Sample records for response genes induced

  1. Radiation-induced gene responses

    SciTech Connect

    Woloschak, G.E.; Paunesku, T.; Shearin-Jones, P.; Oryhon, J.


    In the process of identifying genes that are differentially regulated in cells exposed to ultraviolet radiation (UV), we identified a transcript that was repressed following the exposure of cells to a combination of UV and salicylate, a known inhibitor of NF-kappaB. Sequencing this band determined that it has identify to lactate dehydrogenase, and Northern blots confirmed the initial expression pattern. Analysis of the sequence of the LDH 5` region established the presence of NF-kappaB, Sp1, and two Ap-2 elements; two partial AP- 1; one partial RE, and two halves of E-UV elements were also found. Electromobility shift assays were then performed for the AP-1, NF- kappaB, and E-UV elements. These experiments revealed that binding to NF-kappaB was induced by UV but repressed with salicylic acid; UV did not affect AP-1 binding, but salicylic acid inhibited it alone or following UV exposure; and E-UV binding was repressed by UV, and salicylic acid had little effect. Since the binding of no single element correlated with the expression pattern of LDH, it is likely that multiple elements govern UV/salicylate-mediated expression.

  2. Mechanisms of radiation-induced gene responses

    SciTech Connect

    Woloschak, G.E.; Paunesku, T.


    In the process of identifying genes differentially expressed in cells exposed ultraviolet radiation, we have identified a transcript having a 26-bp region that is highly conserved in a variety of species including Bacillus circulans, yeast, pumpkin, Drosophila, mouse, and man. When the 5` region (flanking region or UTR) of a gene, the sequence is predominantly in +/+ orientation with respect to the coding DNA strand; while in the coding region and the 3` region (UTR), the sequence is most frequently in the +/-orientation with respect to the coding DNA strand. In two genes, the element is split into two parts; however, in most cases, it is found only once but with a minimum of 11 consecutive nucleotides precisely depicting the original sequence. The element is found in a large number of different genes with diverse functions (from human ras p21 to B. circulans chitonase). Gel shift assays demonstrated the presence of a protein in HeLa cell extracts that binds to the sense and antisense single-stranded consensus oligomers, as well as to the double- stranded oligonucleotide. When double-stranded oligomer was used, the size shift demonstrated as additional protein-oligomer complex larger than the one bound to either sense or antisense single-stranded consensus oligomers alone. It is speculated either that this element binds to protein(s) important in maintaining DNA is a single-stranded orientation for transcription or, alternatively that this element is important in the transcription-coupled DNA repair process.

  3. Early antiviral response and virus-induced genes in fish.


    Verrier, Eloi R; Langevin, Christelle; Benmansour, Abdenour; Boudinot, Pierre


    In fish as in mammals, virus infections induce changes in the expression of many host genes. Studies conducted during the last fifteen years revealed a major contribution of the interferon system in fish antiviral response. This review describes the screening methods applied to compare the impact of virus infections on the transcriptome in different fish species. These approaches identified a "core" set of genes that are strongly induced in most viral infections. The "core" interferon-induced genes (ISGs) are generally conserved in vertebrates, some of them inhibiting a wide range of viruses in mammals. A selection of ISGs -PKR, vig-1/viperin, Mx, ISG15 and finTRIMs - is further analyzed here to illustrate the diversity and complexity of the mechanisms involved in establishing an antiviral state. Most of the ISG-based pathways remain to be directly determined in fish. Fish ISGs are often duplicated and the functional specialization of multigenic families will be of particular interest for future studies. PMID:21414349

  4. Relationship between gene responses and symptoms induced by Rice grassy stunt virus

    PubMed Central

    Satoh, Kouji; Yoneyama, Kaori; Kondoh, Hiroaki; Shimizu, Takumi; Sasaya, Takahide; Choi, Il-Ryong; Yoneyama, Koichi; Omura, Toshihiro; Kikuchi, Shoshi


    Rice grassy stunt virus (RGSV) is a serious threat to rice production in Southeast Asia. RGSV is a member of the genus Tenuivirus, and it induces leaf yellowing, stunting, and excess tillering on rice plants. Here we examined gene responses of rice to RGSV infection to gain insight into the gene responses which might be associated with the disease symptoms. The results indicated that (1) many genes related to cell wall synthesis and chlorophyll synthesis were predominantly suppressed by RGSV infection; (2) RGSV infection induced genes associated with tillering process; (3) RGSV activated genes involved in inactivation of gibberellic acid and indole-3-acetic acid; and (4) the genes for strigolactone signaling were suppressed by RGSV. These results suggest that these gene responses to RGSV infection account for the excess tillering specific to RGSV infection as well as other symptoms by RGSV, such as stunting and leaf chlorosis. PMID:24151491

  5. Dual-responsive aggregation-induced emission-active supramolecular nanoparticles for gene delivery and bioimaging.


    Dong, Ruijiao; Ravinathan, Screenath P; Xue, Lizhe; Li, Nan; Zhang, Yingjian; Zhou, Linzhu; Cao, Chengxi; Zhu, Xinyuan


    Dual-responsive aggregation-induced emission-active supramolecular fluorescent nanoparticles are reported, which have the ability to undergo a unique morphological transition combining with a cooperative optical variation in response to pH and light stimuli. The dynamic supramolecular nanoparticles show excellent biocompatibility and effective plasmid DNA condensation capability, further achieving efficient in vitro gene delivery and bioimaging. PMID:27251637

  6. Analysis of Stress Responsive Genes Induced by Single-Walled Carbon Nanotubes in BJ Foreskin Cells

    PubMed Central

    Sarkar, Shubhashish; Sharma, Chidananda; Yog, Rajeshwari; Periakaruppan, Adaikkappan; Jejelowo, Olufisayo; Thomas, Renard; Barrera, Enrique V.; Rice-Ficht, Allison C.; Wilson, Bobby L.; Ramesh, Govindarajan T.


    Nanotechnology is finding its use as a potential technology in consumer products, defense, electronics, and medical applications by exploiting the properties of nanomaterials. Single-walled carbon nanotubes are novel forms of these nanomaterials with potential for large applications. However, the toxicity studies on this material are not explored in detail and therefore limiting its use. It has been earlier reported that single-walled carbon nanotubes induces oxidative stress and also dictates activation of specific signaling pathway in keratinocytes. The present study explores the effect of single-walled carbon nanotubes on stress genes in human BJ Foreskin cells. The results show induction of oxidative stress in BJ Foreskin cells by single-walled carbon nanotubes and increase in stress responsive genes. The genes included inducible genes like HMOX1, HMOX2, and Cyp1B1. In addition we validated increase for four genes by SWCNT, namely ATM, CCNC, DNAJB4, and GADD45A by RT-PCR. Moreover results of the altered stress related genes have been discussed and that partially explains some of the toxic responses induced by single-walled carbon nanotubes. PMID:17450800

  7. DNA vaccination using expression vectors carrying FIV structural genes induces immune response against feline immunodeficiency virus.


    Cuisinier, A M; Mallet, V; Meyer, A; Caldora, C; Aubert, A


    Following inactivated virus vaccination trials, the surface glycoprotein gp120 of the feline immunodeficiency virus (FIV) was considered as one of the determinants for protection. However, several vaccination trials using recombinant Env protein or some peptides failed to induce protection. To understand the role of the gp120 protein in vivo, we vaccinated cats with naked DNA coding for FIV structural proteins gp120 and p10. We analyzed the ability of these vaccinations to induce immune protection and to influence the onset of infection. Injection in cat muscles of expression vectors coding for the FIV gp120 protein induced a humoral response. Cats immunized twice with the gp120 gene showed different patterns after challenge. Two cats were, like the control cats, infected from the second week after infection onwards. The two others maintained a low proviral load with no modification of their antibody pattern. The immune response induced by gp120 DNA injection could control the level of viral replication. This protective-like immune response was not correlated to the humoral response. All the cats immunized with the gp120 gene followed by the p10 gene were infected, like the control cats, from the second week but they developed a complete humoral response against viral proteins after challenge. Furthermore, they showed a sudden but transient drop of the proviral load at 4 weeks after infection. Under these conditions, one injection of the p10 gene after one injection of the gp120 gene was not sufficient to stimulate protection. On the contrary, after a period, it seems to facilitate virus replication. PMID:9269051

  8. Tamoxifen Induces Expression of Immune Response-Related Genes in Cultured Normal Human Mammary Epithelial Cells

    PubMed Central

    Schild-Hay, Laura J.; Leil, Tarek A.; Divi, Rao L.; Olivero, Ofelia, A.; Weston, Ainsley; Poirier, Miriam C.


    Use of tamoxifen (TAM) is associated with a 50% reduction in breast cancer incidence and an increase in endometrial cancer incidence. Here, we documented TAM-induced gene expression changes in cultured normal human mammary epithelial cells (NHMEC strains numbered 5, 16 and 40), established from tissue taken at reduction mammoplasty from 3 individuals. Cells exposed to 0, 10 or 50 μM TAM for 48 hours were evaluated for (E)-α-(deoxyguanosin-N2-yl)-tamoxifen (dG-N2-TAM) adduct formation by TAM-DNA (DNA modified with dG-N2-TAM) chemiluminescence immunoassay (CIA), gene expression changes using NCI DNA-oligonucleotide microarray, and real time (RT)-PCR. At 48 hr, cells exposed to 10 μM and 50 μM TAM were 85.6% and 48.4% viable, respectively, and there were no measurable dG-N2-TAM adducts. For microarray, cells were exposed to 10 μM TAM and genes with expression changes of ≥ 3-fold were as follows: thirteen genes up-regulated and one down-related for strain 16; seventeen genes up-regulated for strain 5; and eleven genes up-regulated for strain 40. Interferon-inducible genes (IFITM1, IFIT1, IFNA1, MXI and GIP3), and a potassium ion channel (KCNJ1) were up-regulated in all 3 strains. No significant expression changes were found for genes related to estrogen or xenobiotic metabolism. RT-PCR revealed up-regulation of interferon α (IFNA1) and confirmed the TAM-induced up-regulation of the genes identified by microarray, with the exception of GIP3 and MX1, which were not up-regulated in strain 40. Induction of interferon-related genes in the three NHMEC strains suggests that, in addition to hormonal effects, TAM exposure may enhance immune response in normal breast tissue. PMID:19155303

  9. Prospective Study of Metal Fume-Induced Responses of Global Gene Expression Profiling in Whole Blood

    PubMed Central

    Wang, Zhaoxi; Neuberg, Donna; Su, Li; Kim, Jee Young; Chen, Jiu-Chiuan; Christiani, David C.


    Metal particulate inhalation causes pulmonary and cardiovascular diseases. Our previous results showed that systemic responses to short-term occupational welding-fume exposure could be assessed by microarray analyses in whole-blood total RNA sampled before and after exposure. To expand our understanding of the duration of particulate-induced gene expression changes, we conducted a study using a similar population 1 yr after the original study and extended our observations in the postexposure period. We recruited 15 individuals with welding fume exposure and 7 nonexposed individuals. Thirteen of the 22 individuals (9 in exposed group and 4 in nonexposed group) had been monitored in the previous study. Whole-blood total RNA was analyzed at 3 time points, including baseline, immediately following exposure (approximately 5 h after baseline), and 24 h after baseline, using cDNA microarray technology. We replicated the patterns of Gene Ontology (GO) terms associated with response to stimulus, cell death, phosphorus metabolism, localization, and regulation of biological processes significantly enriched with altered genes in the nonsmoking exposed group. Most of the identified genes had opposite expression changes between the exposure and postexposure periods in nonsmoking welders. In addition, we found dose-dependent patterns that were affected by smoking status. In conclusion, short-term occupational exposure to metal particulates causes systemic responses in the peripheral blood. Furthermore, the acute particulate-induced effects on gene expression profiling were transient in nonsmoking welders, with most effects diminishing within 19 h following exposure. PMID:18951227

  10. Regulatory elements responsible for inducible expression of the granulocyte colony-stimulating factor gene in macrophages.

    PubMed Central

    Nishizawa, M; Nagata, S


    Granulocyte colony-stimulating factor (G-CSF) plays an essential role in granulopoiesis during bacterial infection. Macrophages produce G-CSF in response to bacterial endotoxins such as lipopolysaccharide (LPS). To elucidate the mechanism of the induction of G-CSF gene in macrophages or macrophage-monocytes, we have examined regulatory cis elements in the promoter of mouse G-CSF gene. Analyses of linker-scanning and internal deletion mutants of the G-CSF promoter by the chloramphenicol acetyltransferase assay have indicated that at least three regulatory elements are indispensable for the LPS-induced expression of the G-CSF gene in macrophages. When one of the three elements was reiterated and placed upstream of the TATA box of the G-CSF promoter, it mediated inducibility as a tissue-specific and orientation-independent enhancer. Although this element contains a conserved NF-kappa B-like binding site, the gel retardation assay and DNA footprint analysis with nuclear extracts from macrophage cell lines demonstrated that nuclear proteins bind to the DNA sequence downstream of the NF-kappa B-like element, but not to the conserved element itself. The DNA sequence of the binding site was found to have some similarities to the LPS-responsive element which was recently identified in the promoter of the mouse class II major histocompatibility gene. Images PMID:1691438

  11. An Arabidopsis ATPase gene involved in nematode-induced syncytium development and abiotic stress responses

    PubMed Central

    Ali, Muhammad Amjad; Plattner, Stephan; Radakovic, Zoran; Wieczorek, Krzysztof; Elashry, Abdelnaser; Grundler, Florian MW; Ammelburg, Moritz; Siddique, Shahid; Bohlmann, Holger


    The beet cyst nematode Heterodera schachtii induces syncytia in the roots of Arabidopsis thaliana, which are its only nutrient source. One gene, At1g64110, that is strongly up-regulated in syncytia as shown by RT-PCR, quantitative RT-PCR, in situ RT-PCR and promoter::GUS lines, encodes an AAA+-type ATPase. Expression of two related genes in syncytia, At4g28000 and At5g52882, was not detected or not different from control root segments. Using amiRNA lines and T-DNA mutants, we show that At1g64110 is important for syncytium and nematode development. At1g64110 was also inducible by wounding, jasmonic acid, salicylic acid, heat and cold, as well as drought, sodium chloride, abscisic acid and mannitol, indicating involvement of this gene in abiotic stress responses. We confirmed this using two T-DNA mutants that were more sensitive to abscisic acid and sodium chloride during seed germination and root growth. These mutants also developed significantly smaller roots in response to abscisic acid and sodium chloride. An in silico analysis showed that ATPase At1g64110 (and also At4g28000 and At5g52882) belong to the ‘meiotic clade’ of AAA proteins that includes proteins such as Vps4, katanin, spastin and MSP1. PMID:23480402

  12. Hypoxia-induced protein binding to O2-responsive sequences on the tyrosine hydroxylase gene.


    Norris, M L; Millhorn, D E


    We reported recently that the gene that encodes tyrosine hydroxylase (TH), the rate-limiting enzyme in the biosynthesis of catecholamines, is regulated by hypoxia in the dopaminergic cells of the mammalian carotid body (Czyzyk-Krzeska, M. F., Bayliss, D. A., Lawson, E. E. & Millhorn, D. E. (1992) J. Neurochem. 58, 1538-1546) and in pheochromocytoma (PC12) cells (Czyzyk-Krzeska, M. F., Furnari, B. A., Lawson, E. E. & Millhorn, D. E. (1994) J. Biol. Chem. 269, 760-764). Regulation of this gene during low O2 conditions occurs at both the level of transcription and RNA stability. Increased transcription during hypoxia is regulated by a region of the proximal promoter that extends from -284 to + 27 bases, relative to transcription start site. The present study was undertaken to further characterize the sequences that confer O2 responsiveness of the TH gene and to identify hypoxia-induced protein interactions with these sequences. Results from chloramphenicol acetyltransferase assays identified a region between bases -284 and -150 that contains the essential sequences for O2 regulation. This region contains a number of regulatory elements including AP1, AP2, and HIF-1. Gel shift assays revealed enhanced protein interactions at the AP1 and HIF-1 elements of the native gene. Further investigations using supershift and shift-Western analysis showed that c-Fos and JunB bind to the AP1 element during hypoxia and that these protein levels are stimulated by hypoxia. Mutation of the AP1 sequence prevented stimulation of transcription of the TH-chloramphenicol acetyltransferase reporter gene by hypoxia. PMID:7559551

  13. Identification of rapidly induced genes in the response of peanut (Arachis hypogaea) to water deficit and abscisic acid

    PubMed Central


    Background Peanut (Arachis hypogaea) is an important crop, but droughts often affect peanut production. There is a lack of genomic information available for peanut; therefore, little is known about the molecular basis of its drought stress response. Results Previously, we found that peanut stomata close rapidly during water deficit and in response to abscisic acid (ABA) treatment, and many genes show changes in their expression levels. To screen for candidate genes involved in the water deficit response, we used the Illumina HiSeq2000/MiSeq sequencing platform to conduct a global transcriptome analysis of peanut seedlings under water deficit with or without an ABA pretreatment. Three peanut tissues (leaves, roots, and stems) collected at each of three developmental stages (four-leaf, flowering, and podding stages) were used to construct sequence libraries. Then, 4.96 × 107 raw sequence reads were generated and the high quality reads were assembled into 47,842 unigenes. We analyzed these sequence libraries to identify differentially expressed genes (DEGs) under water deficit with or without ABA pretreatment. In total, 621 genes were induced rapidly (≥1.5 fold change compared with control) under water deficit, 2,665 genes were induced rapidly under water deficit + ABA pretreatment, and 279 genes overlapped between water deficit and water deficit + ABA pretreatment. Of the 279 overlapping genes, 264 showed the same expression pattern and 15 showed opposite expression patterns. Among the DEGs, 257 were highly induced (>5 fold) by water deficit + ABA pretreatment, while 19 were highly induced (>5 fold) by water deficit alone. The genes induced under water deficit + ABA pretreatment included 100 putative transcription factor (TF) genes, while those induced under water deficit alone included only 22 putative TF genes. To validate the transcriptome results, we conducted quantitative PCR (qPCR) analyses to quantify the transcript levels of nine

  14. Dexamethasone-induced expression of the glucocorticoid response gene lipocalin 2 in chondrocytes.


    Owen, H C; Roberts, S J; Ahmed, S F; Farquharson, C


    Glucocorticoids (GC) are commonly used anti-inflammatory drugs, but long-term use can result in marked growth retardation in children due to their actions on growth plate chondrocytes. To gain an insight into the mechanisms involved in GC-induced growth retardation, we performed Affymetrix microarray analysis of the murine chondrogenic cell line ATDC5, incubated with 10(-6) M dexamethasone (Dex) for 24 h. Downregulated genes included secreted frizzled-related protein and IGF-I, and upregulated genes included serum/GC-regulated kinase, connective-tissue growth factor, and lipocalin 2. Lipocalin 2 expression increased 40-fold after 24-h Dex treatment. Expression increased further after 48-h (75-fold) and 96-h (84-fold) Dex treatment, and this response was Dex concentration dependent. Lipocalin 2 was immunolocalized to both proliferating and hypertrophic growth plate zones, and its expression was increased by Dex in primary chondrocytes at 6 h (3-fold, P < 0.05). The lipocalin 2 response was blocked by the GC-receptor antagonist RU-486 and was increased further by the protein synthesis blocker cycloheximide. Proliferation in lipocalin 2-overexpressing cells was less than in control cells (49%, P < 0.05), and overexpression caused an increase in collagen type X expression (4-fold, P < 0.05). The effects of lipocalin 2 overexpression on chondrocyte proliferation (64%, P < 0.05) and collagen type X expression (8-fold, P < 0.05) were further exacerbated with the addition of 10(-6) M Dex. This synergistic effect may be explained by a further increase in lipocalin 2 expression with Dex treatment of transfected cells (45%, P < 0.05). These results suggest that lipocalin 2 may mediate Dex effects on chondrocytes and provides a potential novel mechanism for GC-induced growth retardation. PMID:18381927

  15. Functional characterization of blue-light-induced responses and PHOTOTROPIN 1 gene in Welwitschia mirabilis.


    Ishishita, Kazuhiro; Suetsugu, Noriyuki; Hirose, Yuki; Higa, Takeshi; Doi, Michio; Wada, Masamitsu; Matsushita, Tomonao; Gotoh, Eiji


    The blue light (BL) receptor phototropin (phot) is specifically found in green plants; it regulates various BL-induced responses such as phototropism, chloroplast movement, stomatal opening, and leaf flattening. In Arabidopsis thaliana, two phototropins--phot1 and phot2--respond to blue light in overlapping but distinct ways. These BL-receptor-mediated responses enhance the photosynthetic activity of plants under weak light and minimize photodamage under strong light conditions. Welwitschia mirabilis Hook.f. found in the Namib Desert, and it has adapted to severe environmental stresses such as limiting water and strong sunlight. Although the plant has physiologically and ecologically unique features, it is unknown whether phototropin is functional in this plant. In this study, we assessed the functioning of phot-mediated BL responses in W. mirabilis. BL-dependent phototropism and stomatal opening was observed but light-dependent chloroplast movement was not detected. We performed a functional analysis of the PHOT1 gene of W. mirabilis, WmPHOT1, in Arabidopsis thaliana. We generated transgenic A. thaliana lines expressing WmPHOT1 in a phot1 phot2 double mutant background. Several Wmphot1 transgenic plants showed normal growth, although phot1 phot2 double mutant plants showed stunted growth. Furthermore, Wmphot1 transgenic plants showed normal phot1-mediated responses including phototropism, chloroplast accumulation, stomatal opening, and leaf flattening, but lacked the chloroplast avoidance response that is specifically mediated by phot2. Thus, our findings indicate that W. mirabilis possesses typical phot-mediated BL responses that were at least partially mediated by functional phototropin 1, an ortholog of Atphot1. PMID:26858202

  16. Hypoxia-induced endothelial NO synthase gene transcriptional activation is mediated through the tax-responsive element in endothelial cells.


    Min, Jiho; Jin, Yoon-Mi; Moon, Je-Sung; Sung, Min-Sun; Jo, Sangmee Ahn; Jo, Inho


    Although hypoxia is known to induce upregulation of endothelial NO synthase (eNOS) gene expression, the underlying mechanism is largely unclear. In this study, we show that hypoxia increases eNOS gene expression through the binding of phosphorylated cAMP-responsive element binding (CREB) protein (pCREB) to the eNOS gene promoter. Hypoxia (1% O2) increased both eNOS expression and NO production, peaking at 24 hours, in bovine aortic endothelial cells, and these increases were accompanied by increases in pCREB. Treatment with the protein kinase A inhibitor H-89 or transfection with dominant-negative inhibitor of CREB reversed the hypoxia-induced increases in eNOS expression and NO production, with concomitant inhibition of the phosphorylation of CREB induced by hypoxia, suggesting an involvement of protein kinase A/pCREB-mediated pathway. To map the regulatory elements of the eNOS gene responsible for pCREB binding under hypoxia, we constructed an eNOS gene promoter (-1600 to +22 nucleotides) fused with a luciferase reporter gene [pGL2-eNOS(-1600)]. Hypoxia (for 24-hour incubation) increased the promoter activity by 2.36+/-0.18-fold in the bovine aortic endothelial cells transfected with pGL2-eNOS(-1600). However, progressive 5'-deletion from -1600 to -873 completely attenuated the hypoxia-induced increase in promoter activity. Electrophoretic mobility shift, anti-pCREB antibody supershift, and site-specific mutation analyses showed that pCREB is bound to the Tax-responsive element (TRE) site, a cAMP-responsive element-like site, located at -924 to -921 of the eNOS promoter. Our data demonstrate that the interaction between pCREB and the Tax-responsive element site within the eNOS promoter may represent a novel mechanism for the mediation of hypoxia-stimulated eNOS gene expression. PMID:16651461

  17. Cross-species comparison of genomewide gene expression profiles reveals induction of hypoxia-inducible factor-responsive genes in iron-deprived intestinal epithelial cells

    PubMed Central

    Hu, Zihua; Gulec, Sukru


    Molecular mechanisms mediating the induction of metal ion homeostasis-related genes in the mammalian intestine during iron deficiency remain unknown. To elucidate relevant regulatory pathways, genomewide gene expression profiles were determined in fully differentiated human intestinal epithelial (Caco-2) cells. Cells were deprived of iron (or not) for 6 or 18 h, and Gene Chip analyses were subsequently performed (Affymetrix). More than 2,000 genes were differentially expressed; genes related to monosaccharide metabolism, regulation of gene expression, hypoxia, and cell death were upregulated, while those related to mitotic cell cycle were downregulated. A large proportion of induced genes are hypoxia responsive, and promoter enrichment analyses revealed a statistical overrepresentation of hypoxia response elements (HREs). Immunoblot experiments demonstrated a >60-fold increase in HIF2α protein abundance in iron-deprived cells; HIF1α levels were unchanged. Furthermore, comparison of the Caco-2 cell data set with a Gene Chip data set from iron-deficient rat intestine revealed 29 common upregulated genes; the majority are hypoxia responsive, and their promoters are enriched for HREs. We conclude that the compensatory response of the intestinal epithelium to iron deprivation relates to hypoxia and that stabilization of HIF2α may be the primary event mediating metabolic and morphological changes observed during iron deficiency. PMID:20702690

  18. Immunogenic response induced by wzm and wzt gene deletion mutants from Brucella abortus S19.


    Wang, Xiu-Ran; Yan, Guang-Mou; Zhang, Rui; Lang, Xu-Long; Yang, Yan-Ling; Li, Xiao-Yan; Chen, Si; Qian, Jing; Wang, Xing-Long


    Brucellosis is an infectious disease affecting humans and animals worldwide. Effective methods of control include inducing immunity in animals by vaccination and elimination. Brucella abortus S19 is one of the popular vaccines for control of cattle brucellosis, as it has low virulence. In this paper, allelic exchange plasmids of wzm and wzt genes were constructed and partially knocked out to evaluate the effects on the induction of immunity to Brucella abortus S19 mutants. Cytokine secretion in vitro, INF-γ induction in vivo and antibody dynamics were evaluated. These data suggested that the immunity-eliciting ability of the wzm and wzt gene deletion mutants was similar, although reduced compared with the S19 strain. The results demonstrated that the wzt gene may be more important in the regulation of the induction of immunity than the wzm gene. PMID:24247358

  19. Stress-induced expression of NICOTINE2-locus genes and their homologs encoding Ethylene Response Factor transcription factors in tobacco.


    Shoji, Tsubasa; Hashimoto, Takashi


    Plants have evolved diverse defense metabolites as adaptations to biotic and abiotic stresses. The defense alkaloid nicotine is produced in Nicotiana tabacum (tobacco) and its biosynthesis is elicited by jasmonates in the roots. At least seven jasmonate-responsive genes that encode transcription factors of the Ethylene Response Factor (ERF) family are clustered at the nicotine-regulatory locus NICOTINE2 (NIC2) in the tobacco genome. A subset of the NIC2-locus ERFs and their homologs, including ERF189 and ERF199, have been shown to be most effective in controlling nicotine biosynthetic pathway genes. Herein reported is that the ERF genes of this group, other than ERF189 and ERF199, were strongly induced by NaCl in tobacco hairy roots, although salt stress had no effect on expression of nicotine biosynthesis genes. Abscisic acid and osmotic stress also increased expression of a subset of these NaCl-inducible ERF genes. Promoter expression analysis in transgenic tobacco hairy roots confirmed that while methyl jasmonate (MJ) activated the promoters of ERF29, ERF210 and ERF199, salt stress up-regulated the promoters of only ERF29 and ERF210, but not ERF199. The protein biosynthesis inhibitor cycloheximide induced expression of the ERFs, and simultaneous addition of MJ and cycloheximide showed synergistic effects. These results indicate that, after several gene duplication events, the NIC2-locus ERFs and possibly their homologs appear to have diverged in their responses to jasmonates and various environmental inputs, including salt stress, and may have evolved to regulate distinct metabolic processes and cellular responses. PMID:24947337

  20. Biological Characterization of Gene Response to Insulin-Induced Hypoglycemia in Mouse Retina

    PubMed Central

    Emery, Martine; Nanchen, Natacha; Preitner, Frédéric; Ibberson, Mark; Roduit, Raphaël


    Glucose is the most important metabolic substrate of the retina and maintenance of normoglycemia is an essential challenge for diabetic patients. Chronic, exaggerated, glycemic excursions could lead to cardiovascular diseases, nephropathy, neuropathy and retinopathy. We recently showed that hypoglycemia induced retinal cell death in mouse via caspase 3 activation and glutathione (GSH) decrease. Ex vivo experiments in 661W photoreceptor cells confirmed the low-glucose induction of death via superoxide production and activation of caspase 3, which was concomitant with a decrease of GSH content. We evaluate herein retinal gene expression 4 h and 48 h after insulin-induced hypoglycemia. Microarray analysis demonstrated clusters of genes whose expression was modified by hypoglycemia and we discuss the potential implication of those genes in retinal cell death. In addition, we identify by gene set enrichment analysis, three important pathways, including lysosomal function, GSH metabolism and apoptotic pathways. Then we tested the effect of recurrent hypoglycemia (three successive 4h periods of hypoglycemia spaced by 48 h recovery) on retinal cell death. Interestingly, exposure to multiple hypoglycemic events prevented GSH decrease and retinal cell death, or adapted the retina to external stress by restoring GSH level comparable to control situation. We hypothesize that scavenger GSH is a key compound in this apoptotic process, and maintaining “normal” GSH level, as well as a strict glycemic control, represents a therapeutic challenge in order to avoid side effects of diabetes, especially diabetic retinopathy. PMID:26918849

  1. Heterografting with nonself rootstocks induces genes involved in stress responses at the graft interface when compared with autografted controls

    PubMed Central

    Cookson, S. J.


    Although grafting is widely used in the agriculture of fruit-bearing crops, little is known about graft union formation in particular when two different species are grafted together. It is fascinating that two different plant species brought together can develop harmoniously as one organism for many decades. The objective of this study was to determine whether grafting two different grapevine genotypes alters gene expression at the graft interface in comparison to the presumably wound-like gene expression changes induced in autografts. Gene expression at the graft interface was studied 3, 7, 14, and 28 d after grafting in hetero- and autografts of grapevine (Vitis spp.). Genes differentially expressed between the hetero- and autografts during graft union formation were identified. These genes were clustered according to their expression profile over the time course. MapMan and Gene Ontology enrichment analysis revealed the coordinated upregulation of genes from numerous functional categories related to stress responses in the hetero- compared to the autografts. This indicates that heterografting with nonself rootstocks upregulates stress responses at the graft interface, potentially suggesting that the cells of the graft interface can detect the presence of a nonself grafting partner. PMID:24692649

  2. Adaptive Response of a Gene Network to Environmental Changes by Fitness-Induced Attractor Selection

    PubMed Central

    Kashiwagi, Akiko; Urabe, Itaru; Kaneko, Kunihiko; Yomo, Tetsuya


    Cells switch between various stable genetic programs (attractors) to accommodate environmental conditions. Signal transduction machineries efficiently convey environmental changes to the gene regulation apparatus in order to express the appropriate genetic program. However, since the number of environmental conditions is much larger than that of available genetic programs so that the cell may utilize the same genetic program for a large set of conditions, it may not have evolved a signaling pathway for every environmental condition, notably those that are rarely encountered. Here we show that in the absence of signal transduction, switching to the appropriate attractor state expressing the genes that afford adaptation to the external condition can occur. In a synthetic bistable gene switch in Escherichia coli in which mutually inhibitory operons govern the expression of two genes required in two alternative nutritional environments, cells reliably selected the “adaptive attractor” driven by gene expression noise. A mathematical model suggests that the “non-adaptive attractor” is avoided because in unfavorable conditions, cellular activity is lower, which suppresses mRNA metabolism, leading to larger fluctuations in gene expression. This, in turn, renders the non-adaptive state less stable. Although attractor selection is not as efficient as signal transduction via a dedicated cascade, it is simple and robust, and may represent a primordial mechanism for adaptive responses that preceded the evolution of signaling cascades for the frequently encountered environmental changes. PMID:17183678

  3. Sequence elements in the human osteocalcin gene confer basal activation and inducible response to hormonal vitamin D sub 3

    SciTech Connect

    Kerner, S.A.; Scott, R.A.; Pike, J.W. )


    Osteoblast-specific expression of the bone protein osteocalcin is controlled at the transcriptional level by the steroid hormone 1{alpha},25-dihydroxyvitamin D{sub 3}. As this protein may represent a marker for bone activity in human disease, the authors examined the regulation of its expression at the molecular level by evaluating human osteocalcin gene promoter function. They describe regions within the promoter that contribute to basal expression of the gene in osteoblast-like cells in culture. Further, they define a 21-base-pair DNA element with the sequence 5{prime}-GTGACTCACCGGGTGAACGGG-3{prime}, which acts in cis to mediate 1{alpha},25-dihydroxyvitamin D{sub 3} inducibility of the osteocalcin gene. This response element bears sequence similarity with other short DNA segments, particularly those for estrogen and thyroid hormone, which act together with their respective trans-acting receptors to modulate gene transcription.

  4. Marek's Disease Virus-Induced Immunosuppression: Array Analysis of Chicken Immune Response Gene Expression Profiling

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Marek’s disease (MD) is a lymphoproliferative disease of chickens induced by a highly cell-associated oncogenic alpha-herpesvirus, Marek’s disease virus (MDV). MDV replicates in chicken lymphocytes and establishes a latency infection within CD4+ T cells. Host-virus interaction, immune responses to...

  5. Two genes with similarity to bacterial response regulators are rapidly and specifically induced by cytokinin in Arabidopsis

    NASA Technical Reports Server (NTRS)

    Brandstatter, I.; Kieber, J. J.; Evans, M. L. (Principal Investigator)


    Cytokinins are central regulators of plant growth and development, but little is known about their mode of action. By using differential display, we identified a gene, IBC6 (for induced by cytokinin), from etiolated Arabidopsis seedlings, that is induced rapidly by cytokinin. The steady state level of IBC6 mRNA was elevated within 10 min by the exogenous application of cytokinin, and this induction did not require de novo protein synthesis. IBC6 was not induced by other plant hormones or by light. A second Arabidopsis gene with a sequence highly similar to IBC6 was identified. This IBC7 gene also was induced by cytokinin, although with somewhat slower kinetics and to a lesser extent. The pattern of expression of the two genes was similar, with higher expression in leaves, rachises, and flowers and lower transcript levels in roots and siliques. Sequence analysis revealed that IBC6 and IBC7 are similar to the receiver domain of bacterial two-component response regulators. This homology, coupled with previously published work on the CKI1 histidine kinase homolog, suggests that these proteins may play a role in early cytokinin signaling.

  6. Insulin signaling genes modulate nicotine-induced behavioral responses in Caenorhabditis elegans.


    Wescott, Seth A; Ronan, Elizabeth A; Xu, X Z Shawn


    Insulin signaling has been suggested to modulate nicotine dependence, but the underlying genetic evidence has been lacking. Here, we used the nematode, Caenorhabditis elegans, to investigate whether genetic alterations in the insulin signaling pathway affect behavioral responses to nicotine. For this, we challenged drug-naive C. elegans with an acute dose of nicotine (100 μmol/l) while recording changes in their locomotion speed. Although nicotine treatment stimulated locomotion speed in wild-type C. elegans, the same treatment reduced locomotion speed in mutants defective in insulin signaling. This phenotype could be suppressed by mutations in daf-16, a gene encoding a FOXO transcription factor that acts downstream of insulin signaling. Our data suggest that insulin signaling genes, daf-2, age-1, pdk-1, akt-1, and akt-2, modulate behavioral responses to nicotine in C. elegans, indicating a genetic link between nicotine behavior and insulin signaling. PMID:26317299

  7. Coregulation of host-response genes in integument: switchover of gene expression correlation pattern and impaired immune responses induced by dipteran parasite infection in the silkworm, Bombyx mori.


    Jayaram, Anitha; Pradeep, Appukuttan Nair R; Awasthi, Arvind K; Murthy, Geetha N; Ponnuvel, Kangayam M; Sasibhushan, Sirigineedi; Rao, Guruprasad C


    The activation of host response proteins against parasitic infection is dependent on the coregulation of immune gene expression. The infection of commercially important silkworm Bombyx mori through endoparasite Exorista bombycis enhanced host-response gene expression in integument early in the infection and was lowered asymptotically. Principal component analysis (PCA) showed heterogeneity while explaining ∼80 % variance among expression timings. PCA showed positive and negative correlation with gene expression and differentiated transcriptional timings, and revealed cross talk within the immune system. Pearson correlation analysis showed significant linear correlation (mean R (2) = >0.7; P < 0.004) between the expression of 16 pairs of genes in control, while the relation switched over to curvilinear due to parasitism. The genes showed pleiotropic interaction among them, with four genes each for prophenoloxidase activating enzyme (PPAE) and caspase. Besides, after parasitism, exclusive correlation of five gene pairs including PPAE-Spatzle pair (R (2) = 0.9; P < 0.011) was observed in the integument. In integument, the phenol oxidase (PO) activity showed a positive correlation with the tyrosine level (R (2) = 0.410; P < 0.002) and a curvilinear relation (R (2) = 0.745; P < 0.0002) with the expanding lysis area. The PO activity was positively correlated with BmToll expression and negatively correlated with paralytical peptide expression, revealing polygenic influence. Caspase expression was tightly regulated by signal genes in control integument, whereas they were deregulated after infection. Switchover from linear to curvilinear correlation and the appearance of new gene correlations in parasitized integument revealed deviation from gene coregulation, leading to impaired immune responses, characterized by lowered gene expression and varied phenotypic consequences. PMID:24310719

  8. A Nutrigenomic Framework to Identify Time-Resolving Responses of Hepatic Genes in Diet-Induced Obese Mice

    PubMed Central

    Heo, Hyoung-Sam; Kim, Eunjung; Jeon, Seon-Min; Kwon, Eun-Young; Shin, Su-Kyung; Paik, Hyojung; Hur, Cheol-Goo; Choi, Myung-Sook


    Obesity and its related complications have emerged as global health problems; however, the pathophysiological mechanism of obesity is still not fully understood. In this study, C57BL/6J mice were fed a normal (ND) or high-fat diet (HFD) for 0, 2, 4, 6, 8, 12, 20, and 24 weeks and the time course was systemically analyzed specifically for the hepatic transcriptome profile. Genes that were differentially expressed in the HFD-fed mice were clustered into 49 clusters and further classified into 8 different expression patterns: long-term up-regulated (pattern 1), long-term down-regulated (pattern 2), early up-regulated (pattern 3), early down-regulated (pattern 4), late up-regulated (pattern 5), late down-regulated (pattern 6), early up-regulated and late down-regulated (pattern 7), and early down-regulated and late up-regulated (pattern 8) HFD-responsive genes. Within each pattern, genes related with inflammation, insulin resistance, and lipid metabolism were extracted, and then, a protein-protein interaction network was generated. The pattern specific sub-network was as follows: pattern 1, cellular assembly and organization, and immunological disease, pattern 2, lipid metabolism, pattern 3, gene expression and inflammatory response, pattern 4, cell signaling, pattern 5, lipid metabolism, molecular transport, and small molecule biochemistry, pattern 6, protein synthesis and cell-to cell signaling and interaction and pattern 7, cell-to cell signaling, cellular growth and proliferation, and cell death. For pattern 8, no significant sub-networks were identified. Taken together, this suggests that genes involved in regulating gene expression and inflammatory response are up-regulated whereas genes involved in lipid metabolism and protein synthesis are down-regulated during diet-induced obesity development. PMID:23813319

  9. Use of Hydroxyapatite Doping to Enhance Responsiveness of Heat-Inducible Gene Switches to Focused Ultrasound.


    Fabiilli, Mario L; Phanse, Rahul A; Moncion, Alexander; Fowlkes, J Brian; Franceschi, Renny T


    Recently, we demonstrated that ultrasound-based hyperthermia can activate cells containing a heat-activated and ligand-inducible gene switch in a spatio-temporally controlled manner. These engineered cells can be incorporated into hydrogel scaffolds (e.g., fibrin) for in vivo implantation, where ultrasound can be used to non-invasively pattern transgene expression. Due to their high water content, the acoustic attenuation of fibrin scaffolds is low. Thus, long ultrasound exposures and high acoustic intensities are needed to generate sufficient hyperthermia for gene activation. Here, we demonstrate that the attenuation of fibrin scaffolds and the resulting hyperthermia achievable with ultrasound can be increased significantly by doping the fibrin with hydroxyapatite (HA) nanopowder. The attenuation of a 1% (w/v) fibrin scaffold with 5% (w/v) HA was similar to soft tissue. Transgene activation of cells harboring the gene switch occurred at lower acoustic intensities and shorter exposures when the cells were encapsulated in HA-doped fibrin scaffolds versus undoped scaffolds. Inclusion of HA in the fibrin scaffold did not affect the viability of the encapsulated cells. PMID:26712417

  10. Influence of E. coli-induced Prostatic Inflammation on Expression of Androgen-Responsive Genes and Transforming Growth Factor Beta 1 Cascade Genes in Rats

    PubMed Central

    Funahashi, Yasuhito; Wang, Zhou; O’Malley, Katherine J.; Tyagi, Pradeep; DeFranco, Donald B.; Gingrich, Jeffrey R.; Takahashi, Ryosuke; Majima, Tsuyoshi; Gotoh, Momokazu; Yoshimura, Naoki


    Background Prostatic inflammation is reportedly associated with the development of prostatic hyperplasia. We investigated the effects of prostatic inflammation on expression levels of androgen-responsive genes and growth factors in the rat prostate. Methods Prostatic inflammation was induced by Escherichia coli (strain 1677) injection (0.2 mL of 1 × 108 CFU/mL) into the prostatic urethra of male Sprague-Dawley rats, and ventral lobes of the prostate were harvested on day 84. Rats were given 10 mg/kg celecoxib during the last month in the COX-2 inhibitor treated group. Histopathology and multiplex ELISA for inflammation-related proteins were performed. Glandular epithelial cells and stromal regions were separately isolated using laser-capture microdissection (LCM). Real-time RT-PCR was performed to examine mRNA levels of androgen-responsive genes in the epithelium and TGF-β1 cascade genes in the stroma. Results Hematoxylin and eosin staining showed that mild inflammation was distributed diffusely throughout the prostate. Polymorphonuclear cells infiltrated the slightly edematous stroma, but no morphological changes were observed in the epithelium. Immunohistochemically, expression of androgen receptor and TGF-β1 in addition to IL-6 and COX-2 were enhanced in the E. coli inoculated rats. All of these factors were suppressed in the celecoxib-treated rats. Upregulation of IL-1α, IL-1β, IL-6, and RANTES in the E. coli-inoculated rats was normalized by celecoxib treatment. Significant upregulation of androgen receptor and androgen-responsive genes such as Eaf2, ELL2, FKBP5, calreticulin and ornithine decarboxylase was observed in the LCM-dissected epithelium. Also TGF-β1 and its downstream cascade genes such as Hic-5, collagen 1, and fibronectin were upregulated significantly in the LCM-dissected stroma. The COX-2 inhibitor treatment suppressed upregulation of these genes. Conclusions Prostatic inflammation changed the expression of androgen-responsive genes in the

  11. A copper-induced metallothionein gene from Exopalaemon carinicauda and its response to heavy metal ions.


    Zhang, Jiquan; Wang, Jing; Gui, Tianshu; Sun, Zheng; Xiang, Jianhai


    A full-length copper-induced metallothionein (EcMT-Cu) cDNA was obtained from Exopalaemon carinicauda (Holthuis) and it contained a 198 bp open reading frame that encoded a peptide with 65 amino acid residues. Twenty-one cysteines were found in deduced amino acid sequence and the cysteine (Cys)-rich characteristic was also reported in different types of metallothioneins from other species. EcMT-Cu mRNA expression profile showed that it is the hepatopancreas specific gene. The expression of EcMT-Cu was extremely different when shrimp were exposed to seawater containing 50 μM CuSO4 or 2.5 μM CdCl2. The expression of EcMT-Cu in shrimp was significantly up-regulated at 12 and 24 h after exposure to CuSO4, however, its expression was not induced compared to that of pretreatment (p>0.05) when shrimp were exposed to CdCl2. The transcript of EcMT-Cu was found to be extremely low at gastrula and nauplius stage and expression of EcMT-Cu could be detected from egg protozoa stage. PMID:24971556

  12. Gene-metabolite expression in blood can discriminate allergen-induced isolated early from dual asthmatic responses.


    Singh, Amrit; Yamamoto, Masatsugu; Kam, Sarah H Y; Ruan, Jian; Gauvreau, Gail M; O'Byrne, Paul M; FitzGerald, J Mark; Schellenberg, Robert; Boulet, Louis-Philippe; Wojewodka, Gabriella; Kanagaratham, Cynthia; De Sanctis, Juan B; Radzioch, Danuta; Tebbutt, Scott J


    Some asthmatic individuals undergoing allergen inhalation challenge develop an isolated early response whereas others develop a dual response (early plus late response). In the present study we have used transcriptomics (microarrays) and metabolomics (mass spectrometry) of peripheral blood to identify molecular patterns that can discriminate allergen-induced isolated early from dual asthmatic responses. Peripheral blood was obtained prior to (pre-) and 2 hours post allergen inhalation challenge from 33 study participants. In an initial cohort of 14 participants, complete blood counts indicated significant differences in neutrophil and lymphocyte counts at pre-challenge between early and dual responders. At post-challenge, significant genes (ALOX15, FADS2 and LPCAT2) and metabolites (lysolipids) were enriched in lipid metabolism pathways. Enzymes encoding for these genes are involved in membrane biogenesis and metabolism of fatty acids into pro-inflammatory and anti-inflammatory mediators. Correlation analysis indicated a strong negative correlation between ALOX15, FADS2, and IL5RA expression with 2-arachidonoylglycerophosphocholine levels in dual responders. However, measuring arachidonic acid and docosahexaenoic acid levels in a validation cohort of 19 participants indicated that the free form of DHA (nmoles/µg of protein) was significantly (p = 0.03) different between early and dual responders after allergen challenge. Collectively these results may suggest an imbalance in lipid metabolism which dictates pro- (anti-) inflammatory and pro-resolving mechanisms. Future studies with larger sample sizes may reveal novel mechanisms and therapeutic targets of the late phase asthmatic response. PMID:23844124

  13. Study of fibroblast gene expression in response to oxidative stress induced by hydrogen peroxide or UVA with skin aging.


    Hazane-Puch, Florence; Bonnet, Mathilde; Valenti, Kita; Schnebert, Sylvianne; Kurfurst, Robin; Favier, Alain; Sauvaigo, Sylvie


    The skin aging process, implying oxidative stress, is associated with specific gene expression. Ultraviolet A (UVA) and hydrogen peroxide (H(2)O(2)) both generate reactive oxygen species (ROS) making them relevant in the study of skin cell responses to oxidative stresses. To investigate transcript expression associated with chronological skin aging and its modulation by two oxidative stresses, cDNA micro-arrays, composed of a set of 81 expressed sequence tag (EST) clones, were used to probe the patterns of transcript expression in human fibroblasts of five young (< 21 years-old) and five older (> 50 years-old) healthy females at basal levels and 24 h after exposure to UVA (7 J/cm2) and H(2)O(2) (20 mM). At the basal state, 22% of total genes were up-regulated in the older group. Although both stresses led to the same cell mortality, H(2)O(2) induced a stronger modulation of gene expression than UVA, with 19.5% of transcripts up-regulated versus 4%. The aging process affected the response to H(2)O(2) and even though cells from old donors presented higher basal levels of transcripts they were not able to regulate them in response to the stress. Interestingly, UVA had a specific strong inhibitory effect on the expression of chemokine (C-C) motif ligand 2 (CCL2) transcript, suggesting a possible mechanism for its anti-inflammatory and immunoregulatory roles. PMID:20299309

  14. Francisella tularensis subsp. tularensis Induces a Unique Pulmonary Inflammatory Response: Role of Bacterial Gene Expression in Temporal Regulation of Host Defense Responses

    PubMed Central

    Walters, Kathie-Anne; Olsufka, Rachael; Kuestner, Rolf E.; Cho, Ji Hoon; Li, Hong; Zornetzer, Gregory A.; Wang, Kai; Skerrett, Shawn J.; Ozinsky, Adrian


    Pulmonary exposure to Francisella tularensis is associated with severe lung pathology and a high mortality rate. The lack of induction of classical inflammatory mediators, including IL1-β and TNF-α, during early infection has led to the suggestion that F. tularensis evades detection by host innate immune surveillance and/or actively suppresses inflammation. To gain more insight into the host response to Francisella infection during the acute stage, transcriptomic analysis was performed on lung tissue from mice exposed to virulent (Francisella tularensis ssp tularensis SchuS4). Despite an extensive transcriptional response in the lungs of animals as early as 4 hrs post-exposure, Francisella tularensis was associated with an almost complete lack of induction of immune-related genes during the initial 24 hrs post-exposure. This broad subversion of innate immune responses was particularly evident when compared to the pulmonary inflammatory response induced by other lethal (Yersinia pestis) and non-lethal (Legionella pneumophila, Pseudomonas aeruginosa) pulmonary infections. However, the unique induction of a subset of inflammation-related genes suggests a role for dysregulation of lymphocyte function and anti-inflammatory pathways in the extreme virulence of Francisella. Subsequent activation of a classical inflammatory response 48 hrs post-exposure was associated with altered abundance of Francisella-specific transcripts, including those associated with bacterial surface components. In summary, virulent Francisella induces a unique pulmonary inflammatory response characterized by temporal regulation of innate immune pathways correlating with altered bacterial gene expression patterns. This study represents the first simultaneous measurement of both host and Francisella transcriptome changes that occur during in vivo infection and identifies potential bacterial virulence factors responsible for regulation of host inflammatory pathways. PMID:23690939

  15. Adenovirus vector induced Innate Immune responses: Impact upon efficacy and toxicity in gene therapy and vaccine applications

    PubMed Central

    Hartman, Zachary C.; Appledorn, Daniel M.; Amalfitano, Andrea


    Extensively characterized, modified, and employed for a variety of purposes, Adenovirus (Ad) vectors are generally regarded as having great potential by many applied virologists who wish to manipulate and use viral biology to achieve beneficial clinical outcomes. Despite widespread functional prominence and utility, (i.e.: Ad based clinical trials have begun to progress to critical Phase III levels, it has recently become apparent that investigations regarding the innate immune response to Ads may reveal not only reasons behind previous failures, but also reveal novel insights that will allow for safer, more efficacious uses of this important gene transfer platform. Insights gained by the exploration of Ad induced innate immune responses will likely be most important to the fields of vaccine development, since Ad based vaccines are highly acknowledged as one of the more promising vaccine platforms in development today. Adenovirus is currently known to interact with several different extracellular, intracellular, and membrane bound innate immune sensing systems. Past and recent studies involving manipulation of the Ad infectious cycle as well as use of different mutants have shed light on some of the initiation mechanisms underlying Ad induced immune responses. More recent studies using microarray based analyses, genetically modified cell lines and/or mouse mutants, and advanced generation Ad vectors have revealed important new insights into the scope and mechanism of this cellular defensive response. This review is an attempt to synthesize these studies, update Ad biologists to the current knowledge surrounding these increasingly important issues, as well point areas where future research should be directed. It should also serve as a sobering reality to researchers exploring the use of any gene transfer vector, as to the complexities potentially involved when contemplating use of such vectors for human applications. PMID:18036698

  16. PGC-1alpha induces dynamic protein interactions on the ERRalpha gene multi-hormone response element nucleosome in kidney cells.


    Wang, Liangli; Li, Yin; Hu, Peng; Teng, Christina T


    ERR (oestrogen-related receptor)-alpha modulates the oestrogen signalling pathway and regulates genes participating in the physiological energy balance programme. Oestrogen and PGC-1alpha (peroxisome proliferator-activated receptor-gamma coactivator-1alpha), the master regulator of the energy homoeostasis programme, both regulate the expression of ERRalpha through the MHRE (multi-hormone response element) of the ERRalpha gene. Although the molecular mechanism of oestrogen action on ERRalpha regulation is well characterized, the mechanism of PGC-1alpha induction is unclear. In this study, we examine chromatin structural changes and protein interactions at the MHRE nucleosome in response to PGC-1alpha expression in HK2 human kidney cells. We mapped the nucleosome positions of the ERRalpha gene promoter and examined the changes of histone acetylation in response to PGC-1alpha expression. The interactions of DNA-binding proteins, ERRalpha and ERRgamma, co-activators {CBP [CREB (cAMP-response-element-binding protein)-binding protein], p300, PCAF (p300/CBP-associated factor)}, co-repressor [RIP140 (receptor-interacting protein of 140 kDa)] and RNA polymerase II at the MHRE nucleosome region were investigated over time before and after PGC-1alpha expression in the HK2 cells. We found a dynamic cyclic interaction of these proteins shortly after PGC-1alpha expression and a slower cycling interaction, with fewer proteins involved, 20 h later. By using the siRNA (small interfering RNA) knockdown approach, we discovered that ERRgamma was involved in the initial phase, but not in the later phase, of PGC-1alpha-induced ERRalpha expression. PMID:18673300

  17. Gene Expression Profile Changes and Cellular Responses to Bleomycin-Induced DNA Damage in Human Fibroblast Cells in Space

    NASA Technical Reports Server (NTRS)

    Lu, Tao; Zhang, Ye; Kidane, Yared; Feiveson, Alan; Stodieck, Louis; Karouia, Fathi; Rohde, Larry; Wu, Honglu


    Living organisms are constantly exposed to space radiation that consists of energetic protons and other heavier charged particles. In addition, DNA in space can be damaged by toxic chemicals or reactive oxygen species generated due to increased levels of environmental and psychological stresses. Understanding the impact of spaceflight factors, microgravity in particular, on cellular responses to DNA damage affects the accuracy of the radiation risk assessment for astronauts and the mutation rate in microorganisms. Although possible synergistic effects of space radiation and microgravity have been investigated since the early days of the human space program, the published results were mostly conflicting and inconsistent. To investigate the effects of spaceflight on cellular responses to DNA damage, confluent human fibroblast cells (AG1522) flown on the International Space Station (ISS) were treated with bleomycin for three hours in the true microgravity environment, which induced DNA damages including double-strand breaks (DSB). Damages in the DNA were quantified by immunofluorescence staining for ?-H2AX, which showed similar percentages of different types of stained cells between flight and ground. However, there was a slight shift in the distribution of the ?-H2AX foci number in the flown cells with countable foci. Comparison of the cells in confluent and in exponential growth conditions indicated that the proliferation rate between flight and the ground may be responsible for such a shift. A microarray analysis of gene expressions in response to bleomycin treatment was also performed. Comparison of the responsive pathways between the flown and ground cells showed similar responses with the p53 network being the top upstream regulator. Similar responses at the RNA level between different gravity conditions were also observed with a PCR array analysis containing a set of genes involved in DNA damage signaling; with BBC3, CDKN1A, PCNA and PPM1D being significantly

  18. Cadmium-induced ethylene production and responses in Arabidopsis thaliana rely on ACS2 and ACS6 gene expression

    PubMed Central


    Background Anthropogenic activities cause metal pollution worldwide. Plants can absorb and accumulate these metals through their root system, inducing stress as a result of excess metal concentrations inside the plant. Ethylene is a regulator of multiple plant processes, and is affected by many biotic and abiotic stresses. Increased ethylene levels have been observed after exposure to excess metals but it remains unclear how the increased ethylene levels are achieved at the molecular level. In this study, the effects of cadmium (Cd) exposure on the production of ethylene and its precursor 1-aminocyclopropane-1-carboxylic acid (ACC), and on the expression of the ACC Synthase (ACS) and ACC Oxidase (ACO) multigene families were investigated in Arabidopsis thaliana. Results Increased ethylene release after Cd exposure was directly measurable in a system using rockwool-cultivated plants; enhanced levels of the ethylene precursor ACC together with higher mRNA levels of ethylene responsive genes: ACO2, ETR2 and ERF1 also indicated increased ethylene production in hydroponic culture. Regarding underlying mechanisms, it was found that the transcript levels of ACO2 and ACO4, the most abundantly expressed members of the ACO multigene family, were increased upon Cd exposure. ACC synthesis is the rate-limiting step in ethylene biosynthesis, and transcript levels of both ACS2 and ACS6 showed the highest increase and became the most abundant isoforms after Cd exposure, suggesting their importance in the Cd-induced increase of ethylene production. Conclusions Cadmium induced the biosynthesis of ACC and ethylene in Arabidopsis thaliana plants mainly via the increased expression of ACS2 and ACS6. This was confirmed in the acs2-1acs6-1 double knockout mutants, which showed a decreased ethylene production, positively affecting leaf biomass and resulting in a delayed induction of ethylene responsive gene expressions without significant differences in Cd contents between wild-type and

  19. DNA damage-responsive Drosophila melanogaster gene is also induced by heat shock

    SciTech Connect

    Vivino, A.A.; Smith, M.D.; Minton, K.W.


    A gene isolated by screening Drosophila melanogaster tissue culture cells for DNA damage regulation was also found to be regulated by heat shock. After UV irradiation or heat shock, induction is at the transcriptional level and results in the accumulation of a 1.0-kilobase polyadenylated transcript. The restriction map of the clone bears no resemblance to the known heat shock genes, which are shown to be uninduced by UV irradiation.

  20. Promoter structures and differential responses to viral and non-viral inducers of chicken melanoma differentiation-associated gene 5.


    Zhang, Wen-Xin; Zuo, Er-Wei; He, Ying; Chen, Dong-Yang; Long, Xie; Chen, Mei-Juan; Li, Ting-Ting; Yang, Xiao-Gan; Xu, Hui-Yan; Lu, Sheng-Sheng; Zhang, Ming; Lu, Ke-Huan; Lu, Yang-Qing


    Melanoma differentiation-associated gene 5 (MDA5) is a member of the retinoic acid-inducible gene I (RIG-I)-like receptors (RLRs) family and plays a pivotal role in the anti-viral innate immune response. As RIG-I is absent in chickens, MDA5 is hypothesized to be important in detecting viral nucleic acids in the cytoplasm. However, the molecular mechanism of the regulation of chicken MDA5 (chMDA5) expression has yet to be fully elucidated. With this in mind, a ∼2.5kb chMDA5 gene promoter region was examined and PCR amplified to assess its role in immune response. A chMDA5 promoter reporter plasmid (piggybac-MDA5-DsRed) was constructed and transfected into DF-1 cells to establish a Piggybac-MDA5-DsRed cell line. The MDA5 promoter activity was extremely low under basal condition, but was dramatically increased when cells were stimulated with polyinosinic: polycytidylic acid (poly I:C), interferon beta (IFN-β) or Infectious Bursal Disease Virus (IBDV). The DsRed mRNA level represented the promoter activity and was remarkably increased, which matched the expression of endogenous MDA5. However, Infectious Bronchitis Virus (IBV) and Newcastle disease virus (NDV) failed to increase the MDA5 promoter activity and the expression of endogenous MDA5. The results indicated that the promoter and the Piggybac-MDA5-DsRed cell line could be utilized to determine whether a ligand regulates MDA5 expression. For the first time, this study provides a tool for testing chMDA5 expression and regulation. PMID:27327127

  1. HLA class II genes modulate vaccine-induced antibody responses to affect HIV-1 acquisition.


    Prentice, Heather A; Tomaras, Georgia D; Geraghty, Daniel E; Apps, Richard; Fong, Youyi; Ehrenberg, Philip K; Rolland, Morgane; Kijak, Gustavo H; Krebs, Shelly J; Nelson, Wyatt; DeCamp, Allan; Shen, Xiaoying; Yates, Nicole L; Zolla-Pazner, Susan; Nitayaphan, Sorachai; Rerks-Ngarm, Supachai; Kaewkungwal, Jaranit; Pitisuttithum, Punnee; Ferrari, Guido; McElrath, M Juliana; Montefiori, David C; Bailer, Robert T; Koup, Richard A; O'Connell, Robert J; Robb, Merlin L; Michael, Nelson L; Gilbert, Peter B; Kim, Jerome H; Thomas, Rasmi


    In the RV144 vaccine trial, two antibody responses were found to correlate with HIV-1 acquisition. Because human leukocyte antigen (HLA) class II-restricted CD4(+) T cells are involved in antibody production, we tested whether HLA class II genotypes affected HIV-1-specific antibody levels and HIV-1 acquisition in 760 individuals. Indeed, antibody responses correlated with acquisition only in the presence of single host HLA alleles. Envelope (Env)-specific immunoglobulin A (IgA) antibodies were associated with increased risk of acquisition specifically in individuals with DQB1*06. IgG antibody responses to Env amino acid positions 120 to 204 were higher and were associated with decreased risk of acquisition and increased vaccine efficacy only in the presence of DPB1*13. Screening IgG responses to overlapping peptides spanning Env 120-204 and viral sequence analysis of infected individuals defined differences in vaccine response that were associated with the presence of DPB1*13 and could be responsible for the protection observed. Overall, the underlying genetic findings indicate that HLA class II modulated the quantity, quality, and efficacy of antibody responses in the RV144 trial. PMID:26180102

  2. HLA class II genes modulate vaccine-induced antibody responses to affect HIV-1 acquisition

    PubMed Central

    Prentice, Heather A.; Tomaras, Georgia D.; Geraghty, Daniel E.; Apps, Richard; Fong, Youyi; Ehrenberg, Philip K.; Rolland, Morgane; Kijak, Gustavo H.; Krebs, Shelly J.; Nelson, Wyatt; DeCamp, Allan; Shen, Xiaoying; Yates, Nicole L.; Zolla-Pazner, Susan; Nitayaphan, Sorachai; Rerks-Ngarm, Supachai; Kaewkungwal, Jaranit; Pitisuttithum, Punnee; Ferrari, Guido; Juliana McElrath, M.; Montefiori, David C.; Bailer, Robert T.; Koup, Richard A.; O’Connell, Robert J.; Robb, Merlin L.; Michael, Nelson L.; Gilbert, Peter B.; Kim, Jerome H.; Thomas, Rasmi


    In the RV144 vaccine trial, two antibody responses were found to correlate with HIV-1 acquisition. Because human leukocyte antigen (HLA) class II–restricted CD4+ T cells are involved in antibody production, we tested whether HLA class II genotypes affected HIV-1–specific antibody levels and HIV-1 acquisition in 760 individuals. Indeed, antibody responses correlated with acquisition only in the presence of single host HLA alleles. Envelope (Env)–specific immunoglobulin A (IgA) antibodies were associated with increased risk of acquisition specifically in individuals with DQB1*06. IgG antibody responses to Env amino acid positions 120 to 204 were higher and were associated with decreased risk of acquisition and increased vaccine efficacy only in the presence of DPB1*13. Screening IgG responses to overlapping peptides spanning Env 120–204 and viral sequence analysis of infected individuals defined differences in vaccine response that were associated with the presence of DPB1*13 and could be responsible for the protection observed. Overall, the underlying genetic findings indicate that HLA class II modulated the quantity, quality, and efficacy of antibody responses in the RV144 trial. PMID:26180102

  3. BET Inhibition Attenuates Helicobacter pylori-Induced Inflammatory Response by Suppressing Inflammatory Gene Transcription and Enhancer Activation.


    Chen, Jinjing; Wang, Zhen; Hu, Xiangming; Chen, Ruichuan; Romero-Gallo, Judith; Peek, Richard M; Chen, Lin-Feng


    Helicobacter pylori infection causes chronic gastritis and peptic ulceration. H. pylori-initiated chronic gastritis is characterized by enhanced expression of many NF-κB-regulated inflammatory cytokines. Brd4 has emerged as an important NF-κB regulator and regulates the expression of many NF-κB-dependent inflammatory genes. In this study, we demonstrated that Brd4 was not only actively involved in H. pylori-induced inflammatory gene mRNA transcription but also H. pylori-induced inflammatory gene enhancer RNA (eRNA) synthesis. Suppression of H. pylori-induced eRNA synthesis impaired H. pylori-induced mRNA synthesis. Furthermore, H. pylori stimulated NF-κB-dependent recruitment of Brd4 to the promoters and enhancers of inflammatory genes to facilitate the RNA polymerase II-mediated eRNA and mRNA synthesis. Inhibition of Brd4 by JQ1 attenuated H. pylori-induced eRNA and mRNA synthesis for a subset of NF-κB-dependent inflammatory genes. JQ1 also inhibited H. pylori-induced interaction between Brd4 and RelA and the recruitment of Brd4 and RNA polymerase II to the promoters and enhancers of inflammatory genes. Finally, we demonstrated that JQ1 suppressed inflammatory gene expression, inflammation, and cell proliferation in H. pylori-infected mice. These studies highlight the importance of Brd4 in H. pylori-induced inflammatory gene expression and suggest that Brd4 could be a potential therapeutic target for the treatment of H. pylori-triggered inflammatory diseases and cancer. PMID:27084101

  4. Loss of the starvation-induced gene Rack1 leads to glycogen deficiency and impaired autophagic responses in Drosophila

    PubMed Central

    Érdi, Balázs; Nagy, Péter; Zvara, Ágnes; Varga, Ágnes; Pircs, Karolina; Ménesi, Dalma; Puskás, László G.; Juhász, Gábor


    Autophagy delivers cytoplasmic material for lysosomal degradation in eukaryotic cells. Starvation induces high levels of autophagy to promote survival in the lack of nutrients. We compared genome-wide transcriptional profiles of fed and starved control, autophagy-deficient Atg7 and Atg1 null mutant Drosophila larvae to search for novel regulators of autophagy. Genes involved in catabolic processes including autophagy were transcriptionally upregulated in all cases. We also detected repression of genes involved in DNA replication in autophagy mutants compared with control animals. The expression of Rack1 (receptor of activated protein kinase C 1) increased 4.1- to 5.5-fold during nutrient deprivation in all three genotypes. The scaffold protein Rack1 plays a role in a wide range of processes including translation, cell adhesion and migration, cell survival and cancer. Loss of Rack1 led to attenuated autophagic response to starvation, and glycogen stores were decreased 11.8-fold in Rack1 mutant cells. Endogenous Rack1 partially colocalized with GFP-Atg8a and early autophagic structures on the ultrastructural level, suggesting its involvement in autophagosome formation. Endogenous Rack1 also showed a high degree of colocalization with glycogen particles in the larval fat body, and with Shaggy, the Drosophila homolog of glycogen synthase kinase 3B (GSK-3B). Our results, for the first time, demonstrated the fundamental role of Rack1 in autophagy and glycogen synthesis. PMID:22562043

  5. The tobacco Cel7 gene promoter is auxin-responsive and locally induced in nematode feeding sites of heterologous plants

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Emerging evidence suggests that plant cell wall modifying enzymes induced by root-parasitic nematodes play important roles in feeding cell formation. We previously identified a tobacco endo-B-1,4-glucanase (cellulase) gene, NtCel7, that was strongly induced in both root-knot and cyst nematode feedi...

  6. Immune responses induced by DNA vaccines bearing Spike gene of PEDV combined with porcine IL-18

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Porcine epidemic diarrhea virus (PEDV) is the causative agent of porcine epidemic diarrhea, a highly contagious enteric disease of swine. The Spike (S) protein is one of the main structural proteins of PEDV capable of inducing neutralizing antibodies in vivo. Herein, we generated three distinct DNA ...

  7. "Bad genes" & criminal responsibility.


    González-Tapia, María Isabel; Obsuth, Ingrid


    The genetics of the accused is trying to break into the courts. To date several candidate genes have been put forward and their links to antisocial behavior have been examined and documented with some consistency. In this paper, we focus on the so called "warrior gene", or the low-activity allele of the MAOA gene, which has been most consistently related to human behavior and specifically to violence and antisocial behavior. In preparing this paper we had two objectives. First, to summarize and analyze the current scientific evidence, in order to gain an in depth understanding of the state of the issue and determine whether a dominant line of generally accepted scientific knowledge in this field can be asserted. Second, to derive conclusions and put forward recommendations related to the use of genetic information, specifically the presence of the low-activity genotype of the MAOA gene, in modulation of criminal responsibility in European and US courts. PMID:25708001

  8. Regulation of glutathione S-transferase Ya subunit gene expression: identification of a unique xenobiotic-responsive element controlling inducible expression by planar aromatic compounds.

    PubMed Central

    Rushmore, T H; King, R G; Paulson, K E; Pickett, C B


    We have identified a region in the 5' flanking sequence of the glutathione S-transferase (RX:glutathione R-transferase, EC Ya subunit gene that contains a unique xenobiotic-responsive element (XRE). The regulatory region spans nucleotides -722 to -682 of the 5' flanking sequence and is responsible for part of the basal level as well as inducible expression of the Ya subunit gene by planar aromatic compounds such as beta-naphthoflavone (beta-NF) and 3-methyl-cholanthrene. The DNA sequence of this region (beta-NF-responsive element) is distinct from the DNA sequence of the XRE found in the cytochrome P-450 IA1 gene. In addition to the region containing the beta-NF-responsive element, two other regulatory regions of the Ya subunit gene have been identified. One region spans nucleotides -867 to -857 and has a DNA sequence with identity to the hepatocyte nuclear factor 1 recognition motif found in several liver-specific genes. The second region spans nucleotides -908 to -899 and contains a DNA sequence with identity to the XRE found in the cytochrome P-450 IA1 gene. The XRE sequence also contributes to part of the responsiveness of the Ya subunit gene to planar aromatic compounds. Our data suggest that regulation of gene expression by planar aromatic compounds can be mediated by a DNA sequence that is distinct from the XRE sequence. Images PMID:2160079


    Technology Transfer Automated Retrieval System (TEKTRAN)

    The necrosis and ethylene inducing protein (Nep1) isolated from Fusarium oxysporum f. sp. erythroxyli causes cell death in many dicot plant species including weed species. Although many of the plant responses to Nep1 are similar to elicited responses leading to induction of plant defense responses,...

  10. Induced transcriptional profiling of phenylpropanoid pathway genes increased flavonoid and lignin content in Arabidopsis leaves in response to microbial products

    PubMed Central


    Background The production and use of biologically derived soil additives is one of the fastest growing sectors of the fertilizer industry. These products have been shown to improve crop yields while at the same time reducing fertilizer inputs to and nutrient loss from cropland. The mechanisms driving the changes in primary productivity and soil processes are poorly understood and little is known about changes in secondary productivity associated with the use of microbial products. Here we investigate secondary metabolic responses to a biologically derived soil additive by monitoring changes in the phenlypropanoid (PP) pathway in Arabidopsis thaliana. Results This study was designed to test the influence of one of these products (Soil Builder™-AF, SB) on secondary metabolism after being applied at different times. One time (TI) application of SB to Arabidopsis increased the accumulation of flavonoids compared to multiple (TII) applications of the same products. Fourteen phenolic compounds including flavonols and anothocyanins were identified by mass spectrometry. Kaempferol-3,7-O-bis-α-L-rhamnoside and quercetin 3,7-dirhamnoside, the major compounds, increased 3-fold and 4-fold, respectively compared to control in the TI treatment. The most abundant anthocyanin was cyanidin 3-rhamnoglucoside, which increased 3-fold and 2-fold in TI compared to the control and TII, respectively. Simultaneously, the expression of genes coding for key enzymes in the PP pathway (phenylalanine ammonia lyase, cinnamate 4-hydroxylase, chalcone synthase, flavonoid-3′-O-hydroxylase, flavonol synthase1 and dihydroflavonol-4-reductase) and regulatory genes (production of anthocyanin pigment2, MYB12, MYB113, MYB114, EGL3, and TT8) were up-regulated in both treatments (TI and TII). Furthermore, application of TI and TII induced expression of the lignin pathway genes (hydroxyl cinamyl transferase, caffeyl-CoA O-methyl transferase, cinnamyl alcohol dehydrogenase, cinnamyl-CoA reductase

  11. Expression of a Grapevine NAC Transcription Factor Gene Is Induced in Response to Powdery Mildew Colonization in Salicylic Acid-Independent Manner

    PubMed Central

    Toth, Zsofia; Winterhagen, Patrick; Kalapos, Balazs; Su, Yingcai; Kovacs, Laszlo; Kiss, Erzsebet


    Tissue colonization by grape powdery mildew (PM) pathogen Erysiphe necator (Schw.) Burr triggers a major remodeling of the transcriptome in the susceptible grapevine Vitis vinifera L. While changes in the expression of many genes bear the signature of salicylic acid (SA) mediated regulation, the breadth of PM-induced changes suggests the involvement of additional regulatory networks. To explore PM-associated gene regulation mediated by other SA-independent systems, we designed a microarray experiment to distinguish between transcriptome changes induced by E. necator colonization and those triggered by elevated SA levels. We found that the majority of genes responded to both SA and PM, but certain genes were responsive to PM infection alone. Among them, we identified genes of stilbene synthases, PR-10 proteins, and several transcription factors. The microarray results demonstrated that the regulation of these genes is either independent of SA, or dependent, but SA alone is insufficient to bring about their regulation. We inserted the promoter-reporter fusion of a PM-responsive transcription factor gene into a wild-type and two SA-signaling deficient Arabidopsis lines and challenged the resulting transgenic plants with an Arabidopsis-adapted PM pathogen. Our results provide experimental evidence that this grape gene promoter is activated by the pathogen in a SA-independent manner. PMID:27488171

  12. Expression of a Grapevine NAC Transcription Factor Gene Is Induced in Response to Powdery Mildew Colonization in Salicylic Acid-Independent Manner.


    Toth, Zsofia; Winterhagen, Patrick; Kalapos, Balazs; Su, Yingcai; Kovacs, Laszlo; Kiss, Erzsebet


    Tissue colonization by grape powdery mildew (PM) pathogen Erysiphe necator (Schw.) Burr triggers a major remodeling of the transcriptome in the susceptible grapevine Vitis vinifera L. While changes in the expression of many genes bear the signature of salicylic acid (SA) mediated regulation, the breadth of PM-induced changes suggests the involvement of additional regulatory networks. To explore PM-associated gene regulation mediated by other SA-independent systems, we designed a microarray experiment to distinguish between transcriptome changes induced by E. necator colonization and those triggered by elevated SA levels. We found that the majority of genes responded to both SA and PM, but certain genes were responsive to PM infection alone. Among them, we identified genes of stilbene synthases, PR-10 proteins, and several transcription factors. The microarray results demonstrated that the regulation of these genes is either independent of SA, or dependent, but SA alone is insufficient to bring about their regulation. We inserted the promoter-reporter fusion of a PM-responsive transcription factor gene into a wild-type and two SA-signaling deficient Arabidopsis lines and challenged the resulting transgenic plants with an Arabidopsis-adapted PM pathogen. Our results provide experimental evidence that this grape gene promoter is activated by the pathogen in a SA-independent manner. PMID:27488171

  13. Virus induced gene silencing of Arabidopsis gene homologues in wheat identify genes conferring improved drought tolerance

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In a non-model staple crop like wheat, functional validation of potential drought stress responsive genes identified in Arabidopsis could provide gene targets for wheat breeding. Virus induced gene silencing (VIGS) of genes of interest can overcome the inherent problems of polyploidy and limited tra...

  14. Effect of SMAD7 gene overexpression on TGF-β1-induced profibrotic responses in fibroblasts derived from Peyronie's plaque

    PubMed Central

    Choi, Min Ji; Song, Kang-Moon; Park, Jin-Mi; Kwon, Mi-Hye; Kwon, Ki-Dong; Park, Soo-Hwan; Ryu, Dong-Soo; Ryu, Ji-Kan; Suh, Jun-Kyu


    Transforming growth factor-β1 (TGF-β1) has been identified as one of the most important fibrogenic cytokines associated with Peyronie's disease (PD). The mothers against decapentaplegic homolog 7 (SMAD7) is an inhibitory Smad protein that blocks TGF-β signaling pathway. The aim of this study was to examine the anti-fibrotic effect of the SMAD7 gene in primary fibroblasts derived from human PD plaques. PD fibroblasts were pretreated with the SMAD7 gene and then stimulated with TGF-β1. Treated fibroblasts were used for Western blotting, fluorescent immunocytochemistry, hydroxyproline determination, and terminal deoxynucleotidyl transferase-mediated deoxyuridine triphosphate nick-end labeling assays. Overexpression of the SMAD7 gene inhibited TGF-β1-induced phosphorylation and nuclear translocation of SMAD2 and SMAD3, transdifferentiation of fibroblasts into myofibroblasts, and quashed TGF-β1-induced production of extracellular matrix protein and hydroxyproline. Overexpression of the SMAD7 gene decreased the expression of cyclin D1 (a positive cell cycle regulator) and induced the expression of poly (ADP-ribose) polymerase 1, which is known to terminate Smad-mediated transcription, in PD fibroblasts. These findings suggest that the blocking of the TGF-β pathway by use of SMAD7 may be a promising therapeutic strategy for the treatment of PD. PMID:25532569

  15. Transcription factor ATF4 directs basal and stress-induced gene expression in the unfolded protein response and cholesterol metabolism in the liver

    PubMed Central

    Fusakio, Michael E.; Willy, Jeffrey A.; Wang, Yongping; Mirek, Emily T.; Al Baghdadi, Rana J. T.; Adams, Christopher M.; Anthony, Tracy G.; Wek, Ronald C.


    Disturbances in protein folding and membrane compositions in the endoplasmic reticulum (ER) elicit the unfolded protein response (UPR). Each of three UPR sensory proteins—PERK (PEK/EIF2AK3), IRE1, and ATF6—is activated by ER stress. PERK phosphorylation of eIF2 represses global protein synthesis, lowering influx of nascent polypeptides into the stressed ER, coincident with preferential translation of ATF4 (CREB2). In cultured cells, ATF4 induces transcriptional expression of genes directed by the PERK arm of the UPR, including genes involved in amino acid metabolism, resistance to oxidative stress, and the proapoptotic transcription factor CHOP (GADD153/DDIT3). In this study, we characterize whole-body and tissue-specific ATF4-knockout mice and show in liver exposed to ER stress that ATF4 is not required for CHOP expression, but instead ATF6 is a primary inducer. RNA-Seq analysis indicates that ATF4 is responsible for a small portion of the PERK-dependent UPR genes and reveals a requirement for expression of ATF4 for expression of genes involved in oxidative stress response basally and cholesterol metabolism both basally and under stress. Consistent with this pattern of gene expression, loss of ATF4 resulted in enhanced oxidative damage, and increased free cholesterol in liver under stress accompanied by lowered cholesterol in sera. PMID:26960794

  16. Myristicin from nutmeg induces apoptosis via the mitochondrial pathway and down regulates genes of the DNA damage response pathways in human leukaemia K562 cells.


    Martins, Célia; Doran, Carolina; Silva, Inês C; Miranda, Claudia; Rueff, José; Rodrigues, António S


    Myristicin, an allylbenzene, is a major active component of various spices, such as nutmeg and cinnamon, plants from the Umbelliferae family or in some essential oils, such as oils of clove or marjoram. Human exposure to myristicin is low but widespread due to consumption of these spices and essential oils, added to food (e.g. cola drinks) or in traditional medicine. Occasionally high dose exposure occurs, leading to various clinical symptoms, however the molecular mechanisms underlying them are unknown. Our previous studies revealed that myristicin is not genotoxic and yet presented apoptotic activity. Therefore, in this work we assessed the apoptotic mechanisms induced by myristicin in human leukaemia cells. In order to gain further insight on the potential of myristicin to modulate gene expression we also analysed alterations in expression of 84 genes associated with the DNA damage response pathway. The results obtained show that myristicin can induce apoptosis as characterised by alterations in the mitochondrial membrane potential, cytochrome c release, caspase-3 activation, PARP-cleavage and DNA fragmentation. The gene expression profile revealed an overall down regulation of DNA damage response genes after exposure to myristicin, with significant under-expression of genes associated with nucleotide excision repair (ERCC1), double strand break repair (RAD50, RAD51) and DNA damage signalling (ATM) and stress response (GADD45A, GADD45G). On the whole, we demonstrate that myristicin can alter mitochondrial membrane function, induce apoptosis and modulate gene expression in human leukaemia K562 cells. This study provides further detail on the molecular mechanisms underlying the biological activity of myristicin. PMID:24792648

  17. Analysis of Magnaporthe oryzae Genome Reveals a Fungal Effector, Which Is Able to Induce Resistance Response in Transgenic Rice Line Containing Resistance Gene, Pi54

    PubMed Central

    Ray, Soham; Singh, Pankaj K.; Gupta, Deepak K.; Mahato, Ajay K.; Sarkar, Chiranjib; Rathour, Rajeev; Singh, Nagendra K.; Sharma, Tilak R.


    Rice blast caused by Magnaporthe oryzae is one of the most important diseases of rice. Pi54, a rice gene that imparts resistance to M. oryzae isolates prevalent in India, was already cloned but its avirulent counterpart in the pathogen was not known. After decoding the whole genome of an avirulent isolate of M. oryzae, we predicted 11440 protein coding genes and then identified four candidate effector proteins which are exclusively expressed in the infectious structure, appresoria. In silico protein modeling followed by interaction analysis between Pi54 protein model and selected four candidate effector proteins models revealed that Mo-01947_9 protein model encoded by a gene located at chromosome 4 of M. oryzae, interacted best at the Leucine Rich Repeat domain of Pi54 protein model. Yeast-two-hybrid analysis showed that Mo-01947_9 protein physically interacts with Pi54 protein. Nicotiana benthamiana leaf infiltration assay confirmed induction of hypersensitive response in the presence of Pi54 gene in a heterologous system. Genetic complementation test also proved that Mo-01947_9 protein induces avirulence response in the pathogen in presence of Pi54 gene. Here, we report identification and cloning of a new fungal effector gene which interacts with blast resistance gene Pi54 in rice. PMID:27551285

  18. Analysis of Magnaporthe oryzae Genome Reveals a Fungal Effector, Which Is Able to Induce Resistance Response in Transgenic Rice Line Containing Resistance Gene, Pi54.


    Ray, Soham; Singh, Pankaj K; Gupta, Deepak K; Mahato, Ajay K; Sarkar, Chiranjib; Rathour, Rajeev; Singh, Nagendra K; Sharma, Tilak R


    Rice blast caused by Magnaporthe oryzae is one of the most important diseases of rice. Pi54, a rice gene that imparts resistance to M. oryzae isolates prevalent in India, was already cloned but its avirulent counterpart in the pathogen was not known. After decoding the whole genome of an avirulent isolate of M. oryzae, we predicted 11440 protein coding genes and then identified four candidate effector proteins which are exclusively expressed in the infectious structure, appresoria. In silico protein modeling followed by interaction analysis between Pi54 protein model and selected four candidate effector proteins models revealed that Mo-01947_9 protein model encoded by a gene located at chromosome 4 of M. oryzae, interacted best at the Leucine Rich Repeat domain of Pi54 protein model. Yeast-two-hybrid analysis showed that Mo-01947_9 protein physically interacts with Pi54 protein. Nicotiana benthamiana leaf infiltration assay confirmed induction of hypersensitive response in the presence of Pi54 gene in a heterologous system. Genetic complementation test also proved that Mo-01947_9 protein induces avirulence response in the pathogen in presence of Pi54 gene. Here, we report identification and cloning of a new fungal effector gene which interacts with blast resistance gene Pi54 in rice. PMID:27551285

  19. Characterization of Changes in Global Genes Expression in the Distal Colon of Loperamide-Induced Constipation SD Rats in Response to the Laxative Effects of Liriope platyphylla

    PubMed Central

    Kim, Ji Eun; Park, So Hae; Kwak, Moon Hwa; Go, Jun; Koh, Eun Kyoung; Song, Sung Hwa; Sung, Ji Eun; Lee, Hee Seob; Hong, Jin Tae; Hwang, Dae Youn


    To characterize the changes in global gene expression in the distal colon of constipated SD rats in response to the laxative effects of aqueous extracts of Liriope platyphylla (AEtLP), including isoflavone, saponin, oligosaccharide, succinic acid and hydroxyproline, the total RNA extracted from the distal colon of AEtLP-treated constipation rats was hybridized to oligonucleotide microarrays. The AEtLP treated rats showed an increase in the number of stools, mucosa thickness, flat luminal surface thickness, mucin secretion, and crypt number. Overall, compared to the controls, 581 genes were up-regulated and 216 genes were down-regulated by the constipation induced by loperamide in the constipated rats. After the AEtLP treatment, 67 genes were up-regulated and 421 genes were down-regulated. Among the transcripts up-regulated by constipation, 89 were significantly down-regulated and 22 were recovered to the normal levels by the AEtLP treatment. The major genes in the down-regulated categories included Slc9a5, klk10, Fgf15, and Alpi, whereas the major genes in the recovered categories were Cyp2b2, Ace, G6pc, and Setbp1. On the other hand, after the AEtLP treatment, ten of these genes down-regulated by constipation were up-regulated significantly and five were recovered to the normal levels. The major genes in the up-regulated categories included Serpina3n, Lcn2 and Slc5a8, whereas the major genes in the recovered categories were Tmem45a, Rerg and Rgc32. These results indicate that several gene functional groups and individual genes as constipation biomarkers respond to an AEtLP treatment in constipated model rats. PMID:26151867

  20. mRNA Noise Reveals that Activators Induce a Biphasic Response in the Promoter Kinetics of Highly Regulated Genes

    NASA Astrophysics Data System (ADS)

    Quinn, Katie; To, Tsz-Leung; Maheshri, Narendra


    A dominant source of fluctuations in gene expression is thought to be the process of transcription. The statistics of these fluctuations arise from the kinetics of transcription. Multiple studies suggest the bulk of fluctuations can be understood by a simple process where genes are inactive for exponentially distributed times punctuated by geometric bursts of mRNA. Yet it's largely unknown how cis and trans factors affect the two lumped kinetic parameters, burst size and burst frequency, that describe this process. Importantly, how these parameters are regulated in a single gene can qualitatively affect the dynamical behavior of the network it is embedded within. Here, we ask whether transcriptional activators increase gene expression by increasing the burst size or burst frequency. We do so by deducing these parameters from steady-state mRNA distributions measured in individual yeast cells using single molecule mRNA FISH. We find that for both a synthetic and natural promoter, activators appear to first increase burst size, then burst frequency. We suggest this biphasic response may be common to all highly regulated genes and was previously unappreciated because of measurement techniques. Furthermore, its origins appear to relate to cis events at the promoter, and may arise from combinations of basal and activator-dependent bursts. Our measurements shed new light on transcriptional mechanisms and should assist in building synthetic promoters with tunable statistics.

  1. Constitutive or Inducible Protective Mechanisms against UV-B Radiation in the Brown Alga Fucus vesiculosus? A Study of Gene Expression and Phlorotannin Content Responses

    PubMed Central

    Creis, Emeline; Delage, Ludovic; Charton, Sophie; Goulitquer, Sophie; Leblanc, Catherine; Potin, Philippe; Ar Gall, Erwan


    A role as UV sunscreens has been suggested for phlorotannins, the phenolic compounds that accumulate in brown algae in response to a number of external stimuli and take part in cell wall structure. After exposure of the intertidal brown alga Fucus vesiculosus to artificial UV-B radiation, we examined its physiological responses by following the transcript level of the pksIII gene encoding a phloroglucinol synthase, likely to be involved in the first step of phlorotannins biosynthesis. We also monitored the expression of three targeted genes, encoding a heat shock protein (hsp70), which is involved in global stress responses, an aryl sulfotransferase (ast), which could be involved in the sulfation of phlorotannins, and a vanadium bromoperoxidase (vbpo), which can potentially participate in the scavenging of Reactive Oxygen Species (ROS) and in the cross-linking and condensation of phlorotannins. We investigated whether transcriptional regulation of these genes is correlated with an induction of phlorotannin accumulation by establishing metabolite profiling of purified fractions of low molecular weight phlorotannins. Our findings demonstrated that a high dose of UV-B radiation induced a significant overexpression of hsp70 after 12 and 24 hours following the exposure to the UV-B treatment, compared to control treatment. The physiological performance of algae quantified by the photosynthetic efficiency (Fv/Fm) was slightly reduced. However UV-B treatment did not induce the accumulation of soluble phlorotannins in F. vesiculosus during the kinetics of four weeks, a result that may be related to the lack of induction of the pksIII gene expression. Taken together these results suggest a constitutive accumulation of phlorotannins occurring during the development of F.vesiculosus, rather than inducible processes. Gene expression studies and phlorotannin profiling provide here complementary approaches to global quantifications currently used in studies of phenolic compounds

  2. The characterization of six auxin-induced tomato GH3 genes uncovers a member, SlGH3.4, strongly responsive to arbuscular mycorrhizal symbiosis.


    Liao, Dehua; Chen, Xiao; Chen, Aiqun; Wang, Huimin; Liu, Jianjian; Liu, Junli; Gu, Mian; Sun, Shubin; Xu, Guohua


    In plants, the GH3 gene family is widely considered to be involved in a broad range of plant physiological processes, through modulation of hormonal homeostasis. Multiple GH3 genes have been functionally characterized in several plant species; however, to date, limited works to study the GH3 genes in tomato have been reported. Here, we characterize the expression and regulatory profiles of six tomato GH3 genes, SlGH3.2, SlGH3.3, SlGH3.4, SlGH3.7, SlGH3.9 and SlGH3.15, in response to different phytohormone applications and arbuscular mycorrhizal (AM) fungal colonization. All six GH3 genes showed inducible responses to external IAA, and three members were significantly up-regulated in response to AM symbiosis. In particular, SlGH3.4, the transcripts of which were barely detectable under normal growth conditions, was strongly activated in the IAA-treated and AM fungal-colonized roots. A comparison of the SlGH3.4 expression in wild-type plants and M161, a mutant with a defect in AM symbiosis, confirmed that SlGH3.4 expression is highly correlated to mycorrhizal colonization. Histochemical staining demonstrated that a 2,258 bp SlGH3.4 promoter fragment could drive β-glucuronidase (GUS) expression strongly in root tips, steles and cortical cells of IAA-treated roots, but predominantly in the fungal-colonized cells of mycorrhizal roots. A truncated 654 bp promoter failed to direct GUS expression in IAA-treated roots, but maintained the symbiosis-induced activity in mycorrhizal roots. In summary, our results suggest that a mycorrhizal signaling pathway that is at least partially independent of the auxin signaling pathway has evolved for the co-regulation of the auxin- and mycorrhiza-activated GH3 genes in plants. PMID:25535196

  3. Sonicated Protein Fractions of Mycoplasma hyopneumoniae Induce Inflammatory Responses and Differential Gene Expression in a Murine Alveolar Macrophage Cell Line.


    Damte, Dereje; Lee, Seung-Jin; Birhanu, Biruk Tesfaye; Suh, Joo-Won; Park, Seung-Chun


    Mycoplasma hyopneumoniae is known to cause porcine enzootic pneumonia (EP), an important disease in swine production. The objective of this study was to examine the effects of sonicated protein fractions of M. hyopneumoniae on inflammatory response and gene expression in the murine alveolar macrophage MH-S cell line. The effects of sonicated protein fractions and intact M. hyopneumoniae on the gene expression of cytokines and iNOS were assessed using RT-PCR. The Annealing Control Primer (ACP)-based PCR method was used to screen differentially expressed genes. Increased transcription of interleukin (IL)-1β, IL-6, tumor necrosis factor (TNF)-α, COX-2, and iNOS mRNA was observed after exposure to the supernatant (SPT), precipitant (PPT), and intact M. hyopneumoniae protein. A time-dependent analysis of the mRNA expression revealed an upregulation after 4 h for IL-6 and iNOS and after 12 h for IL-1β and TNF-α, for both SPT and PPT; the fold change in COX-2 expression was less. A dose- and time-dependent correlation was observed in nitrite (NO) production for both protein fractions; however, there was no significant difference between the effects of the two protein fractions. In a differential gene analysis, PCR revealed differential expression for nine gene bands after 3 h of stimulation - only one gene was downregulated, while the remaining eight were upregulated. The results of this study provide insights that help improve our understanding of the mechanisms underlying the pathogenesis of and macrophage defenses against M. hyopneumoniae assault, and suggest targets for future studies on therapeutic interventions for M. hyopneumoniae infections. PMID:26370797

  4. Virus-induced gene silencing reveals signal transduction components required for the Pvr9-mediated hypersensitive response in Nicotiana benthamiana.


    Tran, Phu-Tri; Choi, Hoseong; Choi, Doil; Kim, Kook-Hyung


    Resistance to pathogens mediated by plant resistance (R) proteins requires different signaling transduction components and pathways. Our previous studies revealed that a potyvirus resistance gene in pepper, Pvr9, confers a hypersensitive response (HR) to pepper mottle virus in Nicotiana benthamiana. Our results show that the Pvr9-mediated HR against pepper mottle virus infection requires HSP90, SGT1, NDR1, but not EDS1. These results suggest that the Pvr9-mediated HR is possibly related to the SA pathway but not the ET, JA, ROS or NO pathways. PMID:27236305

  5. The LIM protein leupaxin is enriched in smooth muscle and functions as an serum response factor cofactor to induce smooth muscle cell gene transcription.


    Sundberg-Smith, Liisa J; DiMichele, Laura A; Sayers, Rebecca L; Mack, Christopher P; Taylor, Joan M


    Leupaxin is a LIM domain-containing adapter protein belonging to the paxillin family that has been previously reported to be preferentially expressed in hematopoietic cells. Herein, we identified leupaxin in a screen for focal adhesion kinase binding partners in aortic smooth muscle, and we show that leupaxin is enriched in human and mouse vascular smooth muscle and that leupaxin expression is dynamically regulated during development. In addition, our studies reveal that leupaxin can undergo cytoplasmic/nuclear shuttling and functions as an serum response factor cofactor in the nucleus. We found that leupaxin forms a complex with serum response factor and associates with CArG-containing regions of smooth muscle promoters and that ectopic expression of leupaxin induces smooth muscle marker gene expression in both 10T1/2 cells and rat aortic smooth muscle cells. Subsequent studies indicated that enhanced focal adhesion kinase activity (induced by fibronectin or expression of constitutively active focal adhesion kinase) attenuates the nuclear accumulation of leupaxin and limits the ability of leupaxin to enhance serum response factor-dependent gene transcription. Thus, these studies indicate that modulation of the subcellular localization of serum response factor cofactors is 1 mechanism by which extracellular matrix-dependent signals may regulate phenotypic switching of smooth muscle cells. PMID:18497331

  6. Local and systemic mycorrhiza-induced protection against the ectoparasitic nematode Xiphinema index involves priming of defence gene responses in grapevine

    PubMed Central

    Hao, Zhipeng; Fayolle, Léon; van Tuinen, Diederik; Chatagnier, Odile; Gianinazzi, Silvio; Gianinazzi-Pearson, Vivienne


    The ectoparasitic dagger nematode (Xiphinema index), vector of Grapevine fanleaf virus (GFLV), provokes gall formation and can cause severe damage to the root system of grapevines. Mycorrhiza formation by Glomus (syn. Rhizophagus) intraradices BEG141 reduced both gall formation on roots of the grapevine rootstock SO4 (Vitis berlandieri×V. riparia) and nematode number in the surrounding soil. Suppressive effects increased with time and were greater when the nematode was post-inoculated rather than co-inoculated with the arbuscular mycorrhizal (AM) fungus. Using a split-root system, decreased X. index development was shown in mycorrhizal and non-mycorrhizal parts of mycorrhizal root systems, indicating that both local and systemic induced bioprotection mechanisms were active against the ectoparasitic nematode. Expression analyses of ESTs (expressed sequence tags) generated in an SSH (subtractive suppressive hybridization) library, representing plant genes up-regulated during mycorrhiza-induced control of X. index, and of described grapevine defence genes showed activation of chitinase 1b, pathogenesis-related 10, glutathione S-transferase, stilbene synthase 1, 5-enolpyruvyl shikimate-3-phosphate synthase, and a heat shock proein 70-interacting protein in association with the observed local and/or systemic induced bioprotection against the nematode. Overall, the data suggest priming of grapevine defence responses by the AM fungus and transmission of a plant-mediated signal to non-mycorrhizal tissues. Grapevine gene responses during AM-induced local and systemic bioprotection against X. index point to biological processes that are related either to direct effects on the nematode or to protection against nematode-imposed stress to maintain root tissue integrity. PMID:22407649

  7. Apyrase Suppression Raises Extracellular ATP Levels and Induces Gene Expression and Cell Wall Changes Characteristic of Stress Responses1[C][W][OPEN

    PubMed Central

    Lim, Min Hui; Wu, Jian; Yao, Jianchao; Gallardo, Ignacio F.; Dugger, Jason W.; Webb, Lauren J.; Huang, James; Salmi, Mari L.; Song, Jawon; Clark, Greg; Roux, Stanley J.


    Plant cells release ATP into their extracellular matrix as they grow, and extracellular ATP (eATP) can modulate the rate of cell growth in diverse tissues. Two closely related apyrases (APYs) in Arabidopsis (Arabidopsis thaliana), APY1 and APY2, function, in part, to control the concentration of eATP. The expression of APY1/APY2 can be inhibited by RNA interference, and this suppression leads to an increase in the concentration of eATP in the extracellular medium and severely reduces growth. To clarify how the suppression of APY1 and APY2 is linked to growth inhibition, the gene expression changes that occur in seedlings when apyrase expression is suppressed were assayed by microarray and quantitative real-time-PCR analyses. The most significant gene expression changes induced by APY suppression were in genes involved in biotic stress responses, which include those genes regulating wall composition and extensibility. These expression changes predicted specific chemical changes in the walls of mutant seedlings, and two of these changes, wall lignification and decreased methyl ester bonds, were verified by direct analyses. Taken together, the results are consistent with the hypothesis that APY1, APY2, and eATP play important roles in the signaling steps that link biotic stresses to plant defense responses and growth changes. PMID:24550243

  8. Induced pluripotency with endogenous and inducible genes

    SciTech Connect

    Duinsbergen, Dirk; Eriksson, Malin; Hoen, Peter A.C. 't; Frisen, Jonas; Mikkers, Harald


    The recent discovery that two partly overlapping sets of four genes induce nuclear reprogramming of mouse and even human cells has opened up new possibilities for cell replacement therapies. Although the combination of genes that induce pluripotency differs to some extent, Oct4 and Sox2 appear to be a prerequisite. The introduction of four genes, several of which been linked with cancer, using retroviral approaches is however unlikely to be suitable for future clinical applications. Towards developing a safer reprogramming protocol, we investigated whether cell types that express one of the most critical reprogramming genes endogenously are predisposed to reprogramming. We show here that three of the original four pluripotency transcription factors (Oct4, Klf4 and c-Myc or MYCER{sup TAM}) induced reprogramming of mouse neural stem (NS) cells exploiting endogenous SoxB1 protein levels in these cells. The reprogrammed neural stem cells differentiated into cells of each germ layer in vitro and in vivo, and contributed to mouse development in vivo. Thus a combinatorial approach taking advantage of endogenously expressed genes and inducible transgenes may contribute to the development of improved reprogramming protocols.

  9. Up-regulation of endoplasmic reticulum stress induced genes of the unfolded protein response in the liver of periparturient dairy cows

    PubMed Central


    Background In dairy cows, the periparturient phase is a stressful period, which is commonly associated with strong metabolic adaptations and the development of pathophysiologic conditions and disorders. Some of the symptoms occurring in the liver, such as the development of fatty liver, are similar to those observed under the condition of endoplasmic reticulum (ER) stress. Therefore, we hypothesized, that in the liver of dairy cows ER stress is induced during the periparturient phase, which in turn leads to an induction of the unfolded protein response (UPR). In order to investigate this hypothesis, we determined relative mRNA concentrations of 14 genes of the ER stress-induced UPR in liver biopsy samples of 13 dairy cows at 3 wk antepartum and 1, 5 and 14 wk postpartum. Results We found, that the mRNA concentrations of 13 out of the 14 genes involved in the UPR in the liver were significantly increased (1.9 to 4.0 fold) at 1 wk postpartum compared to 3 wk antepartum. From 1 wk postpartum to later lactation, mRNA concentrations of all the genes considered were declining. Moreover, at 1 wk postpartum, mRNA concentration of the spliced variant of XBP1 was increased in comparison to 3 wk antepartum, indicating that splicing of XBP1 – a hallmark of ER stress - was induced following the onset of lactation. Conclusion The present study reveals, that ER stress might be induced during the periparturient phase in the liver of dairy cows. We assume that the ER stress-induced UPR might contribute to the pathophysiologic conditions commonly observed in the liver of periparturient cows, such as the development of fatty liver, ketosis or inflammation. PMID:24555446

  10. The quorum sensing luxS gene is induced in Lactobacillus acidophilus NCFM in response to Listeria monocytogenes.


    Moslehi-Jenabian, Saloomeh; Vogensen, Finn Kvist; Jespersen, Lene


    The luxS gene involved in quorum sensing has been shown to control different behaviour of probiotic lactobacilli. In this study we investigated if luxS in Lactobacillus acidophilus NCFM was up-regulated in response to Listeria monocytogenes EGD-e. The two bacterial strains were grown in mono- and co-culture and the growth of both bacteria and the transcriptional level of luxS in L. acidophilus cells were monitored. Contrary to L. acidophilus, the growth of L. monocytogenes was significantly affected by co-cultivation. Transcriptional analysis showed that the expression of luxS increased during exponential growth in L. acidophilus cells with the highest level in the late-exponential growth phase, decreasing in the stationary phase. Following co-cultivation with L. monocytogenes, the transcriptional level of luxS increased significantly in mid-exponential growing cells of L. acidophilus after incubation with viable L. monocytogenes cells and by addition of cell-free culture supernatant of L. monocytogenes, whereas incubation with heat killed cells of L. monocytogenes had no effect on the transcriptional level. This could indicate that the up-regulation of luxS is due to a response to a secreted compound produced by L. monocytogenes cells. PMID:21784546

  11. ERGDB: Estrogen Responsive Genes Database.


    Tang, Suisheng; Han, Hao; Bajic, Vladimir B


    ERGDB is an integrated knowledge database dedicated to genes responsive to estrogen. Genes included in ERGDB are those whose expression levels are experimentally proven to be either up-regulated or down-regulated by estrogen. Genes included are identified based on publications from the PubMed database and each record has been manually examined, evaluated and selected for inclusion by biologists. ERGDB aims to be a unified gateway to store, search, retrieve and update information about estrogen responsive genes. Each record contains links to relevant databases, such as GenBank, LocusLink, Refseq, PubMed and ATCC. The unique feature of ERGDB is that it contains information on the dependence of gene reactions on experimental conditions. In addition to basic information about the genes, information for each record includes gene functional description, experimental methods used, tissue or cell type, gene reaction, estrogen exposure time and the summary of putative estrogen response elements if the gene's promoter sequence was available. Through a web interface at cgi-bin/ users can either browse or query ERGDB. Access is free for academic and non-profit users. PMID:14681475

  12. Identification of low Ca(2+) stress-induced embryo apoptosis response genes in Arachis hypogaea by SSH-associated library lift (SSHaLL).


    Chen, Hua; Zhang, Chong; Cai, Tie Cheng; Deng, Ye; Zhou, Shuangbiao; Zheng, Yixiong; Ma, Shiwei; Tang, Ronghua; Varshney, Rajeev K; Zhuang, Weijian


    Calcium is a universal signal in the regulation of wide aspects in biology, but few are known about the function of calcium in the control of early embryo development. Ca(2+) deficiency in soil induces early embryo abortion in peanut, producing empty pods, which is a general problem; however, the underlying mechanism remains unclear. In this study, embryo abortion was characterized to be caused by apoptosis marked with cell wall degradation. Using a method of SSH cDNA libraries associated with library lift (SSHaLL), 62 differentially expressed genes were isolated from young peanut embryos. These genes were classified to be stress responses, catabolic process, carbohydrate and lipid metabolism, embryo morphogenesis, regulation, etc. The cell retardation with cell wall degradation was caused by up-regulated cell wall hydrolases and down-regulated cellular synthases genes. HsfA4a, which was characterized to be important to embryo development, was significantly down-regulated under Ca(2+) -deficient conditions from 15 days after pegging (DAP) to 30 DAP. Two AhCYP707A4 genes, encoding abscisic acid (ABA) 8'-hydroxylases, key enzymes for ABA catabolism, were up-regulated by 21-fold under Ca(2+) -deficient conditions upstream of HsfA4a, reducing the ABA level in early embryos. Over-expression of AhCYP707A4 in Nicotiana benthamiana showed a phenotype of low ABA content with high numbers of aborted embryos, small pods and less seeds, which confirms that AhCYP707A4 is a key player in regulation of Ca(2+) deficiency-induced embryo abortion via ABA-mediated apoptosis. The results elucidated the mechanism of low Ca(2+) -induced embryo abortion and described the method for other fields of study. PMID:26079063

  13. The Roles of ATF3, an Adaptive-Response Gene, in High-Fat-Diet-Induced Diabetes and Pancreatic β-Cell Dysfunction

    PubMed Central

    Zmuda, Erik J.; Qi, Ling; Zhu, Michael X.; Mirmira, Raghavendra G.; Montminy, Marc R.; Hai, Tsonwin


    Most people with type 2 diabetes (T2D) have reduced β-cell mass, and apoptosis is a key factor for this reduction. Previously, we showed that ATF3, an adaptive-response gene, is induced by various stress signals relevant to T2D, such as high glucose and high fatty acid. Because ATF3 is proapoptotic in β-cells, we tested the hypothesis that ATF3 plays a detrimental role and contributes to the development of T2D. We compared wild-type (WT) and ATF3 knockout (KO) mice in an animal model for T2D, high-fat diet-induced diabetes. We also used INS-1 β-cells and primary islets to analyze the roles of ATF3 in β-cell function, including insulin gene expression and glucose-induced insulin secretion. Surprisingly, WT mice performed better in glucose tolerance test than KO mice, suggesting a protective, rather than detrimental, role of ATF3. At 12 wk on high-fat diet, no β-cell apoptosis was observed, and the WT and KO mice had comparable β-cell areas. However, ATF3 deficiency significantly reduced serum insulin levels in the KO mice without affecting insulin sensitivity, suggesting reduced β-cell function in the KO mice. Analyses using INS-1 cells and primary islets support the notion that this defect is due, at least partly, to reduced insulin gene transcription in the KO islets without detectable reduction in glucose-induced calcium influx, a critical step for insulin secretion. In conclusion, our results support a model in which, before apoptosis becomes obvious, expression of ATF3 can be beneficial by helping β-cells to cope with higher metabolic demand. PMID:20519332

  14. Identification of genes involved in low aminoglycoside-induced SOS response in Vibrio cholerae: a role for transcription stalling and Mfd helicase

    PubMed Central

    Baharoglu, Zeynep; Babosan, Anamaria; Mazel, Didier


    Sub-inhibitory concentrations (sub-MIC) of antibiotics play a very important role in selection and development of resistances. Unlike Escherichia coli, Vibrio cholerae induces its SOS response in presence of sub-MIC aminoglycosides. A role for oxidized guanine residues was observed, but the mechanisms of this induction remained unclear. To select for V. cholerae mutants that do not induce low aminoglycoside-mediated SOS induction, we developed a genetic screen that renders induction of SOS lethal. We identified genes involved in this pathway using two strategies, inactivation by transposition and gene overexpression. Interestingly, we obtained mutants inactivated for the expression of proteins known to destabilize the RNA polymerase complex. Reconstruction of the corresponding mutants confirmed their specific involvement in induction of SOS by low aminoglycoside concentrations. We propose that DNA lesions formed on aminoglycoside treatment are repaired through the formation of single-stranded DNA intermediates, inducing SOS. Inactivation of functions that dislodge RNA polymerase leads to prolonged stalling on these lesions, which hampers SOS induction and repair and reduces viability under antibiotic stress. The importance of these mechanisms is illustrated by a reduction of aminoglycoside sub-MIC. Our results point to a central role for transcription blocking at DNA lesions in SOS induction, so far underestimated. PMID:24319148

  15. Temporal gene expression in the hippocampus and peripheral organs to endoxin-induced systemic inflammatory response in caspase-1 deficient mice

    PubMed Central

    Mastronardi, Claudio Alberto; Paz-Filho, Gilberto; Zanoni, Martina; Molano-González, Nicolas; Arcos-Burgos, Mauricio; Licinio, Julio; Wong, Ma-Li


    Objectives Caspase-1 (casp1), a key protease involved during systemic inflammatory response syndrome (SIRS), controls the brain expression of a set of eight genes: Nos2 and Ptgs2 (nitric oxide synthase 2 and prostaglandin-endoperoxide synthase 2, two inducible enzymes), Cxcl1 and Cxcl10 (C-X-C motif chemokine ligand 1 and ligand 10), Tgtp and Gbp2 (T cell specific GTPase 1 and guanylate binding protein 2, two GTPases), Adamts1 (a disintegrin-like and metallopeptidase with thrombospondin type 1 motif, 1, a metalloprotease), and Il1rn (interleukin (IL)-1 receptor antagonist). Our objective was to ascertain whether casp1 also controlled the peripheral expression of these genes and, if so, to compare their central vs. peripheral patterns of gene expression in immune and endocrine tissues during SIRS. Methods Wild-type (wt) and casp1 knockout (casp1−/−) mice were injected with either saline or a high dose of endotoxin/lypopolysaccharide (LPS; 800μg/mice i.p). Saline-injected mice were immediately euthanized after injection, whereas LPS-injected mice were sacrificed 6 and 12h after LPS administration. Hippocampal, splenic and adrenal gene expressions were determined by real-time PCR. Results Overall, casp1−/− mice showed a lower inflammatory response than wt mice. The expression level of powerful proinflammatory factors such as Nos2 and Ptgs2 was reduced in casp1−/− mice. Moreover, a hierarchical clustering analysis aimed at studying patterns of gene co-expression revealed large alterations in the hippocampal pattern of casp1−/− mice. Surprisingly, the expression of Adamts1was increased in the hippocampus and adrenals of casp1−/− mice. Conclusions The resilience of casp1−/− mice to SIRS lethality is associated with a lower inflammatory response, loss of hippocampal gene co-expression patterns, and increased hippocampal Adamts1 gene expression. The latter might be beneficial for casp1−/− mice, since ADAMTS1 is likely to play a role in neuronal

  16. Heat induces gene amplification in cancer cells

    SciTech Connect

    Yan, Bin; Ouyang, Ruoyun; Huang, Chenghui; Liu, Franklin; Neill, Daniel; Li, Chuanyuan; Dewhirst, Mark


    Highlights: Black-Right-Pointing-Pointer This study discovered that heat exposure (hyperthermia) results in gene amplification in cancer cells. Black-Right-Pointing-Pointer Hyperthermia induces DNA double strand breaks. Black-Right-Pointing-Pointer DNA double strand breaks are considered to be required for the initiation of gene amplification. Black-Right-Pointing-Pointer The underlying mechanism of heat-induced gene amplification is generation of DNA double strand breaks. -- Abstract: Background: Hyperthermia plays an important role in cancer therapy. However, as with radiation, it can cause DNA damage and therefore genetic instability. We studied whether hyperthermia can induce gene amplification in cancer cells and explored potential underlying molecular mechanisms. Materials and methods: (1) Hyperthermia: HCT116 colon cancer cells received water-submerged heating treatment at 42 or 44 Degree-Sign C for 30 min; (2) gene amplification assay using N-(phosphoacetyl)-L-aspartate (PALA) selection of cabamyl-P-synthetase, aspartate transcarbarmylase, dihydro-orotase (cad) gene amplified cells; (3) southern blotting for confirmation of increased cad gene copies in PALA-resistant cells; (4) {gamma}H2AX immunostaining to detect {gamma}H2AX foci as an indication for DNA double strand breaks. Results: (1) Heat exposure at 42 or 44 Degree-Sign C for 30 min induces gene amplification. The frequency of cad gene amplification increased by 2.8 and 6.5 folds respectively; (2) heat exposure at both 42 and 44 Degree-Sign C for 30 min induces DNA double strand breaks in HCT116 cells as shown by {gamma}H2AX immunostaining. Conclusion: This study shows that heat exposure can induce gene amplification in cancer cells, likely through the generation of DNA double strand breaks, which are believed to be required for the initiation of gene amplification. This process may be promoted by heat when cellular proteins that are responsible for checkpoints, DNA replication, DNA repair and

  17. SLCO1B1 and SLC19A1 Gene Variants and Irinotecan-Induced Rapid Response and Survival: A Prospective Multicenter Pharmacogenetics Study of Metastatic Colorectal Cancer

    PubMed Central

    Liao, Xin; Yu, Qianqian; Feng, Jueping; Ma, Hong; Dai, Jing; Li, Min; Chen, Jigui; Zang, Aihua; Wang, Qian; Ge, Shuwang; Qin, Kai; Cai, Juan; Yuan, Xianglin


    Background Rapid response to chemotherapy in metastatic colorectal cancer (mCRC) patients (response within 12 weeks of chemotherapy) may increase the chance of complete resection and improved survival. Few molecular markers predict irinotecan-induced rapid response and survival. Single-nucleotide polymorphisms (SNPs) in solute carrier genes are reported to correlate with the variable pharmacokinetics of irinotecan and folate in cancer patients. This study aims to evaluate the predictive role of 3 SNPs in mCRC patients treated with irinotecan and fluoropyrimidine-containing regimens. Materials and Methods Three SNPs were selected and genotyped in 137 mCRC patients from a Chinese prospective multicenter trial (NCT01282658). The chi-squared test, univariate and multivariable logistic regression model, and receiver operating characteristic analysis were used to evaluate correlations between the genotypes and rapid response. Kaplan-Meier survival analysis and Cox proportional hazard models were used to evaluate the associations between genotypes and survival outcomes. Benjamini and Hochberg False Discovery Rate correction was used in multiple testing Results Genotype GA/AA of SNP rs2306283 of the gene SLCO1B1 and genotype GG of SNP rs1051266 of the gene SLC19A1 were associated with a higher rapid response rate (odds ratio [OR] =3.583 and 3.521, 95%CI =1.301-9.871 and 1.271-9.804, p=0.011 and p=0.013, respectively). The response rate was 70% in patients with both genotypes, compared with only 19.7% in the remaining patients (OR = 9.489, 95%CI = 2.191-41.093, Fisher's exact test p=0.002). Their significances were all maintained even after multiple testing (all pc < 0.05). The rs2306283 GA/AA genotype was also an independent prognostic factor of longer progression-free survival (PFS) (hazard ratio = 0.402, 95%CI = 0.171-0.945, p=0.037). None of the SNPs predicted overall survival. Conclusions Polymorphisms of solute carriers’ may be useful to predict rapid response to

  18. Gene expression profiling of Gram-negative bacteria-induced inflammation in human whole blood: The role of complement and CD14-mediated innate immune response.


    Lau, Corinna; Olstad, Ole Kristoffer; Holden, Marit; Nygård, Ståle; Fure, Hilde; Lappegård, Knut Tore; Brekke, Ole-Lars; Espevik, Terje; Hovig, Eivind; Mollnes, Tom Eirik


    Non-sterile pathogen-induced sepsis and sterile inflammation like in trauma or ischemia-reperfusion injury may both coincide with the life threatening systemic inflammatory response syndrome and multi-organ failure. Consequently, there is an urgent need for specific biomarkers in order to distinguish sepsis from sterile conditions. The overall aim of this study was to uncover putative sepsis biomarkers and biomarker pathways, as well as to test the efficacy of combined inhibition of innate immunity key players complement and Toll-like receptor co-receptor CD14 as a possible therapeutic regimen for sepsis. We performed whole blood gene expression analyses using microarray in order to profile Gram-negative bacteria-induced inflammatory responses in an ex vivo human whole blood model. The experiments were performed in the presence or absence of inhibitors of complement proteins (C3 and CD88 (C5a receptor 1)) and CD14, alone or in combination. In addition, we used blood from a C5-deficient donor. Anti-coagulated whole blood was challenged with heat-inactivated Escherichia coli for 2 h, total RNA was isolated and microarray analyses were performed on the Affymetrix GeneChip Gene 1.0 ST Array platform. The initial experiments were performed in duplicates using blood from two healthy donors. C5-deficiency is very rare, and only one donor could be recruited. In order to increase statistical power, a technical replicate of the C5-deficient samples was run. Subsequently, log2-transformed intensities were processed by robust multichip analysis and filtered using a threshold of four. In total, 73 microarray chips were run and analyzed. The normalized and filtered raw data have been deposited in NCBI's Gene Expression Omnibus (GEO) and are accessible with GEO Series accession number GSE55537. Linear models for microarray data were applied to estimate fold changes between data sets and the respective multiple testing adjusted p-values (FDR q-values). The interpretation of the

  19. Calmodulin of the tropical sea cucumber: Gene structure, inducible expression and contribution to nitric oxide production and pathogen clearance during immune response.


    Chen, Ting; Ren, Chunhua; Li, Wuhu; Jiang, Xiao; Xia, Jianjun; Wong, Nai-Kei; Hu, Chaoqun


    Calmodulin (CaM) is an essential second messenger protein that transduces calcium signals by binding calcium ions (Ca(2+)) and modulating its interactions with various target proteins. In contrast to vertebrates, where CaM is well established as a cofactor for Ca(2+)-dependent physiological and cellular functions including host defense, there is a paucity of understanding on CaM in invertebrates (such as echinoderms) in response to immune challenge or microbial infections. In this study, we obtained and described the gene sequence of CaM from the tropical sea cucumber Stichopus monotuberculatus, a promising yet poorly characterized aquacultural species. mRNA expression of StmCaM could be detected in the intestine and coelomic fluid after Vibrio alginolyticus injection. Transcriptional and translational expression of StmCaM was inducible in nature, as evidenced by the expression patterns in primary coelomocytes following Vibrio challenge. This response could be mimicked by the Vibrio cells membrane components or lipopolysaccharides (LPS), and blocked by co-treatment of the LPS-neutralizing agent polymyxin B (PMB). Furthermore, inhibition of CaM activity by incubation with its inhibitor trifluoroperazine dihydrochloride (TFP) blunted the production of Vibrio-induced nitric oxide (NO) and augmented the survival of invading Vibrio in coelomocytes. Collectively, our study here supplied the first evidence for echinoderm CaM participation in innate immunity, and provided a functional link between CaM expression and antibacterial NO production in sea cucumber. PMID:25913576

  20. [Genes Responsible for Epileptic Syndromes].


    Kato, Mitsuhiro


    The first causative gene for epileptic syndrome was revealed 20 years ago. Since then, many genes responsible for epileptic syndrome, particularly sporadic epileptic encephalopathies, such as Ohtahara syndrome, West syndrome, and focal cortical dysplasia, have been identified. Although epilepsy was recognized as a channelopathy in the beginning stages of gene discovery, other molecular mechanisms for epileptic syndromes, such as interneuronopathy, synaptic vesicle release, and mTOR signal transduction, are emerging. A new technique for gene analysis using the next-generation sequencer is now available for clinical purpose abroad and precision medicine based on the molecular mechanisms has started. Infrastructural development of the official framework, from molecular diagnosis to personalized therapy, is urgently required in Japan. PMID:26873236

  1. Immune Responses Induced by Gene Gun or Intramuscular Injection of DNA Vaccines That Express Immunogenic Regions of the Serine Repeat Antigen from Plasmodium falciparum

    PubMed Central

    Belperron, Alexia A.; Feltquate, David; Fox, Barbara A.; Horii, Toshihiro; Bzik, David J.


    The liver- and blood-stage-expressed serine repeat antigen (SERA) of Plasmodium falciparum is a candidate protein for a human malaria vaccine. We compared the immune responses induced in mice immunized with SERA-expressing plasmid DNA vaccines delivered by intramuscular (i.m.) injection or delivered intradermally by Gene Gun immunization. Mice were immunized with a pcdna3 plasmid encoding the entire 47-kDa domain of SERA (amino acids 17 to 382) or the N-terminal domain (amino acids 17 to 110) of SERA. Minimal antibody responses were detected following DNA vaccination with the N-terminal domain of SERA, suggesting that the N-terminal domain alone is not highly immunogenic by this route of vaccine delivery. Immunization of mice by Gene Gun delivery of the 47-kDa domain of SERA elicited a significantly higher serum antibody titer to the antigen than immunization of mice by i.m. injection with the same plasmid did. The predominant isotype subclass of the antibodies elicited to the SERA protein following i.m. and Gene Gun immunizations with SERA plasmid DNA was immunoglobulin G1. Coimmunization of mice with SERA plasmid DNA and a plasmid expressing the hepatitis B surface antigen (pCMV-s) by the i.m. route resulted in higher anti-SERA titers than those generated in mice immunized with the SERA DNA plasmid alone. Vaccination with DNA may provide a viable alternative or may be used in conjunction with protein-based subunit vaccines to maximize the efficacy of a human malaria vaccine that includes immunogenic regions of the SERA protein. PMID:10496891

  2. Immune responses induced by gene gun or intramuscular injection of DNA vaccines that express immunogenic regions of the serine repeat antigen from Plasmodium falciparum.


    Belperron, A A; Feltquate, D; Fox, B A; Horii, T; Bzik, D J


    The liver- and blood-stage-expressed serine repeat antigen (SERA) of Plasmodium falciparum is a candidate protein for a human malaria vaccine. We compared the immune responses induced in mice immunized with SERA-expressing plasmid DNA vaccines delivered by intramuscular (i.m.) injection or delivered intradermally by Gene Gun immunization. Mice were immunized with a pcdna3 plasmid encoding the entire 47-kDa domain of SERA (amino acids 17 to 382) or the N-terminal domain (amino acids 17 to 110) of SERA. Minimal antibody responses were detected following DNA vaccination with the N-terminal domain of SERA, suggesting that the N-terminal domain alone is not highly immunogenic by this route of vaccine delivery. Immunization of mice by Gene Gun delivery of the 47-kDa domain of SERA elicited a significantly higher serum antibody titer to the antigen than immunization of mice by i.m. injection with the same plasmid did. The predominant isotype subclass of the antibodies elicited to the SERA protein following i.m. and Gene Gun immunizations with SERA plasmid DNA was immunoglobulin G1. Coimmunization of mice with SERA plasmid DNA and a plasmid expressing the hepatitis B surface antigen (pCMV-s) by the i.m. route resulted in higher anti-SERA titers than those generated in mice immunized with the SERA DNA plasmid alone. Vaccination with DNA may provide a viable alternative or may be used in conjunction with protein-based subunit vaccines to maximize the efficacy of a human malaria vaccine that includes immunogenic regions of the SERA protein. PMID:10496891

  3. DNA‐damage response gene GADD45A induces differentiation in hematopoietic stem cells without inhibiting cell cycle or survival

    PubMed Central

    Wingert, Susanne; Thalheimer, Frederic B.; Haetscher, Nadine; Rehage, Maike; Schroeder, Timm


    Abstract Hematopoietic stem cells (HSCs) maintain blood cell production life‐long by their unique abilities of self‐renewal and differentiation into all blood cell lineages. Growth arrest and DNA‐damage‐inducible 45 alpha (GADD45A) is induced by genotoxic stress in HSCs. GADD45A has been implicated in cell cycle control, cell death and senescence, as well as in DNA‐damage repair. In general, GADD45A provides cellular stability by either arresting the cell cycle progression until DNA damage is repaired or, in cases of fatal damage, by inducing apoptosis. However, the function of GADD45A in hematopoiesis remains controversial. We revealed the changes in murine HSC fate control orchestrated by the expression of GADD45A at single cell resolution. In contrast to other cellular systems, GADD45A expression did not cause a cell cycle arrest or an alteration in the decision between cell survival and apoptosis in HSCs. Strikingly, GADD45A strongly induced and accelerated the differentiation program in HSCs. Continuous tracking of individual HSCs and their progeny via time‐lapse microscopy elucidated that once GADD45A was expressed, HSCs differentiate into committed progenitors within 29 hours. GADD45A‐expressing HSCs failed to long‐term reconstitute the blood of recipients by inducing multilineage differentiation in vivo. Importantly, γ‐irradiation of HSCs induced their differentiation by upregulating endogenous GADD45A. The differentiation induction by GADD45A was transmitted by activating p38 Mitogen‐activated protein kinase (MAPK) signaling and allowed the generation of megakaryocytic‐erythroid, myeloid, and lymphoid lineages. These data indicate that genotoxic stress‐induced GADD45A expression in HSCs prevents their fatal transformation by directing them into differentiation and thereby clearing them from the system. Stem Cells 2016;34:699–710 PMID:26731607

  4. DNA-damage response gene GADD45A induces differentiation in hematopoietic stem cells without inhibiting cell cycle or survival.


    Wingert, Susanne; Thalheimer, Frederic B; Haetscher, Nadine; Rehage, Maike; Schroeder, Timm; Rieger, Michael A


    Hematopoietic stem cells (HSCs) maintain blood cell production life-long by their unique abilities of self-renewal and differentiation into all blood cell lineages. Growth arrest and DNA-damage-inducible 45 alpha (GADD45A) is induced by genotoxic stress in HSCs. GADD45A has been implicated in cell cycle control, cell death and senescence, as well as in DNA-damage repair. In general, GADD45A provides cellular stability by either arresting the cell cycle progression until DNA damage is repaired or, in cases of fatal damage, by inducing apoptosis. However, the function of GADD45A in hematopoiesis remains controversial. We revealed the changes in murine HSC fate control orchestrated by the expression of GADD45A at single cell resolution. In contrast to other cellular systems, GADD45A expression did not cause a cell cycle arrest or an alteration in the decision between cell survival and apoptosis in HSCs. Strikingly, GADD45A strongly induced and accelerated the differentiation program in HSCs. Continuous tracking of individual HSCs and their progeny via time-lapse microscopy elucidated that once GADD45A was expressed, HSCs differentiate into committed progenitors within 29 hours. GADD45A-expressing HSCs failed to long-term reconstitute the blood of recipients by inducing multilineage differentiation in vivo. Importantly, γ-irradiation of HSCs induced their differentiation by upregulating endogenous GADD45A. The differentiation induction by GADD45A was transmitted by activating p38 Mitogen-activated protein kinase (MAPK) signaling and allowed the generation of megakaryocytic-erythroid, myeloid, and lymphoid lineages. These data indicate that genotoxic stress-induced GADD45A expression in HSCs prevents their fatal transformation by directing them into differentiation and thereby clearing them from the system. Stem Cells 2016;34:699-710. PMID:26731607

  5. Hepatitis C Virus Frameshift/Alternate Reading Frame Protein Suppresses Interferon Responses Mediated by Pattern Recognition Receptor Retinoic-Acid-Inducible Gene-I

    PubMed Central

    Park, Seung Bum; Seronello, Scott; Mayer, Wasima; Ojcius, David M.


    Hepatitis C virus (HCV) actively evades host interferon (IFN) responses but the mechanisms of how it does so are not completely understood. In this study, we present evidence for an HCV factor that contributes to the suppression of retinoic-acid-inducible gene-I (RIG-I)-mediated IFN induction. Expression of frameshift/alternate reading frame protein (F/ARFP) from HCV -2/+1 frame in Huh7 hepatoma cells suppressed type I IFN responses stimulated by HCV RNA pathogen-associated molecular pattern (PAMP) and poly(IC). The suppression occurred independently of other HCV factors; and activation of interferon stimulated genes, TNFα, IFN-λ1, and IFN-λ2/3 was likewise suppressed by HCV F/ARFP. Point mutations in the full-length HCV sequence (JFH1 genotype 2a strain) were made to introduce premature termination codons in the -2/+1 reading frame coding for F/ARFP while preserving the original reading frame, which enhanced IFNα and IFNβ induction by HCV. The potentiation of IFN response by the F/ARFP mutations was diminished in Huh7.5 cells, which already have a defective RIG-I, and by decreasing RIG-I expression in Huh7 cells. Furthermore, adding F/ARFP back via trans-complementation suppressed IFN induction in the F/ARFP mutant. The F/ARFP mutants, on the other hand, were not resistant to exogenous IFNα. Finally, HCV-infected human liver samples showed significant F/ARFP antibody reactivity, compared to HCV-uninfected control livers. Therefore, HCV F/ARFP likely cooperates with other viral factors to suppress type I and III IFN induction occurring through the RIG-I signaling pathway. This study identifies a novel mechanism of pattern recognition receptor modulation by HCV and suggests a biological function of the HCV alternate reading frame in the modulation of host innate immunity. PMID:27404108

  6. Glutathione-mediated regulation of nitric oxide, S-nitrosothiol and redox homeostasis confers cadmium tolerance by inducing transcription factors and stress response genes in tomato.


    Hasan, Md Kamrul; Liu, Congcong; Wang, Fanan; Ahammed, Golam Jalal; Zhou, Jie; Xu, Ming-Xing; Yu, Jing-Quan; Xia, Xiao-Jian


    Glutathione (GSH) plays a critical role in plant growth, development and responses to stress. However, the mechanism by which GSH regulates tolerance to cadmium (Cd) stress still remains unclear. Here we show that inhibition of GSH biosynthesis by buthionine sulfoximine (BSO) aggravated Cd toxicity by increasing accumulation of reactive oxygen species (ROS) and reducing contents of nitric oxide (NO) and S-nitrosothiol (SNO) in tomato roots. In contrast, exogenous GSH alleviated Cd toxicity by substantially minimizing ROS accumulation and increasing contents of NO and SNO, and activities of antioxidant enzymes that eventually reduced oxidative stress. GSH-induced enhancement in Cd tolerance was closely associated with the upregulation of transcripts of several transcription factors such as ETHYLENE RESPONSIVE TRANSCRIPTION FACTOR 1 (ERF1), ERF2, MYB1 TRANSCRIPTION FACTOR- AIM1 and R2R3-MYB TRANSCRIPTION FACTOR- AN2, and some stress response genes. In addition, GSH modulated the cellular redox balance through maintaining increased GSH: GSSG and AsA: DHA ratios, and also increased phytochelatins contents. Nonetheless, GSH-induced alleviation of Cd phytotoxicity was also associated with increased sequestration of Cd into cell walls and vacuoles but not with Cd accumulation. Under Cd stress, while treatment with BSO slightly decreased vacuolar fraction of Cd, combined treatment with BSO and GSH noticeably increased that fraction. Our results suggest that GSH increases tomato tolerance to Cd stress not only by promoting the chelation and sequestration of Cd but also by stimulating NO, SNO and the antioxidant system through a redox-dependent mechanism. PMID:27472435

  7. The Cellular Response to Oxidatively Induced DNA Damage and Polymorphism of Some DNA Repair Genes Associated with Clinicopathological Features of Bladder Cancer

    PubMed Central

    Savina, Nataliya V.; Nikitchenko, Nataliya V.; Kuzhir, Tatyana D.; Rolevich, Alexander I.; Krasny, Sergei A.; Goncharova, Roza I.


    Genome instability and impaired DNA repair are hallmarks of carcinogenesis. The study was aimed at evaluating the DNA damage response in H2O2-treated lymphocytes using the alkaline comet assay in bladder cancer (BC) patients as compared to clinically healthy controls, elderly persons, and individuals with chronic inflammations. Polymorphism in DNA repair genes involved in nucleotide excision repair (NER) and base excision repair (BER) was studied using the PCR-RFLP method in the Belarusian population to elucidate the possible association of their variations with both bladder cancer risk and clinicopathological features of tumors. The increased level of H2O2-induced DNA damage and a higher proportion of individuals sensitive to oxidative stress were found among BC patients as compared to other groups under study. Heterozygosity in the XPD gene (codon 751) increased cancer risk: OR (95% CI) = 1.36 (1.03–1.81), p = 0.031. The frequency of the XPD 312Asn allele was significantly higher in T ≥ 2 high grade than in T ≥ 2 low grade tumors (p = 0.036); the ERCC6 1097Val/Val genotype was strongly associated with muscle-invasive tumors. Combinations of homozygous wild type alleles occurred with the increased frequency in patients with non-muscle-invasive tumors suggesting that the maintenance of normal DNA repair activity may prevent cancer progression. PMID:26649138

  8. Chicken ovalbumin upstream promoter-transcription factor interacts with estrogen receptor, binds to estrogen response elements and half-sites, and inhibits estrogen-induced gene expression.


    Klinge, C M; Silver, B F; Driscoll, M D; Sathya, G; Bambara, R A; Hilf, R


    Chicken ovalbumin upstream promoter-transcription factor (COUP-TF) was identified as a low abundance protein in bovine uterus that co-purified with estrogen receptor (ER) in a ligand-independent manner and was separated from the ER by its lower retention on estrogen response element (ERE)-Sepharose. In gel mobility shift assays, COUP-TF bound as an apparent dimer to ERE and ERE half-sites. COUP-TF bound to an ERE half-site with high affinity, Kd = 1.24 nM. In contrast, ER did not bind a single ERE half-site. None of the class II nuclear receptors analyzed, i.e. retinoic acid receptor, retinoid X receptor, thyroid receptor, peroxisome proliferator-activated receptor, or vitamin D receptor, were constituents of the COUP-TF.DNA binding complex detected in gel mobility shift assays. Direct interaction of COUP-TF with ER was indicated by GST "pull-down" and co-immunoprecipitation assays. The nature of the ER ligand influenced COUP-TF-ERE half-site binding. When ER was liganded by the antiestrogen 4-hydroxytamoxifen (4-OHT), COUP-TF-half-site interaction decreased. Conversely, COUP-TF transcribed and translated in vitro enhanced the ERE binding of purified estradiol (E2)-liganded ER but not 4-OHT-liganded ER. Co-transfection of ER-expressing MCF-7 human breast cancer cells with an expression vector for COUP-TFI resulted in a dose-dependent inhibition of E2-induced expression of a luciferase reporter gene under the control of three tandem copies of EREc38. The ability of COUP-TF to bind specifically to EREs and half-sites, to interact with ER, and to inhibit E2-induced gene expression suggests COUP-TF regulates ER action by both direct DNA binding competition and through protein-protein interactions. PMID:9395481

  9. Dral Is a P53-Responsive Gene Whose Four and a Half Lim Domain Protein Product Induces Apoptosis

    PubMed Central

    Scholl, Florence A.; McLoughlin, Patricia; Ehler, Elisabeth; de Giovanni, Carla; Schäfer, Beat W.


    DRAL is a four and a half LIM domain protein identified because of its differential expression between normal human myoblasts and the malignant counterparts, rhabdomyosarcoma cells. In the current study, we demonstrate that transcription of the DRAL gene can be stimulated by p53, since transient expression of functional p53 in rhabdomyosarcoma cells as well as stimulation of endogenous p53 by ionizing radiation in wild-type cells enhances DRAL mRNA levels. In support of these observations, five potential p53 target sites could be identified in the promoter region of the human DRAL gene. To obtain insight into the possible functions of DRAL, ectopic expression experiments were performed. Interestingly, DRAL expression efficiently triggered apoptosis in three cell lines of different origin to the extent that no cells could be generated that stably overexpressed this protein. However, transient transfection experiments as well as immunofluorescence staining of the endogenous protein allowed for the localization of DRAL in different cellular compartments, namely cytoplasm, nucleus, focal contacts, as well as Z-discs and to a lesser extent the M-bands in cardiac myofibrils. These data suggest that downregulation of DRAL might be involved in tumor development. Furthermore, DRAL expression might be important for heart function. PMID:11062252

  10. Comparative analysis of cytotoxic T lymphocyte response induced by dendritic cells pulsed with recombinant adeno-associated virus carrying α-fetoprotein gene or cancer cell lysate.


    Zhou, Jun; Ma, Ping; Li, Jun; Song, Wei


    Hepatocellular carcinoma (HCC) is one of the most common and difficult to treat types of cancer worldwide. Antigen‑targeted immunotherapy has the potential to be a novel and effective adjuvant for use in HCC. In the present study, recombinant adeno‑associated virus carrying the α‑fetoprotein gene (rAAV/AFP) and cancer cell lysates were used to pulse antigen‑presenting dendritic cells (DCs) in order to stimulate a cytotoxic T lymphocyte (CTL) response against HCC. rAAV/AFP‑pulsed and cancer cell lysate‑pulsed DCs resulted in a mature DC phenotype with high expression of major histocompatibility complex (MHC) class I, MHC class II, CD80, CD83 and CD86 molecules. However, rAAV/AFP‑pulsed DCs exhibited superiority over cancer cell lysate‑pulsed DCs in terms of stimulating proliferation of T cells, activating T cells to secret interferon‑γ (IFN‑γ) and inducing an AFP‑specific MHC class I‑restricted CTL response. The current data suggest that pulsing of DCs using rAAV/AFP is more effective than the cancer cell lysate‑pulsing technique, and that this technique may be used for the development of immunotherapy in AFP‑positive HCC. PMID:25484119

  11. Lipopolysaccharide-induced early response genes in bovine peripheral blood mononuclear cells implicate GLG1/E-selectin as a key ligand–receptor interaction

    Technology Transfer Automated Retrieval System (TEKTRAN)

    This study uses a systems biology approach, integrating global gene expression information and knowledge of the regulatory events in cells to identify transcription networks controlling peripheral blood mononuclear cells’ (PBMCs) immune response to lipopolysaccharide (LPS) and to identify the molecu...

  12. IL-10 induces gene expression in macrophages: partial overlap with IL-5 but not with IL-4 induced genes.


    Stumpo, Rita; Kauer, Manfred; Martin, Stephan; Kolb, Hubert


    The hypothesis that IL-10, in addition to down-regulating pro-inflammatory activities of macrophages, induces an alternative state of macrophage reactivity was tested. We therefore conducted a systematic search for genes induced by IL-10 using the method of suppression subtractive hybridisation. Of an initial 1,300 candidate clones obtained, several screening rounds led to the identification of 51 clones which were reproducibly at least twofold up-regulated in mouse J774 macrophages in response to treatment with IL-10. Of these, 41 genes were homologous to known genes involved in cell metabolism or immunoregulation, five contained novel sequences and another five were homologous to ESTs without known function. One major finding was that about 25% of the IL-10 genes were also found expressed in response to IFNgamma, and several of these also reappeared in IL-4 or IL-5 induced mRNA species. Hence, Th1 and Th2 type cytokines may elicit a common basal activation response in macrophages. The second major finding was that 57% of IL-10 induced genes reappeared in IL-5 induced mRNA but no more than 18% were also found in IL-4 induced mRNA of J774 cells. We conclude that the gene expression response to IL-10 in macrophages is partially different from the response to IL-5 and is substantially different from the response to IL-4, which suggests an unexpected diversity of biological phenotypes induced by different Th2 type cytokines. PMID:14561490

  13. Analysis of anamnestic immune responses in adult horses and priming in neonates induced by a DNA vaccine expressing the vapA gene of Rhodococcus equi.


    Lopez, A Marianela; Hines, Melissa T; Palmer, Guy H; Knowles, Donald P; Alperin, Debra C; Hines, Stephen A


    Rhodococcus equi remains one of the most important pathogens of early life in horses, yet conventional vaccines to prevent rhodococcal pneumonia have not been successful. DNA vaccination offers an alternative to conventional vaccines with specific advantages for immunization of neonates. We developed a DNA vaccine expressing the vapA gene (pVR1055vapA) that induced an anamnestic response characterized by virulence associated protein A (VapA)-specific IgG antibodies in sera and bronchoalveolar lavage fluid (BALF) as well as VapA-specific proliferation of pulmonary lymphocytes when tested in adult ponies. In contrast, none of the adults receiving the control plasmid responded. To determine if pVR1055vapA induced VapA-specific responses in the foal, the targeted age group for vaccination against R. equi, 10 naïve foals were randomly assigned at birth to two groups of five. At 8-15 days of age (day 1), foals were vaccinated by intranasal and intradermal (i.d.) routes with either pVR1055vapA or the negative control pVR1055vapA_rev. All foals were DNA boosted at day 14 and protein boosted at day 30 with either recombinant VapA or recombinant CAT (control group). Prior to the protein boost, neither group developed VapA-specific immune responses. However, at day 45, two of the VR1055vapA-vaccinated foals had increased titers of VapA-specific IgGb, IgM and IgGa in the sera, and IgG in the BALF. The induction of the opsonizing isotypes IgGa and IgGb has been previously shown to be associated with protection against R. equi. No VapA-specific immune responses were detected in the control group. This study indicates that the DNA vaccine effectively stimulates anamnestic systemic and pulmonary immune responses in adult horses. The results in foals suggest that the DNA vaccine also primed a subset of immunized neonates. These data support further development and modification to produce a DNA vaccine to more effectively prime neonatal foals. PMID:12922115

  14. Gravity-Induced Gene Expression in Plants.

    NASA Astrophysics Data System (ADS)

    Sederoff, Heike; Heber, Steffen; Howard, Brian; Myburg-Nichols, Henrietta; Hammond, Rebecca; Salinas-Mondragon, Raul; Brown, Christopher S.

    Plants sense changes in their orientation towards the vector of gravity and respond with directional growth. Several metabolites in the signal transduction cascade have been identified. However, very little is known about the interaction between these sensing and signal transduction events and even less is known about their role in the differential growth response. Gravity induced changes in transcript abundance have been identified in Arabidopsis whole seedlings and root apices (Moseyko et al. 2002; Kimbrough et al. 2004). Gravity induced transcript abundance changes can be observed within less than 1 min after stimulation (Salinas-Mondragon et al. 2005). Gene expression however requires not only transcription but also translation of the mRNA. Translation can only occur when mRNA is associated with ribosomes, even though not all mRNA associated with ribosomes is actively translated. To approximate translational capacity we quantified whole genome transcript abundances in corn stem pulvini during the first hour after gravity stimulation in total and poly-ribosomal fractions. As in Arabidopsis root apices, transcript abundances of several clusters of genes responded to gravity stimulation. The vast majority of these transcripts were also found to associate with polyribosomes in the same temporal and quantitative pattern. These genes are transcriptionally regulated by gravity stimulation, but do not exhibit translational regulation. However, a small group of genes showed increased transcriptional regulation after gravity stimulation, but no association with polysomes. These transcripts likely are translationally repressed. The mechanism of translational repression for these transcripts is unknown. Based on the hypothesis that the genes essential for gravitropic responses should be expressed in most or all species, we compared the temporal gravity induced expression pattern of all orthologs identified between maize and Arabidopsis. A small group of genes showed high

  15. Gene 33/Mig-6, a transcriptionally inducible adapter protein that binds GTP-Cdc42 and activates SAPK/JNK. A potential marker transcript for chronic pathologic conditions, such as diabetic nephropathy. Possible role in the response to persistent stress.


    Makkinje, A; Quinn, D A; Chen, A; Cadilla, C L; Force, T; Bonventre, J V; Kyriakis, J M


    Chronic stresses, including the mechanical strain caused by hypertension or excess pulmonary ventilation pressure, lead to important clinical consequences, including hypertrophy and acute respiratory distress syndrome. Pathologic hypertrophy contributes to decreased organ function and, ultimately, organ failure; and cardiac and diabetic renal hypertrophy are major causes of morbidity and morality in the developed world. Likewise, acute respiratory distress syndrome is a serious potential side effect of mechanical pulmonary ventilation. Whereas the deleterious effects of chronic stress are well established, the molecular mechanisms by which these stresses affect cell function are still poorly characterized. gene 33 (also called mitogen-inducible gene-6, mig-6) is an immediate early gene that is transcriptionally induced by a divergent array of extracellular stimuli. The physiologic function of Gene 33 is unknown. Here we show that gene 33 mRNA levels increase sharply in response to a set of commonly occurring chronic stress stimuli: mechanical strain, vasoactive peptides, and diabetic nephropathy. Induction of gene 33 requires the stress-activated protein kinases (SAPKs)/c-Jun NH(2)-terminal kinases. This expression pattern suggests that gene 33 is a potential marker for diabetic nephropathy and other pathologic responses to persistent sublethal stress. The structure of Gene 33 indicates an adapter protein capable of binding monomeric GTPases of the Rho subfamily. Consistent with this, Gene 33 interacts in vivo and, in a GTP-dependent manner, in vitro with Cdc42Hs; and transient expression of Gene 33 results in the selective activation of the SAPKs. These results imply a reciprocal, positive feedback relationship between Gene 33 expression and SAPK activation. Expression of Gene 33 at sufficient levels may enable a compensatory reprogramming of cellular function in response to chronic stress, which may have pathophysiological consequences. PMID:10749885

  16. The surgically induced stress response.


    Finnerty, Celeste C; Mabvuure, Nigel Tapiwa; Ali, Arham; Kozar, Rosemary A; Herndon, David N


    The stress response to surgery, critical illness, trauma, and burns encompasses derangements of metabolic and physiological processes that induce perturbations in the inflammatory, acute phase, hormonal, and genomic responses. Hypermetabolism and hypercatabolism result, leading to muscle wasting, impaired immune function and wound healing, organ failure, and death. The surgery-induced stress response is largely similar to that triggered by traumatic injuries; the duration of the stress response, however, varies according to the severity of injury (surgical or traumatic). This spectrum of injuries and insults ranges from small lacerations to severe insults such as large poly-traumatic and burn injuries. Burn injuries provide an extreme model of trauma induced stress responses that can be used to study the long-term effects of a prolonged stress response. Although the stress response to acute trauma evolved to confer improved chances of survival following injury, in modern surgical practice the stress response can be detrimental. PMID:24009246

  17. Early induced protein 1 (PrELIP1) and other photosynthetic, stress and epigenetic regulation genes are involved in Pinus radiata D. don UV-B radiation response.


    Valledor, Luis; Cañal, María Jesús; Pascual, Jesús; Rodríguez, Roberto; Meijón, Mónica


    The continuous atmospheric and environmental deterioration is likely to increase, among others, the influx of ultraviolet B (UV-B) radiation. The plants have photoprotective responses, which are complex mechanisms involving different physiological responses, to avoid the damages caused by this radiation that may lead to plant death. We have studied the adaptive responses to UV-B in Pinus radiata, given the importance of this species in conifer forests and reforestation programs. We analyzed the photosynthetic activity, pigments content, and gene expression of candidate genes related to photosynthesis, stress and gene regulation in needles exposed to UV-B during a 96 h time course. The results reveal a clear increase of pigments under UV-B stress while photosynthetic activity decreased. The expression levels of the studied genes drastically changed after UV-B exposure, were stress related genes were upregulated while photosynthesis (RBCA and RBCS) and epigenetic regulation were downregulated (MSI1, CSDP2, SHM4). The novel gene PrELIP1, fully sequenced for this work, was upregulated and expressed mainly in the palisade parenchyma of needles. This gene has conserved domains related to the dissipation of the UV-B radiation that give to this protein a key role during photoprotection response of the needles in Pinus radiata. PMID:22471584

  18. GhCAX3 Gene, a Novel Ca2+/H+ Exchanger from Cotton, Confers Regulation of Cold Response and ABA Induced Signal Transduction

    PubMed Central

    He, Liangrong; Zhang, Wenwen; He, Xin; Zhang, Xianlong; Yang, Xiyan; Zhu, Longfu


    As a second messenger, Ca2+ plays a major role in cold induced transduction via stimulus-specific increases in [Ca2+]cyt, which is called calcium signature. During this process, CAXs (Ca2+/H+ exchangers) play critical role. For the first time, a putative Ca2+/H+ exchanger GhCAX3 gene from upland cotton (Gossypium hirsutum cv. ‘YZ-1′) was isolated and characterized. It was highly expressed in all tissues of cotton except roots and fibers. This gene may act as a regulator in cotton’s response to abiotic stresses as it could be up-regulated by Ca2+, NaCl, ABA and cold stress. Similar to other CAXs, it was proved that GhCAX3 also had Ca2+ transport activity and the N-terminal regulatory region (NRR) through yeast complementation assay. Over-expression of GhCAX3 in tobacco showed less sensitivity to ABA during seed germination and seedling stages, and the phenotypic difference between wild type (WT) and transgenic plants was more significant when the NRR was truncated. Furthermore, GhCAX3 conferred cold tolerance in yeast as well as in tobacco seedlings based on physiological and molecular studies. However, transgenic plant seeds showed more sensitivity to cold stress compared to WT during seed germination, especially when expressed in N-terminal truncated version. Finally, the extent of sensitivity in transgenic lines was more severe than that in WT line under sodium tungstate treatment (an ABA repressor), indicating that ABA could alleviate cold sensitivity of GhCAX3 seeds, especially in short of its NRR. Meanwhile, we also found that overexpression of GhCAX3 could enhance some cold and ABA responsive marker genes. Taken together, these results suggested that GhCAX3 plays important roles in the cross-talk of ABA and cold signal transduction, and compared to full-length of GhCAX3, the absence of NRR could enhance the tolerance or sensitivity to cold stress, depending on seedling’s developmental stages. PMID:23776653

  19. Biphasic response of checkpoint control proteins in hyperoxia: Exposure to lower levels of oxygen induces genome maintenance genes in experimental baboon BPD

    PubMed Central

    Das, Kumuda C.; Wasnick, John D.


    Breathing high concentrations of oxygen (hyperoxia) causes lung injury and is associated with lung diseases such as bronchopulmonary dysplasia (BPD), respiratory distress syndrome (RDS) and persistent pulmonary hypertension of the newborns (PPHN). Hyperoxia (95–100%O2) causes DNA damage and growth arrest of lung cells and consequently cells die by apoptosis or necrosis. Although supplemental oxygen therapy is clinically important, the level and duration of hyperoxic exposure that would allow lung cells to reenter the cell cycle remains unclear. We hypothesized that cells exposed lower concentrations of hyperoxia will retain the capacity to enter cell cycle when recovered in room air. We employed varying concentrations of oxygen (21–95%) to determine the response of lung cells to hyperoxia. Our results indicate that cells were growth arrested and failed to reenter the cell cycle when exposed to greater than 60% oxygen. Cell cycle checkpoint proteins were increased in a biphasic manner, increasing until 70% oxygen, but declined in greater than 90% oxygen. Microarray analysis shows that there is significant decrease in the abundance of Cdks 6–8 and retinoblastoma protein (Rb), p107 and p130 in exposure to 90% oxygen for 48 hours. We further tested the effect of clinically relevant as needed oxygen [(pro-re-nada (prn)] in premature infant (125d and 140d) baboon model of bronchopulmonary dysplasia (BPD). The microarray results show that 6 or 14d PRN oxygen exposed animals had induced expression of chromosomal maintenance genes (MCMs), genes related to anti-inflammation, proliferation and differentiation. PMID:24939362

  20. Epstein-Barr Virus-Induced Gene 3 (EBI3) Blocking Leads to Induce Antitumor Cytotoxic T Lymphocyte Response and Suppress Tumor Growth in Colorectal Cancer by Bidirectional Reciprocal-Regulation STAT3 Signaling Pathway

    PubMed Central

    Liang, Yanfang; Chen, Qianqian; Du, Wenjing; Chen, Can; Li, Feifei; Yang, Jingying; Peng, Jianyu; Kang, Dongping; Lin, Bihua; Chai, Xingxing; Zhou, Keyuan; Zeng, Jincheng


    Epstein-Barr virus-induced gene 3 (EBI3) is a member of the interleukin-12 (IL-12) family structural subunit and can form a heterodimer with IL-27p28 and IL-12p35 subunit to build IL-27 and IL-35, respectively. However, IL-27 stimulates whereas IL-35 inhibits antitumor T cell responses. To date, little is known about the role of EBI3 in tumor microenvironment. In this study, firstly we assessed EBI3, IL-27p28, IL-12p35, gp130, and p-STAT3 expression with clinicopathological parameters of colorectal cancer (CRC) tissues; then we evaluated the antitumor T cell responses and tumor growth with a EBI3 blocking peptide. We found that elevated EBI3 may be associated with IL-12p35, gp130, and p-STAT3 to promote CRC progression. EBI3 blocking peptide promoted antitumor cytotoxic T lymphocyte (CTL) response by inducing Granzyme B, IFN-γ production, and p-STAT3 expression and inhibited CRC cell proliferation and tumor growth to associate with suppressing gp130 and p-STAT3 expression. Taken together, these results suggest that EBI3 may mediate a bidirectional reciprocal-regulation STAT3 signaling pathway to assist the tumor escape immune surveillance in CRC. PMID:27247488

  1. Injury-induced immune responses in Hydra.


    Wenger, Yvan; Buzgariu, Wanda; Reiter, Silke; Galliot, Brigitte


    The impact of injury-induced immune responses on animal regenerative processes is highly variable, positive or negative depending on the context. This likely reflects the complexity of the innate immune system that behaves as a sentinel in the transition from injury to regeneration. Early-branching invertebrates with high regenerative potential as Hydra provide a unique framework to dissect how injury-induced immune responses impact regeneration. A series of early cellular events likely require an efficient immune response after amputation, as antimicrobial defence, epithelial cell stretching for wound closure, migration of interstitial progenitors toward the wound, cell death, phagocytosis of cell debris, or reconstruction of the extracellular matrix. The analysis of the injury-induced transcriptomic modulations of 2636 genes annotated as immune genes in Hydra identified 43 genes showing an immediate/early pulse regulation in all regenerative contexts examined. These regulations point to an enhanced cytoprotection via ROS signaling (Nrf, C/EBP, p62/SQSMT1-l2), TNFR and TLR signaling (TNFR16-like, TRAF2l, TRAF5l, jun, fos-related, SIK2, ATF1/CREB, LRRC28, LRRC40, LRRK2), proteasomal activity (p62/SQSMT1-l1, Ced6/Gulf, NEDD8-conjugating enzyme Ubc12), stress proteins (CRYAB1, CRYAB2, HSP16.2, DnaJB9, HSP90a1), all potentially regulating NF-κB activity. Other genes encoding immune-annotated proteins such as NPYR4, GTPases, Swap70, the antiproliferative BTG1, enzymes involved in lipid metabolism (5-lipoxygenase, ACSF4), secreted clotting factors, secreted peptidases are also pulse regulated upon bisection. By contrast, metalloproteinases and antimicrobial peptide genes largely follow a context-dependent regulation, whereas the protease inhibitor α2macroglobulin gene exhibits a sustained up-regulation. Hence a complex immune response to injury is linked to wound healing and regeneration in Hydra. PMID:25086685

  2. MNK1-induced eIF-4E phosphorylation in myeloma cells: a pathway mediating IL-6-induced expansion and expression of genes involved in metabolic and proteotoxic responses.


    Shi, Yijiang; Frost, Patrick; Hoang, Bao; Yang, Yonghui; Bardeleben, Carolyne; Gera, Joseph; Lichtenstein, Alan


    Because multiple myeloma (MM) cells are at risk for endoplasmic reticulum (ER) stress, they require a carefully regulated mechanism to promote protein translation of selected transcripts when proliferation is stimulated. MAPK-interacting kinases (MNKs) may provide this mechanism by enhancing cap-dependent translation of a small number of critical transcripts. We, thus, tested whether MNKs played a role in MM responses to the myeloma growth factor interleukin-6 (IL-6). IL-6 activated MNK1 phosphorylation and induced phosphorylation of its substrate, eIF-4E, in MM lines and primary specimens. MNK paralysis, achieved pharmacologically or by shRNA, prevented MM expansion stimulated by IL-6. A phosphodefective eIF-4E mutant also prevented the IL-6 response, supporting the notion that MNK's role was via phosphorylation of eIF-4E. Both pharmacological MNK inhibition and expression of the phosphodefective eIF-4E mutant inhibited MM growth in mice. Although critical for IL-6-induced expansion, eIF-4E phosphorylation had no significant effect on global translation or Ig expression. Deep sequencing of ribosome-protected mRNAs revealed a repertoire of genes involved in metabolic processes and ER stress modulation whose translation was regulated by eIF-4E phosphorylation. These data indicate MM cells exploit the MNK/eIF-4E pathway for selective mRNA translation without enhancing global translation and risking ER stress. PMID:24714040

  3. Transfer RNA Derived Small RNAs Targeting Defense Responsive Genes Are Induced during Phytophthora capsici Infection in Black Pepper (Piper nigrum L.).


    Asha, Srinivasan; Soniya, Eppurath V


    Small RNAs derived from transfer RNAs were recently assigned as potential gene regulatory candidates for various stress responses in eukaryotes. In this study, we report on the cloning and identification of tRNA derived small RNAs from black pepper plants in response to the infection of the quick wilt pathogen, Phytophthora capsici. 5'tRFs cloned from black pepper were validated as highly expressed during P. capsici infection. A high-throughput systematic analysis of the small RNAome (sRNAome) revealed the predominance of 5'tRFs in the infected leaf and root. The abundance of 5'tRFs in the sRNAome and the defense responsive genes as their potential targets indicated their regulatory role during stress response in black pepper. The 5'Ala(CGC) tRF mediated cleavage was experimentally mapped at the tRF binding sites on the mRNA targets of Non-expresser of pathogenesis related protein (NPR1), which was down-regulated during pathogen infection. Comparative sRNAome further demonstrated sequence conservation of 5'Ala tRFs across the angiosperm plant groups, and many important genes in the defense response were identified in silico as their potential targets. Our findings uncovered the diversity, differential expression and stress responsive functional role of tRNA-derived small RNAs during Phytophthora infection in black pepper. PMID:27313593

  4. Transfer RNA Derived Small RNAs Targeting Defense Responsive Genes Are Induced during Phytophthora capsici Infection in Black Pepper (Piper nigrum L.)

    PubMed Central

    Asha, Srinivasan; Soniya, Eppurath V.


    Small RNAs derived from transfer RNAs were recently assigned as potential gene regulatory candidates for various stress responses in eukaryotes. In this study, we report on the cloning and identification of tRNA derived small RNAs from black pepper plants in response to the infection of the quick wilt pathogen, Phytophthora capsici. 5′tRFs cloned from black pepper were validated as highly expressed during P. capsici infection. A high-throughput systematic analysis of the small RNAome (sRNAome) revealed the predominance of 5′tRFs in the infected leaf and root. The abundance of 5′tRFs in the sRNAome and the defense responsive genes as their potential targets indicated their regulatory role during stress response in black pepper. The 5′AlaCGC tRF mediated cleavage was experimentally mapped at the tRF binding sites on the mRNA targets of Non-expresser of pathogenesis related protein (NPR1), which was down-regulated during pathogen infection. Comparative sRNAome further demonstrated sequence conservation of 5′Ala tRFs across the angiosperm plant groups, and many important genes in the defense response were identified in silico as their potential targets. Our findings uncovered the diversity, differential expression and stress responsive functional role of tRNA-derived small RNAs during Phytophthora infection in black pepper. PMID:27313593

  5. The Surgically Induced Stress Response

    PubMed Central

    Finnerty, Celeste C.; Mabvuure, Nigel Tapiwa; Ali, Arham; Kozar, Rosemary A.; Herndon, David N.


    The stress response to surgery, critical illness, trauma, and burns encompasses derangements of metabolic and physiological processes which induce perturbations in the inflammatory, acute phase, hormonal, and genomic responses. Hypermetabolism and hypercatabolism result, leading to muscle wasting, impaired immune function and wound healing, organ failure, and death. The surgery-induced stress response is largely similar to that triggered by traumatic injuries; the duration of the stress response, however, varies according to the severity of injury (surgical or traumatic). This spectrum of injuries and insults ranges from small lacerations to severe insults such as large poly-traumatic and burn injuries. Although the stress response to acute trauma evolved to improve chances of survival following injury, in modern surgical practice the stress response can be detrimental. PMID:24009246

  6. Strong Magnetic Field Induced Changes of Gene Expression in Arabidopsis

    NASA Astrophysics Data System (ADS)

    Paul, A.-L.; Ferl, R. J.; Klingenberg, B.; Brooks, J. S.; Morgan, A. N.; Yowtak, J.; Meisel, M. W.


    We review our studies of the biological impact of magnetic field strengths of up to 30 T on transgenic arabidopsis plants engineered with a stress response gene consisting of the alcohol dehydrogenase (Adh) gene promoter driving the β-glucuronidase (GUS) gene reporter. Field strengths in excess of 15 T induce expression of the Adh/GUS transgene in the roots and leaves. Microarray analyses indicate that such field strengths have a far reaching effect on the genome. Wide spread induction of stress-related genes and transcription factors, and a depression of genes associated with cell wall metabolism are prominent examples.


    EPA Science Inventory

    The choice of a dose-response model used for extrapolation can be influenced by knowledge of mechanism of action. We have already showed that arsenic affects methylation of the human p53 gene promoter. Evidence that genes other than the p53 tumor suppressor gene are affected woul...

  8. Changes in DNA methylation and gene expression during 2,3,7,8-tetrachlorodibenzo-p-dioxin-induced suppression of the lipopolysaccharide-stimulated IgM response in splenocytes.


    McClure, Emily A; North, Colin M; Kaminski, Norbert E; Goodman, Jay I


    Lipopolysaccharide (LPS) is a bacterial endotoxin and a potent B-cell activator capable of inducing a humoral immune response. 2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD) is a well-established immunotoxicant that can suppress humoral immune responses, including those initiated by LPS stimulation. In murine models, TCDD-induced suppression of the LPS-activated primary immunoglobulin M (IgM) response is observed both in vivo and in vitro and is typically evaluated as a decrease in the number of IgM antibody-forming cells. The TCDD-induced suppression of the primary humoral immune response occurs, at least in part, upstream of IgM production. The current study was designed as an initial test of our hypothesis that altered DNA methylation, an epigenetic event, is involved in the LPS-induced IgM response by splenocytes as is the suppression of this response by TCDD. Splenocyte-derived DNA from mice treated in vivo with sesame oil + PBS, LPS, TCDD, or LPS + TCDD was used for the current investigation. DNA methylation was evaluated using a technique that permits assessment of the methylation status of multiple genomic regions simultaneously in an unbiased fashion (no specific genes or genomic regions are preselected). Additionally, the expression of selected genes was determined. Our results indicate that treatment with LPS or TCDD can alter DNA methylation and, importantly, combined TCDD + LPS results in altered DNA methylation that was not simply the addition of the changes discerned in the individual treatment groups. Thus, we have identified cross talk between LPS and TCDD at the level of DNA methylation and gene expression. PMID:21212295

  9. pOp6/LhGR: a stringently regulated and highly responsive dexamethasone-inducible gene expression system for tobacco.


    Samalova, Marketa; Brzobohaty, Bretislav; Moore, Ian


    We describe pOp/LhGR, a dexamethasone-inducible derivative of the pOp/LhG4 transcription activation system, and its use in tobacco to regulate expression of uidA (encoding beta-glucuronidase; GUS) and the cytokinin-biosnythetic gene ipt. The pOp/LhGR system exhibited stringent regulation and strong induced phenotypes in soil and tissue culture. In conjunction with an improved target promoter, pOp6, that carries six copies of an optimized lac operator sequence the pOp6/LhGR system directed induced GUS activities that exceeded those obtained with pOp/LhG4 or the CaMV 35S promoter but without increased uninduced activity. A single dose of dexamethasone was sufficient to direct cytotoxic levels of ipt expression in soil-grown plants although uninduced plants grew normally throughout a complete life cycle. In vitro, induced transcripts were detectable within an hour of dexamethasone application and 1 nM dexamethasone was sufficient for half maximal induction of GUS activity. Various methods of dexamethasone application were successfully applied under tissue culture and greenhouse conditions. We observed no inhibitory effects of dexamethasone or LhGR on plant development even with the highest concentrations of inducer, although tobacco seedlings were adversely affected by ethanol used as a solvent for dexamethasone stock solutions. The pOp/LhGR system provides a highly sensitive, efficient, and tightly regulated chemically inducible transgene expression system for tobacco plants. PMID:15743454

  10. Interferon γ-inducible Protein (IFI) 16 Transcriptionally Regulates Type I Interferons and Other Interferon-stimulated Genes and Controls the Interferon Response to both DNA and RNA Viruses*

    PubMed Central

    Thompson, Mikayla R.; Sharma, Shruti; Atianand, Maninjay; Jensen, Søren B.; Carpenter, Susan; Knipe, David M.; Fitzgerald, Katherine A.; Kurt-Jones, Evelyn A.


    The interferon γ-inducible protein 16 (IFI16) has recently been linked to the detection of nuclear and cytosolic DNA during infection with herpes simplex virus-1 and HIV. IFI16 binds dsDNA via HIN200 domains and activates stimulator of interferon genes (STING), leading to TANK (TRAF family member-associated NF-κB activator)-binding kinase-1 (TBK1)-dependent phosphorylation of interferon regulatory factor (IRF) 3 and transcription of type I interferons (IFNs) and related genes. To better understand the role of IFI16 in coordinating type I IFN gene regulation, we generated cell lines with stable knockdown of IFI16 and examined responses to DNA and RNA viruses as well as cyclic dinucleotides. As expected, stable knockdown of IFI16 led to a severely attenuated type I IFN response to DNA ligands and viruses. In contrast, expression of the NF-κB-regulated cytokines IL-6 and IL-1β was unaffected in IFI16 knockdown cells, suggesting that the role of IFI16 in sensing these triggers was unique to the type I IFN pathway. Surprisingly, we also found that knockdown of IFI16 led to a severe attenuation of IFN-α and the IFN-stimulated gene retinoic acid-inducible gene I (RIG-I) in response to cyclic GMP-AMP, a second messenger produced by cyclic GMP-AMP synthase (cGAS) as well as RNA ligands and viruses. Analysis of IFI16 knockdown cells revealed compromised occupancy of RNA polymerase II on the IFN-α promoter in these cells, suggesting that transcription of IFN-stimulated genes is dependent on IFI16. These results indicate a broader role for IFI16 in the regulation of the type I IFN response to RNA and DNA viruses in antiviral immunity. PMID:25002588

  11. Cold-responsive gene regulation during cold acclimation in plants.


    Lissarre, Mickael; Ohta, Masaru; Sato, Aiko; Miura, Kenji


    Regulation of the transcriptome is necessary for plants to acquire cold tolerance, and cold induces several genes via a cold signaling pathway. The transcription factors CBF/DREB1 (C-repeat binding factor/dehydration responsive element binding1) and ICE1 (inducer of CBF expression1) have important roles in the regulation of cold-responsive gene expression. ICE1 is post-translationally regulated by ubiquitylation-mediated proteolysis and sumoylation. This mini-review highlights some recent studies on plant cold signaling. The relationships among cold signaling, salicylic acid accumulation and stomatal development are also discussed. PMID:20699657

  12. Reconstruction of Gene Networks of Iron Response in Shewanella oneidensis

    SciTech Connect

    Yang, Yunfeng; Harris, Daniel P; Luo, Feng; Joachimiak, Marcin; Wu, Liyou; Dehal, Paramvir; Jacobsen, Janet; Yang, Zamin Koo; Gao, Haichun; Arkin, Adam; Palumbo, Anthony Vito; Zhou, Jizhong


    It is of great interest to study the iron response of the -proteobacterium Shewanella oneidensis since it possesses a high content of iron and is capable of utilizing iron for anaerobic respiration. We report here that the iron response in S. oneidensis is a rapid process. To gain more insights into the bacterial response to iron, temporal gene expression profiles were examined for iron depletion and repletion, resulting in identification of iron-responsive biological pathways in a gene co-expression network. Iron acquisition systems, including genes unique to S. oneidensis, were rapidly and strongly induced by iron depletion, and repressed by iron repletion. Some were required for iron depletion, as exemplified by the mutational analysis of the putative siderophore biosynthesis protein SO3032. Unexpectedly, a number of genes related to anaerobic energy metabolism were repressed by iron depletion and induced by repletion, which might be due to the iron storage potential of their protein products. Other iron-responsive biological pathways include protein degradation, aerobic energy metabolism and protein synthesis. Furthermore, sequence motifs enriched in gene clusters as well as their corresponding DNA-binding proteins (Fur, CRP and RpoH) were identified, resulting in a regulatory network of iron response in S. oneidensis. Together, this work provides an overview of iron response and reveals novel features in S. oneidensis, including Shewanella-specific iron acquisition systems, and suggests the intimate relationship between anaerobic energy metabolism and iron response.

  13. Induced polarization response of microbial induced sulfideprecipitation

    SciTech Connect

    Ntarlagiannis, Dimitrios; Williams, Kenneth Hurst; Slater, Lee; Hubbard, Susan


    A laboratory scale experiment was conducted to examine the use of induced polarization and electrical conductivity to monitor microbial induced sulfide precipitation under anaerobic conditions in sand filled columns. Three columns were fabricated; one for electrical measurements, one for geochemical sampling and a third non-inoculated column was used as a control. A continual upward flow of nutrients and metals in solution was established in each column. Desulfovibrio vulgaris microbes were injected into the middle of the geochemical and electrical columns. Iron and zinc sulfides precipitated along a microbial action front as a result of sulfate reduction due by Desulfovibrio vulgaris. The precipitation front initially developed near the microbial injection location, and subsequently migrated towards the nutrient inlet, as a result of chemotaxis by Desulfovibrio vulgaris. Sampling during and subsequent to the experiment revealed spatiotemporal changes in the biogeochemical measurements associated with microbial sulfate reduction. Conductivity measurements were insensitive to all biogeochemical changes occurred within the column. Changes in the IP response (of up to 14 mrad)were observed to coincide in place and in time with the active microbe respiration/sulfide precipitation front as determined from geochemical sampling. The IP response is correlated with the lactate concentration gradient, an indirect measurement of microbial metabolism, suggesting the potential of IP as a method for monitoring microbial respiration/activity. Post experimental destructive sample analysis and SEM imaging verified the geochemical results and supported our hypothesis that microbe induced sulfide precipitation is directly detectable using electrical methods. Although the processes not fully understood, the IP response appears to be sensitive to this anaerobic microbial precipitation, suggesting a possible novel application for the IP method.

  14. Allergen-induced airway responses.


    Gauvreau, Gail M; El-Gammal, Amani I; O'Byrne, Paul M


    Environmental allergens are an important cause of asthma and can contribute to loss of asthma control and exacerbations. Allergen inhalation challenge has been a useful clinical model to examine the mechanisms of allergen-induced airway responses and inflammation. Allergen bronchoconstrictor responses are the early response, which reaches a maximum within 30 min and resolves by 1-3 h, and late responses, when bronchoconstriction recurs after 3-4 h and reaches a maximum over 6-12 h. Late responses are followed by an increase in airway hyperresponsiveness. These responses occur when IgE on mast cells is cross-linked by an allergen, causing degranulation and the release of histamine, neutral proteases and chemotactic factors, and the production of newly formed mediators, such as cysteinyl leukotrienes and prostaglandin D2. Allergen-induced airway inflammation consists of an increase in airway eosinophils, basophils and, less consistently, neutrophils. These responses are mediated by the trafficking and activation of myeloid dendritic cells into the airways, probably as a result of the release of epithelial cell-derived thymic stromal lymphopoietin, and the release of pro-inflammatory cytokines from type 2 helper T-cells. Allergen inhalation challenge has also been a widely used model to study potential new therapies for asthma and has an excellent negative predictive value for this purpose. PMID:26206871

  15. Five-aza-2′-deoxycytidine-induced hypomethylation of cholesterol 25-hydroxylase gene is responsible for cell death of myelodysplasia/leukemia cells

    PubMed Central

    Tsujioka, Takayuki; Yokoi, Akira; Itano, Yoshitaro; Takahashi, Kentaro; Ouchida, Mamoru; Okamoto, Shuichiro; Kondo, Toshinori; Suemori, Shin-ichiro; Tohyama, Yumi; Tohyama, Kaoru


    DNA methyltransferase inhibitors (DNMT inhibitors) are administered for high-risk MDS, but their action mechanisms are not fully understood. Hence, we performed a genome-wide DNA methylation assay and focused on cholesterol 25-hydroxylase (CH25H) among the genes whose expression was up-regulated and whose promoter region was hypomethylated after decitabine (DAC) treatment in vitro. CH25H catalyzes hydroxylation of cholesterol and produces 25-hydroxycholesterol (25-OHC). Although CH25H mRNA expression level was originally low in MDS/leukemia cell lines, exposure to DNMT inhibitors enhanced CH25H mRNA expression. The promoter region of CH25H was originally hypermethylated in HL-60 and MDS-L cells, but DAC treatment induced their hypomethylation together with increased CH25H mRNA expression, activation of CH25H-oxysterol pathway, 25-OHC production and apoptotic cell death. We further confirmed that normal CD34-positive cells revealed hypomethylated status of the promoter region of CH25H gene. CH25H-knockdown by transfection of shRNA lentiviral vector into the cell lines partially protected the cells from DAC-induced cell death. Exogenous addition of 25-OHC suppressed leukemic cell growth. The present study raises a possibility that DNMT inhibitors activate CH25H-oxysterol pathway by their hypomethylating mechanism and induce leukemic cell death. Further investigations of the promoter analysis of CH25H gene and therapeutic effects of DNMT inhibitors on MDS/leukemia will be warranted. PMID:26577244

  16. The novel white spot syndrome virus-induced gene, PmERP15, encodes an ER stress-responsive protein in black tiger shrimp, Penaeus monodon.


    Leu, Jiann-Horng; Liu, Kuan-Fu; Chen, Kuan-Yu; Chen, Shu-Hwa; Wang, Yu-Bin; Lin, Chung-Yen; Lo, Chu-Fang


    By microarray screening, we identified a white spot syndrome virus (WSSV)-strongly induced novel gene in gills of Penaeus monodon. The gene, PmERP15, encodes a putative transmembrane protein of 15 kDa, which only showed some degree of similarity (54-59%) to several unknown insect proteins, but had no hits to shrimp proteins. RT-PCR showed that PmERP15 was highly expressed in the hemocytes, heart and lymphoid organs, and that WSSV-induced strong expression of PmERP15 was evident in all tissues examined. Western blot analysis likewise showed that WSSV strongly up-regulated PmERP15 protein levels. In WSSV-infected hemocytes, immunofluorescence staining showed that PmERP15 protein was colocalized with an ER enzyme, protein disulfide isomerase, and in Sf9 insect cells, PmERP15-EGFP fusion protein colocalized with ER -Tracker™ Red dye as well. GRP78, an ER stress marker, was found to be up-regulated in WSSV-infected P. monodon, and both PmERP15 and GRP78 were up-regulated in shrimp injected with ER stress inducers tunicamycin and dithiothreitol. Silencing experiments showed that although PmERP15 dsRNA-injected shrimp succumbed to WSSV infection more rapidly, the WSSV copy number had no significant changes. These results suggest that PmERP15 is an ER stress-induced, ER resident protein, and its induction in WSSV-infected shrimp is caused by the ER stress triggered by WSSV infection. Furthermore, although PmERP15 has no role in WSSV multiplication, its presence is essential for the survival of WSSV-infected shrimp. PMID:25499032

  17. Vaccinia viruses with a serpin gene deletion and expressing IFN-γ induce potent immune responses without detectable replication in vivo

    PubMed Central

    Legrand, Fatema A.; Verardi, Paulo H.; Chan, Kenneth S.; Peng, Yue; Jones, Leslie A.; Yilma, Tilahun D.


    In a continuing effort to develop safe and efficacious vaccine and immunotherapeutic vectors, we constructed recombinant vaccinia virus (rVV) vaccines lacking either the B13R (SPI-2) or the B22R (SPI-1) immune-modulating gene and coexpressing IFN-γ. B13R and B22R are nonessential VV immune-modulating genes that have antiapoptotic and antiinflammatory properties with sequence homology to serine protease inhibitors (serpins). IFN-γ is a cytokine with potent immunoregulatory, antineoplastic, and antiviral properties. We observed that these rVVs with a deletion in a serpin gene and expressing IFN-γ replicated to high titers in tissue culture yet were avirulent in both immunocompromised and immunocompetent mice with no detectable viral replication in these animals. A single immunization elicited potent humoral, T helper, and cytotoxic T cell immune responses in mice despite the absence of any detectable virus replication in vivo. IFN-γ coexpression and the inactivation of one or more VV immune-modulating genes provide an optimized method for increasing the safety while maintaining the efficacy of rVV vaccines. This strategy provides a method for developing highly safe and efficacious vaccines for smallpox and other diseases and immunotherapeutic vectors. PMID:15705716

  18. Deletion of the α-(1,3)-Glucan Synthase Genes Induces a Restructuring of the Conidial Cell Wall Responsible for the Avirulence of Aspergillus fumigatus

    PubMed Central

    Beauvais, Anne; Bozza, Silvia; Kniemeyer, Olaf; Formosa, Céline; Balloy, Viviane; Henry, Christine; Roberson, Robert W.; Dague, Etienne; Chignard, Michel; Brakhage, Axel A.; Romani, Luigina; Latgé, Jean-Paul


    α-(1,3)-Glucan is a major component of the cell wall of Aspergillus fumigatus, an opportunistic human fungal pathogen. There are three genes (AGS1, AGS2 and AGS3) controlling the biosynthesis of α-(1,3)-glucan in this fungal species. Deletion of all the three AGS genes resulted in a triple mutant that was devoid of α-(1,3)-glucan in its cell wall; however, its growth and germination was identical to that of the parental strain in vitro. In the experimental murine aspergillosis model, this mutant was less pathogenic than the parental strain. The AGS deletion resulted in an extensive structural modification of the conidial cell wall, especially conidial surface where the rodlet layer was covered by an amorphous glycoprotein matrix. This surface modification was responsible for viability reduction of conidia in vivo, which explains decrease in the virulence of triple agsΔ mutant. PMID:24244155

  19. Responses of a triple mutant defective in three iron deficiency-induced Basic Helix-Loop-Helix genes of the subgroup Ib(2) to iron deficiency and salicylic acid.


    Maurer, Felix; Naranjo Arcos, Maria Augusta; Bauer, Petra


    Plants are sessile organisms that adapt to external stress by inducing molecular and physiological responses that serve to better cope with the adverse growth condition. Upon low supply of the micronutrient iron, plants actively increase the acquisition of soil iron into the root and its mobilization from internal stores. The subgroup Ib(2) BHLH genes function as regulators in this response, however their concrete functions are not fully understood. Here, we analyzed a triple loss of function mutant of BHLH39, BHLH100 and BHLH101 (3xbhlh mutant). We found that this mutant did not have any iron uptake phenotype if iron was provided. However, under iron deficiency the mutant displayed a more severe leaf chlorosis than the wild type. Microarray-based transcriptome analysis revealed that this mutant phenotype resulted in the mis-regulation of 198 genes, out of which only 15% were associated with iron deficiency regulation itself. A detailed analysis revealed potential targets of the bHLH transcription factors as well as genes reflecting an exaggerated iron deficiency response phenotype. Since the BHLH genes of this subgroup have been brought into the context of the plant hormone salicylic acid, we investigated whether the 3xbhlh mutant might have been affected by this plant signaling molecule. Although a very high number of genes responded to SA, also in a differential manner between mutant and wild type, we did not find any indication for an association of the BHLH gene functions in SA responses upon iron deficiency. In summary, our study indicates that the bHLH subgroup Ib(2) transcription factors do not only act in iron acquisition into roots but in other aspects of the adaptation to iron deficiency in roots and leaves. PMID:24919188

  20. Responses of a Triple Mutant Defective in Three Iron Deficiency-Induced BASIC HELIX-LOOP-HELIX Genes of the Subgroup Ib(2) to Iron Deficiency and Salicylic Acid

    PubMed Central

    Maurer, Felix; Naranjo Arcos, Maria Augusta; Bauer, Petra


    Plants are sessile organisms that adapt to external stress by inducing molecular and physiological responses that serve to better cope with the adverse growth condition. Upon low supply of the micronutrient iron, plants actively increase the acquisition of soil iron into the root and its mobilization from internal stores. The subgroup Ib(2) BHLH genes function as regulators in this response, however their concrete functions are not fully understood. Here, we analyzed a triple loss of function mutant of BHLH39, BHLH100 and BHLH101 (3xbhlh mutant). We found that this mutant did not have any iron uptake phenotype if iron was provided. However, under iron deficiency the mutant displayed a more severe leaf chlorosis than the wild type. Microarray-based transcriptome analysis revealed that this mutant phenotype resulted in the mis-regulation of 198 genes, out of which only 15% were associated with iron deficiency regulation itself. A detailed analysis revealed potential targets of the bHLH transcription factors as well as genes reflecting an exaggerated iron deficiency response phenotype. Since the BHLH genes of this subgroup have been brought into the context of the plant hormone salicylic acid, we investigated whether the 3xbhlh mutant might have been affected by this plant signaling molecule. Although a very high number of genes responded to SA, also in a differential manner between mutant and wild type, we did not find any indication for an association of the BHLH gene functions in SA responses upon iron deficiency. In summary, our study indicates that the bHLH subgroup Ib(2) transcription factors do not only act in iron acquisition into roots but in other aspects of the adaptation to iron deficiency in roots and leaves. PMID:24919188

  1. Virus-induced gene complementation in tomato

    PubMed Central

    Kong, Jinhua; Chen, Weiwei; Shen, Jiajia; Qin, Cheng; Lai, Tongfei; Zhang, Pengcheng; Wang, Ying; Wu, Chaoqun; Yang, Xin; Hong, Yiguo


    Virus-induced gene complementation (VIGC), a plant virus technology based on Potato virus X for transient overexpression of endogenous genes complemented tomato mutants, resulting in non-ripening fruits to ripen. This efficient “gain-of-function” approach involves no stable transformation, and reveals a fruit-specific transcriptional network that may exist among key transcription factors in modulating tomato ripening. Thus, VIGC represents a novel and feasible strategy for gene functional analysis in plants. PMID:24305652

  2. Suppression subtractive hybridization identifies genes induced in response to UV-B irradiation in apple skin: isolation of a putative UDP-glucose 4-epimerase.


    Ban, Yusuke; Honda, Chikako; Bessho, Hideo; Pang, Xiao-Ming; Moriguchi, Takaya


    Suppression subtractive hybridization (SSH) successfully identified 11 cDNAs in apple skin with highly induced expression as a result of ultraviolet (UV)-B irradiation. Apart from three putative flavonoid biosynthetic genes, chalcone synthase (CHS; A5C), flavanone-3-hydroxylase (F3H; B5F), and flavonol synthase (FLS; D1F), five clones (A1H, A10E, B11G, D5F, and D11H) were induced by low temperature (17 degrees C) as well, which is also known to induce anthocyanin accumulation in apple skin. Moreover, four clones (A1H, A10E, B11G, and D11H), showing higher expression levels in the skin, accumulated higher anthocyanin concentrations than their counterparts. Of the four clones, only A10E, a putative UDP-glucose 4-epimerase (UGE), was deemed to play an important role in anthocyanin accumulation in apple skin based on the facts that: (i) its transcription level was higher in the deep red cultivar, 'Jonathan', than in the pale red cultivar, 'Tsugaru'; and (ii) it could reversibly catalyse UDP-glucose to UDP-galactose, and the latter molecule is a major sugar donor for cyanidin-glycoside in apple. Therefore, the full-length cDNA of A10E was isolated by rapid amplification of cDNA ends (RACE) and designated as MdUGE1. Further analysis demonstrated that UGE enzymatic activity was positively correlated with anthocyanin accumulation in apple skin. Thus, MdUGE1 isolated by SSH could play an important role in anthocyanin biosynthesis in apple skin in concert with other flavonoid biosynthetic genes. PMID:17404384

  3. Immune responses in rats and sheep induced by a DNA vaccine containing the phosphoglycerate kinase gene of Fasciola hepatica and liver fluke infection.


    Wesołowska, Agnieszka; Zawistowska-Deniziak, Anna; Norbury, Luke J; Wilkowski, Przemysław; Januszkiewicz, Kamil; Pyziel, Anna M; Zygner, Wojciech; Wędrychowicz, Halina


    Immune responses of rats and sheep following vaccination with cDNA encoding phosphoglycerate kinase of Fasciola hepatica (cDNA-FhPGK/pCMV) and F. hepatica infection were investigated in the present study. cDNA-FhPGK/pCMV vaccinated female Sprague-Dawley rats were better protected by vaccination than their male counterparts - 48% reduction in fluke burden for females and no protection for males when compared with appropriate infection control groups. Moreover, male rats developed marked leukocytosis during the study with higher neutrophil, eosinophil and monocyte responses than females. Additionally, dynamics of eosinophil and monocyte responses varied between sexes. Increased titres of anti-FhPGK IgG1 and IgG2a correlated with the protective effect of vaccination that was observed among female rats. In the case of male sheep, no differences in worm burdens and in the course of the immune response were observed following vaccination. Titres of specific antibodies detected were low, and cellular responses were not significant. Apparently, sheep immune responses induced by cDNA-FhPGK/pCMV vaccination are not effective at controlling F. hepatica infection. Poor immunogenicity of DNA vaccines in large animals is still a major obstacle of this technology that has to be overcome. PMID:27078643

  4. Early growth response protein 1 (EGR1) regulates pro-inflammatory gene expression in response to palmitate and TNF alpha in human placenta cells and is induced in obese placenta

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Maternal obesity has been hypothesized to induce a pro-inflammatory response in the placenta. However, the specific factors contributing to this pro-infalmmatory response are yet to be determined. Our objective was to examine the effects of palmitic acid (PA), tumor necrosis factor alpha (TNF alph...

  5. Evaluation of the systemic acute phase response and endometrial gene expression of serum amyloid A and pro- and anti-inflammatory cytokines in mares with experimentally induced endometritis.


    Christoffersen, Mette; Mette, Christoffersen; Baagoe, Camilla Dooleweerdt; Camilla Dooleweerdt, Baagoe; Jacobsen, Stine; Stine, Jacobsen; Bojesen, Anders Miki; Anders Miki, Bojesen; Petersen, Morten Roenn; Morten Roenn, Petersen; Lehn-Jensen, Henrik; Henrik, Lehn-Jensen


    Infectious infertility in the mare is clinically well described, little is however known about the systemic acute phase reaction (APR) and local immunological responses accompanying equine endometritis. The aim of this study was to monitor selected markers of the APR in the systemic circulation and to correlate them to the local innate immune response in the uterus during infectious endometritis. Six adult standard bred mares received an intrauterine infusion of 10(9)CFU Escherichia coli. Blood samples were obtained before (0 h) and 3, 6, 12, 24, 36, 48, 72, 96 and 120 h post inoculation (pi), and endometrial biopsies were sampled before, and 3, 12, 24, 48 and 72 h pi. The infectious endometritis elicited a systemic APR with significantly increased concentrations of the acute phase proteins (APPs) serum amyloid A (SAA) and fibrinogen. Relative gene expression analyses were performed on extracted RNA from endometrial biopsies using quantitative real-time PCR and specific primers for SAA and pro- and anti-inflammatory cytokines. Expression of SAA was significantly up-regulated at 3 and 12h pi, and a significant up-regulated expression of IL-1β, TNFα, IL-8 and IL-10 was observed at 3h pi. Plasma concentration of SAA was significantly correlated to endometrial SAA expression. The results of the present study demonstrate that endometritis gives rise to a systemic APR and an up-regulated endometrial gene expression of SAA and several pro-and anti-inflammatory cytokines. Understanding endometrial expression of acute phase proteins and selected cytokines contributing to uterine immunity in equine endometritis could improve understanding of events leading to infertility in the mare and help identify candidate genes of mediators/markers for diagnostic use. PMID:20728224

  6. Retinoic acid activates human inducible nitric oxide synthase gene through binding of RAR{alpha}/RXR{alpha} heterodimer to a novel retinoic acid response element in the promoter

    SciTech Connect

    Zou Fang; Liu Yan; Liu Li; Wu Kailang; Wei Wei; Zhu Ying . E-mail:; Wu Jianguo . E-mail:


    Human inducible nitric oxide synthase (hiNOS) catalyzes nitric oxide (NO) which has a significant effect on tumor suppression and cancer therapy. Here we revealed the detailed molecular mechanism involved in the regulation of hiNOS expression induced by retinoic acid (RA). We showed that RAR{alpha}/RXR{alpha} heterodimer was important in hiNOS promoter activation, hiNOS protein expression, and NO production. Serial deletion and site-directed mutation analysis revealed two half-sites of retinoic acid response element (RARE) spaced by 5 bp located at -172 to -156 in the hiNOS promoter. EMSA and ChIP assays demonstrated that RAR{alpha}/RXR{alpha} directly bound to this RARE of hiNOS promoter. Our results suggested the identification of a novel RARE in the hiNOS promoter and the roles of the nuclear receptors (RAR{alpha}/RXR{alpha}) in the induction of hiNOS by RA.

  7. Promoter analysis of TCDD-inducible genes in a thymic epithelial cell line indicates the potential for cell-specific transcription factor crosstalk in the AhR response

    SciTech Connect

    Frericks, Markus; Burgoon, Lyle D.; Zacharewski, Timothy R.; Esser, Charlotte


    Activation of the aryl hydrocarbon receptor (AhR{sup 1}) by 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) elicits severe immunosuppression accompanied by thymic atrophy. Previous evidence suggests that TCDD targets both thymocytes and thymic epithelial cells. The AhR induces cell-specific changes in gene transcription via binding to the dioxin response element DRE; however, the underlying specificity-mechanisms, in particular with regard to the role of promoter element context, and possible transcription factor crosstalk remain poorly understood. Global gene expression in the cortical thymic epithelial cell line ET at 2, 4, and 6 h following 5 nM TCDD exposure resulted in differential regulation of 201 genes. JASPAR and TRANSFAC mapped the statistically over-represented promoter elements in the regulated genes to specific transcription factor binding sites, suggesting a regulatory role in AhR signaling. Over-represented elements included the xenobiotic response element XRE, NF{kappa}B-Rel, HRE, PPAR{gamma}, GR, PAX-4 and estrogen receptor binding sites. Co-treatment experiments with TCDD and CoCl{sub 2}, to induce hypoxia, or TCDD and 17-{beta}-estradiol (E2) indicated crosstalk between AhR and Hif or ER, in agreement with other experimental models. The computational identification of TFBS and the demonstration of interaction confirm their interactions with AhR signaling and suggest that the other over-represented elements may also be important in the immunosuppressive effects elicited by TCDD. In conclusion, we demonstrated the importance of promoter element cooperation in the shaping of a cell-specific AhR response. Our findings regarding the transcriptional changes in cortical epithelial cells are congruent with the well-known thymotoxic TCDD-phenotype, and useful in new hypothesis generation of the role of cortical TECs in TCDD toxicity.

  8. Retinoic acid-inducible gene-I-like receptor (RLR)-mediated antiviral innate immune responses in the lower respiratory tract: Roles of TRAF3 and TRAF5.


    Chiba, Yuki; Matsumiya, Tomoh; Satoh, Tsugumi; Hayakari, Ryo; Furudate, Ken; Xing, Fei; Yoshida, Hidemi; Tanji, Kunikazu; Mizukami, Hiroki; Imaizumi, Tadaatsu; Ito, Etsuro


    Upon viral infection, the cytoplasmic viral sensor retinoic acid-inducible gene-I (RIG-I) recognizes viral RNA to activate antiviral signaling to induce type I interferon (IFN). RIG-I-like receptors (RLRs) activate antiviral signaling in a tissue-specific manner. The molecular mechanism underlying antiviral signaling in the respiratory system remains unclear. We studied antiviral signaling in the lower respiratory tract (LRT), which is the site of many harmful viral infections. Epithelial cells of the LRT can be roughly divided into two groups: bronchial epithelial cells (BECs) and pulmonary alveolar epithelial cells (AECs). These two cell types exhibit different phenotypes; therefore, we hypothesized that these cells may play different roles in antiviral innate immunity. We found that BECs exhibited higher antiviral activity than AECs. TNF receptor-associated factor 3 (TRAF3) has been shown to be a crucial molecule in RLR signaling. The expression levels of TRAF3 and TRAF5, which have conserved domains that are nearly identical, in the LRT were examined. We found that the bronchus exhibited the highest expression levels of TRAF3 and TRAF5 in the LRT. These findings suggest the importance of the bronchus in antiviral innate immunity in the LRT and indicate that TRAF3 and TRAF5 may contribute to RLR signaling. PMID:26454171

  9. The cytochrome P450 2AA gene cluster in zebrafish (Danio rerio); expression of CYP2AA1 and CYP2AA2 and response to phenobarbital-type inducers

    PubMed Central

    Kubota, Akira; Bainy, Afonso C.D.; Woodin, Bruce R.; Goldstone, Jared V.; Stegeman, John J.


    The cytochrome P450 (CYP) 2 gene family is the largest and most diverse CYP gene family in vertebrates. In zebrafish, we have identified 10 genes in a new subfamily CYP2AA, which does not show orthology to any human or other mammalian CYP genes. Here we report evolutionary and structural relationships of the 10 CYP2AA genes and expression of the first two genes, CYP2AA1 and CYP2AA2. Parsimony reconstruction of the tandem duplication pattern for the CYP2AA cluster suggests that CYP2AA1, CYP2AA2 and CYP2AA3 likely arose in the earlier duplication events and thus are most diverged in function from the other CYP2AAs. On the other hand, CYP2AA8 and CYP2AA9 are genes that arose in the latest duplication event, implying functional similarity between these two CYPs. A molecular model of CYP2AA1 showing the sequence conservation across the CYP2AA cluster reveals that the regions with the highest variability within the cluster map into CYP2AA1 near the substrate access channels, suggesting differing substrate specificity. Zebrafish CYP2AA1 transcript was expressed predominantly in intestine, while CYP2AA2 was most highly expressed in kidney, suggesting differing roles in physiology. In liver CYP2AA2 expression but not that of CYP2AA1, was increased by 1,4-bis [2-(3,5-dichloropyridyloxy)] benzene (TCPOBOP) and, to a lesser extent, by phenobarbital (PB). In contrast, pregnenolone 16α-carbonitrile (PCN) increased CYP2AA1, but not CYP2AA2 in liver. The results identify a CYP2 subfamily in zebrafish that includes genes apparently induced by PB-type chemicals and PXR agonists, the first concrete in vivo evidence for a PB-type response in fish. PMID:23726801

  10. Synapsins are late activity-induced genes regulated by birdsong

    PubMed Central

    Velho, Tarciso A. F.; Mello, Claudio V.


    The consolidation of long-lasting sensory memories requires the activation of gene expression programs in the brain. In spite of considerable knowledge about the early components of this response, little is known about late components (i.e. genes regulated 2-6 hr after stimulation) and the relationship between early and late genes. Birdsong represents one of the best natural behaviors to study sensory-induced gene expression in awake, freely behaving animals. Here we show that the expression of several isoforms of synapsins, a group of phosphoproteins thought to regulate the dynamics of synaptic vesicle storage and release, is induced by auditory stimulation with birdsong in the caudomedial nidopallium (NCM) of the zebra finch (Taeniopygia guttata) brain. This induction occurs mainly in excitatory (non-GABAergic) neurons and is modulated (suppressed) by early song-inducible proteins. We also show that ZENK, an early song-inducible transcription factor, interacts with the syn3 promoter in vivo, consistent with a direct regulatory effect and an emerging novel view of ZENK action. These results demonstrate that synapsins are a late component of the genomic response to neuronal activation and that their expression depends on a complex set of regulatory interactions between early and late regulated genes. PMID:19005052

  11. Macrophage Expression of Inflammatory Genes in Response to EMCV Infection

    PubMed Central

    Shaheen, Zachary R.; Corbett, John A.


    The expression and production of type 1 interferon is the classic cellular response to virus infection. In addition to this antiviral response, virus infection also stimulates the production of proinflammatory mediators. In this review, the pathways controlling the induction of inflammatory genes and the roles that these inflammatory mediators contribute to host defense against viral pathogens will be discussed. Specific focus will be on the role of the chemokine receptor CCR5, as a signaling receptor controlling the activation of pathways leading to virus-induced inflammatory gene expression. PMID:26295266

  12. Tumour suppressor genes in chemotherapeutic drug response

    PubMed Central

    Lai, Dulcie; Visser-Grieve, Stacy; Yang, Xiaolong


    Since cancer is one of the leading causes of death worldwide, there is an urgent need to find better treatments. Currently, the use of chemotherapeutics remains the predominant option for cancer therapy. However, one of the major obstacles for successful cancer therapy using these chemotherapeutics is that patients often do not respond or eventually develop resistance after initial treatment. Therefore identification of genes involved in chemotherapeutic response is critical for predicting tumour response and treating drug-resistant cancer patients. A group of genes commonly lost or inactivated are tumour suppressor genes, which can promote the initiation and progression of cancer through regulation of various biological processes such as cell proliferation, cell death and cell migration/invasion. Recently, mounting evidence suggests that these tumour suppressor genes also play a very important role in the response of cancers to a variety of chemotherapeutic drugs. In the present review, we will provide a comprehensive overview on how major tumour suppressor genes [Rb (retinoblastoma), p53 family, cyclin-dependent kinase inhibitors, BRCA1 (breast-cancer susceptibility gene 1), PTEN (phosphatase and tensin homologue deleted on chromosome 10), Hippo pathway, etc.] are involved in chemotherapeutic drug response and discuss their applications in predicting the clinical outcome of chemotherapy for cancer patients. We also propose that tumour suppressor genes are critical chemotherapeutic targets for the successful treatment of drug-resistant cancer patients in future applications. PMID:22762204

  13. High magnetic field induced changes of gene expression in arabidopsis

    PubMed Central

    Paul, Anna-Lisa; Ferl, Robert J; Meisel, Mark W


    Background High magnetic fields are becoming increasingly prevalent components of non-invasive, biomedical imaging tools (such as MRI), thus, an understanding of the molecular impacts associated with these field strengths in biological systems is of central importance. The biological impact of magnetic field strengths up to 30 Tesla were investigated in this study through the use of transgenic Arabidopsis plants engineered with a stress response gene consisting of the alcohol dehydrogenase (Adh) gene promoter driving the β-glucuronidase (GUS) gene reporter. Methods Magnetic field induced Adh/GUS activity was evaluated with histochemical staining to assess tissue specific expression and distribution, and with quantitative, spectrofluometric assays to measure degree of activation. The evaluation of global changes in the Arabidopsis genome in response to exposure to high magnetic fields was facilitated with Affymetrix Gene Chip microarrays. Quantitative analyses of gene expression were performed with quantitative real-time polymerase-chain-reaction (qRT-PCR). Results Field strengths in excess of about 15 Tesla induce expression of the Adh/GUS transgene in the roots and leaves. From the microarray analyses that surveyed 8000 genes, 114 genes were differentially expressed to a degree greater than 2.5 fold over the control. These results were quantitatively corroborated by qRT-PCR examination of 4 of the 114 genes. Conclusion The data suggest that magnetic fields in excess of 15 Tesla have far-reaching effect on the genome. The wide-spread induction of stress-related genes and transcription factors, and a depression of genes associated with cell wall metabolism, are prominent examples. The roles of magnetic field orientation of macromolecules and magnetophoretic effects are discussed as possible factors that contribute to the mounting of this response. PMID:17187667

  14. Ask1 Gene Deletion Blocks Maternal Diabetes–Induced Endoplasmic Reticulum Stress in the Developing Embryo by Disrupting the Unfolded Protein Response Signalosome

    PubMed Central

    Wang, Fang; Wu, Yanqing; Gu, Hui; Reece, E. Albert; Fang, Shengyun; Gabbay-Benziv, Rinat; Aberdeen, Graham


    Apoptosis signal–regulating kinase 1 (ASK1) is activated by various stresses. The link between ASK1 activation and endoplasmic reticulum (ER) stress, two causal events in diabetic embryopathy, has not been determined. We sought to investigate whether ASK1 is involved in the unfolded protein response (UPR) that leads to ER stress. Deleting Ask1 abrogated diabetes-induced UPR by suppressing phosphorylation of inositol-requiring enzyme 1α (IRE1α), and double-stranded RNA-activated protein kinase (PKR)-like ER kinase (PERK) blocked the mitochondrial translocation of proapoptotic Bcl-2 members and ER stress. ASK1 participated in the IRE1α signalosome, and removing ASK1 abrogated the proapoptotic kinase activity of IRE1α. Ask1 deletion suppressed diabetes-induced IRE1α endoriboneclease activities, which led to X-box binding protein 1 mRNA cleavage, an ER stress marker, decreased expression of microRNAs, and increased expression of a miR-17 target, thioredoxin-interacting protein (Txnip), a thioredoxin binding protein, which enhanced ASK1 activation by disrupting the thioredoxin-ASK1 complexes. ASK1 is essential for the assembly and function of the IRE1α signalosome, which forms a positive feedback loop with ASK1 through Txnip. ASK1 knockdown in C17.2 neural stem cells diminished high glucose– or tunicamycin-induced IRE1α activation, which further supports our hypothesis that ASK1 plays a causal role in diabetes-induced ER stress and apoptosis. PMID:25249581

  15. The cytochrome P450 2AA gene cluster in zebrafish (Danio rerio): Expression of CYP2AA1 and CYP2AA2 and response to phenobarbital-type inducers

    SciTech Connect

    Kubota, Akira; Bainy, Afonso C.D.; Woodin, Bruce R.; Goldstone, Jared V.; Stegeman, John J.


    The cytochrome P450 (CYP) 2 gene family is the largest and most diverse CYP gene family in vertebrates. In zebrafish, we have identified 10 genes in a new subfamily, CYP2AA, which does not show orthology to any human or other mammalian CYP genes. Here we report evolutionary and structural relationships of the 10 CYP2AA genes and expression of the first two genes, CYP2AA1 and CYP2AA2. Parsimony reconstruction of the tandem duplication pattern for the CYP2AA cluster suggests that CYP2AA1, CYP2AA2 and CYP2AA3 likely arose in the earlier duplication events and thus are most diverged in function from the other CYP2AAs. On the other hand, CYP2AA8 and CYP2AA9 are genes that arose in the latest duplication event, implying functional similarity between these two CYPs. A molecular model of CYP2AA1 showing the sequence conservation across the CYP2AA cluster reveals that the regions with the highest variability within the cluster map onto CYP2AA1 near the substrate access channels, suggesting differing substrate specificities. Zebrafish CYP2AA1 transcript was expressed predominantly in the intestine, while CYP2AA2 was most highly expressed in the kidney, suggesting differing roles in physiology. In the liver CYP2AA2 expression but not that of CYP2AA1, was increased by 1,4-bis [2-(3,5-dichloropyridyloxy)] benzene (TCPOBOP) and, to a lesser extent, by phenobarbital (PB). In contrast, pregnenolone 16α-carbonitrile (PCN) increased CYP2AA1 expression, but not CYP2AA2 in the liver. The results identify a CYP2 subfamily in zebrafish that includes genes apparently induced by PB-type chemicals and PXR agonists, the first concrete in vivo evidence for a PB-type response in fish. - Highlights: • A tandemly duplicated cluster of ten CYP2AA genes was described in zebrafish. • Parsimony and duplication analyses suggest pathways to CYP2AA diversity. • Homology models reveal amino acid positions possibly related to functional diversity. • The CYP2AA locus does not share synteny with

  16. Radiation response and regulation of apoptosis induced by a combination of TRAIL and CHX in cells lacking mitochondrial DNA: A role for NF-{kappa}B-STAT3-directed gene expression

    SciTech Connect

    Ivanov, Vladimir N. Ghandhi, Shanaz A.; Zhou, Hongning; Huang, Sarah X.; Chai, Yunfei; Amundson, Sally A.; Hei, Tom K.


    Mitochondrial DNA depleted ({rho}{sup 0}) human skin fibroblasts (HSF) with suppressed oxidative phosphorylation were characterized by significant changes in the expression of 2100 nuclear genes, encoding numerous protein classes, in NF-{kappa}B and STAT3 signaling pathways, and by decreased activity of mitochondrial death pathway, compared to the parental {rho}{sup +} HSF. In contrast, the extrinsic TRAIL/TRAIL-Receptor mediated death pathway remained highly active, and exogenous TRAIL in a combination with cycloheximide (CHX) induced higher levels of apoptosis in {rho}{sup 0} cells compared to {rho}{sup +} HSF. Global gene expression analysis using microarray and qRT-PCR demonstrated that mRNA expression levels of many growth factors and their adaptor proteins (FGF13, HGF, IGFBP4, IGFBP6, and IGFL2), cytokines (IL6, {Oota}L17{Beta}, {Oota}L18, {Oota}L19, and {Oota}L28{Beta}) and cytokine receptors (IL1R1, IL21R, and IL31RA) were substantially decreased after mitochondrial DNA depletion. Some of these genes were targets of NF-{kappa}B and STAT3, and their protein products could regulate the STAT3 signaling pathway. Alpha-irradiation further induced expression of several NF-{kappa}B/STAT3 target genes, including IL1A, IL1B, IL6, PTGS2/COX2 and MMP12, in {rho}{sup +} HSF, but this response was substantially decreased in {rho}{sup 0} HSF. Suppression of the IKK-NF-{kappa}B pathway by the small molecular inhibitor BMS-345541 and of the JAK2-STAT3 pathway by AG490 dramatically increased TRAIL-induced apoptosis in the control and irradiated {rho}{sup +} HSF. Inhibitory antibodies against IL6, the main activator of JAK2-STAT3 pathway, added into the cell media, also increased TRAIL-induced apoptosis in HSF, especially after alpha-irradiation. Collectively, our results indicated that NF-{kappa}B activation was partially lost in {rho}{sup 0} HSF resulting in downregulation of the basal or radiation-induced expression of numerous NF-{kappa}B targets, further suppressing IL6

  17. AUXIN RESPONSE FACTOR7 Restores the Expression of Auxin-Responsive Genes in Mutant Arabidopsis Leaf Mesophyll ProtoplastsW⃞

    PubMed Central

    Wang, Shucai; Tiwari, Shiv B.; Hagen, Gretchen; Guilfoyle, Tom J.


    AUXIN RESPONSE FACTOR7 (ARF7) is one of five ARF transcriptional activators in Arabidopsis thaliana that is proposed to regulate auxin-responsive expression of genes containing TGTCTC auxin response elements in their promoters. An Arabidopsis mutant (nonphototropic hypocotyl4-1 [nph4-1]) that is a null for ARF7 showed strongly reduced expression of integrated auxin-responsive reporter genes and natural genes that were monitored in Arabidopsis leaf mesophyll protoplasts. Expression of the reporter and natural genes was restored in an auxin-dependent manner when protoplasts were transfected with a 35S:ARF7 effector gene, encoding a full-length ARF7 protein. Transfection of effector genes encoding other ARF activators restored auxin-responsive gene expression to varying degrees, but less than that observed with the ARF7 effector gene. Arabidopsis lines that were null for ARF6, ARF8, or ARF19 were not defective in expression of the reporter and natural auxin response genes assayed in mesophyll protoplasts, suggesting that ARF7 plays a major role in regulating expression of a subset of auxin response genes in leaf mesophyll cells. Auxin-responsive gene expression was induced in wild-type protoplasts and restored in nph4-1 protoplasts only with auxin and not with other hormones, including brassinolide. In the presence of auxin, however, brassinolide modestly enhanced auxin-responsive gene expression. PMID:15923351

  18. The Arabidopsis Stress Responsive Gene Database

    PubMed Central

    Borkotoky, Subhomoi; Saravanan, Vijayakumar; Jaiswal, Amit; Das, Bipul; Selvaraj, Suresh; Murali, Ayaluru; Lakshmi, P. T. V.


    Plants in nature may face a wide range of favorable or unfavorable biotic and abiotic factors during their life cycle. Any of these factors may cause stress in plants; therefore, they have to be more adaptable to stressful environments and must acquire greater response to different stresses. The objective of this study is to retrieve and arrange data from the literature in a standardized electronic format for the development of information resources on potential stress responsive genes in Arabidopsis thaliana. This provides a powerful mean for manipulation, comparison, search, and retrieval of records describing the nature of various stress responsive genes in Arabidopsis thaliana. The database is based exclusively on published stress tolerance genes associated with plants. PMID:23573074

  19. Transcriptional Response of Selenopolypeptide Genes and Selenocysteine Biosynthesis Machinery Genes in Escherichia coli during Selenite Reduction

    PubMed Central

    Tetteh, Antonia Y.; Sun, Katherine H.; Kittur, Farooqahmed S.; Ibeanu, Gordon C.


    Bacteria can reduce toxic selenite into less toxic, elemental selenium (Se0), but the mechanism on how bacterial cells reduce selenite at molecular level is still not clear. We used Escherichia coli strain K12, a common bacterial strain, as a model to study its growth response to sodium selenite (Na2SeO3) treatment and then used quantitative real-time PCR (qRT-PCR) to quantify transcript levels of three E. coli selenopolypeptide genes and a set of machinery genes for selenocysteine (SeCys) biosynthesis and incorporation into polypeptides, whose involvements in the selenite reduction are largely unknown. We determined that 5 mM Na2SeO3 treatment inhibited growth by ∼50% while 0.001 to 0.01 mM treatments stimulated cell growth by ∼30%. Under 50% inhibitory or 30% stimulatory Na2SeO3 concentration, selenopolypeptide genes (fdnG, fdoG, and fdhF) whose products require SeCys but not SeCys biosynthesis machinery genes were found to be induced ≥2-fold. In addition, one sulfur (S) metabolic gene iscS and two previously reported selenite-responsive genes sodA and gutS were also induced ≥2-fold under 50% inhibitory concentration. Our findings provide insight about the detoxification of selenite in E. coli via induction of these genes involved in the selenite reduction process. PMID:24839442

  20. Risperidone induces long-lasting changes in the conditioned avoidance response and accumbal gene expression selectively in animals treated as adolescents.


    Moe, Aung Aung Kywe; Kurniawan, Nyoman D; Alexander, Suzanne; Cui, Xiaoying; Burne, Thomas H J; Eyles, Darryl W


    Adolescence is a period of dynamic remodeling and maturation in the brain. Exposure to psychotropic drugs during adolescence can potentially alter neural maturation in the adolescent brain subsequently altering neural function at maturity. In this regard, antipsychotic drugs (APDs) are important given a notable global increase in prescription of these APDs to adolescents for a variety of behavioural symptoms and conditions over the past twenty years. However, there is a paucity of data on the long-term consequences of APDs on the adolescent brain. In this preclinical study, we have examined whether the adolescent brain is more susceptible than the adult brain to long-term neural changes induced by risperidone, which is the APD most frequently prescribed to adolescents. Rats were chronically treated (21 days) with 1.3 mg/kg/day risperidone or vehicle either as adolescents (postnatal day (PND) 36-56)) or adults (PND80-100). Behaviour was assessed using the well-described suppression of the conditioned avoidance response (CAR) by APDs. We examined CAR after all animals had reached maturity (PND127). We show that mature rats treated with risperidone as adolescents had increased CAR suppression compared to adults when rechallenged with this same drug. In the nucleus accumbens, significant downregulation of serotonergic 5HT2A receptors and catechol-o-methyl transferase mRNA levels was observed only in the adolescent treated animals. Impaired 5HT2A receptor signaling may explain the increased CAR suppression observed in rats treated with risperidone as adolescents. Magnetic resonance imaging (MRI), however, did not detect any risperidone-induced long-term brain structural change at maturity. These findings confirm that APD administration during adolescence may produce long-term behavioural and neurochemical alterations. PMID:27130903

  1. Temperature-Responsive Gene Silencing by a Smart Polymer.


    Wang, Mingming; Cheng, Yiyun


    Intracellular siRNA release is a crucial step in efficient gene silencing mediated by cationic polymers. Here, we show an example of temperature change-induced intracellular siRNA release and silencing using a temperature-responsive polymer consisting of dendrimer, poly(N-isopropylacrylamide) and phenylboronic acid. The smart polymer can trigger the release of loaded siRNA in a controlled manner upon cooling the surrounding solution below its lower critical solution temperature. Gene silencing efficacy of the polymer was significantly increased by cool treatment after its cellular uptake. The polymer and the cool treatment cause minimal toxicity to the transfected cells. The results provide a facile and promising strategy to design stimuli-responsive polymers for efficient gene silencing. PMID:26783999

  2. Androgen-responsive gene database: integrated knowledge on androgen-responsive genes.


    Jiang, Mei; Ma, Yunsheng; Chen, Congcong; Fu, Xuping; Yang, Shu; Li, Xia; Yu, Guohua; Mao, Yumin; Xie, Yi; Li, Yao


    Androgen signaling plays an important role in many biological processes. Androgen Responsive Gene Database (ARGDB) is devoted to providing integrated knowledge on androgen-controlled genes. Gene records were collected on the basis of PubMed literature collections. More than 6000 abstracts and 950 original publications were manually screened, leading to 1785 human genes, 993 mouse genes, and 583 rat genes finally included in the database. All the collected genes were experimentally proved to be regulated by androgen at the expression level or to contain androgen-responsive regions. For each gene important details of the androgen regulation experiments were collected from references, such as expression change, androgen-responsive sequence, response time, tissue/cell type, experimental method, ligand identity, and androgen amount, which will facilitate further evaluation by researchers. Furthermore, the database was integrated with multiple annotation resources, including National Center for Biotechnology Information, Gene Ontology, and Kyoto Encyclopedia of Genes and Genomes pathway, to reveal the biological characteristics and significance of androgen-regulated genes. The ARGDB web site is mainly composed of the Browse, Search, Element Scan, and Submission modules. It is user friendly and freely accessible at Preliminary analysis of the collected data was performed. Many disease pathways, such as prostate carcinogenesis, were found to be enriched in androgen-regulated genes. The discovered androgen-response motifs were similar to those in previous reports. The analysis results are displayed in the web site. In conclusion, ARGDB provides a unified gateway to storage, retrieval, and update of information on androgen-regulated genes. PMID:19762544

  3. A peptide tetramer Tk-tPN induces tolerance of cardiac allografting by conversion of type 1 to type 2 immune responses via the Toll-like receptor 2 signal-promoted activation of the MCP1 gene.


    Li, Zuoqing; Yang, Neng; Zhou, Ling; Gu, Peng; Wang, Hui; Zhou, Yun; Zhou, Peijun; Lu, Liming; Chou, Kuang-Yen


    The plant protein trichosanthin (Tk) and its derived peptide tetramer Tk-tPN have been shown to stimulate the type 2 immune responses for treating autoimmune disease. This work explores the possibility of using Tk-tPN as a non-toxic immunosuppressant to induce transplantation tolerance using the mechanisms by which T-cell-mediated immune responses are transferred from type 1 to type 2 through innate immunity-related pathways. Immunocytes and cytokine secretions involved in the mouse cardiac allografting model with Tk-tPN treatment were characterized. Identification of critical genes and analysis of their functions through Toll-like receptor (TLR) -initiated signalling and the possible epigenetic changes were performed. Mean survival times of the cardiac allografts were delayed from 7.7 ± 0.3 days (control) to 22.7 ± 3.9 days (P < 0.01) or 79.1 ± 19.2 days (P < 0.0001) when Tk-tPN was introduced into the recipients alone or together with rapamycin, respectively. The grafting tolerance was donor-specific. The secretion pattern of the type 1 cytokine/transcription factor (IL-2(+) IFN-γ(+) T-bet(+)), which is responsible for the acute graft rejection, was shifted to the type 2 factor (IL-4(+) IL-10(+) Gata3+), together with a selective expansion of the IL-4/IL-10-producing CD8+ CD28- regulatory T-cell subset. A TLR2-initiated high expression of chemokine gene MCP1 was detectable simultaneously. Epigenetically Tk/Tk-tPN could also acetylate the histone H3K9 of MCP1 promoter to skew the immunity towards T helper type 2 responses. Tk/Tk-tPN is therefore capable of down-regulating the type 1 response-dominant rejection of cardiac allografts by evoking type 2 immunity through the activation of a TLR2-initiated signalling pathway and MCP1 gene to expand the IL-4/IL-10-secreting CD8+ CD28- regulatory T cells. Tk-tPN could be a promising novel immunosuppressant to induce tolerance in allotransplantation. PMID:26694804

  4. Search for hepatopancreatic ecdysteroid-responsive genes during the crayfish molt cycle: from a single gene to multigenicity.


    Shechter, Assaf; Tom, Moshe; Yudkovski, Yana; Weil, Simy; Chang, Sharon A; Chang, Ernest S; Chalifa-Caspi, Vered; Berman, Amir; Sagi, Amir


    The expression of the vitellogenin gene of the red-claw crayfish Cherax quadricarinatus (CqVg) was previously demonstrated in male crayfish during an endocrinologically induced molt cycle. The hypothesis that this expression is under the direct control of ecdysteroids was tested in this study both in vivo and in vitro. Unlike vitellogenin of insects, CqVg was not found to be ecdysteroid-responsive. Thus, a multigenic approach was employed for the identification of other hepatopancreatic ecdysteroid-responsive genes by a cDNA microarray. For the purposes of this study, a multi-parametric molt-staging technique, based on X-ray detection of gastrolith growth, was developed. To identify ecdysteroid-responsive genes during premolt, the molt cycle was induced by two manipulations, 20-hydroxyecdysone administration and X-organ-sinus gland complex removal; both resulted in significant elevation of ecdysteroids. Two clusters of affected genes (129 and 122 genes, respectively) were revealed by the microarray. It is suggested that only genes belonging to similarly responsive (up- or downregulated) gene clusters in both manipulations (102 genes) could be considered putative ecdysteroid-responsive genes. Some of these ecdysteroid-responsive genes showed homology to genes controlling chitin metabolism, proteases and other cellular activities, while 56.8% were unknown. The majority of the genes were downregulated, presumably by an energetic shift of the hepatopancreas prior to ecdysis. The effect of 20-hydroxyecdysone on representative genes from this group was confirmed in vitro using a hepatopancreas tissue culture. This approach for ecdysteroid-responsive gene identification could also be implemented in other tissues for the elucidation of ecdysteroid-specific signaling pathways during the crustacean molt cycle. PMID:17921154

  5. Identification of Novel Defense Response Genes in Medicago truncatula for Improving Disease Resistance in Alfalfa

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Infection of plants by pathogens initiates a cascade of defense responses that halt or limit pathogen growth. However, the role of many of the genes induced by pathogens is unknown. Transcript profiling was used to identify genes associated with defense responses in the model legume Medicago truncat...

  6. Are solar UV-B- and UV-A-dependent gene expression and metabolite accumulation in Arabidopsis mediated by the stress response regulator RADICAL-INDUCED CELL DEATH1?


    Morales, Luis O; Brosché, Mikael; Vainonen, Julia P; Sipari, Nina; Lindfors, Anders V; Strid, Åke; Aphalo, Pedro J


    Wavelengths in the ultraviolet (UV) region of the solar spectrum, UV-B (280-315 nm) and UV-A (315-400 nm), are key environmental signals modifying several aspects of plant physiology. Despite significant advances in the understanding of plant responses to UV-B and the identification of signalling components involved, there is limited information on the molecular mechanisms that control UV-B signalling in plants under natural sunlight. Here, we aimed to corroborate the previous suggested role for RADICAL-INDUCED CELL DEATH1 (RCD1) in UV-B signalling under full spectrum sunlight. Wild-type Arabidopsis thaliana and the rcd1-1 mutant were used in an experimental design outdoors where UV-B and UV-A irradiances were manipulated using plastic films, and gene expression, PYRIDOXINE BIOSYNTHESIS1 (PDX1) accumulation and metabolite profiles were analysed in the leaves. At the level of transcription, RCD1 was not directly involved in the solar UV-B regulation of genes with functions in UV acclimation, hormone signalling and stress-related markers. Furthermore, RCD1 had no role on PDX1 accumulation but modulated the UV-B induction of flavonoid accumulation in leaves of Arabidopsis exposed to solar UV. We conclude that RCD1 does not play an active role in UV-B signalling but rather modulates UV-B responses under full spectrum sunlight. PMID:24689869

  7. Interpreting physiological responses to environmental change through gene expression profiling.


    Gracey, Andrew Y


    Identification of differentially expressed genes in response to environmental change offers insights into the roles of the transcriptome in the regulation of physiological responses. A variety of methods are now available to implement large-scale gene expression screens, and each method has specific advantages and disadvantages. Construction of custom cDNA microarrays remains the most popular route to implement expression screens in the non-model organisms favored by comparative physiologists, and we highlight some factors that should be considered when embarking along this path. Using a carp cDNA microarray, we have undertaken a broad, system-wide gene expression screen to investigate the physiological mechanisms underlying cold and hypoxia acclimation. This dataset provides a starting point from which to explore a range of specific mechanistic hypotheses at all levels of organization, from individual biochemical pathways to the level of the whole organism. We demonstrate the utility of two data analysis methods, Gene Ontology profiling and rank-based statistical methods, to summarize the probable physiological function of acclimation-induced gene expression changes, and to prioritize specific genes as candidates for further study. PMID:17449823

  8. Insulin Response Genes in Different Stages of Periodontal Disease.


    Yu, N; Barros, S P; Zhang, S; Moss, K L; Phillips, S T; Offenbacher, S


    Bacterial infections are known to alter glucose metabolism within tissues via mechanisms of inflammation. We conducted this study to examine whether insulin response genes are differentially expressed in gingival tissues, comparing samples from experimental gingivitis and periodontitis subjects to those from healthy individuals. Total RNA was extracted from gingival biopsies from 26 participants: 8 periodontally healthy, 9 experimental gingivitis, and 9 periodontitis subjects. Gene expression patterns were evaluated with a polymerase chain reaction array panel to examine 84 candidate genes involved with glucose metabolism, insulin resistance, and obesity. Array data were evaluated with a t test adjusted by the false discover rate (P < 0.05), and ingenuity pathway analysis was performed for statistical testing of pathways. Although tissue samples were not sufficient to enable protein quantification, we confirmed the upregulation of the key gene using lipopolysaccharide-stimulated primary gingival epithelial cells by Western blot. The mRNA expression patterns of genes that are associated with insulin response and glucose metabolism are markedly different in experimental gingivitis subjects compared with healthy controls. Thirty-two genes are upregulated significantly by at least 2-fold, adjusted for false discover rate (P < 0.05). Periodontitis subjects show similar but attenuated changes in gene expression patterns, and no genes meet the significance criteria. Ingenuity pathway analysis demonstrates significant activation of the carbohydrate metabolism network in experimental gingivitis but not in periodontitis. G6PD protein increases in response to lipopolysaccharide stimulation in primary gingival epithelial cells, which is in the same direction as upregulated mRNA in tissues. Acute gingival inflammation may be associated with tissue metabolism changes, but these changes are not evident in chronic periodontitis. This study suggests that acute gingival inflammation

  9. Tetracycline inducible gene manipulation in serotonergic neurons.


    Weber, Tillmann; Renzland, Insa; Baur, Max; Mönks, Simon; Herrmann, Elke; Huppert, Verena; Nürnberg, Frank; Schönig, Kai; Bartsch, Dusan


    The serotonergic (5-HT) neuronal system has important and diverse physiological functions throughout development and adulthood. Its dysregulation during development or later in adulthood has been implicated in many neuropsychiatric disorders. Transgenic animal models designed to study the contribution of serotonergic susceptibility genes to a pathological phenotype should ideally allow to study candidate gene overexpression or gene knockout selectively in serotonergic neurons at any desired time during life. For this purpose, conditional expression systems such as the tet-system are preferable. Here, we generated a transactivator (tTA) mouse line (TPH2-tTA) that allows temporal and spatial control of tetracycline (Ptet) controlled transgene expression as well as gene deletion in 5-HT neurons. The tTA cDNA was inserted into a 196 kb PAC containing a genomic mouse Tph2 fragment (177 kb) by homologous recombination in E. coli. For functional analysis of Ptet-controlled transgene expression, TPH2-tTA mice were crossed to a Ptet-regulated lacZ reporter line (Ptet-nLacZ). In adult double-transgenic TPH2-tTA/Ptet-nLacZ mice, TPH2-tTA founder line L62-20 showed strong serotonergic β-galactosidase expression which could be completely suppressed with doxycycline (Dox). Furthermore, Ptet-regulated gene expression could be reversibly activated or inactivated when Dox was either withdrawn or added to the system. For functional analysis of Ptet-controlled, Cre-mediated gene deletion, TPH2-tTA mice (L62-20) were crossed to double transgenic Ptet-Cre/R26R reporter mice to generate TPH2-tTA/Ptet-Cre/R26R mice. Without Dox, 5-HT specific recombination started at E12.5. With permanent Dox administration, Ptet-controlled Cre-mediated recombination was absent. Dox withdrawal either postnatally or during adulthood induced efficient recombination in serotonergic neurons of all raphe nuclei, respectively. In the enteric nervous system, recombination could not be detected. We generated a

  10. HIFU-induced gene activation in vitro

    NASA Astrophysics Data System (ADS)

    Liu, Yunbo; Zhong, Pei; Kon, Takashi; Li, Chuanyuan


    This work investigated the inducible gene activation in cancer cells that were sublethally injured during HIFU treatment. HeLa cells were transfected by an adenovirus vector that encodes GFP under the control of hsp70B promoter, leading to about 65% transfection efficiency. A volume of 10 μL transfected HeLa cells in suspension (5×107 cells/ml) were placed at the bottom of a PCR tube so that the cell suspension could be heated to a peak temperature of 50°C, 60°C, and 70°C for 120, 10, and 1 s, respectively, by a focused 1.1-MHz HIFU transducer operated at a peak negative pressure of -2.7 MPa at different duty cycles. One day after HIFU treatment, cell viability was determined to be 63%, 35%, and 18%, respectively, based on Trypan Blue exclusion test. Importantly, in all test groups, inducible GFP expression was detected in about 40%-50% of the surviving cells with GFP intensity increased by 25-fold based on flow cytometry analysis. These results demonstrate that even under the short exposure duration of HIFU treatment, inducible gene expression could be produced in sublethally injured cell population in vitro. Further studies are underway to explore the optimal HIFU condition for gene activation in vivo.

  11. Salt induced gene expression in Prosopis farcta

    SciTech Connect

    Heimer, I.M.; Golan, A.; Lips, H.


    The authors hypothesize that in facultative halophytes, the genes which impart salt tolerance are expressed when the plants are exposed to salt. As a first step towards possible identification of these genes, they examined salt induced changes of gene expression in the facultative halophyte Prosopis farcta at the protein level, by SDS-PAGE. Exposure to salt of aseptically grown, two-week old seedlings, was carried out in one of two ways: (1) a one step transfer of seedlings from medium without salt to that with the indicated concentrations followed by 5 hr or 24 hr incubation periods. During the last 2 hrs of each incubation period the seedlings were pulse-labelled with /sup 35/S Sulfate or L-Methionine; (2) a gradual increase of the salt concentration at 50 mM increments at 2-4 day intervals. Two days after reaching the desired salt concentration, the seedlings were pulse-labelled for 2 hrs with /sup 35/S sulfate or L-methionine. Protein from roots were extracted and analyzed. Polypeptides were visualized by staining with coomassie blue or by fluorography. Qualitative as well as quantitative changes of gene expression as induced by salt could be observed. Their significance regarding salt tolerance will be discussed.

  12. Identification of a negative response element in the human inducible nitric-oxide synthase (hiNOS) promoter: The role of NF-κB-repressing factor (NRF) in basal repression of the hiNOS gene

    PubMed Central

    Feng, Xuesheng; Guo, Zhong; Nourbakhsh, Mahtab; Hauser, Hansjorg; Ganster, Ray; Shao, Lifang; Geller, David A.


    Although nuclear factor (NF)-κB plays a central role in mediating cytokine-stimulated human inducible nitric-oxide synthase (hiNOS) gene transcription, very little is known about the factors involved in silencing of the hiNOS promoter. NF-κB-repressing factor (NRF) interacts with a specific negative regulatory element (NRE) to mediate transcriptional repression of certain NF-κB responsive genes. By sequence comparison with the IFN-β and IL-8 promoters, we identified an NRE in the hiNOS promoter located at −6.7 kb upstream. In A549 and HeLa human cells, constitutive NRF mRNA expression is detected by RT-PCR. Gel shift assay showed constitutive NRF binding to the hiNOS NRE. Mutation of the −6.7-kb NRE site in the hiNOS promoter resulted in loss of NRF binding and increased basal but not cytokine-stimulated hiNOS transcription in promoter transfection experiments. Interestingly, overexpression of NRF suppressed both basal and cytokine-induced hiNOS promoter activity that depended on an intact cis-acting NRE motif. By using stably transformed HeLa cells with the tetracycline on/off expression system, reduction of cellular NRF by expressing antisense NRF increased basal iNOS promoter activity and resulted in constitutive iNOS mRNA expression. These data demonstrate that the transacting NRF protein is involved in constitutive silencing of the hiNOS gene by binding to a cis-acting NRE upstream in the hiNOS promoter. PMID:12381793

  13. Identification and functional analysis of light-responsive unique or paralogous gene family members in rice using a near genomic gene microarray

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Using a NSF45K-gene-microarray, we performed expression-profiling experiments on 2-week-old light- and dark-grown rice leaf tissue to identify mutants of light-responsive genes. We identified 356 genes that were at least 8-fold light induced genes at FDR of 1.00E-06. Then, we screened rice T-DNA i...

  14. Cold Responsive Gene Expression Profiling of Sugarcane and Saccharum spontaneum with Functional Analysis of a Cold Inducible Saccharum Homolog of NOD26-Like Intrinsic Protein to Salt and Water Stress

    PubMed Central

    Park, Jong-Won; Benatti, Thiago R.; Marconi, Thiago; Yu, Qingyi; Solis-Gracia, Nora; Mora, Victoria; da Silva, Jorge A.


    Transcriptome analysis of sugarcane hybrid CP72-1210 (cold susceptible) and Saccharum spontaneum TUS05-05 (cold tolerant) using Sugarcane Assembled Sequences (SAS) from SUCEST-FUN Database showed that a total of 35,340 and 34,698 SAS genes, respectively, were expressed before and after chilling stress. The analysis revealed that more than 600 genes are differentially expressed in each genotype after chilling stress. Blast2Go annotation revealed that the major difference in gene expression profiles between CP72-1210 and TUS05-05 after chilling stress are present in the genes related to the transmembrane transporter activity. To further investigate the relevance of transmembrane transporter activity against abiotic stress tolerance, a S. spontaneum homolog of a NOD26-like major intrinsic protein gene (SspNIP2) was selected for functional analysis, of which expression was induced after chilling stress in the cold tolerant TUS05-05. Quantitative real-time PCR showed that SspNIP2 expression was increased ~2.5 fold at 30 minutes after cold treatment and stayed induced throughout the 24 hours of cold treatment. The amino acid sequence analysis of the cloned SspNIP2 confirmed the presence of six transmembrane domains and two NPA (Asn-Pro-Ala) motifs, signature features of major intrinsic protein families. Amino acid analysis confirmed that four amino acids, comprising the ar/R (aromatic residue/arginine) region responsible for the substrate specificity among MIPs, are conserved among monocot silicon transporters and SspNIP2. Salinity stress test on SspNIP2 transgenic tobacco plants resulted in more vigorous transgenic lines than the non-transgenic tobacco plants, suggesting some degree of tolerance to salt stress conferred by SspNIP2. SspNIP2-transgenic plants, exposed to 2 weeks of water stress without irrigation, developed various degrees of water stress symptom. The water stress test confirmed that the SspNIP2 transgenic lines had lower evapotranspiration rates than non

  15. Microarray studies of psychostimulant-induced changes in gene expression.


    Yuferov, Vadim; Nielsen, David; Butelman, Eduardo; Kreek, Mary Jeanne


    Alterations in the expression of multiple genes in many brain regions are likely to contribute to psychostimulant-induced behaviours. Microarray technology provides a powerful tool for the simultaneous interrogation of gene expression levels of a large number of genes. Several recent experimental studies, reviewed here, demonstrate the power, limitations and progress of microarray technology in the field of psychostimulant addiction. These studies vary in the paradigms of cocaine or amphetamine administration, drug doses, route and also mode of administration, duration of treatment, animal species, brain regions studied and time of tissue collection after final drug administration. The studies also utilize different microarray platforms and statistical techniques for analysis of differentially expressed genes. These variables influence substantially the results of these studies. It is clear that current microarray techniques cannot detect small changes reliably in gene expression of genes with low expression levels, including functionally significant changes in components of major neurotransmission systems such as glutamate, dopamine, opioid and GABA receptors, especially those that may occur after chronic drug administration or drug withdrawal. However, the microarray studies reviewed here showed cocaine- or amphetamine-induced alterations in the expression of numerous genes involved in the modulation of neuronal growth, cytoskeletal structures, synaptogenesis, signal transduction, apoptosis and cell metabolism. Application of laser capture microdissection and single-cell cDNA amplification may greatly enhance microarray studies of gene expression profiling. The combination of rapidly evolving microarray technology with established methods of neuroscience, molecular biology and genetics, as well as appropriate behavioural models of drug reinforcement, may provide a productive approach for delineating the neurobiological underpinnings of drug responses that lead to

  16. Virus-induced gene silencing of Arabidopsis thaliana gene homologues in wheat identifies genes conferring improved drought tolerance

    PubMed Central

    Lapitan, Nora


    In a non-model staple crop like wheat (Triticum aestivumI L.), functional validation of potential drought stress responsive genes identified in Arabidopsis could provide gene targets for breeding. Virus-induced gene silencing (VIGS) of genes of interest can overcome the inherent problems of polyploidy and limited transformation potential that hamper functional validation studies in wheat. In this study, three potential candidate genes shown to be involved in abiotic stress response pathways in Arabidopsis thaliana were selected for VIGS experiments in wheat. These include Era1 (enhanced response to abscisic acid), Cyp707a (ABA 8’-hydroxylase), and Sal1 (inositol polyphosphate 1-phosphatase). Gene homologues for these three genes were identified in wheat and cloned in the viral vector barley stripe mosaic virus (BSMV) in the antisense direction, followed by rub inoculation of BSMV viral RNA transcripts onto wheat plants. Quantitative real-time PCR showed that VIGS-treated wheat plants had significant reductions in target gene transcripts. When VIGS-treated plants generated for Era1 and Sal1 were subjected to limiting water conditions, they showed increased relative water content, improved water use efficiency, reduced gas exchange, and better vigour compared to water-stressed control plants inoculated with RNA from the empty viral vector (BSMV0). In comparison, the Cyp707a-silenced plants showed no improvement over BSMV0-inoculated plants under limited water condition. These results indicate that Era1 and Sal1 play important roles in conferring drought tolerance in wheat. Other traits affected by Era1 silencing were also studied. Delayed seed germination in Era1-silenced plants suggests this gene may be a useful target for developing resistance to pre-harvest sprouting. PMID:23364940

  17. Applications and advantages of virus-induced gene silencing for gene function studies in plants.


    Burch-Smith, Tessa M; Anderson, Jeffrey C; Martin, Gregory B; Dinesh-Kumar, S P


    Virus-induced gene silencing (VIGS) is a recently developed gene transcript suppression technique for characterizing the function of plant genes. The approach involves cloning a short sequence of a targeted plant gene into a viral delivery vector. The vector is used to infect a young plant, and in a few weeks natural defense mechanisms of the plant directed at suppressing virus replication also result in specific degradation of mRNAs from the endogenous plant gene that is targeted for silencing. VIGS is rapid (3-4 weeks from infection to silencing), does not require development of stable transformants, allows characterization of phenotypes that might be lethal in stable lines, and offers the potential to silence either individual or multiple members of a gene family. Here we briefly review the discoveries that led to the development of VIGS and what is known about the experimental requirements for effective silencing. We describe the methodology of VIGS and how it can be optimized and used for both forward and reverse genetics studies. Advantages and disadvantages of VIGS compared with other loss-of-function approaches available for plants are discussed, along with how the limitations of VIGS might be overcome. Examples are reviewed where VIGS has been used to provide important new insights into the roles of specific genes in plant development and plant defense responses. Finally, we examine the future prospects for VIGS as a powerful tool for assessing and characterizing the function of plant genes. PMID:15315635

  18. JC virus induces altered patterns of cellular gene expression: Interferon-inducible genes as major transcriptional targets

    SciTech Connect

    Verma, Saguna; Ziegler, Katja; Ananthula, Praveen; Co, Juliene K.G.; Frisque, Richard J.; Yanagihara, Richard; Nerurkar, Vivek R. . E-mail:


    Human polyomavirus JC (JCV) infects 80% of the population worldwide. Primary infection, typically occurring during childhood, is asymptomatic in immunocompetent individuals and results in lifelong latency and persistent infection. However, among the severely immunocompromised, JCV may cause a fatal demyelinating disease, progressive multifocal leukoencephalopathy (PML). Virus-host interactions influencing persistence and pathogenicity are not well understood, although significant regulation of JCV activity is thought to occur at the level of transcription. Regulation of the JCV early and late promoters during the lytic cycle is a complex event that requires participation of both viral and cellular factors. We have used cDNA microarray technology to analyze global alterations in gene expression in JCV-permissive primary human fetal glial cells (PHFG). Expression of more than 400 cellular genes was altered, including many that influence cell proliferation, cell communication and interferon (IFN)-mediated host defense responses. Genes in the latter category included signal transducer and activator of transcription 1 (STAT1), interferon stimulating gene 56 (ISG56), myxovirus resistance 1 (MxA), 2'5'-oligoadenylate synthetase (OAS), and cig5. The expression of these genes was further confirmed in JCV-infected PHFG cells and the human glioblastoma cell line U87MG to ensure the specificity of JCV in inducing this strong antiviral response. Results obtained by real-time RT-PCR and Western blot analyses supported the microarray data and provide temporal information related to virus-induced changes in the IFN response pathway. Our data indicate that the induction of an antiviral response may be one of the cellular factors regulating/controlling JCV replication in immunocompetent hosts and therefore constraining the development of PML.

  19. Targeted gene silencing to induce permanent sterility.


    Dissen, G A; Lomniczi, A; Boudreau, R L; Chen, Y H; Davidson, B L; Ojeda, S R


    A non-surgical method to induce sterility would be a useful tool to control feral populations of animals. Our laboratories have experience with approaches aimed at targeting brain cells in vivo with vehicles that deliver a payload of either inhibitory RNAs or genes intended to correct cellular dysfunction. A combination/modification of these methods may provide a useful framework for the design of approaches that can be used to sterilize cats and dogs. For this approach to succeed, it has to meet several conditions: it needs to target a gene essential for fertility. It must involve a method that can selectively silence the gene of interest. It also needs to deliver the silencing agent via a minimally invasive method. Finally, the silencing effect needs to be sustained for many years, so that expansion of the targeted population can be effectively prevented. In this article, we discuss this subject and provide a succinct account of our previous experience with: (i) molecular reagents able to disrupt reproductive cyclicity when delivered to regions of the brain involved in the control of reproduction and (ii) molecular reagents able to ameliorate neuronal disease when delivered systemically using a novel approach of gene therapy. PMID:22827375

  20. Gene-Specific Involvement of β-Oxidation in Wound-Activated Responses in Arabidopsis1

    PubMed Central

    Castillo, M. Cruz; Martínez, Cristina; Buchala, Antony; Métraux, Jean-Pierre; León, José


    The coordinated induced expression of β-oxidation genes is essential to provide the energy supply for germination and postgerminative development. However, very little is known about other functions of β-oxidation in nonreserve organs. We have identified a gene-specific pattern of induced β-oxidation gene expression in wounded leaves of Arabidopsis. Mechanical damage triggered the local and systemic induction of only ACX1 among acyl-coenzyme A oxidase (ACX) genes, and KAT2/PED1 among 3-ketoacyl-coenzyme A thiolase (KAT) genes in Arabidopsis. In turn, wounding induced KAT5/PKT2 only systemically. Although most of the β-oxidation genes were activated by wound-related factors such as dehydration and abscisic acid, jasmonic acid (JA) induced only ACX1 and KAT5. Reduced expression of ACX1 or KAT2 genes, in transgenic plants expressing their corresponding mRNAs in antisense orientation, correlated with defective wound-activated synthesis of JA and with reduced expression of JA-responsive genes. Induced expression of JA-responsive genes by exogenous application of JA was unaffected in those transgenic plants, suggesting that ACX1 and KAT2 play a major role in driving wound-activated responses by participating in the biosynthesis of JA in wounded Arabidopsis plants. PMID:15141068

  1. Pneumococcal Hydrogen Peroxide–Induced Stress Signaling Regulates Inflammatory Genes

    PubMed Central

    Loose, Maria; Hudel, Martina; Zimmer, Klaus-Peter; Garcia, Ernesto; Hammerschmidt, Sven; Lucas, Rudolf; Chakraborty, Trinad; Pillich, Helena


    Microbial infections can induce aberrant responses in cellular stress pathways, leading to translational attenuation, metabolic restriction, and activation of oxidative stress, with detrimental effects on cell survival. Here we show that infection of human airway epithelial cells with Streptococcus pneumoniae leads to induction of endoplasmic reticulum (ER) and oxidative stress, activation of mitogen-associated protein kinase (MAPK) signaling pathways, and regulation of their respective target genes. We identify pneumococcal H2O2 as the causative agent for these responses, as both catalase-treated and pyruvate oxidase-deficient bacteria lacked these activities. Pneumococcal H2O2 induced nuclear NF-κB translocation and transcription of proinflammatory cytokines. Inhibition of translational arrest and ER stress by salubrinal or of MAPK signaling pathways attenuate cytokine transcription. These results provide strong evidence for the notion that inhibition of translation is an important host pathway in monitoring harmful pathogen-associated activities, thereby enabling differentiation between pathogenic and nonpathogenic bacteria. PMID:25183769

  2. Transposable Elements Contribute to Activation of Maize Genes in Response to Abiotic Stress

    PubMed Central

    Makarevitch, Irina; Waters, Amanda J.; West, Patrick T.; Stitzer, Michelle; Hirsch, Candice N.; Ross-Ibarra, Jeffrey; Springer, Nathan M.


    Transposable elements (TEs) account for a large portion of the genome in many eukaryotic species. Despite their reputation as “junk” DNA or genomic parasites deleterious for the host, TEs have complex interactions with host genes and the potential to contribute to regulatory variation in gene expression. It has been hypothesized that TEs and genes they insert near may be transcriptionally activated in response to stress conditions. The maize genome, with many different types of TEs interspersed with genes, provides an ideal system to study the genome-wide influence of TEs on gene regulation. To analyze the magnitude of the TE effect on gene expression response to environmental changes, we profiled gene and TE transcript levels in maize seedlings exposed to a number of abiotic stresses. Many genes exhibit up- or down-regulation in response to these stress conditions. The analysis of TE families inserted within upstream regions of up-regulated genes revealed that between four and nine different TE families are associated with up-regulated gene expression in each of these stress conditions, affecting up to 20% of the genes up-regulated in response to abiotic stress, and as many as 33% of genes that are only expressed in response to stress. Expression of many of these same TE families also responds to the same stress conditions. The analysis of the stress-induced transcripts and proximity of the transposon to the gene suggests that these TEs may provide local enhancer activities that stimulate stress-responsive gene expression. Our data on allelic variation for insertions of several of these TEs show strong correlation between the presence of TE insertions and stress-responsive up-regulation of gene expression. Our findings suggest that TEs provide an important source of allelic regulatory variation in gene response to abiotic stress in maize. PMID:25569788

  3. Mitochondrial gene expression, antioxidant responses, and histopathology after cadmium exposure.


    Al Kaddissi, Simone; Legeay, Alexia; Elia, Antonia Concetta; Gonzalez, Patrice; Floriani, Magali; Cavalie, Isabelle; Massabuau, Jean-Charles; Gilbin, Rodolphe; Simon, Olivier


    The present study investigates cadmium effects on the transcription of mitochondrial genes of Procambarus clarkii after acute (0.05, 0.5, and 5 mg Cd/L; 4-10 days) and chronic exposures (10 μg Cd/L; 30-60 days). Transcriptional responses of cox1, atp6, and 12S using quantitative real-time RT-PCR were assessed in gills and hepatopancreas. Additionally, the expression levels of genes involved in detoxification and/or oxidative stress responses [mt, sod(Mn)] and enzymatic activities of antioxidants (SOD, CAT, GPX, and GST) were analyzed. The histopathological effects in hepatopancreas of crayfish were evaluated by light microscopy. Relationships between endpoints at different levels of biological organization and Cd bioaccumulation were also examined. Cd induced high levels of bioaccumulation, which was followed by mitochondrial dysfunction and histological alterations in both experiments. Moreover, perturbations in the defence mechanisms against oxidative stress tended to increase with time. Results also showed that molecular responses can vary depending on the intensity and duration of the chemical stress applied to the organisms and that the study of mt gene expression levels seemed to be the best tool to assess Cd intoxication. PMID:23065898

  4. Virus-Induced Gene Silencing in Ornametal Plants

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Virus-Induced Gene Silencing (VIGS) provides an attractive tool for high throughput analysis of the functional effects of gene knock-down. Virus genomes are engineered to include fragments of target host genes, and the infected plant recognizes and silences the target genes as part of its viral defe...

  5. Virus-Induced gene silencing in ornamental plants

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Virus-Induced Gene Silencing (VIGS) provides an attractive tool for high throughput analysis of the functional effects of gene knock-down. Virus genomes are engineered to include fragments of target host genes, and the infected plant recognizes and silences the target genes as part of its viral defe...

  6. Identification of Estrogen Response Element in Aquaporin-3 Gene that Mediates Estrogen-induced Cell Migration and Invasion in Estrogen Receptor-positive Breast Cancer

    PubMed Central

    Huang, Yi-Ting; Zhou, Jun; Shi, Shuai; Xu, Hai-Yan; Qu, Fan; Zhang, Dan; Chen, Yi-Ding; Yang, Jing; Huang, He-Feng; Sheng, Jian-Zhong


    Accumulating evidence suggests that aquaporins (AQPs) may facilitate tumor development. The molecular pathways connecting the pathological functions of AQPs are unclear and need to be better defined. This study aimed to investigate whether AQP3, one of the AQPs expressed highly in breast cancer, had any clinical implication in estrogen-receptor (ER) positive breast cancer, and explore the regulatory mechanisms of AQP3 in estrogen-related breast cancer progression. Here we show that AQP3 is an important enforcer of migration and invasion in breast cancer. We, for the first time, reported that ER-positive breast cancer tissues obtained from premenopausal patients had higher AQP3 expression when compared to those obtained from postmenopausal patients. Estrogen directly upregulates AQP3 by activating ERE in the promoter of the AQP3 gene. The upregulation of AQP3 can influence the expression of molecules related to epithelial-mesenchymal transition and the reorganization of actin-cytoskeleton, resulting in enhancement of cell migration and invasion in ER-positive breast cancer cells. PMID:26219409

  7. Sex of the cell dictates its response: differential gene expression and sensitivity to cell death inducing stress in male and female cells.


    Penaloza, Carlos; Estevez, Brian; Orlanski, Shari; Sikorska, Marianna; Walker, Roy; Smith, Catherine; Smith, Brandon; Lockshin, Richard A; Zakeri, Zahra


    Sexual dimorphisms are typically attributed to the hormonal differences arising once sex differentiation has occurred. However, in some sexually dimorphic diseases that differ in frequency but not severity, the differences cannot be logically connected to the sex hormones. Therefore, we asked whether any aspect of sexual dimorphism could be attributed to chromosomal rather than hormonal differences. Cells taken from mice at d 10.5 postconception (PC) before sexual differentiation, at d 17.5 PC after the first embryonic assertion of sexual hormones, and at postnatal day 17 (puberty) were cultured and exposed to 400 microM ethanol or 20 microM camptothecin or to infection with influenza A virus (multiplicity of infection of 5). The results showed that untreated male and female cells of the same age grew at similar rates and manifested similar morphology. However, they responded differently to the applied stressors, even before the production of fetal sex hormones. Furthermore, microarray and qPCR analyses of the whole 10.5 PC embryos also revealed differences in gene expression between male and female tissues. Likewise, the exposure of cells isolated from fetuses and adolescent mice to the stressors and/or sex hormones yielded expression patterns that reflected chromosomal sex, with ethanol feminizing male cells and masculinizing female cells. We conclude that cells differ innately according to sex irrespective of their history of exposure to sex hormones. These differences may have consequences in the course of sexually dimorphic diseases and their therapy. PMID:19190082

  8. CXCR4 gene transfer prevents pressure overload induced heart failure

    PubMed Central

    LaRocca, Thomas J.; Jeong, Dongtak; Kohlbrenner, Erik; Lee, Ahyoung; Chen, JiQiu; Hajjar, Roger J.; Tarzami, Sima T.


    Stem cell and gene therapies are being pursued as strategies for repairing damaged cardiac tissue following myocardial infarction in an attempt to prevent heart failure. The chemokine receptor-4 (CXCR4) and its ligand, CXCL12, play a critical role in stem cell recruitment post-acute myocardial infarction. Whereas progenitor cell migration via the CXCL12/CXCR4 axis is well characterized, little is known about the molecular mechanisms of CXCR4 mediated modulation of cardiac hypertrophy and failure. We used gene therapy to test the effects of CXCR4 gene delivery on adverse ventricular remodeling due to pressure overload. We assessed the effect of cardiac overexpression of CXCR4 during trans-aortic constriction (TAC) using a cardiotropic adeno-associated viral vector (AAV9) carrying the CXCR4 gene. Cardiac overexpression of CXCR4 in mice with pressure overload prevented ventricular remodeling, preserved capillary density and maintained function as determined by echocardiography and in vivo hemodynamics. In isolated adult rat cardiac myocytes, CXCL12 treatment prevented isoproterenol induced hypertrophy and interrupted the calcineurin/NFAT pathway. Finally, a complex involving the L-type calcium channel, β2-adenoreceptor, and CXCR4 (Cav1.2/β2AR/CXCR4) was identified in healthy cardiac myocytes and was shown to dissociate as a consequence of heart failure. CXCR4 administered to the heart via gene transfer prevents pressure overload induced heart failure. The identification of CXCR4 participation in a Cav1.2-β2AR regulatory complex provides further insight into the mechanism by which CXCR4 modulates calcium homeostasis and chronic pressure overload responses in the cardiac myocyte. Together these results suggest AAV9.CXCR4 gene therapy is a potential therapeutic approach for congestive heart failure. PMID:22668785

  9. Bitumen fume-induced gene expression profile in rat lung

    SciTech Connect

    Gate, Laurent . E-mail:; Langlais, Cristina; Micillino, Jean-Claude; Nunge, Herve; Bottin, Marie-Claire; Wrobel, Richard; Binet, Stephane


    Exposure to bitumen fumes during paving and roofing activities may represent an occupational health risk. To date, most of the studies performed on the biological effect of asphalt fumes have been done with regard to their content in carcinogenic polycyclic aromatic hydrocarbons (PAH). In order to gain an additional insight into the mechanisms of action of bitumen fumes, we studied their pulmonary effects in rodents following inhalation using the microarray technology. Fisher 344 rats were exposed for 5 days, 6 h/day to bitumen fumes generated at road paving temperature (170 {sup o}C) using a nose-only exposition device. With the intention of studying the early transcriptional events induced by asphalt fumes, lung tissues were collected immediately following exposure and gene expression profiles in control and exposed rats were determined by using oligonucleotide microarrays. Data analysis revealed that genes involved in lung inflammatory response as well as genes associated with PAH metabolization and detoxification were highly expressed in bitumen-exposed animals. In addition, the expression of genes related to elastase activity and its inhibition which are associated with emphysema was also modulated. More interestingly genes coding for monoamine oxidases A and B involved in the metabolism of neurotransmitters and xenobiotics were downregulated in exposed rats. Altogether, these data give additional information concerning the bitumen fumes biological effects and would allow to better review the health effects of occupational asphalt fumes exposure.

  10. Octylphenol induced gene expression in testes of Frog, Rana chensinensis.


    Li, Xinyi; Liu, Jia; Zhang, Yuhui


    Octylphenol (OP) is an endocrine-disrupting chemical (EDC), which can disrupt the reproductive system. To understand the effect of OP, a subtractive cDNA library was constructed using suppression subtractive hybridization (SSH) to identify alterations of gene transcription in the testes of the frog Rana chensinensis after OP exposure. Two hundred positive clones were selected and 134 sequences of gene fragments were produced from the subtractive library randomly. These genes were identified to be involved in metabolic process, cellular process, biological regulation, stimulus, immune system and female pregnancy process. In order to verify the efficiency of the subtractive cDNA library, PSG9 and PAPP-A were analyzed further as two representatives of differentially expressed transcription genes using semi-quantitative RT-PCR. Our result was the first successful construction of the subtractive cDNA library in frog testes after OP treatment. Based on this cDNA library, OP was shown to affect multiple physiological processes including inducing immune response, disrupting the steroid hormone synthesis and influencing spermatogenesis in the testis by up-regulation of specific genes. PMID:26896894

  11. Bifidobacterium bifidum actively changes the gene expression profile induced by Lactobacillus acidophilus in murine dendritic cells.


    Weiss, Gudrun; Rasmussen, Simon; Nielsen Fink, Lisbeth; Jarmer, Hanne; Nøhr Nielsen, Birgit; Frøkiaer, Hanne


    Dendritic cells (DC) play a pivotal regulatory role in activation of both the innate as well as the adaptive immune system by responding to environmental microorganisms. We have previously shown that Lactobacillus acidophilus induces a strong production of the pro-inflammatory and Th1 polarizing cytokine IL-12 in DC, whereas bifidobacteria do not induce IL-12 but inhibit the IL-12 production induced by lactobacilli. In the present study, genome-wide microarrays were used to investigate the gene expression pattern of murine DC stimulated with Lactobacillus acidophilus NCFM and Bifidobacterium bifidum Z9. L. acidophilus NCFM strongly induced expression of interferon (IFN)-beta, other virus defence genes, and cytokine and chemokine genes related to the innate and the adaptive immune response. By contrast, B. bifidum Z9 up-regulated genes encoding cytokines and chemokines related to the innate immune response. Moreover, B. bifidum Z9 inhibited the expression of the Th1-promoting genes induced by L. acidophilus NCFM and had an additive effect on genes of the innate immune response and Th2 skewing genes. The gene encoding Jun dimerization protein 2 (JDP2), a transcription factor regulating the activation of JNK, was one of the few genes only induced by B. bifidum Z9. Neutralization of IFN-beta abrogated L. acidophilus NCFM-induced expression of Th1-skewing genes, and blocking of the JNK pathway completely inhibited the expression of IFN-beta. Our results indicate that B. bifidum Z9 actively inhibits the expression of genes related to the adaptive immune system in murine dendritic cells and that JPD2 via blocking of IFN-beta plays a central role in this regulatory mechanism. PMID:20548777

  12. Gene expression changes in female zebrafish (Danio rerio) brain in response to acute exposure to methylmercury

    USGS Publications Warehouse

    Richter, Catherine A.; Garcia-Reyero, Natàlia; Martyniuk, Chris; Knoebl, Iris; Pope, Marie; Wright-Osment, Maureen K.; Denslow, Nancy D.; Tillitt, Donald E.


    Methylmercury (MeHg) is a potent neurotoxicant and endocrine disruptor that accumulates in aquatic systems. Previous studies have shown suppression of hormone levels in both male and female fish, suggesting effects on gonadotropin regulation in the brain. The gene expression profile in adult female zebrafish whole brain induced by acute (96 h) MeHg exposure was investigated. Fish were exposed by injection to 0 or 0.5(mu or u)g MeHg/g. Gene expression changes in the brain were examined using a 22,000-feature zebrafish microarray. At a significance level of pgenes were up-regulated and 76 genes were down-regulated in response to MeHg exposure. Individual genes exhibiting altered expression in response to MeHg exposure implicate effects on glutathione metabolism in the mechanism of MeHg neurotoxicity. Gene ontology (GO) terms significantly enriched among altered genes included protein folding, cell redox homeostasis, and steroid biosynthetic process. The most affected biological functions were related to nervous system development and function, as well as lipid metabolism and molecular transport. These results support the involvement of oxidative stress and effects on protein structure in the mechanism of action of MeHg in the female brain. Future studies will compare the gene expression profile induced in response to MeHg with that induced by other toxicants and will investigate responsive genes as potential biomarkers of MeHg exposure.


    PubMed Central

    Richter, Catherine A.; Garcia-Reyero, Natàlia; Martyniuk, Chris; Knoebl, Iris; Pope, Marie; Wright-Osment, Maureen K.; Denslow, Nancy D.; Tillitt, Donald E.


    Methylmercury (MeHg) is a potent neurotoxicant and endocrine disruptor that accumulates in aquatic systems. Previous studies have shown suppression of hormone levels in both male and female fish, suggesting effects on gonadotropin regulation in the brain. The gene expression profile in adult female zebrafish whole brain induced by acute (96 hr) MeHg exposure was investigated. Fish were exposed by injection to 0 or 0.5 μg MeHg/g. Gene expression changes in the brain were examined using a 22,000 feature zebrafish microarray. At a significance level of p<0.01, 79 genes were up-regulated and 76 genes were down-regulated in response to MeHg exposure. Individual genes exhibiting altered expression in response to MeHg exposure implicate effects on glutathione metabolism in the mechanism of MeHg neurotoxicity. Gene ontology (GO) terms significantly enriched among altered genes included protein folding, cell redox homeostasis, and steroid biosynthetic process. The most affected biological functions were related to the nervous system development and function, as well as lipid metabolism and molecular transport. These results support the involvement of oxidative stress and effects on protein structure in the mechanism of action of MeHg in the female brain. Future studies will compare the gene expression profile induced in response to MeHg with that induced by other toxicants and investigate responsive genes as potential biomarkers of MeHg exposure. PMID:21082716

  14. Cellular responses to oxidative stress: the [Ah] gene battery as a paradigm.

    PubMed Central

    Nebert, D W; Petersen, D D; Fornace, A J


    A major source of oxidative stress in animals is plant stress metabolites, also termed phytoalexins. The aromatic hydrocarbon-responsive [Ah] gene battery is considered here as a model system in which we can study metabolically coordinated enzymes that respond to phytoalexin-induced oxidative stress. In the mouse, the [Ah] battery comprises at least six genes: two Phase I genes, CYP1A1 and CYP1A2; and four Phase II genes, Nmo-1, Aldh-1, Ugt-1, and Gt-1. All six genes appear to be regulated positively by inducers such as 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) and other ligands of the Ah receptor. In the absence of foreign inducer, the control of Nmo-1 gene expression is independent of the control of CYP1A1 and CYP1A2 gene expression. The radiation deletion homozygote c14CoS/c14CoS mouse is lacking about 1.1 centiMorgans of chromosome 7. Although having no detectable CYP1A1 or CYP1A2 activation, the untreated c14CoS/c14CoS mouse exhibits markedly elevated transcripts of the Nmo-1 gene and three growth arrest- and DNA damage-inducible (gadd) genes. These data suggest that the missing region on chromosome 7 in the c14CoS/c14CoS mouse contains a gene(s), which we propose to call Nmo-1n, encoding a trans-acting factor(s) that is a negative effector of the Nmo-1 and gadd genes. The three other [Ah] battery Phase II genes behave similarly to Nmo-1 in the c14CoS/c14CoS mouse. This coordinated response to oxidative stress and DNA damage, by way of the release of a mammalian battery of genes from negative control, bears an interesting resemblance to the SOS response in bacteria. PMID:2272308

  15. Stress, and pathogen response gene expression in modeled microgravity

    NASA Technical Reports Server (NTRS)

    Sundaresan, Alamelu; Pellis, Neal R.


    Purpose: Immune suppression in microgravity has been well documented. With the advent of human exploration and long-term space travel, the immune system of the astronaut must be optimally maintained. It is important to investigate the expression patterns of cytokine genes, because they are directly related to immune response. Heat shock proteins (HSPs), also called stress proteins, are a group of proteins that are present in the cells of every life form. These proteins are induced when a cell responds to stressors such as heat, cold and oxygen deprivation. Microgravity is another stressor that may regulate HSPs. Heat shock proteins trigger immune response through activities that occur both inside the cell (intracellular) and outside the cell (extracellular). Knowledge about these two gene groups could lead to establishment of a blueprint of the immune response and adaptation-related genes in the microgravity environment. Methods: Human peripheral blood cells were cultured in 1g (T flask) and modeled microgravity (MMG, rotating-wall vessel) for 24 and 72 hours. Cell samples were collected and subjected to gene array analysis using the Affymetrix HG_U95 array. Data was collected and subjected to a two-way analysis of variance. The genes related to immune and stress responses were analyzed. Results and Conclusions: HSP70 was up-regulated by more than two fold in microgravity culture, while HSP90 was significantly down-regulated. HSP70 is not typically expressed in all kinds of cells, but it is expressed at high levels in stress conditions. HSP70 participates in translation, protein translocation, proteolysis and protein folding, suppressing aggregation and reactivating denatured proteins. Increased serum HSP70 levels correlate with a better outcome for heat-stroke or severe trauma patients. At the same time, elevated serum levels of HSP70 have been detected in patients with peripheral or renal vascular disease. HSP90 has been identified in the cytosol, nucleus and

  16. Silencing in Apolygus lucorum of the olfactory coreceptor Orco gene by RNA interference induces EAG response declining to two putative semiochemicals.


    Zhou, Yan-Le; Zhu, Xiao-Qiang; Gu, Shao-Hua; Cui, Huan-huan; Guo, Yu-Yuan; Zhou, Jing-Jiang; Zhang, Yong-Jun


    Apolygus lucorum (Meyer-Dür) (Hemiptera: Miridae) is an agronomically important pest that causes severe economic damage to the cotton, fruit, and vegetable industries. Similar to other insects, A. lucorum can perceive and discriminate olfactory cues. A highly conserved and broadly expressed olfactory coreceptor (Orco) is crucial for insect olfaction, and Orco orthologs have been identified in several insect species. In this study, a homology-based polymerase chain reaction (PCR) method was utilized to identify AlucOrco, an Orco ortholog essential for olfaction in A. lucorum. AlucOrco shares significant sequence homology with known Orco proteins in other insects. Quantitative real-time PCR (qRT-PCR) analysis revealed that AlucOrco was abundantly expressed in adult A. lucorum. AlucOrco expression level was the highest in the antennae; by contrast, AlucOrco showed negligible expression level in other tissues. We injected AlucOrco siRNA into the conjunctivum between the prothorax and mesothorax of A. lucorum and evaluated its expression 36 h after RNA interference. The results of qRT-PCR demonstrated that the level of mRNA expression was significantly reduced (>90%) in AlucOrco siRNA-treated A. lucorum than in water-injected and non-injected controls. The electroantennogram responses of A. lucorum to two putative semiochemicals, trans-2-hexenal and trans-2-hexenyl butyrate, were also reduced significantly (∼80%) in RNAi-treated A. lucorum than in the controls. These results suggest that AlucOrco is crucial in mediating odorant perception of A. lucorum, especially in perceiving trans-2-hexenal and trans-2-hexenyl butyrate. PMID:24216470

  17. Response to Nodal morphogen gradient is determined by the kinetics of target gene induction

    PubMed Central

    Dubrulle, Julien; Jordan, Benjamin M; Akhmetova, Laila; Farrell, Jeffrey A; Kim, Seok-Hyung; Solnica-Krezel, Lilianna; Schier, Alexander F


    Morphogen gradients expose cells to different signal concentrations and induce target genes with different ranges of expression. To determine how the Nodal morphogen gradient induces distinct gene expression patterns during zebrafish embryogenesis, we measured the activation dynamics of the signal transducer Smad2 and the expression kinetics of long- and short-range target genes. We found that threshold models based on ligand concentration are insufficient to predict the response of target genes. Instead, morphogen interpretation is shaped by the kinetics of target gene induction: the higher the rate of transcription and the earlier the onset of induction, the greater the spatial range of expression. Thus, the timing and magnitude of target gene expression can be used to modulate the range of expression and diversify the response to morphogen gradients. DOI: PMID:25869585

  18. Identification and characterization of a novel NOD-like receptor family CARD domain containing 3 gene in response to extracellular ATP stimulation and its role in regulating LPS-induced innate immune response in Japanese flounder (Paralichthys olivaceus) head kidney macrophages.


    Li, Shuo; Chen, Xiaoli; Hao, Gaixiang; Geng, Xuyun; Zhan, Wenbin; Sun, Jinsheng


    Nucleotide oligomerization domain (NOD)-like receptor (NLR) family with a caspase activation and recruitment domain (CARD) containing 3 (NLRC3) protein is an important cytosolic pattern recognition receptor that negatively regulates innate immune response in mammals. Hitherto, the immunological significance of NLRC3 protein in fish remains largely uncharacterized. Here we identified and characterized a novel NLRC3 gene (named poNLRC3) implicated in regulation of fish innate immunity from Japanese flounder Paralichthys olivaceus. The poNLRC3 protein is a cytoplasmic protein with an undefined N-terminal domain, a NACHT domain, a fish-specific NACHT associated domain, six LRR motifs, and a C-terminal fish-specific PYR/SPYR (B30.2) domain but only shares less than 40% sequence identities with the known Japanese flounder NLRC proteins. poNLRC3 gene is ubiquitously expressed in all tested tissues and is dominantly expressed in the Japanese flounder head kidney macrophages (HKMs). We for the first time showed that poNLRC3 expression was significantly modulated by the stimulation of extracellular ATP, an important danger/damage-associated molecular pattern in activating innate immunity in P. olivaceus. Importantly, we revealed that poNLRC3 plays an important role in positively regulating ATP-induced IL-1beta and IL-6 gene expression, suggesting the involvement of poNLRC3 in extracellular ATP-mediated immune signaling. In addition, we showed that poNLRC3 mRNA expression was up-regulated in response to LPS and Edwardsiella tarda immune challenges. Finally, we showed that down-regulating the endogenous poNLRC3 expression with small interfering RNA significantly reduced LPS-induced proinflammatory cytokine gene expression in the Japanese flounder HKM cells. Altogether, we have identified a novel inducible fish NLR member, poNLRC3, which is involved in extracellular ATP-mediated immune signaling and may positively regulate the LPS-induced innate immune response in the Japanese

  19. The HIF1alpha-inducible pro-cell death gene BNIP3 is a novel target of SIM2s repression through cross-talk on the hypoxia response element.


    Farrall, A L; Whitelaw, M L


    The short isoform of single-minded 2 (SIM2s), a basic helix-loop-helix/PAS (bHLH/PAS) transcription factor, is upregulated in pancreatic and prostate tumours; however, a mechanistic role for SIM2s in these cancers is unknown. Microarray studies in prostate DU145 cells identified the pro-cell death gene, BNIP3 (Bcl-2/adenovirus E1B 19 kDa interacting protein 3), as a novel putative target of SIM2s repression. Further validation showed BNIP3 repression in several prostate and pancreatic carcinoma-derived cell lines with ectopic expression of human SIM2s. BNIP3 levels are enhanced in prostate carcinoma cells upon short interfering (si)RNA-mediated knockdown of endogenous SIM2s. Chromatin immunoprecipitation and promoter studies show that SIM2s represses BNIP3 through its activities at the proximal promoter hypoxia response element (HRE), the site through which the bHLH/PAS family member, hypoxia-inducible factor 1alpha (HIF1alpha), induces BNIP3. SIM2s attenuates BNIP3 hypoxic induction via the HRE, and increased hypoxic induction of BNIP3 occurs with siRNA knockdown of endogenous SIM2s in prostate PC3AR+ cells. BNIP3 is implicated in hypoxia-induced cell death processes. Prolonged treatment of PC3AR+ cells with hypoxia mimetics, DP and DMOG, confers hypoxia-induced autophagy, measured by enhanced LC3-II levels and SQSTM1/p62 turnover. We show that PC3AR+ cells expressing ectopic SIM2s have enhanced survival in these conditions. Induction of LC3-II and turnover of SQSTM1/p62 are attenuated in PC3AR+/SIM2s DMOG and hypoxia-treated cells, suggesting that SIM2s may attenuate autophagic cell death processes, perhaps through BNIP3 repression. These data show, for the first time, SIM2s cross-talk on an endogenous HRE. SIM2s' functional interference with HIF1alpha activities on BNIP3 may indicate a novel role for SIM2s in promoting tumourigenesis. PMID:19668230

  20. Infrared laser-induced gene expression in targeted single cells of Caenorhabditis elegans.


    Suzuki, Motoshi; Toyoda, Naoya; Shimojou, Masaki; Takagi, Shin


    Since the dawn of transgenic technology some 40 years ago, biologists have sought ways to manipulate, at their discretion, the expression of particular genes of interest in living organisms. The infrared laser-evoked gene operator (IR-LEGO) is a recently developed system for inducing gene expression in living organisms in a targeted fashion. It exploits the highly efficient capacity of an infrared laser for heating cells, to provide a high level of gene expression driven by heat-inducible promoters. By irradiating living specimens with a laser under a microscope, heat shock responses can be induced in individual cells, thereby inducing a particular gene, under the control of a heat shock promoter, in specifically targeted cells. In this review we first summarize previous attempts to drive transgene expression in organisms by using heat shock promoters, and then introduce the basic principle of the IR-LEGO system, and its applications. PMID:23614811

  1. A specific library of randomly integrated reporter genes for the isolation of inducible functions by cell sorting

    SciTech Connect

    Lapeyre, J.N.; Marini, F.; Gratzner, H.G. AMC ImmunoDiagnostics, Houston, TX )


    A library of cells containing randomly integrated reporter genes has been constructed. The purpose of this library is to enable the isolation of genes of interest which are inducible by radiation, biological response modifiers, cytokines, or other agents. These genes are located near reporter genes which can be induced by the upstream promoter of the gene of interest. The reporter gene, Lac Z, was randomly inserted into the genome by retroviral transduction and subsequent selection of the neo[sup r] gene with gentamycin. Studies of radiation inducible genes were undertaken, whereby cells with the radiation sensitive function were isolated by sorting the cells fluorescent after staining with the beta gal substrate, fluorescein digalactoside (FDG). This gene-tagging approach is an improvement over the cDNA library subtraction protocol in that a single library of cells with random marker gene integration can be repeatedly and sequentially probed by sorting under different, selective conditions, dependent upon the genes to be characterized.

  2. The bat gene of Halobacterium halobium encodes a trans-acting oxygen inducibility factor.

    PubMed Central

    Gropp, F; Betlach, M C


    Oxygen and light affect the expression of the bacterioopsin gene (bop), which encodes a light-driven proton pump in the purple membrane of Halobacterium halobium. This response is thought to be mediated by a set of genes located adjacent to the bop gene. DNA fragments containing either the bop gene or the entire bop gene cluster reversed the phenotype of purple membrane-deficient strains with mutations in the bop gene. Purple membrane synthesis was constitutive in one of these strains transformed with the bop gene alone. The same strain transformed with the bop gene cluster was inducible by low oxygen tension. Moreover, another strain that constitutively expresses purple membrane remained constitutive when transformed with the bop gene alone but the phenotype of the strain changed to inducible when transformed with the bop gene cluster. Additional experiments have confirmed that one of the genes of the bop gene cluster, the bat gene, encodes a trans-acting factor that is necessary and sufficient to confer inducibility of purple membrane synthesis by low oxygen tension. Images PMID:8202511

  3. Gene expression profiling and mechanism study of neural stem cells response to surface chemistry

    PubMed Central

    Wang, Ying; Yao, Shenglian; Meng, Qingyuan; Yu, Xiaolong; Wang, Xiumei; Cui, Fuzhai


    To declare the mechanisms of neural stem cells (NSCs) in response to material surface chemistry, NSCs were exposed to the self-assemble monolayers of alkanethiolates on gold surfaces terminated with amine (NH2), hydroxyl (OH) and methyl (CH3) for analysis. The morphological responses of NSCs were recorded; the gene expression profilings were detected by genechips; the gene expressions data of NSCs responded to different chemical groups were declared through the gene ontology term and pathway analyses. It showed that cells behaved dissimilar on the three chemical groups, the adhesion, proliferation and migration were easier on the NH2 and OH groups; the gene expressions of NSCs were induced differently, either, involved in several functional processes and signaling pathways. CH3 group induced genes enriched much in chemistry reactions and death processes, whereas many genes of cellular nucleotide metabolism were down-regulated. NH2 group induced NSCs to express many genes of receptors on membrane, and participated in cellular signal transduction of cell adhesion and interactions, or associated with axon growth. OH group was similar to NH2 group to induce the membrane response, but it also down regulated metabolism of cells. Therefore, it declared the chemical groups affected NSCs through inner way and the NH2, OH and CH3 groups triggered the cellular gene expression in different signaling pathways. PMID:26816623

  4. Light-dependent expression of flg22-induced defense genes in Arabidopsis

    PubMed Central

    Sano, Satoshi; Aoyama, Mayu; Nakai, Kana; Shimotani, Koji; Yamasaki, Kanako; Sato, Masa H.; Tojo, Daisuke; Suwastika, I. Nengah; Nomura, Hironari; Shiina, Takashi


    Chloroplasts have been reported to generate retrograde immune signals that activate defense gene expression in the nucleus. However, the roles of light and photosynthesis in plant immunity remain largely elusive. In this study, we evaluated the effects of light on the expression of defense genes induced by flg22, a peptide derived from bacterial flagellins which acts as a potent elicitor in plants. Whole-transcriptome analysis of flg22-treated Arabidopsis thaliana seedlings under light and dark conditions for 30 min revealed that a number of (30%) genes strongly induced by flg22 (>4.0) require light for their rapid expression, whereas flg22-repressed genes include a significant number of genes that are down-regulated by light. Furthermore, light is responsible for the flg22-induced accumulation of salicylic acid (SA), indicating that light is indispensable for basal defense responses in plants. To elucidate the role of photosynthesis in defense, we further examined flg22-induced defense gene expression in the presence of specific inhibitors of photosynthetic electron transport: 3-(3,4-dichlorophenyl)-1,1-dimethylurea (DCMU) and 2,5-dibromo-3-methyl-6-isopropyl-benzoquinone (DBMIB). Light-dependent expression of defense genes was largely suppressed by DBMIB, but only partially suppressed by DCMU. These findings suggest that photosynthetic electron flow plays a role in controlling the light-dependent expression of flg22-inducible defense genes. PMID:25346742

  5. Roles of defense response genes in plant-microbe interactions

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Microarray technology was used to identify genes associated with disease defense responses in the model legume Medicago truncatula. We compared transcript profiles from leaves inoculated with Colletotrichum trifolii and Erysiphe pisi and roots infected with Phytophthora medicaginis to identify genes...

  6. Gene Expression Profiles of Chicken Embryo Fibroblasts in Response to Salmonella Enteritidis Infection

    PubMed Central

    Szmolka, Ama; Wiener, Zoltán; Matulova, Marta Elsheimer; Varmuzova, Karolina; Rychlik, Ivan


    The response of chicken to non-typhoidal Salmonella infection is becoming well characterised but the role of particular cell types in this response is still far from being understood. Therefore, in this study we characterised the response of chicken embryo fibroblasts (CEFs) to infection with two different S. Enteritidis strains by microarray analysis. The expression of chicken genes identified as significantly up- or down-regulated (≥3-fold) by microarray analysis was verified by real-time PCR followed by functional classification of the genes and prediction of interactions between the proteins using Gene Ontology and STRING Database. Finally the expression of the newly identified genes was tested in HD11 macrophages and in vivo in chickens. Altogether 19 genes were induced in CEFs after S. Enteritidis infection. Twelve of them were also induced in HD11 macrophages and thirteen in the caecum of orally infected chickens. The majority of these genes were assigned different functions in the immune response, however five of them (LOC101750351, K123, BU460569, MOBKL2C and G0S2) have not been associated with the response of chicken to Salmonella infection so far. K123 and G0S2 were the only ’non-immune’ genes inducible by S. Enteritidis in fibroblasts, HD11 macrophages and in the caecum after oral infection. The function of K123 is unknown but G0S2 is involved in lipid metabolism and in β-oxidation of fatty acids in mitochondria. PMID:26046914

  7. The chemical defensome: Environmental sensing and response genes in the Strongylocentrotus purpuratus genome

    PubMed Central

    Goldstone, J.V.; Hamdoun, A.; Cole, B.J.; Howard-Ashby, M.; Nebert, D.W.; Scally, M.; Dean, M.; Epel, D.; Hahn, M.E.; Stegeman, J.J.


    Metazoan genomes contain large numbers of genes that participate in responses to environmental stressors. We surveyed the sea urchin Strongylocentrotus purpuratus genome for homologs of gene families thought to protect against chemical stressors; these genes collectively comprise the ‘chemical defensome.’ Chemical defense genes include cytochromes P450 and other oxidases, various conjugating enzymes, ATP-dependent efflux transporters, oxidative detoxification proteins, and transcription factors that regulate these genes. Together such genes account for more than 400 genes in the sea urchin genome. The transcription factors include homologs of the aryl hydrocarbon receptor, hypoxia-inducible factor, nuclear factor erythroid-derived 2, heat shock factor, and nuclear hormone receptors, which regulate stress-response genes in vertebrates. Some defense gene families, including the ABCC, the UGT, and the CYP families, have undergone expansion in the urchin relative to other deuterostome genomes, whereas the stress sensor gene families do not show such expansion. More than half of the defense genes are expressed during embryonic or larval life stages, indicating their importance during development. This genome-wide survey of chemical defense genes in the sea urchin reveals evolutionary conservation of this network combined with lineage-specific diversification that together suggest the importance of these chemical stress sensing and response mechanisms in early deuterostomes. These results should facilitate future studies on the evolution of chemical defense gene networks and the role of these networks in protecting embryos from chemical stress during development. PMID:17097629

  8. Triplex-Induced DNA Damage Response

    PubMed Central

    Rogers, Faye A.; Tiwari, Meetu Kaushik


    Cellular DNA damage response is critical to preserving genomic integrity following exposure to genotoxic stress. A complex series of networks and signaling pathways become activated after DNA damage and trigger the appropriate cellular response, including cell cycle arrest, DNA repair, and apoptosis. The response elicited is dependent upon the type and extent of damage sustained, with the ultimate goal of preventing propagation of the damaged DNA. A major focus of our studies is to determine the cellular pathways involved in processing damage induced by altered helical structures, specifically triplexes. Our lab has demonstrated that the TFIIH factor XPD occupies a central role in triggering apoptosis in response to triplex-induced DNA strand breaks. We have shown that XPD co-localizes with γH2AX, and its presence is required for the phosphorylation of H2AX tyrosine142, which stimulates the signaling pathway to recruit pro-apoptotic factors to the damage site. Herein, we examine the cellular pathways activated in response to triplex formation and discuss our finding that suggests that XPD-dependent apoptosis plays a role in preserving genomic integrity in the presence of excessive structurally induced DNA damage. PMID:24348211

  9. Identification of Chromosomal Shigella flexneri Genes Induced by the Eukaryotic Intracellular Environment

    PubMed Central

    Runyen-Janecky, L. J.; Payne, S. M.


    Upon entry into the eukaryotic cytosol, the facultative intracellular bacterium Shigella flexneri is exposed to an environment that may necessitate the expression of particular genes for it to survive and grow intracellularly. To identify genes that are induced in response to the intracellular environment, we screened a library containing fragments of the S. flexneri chromosome fused to a promoterless green fluorescent protein gene (gfp). Bacteria containing promoter fusions that had a higher level of gfp expression when S. flexneri was intracellular (in Henle cells) than when S. flexneri was extracellular (in Luria-Bertani broth) were isolated by using fluorescence-activated cell sorting. Nine different genes with increased expression in Henle cells were identified. Several genes (uhpT, bioA, and lysA) were involved in metabolic processes. The uhpT gene, which encoded a sugar phosphate transporter, was the most frequently isolated gene and was induced by glucose-6-phosphate in vitro. Two of the intracellularly induced genes (pstS and phoA) encode proteins involved in phosphate acquisition and were induced by phosphate limitation in vitro. Additionally, three iron-regulated genes (sufA, sitA, and fhuA) were identified. The sufA promoter was derepressed in iron-limiting media and was also induced by oxidative stress. To determine whether intracellularly induced genes are required for survival or growth in the intracellular environment, we constructed mutations in the S. flexneri uhpT and pstS genes by allelic exchange. The uhpT mutant could not use glucose-6-phosphate as a sole carbon source in vitro but exhibited normal plaque formation on Henle cell monolayers. The pstS mutant had no apparent growth defect in low-phosphate media in vitro but formed smaller plaques on Henle cell monolayers than the parent strain. Both mutants were as effective as the parent strain in inducing apoptosis in a macrophage cell line. PMID:12117948

  10. A Drosophila immune response against Ras-induced overgrowth

    PubMed Central

    Hauling, Thomas; Krautz, Robert; Markus, Robert; Volkenhoff, Anne; Kucerova, Lucie; Theopold, Ulrich


    ABSTRACT Our goal is to characterize the innate immune response against the early stage of tumor development. For this, animal models where genetic changes in specific cells and tissues can be performed in a controlled way have become increasingly important, including the fruitfly Drosophila melanogaster. Many tumor mutants in Drosophila affect the germline and, as a consequence, also the immune system itself, making it difficult to ascribe their phenotype to a specific tissue. Only during the past decade, mutations have been induced systematically in somatic cells to study the control of tumorous growth by neighboring cells and by immune cells. Here we show that upon ectopic expression of a dominant-active form of the Ras oncogene (RasV12), both imaginal discs and salivary glands are affected. Particularly, the glands increase in size, express metalloproteinases and display apoptotic markers. This leads to a strong cellular response, which has many hallmarks of the granuloma-like encapsulation reaction, usually mounted by the insect against larger foreign objects. RNA sequencing of the fat body reveals a characteristic humoral immune response. In addition we also identify genes that are specifically induced upon expression of RasV12. As a proof-of-principle, we show that one of the induced genes (santa-maria), which encodes a scavenger receptor, modulates damage to the salivary glands. The list of genes we have identified provides a rich source for further functional characterization. Our hope is that this will lead to a better understanding of the earliest stage of innate immune responses against tumors with implications for mammalian immunity. PMID:24659248

  11. Physiological responses induced by pleasant stimuli.


    Watanuki, Shigeki; Kim, Yeon-Kyu


    The specific physiological responses induced by pleasant stimuli were investigated in this study. Various physiological responses of the brain (encephaloelectrogram; EEG), autonomic nervous system (ANS), immune system and endocrine system were monitored when pleasant stimuli such as odors, emotional pictures and rakugo, a typical Japanese comical story-telling, were presented to subjects. The results revealed that (i) EEG activities of the left frontal brain region were enhanced by a pleasant odor; (ii) emotional pictures related to primitive element such as nudes and erotic couples elevated vasomotor sympathetic nervous activity; and (iii) an increase in secretory immunoglobulin A (s-IgA) and a decrease in salivary cortisol (s-cortisol) were induced by rakugo-derived linguistic pleasant emotion. Pleasant emotion is complicated state. However, by considering the evolutionary history of human being, it is possible to assess and evaluate pleasant emotion from certain physiological responses by appropriately summating various physiological parameters. PMID:15684559

  12. Compression loading-induced stress responses in intervertebral disc cells encapsulated in 3D collagen constructs

    PubMed Central

    Chooi, Wai Hon; Chan, Barbara Pui


    Cells protect themselves from stresses through a cellular stress response. In the interverebral disc, such response was also demonstrated to be induced by various environmental stresses. However, whether compression loading will cause cellular stress response in the nucleus pulposus cells (NPCs) is not well studied. By using an in vitro collagen microencapsulation model, we investigated the effect of compression loading on the stress response of NPCs. Cell viability tests, and gene and protein expression experiments were conducted, with primers for the heat shock response (HSR: HSP70, HSF1, HSP27 and HSP90), and unfolded protein response (UPR: GRP78, GRP94, ATF4 and CHOP) genes and an antibody to HSP72. Different gene expression patterns occurred due to loading type throughout experiments. Increasing the loading strain for a short duration did not increase the stress response genes significantly, but over longer durations, HSP70 and HSP27 were upregulated. Longer loading durations also resulted in a continuous upregulation of HSR genes and downregulation of UPR genes, even after load removal. The rate of apoptosis did not increase significantly after loading, suggesting that stress response genes might play a role in cell survival following mechanical stress. These results demonstrate how mechanical stress might induce and control the expression of HSR and UPR genes in NPCs. PMID:27197886

  13. Compression loading-induced stress responses in intervertebral disc cells encapsulated in 3D collagen constructs.


    Chooi, Wai Hon; Chan, Barbara Pui


    Cells protect themselves from stresses through a cellular stress response. In the interverebral disc, such response was also demonstrated to be induced by various environmental stresses. However, whether compression loading will cause cellular stress response in the nucleus pulposus cells (NPCs) is not well studied. By using an in vitro collagen microencapsulation model, we investigated the effect of compression loading on the stress response of NPCs. Cell viability tests, and gene and protein expression experiments were conducted, with primers for the heat shock response (HSR: HSP70, HSF1, HSP27 and HSP90), and unfolded protein response (UPR: GRP78, GRP94, ATF4 and CHOP) genes and an antibody to HSP72. Different gene expression patterns occurred due to loading type throughout experiments. Increasing the loading strain for a short duration did not increase the stress response genes significantly, but over longer durations, HSP70 and HSP27 were upregulated. Longer loading durations also resulted in a continuous upregulation of HSR genes and downregulation of UPR genes, even after load removal. The rate of apoptosis did not increase significantly after loading, suggesting that stress response genes might play a role in cell survival following mechanical stress. These results demonstrate how mechanical stress might induce and control the expression of HSR and UPR genes in NPCs. PMID:27197886

  14. [Identification of Sorghum genes responsible for resistance to Green bug].


    Radchenko, E E


    Genes responsible for resistance to greenbug (Schizaphis graminum Rond.) were identified in sorghum. The dominant (Sgr1) and recessive (Sgr2) genes for resistance were revealed in sample k-457 (PI264453, United States). The samples i-589430 (PI264453, Spain) and k-3852 (Sarvasi, Hungary) carry gene Sgr1. These accessions are assumed to also have gene Sgr2. The samples k-9921 (Shallu, United States) and k-9922 (KS-30, United States) have incompletely dominant resistance gene Sgr3. A symbol Sgr4 was assigned to the dominant gene from sample k-6694 (Deer, United States). The dominant Sgr5 and recessive Sgr6 genes were revealed in the samples k-1362 (Durra Belaya, Syria) and k-1240 (Dzhugara Belaya, China). The cultivar Sorgogradskoe (k-9436, Rostovskaya oblast) has gene Sgr5. The samples k-10092 (Odesskii 360, Ukraine) and k-5091 (Cherhata, Marocco) are assumed to have genes Sgr5 and Sgr6. Sample k-924 (Dzhugara Belaya, China) is protected by the dominant gene Srg7 and recessive gene Sgr8. Sample k-923 (Dzhugara Belaya, China) has at least one of these genes. Two dominant complementary genes for resistance (Sgr9 and Sgr10) were revealed in sample k-930 (Dzhugara Belaya, China). One of two dominant genes of sample k-1237 (Dzhugara Belaya, China) was assigned the symbol Sgr11. Genes Sgr5-Sgr11 responsible for resistance to greenbug are new and were not previously used in breeding. PMID:10822813

  15. Co-expression of soybean Dicer-like genes in response to stress and development.


    Curtin, Shaun J; Kantar, Michael B; Yoon, Han W; Whaley, Adam M; Schlueter, Jessica A; Stupar, Robert M


    Regulation of gene transcription and post-transcriptional processes is critical for proper development, genome integrity, and stress responses in plants. Many genes involved in the key processes of transcriptional and post-transcriptional regulation have been well studied in model diploid organisms. However, gene and genome duplication may alter the function of the genes involved in these processes. To address this question, we assayed the stress-induced transcription patterns of duplicated gene pairs involved in RNAi and DNA methylation processes in the paleopolyploid soybean. Real-time quantitative PCR and Sequenom MassARRAY expression assays were used to profile the relative expression ratios of eight gene pairs across eight different biotic and abiotic stress conditions. The transcriptional responses to stress for genes involved in DNA methylation, RNAi processing, and miRNA processing were compared. The strongest evidence for pairwise co-expression in response to stresses was exhibited by non-paralogous Dicer-like (DCL) genes GmDCL2a-GmDCL3a and GmDCL1b-GmDCL2b, most profoundly in root tissues. Among homoeologous or paralogous DCL genes, the Dicer-like 2 (DCL2) gene pair exhibited the strongest response to stress and most conserved co-expression pattern. This was surprising because the DCL2 duplication event is more ancient than the other DCL duplications. Possible mechanisms that may be driving the DCL2 co-expression are discussed. PMID:22527487

  16. Spatial Control of Gene Expression within a Scaffold by Localized Inducer Release

    PubMed Central

    Baraniak, Priya R.; Nelson, Devin M.; Leeson, Cory E.; Katakam, Anand K.; Friz, Jennifer L.; Cress, Dean E.; Hong, Yi; Guan, Jianjun; Wagner, William R.


    Gene expression can be controlled in genetically modified cells by employing an inducer/promoter system where presence of the inducer molecule regulates the timing and level of gene expression. By applying the principles of controlled release, it should be possible to control gene expression on a biomaterial surface by the presence or absence of inducer release from the underlying material matrix, thus avoiding alternative techniques that rely upon uptake of relatively labile DNA from material surfaces. To evaluate this concept, a modified ecdysone-responsive gene expression system was transfected into B16 murine cells and the ability of an inducer ligand, which was released from elastomeric poly(ester urethane) urea (PEUU), to initiate gene expression was studied. The synthetic inducer ligand was first loaded into PEUU to demonstrate extended release of the bioactive molecule at various loading densities over a one year period in vitro. Patterning films of PEUU variably-loaded with inducer resulted in spatially controlled cell expression of the gene product (green fluorescent protein, GFP). In porous scaffolds made from PEUU by salt leaching, where the central region was exclusively loaded with inducer, cells expressed GFP predominately in the loaded central regions whereas expression was minimal in outer regions where ligand was omitted. This scaffold system may ultimately provide a means to precisely control progenitor cell commitment in a spatially-defined manner in vivo for soft tissue repair and regeneration. PMID:21269687

  17. TNFα signals through specialized factories where responsive coding and miRNA genes are transcribed

    PubMed Central

    Papantonis, Argyris; Kohro, Takahide; Baboo, Sabyasachi; Larkin, Joshua D; Deng, Binwei; Short, Patrick; Tsutsumi, Shuichi; Taylor, Stephen; Kanki, Yasuharu; Kobayashi, Mika; Li, Guoliang; Poh, Huay-Mei; Ruan, Xiaoan; Aburatani, Hiroyuki; Ruan, Yijun; Kodama, Tatsuhiko; Wada, Youichiro; Cook, Peter R


    Tumour necrosis factor alpha (TNFα) is a potent cytokine that signals through nuclear factor kappa B (NFκB) to activate a subset of human genes. It is usually assumed that this involves RNA polymerases transcribing responsive genes wherever they might be in the nucleus. Using primary human endothelial cells, variants of chromosome conformation capture (including 4C and chromatin interaction analysis with paired-end tag sequencing), and fluorescence in situ hybridization to detect single nascent transcripts, we show that TNFα induces responsive genes to congregate in discrete ‘NFκB factories'. Some factories further specialize in transcribing responsive genes encoding micro-RNAs that target downregulated mRNAs. We expect all signalling pathways to contain this extra leg, where responding genes are transcribed in analogous specialized factories. PMID:23103767

  18. Insect and wound induced GUS gene expression from a Beta vulgaris proteinase inhibitor gene promoter

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Inducible gene promoters that are specifically activated by pathogen invasion or insect pest attack are needed for effective expression of resistance genes to control plant diseases. In the present study, a promoter from a serine proteinase inhibitor gene (BvSTI) shown to be up-regulated in resist...

  19. Regulation of endogenous human gene expression by ligand-inducible TALE transcription factors.


    Mercer, Andrew C; Gaj, Thomas; Sirk, Shannon J; Lamb, Brian M; Barbas, Carlos F


    The construction of increasingly sophisticated synthetic biological circuits is dependent on the development of extensible tools capable of providing specific control of gene expression in eukaryotic cells. Here, we describe a new class of synthetic transcription factors that activate gene expression in response to extracellular chemical stimuli. These inducible activators consist of customizable transcription activator-like effector (TALE) proteins combined with steroid hormone receptor ligand-binding domains. We demonstrate that these ligand-responsive TALE transcription factors allow for tunable and conditional control of gene activation and can be used to regulate the expression of endogenous genes in human cells. Since TALEs can be designed to recognize any contiguous DNA sequence, the conditional gene regulatory system described herein will enable the design of advanced synthetic gene networks. PMID:24251925

  20. Thermally induced osteocyte damage initiates pro-osteoclastogenic gene expression in vivo.


    Dolan, Eimear B; Tallon, David; Cheung, Wing-Yee; Schaffler, Mitchell B; Kennedy, Oran D; McNamara, Laoise M


    Bone is often subject to harsh temperatures during orthopaedic procedures resulting in thermally induced bone damage, which may affect the healing response. Postsurgical healing of bone is essential to the success of surgery, therefore, an understanding of the thermally induced responses of bone cells to clinically relevant temperatures in vivo is required. Osteocytes have been shown to be integrally involved in the bone remodelling cascade, via apoptosis, in micro-damage systems. However, it is unknown whether this relationship is similar following thermal damage. Sprague-Dawley rat tibia were exposed to clinically relevant temperatures (47°C or 60°C) to investigate the role of osteocytes in modulating remodelling related factors. Immunohistochemistry was used to quantify osteocyte thermal damage (activated caspase-3). Thermally induced pro-osteoclastogenic genes (Rankl, Opg and M-csf), in addition to genes known to mediate osteoblast and osteoclast differentiation via prostaglandin production (Cox2), vascularization (Vegf) and inflammatory (Il1a) responses, were investigated using gene expression analysis. The results demonstrate that heat-treatment induced significant bone tissue and cellular damage. Pro-osteoclastogenic genes were upregulated depending on the amount of temperature elevation compared with the control. Taken together, the results of this study demonstrate the in vivo effect of thermally induced osteocyte damage on the gene expression profile. PMID:27335224

  1. Cigarette Smoke Modulates Expression of Human Rhinovirus-Induced Airway Epithelial Host Defense Genes

    PubMed Central

    Proud, David; Hudy, Magdalena H.; Wiehler, Shahina; Zaheer, Raza S.; Amin, Minaa A.; Pelikan, Jonathan B.; Tacon, Claire E.; Tonsaker, Tabitha O.; Walker, Brandie L.; Kooi, Cora; Traves, Suzanne L.; Leigh, Richard


    Human rhinovirus (HRV) infections trigger acute exacerbations of chronic obstructive pulmonary disease (COPD) and asthma. The human airway epithelial cell is the primary site of HRV infection and responds to infection with altered expression of multiple genes, the products of which could regulate the outcome to infection. Cigarette smoking aggravates asthma symptoms, and is also the predominant risk factor for the development and progression of COPD. We, therefore, examined whether cigarette smoke extract (CSE) modulates viral responses by altering HRV-induced epithelial gene expression. Primary cultures of human bronchial epithelial cells were exposed to medium alone, CSE alone, purified HRV-16 alone or to HRV-16+ CSE. After 24 h, supernatants were collected and total cellular RNA was isolated. Gene array analysis was performed to examine mRNA expression. Additional experiments, using real-time RT-PCR, ELISA and/or western blotting, validated altered expression of selected gene products. CSE and HRV-16 each induced groups of genes that were largely independent of each other. When compared to gene expression in response to CSE alone, cells treated with HRV+CSE showed no obvious differences in CSE-induced gene expression. By contrast, compared to gene induction in response to HRV-16 alone, cells exposed to HRV+CSE showed marked suppression of expression of a number of HRV-induced genes associated with various functions, including antiviral defenses, inflammation, viral signaling and airway remodeling. These changes were not associated with altered expression of type I or type III interferons. Thus, CSE alters epithelial responses to HRV infection in a manner that may negatively impact antiviral and host defense outcomes. PMID:22808255

  2. Requirement for metabolic activation of acetylaminofluorene to induce multidrug gene expression.

    PubMed Central

    Gant, T W; Schrenk, D; Silverman, J A; Thorgeirsson, S S


    Previously we have demonstrated that several xenobiotics can induce multidrug (mdr) gene expression in cultures of primary isolated hepatocytes. One of the best of these xenobiotic inducers in rat hepatocytes is 2-acetylaminofluorene (2-AAF), which induces mdr expression by an enhancement of mdr gene transcription. In all species studied to date, AAF is extensively and variously metabolized. In this study we have sought to determine if AAF per se or a metabolite is responsible for mediating the increase in mdr gene transcription and expression. This study demonstrates that AAF per se is not active, but that the effect of AAF we have observed on mdr gene transcription and expression in the rat is due to the formation of a reactive metabolite(s). Our data indicate that this reactive metabolite is probably N-acetoxy-2-aminofluorene or the sulfate ester of N-hydroxy-AAF. The requirement for the formation of one of these metabolites may explain the differences in species response to AAF, in terms of mdr gene expression, that we have observed. We hypothesize that the mechanism by which mdr gene transcription is increased in response to AAF involves a covalent interaction between a reactive metabolite and an mdr gene regulatory protein. Our current work is concerned with the exploration of this hypothesis. PMID:7889850

  3. Silver nanoparticles induce endoplasmatic reticulum stress response in zebrafish

    SciTech Connect

    Christen, Verena; Capelle, Martinus; Fent, Karl


    Silver nanoparticles (AgNPs) find increasing applications, and therefore humans and the environment are increasingly exposed to them. However, potential toxicological implications are not sufficiently known. Here we investigate effects of AgNPs (average size 120 nm) on zebrafish in vitro and in vivo, and compare them to human hepatoma cells (Huh7). AgNPs are incorporated in zebrafish liver cells (ZFL) and Huh7, and in zebrafish embryos. In ZFL cells AgNPs lead to induction of reactive oxygen species (ROS), endoplasmatic reticulum (ER) stress response, and TNF-α. Transcriptional alterations also occur in pro-apoptotic genes p53 and Bax. The transcriptional profile differed in ZFL and Huh7 cells. In ZFL cells, the ER stress marker BiP is induced, concomitant with the ER stress marker ATF-6 and spliced XBP-1 after 6 h and 24 h exposure to 0.5 g/L and 0.05 g/L AgNPs, respectively. This indicates the induction of different pathways of the ER stress response. Moreover, AgNPs induce TNF-α. In zebrafish embryos exposed to 0.01, 0.1, 1 and 5 mg/L AgNPs hatching was affected and morphological defects occurred at high concentrations. ER stress related gene transcripts BiP and Synv are significantly up-regulated after 24 h at 0.1 and 5 mg/L AgNPs. Furthermore, transcriptional alterations occurred in the pro-apoptotic genes Noxa and p21. The ER stress response was strong in ZFL cells and occurred in zebrafish embryos as well. Our data demonstrate for the first time that AgNPs lead to induction of ER stress in zebrafish. The induction of ER stress can have several consequences including the activation of apoptotic and inflammatory pathways. - Highlights: • Effects of silver nanoparticles (120 nm AgNPs) are investigated in zebrafish. • AgNPs induce all ER stress reponses in vitro in zebrafish liver cells. • AgNPs induce weak ER stress in zebrafish embryos. • AgNPs induce oxidative stress and transcripts of pro-apoptosis genes.

  4. Bioinformatics Analysis of Estrogen-Responsive Genes.


    Handel, Adam E


    Estrogen is a steroid hormone that plays critical roles in a myriad of intracellular pathways. The expression of many genes is regulated through the steroid hormone receptors ESR1 and ESR2. These bind to DNA and modulate the expression of target genes. Identification of estrogen target genes is greatly facilitated by the use of transcriptomic methods, such as RNA-seq and expression microarrays, and chromatin immunoprecipitation with massively parallel sequencing (ChIP-seq). Combining transcriptomic and ChIP-seq data enables a distinction to be drawn between direct and indirect estrogen target genes. This chapter discusses some methods of identifying estrogen target genes that do not require any expertise in programming languages or complex bioinformatics. PMID:26585125

  5. DNA array analysis of gene expression in response to UV irradiation in Escherichia coli.


    Quillardet, Philippe; Rouffaud, Marie-Ange; Bouige, Philippe


    The capacity of DNA macroarrays that contain all 4290 predicted open reading frames of the E. coli K12 genome was evaluated by measuring changes in gene expression in response to irradiation by ultraviolet light (UV). UV and other DNA damaging agents are known to trigger the induction of the SOS response. This is a coordinated increase in the level of expression of a set of approximately 30 unlinked genes, the SOS genes, negatively regulated by the LexA repressor. The analysis was performed on a set of isogenic strains with mutations that affect expression of genes of the SOS system: (i) the lexA+ strain, in which the SOS system can be induced after DNA damage, (ii) lexAind- mutants in which the SOS system cannot be induced, and (iii) lexAdef mutants in which the SOS system is induced constitutively. We found that a large set of genes appeared to be either upregulated or downregulated following UV irradiation. Among the genes which appeared to be upregulated in a LexA-dependent manner, we correctly identified 9 out of 27 SOS genes printed on the arrays and one gene containing a LexA binding site. One gene, dnaN, encoding the beta subunit of DNA polymerase III holoenzyme, was identified as an upregulated gene in a LexA-independent manner. Our results were compared to those of similar studies previously published. Although the SOS response as a whole could not be illustrated by using DNA arrays, the data suggest that regulation of some SOS genes might be more complex than previously thought. PMID:14527657

  6. Identification of the Regulator Gene Responsible for the Acetone-Responsive Expression of the Binuclear Iron Monooxygenase Gene Cluster in Mycobacteria ▿

    PubMed Central

    Furuya, Toshiki; Hirose, Satomi; Semba, Hisashi; Kino, Kuniki


    The mimABCD gene cluster encodes the binuclear iron monooxygenase that oxidizes propane and phenol in Mycobacterium smegmatis strain MC2 155 and Mycobacterium goodii strain 12523. Interestingly, expression of the mimABCD gene cluster is induced by acetone. In this study, we investigated the regulator gene responsible for this acetone-responsive expression. In the genome sequence of M. smegmatis strain MC2 155, the mimABCD gene cluster is preceded by a gene designated mimR, which is divergently transcribed. Sequence analysis revealed that MimR exhibits amino acid similarity with the NtrC family of transcriptional activators, including AcxR and AcoR, which are involved in acetone and acetoin metabolism, respectively. Unexpectedly, many homologs of the mimR gene were also found in the sequenced genomes of actinomycetes. A plasmid carrying a transcriptional fusion of the intergenic region between the mimR and mimA genes with a promoterless green fluorescent protein (GFP) gene was constructed and introduced into M. smegmatis strain MC2 155. Using a GFP reporter system, we confirmed by deletion and complementation analyses that the mimR gene product is the positive regulator of the mimABCD gene cluster expression that is responsive to acetone. M. goodii strain 12523 also utilized the same regulatory system as M. smegmatis strain MC2 155. Although transcriptional activators of the NtrC family generally control transcription using the σ54 factor, a gene encoding the σ54 factor was absent from the genome sequence of M. smegmatis strain MC2 155. These results suggest the presence of a novel regulatory system in actinomycetes, including mycobacteria. PMID:21856847

  7. Regulation of the human stress response gene GADD153 expression: role of ETS1 and FLI-1 gene products.


    Seth, A; Giunta, S; Franceschil, C; Kola, I; Venanzoni, M C


    We have previously shown that ETS transcription factors, regulate cell growth and differentiation, and ETS1 and ETS2 are able to transcriptionally regulate wt p53 gene expression. In the present study we show that the ETS transcription factors also play a role in regulating expression of GADD153, a wt p53 inducible gene, which induces growth arrest and apoptosis in response to stress signals or DNA damage. We report the presence of a single EBS in the human GADD153 promoter, and that the GADD45 gene promoter lacks EBSs. The GADD153 promoter EBS shows a very high affinity for ETS1 and FLI-1 gene products. In addition, our data show that both ETS1 and FLI-1 strongly activate transcription of the GADD153 EBS linked to the CAT reporter gene. Our results also demonstrate how ETS1 and FLI-1 specifically regulate GADD153 expression. In addition, ectopic ETS2 protein expression resulted in only a weak induction of the same CAT reporter construct. The ETS1 and FLI-1 proteins provide a novel mechanism of activation for GADD153, allowing these two ETS genes to control its expression during cell growth and differentiation, rather than in response to oxidative stress. PMID:10510472

  8. Inducible and combinatorial gene manipulation in mouse brain

    PubMed Central

    Dogbevia, Godwin K.; Marticorena-Alvarez, Ricardo; Bausen, Melanie; Sprengel, Rolf; Hasan, Mazahir T.


    We have deployed recombinant adeno-associated viruses equipped with tetracycline-controlled genetic switches to manipulate gene expression in mouse brain. Here, we show a combinatorial genetic approach for inducible, cell type-specific gene expression and Cre/loxP mediated gene recombination in different brain regions. Our chemical-genetic approach will help to investigate ‘when’, ‘where’, and ‘how’ gene(s) control neuronal circuit dynamics, and organize, for example, sensory signal processing, learning and memory, and behavior. PMID:25954155


    EPA Science Inventory

    Background: The Mycobacterium avium Complex (MAC) includes the species M. avium (MA), M. intracellulare (MI), and possibly others. Organisms belonging to the MAC are phylogenetically closely related, opportunistic pathogens. The macrophage inducing gene (mig) is the only well-des...

  10. Global Gene-Expression Analysis to Identify Differentially Expressed Genes Critical for the Heat Stress Response in Brassica rapa.


    Dong, Xiangshu; Yi, Hankuil; Lee, Jeongyeo; Nou, Ill-Sup; Han, Ching-Tack; Hur, Yoonkang


    Genome-wide dissection of the heat stress response (HSR) is necessary to overcome problems in crop production caused by global warming. To identify HSR genes, we profiled gene expression in two Chinese cabbage inbred lines with different thermotolerances, Chiifu and Kenshin. Many genes exhibited >2-fold changes in expression upon exposure to 0.5- 4 h at 45°C (high temperature, HT): 5.2% (2,142 genes) in Chiifu and 3.7% (1,535 genes) in Kenshin. The most enriched GO (Gene Ontology) items included 'response to heat', 'response to reactive oxygen species (ROS)', 'response to temperature stimulus', 'response to abiotic stimulus', and 'MAPKKK cascade'. In both lines, the genes most highly induced by HT encoded small heat shock proteins (Hsps) and heat shock factor (Hsf)-like proteins such as HsfB2A (Bra029292), whereas high-molecular weight Hsps were constitutively expressed. Other upstream HSR components were also up-regulated: ROS-scavenging genes like glutathione peroxidase 2 (BrGPX2, Bra022853), protein kinases, and phosphatases. Among heat stress (HS) marker genes in Arabidopsis, only exportin 1A (XPO1A) (Bra008580, Bra006382) can be applied to B. rapa for basal thermotolerance (BT) and short-term acquired thermotolerance (SAT) gene. CYP707A3 (Bra025083, Bra021965), which is involved in the dehydration response in Arabidopsis, was associated with membrane leakage in both lines following HS. Although many transcription factors (TF) genes, including DREB2A (Bra005852), were involved in HS tolerance in both lines, Bra024224 (MYB41) and Bra021735 (a bZIP/AIR1 [Anthocyanin-Impaired-Response-1]) were specific to Kenshin. Several candidate TFs involved in thermotolerance were confirmed as HSR genes by real-time PCR, and these assignments were further supported by promoter analysis. Although some of our findings are similar to those obtained using other plant species, clear differences in Brassica rapa reveal a distinct HSR in this species. Our data could also provide a

  11. Global Gene-Expression Analysis to Identify Differentially Expressed Genes Critical for the Heat Stress Response in Brassica rapa

    PubMed Central

    Dong, Xiangshu; Yi, Hankuil; Lee, Jeongyeo; Nou, Ill-Sup; Han, Ching-Tack; Hur, Yoonkang


    Genome-wide dissection of the heat stress response (HSR) is necessary to overcome problems in crop production caused by global warming. To identify HSR genes, we profiled gene expression in two Chinese cabbage inbred lines with different thermotolerances, Chiifu and Kenshin. Many genes exhibited >2-fold changes in expression upon exposure to 0.5– 4 h at 45°C (high temperature, HT): 5.2% (2,142 genes) in Chiifu and 3.7% (1,535 genes) in Kenshin. The most enriched GO (Gene Ontology) items included ‘response to heat’, ‘response to reactive oxygen species (ROS)’, ‘response to temperature stimulus’, ‘response to abiotic stimulus’, and ‘MAPKKK cascade’. In both lines, the genes most highly induced by HT encoded small heat shock proteins (Hsps) and heat shock factor (Hsf)-like proteins such as HsfB2A (Bra029292), whereas high-molecular weight Hsps were constitutively expressed. Other upstream HSR components were also up-regulated: ROS-scavenging genes like glutathione peroxidase 2 (BrGPX2, Bra022853), protein kinases, and phosphatases. Among heat stress (HS) marker genes in Arabidopsis, only exportin 1A (XPO1A) (Bra008580, Bra006382) can be applied to B. rapa for basal thermotolerance (BT) and short-term acquired thermotolerance (SAT) gene. CYP707A3 (Bra025083, Bra021965), which is involved in the dehydration response in Arabidopsis, was associated with membrane leakage in both lines following HS. Although many transcription factors (TF) genes, including DREB2A (Bra005852), were involved in HS tolerance in both lines, Bra024224 (MYB41) and Bra021735 (a bZIP/AIR1 [Anthocyanin-Impaired-Response-1]) were specific to Kenshin. Several candidate TFs involved in thermotolerance were confirmed as HSR genes by real-time PCR, and these assignments were further supported by promoter analysis. Although some of our findings are similar to those obtained using other plant species, clear differences in Brassica rapa reveal a distinct HSR in this species. Our data

  12. Probiotic bacteria change Escherichia coli-induced gene expression in cultured colonocytes: Implications in intestinal pathophysiology

    PubMed Central

    Panigrahi, Pinaki; Braileanu, Gheorghe T; Chen, Hegang; Stine, O Colin


    AIM: To investigate the change in eukaryotic gene expression profile in Caco-2 cells after infection with strains of Escherichia coli and commensal probiotic bacteria. METHODS: A 19200 gene/expressed sequence tag gene chip was used to examine expression of genes after infection of Caco-2 cells with strains of normal flora E. coli, Lactobacillus plantarum, and a combination of the two. RESULTS: The cDNA microarray revealed up-regulation of 155 and down-regulation of 177 genes by E. coli. L. plantarum up-regulated 45 and down-regulated 36 genes. During mixed infection, 27 genes were up-regulated and 59 were down-regulated, with nullification of stimulatory/inhibitory effects on most of the genes. Expression of several new genes was noted in this group. CONCLUSION: The commensal bacterial strains used in this study induced the expression of a large number of genes in colonocyte-like cultured cells and changed the expression of several genes involved in important cellular processes such as regulation of transcription, protein biosynthesis, metabolism, cell adhesion, ubiquitination, and apoptosis. Such changes induced by the presence of probiotic bacteria may shape the physiologic and pathologic responses they trigger in the host. PMID:18081226

  13. Involvement of Reactive Oxygen Species, Glutathione Metabolism, and Lipid Peroxidation in the Cf-Gene-Dependent Defense Response of Tomato Cotyledons Induced by Race-Specific Elicitors of Cladosporium fulvum.

    PubMed Central

    May, M. J.; Hammond-Kosack, K. E.; Jones, JDG.


    The chronological order of responses to Cladosporium fulvum (Cooke) (Cf) race-specific elicitors was assessed in cotyledons of three near-isogenic tomato (Lycopersicon esculentum Mill.) lines carrying either Cf-9 or Cf-2 or no Cf gene. The responses observed were dependent on the presence of a Cf gene, Avr-gene product dose injected, and the relative humidity (RH) of the growth chamber. At ambient RH, superoxide formation and lipid peroxidation occurred after 2 h (Cf9) and 4 h (Cf2). At elevated RH (98%) and at lower avirulence elicitor dose, Cf-Avr-dependent lipid peroxidation was considerably attenuated. Significant electrolyte leakage occurred by 18 h but only at the lower RH. Total glutathione levels began to increase 2 to 4 h and 4 to 8 h after challenge of Cf9 and Cf2 cells, respectively, and by 48 h reached 665 and 570% of initial levels. A large proportion of this accumulation (87%) was as oxidized glutathione. When the RH was increased to 98%, increases in glutathione levels were strongly attenuated. Increased lipoxygenase enzyme activity was detected 8 h postchallenge in either incompatible interaction. These results indicate that the activation of the Cf-Avr-mediated defense response results in severe oxidative stress. PMID:12226267

  14. Identification of novel light-induced genes in the suprachiasmatic nucleus

    PubMed Central

    Porterfield, Veronica M; Piontkivska, Helen; Mintz, Eric M


    Background The transmission of information about the photic environment to the circadian clock involves a complex array of neurotransmitters, receptors, and second messenger systems. Exposure of an animal to light during the subjective night initiates rapid transcription of a number of immediate-early genes in the suprachiasmatic nucleus of the hypothalamus. Some of these genes have known roles in entraining the circadian clock, while others have unknown functions. Using laser capture microscopy, microarray analysis, and quantitative real-time PCR, we performed a comprehensive screen for changes in gene expression immediately following a 30 minute light pulse in suprachiasmatic nucleus of mice. Results The results of the microarray screen successfully identified previously known light-induced genes as well as several novel genes that may be important in the circadian clock. Newly identified light-induced genes include early growth response 2, proviral integration site 3, growth-arrest and DNA-damage-inducible 45 beta, and TCDD-inducible poly(ADP-ribose) polymerase. Comparative analysis of promoter sequences revealed the presence of evolutionarily conserved CRE and associated TATA box elements in most of the light-induced genes, while other core clock genes generally lack this combination of promoter elements. Conclusion The photic signalling cascade in the suprachiasmatic nucleus activates an array of immediate-early genes, most of which have unknown functions in the circadian clock. Detected evolutionary conservation of CRE and TATA box elements in promoters of light-induced genes suggest that the functional role of these elements has likely remained the same over evolutionary time across mammalian orders. PMID:18021443

  15. The cytoskeleton enhances gene expression in the response to the Harpin elicitor in grapevine

    PubMed Central

    Qiao, Fei; Chang, Xiao-Li; Nick, Peter


    The cytoskeleton undergoes dramatic reorganization during plant defence. This response is generally interpreted as part of the cellular repolarization establishing physical barriers against the invading pathogen. To gain insight into the functional significance of cytoskeletal responses for defence, two Vitis cell cultures that differ in their microtubular dynamics were used, and the cytoskeletal response to the elicitor Harpin in parallel to alkalinization of the medium as a fast response, and the activation of defence-related genes were followed. In one cell line derived from the grapevine cultivar ‘Pinot Noir’, microtubules contained mostly tyrosinylated α-tubulin, indicating high microtubular turnover, whereas in another cell line derived from the wild grapevine V. rupestris, the α-tubulin was strongly detyrosinated, indicating low microtubular turnover. The cortical microtubules were disrupted and actin filaments were bundled in both cell lines, but the responses were elevated in V. rupestris as compared with V. vinifera cv. ‘Pinot Noir’. The cytoskeletal responsiveness correlated with elicitor-induced alkalinization and the expression of defence genes. Using resveratrol synthase and stilbene synthase as examples, it could be shown that pharmacological manipulation of microtubules could induce gene expression in the absence of elicitor. These findings are discussed with respect to a role for microtubules as positive regulators of defence-induced gene expression. PMID:20675535

  16. Validation of a set of reference genes to study response to herbicide stress in grasses

    PubMed Central


    Background Non-target-site based resistance to herbicides is a major threat to the chemical control of agronomically noxious weeds. This adaptive trait is endowed by differences in the expression of a number of genes in plants that are resistant or sensitive to herbicides. Quantification of the expression of such genes requires normalising qPCR data using reference genes with stable expression in the system studied as internal standards. The aim of this study was to validate reference genes in Alopecurus myosuroides, a grass (Poaceae) weed of economic and agronomic importance with no genomic resources. Results The stability of 11 candidate reference genes was assessed in plants resistant or sensitive to herbicides subjected or not to herbicide stress using the complementary statistical methods implemented by NormFinder, BestKeeper and geNorm. Ubiquitin, beta-tubulin and glyceraldehyde-3-phosphate dehydrogenase were identified as the best reference genes. The reference gene set accuracy was confirmed by analysing the expression of the gene encoding acetyl-coenzyme A carboxylase, a major herbicide target enzyme, and of an herbicide-induced gene encoding a glutathione-S-transferase. Conclusions This is the first study describing a set of reference genes (ubiquitin, beta-tubulin and glyceraldehyde-3-phosphate dehydrogenase) with a stable expression under herbicide stress in grasses. These genes are also candidate reference genes of choice for studies seeking to identify stress-responsive genes in grasses. PMID:22233533

  17. Virus-induced gene silencing (VIGS) in barley seedling leaves

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Virus-induced gene silencing (VIGS) is one of the most potent reverse genetics technologies for gene functional characterization. This method exploits a dsRNA-mediated antiviral defense mechanism in plants. Using this method allows researchers to generate rapid phenotypic data in a relatively rapid ...

  18. Tomato Whole Genome Transcriptional Response to Tetranychus urticae Identifies Divergence of Spider Mite-Induced Responses Between Tomato and Arabidopsis.


    Martel, Catherine; Zhurov, Vladimir; Navarro, Marie; Martinez, Manuel; Cazaux, Marc; Auger, Philippe; Migeon, Alain; Santamaria, M Estrella; Wybouw, Nicky; Diaz, Isabel; Van Leeuwen, Thomas; Navajas, Maria; Grbic, Miodrag; Grbic, Vojislava


    The two-spotted spider mite Tetranychus urticae is one of the most significant mite pests in agriculture, feeding on more than 1,100 plant hosts, including model plants Arabidopsis thaliana and tomato, Solanum lycopersicum. Here, we describe timecourse tomato transcriptional responses to spider mite feeding and compare them with Arabidopsis in order to determine conserved and divergent defense responses to this pest. To refine the involvement of jasmonic acid (JA) in mite-induced responses and to improve tomato Gene Ontology annotations, we analyzed transcriptional changes in the tomato JA-signaling mutant defenseless1 (def-1) upon JA treatment and spider mite herbivory. Overlay of differentially expressed genes (DEG) identified in def-1 onto those from the timecourse experiment established that JA controls expression of the majority of genes differentially regulated by herbivory. Comparison of defense responses between tomato and Arabidopsis highlighted 96 orthologous genes (of 2,133 DEG) that were recruited for defense against spider mites in both species. These genes, involved in biosynthesis of JA, phenylpropanoids, flavonoids, and terpenoids, represent the conserved core of induced defenses. The remaining tomato DEG support the establishment of tomato-specific defenses, indicating profound divergence of spider mite-induced responses between tomato and Arabidopsis. PMID:25679539

  19. Chromium stress response effect on signal transduction and expression of signaling genes in rice.


    Trinh, Ngoc-Nam; Huang, Tsai-Lien; Chi, Wen-Chang; Fu, Shih-Feng; Chen, Chi-Chien; Huang, Hao-Jen


    Hexavalent chromium [Cr(VI)] is a non-essential metal for normal plants and is toxic to plants at high concentrations. However, signaling pathways and molecular mechanisms of its action on cell function and gene expression remain elusive. In this study, we found that Cr(VI) induced endogenous reactive oxygen species (ROS) generation and Ca(2+) accumulation and activated NADPH oxidase and calcium-dependent protein kinase. We investigated global transcriptional changes in rice roots by microarray analysis. Gene expression profiling indicated activation of abscisic acid-, ethylene- and jasmonic acid-mediated signaling and inactivation of gibberellic acid-related pathways in Cr(VI) stress-treated rice roots. Genes encoding signaling components such as the protein kinases domain of unknown function 26, receptor-like cytoplasmic kinase, LRK10-like kinase type 2 and protein phosphatase 2C, as well as transcription factors WRKY and apetala2/ethylene response factor were predominant during Cr(VI) stress. Genes involved in vesicle trafficking were subjected to functional characterization. Pretreating rice roots with a vesicle trafficking inhibitor, brefeldin A, effectively reduced Cr(VI)-induced ROS production. Suppression of the vesicle trafficking gene, Exo70, by virus-induced gene silencing strategies revealed that vesicle trafficking is required for mediation of Cr(VI)-induced ROS production. Taken together, these findings shed light on the molecular mechanisms in signaling pathways and transcriptional regulation in response to Cr stress in plants. PMID:24033343

  20. HOS1, a genetic locus involved in cold-responsive gene expression in arabidopsis.

    PubMed Central

    Ishitani, M; Xiong, L; Lee, H; Stevenson, B; Zhu, J K


    Low-temperature stress induces the expression of a variety of genes in plants. However, the signal transduction pathway(s) that activates gene expression under cold stress is poorly understood. Mutants defective in cold signaling should facilitate molecular analysis of plant responses to low temperature and eventually lead to the identification and cloning of a cold stress receptor(s) and intracellular signaling components. In this study, we characterize a plant mutant affected in its response to low temperatures. The Arabidopsis hos1-1 mutation identified by luciferase imaging causes superinduction of cold-responsive genes, such as RD29A, COR47, COR15A, KIN1, and ADH. Although these genes are also induced by abscisic acid, high salt, or polyethylene glycol in addition to cold, the hos1-1 mutation only enhances their expression under cold stress. Genetic analysis revealed that hos1-1 is a single recessive mutation in a nuclear gene. Our studies using the firefly luciferase reporter gene under the control of the cold-responsive RD29A promoter have indicated that cold-responsive genes can be induced by temperatures as high as 19 degrees C in hos1-1 plants. In contrast, wild-type plants do not express the luciferase reporter at 10 degrees C or higher. Compared with the wild type, hos1-1 plants are l ess cold hardy. Nonetheless, after 2 days of cold acclimation, hos1-1 plants acquired the same degree of freezing tolerance as did the wild type. The hos1-1 plants flowered earlier than did the wild-type plants and appeared constitutively vernalized. Taken together, our findings show that the HOS1 locus is an important negative regulator of cold signal transduction in plant cells and that it plays critical roles in controlling gene expression under cold stress, freezing tolerance, and flowering time. PMID:9668134

  1. Global gene expression response to telomerase in bovine adrenocortical cells

    SciTech Connect

    Perrault, Steven D.; Hornsby, Peter J.; Betts, Dean H. . E-mail:


    The infinite proliferative capability of most immortalized cells is dependent upon the presence of the enzyme telomerase and its ability to maintain telomere length and structure. However, telomerase may be involved in a greater system than telomere length regulation, as recent evidence has shown it capable of increasing wound healing in vivo, and improving cellular proliferation rate and survival from apoptosis in vitro. Here, we describe the global gene expression response to ectopic telomerase expression in an in vitro bovine adrenocortical cell model. Telomerase-immortalized cells showed an increased ability for proliferation and survival in minimal essential medium above cells transgenic for GFP. cDNA microarray analyses revealed an altered cell state indicative of increased adrenocortical cell proliferation regulated by the IGF2 pathway and alterations in members of the TGF-B family. As well, we identified alterations in genes associated with development and wound healing that support a model that high telomerase expression induces a highly adaptable, progenitor-like state.

  2. Comparative Digital Gene Expression Analysis of the Arabidopsis Response to Volatiles Emitted by Bacillus amyloliquefaciens

    PubMed Central

    Hao, Hai-Ting; Zhao, Xia; Shang, Qian-Han; Wang, Yun; Guo, Zhi-Hong; Zhang, Yu-Bao; Xie, Zhong-Kui; Wang, Ruo-Yu


    Some plant growth-promoting rhizobacteria (PGPR) regulated plant growth and elicited plant basal immunity by volatiles. The response mechanism to the Bacillus amyloliquefaciens volatiles in plant has not been well studied. We conducted global gene expression profiling in Arabidopsis after treatment with Bacillus amyloliquefaciens FZB42 volatiles by Illumina Digital Gene Expression (DGE) profiling of different growth stages (seedling and mature) and tissues (leaves and roots). Compared with the control, 1,507 and 820 differentially expressed genes (DEGs) were identified in leaves and roots at the seedling stage, respectively, while 1,512 and 367 DEGs were identified in leaves and roots at the mature stage. Seventeen genes with different regulatory patterns were validated using quantitative RT-PCR. Numerous DEGs were enriched for plant hormones, cell wall modifications, and protection against stress situations, which suggests that volatiles have effects on plant growth and immunity. Moreover, analyzes of transcriptome difference in tissues and growth stage using DGE profiling showed that the plant response might be tissue-specific and/or growth stage-specific. Thus, genes encoding flavonoid biosynthesis were downregulated in leaves and upregulated in roots, thereby indicating tissue-specific responses to volatiles. Genes related to photosynthesis were downregulated at the seedling stage and upregulated at the mature stage, respectively, thereby suggesting growth period-specific responses. In addition, the emission of bacterial volatiles significantly induced killing of cells of other organism pathway with up-regulated genes in leaves and the other three pathways (defense response to nematode, cell morphogenesis involved in differentiation and trichoblast differentiation) with up-regulated genes were significantly enriched in roots. Interestingly, some important alterations in the expression of growth-related genes, metabolic pathways, defense response to biotic

  3. Comparative Digital Gene Expression Analysis of the Arabidopsis Response to Volatiles Emitted by Bacillus amyloliquefaciens.


    Hao, Hai-Ting; Zhao, Xia; Shang, Qian-Han; Wang, Yun; Guo, Zhi-Hong; Zhang, Yu-Bao; Xie, Zhong-Kui; Wang, Ruo-Yu


    Some plant growth-promoting rhizobacteria (PGPR) regulated plant growth and elicited plant basal immunity by volatiles. The response mechanism to the Bacillus amyloliquefaciens volatiles in plant has not been well studied. We conducted global gene expression profiling in Arabidopsis after treatment with Bacillus amyloliquefaciens FZB42 volatiles by Illumina Digital Gene Expression (DGE) profiling of different growth stages (seedling and mature) and tissues (leaves and roots). Compared with the control, 1,507 and 820 differentially expressed genes (DEGs) were identified in leaves and roots at the seedling stage, respectively, while 1,512 and 367 DEGs were identified in leaves and roots at the mature stage. Seventeen genes with different regulatory patterns were validated using quantitative RT-PCR. Numerous DEGs were enriched for plant hormones, cell wall modifications, and protection against stress situations, which suggests that volatiles have effects on plant growth and immunity. Moreover, analyzes of transcriptome difference in tissues and growth stage using DGE profiling showed that the plant response might be tissue-specific and/or growth stage-specific. Thus, genes encoding flavonoid biosynthesis were downregulated in leaves and upregulated in roots, thereby indicating tissue-specific responses to volatiles. Genes related to photosynthesis were downregulated at the seedling stage and upregulated at the mature stage, respectively, thereby suggesting growth period-specific responses. In addition, the emission of bacterial volatiles significantly induced killing of cells of other organism pathway with up-regulated genes in leaves and the other three pathways (defense response to nematode, cell morphogenesis involved in differentiation and trichoblast differentiation) with up-regulated genes were significantly enriched in roots. Interestingly, some important alterations in the expression of growth-related genes, metabolic pathways, defense response to biotic

  4. Bacterial Outer Membrane Vesicles Induce Plant Immune Responses.


    Bahar, Ofir; Mordukhovich, Gideon; Luu, Dee Dee; Schwessinger, Benjamin; Daudi, Arsalan; Jehle, Anna Kristina; Felix, Georg; Ronald, Pamela C


    Gram-negative bacteria continuously pinch off portions of their outer membrane, releasing membrane vesicles. These outer membrane vesicles (OMVs) are involved in multiple processes including cell-to-cell communication, biofilm formation, stress tolerance, horizontal gene transfer, and virulence. OMVs are also known modulators of the mammalian immune response. Despite the well-documented role of OMVs in mammalian-bacterial communication, their interaction with plants is not well studied. To examine whether OMVs of plant pathogens modulate the plant immune response, we purified OMVs from four different plant pathogens and used them to treat Arabidopsis thaliana. OMVs rapidly induced a reactive oxygen species burst, medium alkalinization, and defense gene expression in A. thaliana leaf discs, cell cultures, and seedlings, respectively. Western blot analysis revealed that EF-Tu is present in OMVs and that it serves as an elicitor of the plant immune response in this form. Our results further show that the immune coreceptors BAK1 and SOBIR1 mediate OMV perception and response. Taken together, our results demonstrate that plants can detect and respond to OMV-associated molecules by activation of their immune system, revealing a new facet of plant-bacterial interactions. PMID:26926999

  5. Synthetic riboswitches that induce gene expression in diverse bacterial species.


    Topp, Shana; Reynoso, Colleen M K; Seeliger, Jessica C; Goldlust, Ian S; Desai, Shawn K; Murat, Dorothée; Shen, Aimee; Puri, Aaron W; Komeili, Arash; Bertozzi, Carolyn R; Scott, June R; Gallivan, Justin P


    We developed a series of ligand-inducible riboswitches that control gene expression in diverse species of Gram-negative and Gram-positive bacteria, including human pathogens that have few or no previously reported inducible expression systems. We anticipate that these riboswitches will be useful tools for genetic studies in a wide range of bacteria. PMID:20935124

  6. SOS Response Induces Persistence to Fluoroquinolones in Escherichia coli

    PubMed Central

    Dörr, Tobias; Lewis, Kim; Vulić, Marin


    Bacteria can survive antibiotic treatment without acquiring heritable antibiotic resistance. We investigated persistence to the fluoroquinolone ciprofloxacin in Escherichia coli. Our data show that a majority of persisters to ciprofloxacin were formed upon exposure to the antibiotic, in a manner dependent on the SOS gene network. These findings reveal an active and inducible mechanism of persister formation mediated by the SOS response, challenging the prevailing view that persisters are pre-existing and formed purely by stochastic means. SOS-induced persistence is a novel mechanism by which cells can counteract DNA damage and promote survival to fluoroquinolones. This unique survival mechanism may be an important factor influencing the outcome of antibiotic therapy in vivo. PMID:20011100

  7. Silver nanoparticles induce endoplasmatic reticulum stress response in zebrafish.


    Christen, Verena; Capelle, Martinus; Fent, Karl


    Silver nanoparticles (AgNPs) find increasing applications, and therefore humans and the environment are increasingly exposed to them. However, potential toxicological implications are not sufficiently known. Here we investigate effects of AgNPs (average size 120 nm) on zebrafish in vitro and in vivo, and compare them to human hepatoma cells (Huh7). AgNPs are incorporated in zebrafish liver cells (ZFL) and Huh7, and in zebrafish embryos. In ZFL cells AgNPs lead to induction of reactive oxygen species (ROS), endoplasmatic reticulum (ER) stress response, and TNF-α. Transcriptional alterations also occur in pro-apoptotic genes p53 and Bax. The transcriptional profile differed in ZFL and Huh7 cells. In ZFL cells, the ER stress marker BiP is induced, concomitant with the ER stress marker ATF-6 and spliced XBP-1 after 6h and 24h exposure to 0.5 g/L and 0.05 g/L AgNPs, respectively. This indicates the induction of different pathways of the ER stress response. Moreover, AgNPs induce TNF-α. In zebrafish embryos exposed to 0.01, 0.1, 1 and 5mg/L AgNPs hatching was affected and morphological defects occurred at high concentrations. ER stress related gene transcripts BiP and Synv are significantly up-regulated after 24h at 0.1 and 5mg/L AgNPs. Furthermore, transcriptional alterations occurred in the pro-apoptotic genes Noxa and p21. The ER stress response was strong in ZFL cells and occurred in zebrafish embryos as well. Our data demonstrate for the first time that AgNPs lead to induction of ER stress in zebrafish. The induction of ER stress can have several consequences including the activation of apoptotic and inflammatory pathways. PMID:23800688

  8. Induction of Senescence and Identification of Differentially Expressed Genes in Tomato in Response to Monoterpene

    PubMed Central

    Kumar, Vinay; Kumar, Anil; Irfan, Mohammad; Chakraborty, Niranjan; Chakraborty, Subhra; Datta, Asis


    Monoterpenes, which are among the major components of plant essential oils, are known for their ecological roles as well for pharmaceutical properties. Geraniol, an acyclic monoterpene induces cell cycle arrest and apoptosis/senescence in various cancer cells and plants; however, the genes involved in the process and the underlying molecular mechanisms are not well understood. In this study, we demonstrate that treatment of tomato plants with geraniol results in induction of senescence due to a substantial alteration in transcriptome. We have identified several geraniol-responsive protein encoding genes in tomato using suppression subtractive hybridization (SSH) approach. These genes comprise of various components of signal transduction, cellular metabolism, reactive oxygen species (ROS), ethylene signalling, apoptosis and DNA damage response. Upregulation of NADPH oxidase and antioxidant genes, and increase in ROS level after geraniol treatment point towards the involvement of ROS in geraniol-mediated senescence. The delayed onset of seedling death and induced expression of geraniol-responsive genes in geraniol-treated ethylene receptor mutant (Nr) suggest that geraniol-mediated senescence involves both ethylene dependent and independent pathways. Moreover, expression analysis during tomato ripening revealed that geraniol-responsive genes are also associated with the natural organ senescence process. PMID:24098759

  9. Radiation-induced genomic instability: radiation quality and dose response

    NASA Technical Reports Server (NTRS)

    Smith, Leslie E.; Nagar, Shruti; Kim, Grace J.; Morgan, William F.


    Genomic instability is a term used to describe a phenomenon that results in the accumulation of multiple changes required to convert a stable genome of a normal cell to an unstable genome characteristic of a tumor. There has been considerable recent debate concerning the importance of genomic instability in human cancer and its temporal occurrence in the carcinogenic process. Radiation is capable of inducing genomic instability in mammalian cells and instability is thought to be the driving force responsible for radiation carcinogenesis. Genomic instability is characterized by a large collection of diverse endpoints that include large-scale chromosomal rearrangements and aberrations, amplification of genetic material, aneuploidy, micronucleus formation, microsatellite instability, and gene mutation. The capacity of radiation to induce genomic instability depends to a large extent on radiation quality or linear energy transfer (LET) and dose. There appears to be a low dose threshold effect with low LET, beyond which no additional genomic instability is induced. Low doses of both high and low LET radiation are capable of inducing this phenomenon. This report reviews data concerning dose rate effects of high and low LET radiation and their capacity to induce genomic instability assayed by chromosomal aberrations, delayed lethal mutations, micronuclei and apoptosis.

  10. The Transcriptional Response of Caenorhabditis elegans to Ivermectin Exposure Identifies Novel Genes Involved in the Response to Reduced Food Intake

    PubMed Central

    Laing, Steven T.; Ivens, Al; Butler, Victoria; Ravikumar, Sai P.; Laing, Roz; Woods, Debra J.; Gilleard, John S.


    We have examined the transcriptional response of Caenorhabditis elegans following exposure to the anthelmintic drug ivermectin (IVM) using whole genome microarrays and real-time QPCR. Our original aim was to identify candidate molecules involved in IVM metabolism and/or excretion. For this reason the IVM tolerant strain, DA1316, was used to minimise transcriptomic changes related to the phenotype of drug exposure. However, unlike equivalent work with benzimidazole drugs, very few of the induced genes were members of xenobiotic metabolising enzyme families. Instead, the transcriptional response was dominated by genes associated with fat mobilization and fatty acid metabolism including catalase, esterase, and fatty acid CoA synthetase genes. This is consistent with the reduction in pharyngeal pumping, and consequential reduction in food intake, upon exposure of DA1316 worms to IVM. Genes with the highest fold change in response to IVM exposure, cyp-37B1, mtl-1 and scl-2, were comparably up-regulated in response to short–term food withdrawal (4 hr) independent of IVM exposure, and GFP reporter constructs confirm their expression in tissues associated with fat storage (intestine and hypodermis). These experiments have serendipitously identified novel genes involved in an early response of C. elegans to reduced food intake and may provide insight into similar processes in higher organisms. PMID:22348077

  11. RelA-Induced Interferon Response Negatively Regulates Proliferation.


    Kochupurakkal, Bose S; Wang, Zhigang C; Hua, Tony; Culhane, Aedin C; Rodig, Scott J; Rajkovic-Molek, Koraljka; Lazaro, Jean-Bernard; Richardson, Andrea L; Biswas, Debajit K; Iglehart, J Dirk


    Both oncogenic and tumor-suppressor activities are attributed to the Nuclear Factor kappa B (NF-kB) pathway. Moreover, NF-kB may positively or negatively regulate proliferation. The molecular determinants of these opposing roles of NF-kB are unclear. Using primary human mammary epithelial cells (HMEC) as a model, we show that increased RelA levels and consequent increase in basal transcriptional activity of RelA induces IRF1, a target gene. Induced IRF1 upregulates STAT1 and IRF7, and in consort, these factors induce the expression of interferon response genes. Activation of the interferon pathway down-regulates CDK4 and up-regulates p27 resulting in Rb hypo-phosphorylation and cell cycle arrest. Stimulation of HMEC with IFN-γ elicits similar phenotypic and molecular changes suggesting that basal activity of RelA and IFN-γ converge on IRF1 to regulate proliferation. The anti-proliferative RelA-IRF1-CDK4 signaling axis is retained in ER+/HER2- breast tumors analyzed by The Cancer Genome Atlas (TCGA). Using immuno-histochemical analysis of breast tumors, we confirm the negative correlation between RelA levels and proliferation rate in ER+/HER2- breast tumors. These findings attribute an anti-proliferative tumor-suppressor role to basal RelA activity. Inactivation of Rb, down-regulation of RelA or IRF1, or upregulation of CDK4 or IRF2 rescues the RelA-IRF1-CDK4 induced proliferation arrest in HMEC and are points of disruption in aggressive tumors. Activity of the RelA-IRF1-CDK4 axis may explain favorable response to CDK4/6 inhibition observed in patients with ER+ Rb competent tumors. PMID:26460486

  12. RelA-Induced Interferon Response Negatively Regulates Proliferation

    PubMed Central

    Kochupurakkal, Bose S.; Wang, Zhigang C.; Hua, Tony; Culhane, Aedin C.; Rodig, Scott J.; Rajkovic-Molek, Koraljka; Lazaro, Jean-Bernard; Richardson, Andrea L.; Biswas, Debajit K.; Iglehart, J. Dirk


    Both oncogenic and tumor-suppressor activities are attributed to the Nuclear Factor kappa B (NF-kB) pathway. Moreover, NF-kB may positively or negatively regulate proliferation. The molecular determinants of these opposing roles of NF-kB are unclear. Using primary human mammary epithelial cells (HMEC) as a model, we show that increased RelA levels and consequent increase in basal transcriptional activity of RelA induces IRF1, a target gene. Induced IRF1 upregulates STAT1 and IRF7, and in consort, these factors induce the expression of interferon response genes. Activation of the interferon pathway down-regulates CDK4 and up-regulates p27 resulting in Rb hypo-phosphorylation and cell cycle arrest. Stimulation of HMEC with IFN-γ elicits similar phenotypic and molecular changes suggesting that basal activity of RelA and IFN-γ converge on IRF1 to regulate proliferation. The anti-proliferative RelA-IRF1-CDK4 signaling axis is retained in ER+/HER2- breast tumors analyzed by The Cancer Genome Atlas (TCGA). Using immuno-histochemical analysis of breast tumors, we confirm the negative correlation between RelA levels and proliferation rate in ER+/HER2- breast tumors. These findings attribute an anti-proliferative tumor-suppressor role to basal RelA activity. Inactivation of Rb, down-regulation of RelA or IRF1, or upregulation of CDK4 or IRF2 rescues the RelA-IRF1-CDK4 induced proliferation arrest in HMEC and are points of disruption in aggressive tumors. Activity of the RelA-IRF1-CDK4 axis may explain favorable response to CDK4/6 inhibition observed in patients with ER+ Rb competent tumors. PMID:26460486

  13. Gene expression during imidacloprid-induced hormesis in green peach aphid.


    Ayyanath, Murali-Mohan; Cutler, G Christopher; Scott-Dupree, Cynthia D; Prithiviraj, Balakrishnan; Kandasamy, Saveetha; Prithiviraj, Kalyani


    Imidacloprid-induced hormesis in the form of stimulated reproduction has previously been reported in green peach aphid, Myzus persicae. Changes in gene expression accompanying this hormetic response have not been previously investigated. In this study, expression of stress response (Hsp60), dispersal (OSD, TOL and ANT), and developmental (FPPS I) genes were examined for two generations during imidacloprid-induced reproductive stimulation in M. persicae. Global DNA methylation was also measured to test the hypothesis that changes in gene expression are heritable. At hormetic concentrations, down-regulation of Hsp60 was followed by up-regulation of this gene in the subsequent generation. Likewise, expression of dispersal-related genes and FPPS I varied with concentration, life stage, and generation. These results indicate that reproductive hormesis in M. persicae is accompanied by a complex transgenerational pattern of up- and down-regulation of genes that likely reflects trade-offs in gene expression and related physiological processes during the phenotypic dose-response. Moreover, DNA methylation in second generation M. persicae occurred at higher doses than in first-generation aphids, suggesting that heritable adaptability to low doses of the stressor might have occurred. PMID:25249837

  14. Moderate malnutrition in rats induces somatic gene mutations.


    Pacheco-Martínez, M Monserrat; Cortés-Barberena, Edith; Cervantes-Ríos, Elsa; Del Carmen García-Rodríguez, María; Rodríguez-Cruz, Leonor; Ortiz-Muñiz, Rocío


    The relationship between malnutrition and genetic damage has been widely studied in human and animal models, leading to the observation that interactions between genotoxic exposure and micronutrient status appear to affect genomic stability. A new assay has been developed that uses the phosphatidylinositol glycan class A gene (Pig-a) as a reporter for measuring in vivo gene mutation. The Pig-a assay can be employed to evaluate mutant frequencies (MFs) in peripheral blood reticulocytes (RETs) and erythrocytes (RBCs) using flow cytometry. In the present study, we assessed the effects of malnutrition on mutagenic susceptibility by exposing undernourished (UN) and well-nourished (WN) rats to N-ethyl-N-nitrosourea (ENU) and measuring Pig-a MFs. Two week-old UN and WN male Han-Wistar rats were treated daily with 0, 20, or 40mg/kg ENU for 3 consecutive days. Blood was collected from the tail vein one day before ENU treatment (Day-1) and after ENU administration on Days 7, 14, 21, 28, 35, 42, 49, 56 and 63. Pig-a MFs were measured in RETs and RBCs as the RET(CD59-) and RBC(CD59-) frequencies. In the vehicle control groups, the frequencies of mutant RETs and RBCs were significantly higher in UN rats compared with WN rats at all sampling times. The ENU treatments increased RET and RBC MFs starting at Day 7. Although ENU-induced Pig-a MFs were consistently lower in UN rats than in WN rats, these differences were not significant. To understand these responses, further studies should use other mutagens and nucleated surrogate cells and examine the types of mutations induced in UN and WN rats. PMID:26994962

  15. [Stress response genes expression analysis of barley Hordeum vulgare under space flight environment].


    Shagimardanova, E I; Gusev, O A; Sychev, V N; Levinskikh, M A; Sharipova, M R; Il'inskaia, O N; Bingham, G; Sugimoto, M


    Transcriptome of barley Hordeum vulgare grown aboard International Space Station (ISS) was analyzed by means of microarray. It was revealed 500 genes with mRNA level, changed more than two folds in space environment. Among them are genes encoding stress response proteins, videlicet Heat Shock Proteins (HSP), Pathogenesis-Related Proteins (PR) and Antioxidant Proteins. Further analysis of these genes by real time PCR showed enhanced transcription level of Reactive oxygen Species (ROS) scavenging genes. The mRNA level of superoxide dismutase (sod) was 6 folds higher in space environment when compare to Earth conditions. Glutamyl transferase gene expression was enhanced 24 times in space. Transcription of catalase gene (cat) was increased 18 times and of ascorbate peroxidase was increased 3 times in space in comparison with ground control. For the first time it was shown that space flight environment may induce oxidative stress in plants. PMID:21090239

  16. The acid adaptive tolerance response in Campylobacter jejuni induces a global response, as suggested by proteomics and microarrays

    PubMed Central

    Varsaki, Athanasia; Murphy, Caroline; Barczynska, Alicja; Jordan, Kieran; Carroll, Cyril


    Campylobacter jejuni CI 120 is a natural isolate obtained during poultry processing and has the ability to induce an acid tolerance response (ATR) to acid + aerobic conditions in early stationary phase. Other strains tested they did not induce an ATR or they induced it in exponential phase. Campylobacter spp. do not contain the genes that encode the global stationary phase stress response mechanism. Therefore, the aim of this study was to identify genes that are involved in the C. jejuni CI 120 early stationary phase ATR, as it seems to be expressing a novel mechanism of stress tolerance. Two-dimensional gel electrophoresis was used to examine the expression profile of cytosolic proteins during the C. jejuni CI 120 adaptation to acid + aerobic stress and microarrays to determine the genes that participate in the ATR. The results indicate induction of a global response that activated a number of stress responses, including several genes encoding surface components and genes involved with iron uptake. The findings of this study provide new insights into stress tolerance of C. jejuni, contribute to a better knowledge of the physiology of this bacterium and highlight the diversity among different strains. PMID:26221965

  17. Disruption of the splicing enhancer sequence within exon 27 of the dystrophin gene by a nonsense mutation induces partial skipping of the exon and is responsible for Becker muscular dystrophy.

    PubMed Central

    Shiga, N; Takeshima, Y; Sakamoto, H; Inoue, K; Yokota, Y; Yokoyama, M; Matsuo, M


    The mechanism of exon skipping induced by nonsense mutations has not been well elucidated. We now report results of in vitro splicing studies which disclosed that a particular example of exon skipping is due to disruption of a splicing enhancer sequence located within the exon. A nonsense mutation (E1211X) due to a G to T transversion at the 28th nucleotide of exon 27 (G3839T) was identified in the dystrophin gene of a Japanese Becker muscular dystrophy case. Partial skipping of the exon resulted in the production of truncated dystrophin mRNA, although the consensus sequences for splicing at both ends of exon 27 were unaltered. To determine how E1211X induced exon 27 skipping, the splicing enhancer activity of purine-rich region within exon 27 was examined in an in vitro splicing system using chimeric doublesex gene pre-mRNA. The mutant sequence containing G3839T abolished splicing enhancer activity of the wild-type purine-rich sequence for the upstream intron in this chimeric pre-mRNA. An artificial polypurine oligonucleotide mimicking the purine-rich sequence of exon 27 also showed enhancer activity that was suppressed by the introduction of a T nucleotide. Furthermore, the splicing enhancer activity was more markedly inhibited when a nonsense codon was created by the inserted T residue. This is the first evidence that partial skipping of an exon harboring a nonsense mutation is due to disruption of a splicing enhancer sequence. PMID:9410897

  18. Disruption of the splicing enhancer sequence within exon 27 of the dystrophin gene by a nonsense mutation induces partial skipping of the exon and is responsible for Becker muscular dystrophy.


    Shiga, N; Takeshima, Y; Sakamoto, H; Inoue, K; Yokota, Y; Yokoyama, M; Matsuo, M


    The mechanism of exon skipping induced by nonsense mutations has not been well elucidated. We now report results of in vitro splicing studies which disclosed that a particular example of exon skipping is due to disruption of a splicing enhancer sequence located within the exon. A nonsense mutation (E1211X) due to a G to T transversion at the 28th nucleotide of exon 27 (G3839T) was identified in the dystrophin gene of a Japanese Becker muscular dystrophy case. Partial skipping of the exon resulted in the production of truncated dystrophin mRNA, although the consensus sequences for splicing at both ends of exon 27 were unaltered. To determine how E1211X induced exon 27 skipping, the splicing enhancer activity of purine-rich region within exon 27 was examined in an in vitro splicing system using chimeric doublesex gene pre-mRNA. The mutant sequence containing G3839T abolished splicing enhancer activity of the wild-type purine-rich sequence for the upstream intron in this chimeric pre-mRNA. An artificial polypurine oligonucleotide mimicking the purine-rich sequence of exon 27 also showed enhancer activity that was suppressed by the introduction of a T nucleotide. Furthermore, the splicing enhancer activity was more markedly inhibited when a nonsense codon was created by the inserted T residue. This is the first evidence that partial skipping of an exon harboring a nonsense mutation is due to disruption of a splicing enhancer sequence. PMID:9410897

  19. Mapping the genes for haloperidol-induced catalepsy.


    Kanes, S; Dains, K; Cipp, L; Gatley, J; Hitzemann, B; Rasmussen, E; Sanderson, S; Silverman, M; Hitzemann, R


    The strain means for haloperidol-induced catalepsy were determined in the 26 strain BXD recombinant inbred series. The ED50 values ranged from 0.55 mg/kg (strain 30) to 7.9 mg/kg (strain 2). Heritability for the catalepsy response was 0.78 and the number of effective loci was estimated to be four. The strain means were correlated with the strain distribution patterns for 1300 marker loci of known chromosomal location and polymorphic between the C57Bl/6J and DBA/2J strains. Six quantitative trait loci (QTLs) were identified at P < .01. Two of the six QTLs were confirmed in a sample of B6XD2 F2 animals (n = 144), phenotyped for haloperidol response and genotyped for microsatellites closely linked to the QTLs. The confirmed QTL on chromosome 4 is near the b locus. The confirmed QTL on chromosome 9 is closely linked to Drd2, the D2 dopamine receptor gene. One hundred of the F2 individuals were phenotyped for D2 dopamine receptor binding using the ligand [125I] epidepride as the ligand. Consistent with previous results, the nonresponsive F2 individuals showed modestly higher receptor binding in all brain regions examined: the nucleus accumbens core, the nucleus accumbens shell, the lateral caudate putamen, the dorsomedial caudate putamen, the substantia nigra zona compacta and the ventral tegmental area. The DBA/2J allele of the chromosome 9 QTL was associated with higher receptor binding in all brain areas except the ventral tegmental area. Overall, the data illustrate that either near or part of Drd2 is a QTL which has significant effects on both haloperidol response and D2 dopamine receptor binding. However, the data also illustrate that most of the genetic variance in either haloperidol response or D2 dopamine receptor binding is not associated with Drd2. PMID:8627512

  20. Transcriptional 'memory' of a stress: transient chromatin and memory (epigenetic) marks at stress-response genes.


    Avramova, Zoya


    Drought, salinity, extreme temperature variations, pathogen and herbivory attacks are recurring environmental stresses experienced by plants throughout their life. To survive repeated stresses, plants provide responses that may be different from their response during the first encounter with the stress. A different response to a similar stress represents the concept of 'stress memory'. A coordinated reaction at the organismal, cellular and gene/genome levels is thought to increase survival chances by improving the plant's tolerance/avoidance abilities. Ultimately, stress memory may provide a mechanism for acclimation and adaptation. At the molecular level, the concept of stress memory indicates that the mechanisms responsible for memory-type transcription during repeated stresses are not based on repetitive activation of the same response pathways activated by the first stress. Some recent advances in the search for transcription 'memory factors' are discussed with an emphasis on super-induced dehydration stress memory response genes in Arabidopsis. PMID:25788029

  1. Arsenic- and cadmium-induced toxicogenomic response in mouse embryos undergoing neurulation

    SciTech Connect

    Robinson, Joshua F.; Yu, Xiaozhong; Moreira, Estefania G.; Hong, Sungwoo; Faustman, Elaine M.


    Arsenic (As) and cadmium (Cd) are well-characterized teratogens in animal models inducing embryotoxicity and neural tube defects (NTDs) when exposed during neurulation. Toxicological research is needed to resolve the specific biological processes and associated molecular pathways underlying metal-induced toxicity during this timeframe in gestational development. In this study, we investigated the dose-dependent effects of As and Cd on gene expression in C57BL/6J mouse embryos exposed in utero during neurulation (GD8) to identify significantly altered genes and corresponding biological processes associated with embryotoxicity. We quantitatively examined the toxicogenomic dose-response relationship at the gene level. Our results suggest that As and Cd induce dose-dependent gene expression alterations representing shared (cell cycle, response to UV, glutathione metabolism, RNA processing) and unique (alcohol/sugar metabolism) biological processes, which serve as robust indicators of metal-induced developmental toxicity and indicate underlying embryotoxic effects. Our observations also correlate well with previously identified impacts of As and Cd on specific genes associated with metal-induced toxicity (Cdkn1a, Mt1). In summary, we have identified in a quantitative manner As and Cd induced dose-dependent effects on gene expression in mouse embryos during a peak window of sensitivity to embryotoxicity and NTDs in the sensitive C57BL/6J strain.

  2. Arsenic- and Cadmium-Induced Toxicogenomic Response in Mouse Embryos Undergoing Neurulation

    PubMed Central

    Robinson, Joshua F.; Yu, Xiaozhong; Moreira, Estefania G.; Hong, Sungwoo; Faustman, Elaine M.


    Arsenic (As) and cadmium (Cd) are well-characterized teratogens in animal models inducing embryotoxicity and neural tube defects (NTDs) when exposed during neurulation. Toxicological research is needed to resolve the specific biological processes and associated molecular pathways underlying metal-induced toxicity during this timeframe in gestational development. In this study, we investigated the dose-dependent effects of As and Cd on gene expression in C57BL/6J mouse embryos exposed in utero during neurulation (GD8) to identify significantly altered genes and corresponding biological processes associated with embryotoxicity. We quantitatively examined the toxicogenomic dose-response relationship at the gene level. Our results suggest As and Cd induce dose-dependent gene expression alterations representing shared (cell cycle, response to UV, glutathione metabolism, RNA processing) and unique (alcohol/sugar metabolism) biological processes, which serve as robust indicators of metal-induced developmental toxicity and indicate underlying embryotoxic effects. Our observations also correlate well with previously identified impacts of As and Cd on specific genes associated with metal-induced toxicity (Cdkn1a, Mt1). In summary, we have identified in a quantitative manner As and Cd induced dose-dependent effects on gene expression in mouse embryos during a peak window of sensitivity to embryotoxicity and NTDs in the sensitive C57BL/6J strain. PMID:20883709

  3. Expression profiling of genes regulated by Fra-1/AP-1 transcription factor during bleomycin-induced pulmonary fibrosis

    PubMed Central


    Background The Fra-1/AP-1 transcription factor regulates the expression of genes controlling various processes including migration, invasion, and survival as well as extracellular remodeling. We recently demonstrated that loss of Fra-1 leads to exacerbated bleomycin-induced pulmonary fibrosis, accompanied by enhanced expression of various inflammatory and fibrotic genes. To better understand the molecular mechanisms by which Fra-1 confers protection during bleomycin-induced lung injury, genome-wide mRNA expression profiling was performed. Results We found that Fra-1 regulates gene expression programs that include: 1) several cytokines and chemokines involved in inflammation, 2) several genes involved in the extracellular remodeling and cell adhesion, and 3) several genes involved in programmed cell death. Conclusion Loss of Fra-1 leads to the enhanced expression of genes regulating inflammation and immune responses and decreased the expression of genes involved in apoptosis, suggesting that this transcription factor distinctly modulates early pro-fibrotic cellular responses. PMID:23758685

  4. Transcriptional regulation of gene expression during osmotic stress responses by the mammalian target of rapamycin.


    Ortells, M Carmen; Morancho, Beatriz; Drews-Elger, Katherine; Viollet, Benoit; Laderoute, Keith R; López-Rodríguez, Cristina; Aramburu, Jose


    Although stress can suppress growth and proliferation, cells can induce adaptive responses that allow them to maintain these functions under stress. While numerous studies have focused on the inhibitory effects of stress on cell growth, less is known on how growth-promoting pathways influence stress responses. We have approached this question by analyzing the effect of mammalian target of rapamycin (mTOR), a central growth controller, on the osmotic stress response. Our results showed that mammalian cells exposed to moderate hypertonicity maintained active mTOR, which was required to sustain their cell size and proliferative capacity. Moreover, mTOR regulated the induction of diverse osmostress response genes, including targets of the tonicity-responsive transcription factor NFAT5 as well as NFAT5-independent genes. Genes sensitive to mTOR-included regulators of stress responses, growth and proliferation. Among them, we identified REDD1 and REDD2, which had been previously characterized as mTOR inhibitors in other stress contexts. We observed that mTOR facilitated transcription-permissive conditions for several osmoresponsive genes by enhancing histone H4 acetylation and the recruitment of RNA polymerase II. Altogether, these results reveal a previously unappreciated role of mTOR in regulating transcriptional mechanisms that control gene expression during cellular stress responses. PMID:22287635

  5. De Novo Assembled Wheat Transcriptomes Delineate Differentially Expressed Host Genes in Response to Leaf Rust Infection

    PubMed Central

    Pathak, Jyoti; Kumari, Supriya; Kumar, Manish; Poddar, Raju; Balyan, Harindra Singh; Gupta, Puspendra Kumar; Prabhu, Kumble Vinod; Mukhopadhyay, Kunal


    Pathogens like Puccinia triticina, the causal organism for leaf rust, extensively damages wheat production. The interaction at molecular level between wheat and the pathogen is complex and less explored. The pathogen induced response was characterized using mock- or pathogen inoculated near-isogenic wheat lines (with or without seedling leaf rust resistance gene Lr28). Four Serial Analysis of Gene Expression libraries were prepared from mock- and pathogen inoculated plants and were subjected to Sequencing by Oligonucleotide Ligation and Detection, which generated a total of 165,767,777 reads, each 35 bases long. The reads were processed and multiple k-mers were attempted for de novo transcript assembly; 22 k-mers showed the best results. Altogether 21,345 contigs were generated and functionally characterized by gene ontology annotation, mining for transcription factors and resistance genes. Expression analysis among the four libraries showed extensive alterations in the transcriptome in response to pathogen infection, reflecting reorganizations in major biological processes and metabolic pathways. Role of auxin in determining pathogenesis in susceptible and resistant lines were imperative. The qPCR expression study of four LRR-RLK (Leucine-rich repeat receptor-like protein kinases) genes showed higher expression at 24 hrs after inoculation with pathogen. In summary, the conceptual model of induced resistance in wheat contributes insights on defense responses and imparts knowledge of Puccinia triticina-induced defense transcripts in wheat plants. PMID:26840746

  6. De Novo Assembled Wheat Transcriptomes Delineate Differentially Expressed Host Genes in Response to Leaf Rust Infection.


    Chandra, Saket; Singh, Dharmendra; Pathak, Jyoti; Kumari, Supriya; Kumar, Manish; Poddar, Raju; Balyan, Harindra Singh; Gupta, Puspendra Kumar; Prabhu, Kumble Vinod; Mukhopadhyay, Kunal


    Pathogens like Puccinia triticina, the causal organism for leaf rust, extensively damages wheat production. The interaction at molecular level between wheat and the pathogen is complex and less explored. The pathogen induced response was characterized using mock- or pathogen inoculated near-isogenic wheat lines (with or without seedling leaf rust resistance gene Lr28). Four Serial Analysis of Gene Expression libraries were prepared from mock- and pathogen inoculated plants and were subjected to Sequencing by Oligonucleotide Ligation and Detection, which generated a total of 165,767,777 reads, each 35 bases long. The reads were processed and multiple k-mers were attempted for de novo transcript assembly; 22 k-mers showed the best results. Altogether 21,345 contigs were generated and functionally characterized by gene ontology annotation, mining for transcription factors and resistance genes. Expression analysis among the four libraries showed extensive alterations in the transcriptome in response to pathogen infection, reflecting reorganizations in major biological processes and metabolic pathways. Role of auxin in determining pathogenesis in susceptible and resistant lines were imperative. The qPCR expression study of four LRR-RLK (Leucine-rich repeat receptor-like protein kinases) genes showed higher expression at 24 hrs after inoculation with pathogen. In summary, the conceptual model of induced resistance in wheat contributes insights on defense responses and imparts knowledge of Puccinia triticina-induced defense transcripts in wheat plants. PMID:26840746

  7. Antipsychotic Induced Gene Regulation in Multiple Brain Regions

    PubMed Central

    Girgenti, Matthew James; Nisenbaum, Laura K.; Bymaster, Franklin; Terwilliger, Rosemarie; Duman, Ronald S; Newton, Samuel Sathyanesan


    The molecular mechanism of action of antipsychotic drugs is not well understood. Their complex receptor affinity profiles indicate that their action could extend beyond dopamine receptor blockade. Single gene expression studies and high-throughput gene profiling have shown the induction of genes from several molecular classes and functional categories. Using a focused microarray approach we investigated gene regulation in rat striatum, frontal cortex and hippocampus after chronic administration of haloperidol or olanzapine. Regulated genes were validated by in-situ hybridization, realtime PCR and immunohistochemistry. Only limited overlap was observed in genes regulated by haloperidol and olanzapine. Both drugs elicited maximal gene regulation in the striatum and least in the hippocampus. Striatal gene induction by haloperidol was predominantly in neurotransmitter signaling, G-protein coupled receptors and transcription factors. Olanzapine prominently induced retinoic acid and trophic factor signaling genes in the frontal cortex. The data also revealed the induction of several genes that could be targeted in future drug development efforts. The study uncovered the induction of several novel genes, including somatostatin receptors and metabotropic glutamate receptors. The results demonstrating the regulation of multiple receptors and transcription factors suggests that both typical and atypical antipsychotics could possess a complex molecular mechanism of action. PMID:20070867

  8. Low doses of neutrons induce changes in gene expression

    SciTech Connect

    Woloschak, G.E.; Chang-Liu, C.M. ); Panozzo, J.; Libertin, C.R. )


    Studies were designed to identify genes induced following low-dose neutron but not following [gamma]-ray exposure in fibroblasts. Our past work had shown differences in the expression of [beta]-protein kinase C and c-fos genes, both being induced following [gamma]-ray but not neutron exposure. We have identified two genes that are induced following neutron, but not [gamma]-ray, exposure: Rp-8 (a gene induced by apoptosis) and the long terminal repeat (LTR) of the human immunodeficiency (HIV). Rp-8 mRNA induction was demonstrated in Syrian hamster embryo fibroblasts and was found to be induced in cells exposed to neutrons administered at low (0.5 cGy/min) and at high dose rate (12 cGy/min). The induction of transcription from the LTR of HIV was demonstrated in HeLa cells bearing a transfected construct of the chloramphenicol acetyl transferase (CAT) gene driven by the HIV-LTR promoter. Measures of CAT activity and CAT transcripts following irradiation demonstrated an unresponsiveness to [gamma] rays over a broad range of doses. Twofold induction of the HIV-LTR was detected following neutron exposure (48 cGy) administered at low (0.5 cGy/min) but not high (12 cGy/min) dose rates. Ultraviolet-mediated HIV-LTR induction was inhibited by low-dose-rate neutron exposure.

  9. Low doses of neutrons induce changes in gene expression

    SciTech Connect

    Woloschak, G.E.; Chang-Liu, C.M.; Panozzo, J.; Libertin, C.R.


    Studies were designed to identify genes induced following low-dose neutron but not following {gamma}-ray exposure in fibroblasts. Our past work had shown differences in the expression of {beta}-protein kinase C and c-fos genes, both being induced following {gamma}-ray but not neutron exposure. We have identified two genes that are induced following neutron, but not {gamma}-ray, exposure: Rp-8 (a gene induced by apoptosis) and the long terminal repeat (LTR) of the human immunodeficiency (HIV). Rp-8 mRNA induction was demonstrated in Syrian hamster embryo fibroblasts and was found to be induced in cells exposed to neutrons administered at low (0.5 cGy/min) and at high dose rate (12 cGy/min). The induction of transcription from the LTR of HIV was demonstrated in HeLa cells bearing a transfected construct of the chloramphenicol acetyl transferase (CAT) gene driven by the HIV-LTR promoter. Measures of CAT activity and CAT transcripts following irradiation demonstrated an unresponsiveness to {gamma} rays over a broad range of doses. Twofold induction of the HIV-LTR was detected following neutron exposure (48 cGy) administered at low (0.5 cGy/min) but not high (12 cGy/min) dose rates. Ultraviolet-mediated HIV-LTR induction was inhibited by low-dose-rate neutron exposure.

  10. ABI3 mediates dehydration stress recovery response in Arabidopsis thaliana by regulating expression of downstream genes.


    Bedi, Sonia; Sengupta, Sourabh; Ray, Anagh; Nag Chaudhuri, Ronita


    ABI3, originally discovered as a seed-specific transcription factor is now implicated to act beyond seed physiology, especially during abiotic stress. In non-seed plants, ABI3 is known to act in desiccation stress signaling. Here we show that ABI3 plays a role in dehydration stress response in Arabidopsis. ABI3 gene was upregulated during dehydration stress and its expression was maintained during subsequent stress recovery phases. Comparative gene expression studies in response to dehydration stress and stress recovery were done with genes which had potential ABI3 binding sites in their upstream regulatory regions. Such studies showed that several genes including known seed-specific factors like CRUCIFERIN1, CRUCIFERIN3 and LEA-group of genes like LEA76, LEA6, DEHYDRIN LEA and LEA-LIKE got upregulated in an ABI3-dependent manner, especially during the stress recovery phase. ABI3 got recruited to regions upstream to the transcription start site of these genes during dehydration stress response through direct or indirect DNA binding. Interestingly, ABI3 also binds to its own promoter region during such stress signaling. Nucleosomes covering potential ABI3 binding sites in the upstream sequences of the above-mentioned genes alter positions, and show increased H3 K9 acetylation during stress-induced transcription. ABI3 thus mediates dehydration stress signaling in Arabidopsis through regulation of a group of genes that play a role primarily during stress recovery phase. PMID:27457990

  11. Three light-inducible heat shock genes of Chlamydomonas reinhardtii.

    PubMed Central

    von Gromoff, E D; Treier, U; Beck, C F


    Genomic clones representing three Chlamydomonas reinhardtii genes homologous to the Drosophila hsp70 heat shock gene were isolated. The mRNAs of genes hsp68, hsp70, and hsp80 could be translated in vitro into proteins of Mr 68,000, 70,000, and 80,000, respectively. Transcription of these genes increased dramatically upon heat shock, and the corresponding mRNAs rapidly accumulated, reaching a peak at around 30 min after a shift to the elevated temperature. Light also induced the accumulation of the mRNAs encoded by these heat shock genes. A shift of dark-grown cells to light resulted in a drastic increase in mRNA levels, which reached a maximum at around 1 h after the shift. Thus, in Chlamydomonas, expression of hsp70-homologous heat shock genes appears to be regulated by thermal stress and light. Images PMID:2779571

  12. Salmonella induces prominent gene expression in the rat colon

    PubMed Central

    Rodenburg, Wendy; Keijer, Jaap; Kramer, Evelien; Roosing, Susanne; Vink, Carolien; Katan, Martijn B; van der Meer, Roelof; Bovee-Oudenhoven, Ingeborg MJ


    Background Salmonella enteritidis is suggested to translocate in the small intestine. In vivo it induces gene expression changes in the ileal mucosa and Peyer's patches. Stimulation of Salmonella translocation by dietary prebiotics fermented in colon suggests involvement of the colon as well. However, effects of Salmonella on colonic gene expression in vivo are largely unknown. We aimed to characterize time dependent Salmonella-induced changes of colonic mucosal gene expression in rats using whole genome microarrays. For this, rats were orally infected with Salmonella enteritidis to mimic a foodborne infection and colonic gene expression was determined at days 1, 3 and 6 post-infection (n = 8 rats per time-point). As fructo-oligosaccharides (FOS) affect colonic physiology, we analyzed colonic mucosal gene expression of FOS-fed versus cellulose-fed rats infected with Salmonella in a separate experiment. Colonic mucosal samples were isolated at day 2 post-infection. Results Salmonella affected transport (e.g. Chloride channel calcium activated 6, H+/K+ transporting Atp-ase), antimicrobial defense (e.g. Lipopolysaccharide binding protein, Defensin 5 and phospholipase A2), inflammation (e.g. calprotectin), oxidative stress related genes (e.g. Dual oxidase 2 and Glutathione peroxidase 2) and Proteolysis (e.g. Ubiquitin D and Proteosome subunit beta type 9). Furthermore, Salmonella translocation increased serum IFNγ and many interferon-related genes in colonic mucosa. The gene most strongly induced by Salmonella infection was Pancreatitis Associated Protein (Pap), showing >100-fold induction at day 6 after oral infection. Results were confirmed by Q-PCR in individual rats. Stimulation of Salmonella translocation by dietary FOS was accompanied by enhancement of the Salmonella-induced mucosal processes, not by induction of other processes. Conclusion We conclude that the colon is a target tissue for Salmonella, considering the abundant changes in mucosal gene expression

  13. Estradiol-induced gene expression in largemouth bass (Micropterus salmoides)

    USGS Publications Warehouse

    Bowman, C.J.; Kroll, K.J.; Gross, T.G.; Denslow, N.D.


    Vitellogenin (Vtg) and estrogen receptor (ER) gene expression levels were measured in largemouth bass to evaluate the activation of the ER-mediated pathway by estradiol (E2). Single injections of E2 ranging from 0.0005 to 5 mg/kg up-regulated plasma Vtg in a dose-dependent manner. Vtg and ER mRNAs were measured using partial cDNA sequences corresponding to the C-terminal domain for Vtg and the ligand-binding domain of ER?? sequences. After acute E2-exposures (2 mg/kg), Vtg and ER mRNAs and plasma Vtg levels peaked after 2 days. The rate of ER mRNA accumulation peaked 36-42 h earlier than Vtg mRNA. The expression window for ER defines the primary response to E2 in largemouth bass and that for Vtg a delayed primary response. The specific effect of E2 on other estrogen-regulated genes was tested during these same time windows using differential display RT-PCR. Specific up-regulated genes that are expressed in the same time window as Vtg were ERp72 (a membrane-bound disulfide isomerase) and a gene with homology to an expressed gene identified in zebrafish. Genes that were expressed in a pattern that mimics the ER include the gene for zona radiata protein ZP2, and a gene with homology to an expressed gene found in winter flounder. One gene for fibrinogen ?? was down-regulated and an unidentified gene was transiently up-regulated after 12 h of exposure and returned to basal levels by 48 h. Taken together these studies indicate that the acute molecular response to E2 involves a complex network of responses over time. ?? 2002 Elsevier Science Ireland Ltd. All rights reserved.

  14. In vivo footprinting of the estrogen-inducible vitellogenin II gene from chicken.

    PubMed Central

    Philipsen, J N; Hennis, B C; Ab, G


    Protein-DNA interactions in the promoter region of the chicken vitellogenin II gene were analyzed by in vivo dimethylsulphate footprinting with expressing and non-expressing tissues. The reactivity of G-residues is essentially the same in erythrocytes, oviduct and control liver, not expressing the gene. In the expressing estrogen-induced liver we find a number of G-residues with altered reactivities. These G's are located within distinct sequences: the estrogen responsive elements, a sequence resembling the NF-1 recognition motive, and several elements which are conserved between yolk protein genes. The expression-dependent binding of proteins to these sites was confirmed by DNaseI footprinting applied to nuclei isolated from estrogen-induced and control liver. Estradiol appears to establish a transcription complex comprising a number of distinct proteins bound to different sites in the 5' flanking region of the vitellogenin II gene. Images PMID:3186442

  15. A genome-wide association study of the maize hypersensitive defense response identifies genes that cluster in related pathways

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Much remains unknown of molecular events controling the plant hypersensitive response (HR), a rapid localized cell death that limits pathogen spread and is mediated by resistance (R-) genes. Natural modifiers of the ectopic HR phenotype induced by an aberrant auto-active R-gene (Rp1-D21), were mappe...

  16. Gene expression profiling in response to the histone deacetylase inhibitor BL1521 in neuroblastoma

    SciTech Connect

    Ruijter, Annemieke J.M. de; Kemp, Stephan . E-mail:


    Neuroblastoma is a childhood tumor with a poor survival in advanced stage disease despite intensive chemotherapeutic regimes. The new histone deacetylase (HDAC) inhibitor BL1521 has shown promising results in neuroblastoma. Inhibition of HDAC resulted in a decrease in proliferation and metabolic activity, induction of apoptosis and differentiation of neuroblastoma cells. In order to elucidate the mechanism mediating the effects of BL1521 on neuroblastoma cells, we investigated the gene expression profile of an MYCN single copy (SKNAS) and an MYCN amplified (IMR32) neuroblastoma cell line after treatment with BL1521 using the Affymetrix oligonucleotide array U133A. An altered expression of 255 genes was observed in both neuroblastoma cell lines. The majority of these genes were involved in gene expression, cellular metabolism, and cell signaling. We observed changes in the expression of vital genes belonging to the cell cycle (cyclin D1 and CDK4) and apoptosis (BNIP3, BID, and BCL2) pathway in response to BL1521. The expression of 37 genes was altered by both BL1521 and Trichostatin A, which could indicate a common gene set regulated by different HDAC inhibitors. BL1521 treatment changed the expression of a number of MYCN-associated genes. Several genes in the Wnt and the Delta/Notch pathways were changed in response to BL1521 treatment, suggesting that BL1521 is able to induce the differentiation of neuroblastoma cells into a more mature phenotype.

  17. Identification of genes in Xanthomonas campestris pv. vesicatoria induced during its interaction with tomato.


    Tamir-Ariel, Dafna; Navon, Naama; Burdman, Saul


    Xanthomonas campestris pv. vesicatoria is the causal agent of bacterial spot disease of tomato and pepper. The disease process is interactive and very intricate and involves a plethora of genes in the pathogen and in the host. In the pathogen, different genes are activated in response to the changing environment to enable it to survive, adapt, evade host defenses, propagate, and damage the host. To understand the disease process, it is imperative to broaden our understanding of the gene machinery that participates in it, and the most reliable way is to identify these genes in vivo. Here, we have adapted a recombinase-based in vivo expression technology (RIVET) to study the genes activated in X. campestris pv. vesicatoria during its interaction with one of its hosts, tomato. This is the first study that demonstrates the feasibility of this approach for identifying in vivo induced genes in a plant pathogen. RIVET revealed 61 unique X. campestris pv. vesicatoria genes or operons that delineate a picture of the different processes involved in the pathogen-host interaction. To further explore the role of some of these genes, we generated knockout mutants for 13 genes and characterized their ability to grow in planta and to cause disease symptoms. This analysis revealed several genes that may be important for the interaction of the pathogen with its host, including a citH homologue gene, encoding a citrate transporter, which was shown to be required for wild-type levels of virulence. PMID:17573477

  18. Heterogeneity of epigenetic changes at ischemia/reperfusion- and endotoxin-induced acute kidney injury genes

    PubMed Central

    Mar, Daniel; Gharib, Sina A.; Zager, Richard A.; Johnson, Ali; Denisenko, Oleg; Bomsztyk, Karol


    Aberrant gene expression is a molecular hallmark of acute kidney injury (AKI). Since epigenetic processes control gene expression in a cell- and environment-defined manner, understanding the epigenetic pathways that regulate genes altered by AKI may open vital new insights into the complexities of disease pathogenesis and identify possible therapeutic targets. Here we used matrix chromatin immunoprecipitation and integrative analysis to study twenty key permissive and repressive epigenetic histone marks at transcriptionally induced Tnf, Ngal, Kim-1 and Icam-1 genes in mouse models of AKI; unilateral renal ischemia/reperfusion, lipopolysaccharide (LPS) and their synergistically injurious combination. Results revealed unexpected heterogeneity of transcriptional and epigenetic responses. Tnf and Ngal were transcriptionally upregulated in response to both treatments individually, and to combination treatment. Kim-1 was induced by ischemia/reperfusion and Icam-1 by LPS only. Epigenetic alterations at these genes exhibited distinct time-dependent changes that shared some similarities, such as reduction in repressive histone modifications, but also had major ischemia/reperfusion vs. endotoxin differences. Thus, diversity of changes at AKI genes in response to different insults indicates involvement of several epigenetic pathways. This could be exploited pharmacologically through rational-drug design to alter the course and improve clinical outcomes of this syndrome. PMID:26061546

  19. Heterogeneity of epigenetic changes at ischemia/reperfusion- and endotoxin-induced acute kidney injury genes.


    Mar, Daniel; Gharib, Sina A; Zager, Richard A; Johnson, Ali; Denisenko, Oleg; Bomsztyk, Karol


    Aberrant gene expression is a molecular hallmark of acute kidney injury (AKI). As epigenetic processes control gene expression in a cell- and environment-defined manner, understanding the epigenetic pathways that regulate genes altered by AKI may open vital new insights into the complexities of disease pathogenesis and identify possible therapeutic targets. Here we used matrix chromatin immunoprecipitation and integrative analysis to study 20 key permissive and repressive epigenetic histone marks at transcriptionally induced Tnf, Ngal, Kim-1, and Icam-1 genes in mouse models of AKI; unilateral renal ischemia/reperfusion, lipopolysaccharide (LPS), and their synergistically injurious combination. Results revealed unexpected heterogeneity of transcriptional and epigenetic responses. Tnf and Ngal were transcriptionally upregulated in response to both treatments individually, and to combination treatment. Kim-1 was induced by ischemia/reperfusion and Icam-1 by LPS only. Epigenetic alterations at these genes exhibited distinct time-dependent changes that shared some similarities, such as reduction in repressive histone modifications, and also had major ischemia/reperfusion versus endotoxin differences. Thus, diversity of changes at AKI genes in response to different insults indicates involvement of several epigenetic pathways. This could be exploited pharmacologically through rational-drug design to alter the course and improve clinical outcomes of this syndrome. PMID:26061546

  20. UVB-induced gene expression in the skin of Xiphophorus maculatus Jp 163 B☆

    PubMed Central

    Yang, Kuan; Boswell, Mikki; Walter, Dylan J.; Downs, Kevin P.; Gaston-Pravia, Kimberly; Garcia, Tzintzuni; Shen, Yingjia; Mitchell, David L.; Walter, Ronald B.


    Xiphophorus fish and interspecies hybrids represent long-standing models to study the genetics underlying spontaneous and induced tumorigenesis. The recent release of the Xiphophorus maculatus genome sequence will allow global genetic regulation studies of genes involved in the inherited susceptibility to UVB-induced melanoma within select backcross hybrids. As a first step toward this goal, we report results of an RNA-Seq approach to identify genes and pathways showing modulated transcription within the skin of X. maculatus Jp 163 B upon UVB exposure. X. maculatus Jp 163 B were exposed to various doses of UVB followed by RNA-Seq analysis at each dose to investigate overall gene expression in each sample. A total of 357 genes with a minimum expression change of 4-fold (p-adj < 0.05) were identified as responsive to UVB. The molecular genetic response of Xiphophorus skin to UVB exposure permitted assessment of; (1) the basal expression level of each transcript for each skin sample, (2) the changes in expression levels for each gene in the transcriptome upon exposure to increasing doses of UVB, and (3) clusters of genes that exhibit similar patterns of change in expression upon UVB exposure. These data provide a foundation for understanding the molecular genetic response of fish skin to UVB exposure. PMID:24556253

  1. Inducible Knockdown of Plasmodium Gene Expression Using the glmS Ribozyme

    PubMed Central

    Prommana, Parichat; Uthaipibull, Chairat; Wongsombat, Chayaphat; Kamchonwongpaisan, Sumalee; Yuthavong, Yongyuth; Knuepfer, Ellen; Holder, Anthony A.; Shaw, Philip J.


    Conventional reverse genetic approaches for study of Plasmodium malaria parasite gene function are limited, or not applicable. Hence, new inducible systems are needed. Here we describe a method to control P. falciparum gene expression in which target genes bearing a glmS ribozyme in the 3′ untranslated region are efficiently knocked down in transgenic P. falciparum parasites in response to glucosamine inducer. Using reporter genes, we show that the glmS ribozyme cleaves reporter mRNA in vivo leading to reduction in mRNA expression following glucosamine treatment. Glucosamine-induced ribozyme activation led to efficient reduction of reporter protein, which could be rapidly reversed by removing the inducer. The glmS ribozyme was validated as a reverse-genetic tool by integration into the essential gene and antifolate drug target dihydrofolate reductase-thymidylate synthase (PfDHFR-TS). Glucosamine treatment of transgenic parasites led to rapid and efficient knockdown of PfDHFR-TS mRNA and protein. PfDHFR-TS knockdown led to a growth/arrest mutant phenotype and hypersensitivity to pyrimethamine. The glmS ribozyme may thus be a tool for study of essential genes in P. falciparum and other parasite species amenable to transfection. PMID:24023691

  2. 20-hydroxyecdysone upregulates Atg genes to induce autophagy in the Bombyx fat body

    PubMed Central

    Tian, Ling; Ma, Li; Guo, Enen; Deng, Xiaojuan; Ma, Sanyuan; Xia, Qingyou; Cao, Yang; Li, Sheng


    Autophagy is finely regulated at multiple levels and plays crucial roles in development and disease. In the fat body of the silkworm, Bombyx mori, autophagy occurs and Atg gene expression peaks during the nonfeeding molting and pupation stages when the steroid hormone (20-hydroxyecdysone; 20E) is high. Injection of 20E into the feeding larvae upregulated Atg genes and reduced TORC1 activity resulting in autophagy induction in the fat body. Conversely, RNAi knockdown of the 20E receptor partner (USP) or targeted overexpression of a dominant negative mutant of the 20E receptor (EcRDN) in the larval fat body reduced autophagy and downregulated the Atg genes, confirming the importance of 20E-induction of Atg gene expression during pupation. Moreover, in vitro treatments of the larval fat body with 20E upregulated the Atg genes. Five Atg genes were potentially 20E primary-responsive, and a 20E response element was identified in the Atg1 (ortholog of human ULK1) promoter region. Furthermore, RNAi knockdown of 4 key genes (namely Br-C, E74, HR3 and βftz-F1) in the 20E-triggered transcriptional cascade reduced autophagy and downregulated Atg genes to different levels. Taken together, we conclude that in addition to blocking TORC1 activity for autophagosome initiation, 20E upregulates Atg genes to induce autophagy in the Bombyx fat body. PMID:23674061

  3. Light-Inducible Gene Regulation with Engineered Zinc Finger Proteins

    PubMed Central

    Polstein, Lauren R.; Gersbach, Charles A.


    The coupling of light-inducible protein-protein interactions with gene regulation systems has enabled the control of gene expression with light. In particular, heterodimer protein pairs from plants can be used to engineer a gene regulation system in mammalian cells that is reversible, repeatable, tunable, controllable in a spatiotemporal manner, and targetable to any DNA sequence. This system, Light-Inducible Transcription using Engineered Zinc finger proteins (LITEZ), is based on the blue light-induced interaction of GIGANTEA and the LOV domain of FKF1 that drives the localization of a transcriptional activator to the DNA-binding site of a highly customizable engineered zinc finger protein. This chapter provides methods for modifying LITEZ to target new DNA sequences, engineering a programmable LED array to illuminate cell cultures, and using the modified LITEZ system to achieve spatiotemporal control of transgene expression in mammalian cells. PMID:24718797

  4. Conservation of the Low-shear Modeled Microgravity Response in Enterobacteriaceae and Analysis of the trp Genes in this Response.


    Soni, Anjali; O'Sullivan, Laura; Quick, Laura N; Ott, C Mark; Nickerson, Cheryl A; Wilson, James W


    Low fluid shear force, including that encountered in microgravity models, induces bacterial responses, but the range of bacteria capable of responding to this signal remains poorly characterized. We systematically analyzed a range of Gram negative Enterobacteriaceae for conservation of the low-shear modeled microgravity (LSMMG) response using phenotypic assays, qPCR, and targeted mutations. Our results indicate LSMMG response conservation across Enterobacteriacae with potential variance in up- or down-regulation of a given response depending on genus. Based on the data, we analyzed the role of the trp operon genes and the TrpR regulator in the LSMMG response using targeted mutations in these genes in S. Typhimurium and E. coli. We found no alteration of the LSMMG response compared to WT in these mutant strains under the conditions tested here. To our knowledge, this study is first-of-kind for Citrobacter, Enterobacter, and Serratia, presents novel data for Escherichia, and provides the first analysis of trp genes in LSMMG responses. This impacts our understanding of how LSMMG affects bacteria and our ability to modify bacteria with this condition in the future. PMID:25006354

  5. Down-Regulation of Gene Expression by RNA-Induced Gene Silencing

    NASA Astrophysics Data System (ADS)

    Travella, Silvia; Keller, Beat

    Down-regulation of endogenous genes via post-transcriptional gene silencing (PTGS) is a key to the characterization of gene function in plants. Many RNA-based silencing mechanisms such as post-transcriptional gene silencing, co-suppression, quelling, and RNA interference (RNAi) have been discovered among species of different kingdoms (plants, fungi, and animals). One of the most interesting discoveries was RNAi, a sequence-specific gene-silencing mechanism initiated by the introduction of double-stranded RNA (dsRNA), homologous in sequence to the silenced gene, which triggers degradation of mRNA. Infection of plants with modified viruses can also induce RNA silencing and is referred to as virus-induced gene silencing (VIGS). In contrast to insertional mutagenesis, these emerging new reverse genetic approaches represent a powerful tool for exploring gene function and for manipulating gene expression experimentally in cereal species such as barley and wheat. We examined how RNAi and VIGS have been used to assess gene function in barley and wheat, including molecular mechanisms involved in the process and available methodological elements, such as vectors, inoculation procedures, and analysis of silenced phenotypes.

  6. cis-Jasmone induces Arabidopsis genes that affect the chemical ecology of multitrophic interactions with aphids and their parasitoids

    PubMed Central

    Bruce, Toby J. A.; Matthes, Michaela C.; Chamberlain, Keith; Woodcock, Christine M.; Mohib, Abdul; Webster, Ben; Smart, Lesley E.; Birkett, Michael A.; Pickett, John A.; Napier, Johnathan A.


    It is of adaptive value for a plant to prepare its defenses when a threat is detected, and certain plant volatiles associated with insect damage, such as cis-jasmone (CJ), are known to switch-on defense metabolism. We used aphid and aphid parasitoid responses to Arabidopsis thaliana as a model system for studying gene expression and defense chemistry and its impact at different trophic levels. Differential responses to volatiles of induced Arabidopsis occurred for specialist and generalist insects: the generalist aphid, Myzus persicae, was repelled, whereas the specialist, Lipaphis erysimi, was attracted; the generalist aphid parasitoid Aphidius ervi was attracted, but the specialist parasitoid Diaeretiella rapae was not affected. A. ervi also spent longer foraging on induced plants than on untreated ones. Transcriptomic analyses of CJ-induced Arabidopsis plants revealed that a limited number of genes, including a gene for a cytochrome P450, CYP81D11, were strongly up-regulated in the treated plants. We examined transgenic Arabidopsis lines constitutively overexpressing this gene in bioassays and found insect responses similar to those obtained for wild-type plants induced with CJ, indicating the importance of this gene in the CJ-activated defense response. Genes involved in glucosinolate biosynthesis and catabolism are unaffected by CJ and, because these genes relate to interactions with herbivores and parasitoids specific to this family of plants (Brassicaceae), this finding may explain the differences in behavioral response of specialist and generalist insects. PMID:18356298

  7. Treatment-induced cell cycle kinetics dictate tumor response to chemotherapy

    PubMed Central

    Hallett, Robin M.; Huang, Cheng; Motazedian, Ali; Auf der Mauer, Stefanie; Pond, Gregory R.; Hassell, John A.; Nordon, Robert E.; Draper, Jonathan S.


    Chemotherapy fails to provide durable cure for the majority of cancer patients. To identify mechanisms associated with chemotherapy resistance, we identified genes differentially expressed before and after chemotherapeutic treatment of breast cancer patients. Treatment response resulted in either increased or decreased cell cycle gene expression. Tumors in which cell cycle gene expression was increased by chemotherapy were likely to be chemotherapy sensitive, whereas tumors in which cell cycle gene transcripts were decreased by chemotherapy were resistant to these agents. A gene expression signature that predicted these changes proved to be a robust and novel index that predicted the response of patients with breast, ovarian, and colon tumors to chemotherapy. Investigations in tumor cell lines supported these findings, and linked treatment induced cell cycle changes with p53 signaling and G1/G0 arrest. Hence, chemotherapy resistance, which can be predicted based on dynamics in cell cycle gene expression, is associated with TP53 integrity. PMID:25749523

  8. Hydrogen-peroxide-induced oxidative stress responses in Desulfovibrio vulgaris Hildenborough

    SciTech Connect

    Zhou, A.; He, Z.; Redding-Johanson, A.M.; Mukhopadhyay, A.; Hemme, C.L.; Joachimiak, M.P.; Bender, K.S.; Keasling, J.D.; Stahl, D.A.; Fields, M.W.; Hazen, T.C.; Arkin, A.P.; Wall, J.D.; Zhou, J.; Luo, F.; Deng, Y.; He, Q.


    To understand how sulphate-reducing bacteria respond to oxidative stresses, the responses of Desulfovibrio vulgaris Hildenborough to H{sub 2}O{sub 2}-induced stresses were investigated with transcriptomic, proteomic and genetic approaches. H{sub 2}O{sub 2} and induced chemical species (e.g. polysulfide, ROS) and redox potential shift increased the expressions of the genes involved in detoxification, thioredoxin-dependent reduction system, protein and DNA repair, and decreased those involved in sulfate reduction, lactate oxidation and protein synthesis. A gene coexpression network analysis revealed complicated network interactions among differentially expressed genes, and suggested possible importance of several hypothetical genes in H{sub 2}O{sub 2} stress. Also, most of the genes in PerR and Fur regulons were highly induced, and the abundance of a Fur regulon protein increased. Mutant analysis suggested that PerR and Fur are functionally overlapped in response to stresses induced by H{sub 2}O{sub 2} and reaction products, and the upregulation of thioredoxin-dependent reduction genes was independent of PerR or Fur. It appears that induction of those stress response genes could contribute to the increased resistance of deletion mutants to H{sub 2}O{sub 2}-induced stresses. In addition, a conceptual cellular model of D. vulgaris responses to H{sub 2}O{sub 2} stress was constructed to illustrate that this bacterium may employ a complicated molecular mechanism to defend against the H{sub 2}O{sub 2}-induced stresses.

  9. Reduced Tyk2 gene expression in β-cells due to natural mutation determines susceptibility to virus-induced diabetes.


    Izumi, Kenichi; Mine, Keiichiro; Inoue, Yoshitaka; Teshima, Miho; Ogawa, Shuichiro; Kai, Yuji; Kurafuji, Toshinobu; Hirakawa, Kanako; Miyakawa, Daiki; Ikeda, Haruka; Inada, Akari; Hara, Manami; Yamada, Hisakata; Akashi, Koichi; Niho, Yoshiyuki; Ina, Keisuke; Kobayashi, Takashi; Yoshikai, Yasunobu; Anzai, Keizo; Yamashita, Teruo; Minagawa, Hiroko; Fujimoto, Shuji; Kurisaki, Hironori; Shimoda, Kazuya; Katsuta, Hitoshi; Nagafuchi, Seiho


    Accumulating evidence suggests that viruses play an important role in the development of diabetes. Although the diabetogenic encephalomyocarditis strain D virus induces diabetes in restricted lines of inbred mice, the susceptibility genes to virus-induced diabetes have not been identified. We report here that novel Tyrosine kinase 2 (Tyk2) gene mutations are present in virus-induced diabetes-sensitive SJL and SWR mice. Mice carrying the mutant Tyk2 gene on the virus-resistant C57BL/6 background are highly sensitive to virus-induced diabetes. Tyk2 gene expression is strongly reduced in Tyk2-mutant mice, associated with low Tyk2 promoter activity, and leads to decreased expression of interferon-inducible genes, resulting in significantly compromised antiviral response. Tyk2-mutant pancreatic β-cells are unresponsive even to high dose of Type I interferon. Reversal of virus-induced diabetes could be achieved by β-cell-specific Tyk2 gene expression. Thus, reduced Tyk2 gene expression in pancreatic β-cells due to natural mutation is responsible for susceptibility to virus-induced diabetes. PMID:25849081

  10. Reduced Tyk2 gene expression in β-cells due to natural mutation determines susceptibility to virus-induced diabetes

    PubMed Central

    Izumi, Kenichi; Mine, Keiichiro; Inoue, Yoshitaka; Teshima, Miho; Ogawa, Shuichiro; Kai, Yuji; Kurafuji, Toshinobu; Hirakawa, Kanako; Miyakawa, Daiki; Ikeda, Haruka; Inada, Akari; Hara, Manami; Yamada, Hisakata; Akashi, Koichi; Niho, Yoshiyuki; Ina, Keisuke; Kobayashi, Takashi; Yoshikai, Yasunobu; Anzai, Keizo; Yamashita, Teruo; Minagawa, Hiroko; Fujimoto, Shuji; Kurisaki, Hironori; Shimoda, Kazuya; Katsuta, Hitoshi; Nagafuchi, Seiho


    Accumulating evidence suggests that viruses play an important role in the development of diabetes. Although the diabetogenic encephalomyocarditis strain D virus induces diabetes in restricted lines of inbred mice, the susceptibility genes to virus-induced diabetes have not been identified. We report here that novel Tyrosine kinase 2 (Tyk2) gene mutations are present in virus-induced diabetes-sensitive SJL and SWR mice. Mice carrying the mutant Tyk2 gene on the virus-resistant C57BL/6 background are highly sensitive to virus-induced diabetes. Tyk2 gene expression is strongly reduced in Tyk2-mutant mice, associated with low Tyk2 promoter activity, and leads to decreased expression of interferon-inducible genes, resulting in significantly compromised antiviral response. Tyk2-mutant pancreatic β-cells are unresponsive even to high dose of Type I interferon. Reversal of virus-induced diabetes could be achieved by β-cell-specific Tyk2 gene expression. Thus, reduced Tyk2 gene expression in pancreatic β-cells due to natural mutation is responsible for susceptibility to virus-induced diabetes. PMID:25849081

  11. High Intensity Focused Ultrasound induced Gene Activation in Solid Tumors

    NASA Astrophysics Data System (ADS)

    Liu, Yunbo; Kon, Takashi; Li, Chuanyuan; Zhong, Pei


    In this work, the feasibility of using high intensity focused ultrasound (HIFU) to activate trans-gene expression in a mouse tumor model was investigated. 4T1 cancer cells were implanted subcutaneously in the hind limbs of Balb/C mice and adenovirus luciferase gene vectors under the control of heat shock protein 70B promoter (Adeno-hsp70B-Luc) were injected intratumoraly for gene transfection. One day following the virus injection, the transfected tumors were heated to a peak temperature of 55, 65, 75, and 85°C, respectively, in 10s at multiple sites around the center of the tumor using a HIFU transducer operated at either 1.1-MHz (fundamental) or 3.3-MHz (3rd harmonic) frequency. Inducible luciferase gene expression was found to vary from 15-fold to 120-fold of the control group following 1.1-MHz HIFU exposure. The maximum gene activation was produced at a peak temperature of 65˜75°C one day following HIFU exposure and decayed gradually to baseline level within 7 days. The inducible gene activation produced by 3.3-MHz HIFU exposure (75°C-10s) was found to be comparable to that produced by hyperthermia (42°C-30min). Altogether, these results demonstrate the feasibility of using HIFU as a simple and versatile physical means to regulate trans-gene expression in vivo. This unique feature may be explored in the future for a synergistic combination of HIFU-induced thermal ablation with heat-induced gene therapy for improved cancer therapy.

  12. Gene response profiles for Daphnia pulex exposed to the environmental stressor cadmium reveals novel crustacean metallothioneins

    PubMed Central

    Shaw, Joseph R; Colbourne, John K; Davey, Jennifer C; Glaholt, Stephen P; Hampton, Thomas H; Chen, Celia Y; Folt, Carol L; Hamilton, Joshua W


    Background Genomic research tools such as microarrays are proving to be important resources to study the complex regulation of genes that respond to environmental perturbations. A first generation cDNA microarray was developed for the environmental indicator species Daphnia pulex, to identify genes whose regulation is modulated following exposure to the metal stressor cadmium. Our experiments revealed interesting changes in gene transcription that suggest their biological roles and their potentially toxicological features in responding to this important environmental contaminant. Results Our microarray identified genes reported in the literature to be regulated in response to cadmium exposure, suggested functional attributes for genes that share no sequence similarity to proteins in the public databases, and pointed to genes that are likely members of expanded gene families in the Daphnia genome. Genes identified on the microarray also were associated with cadmium induced phenotypes and population-level outcomes that we experimentally determined. A subset of genes regulated in response to cadmium exposure was independently validated using quantitative-realtime (Q-RT)-PCR. These microarray studies led to the discovery of three genes coding for the metal detoxication protein metallothionein (MT). The gene structures and predicted translated sequences of D. pulex MTs clearly place them in this gene family. Yet, they share little homology with previously characterized MTs. Conclusion The genomic information obtained from this study represents an important first step in characterizing microarray patterns that may be diagnostic to specific environmental contaminants and give insights into their toxicological mechanisms, while also providing a practical tool for evolutionary, ecological, and toxicological functional gene discovery studies. Advances in Daphnia genomics will enable the further development of this species as a model organism for the environmental sciences

  13. Transcriptome analysis reveals genes commonly induced by Botrytis cinerea infection, cold, drought and oxidative stresses in Arabidopsis.


    Sham, Arjun; Al-Azzawi, Ahmed; Al-Ameri, Salma; Al-Mahmoud, Bassam; Awwad, Falah; Al-Rawashdeh, Ahmed; Iratni, Rabah; AbuQamar, Synan


    Signaling pathways controlling biotic and abiotic stress responses may interact synergistically or antagonistically. To identify the similarities and differences among responses to diverse stresses, we analyzed previously published microarray data on the transcriptomic responses of Arabidopsis to infection with Botrytis cinerea (a biotic stress), and to cold, drought, and oxidative stresses (abiotic stresses). Our analyses showed that at early stages after B. cinerea inoculation, 1498 genes were up-regulated (B. cinerea up-regulated genes; BUGs) and 1138 genes were down-regulated (B. cinerea down-regulated genes; BDGs). We showed a unique program of gene expression was activated in response each biotic and abiotic stress, but that some genes were similarly induced or repressed by all of the tested stresses. Of the identified BUGs, 25%, 6% and 12% were also induced by cold, drought and oxidative stress, respectively; whereas 33%, 7% and 5.5% of the BDGs were also down-regulated by the same abiotic stresses. Coexpression and protein-protein interaction network analyses revealed a dynamic range in the expression levels of genes encoding regulatory proteins. Analysis of gene expression in response to electrophilic oxylipins suggested that these compounds are involved in mediating responses to B. cinerea infection and abiotic stress through TGA transcription factors. Our results suggest an overlap among genes involved in the responses to biotic and abiotic stresses in Arabidopsis. Changes in the transcript levels of genes encoding components of the cyclopentenone signaling pathway in response to biotic and abiotic stresses suggest that the oxylipin signal transduction pathway plays a role in plant defense. Identifying genes that are commonly expressed in response to environmental stresses, and further analyzing the functions of their encoded products, will increase our understanding of the plant stress response. This information could identify targets for genetic

  14. Transcriptome Analysis Reveals Genes Commonly Induced by Botrytis cinerea Infection, Cold, Drought and Oxidative Stresses in Arabidopsis

    PubMed Central

    Al-Ameri, Salma; Al-Mahmoud, Bassam; Awwad, Falah; Al-Rawashdeh, Ahmed; Iratni, Rabah; AbuQamar, Synan


    Signaling pathways controlling biotic and abiotic stress responses may interact synergistically or antagonistically. To identify the similarities and differences among responses to diverse stresses, we analyzed previously published microarray data on the transcriptomic responses of Arabidopsis to infection with Botrytis cinerea (a biotic stress), and to cold, drought, and oxidative stresses (abiotic stresses). Our analyses showed that at early stages after B. cinerea inoculation, 1498 genes were up-regulated (B. cinerea up-regulated genes; BUGs) and 1138 genes were down-regulated (B. cinerea down-regulated genes; BDGs). We showed a unique program of gene expression was activated in response each biotic and abiotic stress, but that some genes were similarly induced or repressed by all of the tested stresses. Of the identified BUGs, 25%, 6% and 12% were also induced by cold, drought and oxidative stress, respectively; whereas 33%, 7% and 5.5% of the BDGs were also down-regulated by the same abiotic stresses. Coexpression and protein-protein interaction network analyses revealed a dynamic range in the expression levels of genes encoding regulatory proteins. Analysis of gene expression in response to electrophilic oxylipins suggested that these compounds are involved in mediating responses to B. cinerea infection and abiotic stress through TGA transcription factors. Our results suggest an overlap among genes involved in the responses to biotic and abiotic stresses in Arabidopsis. Changes in the transcript levels of genes encoding components of the cyclopentenone signaling pathway in response to biotic and abiotic stresses suggest that the oxylipin signal transduction pathway plays a role in plant defense. Identifying genes that are commonly expressed in response to environmental stresses, and further analyzing the functions of their encoded products, will increase our understanding of the plant stress response. This information could identify targets for genetic

  15. Inducible gene expression from the plastid genome by a synthetic riboswitch.


    Verhounig, Andreas; Karcher, Daniel; Bock, Ralph


    Riboswitches are natural RNA sensors that regulate gene expression in response to ligand binding. Riboswitches have been identified in prokaryotes and eukaryotes but are unknown in organelles (mitochondria and plastids). Here we have tested the possibility to engineer riboswitches for plastids (chloroplasts), a genetic system that largely relies on translational control of gene expression. To this end, we have used bacterial riboswitches and modified them in silico to meet the requirements of translational regulation in plastids. These engineered switches were then tested for functionality in vivo by stable transformation of the tobacco chloroplast genome. We report the identification of a synthetic riboswitch that functions as an efficient translational regulator of gene expression in plastids in response to its exogenously applied ligand theophylline. This riboswitch provides a novel tool for plastid genome engineering that facilitates the tightly regulated inducible expression of chloroplast genes and transgenes and thus has wide applications in functional genomics and biotechnology. PMID:20308585

  16. Inducible gene expression from the plastid genome by a synthetic riboswitch

    PubMed Central

    Verhounig, Andreas; Karcher, Daniel; Bock, Ralph


    Riboswitches are natural RNA sensors that regulate gene expression in response to ligand binding. Riboswitches have been identified in prokaryotes and eukaryotes but are unknown in organelles (mitochondria and plastids). Here we have tested the possibility to engineer riboswitches for plastids (chloroplasts), a genetic system that largely relies on translational control of gene expression. To this end, we have used bacterial riboswitches and modified them in silico to meet the requirements of translational regulation in plastids. These engineered switches were then tested for functionality in vivo by stable transformation of the tobacco chloroplast genome. We report the identification of a synthetic riboswitch that functions as an efficient translational regulator of gene expression in plastids in response to its exogenously applied ligand theophylline. This riboswitch provides a novel tool for plastid genome engineering that facilitates the tightly regulated inducible expression of chloroplast genes and transgenes and thus has wide applications in functional genomics and biotechnology. PMID:20308585

  17. The Xenopus Emx genes identify presumptive dorsal telencephalon and are induced by head organizer signals.


    Pannese, M; Lupo, G; Kablar, B; Boncinelli, E; Barsacchi, G; Vignali, R


    We have isolated and studied the expression pattern of Xemx1 and Xemx2 genes in Xenopus laevis. Xemx genes are the homologues of mouse Emx genes, related to Drosophila empty spiracles. They are expressed in selected regions of the developing brain, particularly in the telencephalon, and, outside the brain, in the otic vesicles, olfactory placodes, visceral arches and the developing excretory system. We also report on experiments concerning the tissue and molecular signals responsible for their activation in competent ectoderm. Xemx genes are activated in ectoderm conjugated with head organizer tissue, but not with tail organizer tissue. Furthermore, they are not activated in animal cap either by noggin or by Xnr3, thus suggesting that a different inducer or the integration of several signals may be responsible for their activation. PMID:9545539


    SciTech Connect

    Mann, David George James; McKnight, Timothy E; Mcpherson, Jackson; Hoyt, Peter R; Melechko, Anatoli Vasilievich; Simpson, Michael L; Sayler, Gary Steven


    RNA interference has become a powerful biological tool over the last decade. In this study, a tetracycline-inducible shRNA vector system was designed for silencing CFP expression and introduced alongside the yfp marker gene into Chinese hamster ovary cells using spatially indexed vertically aligned carbon nanofiber arrays (VACNFs) in a gene delivery process termed impalefection. The VACNF architecture provided simultaneous delivery of multiple genes, subsequent adherence and proliferation of interfaced cells, and repeated monitoring of single cells over time. 24 hours after nanofiber-mediated delivery, 53.1% 10.4% of the cells that expressed the yfp marker gene were also fully silenced by the inducible CFP-silencing shRNA vector. Additionally, efficient CFP-silencing was observed in single cells among a population of cells that remained CFP-expressing. This effective transient expression system enables rapid analysis of gene silencing effects using RNAi in single cells and cell populations.

  19. Genetics of gene expression responses to temperature stress in a sea urchin gene network.


    Runcie, Daniel E; Garfield, David A; Babbitt, Courtney C; Wygoda, Jennifer A; Mukherjee, Sayan; Wray, Gregory A


    Stress responses play an important role in shaping species distributions and robustness to climate change. We investigated how stress responses alter the contribution of additive genetic variation to gene expression during development of the purple sea urchin, Strongylocentrotus purpuratus, under increased temperatures that model realistic climate change scenarios. We first measured gene expression responses in the embryos by RNA-seq to characterize molecular signatures of mild, chronic temperature stress in an unbiased manner. We found that an increase from 12 to 18 °C caused widespread alterations in gene expression including in genes involved in protein folding, RNA processing and development. To understand the quantitative genetic architecture of this response, we then focused on a well-characterized gene network involved in endomesoderm and ectoderm specification. Using a breeding design with wild-caught individuals, we measured genetic and gene-environment interaction effects on 72 genes within this network. We found genetic or maternal effects in 33 of these genes and that the genetic effects were correlated in the network. Fourteen network genes also responded to higher temperatures, but we found no significant genotype-environment interactions in any of the genes. This absence may be owing to an effective buffering of the temperature perturbations within the network. In support of this hypothesis, perturbations to regulatory genes did not affect the expression of the genes that they regulate. Together, these results provide novel insights into the relationship between environmental change and developmental evolution and suggest that climate change may not expose large amounts of cryptic genetic variation to selection in this species. PMID:22856327

  20. Molecular dissection of the roles of the SOD genes in mammalian response to low dose irradiation

    SciTech Connect

    Eric Y. Chuang


    It has been long recognized that a significant fraction of the radiation-induced genetic damage to cells are caused by secondary oxidative species. Internal cellular defense systems against oxidative stress play significant roles in countering genetic damage induced by ionizing radiation. The role of the detoxifying enzymes may be even more prominent in the case of low-dose, low-LET irradiation, as the majority of genetic damage may be caused by secondary oxidative species. In this study we have attempted to decipher the roles of the superoxide dismutase (SOD) genes, which are responsible for detoxifying the superoxide anions. We used adenovirus vectors to deliver RNA interference (RNAi or siRNA) technology to down-regulate the expression levels of the SOD genes. We have also over-expressed the SOD genes by use of recombinant adenovirus vectors. Cells infected with the vectors were then subjected to low dose γ-irradiation. Total RNA were extracted from the exposed cells and the expression of 9000 genes were profiled by use of cDNA microarrays. The result showed that low dose radiation had clear effects on gene expression in HCT116 cells. Both over-expression and down-regulation of the SOD1 gene can change the expression profiles of sub-groups of genes. Close to 200 of the 9000 genes examined showed over two-fold difference in expression under various conditions. Genes with changed expression pattern belong to many categories that include: early growth response, DNA-repair, ion transport, apoptosis, and cytokine response.

  1. Interplay between cold-responsive gene regulation, metabolism and RNA processing during plant cold acclimation.


    Zhu, Jianhua; Dong, Chun-Hai; Zhu, Jian-Kang


    Temperate plants are capable of developing freezing tolerance when they are exposed to low nonfreezing temperatures. Acquired freezing tolerance involves extensive reprogramming of gene expression and metabolism. Recent full-genome transcript profiling studies, in combination with mutational and transgenic plant analyses, have provided a snapshot of the complex transcriptional network that operates under cold stress. Ubiquitination-mediated proteosomal protein degradation has a crucial role in regulating one of the upstream transcription factors, INDUCER OF CBF EXPRESSION 1 (ICE1), and thus in controlling the cold-responsive transcriptome. The changes in expression of hundreds of genes in response to cold temperatures are followed by increases in the levels of hundreds of metabolites, some of which are known to have protective effects against the damaging effects of cold stress. Genetic analysis has revealed important roles for cellular metabolic signals, and for RNA splicing, export and secondary structure unwinding, in regulating cold-responsive gene expression and chilling and freezing tolerance. PMID:17468037

  2. Living without Oxygen: Anoxia-Responsive Gene Expression and Regulation.


    Larade, Kevin; Storey, Kenneth B


    Many species of marine mollusks demonstrate exceptional capacities for long term survival without oxygen. Analysis of gene expression under anoxic conditions, including the subsequent translational responses, allows examination of the functional mechanisms that support and regulate natural anaerobiosis and permit noninjurious transitions between aerobic and anoxic states. Identification of stress-specific gene expression can provide important insights into the metabolic adaptations that are needed for anoxia tolerance, with potential applications to anoxia-intolerant systems. Various methods are available to do this, including high throughput microarray screening and construction and screening of cDNA libraries. Anoxia-responsive genes have been identified in mollusks; some have known functions in other organisms but were not previously linked with anoxia survival. In other cases, completely novel anoxia-responsive genes have been discovered, some that show known motifs or domains that hint at function. Selected genes are expressed at different times over an anoxia-recovery time course with their transcription and translation being actively regulated to ensure protein expression at the optimal time. An examination of transcript status over the course of anoxia exposure and subsequent aerobic recovery identifies genes, and the proteins that they encode, that enhance cell survival under oxygen-limited conditions. Analysis of data generated from non-mainstream model systems allows for insight into the response by cells to anoxia stress. PMID:19794879

  3. Ezrin Inhibition Up-regulates Stress Response Gene Expression.


    Çelik, Haydar; Bulut, Gülay; Han, Jenny; Graham, Garrett T; Minas, Tsion Z; Conn, Erin J; Hong, Sung-Hyeok; Pauly, Gary T; Hayran, Mutlu; Li, Xin; Özdemirli, Metin; Ayhan, Ayşe; Rudek, Michelle A; Toretsky, Jeffrey A; Üren, Aykut


    Ezrin is a member of the ERM (ezrin/radixin/moesin) family of proteins that links cortical cytoskeleton to the plasma membrane. High expression of ezrin correlates with poor prognosis and metastasis in osteosarcoma. In this study, to uncover specific cellular responses evoked by ezrin inhibition that can be used as a specific pharmacodynamic marker(s), we profiled global gene expression in osteosarcoma cells after treatment with small molecule ezrin inhibitors, NSC305787 and NSC668394. We identified and validated several up-regulated integrated stress response genes including PTGS2, ATF3, DDIT3, DDIT4, TRIB3, and ATF4 as novel ezrin-regulated transcripts. Analysis of transcriptional response in skin and peripheral blood mononuclear cells from NSC305787-treated mice compared with a control group revealed that, among those genes, the stress gene DDIT4/REDD1 may be used as a surrogate pharmacodynamic marker of ezrin inhibitor compound activity. In addition, we validated the anti-metastatic effects of NSC305787 in reducing the incidence of lung metastasis in a genetically engineered mouse model of osteosarcoma and evaluated the pharmacokinetics of NSC305787 and NSC668394 in mice. In conclusion, our findings suggest that cytoplasmic ezrin, previously considered a dormant and inactive protein, has important functions in regulating gene expression that may result in down-regulation of stress response genes. PMID:27137931

  4. Identification of avian RIG-I responsive genes during influenza infection

    PubMed Central

    Barber, Megan RW; Aldridge, Jerry R; Fleming-Canepa, Ximena; Wang, Yong-Dong; Webster, Robert G; Magor, Katharine E


    Ducks can survive infection with highly pathogenic avian influenza viruses that are lethal to chickens. We showed that the influenza detector, RIG-I, can initiate antiviral responses in ducks, but this gene is absent in chickens. We can reconstitute this pathway by transfecting chicken DF-1 embryonic fibroblast cells with duck RIG-I, which augments their antiviral response to influenza and decreases viral titre. However, the genes downstream of duck RIG-I that mediate this antiviral response to influenza are not known. Using microarrays, we compared the transcriptional profile of chicken embryonic fibroblasts transfected with duck RIG-I or empty vector, and infected with low or highly pathogenic avian influenza viruses. Transfected duck RIG-I expressed in chicken cells was associated with the marked induction of many antiviral innate immune genes upon infection with both viruses. We used real-time PCR to confirm upregulation of a subset of these antiviral genes including MX1, PKR, IFIT5, OASL, IFNB, and downregulation of the influenza matrix gene. These results provide some insight into the genes induced by duck RIG-I upon influenza infection, and provide evidence that duck RIG-I can function to elicit an interferon-driven, antiviral response against influenza in chicken embryonic fibroblasts. PMID:23220072

  5. Complex regulation of heat shock- and glucose-responsive genes in human cells

    SciTech Connect

    Watowich, S.S.; Morimoto, R.I.


    The authors isolated a human genomic clone that encodes the glucose-responsive protein GRP78 and have used this cloned gene probe, together with a cloned HSP70 gene, to study the expression of both stress-induced genes in response to inhibitors of cellular metabolism. On the basis of the effects of this group of chemicals on GRP78 and HSP70 expression, the authors identified three classes of stress gene inducers. The first class induces GRP78 expression and includes inhibitors of glycoprotein processing. The second class results in coordinate activation of both GRP78 and HSP70 synthesis and includes amino acid analogs and heavy metals. Chemicals in the third class coordinately induce GRP78 and repress HSP70 expression; this class includes the calcium ionophore A23187 and the glucose analog 2-deoxyglucose. Whereas induction of GRP78 or HSP70 expression is primarily due to transcriptional activation, chemicals that repress HSP70 expression act through posttranscriptional regulation. These results reveal that the regulation of GRP78 and HSP70 expression is complex and may be dependent on the specificity and magnitude of physiological damage.

  6. Fluoroquinolone-induced gene transfer in multidrug-resistant Salmonella

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Fluoroquinolones are broad spectrum antibiotics that inhibit bacterial DNA gyrase and topoisomerase activity. Bacterial exposure to fluoroquinolones can cause DNA damage and induce a bacterial SOS response to stimulate repair of damaged DNA. Certain prophages (integrated in bacterial chromosomes) ...

  7. Rapid Determination of Gene Function by Virus-induced Gene Silencing in Wheat and Barley

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The cereal crops are essential components to the human and animal food supply. Solutions to many of the problems challenging cereal production will require identification of genes responsible for particular traits. Unfortunately, the process of identifying gene function is very slow and complex in...

  8. Rapid Determination of Gene Function by Virus-Induced Gene Silencing in Wheat and Barley

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The cereal crops are essential components to the human and animal food supply. Solutions to many of the problems challenging cereal production will require identification of genes responsible for particular traits. Unfortunately, the process of identifying gene function is very slow and complex in ...

  9. Sucralose Induces Biochemical Responses in Daphnia magna

    PubMed Central

    Eriksson Wiklund, Ann-Kristin; Adolfsson-Erici, Margaretha; Liewenborg, Birgitta; Gorokhova, Elena


    The intense artificial sweetener sucralose has no bioconcentration properties, and no adverse acute toxic effects have been observed in standard ecotoxicity tests, suggesting negligible environmental risk. However, significant feeding and behavioural alterations have been reported in non-standard tests using aquatic crustaceans, indicating possible sublethal effects. We hypothesized that these effects are related to alterations in acetylcholinesterase (AChE) and oxidative status in the exposed animals and investigated changes in AChE and oxidative biomarkers (oxygen radical absorbing capacity, ORAC, and lipid peroxidation, TBARS) in the crustacean Daphnia magna exposed to sucralose (0.0001–5 mg L−1). The sucralose concentration was a significant positive predictor for ORAC, TBARS and AChE in the daphnids. Moreover, the AChE response was linked to both oxidative biomarkers, with positive and negative relationships for TBARS and ORAC, respectively. These joint responses support our hypothesis and suggest that exposure to sucralose may induce neurological and oxidative mechanisms with potentially important consequences for animal behaviour and physiology. PMID:24699280

  10. Peripherally restricted acute phase response to a viral mimic alters hippocampal gene expression.


    Michalovicz, Lindsay T; Konat, Gregory W


    We have previously shown that peripherally restricted acute phase response (APR) elicited by intraperitoneal (i.p.) injection of a viral mimic, polyinosinic-polycytidylic acid (PIC), renders the brain hypersusceptible to excitotoxic insult as seen from profoundly exacerbated kainic acid (KA)-induced seizures. In the present study, we found that this hypersusceptibility was protracted for up to 72 h. RT-PCR profiling of hippocampal gene expression revealed rapid upregulation of 23 genes encoding cytokines, chemokines and chemokine receptors generally within 6 h after PIC challenge. The expression of most of these genes decreased by 24 h. However, two chemokine genes, i.e., Ccl19 and Cxcl13 genes, as well as two chemokine receptor genes, Ccr1 and Ccr7, remained upregulated for 72 h suggesting their possible involvement in the induction and sustenance of seizure hypersusceptibility. Also, 12 genes encoding proteins related to glutamatergic and GABAergic neurotransmission featured initial upregulation or downregulation followed by gradual normalization. The upregulation of the Gabrr3 gene remained upregulated at 72 h, congruent with its plausible role in the hypersusceptible phenotype. Moreover, the expression of ten microRNAs (miRs) was rapidly affected by PIC challenge, but their levels generally exhibited oscillating profiles over the time course of seizure hypersusceptibility. These results indicate that protracted seizure susceptibility following peripheral APR is associated with a robust polygenic response in the hippocampus. PMID:24363211

  11. Roles of factorial noise in inducing bimodal gene expression.


    Liu, Peijiang; Yuan, Zhanjiang; Huang, Lifang; Zhou, Tianshou


    Some gene regulatory systems can exhibit bimodal distributions of mRNA or protein although the deterministic counterparts are monostable. This noise-induced bimodality is an interesting phenomenon and has important biological implications, but it is unclear how different sources of expression noise (each source creates so-called factorial noise that is defined as a component of the total noise) contribute separately to this stochastic bimodality. Here we consider a minimal model of gene regulation, which is monostable in the deterministic case. Although simple, this system contains factorial noise of two main kinds: promoter noise due to switching between gene states and transcriptional (or translational) noise due to synthesis and degradation of mRNA (or protein). To better trace the roles of factorial noise in inducing bimodality, we also analyze two limit models, continuous and adiabatic approximations, apart from the exact model. We show that in the case of slow gene switching, the continuous model where only promoter noise is considered can exhibit bimodality; in the case of fast switching, the adiabatic model where only transcriptional or translational noise is considered can also exhibit bimodality but the exact model cannot; and in other cases, both promoter noise and transcriptional or translational noise can cooperatively induce bimodality. Since slow gene switching and large protein copy numbers are characteristics of eukaryotic cells, whereas fast gene switching and small protein copy numbers are characteristics of prokaryotic cells, we infer that eukaryotic stochastic bimodality is induced mainly by promoter noise, whereas prokaryotic stochastic bimodality is induced primarily by transcriptional or translational noise. PMID:26172735

  12. Roles of factorial noise in inducing bimodal gene expression

    NASA Astrophysics Data System (ADS)

    Liu, Peijiang; Yuan, Zhanjiang; Huang, Lifang; Zhou, Tianshou


    Some gene regulatory systems can exhibit bimodal distributions of mRNA or protein although the deterministic counterparts are monostable. This noise-induced bimodality is an interesting phenomenon and has important biological implications, but it is unclear how different sources of expression noise (each source creates so-called factorial noise that is defined as a component of the total noise) contribute separately to this stochastic bimodality. Here we consider a minimal model of gene regulation, which is monostable in the deterministic case. Although simple, this system contains factorial noise of two main kinds: promoter noise due to switching between gene states and transcriptional (or translational) noise due to synthesis and degradation of mRNA (or protein). To better trace the roles of factorial noise in inducing bimodality, we also analyze two limit models, continuous and adiabatic approximations, apart from the exact model. We show that in the case of slow gene switching, the continuous model where only promoter noise is considered can exhibit bimodality; in the case of fast switching, the adiabatic model where only transcriptional or translational noise is considered can also exhibit bimodality but the exact model cannot; and in other cases, both promoter noise and transcriptional or translational noise can cooperatively induce bimodality. Since slow gene switching and large protein copy numbers are characteristics of eukaryotic cells, whereas fast gene switching and small protein copy numbers are characteristics of prokaryotic cells, we infer that eukaryotic stochastic bimodality is induced mainly by promoter noise, whereas prokaryotic stochastic bimodality is induced primarily by transcriptional or translational noise.

  13. Survey of Transcript Expression in Rainbow Trout Leukocytes Reveals a Major Contribution of Interferon-Responsive Genes in the Early Response to a Rhabdovirus Infection

    PubMed Central

    O'Farrell, Caroline; Vaghefi, Nikta; Cantonnet, Monique; Buteau, Bénédicte; Boudinot, Pierre; Benmansour, Abdenour


    Virus infections induce changes in the expression of host cell genes. A global knowledge of these modifications should help to better understand the virus/host cell interactions. To obtain a more comprehensive view of the rainbow trout response to a viral infection, we used the subtractive suppressive hybridization methodology in the viral hemorrhagic septicemia model of infection. We infected rainbow trout leukocytes with viral hemorrhagic septicemia virus (VHSV), and total RNA from infected and mock-infected cells was compared at 40 h postinfection. Twenty-four virus-induced genes were ultimately retrieved from the subtracted cDNA library, and their differential expression was further confirmed by semiquantitative reverse transcription-PCR and Northern blot analysis. Among these sequences, three were already described as VHSV-induced genes. Eight sequences with known homologs were extended to full-length cDNA using 5′ and 3′ rapid amplification of cDNA ends, and they were subsequently divided into three functional subsets. Four genes were homologous to mammalian interferon responsive genes, three were similar to chemo-attractant molecules (CXC chemokine, galectin), and two had nucleic acid binding domains. All of the virus-induced genes were also induced by rainbow trout interferon, indicating that the interferon pathway is the predominant component of the anti-VHSV response. They were also expressed in vivo in experimentally infected fish, indicating their biological relevance in natural infection. PMID:12134009

  14. Gene expression profiling in undifferentiated thyroid carcinoma induced by high-dose radiation.


    Bang, Hyun Soon; Choi, Moo Hyun; Kim, Cha Soon; Choi, Seung Jin


    Published gene expression studies for radiation-induced thyroid carcinogenesis have used various methodologies. In this study, we identified differential gene expression in a human thyroid epithelial cell line after exposure to high-dose γ-radiation. HTori-3 cells were exposed to 5 or 10 Gy of ionizing radiation using two dose rates (high-dose rate: 4.68 Gy/min, and low-dose rate: 40 mGy/h) and then implanted into the backs of BALB/c nude mice after 4 (10 Gy) or 5 weeks (5 Gy). Decreases in cell viability, increases in giant cell frequency, anchorage-independent growth in vitro, and tumorigenicity in vivo were observed. Particularly, the cells irradiated with 5 Gy at the high-dose rate or 10 Gy at the low-dose rate demonstrated more prominent tumorigenicity. Gene expression profiling was analyzed via microarray. Numerous genes that were significantly altered by a fold-change of >50% following irradiation were identified in each group. Gene expression analysis identified six commonly misregulated genes, including CRYAB, IL-18, ZNF845, CYP24A1, OR4N4 and VN1R4, at all doses. These genes involve apoptosis, the immune response, regulation of transcription, and receptor signaling pathways. Overall, the altered genes in high-dose rate (HDR) 5 Gy and low-dose rate (LDR) 10 Gy were more than those of LDR 5 Gy and HDR 10 Gy. Thus, we investigated genes associated with aggressive tumor development using the two dosage treatments. In this study, the identified gene expression profiles reflect the molecular response following high doses of external radiation exposure and may provide helpful information about radiation-induced thyroid tumors in the high-dose range. PMID:27006382

  15. Gene expression profiling in undifferentiated thyroid carcinoma induced by high-dose radiation

    PubMed Central

    Bang, Hyun Soon; Choi, Moo Hyun; Kim, Cha Soon; Choi, Seung Jin


    Published gene expression studies for radiation-induced thyroid carcinogenesis have used various methodologies. In this study, we identified differential gene expression in a human thyroid epithelial cell line after exposure to high-dose γ-radiation. HTori-3 cells were exposed to 5 or 10 Gy of ionizing radiation using two dose rates (high-dose rate: 4.68 Gy/min, and low-dose rate: 40 mGy/h) and then implanted into the backs of BALB/c nude mice after 4 (10 Gy) or 5 weeks (5 Gy). Decreases in cell viability, increases in giant cell frequency, anchorage-independent growth in vitro, and tumorigenicity in vivo were observed. Particularly, the cells irradiated with 5 Gy at the high-dose rate or 10 Gy at the low-dose rate demonstrated more prominent tumorigenicity. Gene expression profiling was analyzed via microarray. Numerous genes that were significantly altered by a fold-change of >50% following irradiation were identified in each group. Gene expression analysis identified six commonly misregulated genes, including CRYAB, IL-18, ZNF845, CYP24A1, OR4N4 and VN1R4, at all doses. These genes involve apoptosis, the immune response, regulation of transcription, and receptor signaling pathways. Overall, the altered genes in high-dose rate (HDR) 5 Gy and low-dose rate (LDR) 10 Gy were more than those of LDR 5 Gy and HDR 10 Gy. Thus, we investigated genes associated with aggressive tumor development using the two dosage treatments. In this study, the identified gene expression profiles reflect the molecular response following high doses of external radiation exposure and may provide helpful information about radiation-induced thyroid tumors in the high-dose range. PMID:27006382

  16. Radiation-Inducible Caspase-8 Gene Therapy for Malignant Brain Tumors

    SciTech Connect

    Tsurushima, Hideo Yuan Xuan; Dillehay, Larry E.; Leong, Kam W.


    Purpose: Patients with malignant gliomas have a poor prognosis. To explore a novel and more effective approach for the treatment of patients with malignant gliomas, we designed a strategy that combines caspase-8 (CSP8) gene therapy and radiation treatment (RT). In addition, the specificity of the combined therapy was investigated to decrease the unpleasant effects experienced by the surrounding normal tissue. Methods and Materials: We constructed the plasmid pEGR-green fluorescence protein that included the radiation-inducible early growth response gene-1 (Egr-1) promoter and evaluated its characteristics. The pEGR-CSP8 was constructed and included the Egr-1 promoter and CSP8 complementary DNA. Assays that evaluated the apoptosis inducibility and cytotoxicity caused by CSP8 gene therapy combined with RT were performed using U251 and U87 glioma cells. The pEGR-CSP8 was transfected into the subcutaneous U251 glioma cells of nude mice by means of in vivo electroporation. The in vivo effects of CSP8 gene therapy combined with RT were evaluated. Results: The Egr-1 promoter yielded a better response with fractionated RT than with single-dose RT. In the assay of apoptosis inducibility and cytotoxicity, pEGR-CSP8 showed response for RT. The pEGR-CSP8 combined with RT is capable of inducing cell death effectively. In mice treated with pEGR-CSP8 and RT, apoptotic cells were detected in pathologic sections, and a significant difference was observed in tumor volumes. Conclusions: Our results indicate that radiation-inducible gene therapy may have great potential because this can be spatially or temporally controlled by exogenous RT and is safe and specific.

  17. Expression of heat shock protein genes in insect stress responses

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The heat shock proteins (HSPs) that are abundantly expressed in insects are important modulators of insect survival. Expression of HSP genes in insects is not only developmentally regulated, but also induced by various stressors in order to confer protection against such stressors. The expression o...

  18. Expression analysis of immune response genes in fish epithelial cells following ranavirus infection.


    Holopainen, Riikka; Tapiovaara, Hannele; Honkanen, Jarno


    Ranaviruses (family Iridoviridae) are a growing threat to fish and amphibian populations worldwide. The immune response to ranavirus infection has been studied in amphibians, but little is known about the responses elicited in piscine hosts. In this study, the immune response and apoptosis induced by ranaviruses were investigated in fish epithelial cells. Epithelioma papulosum cyprini (EPC) cells were infected with four different viral isolates: epizootic haematopoietic necrosis virus (EHNV), frog virus 3 (FV3), European catfish virus (ECV) and doctor fish virus (DFV). Quantitative real-time PCR (qPCR) assays were developed to measure the mRNA expression of immune response genes during ranavirus infection. The target genes included tumour necrosis factor α (TNF-α), interleukin-1β (IL-1β), β2-microglobulin (β2M), interleukin-10 (IL-10) and transforming growth factor β (TGF-β). All ranaviruses elicited changes in immune gene expression. EHNV and FV3 caused a strong pro-inflammatory response with an increase in the expression of both IL-1β and TNF-α, whereas ECV and DFV evoked transient up-regulation of regulatory cytokine TGF-β. Additionally, all viral isolates induced increased β2M expression as well as apoptosis in the EPC cells. Our results indicate that epithelial cells can serve as an in vitro model for studying the mechanisms of immune response in the piscine host in the first stages of ranavirus infection. PMID:22452879

  19. Inhibitory PAS domain protein is a negative regulator of hypoxia-inducible gene expression

    NASA Astrophysics Data System (ADS)

    Makino, Yuichi; Cao, Renhai; Svensson, Kristian; Bertilsson, Göran; Asman, Mikael; Tanaka, Hirotoshi; Cao, Yihai; Berkenstam, Anders; Poellinger, Lorenz


    Alteration of gene expression is a crucial component of adaptive responses to hypoxia. These responses are mediated by hypoxia-inducible transcription factors (HIFs). Here we describe an inhibitory PAS (Per/Arnt/Sim) domain protein, IPAS, which is a basic helix-loop-helix (bHLH)/PAS protein structurally related to HIFs. IPAS contains no endogenous transactivation function but demonstrates dominant negative regulation of HIF-mediated control of gene expression. Ectopic expression of IPAS in hepatoma cells selectively impairs induction of genes involved in adaptation to a hypoxic environment, notably the vascular endothelial growth factor (VEGF) gene, and results in retarded tumour growth and tumour vascular density in vivo. In mice, IPAS was predominantly expressed in Purkinje cells of the cerebellum and in corneal epithelium of the eye. Expression of IPAS in the cornea correlates with low levels of expression of the VEGF gene under hypoxic conditions. Application of an IPAS antisense oligonucleotide to the mouse cornea induced angiogenesis under normal oxygen conditions, and demonstrated hypoxia-dependent induction of VEGF gene expression in hypoxic corneal cells. These results indicate a previously unknown mechanism for negative regulation of angiogenesis and maintenance of an avascular phenotype.

  20. Functional study of a salt-inducible TaSR gene in Triticum aestivum.


    Ma, Xiao-Li; Cui, Wei-Na; Zhao, Qian; Zhao, Jing; Hou, Xiao-Na; Li, Dong-Yan; Chen, Zhao-Liang; Shen, Yin-Zhu; Huang, Zhan-Jing


    The gene expression chip of a salt-tolerant wheat mutant under salt stress was used to clone a salt-induced gene with unknown functions. This gene was designated as TaSR (Triticum aestivum salt-response gene) and submitted to GenBank under accession number EF580107. Quantitative polymerase chain reaction (PCR) analysis showed that gene expression was induced by salt stress. Arabidopsis and rice (Oryza sativa) plants expressing TaSR presented higher salt tolerance than the controls, whereas AtSR mutant and RNA interference rice plants were more sensitive to salt. Under salt stress, TaSR reduced Na(+) concentration and improved cellular K(+) and Ca(2+) concentrations; this gene was also localized on the cell membrane. β-Glucuronidase (GUS) staining and GUS fluorescence quantitative determination were conducted through fragmentation cloning of the TaSR promoter. Salt stress-responsive elements were detected at 588-1074 bp upstream of the start codon. GUS quantitative tests of the full-length promoter in different tissues indicated that promoter activity was highest in the leaf under salt stress. Bimolecular fluorescence complementation and yeast two-hybrid screening further showed the correlation of TaSR with TaPRK and TaKPP. In vitro phosphorylation of TaSR and TaPRK2697 showed that TaPRK2697 did not phosphorylate TaSR. This study revealed that the novel TaSR may be used to improve plant tolerance to salt stress. PMID:25855206

  1. Responses of human cells to ZnO nanoparticles: a gene transcription study†

    PubMed Central

    Moos, Philip J.; Olszewski, Kyle; Honeggar, Matthew; Cassidy, Pamela; Leachman, Sancy; Woessner, David; Cutler, N. Shane; Veranth, John M.


    The gene transcript profile responses to metal oxide nanoparticles was studied using human cell lines derived from the colon and skin tumors. Much of the research on nanoparticle toxicology has focused on models of inhalation and intact skin exposure, and effects of ingestion exposure and application to diseased skin are relatively unknown. Powders of nominally nanosized SiO2, TiO2, ZnO and Fe2O3 were chosen because these substances are widely used in consumer products. The four oxides were evaluated using colon-derived cell lines, RKO and CaCo-2, and ZnO and TiO2 were evaluated further using skin-derived cell lines HaCaT and SK Mel-28. ZnO induced the most notable gene transcription changes, even though this material was applied at the lowest concentration. Nano-sized and conventional ZnO induced similar responses suggesting common mechanisms of action. The results showed neither a non-specific response pattern common to all substances nor synergy of the particles with TNF-α cotreatment. The response to ZnO was not consistent with a pronounced proinflammatory signature, but involved changes in metal metabolism, chaperonin proteins, and protein folding genes. This response was observed in all cell lines when ZnO was in contact with the human cells. When the cells were exposed to soluble Zn, the genes involved in metal metabolism were induced but the genes involved in protein refoldling were unaffected. This provides some of the first data on the effects of commercial metal oxide nanoparticles on human colon-derived and skin-derived cells. PMID:21769377

  2. Virus-Induced Gene Silencing in Hexaploid Wheat

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Functional genomics analysis in hexaploid wheat is greatly impeded by the genetic redundancy of polyploidy and the difficulties in generating large numbers of transgenic plants required in insertional mutagenesis strategies. Virus-induced gene silencing (VIGS), however, is a strategy for creating g...

  3. Metal-dependent SV40 viruses containing inducible enhancers from the upstream region of metallothionein genes.

    PubMed Central

    Serfling, E; Lübbe, A; Dorsch-Häsler, K; Schaffner, W


    We have isolated SV40 recombinant viruses which are dependent on heavy metal ions for efficient propagation. They were obtained after-co-transfection of enhancerless SV40 DNA (the so-called enhancer trap) with sonicated DNA from the mouse metallothionein-I (mMT-I) or human metallothionein-IIA (hMT-IIA) upstream regions. To substitute for the SV40 enhancer, these viruses have incorporated a segment of the immediate upstream region of the metallothionein genes. Two recombinant viruses of the SVMT-I type carry segments of the mMT-I gene from positions -73 to -187 and -39 to -194 inverted with respect to their natural configuration. The overlapping segment contains two of the four metal-responsive elements involved in the induction of the mMT-I gene by heavy metal ions. The SVMT-II recombinant virus contains a segment of the hMT-IIA gene from position -39 to -366 which harbors the metal- and hormone-responsive elements of the hMT-IIA gene. Insertion of the mMT-I segment downstream of a rabbit beta-globin test gene enhances beta-globin transcription upon metal ion stimulation. This shows that the immediate upstream region of the mouse metalliothionein-I gene, when detached from its TATA box, can act as an inducible enhancer. It may be generally true that the enhancer/promoters of inducible genes are composed of several regulatory sequence elements which are interspersed with constitutive elements. The number and spatial arrangement of these elements probably determines the basal versus induced level of expression. Images Fig. 3. Fig. 4. Fig. 5. Fig. 6. PMID:2419129

  4. Novel drought-inducible genes in the highly drought-tolerant cowpea: cloning of cDNAs and analysis of the expression of the corresponding genes.


    Iuchi, S; Yamaguchi-Shinozaki, K; Urao, T; Terao, T; Shinozaki, K


    Ten cDNAs of genes that were induced by dehydration stress were cloned by differential screening from the highly drought-tolerant legume, cowpea (Vigna unguiculata), a major crop in West Africa. The clones were collectively named CPRD (cowpea clones responsive to dehydration). Northern blot analysis revealed that nine of the CPRD genes were induced by dehydration stress, but the timing of induction of mRNA synthesis varied among the CPRD genes. We analyzed the effects of other environmental stresses on the expression of the CPRD8, CPRD14 and CPRD22 genes, and we found that these genes were strongly induced by high-salinity stress but not by cold or heat stress. Drought-stressed cowpea plants accumulated abscisic acid (ABA) to a level that was 160 times higher than that in unstressed plants. The CPRD8 and CPRD22 genes were induced to a significant extent by the application of exogenous ABA but the CPRD14 gene was not. These results indicate the existence of at least two signal-transduction pathways between the detection of water stress and the expression of CPRD genes in cowpea. Sequence analysis of CPRD8 and CPRD22 cDNAs revealed that they encoded putative proteins that were related to old yellow enzyme and group 2 LEA proteins, respectively. The protein encoded by CPRD14 exhibited sequence homology to dihydroflavonol-4-reductase (DFR) and vestitone reductase (VR). Old yellow enzyme, DFR and VR have not been identified as drought-inducible proteins in other plants, whereas LEA genes have been well characterized as drought-inducible genes. The various gene products might function to protect cells from environmental stress. PMID:9032963

  5. A geminivirus-induced gene silencing system for gene function validation in cassava.


    Fofana, Ismael B F; Sangaré, Abdourahamane; Collier, Ray; Taylor, Christopher; Fauquet, Claude M


    We have constructed an African cassava mosaic virus (ACMV) based gene-silencing vector as a reverse genetics tool for gene function analysis in cassava. The vector carrying a fragment from the Nicotiana tabacum sulfur gene (su), encoding one unit of the chloroplast enzyme magnesium chelatase, was used to induce the silencing of the cassava orthologous gene resulting in yellow-white spots characteristic of the inhibition of su expression. This result suggests that well developed sequence databases from model plants like Arabidopsis thaliana, Nicotiana benthamiana, N. tabacum, Lycopersicon esculentum and others could be used as a major source of information and sequences for functional genomics in cassava. Furthermore, a fragment of the cassava CYP79D2 endogenous gene, sharing 89% homology with CYP79D1 endogenous gene was inserted into the ACMV vector. The resultant vector was inducing the down regulation of the expression of these two genes which catalyze the first-dedicated step in the synthesis of linamarin, the major cyanogenic glycoside in cassava. At 21 days post-inoculation (dpi), a 76% reduction of linamarin content was observed in silenced leaves. Using transgenic plants expressing antisense RNA of CYP79D1 and CYP79D2, Siritunga and Sayre (2003) obtained several lines with a reduction level varying from 60% to 94%. This result provides the first example of direct comparison of the efficiency of a virus-induced gene silencing (VIGS) system and the transgenic approach for suppression of a biosynthetic pathway. The ACMV VIGS system will certainly be a complement and in some cases an alternative to the transgenic approach, for gene discovery and gene function analysis in cassava. PMID:15630624

  6. Hypergravity-induced changes in gene expression in Arabidopsis hypocotyls

    NASA Astrophysics Data System (ADS)

    Yoshioka, R.; Soga, K.; Wakabayashi, K.; Takeba, G.; Hoson, T.


    Under hypergravity conditions, the cell wall of stem organs becomes mechanically rigid and elongation growth is suppressed, which can be recognized as the mechanism for plants to resist gravitational force. The changes in gene expression by hypergravity treatment were analyzed in Arabidopsis hypocotyls by the differential display method, for identifying genes involved in hypergravity-induced growth suppression. Sixty-two cDNA clones were expressed differentially between the control and 300 g conditions: the expression levels of 39 clones increased, whereas those of 23 clones decreased under hypergravity conditions. Sequence analysis and database searching revealed that 12 clones, 9 up-regulated and 3 down-regulated, have homology to known proteins. The expression of these genes was further analyzed using RT-PCR. Finally, six genes were confirmed to be up-regulated by hypergravity. One of such genes encoded 3-hydroxy-3-methylglutaryl-Coenzyme A reductase (HMGR), which catalyzes a reaction producing mevalonic acid, a key precursor ofterpenoids such as membrane sterols and several types of hormones. The expression of HMGR gene increased within several hours after hypergravity treatment. Also, compactin, an inhibitor of HMGR, prevented hypergravity-induced growth suppression, suggesting that HMGR is involved in suppression of Arabidopsis hypocotyl growth by hypergravity. In addition, hypergravity increased the expression levels of genes encoding CCR1 and ERD15, which were shown to take part in the signaling pathway of environmental stimuli such as temperature and water, and those of the α-tubulin gene. These genes may be involved in a series of cellular events leading to growth suppression of stem organs under hypergravity conditions.

  7. Benzoic Acid-Inducible Gene Expression in Mycobacteria

    PubMed Central

    Dragset, Marte S.; Barczak, Amy K.; Kannan, Nisha; Mærk, Mali; Flo, Trude H.; Valla, Svein; Rubin, Eric J.; Steigedal, Magnus


    Conditional expression is a powerful tool to investigate the role of bacterial genes. Here, we adapt the Pseudomonas putida-derived positively regulated XylS/Pm expression system to control inducible gene expression in Mycobacterium smegmatis and Mycobacterium tuberculosis, the causative agent of human tuberculosis. By making simple changes to a Gram-negative broad-host-range XylS/Pm-regulated gene expression vector, we prove that it is possible to adapt this well-studied expression system to non-Gram-negative species. With the benzoic acid-derived inducer m-toluate, we achieve a robust, time- and dose-dependent reversible induction of Pm-mediated expression in mycobacteria, with low background expression levels. XylS/Pm is thus an important addition to existing mycobacterial expression tools, especially when low basal expression is of particular importance. PMID:26348349

  8. Foxtail Mosaic Virus-Induced Gene Silencing in Monocot Plants.


    Liu, Na; Xie, Ke; Jia, Qi; Zhao, Jinping; Chen, Tianyuan; Li, Huangai; Wei, Xiang; Diao, Xianmin; Hong, Yiguo; Liu, Yule


    Virus-induced gene silencing (VIGS) is a powerful technique to study gene function in plants. However, very few VIGS vectors are available for monocot plants. Here we report that Foxtail mosaic virus (FoMV) can be engineered as an effective VIGS system to induce efficient silencing of endogenous genes in monocot plants including barley (Hordeum vulgare L.), wheat (Triticum aestivum) and foxtail millet (Setaria italica). This is evidenced by FoMV-based silencing of phytoene desaturase (PDS) and magnesium chelatase in barley, of PDS and Cloroplastos alterados1 in foxtail millet and wheat, and of an additional gene IspH in foxtail millet. Silencing of these genes resulted in photobleached or chlorosis phenotypes in barley, wheat, and foxtail millet. Furthermore, our FoMV-based gene silencing is the first VIGS system reported for foxtail millet, an important C4 model plant. It may provide an efficient toolbox for high-throughput functional genomics in economically important monocot crops. PMID:27225900

  9. Strategies to Modulate Immune Responses: A New Frontier for Gene Therapy

    PubMed Central

    Arruda, Valder R; Favaro, Patricia; Finn, Jonathan D


    The success of gene therapy strategies to cure disease relies on the control of unwanted immune responses to transgene products, genetically modified cells and/or to the vector. Effective treatment of an established immune response is much harder to achieve than prevention of a response before it has had a chance to develop. However, preventive strategies are not always effective in avoiding immune responses, thus the use of drugs to induce immunosuppression (IS) is required. The growing discovery of novel drugs provides a conceptual shift from using generalized, moderately intensive immunosuppressive regimens towards a refined approach to attain the optimal balance of naive cells, effector cells, memory cells, and regulatory cells, harnessing the natural tolerance mechanisms of the body. We review several strategies based on transient IS coupled with gene therapy for sustained immune tolerance induction to the therapeutic transgene. PMID:19584819

  10. Non-targeted effects of virus-induced gene silencing vectors on host endogenous gene expression.


    Oláh, Enikő; Pesti, Réka; Taller, Dénes; Havelda, Zoltán; Várallyay, Éva


    Virus-induced gene silencing (VIGS) uses recombinant viruses to study gene function; however, the effect of the virus vector itself on the gene expression of the host is not always considered. In our work, we investigated non-targeted gene expression changes of the host in order to see how often these changes appear. Effects of various VIGS vector infections were analysed by monitoring gene expression levels of housekeeping genes by Northern blot analysis in four different hosts. We found that non-targeted changes happens very often. More importantly, these non-targeted effects can cause drastic changes in the gene-expression pattern of host genes that are usually used as references in these studies. We have also found that in a tobacco rattle virus (TRV)-based VIGS, the presence of foreign sequences in the cloning site of the vector can also have a non-targeted effect, and even the use of an internal control can lead to unpredicted changes. Our results show that although VIGS is a very powerful technique, the VIGS vector, as a pathogen of the host, can cause unwanted changes in its gene-expression pattern, highlighting the importance of careful selection of both the genes to be tested and those to be used as references in the planned experiments. PMID:27283101

  11. Inhibition of DNA Methylation Suppresses Intestinal Tumor Organoids by Inducing an Anti-Viral Response

    PubMed Central

    Saito, Yoshimasa; Nakaoka, Toshiaki; Sakai, Kasumi; Muramatsu, Toshihide; Toshimitsu, Kohta; Kimura, Masaki; Kanai, Takanori; Sato, Toshiro; Saito, Hidetsugu


    Recent studies have proposed that the major anti-tumor effect of DNA methylation inhibitors is induction of interferon-responsive genes via dsRNAs-containing endogenous retroviruses. Recently, a 3D culture system for stem cells known as organoid culture has been developed. Lgr5-positive stem cells form organoids that closely recapitulate the properties of original tissues. To investigate the effect of DNA demethylation on tumor organoids, we have established organoids from intestinal tumors of ApcMin/+ (Min) mice and subjected them to 5-aza-2′-deoxycytidine (5-Aza-CdR) treatment and Dnmt1 knockdown. DNA demethylation induced by 5-Aza-CdR treatment and Dnmt1 knockdown significantly reduced the cell proliferation of the tumor organoids. Microarray analyses of the tumor organoids after 5-Aza-CdR treatment and Dnmt1 knockdown revealed that interferon-responsive genes were activated by DNA demethylation. Gene ontology and pathway analyses clearly demonstrated that these genes activated by DNA demethylation are involved in the anti-viral response. These findings indicate that DNA demethylation suppresses the proliferation of intestinal tumor organoids by inducing an anti-viral response including activation of interferon-responsive genes. Treatment with DNA methylation inhibitors to activate a growth-inhibiting immune response may be an effective therapeutic approach for colon cancers. PMID:27143627

  12. Systems genetics reveals key genetic elements of drought induced gene regulation in diploid potato.


    van Muijen, Dennis; Anithakumari, A M; Maliepaard, Chris; Visser, Richard G F; van der Linden, C Gerard


    In plants, tolerance to drought stress is a result of numerous minor effect loci in which transcriptional regulation contributes significantly to the observed phenotypes. Under severe drought conditions, a major expression quantitative trait loci hotspot was identified on chromosome five in potato. A putative Nuclear factor y subunit C4 was identified as key candidate in the regulatory cascade in response to drought. Further investigation of the eQTL hotspots suggests a role for a putative Homeobox leucine zipper protein 12 in relation to drought in potato. Genes strongly co-expressed with Homeobox leucine zipper protein 12 were plant growth regulators responsive to water deficit stress in Arabidopsis thaliana, implying a possible conserved mechanism. Integrative analysis of genetic, genomic, phenotypic and transcriptomic data provided insights in the downstream functional components of the drought response. The abscisic acid- and environmental stress-inducible protein TAS14 was highly induced by severe drought in potato and acts as a reliable biomarker for the level of stress perceived by the plant. The systems genetics approach supported a role for multiple genes responsive to severe drought stress of Solanum tuberosum. The combination of gene regulatory networks, expression quantitative trait loci mapping and phenotypic analysis proved useful for candidate gene selection. PMID:27353051

  13. Identification of human metapneumovirus-induced gene networks in airway epithelial cells by microarray analysis

    SciTech Connect

    Bao, X.; Sinha, M. |; Liu, T.; Hong, C.; Luxon, B.A. |; Garofalo, R.P. ||; Casola, A. ||


    Human metapneumovirus (hMPV) is a major cause of lower respiratory tract infections in infants, elderly and immunocompromised patients. Little is known about the response to hMPV infection of airway epithelial cells, which play a pivotal role in initiating and shaping innate and adaptive immune responses. In this study, we analyzed the transcriptional profiles of airway epithelial cells infected with hMPV using high-density oligonucleotide microarrays. Of the 47,400 transcripts and variants represented on the Affimetrix GeneChip Human Genome HG-U133 plus 2 array, 1601 genes were significantly altered following hMPV infection. Altered genes were then assigned to functional categories and mapped to signaling pathways. Many up-regulated genes are involved in the initiation of pro-inflammatory and antiviral immune responses, including chemokines, cytokines, type I interferon and interferon-inducible proteins. Other important functional classes up-regulated by hMPV infection include cellular signaling, gene transcription and apoptosis. Notably, genes associated with antioxidant and membrane transport activity, several metabolic pathways and cell proliferation were down-regulated in response to hMPV infection. Real-time PCR and Western blot assays were used to confirm the expression of genes related to several of these functional groups. The overall result of this study provides novel information on host gene expression upon infection with hMPV and also serves as a foundation for future investigations of genes and pathways involved in the pathogenesis of this important viral infection. Furthermore, it can facilitate a comparative analysis of other paramyxoviral infections to determine the transcriptional changes that are conserved versus the one that are specific to individual pathogens.

  14. African Swine Fever Virus Multigene Family 360 and 530 Genes Affect Host Interferon Response

    PubMed Central

    Afonso, C. L.; Piccone, M. E.; Zaffuto, K. M.; Neilan, J.; Kutish, G. F.; Lu, Z.; Balinsky, C. A.; Gibb, T. R.; Bean, T. J.; Zsak, L.; Rock, D. L.


    African swine fever virus (ASFV) multigene family 360 and 530 (MGF360/530) genes affect viral growth in macrophage cell cultures and virulence in pigs (L. Zsak, Z. Lu, T. G. Burrage, J. G. Neilan, G. F. Kutish, D. M. Moore, and D. L. Rock, J. Virol. 75:3066-3076, 2001). The mechanism by which these novel genes affect virus-host interactions is unknown. To define MGF360/530 gene function, we compared macrophage transcriptional responses following infection with parental ASFV (Pr4) and an MGF360/530 deletion mutant (Pr4Δ35). A swine cDNA microarray containing 7,712 macrophage cDNA clones was used to compare the transcriptional profiles of swine macrophages infected with Pr4 and Pr4Δ35 at 3 and 6 h postinfection (hpi). While at 3 hpi most (7,564) of the genes had similar expression levels in cells infected with either virus, 38 genes had significantly increased (>2.0-fold, P < 0.05) mRNA levels in Pr4Δ35-infected macrophages. Similar up-regulation of these genes was observed at 6 hpi. Viral infection was required for this induced transcriptional response. Most Pr4Δ35 up-regulated genes were part of a type I interferon (IFN) response or were genes that are normally induced by double-stranded RNA and/or viral infection. These included monocyte chemoattractant protein, transmembrane protein 3, tetratricopeptide repeat protein 1, a ubiquitin-like 17-kDa protein, ubiquitin-specific protease ISG43, an RNA helicase DEAD box protein, GTP-binding MX protein, the cytokine IP-10, and the PKR activator PACT. Differential expression of IFN early-response genes in Pr4Δ35 relative to Pr4 was confirmed by Northern blot analysis and real-time PCR. Analysis of IFN-α mRNA and secreted IFN-α levels at 3, 8, and 24 hpi revealed undetectable IFN-α in mock- and Pr4-infected macrophages but significant IFN-α levels at 24 hpi in Pr4Δ35-infected macrophages. The absence of IFN-α in Pr4-infected macrophages suggests that MGF360/530 genes either directly or indirectly suppress a type

  15. African swine fever virus multigene family 360 and 530 genes affect host interferon response.


    Afonso, C L; Piccone, M E; Zaffuto, K M; Neilan, J; Kutish, G F; Lu, Z; Balinsky, C A; Gibb, T R; Bean, T J; Zsak, L; Rock, D L


    African swine fever virus (ASFV) multigene family 360 and 530 (MGF360/530) genes affect viral growth in macrophage cell cultures and virulence in pigs (L. Zsak, Z. Lu, T. G. Burrage, J. G. Neilan, G. F. Kutish, D. M. Moore, and D. L. Rock, J. Virol. 75:3066-3076, 2001). The mechanism by which these novel genes affect virus-host interactions is unknown. To define MGF360/530 gene function, we compared macrophage transcriptional responses following infection with parental ASFV (Pr4) and an MGF360/530 deletion mutant (Pr4 Delta 35). A swine cDNA microarray containing 7,712 macrophage cDNA clones was used to compare the transcriptional profiles of swine macrophages infected with Pr4 and Pr4 Delta 35 at 3 and 6 h postinfection (hpi). While at 3 hpi most (7,564) of the genes had similar expression levels in cells infected with either virus, 38 genes had significantly increased (>2.0-fold, P < 0.05) mRNA levels in Pr4 Delta 35-infected macrophages. Similar up-regulation of these genes was observed at 6 hpi. Viral infection was required for this induced transcriptional response. Most Pr Delta 35 up-regulated genes were part of a type I interferon (IFN) response or were genes that are normally induced by double-stranded RNA and/or viral infection. These included monocyte chemoattractant protein, transmembrane protein 3, tetratricopeptide repeat protein 1, a ubiquitin-like 17-kDa protein, ubiquitin-specific protease ISG43, an RNA helicase DEAD box protein, GTP-binding MX protein, the cytokine IP-10, and the PKR activator PACT. Differential expression of IFN early-response genes in Pr4 Delta 35 relative to Pr4 was confirmed by Northern blot analysis and real-time PCR. Analysis of IFN-alpha mRNA and secreted IFN-alpha levels at 3, 8, and 24 hpi revealed undetectable IFN-alpha in mock- and Pr4-infected macrophages but significant IFN-alpha levels at 24 hpi in Pr4 Delta 35-infected macrophages. The absence of IFN-alpha in Pr4-infected macrophages suggests that MGF360/530 genes

  16. Differential gene expression and lipid metabolism in fatty liver induced by acute ethanol treatment in mice

    SciTech Connect

    Yin Huquan; Kim, Mingoo; Kim, Ju-Han; Kong, Gu; Kang, Kyung-Sun; Kim, Hyung-Lae; Yoon, Byung-IL; Lee, Mi-Ock; Lee, Byung-Hoon


    Ethanol induces cumulative liver damage including steatosis, steatohepatitis and cirrhosis. The aim of this study is to investigate the global intrahepatic gene expression profile in the mouse liver treated with ethanol. A single oral dose of 0.5 or 5 g/kg ethanol was administered to male ICR mice, and liver samples were obtained after 6, 24 and 72 h. Histopathological evaluation showed typical fatty livers in the high-dose group at 24 h. Microarray analysis identified 28 genes as being ethanol responsive (two-way ANOVA; p < 0.05), after adjustment by the Benjamini-Hochberg multiple testing correction; these genes displayed {>=} 2-fold induction or repression. The expression of genes that are known to be involved in fatty acid synthesis was examined. The transcript for lipogenic transcription factor, sterol regulatory element (SRE)-binding factor 1 (Srebf1), was upregulated by acute ethanol exposure. Of the genes known to contain SRE or SRE-like sequences and to be regulated by SRE-binding protein 1 (SREBP1), those encoding malic enzyme (Mod1), ATP-citrate lyase (Acly), fatty acid synthase (Fasn) and stearyl-CoA desaturase (Scd1) were induced by ethanol. Quantitative real-time PCR confirmed the changes in the expression levels of the selected genes. The change in the Srebf1 mRNA level correlates well with that of the SREBP1 protein expression as well as its binding to the promoters of the target genes. The present study identifies differentially expressed genes that can be applied to the biomarkers for alcohol-binge-induced fatty liver. These results support the hypothesis by which ethanol-induced steatosis in mice is mediated by the fatty acid synthetic pathway regulated by SREBP1.

  17. Quantitative expression profiling of immune response genes in rainbow trout following infectious haematopoietic necrosis virus (IHNV) infection or DNA vaccination

    USGS Publications Warehouse

    Purcell, Maureen K.; Kurath, Gael; Garver, Kyle A.; Herwig, Russell P.; Winton, James R.


    Infectious haematopoietic necrosis virus (IHNV) is a well-studied virus of salmonid fishes. A highly efficacious DNA vaccine has been developed against this virus and studies have demonstrated that this vaccine induces both an early and transient non-specific anti-viral phase as well as long-term specific protection. The mechanisms of the early anti-viral phase are not known, but previous studies noted changes in Mx gene expression, suggesting a role for type I interferon. This study used quantitative real-time reverse transcriptase PCR methodology to compare expression changes over time of a number of cytokine or cytokine-related genes in the spleen of rainbow trout following injection with poly I:C, live IHNV, the IHNV DNA vaccine or a control plasmid encoding the non-antigenic luciferase gene. The target genes included Mx-1, viral haemorrhagic septicaemia virus induced gene 8 (Vig-8), TNF-α1, TNF-α2, IL-1β1, IL-8, TGF-β1 and Hsp70. Poly I:C stimulation induced several genes but the strongest and significant response was observed in the Mx-1 and Vig-8 genes. The live IHN virus induced a significant response in all genes examined except TGF-β1. The control plasmid construct and the IHNV DNA vaccine marginally induced a number of genes, but the main difference between these two groups was a statistically significant induction of the Mx-1 and Vig-8 genes by the IHNV vaccine only. The gene expression profiles elicited by the live virus and the IHNV DNA vaccine differed in a number of aspects but this study confirms the clear role for a type I interferon-like response in early anti-viral defence.

  18. Tert-butylhydroquinone ameliorates doxorubicin-induced cardiotoxicity by activating Nrf2 and inducing the expression of its target genes

    PubMed Central

    Wang, Lin-Feng; Su, Su-Wen; Wang, Lei; Zhang, Guo-Qiang; Zhang, Rong; Niu, Yu-Jie; Guo, Yan-Su; Li, Chun-Yan; Jiang, Wen-Bo; Liu, Yi; Guo, Hui-Cai


    Oxidative stress plays an important role in doxorubicin (DOX)-induced cardiotoxicity. Nuclear factor E2-related factor-2 (Nrf2) is a transcription factor that orchestrates the antioxidant and cytoprotective responses to oxidative stress. In the present study, we tested whether tert-butylhydroquinone (tBHQ) could protect against DOX-induced cardiotoxicity in vivo and, if so, whether the protection was associated with the up-regulation of the Nrf2 pathway. The results showed that treatment with tBHQ significantly decreased the DOX-induced cardiac injury in wild-type mice. Moreover, tBHQ ameliorated the DOX-induced oxidative stress and apoptosis. Further studies suggested that tBHQ increased the nuclear accumulation of Nrf2 and the Nrf2-regulated gene expression, including heme oxygenase-1 (HO-1) and NAD(P)H:quinone oxido-reductase-1 (NQO-1) expression. Knocking out Nrf2 in mice abolished the protective effect of tBHQ on the DOX-induced cardiotoxicity. These results indicate that tBHQ has a beneficial effect on DOX-induced cardiotoxicity, and this effect was associated with the enhanced expression of Nrf2 and its downstream antioxidant genes, HO-1 and NQO-1. PMID:26692920

  19. Fine Ambient Particles Induce Oxidative Stress and Metal Binding Genes in Human Alveolar Macrophages

    PubMed Central

    Huang, Yuh-Chin T.; Li, Zhuowei; Carter, Jacqueline D.; Soukup, Joleen M.; Schwartz, David A.; Yang, Ivana V.


    Exposure to pollutant particles increased respiratory morbidity and mortality. The alveolar macrophages (AMs) are one cell type in the lung directly exposed to particles. Upon contact with particles, AMs are activated and produce reactive oxygen species, but the scope of this oxidative stress response remains poorly defined. In this study, we determined the gene expression profile in human AMs exposed to particles, and sought to characterize the global response of pro- and antioxidant genes. We exposed AMs obtained by bronchoscopy from normal individuals to Chapel Hill particulate matter of 2.5-μm diameter or smaller (PM2.5; 1 μg/ml) or vehicle for 4 hours (n = 6 independent samples). mRNAs were extracted, amplified, and hybridized to Agilent human 1A microarray. Significant genes were identified by significance analysis of microarrays (false discovery rate, 10%; P ≤ 0.05) and mapped with Gene Ontology in the Database for Annotation, Visualization, and Integrated Discovery. We found 34 and 41 up- and down-regulated genes, respectively; 22 genes (∼30%) were involved in metal binding, and 11 were linked to oxidative stress, including up-regulation of five metallothionein (MT)-1 isoforms. Exogenous MT1 attenuated PM2.5-induced H2O2 release. PM2.5 premixed with MT1 stimulated less H2O2 release. Knockdown of MT1F gene increased PM2.5-induced H2O2 release. PM2.5 at 1 μg/ml did not increase H2O2 release. Mount St. Helens PM2.5 and acid-extracted Chapel Hill PM2.5, both poor in metals, did not induce MT1F or H2O2 release. Our results show that PM2.5 induced a gene expression profile prevalent with genes related to metal binding and oxidative stress in human AMs, independent of oxidative stress. Metals associated with PM may play an important role in particle-induced gene changes. PMID:19251948

  20. Fine ambient particles induce oxidative stress and metal binding genes in human alveolar macrophages.


    Huang, Yuh-Chin T; Li, Zhuowei; Carter, Jacqueline D; Soukup, Joleen M; Schwartz, David A; Yang, Ivana V


    Exposure to pollutant particles increased respiratory morbidity and mortality. The alveolar macrophages (AMs) are one cell type in the lung directly exposed to particles. Upon contact with particles, AMs are activated and produce reactive oxygen species, but the scope of this oxidative stress response remains poorly defined. In this study, we determined the gene expression profile in human AMs exposed to particles, and sought to characterize the global response of pro- and antioxidant genes. We exposed AMs obtained by bronchoscopy from normal individuals to Chapel Hill particulate matter of 2.5-microm diameter or smaller (PM(2.5); 1 microg/ml) or vehicle for 4 hours (n = 6 independent samples). mRNAs were extracted, amplified, and hybridized to Agilent human 1A microarray. Significant genes were identified by significance analysis of microarrays (false discovery rate, 10%; P < or = 0.05) and mapped with Gene Ontology in the Database for Annotation, Visualization, and Integrated Discovery. We found 34 and 41 up- and down-regulated genes, respectively; 22 genes (approximately 30%) were involved in metal binding, and 11 were linked to oxidative stress, including up-regulation of five metallothionein (MT)-1 isoforms. Exogenous MT1 attenuated PM(2.5)-induced H2O2 release. PM(2.5) premixed with MT1 stimulated less H2O2 release. Knockdown of MT1F gene increased PM(2.5)-induced H2O2 release. PM(2.5) at 1 microg/ml did not increase H2O2 release. Mount St. Helens PM(2.5) and acid-extracted Chapel Hill PM(2.5), both poor in metals, did not induce MT1F or H2O2 release. Our results show that PM(2.5) induced a gene expression profile prevalent with genes related to metal binding and oxidative stress in human AMs, independent of oxidative stress. Metals associated with PM may play an important role in particle-induced gene changes. PMID:19251948

  1. Gene expression profile comparison in the penile tissue of diabetes and cavernous nerve injury-induced erectile dysfunction rat model

    PubMed Central

    Kam, Sung Chul; Lee, Sang Hoon; Jeon, Ju Hong; So, Insuk; Chae, Mee Ree; Park, Jong Kwan


    Purpose To investigate the effects of cavernous nerve injury (CNI) on gene expression profiles in the cavernosal tissue of a CNI-induced erectile dysfunction (ED) model and to provide a basis for future investigations to discover potential target genes for ED treatment. Materials and Methods Young adult rats were divided randomly into 2 groups: sham operation and bilateral CN resection. At 12 weeks after CNI we measured erectile responses and performed microarray experiments and gene set enrichment analysis to reveal gene signatures that were enriched in the CNI-induced ED model. Alterations in gene signatures were compared with those in the diabetes-induced ED model. The diabetic-induced ED data is taken from GSE2457. Results The mean ratio of intracavernosal pressure/blood pressure for the CNI group (0.54±0.4 cmH2O) was significantly lower than that in the sham operation group (0.73±0.8 cmH2O, p<0.05). Supervised and unsupervised clustering analysis showed that the diabetes- and CNI-induced ED cavernous tissues had different gene expression profiles from normal cavernous tissues. We identified 46 genes that were upregulated and 77 genes that were downregulated in both the CNI- and diabetes-induced ED models. Conclusions Our genome-wide and computational studies provide the groundwork for understanding complex mechanisms and molecular signature changes in ED. PMID:27437539

  2. Transcriptome Analysis of Early Responsive Genes in Rice during Magnaporthe oryzae Infection.


    Wang, Yiming; Kwon, Soon Jae; Wu, Jingni; Choi, Jaeyoung; Lee, Yong-Hwan; Agrawal, Ganesh Kumar; Tamogami, Shigeru; Rakwal, Randeep; Park, Sang-Ryeol; Kim, Beom-Gi; Jung, Ki-Hong; Kang, Kyu Young; Kim, Sang Gon; Kim, Sun Tae


    Rice blast disease caused by Magnaporthe oryzae is one of the most serious diseases of cultivated rice (Oryza sativa L.) in most rice-growing regions of the world. In order to investigate early response genes in rice, we utilized the transcriptome analysis approach using a 300 K tilling microarray to rice leaves infected with compatible and incompatible M. oryzae strains. Prior to the microarray experiment, total RNA was validated by measuring the differential expression of rice defense-related marker genes (chitinase 2, barwin, PBZ1, and PR-10) by RT-PCR, and phytoalexins (sakuranetin and momilactone A) with HPLC. Microarray analysis revealed that 231 genes were up-regulated (>2 fold change, p < 0.05) in the incompatible interaction compared to the compatible one. Highly expressed genes were functionally characterized into metabolic processes and oxidation-reduction categories. The oxidative stress response was induced in both early and later infection stages. Biotic stress overview from MapMan analysis revealed that the phytohormone ethylene as well as signaling molecules jasmonic acid and salicylic acid is important for defense gene regulation. WRKY and Myb transcription factors were also involved in signal transduction processes. Additionally, receptor-like kinases were more likely associated with the defense response, and their expression patterns were validated by RT-PCR. Our results suggest that candidate genes, including receptor-like protein kinases, may play a key role in disease resistance against M. oryzae attack. PMID:25506299

  3. Comprehensive and computational analysis of genes in human umbilical vein endothelial cells responsive to X-irradiation.


    Furusawa, Yukihiro; Zhao, Qing-Li; Hattori, Yuichi; Tabuchi, Yoshiaki; Iwasaki, Toshiyasu; Nomura, Takaharu; Kondo, Takashi


    Radiation exposure such as A-bomb or radiation therapy is considered a major health-risk factor for cardiovascular disease. In order to understand the molecular mechanisms underlying the inflammatory reaction frequently encountered in the vascular system after exposure to ionizing radiation, we carried out a global scale microarray and computational gene expression analyses on human umbilical endothelial cells (HUVECs) exposed to X-ray (2.5 Gy). The gene ontology analysis revealed that the down-regulated genes were associated with cell cycle regulation, whereas the up-regulated genes were associated with inflammatory responses, in particular, the type 1 interferon response. The computational analysis using ingenuity pathway analysis also identified a gene network containing the interferon response factor 7 (IRF7) and its transcriptional targets such as interferon-induced transcripts (IFITs) and Mx1, which have been known to be associated with inflammation in endothelial cells. The up-regulated genes and the gene network identified here may explain the inflammatory response induced by X-irradiation. These findings uncover part of the molecular basis of the mechanism(s) of the inflammatory disorder in response to X-irradiation in HUVECs. The dataset is publicly available at the Gene Expression Omnibus (GEO) repository ( with accession number GSE76484. PMID:27275413

  4. Sequential Infection with Common Pathogens Promotes Human-like Immune Gene Expression and Altered Vaccine Response.


    Reese, Tiffany A; Bi, Kevin; Kambal, Amal; Filali-Mouhim, Ali; Beura, Lalit K; Bürger, Matheus C; Pulendran, Bali; Sekaly, Rafick-Pierre; Jameson, Stephen C; Masopust, David; Haining, W Nicholas; Virgin, Herbert W


    Immune responses differ between laboratory mice and humans. Chronic infection with viruses and parasites are common in humans, but are absent in laboratory mice, and thus represent potential contributors to inter-species differences in immunity. To test this, we sequentially infected laboratory mice with herpesviruses, influenza, and an intestinal helminth and compared their blood immune signatures to mock-infected mice before and after vaccination against yellow fever virus (YFV-17D). Sequential infection altered pre- and post-vaccination gene expression, cytokines, and antibodies in blood. Sequential pathogen exposure induced gene signatures that recapitulated those seen in blood from pet store-raised versus laboratory mice, and adult versus cord blood in humans. Therefore, basal and vaccine-induced murine immune responses are altered by infection with agents common outside of barrier facilities. This raises the possibility that we can improve mouse models of vaccination and immunity by selective microbial exposure of laboratory animals to mimic that of humans. PMID:27107939

  5. Identification of genes regulating TRAIL-induced apoptosis in rheumatoid arthritis fibroblasts-like synoviocytes.


    Audo, R; Hegglin, A; Severac, D; Dantec, C; Combe, B; Hahne, M; Morel, J


    We previously described that sensitivity to tumor necrosis factor-related apoptosis-inducing ligand (TRAIL)-induced apoptosis varied in rheumatoid arthritis fibroblasts-like synoviocytes (RAFLS) from one patient to another and was correlated with disease severity. Therefore, we screened for genes differentially expressed in RAFLS sensitive and resistant to TRAIL-induced apoptosis. The sensitivity of RAFLS was defined based on the percentage of TRAIL-induced apoptosis: 0-10% for resistant cells and >25% for sensitive RAFLS. We performed transcriptomic comparison between RAFLS-S (n=6) and RAFLS-R (n=6) and then examined the implication of identified candidates in the regulation of apoptosis using small interference RNA (siRNA). Microarray analysis revealed 10 functional genes differentially expressed according to TRAIL sensitivity. These factors are implicated in different functions, such as the respiratory chain (ND3), the transport of lipids (OSBP2, PLTP), the regulation of signaling linked to extracellular factors (SULF2, GALNT1, SIAE) or the regulation of gene expression (TET2 and LARP6). We confirmed differential expression for GALNT1 and LARP6 by quantitative reverse transcriptase-PCR. Using siRNA extinction, we demonstrated the implication of GALNT1, SULF2 and LARP6 in the control of TRAIL-induced responses. These results are of particular interest as GALNT1 and LARP6 have been implicated in the regulation of cell death and may represent interesting targets to induce apoptosis of RAFLS. PMID:26247836

  6. Characterization and expression of a murine gene homologous to human EPA/TIMP: a virus-induced gene in the mouse.

    PubMed Central

    Gewert, D R; Coulombe, B; Castelino, M; Skup, D; Williams, B R


    A genomic clone encompassing the entire coding region of a murine gene homologous to human erythroid potentiating activity/tissue inhibitor of metalloproteinase (EPA/TIMP) was isolated and sequenced. Based on alignment with human EPA/TIMP cDNAs we deduce a structure comprising five exons and four introns extending over 4.3 kb of DNA. In mouse and hamster cell lines transcription from this gene and interferon genes is induced by Newcastle Disease virus (NDV). Examination of the 5'-flanking sequences of the gene reveals a set of repeated elements with structural similarity to those previously described as inducer-responsive elements in the human IFN-beta 1 gene. The 4.3-kb DNA fragment encompassing the homologous murine EPA/TIMP gene was transfected into human T98G cells and transfectants tested for NDV inducibility. In contrast to the endogenous human gene, the integrated murine EPA/TIMP gene was NDV-inducible and TIMP activity was detectable in the cell culture fluid. Images Fig. 3. Fig. 4. Fig. 5. Fig. 6. Fig. 8. Fig. 9. PMID:3034603

  7. Mycobacterium fortuitum induces A20 expression that impairs macrophage inflammatory responses.


    Lee, Gippeum Joy; Lee, Hye-Mi; Kim, Tae Sung; Kim, Jin Kyung; Sohn, Kyung Mok; Jo, Eun-Kyeong


    Mycobacterium fortuitum is a rapidly growing mycobacterium that has been regarded as an etiological agent of a variety of human infections. However, little is known about the host inflammatory responses and the molecular mechanisms by which MF-induced inflammation is regulated in macrophages. In this study, we report that MF infection leads to the induction of an anti-inflammatory molecule, A20 (also known as TNFAIP3), which is essential for the regulation of MF-induced inflammatory responses in murine bone marrow-derived macrophages (BMDMs). MF triggered the expression of tumor necrosis factor-α and interleukin-6 in BMDMs through signaling of the Toll-like receptor 2 (TLR2)-myeloid differentiation primary response gene 88. Additionally, MF rapidly induced the expression of A20, which inhibited proinflammatory cytokine expression and nuclear factor (NF)-κB reporter gene activities in BMDMs. Notably, MF-induced activation of NF-κB signaling was required for A20 expression and proinflammatory responses in BMDMs. Furthermore, the rough morphotype of the MF clinical strain induced a higher level of proinflammatory signaling activation, but less A20 induction in BMDMs, compared to the smooth morphotype. Taken together, these results suggest that MF-induced activation of host proinflammatory responses is negatively regulated through TLR2-dependent A20 expression. PMID:26940588

  8. A systems biology approach to suppress TNF-induced proinflammatory gene expressions

    PubMed Central


    Background Tumor necrosis factor (TNF) is a widely studied cytokine (ligand) that induces proinflammatory signaling and regulates myriad cellular processes. In major illnesses, such as rheumatoid arthritis and certain cancers, the expression of TNF is elevated. Despite much progress in the field, the targeted regulation of TNF response for therapeutic benefits remains suboptimal. Here, to effectively regulate the proinflammatory response induced by TNF, a systems biology approach was adopted. Results We developed a computational model to investigate the temporal activations of MAP kinase (p38), nuclear factor (NF)-κB, and the kinetics of 3 groups of genes, defined by early, intermediate and late phases, in murine embryonic fibroblast (MEF) and 3T3 cells. To identify a crucial target that suppresses, and not abolishes, proinflammatory genes, the model was tested in several in silico knock out (KO) conditions. Among the candidate molecules tested, in silico RIP1 KO effectively regulated all groups of proinflammatory genes (early, middle and late). To validate this result, we experimentally inhibited TNF signaling in MEF and 3T3 cells with RIP1 inhibitor, Necrostatin-1 (Nec-1), and investigated 10 genes (Il6, Nfkbia, Jun, Tnfaip3, Ccl7, Vcam1, Cxcl10, Mmp3, Mmp13, Enpp2) belonging to the 3 major groups of upregulated genes. As predicted by the model, all measured genes were significantly impaired. Conclusions Our results demonstrate that Nec-1 modulates TNF-induced proinflammatory response, and may potentially be used as a therapeutic target for inflammatory diseases such as rheumatoid arthritis and osteoarthritis. PMID:24199619

  9. The extracellular signal-regulated kinase mitogen-activated protein kinase/ribosomal S6 protein kinase 1 cascade phosphorylates cAMP response element-binding protein to induce MUC5B gene expression via D-prostanoid receptor signaling.


    Choi, Yeon Ho; Lee, Sang-Nam; Aoyagi, Hiroki; Yamasaki, Yasundo; Yoo, Jung-Yoon; Park, Boryung; Shin, Dong Min; Yoon, Ho-Geun; Yoon, Joo-Heon


    Mucus hypersecretion is a prominent feature of respiratory diseases, and MUC5B is a major airway mucin. Mucin gene expression can be affected by inflammatory mediators, including prostaglandin (PG) D(2,) an inflammatory mediator synthesized by hematopoietic PGD synthase (H-PGDS). PGD(2) binds to either D-prostanoid receptor (DP1) or chemoattractant receptor homologous molecule expressed on T-helper type 2 cells (CRTH2). We investigated the mechanisms by which PGD(2) induces MUC5B gene expression in airway epithelial cells. Western blot analysis showed that H-PGDS was highly expressed in nasal polyps. Similar results were obtained for PGD(2) expression. In addition, we could clearly detect the expressions of both H-PGDS and DP1 in nasal epithelial cells but not CRTH2. We demonstrated that PGD(2) increased MUC5B gene expression in normal human nasal epithelial cells as well as in NCI-H292 cells in vitro. S5751, a DP1 antagonist, inhibited PGD(2)-induced MUC5B expression, whereas a CRTH2 antagonist (OC0459) did not. These data suggest that PGD(2) induced MUC5B expression via DP1. Pretreatment with extracellular signal-regulated kinase (ERK) inhibitor (PD98059) blocked both PGD(2)-induced ERK mitogen-activated protein kinase (MAPK) activation and MUC5B expression. Proximity ligation assays showed direct interaction between RSK1 and cAMP response element-binding protein (CREB). Stimulation with PGD(2) caused an increase in intracellular cAMP levels, whereas intracellular Ca(2+) did not have such an effect. PGD(2)-induced MUC5B mRNA levels were regulated by CREB via direct interaction with two cAMP-response element sites (-921/-914 and -900/-893). Finally, we demonstrated that PGD(2) can induce MUC5B overproduction via ERK MAPK/RSK1/CREB signaling and that DP1 receptor may have suppressive effects in controlling MUC5B overproduction in the airway. PMID:21832046

  10. GATA2 Mediates Thyrotropin-Releasing Hormone-Induced Transcriptional Activation of the Thyrotropin β Gene

    PubMed Central

    Ohba, Kenji; Sasaki, Shigekazu; Matsushita, Akio; Iwaki, Hiroyuki; Matsunaga, Hideyuki; Suzuki, Shingo; Ishizuka, Keiko; Misawa, Hiroko; Oki, Yutaka; Nakamura, Hirotoshi


    Thyrotropin-releasing hormone (TRH) activates not only the secretion of thyrotropin (TSH) but also the transcription of TSHβ and α-glycoprotein (αGSU) subunit genes. TSHβ expression is maintained by two transcription factors, Pit1 and GATA2, and is negatively regulated by thyroid hormone (T3). Our prior studies suggest that the main activator of the TSHβ gene is GATA2, not Pit1 or unliganded T3 receptor (TR). In previous studies on the mechanism of TRH-induced activation of the TSHβ gene, the involvements of Pit1 and TR have been investigated, but the role of GATA2 has not been clarified. Using kidney-derived CV1 cells and pituitary-derived GH3 and TαT1 cells, we demonstrate here that TRH signaling enhances GATA2-dependent activation of the TSHβ promoter and that TRH-induced activity is abolished by amino acid substitution in the GATA2-Zn finger domain or mutation of GATA-responsive element in the TSHβ gene. In CV1 cells transfected with TRH receptor expression plasmid, GATA2-dependent transactivation of αGSU and endothelin-1 promoters was enhanced by TRH. In the gel shift assay, TRH signal potentiated the DNA-binding capacity of GATA2. While inhibition by T3 is dominant over TRH-induced activation, unliganded TR or the putative negative T3-responsive element are not required for TRH-induced stimulation. Studies using GH3 cells showed that TRH-induced activity of the TSHβ promoter depends on protein kinase C but not the mitogen-activated protein kinase, suggesting that the signaling pathway is different from that in the prolactin gene. These results indicate that GATA2 is the principal mediator of the TRH signaling pathway in TSHβ expression. PMID:21533184

  11. Identification of Genes Required for Normal Pheromone-Induced Cell Polarization in Saccharomyces Cerevisiae

    PubMed Central

    Chenevert, J.; Valtz, N.; Herskowitz, I.


    In response to mating pheromones, cells of the yeast Saccharomyces cerevisiae adopt a polarized ``shmoo'' morphology, in which the cytoskeleton and proteins involved in mating are localized to a cell-surface projection. This polarization is presumed to reflect the oriented morphogenesis that occurs between mating partners to facilitate cell and nuclear fusion. To identify genes involved in pheromone-induced cell polarization, we have isolated mutants defective in mating to an enfeebled partner and studied a subset of these mutants. The 34 mutants of interest are proficient for pheromone production, arrest in response to pheromone, mate to wild-type strains, and exhibit normal cell polarity during vegetative growth. The mutants were divided into classes based on their morphological responses to mating pheromone. One class is unable to localize cell-surface growth in response to mating factor and instead enlarges in a uniform manner. These mutants harbor special alleles of genes required for cell polarization during vegetative growth, BEM1 and CDC24. Another class of mutants forms bilobed, peanut-like shapes when treated with pheromone and defines two genes, PEA1 and PEA2. PEA1 is identical to SPA2. A third class forms normally shaped but tiny shmoos and defines the gene TNY1. A final group of mutants exhibits apparently normal shmoo morphology. The nature of their mating defect is yet to be determined. We discuss the possible roles of these gene products in establishing cell polarity during mating. PMID:8013906

  12. SpoT-triggered stringent response controls usp gene expression in Pseudomonas aeruginosa.


    Boes, Nelli; Schreiber, Kerstin; Schobert, Max


    The universal stress proteins (Usps) UspK (PA3309) and UspN (PA4352) of Pseudomonas aeruginosa are essential for surviving specific anaerobic energy stress conditions such as pyruvate fermentation and anaerobic stationary phase. Expression of the respective genes is under the control of the oxygen-sensing regulator Anr. In this study we investigated the regulation of uspN and three additional P. aeruginosa usp genes: uspL (PA1789), uspM (PA4328), and uspO (PA5027). Anr induces expression of these genes in response to anaerobic conditions. Using promoter-lacZ fusions, we showed that PuspL-lacZ, PuspM-lacZ, and PuspO-lacZ were also induced in stationary phase as described for PuspN-lacZ. However, stationary phase gene expression was abolished in the P. aeruginosa triple mutant Deltaanr DeltarelA DeltaspoT. The relA and spoT genes encode the regulatory components of the stringent response. We determined pppGpp and ppGpp levels using a thin-layer chromatography approach and detected the accumulation of ppGpp in the wild type and the DeltarelA mutant in stationary phase, indicating a SpoT-derived control of ppGpp accumulation. Additional investigation of stationary phase in LB medium revealed that alkaline pH values are involved in the regulatory process of ppGpp accumulation. PMID:18776018

  13. Differentially expressed genes of Chenopodium amaranticolor in response to cymbidium mosaic virus infection.


    Kim, Su Min; Baek, Eseul; Ryu, Ki Hyun; Choi, Sun Hee


    Cymbidium mosaic virus (CymMV)-induced expressed sequence tag (EST) clones from Chenopodium amaranticolor were identified. CymMV was mechanically inoculated onto C. amaranticolor, and local lesion symptoms were observed. Inoculated leaves were collected on serial days post inoculation (dpi) to identify activated or suppressed genes. mRNA isolation and suppression subtractive hybridization (SSH) were then performed to identify differentially expressed genes related to the local lesion response. Fifty-three ESTs, including genes related to defense and stress responses (e.g., lipoxygenase, jasmonate-induced protein, and heat shock protein), were generated. In addition, a large proportion of the ESTs were found to be involved in photosynthesis, as determined by their functional categories. Expression levels of several EST genes were observed using quantitative real-time reverse transcription-polymerase chain reaction, and the evaluated genes showed varying levels of expression during the experimental period. In this study, differentially expressed sequences via SSH were identified from CymMV-infected C. amaranticolor, and profiling and annotation were carried out to determine the expression pattern of CymMV and its interaction with C. amaranticolor. PMID:27364083

  14. Identification of genes induced by neuregulin in cultured myotubes.


    Fu, A K; Cheung, W M; Ip, F C; Ip, N Y


    The formation of the neuromuscular junction (NMJ) involves a series of inductive interactions between motor neurons and muscle fibers. The neural signals proposed to induce the mRNA expression of acetylcholine receptors in muscle include neuregulin (NRG). In the present study, we have employed RNA fingerprinting by arbitrarily primed PCR analysis to identify the differentially expressed transcripts following NRG treatment in cultured myotubes. Nine partial cDNA fragments were isolated; the mRNA expression of eight of these genes was found to be up-regulated by NRG. The spatial and temporal expression profiles of these NRG-regulated genes in rat tissues during development suggest potential functional roles during the formation of NMJ in vivo. Our findings not only allowed the identification of novel genes, but also suggested possible functions for some known genes that are consistent with their potential roles at the NMJ. Furthermore, the identification of G-protein beta1 subunit and G-protein-coupled receptor as NRG-regulated genes has provided the first demonstration that activation of the NRG signaling pathway can induce the expression of components in the G-protein signaling cascade. PMID:10576892

  15. Association of Norepinephrine Transporter Gene with Methylphenidate Response.

    ERIC Educational Resources Information Center

    Yang, Li; Wang, Yu-Feng; Li, Jun; Faraone, Stephen V.


    Objective: This study aimed to explore the association between alleles of the norepinephrine transporter gene and the methylphenidate response. Method: Chinese Han youths with attention-deficit/hyperactivity disorder recruited in the Outpatient Department of the Institute of Mental Health from 2001 to 2004 were treated with methylphenidate in…

  16. Modulation of gene expression in endothelial cells in response to high LET nickel ion irradiation.


    Beck, Michaël; Rombouts, Charlotte; Moreels, Marjan; Aerts, An; Quintens, Roel; Tabury, Kevin; Michaux, Arlette; Janssen, Ann; Neefs, Mieke; Ernst, Eric; Dieriks, Birger; Lee, Ryonfa; De Vos, Winnok H; Lambert, Charles; Van Oostveldt, Patrick; Baatout, Sarah


    Ionizing radiation can elicit harmful effects on the cardiovascular system at high doses. Endothelial cells are critical targets in radiation-induced cardiovascular damage. Astronauts performing a long-term deep space mission are exposed to consistently higher fluences of ionizing radiation that may accumulate to reach high effective doses. In addition, cosmic radiation contains high linear energy transfer (LET) radiation that is known to produce high values of relative biological effectiveness (RBE). The aim of this study was to broaden the understanding of the molecular response to high LET radiation by investigating the changes in gene expression in endothelial cells. For this purpose, a human endothelial cell line (EA.hy926) was irradiated with accelerated nickel ions (Ni) (LET, 183 keV/µm) at doses of 0.5, 2 and 5 Gy. DNA damage was measured 2 and 24 h following irradiation by γ-H2AX foci detection by fluorescence microscopy and gene expression changes were measured by microarrays at 8 and 24 h following irradiation. We found that exposure to accelerated nickel particles induced a persistent DNA damage response up to 24 h after treatment. This was accompanied by a downregulation in the expression of a multitude of genes involved in the regulation of the cell cycle and an upregulation in the expression of genes involved in cell cycle checkpoints. In addition, genes involved in DNA damage response, oxidative stress, apoptosis and cell-cell signaling (cytokines) were found to be upregulated. An in silico analysis of the involved genes suggested that the transcription factors, E2F and nuclear factor (NF)-κB, may be involved in these cellular responses. PMID:25118949

  17. Functional characterization of a Penicillium chrysogenum mutanase gene induced upon co-cultivation with Bacillus subtilis

    PubMed Central


    Background Microbial gene expression is strongly influenced by environmental growth conditions. Comparison of gene expression under different conditions is frequently used for functional analysis and to unravel regulatory networks, however, gene expression responses to co-cultivation with other microorganisms, a common occurrence in nature, is rarely studied under laboratory conditions. To explore cellular responses of the antibiotic-producing fungus Penicillium chrysogenum to prokaryotes, the present study investigates its transcriptional responses during co-cultivation with Bacillus subtilis. Results Steady-state glucose-limited chemostats of P. chrysogenum grown under penillicin-non-producing conditions were inoculated with B. subtilis. Physiological and transcriptional responses of P. chrysogenum in the resulting mixed culture were monitored over 72 h. Under these conditions, B. subtilis outcompeted P. chrysogenum, as reflected by a three-fold increase of the B. subtilis population size and a two-fold reduction of the P. chrysogenum biomass concentration. Genes involved in the penicillin pathway and in synthesis of the penicillin precursors and side-chain were unresponsive to the presence of B. subtilis. Moreover, Penicillium polyketide synthase and nonribosomal peptide synthase genes were either not expressed or down-regulated. Among the highly responsive genes, two putative α-1,3 endoglucanase (mutanase) genes viz Pc12g07500 and Pc12g13330 were upregulated by more than 15-fold and 8-fold, respectively. Measurement of enzyme activity in the supernatant of mixed culture confirmed that the co-cultivation with B. subtilis induced mutanase production. Mutanase activity was neither observed in pure cultures of P. chrysogenum or B. subtilis, nor during exposure of P. chrysogenum to B. subtilis culture supernatants or heat-inactivated B. subtilis cells. However, mutanase production was observed in cultures of P. chrysogenum exposed to filter-sterilized supernatants

  18. Gene Expression Responses to Mechanical Stimulation of Mesenchymal Stem Cells Seeded on Calcium Phosphate Cement

    PubMed Central

    Gharibi, Borzo; Cama, Giuseppe; Capurro, Marco; Thompson, Ian; Deb, Sanjukta; Di Silvio, Lucy


    Introduction The aim of the study reported here was to investigate the molecular responses of human mesenchymal stem cells (MSC) to loading with a model that attempts to closely mimic the physiological mechanical loading of bone, using monetite calcium phosphate (CaP) scaffolds to mimic the biomechanical properties of bone and a bioreactor to induce appropriate load and strain. Methods Human MSCs were seeded onto CaP scaffolds and subjected to a pulsating compressive force of 5.5±4.5 N at a frequency of 0.1 Hz. Early molecular responses to mechanical loading were assessed by microarray and quantitative reverse transcription-polymerase chain reaction and activation of signal transduction cascades was evaluated by western blotting analysis. Results The maximum mechanical strain on cell/scaffolds was calculated at around 0.4%. After 2 h of loading, a total of 100 genes were differentially expressed. The largest cluster of genes activated with 2 h stimulation was the regulator of transcription, and it included FOSB. There were also changes in genes involved in cell cycle and regulation of protein kinase cascades. When cells were rested for 6 h after mechanical stimulation, gene expression returned to normal. Further resting for a total of 22 h induced upregulation of 63 totally distinct genes that were mainly involved in cell surface receptor signal transduction and regulation of metabolic and cell division processes. In addition, the osteogenic transcription factor RUNX-2 was upregulated. Twenty-four hours of persistent loading also markedly induced osterix expression. Mechanical loading resulted in upregulation of Erk1/2 phosphorylation and the gene expression study identified a number of possible genes (SPRY2, RIPK1, SPRED2, SERTAD1, TRIB1, and RAPGEF2) that may regulate this process. Conclusion The results suggest that mechanical loading activates a small number of immediate-early response genes that are mainly associated with transcriptional

  19. Ethological concepts revisited: immediate early gene induction in response to sexual stimuli in birds.


    Ball, G F; Balthazar, J


    Courtship behaviors were interpreted by ethologists as being examples of 'sign stimuli' that would act as 'releasers' of stereotypic species-typical behaviors in conspecifics. A key component of the sign stimulus concept is that some form of stimulus filtering occurs that is responsible for the marked selective behavioral responsiveness. Studies of immediate early gene induction in the avian brain in response to conspecific stimuli associated with courtship and mating reveal that such gene induction is highly selective. In male Japanese quail (Coturnix japonica), studies of the immediate early gene c-fos or zenk have been conducted in birds engaging in both appetitive and consummatory aspects of male sexual behavior. High induction of immediate early genes occurs in hypothalamic and limbic areas such as the medial preoptic nucleus, bed nucleus striae terminalis and parts of the archistriatum in birds who had copulated and/or who had expressed a learned social proximity response, reflecting appetitive sexual behavior. Immediate early gene expression was also increased in telencephalic areas such as the hyperstriatum ventrale that presumably plays a role in the integration of sensory cues related to female recognition. In European starlings, studies of zenk induction have been conducted in females who hear male-typical courtship song. Clayton and Mello had shown that zenk is induced in the auditory telencephalon of canaries and zebra finches at high levels specifically in response to conspecific song. Immediate early genes such as fos and zenk are also expressed in song control nuclei specifically in association with song production. In starlings it was found that song was effective in rapidly inducing zenk expression in the auditory telencephalon in males and in females in the breeding as well as in the non-breeding season. Thus, the expression is not greater in females who use song to choose mates or during the breeding season when females are choosing mates

  20. Molecular analysis of poplar defense against herbivory: comparison of wound- and insect elicitor-induced gene expression.


    Major, Ian T; Constabel, C Peter


    In order to characterize defense responses of hybrid poplar (Populus trichocarpax P. deltoides), we profiled leaf transcript patterns elicited by wounding and by regurgitant from forest tent caterpillar (FTC; Malacosoma disstria), a Lepidopteran defoliator of poplars. Macroarrays were used to compare transcript profiles. Both FTC-regurgitant (FTC-R) and mechanical wounding with pliers elicited expression of a variety of genes, and for these genes our analysis indicated that these treatments induced qualitatively similar responses. Similarly, a comparison of responses of directly treated and systemically induced leaves indicated extensive overlap in the sets of induced genes. FTC-R was found to contain the insect-derived elicitor volicitin. The simulated herbivory treatments resulted in the induction of genes involved in poplar defense and secondary metabolism. We also identified wound-responsive genes with roles in primary metabolism, including a putative invertase, lipase, and acyl-activating enzyme; some of these genes may have roles in defense signaling. In addition, we found three unknown genes containing a ZIM motif which may represent novel transcription factors. PMID:17096789

  1. A dual activation mechanism for Myb-responsive genes in myelomonocytic cells.


    Yamkamon, Vichanan; Ivanova, Olga; Braas, Daniel; Chayka, Olesya; Patmasiriwat, Pimpicha; Klempnauer, Karl-Heinz


    The retroviral oncogene v-myb encodes a transcription factor (v-Myb) which is responsible for the transformation of myelomonocytic cells by avian myeloblastosis virus (AMV). v-Myb is thought to exert its biological effects by deregulating the expression of specific target genes. Here we have used DNaseI hypersensitive site mapping and reporter gene assays to study the activation of three Myb target genes--mim-1, the lysozyme gene and the C/EBPbeta gene--all of which are activated by Myb in myelomonocytic cells but not in other hematopoietic lineages. We have found that these genes are activated by Myb via more than one cis-regulatory region. Our data suggest that all three genes are activated by Myb by dual mechanisms involving the promoters as well as enhancers. Using a cell line that expresses an estrogen-inducible v-Myb/estrogen receptor fusion protein we have also determined the effect of Myb on the expression of the C/EBPalpha gene. Our results show that C/EBPalpha expression is down-regulated by v-Myb. Thus, v-Myb affects the expression of two C/EBP family members in opposite directions. PMID:17950008

  2. Rescue Effects and Underlying Mechanisms of Intragland Shh Gene Delivery on Irradiation-Induced Hyposalivation.


    Hai, Bo; Zhao, Qingguo; Qin, Lizheng; Rangaraj, Dharanipathy; Gutti, Veera R; Liu, Fei


    Irreversible hypofunction of salivary glands is common in head and neck cancer survivors treated with radiotherapy and can only be temporarily relieved with current treatments. We found in an inducible sonic hedgehog (Shh) transgenic mouse model that transient activation of the Hedgehog pathway after irradiation rescued salivary gland function in males by preserving salivary stem/progenitor cells and parasympathetic innervation. To translate these findings into feasible clinical application, we evaluated the effects of Shh gene transfer to salivary glands of wild-type mice on irradiation-induced hyposalivation. Shh or control GFP gene was delivered by noninvasive retrograde ductal instillation of corresponding adenoviral vectors. In both male and female mice, Shh gene delivery efficiently activated Hedgehog/Gli signaling, and significantly improved stimulated saliva secretion and preserved saliva-producing acinar cells after irradiation. In addition to preserving parasympathetic innervation through induction of neurotrophic factors, Shh gene delivery also alleviated the irradiation damage of the microvasculature, likely via inducing angiogenic factors, but did not expand the progeny of cells responsive to Hedgehog/Gli signaling. These data indicate that transient activation of the Hedgehog pathway by gene delivery is promising to rescue salivary function after irradiation in both sexes, and the Hedgehog/Gli pathway may function mainly in cell nonautonomous manners to achieve the rescue effect. PMID:27021743

  3. [Role of DNA repair genes in radiation-induced changes of lifespan of Drosophila melanogaster].


    Shilova, L A; Pliusnina, E N; Zemskaia, N V; Moskalev, A A


    One of the main effects of various stress factors, including ionizing radiation, is DNA damage. Accumulation of DNA damage and somatic mutations in the somatic tissues is regarded as one of the basic mechanisms of aging. We have developed an approach to the study of molecular and genetic mechanisms of radioadaptation, which is based on the analysis of changes in the lifespan of Drosophila with a transformed genotype. In this study we investigated the radioadaptive response and hormesis by radiation-induced changed of the lifespan of different strains of Drosophila melanogaster, such as a wild type strain Canton-Sand strains with mutations in DNA damage response gene (homologue of GADD45), excision repair genes (homologues of XPF, XPC, PCNA) and double-strand breaks repair genes (homologues of RAD54, XRCC3, BLM). The exposure to irradiation at the dose rate of 40 cGy was performed chronically through the stages of fly development; an acute exposure at the dose rate of 30 Gy was applied to the adult stages of flies. Also, we investigated the resistance to acute gamma-radiation of Drosophila with conditional ubiquitous overexpression of genes that are involved in DNA damage recognition (homologues of GADD45, HUS1, CHK2), excision repair (homologues of XPF, XPC, AP-endonuclease-1) and double-strand break repair (homologues of BRCA2, XRCC3, KU80, WRNexo). In the wild type strain Canton-S, manifestation of the radioadaptive response and radiation hormesis were observed. In individuals with DNA repair gene mutations, no radioadaptive response was observed, or observed to a lesser extent than in wild type flies. Mifepristone--inducible transgene activation does not lead to an increase in resistance to acute irradiation by the parameters of lifespan of Drosophila. Overexpression of DNA repair genes led to a sharp decline in lifespan also in the absence of irradiation. PMID:25775840

  4. Evaluating the ability of the barley stripe mosaic virus-induced gene silencing system to simultaneously silence two wheat genes

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Virus-induced gene silencing (VIGS) is an important tool for rapid assessment of gene function in plants. The ability of the Barley Stripe Mosaic Virus (BSMV) VIGS system to simultaneously silence two genes was assessed by comparing the extent of down-regulation of the wheat PDS and SGT1 genes afte...

  5. Evaluating the Ability of the Barley Stripe Mosaic Virus-Induced Gene Silencing System to Simultaneously Silence Two Wheat Genes

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Virus-induced gene silencing (VIGS) is an important tool for rapid assessment of gene function in plants. The ability of the Barley stripe mosaic virus (BSMV) VIGS system to simultaneously silence two genes was assessed by comparing the extent of down-regulation of the wheat PDS and SGT1 genes afte...

  6. Identification of Arabidopsis Candidate Genes in Response to Biotic and Abiotic Stresses Using Comparative Microarrays

    PubMed Central

    Sham, Arjun; Moustafa, Khaled; Al-Ameri, Salma; Al-Azzawi, Ahmed; Iratni, Rabah; AbuQamar, Synan


    Plants have evolved with intricate mechanisms to cope with multiple environmental stresses. To adapt with biotic and abiotic stresses, plant responses involve changes at the cellular and molecular levels. The current study was designed to investigate the effects of combinations of different environmental stresses on the transcriptome level of Arabidopsis genome using public microarray databases. We investigated the role of cyclopentenones in mediating plant responses to environmental stress through TGA (TGACG motif-binding factor) transcription factor, independently from jasmonic acid. Candidate genes were identified by comparing plants inoculated with Botrytis cinerea or treated with heat, salt or osmotic stress with non-inoculated or non-treated tissues. About 2.5% heat-, 19% salinity- and 41% osmotic stress-induced genes were commonly upregulated by B. cinerea-treatment; and 7.6%, 19% and 48% of genes were commonly downregulated by B. cinerea-treatment, respectively. Our results indicate that plant responses to biotic and abiotic stresses are mediated by several common regulatory genes. Comparisons between transcriptome data from Arabidopsis stressed-plants support our hypothesis that some molecular and biological processes involved in biotic and abiotic stress response are conserved. Thirteen of the common regulated genes to abiotic and biotic stresses were studied in detail to determine their role in plant resistance to B. cinerea. Moreover, a T-DNA insertion mutant of the Responsive to Dehydration gene (rd20), encoding for a member of the caleosin (lipid surface protein) family, showed an enhanced sensitivity to B. cinerea infection and drought. Overall, the overlapping of plant responses to abiotic and biotic stresses, coupled with the sensitivity of the rd20 mutant, may provide new interesting programs for increased plant resistance to multiple environmental stresses, and ultimately increases its chances to survive. Future research directions towards a

  7. Identification of Arabidopsis candidate genes in response to biotic and abiotic stresses using comparative microarrays.


    Sham, Arjun; Moustafa, Khaled; Al-Ameri, Salma; Al-Azzawi, Ahmed; Iratni, Rabah; AbuQamar, Synan


    Plants have evolved with intricate mechanisms to cope with multiple environmental stresses. To adapt with biotic and abiotic stresses, plant responses involve changes at the cellular and molecular levels. The current study was designed to investigate the effects of combinations of different environmental stresses on the transcriptome level of Arabidopsis genome using public microarray databases. We investigated the role of cyclopentenones in mediating plant responses to environmental stress through TGA (TGACG motif-binding factor) transcription factor, independently from jasmonic acid. Candidate genes were identified by comparing plants inoculated with Botrytis cinerea or treated with heat, salt or osmotic stress with non-inoculated or non-treated tissues. About 2.5% heat-, 19% salinity- and 41% osmotic stress-induced genes were commonly upregulated by B. cinerea-treatment; and 7.6%, 19% and 48% of genes were commonly downregulated by B. cinerea-treatment, respectively. Our results indicate that plant responses to biotic and abiotic stresses are mediated by several common regulatory genes. Comparisons between transcriptome data from Arabidopsis stressed-plants support our hypothesis that some molecular and biological processes involved in biotic and abiotic stress response are conserved. Thirteen of the common regulated genes to abiotic and biotic stresses were studied in detail to determine their role in plant resistance to B. cinerea. Moreover, a T-DNA insertion mutant of the Responsive to Dehydration gene (rd20), encoding for a member of the caleosin (lipid surface protein) family, showed an enhanced sensitivity to B. cinerea infection and drought. Overall, the overlapping of plant responses to abiotic and biotic stresses, coupled with the sensitivity of the rd20 mutant, may provide new interesting programs for increased plant resistance to multiple environmental stresses, and ultimately increases its chances to survive. Future research directions towards a

  8. Distinct structural transitions of chromatin topological domains correlate with coordinated hormone-induced gene regulation

    PubMed Central

    Le Dily, François; Baù, Davide; Pohl, Andy; Vicent, Guillermo P.; Serra, François; Soronellas, Daniel; Castellano, Giancarlo; Wright, Roni H.G.; Ballare, Cecilia; Filion, Guillaume; Marti-Renom, Marc A.


    The human genome is segmented into topologically associating domains (TADs), but the role of this conserved organization during transient changes in gene expression is not known. Here we describe the distribution of progestin-induced chromatin modifications and changes in transcriptional activity over TADs in T47D breast cancer cells. Using ChIP-seq (chromatin immunoprecipitation combined with high-throughput sequencing), Hi-C (chromosome capture followed by high-throughput sequencing), and three-dimensional (3D) modeling techniques, we found that the borders of the ∼2000 TADs in these cells are largely maintained after hormone treatment and that up to 20% of the TADs could be considered as discrete regulatory units where the majority of the genes are either transcriptionally activated or repressed in a coordinated fashion. The epigenetic signatures of the TADs are homogeneously modified by hormones in correlation with the transcriptional changes. Hormone-induced changes in gene activity and chromatin remodeling are accompanied by differential structural changes for activated and repressed TADs, as reflected by specific and opposite changes in the strength of intra-TAD interactions within responsive TADs. Indeed, 3D modeling of the Hi-C data suggested that the structure of TADs was modified upon treatment. The differential responses of TADs to progestins and estrogens suggest that TADs could function as “regulons” to enable spatially proximal genes to be coordinately transcribed in response to hormones. PMID:25274727

  9. Gene Expression of Corals in Response to Macroalgal Competitors

    PubMed Central

    Shearer, Tonya L.; Snell, Terry W.; Hay, Mark E.


    As corals decline and macroalgae proliferate on coral reefs, coral-macroalgal competition becomes more frequent and ecologically important. Whether corals are damaged by these interactions depends on susceptibility of the coral and traits of macroalgal competitors. Investigating changes in gene expression of corals and their intracellular symbiotic algae, Symbiodinium, in response to contact with different macroalgae provides insight into the biological processes and cellular pathways affected by competition with macroalgae. We evaluated the gene expression profiles of coral and Symbiodinium genes from two confamilial corals, Acropora millepora and Montipora digitata, after 6 h and 48 h of contact with four common macroalgae that differ in their allelopathic potency to corals. Contacts with macroalgae affected different biological pathways in the more susceptible (A. millepora) versus the more resistant (M. digitata) coral. Genes of coral hosts and of their associated Symbiodinium also responded in species-specific and time-specific ways to each macroalga. Changes in number and expression intensity of affected genes were greater after 6 h compared to 48 h of contact and were greater following contact with Chlorodesmis fastigiata and Amphiroa crassa than following contact with Galaxaura filamentosa or Turbinaria conoides. We documented a divergence in transcriptional responses between two confamilial corals and their associated Symbiodinium, as well as a diversity of dynamic responses within each coral species with respect to the species of macroalgal competitor and the duration of exposure to that competitor. These responses included early initiation of immune processes by Montipora, which is more resistant to damage after long-term macroalgal contact. Activation of the immune response by corals that better resist algal competition is consistent with the hypothesis that some macroalgal effects on corals may be mediated by microbial pathogens. PMID:25500576

  10. Gene expression of corals in response to macroalgal competitors.


    Shearer, Tonya L; Snell, Terry W; Hay, Mark E


    As corals decline and macroalgae proliferate on coral reefs, coral-macroalgal competition becomes more frequent and ecologically important. Whether corals are damaged by these interactions depends on susceptibility of the coral and traits of macroalgal competitors. Investigating changes in gene expression of corals and their intracellular symbiotic algae, Symbiodinium, in response to contact with different macroalgae provides insight into the biological processes and cellular pathways affected by competition with macroalgae. We evaluated the gene expression profiles of coral and Symbiodinium genes from two confamilial corals, Acropora millepora and Montipora digitata, after 6 h and 48 h of contact with four common macroalgae that differ in their allelopathic potency to corals. Contacts with macroalgae affected different biological pathways in the more susceptible (A. millepora) versus the more resistant (M. digitata) coral. Genes of coral hosts and of their associated Symbiodinium also responded in species-specific and time-specific ways to each macroalga. Changes in number and expression intensity of affected genes were greater after 6 h compared to 48 h of contact and were greater following contact with Chlorodesmis fastigiata and Amphiroa crassa than following contact with Galaxaura filamentosa or Turbinaria conoides. We documented a divergence in transcriptional responses between two confamilial corals and their associated Symbiodinium, as well as a diversity of dynamic responses within each coral species with respect to the species of macroalgal competitor and the duration of exposure to that competitor. These responses included early initiation of immune processes by Montipora, which is more resistant to damage after long-term macroalgal contact. Activation of the immune response by corals that better resist algal competition is consistent with the hypothesis that some macroalgal effects on corals may be mediated by microbial pathogens. PMID:25500576

  11. 3′, 5′-Cyclic Adenosine 5′-Monophosphate Response Element-Dependent Transcriptional Regulation of the Secretogranin II Gene Promoter Depends on Gonadotropin-Releasing Hormone-Induced Mitogen-Activated Protein Kinase Activation and the Transactivator Activating Transcription Factor 3

    PubMed Central

    Xie, Jianjun; Roberson, Mark S.


    Previous studies demonstrated that GnRH-induced secretogranin II (SgII) promoter regulation required a consensus cAMP response element (CRE) and protein kinase A/CRE binding protein. The present studies examined the role of additional components of the GnRH signaling network on SgII promoter activity with particular attention devoted to CRE-dependent gene regulation. Disruption of the SgII CRE by mutagenesis resulted in inhibition of GnRH agonist (GnRHa) induction of this promoter in αT3-1 cells. Pharmacological and dominant-negative inhibition of the ERK and c-Jun N-terminal kinase (JNK) signaling pathways revealed that GnRHa-induced SgII promoter activity required functional JNK and ERK modules. Combined inhibition of both pathways nearly abolished GnRHa-induced SgII promoter activity. Specific induction of the ERK cascade alone using overexpression of Raf-CAAX was not sufficient to activate the SgII gene promoter. In contrast, overexpression of the catalytic domain of the more pleiotropic MAPK activator, MAPK/ERK kinase-1, was sufficient to induce SgII promoter activity. The effect(s) of mitogen-activated protein/ERK kinase-1 on SgII promoter activity was CRE dependent and was reversed by the combined pharmacological inhibition of both JNK and ERK modules. CRE DNA binding studies demonstrated the recruitment of activating transcription factor (ATF)-3 and c-Jun to the CRE after administration of GnRHa to αT3-1 cells. Specific small interfering RNA knockdown of ATF3 reduced ATF3 DNA binding and the effect of GnRHa on the SgII promoter. These studies support the conclusion that MAPK signaling and ATF3 action are essential for full SgII promoter activation by GnRHa through a canonical CRE. Moreover, we suggest that within the GnRH signaling network, CRE-dependent gene regulation in general may be mediated primarily through the immediate early response gene ATF3. PMID:17962349

  12. Development of an inducible gene expression system for primary murine keratinocytes

    PubMed Central

    Nagarajan, Priyadharsini


    Background The tetracycline (Tet) responsive system is a valuable tool that is routinely used in a wide variety of mammalian cells for regulatable expression of gene products. However, technical difficulties such as harsh selection conditions and extensive screening processes to identify suitably responsive clones limit the generation of stable cell lines. Hence, application of this system in mammalian cells with relatively slow growth rates and / or the capacity to undergo terminal differentiation such as primary mouse keratinocytes is particularly challenging. Objective To our knowledge, no Tet-responsive stable cell lines have been generated from mouse keratinocytes, presumably due to their sensitivity to selection conditions. Our goal was to utilize a modified and robust Tet-expression system to generate a stable primary mouse keratinocyte cell line. These cells could be then utilized for conditional expression of potentially toxic proteins in an inducible fashion. Methods We utilized a eukaryotic promoter instead of a viral promoter to express a modified reverse tetracycline transactivator in mouse keratinocytes and optimized the selection process for generating stable cell lines. Results Here, we report the generation of a stable mouse keratinocyte cell line for Tet-regulated gene expression with minimal leakiness and high degree of Tet responsivity. This mouse keratinocyte cell line was further engineered for generation of a double stable cell line, which expresses the transcription factor AP-2α in an inducible manner. Importantly, the selected cells retain their inherent keratinocyte morphology, respond to differentiation signals and exhibit a persistent and highly tunable Tet inducibility upon continuous culturing. Conclusion We have generated a tetracycline inducible gene expression model system in mouse epidermal keratinocytes. Such inducible cell lines will serve as valuable in vitro models for future gain-of-function and loss-of-function studies. PMID

  13. Venezuelan equine encephalitis virus infection causes modulation of inflammatory and immune response genes in mouse brain

    PubMed Central

    Sharma, Anuj; Bhattacharya, Bhaskar; Puri, Raj K; Maheshwari, Radha K


    Background Neurovirulent Venezuelan equine encephalitis virus (VEEV) causes lethal encephalitis in equines and is transmitted to humans by mosquitoes. VEEV is highly infectious when transmitted by aerosol and has been developed as a bio-warfare agent, making it an important pathogen to study from a military and civilian standpoint. Molecular mechanisms of VEE pathogenesis are poorly understood. To study these, the gene expression profile of VEEV infected mouse brains was investigated. Changes in gene expression were correlated with histological changes in the brain. In addition, a molecular framework of changes in gene expression associated with progression of the disease was studied. Results Our results demonstrate that genes related to important immune pathways such as antigen presentation, inflammation, apoptosis and response to virus (Cxcl10, CxCl11, Ccl5, Ifr7, Ifi27 Oas1b, Fcerg1,Mif, Clusterin and MHC class II) were upregulated as a result of virus infection. The number of over-expressed genes (>1.5-fold level) increased as the disease progressed (from 197, 296, 400, to 1086 at 24, 48, 72 and 96 hours post infection, respectively). Conclusion Identification of differentially expressed genes in brain will help in the understanding of VEEV-induced pathogenesis and selection of biomarkers for diagnosis and targeted therapy of VEEV-induced neurodegeneration. PMID:18558011

  14. Multi-walled carbon nanotube-induced gene expression in vitro: concordance with in vivo studies

    PubMed Central

    Snyder-Talkington, Brandi N.; Dong, Chunlin; Zhao, Xiangyi; Dymacek, Julian; Porter, Dale W.; Wolfarth, Michael G.; Castranova, Vincent; Qian, Yong; Guo, Nancy L.


    There is a current interest in reducing the in vivo toxicity testing of nanomaterials in animals by increasing toxicity testing using in vitro cellular assays; however, toxicological results are seldom concordant between in vivo and in vitro models. This study compared global multi-walled carbon nanotube (MWCNT)-induced gene expression from human lung epithelial and microvascular endothelial cells in monoculture and coculture with gene expression from mouse lungs exposed to MWCNT. Using a cutoff of 10% false discovery rate and 1.5 fold change, we determined that there were more concordant genes (gene expression both up- or downregulated in vivo and in vitro) expressed in both cell types in coculture than in monoculture. When reduced to only those genes involved in inflammation and fibrosis, known outcomes of in vivo MWCNT exposure, there were more disease-related concordant genes expressed in coculture than monoculture. Additionally, different cellular signaling pathways are activated in response to MWCNT dependent upon culturing conditions. As coculture gene expression better correlated with in vivo gene expression, we suggest that cellular cocultures may offer enhanced in vitro models for nanoparticle risk assessment and the reduction of in vivo toxicological testing. PMID:25511174

  15. Genome-wide identification of BURP domain-containing genes in rice reveals a gene family with diverse structures and responses to abiotic stresses.


    Ding, Xipeng; Hou, Xin; Xie, Kabin; Xiong, Lizhong


    Increasing evidence suggests that a gene family encoding proteins containing BURP domains have diverse functions in plants, but systematic characterization of this gene family have not been reported. In this study, 17 BURP family genes (OsBURP01-17) were identified and analyzed in rice (Oryza sativa L.). These genes have diverse exon-intron structures and distinct organization of putative motifs. Based on the phylogenetic analysis of BURP protein sequences from rice and other plant species, the BURP family was classified into seven subfamilies, including two subfamilies (BURP V and BURP VI) with members from rice only and one subfamily (BURP VII) with members from monocotyledons only. Two BURP gene clusters, belonging to BURP V and BURP VI, were located in the duplicated region on chromosome 5 and 6 of rice, respectively. Transcript level analysis of BURP genes of rice in various tissues and organs revealed different tempo-spatial expression patterns, suggesting that these genes may function at different stages of plant growth and development. Interestingly, all the genes of the BURP VII subfamily were predominantly expressed in flower organs. We also investigated the expression patterns of BURP genes of rice under different stress conditions. The results suggested that, except for two genes (OsBURP01 and OsBURP13), all other members were induced by at least one of the stresses including drought, salt, cold, and abscisic acid treatment. Two genes (OsBURP05 and OsBURP16) were responsive to all the stress treatments and most of the OsBURP genes were responsive to salt stress. Promoter sequence analysis revealed an over-abundance of stress-related cis-elements in the stress-responsive genes. The data presented here provide important clues for elucidating the functions of genes of this family. PMID:19363683

  16. Aging changes agonist induced contractile responses in permeabilized rat bladder.


    Durlu-Kandilci, N Tugba; Denizalti, Merve; Sahin-Erdemli, Inci


    Aging alters bladder functions where a decrease in filling, storage and emptying is observed. These changes cause urinary incontinence, especially in women. The aim of this study is to examine how aging affects the intracellular calcium movements due to agonist-induced contractions in permeabilized female rat bladder. Urinary bladder isolated from young and old female Sprague-Dawley rats were used. Small detrusor strips were permeabilized with β-escin. The contractile responses induced with agonists were compared between young and old groups. Carbachol-induced contractions were decreased in permeabilized detrusor from old rats compared to young group. Heparin and ryanodine decreased carbachol-induced contractions in young rats where only heparin inhibited these contractions in olds. Caffeine-induced contractions but not inositol triphosphate (IP3)-induced contractions were decreased in old group compared to youngs. The cumulative calcium response curves (pCa 8-4) were also decreased in old rats. Carbachol-induced calcium sensitization responses did not alter by age where GTP-β-S and GF-109203X but not Y-27632 inhibited these responses. Carbachol-induced contractions decrease with aging in rat bladder detrusor. It can be postulated as IP3-induced calcium release (IICR) is primarily responsible for the contractions in older rats where the decrease in carbachol contractions in aging may be as a result of a decrease in calcium-induced calcium release (CICR), rather than carbachol-induced calcium sensitization. PMID:26153091

  17. Gene expression in epithelial cells in response to pneumovirus infection

    PubMed Central

    Domachowske, Joseph B; Bonville, Cynthia A; Rosenberg, Helene F


    Respiratory syncytial virus (RSV) and pneumonia virus of mice (PVM) are viruses of the family Paramyxoviridae, subfamily pneumovirus, which cause clinically important respiratory infections in humans and rodents, respectively. The respiratory epithelial target cells respond to viral infection with specific alterations in gene expression, including production of chemoattractant cytokines, adhesion molecules, elements that are related to the apoptosis response, and others that remain incompletely understood. Here we review our current understanding of these mucosal responses and discuss several genomic approaches, including differential display reverse transcription-polymerase chain reaction (PCR) and gene array strategies, that will permit us to unravel the nature of these responses in a more complete and systematic manner. PMID:11686888

  18. Gene expression profiling of replicative and induced senescence.


    Purcell, Maggie; Kruger, Adele; Tainsky, Michael A


    Cellular senescence is a cell cycle arrest accompanied by high expression of cyclin dependent kinase inhibitors which counteract overactive growth signals, which serves as a tumor suppressive mechanism. Senescence can be a result of telomere shortening (natural or replicative senescence) or DNA damage resulting from exogenous stressors (induced senescence). Here, we performed gene expression profiling through RNA-seq of replicative senescence, adriamycin-induced senescence, H2O2-induced senescence, and 5-aza-2-deoxycytidine-induced senescence in order to profile the pathways controlling various types of senescence. Overall, the pathways common to all 4 types of senescence were related to inflammation and the innate immune system. It was also evident that 5-aza-induced senescence mirrors natural replicative senescence due to telomere shortening. We also examined the prevalence of senescence-associated secretory phenotype (SASP) factors in the RNA-seq data, showing that it is a common characteristic of all 4 types of senescence. In addition, we could discriminate changes in gene expression due to quiescence during cellular senescence from those that were specific to senescence. PMID:25483067


    SciTech Connect

    Mann, David George James; McKnight, Timothy E; Mcpherson, Jackson; Hoyt, Peter R; Melechko, Anatoli Vasilievich; Simpson, Michael L; Sayler, Gary Steven


    RNA interference has become a powerful biological tool over the last decade. In this study, a tetracycline-inducible shRNA vector system was designed for silencing CFP expression and delivered alongside the yfp marker gene into Chinese hamster ovary cells using impalefection on spatially indexed vertically aligned carbon nanofiber arrays (VACNFs). The VACNF architecture provided simultaneous delivery of multiple genes, subsequent adherence and proliferation of interfaced cells, and repeated monitoring of single cells over time. Following impalefection and tetracycline induction, 53.1% 10.4% of impalefected cells were fully silenced by the inducible CFP-silencing shRNA vector. Additionally, efficient CFP-silencing was observed in single cells among a population of cells that remained CFP-expressing. This effective transient expression system enables rapid analysis of gene silencing effects using RNAi in single cells and cell populations.

  20. RNAseq reveals weed-induced PIF3-like as a candidate target to manipulate weed stress response in soybean.


    Horvath, David P; Hansen, Stephanie A; Moriles-Miller, Janet P; Pierik, Ronald; Yan, Changhui; Clay, David E; Scheffler, Brian; Clay, Sharon A


    Weeds reduce yield in soybeans (Glycine max) through incompletely defined mechanisms. The effects of weeds on the soybean transcriptome were evaluated in field conditions during four separate growing seasons. RNASeq data were collected from six biological samples of soybeans growing with or without weeds. Weed species and the methods to maintain weed-free controls varied between years to mitigate treatment effects, and to allow detection of general soybean weed responses. Soybean plants were not visibly nutrient- or water-stressed. We identified 55 consistently downregulated genes in weedy plots. Many of the downregulated genes were heat shock genes. Fourteen genes were consistently upregulated. Several transcription factors including a PHYTOCHROME INTERACTING FACTOR 3-like gene (PIF3) were included among the upregulated genes. Gene set enrichment analysis indicated roles for increased oxidative stress and jasmonic acid signaling responses during weed stress. The relationship of this weed-induced PIF3 gene to genes involved in shade avoidance responses in Arabidopsis provide evidence that this gene may be important in the response of soybean to weeds. These results suggest that the weed-induced PIF3 gene will be a target for manipulating weed tolerance in soybean. PMID:25711503

  1. Physiological and gene expression responses of sunflower (Helianthus annuus L.) plants differ according to irrigation placement.


    Aguado, Ana; Capote, Nieves; Romero, Fernando; Dodd, Ian C; Colmenero-Flores, José M


    To investigate effects of soil moisture heterogeneity on plant physiology and gene expression in roots and leaves, three treatments were implemented in sunflower plants growing with roots split between two compartments: a control (C) treatment supplying 100% of plant evapotranspiration, and two treatments receiving 50% of plant evapotranspiration, either evenly distributed to both compartments (deficit irrigation - DI) or unevenly distributed to ensure distinct wet and dry compartments (partial rootzone drying - PRD). Plants receiving the same amount of water responded differently under the two irrigation systems. After 3 days, evapotranspiration was similar in C and DI, but 20% less in PRD, concomitant with decreased leaf water potential (Ψleaf) and increased leaf xylem ABA concentration. Six water-stress responsive genes were highly induced in roots growing in the drying soil compartment of PRD plants, and their expression was best correlated with local soil water content. On the other hand, foliar gene expression differed significantly from that of the root and correlated better with xylem ABA concentration and Ψleaf. While the PRD irrigation strategy triggered stronger physiological and molecular responses, suggesting a more intense and systemic stress reaction due to local dehydration of the dry compartment of PRD plants, the DI strategy resulted in similar water savings without strongly inducing these responses. Correlating physiological and molecular responses in PRD/DI plants may provide insights into the severity and location of water deficits and may enable a better understanding of long-distance signalling mechanisms. PMID:25219304

  2. Loading-Induced Heat-Shock Response in Bovine Intervertebral Disc Organ Culture.


    Chooi, Wai Hon; Chan, Samantha Chun Wai; Gantenbein, Benjamin; Chan, Barbara Pui


    Mechanical loading has been shown to affect cell viability and matrix maintenance in the intervertebral disc (IVD) but there is no investigation on how cells survive mechanical stress and whether the IVD cells perceive mechanical loading as stress and respond by expression of heat shock proteins. This study investigates the stress response in the IVD in response to compressive loading. Bovine caudal disc organ culture was used to study the effect of physiological range static loading and dynamic loading. Cell activity, gene expression and immunofluorescence staining were used to analyze the cell response. Cell activity and cytoskeleton of the cells did not change significantly after loading. In gene expression analysis, significant up-regulation of heat shock protein-70 (HSP70) was observed in nucleus pulposus after two hours of loading. However, the expression of the matrix remodeling genes did not change significantly after loading. Similarly, expressions of stress response and matrix remodeling genes changed with application and removal of the dynamic loading. The results suggest that stress response was induced by physiological range loading without significantly changing cell activity and upregulating matrix remodeling. This study provides direct evidence on loading induced stress response in IVD cells and contributes to our understanding in the mechanoregulation of intervertebral disc cells. PMID:27580124

  3. Abiotic and Biotic Stressors Causing Equivalent Mortality Induce Highly Variable Transcriptional Responses in the Soybean Aphid

    PubMed Central

    Enders, Laramy S.; Bickel, Ryan D.; Brisson, Jennifer A.; Heng-Moss, Tiffany M.; Siegfried, Blair D.; Zera, Anthony J.; Miller, Nicholas J.


    Environmental stress affects basic organismal functioning and can cause physiological, developmental, and reproductive impairment. However, in many nonmodel organisms, the core molecular stress response remains poorly characterized and the extent to which stress-induced transcriptional changes differ across qualitatively different stress types is largely unexplored. The current study examines the molecular stress response of the soybean aphid (Aphis glycines) using RNA sequencing and compares transcriptional responses to multiple stressors (heat, starvation, and plant defenses) at a standardized stress level (27% adult mortality). Stress-induced transcriptional changes showed remarkable variation, with starvation, heat, and plant defensive stress altering the expression of 3985, 510, and 12 genes, respectively. Molecular responses showed little overlap across all three stressors. However, a common transcriptional stress response was identified under heat and starvation, involved with up-regulation of glycogen biosynthesis and molecular chaperones and down-regulation of bacterial endosymbiont cellular and insect cuticular components. Stressor-specific responses indicated heat affected expression of heat shock proteins and cuticular components, whereas starvation altered a diverse set of genes involved in primary metabolism, oxidative reductive processes, nucleosome and histone assembly, and the regulation of DNA repair and replication. Exposure to host plant defenses elicited the weakest response, of which half of the genes were of unknown function. This study highlights the need for standardizing stress levels when comparing across stress types and provides a basis for understanding the role of general vs. stressor specific molecular responses in aphids. PMID:25538100

  4. Human Alveolar Macrophage Gene Responses to Mycobacterium tuberculosis Strains H37Ra and H37Rv

    PubMed Central

    Silver, Richard F.; Walrath, Jessica; Lee, Hung; Jacobson, Bruce A.; Horton, Heidi; Bowman, Michael R.; Nocka, Karl; Sypek, Joseph P.


    H37Rv and H37Ra have been widely used as models of virulent and avirulent strains, respectively, of Mycobacterium tuberculosis. Since the sequencing of H37Rv, microarrays have been used to investigate gene expression of M. tuberculosis strains under various conditions, and to compare gene expression of specific isolates of the organism. Because differences in the virulence of these organisms could also be manifest via their differential induction of host genes, we used Affymetrix Human Genome Arrays U133A and U133B to evaluate human alveolar macrophage (AM) responses to infection with H37Rv and H37Ra. H37Rv altered expression of far more genes than did H37Ra. Moreover, the genes induced by H37Rv to a greater extent than by H37Ra were predominantly associated with the development of effective immunity. H37Rv markedly increased expression of IL-23 p19, whereas neither organism significantly induced IL-12 p35 expression. Quantitative PCR confirmed that H37Rv induced significantly more AM p19 expression than did H37Ra. After low-level infection of both AM and peripheral blood monocytes (MN) with H37Rv, neither cell type produced IL-12 (by ELISA). In contrast, AM displayed significant IL-23 production in response to H37Rv, whereas MN did not. Our findings thus suggest an important role for IL-23 in human host responses to pulmonary infection with M. tuberculosis, and are consistent with epidemiologic and genetic studies that imply that H37Rv may not have unusual capacity to cause human disease. PMID:18787177

  5. Screening Helicobacter pylori genes induced during infection of mouse stomachs

    PubMed Central

    Singh, Aparna; Hodgson, Nathaniel; Yan, Ming; Joo, Jungsoo; Gu, Lei; Sang, Hong; Gregory-Bryson, Emmalena; Wood, William G; Ni, Yisheng; Smith, Kimberly; Jackson, Sharon H; Coleman, William G


    AIM: To investigate the effect of in vivo environment on gene expression in Helicobacter pylori (H. pylori) as it relates to its survival in the host. METHODS: In vivo expression technology (IVET) systems are used to identify microbial virulence genes. We modified the IVET-transcriptional fusion vector, pIVET8, which uses antibiotic resistance as the basis for selection of candidate genes in host tissues to develop two unique IVET-promoter-screening vectors, pIVET11 and pIVET12. Our novel IVET systems were developed by the fusion of random Sau3A DNA fragments of H. pylori and a tandem-reporter system of chloramphenicol acetyltransferase and beta-galactosidase. Additionally, each vector contains a kanamycin resistance gene. We used a mouse macrophage cell line, RAW 264.7 and mice, as selective media to identify specific genes that H. pylori expresses in vivo. Gene expression studies were conducted by infecting RAW 264.7 cells with H. pylori. This was followed by real time polymerase chain reaction (PCR) analysis to determine the relative expression levels of in vivo induced genes. RESULTS: In this study, we have identified 31 in vivo induced (ivi) genes in the initial screens. These 31 genes belong to several functional gene families, including several well-known virulence factors that are expressed by the bacterium in infected mouse stomachs. Virulence factors, vacA and cagA, were found in this screen and are known to play important roles in H. pylori infection, colonization and pathogenesis. Their detection validates the efficacy of these screening systems. Some of the identified ivi genes have already been implicated to play an important role in the pathogenesis of H. pylori and other bacterial pathogens such as Escherichia coli and Vibrio cholerae. Transcription profiles of all ivi genes were confirmed by real time PCR analysis of H. pylori RNA isolated from H. pylori infected RAW 264.7 macrophages. We compared the expression profile of H. pylori and RAW 264

  6. The Arabidopsis mediator complex subunits MED16, MED14, and MED2 regulate mediator and RNA polymerase II recruitment to CBF-responsive cold-regulated genes.


    Hemsley, Piers A; Hurst, Charlotte H; Kaliyadasa, Ewon; Lamb, Rebecca; Knight, Marc R; De Cothi, Elizabeth A; Steele, John F; Knight, Heather


    The Mediator16 (MED16; formerly termed SENSITIVE TO FREEZING6 [SFR6]) subunit of the plant Mediator transcriptional coactivator complex regulates cold-responsive gene expression in Arabidopsis thaliana, acting downstream of the C-repeat binding factor (CBF) transcription factors to recruit the core Mediator complex to cold-regulated genes. Here, we use loss-of-function mutants to show that RNA polymerase II recruitment to CBF-responsive cold-regulated genes requires MED16, MED2, and MED14 subunits. Transcription of genes known to be regulated via CBFs binding to the C-repeat motif/drought-responsive element promoter motif requires all three Mediator subunits, as does cold acclimation-induced freezing tolerance. In addition, these three subunits are required for low temperature-induced expression of some other, but not all, cold-responsive genes, including genes that are not known targets of CBFs. Genes inducible by darkness also required MED16 but required a different combination of Mediator subunits for their expression than the genes induced by cold. Together, our data illustrate that plants control transcription of specific genes through the action of subsets of Mediator subunits; the specific combination defined by the nature of the stimulus but also by the identity of the gene induced. PMID:24415770

  7. Gene and MicroRNA Expression Responses to Exercise; Relationship with Insulin Sensitivity

    PubMed Central

    McLean, Carrie S.; Mielke, Clinton; Cordova, Jeanine M.; Langlais, Paul R.; Bowen, Benjamin; Miranda, Danielle; Coletta, Dawn K.; Mandarino, Lawrence J.


    Background Healthy individuals on the lower end of the insulin sensitivity spectrum also have a reduced gene expression response to exercise for specific genes. The goal of this study was to determine the relationship between insulin sensitivity and exercise-induced gene expression in an unbiased, global manner. Methods and Findings Euglycemic clamps were used to measure insulin sensitivity and muscle biopsies were done at rest and 30 minutes after a single acute exercise bout in 14 healthy participants. Changes in mRNA expression were assessed using microarrays, and miRNA analysis was performed in a subset of 6 of the participants using sequencing techniques. Following exercise, 215 mRNAs were changed at the probe level (Bonferroni-corrected P<0.00000115). Pathway and Gene Ontology analysis showed enrichment in MAP kinase signaling, transcriptional regulation and DNA binding. Changes in several transcription factor mRNAs were correlated with insulin sensitivity, including MYC, r=0.71; SNF1LK, r=0.69; and ATF3, r= 0.61 (5 corrected for false discovery rate). Enrichment in the 5’-UTRs of exercise-responsive genes suggested regulation by common transcription factors, especially EGR1. miRNA species of interest that changed after exercise included miR-378, which is located in an intron of the PPARGC1B gene. Conclusions These results indicate that transcription factor gene expression responses to exercise depend highly on insulin sensitivity in healthy people. The overall pattern suggests a coordinated cycle by which exercise and insulin sensitivity regulate gene expression in muscle. PMID:25984722

  8. The BLADE-ON-PETIOLE genes of Arabidopsis are essential for resistance induced by methyl jasmonate

    PubMed Central


    Background NPR1 is a gene of Arabidopsis thaliana required for the perception of salicylic acid. This perception triggers a defense response and negatively regulates the perception of jasmonates. Surprisingly, the application of methyl jasmonate also induces resistance, and NPR1 is also suspected to be relevant. Since an allelic series of npr1 was recently described, the behavior of these alleles was tested in response to methyl jasmonate. Results The response to methyl jasmonate of different npr1s alleles and NPR1 paralogs null mutants was measured by the growth of a pathogen. We have also tested the subcellular localization of some npr1s, along with the protein-protein interactions that can be measured in yeast. The localization of the protein in npr1 alleles does not affect the response to methyl jasmonate. In fact, NPR1 is not required. The genes that are required in a redundant fashion are the BOPs. The BOPs are paralogs of NPR1, and they physically interact with the TGA family of transcription factors. Conclusions Some npr1 alleles have a phenotype in this response likely because they are affecting the interaction between BOPs and TGAs, and these two families of proteins are responsible for the resistance induced by methyl jasmonate in wild type plants. PMID:23116333

  9. Identification and characterization of the retinoic acid response elements in the human RIG1 gene promoter

    SciTech Connect

    Jiang, S.-Y.; Wu, M.-S.; Chen, L.-M.; Hung, M.-W.; Lin, H.-E.; Chang, G.-G.; Chang, T.-C. . E-mail:


    The expression of retinoic acid-induced gene 1 (RIG1), a class II tumor suppressor gene, is induced in cells treated with retinoids. RIG1 has been shown to express ubiquitously and the increased expression of this gene appears to suppress cell proliferation. Recent studies also demonstrated that this gene may play an important role in cell differentiation and the progression of cancer. In spite of the remarkable regulatory role of this protein, the molecular mechanism of RIG1 expression induced by retinoids remains to be clarified. The present study was designed to study the molecular mechanism underlying the all-trans retinoic acid (atRA)-mediated induction of RIG1 gene expression. Polymerase chain reaction was used to generate a total of 10 luciferase constructs that contain various fragments of the RIG1 5'-genomic region. These constructs were then transfected into human gastric cancer SC-M1 and breast cancer T47D cells for transactivation analysis. atRA exhibited a significant induction in luciferase activity only through the -4910/-5509 fragment of the 5'-genomic region of RIG1 gene relative to the translation initiation site. Further analysis of this promoter fragment indicated that the primary atRA response region is located in between -5048 and -5403 of the RIG1 gene. Within this region, a direct repeat sequence with five nucleotide spacing, 5'-TGACCTctattTGCCCT-3' (DR5, -5243/-5259), and an inverted repeat sequence with six nucleotide spacing, 5'-AGGCCAtggtaaTGGCCT-3' (IR6, -5323/-5340), were identified. Deletion and mutation of the DR5, but not the IR6 element, abolished the atRA-mediated activity. Electrophoretic mobility shift assays with nuclear extract from atRA-treated cells indicated the binding of retinoic acid receptor (RAR) and retinoid X receptor (RXR) heterodimers specifically to this response element. In addition to the functional DR5, the region contains many other potential sequence elements that are required to maximize the at

  10. Mapping Microbial Response Metabolomes for Induced Natural Product Discovery.


    Derewacz, Dagmara K; Covington, Brett C; McLean, John A; Bachmann, Brian O


    Intergeneric microbial interactions may originate a significant fraction of secondary metabolic gene regulation in nature. Herein, we expose a genomically characterized Nocardiopsis strain, with untapped polyketide biosynthetic potential, to intergeneric interactions via coculture with low inoculum exposure to Escherichia, Bacillus, Tsukamurella, and Rhodococcus. The challenge-induced responses of extracted metabolites were characterized via multivariate statistical and self-organizing map (SOM) analyses, revealing the magnitude and selectivity engendered by the limiting case of low inoculum exposure. The collected inventory of cocultures revealed substantial metabolomic expansion in comparison to monocultures with nearly 14% of metabolomic features in cocultures undetectable in monoculture conditions and many features unique to coculture genera. One set of SOM-identified responding features was isolated, structurally characterized by multidimensional NMR, and revealed to comprise previously unreported polyketides containing an unusual pyrrolidinol substructure and moderate and selective cytotoxicity. Designated ciromicin A and B, they are detected across mixed cultures with intergeneric preferences under coculture conditions. The structural novelty of ciromicin A is highlighted by its ability to undergo a diastereoselective photochemical 12-π electron rearrangement to ciromicin B at visible wavelengths. This study shows how organizing trends in metabolomic responses under coculture conditions can be harnessed to characterize multipartite cultures and identify previously silent secondary metabolism. PMID:26039241

  11. Characterization of Pseudomonas putida Genes Responsive to Nutrient Limitation

    SciTech Connect

    Syn, Chris K.; Magnuson, Jon K.; Kingsley, Mark T.; Swarup, Sanjay


    The low bioavailability of nutrients and oxygen in the soil environment has hampered successful expression of biodegradation/biocontrol genes that are driven by promoters highly active during routine laboratory conditions of high nutrient- and oxygen-availability. Hence, in the present study, expression of the gus-tagged genes in 12 Tn5-gus mutants of the soil microbe Pseudomonas putida PNL-MK25 was examined under various conditions chosen to mimic the soil environment: low carbon, phosphate, nitrate, or oxygen, and in the rhizosphere. Based on their expression profiles, three nutrient-responsive mutant (NRM) strains, NRM5, NRM7, and NRM17, were selected for identification of the tagged genes. In the mutant strain NRM5, expression of the glutamate dehydrogenase (gdhA) gene was increased between 4.9- to 26.4-fold under various low nutrient conditions. In NRM7, expression of the novel NADPH:quinone oxidoreductase-like (nql) gene was consistently amongst the highest and was synergistically upregulated by low nutrient and anoxic conditions. The cyoD gene in NRM17, which encodes the fourth subunit of the cytochrome o ubiquinol oxidase complex, had decreased expression in low nutrient conditions but its absolute expression levels was still amongst the highest. Additionally, it was independent of oxygen availability, in contrast to that in E. coli.

  12. Gene expression profiles of murine fatty liver induced by the administration of valproic acid

    SciTech Connect

    Lee, Min-Ho; Hong, Il; Kim, Mingoo; Lee, Byung Hoon; Kim, Ju-Han; Kang, Kyung-Sun; Kim, Hyung-Lae; Yoon, Byung-Il; Chung, Heekyoung; Kong, Gu; Lee, Mi-Ock . E-mail:


    Valproic acid (VPA) has been used as anticonvulsants, however, it induces hepatotoxicity such as microvesicular steatosis and necrosis in the liver. To explore the mechanisms of VPA-induced steatosis, we profiled the gene expression patterns of the mouse liver that were altered by treatment with VPA using microarray analysis. VPA was orally administered as a single dose of 100 mg/kg (low-dose) or 1000 mg/kg (high-dose) to ICR mice and the animals were killed at 6, 24, or 72 h after treatment. Serum alanine aminotransferase and aspartate aminotransferase levels were not significantly altered in the experimental animals. However, symptoms of steatosis were observed at 72 h with low-dose and at 24 h and 72 h with high-dose. After microarray data analysis, 1910 genes were selected by two-way ANOVA (P < 0.05) as VPA-responsive genes. Hierarchical clustering revealed that gene expression changes depended on the time rather than the dose of VPA treatment. Gene profiling data showed striking changes in the expression of genes associated with lipid, fatty acid, and steroid metabolism, oncogenesis, signal transduction, and development. Functional categorization of 1156 characteristically up- and down-regulated genes (cutoff > 1.5-fold) revealed that 60 genes were involved in lipid metabolism that was interconnected with biological pathways for biosynthesis of triglyceride and cholesterol, catabolism of fatty acid, and lipid transport. This gene expression profile may be associated with the known steatogenic hepatotoxicity of VPA and it may provide useful information for prediction of hepatotoxicity of unknown chemicals or new drug candidates through pattern recognition.

  13. Identification of activity-dependent gene expression profiles reveals specific subsets of genes induced by different routes of Ca(2+) entry in cultured rat cortical neurons.


    Xiang, Guangxin; Pan, Liangbin; Xing, Wanli; Zhang, Liang; Huang, Lihua; Yu, Jian; Zhang, Rui; Wu, Jianping; Cheng, Jing; Zhou, Yuxiang


    Neuronal activity-dependent gene transcription is a key feature of long-lasting synaptic strengthening associated with learning and memory, as well as activity-dependent neuroprotection. To comprehensively determine the molecular alterations, we carried out genome-wide microarray analysis in cultured rat cortical neurons treated with specific pharmacological agents, a model with alterations in neuronal activity, which were monitored by multi-site electrophysiological recordings. Of the approximately 27,000 genes, the expression of 248 genes was strongly changed in response to enhanced activity. These genes encompass a large number of members of distinct families, including synaptic vesicle proteins, ion channels, signal transduction molecules, synaptic growth regulators, and others. Two subsets of these genes were further confirmed to be specifically induced by Ca(2+) influx through N-methyl-D-aspartate (NMDA) receptors and L-type voltage-gated Ca(2+) channels (VGCCs). In addition, those genes dynamically regulated by the enhanced activity were also elucidated, as well as those candidate genes associated with synaptic plasticity and neuroprotection. Our findings therefore would help define the molecular mechanisms that occur in response to neuronal activity and identify specific clusters of genes that contribute to activity-dependent and Ca(2+)-inducible modulation of brain development and function. PMID:17443680

  14. Activation of vascular endothelial growth factor gene transcription by hypoxia-inducible factor 1.

    PubMed Central

    Forsythe, J A; Jiang, B H; Iyer, N V; Agani, F; Leung, S W; Koos, R D; Semenza, G L


    Expression of vascular endothelial growth factor (VEGF) is induced in cells exposed to hypoxia or ischemia. Neovascularization stimulated by VEGF occurs in several important clinical contexts, including myocardial ischemia, retinal disease, and tumor growth. Hypoxia-inducible factor 1 (HIF-1) is a heterodimeric basic helix-loop-helix protein that activates transcription of the human erythropoietin gene in hypoxic cells. Here we demonstrate the involvement of HIF-1 in the activation of VEGF transcription. VEGF 5'-flanking sequences mediated transcriptional activation of reporter gene expression in hypoxic Hep3B cells. A 47-bp sequence located 985 to 939 bp 5' to the VEGF transcription initiation site mediated hypoxia-inducible reporter gene expression directed by a simian virus 40 promoter element that was otherwise minimally responsive to hypoxia. When reporters containing VEGF sequences, in the context of the native VEGF or heterologous simian virus 40 promoter, were cotransfected with expression vectors encoding HIF-1alpha and HIF-1beta (ARNT [aryl hydrocarbon receptor nuclear translocator]), reporter gene transcription was much greater in both hypoxic and nonhypoxic cells than in cells transfected with the reporter alone. A HIF-1 binding site was demonstrated in the 47-bp hypoxia response element, and a 3-bp substitution eliminated the ability of the element to bind HIF-1 and to activate transcription in response to hypoxia and/or recombinant HIF-1. Cotransfection of cells with an expression vector encoding a dominant negative form of HIF-1alpha inhibited the activation of reporter transcription in hypoxic cells in a dose-dependent manner. VEGF mRNA was not induced by hypoxia in mutant cells that do not express the HIF-1beta (ARNT) subunit. These findings implicate HIF-1 in the activation of VEGF transcription in hypoxic cells. PMID:8756616

  15. Research resource: estrogen-driven prolactin-mediated gene-expression networks in hormone-induced prostatic intraepithelial neoplasia.


    Tam, Neville N C; Szeto, Carol Y Y; Freudenberg, Johannes M; Fullenkamp, Amy N; Medvedovic, Mario; Ho, Shuk-Mei


    Cotreatment with testosterone (T) and 17β-estradiol (E2) is an established regimen for inducing of prostatic intraepithelial neoplasia (PIN) and prostate cancer in rodent models. We previously used the pure antiestrogen ICI 182,780 (ICI) and bromocriptine, a dopamine receptor agonist, to inhibit PIN induction and systemic hyperprolactinemia in Noble rats and found that the carcinogenic action of T+E2 is mediated directly by the effects of E2 on the prostate and/or indirectly via E2-induced hyperprolactinemia. In this study, we delineate the specific action(s) of E2 and prolactin (PRL) in early prostate carcinogenesis by an integrated approach combining global transcription profiling, gene ontology, and gene-network mapping. We identified 2504 differentially expressed genes in the T+E2-treated lateral prostate. The changes in expression of a subset of 1990 genes (∼80%) were blocked upon cotreatment with ICI and bromocriptine, respectively, whereas those of 262 genes (∼10%) were blocked only by treatment with ICI, suggesting that E2-induced pituitary PRL is the primary mediator of the prostatic transcriptional response to the altered hormone milieu. Bioinformatics analyses identified hormone-responsive gene networks involved in immune responses, stromal tissue remodeling, and the ERK pathway. In particular, our data suggest that IL-1β may mediate, at least in part, hormone-induced changes in gene expression during PIN formation. Together, these data highlight the importance of pituitary PRL in estrogen-induced prostate tumorigenesis. The identification of both E2- and pituitary PRL-responsive genes provides a comprehensive resource for future investigations of the complex mechanisms by which changes in the endocrine milieu contribute to prostate carcinogenesis in vivo. PMID:20861223

  16. Microarray-based compendium of hepatic gene expression profiles for prototypical ADME gene-inducing compounds in rats and mice in vivo.


    Slatter, J G; Cheng, O; Cornwell, P D; de Souza, A; Rockett, J; Rushmore, T; Hartley, D; Evers, R; He, Y; Dai, X; Hu, R; Caguyong, M; Roberts, C J; Castle, J; Ulrich, R G


    To examine species-specific aspects of the induction of absorption, distribution, metabolism and excretion (ADME)-related genes, we used 25 000 gene oligonucleotide microarrays to construct a rodent gene-response compendium that compared hepatic gene expression profiles and developed consensus aryl hydrocarbon receptor (AhR), constitutive androstane receptor (CAR) and pregnane X-receptor (PXR) ligand signatures relevant to drug clearance. Twenty-six inducer compounds were chosen from the literature. Rats and mice received one of six dose levels (log2 dose escalation, 32-fold dose range) of each compound daily for 3 days. Animals were necropsied 6-9 h after the last dose, and tissues were collected for RNA analysis. Hepatic gene expression profiles were obtained using Rosetta Resolver expression analysis system, and ADME-related genes were extracted. Cross-talk among nuclear receptors or hepatoxicity at high dose levels resulted in large signatures (usually >1000 genes at p < 0.01) for most compounds. After ADME gene transcript enrichment, agglomerative clustering separated AhR ligands from CAR/PXR ligands, but it was difficult to distinguish CAR from PXR ligands. Consensus signatures were derived from groups of AhR, CAR and PXR ligands; and cross-talk among responding genes was determined. Many compounds had distinct log dose-response profiles, and relative potencies for ligands were established. Robust responses by CYP1A1, CYP2B10 (CAR responsive in mice) and CYP2B15 (CAR responsive in rats) and CYP3A1 (PXR responsive in rats) were used to benchmark the relative potency of different ligands and to determine the relative selectivity for AhR, CAR or PXR. By using a compendium of gene expression profiles, we defined species-specific induction patterns across the ADME transcriptome. PMID:17118914

  17. Pyridoxine responsiveness in novel mutations of the PNPO gene

    PubMed Central

    Paul, Karl; Mills, Philippa; Clayton, Peter; Paschke, Eduard; Maier, Oliver; Hasselmann, Oswald; Schmiedel, Gudrun; Kanz, Simone; Connolly, Mary; Wolf, Nicole; Struys, Eduard; Stockler, Sylvia; Abela, Lucia; Hofer, Doris


    Objective: To determine whether patients with pyridoxine-responsive seizures but normal biomarkers for antiquitin deficiency and normal sequencing of the ALDH7A1 gene may have PNPO mutations. Methods: We sequenced the PNPO gene in 31 patients who fulfilled the above-mentioned criteria. Results: We were able to identify 11 patients carrying 3 novel mutations of the PNPO gene. In 6 families, a homozygous missense mutation p.Arg225His in exon 7 was identified, while 1 family was compound heterozygous for a novel missense mutation p.Arg141Cys in exon 5 and a deletion c.279_290del in exon 3. Pathogenicity of the respective mutations was proven by absence in 100 control alleles and expression studies in CHO-K1 cell lines. The response to pyridoxine was prompt in 4, delayed in 2, on EEG only in 2, and initially absent in another 2 patients. Two unrelated patients homozygous for the p.Arg225His mutation experienced status epilepticus when switched to pyridoxal 5′-phosphate (PLP). Conclusions: This study challenges the paradigm of exclusive PLP responsiveness in patients with pyridoxal 5′-phosphate oxidase deficiency and underlines the importance of consecutive testing of pyridoxine and PLP in neonates with antiepileptic drug–resistant seizures. Patients with pyridoxine response but normal biomarkers for antiquitin deficiency should undergo PNPO mutation analysis. PMID:24658933

  18. Biomarker discovery and gene expression responses in Lycopersicon esculentum root exposed to lead.


    Hou, Jing; Bai, Lili; Xie, Yujia; Liu, Xinhui; Cui, Baoshan


    Gene expression analysis has shown particular promise for the identification of molecular biomarkers that can be used for further evaluation of potential toxicity of chemicals present in agricultural soil. In the study, we focused on the development of molecular markers to detect Pb toxicity in agricultural soil. Using the results obtained from microarray analysis, twelve Pb-responsive genes were selected and tested in different Pb concentrations to examine their concentration-response characteristics using real-time quantitative polymerase chain reaction (RT-qPCR). All the Pb treatments set in our study could generally induce the differential expression of the 12 genes, while the lowest observable adverse effect concentration (LOAEC) of Pb for seed germination, root elongation, biomass and structural modification derived from 1,297, 177, 177, and 1,297 mg Pb/kg soil, respectively, suggesting that the transcriptional approach was more sensitive than the traditional end points of death, growth, and morphology for the evaluation of Pb toxicity. The relative expression of glycoalkaloid metabolism 1 (P=-0.790), ethylene-responsive transcription factor ERF017 (P=-0.686) and CASP-like protein 4C2 (P=-0.652) demonstrates a dose-dependent response with Pb content in roots, implying that the three genes can be used as sensitive bioindicators of Pb stress in Lycopersicon esculentum. PMID:26252993

  19. Response of marine bacterioplankton pH homeostasis gene expression to elevated CO2

    NASA Astrophysics Data System (ADS)

    Bunse, Carina; Lundin, Daniel; Karlsson, Christofer M. G.; Akram, Neelam; Vila-Costa, Maria; Palovaara, Joakim; Svensson, Lovisa; Holmfeldt, Karin; González, José M.; Calvo, Eva; Pelejero, Carles; Marrasé, Cèlia; Dopson, Mark; Gasol, Josep M.; Pinhassi, Jarone


    Human-induced ocean acidification impacts marine life. Marine bacteria are major drivers of biogeochemical nutrient cycles and energy fluxes; hence, understanding their performance under projected climate change scenarios is crucial for assessing ecosystem functioning. Whereas genetic and physiological responses of phytoplankton to ocean acidification are being disentangled, corresponding functional responses of bacterioplankton to pH reduction from elevated CO2 are essentially unknown. Here we show, from metatranscriptome analyses of a phytoplankton bloom mesocosm experiment, that marine bacteria responded to lowered pH by enhancing the expression of genes encoding proton pumps, such as respiration complexes, proteorhodopsin and membrane transporters. Moreover, taxonomic transcript analysis showed that distinct bacterial groups expressed different pH homeostasis genes in response to elevated CO2. These responses were substantial for numerous pH homeostasis genes under low-chlorophyll conditions (chlorophyll a <2.5 μg l-1) however, the changes in gene expression under high-chlorophyll conditions (chlorophyll a >20 μg l-1) were low. Given that proton expulsion through pH homeostasis mechanisms is energetically costly, these findings suggest that bacterioplankton adaptation to ocean acidification could have long-term effects on the economy of ocean ecosystems.

  20. Characterization of Chemically Induced Liver Injuries Using Gene Co-Expression Modules

    PubMed Central

    Tawa, Gregory J.; AbdulHameed, Mohamed Diwan M.; Yu, Xueping; Kumar, Kamal; Ippolito, Danielle L.; Lewis, John A.; Stallings, Jonathan D.; Wallqvist, Anders


    Liver injuries due to ingestion or exposure to chemicals and industrial toxicants pose a serious health risk that may be hard to assess due to a lack of non-invasive diagnostic tests. Mapping chemical injuries to organ-specific damage and clinical outcomes via biomarkers or biomarker panels will provide the foundation for highly specific and robust diagnostic tests. Here, we have used DrugMatrix, a toxicogenomics database containing organ-specific gene expression data matched to dose-dependent chemical exposures and adverse clinical pathology assessments in Sprague Dawley rats, to identify groups of co-expressed genes (modules) specific to injury endpoints in the liver. We identified 78 such gene co-expression modules associated with 25 diverse injury endpoints categorized from clinical pathology, organ weight changes, and histopathology. Using gene expression data associated with an injury condition, we showed that these modules exhibited different patterns of activation characteristic of each injury. We further showed that specific module genes mapped to 1) known biochemical pathways associated with liver injuries and 2) clinically used diagnostic tests for liver fibrosis. As such, the gene modules have characteristics of both generalized and specific toxic response pathways. Using these results, we proposed three gene signature sets characteristic of liver fibrosis, steatosis, and general liver injury based on genes from the co-expression modules. Out of all 92 identified genes, 18 (20%) genes have well-documented relationships with liver disease, whereas the rest are novel and have not previously been associated with liver disease. In conclusion, identifying gene co-expression modules associated with chemically induced liver injuries aids in generating testable hypotheses and has the potential to identify putative biomarkers of adverse health effects. PMID:25226513

  1. Nitrate-Induced Genes in Tomato Roots. Array Analysis Reveals Novel Genes That May Play a Role in Nitrogen Nutrition1[w

    PubMed Central

    Wang, Yi-Hong; Garvin, David F.; Kochian, Leon V.


    A subtractive tomato (Lycopersicon esculentum) root cDNA library enriched in genes up-regulated by changes in plant mineral status was screened with labeled mRNA from roots of both nitrate-induced and mineral nutrient-deficient (−nitrogen [N], −phosphorus, −potassium [K], −sulfur, −magnesium, −calcium, −iron, −zinc, and −copper) tomato plants. A subset of cDNAs was selected from this library based on mineral nutrient-related changes in expression. Additional cDNAs were selected from a second mineral-deficient tomato root library based on sequence homology to known genes. These selection processes yielded a set of 1,280 mineral nutrition-related cDNAs that were arrayed on nylon membranes for further analysis. These high-density arrays were hybridized with mRNA from tomato plants exposed to nitrate at different time points after N was withheld for 48 h, for plants that were grown on nitrate/ammonium for 5 weeks prior to the withholding of N. One hundred-fifteen genes were found to be up-regulated by nitrate resupply. Among these genes were several previously identified as nitrate responsive, including nitrate transporters, nitrate and nitrite reductase, and metabolic enzymes such as transaldolase, transketolase, malate dehydrogenase, asparagine synthetase, and histidine decarboxylase. We also identified 14 novel nitrate-inducible genes, including: (a) water channels, (b) root phosphate and K+ transporters, (c) genes potentially involved in transcriptional regulation, (d) stress response genes, and (e) ribosomal protein genes. In addition, both families of nitrate transporters were also found to be inducible by phosphate, K, and iron deficiencies. The identification of these novel nitrate-inducible genes is providing avenues of research that will yield new insights into the molecular basis of plant N nutrition, as well as possible networking between the regulation of N, phosphorus, and K nutrition. PMID:11553762

  2. Integrated Response to Inducers by Communication between a Catabolic Pathway and Its Regulatory System▿

    PubMed Central

    Martínez-Pérez, Olga; López-Sánchez, Aroa; Reyes-Ramírez, Francisca; Floriano, Belén; Santero, Eduardo


    Efficient gene regulation of metabolic pathways implies that the profile of molecules inducing the pathway matches that of the molecules that are metabolized. Gratuitous induction, a well-known phenomenon in catabolic pathways, is the consequence of differences in the substrate and inducer profiles. This phenomenon is particularly evident in pathways for biodegradation of organic contaminants that can be induced by a variety of molecules similar to the real substrates. Analysis of the regulation of tetralin biodegradation genes in mutant strains with mutations that affect each component of the initial dioxygenase enzymatic complex indicated that the response of the regulatory system to potential inducers is altered differently depending on the mutated component. Based on the expression phenotypes of a number of single or double mutants, we propose a model that represents an unprecedented way of communication between a catabolic pathway and its regulatory system to prevent efficient induction by a molecule that is not a real substrate. This communication allows a better fit of the substrate and inducer profiles, thus minimizing gratuitous induction, without a requirement for optimal coevolution to match the specificity of catabolic enzymes and their regulatory systems. Modulation of the regulatory system in this way not only provides a more appropriate response to potential inducers recognized by the regulatory system but also may properly adjust the levels of gene expression to the substrate availability. PMID:17351041

  3. Two host-inducible genes of Rhizobium fredii and characterization of the inducing compound.

    PubMed Central

    Sadowsky, M J; Olson, E R; Foster, V E; Kosslak, R M; Verma, D P


    Random transcription fusions with Mu d1(Kan lac) generated three mutants in Rhizobium fredii (strain USDA 201) which showed induction of beta-galactosidase when grown in root exudate of the host plants Glycine max, Phaseolus vulgaris, and Vigna ungliculata. Two genes were isolated from a library of total plasmid DNA of one of the mutants, 3F1. These genes, present in tandem on a 4.2-kilobase HindIII fragment, appear in one copy each on the symbiotic plasmid and do not hybridize to the Rhizobium meliloti common nodulation region. They comprise two separate transcriptional units coding for about 450 and 950 nucleotides, both of which are transcribed in the same direction. The two open reading frames are separated by 586 base pairs, and the 5H regions of the two genes show a common sequence. No similarity was found with the promoter areas of Rhizobium trifolii, R. meliloti, or Bradyrhizobium japonicum nif genes and with any known nodulation genes. Regions homologous to both sequences were detected in EcoRI digests of genomic DNAs from B. japonicum USDA 110, USDA 122, and 61A76, but not in genomic DNA from R. trifolii, Rhizobium leguminosarum, or Rhizobium phaseoli. Mass spectrometry and nuclear magnetic resonance analysis indicated that the inducing compound has properties of 4',7-dihydroxyisoflavone, daidzein. These results suggest that, in addition to common nodulation genes, several other genes appear to be specifically induced by compounds in the root exudate of the host plants. Images PMID:2447061

  4. Hypoxia-inducible genes encoding small EF-hand proteins in rice and tomato.


    Otsuka, Chie; Minami, Ikuko; Oda, Kenji


    Rice has evolved metabolic and morphological adaptations to low-oxygen stress to grow in submerged paddy fields. To characterize the molecular components that mediate the response to hypoxia in rice, we identified low-oxygen stress early response genes by microarray analysis. Among the highly responsive genes, five genes, OsHREF1 to OsHREF5, shared strong homology. They encoded small proteins harboring two EF-hands, typical Ca(2+)-binding motifs. Homologous genes were found in many land plants, including SlHREF in tomato, which is also strongly induced by hypoxia. SlHREF induction was detected in both roots and shoots of tomato plants under hypoxia. With the exception of OsHREF5, OsHREF expression was unaffected by drought, salinity, cold, or osmotic stress. Fluorescent signals of green fluorescent protein-fused OsHREFs were detected in the cytosol and nucleus. Ruthenium red, an inhibitor of intracellular Ca(2+) release, repressed induction of OsHREF1-4 under hypoxia. The HREFs may be related to the Ca(2+) response to hypoxia. PMID:21150100

  5. β-Cryptoxanthin Alleviates Diet-Induced Nonalcoholic Steatohepatitis by Suppressing Inflammatory Gene Expression in Mice

    PubMed Central

    Kobori, Masuko; Ni, Yinhua; Takahashi, Yumiko; Watanabe, Natsumi; Sugiura, Minoru; Ogawa, Kazunori; Nagashimada, Mayumi; Kaneko, Shuichi; Naito, Shigehiro; Ota, Tsuguhito


    Recent nutritional epidemiological surveys showed that serum β-cryptoxanthin inversely associates with the risks for insulin resistance and liver dysfunction. Consumption of β-cryptoxanthin possibly prevents nonalcoholic steatohepatitis (NASH), which is suggested to be caused by insulin resistance and oxidative stress from nonalcoholic fatty liver disease. To evaluate the effect of β-cryptoxanthin on diet-induced NASH, we fed a high-cholesterol and high-fat diet (CL diet) with or without 0.003% β-cryptoxanthin to C56BL/6J mice for 12 weeks. After feeding, β-cryptoxanthin attenuated fat accumulation, increases in Kupffer and activated stellate cells, and fibrosis in CL diet-induced NASH in the mice. Comprehensive gene expression analysis showed that although β-cryptoxanthin histochemically reduced steatosis, it was more effective in inhibiting inflammatory gene expression change in NASH. β-Cryptoxanthin reduced the alteration of expression of genes associated with cell death, inflammatory responses, infiltration and activation of macrophages and other leukocytes, quantity of T cells, and free radical scavenging. However, it showed little effect on the expression of genes related to cholesterol and other lipid metabolism. The expression of markers of M1 and M2 macrophages, T helper cells, and cytotoxic T cells was significantly induced in NASH and reduced by β-cryptoxanthin. β-Cryptoxanthin suppressed the expression of lipopolysaccharide (LPS)-inducible and/or TNFα-inducible genes in NASH. Increased levels of the oxidative stress marker thiobarbituric acid reactive substances (TBARS) were reduced by β-cryptoxanthin in NASH. Thus, β-cryptoxanthin suppresses inflammation and the resulting fibrosis probably by primarily suppressing the increase and activation of macrophages and other immune cells. Reducing oxidative stress is likely to be a major mechanism of inflammation and injury suppression in the livers of mice with NASH. PMID:24858832

  6. Efficient Virus-Induced Gene Silencing in Solanum rostratum

    PubMed Central

    Meng, Lan-Huan; Wang, Rui-Heng; Zhu, Ben-Zhong; Zhu, Hong-Liang; Luo, Yun-Bo; Fu, Da-Qi


    Solanum rostratum is a “super weed” that grows fast, is widespread, and produces the toxin solanine, which is harmful to both humans and other animals. To our knowledge, no study has focused on its molecular biology owing to the lack of available transgenic methods and sequence information for S. rostratum. Virus-induced gene silencing (VIGS) is a powerful tool for the study of gene function in plants; therefore, in the present study, we aimed to establish tobacco rattle virus (TRV)-derived VIGS in S. rostratum. The genes for phytoene desaturase (PDS) and Chlorophyll H subunit (ChlH) of magnesium protoporphyrin chelatase were cloned from S. rostratum and used as reporters of gene silencing. It was shown that high-efficiency VIGS can be achieved in the leaves, flowers, and fruit of S. rostratum. Moreover, based on our comparison of three different types of infection methods, true leaf infection was found to be more efficient than cotyledon and sprout infiltration in long-term VIGS in multiple plant organs. In conclusion, the VIGS technology and tomato genomic sequences can be used in the future to study gene function in S. rostratum. PMID:27258320

  7. Efficient Virus-Induced Gene Silencing in Solanum rostratum.


    Meng, Lan-Huan; Wang, Rui-Heng; Zhu, Ben-Zhong; Zhu, Hong-Liang; Luo, Yun-Bo; Fu, Da-Qi


    Solanum rostratum is a "super weed" that grows fast, is widespread, and produces the toxin solanine, which is harmful to both humans and other animals. To our knowledge, no study has focused on its molecular biology owing to the lack of available transgenic methods and sequence information for S. rostratum. Virus-induced gene silencing (VIGS) is a powerful tool for the study of gene function in plants; therefore, in the present study, we aimed to establish tobacco rattle virus (TRV)-derived VIGS in S. rostratum. The genes for phytoene desaturase (PDS) and Chlorophyll H subunit (ChlH) of magnesium protoporphyrin chelatase were cloned from S. rostratum and used as reporters of gene silencing. It was shown that high-efficiency VIGS can be achieved in the leaves, flowers, and fruit of S. rostratum. Moreover, based on our comparison of three different types of infection methods, true leaf infection was found to be more efficient than cotyledon and sprout infiltration in long-term VIGS in multiple plant organs. In conclusion, the VIGS technology and tomato genomic sequences can be used in the future to study gene function in S. rostratum. PMID:27258320

  8. Virus-induced gene silencing in eggplant (Solanum melongena).


    Liu, Haiping; Fu, Daqi; Zhu, Benzhong; Yan, Huaxue; Shen, Xiaoying; Zuo, Jinhua; Zhu, Yi; Luo, Yunbo


    Eggplant (Solanum melongena) is an economically important vegetable requiring investigation into its various genomic functions. The current limitation in the investigation of genomic function in eggplant is the lack of effective tools available for conducting functional assays. Virus-induced gene silencing (VIGS) has played a critical role in the functional genetic analyses. In this paper, TRV-mediated VIGS was successfully elicited in eggplant. We first cloned the CDS sequence of PDS (PHYTOENE DESATURASE) in eggplant and then silenced the PDS gene. Photo-bleaching was shown on the newly-developed leaves four weeks after agroinoculation, indicating that VIGS can be used to silence genes in eggplant. To further illustrate the reliability of VIGS in eggplant, we selected Chl H, Su and CLA1 as reporters to elicit VIGS using the high-pressure spray method. Suppression of Chl H and Su led to yellow leaves, while the depletion of CLA1 resulted in albino. In conclusion, four genes, PDS, Chl H, Su (Sulfur), CLA1, were down-regulated significantly by VIGS, indicating that the VIGS system can be successfully applied in eggplant and is a reliable tool for the study of gene function. PMID:22268843

  9. Barcode Sequencing Screen Identifies SUB1 as a Regulator of Yeast Pheromone Inducible Genes.


    Sliva, Anna; Kuang, Zheng; Meluh, Pamela B; Boeke, Jef D


    The yeast pheromone response pathway serves as a valuable model of eukaryotic mitogen-activated protein kinase (MAPK) pathways, and transcription of their downstream targets. Here, we describe application of a screening method combining two technologies: fluorescence-activated cell sorting (FACS), and barcode analysis by sequencing (Bar-Seq). Using this screening method, and pFUS1-GFP as a reporter for MAPK pathway activation, we readily identified mutants in known mating pathway components. In this study, we also include a comprehensive analysis of the FUS1 induction properties of known mating pathway mutants by flow cytometry, featuring single cell analysis of each mutant population. We also characterized a new source of false positives resulting from the design of this screen. Additionally, we identified a deletion mutant, sub1Δ, with increased basal expression of pFUS1-GFP. Here, in the first ChIP-Seq of Sub1, our data shows that Sub1 binds to the promoters of about half the genes in the genome (tripling the 991 loci previously reported), including the promoters of several pheromone-inducible genes, some of which show an increase upon pheromone induction. Here, we also present the first RNA-Seq of a sub1Δ mutant; the majority of genes have no change in RNA, but, of the small subset that do, most show decreased expression, consistent with biochemical studies implicating Sub1 as a positive transcriptional regulator. The RNA-Seq data also show that certain pheromone-inducible genes are induced less in the sub1Δ mutant relative to the wild type, supporting a role for Sub1 in regulation of mating pathway genes. The sub1Δ mutant has increased basal levels of a small subset of other genes besides FUS1, including IMD2 and FIG1, a gene encoding an integral membrane protein necessary for efficient mating. PMID:26837954

  10. Barcode Sequencing Screen Identifies SUB1 as a Regulator of Yeast Pheromone Inducible Genes

    PubMed Central

    Sliva, Anna; Kuang, Zheng; Meluh, Pamela B.; Boeke, Jef D.


    The yeast pheromone response pathway serves as a valuable model of eukaryotic mitogen-activated protein kinase (MAPK) pathways, and transcription of their downstream targets. Here, we describe application of a screening method combining two technologies: fluorescence-activated cell sorting (FACS), and barcode analysis by sequencing (Bar-Seq). Using this screening method, and pFUS1-GFP as a reporter for MAPK pathway activation, we readily identified mutants in known mating pathway components. In this study, we also include a comprehensive analysis of the FUS1 induction properties of known mating pathway mutants by flow cytometry, featuring single cell analysis of each mutant population. We also characterized a new source of false positives resulting from the design of this screen. Additionally, we identified a deletion mutant, sub1Δ, with increased basal expression of pFUS1-GFP. Here, in the first ChIP-Seq of Sub1, our data shows that Sub1 binds to the promoters of about half the genes in the genome (tripling the 991 loci previously reported), including the promoters of several pheromone-inducible genes, some of which show an increase upon pheromone induction. Here, we also present the first RNA-Seq of a sub1Δ mutant; the majority of genes have no change in RNA, but, of the small subset that do, most show decreased expression, consistent with biochemical studies implicating Sub1 as a positive transcriptional regulator. The RNA-Seq data also show that certain pheromone-inducible genes are induced less in the sub1Δ mutant relative to the wild type, supporting a role for Sub1 in regulation of mating pathway genes. The sub1Δ mutant has increased basal levels of a small subset of other genes besides FUS1, including IMD2 and FIG1, a gene encoding an integral membrane protein necessary for efficient mating. PMID:26837954

  11. Gas-inducible product gene expression in bioreactors.


    Weber, Wilfried; Rimann, Markus; de Glutz, François-Nicolas; Weber, Eric; Memmert, Klaus; Fussenegger, Martin


    Inducible transgene expression technologies are of unmatched potential for biopharmaceutical manufacturing of unstable, growth-impairing and cytotoxic proteins as well as conditional metabolic engineering to improve desired cell phenotypes. Currently available transgene dosing modalities which rely on physical parameters or small-molecule drugs for transgene fine-tuning compromise downstream processing and/or are difficult to implement technologically. The recently designed gas-inducible acetaldehyde-inducible regulation (AIR) technology takes advantage of gaseous acetaldehyde to modulate product gene expression levels. At regulation effective concentrations gaseous acetaldehyde is physiologically inert and approved as food additive by the Federal Drug Administration (FDA). During standard bioreactor operation, gaseous acetaldehyde could simply be administered using standard/existing gas supply tubing and eventually eliminated by stripping with inducer-free air. We have determined key parameters controlling acetaldehyde transfer in three types of bioreactors and designed a mass balance-based model for optimal product gene expression fine-tuning using gaseous acetaldehyde. Operating a standard stirred-tank bioreactor set-up at 10 L scale we have validated AIR technology using CHO-K1-derived serum-free suspension cultures transgenic for gas-inducible production of human interferon-beta (IFN-beta). Gaseous acetaldehyde-inducible IFN-beta production management was fully reversible while maintaining cell viability at over 95% during the entire process. Compatible with standard bioreactor design and downstream processing procedures AIR-based technology will foster novel opportunities for pilot and large-scale manufacturing of difficult-to-produce protein pharmaceuticals. PMID:15885616

  12. Expression of Defense Genes in Strawberry Fruits Treated with Different Resistance Inducers.


    Landi, Lucia; Feliziani, Erica; Romanazzi, Gianfranco


    The expression of 18 defense genes in strawberry fruit treated with elicitors: chitosan, BTH, and COA, at 0.5, 6, 24, and 48 h post-treatment was analyzed. The genes were up-regulated differentially, according to the elicitor. Chitosan and COA treatments promoted the expression of key phenylpropanoid pathway genes, for synthesis of lignin and flavonoids; only those associated with flavonoid metabolism were up-regulated by BTH. The calcium-dependent protein kinase, endo-β 1,4-glucanase, ascorbate peroxidase, and glutathione-S-transferase genes were up-regulated by BTH. The K(+) channel, polygalacturonase, polygalacturonase-inhibiting protein, and β-1,3-glucanase, increased in response to all tested elicitors. The enzyme activities of phenylalanine ammonia lyase, β-1,3-glucanase, Chitinase, and guaiacol peroxidase supported the gene expression results. Similarity of gene expression was >72% between chitosan and COA treatments, while BTH showed lower similarity (38%) with the other elicitors. This study suggests the relationship between the composition of the elicitors and a specific pattern of induced defense genes. PMID:24627944

  13. Effects of L-theanine on posttraumatic stress disorder induced changes in rat brain gene expression.


    Ceremuga, Tomás Eduardo; Martinson, Stephanie; Washington, Jason; Revels, Robert; Wojcicki, Jessica; Crawford, Damali; Edwards, Robert; Kemper, Joshua Luke; Townsend, William Luke; Herron, Geno M; Ceremuga, George Allen; Padron, Gina; Bentley, Michael


    Posttraumatic stress disorder (PTSD) is characterized by the occurrence of a traumatic event that is beyond the normal range of human experience. The future of PTSD treatment may specifically target the molecular mechanisms of PTSD. In the US, approximately 20% of adults report taking herbal products to treat medical illnesses. L-theanine is the amino acid in green tea primarily responsible for relaxation effects. No studies have evaluated the potential therapeutic properties of herbal medications on gene expression in PTSD. We evaluated gene expression in PTSD-induced changes in the amygdala and hippocampus of Sprague-Dawley rats. The rats were assigned to PTSD-stressed and nonstressed groups that received either saline, midazolam, L-theanine, or L-theanine + midazolam. Amygdala and hippocampus tissue samples were analyzed for changes in gene expression. One-way ANOVA was used to detect significant difference between groups in the amygdala and hippocampus. Of 88 genes examined, 17 had a large effect size greater than 0.138. Of these, 3 genes in the hippocampus and 5 genes in the amygdala were considered significant (P < 0.05) between the groups. RT-PCR analysis revealed significant changes between groups in several genes implicated in a variety of disorders ranging from PTSD, anxiety, mood disorders, and substance dependence. PMID:25165739

  14. The ternary complex factor net is downregulated by hypoxia and regulates hypoxia-responsive genes.


    Gross, Christian; Buchwalter, Gilles; Dubois-Pot, Hélène; Cler, Emilie; Zheng, Hong; Wasylyk, Bohdan


    Hypoxia and the Net ternary complex factor (TCF) regulate similar processes (angiogenesis, wound healing, and cellular migration) and genes (PAI-1, c-fos, erg-1, NOS-2, HO-1, and vascular endothelial growth factor genes), suggesting that they are involved in related pathways. We show here that hypoxia regulates Net differently from the other TCFs and that Net plays a role in the hypoxic response in vivo in mice and in cells. Hypoxia induces Net depletion from target promoters, nuclear export, ubiquitylation, and proteasomal degradation. Key mediators of the hypoxic response, the prolyl-4-hydroxylases containing domain proteins (PHDs), regulate Net. PHD downregulation in normoxia leads to Net degradation, and PHD overexpression delays Net downregulation by hypoxia. Net inhibition by RNA interference or mutation leads to altered regulation by hypoxia of the Net targets PAI-1, c-fos, and egr-1. We propose that hypoxia stimulates transcription of target promoters through removal of the repressor function of Net. Interestingly, the hematocrit response to a chemical inducer of hypoxia-like responses (cobalt chloride) is strongly altered in Net mutant mice. Our results show that the Net TCF is part of the biological response to hypoxia, adding a new component to an important pathological and physiological process. PMID:17403894

  15. Transcriptional Regulation of Cell Cycle Genes in Response to Abiotic Stresses Correlates with Dynamic Changes in Histone Modifications in Maize

    PubMed Central

    Hou, Haoli; Zhang, Hao; Wang, Yapei; Yan, Shihan; Huang, Yan; Li, Hui; Tan, Junjun; Hu, Ao; Gao, Fei; Zhang, Qi; Li, Yingnan; Zhou, Hong; Zhang, Wei; Li, Lijia


    The histone modification level has been shown to be related with gene activation and repression in stress-responsive process, but there is little information on the relationship between histone modification and cell cycle gene expression responsive to environmental cues. In this study, the function of histone modifications in mediating the transcriptional regulation of cell cycle genes under various types of stress was investigated in maize (Zea mays L.). Abiotic stresses all inhibit the growth of maize seedlings, and induce total acetylation level increase compared with the control group in maize roots. The positive and negative regulation of the expression of some cell cycle genes leads to perturbation of cell cycle progression in response to abiotic stresses. Chromatin immunoprecipitation analysis reveals that dynamic histone acetylation change in the promoter region of cell cycle genes is involved in the control of gene expression in response to external stress and different cell cycle genes have their own characteristic patterns for histone acetylation. The data also showed that the combinations of hyperacetylation and hypoacetylation states of specific lysine sites on the H3 and H4 tails on the promoter regions of cell cycle genes regulate specific cell cycle gene expression under abiotic stress conditions, thus resulting in prolonged cell cycle duration and an inhibitory effect on growth and development in maize seedlings. PMID:25171199

  16. Inducible long-term gene expression in brain with adeno-associated virus gene transfer.


    Haberman, R P; McCown, T J; Samulski, R J


    Recombinant adeno-associated virus (rAAV) vectors hold promise for treating a number of neurological disorders due to the ability to deliver long-term gene expression without toxicity or immune response. Critical to these endeavors will be controlled expression of the therapeutic gene in target cells. We have constructed and tested a dual cassette rAAV vector carrying a reporter gene under the control of the tetracycline-responsive system and the tetracycline transactivator. Transduction in vitro resulted in stable expression from the vector that can be suppressed 20-fold by tetracycline treatment. In vivo experiments, carried out to 6 weeks, demonstrated that vector-transduced expression is sustained until doxycycline administration upon which reporter gene expression is reduced. Moreover, the suppression of vector-driven expression can be reversed by removal of the drug. These studies demonstrate long-term regulated gene expression from rAAV vectors. This system will provide a valuable approach for controlling vector gene expression both in vitro and in vivo. PMID:10023439

  17. Stress induced gene expression drives transient DNA methylation changes at adjacent repetitive elements

    PubMed Central

    Secco, David; Wang, Chuang; Shou, Huixia; Schultz, Matthew D; Chiarenza, Serge; Nussaume, Laurent; Ecker, Joseph R; Whelan, James; Lister, Ryan


    Cytosine DNA methylation (mC) is a genome modification that can regulate the expression of coding and non-coding genetic elements. However, little is known about the involvement of mC in response to environmental cues. Using whole genome bisulfite sequencing to assess the spatio-temporal dynamics of mC in rice grown under phosphate starvation and recovery conditions, we identified widespread phosphate starvation-induced changes in mC, preferentially localized in transposable elements (TEs) close to highly induced genes. These changes in mC occurred after changes in nearby gene transcription, were mostly DCL3a-independent, and could partially be propagated through mitosis, however no evidence of meiotic transmission was observed. Similar analyses performed in Arabidopsis revealed a very limited effect of phosphate starvation on mC, suggesting a species-specific mechanism. Overall, this suggests that TEs in proximity to environmentally induced genes are silenced via hypermethylation, and establishes the temporal hierarchy of transcriptional and epigenomic changes in response to stress. DOI: PMID:26196146

  18. Exchange factors directly activated by cAMP mediate melanocortin 4 receptor-induced gene expression

    PubMed Central

    Glas, Evi; Mückter, Harald; Gudermann, Thomas; Breit, Andreas


    Gs protein-coupled receptors regulate many vital body functions by activation of cAMP response elements (CRE) via cAMP-dependent kinase A (PKA)-mediated phosphorylation of the CRE binding protein (CREB). Melanocortin 4 receptors (MC4R) are prototypical Gs-coupled receptors that orchestrate the hypothalamic control of food-intake and metabolism. Remarkably, the significance of PKA for MC4R-induced CRE-dependent transcription in hypothalamic cells has not been rigorously interrogated yet. In two hypothalamic cell lines, we observed that blocking PKA activity had only weak or no effects on reporter gene expression. In contrast, inhibitors of exchange factors directly activated by cAMP-1/2 (EPAC-1/2) mitigated MC4R-induced CRE reporter activation and mRNA induction of the CREB-dependent genes c-fos and thyrotropin-releasing hormone. Furthermore, we provide first evidence that extracellular-regulated kinases-1/2 (ERK-1/2) activated by EPACs and not PKA are the elusive CREB kinases responsible for MC4R-induced CREB/CRE activation in hypothalamic cells. Overall, these data emphasize the pivotal role of EPACs rather than PKA in hypothalamic gene expression elicited by a prototypical Gs-coupled receptor. PMID:27612207

  19. Inducible Gene Manipulations in Brain Serotonergic Neurons of Transgenic Rats

    PubMed Central

    Tews, Björn; Bartsch, Dusan


    The serotonergic (5-HT) system has been implicated in various physiological processes and neuropsychiatric disorders, but in many aspects its role in normal and pathologic brain function is still unclear. One reason for this might be the lack of appropriate animal models which can address the complexity of physiological and pathophysiological 5-HT functioning. In this respect, rats offer many advantages over mice as they have been the animal of choice for sophisticated neurophysiological and behavioral studies. However, only recently technologies for the targeted and tissue specific modification of rat genes - a prerequisite for a detailed study of the 5-HT system - have been successfully developed. Here, we describe a rat transgenic system for inducible gene manipulations in 5-HT neurons. We generated a Cre driver line consisting of a tamoxifen-inducible CreERT2 recombinase under the control of mouse Tph2 regulatory sequences. Tissue-specific serotonergic Cre recombinase expression was detected in four transgenic TPH2-CreERT2 rat founder lines. For functional analysis of Cre-mediated recombination, we used a rat Cre reporter line (CAG-loxP.EGFP), in which EGFP is expressed after Cre-mediated removal of a loxP-flanked lacZ STOP cassette. We show an in-depth characterisation of this rat Cre reporter line and demonstrate its applicability for monitoring Cre-mediated recombination in all major neuronal subpopulations of the rat brain. Upon tamoxifen induction, double transgenic TPH2-CreERT2/CAG-loxP.EGFP rats show selective and efficient EGFP expression in 5-HT neurons. Without tamoxifen administration, EGFP is only expressed in few 5-HT neurons which confirms minimal background recombination. This 5-HT neuron specific CreERT2 line allows Cre-mediated, inducible gene deletion or gene overexpression in transgenic rats which provides new opportunities to decipher the complex functions of the mammalian serotonergic system. PMID:22140568

  20. Testosterone-induced permanent changes of hepatic gene expression in female mice sustained during Plasmodium chabaudi malaria infection.


    Delić, Denis; Gailus, Nicole; Vohr, Hans-Werner; Dkhil, Mohamed; Al-Quraishy, Saleh; Wunderlich, Frank


    Testosterone has been previously shown to induce persistent susceptibility to Plasmodium chabaudi malaria in otherwise resistant female C57BL/6 mice. Here, we investigate as to whether this conversion coincides with permanent changes of hepatic gene expression profiles. Female mice aged 10-12 weeks were treated with testosterone for 3 weeks; then, testosterone treatment was discontinued for 12 weeks before challenging with 10⁶ P. chabaudi-infected erythrocytes. Hepatic gene expression was examined after 12 weeks of testosterone withdrawal and after subsequent infection with P. chabaudi at peak parasitemia, using Affymetrix microarrays with 22 ,690 probe sets representing 14, 000 genes. The expression of 54 genes was found to be permanently changed by testosterone, which remained changed during malaria infection. Most genes were involved in liver metabolism: the female-prevalent genes Cyp2b9, Cyp2b13, Cyp3a41, Cyp3a44, Fmo3, Sult2a2, Sult3a1, and BC014805 were repressed, while the male-prevalent genes Cyp2d9, Cyp7b1, Cyp4a10, Ugt2b1, Ugt2b38, Hsd3b5, and Slco1a1 were upregulated. Genes encoding different nuclear receptors were not persistently changed. Moreover, testosterone induced persistent upregulation of genes involved in hepatocellular carcinoma such as Lama3 and Nox4, whereas genes involved in immune response such as Ifnγ and Igk-C were significantly decreased. Our data provide evidence that testosterone is able to induce specific and robust long-term changes of gene expression profiles in the female mouse liver. In particular, those changes, which presumably indicate masculinized liver metabolism and impaired immune response, may be critical for the testosterone-induced persistent susceptibility of mice to P. chabaudi malaria. PMID:20844152

  1. Radiation-induced gene expression in the nematode Caenorhabditis elegans

    NASA Technical Reports Server (NTRS)

    Nelson, Gregory A.; Jones, Tamako A.; Chesnut, Aaron; Smith, Anna L.


    We used the nematode C. elegans to characterize the genotoxic and cytotoxic effects of ionizing radiation in a simple animal model emphasizing the unique effects of charged particle radiation. Here we demonstrate by RT-PCR differential display and whole genome microarray hybridization experiments that gamma rays, accelerated protons and iron ions at the same physical dose lead to unique transcription profiles. 599 of 17871 genes analyzed (3.4%) showed differential expression 3 hrs after exposure to 3 Gy of radiation. 193 were up-regulated, 406 were down-regulated and 90% were affected only by a single species of radiation. A novel statistical clustering technique identified the regulatory relationships between the radiation-modulated genes and showed that genes affected by each radiation species were associated with unique regulatory clusters. This suggests that independent homeostatic mechanisms are activated in response to radiation exposure as a function of track structure or ionization density.

  2. The Sch9 kinase is a chromatin-associated transcriptional activator of osmostress-responsive genes

    PubMed Central

    Pascual-Ahuir, Amparo; Proft, Markus


    The yeast Sch9 kinase has been implicated in the cellular adjustment to nutrient availability and in the regulation of aging. Here, we define a novel role for Sch9 in the transcriptional activation of osmostress inducible genes. Loss-of-function mutants sch9 are sensitive to hyperosmotic stress and show an impaired transcriptional response upon osmotic shock of several defense genes. We show that Sch9 is required for gene expression regulated by Sko1, a transcription factor, which is directly targeted by the Hog1 MAP kinase. Sch9 interacts in vitro with both Sko1 and Hog1. Additionally, Sch9 phosphorylates Sko1 in vitro. When artificially tethered to promoter DNA, Sch9 strongly activates transcription independently of osmotic stress. Using in vivo chromatin immunoprecipitation, we demonstrate that Sch9 is recruited to the GRE2 and CTT1 genes exclusively under osmostress conditions, and that this recruitment is dependent on Hog1 and Sko1. Furthermore, Sch9 is required for the proper recruitment of Hog1 at the same genes. Our data reveal the complexity of stress-induced transcription by the regulated association of signaling kinases to chromatin. PMID:17568771

  3. Identification of a p53-response element in the promoter of the proline oxidase gene

    SciTech Connect

    Maxwell, Steve A. Kochevar, Gerald J.


    Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significant p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.

  4. KGF alters gene expression in human airway epithelia: potential regulation of the inflammatory response.


    Prince, L S; Karp, P H; Moninger, T O; Welsh, M J


    Keratinocyte growth factor (KGF) regulates several functions in adult and developing lung epithelia; it causes proliferation, stimulates secretion of fluid and electrolytes, enhances repair, and may minimize injury. To gain insight into the molecular processes influenced by KGF, we applied KGF to primary cultures of well-differentiated human airway epithelia and used microarray hybridization to assess the abundance of gene transcripts. Of 7,069 genes tested, KGF changed expression levels of 910. Earlier studies showed that KGF causes epithelial proliferation, and as expected, treatment altered expression of numerous genes involved in cell proliferation. We found that KGF stimulated transepithelial Cl(-) transport, but the number of cystic fibrosis (CF) transmembrane conductance regulator (CFTR) transcripts fell. Although transcripts for ClC-1 and ClC-7 Cl(-) channels increased, KGF failed to augment transepithelial Cl(-) transport in CF epithelia, suggesting that KGF-stimulated Cl(-) transport in differentiated airway epithelia depends on the CFTR Cl(-) channel. Interestingly, KGF decreased transcripts for many interferon (IFN)-induced genes. IFN causes trafficking of Stat dimers to the nucleus, where they activate transcription of IFN-induced genes. We found that KGF prevented the IFN-stimulated trafficking of Stat1 from the cytosol to the nucleus, suggesting a molecular mechanism for KGF-mediated suppression of the IFN-signaling pathway. These results suggest that in addition to stimulating proliferation and repair of damaged airway epithelia, KGF stimulates Cl(-) transport and may dampen the response of epithelial cells to inflammatory mediators. PMID:11459923

  5. Gene expression profiling of rice seedlings in response to glutamine treatment

    PubMed Central

    Kan, Chia-Cheng; Chung, Tsui-Yun; Hsieh, Ming-Hsiun


    Glutamine, the most abundant free amino acid in humans (Curi et al., 2007 [1]), has many functions. In addition to protein, amino acid, and nucleic acid biosynthesis, glutamine also regulates the expression of genes related to metabolism, cell defense, and signal transduction in humans (Curi et al., 2007 [1]; Brasse-Lagnel et al., 2009 [2]). Glutamine is also one of the major forms of nitrogen in rice (Fukumorita and Chino, 1982 [3]). In addition to metabolic and nutritional effects, glutamine may function as a signaling molecule to regulate gene expression in plants. To this end, we used microarray analysis to identify genes that are rapidly induced by 2.5 mM glutamine in rice roots. The results revealed that glutamine induced the expression of at least 35 genes involved in metabolism, transport, signal transduction, and stress responses within 30 min (Kan et al., 2015 [4]). Here, we provide the details of the experimental procedure associated with our microarray data deposited in NCBI's Gene Expression Omnibus (GEO ID: GSE56770). PMID:26697351

  6. Dose-Response Relationships in Gene Expression Profiles in Rainbow Trout, Onorhyncus mykiss Exposed to Ethynylestradiol

    SciTech Connect

    Hook, Sharon E.; Skillman, Ann D.; Small, Jack A.; Schultz, Irv R.


    Determining how gene expression profiles change with toxicant dose will improve the utility of arrays in identifying biomarkers and modes of toxic action. We exposed isogenic rainbow trout, Onorhyncus mykiss, to 10, 50 or 100 ng/L ethynylestradiol (a xeno-estrogen) for 7 days. Following exposure, fish were euthanized, livers harvested and RNA extracted. Fluorescently labeled cDNA were generated and hybridized against a commercially available Atlantic Salmon/Trout array (GRASP project, University of Victoria) spotted with 16,000 cDNA's. The slides were scanned to measure abundance of a given transcript in each sample relative to controls. Data were analyzed via Genespring (Silicon Genetics) to identify genes with altered expression, as well as to determine gene clustering patterns that can be used as ''expression signatures''. Array results were confirmed via qRT PCR. Our analysis indicates that gene expression profiles varied somewhat with dose. Established biomarkers of exposure to estrogenic chemicals, such as vitellogenin, vitelline envelope proteins, and the estrogen receptor alpha, were induced at every dose. Other genes were dose specific, suggesting that different doses induce distinct physiological responses. These findings demonstrate that cDNA microarrays could be used to identify both toxicant class and relative dose.

  7. The adeno-associated virus rep gene suppresses herpes simplex virus-induced DNA amplification.

    PubMed Central

    Heilbronn, R; Bürkle, A; Stephan, S; zur Hausen, H


    Herpes simplex virus (HSV) induces within the host cell genome DNA amplification which can be suppressed by coinfection with adeno-associated virus (AAV). To characterize the AAV functions mediating this effect, cloned AAV type 2 wild-type or mutant genomes were transfected into simian virus 40 (SV40)-transformed hamster cells together with the six HSV replication genes (encoding UL5, UL8, major DNA-binding protein, DNA polymerase, UL42, and UL52) which together are necessary and sufficient for the induction of SV40 DNA amplification (R. Heilbronn and H. zur Hausen, J. Virol. 63:3683-3692, 1989). The AAV rep gene was identified as being responsible for the complete inhibition of HSV-induced SV40 DNA amplification. Likewise, rep inhibited origin-dependent HSV replication. rep neither killed the transfected host cells nor interfered with gene expression from the cotransfected amplification genes. This points to a specific interference with HSV-induced DNA amplification. Images PMID:2159559

  8. Virus induced gene silencing of a gene repressing flowering in sugar beet.

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Exposure to a prolonged cold period during winter is necessary for flowering in the next spring in many biennial plants - a process termed vernalization. We have described BvFL1, a vernalization gene in sugar beet (Beta vulgaris), which is a repressor of flowering that is downregulated in response ...

  9. Transcriptional induction of IFN-gamma-responsive genes is modulated by DNA surrounding the interferon stimulation response element.

    PubMed Central

    Strehlow, I; Decker, T


    The 9/27 and GBP mRNAs are both inducible by Interferon-gamma (IFN-gamma). The promoters of both genes contain an Interferon Stimulation Response Element (ISRE), but while the GBP gene is strongly induced transcriptionally by IFN-gamma the response of the 9/27 promoter is very weak. We investigated the molecular basis for this difference. The different IFN-gamma-responsiveness was found to have more than one reason. First, 9/27 promoter DNA was unable to bind the Gamma Interferon Activation Factor (GAF) with a single high affinity site. It efficiently competed for the association of the GAF with the GBP promoter but this competition was due to the presence of two low affinity sites, the ISRE and an ISRE-like sequence, suggesting that the GAS and ISRE, though both having clear preferences for specific proteins, may nevertheless share a certain degree of structural homology. Second, the 9/27 and GBP ISREs differed markedly in their affinities for regulatory proteins (ISGFs 1,2,3) and the GBP ISRE was more potent in mediating IFN-gamma-induced promoter activity in transient transfection. Third and most importantly, however, the strong difference between the IFN-gamma response of the two promoters was mainly due to the sequences surrounding the ISRE: the positive-acting GAS on one side and sequences with silencing properties 5' and 3' of the 9/27 ISRE on the other side. The data thus show mechanisms to both up- and down-regulate the activity of the ISRE. Images PMID:1508672

  10. Mitochondrial dysfunction induces SESN2 gene expression through Activating Transcription Factor 4.


    Garaeva, Alisa A; Kovaleva, Irina E; Chumakov, Peter M; Evstafieva, Alexandra G


    We found that inhibitors of mitochondrial respiratory chain complexes III (myxothiazol) and I (piericidin A) in some epithelial carcinoma cell lines induce transcription of the p53-responsive SESN2 gene that plays an important role in stress response and homeostatic regulation. However, the effect did not depend on p53 because i) there was no induction of p53 after the treatment with piericidin A; ii) after the treatment with myxothiazol the peak of SESN2 gene upregulation occurred as early as 5h, before the onset of p53 activation (13h); iii) a supplementation with uridine that abolishes the p53 activation in response to myxothiazol did not abrogate the induction of SESN2 transcripts; iv) in the p53 negative HCT116 p53 -/- cells SESN2 transcription could be also induced by myxothiazol. In response to the respiratory chain inhibitors we observed an induction of ATF4, the key transcription factor of the integrated stress response (ISR). We found that the induction of SESN2 transcripts could be prevented by the ISR inhibitory small molecule ISRIB. Also, by inhibiting or overexpressing ATF4 with specific shRNA or ATF4-expressing constructs, respectively, we have confirmed the role of ATF4 in the SESN2 gene upregulation induced by mitochondrial dysfunction. At a distance of 228 bp upstream from the SESN2 transcription start site we found a candidate sequence for the ATF4 binding site and confirmed its requirement for the induction of SESN2 in luciferase reporter experiments. We suggest that the upregulation of SESN2 by mitochondrial dysfunction provides a homeostatic feedback that attenuates biosynthetic processes during temporal losses of energy supply from mitochondria thereby assisting better adaptation and viability of cells in hostile environments. PMID:26771712

  11. Modulations of gene expression induced by daily ultraviolet light can be prevented by a broad spectrum sunscreen.


    Marionnet, Claire; Pierrard, Cécile; Lejeune, François; Bernerd, Françoise


    Realistic non-zenithal solar ultraviolet (UV) exposure, obtained using standard ultraviolet daylight spectrum (DUVR), has deleterious impact on epidermal and dermal compartments of human skin. The present study was designed to assess gene expression in human reconstructed skin following exposure to DUVR and the protective effect of a broad spectrum sunscreen. Reconstructed skins were exposed to a realistic daily UV dose of 12 J/cm(2) DUVR in the presence of a sunscreen product (Sun(burn) Protection Factor (SPF)=13 and UVA protection factor UVAPF (PPD) 10.5) or its vehicle. Six hours post exposure, gene expression was investigated in fibroblasts (225 genes) and keratinocytes (244 genes) separately using quantitative PCR arrays. DUVR exposure led to significant modulation of 35 and 66 genes in fibroblasts and keratinocytes, respectively. These genes were involved in extracellular matrix homeostasis, oxidative stress response, cell growth, inflammation and epidermal differentiation. Sunscreen use significantly reduced DUVR-induced gene modulation. Hierarchical clustering showed that gene expression profiles in protected and DUVR-exposed samples were very close to those of unexposed samples. The number of DUVR-modulated genes was significantly decreased by tested sunscreen (zero and four modulated genes in fibroblasts and keratinocytes, respectively). Our results demonstrate that a broad-spectrum sunscreen product is highly effective in protecting reconstructed human skin against DUVR-induced changes in gene expression. PMID:22960577

  12. The Challenge for Gene Therapy: Innate Immune Response to Adenoviruses

    PubMed Central

    Thaci, Bart; Ulasov, Ilya V.; Wainwright, Derek A.; Lesniak, Maciej S.


    Adenoviruses are the most commonly used vectors for gene therapy. Despite the promising safety profile demonstrated in clinical trials, the efficacy of using adenoviruses for gene therapy is poor. A major hurdle to adenoviral-mediated gene therapy is the innate immune system. Cell-mediated recognition of viruses via capsid components or nucleic acids has received significant attention, principally thought to be regulated by the toll-like receptors (TLRs). Antiviral innate immune responses are initiated by the infected cell, which activates the interferon (IFN) response to block viral replication, while simultaneously releasing chemokines to attract neutrophils, mononuclear- and natural killer-cells. While the IFN and cellular recruitment pathways are activated and regulated independently of each other, both are required to overcome immune escape mechanisms by adenoviruses. Recent work has shown that the generation of adenoviral vectors lacking specific transcriptionally-active regions decreases immune system activation and increases the chance for immune escape. In this review, we elucidate how adenoviral vector modifications alter the IFN and innate inflammatory pathway response and propose future targets with clinically-translational relevance. PMID:21399236

  13. Identification of heat stress-responsive genes in heat-adapted thermal Agrostis scabra by suppression subtractive hybridization.


    Tian, Jiang; Belanger, Faith C; Huang, Bingru


    To gain insights into molecular mechanisms of grass tolerance to heat stress, we constructed a suppression subtractive cDNA library to identify heat-responsive genes for a C(3) grass species, thermal Agrostis scabra adapted to heat stress in geothermal areas in Yellowstone National Park. Plants were exposed to 20 degrees C (control) or 35 degrees C for 12d. The SSH analysis was performed with control samples as the driver and heat-stressed samples as the tester. Differentially expressed cDNA fragments were cloned to screen the heat up-regulated library. The SSH analysis identified 120 non-redundant putative heat-responsive cDNAs out of 1180 clones. Genes with homology to known proteins were categorized into six functional groups, with the largest group of genes involved in stress/defense, followed by the group of genes related to protein metabolism. Immunoblot analysis confirmed increases in transcripts of selected genes under heat stress. Transcripts of seven and eight genes were strongly enhanced or induced in shoots and roots, respectively, while two genes were only induced in roots under heat stress. The heat up-regulated genes in thermal A. scabra adapted to long-term heat stress are potential candidate genes for engineering stress-tolerant grasses and for revealing molecular mechanisms of grass adaptation to heat stress. PMID:18950897

  14. Atypical antipsychotics induce both proinflammatory and adipogenic gene expression in human adipocytes in vitro

    SciTech Connect

    Sárvári, Anitta K.; Veréb, Zoltán; Uray, Iván P.; Fésüs, László; Balajthy, Zoltán


    Highlights: • Antipsychotics modulate the expression of adipogenic genes in human adipocytes. • Secretion of proinflammatory cytokine IL8 and MCP-1 is induced by antipsychotics. • Adipocyte-dependent inflammatory abnormality could develop during chronic treatment. • Infiltrated macrophages would further enhance proinflammatory cytokine production. - Abstract: Schizophrenia requires lifelong treatment, potentially causing systemic changes in metabolic homeostasis. In the clinical setting, antipsychotic treatment may differentially lead to weight gain among individual patients, although the molecular determinants of such adverse effects are currently unknown. In this study, we investigated changes in the expression levels of critical regulatory genes of adipogenesis, lipid metabolism and proinflammatory genes during the differentiation of primary human adipose-derived stem cells (ADSCs). These cells were isolated from patients with body mass indices <25 and treated with the second-generation antipsychotics olanzapine, ziprasidone, clozapine, quetiapine, aripiprazole and risperidone and the first-generation antipsychotic haloperidol. We found that antipsychotics exhibited a marked effect on key genes involved in the regulation of cell cycle, signal transduction, transcription factors, nuclear receptors, differentiation markers and metabolic enzymes. In particular, we observed an induction of the transcription factor NF-KB1 and NF-KB1 target genes in adipocytes in response to these drugs, including the proinflammatory cytokines TNF-α, IL-1β, IL-8 and MCP-1. In addition, enhanced secretion of both IL8 and MCP-1 was observed in the supernatant of these cell cultures. In addition to their remarkable stimulatory effects on proinflammatory gene transcription, three of the most frequently prescribed antipsychotic drugs, clozapine, quetiapine and aripiprazole, also induced the expression of essential adipocyte differentiation genes and the adipocyte hormones leptin

  15. Cylindrospermopsin induced transcriptional responses in human hepatoma HepG2 cells.


    Straser, Alja; Filipič, Metka; Zegura, Bojana


    The newly emerging cyanotoxin cylindrospermopsin (CYN) is showing genotoxic effects in a range of test systems. However, the knowledge on the mechanisms involved is limited. To get insight into the cellular responses to CYN a toxicogenomic analysis of selected genes commonly affected by genotoxic stress was performed on HepG2 cells exposed to a non-cytotoxic but genotoxic concentration of CYN (0.5 μg/ml for 12 and 24h). CYN increased expression of the immediate-early response genes from the FOS and JUN gene families and there was strong evidence for the involvement of P53 and NF-κB signaling. Strong up-regulation of the growth arrest and DNA damage inducible genes (GADD45A and GADD45B), cyclin-dependent kinase inhibitors (CDKN1A and CDKN2B), checkpoint kinase 1 (CHEK1), and genes involved in DNA damage repair (XPC, ERCC4 and others) indicated cell-cycle arrest and induction of nucleotide excision and double strand break repair. Up-regulation of metabolic enzyme genes provided evidence for the involvement of phase I (CYP1A1, CYP1B1, ALDH1A2 and CES2) and phase II (UGT1A6, UGT1A1, NAT1 and GSTM3) enzymes in the detoxification response and potential activation of CYN. The obtained transcriptional patterns after exposure of HepG2 cells to CYN provide valuable new information on the cellular response to CYN. PMID:23726867

  16. Wound-inducible nuclear protein binds DNA fragments that regulate a proteinase inhibitor II gene from potato.

    PubMed Central

    Palm, C J; Costa, M A; An, G; Ryan, C A


    Deletion analysis from the 3' to the 5' end of the promoter region of the wound-inducible potato proteinase inhibitor IIK gene has identified a 421-base sequence at -136 to -557 that is necessary for expression. Utilizing DNA band-shift assays, a 10-base sequence within the 421-base region was found to bind a nuclear protein from wounded tomato leaves. This 10-base sequence is adjacent to an 8-base consensus sequence at -147 to -155 that is present in the promoter region of several elicitor-inducible genes from various other plants. The evidence suggests that a complex set of cis- and trans-acting elements within the -136 to -165 region of the potato IIK gene may be involved with the signaling mechanisms that regulate the inducibility of this gene in response to pest and pathogen attacks. Images PMID:2405385

  17. Gene expression profile and synovial microcirculation at early stages of collagen-induced arthritis

    PubMed Central

    Gierer, Philip; Ibrahim, Saleh; Mittlmeier, Thomas; Koczan, Dirk; Moeller, Steffen; Landes, Jürgen; Gradl, Georg; Vollmar, Brigitte


    A better understanding of the initial mechanisms that lead to arthritic disease could facilitate development of improved therapeutic strategies. We characterized the synovial microcirculation of knee joints in susceptible mouse strains undergoing intradermal immunization with bovine collagen II in complete Freund's adjuvant to induce arthritis (i.e. collagen-induced arthritis [CIA]). Susceptible DBA1/J and collagen II T-cell receptor transgenic mice were compared with CIA-resistant FVB/NJ mice. Before onset of clinical symptoms of arthritis, in vivo fluorescence microscopy of knee joints revealed marked leucocyte activation and interaction with the endothelial lining of synovial microvessels. This initial inflammatory cell response correlated with the gene expression profile at this disease stage. The majority of the 655 differentially expressed genes belonged to classes of genes that are involved in cell movement and structure, cell cycle and signal transduction, as well as transcription, protein synthesis and metabolism. However, 24 adhesion molecules and chemokine/cytokine genes were identified, some of which are known to contribute to arthritis (e.g. CD44 and neutrophil cytosolic factor 1) and some of which are novel in this respect (e.g. CC chemokine ligand-27 and IL-13 receptor α1). Online in vivo data on synovial tissue microcirculation, together with gene expression profiling, emphasize the potential role played by early inflammatory events in the development of arthritis. PMID:15987489

  18. Delay-Induced Transient Increase and Heterogeneity in Gene Expression in Negatively Auto-Regulated Gene Circuits

    PubMed Central

    Maithreye, R.; Sarkar, Ram Rup; Parnaik, Veena K.; Sinha, Somdatta


    A generic feature in all intracellular biochemical processes is the time required to complete the whole sequence of reactions to yield any observable quantity-from gene expression to circadian rhythms. This widespread phenomenon points towards the importance of time delay in biological functions. Theoretically time delay is known to be the source of instability, and has been attributed to lead to oscillations or transient dynamics in several biological functions. Negative feedback loops, common in biochemical pathways, have been shown to provide stability and withstand considerable variations and random perturbations of biochemical parameters. The interaction of these two opposing factors-of instability and homeostasis-are features that are widespread in intracellular processes. To test the effect of these divergent forces in the dynamics of gene expression, we have designed and constructed simple negatively auto-regulated gene circuits consisting of a basic regulator and transcriptional repressor module, and compared it with one, which has delayed repression. We show, both theoretically and experimentally, that delayed repression induces transient increase and heterogeneity in gene expression before the gain of stability effected by the negative feedback. This design, therefore, seems to be suitable for conferring both stability and variability in cells required for adaptive response to a noisy environment. PMID:18698420

  19. Chlamydomonas reinhardtii, a model system for functional validation of abiotic stress responsive genes.


    Hema, R; Senthil-Kumar, M; Shivakumar, S; Chandrasekhara Reddy, P; Udayakumar, M


    Stress tolerance is a multigenic character and there are many stress responsive genes, which are stress specific. Although many of these have been cloned, their functional significance remains fragmentary. Hence it is important to identify the relevant stress genes involved in altering the metabolism for adaptation. Overexpression is one of the several approaches and Chlamydomonas is a suitable system to study the functional relevance of stress genes. Stress responses can only be assessed on prior exposure to sublethal induction stress. In this study the acclimation response of Chlamydomonas was assessed for different abiotic stresses using physiological screens like chlorophyll stability, membrane damage, cell viability, accumulation of free radicals, survival and recovery growth. We demonstrate that Chlamydomonas responds to diverse stresses and is a potential system to study the relevance of stress genes. The relevance of choline oxidase A (codA), a key enzyme in glycinebetaine biosynthesis, was examined by developing transformants expressing codA gene from Arthrobacter globiformis. Southern positive transformants showed enhanced accumulation of glycinebetaine. The transformants also showed enhanced growth under salinity, high light coupled with methylviologen-induced oxidative stress, high temperature and cold stress. However the transgenics were not tolerant to PEG-mediated simulated osmotic stress, LiCl, menadione and UV stress. Increased cell survival and decreased chlorophyll degradation in transformants under acclimated conditions further confirmed the relevance of codA in imparting stress tolerance. Our results indicated that the relevance of stress responsive genes can be efficiently validated for diverse abiotic stresses using Chlamydomonas system. PMID:17431668

  20. The ecdysone-inducible Broad-complex and E74 early genes interact to regulate target gene transcription and Drosophila metamorphosis.


    Fletcher, J C; Thummel, C S


    Pulses of the steroid hormone ecdysone initiate Drosophila metamorphosis by inducing widespread changes in gene expression. The Broad-Complex (BR-C) and E74 are induced directly by ecdysone and encode families of transcription factors that regulate ecdysone primary- and secondary-response genes. Genetic analyses have revealed that mutations in the BR-C and E74 are lethal during metamorphosis and that these mutations cause some similar lethal phenotypes and alterations in secondary-response gene transcription. To examine whether the BR-C and E74 function together during development, we have combined representative alleles from each BR-C and E74 complementation group. Analysis of the morphological and molecular phenotypes of the double-mutant animals reveals that BR-C and E74 alleles act together to produce both novel and synergistic effects. We find that the BR-C and E74 share functions in puparium formation, pupation and early gene induction. In addition, our evidence suggests that the BR-C and E74 transcription factors may directly interact to regulate the expression of salivary gland glue and late genes. This data is consistent with current models which propose that combinations of ecdysone primary-response genes regulate common morphogenetic pathways during insect metamorphosis. PMID:8582609

  1. Acrylamide-responsive genes in the nematode Caenorhabditis elegans.


    Hasegawa, Koichi; Miwa, Satsuki; Isomura, Kazunori; Tsutsumiuchi, Kaname; Taniguchi, Hajime; Miwa, Johji


    As acrylamide is a known neurotoxin for many animals and potential carcinogen for humans, it came as a surprise when the Swedish National Food Agency and Stockholm University reported in 2002 that it is formed during the frying or baking of foods. We report here genomic and proteomic analyses on genes and proteins of Caenorhabditis elegans exposed to 500 mg/l acrylamide. Of the 21,120 genes profiled, 409 genes were more than twofold upregulated and 111 genes were downregulated. Upregulated genes included many that encode detoxification enzymes such as glutathione S-transferases (GSTs), uridine diphosphate-glucuronosyl/glucosyl transferases, and short-chain type dehydrogenases but only one cytochrome P450. Subsequent proteomic analysis confirmed the heavy involvement of GSTs. Because of their high expression levels and central roles in acrylamide metabolism, we analyzed the in vivo expression patterns of eight gst genes. Although all encoded GST and were more than twofold upregulated by acrylamide treatment, their expression patterns were varied, and their regulation involved the transcription factor SKN-1 (a C. elegans homolog of Nuclear factor E2-related factors 1 and 2). We then selected the gst-4::gfp-transformed C. elegans to study the detoxification rate of acrylamide and its metabolite glycidimide in living animals. This animal detects acrylamide as a green fluorescence protein (GFP) expression signal in a dose- and time-dependent manner and may prove to be a useful tool not only for rapidly and inexpensively detecting acrylamide, a harmful substance in food, but also for analyzing mechanisms of GST induction by acrylamide and other inducers like oxidative stresses. PMID:17989133

  2. Expression of zinc and cadmium responsive genes in leaves of willow (Salix caprea L.) genotypes with different accumulation characteristics

    PubMed Central

    Konlechner, Cornelia; Türktaş, Mine; Langer, Ingrid; Vaculík, Marek; Wenzel, Walter W.; Puschenreiter, Markus; Hauser, Marie-Theres


    Salix caprea is well suited for phytoextraction strategies. In a previous survey we showed that genetically distinct S. caprea plants isolated from metal-polluted and unpolluted sites differed in their zinc (Zn) and cadmium (Cd) tolerance and accumulation abilities. To determine the molecular basis of this difference we examined putative homologues of genes involved in heavy metal responses and identified over 200 new candidates with a suppression subtractive hybridization (SSH) screen. Quantitative expression analyses of 20 genes in leaves revealed that some metallothioneins and cell wall modifying genes were induced irrespective of the genotype's origin and metal uptake capacity while a cysteine biosynthesis gene was expressed constitutively higher in the metallicolous genotype. The third and largest group of genes was only induced in the metallicolous genotype. These data demonstrate that naturally adapted woody non-model species can help to discover potential novel molecular mechanisms for metal accumulation and tolerance. PMID:23562959

  3. Neutron Radiation Affects the Expression of Genes Involved in the Response to Auxin, Senescence and Oxidative Stress in Arabidopsis

    NASA Astrophysics Data System (ADS)

    Fortunati, A.; Tassone, P.; Migliaccio, F.


    Researches were conducted on the effect of neutron radiation on the expression of genes auxin activated or connected with the process of senescence in Arabidopsis plants. The research was done by applying the real-time polymerase chain reaction (PCR) technique. The results indicated that the auxin response factors (ARFs) genes are clearly downregulated, whereas the indolacetic acid-induced (Aux/IAAs) genes in some cases were upregulated. By contrast in the mutants for auxin transport aux1 and eir1 the ARFs genes were upregulated. In addition, both in the wildtype and mutants, some already known genes activated by stress and senescence were significantly upregulated. On the basis of these researches we conclude that the process of senescence induced by irradiation is, at least in part, controlled by the physiology of the hormone auxin.

  4. Identification of Toxoplasma gondii Genes Responsive to the Host Immune Response during In Vivo Infection

    PubMed Central

    Skariah, Sini; Mordue, Dana G.


    Toxoplasma gondii is an obligate intracellular protozoa parasite that causes the disease toxoplasmosis. It resides within host cells in a parasitophorous vacuole distinct from the host cell endocytic system. T. gondii was used as a model to investigate how obligate intracellular parasites alter their gene expression in response to the host immune response during infection compared to growth in host cells in vitro. While bacterial pathogens clearly alter gene expression to adapt to the host environment during infection, the degree to which the external environment affects gene expression by obligate intracellular pathogens sequestered within host cells is less clear. The global transcriptome of T. gondii was analyzed in vivo in the presence and absence of the IFN-γ-dependent host innate immune response. The parasites' in vivo transcriptome was also compared to its transcriptome in vitro in fibroblast cells. Our results indicate that the parasite transcriptome is significantly altered during in vivo infection in the presence, but not absence, of IFN–γ-dependent immunity compared with fibroblasts infected in vitro. Many of the parasite genes increased in vivo appear to be common to an early general stress response by the parasite; surprisingly putative oocyst stage specific genes were also disproportionately increased during infection. PMID:23071600

  5. Virus-induced gene silencing of fiber-related genes in cotton.


    Tuttle, John R; Haigler, Candace H; Robertson, Dominique Niki


    Virus-Induced Gene Silencing (VIGS) is a useful method for transient downregulation of gene expression in crop plants. The geminivirus Cotton leaf crumple virus (CLCrV) has been modified to serve as a VIGS vector for persistent gene silencing in cotton. Here the use of Green Fluorescent Protein (GFP) is described as a marker for identifying silenced tissues in reproductive tissues, a procedure that requires the use of transgenic plants. Suggestions are given for isolating and cloning combinations of target and marker sequences so that the total length of inserted foreign DNA is between 500 and 750 bp. Using this strategy, extensive silencing is achieved with only 200-400 bp of sequence homologous to an endogenous gene, reducing the possibility of off-target silencing. Cotyledons can be inoculated using either the gene gun or Agrobacterium and will continue to show silencing throughout fruit and fiber development. CLCrV is not transmitted through seed, and VIGS is limited to genes expressed in the maternally derived seed coat and fiber in the developing seed. This complicates the use of GFP as a marker for VIGS because cotton fibers must be separated from unsilenced tissue in the seed to determine if they are silenced. Nevertheless, fibers from a large number of seeds can be rapidly screened following placement into 96-well plates. Methods for quantifying the extent of silencing using semiquantitative RT-PCR are given. PMID:25740368

  6. Functional analyses of cellulose synthase genes in flax (Linum usitatissimum) by virus-induced gene silencing.


    Chantreau, Maxime; Chabbert, Brigitte; Billiard, Sylvain; Hawkins, Simon; Neutelings, Godfrey


    Flax (Linum usitatissimum) bast fibres are located in the stem cortex where they play an important role in mechanical support. They contain high amounts of cellulose and so are used for linen textiles and in the composite industry. In this study, we screened the annotated flax genome and identified 14 distinct cellulose synthase (CESA) genes using orthologous sequences previously identified. Transcriptomics of 'primary cell wall' and 'secondary cell wall' flax CESA genes showed that some were preferentially expressed in different organs and stem tissues providing clues as to their biological role(s) in planta. The development for the first time in flax of a virus-induced gene silencing (VIGS) approach was used to functionally evaluate the biological role of different CESA genes in stem tissues. Quantification of transcript accumulation showed that in many cases, silencing not only affected targeted CESA clades, but also had an impact on other CESA genes. Whatever the targeted clade, inactivation by VIGS affected plant growth. In contrast, only clade 1- and clade 6-targeted plants showed modifications in outer-stem tissue organization and secondary cell wall formation. In these plants, bast fibre number and structure were severely impacted, suggesting that the targeted genes may play an important role in the establishment of the fibre cell wall. Our results provide new fundamental information about cellulose biosynthesis in flax that should facilitate future plant improvement/engineering. PMID:25688574

  7. Identification of Genes Involved in the Response of Arabidopsis to Simultaneous Biotic and Abiotic Stresses1[C][W][OPEN

    PubMed Central

    Atkinson, Nicky J.; Lilley, Catherine J.; Urwin, Peter E.


    In field conditions, plants may experience numerous environmental stresses at any one time. Research suggests that the plant response to multiple stresses is different from that for individual stresses, producing nonadd