides, we revealed slight and LIS-1 independent mRNA level changes of KRP2 and ING1 genes, which are adjacent to LIS-1, under nutrition stress. Differentially expressed genes were identified in flax plants, which were grown under phosphate deficiency and excess nutrition, on the basis of high-throughput sequencing and qPCR data. We showed that WRKY and JAS gene families participate in flax response to imbalanced nutrient content in soil. Besides, we have not identified any mRNA, which could be derived from LIS-1, in our transcriptome sequencing data. Expression of LIS-1 flanking genes, ING1 and KRP2, was suggested not to be nutrient stress-induced. Obtained results provide new insights into edaphic stress response in flax and the role of LIS-1 in these process.

Uncovering the Repertoire of Endogenous Flaviviral Elements in Aedes Mosquito Genomes

PubMed Central

Suzuki, Yasutsugu; Frangeul, Lionel; Dickson, Laura B.; Blanc, Hervé; Verdier, Yann; Vinh, Joelle

2017-01-01

ABSTRACT Endogenous viral elements derived from nonretroviral RNA viruses have been described in various animal genomes. Whether they have a biological function, such as host immune protection against related viruses, is a field of intense study. Here, we investigated the repertoire of endogenous flaviviral elements (EFVEs) in Aedes mosquitoes, the vectors of arboviruses such as dengue and chikungunya viruses. Previous studies identified three EFVEs from Aedes albopictus cell lines and one from Aedes aegypti cell lines. However, an in-depth characterization of EFVEs in wild-type mosquito populations and individual mosquitoes in vivo has not been performed. We detected the full-length DNA sequence of the previously described EFVEs and their respective transcripts in several A. albopictus and A. aegypti populations from geographically distinct areas. However, EFVE-derived proteins were not detected by mass spectrometry. Using deep sequencing, we detected the production of PIWI-interacting RNA-like small RNAs, in an antisense orientation, targeting the EFVEs and their flanking regions in vivo. The EFVEs were integrated in repetitive regions of the mosquito genomes, and their flanking sequences varied among mosquito populations. We bioinformatically predicted several new EFVEs from a Vietnamese A. albopictus population and observed variation in the occurrence of those elements among mosquitoes. Phylogenetic analysis of an A. aegypti EFVE suggested that it integrated prior to the global expansion of the species and subsequently diverged among and within populations. The findings of this study together reveal the substantial structural and nucleotide diversity of flaviviral integrations in Aedes genomes. Unraveling this diversity will help to elucidate the potential biological function of these EFVEs. IMPORTANCE Endogenous viral elements (EVEs) are whole or partial viral sequences integrated in host genomes. Interestingly, some EVEs have important functions for host fitness and antiviral defense. Because mosquitoes also have EVEs in their genomes, characterizing these EVEs is a prerequisite for their potential use to manipulate the mosquito antiviral response. In the study described here, we focused on EVEs related to the Flavivirus genus, to which dengue and Zika viruses belong, in individual Aedes mosquitoes from geographically distinct areas. We show the existence in vivo of flaviviral EVEs previously identified in mosquito cell lines, and we detected new ones. We show that EVEs have evolved differently in each mosquito population. They produce transcripts and small RNAs but not proteins, suggesting a function at the RNA level. Our study uncovers the diverse repertoire of flaviviral EVEs in Aedes mosquito populations and contributes to an understanding of their role in the host antiviral system. PMID:28539440

Uncovering the Repertoire of Endogenous Flaviviral Elements in Aedes Mosquito Genomes.

PubMed

Suzuki, Yasutsugu; Frangeul, Lionel; Dickson, Laura B; Blanc, Hervé; Verdier, Yann; Vinh, Joelle; Lambrechts, Louis; Saleh, Maria-Carla

2017-08-01

Endogenous viral elements derived from nonretroviral RNA viruses have been described in various animal genomes. Whether they have a biological function, such as host immune protection against related viruses, is a field of intense study. Here, we investigated the repertoire of endogenous flaviviral elements (EFVEs) in Aedes mosquitoes, the vectors of arboviruses such as dengue and chikungunya viruses. Previous studies identified three EFVEs from Aedes albopictus cell lines and one from Aedes aegypti cell lines. However, an in-depth characterization of EFVEs in wild-type mosquito populations and individual mosquitoes in vivo has not been performed. We detected the full-length DNA sequence of the previously described EFVEs and their respective transcripts in several A. albopictus and A. aegypti populations from geographically distinct areas. However, EFVE-derived proteins were not detected by mass spectrometry. Using deep sequencing, we detected the production of PIWI-interacting RNA-like small RNAs, in an antisense orientation, targeting the EFVEs and their flanking regions in vivo The EFVEs were integrated in repetitive regions of the mosquito genomes, and their flanking sequences varied among mosquito populations. We bioinformatically predicted several new EFVEs from a Vietnamese A. albopictus population and observed variation in the occurrence of those elements among mosquitoes. Phylogenetic analysis of an A. aegypti EFVE suggested that it integrated prior to the global expansion of the species and subsequently diverged among and within populations. The findings of this study together reveal the substantial structural and nucleotide diversity of flaviviral integrations in Aedes genomes. Unraveling this diversity will help to elucidate the potential biological function of these EFVEs. IMPORTANCE Endogenous viral elements (EVEs) are whole or partial viral sequences integrated in host genomes. Interestingly, some EVEs have important functions for host fitness and antiviral defense. Because mosquitoes also have EVEs in their genomes, characterizing these EVEs is a prerequisite for their potential use to manipulate the mosquito antiviral response. In the study described here, we focused on EVEs related to the Flavivirus genus, to which dengue and Zika viruses belong, in individual Aedes mosquitoes from geographically distinct areas. We show the existence in vivo of flaviviral EVEs previously identified in mosquito cell lines, and we detected new ones. We show that EVEs have evolved differently in each mosquito population. They produce transcripts and small RNAs but not proteins, suggesting a function at the RNA level. Our study uncovers the diverse repertoire of flaviviral EVEs in Aedes mosquito populations and contributes to an understanding of their role in the host antiviral system. Copyright © 2017 Suzuki et al.

Insertion sequences enrichment in extreme Red sea brine pool vent.

PubMed

Elbehery, Ali H A; Aziz, Ramy K; Siam, Rania

2017-03-01

Mobile genetic elements are major agents of genome diversification and evolution. Limited studies addressed their characteristics, including abundance, and role in extreme habitats. One of the rare natural habitats exposed to multiple-extreme conditions, including high temperature, salinity and concentration of heavy metals, are the Red Sea brine pools. We assessed the abundance and distribution of different mobile genetic elements in four Red Sea brine pools including the world's largest known multiple-extreme deep-sea environment, the Red Sea Atlantis II Deep. We report a gradient in the abundance of mobile genetic elements, dramatically increasing in the harshest environment of the pool. Additionally, we identified a strong association between the abundance of insertion sequences and extreme conditions, being highest in the harshest and deepest layer of the Red Sea Atlantis II Deep. Our comparative analyses of mobile genetic elements in secluded, extreme and relatively non-extreme environments, suggest that insertion sequences predominantly contribute to polyextremophiles genome plasticity.

A proposal to rename the hyperthermophile Pyrococcus woesei as Pyrococcus furiosus subsp. woesei.

PubMed

Kanoksilapatham, Wirojne; González, Juan M; Maeder, Dennis L; DiRuggiero, Jocelyne; Robb, Frank T

2004-10-01

Pyrococcus species are hyperthermophilic members of the order Thermococcales, with optimal growth temperatures approaching 100 degrees C. All species grow heterotrophically and produce H2 or, in the presence of elemental sulfur (S(o)), H2S. Pyrococcus woesei and P. furiosus were isolated from marine sediments at the same Vulcano Island beach site and share many morphological and physiological characteristics. We report here that the rDNA operons of these strains have identical sequences, including their intergenic spacer regions and part of the 23S rRNA. Both species grow rapidly and produce H2 in the presence of 0.1% maltose and 10-100 microM sodium tungstate in S(o)-free medium. However, P. woesei shows more extensive autolysis than P. furiosus in the stationary phase. Pyrococcus furiosus and P. woesei share three closely related families of insertion sequences (ISs). A Southern blot performed with IS probes showed extensive colinearity between the genomes of P. woesei and P. furiosus. Cloning and sequencing of ISs that were in different contexts in P. woesei and P. furiosus revealed that the napA gene in P. woesei is disrupted by a type III IS element, whereas in P. furiosus, this gene is intact. A type I IS element, closely linked to the napA gene, was observed in the same context in both P. furiosus and P. woesei genomes. Our results suggest that the IS elements are implicated in genomic rearrangements and reshuffling in these closely related strains. We propose to rename P. woesei a subspecies of P. furiosus based on their identical rDNA operon sequences, many common IS elements that are shared genomic markers, and the observation that all P. woesei nucleotide sequences deposited in GenBank to date are > 99% identical to P. furiosus sequences.

Interactions between the R2R3-MYB Transcription Factor, AtMYB61, and Target DNA Binding Sites

PubMed Central

Prouse, Michael B.; Campbell, Malcolm M.

2013-01-01

Despite the prominent roles played by R2R3-MYB transcription factors in the regulation of plant gene expression, little is known about the details of how these proteins interact with their DNA targets. For example, while Arabidopsis thaliana R2R3-MYB protein AtMYB61 is known to alter transcript abundance of a specific set of target genes, little is known about the specific DNA sequences to which AtMYB61 binds. To address this gap in knowledge, DNA sequences bound by AtMYB61 were identified using cyclic amplification and selection of targets (CASTing). The DNA targets identified using this approach corresponded to AC elements, sequences enriched in adenosine and cytosine nucleotides. The preferred target sequence that bound with the greatest affinity to AtMYB61 recombinant protein was ACCTAC, the AC-I element. Mutational analyses based on the AC-I element showed that ACC nucleotides in the AC-I element served as the core recognition motif, critical for AtMYB61 binding. Molecular modelling predicted interactions between AtMYB61 amino acid residues and corresponding nucleotides in the DNA targets. The affinity between AtMYB61 and specific target DNA sequences did not correlate with AtMYB61-driven transcriptional activation with each of the target sequences. CASTing-selected motifs were found in the regulatory regions of genes previously shown to be regulated by AtMYB61. Taken together, these findings are consistent with the hypothesis that AtMYB61 regulates transcription from specific cis-acting AC elements in vivo. The results shed light on the specifics of DNA binding by an important family of plant-specific transcriptional regulators. PMID:23741471

The BTB and CNC homology 1 (BACH1) target genes are involved in the oxidative stress response and in control of the cell cycle.

PubMed

Warnatz, Hans-Jörg; Schmidt, Dominic; Manke, Thomas; Piccini, Ilaria; Sultan, Marc; Borodina, Tatiana; Balzereit, Daniela; Wruck, Wasco; Soldatov, Alexey; Vingron, Martin; Lehrach, Hans; Yaspo, Marie-Laure

2011-07-01

The regulation of gene expression in response to environmental signals and metabolic imbalances is a key step in maintaining cellular homeostasis. BTB and CNC homology 1 (BACH1) is a heme-binding transcription factor repressing the transcription from a subset of MAF recognition elements at low intracellular heme levels. Upon heme binding, BACH1 is released from the MAF recognition elements, resulting in increased expression of antioxidant response genes. To systematically address the gene regulatory networks involving BACH1, we combined chromatin immunoprecipitation sequencing analysis of BACH1 target genes in HEK 293 cells with knockdown of BACH1 using three independent types of small interfering RNAs followed by transcriptome profiling using microarrays. The 59 BACH1 target genes identified by chromatin immunoprecipitation sequencing were found highly enriched in genes showing expression changes after BACH1 knockdown, demonstrating the impact of BACH1 repression on transcription. In addition to known and new BACH1 targets involved in heme degradation (HMOX1, FTL, FTH1, ME1, and SLC48A1) and redox regulation (GCLC, GCLM, and SLC7A11), we also discovered BACH1 target genes affecting cell cycle and apoptosis pathways (ITPR2, CALM1, SQSTM1, TFE3, EWSR1, CDK6, BCL2L11, and MAFG) as well as subcellular transport processes (CLSTN1, PSAP, MAPT, and vault RNA). The newly identified impact of BACH1 on genes involved in neurodegenerative processes and proliferation provides an interesting basis for future dissection of BACH1-mediated gene repression in neurodegeneration and virus-induced cancerogenesis.

The transcriptional regulatory network mediated by banana (Musa acuminata) dehydration-responsive element binding (MaDREB) transcription factors in fruit ripening.

PubMed

Kuang, Jian-Fei; Chen, Jian-Ye; Liu, Xun-Cheng; Han, Yan-Chao; Xiao, Yun-Yi; Shan, Wei; Tang, Yang; Wu, Ke-Qiang; He, Jun-Xian; Lu, Wang-Jin

2017-04-01

Fruit ripening is a complex, genetically programmed process involving the action of critical transcription factors (TFs). Despite the established significance of dehydration-responsive element binding (DREB) TFs in plant abiotic stress responses, the involvement of DREBs in fruit ripening is yet to be determined. Here, we identified four genes encoding ripening-regulated DREB TFs in banana (Musa acuminata), MaDREB1, MaDREB2, MaDREB3, and MaDREB4, and demonstrated that they play regulatory roles in fruit ripening. We showed that MaDREB1-MaDREB4 are nucleus-localized, induced by ethylene and encompass transcriptional activation activities. We performed a genome-wide chromatin immunoprecipitation and high-throughput sequencing (ChIP-Seq) experiment for MaDREB2 and identified 697 genomic regions as potential targets of MaDREB2. MaDREB2 binds to hundreds of loci with diverse functions and its binding sites are distributed in the promoter regions proximal to the transcriptional start site (TSS). Most of the MaDREB2-binding targets contain the conserved (A/G)CC(G/C)AC motif and MaDREB2 appears to directly regulate the expression of a number of genes involved in fruit ripening. In combination with transcriptome profiling (RNA sequencing) data, our results indicate that MaDREB2 may serve as both transcriptional activator and repressor during banana fruit ripening. In conclusion, our study suggests a hierarchical regulatory model of fruit ripening in banana and that the MaDREB TFs may act as transcriptional regulators in the regulatory network. © 2017 The Authors. New Phytologist © 2017 New Phytologist Trust.

Stress-Induced Transcriptional Regulation in the Developing Rat Brain Involves Increased Cyclic Adenosine 3′,5′-Monophosphate-Regulatory Element Binding Activity

PubMed Central

Hatalski, Carolyn G.; Baram, Tallie Z.

2012-01-01

The cAMP-regulatory element (CRE) binding protein (CREB) functions as a trans-acting regulator of genes containing the CRE sequence in their promoter. These include a number of critical genes, such as CRF, involved in the hypothalamic response to stressful stimuli in the adult. The ability of the developing rat (during the first 2 postnatal weeks) to mount the full complement of this stress response has been questioned. We have previously demonstrated the stress-induced up-regulation of the transcription of hypothalamic CRF during the second postnatal week in the rat. The focus of the current study was to explore the mechanism of transcriptional regulation in response to stress through the physiological induction of transcriptional trans-activators that bind to the CRE in the developing rat brain. CRE-binding activity was detected via gel shift analysis in extracts from both the hypothalamus and the cerebral cortex of the developing rat. CREB was identified in these extracts by Western blot analysis and was shown to be the major contributor to the CRE-binding activity by gel shift analysis with two specific antibodies directed against CREB. After acute hypothermic stress, the abundance of CRE-binding activity (but not of total immunoreactive CREB), increased in hypothalamic extracts. This enhanced CRE-binding activity was blocked by an antiserum directed against CREB and was accompanied by an apparent increase in CREB phosphorylation. These results indicate that posttranslational enhancement of CRE-binding activity is likely to constitute an important mechanism for up-regulation of genes possessing the CRE sequence in the developing rat hypothalamus by adverse external signals. PMID:9415405

TAR-independent transactivation by Tat in cells derived from the CNS: a novel mechanism of HIV-1 gene regulation.

PubMed Central

Taylor, J P; Pomerantz, R; Bagasra, O; Chowdhury, M; Rappaport, J; Khalili, K; Amini, S

1992-01-01

The Tat protein of human immunodeficiency virus type 1 (HIV-1) is essential for productive infection and is a potential target for antiviral therapy. Tat, a potent activator of HIV-1 gene expression, serves to greatly increase the rate of transcription directed by the viral promoter. This induction, which seems to be an important component in the progression of acquired immune deficiency syndrome (AIDS), may be due to increased transcriptional initiation, increased transcriptional elongation, or a combination of these processes. Much attention has been focused on the interaction of Tat with a specific RNA target termed TAR (transactivation responsive) which is present in the leader sequence of all HIV-1 mRNAs. This interaction is believed to be an important component of the mechanism of transactivation. In this report we demonstrate that in certain CNS-derived cells Tat is capable of activating HIV-1 through a TAR-independent pathway. A Tat-responsive element is found upstream within the viral promoter that in glial-derived cell lines allows transactivation in the absence of TAR. Deletion mapping and hybrid promoter constructs demonstrate that the newly identified Tat-responsive element corresponds to a sequence within the viral long terminal repeat (LTR) previously identified as the HIV-1 enhancer, or NF-kappa B domain. DNA band-shift analysis reveals NF-kappa B binding activity in glial cells that differs from that present in T lymphoid cells. Further, we observe that TAR-deleted mutants of HIV-1 demonstrate normal late gene expression in glial cells as evidenced by syncytia formation and production of viral p24 antigen.(ABSTRACT TRUNCATED AT 250 WORDS) Images PMID:1505523

A bacterial genome in transition - an exceptional enrichment of IS elements but lack of evidence for recent transposition in the symbiont Amoebophilus asiaticus

PubMed Central

2011-01-01

Background Insertion sequence (IS) elements are important mediators of genome plasticity and are widespread among bacterial and archaeal genomes. The 1.88 Mbp genome of the obligate intracellular amoeba symbiont Amoebophilus asiaticus contains an unusually large number of transposase genes (n = 354; 23% of all genes). Results The transposase genes in the A. asiaticus genome can be assigned to 16 different IS elements termed ISCaa1 to ISCaa16, which are represented by 2 to 24 full-length copies, respectively. Despite this high IS element load, the A. asiaticus genome displays a GC skew pattern typical for most bacterial genomes, indicating that no major rearrangements have occurred recently. Additionally, the high sequence divergence of some IS elements, the high number of truncated IS element copies (n = 143), as well as the absence of direct repeats in most IS elements suggest that the IS elements of A. asiaticus are transpositionally inactive. Although we could show transcription of 13 IS elements, we did not find experimental evidence for transpositional activity, corroborating our results from sequence analyses. However, we detected contiguous transcripts between IS elements and their downstream genes at nine loci in the A. asiaticus genome, indicating that some IS elements influence the transcription of downstream genes, some of which might be important for host cell interaction. Conclusions Taken together, the IS elements in the A. asiaticus genome are currently in the process of degradation and largely represent reflections of the evolutionary past of A. asiaticus in which its genome was shaped by their activity. PMID:21943072

Complete genetic analysis of plasmids carrying mcr-1 and other resistance genes in an Escherichia coli isolate of animal origin.

PubMed

Li, Ruichao; Xie, Miaomiao; Lv, Jingzhang; Wai-Chi Chan, Edward; Chen, Sheng

2017-03-01

To investigate the genetic features of three plasmids recovered from an MCR-1 and ESBL-producing Escherichia coli strain, HYEC7, and characterize the transmission mechanism of mcr-1 . The genetic profiles of three plasmids were determined by PCR, S1-PFGE, Southern hybridization and WGS analysis. The ability of the mcr-1 -bearing plasmid to undergo conjugation was also assessed. The mcr-1 -bearing transposon Tn 6330 was characterized by PCR and DNA sequencing. Complete sequences of three plasmids were obtained. A non-conjugative phage P7-like plasmid, pHYEC7- mcr1 , was found to harbour the mcr-1 -bearing transposon Tn 6330 , which could be excised from the plasmid by generating a circular intermediate harbouring mcr-1 and the IS Apl1 element. The insertion of the circular intermediate into another plasmid, pHYEC7-IncHI2, could form pHNSHP45-2, the original IncHI2-type mcr-1 -carrying plasmid that was reported. The third plasmid, pHYEC7-110, harboured two replicons, IncX1 and IncFIB, and comprised multiple antimicrobial resistance mobile elements, some of which were shared by pHYEC7-IncHI2. The Tn 6330 element located in the phage-like plasmid pHYEC7- mcr1 could be excised from the plasmid and formed a circular intermediate that could be integrated into plasmids containing the IS Apl1 element. This phenomenon indicated that Tn 6330 is a key element responsible for widespread dissemination of mcr-1 among various types of plasmids and bacterial chromosomes. The dissemination rate of such an element may be further enhanced upon translocation into phage-like vectors, which may also be transmitted via transduction events. © The Author 2016. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Cloning and functional analysis of 5'-upstream region of the Pokemon gene.

PubMed

Yang, Yutao; Zhou, Xiaowei; Zhu, Xudong; Zhang, Chuanfu; Yang, Zhixin; Xu, Long; Huang, Peitang

2008-04-01

Pokemon, the POK erythroid myeloid ontogenic factor, not only regulates the expression of many genes, but also plays an important role in cell tumorigenesis. To investigate the molecular mechanism regulating expression of the Pokemon gene in humans, its 5'-upstream region was cloned and analyzed. Transient analysis revealed that the Pokemon promoter is constitutive. Deletion analysis and a DNA decoy assay indicated that the NEG-U and NEG-D elements were involved in negative regulation of the Pokemon promoter, whereas the POS-D element was mainly responsible for its strong activity. Electrophoretic mobility shift assays suggested that the NEG-U, NEG-D and POS-D elements were specifically bound by the nuclear extract from A549 cells in vitro. Mutation analysis demonstrated that cooperation of the NEG-U and NEG-D elements led to negative regulation of the Pokemon promoter. Moreover, the NEG-U and NEG-D elements needed to be an appropriate distance apart in the Pokemon promoter in order to cooperate. Taken together, our results elucidate the mechanism underlying the regulation of Pokemon gene transcription, and also define a novel regulatory sequence that may be used to decrease expression of the Pokemon gene in cancer gene therapy.

The STAT3 HIES mutation is a gain-of-function mutation that activates genes via AGG-element carrying promoters.

PubMed

Xu, Li; Ji, Jin-Jun; Le, Wangping; Xu, Yan S; Dou, Dandan; Pan, Jieli; Jiao, Yifeng; Zhong, Tianfei; Wu, Dehong; Wang, Yumei; Wen, Chengping; Xie, Guan-Qun; Yao, Feng; Zhao, Heng; Fan, Yong-Sheng; Chin, Y Eugene

2015-10-15

Cytokine or growth factor activated STAT3 undergoes multiple post-translational modifications, dimerization and translocation into nuclei, where it binds to serum-inducible element (SIE, 'TTC(N3)GAA')-bearing promoters to activate transcription. The STAT3 DNA binding domain (DBD, 320-494) mutation in hyper immunoglobulin E syndrome (HIES), called the HIES mutation (R382Q, R382W or V463Δ), which elevates IgE synthesis, inhibits SIE binding activity and sensitizes genes such as TNF-α for expression. However, the mechanism by which the HIES mutation sensitizes STAT3 in gene induction remains elusive. Here, we report that STAT3 binds directly to the AGG-element with the consensus sequence 'AGG(N3)AGG'. Surprisingly, the helical N-terminal region (1-355), rather than the canonical STAT3 DBD, is responsible for AGG-element binding. The HIES mutation markedly enhances STAT3 AGG-element binding and AGG-promoter activation activity. Thus, STAT3 is a dual specificity transcription factor that promotes gene expression not only via SIE- but also AGG-promoter activity. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

Variation in a surface-exposed region of the Mycoplasma pneumoniae P40 protein as a consequence of homologous DNA recombination between RepMP5 elements.

PubMed

Spuesens, Emiel B M; van de Kreeke, Nick; Estevão, Silvia; Hoogenboezem, Theo; Sluijter, Marcel; Hartwig, Nico G; van Rossum, Annemarie M C; Vink, Cornelis

2011-02-01

Mycoplasma pneumoniae is a human pathogen that causes a range of respiratory tract infections. The first step in infection is adherence of the bacteria to the respiratory epithelium. This step is mediated by a specialized organelle, which contains several proteins (cytadhesins) that have an important function in adherence. Two of these cytadhesins, P40 and P90, represent the proteolytic products from a single 130 kDa protein precursor, which is encoded by the MPN142 gene. Interestingly, MPN142 contains a repetitive DNA element, termed RepMP5, of which homologues are found at seven other loci within the M. pneumoniae genome. It has been hypothesized that these RepMP5 elements, which are similar but not identical in sequence, recombine with their counterpart within MPN142 and thereby provide a source of sequence variation for this gene. As this variation may give rise to amino acid changes within P40 and P90, the recombination between RepMP5 elements may constitute the basis of antigenic variation and, possibly, immune evasion by M. pneumoniae. To investigate the sequence variation of MPN142 in relation to inter-RepMP5 recombination, we determined the sequences of all RepMP5 elements in a collection of 25 strains. The results indicate that: (i) inter-RepMP5 recombination events have occurred in seven of the strains, and (ii) putative RepMP5 recombination events involving MPN142 have induced amino acid changes in a surface-exposed part of the P40 protein in two of the strains. We conclude that recombination between RepMP5 elements is a common phenomenon that may lead to sequence variation of MPN142-encoded proteins.

Characterization of human glucocorticoid receptor complexes formed with DNA fragments containing or lacking glucocorticoid response elements

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tully, D.B.; Cidlowski, J.A.

1989-03-07

Sucrose density gradient shift assays were used to study the interactions of human glucocorticoid receptors (GR) with small DNA fragments either containing or lacking glucocorticoid response element (GRE) DNA consensus sequences. When crude cytoplasmic extracts containing ({sup 3}H)triamcinolone acetonide (({sup 3}H)TA) labeled GR were incubated with unlabeled DNA under conditions of DNA excess, a GRE-containing DNA fragment obtained from the 5' long terminal repeat of mouse mammary tumor virus (MMTV LTR) formed a stable 12-16S complex with activated, but not nonactivated, ({sup 3}H)TA receptor. By contrast, if the cytosols were treated with calf thymus DNA-cellulose to deplete non-GR-DNA-binding proteins priormore » to heat activation, a smaller 7-10S complex was formed with the MMTV LTR DNA fragment. Activated ({sup 3}H)TA receptor from DNA-cellulose pretreated cytosols also interacted with two similarly sized fragments from pBR322 DNA. Stability of the complexes formed between GR and these three DNA fragments was strongly affected by even moderate alterations in either the salt concentration or the pH of the gradient buffer. Under all conditions tested, the complex formed with the MMTV LTR DNA fragment was more stable than the complexes formed with either of the pBR322 DNA fragments. Together these observations indicate that the formation of stable complexes between activated GR and isolated DNA fragments requires the presence of GRE consensus sequences in the DNA.« less

A compact, in vivo screen of all 6-mers reveals drivers of tissue-specific expression and guides synthetic regulatory element design.

PubMed

Smith, Robin P; Riesenfeld, Samantha J; Holloway, Alisha K; Li, Qiang; Murphy, Karl K; Feliciano, Natalie M; Orecchia, Lorenzo; Oksenberg, Nir; Pollard, Katherine S; Ahituv, Nadav

2013-07-18

Large-scale annotation efforts have improved our ability to coarsely predict regulatory elements throughout vertebrate genomes. However, it is unclear how complex spatiotemporal patterns of gene expression driven by these elements emerge from the activity of short, transcription factor binding sequences. We describe a comprehensive promoter extension assay in which the regulatory potential of all 6 base-pair (bp) sequences was tested in the context of a minimal promoter. To enable this large-scale screen, we developed algorithms that use a reverse-complement aware decomposition of the de Bruijn graph to design a library of DNA oligomers incorporating every 6-bp sequence exactly once. Our library multiplexes all 4,096 unique 6-mers into 184 double-stranded 15-bp oligomers, which is sufficiently compact for in vivo testing. We injected each multiplexed construct into zebrafish embryos and scored GFP expression in 15 tissues at two developmental time points. Twenty-seven constructs produced consistent expression patterns, with the majority doing so in only one tissue. Functional sequences are enriched near biologically relevant genes, match motifs for developmental transcription factors, and are required for enhancer activity. By concatenating tissue-specific functional sequences, we generated completely synthetic enhancers for the notochord, epidermis, spinal cord, forebrain and otic lateral line, and show that short regulatory sequences do not always function modularly. This work introduces a unique in vivo catalog of short, functional regulatory sequences and demonstrates several important principles of regulatory element organization. Furthermore, we provide resources for designing compact, reverse-complement aware k-mer libraries.

A mobile element in mutS drives hypermutation in a marine Vibrio

DOE PAGES

Chu, Nathaniel D.; Clarke, Sean A.; Timberlake, Sonia; ...

2017-02-07

Bacteria face a trade-off between genetic fidelity, which reduces deleterious mistakes in the genome, and genetic innovation, which allows organisms to adapt. Evidence suggests that many bacteria balance this trade-off by modulating their mutation rates, but few mechanisms have been described for such modulation. Following experimental evolution and whole-genome resequencing of the marine bacterium Vibrio splendidus 12B01, we discovered one such mechanism, which allows this bacterium to switch to an elevated mutation rate. This switch is driven by the excision of a mobile element residing in mutS, which encodes a DNA mismatch repair protein. When integrated within the bacterial genome,more » the mobile element provides independent promoter and translation start sequences for mutS—different from the bacterium’s original mutS promoter region—which allow the bacterium to make a functional mutS gene product. Excision of this mobile element rejoins the mutS gene with host promoter and translation start sequences but leaves a 2-bp deletion in the mutS sequence, resulting in a frameshift and a hypermutator phenotype. We further identified hundreds of clinical and environmental bacteria across Betaproteobacteria and Gammaproteobacteria that possess putative mobile elements within the same amino acid motif in mutS. In a subset of these bacteria, we detected excision of the element but not a frameshift mutation; the mobile elements leave an intact mutS coding sequence after excision. Finally, our findings reveal a novel mechanism by which one bacterium alters its mutation rate and hint at a possible evolutionary role for mobile elements within mutS in other bacteria.« less

A mobile element in mutS drives hypermutation in a marine Vibrio

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chu, Nathaniel D.; Clarke, Sean A.; Timberlake, Sonia

Bacteria face a trade-off between genetic fidelity, which reduces deleterious mistakes in the genome, and genetic innovation, which allows organisms to adapt. Evidence suggests that many bacteria balance this trade-off by modulating their mutation rates, but few mechanisms have been described for such modulation. Following experimental evolution and whole-genome resequencing of the marine bacterium Vibrio splendidus 12B01, we discovered one such mechanism, which allows this bacterium to switch to an elevated mutation rate. This switch is driven by the excision of a mobile element residing in mutS, which encodes a DNA mismatch repair protein. When integrated within the bacterial genome,more » the mobile element provides independent promoter and translation start sequences for mutS—different from the bacterium’s original mutS promoter region—which allow the bacterium to make a functional mutS gene product. Excision of this mobile element rejoins the mutS gene with host promoter and translation start sequences but leaves a 2-bp deletion in the mutS sequence, resulting in a frameshift and a hypermutator phenotype. We further identified hundreds of clinical and environmental bacteria across Betaproteobacteria and Gammaproteobacteria that possess putative mobile elements within the same amino acid motif in mutS. In a subset of these bacteria, we detected excision of the element but not a frameshift mutation; the mobile elements leave an intact mutS coding sequence after excision. Finally, our findings reveal a novel mechanism by which one bacterium alters its mutation rate and hint at a possible evolutionary role for mobile elements within mutS in other bacteria.« less

LINE-1 Elements in Structural Variation and Disease

PubMed Central

Beck, Christine R.; Garcia-Perez, José Luis; Badge, Richard M.; Moran, John V.

2014-01-01

The completion of the human genome reference sequence ushered in a new era for the study and discovery of human transposable elements. It now is undeniable that transposable elements, historically dismissed as junk DNA, have had an instrumental role in sculpting the structure and function of our genomes. In particular, long interspersed element-1 (LINE-1 or L1) and short interspersed elements (SINEs) continue to affect our genome, and their movement can lead to sporadic cases of disease. Here, we briefly review the types of transposable elements present in the human genome and their mechanisms of mobility. We next highlight how advances in DNA sequencing and genomic technologies have enabled the discovery of novel retrotransposons in individual genomes. Finally, we discuss how L1-mediated retrotransposition events impact human genomes. PMID:21801021

Cell type-specific termination of transcription by transposable element sequences.

PubMed

Conley, Andrew B; Jordan, I King

2012-09-30

Transposable elements (TEs) encode sequences necessary for their own transposition, including signals required for the termination of transcription. TE sequences within the introns of human genes show an antisense orientation bias, which has been proposed to reflect selection against TE sequences in the sense orientation owing to their ability to terminate the transcription of host gene transcripts. While there is evidence in support of this model for some elements, the extent to which TE sequences actually terminate transcription of human gene across the genome remains an open question. Using high-throughput sequencing data, we have characterized over 9,000 distinct TE-derived sequences that provide transcription termination sites for 5,747 human genes across eight different cell types. Rarefaction curve analysis suggests that there may be twice as many TE-derived termination sites (TE-TTS) genome-wide among all human cell types. The local chromatin environment for these TE-TTS is similar to that seen for 3' UTR canonical TTS and distinct from the chromatin environment of other intragenic TE sequences. However, those TE-TTS located within the introns of human genes were found to be far more cell type-specific than the canonical TTS. TE-TTS were much more likely to be found in the sense orientation than other intragenic TE sequences of the same TE family and TE-TTS in the sense orientation terminate transcription more efficiently than those found in the antisense orientation. Alu sequences were found to provide a large number of relatively weak TTS, whereas LTR elements provided a smaller number of much stronger TTS. TE sequences provide numerous termination sites to human genes, and TE-derived TTS are particularly cell type-specific. Thus, TE sequences provide a powerful mechanism for the diversification of transcriptional profiles between cell types and among evolutionary lineages, since most TE-TTS are evolutionarily young. The extent of transcription termination by TEs seen here, along with the preference for sense-oriented TE insertions to provide TTS, is consistent with the observed antisense orientation bias of human TEs.

Genomic sequences of murine gamma B- and gamma C-crystallin-encoding genes: promoter analysis and complete evolutionary pattern of mouse, rat and human gamma-crystallins.

PubMed

Graw, J; Liebstein, A; Pietrowski, D; Schmitt-John, T; Werner, T

1993-12-22

The murine genes, gamma B-cry and gamma C-cry, encoding the gamma B- and gamma C-crystallins, were isolated from a genomic DNA library. The complete nucleotide (nt) sequences of both genes were determined from 661 and 711 bp, respectively, upstream from the first exon to the corresponding polyadenylation sites, comprising more than 2650 and 2890 bp, respectively. The new sequences were compared to the partial cDNA sequences available for the murine gamma B-cry and gamma C-cry, as well as to the corresponding genomic sequences from rat and man, at both the nt and predicted amino acid (aa) sequence levels. In the gamma B-cry promoter region, a canonical CCAAT-box, a TATA-box, putative NF-I and C/EBP sites were detected. An R-repeat is inserted 366 bp upstream from the transcription start point. In contrast, the gamma C-cry promoter does not contain a CCAAT-box, but some other putative binding sites for transcription factors (AP-2, UBP-1, LBP-1) were located by computer analysis. The promoter regions of all six gamma-cry from mouse, rat and human, except human psi gamma F-cry, were analyzed for common sequence elements. A complex sequence element of about 70-80 bp was found in the proximal promoter, which contains a gamma-cry-specific and almost invariant sequence (crygpel) of 14 nt, and ends with the also invariant TATA-box. Within the complex sequence element, a minimum of three further features specific for the gamma A-, gamma B- and gamma D/E/F-cry genes can be defined, at least two of which were recently shown to be functional. In addition to these four sequence elements, a subtype-specific structure of inverted repeats with different-sized spacers can be deduced from the multiple sequence alignment. A phylogenetic analysis based on the promoter region, as well as the complete exon 3 of all gamma-cry from mouse, rat and man, suggests separation of only five gamma-cry subtypes (gamma A-, gamma B-, gamma C-, gamma D- and gamma E/F-cry) prior to species separation.

Induction of chinook salmon growth hormone promoter activity by the adenosine 3',5'-monophosphate (cAMP)-dependent pathway involves two cAMP-response elements with the CGTCA motif and the pituitary-specific transcription factor Pit-1.

PubMed

Wong, A O; Le Drean, Y; Liu, D; Hu, Z Z; Du, S J; Hew, C L

1996-05-01

In this study, the functional role of two cAMP-response elements (CRE) in the promoter of the chinook salmon GH gene and their interactions with the transcription factor Pit-1 in regulating GH gene expression were examined. A chimeric construct of the chloramphenicol acetyltransferase (CAT) reporter gene with the CRE-containing GH promoter (pGH.CAT) was transiently transfected into primary cultures of rainbow trout pituitary cells. The expression of CAT activity was stimulated by an adenylate cyclase activator forskolin as well as a membrane-permeant cAMP analog 8-bromo-cAMP. Furthermore, these stimulatory responses were inhibited by a protein kinase A inhibitor H89, suggesting that these CREs are functionally coupled to the adenylate cyclase-cAMP-protein kinase A cascade. This hypothesis is supported by parallel studies using GH4ZR7 cells, a rat pituitary cell line stably transfected with dopamine D2 receptors. In this cell line, D2 receptor activation is known to inhibit adenylate cyclase activity and cAMP synthesis. Stimulation with a nonselective dopamine agonist, apomorphine, or a D2-specific agonist, Ly171555, suppressed the expression of pGH.CAT in GH4ZR7 cells, and this inhibition was blocked by simultaneous treatment with forskolin. These results indicate that inhibition of the cAMP-dependent pathway reduces the basal promoter activity of the CRE-containing pGH.CAT. The functionality of these CREs was further confirmed by deletion analysis and site-specific mutagenesis. In trout pituitary cells, the cAMP inducibility of pGH.CAT was inhibited after deleting the CRE-containing sequence from the GH promoter. When the CRE-containing sequence was cloned into a CAT construct with a viral thymidine kinase promoter, a significant elevation of cAMP inducibility was observed. This stimulatory response, however, was abolished by mutating the core sequence, CGTCA, in these CREs, suggesting that these cis-acting elements confer cAMP inducibility to the salmon GH gene. The interactions between CREs and the transcription factor Pit-1 in mediating GH gene expression were also examined. In HeLa cells, a human cervical cancer cell line deficient in Pit-1, both basal and cAMP-induced expression of pGH.CAT were apparent only with the cotransfection of a Pit-1 expression vector. These results taken together indicate that the two CREs in the chinook salmon GH gene are functionally associated with the cAMP-dependent pathway and that their promoter activity is dependent on the presence of Pit-1

FB-NOF is a non-autonomous transposable element, expressed in Drosophila melanogaster and present only in the melanogaster group.

PubMed

Badal, Martí; Xamena, Noel; Cabré, Oriol

2013-09-10

Most foldback elements are defective due to the lack of coding sequences but some are associated with coding sequences and may represent the entire element. This is the case of the NOF sequences found in the FB of Drosophila melanogaster, formerly considered as an autonomous TE and currently proposed as part of the so-called FB-NOF element, the transposon that would be complete and fully functional. NOF is always associated with FB and never seen apart from the FB inverted repeats (IR). This is the reason why the FB-NOF composite element can be considered the complete element. At least one of its ORFs encodes a protein that has always been considered its transposase, but no detailed studies have been carried out to verify this. In this work we test the hypothesis that FB-NOF is an active transposon nowadays. We search for its expression product, obtaining its cDNA, and propose the ORF and the sequence of its potential protein. We found that the NOF protein is not a transposase as it lacks any of the motifs of known transposases and also shows structural homology with hydrolases, therefore FB-NOF cannot belong to the superfamily MuDR/foldback, as up to now it has been classified, and can be considered as a non-autonomous transposable element. The alignment with the published genomes of 12 Drosophila species shows that NOF presence is restricted only to the 6 Drosophila species belonging to the melanogaster group. Copyright © 2013 Elsevier B.V. All rights reserved.

Transposon-like properties of the major, long repetitive sequence family in the genome of Physarum polycephalum

PubMed Central

Pearston, Douglas H.; Gordon, Mairi; Hardman, Norman

1985-01-01

A family of long, highly-repetitive sequences, referred to previously as `HpaII-repeats', dominates the genome of the eukaryotic slime mould Physarum polycephalum. These sequences are found exclusively in scrambled clusters. They account for about one-half of the total complement of repetitive DNA in Physarum, and represent the major sequence component found in hypermethylated, 20-50 kb segments of Physarum genomic DNA that fail to be cleaved using the restriction endonuclease HpaII. The structure of this abundant repetitive element was investigated by analysing cloned segments derived from the hypermethylated genomic DNA compartment. We show that the `HpaII-repeat' forms part of a larger repetitive DNA structure, ∼8.6 kb in length, with several structural features in common with recognised eukaryotic transposable genetic elements. Scrambled clusters of the sequence probably arise as a result of transposition-like events, during which the element preferentially recombines in either orientation with target sites located in other copies of the same repeated sequence. The target sites for transposition/recombination are not related in sequence but in all cases studied they are potentially capable of promoting the formation of small `cruciforms' or `Z-DNA' structures which might be recognised during the recombination process. ImagesFig. 3.Fig. 4. PMID:16453652

Animal vocal sequences: not the Markov chains we thought they were

PubMed Central

Kershenbaum, Arik; Bowles, Ann E.; Freeberg, Todd M.; Jin, Dezhe Z.; Lameira, Adriano R.; Bohn, Kirsten

2014-01-01

Many animals produce vocal sequences that appear complex. Most researchers assume that these sequences are well characterized as Markov chains (i.e. that the probability of a particular vocal element can be calculated from the history of only a finite number of preceding elements). However, this assumption has never been explicitly tested. Furthermore, it is unclear how language could evolve in a single step from a Markovian origin, as is frequently assumed, as no intermediate forms have been found between animal communication and human language. Here, we assess whether animal taxa produce vocal sequences that are better described by Markov chains, or by non-Markovian dynamics such as the ‘renewal process’ (RP), characterized by a strong tendency to repeat elements. We examined vocal sequences of seven taxa: Bengalese finches Lonchura striata domestica, Carolina chickadees Poecile carolinensis, free-tailed bats Tadarida brasiliensis, rock hyraxes Procavia capensis, pilot whales Globicephala macrorhynchus, killer whales Orcinus orca and orangutans Pongo spp. The vocal systems of most of these species are more consistent with a non-Markovian RP than with the Markovian models traditionally assumed. Our data suggest that non-Markovian vocal sequences may be more common than Markov sequences, which must be taken into account when evaluating alternative hypotheses for the evolution of signalling complexity, and perhaps human language origins. PMID:25143037

Primate-Specific Evolution of an LDLR Enhancer

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wang, Qian-fei; Prabhakar, Shyam; Wang, Qianben

2006-06-28

Sequence changes in regulatory regions have often beeninvoked to explain phenotypic divergence among species, but molecularexamples of this have been difficult to obtain. In this study, weidentified an anthropoid primate specific sequence element thatcontributed to the regulatory evolution of the LDL receptor. Using acombination of close and distant species genomic sequence comparisonscoupled with in vivo and in vitro studies, we show that a functionalcholesterol-sensing sequence motif arose and was fixed within apre-existing enhancer in the common ancestor of anthropoid primates. Ourstudy demonstrates one molecular mechanism by which ancestral mammalianregulatory elements can evolve to perform new functions in the primatelineage leadingmore » to human.« less

Rat prostatic steroid binding protein: DNA sequence and transcript maps of the two C3 genes.

PubMed Central

Hurst, H C; Parker, M G

1983-01-01

In the rat there are two non-allelic genes C3(1) and C3(2) for the C3 polypeptide of prostatic steroid binding protein. We have cloned and sequenced both genes and show that only C3(1) is responsible for the production of authentic C3. Although there is a marked difference in their transcriptional activity, the two genes share extensive DNA sequence homology there being only one base difference from nucleotide - 235 to within the first intron. Transcript mapping has shown that there are two distinct C3 transcripts which share a unique 3' terminus but have 5' termini 38 bases apart each preceded by a 'TATA' box homology. Interestingly, an identical repetitive element is present just upstream of both genes. Both families of transcripts, which are produced in a ratio of 18:1, are coordinately regulated by testosterone. Images Fig. 3. Fig. 4. Fig. 5. PMID:6685625

Cloning and characterization of a tuberous root-specific promoter from cassava (Manihot esculenta Crantz).

PubMed

Koehorst-van Putten, Herma J J; Wolters, Anne-Marie A; Pereira-Bertram, Isolde M; van den Berg, Hans H J; van der Krol, Alexander R; Visser, Richard G F

2012-12-01

In order to obtain a tuberous root-specific promoter to be used in the transformation of cassava, a 1,728 bp sequence containing the cassava granule-bound starch synthase (GBSSI) promoter was isolated. The sequence proved to contain light- and sugar-responsive cis elements. Part of this sequence (1,167 bp) was cloned into binary vectors to drive expression of the firefly luciferase gene. Cassava cultivar Adira 4 was transformed with this construct or a control construct in which the luciferase gene was cloned behind the 35S promoter. Luciferase activity was measured in leaves, stems, roots and tuberous roots. As expected, the 35S promoter induced luciferase activity in all organs at similar levels, whereas the GBSSI promoter showed very low expression in leaves, stems and roots, but very high expression in tuberous roots. These results show that the cassava GBSSI promoter is an excellent candidate to achieve tuberous root-specific expression in cassava.

Integrating a New Medicinal Chemistry and Pharmacology Course Sequence into the PharmD Curriculum

PubMed Central

Engels, Melanie; Garcia, George

2015-01-01

Objective. To evaluate the implementation of an integrated medicinal chemistry/pharmacology course sequence and its alignment with a therapeutics series. Design. Each topic was divided into modules consisting of 2-hour blocks, and the content was integrated and aligned with the therapeutics series. Recitation sessions emphasizing application skills in an interactive environment followed each of three 2-hour blocks. To ensure that students achieved competency in each unit, students failing any unit examination were encouraged to undergo remediation. Assessment. Student feedback was collected by an independent researcher through social media and focus groups and relayed anonymously to course directors for midcourse improvements. Responses from surveys, interviews, and student ratings of faculty members and of courses were used to implement changes for future editions of the courses. Conclusion. The majority of students and faculty members felt the integration and alignment processes were beneficial changes to the curriculum. Elements of the new sequence, including remediation, were viewed positively by students and faculty members as well. PMID:25741029

Flexible and polarization-controllable diffusion metasurface with optical transparency

NASA Astrophysics Data System (ADS)

Zhuang, Yaqiang; Wang, Guangming; Liang, Jiangang; Cai, Tong; Guo, Wenlong; Zhang, Qingfeng

2017-11-01

In this paper, a novel coding metasurface is proposed to realize polarization-controllable diffusion scattering. The anisotropic Jerusalem-cross unit cell is employed as the basic coding element due to its polarization-dependent phase response. The isotropic random coding sequence is firstly designed to obtain diffusion scattering, and the anisotropic random coding sequence is subsequently realized by adding different periodic coding sequences to the original isotropic one along different directions. For demonstration, we designed and fabricated a flexible polarization-controllable diffusion metasurface (PCDM) with both chessboard diffusion and hedge diffusion under different polarizations. The specular scattering reduction performance of the anisotropic metasurface is better than the isotropic one because the scattered energies are redirected away from the specular reflection direction. For potential applications, the flexible PCDM wrapped around a cylinder structure is investigated and tested for polarization-controllable diffusion scattering. The numerical and experimental results coincide well, indicating anisotropic low scatterings with comparable performances. This paper provides an alternative approach for designing high-performance, flexible, low-scattering platforms.

A proposed model for the flowering signaling pathway of sugarcane under photoperiodic control.

PubMed

Coelho, C P; Costa Netto, A P; Colasanti, J; Chalfun-Júnior, A

2013-04-25

Molecular analysis of floral induction in Arabidopsis has identified several flowering time genes related to 4 response networks defined by the autonomous, gibberellin, photoperiod, and vernalization pathways. Although grass flowering processes include ancestral functions shared by both mono- and dicots, they have developed their own mechanisms to transmit floral induction signals. Despite its high production capacity and its important role in biofuel production, almost no information is available about the flowering process in sugarcane. We searched the Sugarcane Expressed Sequence Tags database to look for elements of the flowering signaling pathway under photoperiodic control. Sequences showing significant similarity to flowering time genes of other species were clustered, annotated, and analyzed for conserved domains. Multiple alignments comparing the sequences found in the sugarcane database and those from other species were performed and their phylogenetic relationship assessed using the MEGA 4.0 software. Electronic Northerns were run with Cluster and TreeView programs, allowing us to identify putative members of the photoperiod-controlled flowering pathway of sugarcane.

Elements of Mathematics, Book O: Intuitive Background. Chapter 14, Geometry: Similitudes, Coordinates, and Trigonometry.

ERIC Educational Resources Information Center

Exner, Robert; And Others

The sixteen chapters of this book provide the core material for the Elements of Mathematics Program, a secondary sequence developed for highly motivated students with strong verbal abilities. The sequence is based on a functional-relational approach to mathematics teaching, and emphasizes teaching by analysis of real-life situations. This text is…

The Spiralled Sequence Story Curriculum: A Structuralist Approach to Teaching Fiction in the Elementary Grades.

ERIC Educational Resources Information Center

Stott, Jon C.

1987-01-01

Suggests that children, even in early elementary grades, can grasp basic elements of children's literature using a spiralled sequence story curriculum, which helps them examine types of character, such as the trickster; elements of plot, such as the journey; and generally see patterns in the stories they read. (JC)

Transcription Factor CBF4 Is a Regulator of Drought Adaptation in Arabidopsis1

PubMed Central

Haake, Volker; Cook, Daniel; Riechmann, José Luis; Pineda, Omaira; Thomashow, Michael F.; Zhang, James Z.

2002-01-01

In plants, low temperature and dehydration activate a set of genes containing C-repeat/dehydration-responsive elements in their promoter. It has been shown previously that the Arabidopsis CBF/DREB1 transcription activators are critical regulators of gene expression in the signal transduction of cold acclimation. Here, we report the isolation of an apparent homolog of the CBF/DREB1 proteins (CBF4) that plays the equivalent role during drought adaptation. In contrast to the three already identified CBF/DREB1 homologs, which are induced under cold stress, CBF4 gene expression is up-regulated by drought stress, but not by low temperature. Overexpression of CBF4 in transgenic Arabidopsis plants results in the activation of C-repeat/dehydration-responsive element containing downstream genes that are involved in cold acclimation and drought adaptation. As a result, the transgenic plants are more tolerant to freezing and drought stress. Because of the physiological similarity between freezing and drought stress, and the sequence and structural similarity of the CBF/DREB1 and the CBF4 proteins, we propose that the plant's response to cold and drought evolved from a common CBF-like transcription factor, first through gene duplication and then through promoter evolution. PMID:12376631

FAST - FREEDOM ASSEMBLY SEQUENCING TOOL PROTOTYPE

NASA Technical Reports Server (NTRS)

Borden, C. S.

1994-01-01

FAST is a project management tool designed to optimize the assembly sequence of Space Station Freedom. An appropriate assembly sequence coordinates engineering, design, utilization, transportation availability, and operations requirements. Since complex designs tend to change frequently, FAST assesses the system level effects of detailed changes and produces output metrics that identify preferred assembly sequences. FAST incorporates Space Shuttle integration, Space Station hardware, on-orbit operations, and programmatic drivers as either precedence relations or numerical data. Hardware sequencing information can either be input directly and evaluated via the "specified" mode of operation or evaluated from the input precedence relations in the "flexible" mode. In the specified mode, FAST takes as its input a list of the cargo elements assigned to each flight. The program determines positions for the cargo elements that maximize the center of gravity (c.g.) margin. These positions are restricted by the geometry of the cargo elements and the location of attachment fittings both in the orbiter and on the cargo elements. FAST calculates every permutation of cargo element location according to its height, trunnion fitting locations, and required intercargo element spacing. Each cargo element is tested in both its normal and reversed orientation (rotated 180 degrees). The best solution is that which maximizes the c.g. margin for each flight. In the flexible mode, FAST begins with the first flight and determines all feasible combinations of cargo elements according to mass, volume, EVA, and precedence relation constraints. The program generates an assembly sequence that meets mass, volume, position, EVA, and precedence constraints while minimizing the total number of Shuttle flights required. Issues associated with ground operations, spacecraft performance, logistics requirements and user requirements will be addressed in future versions of the model. FAST is written in C-Language and has been implemented on DEC VAX series computers running VMS. The program is distributed in executable form. The source code is also provided, but it cannot be compiled without the Tree Manipulation Based Routines (TMBR) package from the Jet Propulsion Laboratory, which is not currently available from COSMIC. The main memory requirement is based on the data used to drive the FAST program. All applications should easily run on an installation with 10Mb of main memory. FAST was developed in 1990 and is a copyrighted work with all copyright vested in NASA. DEC, VAX and VMS are trademarks of Digital Equipment Corporation.

Sequence information signal processor for local and global string comparisons

DOEpatents

Peterson, John C.; Chow, Edward T.; Waterman, Michael S.; Hunkapillar, Timothy J.

1997-01-01

A sequence information signal processing integrated circuit chip designed to perform high speed calculation of a dynamic programming algorithm based upon the algorithm defined by Waterman and Smith. The signal processing chip of the present invention is designed to be a building block of a linear systolic array, the performance of which can be increased by connecting additional sequence information signal processing chips to the array. The chip provides a high speed, low cost linear array processor that can locate highly similar global sequences or segments thereof such as contiguous subsequences from two different DNA or protein sequences. The chip is implemented in a preferred embodiment using CMOS VLSI technology to provide the equivalent of about 400,000 transistors or 100,000 gates. Each chip provides 16 processing elements, and is designed to provide 16 bit, two's compliment operation for maximum score precision of between -32,768 and +32,767. It is designed to provide a comparison between sequences as long as 4,194,304 elements without external software and between sequences of unlimited numbers of elements with the aid of external software. Each sequence can be assigned different deletion and insertion weight functions. Each processor is provided with a similarity measure device which is independently variable. Thus, each processor can contribute to maximum value score calculation using a different similarity measure.

Sexual responsiveness in women with spinal cord injuries: differential effects of anxiety-eliciting stimulation.

PubMed

Sipski, Marca L; Rosen, Raymond C; Alexander, Craig J; Gómez-Marín, Orlando

2004-06-01

Sexual dysfunction is a common problem in women after spinal cord injuries (SCIs). Recently, the use of anxiety-provoking stimulation has been explored as a means of improving sexual responses in able-bodied sexually functional and dysfunctional women. In this laboratory-based study, we assessed the sexual and autonomic responses of women with SCIs with varying degrees of preservation of sympathetic innervation to their genitals to respond to anxiety-provoking audiovisual (AV) stimulation. Subjects were 45 women with SCIs and 11 able-bodied women. For purposes of analysis, SCI subjects were grouped on the basis of the degree of preservation of sensation in the T11-L2 dermatomes. Results revealed that women with low sensory scores in these dermatomes achieved higher vaginal pulse amplitude (VPA) responses to audiovisual erotic stimulation after anxiety preexposure than after neutral preexposure; however, women with SCIs and the greatest degree of preservation of sensory function in the T11-L2 dermatomes, as well as able-bodied controls, did not. Moreover, these same 2 groups of subjects had a decrease in VPA responses during baseline periods in which an anxiety-provoking video sequence was shown, but not during the neutral sequence. It is concluded that these findings are due to the proximity of sensory and autonomic neurologic elements in the spinal cord. Moreover, they demonstrate the differential effects of sympathetic stimulation on genital sexual arousal.

Flying Cassini with Virtual Operations Teams

NASA Technical Reports Server (NTRS)

Dodd, Suzanne; Gustavson, Robert

1998-01-01

The Cassini Program's challenge is to fly a large, complex mission with a reduced operations budget. A consequence of the reduced budget is elimination of the large, centrally located group traditionally used for uplink operations. Instead, responsibility for completing parts of the uplink function is distributed throughout the Program. A critical strategy employed to handle this challenge is the use of Virtual Uplink Operations Teams. A Virtual Team is comprised of a group of people with the necessary mix of engineering and science expertise who come together for the purpose of building a specific uplink product. These people are drawn from throughout the Cassini Program and participate across a large geographical area (from Germany to the West coast of the USA), covering ten time zones. The participants will often split their time between participating in the Virtual Team and accomplishing their core responsibilities, requiring significant planning and time management. When the particular uplink product task is complete, the Virtual Team disbands and the members turn back to their home organization element for future work assignments. This time-sharing of employees is used on Cassini to build mission planning products, via the Mission Planning Virtual Team, and sequencing products and monitoring of the sequence execution, via the Sequence Virtual Team. This challenging, multitasking approach allows efficient use of personnel in a resource constrained environment.

Reverted glutathione S-transferase-like genes that influence flower color intensity of carnation (Dianthus caryophyllus L.) originated from excision of a transposable element

PubMed Central

Momose, Masaki; Itoh, Yoshio; Umemoto, Naoyuki; Nakayama, Masayoshi; Ozeki, Yoshihiro

2013-01-01

A glutathione S-transferase-like gene, DcGSTF2, is responsible for carnation (Dianthus caryophyllus L.) flower color intensity. Two defective genes, DcGSTF2mu with a nonsense mutation and DcGSTF2-dTac1 containing a transposable element dTac1, have been characterized in detail in this report. dTac1 is an active element that produces reverted functional genes by excision of the element. A pale-pink cultivar ‘Daisy’ carries both defective genes, whereas a spontaneous deep-colored mutant ‘Daisy-VPR’ lost the element from DcGSTF2-dTac1. This finding confirmed that dTac1 is active and that the resulting reverted gene, DcGSTF2rev1, missing the element is responsible for this color change. Crosses between the pale-colored cultivar ‘06-LA’ and a deep-colored cultivar ‘Spectrum’ produced segregating progeny. Only the deep-colored progeny had DcGSTF2rev2 derived from the ‘Spectrum’ parent, whereas progeny with pale-colored flowers had defective forms from both parents, DcGSTF2mu and DcGSTF2-dTac1. Thus, DcGSTF2rev2 had functional activity and likely originated from excision of dTac1 since there was a footprint sequence at the vacated site of the dTac1 insertion. Characterizing the DcGSTF2 genes in several cultivars revealed that the two functional genes, DcGSTF2rev1 and DcGSTF2rev2, have been used for some time in carnation breeding with the latter in use for more than half a century. PMID:24399917

Reverted glutathione S-transferase-like genes that influence flower color intensity of carnation (Dianthus caryophyllus L.) originated from excision of a transposable element.

PubMed

Momose, Masaki; Itoh, Yoshio; Umemoto, Naoyuki; Nakayama, Masayoshi; Ozeki, Yoshihiro

2013-12-01

A glutathione S-transferase-like gene, DcGSTF2, is responsible for carnation (Dianthus caryophyllus L.) flower color intensity. Two defective genes, DcGSTF2mu with a nonsense mutation and DcGSTF2-dTac1 containing a transposable element dTac1, have been characterized in detail in this report. dTac1 is an active element that produces reverted functional genes by excision of the element. A pale-pink cultivar 'Daisy' carries both defective genes, whereas a spontaneous deep-colored mutant 'Daisy-VPR' lost the element from DcGSTF2-dTac1. This finding confirmed that dTac1 is active and that the resulting reverted gene, DcGSTF2rev1, missing the element is responsible for this color change. Crosses between the pale-colored cultivar '06-LA' and a deep-colored cultivar 'Spectrum' produced segregating progeny. Only the deep-colored progeny had DcGSTF2rev2 derived from the 'Spectrum' parent, whereas progeny with pale-colored flowers had defective forms from both parents, DcGSTF2mu and DcGSTF2-dTac1. Thus, DcGSTF2rev2 had functional activity and likely originated from excision of dTac1 since there was a footprint sequence at the vacated site of the dTac1 insertion. Characterizing the DcGSTF2 genes in several cultivars revealed that the two functional genes, DcGSTF2rev1 and DcGSTF2rev2, have been used for some time in carnation breeding with the latter in use for more than half a century.

Mutational studies reveal a complex set of positive and negative control elements within the chicken vitellogenin II promoter.

PubMed

Seal, S N; Davis, D L; Burch, J B

1991-05-01

The endogenous chicken vitellogenin II (VTGII) gene is transcribed exclusively in hepatocytes in response to estrogen. We previously identified two estrogen response elements (EREs) upstream of this gene. We now present an analysis of the VTGII promoter activated by these EREs in response to estrogen. Chimeric VTGII-CAT genes were cotransfected into LMH chicken hepatoma cells along with an estrogen receptor expression vector, and transient CAT expression was assayed after culturing the cells in the absence or presence of estrogen. An analysis of constructs bearing deletions downstream of the more proximal ERE indicated that promoter elements relevant to transcription in LMH cells extend to between -113 and -96. The relative importance of sequences within the VTGII promoter was examined by using 10 contiguous linker scanner mutations spanning the region from -117 to -24. Although most of these mutations compromised VTGII promoter function, one dramatically increased expression in LMH cells and also rendered the VTGII promoter capable of being activated by cis-linked EREs in fibroblasts cotransfected with an estrogen receptor expression vector. Gel retardation and DNase I footprinting assays revealed four factor-binding sites within this promoter. We demonstrate that three of these sites bind C/EBP, SP1, and USF (or related factors), respectively; the fourth site binds a factor that we denote TF-V beta. The biological relevance of these findings is suggested by the fact that three of these binding sites map to sites previously shown to be occupied in vivo in response to estrogen.

Billions of basepairs of recently expanded, repetitive sequences are eliminated from the somatic genome during copepod development.

PubMed

Sun, Cheng; Wyngaard, Grace; Walton, D Brian; Wichman, Holly A; Mueller, Rachel Lockridge

2014-03-11

Chromatin diminution is the programmed deletion of DNA from presomatic cell or nuclear lineages during development, producing single organisms that contain two different nuclear genomes. Phylogenetically diverse taxa undergo chromatin diminution--some ciliates, nematodes, copepods, and vertebrates. In cyclopoid copepods, chromatin diminution occurs in taxa with massively expanded germline genomes; depending on species, germline genome sizes range from 15 - 75 Gb, 12-74 Gb of which are lost from pre-somatic cell lineages at germline--soma differentiation. This is more than an order of magnitude more sequence than is lost from other taxa. To date, the sequences excised from copepods have not been analyzed using large-scale genomic datasets, and the processes underlying germline genomic gigantism in this clade, as well as the functional significance of chromatin diminution, have remained unknown. Here, we used high-throughput genomic sequencing and qPCR to characterize the germline and somatic genomes of Mesocyclops edax, a freshwater cyclopoid copepod with a germline genome of ~15 Gb and a somatic genome of ~3 Gb. We show that most of the excised DNA consists of repetitive sequences that are either 1) verifiable transposable elements (TEs), or 2) non-simple repeats of likely TE origin. Repeat elements in both genomes are skewed towards younger (i.e. less divergent) elements. Excised DNA is a non-random sample of the germline repeat element landscape; younger elements, and high frequency DNA transposons and LINEs, are disproportionately eliminated from the somatic genome. Our results suggest that germline genome expansion in M. edax reflects explosive repeat element proliferation, and that billions of base pairs of such repeats are deleted from the somatic genome every generation. Thus, we hypothesize that chromatin diminution is a mechanism that controls repeat element load, and that this load can evolve to be divergent between tissue types within single organisms.

Billions of basepairs of recently expanded, repetitive sequences are eliminated from the somatic genome during copepod development

PubMed Central

2014-01-01

Background Chromatin diminution is the programmed deletion of DNA from presomatic cell or nuclear lineages during development, producing single organisms that contain two different nuclear genomes. Phylogenetically diverse taxa undergo chromatin diminution — some ciliates, nematodes, copepods, and vertebrates. In cyclopoid copepods, chromatin diminution occurs in taxa with massively expanded germline genomes; depending on species, germline genome sizes range from 15 – 75 Gb, 12–74 Gb of which are lost from pre-somatic cell lineages at germline – soma differentiation. This is more than an order of magnitude more sequence than is lost from other taxa. To date, the sequences excised from copepods have not been analyzed using large-scale genomic datasets, and the processes underlying germline genomic gigantism in this clade, as well as the functional significance of chromatin diminution, have remained unknown. Results Here, we used high-throughput genomic sequencing and qPCR to characterize the germline and somatic genomes of Mesocyclops edax, a freshwater cyclopoid copepod with a germline genome of ~15 Gb and a somatic genome of ~3 Gb. We show that most of the excised DNA consists of repetitive sequences that are either 1) verifiable transposable elements (TEs), or 2) non-simple repeats of likely TE origin. Repeat elements in both genomes are skewed towards younger (i.e. less divergent) elements. Excised DNA is a non-random sample of the germline repeat element landscape; younger elements, and high frequency DNA transposons and LINEs, are disproportionately eliminated from the somatic genome. Conclusions Our results suggest that germline genome expansion in M. edax reflects explosive repeat element proliferation, and that billions of base pairs of such repeats are deleted from the somatic genome every generation. Thus, we hypothesize that chromatin diminution is a mechanism that controls repeat element load, and that this load can evolve to be divergent between tissue types within single organisms. PMID:24618421

Characterisation of IS153, an IS3-family insertion sequence isolated from Lactobacillus sanfranciscensis and its use for strain differentiation.

PubMed

Ehrmann, M A; Vogel, R E

2001-11-01

An insertion sequence has been identified in the genome of Lactobacillus sanfranciscensis DSM 20451T as segment of 1351 nucleotides containing 37-bp imperfect terminal inverted repeats. The sequence of this element encodes two out of phase, overlapping open reading frames, orfA and orfB, from which three putative proteins are produced. OrfAB is a transframe protein produced by -1 translational frame shifting between orf A and orf B that is presumed to be the transposase. The large orfAB of this element encodes a 342 amino acid protein that displays similarities with transposases encoded by bacterial insertion sequences belonging to the IS3 family. In L. sanfranciscensis type strain DSM 20451T multiple truncated IS elements were identified. Inverse PCR was used to analyze target sites of four of these elements, but except of their highly AT rich character not any sequence specificity was identified so far. Moreover, no flanking direct repeats were identified. Multiple copies of IS153 were detected by hybridization in other strains of L. sanfranciscensis. Resulting hybridization patterns were shown to differentiate between organisms at strain level rather than a probe targeted against the 16S rDNA. With a PCR based approach IS153 or highly similar sequences were detected in L. acidophilus, L. casei, L. malefermentans, L. plantarum, L. hilgardii, L. collinoides L. farciminis L. sakei and L. salivarius, L. reuteri as well as in Enterococcus faecium, Pediococcus acidilactici and P. pentosaceus.

The Role of CRISPR-Cas Systems in Virulence of Pathogenic Bacteria

PubMed Central

Staals, Raymond H. J.; Endtz, Hubert P.; van Baarlen, Peter; van der Oost, John

2014-01-01

SUMMARY Clustered regularly interspaced short palindromic repeats (CRISPR) and CRISPR-associated (Cas) genes are present in many bacterial and archaeal genomes. Since the discovery of the typical CRISPR loci in the 1980s, well before their physiological role was revealed, their variable sequences have been used as a complementary typing tool in diagnostic, epidemiologic, and evolutionary analyses of prokaryotic strains. The discovery that CRISPR spacers are often identical to sequence fragments of mobile genetic elements was a major breakthrough that eventually led to the elucidation of CRISPR-Cas as an adaptive immunity system. Key elements of this unique prokaryotic defense system are small CRISPR RNAs that guide nucleases to complementary target nucleic acids of invading viruses and plasmids, generally followed by the degradation of the invader. In addition, several recent studies have pointed at direct links of CRISPR-Cas to regulation of a range of stress-related phenomena. An interesting example concerns a pathogenic bacterium that possesses a CRISPR-associated ribonucleoprotein complex that may play a dual role in defense and/or virulence. In this review, we describe recently reported cases of potential involvement of CRISPR-Cas systems in bacterial stress responses in general and bacterial virulence in particular. PMID:24600041

The role of CRISPR-Cas systems in virulence of pathogenic bacteria.

PubMed

Louwen, Rogier; Staals, Raymond H J; Endtz, Hubert P; van Baarlen, Peter; van der Oost, John

2014-03-01

Clustered regularly interspaced short palindromic repeats (CRISPR) and CRISPR-associated (Cas) genes are present in many bacterial and archaeal genomes. Since the discovery of the typical CRISPR loci in the 1980s, well before their physiological role was revealed, their variable sequences have been used as a complementary typing tool in diagnostic, epidemiologic, and evolutionary analyses of prokaryotic strains. The discovery that CRISPR spacers are often identical to sequence fragments of mobile genetic elements was a major breakthrough that eventually led to the elucidation of CRISPR-Cas as an adaptive immunity system. Key elements of this unique prokaryotic defense system are small CRISPR RNAs that guide nucleases to complementary target nucleic acids of invading viruses and plasmids, generally followed by the degradation of the invader. In addition, several recent studies have pointed at direct links of CRISPR-Cas to regulation of a range of stress-related phenomena. An interesting example concerns a pathogenic bacterium that possesses a CRISPR-associated ribonucleoprotein complex that may play a dual role in defense and/or virulence. In this review, we describe recently reported cases of potential involvement of CRISPR-Cas systems in bacterial stress responses in general and bacterial virulence in particular.

Description of the PMAD DC test bed architecture and integration sequence

NASA Technical Reports Server (NTRS)

Beach, R. F.; Trash, L.; Fong, D.; Bolerjack, B.

1991-01-01

NASA-Lewis is responsible for the development, fabrication, and assembly of the electric power system (EPS) for the Space Station Freedom (SSF). The SSF power system is radically different from previous spacecraft power systems in both the size and complexity of the system. Unlike past spacecraft power system the SSF EPS will grow and be maintained on orbit and must be flexible to meet changing user power needs. The SSF power system is also unique in comparison with terrestrial power systems because it is dominated by power electronic converters which regulate and control the power. Although spacecraft historically have used power converters for regulation they typically involved only a single series regulating element. The SSF EPS involves multiple regulating elements, two or more in series, prior to the load. These unique system features required the construction of a testbed which would allow the development of spacecraft power system technology. A description is provided of the Power Management and Distribution (PMAD) DC Testbed which was assembled to support the design and early evaluation of the SSF EPS. A description of the integration process used in the assembly sequence is also given along with a description of the support facility.

Non-canonical mechanism for translational control in bacteria: synthesis of ribosomal protein S1

PubMed Central

Boni, Irina V.; Artamonova, Valentina S.; Tzareva, Nina V.; Dreyfus, Marc

2001-01-01

Translation initiation region (TIR) of the rpsA mRNA encoding ribosomal protein S1 is one of the most efficient in Escherichia coli despite the absence of a canonical Shine–Dalgarno-element. Its high efficiency is under strong negative autogenous control, a puzzling phenomenon as S1 has no strict sequence specificity. To define sequence and structural elements responsible for translational efficiency and autoregulation of the rpsA mRNA, a series of rpsA′–′lacZ chromosomal fusions bearing various mutations in the rpsA TIR was created and tested for β-galactosidase activity in the absence and presence of excess S1. These in vivo results, as well as data obtained by in vitro techniques and phylogenetic comparison, allow us to propose a model for the structural and functional organization of the rpsA TIR specific for proteobacteria related to E.coli. According to the model, the high efficiency of translation initiation is provided by a specific fold of the rpsA leader forming a non-contiguous ribosome entry site, which is destroyed upon binding of free S1 when it acts as an autogenous repressor. PMID:11483525

Characterization of short interspersed elements (SINEs) in a red alga, Porphyra yezoensis.

PubMed

Zhang, Wenbo; Lin, Xiaofei; Peddigari, Suresh; Takechi, Katsuaki; Takano, Hiroyoshi; Takio, Susumu

2007-02-01

Short interspersed element (SINE)-like sequences referred to as PySN1 and PySN2 were identified in a red alga, Porphyra yezoensis. Both elements contained an internal promoter with motifs (A box and B box) recognized by RNA polymerase III, and target site duplications at both ends. Genomic Southern blot analysis revealed that both elements were widely and abundantly distributed on the genome. 3' and 5' RACE suggested that PySN1 was expressed as a chimera transcript with flanking SINE-unrelated sequences and possessed the poly-A tail at the same position near the 3' end of PySN1.

ISEScan: automated identification of insertion sequence elements in prokaryotic genomes.

PubMed

Xie, Zhiqun; Tang, Haixu

2017-11-01

The insertion sequence (IS) elements are the smallest but most abundant autonomous transposable elements in prokaryotic genomes, which play a key role in prokaryotic genome organization and evolution. With the fast growing genomic data, it is becoming increasingly critical for biology researchers to be able to accurately and automatically annotate ISs in prokaryotic genome sequences. The available automatic IS annotation systems are either providing only incomplete IS annotation or relying on the availability of existing genome annotations. Here, we present a new IS elements annotation pipeline to address these issues. ISEScan is a highly sensitive software pipeline based on profile hidden Markov models constructed from manually curated IS elements. ISEScan performs better than existing IS annotation systems when tested on prokaryotic genomes with curated annotations of IS elements. Applying it to 2784 prokaryotic genomes, we report the global distribution of IS families across taxonomic clades in Archaea and Bacteria. ISEScan is implemented in Python and released as an open source software at https://github.com/xiezhq/ISEScan. hatang@indiana.edu. Supplementary data are available at Bioinformatics online. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com

Searching for nuclear export elements in hepatitis D virus RNA.

PubMed

Freitas, Natália; Cunha, Celso

2013-08-12

To search for the presence of cis elements in hepatitis D virus (HDV) genomic and antigenomic RNA capable of promoting nuclear export. We made use of a well characterized chloramphenicol acetyl-transferase reporter system based on plasmid pDM138. Twenty cDNA fragments corresponding to different HDV genomic and antigenomic RNA sequences were inserted in plasmid pDM138, and used in transfection experiments in Huh7 cells. The relative amounts of HDV RNA in nuclear and cytoplasmic fractions were then determined by real-time polymerase chain reaction and Northern blotting. The secondary structure of the RNA sequences that displayed nuclear export ability was further predicted using a web interface. Finally, the sensitivity to leptomycin B was assessed in order to investigate possible cellular pathways involved in HDV RNA nuclear export. Analysis of genomic RNA sequences did not allow identifying an unequivocal nuclear export element. However, two regions were found to promote the export of reporter mRNAs with efficiency higher than the negative controls albeit lower than the positive control. These regions correspond to nucleotides 266-489 and 584-920, respectively. In addition, when analyzing antigenomic RNA sequences a nuclear export element was found in positions 214-417. Export mediated by the nuclear export element of HDV antigenomic RNA is sensitive to leptomycin B suggesting a possible role of CRM1 in this transport pathway. A cis-acting nuclear export element is present in nucleotides 214-417 of HDV antigenomic RNA.

ESPERR: learning strong and weak signals in genomic sequence alignments to identify functional elements.

PubMed

Taylor, James; Tyekucheva, Svitlana; King, David C; Hardison, Ross C; Miller, Webb; Chiaromonte, Francesca

2006-12-01

Genomic sequence signals - such as base composition, presence of particular motifs, or evolutionary constraint - have been used effectively to identify functional elements. However, approaches based only on specific signals known to correlate with function can be quite limiting. When training data are available, application of computational learning algorithms to multispecies alignments has the potential to capture broader and more informative sequence and evolutionary patterns that better characterize a class of elements. However, effective exploitation of patterns in multispecies alignments is impeded by the vast number of possible alignment columns and by a limited understanding of which particular strings of columns may characterize a given class. We have developed a computational method, called ESPERR (evolutionary and sequence pattern extraction through reduced representations), which uses training examples to learn encodings of multispecies alignments into reduced forms tailored for the prediction of chosen classes of functional elements. ESPERR produces a greatly improved Regulatory Potential score, which can discriminate regulatory regions from neutral sites with excellent accuracy ( approximately 94%). This score captures strong signals (GC content and conservation), as well as subtler signals (with small contributions from many different alignment patterns) that characterize the regulatory elements in our training set. ESPERR is also effective for predicting other classes of functional elements, as we show for DNaseI hypersensitive sites and highly conserved regions with developmental enhancer activity. Our software, training data, and genome-wide predictions are available from our Web site (http://www.bx.psu.edu/projects/esperr).

Population genetics and molecular evolution of DNA sequences in transposable elements. I. A simulation framework.

PubMed

Kijima, T E; Innan, Hideki

2013-11-01

A population genetic simulation framework is developed to understand the behavior and molecular evolution of DNA sequences of transposable elements. Our model incorporates random transposition and excision of transposable element (TE) copies, two modes of selection against TEs, and degeneration of transpositional activity by point mutations. We first investigated the relationships between the behavior of the copy number of TEs and these parameters. Our results show that when selection is weak, the genome can maintain a relatively large number of TEs, but most of them are less active. In contrast, with strong selection, the genome can maintain only a limited number of TEs but the proportion of active copies is large. In such a case, there could be substantial fluctuations of the copy number over generations. We also explored how DNA sequences of TEs evolve through the simulations. In general, active copies form clusters around the original sequence, while less active copies have long branches specific to themselves, exhibiting a star-shaped phylogeny. It is demonstrated that the phylogeny of TE sequences could be informative to understand the dynamics of TE evolution.

Comparative Analysis of WRKY Genes Potentially Involved in Salt Stress Responses in Triticum turgidum L. ssp. durum.

PubMed

Yousfi, Fatma-Ezzahra; Makhloufi, Emna; Marande, William; Ghorbel, Abdel W; Bouzayen, Mondher; Bergès, Hélène

2016-01-01

WRKY transcription factors are involved in multiple aspects of plant growth, development and responses to biotic stresses. Although they have been found to play roles in regulating plant responses to environmental stresses, these roles still need to be explored, especially those pertaining to crops. Durum wheat is the second most widely produced cereal in the world. Complex, large and unsequenced genomes, in addition to a lack of genomic resources, hinder the molecular characterization of tolerance mechanisms. This paper describes the isolation and characterization of five TdWRKY genes from durum wheat ( Triticum turgidum L . ssp. durum ). A PCR-based screening of a T. turgidum BAC genomic library using primers within the conserved region of WRKY genes resulted in the isolation of five BAC clones. Following sequencing fully the five BACs, fine annotation through Triannot pipeline revealed 74.6% of the entire sequences as transposable elements and a 3.2% gene content with genes organized as islands within oceans of TEs. Each BAC clone harbored a TdWRKY gene. The study showed a very extensive conservation of genomic structure between TdWRKYs and their orthologs from Brachypodium, barley, and T. aestivum . The structural features of TdWRKY proteins suggested that they are novel members of the WRKY family in durum wheat. TdWRKY1/2/4, TdWRKY3, and TdWRKY5 belong to the group Ia, IIa, and IIc, respectively. Enrichment of cis -regulatory elements related to stress responses in the promoters of some TdWRKY genes indicated their potential roles in mediating plant responses to a wide variety of environmental stresses. TdWRKY genes displayed different expression patterns in response to salt stress that distinguishes two durum wheat genotypes with contrasting salt stress tolerance phenotypes. TdWRKY genes tended to react earlier with a down-regulation in sensitive genotype leaves and with an up-regulation in tolerant genotype leaves. The TdWRKY transcripts levels in roots increased in tolerant genotype compared to sensitive genotype. The present results indicate that these genes might play some functional role in the salt tolerance in durum wheat.

A Large Family of AvrLm6-like Genes in the Apple and Pear Scab Pathogens, Venturia inaequalis and Venturia pirina

PubMed Central

Shiller, Jason; Van de Wouw, Angela P.; Taranto, Adam P.; Bowen, Joanna K.; Dubois, David; Robinson, Andrew; Deng, Cecilia H.; Plummer, Kim M.

2015-01-01

Venturia inaequalis and V. pirina are Dothideomycete fungi that cause apple scab and pear scab disease, respectively. Whole genome sequencing of V. inaequalis and V. pirina isolates has revealed predicted proteins with sequence similarity to AvrLm6, a Leptosphaeria maculans effector that triggers a resistance response in Brassica napus and B. juncea carrying the resistance gene, Rlm6. AvrLm6-like genes are present as large families (>15 members) in all sequenced strains of V. inaequalis and V. pirina, while in L. maculans, only AvrLm6 and a single paralog have been identified. The Venturia AvrLm6-like genes are located in gene-poor regions of the genomes, and mostly in close proximity to transposable elements, which may explain the expansion of these gene families. An AvrLm6-like gene from V. inaequalis with the highest sequence identity to AvrLm6 was unable to trigger a resistance response in Rlm6-carrying B. juncea. RNA-seq and qRT-PCR gene expression analyses, of in planta- and in vitro-grown V. inaequalis, has revealed that many of the AvrLm6-like genes are expressed during infection. An AvrLm6 homolog from V. inaequalis that is up-regulated during infection was shown (using an eYFP-fusion protein construct) to be localized to the sub-cuticular stroma during biotrophic infection of apple hypocotyls. PMID:26635823

Auditory and visual sequence learning in humans and monkeys using an artificial grammar learning paradigm.

PubMed

Milne, Alice E; Petkov, Christopher I; Wilson, Benjamin

2017-07-05

Language flexibly supports the human ability to communicate using different sensory modalities, such as writing and reading in the visual modality and speaking and listening in the auditory domain. Although it has been argued that nonhuman primate communication abilities are inherently multisensory, direct behavioural comparisons between human and nonhuman primates are scant. Artificial grammar learning (AGL) tasks and statistical learning experiments can be used to emulate ordering relationships between words in a sentence. However, previous comparative work using such paradigms has primarily investigated sequence learning within a single sensory modality. We used an AGL paradigm to evaluate how humans and macaque monkeys learn and respond to identically structured sequences of either auditory or visual stimuli. In the auditory and visual experiments, we found that both species were sensitive to the ordering relationships between elements in the sequences. Moreover, the humans and monkeys produced largely similar response patterns to the visual and auditory sequences, indicating that the sequences are processed in comparable ways across the sensory modalities. These results provide evidence that human sequence processing abilities stem from an evolutionarily conserved capacity that appears to operate comparably across the sensory modalities in both human and nonhuman primates. The findings set the stage for future neurobiological studies to investigate the multisensory nature of these sequencing operations in nonhuman primates and how they compare to related processes in humans. Copyright © 2017 The Author(s). Published by Elsevier Ltd.. All rights reserved.

Identification of an active ID-like group of SINEs in the mouse

PubMed Central

Kass, David H; Jamison, Nicole

2007-01-01

The mouse genome consists of five known families of SINEs: B1, B2, B4/RSINE, ID, and MIR. Using RT-PCR we identified a germ-line transcript that demonstrates 92.7% sequence identity to ID (excluding primer sequence), yet a BLAST search identified numerous matches of 100% sequence identity. We analyzed four of these elements for their presence in orthologous genes in strains and subspecies of M. musculus as well as other species of Mus using a PCR-based assay. All four analyzed elements were either identified only in M. musculus or exclusively in both M. musculus and M. domesticus indicative of recent integrations. In conjunction with the identification of transcripts, we present an active ID-like group of elements that is not derived from the proposed BC1 master gene of ID elements. A BLAST of the rat genome indicated that these elements were not in the rat. Therefore, this family of SINEs has recently evolved, and since thus far has mainly been observed in M. musculus, we then refer to this family as MMIDL. PMID:17572061

Identification of an active ID-like group of SINEs in the mouse.

PubMed

Kass, David H; Jamison, Nicole

2007-09-01

The mouse genome consists of five known families of SINEs: B1, B2, B4/RSINE, ID, and MIR. Using RT-PCR we identified a germ-line transcript that demonstrates 92.7% sequence identity to ID (excluding primer sequence), yet a BLAST search identified numerous matches of 100% sequence identity. We analyzed four of these elements for their presence in orthologous genes in strains and subspecies of Mus musculus as well as other species of Mus using a PCR-based assay. All four analyzed elements were identified either only in M. musculus or exclusively in both M. musculus and M. domesticus, indicative of recent integrations. In conjunction with the identification of transcripts, we present an active ID-like group of elements that is not derived from the proposed BC1 master gene of ID elements. A BLAST of the rat genome indicated that these elements were not in the rat. Therefore, this family of SINEs has recently evolved, and since it has thus far been observed mainly in M. musculus, we refer to this family as MMIDL.

Full-Scale Crash Test and Finite Element Simulation of a Composite Prototype Helicopter

NASA Technical Reports Server (NTRS)

Jackson, Karen E.; Fasanella, Edwin L.; Boitnott, Richard L.; Lyle, Karen H.

2003-01-01

A full-scale crash test of a prototype composite helicopter was performed at the Impact Dynamics Research Facility at NASA Langley Research Center in 1999 to obtain data for validation of a finite element crash simulation. The helicopter was the flight test article built by Sikorsky Aircraft during the Advanced Composite Airframe Program (ACAP). The composite helicopter was designed to meet the stringent Military Standard (MIL-STD-1290A) crashworthiness criteria and was outfitted with two crew and two troop seats and four anthropomorphic dummies. The test was performed at 38-ft/s vertical and 32.5-ft/s horizontal velocity onto a rigid surface. An existing modal-vibration model of the Sikorsky ACAP helicopter was converted into a model suitable for crash simulation. A two-stage modeling approach was implemented and an external user-defined subroutine was developed to represent the complex landing gear response. The crash simulation was executed with a nonlinear, explicit transient dynamic finite element code. Predictions of structural deformation and failure, the sequence of events, and the dynamic response of the airframe structure were generated and the numerical results were correlated with the experimental data to validate the simulation. The test results, the model development, and the test-analysis correlation are described.

Whole genome and transcriptome analyses of environmental antibiotic sensitive and multi-resistant Pseudomonas aeruginosa isolates exposed to waste water and tap water

PubMed Central

Schwartz, Thomas; Armant, Olivier; Bretschneider, Nancy; Hahn, Alexander; Kirchen, Silke; Seifert, Martin; Dötsch, Andreas

2015-01-01

The fitness of sensitive and resistant Pseudomonas aeruginosa in different aquatic environments depends on genetic capacities and transcriptional regulation. Therefore, an antibiotic-sensitive isolate PA30 and a multi-resistant isolate PA49 originating from waste waters were compared via whole genome and transcriptome Illumina sequencing after exposure to municipal waste water and tap water. A number of different genomic islands (e.g. PAGIs, PAPIs) were identified in the two environmental isolates beside the highly conserved core genome. Exposure to tap water and waste water exhibited similar transcriptional impacts on several gene clusters (antibiotic and metal resistance, genetic mobile elements, efflux pumps) in both environmental P. aeruginosa isolates. The MexCD-OprJ efflux pump was overexpressed in PA49 in response to waste water. The expression of resistance genes, genetic mobile elements in PA49 was independent from the water matrix. Consistently, the antibiotic sensitive strain PA30 did not show any difference in expression of the intrinsic resistance determinants and genetic mobile elements. Thus, the exposure of both isolates to polluted waste water and oligotrophic tap water resulted in similar expression profiles of mentioned genes. However, changes in environmental milieus resulted in rather unspecific transcriptional responses than selected and stimuli-specific gene regulation. PMID:25186059

Identification of two novel functional p53 responsive elements in the herpes simplex virus-1 genome.

PubMed

Hsieh, Jui-Cheng; Kuta, Ryan; Armour, Courtney R; Boehmer, Paul E

2014-07-01

Analysis of the herpes simplex virus-1 (HSV-1) genome reveals two candidate p53 responsive elements (p53RE), located in proximity to the replication origins oriL and oriS, referred to as p53RE-L and p53RE-S, respectively. The sequences of p53RE-L and p53RE-S conform to the p53 consensus site and are present in HSV-1 strains KOS, 17, and F. p53 binds to both elements in vitro and in virus-infected cells. Both p53RE-L and p53RE-S are capable of conferring p53-dependent transcriptional activation onto a heterologous reporter gene. Importantly, expression of the essential immediate early viral transactivator ICP4 and the essential DNA replication protein ICP8, that are adjacent to p53RE-S and p53RE-L, are repressed in a p53-dependent manner. Taken together, this study identifies two novel functional p53RE in the HSV-1 genome and suggests a complex mechanism of viral gene regulation by p53 which may determine progression of the lytic viral replication cycle or the establishment of latency. Copyright © 2014 Elsevier Inc. All rights reserved.

A receptor-like kinase gene (GbRLK) from Gossypium barbadense enhances salinity and drought-stress tolerance in Arabidopsis

PubMed Central

2013-01-01

Background Cotton (Gossypium spp.) is widely cultivated due to the important economic value of its fiber. However, extreme environmental degradation impedes cotton growth and production. Receptor-like kinase (RLK) proteins play important roles in signal transduction and participate in a diverse range of processes in response to plant hormones and environmental cues. Here, we introduced an RLK gene (GbRLK) from cotton into Arabidopsis and investigated its role in imparting abiotic stress tolerance. Results GbRLK transcription was induced by exogenously supplied abscisic acid (ABA), salicylic acid, methyl jasmonate, mock drought conditions and high salinity. We cloned the promoter sequence of this gene via self-formed adaptor PCR. Sequence analysis revealed that the promoter region contains many cis-acting stress-responsive elements such as ABRE, W-Box, MYB-core, W-Box core, TCA-element and others. We constructed a vector containing a 1,890-bp sequence in the 5′ region upstream of the initiation codon of this promoter and transformed it into Arabidopsis thaliana. GUS histochemical staining analysis showed that GbRLK was expressed mainly in leaf veins, petioles and roots of transgenic Arabidopsis, but not in the cotyledons or root hairs. GbRLK promoter activity was induced by ABA, PEG, NaCl and Verticillium dahliae. Transgenic Arabidopsis with constitutive overexpression of GbRLK exhibited a reduced rate of water loss in leaves in vitro, along with improved salinity and drought tolerance and increased sensitivity to ABA compared with non-transgenic Col-0 Arabidopsis. Expression analysis of stress-responsive genes in GbRLK Arabidopsis revealed that there was increased expression of genes involved in the ABA-dependent signaling pathway (AtRD20, AtRD22 and AtRD26) and antioxidant genes (AtCAT1, AtCCS, AtCSD2 and AtCSD1) but not ion transporter genes (AtNHX1, AtSOS1). Conclusions GbRLK is involved in the drought and high salinity stresses pathway by activating or participating in the ABA signaling pathway. Overexpression of GbRLK may improve stress tolerance by regulating stress-responsive genes to reduce water loss. GbRLK may be employed in the genetic engineering of novel cotton cultivars in the future. Further studying of GbRLK will help elucidate abiotic stress signaling pathways. PMID:23915077

A receptor-like kinase gene (GbRLK) from Gossypium barbadense enhances salinity and drought-stress tolerance in Arabidopsis.

PubMed

Zhao, Jun; Gao, Yulong; Zhang, Zhiyuan; Chen, Tianzi; Guo, Wangzhen; Zhang, Tianzhen

2013-08-06

Cotton (Gossypium spp.) is widely cultivated due to the important economic value of its fiber. However, extreme environmental degradation impedes cotton growth and production. Receptor-like kinase (RLK) proteins play important roles in signal transduction and participate in a diverse range of processes in response to plant hormones and environmental cues. Here, we introduced an RLK gene (GbRLK) from cotton into Arabidopsis and investigated its role in imparting abiotic stress tolerance. GbRLK transcription was induced by exogenously supplied abscisic acid (ABA), salicylic acid, methyl jasmonate, mock drought conditions and high salinity. We cloned the promoter sequence of this gene via self-formed adaptor PCR. Sequence analysis revealed that the promoter region contains many cis-acting stress-responsive elements such as ABRE, W-Box, MYB-core, W-Box core, TCA-element and others. We constructed a vector containing a 1,890-bp sequence in the 5' region upstream of the initiation codon of this promoter and transformed it into Arabidopsis thaliana. GUS histochemical staining analysis showed that GbRLK was expressed mainly in leaf veins, petioles and roots of transgenic Arabidopsis, but not in the cotyledons or root hairs. GbRLK promoter activity was induced by ABA, PEG, NaCl and Verticillium dahliae. Transgenic Arabidopsis with constitutive overexpression of GbRLK exhibited a reduced rate of water loss in leaves in vitro, along with improved salinity and drought tolerance and increased sensitivity to ABA compared with non-transgenic Col-0 Arabidopsis. Expression analysis of stress-responsive genes in GbRLK Arabidopsis revealed that there was increased expression of genes involved in the ABA-dependent signaling pathway (AtRD20, AtRD22 and AtRD26) and antioxidant genes (AtCAT1, AtCCS, AtCSD2 and AtCSD1) but not ion transporter genes (AtNHX1, AtSOS1). GbRLK is involved in the drought and high salinity stresses pathway by activating or participating in the ABA signaling pathway. Overexpression of GbRLK may improve stress tolerance by regulating stress-responsive genes to reduce water loss. GbRLK may be employed in the genetic engineering of novel cotton cultivars in the future. Further studying of GbRLK will help elucidate abiotic stress signaling pathways.

Reproductive organ and vascular specific promoter of the rice plasma membrane Ca2+ATPase mediates environmental stress responses in plants.

PubMed

Huda, Kazi Md Kamrul; Banu, Mst Sufara Akhter; Pathi, Krishna Mohan; Tuteja, Narendra

2013-01-01

Plasma membrane Ca(2+)ATPase is a transport protein in the plasma membrane of cells and helps in removal of calcium (Ca(2+)) from the cell, hence regulating Ca(2+) level within cells. Though plant Ca(2+)ATPases have been shown to be involved in plant stress responses but their promoter regions have not been well studied. The 1478 bp promoter sequence of rice plasma membrane Ca(2+)ATPase contains cis-acting elements responsive to stresses and plant hormones. To identify the functional region, serial deletions of the promoter were fused with the GUS sequence and four constructs were obtained. These were differentially activated under NaCl, PEG cold, methyl viologen, abscisic acid and methyl jasmonate treatments. We demonstrated that the rice plasma membrane Ca(2+)ATPase promoter is responsible for vascular-specific and multiple stress-inducible gene expression. Only full-length promoter showed specific GUS expression under stress conditions in floral parts. High GUS activity was observed in roots with all the promoter constructs. The -1478 to -886 bp flanking region responded well upon treatment with salt and drought. Only the full-length promoter presented cold-induced GUS expression in leaves, while in shoots slight expression was observed for -1210 and -886 bp flanking region. The -1210 bp deletion significantly responded to exogenous methyl viologen and abscisic acid induction. The -1210 and -886 bp flanking region resulted in increased GUS activity in leaves under methyl jasmonate treatments, whereas in shoots the -886 bp and -519 bp deletion gave higher expression. Salicylic acid failed to induce GUS activities in leaves for all the constructs. The rice plasma membrane Ca(2+)ATPase promoter is a reproductive organ-specific as well as vascular-specific. This promoter contains drought, salt, cold, methyl viologen, abscisic acid and methyl jasmonate related cis-elements, which regulated gene expression. Overall, the tissue-specificity and inducible nature of this promoter could grant wide applicability in plant biotechnology.

Structure and regulation of an archaebacterial promoter: An in vivo study. Progress report, August 1, 1991--March 31, 1993

DOE Office of Scientific and Technical Information (OSTI.GOV)

Daniels, C.J.

1993-06-01

We have established that a 100 bp DNA fragment from the Haloferax volcanii tRNALys gene directs transcription in vivo. This element served as the starting point for a detailed analysis of the requirements for in vivo transcription. Among several gene tentatively identified as reporter elements, we selected a eukaryotic intron-containing tRNAPro gene for when it is driven by the H. volcanii tRNALys promoter fragment, produces a single small transcript. Transcript analysis, by Sl mapping and primer extension, showed that this RNA initiated at the expected tRNALys BoxB sequence and terminated in the tRNAPro RNA Pol III termination element present onmore » the DNA fragment. In initial studies we determined that the 3 inches proximal region of this tRNALys promoter element was sufficient for transcription initiation in vivo. This 40 bp region contains only the BoxA and BoxB regions and short purine rich regions 5 inches to the BoxA and BoxB sequence. Using the tRNAPro gene as the reporter and this minimal promoter, we performed a comprehensive analysis of the BoxA region. Each position of the BoxA region was converted to an four possible nucleotides and the transcription of 36 mutants was quantitated. Among the sites analyzed, only five of the positions showed high levels of discrimination; the preferred BoxA element was 5 inches-TT({sub T}/A)({sup A}/T) ANNNN-3 inches. Mutational analysis demonstrated that a transition from T-rich to A-rich sequences in the BoxA element is essential and that there is some flexibility in the location of the ``TA`` sequence. Additionally the TA sequence appears to determine the location of the transcription start site. The BoxA element defined in this study is similar to those observed for Sulfolobus and the methanogen promoters, and supports the hypothesis that a similar core promoter element is used by all archaeal RNA polymerases.« less

Retrotransposon insertion targeting: a mechanism for homogenization of centromere sequences on nonhomologous chromosomes.

PubMed

Birchler, James A; Presting, Gernot G

2012-04-01

The centromeres of most eukaryotic organisms consist of highly repetitive arrays that are similar across nonhomologous chromosomes. These sequences evolve rapidly, thus posing a mystery as to how such arrays can be homogenized. Recent work in species in which centromere-enriched retrotransposons occur indicates that these elements preferentially insert into the centromeric regions. In two different Arabidopsis species, a related element was recognized in which the specificity for such targeting was altered. These observations provide a partial explanation for how homogenization of centromere DNA sequences occurs.

Evolution of Hsp70 Gene Expression: A Role for Changes in AT-Richness within Promoters

PubMed Central

Ma, Ronghui; Zhang, Bo; Kang, Le

2011-01-01

In disparate organisms adaptation to thermal stress has been linked to changes in the expression of genes encoding heat-shock proteins (Hsp). The underlying genetics, however, remain elusive. We show here that two AT-rich sequence elements in the promoter region of the hsp70 gene of the fly Liriomyza sativae that are absent in the congeneric species, Liriomyza huidobrensis, have marked cis-regulatory consequences. We studied the cis-regulatory consequences of these elements (called ATRS1 and ATRS2) by measuring the constitutive and heat-shock-induced luciferase luminescence that they drive in cells transfected with constructs carrying them modified, deleted, or intact, in the hsp70 promoter fused to the luciferase gene. The elements affected expression level markedly and in different ways: Deleting ATRS1 augmented both the constitutive and the heat-shock-induced luminescence, suggesting that this element represses transcription. Interestingly, replacing the element with random sequences of the same length and A+T content delivered the wild-type luminescence pattern, proving that the element's high A+T content is crucial for its effects. Deleting ATRS2 decreased luminescence dramatically and almost abolished heat-shock inducibility and so did replacing the element with random sequences matching the element's length and A+T content, suggesting that ATRS2's effects on transcription and heat-shock inducibility involve a common mechanism requiring at least in part the element's specific primary structure. Finally, constitutive and heat-shock luminescence were reduced strongly when two putative binding sites for the Zeste transcription factor identified within ATRS2 were altered through site-directed mutagenesis, and the heat-shock-induced luminescence increased when Zeste was over-expressed, indicating that Zeste participates in the effects mapped to ATRS2 at least in part. AT-rich sequences are common in promoters and our results suggest that they should play important roles in regulatory evolution since they can affect expression markedly and constrain promoter DNA in at least two different ways. PMID:21655251

Optical mapping reveals a large genetic inversion between two methicillin-resistant Staphylococcus aureus strains.

PubMed

Shukla, Sanjay K; Kislow, Jennifer; Briska, Adam; Henkhaus, John; Dykes, Colin

2009-09-01

Staphylococcus aureus is a highly versatile and evolving bacterium of great clinical importance. S. aureus can evolve by acquiring single nucleotide polymorphisms and mobile genetic elements and by recombination events. Identification and location of novel genomic elements in a bacterial genome are not straightforward, unless the whole genome is sequenced. Optical mapping is a new tool that creates a high-resolution, in situ ordered restriction map of a bacterial genome. These maps can be used to determine genomic organization and perform comparative genomics to identify genomic rearrangements, such as insertions, deletions, duplications, and inversions, compared to an in silico (virtual) restriction map of a known genome sequence. Using this technology, we report here the identification, approximate location, and characterization of a genetic inversion of approximately 500 kb of a DNA element between the NRS387 (USA800) and FPR3757 (USA300) strains. The presence of the inversion and location of its junction sites were confirmed by site-specific PCR and sequencing. At both the left and right junction sites in NRS387, an IS1181 element and a 73-bp sequence were identified as inverted repeats, which could explain the possible mechanism of the inversion event.

Genomic deletion of a long-range bone enhancer misregulatessclerostin in Van Buchem disease

DOE Office of Scientific and Technical Information (OSTI.GOV)

Loots, Gabriela G.; Kneissel, Michaela; Keller, Hansjoerg

2005-04-15

Mutations in distant regulatory elements can negatively impact human development and health, yet due to the difficulty of detecting these critical sequences we predominantly focus on coding sequences for diagnostic purposes. We have undertaken a comparative sequence-based approach to characterize a large noncoding region deleted in patients affected by Van Buchem disease (VB), a severe sclerosing bone dysplasia. Using BAC recombination and transgenesis we characterized the expression of human sclerostin (sost) from normal (hSOSTwt) or Van Buchem(hSOSTvb D) alleles. Only the hSOSTwt allele faithfully expressed high levels of human sost in the adult bone and impacted bone metabolism, consistent withmore » the model that the VB noncoding deletion removes a sost specific regulatory element. By exploiting cross-species sequence comparisons with in vitro and in vivo enhancer assays we were able to identify a candidate enhancer element that drives human sost expression in osteoblast-like cell lines in vitro and in the skeletal anlage of the E14.5 mouse embryo, and discovered a novel function for sclerostin during limb development. Our approach represents a framework for characterizing distant regulatory elements associated with abnormal human phenotypes.« less

Transposon Insertion Finder (TIF): a novel program for detection of de novo transpositions of transposable elements.

PubMed

Nakagome, Mariko; Solovieva, Elena; Takahashi, Akira; Yasue, Hiroshi; Hirochika, Hirohiko; Miyao, Akio

2014-03-14

Transposition event detection of transposable element (TE) in the genome using short reads from the next-generation sequence (NGS) was difficult, because the nucleotide sequence of TE itself is repetitive, making it difficult to identify locations of its insertions by alignment programs for NGS. We have developed a program with a new algorithm to detect the transpositions from NGS data. In the process of tool development, we used next-generation sequence (NGS) data of derivative lines (ttm2 and ttm5) of japonica rice cv. Nipponbare, regenerated through cell culture. The new program, called a transposon insertion finder (TIF), was applied to detect the de novo transpositions of Tos17 in the regenerated lines. TIF searched 300 million reads of a line within 20 min, identifying 4 and 12 de novo transposition in ttm2 and ttm5 lines, respectively. All of the transpositions were confirmed by PCR/electrophoresis and sequencing. Using the program, we also detected new transposon insertions of P-element from NGS data of Drosophila melanogaster. TIF operates to find the transposition of any elements provided that target site duplications (TSDs) are generated by their transpositions.

Current strategies for mobilome research.

PubMed

Jørgensen, Tue S; Kiil, Anne S; Hansen, Martin A; Sørensen, Søren J; Hansen, Lars H

2014-01-01

Mobile genetic elements (MGEs) are pivotal for bacterial evolution and adaptation, allowing shuffling of genes even between distantly related bacterial species. The study of these elements is biologically interesting as the mode of genetic propagation is kaleidoscopic and important, as MGEs are the main vehicles of the increasing bacterial antibiotic resistance that causes thousands of human deaths each year. The study of MGEs has previously focused on plasmids from individual isolates, but the revolution in sequencing technology has allowed the study of mobile genomic elements of entire communities using metagenomic approaches. The problem in using metagenomic sequencing for the study of MGEs is that plasmids and other mobile elements only comprise a small fraction of the total genetic content that are difficult to separate from chromosomal DNA based on sequence alone. The distinction between plasmid and chromosome is important as the mobility and regulation of genes largely depend on their genetic context. Several different approaches have been proposed that specifically enrich plasmid DNA from community samples. Here, we review recent approaches used to study entire plasmid pools from complex environments, and point out possible future developments for and pitfalls of these approaches. Further, we discuss the use of the PacBio long-read sequencing technology for MGE discovery.

Epigenetic Mediation of Endocrine and Immune Response in an Animal Model of Gulf War Illness

DTIC Science & Technology

2015-10-01

Illness 5b. GRANT NUMBER W81XWH-14-1-0550 5c. PROGRAM ELEMENT NUMBER 6. AUTHOR(S) 5d. PROJECT NUMBER Patrick O. McGowan, PhD, Gordon Broderick , PhD...ensure alignment with the overarching Consortium GW120045 (project W81XWH-12-2-0085; Morris, PI). Feb. 24-27 2015. Dr. Broderick met with Drs...Coordinated sharing of existing RNA sequencing data with McGowan group for first review of most promising target genes Mar. 30-31 2015. Dr. Broderick met

Symmetries in laminated composite plates

NASA Technical Reports Server (NTRS)

Noor, A. K.

1976-01-01

The different types of symmetry exhibited by laminated anisotropic fibrous composite plates are identified and contrasted with the symmetries of isotropic and homogeneous orthotropic plates. The effects of variations in the fiber orientation and the stacking sequence of the layers on the symmetries exhibited by composite plates are discussed. Both the linear and geometrically nonlinear responses of the plates are considered. A simple procedure is presented for exploiting the symmetries in the finite element analysis. Examples are given of square, skew and polygonal plates where use of symmetry concepts can significantly reduce the scope and cost of analysis.

Molecular Characterization, Gene Evolution, and Expression Analysis of the Fructose-1, 6-bisphosphate Aldolase (FBA) Gene Family in Wheat (Triticum aestivum L.)

PubMed Central

Lv, Geng-Yin; Guo, Xiao-Guang; Xie, Li-Ping; Xie, Chang-Gen; Zhang, Xiao-Hong; Yang, Yuan; Xiao, Lei; Tang, Yu-Ying; Pan, Xing-Lai; Guo, Ai-Guang; Xu, Hong

2017-01-01

Fructose-1, 6-bisphosphate aldolase (FBA) is a key plant enzyme that is involved in glycolysis, gluconeogenesis, and the Calvin cycle. It plays significant roles in biotic and abiotic stress responses, as well as in regulating growth and development processes. In the present paper, 21 genes encoding TaFBA isoenzymes were identified, characterized, and categorized into three groups: class I chloroplast/plastid FBA (CpFBA), class I cytosol FBA (cFBA), and class II chloroplast/plastid FBA. By using a prediction online database and genomic PCR analysis of Chinese Spring nulli-tetrasomic lines, we have confirmed the chromosomal location of these genes in 12 chromosomes of four homologous groups. Sequence and genomic structure analysis revealed the high identity of the allelic TaFBA genes and the origin of different TaFBA genes. Numerous putative environment stimulus-responsive cis-elements have been identified in 1,500-bp regions of TaFBA gene promoters, of which the most abundant are the light-regulated elements (LREs). Phylogenetic reconstruction using the deduced protein sequence of 245 FBA genes indicated an independent evolutionary pathway for the class I and class II groups. Although, earlier studies have indicated that class II FBA only occurs in prokaryote and fungi, our results have demonstrated that a few class II CpFBAs exist in wheat and other closely related species. Class I TaFBA was predicted to be tetramers and class II to be dimers. Gene expression analysis based on microarray and transcriptome databases suggested the distinct role of TaFBAs in different tissues and developmental stages. The TaFBA 4–9 genes were highly expressed in leaves and might play important roles in wheat development. The differential expression patterns of the TaFBA genes in light/dark and a few abiotic stress conditions were also analyzed. The results suggested that LRE cis-elements of TaFBA gene promoters were not directly related to light responses. Most TaFBA genes had higher expression levels in the roots than in the shoots when under various stresses. Class I cytosol TaFBA genes, particularly TaFBA10/12/18 and TaFBA13/16, and three class II TaFBA genes are involved in responses to various abiotic stresses. Class I CpFBA genes in wheat are apparently sensitive to different stress conditions. PMID:28659962

The role of heterologous chloroplast sequence elements in transgene integration and expression.

PubMed

Ruhlman, Tracey; Verma, Dheeraj; Samson, Nalapalli; Daniell, Henry

2010-04-01

Heterologous regulatory elements and flanking sequences have been used in chloroplast transformation of several crop species, but their roles and mechanisms have not yet been investigated. Nucleotide sequence identity in the photosystem II protein D1 (psbA) upstream region is 59% across all taxa; similar variation was consistent across all genes and taxa examined. Secondary structure and predicted Gibbs free energy values of the psbA 5' untranslated region (UTR) among different families reflected this variation. Therefore, chloroplast transformation vectors were made for tobacco (Nicotiana tabacum) and lettuce (Lactuca sativa), with endogenous (Nt-Nt, Ls-Ls) or heterologous (Nt-Ls, Ls-Nt) psbA promoter, 5' UTR and 3' UTR, regulating expression of the anthrax protective antigen (PA) or human proinsulin (Pins) fused with the cholera toxin B-subunit (CTB). Unique lettuce flanking sequences were completely eliminated during homologous recombination in the transplastomic tobacco genomes but not unique tobacco sequences. Nt-Ls or Ls-Nt transplastomic lines showed reduction of 80% PA and 97% CTB-Pins expression when compared with endogenous psbA regulatory elements, which accumulated up to 29.6% total soluble protein PA and 72.0% total leaf protein CTB-Pins, 2-fold higher than Rubisco. Transgene transcripts were reduced by 84% in Ls-Nt-CTB-Pins and by 72% in Nt-Ls-PA lines. Transcripts containing endogenous 5' UTR were stabilized in nonpolysomal fractions. Stromal RNA-binding proteins were preferentially associated with endogenous psbA 5' UTR. A rapid and reproducible regeneration system was developed for lettuce commercial cultivars by optimizing plant growth regulators. These findings underscore the need for sequencing complete crop chloroplast genomes, utilization of endogenous regulatory elements and flanking sequences, as well as optimization of plant growth regulators for efficient chloroplast transformation.

The Role of Heterologous Chloroplast Sequence Elements in Transgene Integration and Expression1[W][OA

PubMed Central

Ruhlman, Tracey; Verma, Dheeraj; Samson, Nalapalli; Daniell, Henry

2010-01-01

Heterologous regulatory elements and flanking sequences have been used in chloroplast transformation of several crop species, but their roles and mechanisms have not yet been investigated. Nucleotide sequence identity in the photosystem II protein D1 (psbA) upstream region is 59% across all taxa; similar variation was consistent across all genes and taxa examined. Secondary structure and predicted Gibbs free energy values of the psbA 5′ untranslated region (UTR) among different families reflected this variation. Therefore, chloroplast transformation vectors were made for tobacco (Nicotiana tabacum) and lettuce (Lactuca sativa), with endogenous (Nt-Nt, Ls-Ls) or heterologous (Nt-Ls, Ls-Nt) psbA promoter, 5′ UTR and 3′ UTR, regulating expression of the anthrax protective antigen (PA) or human proinsulin (Pins) fused with the cholera toxin B-subunit (CTB). Unique lettuce flanking sequences were completely eliminated during homologous recombination in the transplastomic tobacco genomes but not unique tobacco sequences. Nt-Ls or Ls-Nt transplastomic lines showed reduction of 80% PA and 97% CTB-Pins expression when compared with endogenous psbA regulatory elements, which accumulated up to 29.6% total soluble protein PA and 72.0% total leaf protein CTB-Pins, 2-fold higher than Rubisco. Transgene transcripts were reduced by 84% in Ls-Nt-CTB-Pins and by 72% in Nt-Ls-PA lines. Transcripts containing endogenous 5′ UTR were stabilized in nonpolysomal fractions. Stromal RNA-binding proteins were preferentially associated with endogenous psbA 5′ UTR. A rapid and reproducible regeneration system was developed for lettuce commercial cultivars by optimizing plant growth regulators. These findings underscore the need for sequencing complete crop chloroplast genomes, utilization of endogenous regulatory elements and flanking sequences, as well as optimization of plant growth regulators for efficient chloroplast transformation. PMID:20130101

Glucocorticoids induce transactivation of tight junction genes occludin and claudin-5 in retinal endothelial cells via a novel cis-element.

PubMed

Felinski, Edward A; Cox, Amy E; Phillips, Brett E; Antonetti, David A

2008-06-01

Tight junctions between vascular endothelial cells help to create the blood-brain and blood-retinal barriers. Breakdown of the retinal tight junction complex is problematic in several disease states including diabetic retinopathy. Glucocorticoids can restore and/or preserve the endothelial barrier to paracellular permeability, although the mechanism remains unclear. We show that glucocorticoid treatment of primary retinal endothelial cells increases content of the tight junction proteins occludin and claudin-5, co-incident with an increase in barrier properties of endothelial monolayers. The glucocorticoid receptor antagonist RU486 reverses both the glucocorticoid-stimulated increase in occludin content and the increase in barrier properties. Transcriptional activity from the human occludin and claudin-5 promoters increases in retinal endothelial cells upon glucocorticoid treatment, and is dependent on the glucocorticoid receptor (GR) as demonstrated by siRNA. Deletion analysis of the occludin promoter reveals a 205bp sequence responsible for the glucocorticoid response. However, this region does not possess a canonical glucocorticoid response element and does not bind to the GR in a chromatin immunoprecipitation (ChIP) assay. Mutational analysis of this region revealed a novel 40bp occludin enhancer element (OEE), containing two highly conserved regions of 10 and 13 base pairs, that is both necessary and sufficient for glucocorticoid-induced gene expression in retinal endothelial cells. These data suggest a novel mechanism for glucocorticoid induction of vascular endothelial barrier properties through increased occludin and claudin-5 gene expression.